Identification of human chromosome 22 transcribed sequences with ORF expressed sequence tags
de Souza, Sandro J.; Camargo, Anamaria A.; Briones, Marcelo R. S.; Costa, Fernando F.; Nagai, Maria Aparecida; Verjovski-Almeida, Sergio; Zago, Marco A.; Andrade, Luis Eduardo C.; Carrer, Helaine; El-Dorry, Hamza F. A.; Espreafico, Enilza M.; Habr-Gama, Angelita; Giannella-Neto, Daniel; Goldman, Gustavo H.; Gruber, Arthur; Hackel, Christine; Kimura, Edna T.; Maciel, Rui M. B.; Marie, Suely K. N.; Martins, Elizabeth A. L.; Nóbrega, Marina P.; Paçó-Larson, Maria Luisa; Pardini, Maria Inês M. C.; Pereira, Gonçalo G.; Pesquero, João Bosco; Rodrigues, Vanderlei; Rogatto, Silvia R.; da Silva, Ismael D. C. G.; Sogayar, Mari C.; de Fátima Sonati, Maria; Tajara, Eloiza H.; Valentini, Sandro R.; Acencio, Marcio; Alberto, Fernando L.; Amaral, Maria Elisabete J.; Aneas, Ivy; Bengtson, Mário Henrique; Carraro, Dirce M.; Carvalho, Alex F.; Carvalho, Lúcia Helena; Cerutti, Janete M.; Corrêa, Maria Lucia C.; Costa, Maria Cristina R.; Curcio, Cyntia; Gushiken, Tsieko; Ho, Paulo L.; Kimura, Elza; Leite, Luciana C. C.; Maia, Gustavo; Majumder, Paromita; Marins, Mozart; Matsukuma, Adriana; Melo, Analy S. A.; Mestriner, Carlos Alberto; Miracca, Elisabete C.; Miranda, Daniela C.; Nascimento, Ana Lucia T. O.; Nóbrega, Francisco G.; Ojopi, Élida P. B.; Pandolfi, José Rodrigo C.; Pessoa, Luciana Gilbert; Rahal, Paula; Rainho, Claudia A.; da Ro's, Nancy; de Sá, Renata G.; Sales, Magaly M.; da Silva, Neusa P.; Silva, Tereza C.; da Silva, Wilson; Simão, Daniel F.; Sousa, Josane F.; Stecconi, Daniella; Tsukumo, Fernando; Valente, Valéria; Zalcberg, Heloisa; Brentani, Ricardo R.; Reis, Luis F. L.; Dias-Neto, Emmanuel; Simpson, Andrew J. G.
2000-01-01
Transcribed sequences in the human genome can be identified with confidence only by alignment with sequences derived from cDNAs synthesized from naturally occurring mRNAs. We constructed a set of 250,000 cDNAs that represent partial expressed gene sequences and that are biased toward the central coding regions of the resulting transcripts. They are termed ORF expressed sequence tags (ORESTES). The 250,000 ORESTES were assembled into 81,429 contigs. Of these, 1,181 (1.45%) were found to match sequences in chromosome 22 with at least one ORESTES contig for 162 (65.6%) of the 247 known genes, for 67 (44.6%) of the 150 related genes, and for 45 of the 148 (30.4%) EST-predicted genes on this chromosome. Using a set of stringent criteria to validate our sequences, we identified a further 219 previously unannotated transcribed sequences on chromosome 22. Of these, 171 were in fact also defined by EST or full length cDNA sequences available in GenBank but not utilized in the initial annotation of the first human chromosome sequence. Thus despite representing less than 15% of all expressed human sequences in the public databases at the time of the present analysis, ORESTES sequences defined 48 transcribed sequences on chromosome 22 not defined by other sequences. All of the transcribed sequences defined by ORESTES coincided with DNA regions predicted as encoding exons by genscan. (http://genes.mit.edu/GENSCAN.html). PMID:11070084
Identification of human chromosome 22 transcribed sequences with ORF expressed sequence tags
DEFF Research Database (Denmark)
de Souza, S J; Camargo, A A; Briones, M R
2000-01-01
Transcribed sequences in the human genome can be identified with confidence only by alignment with sequences derived from cDNAs synthesized from naturally occurring mRNAs. We constructed a set of 250,000 cDNAs that represent partial expressed gene sequences and that are biased toward the central ...
Liu, Y T; Chen, R K; Lin, S J; Chen, Y C; Chin, S W; Chen, F C; Lee, C Y
2014-04-08
The Orchidaceae is one of the largest and most diverse families of flowering plants. The Dendrobium genus has high economic potential as ornamental plants and for medicinal purposes. In addition, the species of this genus are able to produce large crops. However, many Dendrobium varieties are very similar in outward appearance, making it difficult to distinguish one species from another. This study demonstrated that the 12 Dendrobium species used in this study may be divided into 2 groups by internal transcribed spacer (ITS) sequence analysis. Red and yellow flowers may also be used to separate these species into 2 main groups. In particular, the deciduous characteristic is associated with the ITS genetic diversity of the A group. Of 53 designed simple sequence repeat (SSR) primer pairs, 7 pairs were polymorphic for polymerase chain reaction products that were amplified from a specific band. The results of this study demonstrate that these 7 SSR primer pairs may potentially be used to identify Dendrobium species and their progeny in future studies.
Alastruey-Izquierdo, Ana; Castelli, Maria Victoria; Cuesta, Isabel; Monzon, Araceli; Cuenca-Estrella, Manuel; Rodriguez-Tudela, Juan Luis
2009-04-01
The antifungal susceptibility profiles of 77 clinical strains of Mucorales species, identified by internal transcribed spacer sequencing, were analyzed. MICs obtained at 24 and 48 h were compared. Amphotericin B was the most active agent against all isolates, except for Cunninghamella and Apophysomyces isolates. Posaconazole also showed good activity for all species but Cunninghamella bertholletiae. Voriconazole had no activity against any of the fungi tested. Terbinafine showed good activity, except for Rhizopus oryzae, Mucor circinelloides, and Rhizomucor variabilis isolates.
Alastruey-Izquierdo, Ana; Castelli, Maria Victoria; Cuesta, Isabel; Monzon, Araceli; Cuenca-Estrella, Manuel; Rodriguez-Tudela, Juan Luis
2009-01-01
The antifungal susceptibility profiles of 77 clinical strains of Mucorales species, identified by internal transcribed spacer sequencing, were analyzed. MICs obtained at 24 and 48 h were compared. Amphotericin B was the most active agent against all isolates, except for Cunninghamella and Apophysomyces isolates. Posaconazole also showed good activity for all species but Cunninghamella bertholletiae. Voriconazole had no activity against any of the fungi tested. Terbinafine showed good activity, except for Rhizopus oryzae, Mucor circinelloides, and Rhizomucor variabilis isolates. PMID:19171801
PCR-Internal Transcribed Spacer (ITS) genes sequencing and ...
African Journals Online (AJOL)
Methods: DNA extraction, purification, amplification and sequencing of Internal Transcribed Spacer (ITS) genes were per- formed using ... Keywords: Internal transcribed spacer genes, phylogenetic, genetic relationship, clinical and environmental fungi, HIV-TB. ... Nigeria. An Ethical clearance was obtained from the Eth-.
Petrisko, Jill E; Pearl, Christopher A; Pilliod, David S; Sheridan, Peter P; Williams, Charles F; Peterson, Charles R; Bury, R Bruce
2008-01-01
We assessed the diversity and phylogeny of Saprolegniaceae on amphibian eggs from the Pacific Northwest, with particular focus on Saprolegnia ferax, a species implicated in high egg mortality. We identified isolates from eggs of six amphibians with the internal transcribed spacer (ITS) and 5.8S gene regions and BLAST of the GenBank database. We identified 68 sequences as Saprolegniaceae and 43 sequences as true fungi from at least nine genera. Our phylogenetic analysis of the Saprolegniaceae included isolates within the genera Saprolegnia, Achlya and Leptolegnia. Our phylogeny grouped S. semihypogyna with Achlya rather than with the Saprolegnia reference sequences. We found only one isolate that grouped closely with S. ferax, and this came from a hatchery-raised salmon (Idaho) that we sampled opportunistically. We had representatives of 7-12 species and three genera of Saprolegniaceae on our amphibian eggs. Further work on the ecological roles of different species of Saprolegniaceae is needed to clarify their potential importance in amphibian egg mortality and potential links to population declines.
MytiBase: a knowledgebase of mussel (M. galloprovincialis transcribed sequences
Directory of Open Access Journals (Sweden)
Roch Philippe
2009-02-01
Full Text Available Abstract Background Although Bivalves are among the most studied marine organisms due to their ecological role, economic importance and use in pollution biomonitoring, very little information is available on the genome sequences of mussels. This study reports the functional analysis of a large-scale Expressed Sequence Tag (EST sequencing from different tissues of Mytilus galloprovincialis (the Mediterranean mussel challenged with toxic pollutants, temperature and potentially pathogenic bacteria. Results We have constructed and sequenced seventeen cDNA libraries from different Mediterranean mussel tissues: gills, digestive gland, foot, anterior and posterior adductor muscle, mantle and haemocytes. A total of 24,939 clones were sequenced from these libraries generating 18,788 high-quality ESTs which were assembled into 2,446 overlapping clusters and 4,666 singletons resulting in a total of 7,112 non-redundant sequences. In particular, a high-quality normalized cDNA library (Nor01 was constructed as determined by the high rate of gene discovery (65.6%. Bioinformatic screening of the non-redundant M. galloprovincialis sequences identified 159 microsatellite-containing ESTs. Clusters, consensuses, related similarities and gene ontology searches have been organized in a dedicated, searchable database http://mussel.cribi.unipd.it. Conclusion We defined the first species-specific catalogue of M. galloprovincialis ESTs including 7,112 unique transcribed sequences. Putative microsatellite markers were identified. This annotated catalogue represents a valuable platform for expression studies, marker validation and genetic linkage analysis for investigations in the biology of Mediterranean mussels.
Jill E. Petrisko; Christopher A. Pearl; David S. Pilliod; Peter P. Sheridan; Charles F. Williams; Charles R. Peterson; R. Bruce Bury
2008-01-01
We assessed the diversity and phylogeny of Saprolegniaceae on amphibian eggs from the Pacific Northwest, with particular focus on Saprolegnia ferax, a species implicated in high egg mortality. We identified isolates from eggs of six amphibians with the internal transcribed spacer (ITS) and 5.8S gene regions and BLAST of the GenBank database. We...
Energy Technology Data Exchange (ETDEWEB)
Gardiner, K.
1993-11-01
The Second International Workshop on the Identification of Transcribed Sequences was held in San Francisco on November 7--8, 1992. The purpose of the workshop was to discuss and evaluate techniques for developing a complete transcriptional map of the human genome. Such a map requires the positions, sequences, and expression patterns of all genes. This goal is being approached from two different directions, each with strengths and weaknesses. One method is to identify the transcribed sequences from genomic DNA of a given region; the other is to systematically sequence and map cDNAs. The cDNA approach yields sequence information rapidly, but mapping each cDNA is a technical challenge. In the first approach, the map locations of genomic sequences are known at the outset, and the challenge is to identify exons. The efficient construction of a transcriptional map will require a diverse array of techniques.
Estrada-Gómez, Sebastian; Vargas-Muñoz, Leidy Johana; Saldarriaga-Córdoba, Mónica; Cifuentes, Yeimy; Perafan, Carlos
2017-04-01
Theraphosidae spider venoms are well known for possess a complex mixture of protein and non-protein compounds in their venom. The objective of this study was to report and identify different proteins translated from the venom gland DNA information of the recently described Theraphosidae spider Pamphobeteus verdolaga. Using a venom gland transcriptomic analysis, we reported a set of the first complete sequences of seven different proteins of the recenlty described Theraphosidae spider P. verdolaga. Protein analysis indicates the presence of different proteins on the venom composition of this new spider, some of them uncommon in the Theraphosidae family. MS/MS analysis of P. verdolaga showed different fragments matching sphingomyelinases (sicaritoxin), barytoxins, hexatoxins, latroinsectotoxins, and linear (zadotoxins) peptides. Only four of the MS/MS fragments showed 100% sequence similarity with one of the transcribed proteins. Transcriptomic analysis showed the presence of different groups of proteins like phospholipases, hyaluronidases, inhibitory cysteine knots (ICK) peptides among others. The three database of protein domains used in this study (Pfam, SMART and CDD) showed congruency in the search of unique conserved protein domain for only four of the translated proteins. Those proteins matched with EF-hand proteins, cysteine rich secretory proteins, jingzhaotoxins, theraphotoxins and hexatoxins, from different Mygalomorphae spiders belonging to the families Theraphosidae, Barychelidae and Hexathelidae. None of the analyzed sequences showed a complete 100% similarity. Copyright © 2017 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Koushik Das
2015-01-01
Full Text Available Taxonomic differentiation among morphologically identical Ascaris species is a debatable scientific issue in the context of Ascariasis epidemiology. To explain the disease epidemiology and also the taxonomic position of different Ascaris species, genome information of infecting strains from endemic areas throughout the world is certainly crucial. Ascaris population from human has been genetically characterized based on the widely used genetic marker, internal transcribed spacer1 (ITS1. Along with previously reported and prevalent genotype G1, 8 new sequence variants of ITS1 have been identified. Genotype G1 was significantly present among female patients aged between 10 to 15 years. Intragenic linkage disequilibrium (LD analysis at target locus within our study population has identified an incomplete LD value with potential recombination events. A separate cluster of Indian isolates with high bootstrap value indicate their distinct phylogenetic position in comparison to the global Ascaris population. Genetic shuffling through recombination could be a possible reason for high population diversity and frequent emergence of new sequence variants, identified in present and other previous studies. This study explores the genetic organization of Indian Ascaris population for the first time which certainly includes some fundamental information on the molecular epidemiology of Ascariasis.
Motif signatures of transcribed enhancers
Kleftogiannis, Dimitrios
2017-09-14
In mammalian cells, transcribed enhancers (TrEn) play important roles in the initiation of gene expression and maintenance of gene expression levels in spatiotemporal manner. One of the most challenging questions in biology today is how the genomic characteristics of enhancers relate to enhancer activities. This is particularly critical, as several recent studies have linked enhancer sequence motifs to specific functional roles. To date, only a limited number of enhancer sequence characteristics have been investigated, leaving space for exploring the enhancers genomic code in a more systematic way. To address this problem, we developed a novel computational method, TELS, aimed at identifying predictive cell type/tissue specific motif signatures. We used TELS to compile a comprehensive catalog of motif signatures for all known TrEn identified by the FANTOM5 consortium across 112 human primary cells and tissues. Our results confirm that distinct cell type/tissue specific motif signatures characterize TrEn. These signatures allow discriminating successfully a) TrEn from random controls, proxy of non-enhancer activity, and b) cell type/tissue specific TrEn from enhancers expressed and transcribed in different cell types/tissues. TELS codes and datasets are publicly available at http://www.cbrc.kaust.edu.sa/TELS.
Internal transcribed spacer 2 barcode: A good tool for identifying Acanthopanacis cortex
Directory of Open Access Journals (Sweden)
Sha eZhao
2015-10-01
Full Text Available Acanthopanacis cortex has been used in clinical applications for a long time. Considering some historical and geographical factors, Acanthopanacis cortex is easily confused with other herbs in medicine markets, thereby causing potential safety issues. In this study, we used the internal transcribed spacer 2 (ITS2 barcode to identify 69 samples belonging to six species, including Acanthopanacis cortex and its adulterants. The nearest distance, single-nucleotide polymorphisms (SNPs, and neighbor-joining (NJ tree methods were used to evaluate the identification ability of the ITS2 barcode. According to the kimura-2-parameter model, the intraspecific distance of Eleutherococcus nodiflorus ITS2 sequences ranged from 0 to 0.0132. The minimum interspecific distance between E. nodiflorus and E. giraldii was 0.0221, which was larger than the maximum intraspecific distance of E. nodiflorus. Three stable SNPs in ITS2 can be used to distinguish Acanthopanacis cortex and its closely related species. The NJ tree indicated that the Acanthopanacis cortex samples clustered into one clade, which can be distinguished clearly from the adulterants of this herb. A secondary structure of ITS2 provided another dimensionality to identify species. In conclusion, the ITS2 barcode effectively identifies Acanthopanacis cortex, and DNA barcoding is a convenient tool for medicine market supervision.
A revised nomenclature for transcribed human endogenous retroviral loci
2011-01-01
Background Endogenous retroviruses (ERVs) and ERV-like sequences comprise 8% of the human genome. A hitherto unknown proportion of ERV loci are transcribed and thus contribute to the human transcriptome. A small proportion of these loci encode functional proteins. As the role of ERVs in normal and diseased biological processes is not yet established, transcribed ERV loci are of particular interest. As more transcribed ERV loci are likely to be identified in the near future, the development of a systematic nomenclature is important to ensure that all information on each locus can be easily retrieved. Results Here we present a revised nomenclature of transcribed human endogenous retroviral loci that sorts loci into groups based on Repbase classifications. Each symbol is of the format ERV + group symbol + unique number. Group symbols are based on a mixture of Repbase designations and well-supported symbols used in the literature. The presented guidelines will allow newly identified loci to be easily incorporated into the scheme. Conclusions The naming system will be employed by the HUGO Gene Nomenclature Committee for naming transcribed human ERV loci. We hope that the system will contribute to clarifying a certain aspect of a sometimes confusing nomenclature for human endogenous retroviruses. The presented system may also be employed for naming transcribed loci of human non-ERV repeat loci. PMID:21542922
Zhao, Ying; Tsang, Chi-Ching; Xiao, Meng; Cheng, Jingwei; Xu, Yingchun; Lau, Susanna K P; Woo, Patrick C Y
2015-10-22
Internal transcribed spacer region (ITS) sequencing is the most extensively used technology for accurate molecular identification of fungal pathogens in clinical microbiology laboratories. Intra-genomic ITS sequence heterogeneity, which makes fungal identification based on direct sequencing of PCR products difficult, has rarely been reported in pathogenic fungi. During the process of performing ITS sequencing on 71 yeast strains isolated from various clinical specimens, direct sequencing of the PCR products showed ambiguous sequences in six of them. After cloning the PCR products into plasmids for sequencing, interpretable sequencing electropherograms could be obtained. For each of the six isolates, 10-49 clones were selected for sequencing and two to seven intra-genomic ITS copies were detected. The identities of these six isolates were confirmed to be Candida glabrata (n=2), Pichia (Candida) norvegensis (n=2), Candida tropicalis (n=1) and Saccharomyces cerevisiae (n=1). Multiple sequence alignment revealed that one to four intra-genomic ITS polymorphic sites were present in the six isolates, and all these polymorphic sites were located in the ITS1 and/or ITS2 regions. We report and describe the first evidence of intra-genomic ITS sequence heterogeneity in four different pathogenic yeasts, which occurred exclusively in the ITS1 and ITS2 spacer regions for the six isolates in this study.
(ISSR) and internal transcribed spacer
African Journals Online (AJOL)
Cladistic relationships within the genus Cinnamomum (Lauraceae) in Taiwan based on analysis of leaf morphology and inter-simple sequence repeat (ISSR) and internal transcribed spacer (ITS) molecular markers.
Al-Qurainy, F; Khan, S; Nadeem, M; Tarroum, M; Alaklabi, A
2013-03-11
The rare and endangered plants of any country are important genetic resources that often require urgent conservation measures. Assessment of phylogenetic relationships and evaluation of genetic diversity is very important prior to implementation of conservation strategies for saving rare and endangered plant species. We used internal transcribed spacer sequences of nuclear ribosomal DNA for the evaluation of sequence identity from the available taxa in the GenBank database by using the Basic Local Alignment Search Tool (BLAST). Two rare plant species viz, Heliotropium strigosum claded with H. pilosum (98% branch support) and Pancratium tortuosum claded with P. tenuifolium (61% branch support) clearly. However, some species, viz Scadoxus multiflorus, Commiphora myrrha and Senecio hadiensis showed close relationships with more than one species. We conclude that nuclear ribosomal internal transcribed spacer sequences are useful markers for phylogenetic study of these rare plant species in Saudi Arabia.
Tosto, D S; Hopp, H E
1996-01-01
The internal transcribed spacer region (ITS1 and ITS2) of the 18S-25S nuclear ribosomal DNA sequence and the intervening 5.8S region from five species of the genus Oxalis was amplified by polymerase chain reaction and subjected to direct DNA sequencing. On the basis of cytogenetic studies some species of this genus were postulated to be related by the number of chromosomes. Sequence homologies in the ITS1, 5.8S and ITS2 among species are in good agreement with previous relationships established on the basis of chromosome numbers. We also identified a highly conserved sequence of six bp in the ITS1, reported to be present in a wide range of flowering plants, but not in the Oxalidaceae family to which the genus Oxalis belongs to.
Lee, Shih-Chieh; Wang, Chia-Hsiang; Yen, Cheng-En; Chang, Chieh
2017-04-01
The major aim of made tea identification is to identify the variety and provenance of the tea plant. The present experiment used 113 tea plants [Camellia sinensis (L.) O. Kuntze] housed at the Tea Research and Extension Substation, from which 113 internal transcribed spacer 2 (ITS2) fragments, 104 trnL intron, and 98 trnL-trnF intergenic sequence region DNA sequences were successfully sequenced. The similarity of the ITS2 nucleotide sequences between tea plants housed at the Tea Research and Extension Substation was 0.379-0.994. In this polymerase chain reaction-amplified noncoding region, no varieties possessed identical sequences. Compared with the trnL intron and trnL-trnF intergenic sequence fragments of chloroplast cpDNA, the proportion of ITS2 nucleotide sequence variation was large and is more suitable for establishing a DNA barcode database to identify tea plant varieties. After establishing the database, 30 imported teas and 35 domestic made teas were used in this model system to explore the feasibility of using ITS2 sequences to identify the varieties and provenances of made teas. A phylogenetic tree was constructed using ITS2 sequences with the unweighted pair group method with arithmetic mean, which indicated that the same variety of tea plant is likely to be successfully categorized into one cluster, but contamination from other tea plants was also detected. This result provides molecular evidence that the similarity between important tea varieties in Taiwan remains high. We suggest a direct, wide collection of made tea and original samples of tea plants to establish an ITS2 sequence molecular barcode identification database to identify the varieties and provenances of tea plants. The DNA barcode comparison method can satisfy the need for a rapid, low-cost, frontline differentiation of the large amount of made teas from Taiwan and abroad, and can provide molecular evidence of their varieties and provenances. Copyright © 2016. Published by Elsevier B.V.
Choe, Se-Eun; Nguyen, Thuy Thi-Dieu; Kang, Tae-Gyu; Kweon, Chang-Hee; Kang, Seung-Won
2011-09-01
Nuclear ribosomal DNA sequence of the second internal transcribed spacer (ITS-2) has been used efficiently to identify the liver fluke species collected from different hosts and various geographic regions. ITS-2 sequences of 19 Fasciola samples collected from Korean native cattle were determined and compared. Sequence comparison including ITS-2 sequences of isolates from this study and reference sequences from Fasciola hepatica and Fasciola gigantica and intermediate Fasciola in Genbank revealed seven identical variable sites of investigated isolates. Among 19 samples, 12 individuals had ITS-2 sequences completely identical to that of pure F. hepatica, five possessed the sequences identical to F. gigantica type, whereas two shared the sequence of both F. hepatica and F. gigantica. No variations in length and nucleotide composition of ITS-2 sequence were observed within isolates that belonged to F. hepatica or F. gigantica. At the position of 218, five Fasciola containing a single-base substitution (C>T) formed a distinct branch inside the F. gigantica-type group which was similar to those of Asian-origin isolates. The phylogenetic tree of the Fasciola spp. based on complete ITS-2 sequences from this study and other representative isolates in different locations clearly showed that pure F. hepatica, F. gigantica type and intermediate Fasciola were observed. The result also provided additional genetic evidence for the existence of three forms of Fasciola isolated from native cattle in Korea by genetic approach using ITS-2 sequence.
Oliveros, R; Cutillas, C; De Rojas, M; Arias, P
2000-12-01
Adult worms of Trichuris ovis and T. globulosa were collected from Ovis aries (sheep) and Capra hircus (goats). T. suis was isolated from Sus scrofa domestica (swine) and T. leporis was isolated from Lepus europaeus (rabbits) in Spain. Genomic DNA was isolated and a ribosomal internal transcribed spacer (ITS2) was amplified and sequenced using polymerase-chain-reaction (PCR) techniques. The ITS2 of T. ovis and T. globulosa was 407 nucleotides in length and had a GC content of about 62%. Furthermore, the ITS2 of T. suis and T. leporis was 534 and 418 nucleotides in length and had a GC content of about 64.8% and 62.4%, respectively. There was evidence of slight variation in the sequence within individuals of all species analyzed, indicating intraindividual variation in the sequence of different copies of the ribosomal DNA. Furthermore, low-level intraspecific variation was detected. Sequence analyses of ITS2 products of T. ovis and T. globulosa demonstrated no sequence difference between them. Nevertheless, differences were detected between the ITS2 sequences of T. suis, T. leporis, and T. ovis, indicating that Trichuris species can reliably be differentiated by their ITS2 sequences and PCR-linked restriction-fragment-length polymorphism (RFLP).
[Comparison of rDNA internal transcribed spacer sequences in asparagus].
Ou, Li-Jun; Ye, Wei; Zeng, Gui-Ping; Jiang, Xiang-Hui; She, Chao-Wen; Xu, Dong; Yang, Jia-Qiang
2010-10-01
Using ITS sequence of nine species to identify counterfeiting medicine and analyse phylogenetic of Asparagus. Analysing ITS sequences by amplification, cloning,sequencing and alignment. The length range of ITS sequence of nine species was from 711 to 748 bp, the percentage of G + C content was about 60%. The phylogenetic tree constructed on the basis of the ITS sequences showed that nine species were divided into two branches: Asparagus cochinchinensis, Asparagus officinalis, Asparagus densiflorus, Asparagus densiflorus cv. Myers and Asparagus densiflorus cv. Sprengeri were a branch and the others were a branch. Asparagus densiflorus and Asparagus densflorus cv. Myers those were from Africa had priority to clustering and then clustering with Asparagus densiflorus cv. Sprengeri that was a variant of Asparagus densiflorus in the first branch. Asparagus setaceus had relatively distant genetic relationship with the others three materials in another branch. The ITS sequences could distinguish species of Asparagus to test the counterfeit. Division status in phylogenetic tree of some species were debatable and ITS sequence was combined with others analytical tools to analyze the realistic phylogeny.
Directory of Open Access Journals (Sweden)
Mahsa Shahbakhsh
2016-02-01
Full Text Available Background: The Fasciola trematodes are the most common liver flukes, living in a range of animals with global distribution and resulting in profound economic loss and public health challenges. Previous studies have indicated that the sequences of the second internal transcribed spacer (ITS-2 of ribosomal DNA (rDNA provide reliable genetic markers for molecular systemic studies of Fasciola. Objectives: The objective of the present study was to characterize Fasciola samples from different geographical regions of Sistan and Balouchestan province using sequences of second internal transcribed spacer (ITS-2 of ribosomal DNA (rDNA. Materials and Methods: Twenty adult trematodes were collected from the livers of slaughtered infected cattle. Total genomic DNA was extracted and ITS-2 rDNA targets were amplified by polymerase chain reaction (PCR. All samples were sequenced and investigated using the ClustalW2 sequence alignment tool and MEGA software. The sequences of some Iranian and non-Iranian isolates were used for comparison, in order to evaluate the variation in sequence homology between geographically different trematode populations. Results: The results of comparing the ITS-2 sequences with the BLAST GenBank database showed one type of sequence for F. hepatica and three different types of sequences for F. gigantica in the specimens. Conclusions: The present study demonstrated that Fasciola samples from cattle in two geographical locations in Sistan and Balouchestan province represented no genetic diversity in F. hepatica and high genetic variation in F. gigantica.
Ciardo, Diana E; Lucke, Katja; Imhof, Alex; Bloemberg, Guido V; Böttger, Erik C
2010-08-01
The implementation of internal transcribed spacer (ITS) sequencing for routine identification of molds in the diagnostic mycology laboratory was analyzed in a 5-year study. All mold isolates (n = 6,900) recovered in our laboratory from 2005 to 2009 were included in this study. According to a defined work flow, which in addition to troublesome phenotypic identification takes clinical relevance into account, 233 isolates were subjected to ITS sequence analysis. Sequencing resulted in successful identification for 78.6% of the analyzed isolates (57.1% at species level, 21.5% at genus level). In comparison, extended in-depth phenotypic characterization of the isolates subjected to sequencing achieved taxonomic assignment for 47.6% of these, with a mere 13.3% at species level. Optimization of DNA extraction further improved the efficacy of molecular identification. This study is the first of its kind to testify to the systematic implementation of sequence-based identification procedures in the routine workup of mold isolates in the diagnostic mycology laboratory.
Murray, Vincent; Chen, Jon K; Galea, Anne M
2014-04-01
The genome-wide pattern of DNA cleavage at transcription start sites (TSSs) for the anti-tumor drug bleomycin was examined in human HeLa cells using next-generation DNA sequencing. It was found that actively transcribed genes were preferentially cleaved compared with non-transcribed genes. The 143,600 identified human TSSs were split into non-transcribed genes (82,596) and transcribed genes (61,004) for HeLa cells. These transcribed genes were further split into quintiles of 12,201 genes comprising the top 20, 20-40, 40-60, 60-80, and 80-100 % of expressed genes. The bleomycin cleavage pattern at highly transcribed gene TSSs was greatly enhanced compared with purified DNA and non-transcribed gene TSSs. The top 20 and 20-40 % quintiles had a very similar enhanced cleavage pattern, the 40-60 % quintile was intermediate, while the 60-80 and 80-100 % quintiles were close to the non-transcribed and purified DNA profiles. The pattern of bleomycin enhanced cleavage had peaks that were approximately 200 bp apart, and this indicated that bleomycin was identifying the presence of phased nucleosomes at TSSs. Hence bleomycin can be utilized to detect chromatin structures that are present at actively transcribed genes. In this study, for the first time, the pattern of DNA damage by a clinically utilized cancer chemotherapeutic agent was performed on a human genome-wide scale at the nucleotide level.
Ciardo, Diana E.; Lucke, Katja; Imhof, Alex; Bloemberg, Guido V.; Böttger, Erik C.
2010-01-01
The implementation of internal transcribed spacer (ITS) sequencing for routine identification of molds in the diagnostic mycology laboratory was analyzed in a 5-year study. All mold isolates (n = 6,900) recovered in our laboratory from 2005 to 2009 were included in this study. According to a defined work flow, which in addition to troublesome phenotypic identification takes clinical relevance into account, 233 isolates were subjected to ITS sequence analysis. Sequencing resulted in successful identification for 78.6% of the analyzed isolates (57.1% at species level, 21.5% at genus level). In comparison, extended in-depth phenotypic characterization of the isolates subjected to sequencing achieved taxonomic assignment for 47.6% of these, with a mere 13.3% at species level. Optimization of DNA extraction further improved the efficacy of molecular identification. This study is the first of its kind to testify to the systematic implementation of sequence-based identification procedures in the routine workup of mold isolates in the diagnostic mycology laboratory. PMID:20573873
Directory of Open Access Journals (Sweden)
Maíra C. M. Freire
2008-01-01
Full Text Available Phakopsora pachyrhizi has dispersed globally and brought severe economic losses to soybean growers. The fungus has been established in Brazil since 2002 and is found nationwide. To gather information on the temporal and spatial patterns of genetic variation in P. pachyrhizi , we sequenced the nuclear internal transcribed spacer regions (ITS1 and ITS2. Total genomic DNA was extracted using either lyophilized urediniospores or lesions removed from infected leaves sampled from 26 soybean fields in Brazil and one field in South Africa. Cloning prior to sequencing was necessary because direct sequencing of PCR amplicons gave partially unreadable electrophoretograms with peak displacements suggestive of multiple sequences with length polymorphism. Sequences were determined from four clones per field. ITS sequences from African or Asian isolates available from the GenBank were included in the analyses. Independent sequence alignments of the ITS1 and ITS2 datasets identified 27 and 19 ribotypes, respectively. Molecular phylogeographic analyses revealed that ribotypes of widespread distribution in Brazil displayed characteristics of ancestrality and were shared with Africa and Asia, while ribotypes of rare occurrence in Brazil were indigenous. The results suggest P. pachyrhizi found in Brazil as originating from multiple, independent long-distance dispersal events.
International Nuclear Information System (INIS)
Qurainy, F.A.; Khan, S.; Ali, M.A.; Hemaid, M.A.; Ashraf, M.
2011-01-01
Ruta graveolens L. (Rutaceae) is commonly known as 'Sudab' which is well known for hippocratic medicine and is commonly used in indigenous health-care system in India. Euphorbia dracunculoides Lam. (Euphorbiaceae) in raw drug trading has almost similar morphology to R. graveolens in dried state, is being sold locally or used clinically as an adulterant of R. graveolens (genuine) at a relatively low price under the same name 'Sudab' which has ultimately reduced the efficacy and quality of this herb. The internal transcribed spacer (ITS) sequence of nuclear ribosomal DNA gene of genuine and adulterant were sequenced and analyzed to assess species admixture in raw drug trading of genuine herbal drug. The BLAST search results of ITS sequence of genuine sample of 'Sudab' i.e., R. graveolens showed 99% similarity to the sequence of R. graveolens, however, E. dracunculoides showed 100% similarity to the species of Euphorbia and did not show any similarity with R. graveolens. The sequence alignment of both species was entirely different to each other. Phylogenetic analysis based on ITS sequence of adulterant sample i.e., E. dracunculoides together with sequences of Euphorbia species available in the GenBank has also clearly showed its nesting within the Euphorbia tree. The generated ITS sequences of both samples in the present study may be referred hereafter as species-specific DNA barcode signature, which can be used in authenticating and validating the exact species identities to discriminate the genuine sample of 'Sudab' from its adulterants if any available to guarantee the quality and purity of this drug in the herbal drug market. (author)
Transcribing for Greater Musicality.
Hinz, Bob
1995-01-01
States that transcribing is notating the performance of a musical composition or improvisation as the music is grasped aurally. Maintains that transcribing is effective for high school and college students who want to understand jazz techniques. Includes eight suggestions for teaching transcribing. (CFR)
Cacciò, Simone M; Beck, Relja; Almeida, Andre; Bajer, Anna; Pozio, Edoardo
2010-05-01
PCR assays have been developed mainly to assist investigations into the epidemiology of Giardia duodenalis, the only species in the Giardia genus having zoonotic potential. However, a reliable identification of all species is of practical importance, particularly when water samples and samples from wild animals are investigated. The aim of the present work was to genotype Giardia species and G. duodenalis assemblages using as a target the region spanning the 5.8S gene and the 2 flanking internal transcribed spacers (ITS1 and ITS2) of the ribosomal gene. Primers were designed to match strongly conserved regions in the 3' end of the small subunit and in the 5' end of the large subunit ribosomal genes. The corresponding region (about 310 bp) was amplified from 49 isolates of both human and animal origin, representing all G. duodenalis assemblages as well as G. muris and G. microti. Sequence comparison and phylogenetic analysis showed that G. ardeae, G. muris, G. microti as well as the 7 G. duodenalis assemblages can be easily distinguished. Since the major subgroups within the zoonotic assemblages A and B can be identified by sequence analysis, this assay is also informative for molecular epidemiological studies.
Park, J-H; Sulyok, M; Lemons, A R; Green, B J; Cox-Ganser, J M
2018-05-04
Recent developments in molecular and chemical methods have enabled the analysis of fungal DNA and secondary metabolites, often produced during fungal growth, in environmental samples. We compared 3 fungal analytical methods by analysing floor dust samples collected from an office building for fungi using viable culture, internal transcribed spacer (ITS) sequencing and secondary metabolites using liquid chromatography-tandem mass spectrometry. Of the 32 metabolites identified, 29 had a potential link to fungi with levels ranging from 0.04 (minimum for alternariol monomethylether) to 5700 ng/g (maximum for neoechinulin A). The number of fungal metabolites quantified per sample ranged from 8 to 16 (average = 13/sample). We identified 216 fungal operational taxonomic units (OTUs) with the number per sample ranging from 6 to 29 (average = 18/sample). We identified 37 fungal species using culture, and the number per sample ranged from 2 to 13 (average = 8/sample). Agreement in identification between ITS sequencing and culturing was weak (kappa = -0.12 to 0.27). The number of cultured fungal species poorly correlated with OTUs, which did not correlate with the number of metabolites. These suggest that using multiple measurement methods may provide an improved understanding of fungal exposures in indoor environments and that secondary metabolites may be considered as an additional source of exposure. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Hebeler-Barbosa, Flavia; Morais, Flavia V.; Montenegro, Mario R.; Kuramae, Eiko E.; Montes, Beatriz; McEwen, Juan G.; Bagagli, Eduardo; Puccia, Rosana
2003-01-01
Paracoccidioides brasiliensis isolates from 10 nine-banded armadillos (Dasypus novemcinctus) were comparable with 19 clinical isolates by sequence analysis of the PbGP43 gene and ribosomal internal transcribed spacer 1 (ITS1) and ITS2 and by random amplified polymorphic DNA. In this original ITS study, eight isolates differed by one or three sites among five total substitution sites. PMID:14662970
Lee, Chao-Hung; Helweg-Larsen, Jannik; Tang, Xing; Jin, Shaoling; Li, Baozheng; Bartlett, Marilyn S.; Lu, Jang-Jih; Lundgren, Bettina; Lundgren, Jens D.; Olsson, Mats; Lucas, Sebastian B.; Roux, Patricia; Cargnel, Antonietta; Atzori, Chiara; Matos, Olga; Smith, James W.
1998-01-01
Pneumocystis carinii f. sp. hominis isolates from 207 clinical specimens from nine countries were typed based on nucleotide sequence variations in the internal transcribed spacer regions I and II (ITS1 and ITS2, respectively) of rRNA genes. The number of ITS1 nucleotides has been revised from the previously reported 157 bp to 161 bp. Likewise, the number of ITS2 nucleotides has been changed from 177 to 192 bp. The number of ITS1 sequence types has increased from 2 to 15, and that of ITS2 has increased from 3 to 14. The 15 ITS1 sequence types are designated types A through O, and the 14 ITS2 types are named types a through n. A total of 59 types of P. carinii f. sp. hominis were found in this study. PMID:9508304
Directory of Open Access Journals (Sweden)
Irshad M. Sulaiman
2014-06-01
Full Text Available In our previous study, we described the development of an internal transcribed spacer (ITS1 sequencing method, and used this protocol in species-identification of isolated fungi collected from the manufacturing areas of a compounding company known to have caused the multistate fungal meningitis outbreak in the United States. In this follow-up study, we have analyzed the unopened vials of Greek yogurt from the recalled batch to determine the possible cause of microbial contamination in the product. A total of 15 unopened vials of Greek yogurt belonging to the recalled batch were examined for the detection of fungi in these samples known to cause foodborne illness following conventional microbiological protocols. Fungi were isolated from all of the 15 Greek yogurt samples analyzed. The isolated fungi were genetically typed by DNA sequencing of PCR-amplified ITS1 region of rRNA gene. Analysis of data confirmed all of the isolated fungal isolates from the Greek yogurt to be Rhizomucor variabilis. The generated ITS1 sequences matched 100% with the published sequences available in GenBank. In addition, these yogurt samples were also tested for the presence of five types of bacteria (Salmonella, Listeria, Staphylococcus, Bacillus and Escherichia coli causing foodborne disease in humans, and found negative for all of them.
Kehie, Mechuselie; Kumaria, Suman; Devi, Khumuckcham Sangeeta; Tandon, Pramod
2016-02-01
Sequences of the Internal Transcribed Spacer (ITS1-5.8S-ITS2) of nuclear ribosomal DNAs were explored to study the genetic diversity and molecular evolution of Naga King Chili. Our study indicated the occurrence of nucleotide polymorphism and haplotypic diversity in the ITS regions. The present study demonstrated that the variability of ITS1 with respect to nucleotide diversity and sequence polymorphism exceeded that of ITS2. Sequence analysis of 5.8S gene revealed a much conserved region in all the accessions of Naga King Chili. However, strong phylogenetic information of this species is the distinct 13 bp deletion in the 5.8S gene which discriminated Naga King Chili from the rest of the Capsicum sp. Neutrality test results implied a neutral variation, and population seems to be evolving at drift-mutation equilibrium and free from directed selection pressure. Furthermore, mismatch analysis showed multimodal curve indicating a demographic equilibrium. Phylogenetic relationships revealed by Median Joining Network (MJN) analysis denoted a clear discrimination of Naga King Chili from its closest sister species (Capsicum chinense and Capsicum frutescens). The absence of star-like network of haplotypes suggested an ancient population expansion of this chili.
Rasmussen, C; Purcell, M K; Gregg, J L; LaPatra, S E; Winton, J R; Hershberger, P K
2010-03-09
The mesomycetozoean parasite Ichthyophonus hoferi is most commonly associated with marine fish hosts but also occurs in some components of the freshwater rainbow trout Oncorhynchus mykiss aquaculture industry in Idaho, USA. It is not certain how the parasite was introduced into rainbow trout culture, but it might have been associated with the historical practice of feeding raw, ground common carp Cyprinus carpio that were caught by commercial fisherman. Here, we report a major genetic division between west coast freshwater and marine isolates of Ichthyophonus hoferi. Sequence differences were not detected in 2 regions of the highly conserved small subunit (18S) rDNA gene; however, nucleotide variation was seen in internal transcribed spacer loci (ITS1 and ITS2), both within and among the isolates. Intra-isolate variation ranged from 2.4 to 7.6 nucleotides over a region consisting of approximately 740 bp. Majority consensus sequences from marine/anadromous hosts differed in only 0 to 3 nucleotides (99.6 to 100% nucleotide identity), while those derived from freshwater rainbow trout had no nucleotide substitutions relative to each other. However, the consensus sequences between isolates from freshwater rainbow trout and those from marine/anadromous hosts differed in 13 to 16 nucleotides (97.8 to 98.2% nucleotide identity).
Wang, Pei; Lu, Yanli; Zheng, Mingmin; Rong, Tingzhao; Tang, Qilin
2011-01-01
Genetic relationship of a newly discovered teosinte from Nicaragua, Zea nicaraguensis with waterlogging tolerance, was determined based on randomly amplified polymorphic DNA (RAPD) markers and the internal transcribed spacer (ITS) sequences of nuclear ribosomal DNA using 14 accessions from Zea species. RAPD analysis showed that a total of 5,303 fragments were produced by 136 random decamer primers, of which 84.86% bands were polymorphic. RAPD-based UPGMA analysis demonstrated that the genus Zea can be divided into section Luxuriantes including Zea diploperennis, Zea luxurians, Zea perennis and Zea nicaraguensis, and section Zea including Zea mays ssp. mexicana, Zea mays ssp. parviglumis, Zea mays ssp. huehuetenangensis and Zea mays ssp. mays. ITS sequence analysis showed the lengths of the entire ITS region of the 14 taxa in Zea varied from 597 to 605 bp. The average GC content was 67.8%. In addition to the insertion/deletions, 78 variable sites were recorded in the total ITS region with 47 in ITS1, 5 in 5.8S, and 26 in ITS2. Sequences of these taxa were analyzed with neighbor-joining (NJ) and maximum parsimony (MP) methods to construct the phylogenetic trees, selecting Tripsacum dactyloides L. as the outgroup. The phylogenetic relationships of Zea species inferred from the ITS sequences are highly concordant with the RAPD evidence that resolved two major subgenus clades. Both RAPD and ITS sequence analyses indicate that Zea nicaraguensis is more closely related to Zea luxurians than the other teosintes and cultivated maize, which should be regarded as a section Luxuriantes species. PMID:21525982
International Nuclear Information System (INIS)
Snijder, E.J.; Horzinek, M.C.; Spaan, W.J.
1990-01-01
By using poly(A)-selected RNA from Berne virus (BEV)-infected embryonic mule skin cells as a template, cDNA was prepared and cloned in plasmid pUC9. Recombinants covering a contiguous sequence of about 10 kilobases were identified. Northern (RNA) blot hybridizations with various restriction fragments from these clones showed that the five BEV mRNAs formed a 3'-coterminal nested set. Sequence analysis revealed the presence of four complete open reading frames of 4743, 699, 426, and 480 nucleotides, with initiation codons coinciding with the 5' ends of BEV RNAs 2 through 5, respectively. By using primer extension analysis and oligonucleotide hybridizations, RNA 5 was found to be contiguous on the consensus sequence. The transcription of BEV mRNAs was studied by means of UV mapping. BEV RNAs 1, 2, and 3 were shown to be transcribed independently, which is also likely--although not rigorously proven--for RNAs 4 and 5. Upstream of the AUG codon of each open reading frame a conserved sequence pattern was observed which is postulated to function as a core promoter sequence in subgenomic RNA transcription. In the area surrounding the core promoter region of the two most abundant subgenomic BEV RNAs, a number of homologous sequence motifs were identified
Directory of Open Access Journals (Sweden)
Teofânia HDA Vidigal
2004-03-01
Full Text Available The first and second internal transcribed spacer regions (ITS1 and ITS2 of the ribosomal DNA of Biomphalaria tenagophila complex (B. tenagophila, B. occidentalis, and B. t. guaibensis were sequenced and compared. The alignment lengths of these regions were about 655 bp and 481 bp, respectively. Phylogenetic relationships among the Biomphalaria species were inferred by Maximum Parsimony and Neighbor-joining methods. The phylogenetic trees produced, in most of the cases, were in accordance with morphological systematics and other molecular data previously obtained by polymerase chain reaction and restriction fragment length polymorphism analysis. The present results provide support for the proposal that B. tenagophila represents a complex comprising B. tenagophila, B. occidentalis and B. t. guaibensis.
Santamaria, Monica; Fosso, Bruno; Licciulli, Flavio; Balech, Bachir; Larini, Ilaria; Grillo, Giorgio; De Caro, Giorgio; Liuni, Sabino; Pesole, Graziano
2018-01-04
A holistic understanding of environmental communities is the new challenge of metagenomics. Accordingly, the amplicon-based or metabarcoding approach, largely applied to investigate bacterial microbiomes, is moving to the eukaryotic world too. Indeed, the analysis of metabarcoding data may provide a comprehensive assessment of both bacterial and eukaryotic composition in a variety of environments, including human body. In this respect, whereas hypervariable regions of the 16S rRNA are the de facto standard barcode for bacteria, the Internal Transcribed Spacer 1 (ITS1) of ribosomal RNA gene cluster has shown a high potential in discriminating eukaryotes at deep taxonomic levels. As metabarcoding data analysis rely on the availability of a well-curated barcode reference resource, a comprehensive collection of ITS1 sequences supplied with robust taxonomies, is highly needed. To address this issue, we created ITSoneDB (available at http://itsonedb.cloud.ba.infn.it/) which in its current version hosts 985 240 ITS1 sequences spanning over 134 000 eukaryotic species. Each ITS1 is mapped on the NCBI reference taxonomy with its start and end positions precisely annotated. ITSoneDB has been developed in agreement to the FAIR guidelines by enabling the users to query and download its content through a simple web-interface and access relevant metadata by cross-linking to European Nucleotide Archive. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Whipps, Christopher M.; El-Matbouli, M.; Hedrick, R.P.; Blazer, V.; Kent, M.L.
2004-01-01
Molecular approaches for resolving relationships among the Myxozoa have relied mainly on small subunit (SSU) ribosomal DNA (rDNA) sequence analysis. This region of the gene is generally used for higher phylogenetic studies, and the conservative nature of this gene may make it inadequate for intraspecific comparisons. Previous intraspecific studies of Myxobolus cerebralis based on molecular analyses reported that the sequence of SSU rDNA and the internal transcribed spacer (ITS) were highly conserved in representatives of the parasite from North America and Europe. Considering that the ITS is usually a more variable region than the SSU, we reanalyzed available sequences on GenBank and obtained sequences from other M. cerebralis representatives from the states of California and West Virginia in the USA and from Germany and Russia. With the exception of 7 base pairs, most of the sequence designated as ITS-1 in GenBank was a highly conserved portion of the rDNA near the 3-prime end of the SSU region. Nonetheless, the additional ITS-1 sequences obtained from the available geographic representatives were well conserved. It is unlikely that we would have observed virtually identical ITS-1 sequences between European and American M. cerebralis samples had it spread naturally over time, particularly when compared to the variation seen between isolates of another myxozoan (Kudoa thyrsites) that has most likely spread naturally. These data further support the hypothesis that the current distribution of M. cerebralis in North America is a result of recent introductions followed by dispersal via anthropogenic means, largely through the stocking of infected trout for sport fishing.
Geisler, Christoph; Jarvis, Donald L
2016-07-01
Spodoptera frugiperda (Sf) cell lines are used to produce several biologicals for human and veterinary use. Recently, it was discovered that all tested Sf cell lines are persistently infected with Sf-rhabdovirus, a novel rhabdovirus. As part of an effort to search for other adventitious viruses, we searched the Sf cell genome and transcriptome for sequences related to Sf-rhabdovirus. To our surprise, we found intact Sf-rhabdovirus N- and P-like ORFs, and partial Sf-rhabdovirus G- and L-like ORFs. The transcribed and genomic sequences matched, indicating the transcripts were derived from the genomic sequences. These appear to be endogenous viral elements (EVEs), which result from the integration of partial viral genetic material into the host cell genome. It is theoretically impossible for the Sf-rhabdovirus-like EVEs to produce infectious virus particles as 1) they are disseminated across 4 genomic loci, 2) the G and L ORFs are incomplete, and 3) the M ORF is missing. Our finding of transcribed virus-like sequences in Sf cells underscores that MPS-based searches for adventitious viruses in cell substrates used to manufacture biologics should take into account both genomic and transcribed sequences to facilitate the identification of transcribed EVE's, and to avoid false positive detection of replication-competent adventitious viruses. Copyright © 2016 International Alliance for Biological Standardization. Published by Elsevier Ltd. All rights reserved.
Ghosh, Jayadri Sekhar; Bhattacharya, Samik; Pal, Amita
2017-06-01
The unavailability of the reproductive structure and unpredictability of vegetative characters for the identification and phylogenetic study of bamboo prompted the application of molecular techniques for greater resolution and consensus. We first employed internal transcribed spacer (ITS1, 5.8S rRNA and ITS2) sequences to construct the phylogenetic tree of 21 tropical bamboo species. While the sequence alone could grossly reconstruct the traditional phylogeny amongst the 21-tropical species studied, some anomalies were encountered that prompted a further refinement of the phylogenetic analyses. Therefore, we integrated the secondary structure of the ITS sequences to derive individual sequence-structure matrix to gain more resolution on the phylogenetic reconstruction. The results showed that ITS sequence-structure is the reliable alternative to the conventional phenotypic method for the identification of bamboo species. The best-fit topology obtained by the sequence-structure based phylogeny over the sole sequence based one underscores closer clustering of all the studied Bambusa species (Sub-tribe Bambusinae), while Melocanna baccifera, which belongs to Sub-Tribe Melocanneae, disjointedly clustered as an out-group within the consensus phylogenetic tree. In this study, we demonstrated the dependability of the combined (ITS sequence+structure-based) approach over the only sequence-based analysis for phylogenetic relationship assessment of bamboo.
2012-01-01
Background Apple is an economically important fruit crop worldwide. Developing a genetic linkage map is a critical step towards mapping and cloning of genes responsible for important horticultural traits in apple. To facilitate linkage map construction, we surveyed and characterized the distribution and frequency of perfect microsatellites in assembled contig sequences of the apple genome. Results A total of 28,538 SSRs have been identified in the apple genome, with an overall density of 40.8 SSRs per Mb. Di-nucleotide repeats are the most frequent microsatellites in the apple genome, accounting for 71.9% of all microsatellites. AT/TA repeats are the most frequent in genomic regions, accounting for 38.3% of all the G-SSRs, while AG/GA dimers prevail in transcribed sequences, and account for 59.4% of all EST-SSRs. A total set of 310 SSRs is selected to amplify eight apple genotypes. Of these, 245 (79.0%) are found to be polymorphic among cultivars and wild species tested. AG/GA motifs in genomic regions have detected more alleles and higher PIC values than AT/TA or AC/CA motifs. Moreover, AG/GA repeats are more variable than any other dimers in apple, and should be preferentially selected for studies, such as genetic diversity and linkage map construction. A total of 54 newly developed apple SSRs have been genetically mapped. Interestingly, clustering of markers with distorted segregation is observed on linkage groups 1, 2, 10, 15, and 16. A QTL responsible for malic acid content of apple fruits is detected on linkage group 8, and accounts for ~13.5% of the observed phenotypic variation. Conclusions This study demonstrates that di-nucleotide repeats are prevalent in the apple genome and that AT/TA and AG/GA repeats are the most frequent in genomic and transcribed sequences of apple, respectively. All SSR motifs identified in this study as well as those newly mapped SSRs will serve as valuable resources for pursuing apple genetic studies, aiding the apple breeding
International Nuclear Information System (INIS)
Al-Qurainy, F.; Al-Hemaidi, F.M.; Khan, S.; Ali, M.A.; Tarroum, M.; Ashraf, M.
2011-01-01
Sodium azide (NaN/sub 3/) is a well known chemical mutagen which can effectively cause point mutation in plant genome. The mutagenicity by this potential mutagen was assessed in the regenerated mutant shoots of Artemisia annua using internal transcribed spacer (ITS) sequences of n rDNA. Insertions and/or deletions were detected in n rDNA-ITS sequences of all mutant shoots and compared with control ones using the ClustalX program. The regenerated shoots TS1 and TS2 had deleted bases, whereas TS3, TS4 and TS5 had insertions, because NaN/sub 3/ replaced the cytosine (C) by thymine (T) (C - T) (shoots; TS1 and TS4) and thymine (T) replaced by guanine (G) (T - G) (shoot; TS5), respectively. Artemisinin content was also measured in the regenerated six-week-old shoots of A. annua. All regenerated shoots had enhanced level of this compound as compared to that in the controls, being highest in the regenerated shoot TS3. (author)
Directory of Open Access Journals (Sweden)
Ana Sahara
2015-10-01
Full Text Available Rhiphicephalus (Boophilus microplus is important obligatory blood feeding ectoparasites transmittingmany different viral, bacterial and protozoan and plays a role as a vector of Babesia sp., The leria sp. andAnaplasma sp. in cattle. The accuracy in identifying and distinguishing interspecies and intraspeciesdiversity among parasites is needed to understand the epidemiology, biology and capacity as a vector.Variations in the DNA base sequence of the internal transcribed spacer region2 (ITS 2 has been used asa molecular marker for identification in an effort to determine phylogenetic relationships. The aim of thisstudy was to determine the ITS 2 gene nucleotide sequence of R. microplus, which was expected to beuseful for accurate identification the parasite diversity and phylogenetic relationship among many differentspecies. DNA amplification was conducted using BOO2 forward dan BOO2 reverse primers. The DNAsamples containing ITS2 region fragment of 1099 nt were derived from the nucleotide sequence multiplealignments of R.microplus and other ticks genes obtained from Gene bank using Clustal W software, andthen analyzed using the MEGA program version 6. Genetic distances based on nucleotide sequence weredetermined with Kimura 2-parameter method producing the smallest genetic distance of 0 % and 1.2 %.Construction of phylogenetic trees using the Neighbor joining method showed that ticks from variousregions in Indonesia was species complex which have a closer with R.microplus isolates from India, Laos,South Africa, China and Australia R.australis origin.
Gosman, Minna L.
Developed as a result of an analysis of the task of transcribing as practiced in a health facility, this study guide was designed to teach the knowledge and skills required of a medical transcriber. The medical record department was identified as a major occupational area, and a task inventory for medical records was developed and used as a basis…
Gosman, Minna L.
Following an analysis of the task of transcribing as practiced in a health facility, this study guide was developed to teach the knowledge and skills required of a medical transcriber. The medical record department was identified as a major occupational area, and a task inventory for medical records was developed and used as a basis for a…
Directory of Open Access Journals (Sweden)
Qiwei Zeng
Full Text Available Mulberry, belonging to the order Rosales, family Moraceae, and genus Morus, has received attention because of both its economic and medicinal value, as well as for its important ecological function. The genus Morus has a worldwide distribution, however, its taxonomy remains complex and disputed. Many studies have attempted to classify Morus species, resulting in varied numbers of designated Morus spp. To address this issue, we used information from internal transcribed spacer (ITS genetic sequences to study the taxonomy of all the members of generally accepted genus Morus. We found that intraspecific 5.8S rRNA sequences were identical but that interspecific 5.8S sequences were diverse. M. alba and M. notabilis showed the shortest (215 bp and the longest (233 bp ITS1 sequence length, respectively. With the completion of the mulberry genome, we could identify single nucleotide polymorphisms within the ITS locus in the M. notabilis genome. From reconstruction of a phylogenetic tree based on the complete ITS data, we propose that the Morus genus should be classified into eight species, including M. alba, M. nigra, M. notabilis, M. serrata, M. celtidifolia, M. insignis, M. rubra, and M. mesozygia. Furthermore, the classification of the ITS sequences of known interspecific hybrid clones into both paternal and maternal clades indicated that ITS variation was sufficient to distinguish interspecific hybrids in the genus Morus.
Zeng, Qiwei; Chen, Hongyu; Zhang, Chao; Han, Minjing; Li, Tian; Qi, Xiwu; Xiang, Zhonghuai; He, Ningjia
2015-01-01
Mulberry, belonging to the order Rosales, family Moraceae, and genus Morus, has received attention because of both its economic and medicinal value, as well as for its important ecological function. The genus Morus has a worldwide distribution, however, its taxonomy remains complex and disputed. Many studies have attempted to classify Morus species, resulting in varied numbers of designated Morus spp. To address this issue, we used information from internal transcribed spacer (ITS) genetic sequences to study the taxonomy of all the members of generally accepted genus Morus. We found that intraspecific 5.8S rRNA sequences were identical but that interspecific 5.8S sequences were diverse. M. alba and M. notabilis showed the shortest (215 bp) and the longest (233 bp) ITS1 sequence length, respectively. With the completion of the mulberry genome, we could identify single nucleotide polymorphisms within the ITS locus in the M. notabilis genome. From reconstruction of a phylogenetic tree based on the complete ITS data, we propose that the Morus genus should be classified into eight species, including M. alba, M. nigra, M. notabilis, M. serrata, M. celtidifolia, M. insignis, M. rubra, and M. mesozygia. Furthermore, the classification of the ITS sequences of known interspecific hybrid clones into both paternal and maternal clades indicated that ITS variation was sufficient to distinguish interspecific hybrids in the genus Morus.
Zeng, Qiwei; Chen, Hongyu; Zhang, Chao; Han, Minjing; Li, Tian; Qi, Xiwu; Xiang, Zhonghuai; He, Ningjia
2015-01-01
Mulberry, belonging to the order Rosales, family Moraceae, and genus Morus, has received attention because of both its economic and medicinal value, as well as for its important ecological function. The genus Morus has a worldwide distribution, however, its taxonomy remains complex and disputed. Many studies have attempted to classify Morus species, resulting in varied numbers of designated Morus spp. To address this issue, we used information from internal transcribed spacer (ITS) genetic sequences to study the taxonomy of all the members of generally accepted genus Morus. We found that intraspecific 5.8S rRNA sequences were identical but that interspecific 5.8S sequences were diverse. M. alba and M. notabilis showed the shortest (215 bp) and the longest (233 bp) ITS1 sequence length, respectively. With the completion of the mulberry genome, we could identify single nucleotide polymorphisms within the ITS locus in the M. notabilis genome. From reconstruction of a phylogenetic tree based on the complete ITS data, we propose that the Morus genus should be classified into eight species, including M. alba, M. nigra, M. notabilis, M. serrata, M. celtidifolia, M. insignis, M. rubra, and M. mesozygia. Furthermore, the classification of the ITS sequences of known interspecific hybrid clones into both paternal and maternal clades indicated that ITS variation was sufficient to distinguish interspecific hybrids in the genus Morus. PMID:26266951
Identifying structural variants using linked-read sequencing data.
Elyanow, Rebecca; Wu, Hsin-Ta; Raphael, Benjamin J
2017-11-03
Structural variation, including large deletions, duplications, inversions, translocations, and other rearrangements, is common in human and cancer genomes. A number of methods have been developed to identify structural variants from Illumina short-read sequencing data. However, reliable identification of structural variants remains challenging because many variants have breakpoints in repetitive regions of the genome and thus are difficult to identify with short reads. The recently developed linked-read sequencing technology from 10X Genomics combines a novel barcoding strategy with Illumina sequencing. This technology labels all reads that originate from a small number (~5-10) DNA molecules ~50Kbp in length with the same molecular barcode. These barcoded reads contain long-range sequence information that is advantageous for identification of structural variants. We present Novel Adjacency Identification with Barcoded Reads (NAIBR), an algorithm to identify structural variants in linked-read sequencing data. NAIBR predicts novel adjacencies in a individual genome resulting from structural variants using a probabilistic model that combines multiple signals in barcoded reads. We show that NAIBR outperforms several existing methods for structural variant identification - including two recent methods that also analyze linked-reads - on simulated sequencing data and 10X whole-genome sequencing data from the NA12878 human genome and the HCC1954 breast cancer cell line. Several of the novel somatic structural variants identified in HCC1954 overlap known cancer genes. Software is available at compbio.cs.brown.edu/software. braphael@princeton.edu. Supplementary data are available at Bioinformatics online. © The Author (2017). Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com
Newton, L A; Chilton, N B; Beveridge, I; Gasser, R B
1998-02-01
Genetic differences among Nematodirus spathiger, Nematodirus filicollis, Nematodirus helvetianus and Nematodirus battus in the nucleotide sequence of the second internal transcribed spacer (ITS-2) of ribosomal DNA ranged from 3.9 to 24.7%. Pairwise comparisons of their ITS-2 sequences indicated that the most genetically similar species were N. spathiger and N. helvetianus. N. battus was the most genetically distinct species, with differences ranging from 22.8 to 24.7% with respect to the other three species. Some of the nucleotide differences among species provided different endonuclease restriction sites that could be used in restriction fragment length polymorphism studies. The ITS-2 sequence data may prove useful in studies of the systematics of molineid nematodes.
Distanced Data: Transcribing Other People's Research Tapes
Tilley, Susan A.; Powick, Kelly D.
2004-01-01
In this article, we report on our qualitative study involving eight individuals hired to transcribe research tapes in university contexts. We consider issues of data analysis and data trustworthiness and the implications for both when transcription is assigned to someone other than the researcher. We explore the challenges transcribers faced…
Hiesel, Rudolf; Schobel, Werner; Schuster, Wolfgang; Brennicke, Axel
1987-01-01
Two loci encoding subunit III of the cytochrome oxidase (COX) in Oenothera mitochondria have been identified from a cDNA library of mitochondrial transcripts. A 657-bp sequence block upstream from the open reading frame is also present in the two copies of the COX subunit I gene and is presumably involved in homologous sequence rearrangement. The proximal points of sequence rearrangements are located 3 bp upstream from the COX I and 1139 bp upstream from the COX III initiation codons. The 5'-termini of both COX I and COX III mRNAs have been mapped in this common sequence confining the promoter region for the Oenothera mitochondrial COX I and COX III genes to the homologous sequence block. ImagesFig. 5. PMID:15981332
Borodulina, Olga R; Golubchikova, Julia S; Ustyantsev, Ilia G; Kramerov, Dmitri A
2016-02-01
It is generally accepted that only transcripts synthesized by RNA polymerase II (e.g., mRNA) were subject to AAUAAA-dependent polyadenylation. However, we previously showed that RNA transcribed by RNA polymerase III (pol III) from mouse B2 SINE could be polyadenylated in an AAUAAA-dependent manner. Many species of mammalian SINEs end with the pol III transcriptional terminator (TTTTT) and contain hexamers AATAAA in their A-rich tail. Such SINEs were united into Class T(+), whereas SINEs lacking the terminator and AATAAA sequences were classified as T(-). Here we studied the structural features of SINE pol III transcripts that are necessary for their polyadenylation. Eight and six SINE families from classes T(+) and T(-), respectively, were analyzed. The replacement of AATAAA with AACAAA in T(+) SINEs abolished the RNA polyadenylation. Interestingly, insertion of the polyadenylation signal (AATAAA) and pol III transcription terminator in T(-) SINEs did not result in polyadenylation. The detailed analysis of three T(+) SINEs (B2, DIP, and VES) revealed areas important for the polyadenylation of their pol III transcripts: the polyadenylation signal and terminator in A-rich tail, β region positioned immediately downstream of the box B of pol III promoter, and τ region located upstream of the tail. In DIP and VES (but not in B2), the τ region is a polypyrimidine motif which is also characteristic of many other T(+) SINEs. Most likely, SINEs of different mammals acquired these structural features independently as a result of parallel evolution. Copyright © 2015 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Forrester, H.B.; Radford, I.R.
2003-01-01
Full text: DNA rearrangement events leading to chromosomal aberrations are central to ionizing radiation-induced cell death. Although DNA double-strand breaks are probably the lesion that initiates formation of chromosomal aberrations, little is understood about the molecular mechanisms that generate and modulate DNA rearrangement. Examination of the sequences that flank sites of DNA rearrangement may provide information regarding the processes and enzymes involved in rearrangement events. Accordingly, we developed a method using inverse PCR that allows the detection and sequencing of putative radiation-induced DNA rearrangements in defined regions of the human genome. The method can detect single copies of a rearrangement event that has occurred in a particular region of the genome and, therefore, DNA rearrangement detection does not require survival and continued multiplication of the affected cell. Ionizing radiation-induced DNA rearrangements were detected in several different regions of the genome of human fibroblast cells that were exposed to 30 Gy of γ-irradiation and then incubated for 24 hours at 37 deg C. There was a 3- to 5-fold increase in the number of products amplified from irradiated as compared with control cells in the target regions 5' to the C-MYC, CDKN1A, RB1, and FGFR2 genes. Sequences were examined from 121 DNA rearrangements. Approximately half of the PCR products were derived from possible inter-chromosomal rearrangements and the remainder were from intra-chromosomal events. A high proportion of the sequences that rearranged with target regions were located in genes, suggesting that rearrangements may occur preferentially in transcribed regions. Eighty-four percent of the sequences examined by reverse transcriptase PCR were from transcribed sequences in IMR-90 cells. The distribution of DNA rearrangements within the target regions is non-random and homology occurs between the sequences involved in rearrangements in some cases but is not
Pereira, J O P; Freitas, B M; Jorge, D M M; Torres, D C; Soares, C E A; Grangeiro, T B
2009-01-01
Melipona quinquefasciata is a ground-nesting South American stingless bee whose geographic distribution was believed to comprise only the central and southern states of Brazil. We obtained partial sequences (about 500-570 bp) of first internal transcribed spacer (ITS1) nuclear ribosomal DNA from Melipona specimens putatively identified as M. quinquefasciata collected from different localities in northeastern Brazil. To confirm the taxonomic identity of the northeastern samples, specimens from the state of Goiás (Central region of Brazil) were included for comparison. All sequences were deposited in GenBank (accession numbers EU073751-EU073759). The mean nucleotide divergence (excluding sites with insertions/deletions) in the ITS1 sequences was only 1.4%, ranging from 0 to 4.1%. When the sites with insertions/deletions were also taken into account, sequence divergences varied from 0 to 5.3%. In all pairwise comparisons, the ITS1 sequence from the specimens collected in Goiás was most divergent compared to the ITS1 sequences of the bees from the other locations. However, neighbor-joining phylogenetic analysis showed that all ITS1 sequences from northeastern specimens along with the sample of Goiás were resolved in a single clade with a bootstrap support of 100%. The ITS1 sequencing data thus support the occurrence of M. quinquefasciata in northeast Brazil.
Zhang, Dequan; Jiang, Bei; Duan, Lizhen; Zhou, Nong
2016-01-01
DNA barcoding is a technique used to identify species based on species-specific differences in short regions of their DNA. It is widely used in species discrimination of medicinal plants and traditional medicines. In the present study, four potential DNA barcodes, namely rbcL , matK , trnH-psbA and ITS (nuclear ribosomal internal transcribed spacer) were adopted for species discrimination in Crawfurdia Wall (Genetiaceae). Identification ability of these DNA barcodes and combinations were evaluated using three classic methods (Distance, Blast and Tree-Building). As a result, ITS, trnH-psbA and rbcL regions showed great universality for a success rate of 100%; whereas matK was disappointing for which only 65% samples gained useful DNA sequences. ITS region, which could clearly and effectively identify the five species in Crawfurdia , performed very well in this study. On the contrary, trnH-psbA and rbcL performed poorly in discrimination among these species. ITS marker was an ideal DNA barcode in Crawfurdia and it should be incorporated into one of the core barcodes for seed plants.
Identifying Corneal Infections in Formalin-Fixed Specimens Using Next Generation Sequencing.
Li, Zhigang; Breitwieser, Florian P; Lu, Jennifer; Jun, Albert S; Asnaghi, Laura; Salzberg, Steven L; Eberhart, Charles G
2018-01-01
We test the ability of next-generation sequencing, combined with computational analysis, to identify a range of organisms causing infectious keratitis. This retrospective study evaluated 16 cases of infectious keratitis and four control corneas in formalin-fixed tissues from the pathology laboratory. Infectious cases also were analyzed in the microbiology laboratory using culture, polymerase chain reaction, and direct staining. Classified sequence reads were analyzed with two different metagenomics classification engines, Kraken and Centrifuge, and visualized using the Pavian software tool. Sequencing generated 20 to 46 million reads per sample. On average, 96% of the reads were classified as human, 0.3% corresponded to known vectors or contaminant sequences, 1.7% represented microbial sequences, and 2.4% could not be classified. The two computational strategies successfully identified the fungal, bacterial, and amoebal pathogens in most patients, including all four bacterial and mycobacterial cases, five of six fungal cases, three of three Acanthamoeba cases, and one of three herpetic keratitis cases. In several cases, additional potential pathogens also were identified. In one case with cytomegalovirus identified by Kraken and Centrifuge, the virus was confirmed by direct testing, while two where Staphylococcus aureus or cytomegalovirus were identified by Centrifuge but not Kraken could not be confirmed. Confirmation was not attempted for an additional three potential pathogens identified by Kraken and 11 identified by Centrifuge. Next generation sequencing combined with computational analysis can identify a wide range of pathogens in formalin-fixed corneal specimens, with potential applications in clinical diagnostics and research.
Meijer, Wilhelmus; Enequist, H.G.; Terpstra, Peter; Dijkhuizen, L.
The genes encoding fructosebisphosphatase and phosphoribulokinase present on a 2.5 kb SalI fragment from Xanthobacter flavus H4-14 were sequenced. Two large open reading frames (ORFs) were identified, preceded by plausible ribosome-binding sites. The ORFs were transcribed in the same direction and
Manuscript Transcription by Crowdsourcing: Transcribe Bentham
Directory of Open Access Journals (Sweden)
Martin Moyle
2011-02-01
Full Text Available Transcribe Bentham is testing the feasibility of outsourcing the work of manuscript transcription to members of the public. UCL Library Services holds 60,000 folios of manuscripts of the philosopher and jurist Jeremy Bentham (1748–1832. Transcribe Bentham will digitise 12,500 Bentham folios, and, through a wiki-based interface, allow volunteer transcribers to take temporary ownership of manuscript images and to create TEI-encoded transcription text for final approval by UCL experts. Approved transcripts will be stored and preserved, with the manuscript images, in UCL’s public Digital Collections repository. The project makes innovative use of traditional library material. It will stimulate public engagement with UCL’s scholarly archive collections and the challenges of palaeography and manuscript transcription; it will raise the profile of the work and thought of Jeremy Bentham; and it will create new digital resources for future use by professional researchers. Towards the end of the project, the transcription tool will be made available to other projects and services. This paper is based on a presentation given by the lead author at LIBER’s 39th Annual General Conference in Aarhus, Denmark, 2010.
Motif signatures of transcribed enhancers
Kleftogiannis, Dimitrios A.; Ashoor, Haitham; Zarokanellos, Nikolaos; Bajic, Vladimir B.
2017-01-01
In mammalian cells, transcribed enhancers (TrEn) play important roles in the initiation of gene expression and maintenance of gene expression levels in spatiotemporal manner. One of the most challenging questions in biology today is how the genomic
Close Sequence Comparisons are Sufficient to Identify Humancis-Regulatory Elements
Energy Technology Data Exchange (ETDEWEB)
Prabhakar, Shyam; Poulin, Francis; Shoukry, Malak; Afzal, Veena; Rubin, Edward M.; Couronne, Olivier; Pennacchio, Len A.
2005-12-01
Cross-species DNA sequence comparison is the primary method used to identify functional noncoding elements in human and other large genomes. However, little is known about the relative merits of evolutionarily close and distant sequence comparisons, due to the lack of a universal metric for sequence conservation, and also the paucity of empirically defined benchmark sets of cis-regulatory elements. To address this problem, we developed a general-purpose algorithm (Gumby) that detects slowly-evolving regions in primate, mammalian and more distant comparisons without requiring adjustment of parameters, and ranks conserved elements by P-value using Karlin-Altschul statistics. We benchmarked Gumby predictions against previously identified cis-regulatory elements at diverse genomic loci, and also tested numerous extremely conserved human-rodent sequences for transcriptional enhancer activity using reporter-gene assays in transgenic mice. Human regulatory elements were identified with acceptable sensitivity and specificity by comparison with 1-5 other eutherian mammals or 6 other simian primates. More distant comparisons (marsupial, avian, amphibian and fish) failed to identify many of the empirically defined functional noncoding elements. We derived an intuitive relationship between ancient and recent noncoding sequence conservation from whole genome comparative analysis, which explains some of these findings. Lastly, we determined that, in addition to strength of conservation, genomic location and/or density of surrounding conserved elements must also be considered in selecting candidate enhancers for testing at embryonic time points.
Identification of tissue-embedded ascarid larvae by ribosomal DNA sequencing.
Ishiwata, Kenji; Shinohara, Akio; Yagi, Kinpei; Horii, Yoichiro; Tsuchiya, Kimiyuki; Nawa, Yukifumi
2004-01-01
Polymerase chain reaction (PCR) was applied to identify tissue-embedded ascarid nematode larvae. Two sequences of the internal transcribed spacer (ITS) regions of ribosomal DNA (rDNA), ITS1 and ITS2, of the ascarid parasites were amplified and compared with those of ascarid-nematodes registered in a DNA database (GenBank). The ITS sequences of the PCR products obtained from the ascarid parasite specimen in our laboratory were compatible with those of registered adult Ascaris and Toxocara parasites. PCR amplification of the ITS regions was sensitive enough to detect a single larva of Ascaris suum mixed with porcine liver tissue. Using this method, ascarid larvae embedded in the liver of a naturally infected turkey were identified as Toxocara canis. These results suggest that even a single larva embedded in tissues from patients with larva migrans could be identified by sequencing the ITS regions.
Gene Unprediction with Spurio: A tool to identify spurious protein sequences.
Höps, Wolfram; Jeffryes, Matt; Bateman, Alex
2018-01-01
We now have access to the sequences of tens of millions of proteins. These protein sequences are essential for modern molecular biology and computational biology. The vast majority of protein sequences are derived from gene prediction tools and have no experimental supporting evidence for their translation. Despite the increasing accuracy of gene prediction tools there likely exists a large number of spurious protein predictions in the sequence databases. We have developed the Spurio tool to help identify spurious protein predictions in prokaryotes. Spurio searches the query protein sequence against a prokaryotic nucleotide database using tblastn and identifies homologous sequences. The tblastn matches are used to score the query sequence's likelihood of being a spurious protein prediction using a Gaussian process model. The most informative feature is the appearance of stop codons within the presumed translation of homologous DNA sequences. Benchmarking shows that the Spurio tool is able to distinguish spurious from true proteins. However, transposon proteins are prone to be predicted as spurious because of the frequency of degraded homologs found in the DNA sequence databases. Our initial experiments suggest that less than 1% of the proteins in the UniProtKB sequence database are likely to be spurious and that Spurio is able to identify over 60 times more spurious proteins than the AntiFam resource. The Spurio software and source code is available under an MIT license at the following URL: https://bitbucket.org/bateman-group/spurio.
Exome sequencing identifies ZNF644 mutations in high myopia.
Directory of Open Access Journals (Sweden)
Yi Shi
2011-06-01
Full Text Available Myopia is the most common ocular disorder worldwide, and high myopia in particular is one of the leading causes of blindness. Genetic factors play a critical role in the development of myopia, especially high myopia. Recently, the exome sequencing approach has been successfully used for the disease gene identification of Mendelian disorders. Here we show a successful application of exome sequencing to identify a gene for an autosomal dominant disorder, and we have identified a gene potentially responsible for high myopia in a monogenic form. We captured exomes of two affected individuals from a Han Chinese family with high myopia and performed sequencing analysis by a second-generation sequencer with a mean coverage of 30× and sufficient depth to call variants at ∼97% of each targeted exome. The shared genetic variants of these two affected individuals in the family being studied were filtered against the 1000 Genomes Project and the dbSNP131 database. A mutation A672G in zinc finger protein 644 isoform 1 (ZNF644 was identified as being related to the phenotype of this family. After we performed sequencing analysis of the exons in the ZNF644 gene in 300 sporadic cases of high myopia, we identified an additional five mutations (I587V, R680G, C699Y, 3'UTR+12 C>G, and 3'UTR+592 G>A in 11 different patients. All these mutations were absent in 600 normal controls. The ZNF644 gene was expressed in human retinal and retinal pigment epithelium (RPE. Given that ZNF644 is predicted to be a transcription factor that may regulate genes involved in eye development, mutation may cause the axial elongation of eyeball found in high myopia patients. Our results suggest that ZNF644 might be a causal gene for high myopia in a monogenic form.
Directory of Open Access Journals (Sweden)
Xiaoyue Wang
2017-01-01
Full Text Available Many species belonging to the genus Dendrobium are of great commercial value. However, their difficult growth conditions and high demand have caused many of these species to become endangered. Indeed, counterfeit Dendrobium products are common, especially in medicinal markets. This study aims to assess the suitability of the internal transcribed spacer 2 (ITS2 region as a marker for identifying Dendrobium and to evaluate its intragenomic variation in Dendrobium species. In total, 29,624 ITS2 copies from 18 species were obtained using 454 pyrosequencing to evaluate intragenomic variation. In addition, 513 ITS2 sequences from 26 Dendrobium species were used to assess its identification suitability. The highest intragenomic genetic distance was observed in Dendrobium chrysotoxum (0.081. The average intraspecific genetic distances of each species ranged from 0 to 0.032. Phylogenetic trees based on ITS2 sequences showed that most Dendrobium species are monophyletic. The intragenomic and intraspecies divergence analysis showed that greater intragenomic divergence is mostly correlated with larger intraspecific variation. As a major ITS2 variant becomes more common in genome, there are fewer intraspecific variable sites in ITS2 sequences at the species level. The results demonstrated that the intragenomic multiple copies of ITS2 did not affect species identification.
Wang, Xiaoyue; Chen, Xiaochen; Yang, Pei; Wang, Lili; Han, Jianping
2017-01-01
Many species belonging to the genus Dendrobium are of great commercial value. However, their difficult growth conditions and high demand have caused many of these species to become endangered. Indeed, counterfeit Dendrobium products are common, especially in medicinal markets. This study aims to assess the suitability of the internal transcribed spacer 2 (ITS2) region as a marker for identifying Dendrobium and to evaluate its intragenomic variation in Dendrobium species. In total, 29,624 ITS2 copies from 18 species were obtained using 454 pyrosequencing to evaluate intragenomic variation. In addition, 513 ITS2 sequences from 26 Dendrobium species were used to assess its identification suitability. The highest intragenomic genetic distance was observed in Dendrobium chrysotoxum (0.081). The average intraspecific genetic distances of each species ranged from 0 to 0.032. Phylogenetic trees based on ITS2 sequences showed that most Dendrobium species are monophyletic. The intragenomic and intraspecies divergence analysis showed that greater intragenomic divergence is mostly correlated with larger intraspecific variation. As a major ITS2 variant becomes more common in genome, there are fewer intraspecific variable sites in ITS2 sequences at the species level. The results demonstrated that the intragenomic multiple copies of ITS2 did not affect species identification.
Nelson, Leigh A; Wallman, James F; Dowton, Mark
2008-05-20
The identification of forensically important blowflies of the genus Chrysomya (Diptera: Calliphoridae) may be hampered by their close morphological similarities, especially as immatures. In contrast to most previous studies, the utility of a nuclear rather than mitochondrial genetic marker was investigated to solve this problem. The second internal transcribed spacer (ITS2) of ribosomal DNA (rDNA) was amplified and sequenced from all nine Chrysomya species known from Australia. Difficulties encountered with direct sequencing of ITS2 for Chrysomya flavifrons necessitated cloning prior to sequencing for this species, which revealed a low level (0-0.23%) of intraindividual variation. Five restriction enzymes (DraI, BsaXI, BciVI, AseI and HinfI) were identified that were able to differentiate most members of the genus by polymerase chain reaction (PCR) restriction fragment length polymorphism (PCR-RFLP). The PCR-RFLP analysis revealed characteristic restriction profiles for all species except the closely related species pairs Chrysomya latifrons+Chrysomya semimetallica and Chrysomya incisuralis+Chrysomya rufifacies. Ch. incisuralis and Ch. rufifacies were able to be separated using the size differences resulting from amplification of the entire ITS region. The lack of intraspecific ITS2 sequence variation among eight Ch. incisuralis specimens was verified by the identical restriction profiles generated from these specimens. A DNA-based approach, such as PCR-RFLP, has the capacity to be useful for the identification of forensic entomological evidence in cases where morphological characters are unreliable.
Directory of Open Access Journals (Sweden)
Peng Chen
2016-03-01
Full Text Available Serofluid dish (or Jiangshui, in Chinese, a traditional food in the Chinese culture for thousands of years, is made from vegetables by fermentation. In this work, microorganism community of the fermented serofluid dish was investigated by the culture-independent method. The metagenomic data in this article contains the sequences of fungal internal transcribed spacer (ITS regions of rRNA genes from 12 different serofluid dish samples. The metagenome comprised of 50,865 average raw reads with an average of 8,958,220 bp and G + C content is 45.62%. This is the first report on metagenomic data of fungal ITS from serofluid dish employing Illumina platform to profile the fungal communities of this little known fermented food from Gansu Province, China. The Metagenomic data of fungal internal transcribed spacer can be accessed at NCBI, SRA database accession no. SRP067411. Keywords: Serofluid dish, Jiangshui, Fungal ITS, Cultivation-independent, Microbial diversity
Kanhayuwa, Lakkhana; Coutts, Robert H A
2016-01-01
Novel families of short interspersed nuclear element (SINE) sequences in the human pathogenic fungus Aspergillus fumigatus, clinical isolate Af293, were identified and categorised into tRNA-related and 5S rRNA-related SINEs. Eight predicted tRNA-related SINE families originating from different tRNAs, and nominated as AfuSINE2 sequences, contained target site duplications of short direct repeat sequences (4-14 bp) flanking the elements, an extended tRNA-unrelated region and typical features of RNA polymerase III promoter sequences. The elements ranged in size from 140-493 bp and were present in low copy number in the genome and five out of eight were actively transcribed. One putative tRNAArg-derived sequence, AfuSINE2-1a possessed a unique feature of repeated trinucleotide ACT residues at its 3'-terminus. This element was similar in sequence to the I-4_AO element found in A. oryzae and an I-1_AF long nuclear interspersed element-like sequence identified in A. fumigatus Af293. Families of 5S rRNA-related SINE sequences, nominated as AfuSINE3, were also identified and their 5'-5S rRNA-related regions show 50-65% and 60-75% similarity to respectively A. fumigatus 5S rRNAs and SINE3-1_AO found in A. oryzae. A. fumigatus Af293 contains five copies of AfuSINE3 sequences ranging in size from 259-343 bp and two out of five AfuSINE3 sequences were actively transcribed. Investigations on AfuSINE distribution in the fungal genome revealed that the elements are enriched in pericentromeric and subtelomeric regions and inserted within gene-rich regions. We also demonstrated that some, but not all, AfuSINE sequences are targeted by host RNA silencing mechanisms. Finally, we demonstrated that infection of the fungus with mycoviruses had no apparent effects on SINE activity.
Zhao, Mingming; Shi, Yuhua; Wu, Lan; Guo, Licheng; Liu, Wei; Xiong, Chao; Yan, Song; Sun, Wei; Chen, Shilin
2016-05-05
Saffron is one of the most expensive species of Chinese herbs and has been subjected to various types of adulteration because of its high price and limited production. The present study introduces a loop-mediated isothermal amplification (LAMP) technique for the differentiation of saffron from its adulterants. This novel technique is sensitive, efficient and simple. Six specific LAMP primers were designed on the basis of the nucleotide sequence of the internal transcribed spacer 2 (ITS2) nuclear ribosomal DNA of Crocus sativus. All LAMP amplifications were performed successfully, and visual detection occurred within 60 min at isothermal conditions of 65 °C. The results indicated that the LAMP primers are accurate and highly specific for the discrimination of saffron from its adulterants. In particular, 10 fg of genomic DNA was determined to be the limit for template accuracy of LAMP in saffron. Thus, the proposed novel, simple, and sensitive LAMP assay is well suited for immediate on-site discrimination of herbal materials. Based on the study, a practical standard operating procedure (SOP) for utilizing the LAMP protocol for herbal authentication is provided.
Luo, Yonglun; Blechingberg, Jenny; Fernandes, Ana Miguel; Li, Shengting; Fryland, Tue; Børglum, Anders D; Bolund, Lars; Nielsen, Anders Lade
2015-11-14
FUS (TLS) and EWS (EWSR1) belong to the FET-protein family of RNA and DNA binding proteins. FUS and EWS are structurally and functionally related and participate in transcriptional regulation and RNA processing. FUS and EWS are identified in translocation generated cancer fusion proteins and involved in the human neurological diseases amyotrophic lateral sclerosis and fronto-temporal lobar degeneration. To determine the gene regulatory functions of FUS and EWS at the level of chromatin, we have performed chromatin immunoprecipitation followed by next generation sequencing (ChIP-seq). Our results show that FUS and EWS bind to a subset of actively transcribed genes, that binding often is downstream the poly(A)-signal, and that binding overlaps with RNA polymerase II. Functional examinations of selected target genes identified that FUS and EWS can regulate gene expression at different levels. Gene Ontology analyses showed that FUS and EWS target genes preferentially encode proteins involved in regulatory processes at the RNA level. The presented results yield new insights into gene interactions of EWS and FUS and have identified a set of FUS and EWS target genes involved in pathways at the RNA regulatory level with potential to mediate normal and disease-associated functions of the FUS and EWS proteins.
Pöggeler, S; Kück, U
2000-03-01
The mating-type locus controls mating and sexual development in filamentous ascomycetes. In the heterothallic ascomycete Neurospora crassa, the genes that confer mating behavior comprise dissimilar DNA sequences (idiomorphs) in the mat a and mat A mating partners. In the homothallic fungus Sordaria macrospora, sequences corresponding to both idiomorphs are located contiguously in the mating-type locus, which contains one chimeric gene, Smt A-3, that includes sequences which are similar to sequences found at the mat A and mat a mating-type idiomorphs in N. crassa. In this study, we describe the comparative transcriptional analysis of the chimeric mating-type region of S. macrospora and the corresponding region of the N. crassa mat a idiomorph. By means of RT-PCR experiments, we identified novel intervening sequences in the mating-type loci of both ascomycetes and, hence, concluded that an additional ORF, encoding a putative polypeptide of 79 amino acids, is present in the N. crassa mat a idiomorph. Furthermore, our analysis revealed co-transcription of the novel gene with the mat a-1 gene in N. crassa. The same mode of transcription was found in the corresponding mating-type region of S. macrospora, where the chimeric Smt A-3 gene is co-transcribed with the mat a-specific Smt a-1 gene. Analysis of a Smt A-3 cDNA revealed optional splicing of two introns. We believe that this is the first report of co-transcription of protein-encoding nuclear genes in filamentous fungi. Possible functions of the novel ORFs in regulating mating-type gene expression are discussed.
The Effect of Transcribing on Elementary Iranian EFL Learners’ Listening Comprehension
Directory of Open Access Journals (Sweden)
Mohammad Afsharrad
2015-12-01
Full Text Available This study is motivated by the gap existing between theory and practice in teaching listening. Most of the techniques used to teach listening put more emphasis on top-down processing while listeners’ problems are more of perceptive ones (bottom-up. In order to address the pervasive decoding problem in listening, this study suggests using transcribing exercise as an input enhancement device and investigates its effect on beginning learners’ listening ability. To this end, 31 learners participated in the study. The control group did not have any transcribing practice while the experimental group received transcribing exercise. In the data analysis step, an independent samples t test was employed to compare the two groups. The results show that transcribing has a significant positive effect on beginning learners’ listening comprehension. The findings of the study as well as advantages of transcribing exercise are discussed. Implications of the study and scope for future research are also addressed.
Directory of Open Access Journals (Sweden)
Moudgil A. D.
2017-06-01
Full Text Available The eggs recovered during faecal screening of Asiatic lions (kept at MC Zoological Park, Punjab, India were delineated as Toxascaris leonina eggs based on morphometric and molecular studies (polymerase chain reaction targeting internal transcribed spacer sequences. Therapeutic management with fenbendazole @10 mg/kg body weight, once daily orally for three consecutive days proved ineffective with maximum faecal egg count reduction (FECR on day 3 post treatments (69.35 %. But, therapeutic intervention with extended period dose schedule (5 consecutive days with fenbendazole (@10 mg/kg body weight proved effective and showed a maximum FECR of 95.34 % at day 7 post treatments. But, when ivermectin (@100μg/kg body weight was given orally on three alternate days, proved effective as FECR of 95.74 % was recorded at day 7 post treatments. Thus, present study highlights the molecular confi rmation of T. leonina and its management using fenbendazole and ivermectin in Asiatic lions.
Tam, Emily W T; Chen, Jonathan H K; Lau, Eunice C L; Ngan, Antonio H Y; Fung, Kitty S C; Lee, Kim-Chung; Lam, Ching-Wan; Yuen, Kwok-Yung; Lau, Susanna K P; Woo, Patrick C Y
2014-04-01
Aspergillus nomius and Aspergillus tamarii are Aspergillus species that phenotypically resemble Aspergillus flavus. In the last decade, a number of case reports have identified A. nomius and A. tamarii as causes of human infections. In this study, using an internal transcribed spacer, β-tubulin, and calmodulin gene sequencing, only 8 of 11 clinical isolates reported as A. flavus in our clinical microbiology laboratory by phenotypic methods were identified as A. flavus. The other three isolates were A. nomius (n = 2) or A. tamarii (n = 1). The results corresponded with those of metabolic fingerprinting, in which the A. flavus, A. nomius, and A. tamarii strains were separated into three clusters based on ultra-high-performance liquid chromatography-tandem mass spectrometry (UHPLC MS) analysis. The first two patients with A. nomius infections had invasive aspergillosis and chronic cavitary and fibrosing pulmonary and pleural aspergillosis, respectively, whereas the third patient had A. tamarii colonization of the airway. Identification of the 11 clinical isolates and three reference strains by matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) showed that only six of the nine strains of A. flavus were identified correctly. None of the strains of A. nomius and A. tamarii was correctly identified. β-Tubulin or the calmodulin gene should be the gene target of choice for identifying A. flavus, A. nomius, and A. tamarii. To improve the usefulness of MALDI-TOF MS, the number of strains for each species in MALDI-TOF MS databases should be expanded to cover intraspecies variability.
Tam, Emily W. T.; Chen, Jonathan H. K.; Lau, Eunice C. L.; Ngan, Antonio H. Y.; Fung, Kitty S. C.; Lee, Kim-Chung; Lam, Ching-Wan; Yuen, Kwok-Yung
2014-01-01
Aspergillus nomius and Aspergillus tamarii are Aspergillus species that phenotypically resemble Aspergillus flavus. In the last decade, a number of case reports have identified A. nomius and A. tamarii as causes of human infections. In this study, using an internal transcribed spacer, β-tubulin, and calmodulin gene sequencing, only 8 of 11 clinical isolates reported as A. flavus in our clinical microbiology laboratory by phenotypic methods were identified as A. flavus. The other three isolates were A. nomius (n = 2) or A. tamarii (n = 1). The results corresponded with those of metabolic fingerprinting, in which the A. flavus, A. nomius, and A. tamarii strains were separated into three clusters based on ultra-high-performance liquid chromatography-tandem mass spectrometry (UHPLC MS) analysis. The first two patients with A. nomius infections had invasive aspergillosis and chronic cavitary and fibrosing pulmonary and pleural aspergillosis, respectively, whereas the third patient had A. tamarii colonization of the airway. Identification of the 11 clinical isolates and three reference strains by matrix-assisted laser desorption ionization–time of flight mass spectrometry (MALDI-TOF MS) showed that only six of the nine strains of A. flavus were identified correctly. None of the strains of A. nomius and A. tamarii was correctly identified. β-Tubulin or the calmodulin gene should be the gene target of choice for identifying A. flavus, A. nomius, and A. tamarii. To improve the usefulness of MALDI-TOF MS, the number of strains for each species in MALDI-TOF MS databases should be expanded to cover intraspecies variability. PMID:24452174
Exome Sequencing Fails to Identify the Genetic Cause of Aicardi Syndrome.
Lund, Caroline; Striano, Pasquale; Sorte, Hanne Sørmo; Parisi, Pasquale; Iacomino, Michele; Sheng, Ying; Vigeland, Magnus D; Øye, Anne-Marte; Møller, Rikke Steensbjerre; Selmer, Kaja K; Zara, Federico
2016-09-01
Aicardi syndrome (AS) is a well-characterized neurodevelopmental disorder with an unknown etiology. In this study, we performed whole-exome sequencing in 11 female patients with the diagnosis of AS, in order to identify the disease-causing gene. In particular, we focused on detecting variants in the X chromosome, including the analysis of variants with a low number of sequencing reads, in case of somatic mosaicism. For 2 of the patients, we also sequenced the exome of the parents to search for de novo mutations. We did not identify any genetic variants likely to be damaging. Only one single missense variant was identified by the de novo analyses of the 2 trios, and this was considered benign. The failure to identify a disease gene in this study may be due to technical limitations of our study design, including the possibility that the genetic aberration leading to AS is situated in a non-exonic region or that the mutation is somatic and not detectable by our approach. Alternatively, it is possible that AS is genetically heterogeneous and that 11 patients are not sufficient to reveal the causative genes. Future studies of AS should consider designs where also non-exonic regions are explored and apply a sequencing depth so that also low-grade somatic mosaicism can be detected.
Directory of Open Access Journals (Sweden)
Lakkhana Kanhayuwa
Full Text Available Novel families of short interspersed nuclear element (SINE sequences in the human pathogenic fungus Aspergillus fumigatus, clinical isolate Af293, were identified and categorised into tRNA-related and 5S rRNA-related SINEs. Eight predicted tRNA-related SINE families originating from different tRNAs, and nominated as AfuSINE2 sequences, contained target site duplications of short direct repeat sequences (4-14 bp flanking the elements, an extended tRNA-unrelated region and typical features of RNA polymerase III promoter sequences. The elements ranged in size from 140-493 bp and were present in low copy number in the genome and five out of eight were actively transcribed. One putative tRNAArg-derived sequence, AfuSINE2-1a possessed a unique feature of repeated trinucleotide ACT residues at its 3'-terminus. This element was similar in sequence to the I-4_AO element found in A. oryzae and an I-1_AF long nuclear interspersed element-like sequence identified in A. fumigatus Af293. Families of 5S rRNA-related SINE sequences, nominated as AfuSINE3, were also identified and their 5'-5S rRNA-related regions show 50-65% and 60-75% similarity to respectively A. fumigatus 5S rRNAs and SINE3-1_AO found in A. oryzae. A. fumigatus Af293 contains five copies of AfuSINE3 sequences ranging in size from 259-343 bp and two out of five AfuSINE3 sequences were actively transcribed. Investigations on AfuSINE distribution in the fungal genome revealed that the elements are enriched in pericentromeric and subtelomeric regions and inserted within gene-rich regions. We also demonstrated that some, but not all, AfuSINE sequences are targeted by host RNA silencing mechanisms. Finally, we demonstrated that infection of the fungus with mycoviruses had no apparent effects on SINE activity.
Goodwin, S B; Dunkle, L D; Zismann, V L
2001-07-01
ABSTRACT Most of the 3,000 named species in the genus Cercospora have no known sexual stage, although a Mycosphaerella teleomorph has been identified for a few. Mycosphaerella is an extremely large and important genus of plant pathogens, with more than 1,800 named species and at least 43 associated anamorph genera. The goal of this research was to perform a large-scale phylogenetic analysis to test hypotheses about the past evolutionary history of Cercospora and Mycosphaerella. Based on the phylogenetic analysis of internal transcribed spacer (ITS) sequence data (ITS1, 5.8S rRNA gene, ITS2), the genus Mycosphaerella is monophyletic. In contrast, many anamorph genera within Mycosphaerella were polyphyletic and were not useful for grouping species. One exception was Cercospora, which formed a highly supported monophyletic group. Most Cercospora species from cereal crops formed a subgroup within the main Cercospora cluster. Only species within the Cercospora cluster produced the toxin cercosporin, suggesting that the ability to produce this compound had a single evolutionary origin. Intraspecific variation for 25 taxa in the Mycosphaerella clade averaged 1.7 nucleotides (nts) in the ITS region. Thus, isolates with ITS sequences that differ by two or more nucleotides may be distinct species. ITS sequences of groups I and II of the gray leaf spot pathogen Cercospora zeae-maydis differed by 7 nts and clearly represent different species. There were 6.5 nt differences on average between the ITS sequences of the sorghum pathogen Cercospora sorghi and the maize pathogen Cercospora sorghi var. maydis, indicating that the latter is a separate species and not simply a variety of Cercospora sorghi. The large monophyletic Mycosphaerella cluster contained a number of anamorph genera with no known teleomorph associations. Therefore, the number of anamorph genera related to Mycosphaerella may be much larger than suspected previously.
HIV-1 envelope sequence-based diversity measures for identifying recent infections.
Directory of Open Access Journals (Sweden)
Alexis Kafando
Full Text Available Identifying recent HIV-1 infections is crucial for monitoring HIV-1 incidence and optimizing public health prevention efforts. To identify recent HIV-1 infections, we evaluated and compared the performance of 4 sequence-based diversity measures including percent diversity, percent complexity, Shannon entropy and number of haplotypes targeting 13 genetic segments within the env gene of HIV-1. A total of 597 diagnostic samples obtained in 2013 and 2015 from recently and chronically HIV-1 infected individuals were selected. From the selected samples, 249 (134 from recent versus 115 from chronic infections env coding regions, including V1-C5 of gp120 and the gp41 ectodomain of HIV-1, were successfully amplified and sequenced by next generation sequencing (NGS using the Illumina MiSeq platform. The ability of the four sequence-based diversity measures to correctly identify recent HIV infections was evaluated using the frequency distribution curves, median and interquartile range and area under the curve (AUC of the receiver operating characteristic (ROC. Comparing the median and interquartile range and evaluating the frequency distribution curves associated with the 4 sequence-based diversity measures, we observed that the percent diversity, number of haplotypes and Shannon entropy demonstrated significant potential to discriminate recent from chronic infections (p<0.0001. Using the AUC of ROC analysis, only the Shannon entropy measure within three HIV-1 env segments could accurately identify recent infections at a satisfactory level. The env segments were gp120 C2_1 (AUC = 0.806, gp120 C2_3 (AUC = 0.805 and gp120 V3 (AUC = 0.812. Our results clearly indicate that the Shannon entropy measure represents a useful tool for predicting HIV-1 infection recency.
Brown, Shawn P; Callaham, Mac A; Oliver, Alena K; Jumpponen, Ari
2013-12-01
Prescribed burning is a common management tool to control fuel loads, ground vegetation, and facilitate desirable game species. We evaluated soil fungal community responses to long-term prescribed fire treatments in a loblolly pine forest on the Piedmont of Georgia and utilized deep Internal Transcribed Spacer Region 1 (ITS1) amplicon sequencing afforded by the recent Ion Torrent Personal Genome Machine (PGM). These deep sequence data (19,000 + reads per sample after subsampling) indicate that frequent fires (3-year fire interval) shift soil fungus communities, whereas infrequent fires (6-year fire interval) permit system resetting to a state similar to that without prescribed fire. Furthermore, in nonmetric multidimensional scaling analyses, primarily ectomycorrhizal taxa were correlated with axes associated with long fire intervals, whereas soil saprobes tended to be correlated with the frequent fire recurrence. We conclude that (1) multiplexed Ion Torrent PGM analyses allow deep cost effective sequencing of fungal communities but may suffer from short read lengths and inconsistent sequence quality adjacent to the sequencing adaptor; (2) frequent prescribed fires elicit a shift in soil fungal communities; and (3) such shifts do not occur when fire intervals are longer. Our results emphasize the general responsiveness of these forests to management, and the importance of fire return intervals in meeting management objectives. © 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.
2013-01-01
Background Salamanders are unique among vertebrates in their ability to completely regenerate amputated limbs through the mediation of blastema cells located at the stump ends. This regeneration is nerve-dependent because blastema formation and regeneration does not occur after limb denervation. To obtain the genomic information of blastema tissues, de novo transcriptomes from both blastema tissues and denervated stump ends of Ambystoma mexicanum (axolotls) 14 days post-amputation were sequenced and compared using Solexa DNA sequencing. Results The sequencing done for this study produced 40,688,892 reads that were assembled into 307,345 transcribed sequences. The N50 of transcribed sequence length was 562 bases. A similarity search with known proteins identified 39,200 different genes to be expressed during limb regeneration with a cut-off E-value exceeding 10-5. We annotated assembled sequences by using gene descriptions, gene ontology, and clusters of orthologous group terms. Targeted searches using these annotations showed that the majority of the genes were in the categories of essential metabolic pathways, transcription factors and conserved signaling pathways, and novel candidate genes for regenerative processes. We discovered and confirmed numerous sequences of the candidate genes by using quantitative polymerase chain reaction and in situ hybridization. Conclusion The results of this study demonstrate that de novo transcriptome sequencing allows gene expression analysis in a species lacking genome information and provides the most comprehensive mRNA sequence resources for axolotls. The characterization of the axolotl transcriptome can help elucidate the molecular mechanisms underlying blastema formation during limb regeneration. PMID:23815514
Directory of Open Access Journals (Sweden)
Martin Darren P
2009-04-01
Full Text Available Abstract Background Recombination has a profound impact on the evolution of viruses, but characterizing recombination patterns in molecular sequences remains a challenging endeavor. Despite its importance in molecular evolutionary studies, identifying the sequences that exhibit such patterns has received comparatively less attention in the recombination detection framework. Here, we extend a quartet-mapping based recombination detection method to enable identification of recombinant sequences without prior specifications of either query and reference sequences. Through simulations we evaluate different recombinant identification statistics and significance tests. We compare the quartet approach with triplet-based methods that employ additional heuristic tests to identify parental and recombinant sequences. Results Analysis of phylogenetic simulations reveal that identifying the descendents of relatively old recombination events is a challenging task for all methods available, and that quartet scanning performs relatively well compared to the triplet based methods. The use of quartet scanning is further demonstrated by analyzing both well-established and putative HIV-1 recombinant strains. In agreement with recent findings, we provide evidence that the presumed circulating recombinant CRF02_AG is a 'pure' lineage, whereas the presumed parental lineage subtype G has a recombinant origin. We also demonstrate HIV-1 intrasubtype recombination, confirm the hybrid origin of SIV in chimpanzees and further disentangle the recombinant history of SIV lineages in a primate immunodeficiency virus data set. Conclusion Quartet scanning makes a valuable addition to triplet-based methods for identifying recombinant sequences without prior specifications of either query and reference sequences. The new method is available in the VisRD v.3.0 package http://www.cmp.uea.ac.uk/~vlm/visrd.
DSAP: deep-sequencing small RNA analysis pipeline.
Huang, Po-Jung; Liu, Yi-Chung; Lee, Chi-Ching; Lin, Wei-Chen; Gan, Richie Ruei-Chi; Lyu, Ping-Chiang; Tang, Petrus
2010-07-01
DSAP is an automated multiple-task web service designed to provide a total solution to analyzing deep-sequencing small RNA datasets generated by next-generation sequencing technology. DSAP uses a tab-delimited file as an input format, which holds the unique sequence reads (tags) and their corresponding number of copies generated by the Solexa sequencing platform. The input data will go through four analysis steps in DSAP: (i) cleanup: removal of adaptors and poly-A/T/C/G/N nucleotides; (ii) clustering: grouping of cleaned sequence tags into unique sequence clusters; (iii) non-coding RNA (ncRNA) matching: sequence homology mapping against a transcribed sequence library from the ncRNA database Rfam (http://rfam.sanger.ac.uk/); and (iv) known miRNA matching: detection of known miRNAs in miRBase (http://www.mirbase.org/) based on sequence homology. The expression levels corresponding to matched ncRNAs and miRNAs are summarized in multi-color clickable bar charts linked to external databases. DSAP is also capable of displaying miRNA expression levels from different jobs using a log(2)-scaled color matrix. Furthermore, a cross-species comparative function is also provided to show the distribution of identified miRNAs in different species as deposited in miRBase. DSAP is available at http://dsap.cgu.edu.tw.
Identifying transposon insertions and their effects from RNA-sequencing data.
de Ruiter, Julian R; Kas, Sjors M; Schut, Eva; Adams, David J; Koudijs, Marco J; Wessels, Lodewyk F A; Jonkers, Jos
2017-07-07
Insertional mutagenesis using engineered transposons is a potent forward genetic screening technique used to identify cancer genes in mouse model systems. In the analysis of these screens, transposon insertion sites are typically identified by targeted DNA-sequencing and subsequently assigned to predicted target genes using heuristics. As such, these approaches provide no direct evidence that insertions actually affect their predicted targets or how transcripts of these genes are affected. To address this, we developed IM-Fusion, an approach that identifies insertion sites from gene-transposon fusions in standard single- and paired-end RNA-sequencing data. We demonstrate IM-Fusion on two separate transposon screens of 123 mammary tumors and 20 B-cell acute lymphoblastic leukemias, respectively. We show that IM-Fusion accurately identifies transposon insertions and their true target genes. Furthermore, by combining the identified insertion sites with expression quantification, we show that we can determine the effect of a transposon insertion on its target gene(s) and prioritize insertions that have a significant effect on expression. We expect that IM-Fusion will significantly enhance the accuracy of cancer gene discovery in forward genetic screens and provide initial insight into the biological effects of insertions on candidate cancer genes. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Zhou, Qiongqiong; Sun, Wenjuan; Liu, Xiyan; Wang, Xiliang; Xiao, Yuncai; Bi, Dingren; Yin, Jingdong; Shi, Deshi
2016-01-01
Pig liver carboxylesterase (PLE) gene sequences in GenBank are incomplete, which has led to difficulties in studying the genetic structure and regulation mechanisms of gene expression of PLE family genes. The aim of this study was to obtain and analysis of complete gene sequences of PLE family by screening from a Rongchang pig BAC library and third-generation PacBio gene sequencing. After a number of existing incomplete PLE isoform gene sequences were analysed, primers were designed based on conserved regions in PLE exons, and the whole pig genome used as a template for Polymerase chain reaction (PCR) amplification. Specific primers were then selected based on the PCR amplification results. A three-step PCR screening method was used to identify PLE-positive clones by screening a Rongchang pig BAC library and PacBio third-generation sequencing was performed. BLAST comparisons and other bioinformatics methods were applied for sequence analysis. Five PLE-positive BAC clones, designated BAC-10, BAC-70, BAC-75, BAC-119 and BAC-206, were identified. Sequence analysis yielded the complete sequences of four PLE genes, PLE1, PLE-B9, PLE-C4, and PLE-G2. Complete PLE gene sequences were defined as those containing regulatory sequences, exons, and introns. It was found that, not only did the PLE exon sequences of the four genes show a high degree of homology, but also that the intron sequences were highly similar. Additionally, the regulatory region of the genes contained two 720bps reverse complement sequences that may have an important function in the regulation of PLE gene expression. This is the first report to confirm the complete sequences of four PLE genes. In addition, the study demonstrates that each PLE isoform is encoded by a single gene and that the various genes exhibit a high degree of sequence homology, suggesting that the PLE family evolved from a single ancestral gene. Obtaining the complete sequences of these PLE genes provides the necessary foundation for
RNA-ID, a Powerful Tool for Identifying and Characterizing Regulatory Sequences.
Brule, C E; Dean, K M; Grayhack, E J
2016-01-01
The identification and analysis of sequences that regulate gene expression is critical because regulated gene expression underlies biology. RNA-ID is an efficient and sensitive method to discover and investigate regulatory sequences in the yeast Saccharomyces cerevisiae, using fluorescence-based assays to detect green fluorescent protein (GFP) relative to a red fluorescent protein (RFP) control in individual cells. Putative regulatory sequences can be inserted either in-frame or upstream of a superfolder GFP fusion protein whose expression, like that of RFP, is driven by the bidirectional GAL1,10 promoter. In this chapter, we describe the methodology to identify and study cis-regulatory sequences in the RNA-ID system, explaining features and variations of the RNA-ID reporter, as well as some applications of this system. We describe in detail the methods to analyze a single regulatory sequence, from construction of a single GFP variant to assay of variants by flow cytometry, as well as modifications required to screen libraries of different strains simultaneously. We also describe subsequent analyses of regulatory sequences. © 2016 Elsevier Inc. All rights reserved.
Romi, Wahengbam; Keisam, Santosh; Ahmed, Giasuddin; Jeyaram, Kumaraswamy
2014-02-28
Meyerozyma guilliermondii (anamorph Candida guilliermondii) and Meyerozyma caribbica (anamorph Candida fermentati) are closely related species of the genetically heterogenous M. guilliermondii complex. Conventional phenotypic methods frequently misidentify the species within this complex and also with other species of the Saccharomycotina CTG clade. Even the long-established sequencing of large subunit (LSU) rRNA gene remains ambiguous. We also faced similar problem during identification of yeast isolates of M. guilliermondii complex from indigenous bamboo shoot fermentation in North East India. There is a need for development of reliable and accurate identification methods for these closely related species because of their increasing importance as emerging infectious yeasts and associated biotechnological attributes. We targeted the highly variable internal transcribed spacer (ITS) region (ITS1-5.8S-ITS2) and identified seven restriction enzymes through in silico analysis for differentiating M. guilliermondii from M. caribbica. Fifty five isolates of M. guilliermondii complex which could not be delineated into species-specific taxonomic ranks by API 20 C AUX and LSU rRNA gene D1/D2 sequencing were subjected to ITS-restriction fragment length polymorphism (ITS-RFLP) analysis. TaqI ITS-RFLP distinctly differentiated the isolates into M. guilliermondii (47 isolates) and M. caribbica (08 isolates) with reproducible species-specific patterns similar to the in silico prediction. The reliability of this method was validated by ITS1-5.8S-ITS2 sequencing, mitochondrial DNA RFLP and electrophoretic karyotyping. We herein described a reliable ITS-RFLP method for distinct differentiation of frequently misidentified M. guilliermondii from M. caribbica. Even though in silico analysis differentiated other closely related species of M. guilliermondii complex from the above two species, it is yet to be confirmed by in vitro analysis using reference strains. This method can be used
Natural history bycatch: a pipeline for identifying metagenomic sequences in RADseq data
Directory of Open Access Journals (Sweden)
Iris Holmes
2018-04-01
Full Text Available Background Reduced representation genomic datasets are increasingly becoming available from a variety of organisms. These datasets do not target specific genes, and so may contain sequences from parasites and other organisms present in the target tissue sample. In this paper, we demonstrate that (1 RADseq datasets can be used for exploratory analysis of tissue-specific metagenomes, and (2 tissue collections house complete metagenomic communities, which can be investigated and quantified by a variety of techniques. Methods We present an exploratory method for mining metagenomic “bycatch” sequences from a range of host tissue types. We use a combination of the pyRAD assembly pipeline, NCBI’s blastn software, and custom R scripts to isolate metagenomic sequences from RADseq type datasets. Results When we focus on sequences that align with existing references in NCBI’s GenBank, we find that between three and five percent of identifiable double-digest restriction site associated DNA (ddRAD sequences from host tissue samples are from phyla to contain known blood parasites. In addition to tissue samples, we examine ddRAD sequences from metagenomic DNA extracted snake and lizard hind-gut samples. We find that the sequences recovered from these samples match with expected bacterial and eukaryotic gut microbiome phyla. Discussion Our results suggest that (1 museum tissue banks originally collected for host DNA archiving are also preserving valuable parasite and microbiome communities, (2 that publicly available RADseq datasets may include metagenomic sequences that could be explored, and (3 that restriction site approaches are a useful exploratory technique to identify microbiome lineages that could be missed by primer-based approaches.
Whole-Genome Sequencing of Sordaria macrospora Mutants Identifies Developmental Genes.
Nowrousian, Minou; Teichert, Ines; Masloff, Sandra; Kück, Ulrich
2012-02-01
The study of mutants to elucidate gene functions has a long and successful history; however, to discover causative mutations in mutants that were generated by random mutagenesis often takes years of laboratory work and requires previously generated genetic and/or physical markers, or resources like DNA libraries for complementation. Here, we present an alternative method to identify defective genes in developmental mutants of the filamentous fungus Sordaria macrospora through Illumina/Solexa whole-genome sequencing. We sequenced pooled DNA from progeny of crosses of three mutants and the wild type and were able to pinpoint the causative mutations in the mutant strains through bioinformatics analysis. One mutant is a spore color mutant, and the mutated gene encodes a melanin biosynthesis enzyme. The causative mutation is a G to A change in the first base of an intron, leading to a splice defect. The second mutant carries an allelic mutation in the pro41 gene encoding a protein essential for sexual development. In the mutant, we detected a complex pattern of deletion/rearrangements at the pro41 locus. In the third mutant, a point mutation in the stop codon of a transcription factor-encoding gene leads to the production of immature fruiting bodies. For all mutants, transformation with a wild type-copy of the affected gene restored the wild-type phenotype. Our data demonstrate that whole-genome sequencing of mutant strains is a rapid method to identify developmental genes in an organism that can be genetically crossed and where a reference genome sequence is available, even without prior mapping information.
Directory of Open Access Journals (Sweden)
Iole Di Capua
Full Text Available Copepods belonging to the Oncaeidae family are commonly and abundantly found in marine zooplankton. In the Mediterranean Sea, forty-seven oncaeid species occur, of which eleven in the Gulf of Naples. In this Gulf, several Oncaea species were morphologically analysed and described at the end of the XIX century by W. Giesbrecht. In the same area, oncaeids are being investigated over seasonal and inter-annual scales at the long-term coastal station LTER-MC. In the present work, we identified six oncaeid species using the nuclear ribosomal internal transcribed spacers (ITS rDNA and the mitochondrial cytochrome c oxidase subunit I (mtCOI. Phylogenetic analyses based on these two genomic regions validated the sisterhood of the genera Triconia and the Oncaea sensu stricto. ITS1 and ITS2 phylogenies produced incongruent results about the position of Oncaea curta, calling for further investigations on this species. We also characterised the ITS2 region by secondary structure predictions and found that all the sequences analysed presented the distinct eukaryotic hallmarks. A Compensatory Base Change search corroborated the close relationship between O. venusta and O. curta and between O. media and O. venusta already identified by ITS phylogenies. The present results, which stem from the integration of molecular and morphological taxonomy, represent an encouraging step towards an improved knowledge of copepod biodiversity: The two complementary approaches, when applied to long-term copepod monitoring, will also help to better understanding their genetic variations and ecological niches of co-occurring species.
: Hemoglobin-y gene of channel catfish , lctalurus punctatus, was cloned and sequenced . Total RNA from head kidneys was isolated, reverse transcribed and amplified . The sequence of the channel catfish hemoglobin-y gene consists of 600 nucleotides . Analysis of the nucleotide sequence reveals one o...
Exome sequencing identifies SUCO mutations in mesial temporal lobe epilepsy.
Sha, Zhiqiang; Sha, Longze; Li, Wenting; Dou, Wanchen; Shen, Yan; Wu, Liwen; Xu, Qi
2015-03-30
Mesial temporal lobe epilepsy (mTLE) is the main type and most common medically intractable form of epilepsy. Severity of disease-based stratified samples may help identify new disease-associated mutant genes. We analyzed mRNA expression profiles from patient hippocampal tissue. Three of the seven patients had severe mTLE with generalized-onset convulsions and consciousness loss that occurred over many years. We found that compared with other groups, patients with severe mTLE were classified into a distinct group. Whole-exome sequencing and Sanger sequencing validation in all seven patients identified three novel SUN domain-containing ossification factor (SUCO) mutations in severely affected patients. Furthermore, SUCO knock down significantly reduced dendritic length in vitro. Our results indicate that mTLE defects may affect neuronal development, and suggest that neurons have abnormal development due to lack of SUCO, which may be a generalized-onset epilepsy-related gene. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Sutton, Bruce D.; Steck, Gary J.; Norrbom, Allen L.; Rodriguez, Erick J.; Srivastava, Pratibha; Alvarado, Norma Nolazco; Colque, Fredy; Landa, Erick Yábar; Sánchez, Juan José Lagrava; Quisberth, Elizabeth; Peñaranda, Emilio Arévalo; Clavijo, P. A. Rodriguez; Alvarez-Baca, Jeniffer K.; Zapata, Tito Guevara; Ponce, Patricio
2015-01-01
Abstract The nuclear ribosomal internal transcribed spacer 1 (ITS1) was sequenced for Anastrepha fraterculus (Wiedemann, 1830) originating from 85 collections from the northern and central Andean countries of South America including Argentina (Tucumán), Bolivia, Perú, Ecuador, Colombia, and Venezuela. The ITS1 regions of additional specimens (17 collections) from Central America (México, Guatemala, Costa Rica, and Panamá), Brazil, Caribbean Colombia, and coastal Venezuela were sequenced and together with published sequences (Paraguay) provided context for interpretation. A total of six ITS1 sequence variants were recognized in the Andean region comprising four groups. Type I predominates in the southernmost range of Anastrepha fraterculus. Type II predominates in its northernmost range. In the central and northern Andes, the geographic distributions overlap and interdigitate with a strong elevational effect. A discussion of relationships between observed ITS1 types and morphometric types is included. PMID:26798259
Poly A tail length analysis of in vitro transcribed mRNA by LC-MS.
Beverly, Michael; Hagen, Caitlin; Slack, Olga
2018-02-01
The 3'-polyadenosine (poly A) tail of in vitro transcribed (IVT) mRNA was studied using liquid chromatography coupled to mass spectrometry (LC-MS). Poly A tails were cleaved from the mRNA using ribonuclease T1 followed by isolation with dT magnetic beads. Extracted tails were then analyzed by LC-MS which provided tail length information at single-nucleotide resolution. A 2100-nt mRNA with plasmid-encoded poly A tail lengths of either 27, 64, 100, or 117 nucleotides was used for these studies as enzymatically added poly A tails showed significant length heterogeneity. The number of As observed in the tails closely matched Sanger sequencing results of the DNA template, and even minor plasmid populations with sequence variations were detected. When the plasmid sequence contained a discreet number of poly As in the tail, analysis revealed a distribution that included tails longer than the encoded tail lengths. These observations were consistent with transcriptional slippage of T7 RNAP taking place within a poly A sequence. The type of RNAP did not alter the observed tail distribution, and comparison of T3, T7, and SP6 showed all three RNAPs produced equivalent tail length distributions. The addition of a sequence at the 3' end of the poly A tail did, however, produce narrower tail length distributions which supports a previously described model of slippage where the 3' end can be locked in place by having a G or C after the poly nucleotide region. Graphical abstract Determination of mRNA poly A tail length using magnetic beads and LC-MS.
kmer-SVM: a web server for identifying predictive regulatory sequence features in genomic data sets
Fletez-Brant, Christopher; Lee, Dongwon; McCallion, Andrew S.; Beer, Michael A.
2013-01-01
Massively parallel sequencing technologies have made the generation of genomic data sets a routine component of many biological investigations. For example, Chromatin immunoprecipitation followed by sequence assays detect genomic regions bound (directly or indirectly) by specific factors, and DNase-seq identifies regions of open chromatin. A major bottleneck in the interpretation of these data is the identification of the underlying DNA sequence code that defines, and ultimately facilitates prediction of, these transcription factor (TF) bound or open chromatin regions. We have recently developed a novel computational methodology, which uses a support vector machine (SVM) with kmer sequence features (kmer-SVM) to identify predictive combinations of short transcription factor-binding sites, which determine the tissue specificity of these genomic assays (Lee, Karchin and Beer, Discriminative prediction of mammalian enhancers from DNA sequence. Genome Res. 2011; 21:2167–80). This regulatory information can (i) give confidence in genomic experiments by recovering previously known binding sites, and (ii) reveal novel sequence features for subsequent experimental testing of cooperative mechanisms. Here, we describe the development and implementation of a web server to allow the broader research community to independently apply our kmer-SVM to analyze and interpret their genomic datasets. We analyze five recently published data sets and demonstrate how this tool identifies accessory factors and repressive sequence elements. kmer-SVM is available at http://kmersvm.beerlab.org. PMID:23771147
DEFF Research Database (Denmark)
Jørgensen, Johannes Ravn; Carstensen, Jens Michael; Søren, Knudsen
) in the reflectance mode (5 Mpix per band, pixel size app. 45 μm x 45 μm). Spectral information over the surface of seeds may be combined with information about size, shape, and texture of the seeds. This information links detection of fungal infection with other seed characteristics known from general seed testing...... species in the genus produce mycotoxins responsible for serious quality deterioration. In malting barley, Fusarium also has a negative effect by causing gushing in beer. A number of barley seeds (app. 200) assumed to be infected by fungal from different origins and years of cultivation were tested by NGS...... sequencing the ITS (Internal Transcribed Spacer) region from total DNA. Approximately 2-4000 sequences were obtained from each seed and these were subsequently identified to species level in order to give an exact identification of fungal genera on each seed. The main fungal genera identified were Fusarium...
Directory of Open Access Journals (Sweden)
Rolf K Swoboda
2014-01-01
Full Text Available Noncoding regions of the genome play an important role in tumorigenesis of cancer. Using expression cloning, we have identified a cytotoxic T lymphocyte (CTL–defined antigen that recognizes a protein sequence derived from an open reading frame transcribed from the reverse strand in the 3′ untranslated region of tRNA isopentenyltransferase 1 (TRIT1. A peptide derived from this open reading frame (ORF sequence and predicted to bind to HLA-B57, sensitized HLA-B57+ tumor cells to lysis by CTL793. The peptide also induced a CTL response in peripheral blood mononuclear cells (PBMC of patient 793 and in two other melanoma patients. The CTL lysed peptide-pulsed HLA-B57+ target cells and melanoma cells with endogenous antigen expression. The recognition of this antigen is not limited to HLA-B57-restricted CTLs. An HLA-A2 peptide derived from the ORF was able to induce CTLs in PBMC of 2 HLA-A2+ patients. This study describes for the first time a CTL-defined melanoma antigen that is derived from an ORF on the reverse strand of the putative tumor suppressor gene TRIT1. This antigen has potential use as a vaccine or its ability to induce CTLs in vitro could be used as a predictive biomarker.
Miller, Mark P.; Knaus, Brian J.; Mullins, Thomas D.; Haig, Susan M.
2013-01-01
SSR_pipeline is a flexible set of programs designed to efficiently identify simple sequence repeats (e.g., microsatellites) from paired-end high-throughput Illumina DNA sequencing data. The program suite contains 3 analysis modules along with a fourth control module that can automate analyses of large volumes of data. The modules are used to 1) identify the subset of paired-end sequences that pass Illumina quality standards, 2) align paired-end reads into a single composite DNA sequence, and 3) identify sequences that possess microsatellites (both simple and compound) conforming to user-specified parameters. The microsatellite search algorithm is extremely efficient, and we have used it to identify repeats with motifs from 2 to 25bp in length. Each of the 3 analysis modules can also be used independently to provide greater flexibility or to work with FASTQ or FASTA files generated from other sequencing platforms (Roche 454, Ion Torrent, etc.). We demonstrate use of the program with data from the brine fly Ephydra packardi (Diptera: Ephydridae) and provide empirical timing benchmarks to illustrate program performance on a common desktop computer environment. We further show that the Illumina platform is capable of identifying large numbers of microsatellites, even when using unenriched sample libraries and a very small percentage of the sequencing capacity from a single DNA sequencing run. All modules from SSR_pipeline are implemented in the Python programming language and can therefore be used from nearly any computer operating system (Linux, Macintosh, and Windows).
Miller, Mark P; Knaus, Brian J; Mullins, Thomas D; Haig, Susan M
2013-01-01
SSR_pipeline is a flexible set of programs designed to efficiently identify simple sequence repeats (e.g., microsatellites) from paired-end high-throughput Illumina DNA sequencing data. The program suite contains 3 analysis modules along with a fourth control module that can automate analyses of large volumes of data. The modules are used to 1) identify the subset of paired-end sequences that pass Illumina quality standards, 2) align paired-end reads into a single composite DNA sequence, and 3) identify sequences that possess microsatellites (both simple and compound) conforming to user-specified parameters. The microsatellite search algorithm is extremely efficient, and we have used it to identify repeats with motifs from 2 to 25 bp in length. Each of the 3 analysis modules can also be used independently to provide greater flexibility or to work with FASTQ or FASTA files generated from other sequencing platforms (Roche 454, Ion Torrent, etc.). We demonstrate use of the program with data from the brine fly Ephydra packardi (Diptera: Ephydridae) and provide empirical timing benchmarks to illustrate program performance on a common desktop computer environment. We further show that the Illumina platform is capable of identifying large numbers of microsatellites, even when using unenriched sample libraries and a very small percentage of the sequencing capacity from a single DNA sequencing run. All modules from SSR_pipeline are implemented in the Python programming language and can therefore be used from nearly any computer operating system (Linux, Macintosh, and Windows).
Chassaing, Nicolas; Vigouroux, Adeline; Calvas, Patrick
2009-06-01
Microphthalmia and anophthalmia are at the severe end of the spectrum of abnormalities in ocular development. A few genes (SOX2, OTX2, RAX, and CHX10) have been implicated in isolated micro/anophthalmia, but causative mutations of these genes explain less than a quarter of these developmental defects. A specifically conserved SOX2/OTX2-mediated RAX expression regulatory sequence has recently been identified. We postulated that mutations in this sequence could lead to micro/anophthalmia, and thus we performed molecular screening of this regulatory element in patients suffering from micro/anophthalmia. Fifty-one patients suffering from nonsyndromic microphthalmia (n = 40) or anophthalmia (n = 11) were included in this study after negative molecular screening for SOX2, OTX2, RAX, and CHX10 mutations. Mutation screening of the RAX regulatory sequence was performed by direct sequencing for these patients. No mutations were identified in the highly conserved RAX regulatory sequence in any of the 51 patients. Mutations in the newly identified RAX regulatory sequence do not represent a frequent cause of nonsyndromic micro/anophthalmia.
Ribosomal DNA internal transcribed spacer 1 and internal ...
African Journals Online (AJOL)
USER
2010-07-26
Jul 26, 2010 ... in some East Asian countries such as China, Korea and. *Corresponding author. E-mail: soonkwan@kangwon.ac.kr. Tel: +82 33 250 6476. Fax: +82 33 250 6470. Abbreviations: nrDNA, Nuclear ribosomal DNA; ITS, internal transcribed spacer; PCR, polymerase chain reaction; BLAST, basic local alignment ...
The prophage sequences of Lactobacillus plantarum strain WCFS1
International Nuclear Information System (INIS)
Ventura, Marco; Canchaya, Carlos; Kleerebezem, Michiel; Vos, Willem M. de; Siezen, Roland J.; Bruessow, Harald
2003-01-01
The Lactobacillus plantarum commensal WCFS1 contains four prophage elements in its genome. Lp1 and Lp2 are two about 40-kb-long uninducible prophages that share closely related DNA packaging, head and tail genes defining a second lineage of pac-site Siphoviridae in L. plantarum, distinct from L. plantarum phage phig1e, but related to Bacillus phage SPP1 and Lactococcus phage TP901-1. Northern analysis revealed transcribed prophage genes exclusively near both attachment sites. Comparative genomics identified candidate lysogenic conversion genes (LCG) downstream of the lysis cassette and within the lysogeny module. Notable are genes with sequence similarities to putative LCG from Streptococcus pyogenes prophages and to a Bacillus plasmid. Both prophages harbored tRNA genes. R-Lp3 and R-Lp4 represent short prophage remnants; R-Lp3 abuts Lp2 and displays sequence links to cos-site Siphoviridae
Genetic mapping and exome sequencing identify variants associated with five novel diseases.
Directory of Open Access Journals (Sweden)
Erik G Puffenberger
Full Text Available The Clinic for Special Children (CSC has integrated biochemical and molecular methods into a rural pediatric practice serving Old Order Amish and Mennonite (Plain children. Among the Plain people, we have used single nucleotide polymorphism (SNP microarrays to genetically map recessive disorders to large autozygous haplotype blocks (mean = 4.4 Mb that contain many genes (mean = 79. For some, uninformative mapping or large gene lists preclude disease-gene identification by Sanger sequencing. Seven such conditions were selected for exome sequencing at the Broad Institute; all had been previously mapped at the CSC using low density SNP microarrays coupled with autozygosity and linkage analyses. Using between 1 and 5 patient samples per disorder, we identified sequence variants in the known disease-causing genes SLC6A3 and FLVCR1, and present evidence to strongly support the pathogenicity of variants identified in TUBGCP6, BRAT1, SNIP1, CRADD, and HARS. Our results reveal the power of coupling new genotyping technologies to population-specific genetic knowledge and robust clinical data.
CORE-SINEs: eukaryotic short interspersed retroposing elements with common sequence motifs.
Gilbert, N; Labuda, D
1999-03-16
A 65-bp "core" sequence is dispersed in hundreds of thousands copies in the human genome. This sequence was found to constitute the central segment of a group of short interspersed elements (SINEs), referred to as mammalian-wide interspersed repeats, that proliferated before the radiation of placental mammals. Here, we propose that the core identifies an ancient tRNA-like SINE element, which survived in different lineages such as mammals, reptiles, birds, and fish, as well as mollusks, presumably for >550 million years. This element gave rise to a number of sequence families (CORE-SINEs), including mammalian-wide interspersed repeats, whose distinct 3' ends are shared with different families of long interspersed elements (LINEs). The evolutionary success of the generic CORE-SINE element can be related to the recruitment of the internal promoter from highly transcribed host RNA as well as to its capacity to adapt to changing retropositional opportunities by sequence exchange with actively amplifying LINEs. It reinforces the notion that the very existence of SINEs depends on the cohabitation with both LINEs and the host genome.
Tedersoo, Leho; Abarenkov, Kessy; Nilsson, R Henrik; Schüssler, Arthur; Grelet, Gwen-Aëlle; Kohout, Petr; Oja, Jane; Bonito, Gregory M; Veldre, Vilmar; Jairus, Teele; Ryberg, Martin; Larsson, Karl-Henrik; Kõljalg, Urmas
2011-01-01
Sequence analysis of the ribosomal RNA operon, particularly the internal transcribed spacer (ITS) region, provides a powerful tool for identification of mycorrhizal fungi. The sequence data deposited in the International Nucleotide Sequence Databases (INSD) are, however, unfiltered for quality and are often poorly annotated with metadata. To detect chimeric and low-quality sequences and assign the ectomycorrhizal fungi to phylogenetic lineages, fungal ITS sequences were downloaded from INSD, aligned within family-level groups, and examined through phylogenetic analyses and BLAST searches. By combining the fungal sequence database UNITE and the annotation and search tool PlutoF, we also added metadata from the literature to these accessions. Altogether 35,632 sequences belonged to mycorrhizal fungi or originated from ericoid and orchid mycorrhizal roots. Of these sequences, 677 were considered chimeric and 2,174 of low read quality. Information detailing country of collection, geographical coordinates, interacting taxon and isolation source were supplemented to cover 78.0%, 33.0%, 41.7% and 96.4% of the sequences, respectively. These annotated sequences are publicly available via UNITE (http://unite.ut.ee/) for downstream biogeographic, ecological and taxonomic analyses. In European Nucleotide Archive (ENA; http://www.ebi.ac.uk/ena/), the annotated sequences have a special link-out to UNITE. We intend to expand the data annotation to additional genes and all taxonomic groups and functional guilds of fungi.
Exome Sequencing Fails to Identify the Genetic Cause of Aicardi Syndrome
DEFF Research Database (Denmark)
Lund, Caroline; Striano, Pasquale; Sorte, Hanne Sørmo
2016-01-01
Aicardi syndrome (AS) is a well-characterized neurodevelopmental disorder with an unknown etiology. In this study, we performed whole-exome sequencing in 11 female patients with the diagnosis of AS, in order to identify the disease-causing gene. In particular, we focused on detecting variants in ...
International Nuclear Information System (INIS)
Black, C.G.; Fyfe, J.A.M.; Davies, J.K.
1997-01-01
A recombinant plasmid capable of restoring UV resistance to an Escherichia coli uvrA mutant was isolated from a genomic library of Neisseria gonorrhoeae. Sequence analysis revealed an open reading frame whose deduced amino acid sequence displayed significant similarity to those of the UvrA proteins of other bacterial species. A second open reading frame (ORF259) was identified upstream from, and in the opposite orientation to the gonococcal uvrA gene. Transcriptional fusions between portions of the gonococcal uvrA upstream region and a reporter gene were used to localise promoter activity in both E. coli and N. gonorrhoeae. The transcriptional starting points of uvrA and ORF259 were mapped in E. coli by primer extension analysis, and corresponding σ 70 promoters were identified. The arrangement of the uvrA-ORF259 intergenic region is similar to that of the gonococcal recA-aroD intergenic region. Both contain inverted copies of the 10 bp neisserial DNA uptake sequence situated between divergently transcribed genes. However, there is no evidence that either the uptake sequence or the proximity of the promoters influences expression of these genes. (author)
SeqAnt: A web service to rapidly identify and annotate DNA sequence variations
Directory of Open Access Journals (Sweden)
Patel Viren
2010-09-01
Full Text Available Abstract Background The enormous throughput and low cost of second-generation sequencing platforms now allow research and clinical geneticists to routinely perform single experiments that identify tens of thousands to millions of variant sites. Existing methods to annotate variant sites using information from publicly available databases via web browsers are too slow to be useful for the large sequencing datasets being routinely generated by geneticists. Because sequence annotation of variant sites is required before functional characterization can proceed, the lack of a high-throughput pipeline to efficiently annotate variant sites can act as a significant bottleneck in genetics research. Results SeqAnt (Sequence Annotator is an open source web service and software package that rapidly annotates DNA sequence variants and identifies recessive or compound heterozygous loci in human, mouse, fly, and worm genome sequencing experiments. Variants are characterized with respect to their functional type, frequency, and evolutionary conservation. Annotated variants can be viewed on a web browser, downloaded in a tab-delimited text file, or directly uploaded in a BED format to the UCSC genome browser. To demonstrate the speed of SeqAnt, we annotated a series of publicly available datasets that ranged in size from 37 to 3,439,107 variant sites. The total time to completely annotate these data completely ranged from 0.17 seconds to 28 minutes 49.8 seconds. Conclusion SeqAnt is an open source web service and software package that overcomes a critical bottleneck facing research and clinical geneticists using second-generation sequencing platforms. SeqAnt will prove especially useful for those investigators who lack dedicated bioinformatics personnel or infrastructure in their laboratories.
Unique Trichomonas vaginalis gene sequences identified in multinational regions of Northwest China.
Liu, Jun; Feng, Meng; Wang, Xiaolan; Fu, Yongfeng; Ma, Cailing; Cheng, Xunjia
2017-07-24
Trichomonas vaginalis (T. vaginalis) is a flagellated protozoan parasite that infects humans worldwide. This study determined the sequence of the 18S ribosomal RNA gene of T. vaginalis infecting both females and males in Xinjiang, China. Samples from 73 females and 28 males were collected and confirmed for infection with T. vaginalis, a total of 110 sequences were identified when the T. vaginalis 18S ribosomal RNA gene was sequenced. These sequences were used to prepare a phylogenetic network. The rooted network comprised three large clades and several independent branches. Most of the Xinjiang sequences were in one group. Preliminary results suggest that Xinjiang T. vaginalis isolates might be genetically unique, as indicated by the sequence of their 18S ribosomal RNA gene. Low migration rate of local people in this province may contribute to a genetic conservativeness of T. vaginalis. The unique genetic feature of our isolates may suggest a different clinical presentation of trichomoniasis, including metronidazole susceptibility, T. vaginalis virus or Mycoplasma co-infection characteristics. The transmission and evolution of Xinjiang T. vaginalis is of interest and should be studied further. More attention should be given to T. vaginalis infection in both females and males in Xinjiang.
Matheson, Jennifer L.
2007-01-01
Transcribing interview data is a time-consuming task that most qualitative researchers dislike. Transcribing is even more difficult for people with physical limitations because traditional transcribing requires manual dexterity and the ability to sit at a computer for long stretches of time. Researchers have begun to explore using an automated…
Directory of Open Access Journals (Sweden)
Steven N Hart
Full Text Available BACKGROUND: Structural variation (SV represents a significant, yet poorly understood contribution to an individual's genetic makeup. Advanced next-generation sequencing technologies are widely used to discover such variations, but there is no single detection tool that is considered a community standard. In an attempt to fulfil this need, we developed an algorithm, SoftSearch, for discovering structural variant breakpoints in Illumina paired-end next-generation sequencing data. SoftSearch combines multiple strategies for detecting SV including split-read, discordant read-pair, and unmated pairs. Co-localized split-reads and discordant read pairs are used to refine the breakpoints. RESULTS: We developed and validated SoftSearch using real and synthetic datasets. SoftSearch's key features are 1 not requiring secondary (or exhaustive primary alignment, 2 portability into established sequencing workflows, and 3 is applicable to any DNA-sequencing experiment (e.g. whole genome, exome, custom capture, etc.. SoftSearch identifies breakpoints from a small number of soft-clipped bases from split reads and a few discordant read-pairs which on their own would not be sufficient to make an SV call. CONCLUSIONS: We show that SoftSearch can identify more true SVs by combining multiple sequence features. SoftSearch was able to call clinically relevant SVs in the BRCA2 gene not reported by other tools while offering significantly improved overall performance.
A Direct TeX-to-Braille Transcribing Method
Papasalouros, Andreas; Tsolomitis, Antonis
2017-01-01
The TeX/LaTeX typesetting system is the most wide-spread system for creating documents in Mathematics and Science. However, no reliable tool exists to this day for automatically transcribing documents from the above formats into Braille/Nemeth code. Thus, visually impaired students of related fields do not have access to the bulk of study material…
Hong, Jungeui; Gresham, David
2017-11-01
Quantitative analysis of next-generation sequencing (NGS) data requires discriminating duplicate reads generated by PCR from identical molecules that are of unique origin. Typically, PCR duplicates are identified as sequence reads that align to the same genomic coordinates using reference-based alignment. However, identical molecules can be independently generated during library preparation. Misidentification of these molecules as PCR duplicates can introduce unforeseen biases during analyses. Here, we developed a cost-effective sequencing adapter design by modifying Illumina TruSeq adapters to incorporate a unique molecular identifier (UMI) while maintaining the capacity to undertake multiplexed, single-index sequencing. Incorporation of UMIs into TruSeq adapters (TrUMIseq adapters) enables identification of bona fide PCR duplicates as identically mapped reads with identical UMIs. Using TrUMIseq adapters, we show that accurate removal of PCR duplicates results in improved accuracy of both allele frequency (AF) estimation in heterogeneous populations using DNA sequencing and gene expression quantification using RNA-Seq.
Dunster, Emily S; Kipnis, Daniel G; Angelo, F Michael
2014-01-01
In fall 2011, the Scott Memorial Library purchased 53 letters belonging to an 1841 graduate of Jefferson Medical College, John Plimpton Green. The library staff transcribed and digitized the letters, creating an online collection in the university's institutional repository, Jefferson Digital Commons. This article will detail the process of transcribing and digitizing the collection along with sharing statistics and the benefits of this project to global researchers.
Whole-exome sequencing identifies USH2A mutations in a pseudo-dominant Usher syndrome family.
Zheng, Sui-Lian; Zhang, Hong-Liang; Lin, Zhen-Lang; Kang, Qian-Yan
2015-10-01
Usher syndrome (USH) is an autosomal recessive (AR) multi-sensory degenerative disorder leading to deaf-blindness. USH is clinically subdivided into three subclasses, and 10 genes have been identified thus far. Clinical and genetic heterogeneities in USH make a precise diagnosis difficult. A dominant‑like USH family in successive generations was identified, and the present study aimed to determine the genetic predisposition of this family. Whole‑exome sequencing was performed in two affected patients and an unaffected relative. Systematic data were analyzed by bioinformatic analysis to remove the candidate mutations via step‑wise filtering. Direct Sanger sequencing and co‑segregation analysis were performed in the pedigree. One novel and two known mutations in the USH2A gene were identified, and were further confirmed by direct sequencing and co‑segregation analysis. The affected mother carried compound mutations in the USH2A gene, while the unaffected father carried a heterozygous mutation. The present study demonstrates that whole‑exome sequencing is a robust approach for the molecular diagnosis of disorders with high levels of genetic heterogeneity.
Tsangaras, Kyriakos; Mayer, Jens; Alquezar-Planas, David E; Greenwood, Alex D
2015-11-24
Transcriptome analysis of polar bear (Ursus maritimus) tissues identified sequences with similarity to Porcine Endogenous Retroviruses (PERV). Based on these sequences, four proviral copies and 15 solo long terminal repeats (LTRs) of a newly described endogenous retrovirus were characterized from the polar bear draft genome sequence. Closely related sequences were identified by PCR analysis of brown bear (Ursus arctos) and black bear (Ursus americanus) but were absent in non-Ursinae bear species. The virus was therefore designated UrsusERV. Two distinct groups of LTRs were observed including a recombinant ERV that contained one LTR belonging to each group indicating that genomic invasions by at least two UrsusERV variants have recently occurred. Age estimates based on proviral LTR divergence and conservation of integration sites among ursids suggest the viral group is only a few million years old. The youngest provirus was polar bear specific, had intact open reading frames (ORFs) and could potentially encode functional proteins. Phylogenetic analyses of UrsusERV consensus protein sequences suggest that it is part of a pig, gibbon and koala retrovirus clade. The young age estimates and lineage specificity of the virus suggests UrsusERV is a recent cross species transmission from an unknown reservoir and places the viral group among the youngest of ERVs identified in mammals.
Tsangaras, Kyriakos; Mayer, Jens; Alquezar-Planas, David E.; Greenwood, Alex D.
2015-01-01
Transcriptome analysis of polar bear (Ursus maritimus) tissues identified sequences with similarity to Porcine Endogenous Retroviruses (PERV). Based on these sequences, four proviral copies and 15 solo long terminal repeats (LTRs) of a newly described endogenous retrovirus were characterized from the polar bear draft genome sequence. Closely related sequences were identified by PCR analysis of brown bear (Ursus arctos) and black bear (Ursus americanus) but were absent in non-Ursinae bear species. The virus was therefore designated UrsusERV. Two distinct groups of LTRs were observed including a recombinant ERV that contained one LTR belonging to each group indicating that genomic invasions by at least two UrsusERV variants have recently occurred. Age estimates based on proviral LTR divergence and conservation of integration sites among ursids suggest the viral group is only a few million years old. The youngest provirus was polar bear specific, had intact open reading frames (ORFs) and could potentially encode functional proteins. Phylogenetic analyses of UrsusERV consensus protein sequences suggest that it is part of a pig, gibbon and koala retrovirus clade. The young age estimates and lineage specificity of the virus suggests UrsusERV is a recent cross species transmission from an unknown reservoir and places the viral group among the youngest of ERVs identified in mammals. PMID:26610552
Directory of Open Access Journals (Sweden)
Audra Skukauskaite
2012-01-01
Full Text Available This article presents a reflexive analysis of two transcripts of an open-ended interview and argues for transparency in transcribing processes and outcomes. By analyzing ways in which a researcher's theories become consequential in producing and using transcripts of an open-ended interview, this paper makes visible the importance of examining and presenting theoretical bases of transcribing decisions. While scholars across disciplines have argued that transcribing is a theoretically laden process (GREEN, FRANQUIZ & DIXON, 1997; KVALE & BRINKMAN, 2009, few have engaged in reflexive analyses of the data history to demonstrate the consequences particular theoretical and methodological approaches pose in producing knowledge claims and inciting dialogues across traditions. The article demonstrates how theory-method-claim relationships in transcribing influence research transparency and warrantability. URN: http://nbn-resolving.de/urn:nbn:de:0114-fqs1201146
Keller, A; Danner, N; Grimmer, G; Ankenbrand, M; von der Ohe, K; von der Ohe, W; Rost, S; Härtel, S; Steffan-Dewenter, I
2015-03-01
The identification of pollen plays an important role in ecology, palaeo-climatology, honey quality control and other areas. Currently, expert knowledge and reference collections are essential to identify pollen origin through light microscopy. Pollen identification through molecular sequencing and DNA barcoding has been proposed as an alternative approach, but the assessment of mixed pollen samples originating from multiple plant species is still a tedious and error-prone task. Next-generation sequencing has been proposed to avoid this hindrance. In this study we assessed mixed pollen probes through next-generation sequencing of amplicons from the highly variable, species-specific internal transcribed spacer 2 region of nuclear ribosomal DNA. Further, we developed a bioinformatic workflow to analyse these high-throughput data with a newly created reference database. To evaluate the feasibility, we compared results from classical identification based on light microscopy from the same samples with our sequencing results. We assessed in total 16 mixed pollen samples, 14 originated from honeybee colonies and two from solitary bee nests. The sequencing technique resulted in higher taxon richness (deeper assignments and more identified taxa) compared to light microscopy. Abundance estimations from sequencing data were significantly correlated with counted abundances through light microscopy. Simulation analyses of taxon specificity and sensitivity indicate that 96% of taxa present in the database are correctly identifiable at the genus level and 70% at the species level. Next-generation sequencing thus presents a useful and efficient workflow to identify pollen at the genus and species level without requiring specialised palynological expert knowledge. © 2014 German Botanical Society and The Royal Botanical Society of the Netherlands.
International Nuclear Information System (INIS)
Tucker, M.A.
1988-01-01
Poly(A) + RNA from early or mid-stage ovarian follicles of C. erythrocephala was used to generate radiolabelled oogenesis-specific cDNA probes for screening the phage libraries. A cDNA probe made from mid-stage embryo poly(A) + RNA was used as the differential screening probe. Thus plaques hybridizing to the two oogenesis-specific probes but not the mid-stage embryo probe were selected as potentially containing oogenesis-specific genes. Two further rounds of screening were used to eliminate false positives and, after plaque purification, restriction digests of the remaining clones were screened by Southern blot hybridization to identify DNA fragments transcribed in an oogenesis-specific manner. In situ hybridization to sections of ovarian follicles has been used to determine the cell types within the follicles in which the various genes are expressed. Radiolabelled RNA probes for four of the C. erythrocephala oogenesis-specific clones and the two D. melanogaster clones have been hybridized to ovarian follicles. Further studies have been concentrated on the two germ-line transcribed, oogenesis-specific clones isolated from the D. melanogaster clone library. Detailed genetic mapping of the DA clone and of these mutations was performed to determine which mutations might represent the DA gene. cDNA clones have been isolated for the transcribed region of clone DA and have been used to further define the transcription unit from this region of the D. melanogaster genome
Kusaba, M; Tsuge, T
1995-10-01
The internal transcribed spacer regions (ITS1 and ITS2) of ribosomal DNA from Alternaria species, including seven fungi known to produce host-specific toxins, were analyzed by polymerase chain reaction-amplification and direct sequencing. Phylogenetic analysis of the sequence data by the Neighbor-joining method showed that the seven toxin-producing fungi belong to a monophyletic group together with A. alternata. In contract, A. dianthi, A. panax, A. dauci, A. bataticola, A. porri, A. sesami and A. solani, species that can be morphologically distinguished from A. alternata, could be clearly separated from A. alternata by phylogenetic of the ITS variation. These results suggest that Alternaria pathogens which produce host-specific toxins are pathogenic variants within a single variable species, A. alternata.
Identifying driver mutations in sequenced cancer genomes
DEFF Research Database (Denmark)
Raphael, Benjamin J; Dobson, Jason R; Oesper, Layla
2014-01-01
High-throughput DNA sequencing is revolutionizing the study of cancer and enabling the measurement of the somatic mutations that drive cancer development. However, the resulting sequencing datasets are large and complex, obscuring the clinically important mutations in a background of errors, nois...... patterns of mutual exclusivity. These techniques, coupled with advances in high-throughput DNA sequencing, are enabling precision medicine approaches to the diagnosis and treatment of cancer....
Deep sequencing of uveal melanoma identifies a recurrent mutation in PLCB4
DEFF Research Database (Denmark)
Johansson, Peter; Aoude, Lauren G; Wadt, Karin
2016-01-01
Next generation sequencing of uveal melanoma (UM) samples has identified a number of recurrent oncogenic or loss-of-function mutations in key driver genes including: GNAQ, GNA11, EIF1AX, SF3B1 and BAP1. To search for additional driver mutations in this tumor type we carried out whole......, instead, a BRCA mutation signature predominated. In addition to mutations in the known UM driver genes, we found a recurrent mutation in PLCB4 (c.G1888T, p.D630Y, NM_000933), which was validated using Sanger sequencing. The identical mutation was also found in published UM sequence data (1 of 56 tumors......-genome or whole-exome sequencing of 28 tumors or primary cell lines. These samples have a low mutation burden, with a mean of 10.6 protein changing mutations per sample (range 0 to 53). As expected for these sun-shielded melanomas the mutation spectrum was not consistent with an ultraviolet radiation signature...
Arbefeville, S; Harris, A; Ferrieri, P
2017-09-01
Fungal infections cause considerable morbidity and mortality in immunocompromised patients. Rapid and accurate identification of fungi is essential to guide accurately targeted antifungal therapy. With the advent of molecular methods, clinical laboratories can use new technologies to supplement traditional phenotypic identification of fungi. The aims of the study were to evaluate the sole commercially available MicroSEQ® D2 LSU rDNA Fungal Identification Kit compared to the in-house developed internal transcribed spacer (ITS) regions assay in identifying moulds, using two well-known online public databases to analyze sequenced data. 85 common and uncommon clinically relevant fungi isolated from clinical specimens were sequenced for the D2 region of the large subunit (LSU) of ribosomal RNA (rRNA) gene with the MicroSEQ® Kit and the ITS regions with the in house developed assay. The generated sequenced data were analyzed with the online GenBank and MycoBank public databases. The D2 region of the LSU rRNA gene identified 89.4% or 92.9% of the 85 isolates to the genus level and the full ITS region (f-ITS) 96.5% or 100%, using GenBank or MycoBank, respectively, when compared to the consensus ID. When comparing species-level designations to the consensus ID, D2 region of the LSU rRNA gene aligned with 44.7% (38/85) or 52.9% (45/85) of these isolates in GenBank or MycoBank, respectively. By comparison, f-ITS possessed greater specificity, followed by ITS1, then ITS2 regions using GenBank or MycoBank. Using GenBank or MycoBank, D2 region of the LSU rRNA gene outperformed phenotypic based ID at the genus level. Comparing rates of ID between D2 region of the LSU rRNA gene and the ITS regions in GenBank or MycoBank at the species level against the consensus ID, f-ITS and ITS2 exceeded performance of the D2 region of the LSU rRNA gene, but ITS1 had similar performance to the D2 region of the LSU rRNA gene using MycoBank. Our results indicated that the MicroSEQ® D2 LSU r
Directory of Open Access Journals (Sweden)
Shafipour1, M.
2014-11-01
Full Text Available The identification of Mycobacteria in the species level has great medical importance. Biochemical tests are laborious and time-consuming, so new techniques could be used to identify the species. This research aimed to the comparison of biochemical and sequencing 16S rDNA gene methods to identify nontuberculous Mycobacteria in patients suspected to tuberculosis in Golestan province which is the most prevalent region of tuberculosis in Iran. Among 3336 patients suspected to tuberculosis referred to hospitals and health care centres in Golestan province during 2010-2011, 319 (9.56% culture positive cases were collected. Identification of species by using biochemical tests was done. On the samples recognized as nontuberculous Mycobacteria, after DNA extraction by boiling, 16S rDNA PCR was done and their sequencing were identified by NCBI BLAST. Of the 319 positive samples in Golestan Province, 300 cases were M.tuberculosis and 19 cases (5.01% were identified as nontuberculous Mycobacteria by biochemical tests. 15 out of 19 nontuberculous Mycobacteria were identified by PCR and sequencing method as similar by biochemical methods (similarity rate: 78.9%. But after PCR, 1 case known as M.simiae by biochemical test was identified as M. lentiflavum and 3 other cases were identified as Nocardia. Biochemical methods corresponded to the 16S rDNA PCR and sequencing in 78.9% of cases. However, in identification of M. lentiflavum and Nocaria sp. the molecular method is better than biochemical methods.
Lange, Leslie A.; Hu, Youna; Zhang, He; Xue, Chenyi; Schmidt, Ellen M.; Tang, Zheng-Zheng; Bizon, Chris; Lange, Ethan M.; Smith, Joshua D.; Turner, Emily H.; Jun, Goo; Kang, Hyun Min; Peloso, Gina; Auer, Paul; Li, Kuo-ping; Flannick, Jason; Zhang, Ji; Fuchsberger, Christian; Gaulton, Kyle; Lindgren, Cecilia; Locke, Adam; Manning, Alisa; Sim, Xueling; Rivas, Manuel A.; Holmen, Oddgeir L.; Gottesman, Omri; Lu, Yingchang; Ruderfer, Douglas; Stahl, Eli A.; Duan, Qing; Li, Yun; Durda, Peter; Jiao, Shuo; Isaacs, Aaron; Hofman, Albert; Bis, Joshua C.; Correa, Adolfo; Griswold, Michael E.; Jakobsdottir, Johanna; Smith, Albert V.; Schreiner, Pamela J.; Feitosa, Mary F.; Zhang, Qunyuan; Huffman, Jennifer E.; Crosby, Jacy; Wassel, Christina L.; Do, Ron; Franceschini, Nora; Martin, Lisa W.; Robinson, Jennifer G.; Assimes, Themistocles L.; Crosslin, David R.; Rosenthal, Elisabeth A.; Tsai, Michael; Rieder, Mark J.; Farlow, Deborah N.; Folsom, Aaron R.; Lumley, Thomas; Fox, Ervin R.; Carlson, Christopher S.; Peters, Ulrike; Jackson, Rebecca D.; van Duijn, Cornelia M.; Uitterlinden, André G.; Levy, Daniel; Rotter, Jerome I.; Taylor, Herman A.; Gudnason, Vilmundur; Siscovick, David S.; Fornage, Myriam; Borecki, Ingrid B.; Hayward, Caroline; Rudan, Igor; Chen, Y. Eugene; Bottinger, Erwin P.; Loos, Ruth J.F.; Sætrom, Pål; Hveem, Kristian; Boehnke, Michael; Groop, Leif; McCarthy, Mark; Meitinger, Thomas; Ballantyne, Christie M.; Gabriel, Stacey B.; O’Donnell, Christopher J.; Post, Wendy S.; North, Kari E.; Reiner, Alexander P.; Boerwinkle, Eric; Psaty, Bruce M.; Altshuler, David; Kathiresan, Sekar; Lin, Dan-Yu; Jarvik, Gail P.; Cupples, L. Adrienne; Kooperberg, Charles; Wilson, James G.; Nickerson, Deborah A.; Abecasis, Goncalo R.; Rich, Stephen S.; Tracy, Russell P.; Willer, Cristen J.; Gabriel, Stacey B.; Altshuler, David M.; Abecasis, Gonçalo R.; Allayee, Hooman; Cresci, Sharon; Daly, Mark J.; de Bakker, Paul I.W.; DePristo, Mark A.; Do, Ron; Donnelly, Peter; Farlow, Deborah N.; Fennell, Tim; Garimella, Kiran; Hazen, Stanley L.; Hu, Youna; Jordan, Daniel M.; Jun, Goo; Kathiresan, Sekar; Kang, Hyun Min; Kiezun, Adam; Lettre, Guillaume; Li, Bingshan; Li, Mingyao; Newton-Cheh, Christopher H.; Padmanabhan, Sandosh; Peloso, Gina; Pulit, Sara; Rader, Daniel J.; Reich, David; Reilly, Muredach P.; Rivas, Manuel A.; Schwartz, Steve; Scott, Laura; Siscovick, David S.; Spertus, John A.; Stitziel, Nathaniel O.; Stoletzki, Nina; Sunyaev, Shamil R.; Voight, Benjamin F.; Willer, Cristen J.; Rich, Stephen S.; Akylbekova, Ermeg; Atwood, Larry D.; Ballantyne, Christie M.; Barbalic, Maja; Barr, R. Graham; Benjamin, Emelia J.; Bis, Joshua; Boerwinkle, Eric; Bowden, Donald W.; Brody, Jennifer; Budoff, Matthew; Burke, Greg; Buxbaum, Sarah; Carr, Jeff; Chen, Donna T.; Chen, Ida Y.; Chen, Wei-Min; Concannon, Pat; Crosby, Jacy; Cupples, L. Adrienne; D’Agostino, Ralph; DeStefano, Anita L.; Dreisbach, Albert; Dupuis, Josée; Durda, J. Peter; Ellis, Jaclyn; Folsom, Aaron R.; Fornage, Myriam; Fox, Caroline S.; Fox, Ervin; Funari, Vincent; Ganesh, Santhi K.; Gardin, Julius; Goff, David; Gordon, Ora; Grody, Wayne; Gross, Myron; Guo, Xiuqing; Hall, Ira M.; Heard-Costa, Nancy L.; Heckbert, Susan R.; Heintz, Nicholas; Herrington, David M.; Hickson, DeMarc; Huang, Jie; Hwang, Shih-Jen; Jacobs, David R.; Jenny, Nancy S.; Johnson, Andrew D.; Johnson, Craig W.; Kawut, Steven; Kronmal, Richard; Kurz, Raluca; Lange, Ethan M.; Lange, Leslie A.; Larson, Martin G.; Lawson, Mark; Lewis, Cora E.; Levy, Daniel; Li, Dalin; Lin, Honghuang; Liu, Chunyu; Liu, Jiankang; Liu, Kiang; Liu, Xiaoming; Liu, Yongmei; Longstreth, William T.; Loria, Cay; Lumley, Thomas; Lunetta, Kathryn; Mackey, Aaron J.; Mackey, Rachel; Manichaikul, Ani; Maxwell, Taylor; McKnight, Barbara; Meigs, James B.; Morrison, Alanna C.; Musani, Solomon K.; Mychaleckyj, Josyf C.; Nettleton, Jennifer A.; North, Kari; O’Donnell, Christopher J.; O’Leary, Daniel; Ong, Frank; Palmas, Walter; Pankow, James S.; Pankratz, Nathan D.; Paul, Shom; Perez, Marco; Person, Sharina D.; Polak, Joseph; Post, Wendy S.; Psaty, Bruce M.; Quinlan, Aaron R.; Raffel, Leslie J.; Ramachandran, Vasan S.; Reiner, Alexander P.; Rice, Kenneth; Rotter, Jerome I.; Sanders, Jill P.; Schreiner, Pamela; Seshadri, Sudha; Shea, Steve; Sidney, Stephen; Silverstein, Kevin; Smith, Nicholas L.; Sotoodehnia, Nona; Srinivasan, Asoke; Taylor, Herman A.; Taylor, Kent; Thomas, Fridtjof; Tracy, Russell P.; Tsai, Michael Y.; Volcik, Kelly A.; Wassel, Chrstina L.; Watson, Karol; Wei, Gina; White, Wendy; Wiggins, Kerri L.; Wilk, Jemma B.; Williams, O. Dale; Wilson, Gregory; Wilson, James G.; Wolf, Phillip; Zakai, Neil A.; Hardy, John; Meschia, James F.; Nalls, Michael; Singleton, Andrew; Worrall, Brad; Bamshad, Michael J.; Barnes, Kathleen C.; Abdulhamid, Ibrahim; Accurso, Frank; Anbar, Ran; Beaty, Terri; Bigham, Abigail; Black, Phillip; Bleecker, Eugene; Buckingham, Kati; Cairns, Anne Marie; Caplan, Daniel; Chatfield, Barbara; Chidekel, Aaron; Cho, Michael; Christiani, David C.; Crapo, James D.; Crouch, Julia; Daley, Denise; Dang, Anthony; Dang, Hong; De Paula, Alicia; DeCelie-Germana, Joan; Drumm, Allen DozorMitch; Dyson, Maynard; Emerson, Julia; Emond, Mary J.; Ferkol, Thomas; Fink, Robert; Foster, Cassandra; Froh, Deborah; Gao, Li; Gershan, William; Gibson, Ronald L.; Godwin, Elizabeth; Gondor, Magdalen; Gutierrez, Hector; Hansel, Nadia N.; Hassoun, Paul M.; Hiatt, Peter; Hokanson, John E.; Howenstine, Michelle; Hummer, Laura K.; Kanga, Jamshed; Kim, Yoonhee; Knowles, Michael R.; Konstan, Michael; Lahiri, Thomas; Laird, Nan; Lange, Christoph; Lin, Lin; Lin, Xihong; Louie, Tin L.; Lynch, David; Make, Barry; Martin, Thomas R.; Mathai, Steve C.; Mathias, Rasika A.; McNamara, John; McNamara, Sharon; Meyers, Deborah; Millard, Susan; Mogayzel, Peter; Moss, Richard; Murray, Tanda; Nielson, Dennis; Noyes, Blakeslee; O’Neal, Wanda; Orenstein, David; O’Sullivan, Brian; Pace, Rhonda; Pare, Peter; Parker, H. Worth; Passero, Mary Ann; Perkett, Elizabeth; Prestridge, Adrienne; Rafaels, Nicholas M.; Ramsey, Bonnie; Regan, Elizabeth; Ren, Clement; Retsch-Bogart, George; Rock, Michael; Rosen, Antony; Rosenfeld, Margaret; Ruczinski, Ingo; Sanford, Andrew; Schaeffer, David; Sell, Cindy; Sheehan, Daniel; Silverman, Edwin K.; Sin, Don; Spencer, Terry; Stonebraker, Jackie; Tabor, Holly K.; Varlotta, Laurie; Vergara, Candelaria I.; Weiss, Robert; Wigley, Fred; Wise, Robert A.; Wright, Fred A.; Wurfel, Mark M.; Zanni, Robert; Zou, Fei; Nickerson, Deborah A.; Rieder, Mark J.; Green, Phil; Shendure, Jay; Akey, Joshua M.; Bustamante, Carlos D.; Crosslin, David R.; Eichler, Evan E.; Fox, P. Keolu; Fu, Wenqing; Gordon, Adam; Gravel, Simon; Jarvik, Gail P.; Johnsen, Jill M.; Kan, Mengyuan; Kenny, Eimear E.; Kidd, Jeffrey M.; Lara-Garduno, Fremiet; Leal, Suzanne M.; Liu, Dajiang J.; McGee, Sean; O’Connor, Timothy D.; Paeper, Bryan; Robertson, Peggy D.; Smith, Joshua D.; Staples, Jeffrey C.; Tennessen, Jacob A.; Turner, Emily H.; Wang, Gao; Yi, Qian; Jackson, Rebecca; Peters, Ulrike; Carlson, Christopher S.; Anderson, Garnet; Anton-Culver, Hoda; Assimes, Themistocles L.; Auer, Paul L.; Beresford, Shirley; Bizon, Chris; Black, Henry; Brunner, Robert; Brzyski, Robert; Burwen, Dale; Caan, Bette; Carty, Cara L.; Chlebowski, Rowan; Cummings, Steven; Curb, J. David; Eaton, Charles B.; Ford, Leslie; Franceschini, Nora; Fullerton, Stephanie M.; Gass, Margery; Geller, Nancy; Heiss, Gerardo; Howard, Barbara V.; Hsu, Li; Hutter, Carolyn M.; Ioannidis, John; Jiao, Shuo; Johnson, Karen C.; Kooperberg, Charles; Kuller, Lewis; LaCroix, Andrea; Lakshminarayan, Kamakshi; Lane, Dorothy; Lasser, Norman; LeBlanc, Erin; Li, Kuo-Ping; Limacher, Marian; Lin, Dan-Yu; Logsdon, Benjamin A.; Ludlam, Shari; Manson, JoAnn E.; Margolis, Karen; Martin, Lisa; McGowan, Joan; Monda, Keri L.; Kotchen, Jane Morley; Nathan, Lauren; Ockene, Judith; O’Sullivan, Mary Jo; Phillips, Lawrence S.; Prentice, Ross L.; Robbins, John; Robinson, Jennifer G.; Rossouw, Jacques E.; Sangi-Haghpeykar, Haleh; Sarto, Gloria E.; Shumaker, Sally; Simon, Michael S.; Stefanick, Marcia L.; Stein, Evan; Tang, Hua; Taylor, Kira C.; Thomson, Cynthia A.; Thornton, Timothy A.; Van Horn, Linda; Vitolins, Mara; Wactawski-Wende, Jean; Wallace, Robert; Wassertheil-Smoller, Sylvia; Zeng, Donglin; Applebaum-Bowden, Deborah; Feolo, Michael; Gan, Weiniu; Paltoo, Dina N.; Sholinsky, Phyliss; Sturcke, Anne
2014-01-01
Elevated low-density lipoprotein cholesterol (LDL-C) is a treatable, heritable risk factor for cardiovascular disease. Genome-wide association studies (GWASs) have identified 157 variants associated with lipid levels but are not well suited to assess the impact of rare and low-frequency variants. To determine whether rare or low-frequency coding variants are associated with LDL-C, we exome sequenced 2,005 individuals, including 554 individuals selected for extreme LDL-C (>98th or <2nd percentile). Follow-up analyses included sequencing of 1,302 additional individuals and genotype-based analysis of 52,221 individuals. We observed significant evidence of association between LDL-C and the burden of rare or low-frequency variants in PNPLA5, encoding a phospholipase-domain-containing protein, and both known and previously unidentified variants in PCSK9, LDLR and APOB, three known lipid-related genes. The effect sizes for the burden of rare variants for each associated gene were substantially higher than those observed for individual SNPs identified from GWASs. We replicated the PNPLA5 signal in an independent large-scale sequencing study of 2,084 individuals. In conclusion, this large whole-exome-sequencing study for LDL-C identified a gene not known to be implicated in LDL-C and provides unique insight into the design and analysis of similar experiments. PMID:24507775
Directory of Open Access Journals (Sweden)
Kyriakos Tsangaras
2015-11-01
Full Text Available Transcriptome analysis of polar bear (Ursus maritimus tissues identified sequences with similarity to Porcine Endogenous Retroviruses (PERV. Based on these sequences, four proviral copies and 15 solo long terminal repeats (LTRs of a newly described endogenous retrovirus were characterized from the polar bear draft genome sequence. Closely related sequences were identified by PCR analysis of brown bear (Ursus arctos and black bear (Ursus americanus but were absent in non-Ursinae bear species. The virus was therefore designated UrsusERV. Two distinct groups of LTRs were observed including a recombinant ERV that contained one LTR belonging to each group indicating that genomic invasions by at least two UrsusERV variants have recently occurred. Age estimates based on proviral LTR divergence and conservation of integration sites among ursids suggest the viral group is only a few million years old. The youngest provirus was polar bear specific, had intact open reading frames (ORFs and could potentially encode functional proteins. Phylogenetic analyses of UrsusERV consensus protein sequences suggest that it is part of a pig, gibbon and koala retrovirus clade. The young age estimates and lineage specificity of the virus suggests UrsusERV is a recent cross species transmission from an unknown reservoir and places the viral group among the youngest of ERVs identified in mammals.
Deep sequencing as a method of typing bluetongue virus isolates.
Rao, Pavuluri Panduranga; Reddy, Yella Narasimha; Ganesh, Kapila; Nair, Shreeja G; Niranjan, Vidya; Hegde, Nagendra R
2013-11-01
Bluetongue (BT) is an economically important endemic disease of livestock in tropics and subtropics. In addition, its recent spread to temperate regions like North America and Northern Europe is of serious concern. Rapid serotyping and characterization of BT virus (BTV) is an essential step in the identification of origin of the virus and for controlling the disease. Serotyping of BTV is typically performed by serum neutralization, and of late by nucleotide sequencing. This report describes the near complete genome sequencing and typing of two isolates of BTV using Illumina next generation sequencing platform. Two of the BTV RNAs were multiplexed with ten other unknown samples. Viral RNA was isolated and fragmented, reverse transcribed, the cDNA ends were repaired and ligated with a multiplex oligo. The genome library was amplified using primers complementary to the ligated oligo and subjected to single and paired end sequencing. The raw reads were assembled using a de novo method and reference-based assembly was performed based on the contig data. Near complete sequences of all segments of BTV were obtained with more than 20× coverage, and single read sequencing method was sufficient to identify the genotype and serotype of the virus. The two viruses used in this study were typed as BTV-1 and BTV-9E. Copyright © 2013 Elsevier B.V. All rights reserved.
Harpke, Doerte; Peterson, Angela
2008-05-01
The internal transcribed spacer (ITS) region (ITS1, 5.8S rDNA, ITS2) represents the most widely applied nuclear marker in eukaryotic phylogenetics. Although this region has been assumed to evolve in concert, the number of investigations revealing high degrees of intra-individual polymorphism connected with the presence of pseudogenes has risen. The 5.8S rDNA is the most important diagnostic marker for functionality of the ITS region. In Mammillaria, intra-individual 5.8S rDNA polymorphisms of up to 36% and up to nine different types have been found. Twenty-eight of 30 cloned genomic Mammillaria sequences were identified as putative pseudogenes. For the identification of pseudogenic ITS regions, in addition to formal tests based on substitution rates, we attempted to focus on functional features of the 5.8S rDNA (5.8S motif, secondary structure). The importance of functional data for the identification of pseudogenes is outlined and discussed. The identification of pseudogenes is essential, because they may cause erroneous phylogenies and taxonomic problems.
Functional brain activation differences in stuttering identified with a rapid fMRI sequence
Kraft, Shelly Jo; Choo, Ai Leen; Sharma, Harish; Ambrose, Nicoline G.
2011-01-01
The purpose of this study was to investigate whether brain activity related to the presence of stuttering can be identified with rapid functional MRI (fMRI) sequences that involved overt and covert speech processing tasks. The long-term goal is to develop sensitive fMRI approaches with developmentally appropriate tasks to identify deviant speech motor and auditory brain activity in children who stutter closer to the age at which recovery from stuttering is documented. Rapid sequences may be preferred for individuals or populations who do not tolerate long scanning sessions. In this report, we document the application of a picture naming and phoneme monitoring task in three minute fMRI sequences with adults who stutter (AWS). If relevant brain differences are found in AWS with these approaches that conform to previous reports, then these approaches can be extended to younger populations. Pairwise contrasts of brain BOLD activity between AWS and normally fluent adults indicated the AWS showed higher BOLD activity in the right inferior frontal gyrus (IFG), right temporal lobe and sensorimotor cortices during picture naming and and higher activity in the right IFG during phoneme monitoring. The right lateralized pattern of BOLD activity together with higher activity in sensorimotor cortices is consistent with previous reports, which indicates rapid fMRI sequences can be considered for investigating stuttering in younger participants. PMID:22133409
Wang, Zan; Yu, Guohui; Shi, Binbin; Wang, Xuemin; Qiang, Haiping; Gao, Hongwen
2014-01-01
Sufficient codominant genetic markers are needed for various genetic investigations in alfalfa since the species is an outcrossing autotetraploid. With the newly developed next generation sequencing technology, a large amount of transcribed sequences of alfalfa have been generated and are available for identifying SSR markers by data mining. A total of 54,278 alfalfa non-redundant unigenes were assembled through the Illumina HiSeqTM 2000 sequencing technology. Based on 3,903 unigene sequences, 4,493 SSRs were identified. Tri-nucleotide repeats (56.71%) were the most abundant motif class while AG/CT (21.7%), AGG/CCT (19.8%), AAC/GTT (10.3%), ATC/ATG (8.8%), and ACC/GGT (6.3%) were the subsequent top five nucleotide repeat motifs. Eight hundred and thirty- seven EST-SSR primer pairs were successfully designed. Of these, 527 (63%) primer pairs yielded clear and scored PCR products and 372 (70.6%) exhibited polymorphisms. High transferability was observed for ssp falcata at 99.2% (523) and 71.7% (378) in M. truncatula. In addition, 313 of 527 SSR marker sequences were in silico mapped onto the eight M. truncatula chromosomes. Thirty-six polymorphic SSR primer pairs were used in the genetic relatedness analysis of 30 Chinese alfalfa cultivated accessions generating a total of 199 scored alleles. The mean observed heterozygosity and polymorphic information content were 0.767 and 0.635, respectively. The codominant markers not only enriched the current resources of molecular markers in alfalfa, but also would facilitate targeted investigations in marker-trait association, QTL mapping, and genetic diversity analysis in alfalfa. PMID:24642969
Directory of Open Access Journals (Sweden)
Kristian Ovaska
Full Text Available Identification of responsive genes to an extra-cellular cue enables characterization of pathophysiologically crucial biological processes. Deep sequencing technologies provide a powerful means to identify responsive genes, which creates a need for computational methods able to analyze dynamic and multi-level deep sequencing data. To answer this need we introduce here a data-driven algorithm, SPINLONG, which is designed to search for genes that match the user-defined hypotheses or models. SPINLONG is applicable to various experimental setups measuring several molecular markers in parallel. To demonstrate the SPINLONG approach, we analyzed ChIP-seq data reporting PolII, estrogen receptor α (ERα, H3K4me3 and H2A.Z occupancy at five time points in the MCF-7 breast cancer cell line after estradiol stimulus. We obtained 777 ERa early responsive genes and compared the biological functions of the genes having ERα binding within 20 kb of the transcription start site (TSS to genes without such binding site. Our results show that the non-genomic action of ERα via the MAPK pathway, instead of direct ERa binding, may be responsible for early cell responses to ERα activation. Our results also indicate that the ERα responsive genes triggered by the genomic pathway are transcribed faster than those without ERα binding sites. The survival analysis of the 777 ERα responsive genes with 150 primary breast cancer tumors and in two independent validation cohorts indicated the ATAD3B gene, which does not have ERα binding site within 20 kb of its TSS, to be significantly associated with poor patient survival.
Somatic mosaicism of a CDKL5 mutation identified by next-generation sequencing.
Kato, Takeshi; Morisada, Naoya; Nagase, Hiroaki; Nishiyama, Masahiro; Toyoshima, Daisaku; Nakagawa, Taku; Maruyama, Azusa; Fu, Xue Jun; Nozu, Kandai; Wada, Hiroko; Takada, Satoshi; Iijima, Kazumoto
2015-10-01
CDKL5-related encephalopathy is an X-linked dominantly inherited disorder that is characterized by early infantile epileptic encephalopathy or atypical Rett syndrome. We describe a 5-year-old Japanese boy with intractable epilepsy, severe developmental delay, and Rett syndrome-like features. Onset was at 2 months, when his electroencephalogram showed sporadic single poly spikes and diffuse irregular poly spikes. We conducted a genetic analysis using an Illumina® TruSight™ One sequencing panel on a next-generation sequencer. We identified two epilepsy-associated single nucleotide variants in our case: CDKL5 p.Ala40Val and KCNQ2 p.Glu515Asp. CDKL5 p.Ala40Val has been previously reported to be responsible for early infantile epileptic encephalopathy. In our case, the CDKL5 heterozygous mutation showed somatic mosaicism because the boy's karyotype was 46,XY. The KCNQ2 variant p.Glu515Asp is known to cause benign familial neonatal seizures-1, and this variant showed paternal inheritance. Although we believe that the somatic mosaic CDKL5 mutation is mainly responsible for the neurological phenotype in the patient, the KCNQ2 variant might have some neurological effect. Genetic analysis by next-generation sequencing is capable of identifying multiple variants in a patient. Copyright © 2015 The Japanese Society of Child Neurology. Published by Elsevier B.V. All rights reserved.
Sequence-Based Introgression Mapping Identifies Candidate White Mold Tolerance Genes in Common Bean
Directory of Open Access Journals (Sweden)
Sujan Mamidi
2016-07-01
Full Text Available White mold, caused by the necrotrophic fungus (Lib. de Bary, is a major disease of common bean ( L.. WM7.1 and WM8.3 are two quantitative trait loci (QTL with major effects on tolerance to the pathogen. Advanced backcross populations segregating individually for either of the two QTL, and a recombinant inbred (RI population segregating for both QTL were used to fine map and confirm the genetic location of the QTL. The QTL intervals were physically mapped using the reference common bean genome sequence, and the physical intervals for each QTL were further confirmed by sequence-based introgression mapping. Using whole-genome sequence data from susceptible and tolerant DNA pools, introgressed regions were identified as those with significantly higher numbers of single-nucleotide polymorphisms (SNPs relative to the whole genome. By combining the QTL and SNP data, WM7.1 was located to a 660-kb region that contained 41 gene models on the proximal end of chromosome Pv07, while the WM8.3 introgression was narrowed to a 1.36-Mb region containing 70 gene models. The most polymorphic candidate gene in the WM7.1 region encodes a BEACH-domain protein associated with apoptosis. Within the WM8.3 interval, a receptor-like protein with the potential to recognize pathogen effectors was the most polymorphic gene. The use of gene and sequence-based mapping identified two candidate genes whose putative functions are consistent with the current model of pathogenicity.
Taxonomic evaluation of selected Ganoderma species and database sequence validation
Directory of Open Access Journals (Sweden)
Suldbold Jargalmaa
2017-07-01
Full Text Available Species in the genus Ganoderma include several ecologically important and pathogenic fungal species whose medicinal and economic value is substantial. Due to the highly similar morphological features within the Ganoderma, identification of species has relied heavily on DNA sequencing using BLAST searches, which are only reliable if the GenBank submissions are accurately labeled. In this study, we examined 113 specimens collected from 1969 to 2016 from various regions in Korea using morphological features and multigene analysis (internal transcribed spacer, translation elongation factor 1-α, and the second largest subunit of RNA polymerase II. These specimens were identified as four Ganoderma species: G. sichuanense, G. cf. adspersum, G. cf. applanatum, and G. cf. gibbosum. With the exception of G. sichuanense, these species were difficult to distinguish based solely on morphological features. However, phylogenetic analysis at three different loci yielded concordant phylogenetic information, and supported the four species distinctions with high bootstrap support. A survey of over 600 Ganoderma sequences available on GenBank revealed that 65% of sequences were either misidentified or ambiguously labeled. Here, we suggest corrected annotations for GenBank sequences based on our phylogenetic validation and provide updated global distribution patterns for these Ganoderma species.
Taxonomic evaluation of selected Ganoderma species and database sequence validation
Jargalmaa, Suldbold; Eimes, John A.; Park, Myung Soo; Park, Jae Young; Oh, Seung-Yoon
2017-01-01
Species in the genus Ganoderma include several ecologically important and pathogenic fungal species whose medicinal and economic value is substantial. Due to the highly similar morphological features within the Ganoderma, identification of species has relied heavily on DNA sequencing using BLAST searches, which are only reliable if the GenBank submissions are accurately labeled. In this study, we examined 113 specimens collected from 1969 to 2016 from various regions in Korea using morphological features and multigene analysis (internal transcribed spacer, translation elongation factor 1-α, and the second largest subunit of RNA polymerase II). These specimens were identified as four Ganoderma species: G. sichuanense, G. cf. adspersum, G. cf. applanatum, and G. cf. gibbosum. With the exception of G. sichuanense, these species were difficult to distinguish based solely on morphological features. However, phylogenetic analysis at three different loci yielded concordant phylogenetic information, and supported the four species distinctions with high bootstrap support. A survey of over 600 Ganoderma sequences available on GenBank revealed that 65% of sequences were either misidentified or ambiguously labeled. Here, we suggest corrected annotations for GenBank sequences based on our phylogenetic validation and provide updated global distribution patterns for these Ganoderma species. PMID:28761785
An algorithm to find all palindromic sequences in proteins
Indian Academy of Sciences (India)
2013-01-20
Jan 20, 2013 ... 1976; Karrer and Gall 1976; Vogt and Braun 1976) and (iii) in the formation of hairpin loops in the newly transcribed RNA. Palindromic sequences are observed in various classes of proteins like histones (Cheng et al. 1989), prion proteins (Sulkowski 1992; Kazim 1993),. DNA-binding proteins (Suzuki 1992; ...
Directory of Open Access Journals (Sweden)
Siya Liu
2017-09-01
Full Text Available Saprolegniasis, caused by Saprolegnia infection, is one of the most common diseases in freshwater fish. Our study aimed to determine the epidemiological characteristics of saprolegniasis in Chinese regions of high incidence. Saprolegnia were isolated and identified by morphological and molecular methods targeting the internal transcribed spacer (ITS ribosomal DNA (rDNA and building neighbor-joining (NJ and maximum parsimony (MP phylogenetic trees. The ITS sequences of eight isolated strains were compared with GenBank sequences and all strains fell into three clades: CLADE1 (02, LP, 04 and 14, CLADE2 (S1, and CLADE3 (CP, S2, L5 and the reference ATCC200013. Isolates 02 and LP shared 80% sequence similarity with S. diclina, S. longicaulis, S. ferax, S. mixta, and S. anomalies. Further, isolates 04 and 14 shared 80% similarity with S. bulbosa and S. oliviae. Finally, extremely high ITS sequence similarities were identified between isolates S1 and S. australis (100%; CP and S. hypogyna (96%; and S2, L5, ATCC200013 and S. salmonis (98%. This research provides insights into the identification, prevention and control of saprolegniasis pathogens and the potential development of effective drugs.
Directory of Open Access Journals (Sweden)
Kema Gert HJ
2008-11-01
Full Text Available Abstract Background The ascomycete fungus Cercospora zeae-maydis is an aggressive foliar pathogen of maize that causes substantial losses annually throughout the Western Hemisphere. Despite its impact on maize production, little is known about the regulation of pathogenesis in C. zeae-maydis at the molecular level. The objectives of this study were to generate a collection of expressed sequence tags (ESTs from C. zeae-maydis and evaluate their expression during vegetative, infectious, and reproductive growth. Results A total of 27,551 ESTs was obtained from five cDNA libraries constructed from vegetative and sporulating cultures of C. zeae-maydis. The ESTs, grouped into 4088 clusters and 531 singlets, represented 4619 putative unique genes. Of these, 36% encoded proteins similar (E value ≤ 10-05 to characterized or annotated proteins from the NCBI non-redundant database representing diverse molecular functions and biological processes based on Gene Ontology (GO classification. We identified numerous, previously undescribed genes with potential roles in photoreception, pathogenesis, and the regulation of development as well as Zephyr, a novel, actively transcribed transposable element. Differential expression of selected genes was demonstrated by real-time PCR, supporting their proposed roles in vegetative, infectious, and reproductive growth. Conclusion Novel genes that are potentially involved in regulating growth, development, and pathogenesis were identified in C. zeae-maydis, providing specific targets for characterization by molecular genetics and functional genomics. The EST data establish a foundation for future studies in evolutionary and comparative genomics among species of Cercospora and other groups of plant pathogenic fungi.
Whole-genome sequencing identifies recurrent mutations in chronic lymphocytic leukaemia
Puente, Xose S.; Pinyol, Magda; Quesada, Víctor; Conde, Laura; Ordóñez, Gonzalo R.; Villamor, Neus; Escaramis, Georgia; Jares, Pedro; Beà, Sílvia; González-Díaz, Marcos; Bassaganyas, Laia; Baumann, Tycho; Juan, Manel; López-Guerra, Mónica; Colomer, Dolors; Tubío, José M. C.; López, Cristina; Navarro, Alba; Tornador, Cristian; Aymerich, Marta; Rozman, María; Hernández, Jesús M.; Puente, Diana A.; Freije, José M. P.; Velasco, Gloria; Gutiérrez-Fernández, Ana; Costa, Dolors; Carrió, Anna; Guijarro, Sara; Enjuanes, Anna; Hernández, Lluís; Yagüe, Jordi; Nicolás, Pilar; Romeo-Casabona, Carlos M.; Himmelbauer, Heinz; Castillo, Ester; Dohm, Juliane C.; de Sanjosé, Silvia; Piris, Miguel A.; de Alava, Enrique; Miguel, Jesús San; Royo, Romina; Gelpí, Josep L.; Torrents, David; Orozco, Modesto; Pisano, David G.; Valencia, Alfonso; Guigó, Roderic; Bayés, Mónica; Heath, Simon; Gut, Marta; Klatt, Peter; Marshall, John; Raine, Keiran; Stebbings, Lucy A.; Futreal, P. Andrew; Stratton, Michael R.; Campbell, Peter J.; Gut, Ivo; López-Guillermo, Armando; Estivill, Xavier; Montserrat, Emili; López-Otín, Carlos; Campo, Elías
2012-01-01
Chronic lymphocytic leukaemia (CLL), the most frequent leukaemia in adults in Western countries, is a heterogeneous disease with variable clinical presentation and evolution1,2. Two major molecular subtypes can be distinguished, characterized respectively by a high or low number of somatic hypermutations in the variable region of immunoglobulin genes3,4. The molecular changes leading to the pathogenesis of the disease are still poorly understood. Here we performed whole-genome sequencing of four cases of CLL and identified 46 somatic mutations that potentially affect gene function. Further analysis of these mutations in 363 patients with CLL identified four genes that are recurrently mutated: notch 1 (NOTCH1), exportin 1 (XPO1), myeloid differentiation primary response gene 88 (MYD88) and kelch-like 6 (KLHL6). Mutations in MYD88 and KLHL6 are predominant in cases of CLL with mutated immunoglobulin genes, whereas NOTCH1 and XPO1 mutations are mainly detected in patients with unmutated immunoglobulins. The patterns of somatic mutation, supported by functional and clinical analyses, strongly indicate that the recurrent NOTCH1, MYD88 and XPO1 mutations are oncogenic changes that contribute to the clinical evolution of the disease. To our knowledge, this is the first comprehensive analysis of CLL combining whole-genome sequencing with clinical characteristics and clinical outcomes. It highlights the usefulness of this approach for the identification of clinically relevant mutations in cancer. PMID:21642962
Directory of Open Access Journals (Sweden)
Ali Saber
Full Text Available ALK-break positive non-small cell lung cancer (NSCLC patients initially respond to crizotinib, but resistance occurs inevitably. In this study we aimed to identify fusion genes in crizotinib resistant tumor samples. Re-biopsies of three patients were subjected to paired-end RNA sequencing to identify fusion genes using deFuse and EricScript. The IGV browser was used to determine presence of known resistance-associated mutations. Sanger sequencing was used to validate fusion genes and digital droplet PCR to validate mutations. ALK fusion genes were detected in all three patients with EML4 being the fusion partner. One patient had no additional fusion genes. Another patient had one additional fusion gene, but without a predicted open reading frame (ORF. The third patient had three additional fusion genes, of which two were derived from the same chromosomal region as the EML4-ALK. A predicted ORF was identified only in the CLIP4-VSNL1 fusion product. The fusion genes validated in the post-treatment sample were also present in the biopsy before crizotinib. ALK mutations (p.C1156Y and p.G1269A detected in the re-biopsies of two patients, were not detected in pre-treatment biopsies. In conclusion, fusion genes identified in our study are unlikely to be involved in crizotinib resistance based on presence in pre-treatment biopsies. The detection of ALK mutations in post-treatment tumor samples of two patients underlines their role in crizotinib resistance.
Directory of Open Access Journals (Sweden)
Chuphong Thongnak
2018-01-01
Full Text Available Autism spectrum disorder (ASD has a strong genetic basis, although the genetics of autism is complex and it is unclear. Genetic testing such as microarray or sequencing was widely used to identify autism markers, but they are unsuccessful in several cases. The objective of this study is to identify causative variants of autism in two Thai families by using whole-exome sequencing technique. Whole-exome sequencing was performed with autism-affected children from two unrelated families. Each sample was sequenced on SOLiD 5500xl Genetic Analyzer system followed by combined bioinformatics pipeline including annotation and filtering process to identify candidate variants. Candidate variants were validated, and the segregation study with other family members was performed using Sanger sequencing. This study identified a possible causative variant for ASD, c.2951G>A, in the FGD6 gene. We demonstrated the potential for ASD genetic variants associated with ASD using whole-exome sequencing and a bioinformatics filtering procedure. These techniques could be useful in identifying possible causative ASD variants, especially in cases in which variants cannot be identified by other techniques.
PCR-RFLP diagnostic method for identifying Globodera species in Slovenia
Directory of Open Access Journals (Sweden)
Sasa ŠIRCA
2011-01-01
Full Text Available Species identification within the genus Globodera is based on the morphological and morphometrical characters of the cysts and second stage juveniles, and these are included in the majority of identification keys. Morphometrical methods are fast and can be applied to most of samples but they demand a trained and experienced specialist. Furthermore, some morphometrical characters may overlap between populations and beetwen species, leading to inaccurate identification. To confirm and complement the morphometrical identification of Globodera species molecular methods have been developed. Sequences of the internal transcribed spacer regions ITS1 and ITS2 of the rDNA gene cluster proved to be useful for identifying nematode species identification. A PCR-RFLP molecular method was used to identify Globodera rostochiensis, G. pallida, G. tabacum and G. achilleae. Globodera rostochiensis, G. pallida, G. tabacum and G. achilleae can be distinguished with PCR-RFLP analysis of the rDNA ITS fragment using five restriction enzymes. The RFLP patterns of G. rostochiensis, G. tabacum and G. achilleae were species-specific, while those of G. pallida varied. South American populations of G. pallida differed from other populations as their RFLP patterns were demonstrated to be distinct by in silico restriction of the ITS sequences deposited at NCBI.
Molecular defects identified by whole exome sequencing in a child with Fanconi anemia.
Zheng, Zhaojing; Geng, Juan; Yao, Ru-En; Li, Caihua; Ying, Daming; Shen, Yongnian; Ying, Lei; Yu, Yongguo; Fu, Qihua
2013-11-10
Fanconi anemia is a rare genetic disease characterized by bone marrow failure, multiple congenital malformations, and an increased susceptibility to malignancy. At least 15 genes have been identified that are involved in the pathogenesis of Fanconi anemia. However, it is still a challenge to assign the complementation group and to characterize the molecular defects in patients with Fanconi anemia. In the current study, whole exome sequencing was used to identify the affected gene(s) in a boy with Fanconi anemia. A recurring, non-synonymous mutation was found (c.3971C>T, p.P1324L) as well as a novel frameshift mutation (c.989_995del, p.H330LfsX2) in FANCA gene. Our results indicate that whole exome sequencing may be useful in clinical settings for rapid identification of disease-causing mutations in rare genetic disorders such as Fanconi anemia. © 2013 Elsevier B.V. All rights reserved.
MetaPhinder-Identifying Bacteriophage Sequences in Metagenomic Data Sets
DEFF Research Database (Denmark)
Jurtz, Vanessa Isabell; Villarroel, Julia; Lund, Ole
2016-01-01
genome structure of many bacteriophages. The method is demonstrated to outperform both BLAST methods based on single hits and methods based on k-mer comparisons. MetaPhinder is available as a web service at the Center for Genomic Epidemiology https://cge.cbs.dtu.dk/services/MetaPhinder/, while the source...... and understand them. Here we present MetaPhinder, a method to identify assembled genomic fragments (i.e. contigs) of phage origin in metage-nomic data sets. The method is based on a comparison to a database of whole genome bacteriophage sequences, integrating hits to multiple genomes to accomodate for the mosaic...... code can be downloaded from https://bitbucket.org/genomicepidemiology/metaphinder or https://github.com/vanessajurtz/MetaPhinder....
Exome sequencing identifies three novel candidate genes implicated in intellectual disability.
Directory of Open Access Journals (Sweden)
Zehra Agha
Full Text Available Intellectual disability (ID is a major health problem mostly with an unknown etiology. Recently exome sequencing of individuals with ID identified novel genes implicated in the disease. Therefore the purpose of the present study was to identify the genetic cause of ID in one syndromic and two non-syndromic Pakistani families. Whole exome of three ID probands was sequenced. Missense variations in two plausible novel genes implicated in autosomal recessive ID were identified: lysine (K-specific methyltransferase 2B (KMT2B, zinc finger protein 589 (ZNF589, as well as hedgehog acyltransferase (HHAT with a de novo mutation with autosomal dominant mode of inheritance. The KMT2B recessive variant is the first report of recessive Kleefstra syndrome-like phenotype. Identification of plausible causative mutations for two recessive and a dominant type of ID, in genes not previously implicated in disease, underscores the large genetic heterogeneity of ID. These results also support the viewpoint that large number of ID genes converge on limited number of common networks i.e. ZNF589 belongs to KRAB-domain zinc-finger proteins previously implicated in ID, HHAT is predicted to affect sonic hedgehog, which is involved in several disorders with ID, KMT2B associated with syndromic ID fits the epigenetic module underlying the Kleefstra syndromic spectrum. The association of these novel genes in three different Pakistani ID families highlights the importance of screening these genes in more families with similar phenotypes from different populations to confirm the involvement of these genes in pathogenesis of ID.
Ieda, Shinsuke; Moriyama, Masafumi; Takeshita, Toru; Takashita, Toru; Maehara, Takashi; Imabayashi, Yumi; Shinozaki, Shoichi; Tanaka, Akihiko; Hayashida, Jun-Nosuke; Furukawa, Sachiko; Ohta, Miho; Yamashita, Yoshihisa; Nakamura, Seiji
2014-01-01
Oral candidiasis is closely associated with changes in the oral fungal flora and is caused primarily by Candida albicans. Conventional methods of fungal culture are time-consuming and not always conclusive. However, molecular genetic analysis of internal transcribed spacer (ITS) regions of fungal rRNA is rapid, reproducible and simple to perform. In this study we examined the fungal flora in patients with oral candidiasis and investigated changes in the flora after antifungal treatment using length heterogeneity-polymerization chain reaction (LH-PCR) analysis of ITS regions. Fifty-two patients with pseudomembranous oral candidiasis (POC) and 30 healthy controls were included in the study. Fungal DNA from oral rinse was examined for fungal species diversity by LH-PCR. Fungal populations were quantified by real-time PCR and previously-unidentified signals were confirmed by nucleotide sequencing. Relationships between the oral fungal flora and treatment-resistant factors were also examined. POC patients showed significantly more fungal species and a greater density of fungi than control individuals. Sixteen fungi were newly identified. The fungal populations from both groups were composed predominantly of C. albicans, though the ratio of C. dubliniensis was significantly higher in POC patients than in controls. The diversity and density of fungi were significantly reduced after treatment. Furthermore, fungal diversity and the proportion of C. dubliniensis were positively correlated with treatment duration. These results suggest that C. dubliniensis and high fungal flora diversity might be involved in the pathogenesis of oral candidiasis. We therefore conclude that LH-PCR is a useful technique for diagnosing and assessing the severity of oral candidal infection.
Novel expressed sequences identified in a model of androgen independent prostate cancer
Directory of Open Access Journals (Sweden)
Jones Steven JM
2007-01-01
Full Text Available Abstract Background Prostate cancer is the most frequently diagnosed cancer in American men, and few effective treatment options are available to patients who develop hormone-refractory prostate cancer. The molecular changes that occur to allow prostate cells to proliferate in the absence of androgens are not fully understood. Results Subtractive hybridization experiments performed with samples from an in vivo model of hormonal progression identified 25 expressed sequences representing novel human transcripts. Intriguingly, these 25 sequences have small open-reading frames and are not highly conserved through evolution, suggesting many of these novel expressed sequences may be derived from untranslated regions of novel transcripts or from non-coding transcripts. Examination of a large metalibrary of human Serial Analysis of Gene Expression (SAGE tags demonstrated that only three of these novel sequences had been previously detected. RT-PCR experiments confirmed that the 6 sequences tested were expressed in specific human tissues, as well as in clinical samples of prostate cancer. Further RT-PCR experiments for five of these fragments indicated they originated from large untranslated regions of unannotated transcripts. Conclusion This study underlines the value of using complementary techniques in the annotation of the human genome. The tissue-specific expression of 4 of the 6 clones tested indicates the expression of these novel transcripts is tightly regulated, and future work will determine the possible role(s these novel transcripts may play in the progression of prostate cancer.
Belagal, Praveen; Normand, Christophe; Shukla, Ashutosh; Wang, Renjie; Léger-Silvestre, Isabelle; Dez, Christophe; Bhargava, Purnima; Gadal, Olivier
2016-01-01
The association of RNA polymerase III (Pol III)–transcribed genes with nucleoli seems to be an evolutionarily conserved property of the spatial organization of eukaryotic genomes. However, recent studies of global chromosome architecture in budding yeast have challenged this view. We used live-cell imaging to determine the intranuclear positions of 13 Pol III–transcribed genes. The frequency of association with nucleolus and nuclear periphery depends on linear genomic distance from the tethering elements—centromeres or telomeres. Releasing the hold of the tethering elements by inactivating centromere attachment to the spindle pole body or changing the position of ribosomal DNA arrays resulted in the association of Pol III–transcribed genes with nucleoli. Conversely, ectopic insertion of a Pol III–transcribed gene in the vicinity of a centromere prevented its association with nucleolus. Pol III–dependent transcription was independent of the intranuclear position of the gene, but the nucleolar recruitment of Pol III–transcribed genes required active transcription. We conclude that the association of Pol III–transcribed genes with the nucleolus, when permitted by global chromosome architecture, provides nucleolar and/or nuclear peripheral anchoring points contributing locally to intranuclear chromosome organization. PMID:27559135
X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes
Hu, H.; Haas, S.A.; Chelly, J.; Van Esch, H.; Raynaud, M.; de Brouwer, A.P.M.; Weinert, S.; Froyen, G.; Frints, S.G.M.; Laumonnier, F.; Zemojtel, T.; Love, M.I.; Richard, H.; Emde, A.K.; Bienek, M.
2016-01-01
X-linked intellectual disability (XLID) is a clinically and genetically heterogeneous disorder. During the past two decades in excess of 100 X-chromosome ID genes have been identified. Yet, a large number of families mapping to the X-chromosome remained unresolved suggesting that more XLID genes or loci are yet to be identified. Here, we have investigated 405 unresolved families with XLID. We employed massively parallel sequencing of all X-chromosome exons in the index males. The majority of ...
Thoendel, Matthew; Jeraldo, Patricio; Greenwood-Quaintance, Kerryl E; Chia, Nicholas; Abdel, Matthew P; Steckelberg, James M; Osmon, Douglas R; Patel, Robin
2017-07-15
Defining the microbial etiology of culture-negative prosthetic joint infection (PJI) can be challenging. Metagenomic shotgun sequencing is a new tool to identify organisms undetected by conventional methods. We present a case where metagenomics was used to identify Mycoplasma salivarium as a novel PJI pathogen in a patient with hypogammaglobulinemia. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.
Transcribed enhancers lead waves of coordinated transcription in transitioning mammalian cells
DEFF Research Database (Denmark)
Arner, Erik; Daub, Carsten O.; Vitting-Seerup, Kristoffer
2015-01-01
Although it is generally accepted that cellular differentiation requires changes to transcriptional networks, dynamic regulation of promoters and enhancers at specific sets of genes has not been previously studied en masse. Exploiting the fact that active promoters and enhancers are transcribed, ...
Rodriguez-Flores, Juan L.; Fakhro, Khalid; Hackett, Neil R.; Salit, Jacqueline; Fuller, Jennifer; Agosto-Perez, Francisco; Gharbiah, Maey; Malek, Joel A.; Zirie, Mahmoud; Jayyousi, Amin; Badii, Ramin; Al-Marri, Ajayeb Al-Nabet; Chouchane, Lotfi; Stadler, Dora J.; Hunter-Zinck, Haley; Mezey, Jason G.; Crystal, Ronald G.
2013-01-01
Exome sequencing of families of related individuals has been highly successful in identifying genetic polymorphisms responsible for Mendelian disorders. Here, we demonstrate the value of the reverse approach, where we use exome sequencing of a sample of unrelated individuals to analyze allele frequencies of known causal mutations for Mendelian diseases. We sequenced the exomes of 100 individuals representing the three major genetic subgroups of the Qatari population (Q1 Bedouin, Q2 Persian-South Asian, Q3 African) and identified 37 variants in 33 genes with effects on 36 clinically significant Mendelian diseases. These include variants not present in 1000 Genomes and variants at high frequency when compared to 1000 Genomes populations. Several of these Mendelian variants were only segregating in one Qatari subpopulation, where the observed subpopulation specificity trends were confirmed in an independent population of 386 Qataris. Pre-marital genetic screening in Qatar tests for only 4 out of the 37, such that this study provides a set of Mendelian disease variants with potential impact on the epidemiological profile of the population that could be incorporated into the testing program if further experimental and clinical characterization confirms high penetrance. PMID:24123366
Pangrazio, Alessandra; Puddu, Alessandro; Oppo, Manuela; Valentini, Maria; Zammataro, Luca; Vellodi, Ashok; Gener, Blanca; Llano-Rivas, Isabel; Raza, Jamal; Atta, Irum; Vezzoni, Paolo; Superti-Furga, Andrea; Villa, Anna; Sobacchi, Cristina
2014-01-01
Autosomal Recessive Osteopetrosis is a genetic disorder characterized by increased bone density due to lack of resorption by the osteoclasts. Genetic studies have widely unraveled the molecular basis of the most severe forms, while cases of intermediate severity are more difficult to characterize, probably because of a large heterogeneity. Here, we describe the use of exome sequencing in the molecular diagnosis of 2 siblings initially thought to be affected by “intermediate osteopetrosis”, which identified a homozygous mutation in the CTSK gene. Prompted by this finding, we tested by Sanger sequencing 25 additional patients addressed to us for recessive osteopetrosis and found CTSK mutations in 4 of them. In retrospect, their clinical and radiographic features were found to be compatible with, but not typical for, Pycnodysostosis. We sought to identify modifier genes that might have played a role in the clinical manifestation of the disease in these patients, but our results were not informative. In conclusion, we underline the difficulties of differential diagnosis in some patients whose clinical appearance does not fit the classical malignant or benign picture and recommend that CTSK gene be included in the molecular diagnosis of high bone density conditions. PMID:24269275
Amor, Nabil; Halajian, Ali; Farjallah, Sarra; Merella, Paolo; Said, Khaled; Ben Slimane, Badreddine
2011-07-01
Fasciolosis caused by Fasciola spp. (Platyhelminthes: Trematoda: Digenea) is considered as the most important helminth infection of ruminants in tropical countries, causing considerable socioeconomic problems. In the endemic regions of the North of Iran, Fasciola hepatica and Fasciola gigantica have been previously characterized on the basis of morphometric differences, but the use of molecular markers is necessary to distinguish exactly between species and intermediate forms. Samples from buffaloes and goats from different localities of northern Iran were identified morphologically and then genetically characterized by sequences of the first (ITS-1) and second (ITS-2) Internal Transcribed Spacers (ITS) of nuclear ribosomal DNA (rDNA). Comparison of the ITS of the northern Iranian samples with sequences of Fasciola spp. from GenBank showed that the examined specimens had sequences identical to those of the most frequent haplotypes of F. hepatica (n=25, 48.1%) and F. gigantica (n=20, 38.45%), which differed from each other in different variable nucleotide positions of ITS region sequences, and their intermediate forms (n=7, 13.45%), which had nucleotides overlapped between the two Fasciola species in all the positions. The ITS sequences from populations of Fasciola isolates in buffaloes and goats had experienced introgression/hybridization as previously reported in isolates from other ruminants and humans. Based on ITS-1 and ITS-2 sequences, flukes are scattered in pure F. hepatica, F. gigantica and intermediate Fasciola clades, revealing that multiple genotypes of Fasciola are able to infect goats and buffaloes in North of Iran. Furthermore, the phylogenetic trees based upon the ITS-1 and ITS-2 sequences showed a close relationship of the Iranian samples with isolates of F. hepatica and F. gigantica from different localities of Africa and Asia. In the present study, the intergenic transcribed spacers ITS-1 and ITS-2 showed to be reliable approaches for the genetic
Introduction of in vitro transcribed ENO1 mRNA into neuroblastoma cells induces cell death
International Nuclear Information System (INIS)
Ejeskär, Katarina; Krona, Cecilia; Carén, Helena; Zaibak, Faten; Li, Lingli; Martinsson, Tommy; Ioannou, Panayiotis A
2005-01-01
Neuroblastoma is a solid tumour of childhood often with an unfavourable outcome. One common genetic feature in aggressive tumours is 1p-deletion. The α-enolase (ENO1) gene is located in chromosome region 1p36.2, within the common region of deletion in neuroblastoma. One alternative translated product of the ENO1 gene, known as MBP-1, acts as a negative regulator of the c-myc oncogene, making the ENO1 gene a candidate as a tumour suppressor gene. Methods used in this study are transfection of cDNA-vectors and in vitro transcribed mRNA, cell growth assay, TUNEL-assay, real-time RT-PCR (TaqMan) for expression studies, genomic sequencing and DHPLC for mutation detection. Here we demonstrate that transfection of ENO1 cDNA into 1p-deleted neuroblastoma cell lines causes' reduced number of viable cells over time compared to a negative control and that it induces apoptosis. Interestingly, a similar but much stronger dose-dependent reduction of cell growth was observed by transfection of in vitro transcribed ENO1 mRNA into neuroblastoma cells. These effects could also be shown in non-neuroblastoma cells (293-cells), indicating ENO1 to have general tumour suppressor activity. Expression of ENO1 is detectable in primary neuroblastomas of all different stages and no difference in the level of expression can be detected between 1p-deleted and 1p-intact tumour samples. Although small numbers (11 primary neuroblastomas), there is some evidence that Stage 4 tumours has a lower level of ENO1-mRNA than Stage 2 tumours (p = 0.01). However, mutation screening of 44 primary neuroblastomas of all different stages, failed to detect any mutations. Our studies indicate that ENO1 has tumour suppressor activity and that high level of ENO1 expression has growth inhibitory effects
Supervised Sequence Labelling with Recurrent Neural Networks
Graves, Alex
2012-01-01
Supervised sequence labelling is a vital area of machine learning, encompassing tasks such as speech, handwriting and gesture recognition, protein secondary structure prediction and part-of-speech tagging. Recurrent neural networks are powerful sequence learning tools—robust to input noise and distortion, able to exploit long-range contextual information—that would seem ideally suited to such problems. However their role in large-scale sequence labelling systems has so far been auxiliary. The goal of this book is a complete framework for classifying and transcribing sequential data with recurrent neural networks only. Three main innovations are introduced in order to realise this goal. Firstly, the connectionist temporal classification output layer allows the framework to be trained with unsegmented target sequences, such as phoneme-level speech transcriptions; this is in contrast to previous connectionist approaches, which were dependent on error-prone prior segmentation. Secondly, multidimensional...
Nuclear RNA sequencing of the mouse erythroid cell transcriptome.
Directory of Open Access Journals (Sweden)
Jennifer A Mitchell
Full Text Available In addition to protein coding genes a substantial proportion of mammalian genomes are transcribed. However, most transcriptome studies investigate steady-state mRNA levels, ignoring a considerable fraction of the transcribed genome. In addition, steady-state mRNA levels are influenced by both transcriptional and posttranscriptional mechanisms, and thus do not provide a clear picture of transcriptional output. Here, using deep sequencing of nuclear RNAs (nucRNA-Seq in parallel with chromatin immunoprecipitation sequencing (ChIP-Seq of active RNA polymerase II, we compared the nuclear transcriptome of mouse anemic spleen erythroid cells with polymerase occupancy on a genome-wide scale. We demonstrate that unspliced transcripts quantified by nucRNA-seq correlate with primary transcript frequencies measured by RNA FISH, but differ from steady-state mRNA levels measured by poly(A-enriched RNA-seq. Highly expressed protein coding genes showed good correlation between RNAPII occupancy and transcriptional output; however, genome-wide we observed a poor correlation between transcriptional output and RNAPII association. This poor correlation is due to intergenic regions associated with RNAPII which correspond with transcription factor bound regulatory regions and a group of stable, nuclear-retained long non-coding transcripts. In conclusion, sequencing the nuclear transcriptome provides an opportunity to investigate the transcriptional landscape in a given cell type through quantification of unspliced primary transcripts and the identification of nuclear-retained long non-coding RNAs.
Mark, Kristiina; Cornejo, Carolina; Keller, Christine; Flück, Daniela; Scheidegger, Christoph
2016-09-01
Although lichens (lichen-forming fungi) play an important role in the ecological integrity of many vulnerable landscapes, only a minority of lichen-forming fungi have been barcoded out of the currently accepted ∼18 000 species. Regular Sanger sequencing can be problematic when analyzing lichens since saprophytic, endophytic, and parasitic fungi live intimately admixed, resulting in low-quality sequencing reads. Here, high-throughput, long-read 454 pyrosequencing in a GS FLX+ System was tested to barcode the fungal partner of 100 epiphytic lichen species from Switzerland using fungal-specific primers when amplifying the full internal transcribed spacer region (ITS). The present study shows the potential of DNA barcoding using pyrosequencing, in that the expected lichen fungus was successfully sequenced for all samples except one. Alignment solutions such as BLAST were found to be largely adequate for the generated long reads. In addition, the NCBI nucleotide database-currently the most complete database for lichen-forming fungi-can be used as a reference database when identifying common species, since the majority of analyzed lichens were identified correctly to the species or at least to the genus level. However, several issues were encountered, including a high sequencing error rate, multiple ITS versions in a genome (incomplete concerted evolution), and in some samples the presence of mixed lichen-forming fungi (possible lichen chimeras).
Huang, Xiao-Yan; Zhuang, Hong; Wu, Ji-Hong; Li, Jian-Kang; Hu, Fang-Yuan; Zheng, Yu; Tellier, Laurent Christian Asker M.; Zhang, Sheng-Hai; Gao, Feng-Juan; Zhang, Jian-Guo
2017-01-01
Purpose Familial exudative vitreoretinopathy (FEVR) is a genetically and clinically heterogeneous disease, characterized by failure of vascular development of the peripheral retina. The symptoms of FEVR vary widely among patients in the same family, and even between the two eyes of a given patient. This study was designed to identify the genetic defect in a patient cohort of ten Chinese families with a definitive diagnosis of FEVR. Methods To identify the causative gene, next-generation sequencing (NGS)-based target capture sequencing was performed. Segregation analysis of the candidate variant was performed in additional family members by using Sanger sequencing and quantitative real-time PCR (QPCR). Results Of the cohort of ten FEVR families, six pathogenic variants were identified, including four novel and two known heterozygous mutations. Of the variants identified, four were missense variants, and two were novel heterozygous deletion mutations [LRP5, c.4053 DelC (p.Ile1351IlefsX88); TSPAN12, EX8Del]. The two novel heterozygous deletion mutations were not observed in the control subjects and could give rise to a relatively severe FEVR phenotype, which could be explained by the protein function prediction. Conclusions We identified two novel heterozygous deletion mutations [LRP5, c.4053 DelC (p.Ile1351IlefsX88); TSPAN12, EX8Del] using targeted NGS as a causative mutation for FEVR. These genetic deletion variations exhibit a severe form of FEVR, with tractional retinal detachments compared with other known point mutations. The data further enrich the mutation spectrum of FEVR and enhance our understanding of genotype–phenotype correlations to provide useful information for disease diagnosis, prognosis, and effective genetic counseling. PMID:28867931
X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes.
Hu, H; Haas, S A; Chelly, J; Van Esch, H; Raynaud, M; de Brouwer, A P M; Weinert, S; Froyen, G; Frints, S G M; Laumonnier, F; Zemojtel, T; Love, M I; Richard, H; Emde, A-K; Bienek, M; Jensen, C; Hambrock, M; Fischer, U; Langnick, C; Feldkamp, M; Wissink-Lindhout, W; Lebrun, N; Castelnau, L; Rucci, J; Montjean, R; Dorseuil, O; Billuart, P; Stuhlmann, T; Shaw, M; Corbett, M A; Gardner, A; Willis-Owen, S; Tan, C; Friend, K L; Belet, S; van Roozendaal, K E P; Jimenez-Pocquet, M; Moizard, M-P; Ronce, N; Sun, R; O'Keeffe, S; Chenna, R; van Bömmel, A; Göke, J; Hackett, A; Field, M; Christie, L; Boyle, J; Haan, E; Nelson, J; Turner, G; Baynam, G; Gillessen-Kaesbach, G; Müller, U; Steinberger, D; Budny, B; Badura-Stronka, M; Latos-Bieleńska, A; Ousager, L B; Wieacker, P; Rodríguez Criado, G; Bondeson, M-L; Annerén, G; Dufke, A; Cohen, M; Van Maldergem, L; Vincent-Delorme, C; Echenne, B; Simon-Bouy, B; Kleefstra, T; Willemsen, M; Fryns, J-P; Devriendt, K; Ullmann, R; Vingron, M; Wrogemann, K; Wienker, T F; Tzschach, A; van Bokhoven, H; Gecz, J; Jentsch, T J; Chen, W; Ropers, H-H; Kalscheuer, V M
2016-01-01
X-linked intellectual disability (XLID) is a clinically and genetically heterogeneous disorder. During the past two decades in excess of 100 X-chromosome ID genes have been identified. Yet, a large number of families mapping to the X-chromosome remained unresolved suggesting that more XLID genes or loci are yet to be identified. Here, we have investigated 405 unresolved families with XLID. We employed massively parallel sequencing of all X-chromosome exons in the index males. The majority of these males were previously tested negative for copy number variations and for mutations in a subset of known XLID genes by Sanger sequencing. In total, 745 X-chromosomal genes were screened. After stringent filtering, a total of 1297 non-recurrent exonic variants remained for prioritization. Co-segregation analysis of potential clinically relevant changes revealed that 80 families (20%) carried pathogenic variants in established XLID genes. In 19 families, we detected likely causative protein truncating and missense variants in 7 novel and validated XLID genes (CLCN4, CNKSR2, FRMPD4, KLHL15, LAS1L, RLIM and USP27X) and potentially deleterious variants in 2 novel candidate XLID genes (CDK16 and TAF1). We show that the CLCN4 and CNKSR2 variants impair protein functions as indicated by electrophysiological studies and altered differentiation of cultured primary neurons from Clcn4(-/-) mice or after mRNA knock-down. The newly identified and candidate XLID proteins belong to pathways and networks with established roles in cognitive function and intellectual disability in particular. We suggest that systematic sequencing of all X-chromosomal genes in a cohort of patients with genetic evidence for X-chromosome locus involvement may resolve up to 58% of Fragile X-negative cases.
Because less than one-third of clinically relevant fusaria can be accurately identified to species level using phenotypic data (i.e., morphological species recognition), we constructed a three-locus DNA sequence database to facilitate molecular identification of the 69 Fusarium species associated wi...
Schwab, Stefan; Souza, Emanuel M; Yates, Marshall G; Persuhn, Darlene C; Steffens, M Berenice R; Chubatsu, Leda S; Pedrosa, Fábio O; Rigo, Liu U
2007-01-01
Herbaspirillum seropedicae is an endophytic bacterium that fixes nitrogen under microaerophilic conditions. The putative promoter sequences glnAp1 (sigma70-dependent) and glnAp2 (sigma54), and two NtrC-binding sites were identified upstream from the glnA, ntrB and ntrC genes of this microorganism. To study their transcriptional regulation, we used lacZ fusions to the H. seropedicae glnA gene, and the glnA-ntrB and ntrB-ntrC intergenic regions. Expression of glnA was up-regulated under low ammonium, but no transcription activity was detected from the intergenic regions under any condition tested, suggesting that glnA, ntrB and ntrC are co-transcribed from the promoters upstream of glnA. Ammonium regulation was lost in the ntrC mutant strain. A point mutation was introduced in the conserved -25/-24 dinucleotide (GG-->TT) of the putative sigma54-dependent promoter (glnAp2). Contrary to the wild-type promoter, glnA expression with the mutant glnAp2 promoter was repressed in the wild-type strain under low ammonium levels, but this repression was abolished in an ntrC background. Together our results indicate that the H. seropedicae glnAntrBC operon is regulated from two functional promoters upstream from glnA, which are oppositely regulated by the NtrC protein.
Su, Lei; Zhang, Qianqian; Gong, Jun
2017-07-01
Peritrich ciliates are highly diverse and can be important bacterial grazers in aquatic ecosystems. Morphological identifications of peritrich species and assemblages in the environment are time-consuming and expertise-demanding. In this study, two peritrich-specific PCR primers were newly designed to amplify a fragment including the internal transcribed spacer (ITS) region of ribosomal rDNA from environmental samples. The primers showed high specificity in silico, and in tests with peritrich isolates and environmental DNA. Application of these primers in clone library construction and sequencing yielded exclusively sequences of peritrichs for water and sediment samples. We also found the ITS1, ITS2, ITS, D1 region of 28S rDNA, and ITS+D1 region co-varied with, and generally more variable than, the V9 region of 18S rDNA in peritrichs. The newly designed specific primers thus provide additional tools to study the molecular diversity, community composition, and phylogeography of these ecologically important protists in different systems.
Pangrazio, Alessandra; Puddu, Alessandro; Oppo, Manuela; Valentini, Maria; Zammataro, Luca; Vellodi, Ashok; Gener, Blanca; Llano-Rivas, Isabel; Raza, Jamal; Atta, Irum; Vezzoni, Paolo; Superti-Furga, Andrea; Villa, Anna; Sobacchi, Cristina
2014-02-01
Autosomal Recessive Osteopetrosis is a genetic disorder characterized by increased bone density due to lack of resorption by the osteoclasts. Genetic studies have widely unraveled the molecular basis of the most severe forms, while cases of intermediate severity are more difficult to characterize, probably because of a large heterogeneity. Here, we describe the use of exome sequencing in the molecular diagnosis of 2 siblings initially thought to be affected by "intermediate osteopetrosis", which identified a homozygous mutation in the CTSK gene. Prompted by this finding, we tested by Sanger sequencing 25 additional patients addressed to us for recessive osteopetrosis and found CTSK mutations in 4 of them. In retrospect, their clinical and radiographic features were found to be compatible with, but not typical for, Pycnodysostosis. We sought to identify modifier genes that might have played a role in the clinical manifestation of the disease in these patients, but our results were not informative. In conclusion, we underline the difficulties of differential diagnosis in some patients whose clinical appearance does not fit the classical malignant or benign picture and recommend that CTSK gene be included in the molecular diagnosis of high bone density conditions. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.
Greub, Gilbert; Kebbi-Beghdadi, Carole; Bertelli, Claire; Collyn, François; Riederer, Beat M; Yersin, Camille; Croxatto, Antony; Raoult, Didier
2009-12-23
With the availability of new generation sequencing technologies, bacterial genome projects have undergone a major boost. Still, chromosome completion needs a costly and time-consuming gap closure, especially when containing highly repetitive elements. However, incomplete genome data may be sufficiently informative to derive the pursued information. For emerging pathogens, i.e. newly identified pathogens, lack of release of genome data during gap closure stage is clearly medically counterproductive. We thus investigated the feasibility of a dirty genome approach, i.e. the release of unfinished genome sequences to develop serological diagnostic tools. We showed that almost the whole genome sequence of the emerging pathogen Parachlamydia acanthamoebae was retrieved even with relatively short reads from Genome Sequencer 20 and Solexa. The bacterial proteome was analyzed to select immunogenic proteins, which were then expressed and used to elaborate the first steps of an ELISA. This work constitutes the proof of principle for a dirty genome approach, i.e. the use of unfinished genome sequences of pathogenic bacteria, coupled with proteomics to rapidly identify new immunogenic proteins useful to develop in the future specific diagnostic tests such as ELISA, immunohistochemistry and direct antigen detection. Although applied here to an emerging pathogen, this combined dirty genome sequencing/proteomic approach may be used for any pathogen for which better diagnostics are needed. These genome sequences may also be very useful to develop DNA based diagnostic tests. All these diagnostic tools will allow further evaluations of the pathogenic potential of this obligate intracellular bacterium.
Differential Reading, Naming, and Transcribing Speeds of Japanese Romaji and Hiragana
Yamada, Jun; Leong, Che Kan
2005-01-01
The morpho-syllabic Japanese writing system consists of the phonetic scripts of hiragana and katakana, the logographic kanji derived from Chinese characters and the less well researched romaji based on the Roman alphabet. In four experiments we investigated the speed with which Japanese college students read, named, and transcribed romaji as…
Identification and analysis of pig chimeric mRNAs using RNA sequencing data
2012-01-01
Background Gene fusion is ubiquitous over the course of evolution. It is expected to increase the diversity and complexity of transcriptomes and proteomes through chimeric sequence segments or altered regulation. However, chimeric mRNAs in pigs remain unclear. Here we identified some chimeric mRNAs in pigs and analyzed the expression of them across individuals and breeds using RNA-sequencing data. Results The present study identified 669 putative chimeric mRNAs in pigs, of which 251 chimeric candidates were detected in a set of RNA-sequencing data. The 618 candidates had clear trans-splicing sites, 537 of which obeyed the canonical GU-AG splice rule. Only two putative pig chimera variants whose fusion junction was overlapped with that of a known human chimeric mRNA were found. A set of unique chimeric events were considered middle variances in the expression across individuals and breeds, and revealed non-significant variance between sexes. Furthermore, the genomic region of the 5′ partner gene shares a similar DNA sequence with that of the 3′ partner gene for 458 putative chimeric mRNAs. The 81 of those shared DNA sequences significantly matched the known DNA-binding motifs in the JASPAR CORE database. Four DNA motifs shared in parental genomic regions had significant similarity with known human CTCF binding sites. Conclusions The present study provided detailed information on some pig chimeric mRNAs. We proposed a model that trans-acting factors, such as CTCF, induced the spatial organisation of parental genes to the same transcriptional factory so that parental genes were coordinatively transcribed to give birth to chimeric mRNAs. PMID:22925561
Identification and analysis of pig chimeric mRNAs using RNA sequencing data
Directory of Open Access Journals (Sweden)
Ma Lei
2012-08-01
Full Text Available Abstract Background Gene fusion is ubiquitous over the course of evolution. It is expected to increase the diversity and complexity of transcriptomes and proteomes through chimeric sequence segments or altered regulation. However, chimeric mRNAs in pigs remain unclear. Here we identified some chimeric mRNAs in pigs and analyzed the expression of them across individuals and breeds using RNA-sequencing data. Results The present study identified 669 putative chimeric mRNAs in pigs, of which 251 chimeric candidates were detected in a set of RNA-sequencing data. The 618 candidates had clear trans-splicing sites, 537 of which obeyed the canonical GU-AG splice rule. Only two putative pig chimera variants whose fusion junction was overlapped with that of a known human chimeric mRNA were found. A set of unique chimeric events were considered middle variances in the expression across individuals and breeds, and revealed non-significant variance between sexes. Furthermore, the genomic region of the 5′ partner gene shares a similar DNA sequence with that of the 3′ partner gene for 458 putative chimeric mRNAs. The 81 of those shared DNA sequences significantly matched the known DNA-binding motifs in the JASPAR CORE database. Four DNA motifs shared in parental genomic regions had significant similarity with known human CTCF binding sites. Conclusions The present study provided detailed information on some pig chimeric mRNAs. We proposed a model that trans-acting factors, such as CTCF, induced the spatial organisation of parental genes to the same transcriptional factory so that parental genes were coordinatively transcribed to give birth to chimeric mRNAs.
Milosevic Feenstra, Jelena D; Nivarthi, Harini; Gisslinger, Heinz; Leroy, Emilie; Rumi, Elisa; Chachoua, Ilyas; Bagienski, Klaudia; Kubesova, Blanka; Pietra, Daniela; Gisslinger, Bettina; Milanesi, Chiara; Jäger, Roland; Chen, Doris; Berg, Tiina; Schalling, Martin; Schuster, Michael; Bock, Christoph; Constantinescu, Stefan N; Cazzola, Mario; Kralovics, Robert
2016-01-21
Essential thrombocythemia (ET) and primary myelofibrosis (PMF) are chronic diseases characterized by clonal hematopoiesis and hyperproliferation of terminally differentiated myeloid cells. The disease is driven by somatic mutations in exon 9 of CALR or exon 10 of MPL or JAK2-V617F in >90% of the cases, whereas the remaining cases are termed "triple negative." We aimed to identify the disease-causing mutations in the triple-negative cases of ET and PMF by applying whole-exome sequencing (WES) on paired tumor and control samples from 8 patients. We found evidence of clonal hematopoiesis in 5 of 8 studied cases based on clonality analysis and presence of somatic genetic aberrations. WES identified somatic mutations in 3 of 8 cases. We did not detect any novel recurrent somatic mutations. In 3 patients with clonal hematopoiesis analyzed by WES, we identified a somatic MPL-S204P, a germline MPL-V285E mutation, and a germline JAK2-G571S variant. We performed Sanger sequencing of the entire coding region of MPL in 62, and of JAK2 in 49 additional triple-negative cases of ET or PMF. New somatic (T119I, S204F, E230G, Y591D) and 1 germline (R321W) MPL mutation were detected. All of the identified MPL mutations were gain-of-function when analyzed in functional assays. JAK2 variants were identified in 5 of 57 triple-negative cases analyzed by WES and Sanger sequencing combined. We could demonstrate that JAK2-V625F and JAK2-F556V are gain-of-function mutations. Our results suggest that triple-negative cases of ET and PMF do not represent a homogenous disease entity. Cases with polyclonal hematopoiesis might represent hereditary disorders. © 2016 by The American Society of Hematology.
Niu, Qingli; Marchand, Jordan; Yang, Congshan; Bonsergent, Claire; Guan, Guiquan; Yin, Hong; Malandrin, Laurence
2015-07-30
Sheep babesiosis occurs mainly in tropical and subtropical areas. The sheep parasite Babesia sp. Xinjiang is widespread in China, and our goal is to characterize rap-1 (rhoptry-associated protein 1) gene diversity and expression as a first step of a long term goal aiming at developing a recombinant subunit vaccine. Seven different rap-1a genes were amplified in Babesia sp. Xinjiang, using degenerate primers designed from conserved motifs. Rap-1b and rap-1c gene types could not be identified. In all seven rap-1a genes, the 5' regions exhibited identical sequences over 936 nt, and the 3' regions differed at 28 positions over 147 nt, defining two types of genes designated α and β. The remaining 3' part varied from 72 to 360 nt in length, depending on the gene. This region consists of a succession of two to ten 36 nt repeats, which explains the size differences. Even if the nucleotide sequences varied, 6 repeats encoded the same stretch of amino acids. Transcription of at least four α and two β genes was demonstrated by standard RT-PCR. Copyright © 2015 Elsevier B.V. All rights reserved.
Belagal, Praveen; Normand, Christophe; Shukla, Ashutosh; Wang, Renjie; Léger-Silvestre, Isabelle; Dez, Christophe; Bhargava, Purnima; Gadal, Olivier
2016-10-15
The association of RNA polymerase III (Pol III)-transcribed genes with nucleoli seems to be an evolutionarily conserved property of the spatial organization of eukaryotic genomes. However, recent studies of global chromosome architecture in budding yeast have challenged this view. We used live-cell imaging to determine the intranuclear positions of 13 Pol III-transcribed genes. The frequency of association with nucleolus and nuclear periphery depends on linear genomic distance from the tethering elements-centromeres or telomeres. Releasing the hold of the tethering elements by inactivating centromere attachment to the spindle pole body or changing the position of ribosomal DNA arrays resulted in the association of Pol III-transcribed genes with nucleoli. Conversely, ectopic insertion of a Pol III-transcribed gene in the vicinity of a centromere prevented its association with nucleolus. Pol III-dependent transcription was independent of the intranuclear position of the gene, but the nucleolar recruitment of Pol III-transcribed genes required active transcription. We conclude that the association of Pol III-transcribed genes with the nucleolus, when permitted by global chromosome architecture, provides nucleolar and/or nuclear peripheral anchoring points contributing locally to intranuclear chromosome organization. © 2016 Belagal et al. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).
Photobiont diversity in lichens from metal-rich substrata based on ITS rDNA sequences.
Backor, Martin; Peksa, Ondrej; Skaloud, Pavel; Backorová, Miriam
2010-05-01
The photobiont is considered as the more sensitive partner of lichen symbiosis in metal pollution. For this reason the presence of a metal tolerant photobiont in lichens may be a key factor of ecological success of lichens growing on metal polluted substrata. The photobiont inventory was examined for terricolous lichen community growing in Cu mine-spoil heaps derived by historical mining. Sequences of internal transcribed spacer (ITS) were phylogenetically analyzed using maximum likelihood analyses. A total of 50 ITS algal sequences were obtained from 22 selected lichen taxa collected at three Cu mine-spoil heaps and two control localities. Algae associated with Cladonia and Stereocaulon were identified as members of several Asterochloris lineages, photobionts of cetrarioid lichens clustered with Trebouxia hypogymniae ined. We did not find close relationship between heavy metal content (in localities as well as lichen thalli) and photobiont diversity. Presence of multiple algal genotypes in single lichen thallus has been confirmed. Copyright 2009 Elsevier Inc. All rights reserved.
Transcribing Gail Jefferson: The 1977 Boston talk as it actually was
DEFF Research Database (Denmark)
Nevile, Maurice Richard
2015-01-01
A talk by Gail Jefferson, one of the founders of Conversation Analysis, has been recently made available, and Maurice Nevile undertook to transcribe it for the benefit of the language-in-interaction community. Here he reports on what it meant to him, and what we can all get out of such a powerful...
Directory of Open Access Journals (Sweden)
Gilbert Greub
Full Text Available BACKGROUND: With the availability of new generation sequencing technologies, bacterial genome projects have undergone a major boost. Still, chromosome completion needs a costly and time-consuming gap closure, especially when containing highly repetitive elements. However, incomplete genome data may be sufficiently informative to derive the pursued information. For emerging pathogens, i.e. newly identified pathogens, lack of release of genome data during gap closure stage is clearly medically counterproductive. METHODS/PRINCIPAL FINDINGS: We thus investigated the feasibility of a dirty genome approach, i.e. the release of unfinished genome sequences to develop serological diagnostic tools. We showed that almost the whole genome sequence of the emerging pathogen Parachlamydia acanthamoebae was retrieved even with relatively short reads from Genome Sequencer 20 and Solexa. The bacterial proteome was analyzed to select immunogenic proteins, which were then expressed and used to elaborate the first steps of an ELISA. CONCLUSIONS/SIGNIFICANCE: This work constitutes the proof of principle for a dirty genome approach, i.e. the use of unfinished genome sequences of pathogenic bacteria, coupled with proteomics to rapidly identify new immunogenic proteins useful to develop in the future specific diagnostic tests such as ELISA, immunohistochemistry and direct antigen detection. Although applied here to an emerging pathogen, this combined dirty genome sequencing/proteomic approach may be used for any pathogen for which better diagnostics are needed. These genome sequences may also be very useful to develop DNA based diagnostic tests. All these diagnostic tools will allow further evaluations of the pathogenic potential of this obligate intracellular bacterium.
Directory of Open Access Journals (Sweden)
Liang Cheng
Full Text Available The significantly related diseases of sequences could play an important role in understanding the functions of these sequences. In this paper, we introduced BLAT2DOLite, an online system for annotating human genes and diseases and identifying the significant relationships between sequences and diseases. Currently, BLAT2DOLite integrates Entrez Gene database and Disease Ontology Lite (DOLite, which contain loci of gene and relationships between genes and diseases. It utilizes hypergeometric test to calculate P-values between genes and diseases of DOLite. The system can be accessed from: http://123.59.132.21:8080/BLAT2DOLite. The corresponding web service is described in: http://123.59.132.21:8080/BLAT2DOLite/BLAT2DOLiteIDMappingPort?wsdl.
2010-01-01
of appropriate animal model systems. For OP poisoning, the guinea pig (Cavia porcellus) is a commonly used animal model because guinea pigs more...endogenous bioscavenger in vivo. Although guinea pigs historically have been used to test OP poisoning therapies, it has been found recently that guinea pig AChE...transcribed mRNA encoding guinea pig AChE, amplified the resulting cDNA, and sequenced this product. The nucleotide and deduced amino acid sequences of
Bellissimo, Daniel B; Christopherson, Pamela A; Flood, Veronica H; Gill, Joan Cox; Friedman, Kenneth D; Haberichter, Sandra L; Shapiro, Amy D; Abshire, Thomas C; Leissinger, Cindy; Hoots, W Keith; Lusher, Jeanne M; Ragni, Margaret V; Montgomery, Robert R
2012-03-01
Diagnosis and classification of VWD is aided by molecular analysis of the VWF gene. Because VWF polymorphisms have not been fully characterized, we performed VWF laboratory testing and gene sequencing of 184 healthy controls with a negative bleeding history. The controls included 66 (35.9%) African Americans (AAs). We identified 21 new sequence variations, 13 (62%) of which occurred exclusively in AAs and 2 (G967D, T2666M) that were found in 10%-15% of the AA samples, suggesting they are polymorphisms. We identified 14 sequence variations reported previously as VWF mutations, the majority of which were type 1 mutations. These controls had VWF Ag levels within the normal range, suggesting that these sequence variations might not always reduce plasma VWF levels. Eleven mutations were found in AAs, and the frequency of M740I, H817Q, and R2185Q was 15%-18%. Ten AA controls had the 2N mutation H817Q; 1 was homozygous. The average factor VIII level in this group was 99 IU/dL, suggesting that this variation may confer little or no clinical symptoms. This study emphasizes the importance of sequencing healthy controls to understand ethnic-specific sequence variations so that asymptomatic sequence variations are not misidentified as mutations in other ethnic or racial groups.
Malik, Assaf
2011-08-12
The blind subterranean mole rat (Spalax ehrenbergi superspecies) is a model animal for survival under extreme environments due to its ability to live in underground habitats under severe hypoxic stress and darkness. Here we report the transcriptome sequencing of Spalax galili, a chromosomal type of S. ehrenbergi. cDNA pools from muscle and brain tissues isolated from animals exposed to hypoxic and normoxic conditions were sequenced using Sanger, GS FLX, and GS FLX Titanium technologies. Assembly of the sequences yielded over 51,000 isotigs with homology to ~12,000 mouse, rat or human genes. Based on these results, it was possible to detect large numbers of splice variants, SNPs, and novel transcribed regions. In addition, multiple differential expression patterns were detected between tissues and treatments. The results presented here will serve as a valuable resource for future studies aimed at identifying genes and gene regions evolved during the adaptive radiation associated with underground life of the blind mole rat. 2011 Malik et al.
Directory of Open Access Journals (Sweden)
Patrick P Edger
Full Text Available The internal transcribed spacers of the nuclear ribosomal RNA gene cluster, termed ITS1 and ITS2, are the most frequently used nuclear markers for phylogenetic analyses across many eukaryotic groups including most plant families. The reasons for the popularity of these markers include: 1. Ease of amplification due to high copy number of the gene clusters, 2. Available cost-effective methods and highly conserved primers, 3. Rapidly evolving markers (i.e. variable between closely related species, and 4. The assumption (and/or treatment that these sequences are non-functional, neutrally evolving phylogenetic markers. Here, our analyses of ITS1 and ITS2 for 50 species suggest that both sequences are instead under selective constraints to preserve proper secondary structure, likely to maintain complete self-splicing functions, and thus are not neutrally-evolving phylogenetic markers. Our results indicate the majority of sequence sites are co-evolving with other positions to form proper secondary structure, which has implications for phylogenetic inference. We also found that the lowest energy state and total number of possible alternate secondary structures are highly significantly different between ITS regions and random sequences with an identical overall length and Guanine-Cytosine (GC content. Lastly, we review recent evidence highlighting some additional problematic issues with using these regions as the sole markers for phylogenetic studies, and thus strongly recommend additional markers and cost-effective approaches for future studies to estimate phylogenetic relationships.
Segment-specific terminal sequences of Bunyamwera bunyavirus regulate genome replication
International Nuclear Information System (INIS)
Barr, John N.; Elliott, Richard M.; Dunn, Ewan F.; Wertz, Gail W.
2003-01-01
Bunyamwera virus (BUNV) is the prototype of both the Orthobunyavirus genus and the Bunyaviridae family of segmented negative sense RNA viruses. The tripartite BUNV genome consists of small (S), medium (M), and large (L) segments that are transcribed to give a single mRNA and replicated to generate an antigenome that is the template for synthesis of further genomic RNA strands. We modified an existing cDNA-derived RNA synthesis system to allow identification of BUNV RNA replication and transcription products by direct metabolic labeling. Direct RNA analysis allowed us to distinguish between template activities that affected either RNA replication or mRNA transcription, an ability that was not possible using previous reporter gene expression assays. We generated genome analogs containing the entire nontranslated terminal sequences of the S, M, and L BUNV segments surrounding a common sequence. Analysis of RNAs synthesized from these templates revealed that the relative abilities of BUNV segments to perform RNA replication was M > L > S. Exchange of segment-specific terminal nucleotides identified a 12-nt region located within both the 3' and 5' termini of the M segment that correlated with its high replication ability
DNA-based approaches to identify forest fungi in Pacific Islands: A pilot study
Anna E. Case; Sara M. Ashiglar; Phil G. Cannon; Ernesto P. Militante; Edwin R. Tadiosa; Mutya Quintos-Manalo; Nelson M. Pampolina; John W. Hanna; Fred E. Brooks; Amy L. Ross-Davis; Mee-Sook Kim; Ned B. Klopfenstein
2013-01-01
DNA-based diagnostics have been successfully used to characterize diverse forest fungi (e.g., Hoff et al. 2004, Kim et al. 2006, Glaeser & Lindner 2011). DNA sequencing of the internal transcribed spacer (ITS) and large subunit (LSU) regions of nuclear ribosomal DNA (rDNA) has proved especially useful (Sonnenberg et al. 2007, Seifert 2009, Schoch et al. 2012) for...
Directory of Open Access Journals (Sweden)
Devier Benjamin
2007-08-01
Full Text Available Abstract Background The basidiomycete fungus Microbotryum violaceum is responsible for the anther-smut disease in many plants of the Caryophyllaceae family and is a model in genetics and evolutionary biology. Infection is initiated by dikaryotic hyphae produced after the conjugation of two haploid sporidia of opposite mating type. This study describes M. violaceum ESTs corresponding to nuclear genes expressed during conjugation and early hyphal production. Results A normalized cDNA library generated 24,128 sequences, which were assembled into 7,765 unique genes; 25.2% of them displayed significant similarity to annotated proteins from other organisms, 74.3% a weak similarity to the same set of known proteins, and 0.5% were orphans. We identified putative pheromone receptors and genes that in other fungi are involved in the mating process. We also identified many sequences similar to genes known to be involved in pathogenicity in other fungi. The M. violaceum EST database, MICROBASE, is available on the Web and provides access to the sequences, assembled contigs, annotations and programs to compare similarities against MICROBASE. Conclusion This study provides a basis for cloning the mating type locus, for further investigation of pathogenicity genes in the anther smut fungi, and for comparative genomics.
WHITE-DWARF-MAIN-SEQUENCE BINARIES IDENTIFIED FROM THE LAMOST PILOT SURVEY
International Nuclear Information System (INIS)
Ren Juanjuan; Luo Ali; Li Yinbi; Wei Peng; Zhao Jingkun; Zhao Yongheng; Song Yihan; Zhao Gang
2013-01-01
We present a set of white-dwarf-main-sequence (WDMS) binaries identified spectroscopically from the Large sky Area Multi-Object fiber Spectroscopic Telescope (LAMOST, also called the Guo Shou Jing Telescope) pilot survey. We develop a color selection criteria based on what is so far the largest and most complete Sloan Digital Sky Survey (SDSS) DR7 WDMS binary catalog and identify 28 WDMS binaries within the LAMOST pilot survey. The primaries in our binary sample are mostly DA white dwarfs except for one DB white dwarf. We derive the stellar atmospheric parameters, masses, and radii for the two components of 10 of our binaries. We also provide cooling ages for the white dwarf primaries as well as the spectral types for the companion stars of these 10 WDMS binaries. These binaries tend to contain hot white dwarfs and early-type companions. Through cross-identification, we note that nine binaries in our sample have been published in the SDSS DR7 WDMS binary catalog. Nineteen spectroscopic WDMS binaries identified by the LAMOST pilot survey are new. Using the 3σ radial velocity variation as a criterion, we find two post-common-envelope binary candidates from our WDMS binary sample
Globicatella sanguinis bacteraemia identified by partial 16S rRNA gene sequencing
DEFF Research Database (Denmark)
Abdul-Redha, Rawaa Jalil; Balslew, Ulla; Christensen, Jens Jørgen
2007-01-01
Globicatella sanguinis is a gram-positive coccus, resembling non-haemolytic streptococci. The organism has been isolated infrequently from normally sterile sites of humans. Three isolates obtained by blood culture could not be identified by Rapid 32 ID Strep, but partial sequencing of the 16S r......RNA gene revealed the identity of the isolated bacteria, and supplementary biochemical tests confirmed the species identification. The cases histories illustrate the dilemma of finding relevant, newly recognized, opportunistic pathogens and the identification achievement (s) that can be obtained by using...
Directory of Open Access Journals (Sweden)
Sarver Aaron L
2012-06-01
Full Text Available Abstract Background Next generation sequencing approaches applied to the analyses of transposon insertion junction fragments generated in high throughput forward genetic screens has created the need for clear informatics and statistical approaches to deal with the massive amount of data currently being generated. Previous approaches utilized to 1 map junction fragments within the genome and 2 identify Common Insertion Sites (CISs within the genome are not practical due to the volume of data generated by current sequencing technologies. Previous approaches applied to this problem also required significant manual annotation. Results We describe Transposon Annotation Poisson Distribution Association Network Connectivity Environment (TAPDANCE software, which automates the identification of CISs within transposon junction fragment insertion data. Starting with barcoded sequence data, the software identifies and trims sequences and maps putative genomic sequence to a reference genome using the bowtie short read mapper. Poisson distribution statistics are then applied to assess and rank genomic regions showing significant enrichment for transposon insertion. Novel methods of counting insertions are used to ensure that the results presented have the expected characteristics of informative CISs. A persistent mySQL database is generated and utilized to keep track of sequences, mappings and common insertion sites. Additionally, associations between phenotypes and CISs are also identified using Fisher’s exact test with multiple testing correction. In a case study using previously published data we show that the TAPDANCE software identifies CISs as previously described, prioritizes them based on p-value, allows holistic visualization of the data within genome browser software and identifies relationships present in the structure of the data. Conclusions The TAPDANCE process is fully automated, performs similarly to previous labor intensive approaches
Contig Maps and Genomic Sequencing Identify Candidate Genes in the Usher 1C Locus
Higgins, Michael J.; Day, Colleen D.; Smilinich, Nancy J.; Ni, L.; Cooper, Paul R.; Nowak, Norma J.; Davies, Chris; de Jong, Pieter J.; Hejtmancik, Fielding; Evans, Glen A.; Smith, Richard J.H.; Shows, Thomas B.
1998-01-01
Usher syndrome 1C (USH1C) is a congenital condition manifesting profound hearing loss, the absence of vestibular function, and eventual retinal degeneration. The USH1C locus has been mapped genetically to a 2- to 3-cM interval in 11p14–15.1 between D11S899 and D11S861. In an effort to identify the USH1C disease gene we have isolated the region between these markers in yeast artificial chromosomes (YACs) using a combination of STS content mapping and Alu–PCR hybridization. The YAC contig is ∼3.5 Mb and has located several other loci within this interval, resulting in the order CEN-LDHA-SAA1-TPH-D11S1310-(D11S1888/KCNC1)-MYOD1-D11S902D11S921-D11S1890-TEL. Subsequent haplotyping and homozygosity analysis refined the location of the disease gene to a 400-kb interval between D11S902 and D11S1890 with all affected individuals being homozygous for the internal marker D11S921. To facilitate gene identification, the critical region has been converted into P1 artificial chromosome (PAC) clones using sequence-tagged sites (STSs) mapped to the YAC contig, Alu–PCR products generated from the YACs, and PAC end probes. A contig of >50 PAC clones has been assembled between D11S1310 and D11S1890, confirming the order of markers used in haplotyping. Three PAC clones representing nearly two-thirds of the USH1C critical region have been sequenced. PowerBLAST analysis identified six clusters of expressed sequence tags (ESTs), two known genes (BIR,SUR1) mapped previously to this region, and a previously characterized but unmapped gene NEFA (DNA binding/EF hand/acidic amino-acid-rich). GRAIL analysis identified 11 CpG islands and 73 exons of excellent quality. These data allowed the construction of a transcription map for the USH1C critical region, consisting of three known genes and six or more novel transcripts. Based on their map location, these loci represent candidate disease loci for USH1C. The NEFA gene was assessed as the USH1C locus by the sequencing of an amplified NEFA
Polymorphic DNA sequences of the fungal honey bee pathogen Ascosphaera apis
DEFF Research Database (Denmark)
Jensen, Annette B; Welker, Dennis L; Kryger, Per
2012-01-01
The pathogenic fungus Ascosphaera apis is ubiquitous in honey bee populations. We used the draft genome assembly of this pathogen to search for polymorphic intergenic loci that could be used to differentiate haplotypes. Primers were developed for five such loci, and the species specificities were...... verified using DNA from nine closely related species. The sequence variation was compared among 12 A. apis isolates at each of these loci, and two additional loci, the internal transcribed spacer of the ribosomal RNA (ITS) and a variable part of the elongation factor 1α (Ef1α). The degree of variation...... was then compared among the different loci, and three were found to have the greatest detection power for identifying A. apis haplotypes. The described loci can help to resolve strain differences and population genetic structures, to elucidate host–pathogen interaction and to test evolutionary hypotheses...
Directory of Open Access Journals (Sweden)
Javed Iqbal Wattoo
2016-11-01
Full Text Available Background: DNA barcoding is a novel method of species identification based on nucleotide diversity of conserved sequences. The establishment and refining of plant DNA barcoding systems is more challenging due to high genetic diversity among different species. Therefore, targeting the conserved nuclear transcribed regions would be more reliable for plant scientists to reveal genetic diversity, species discrimination and phylogeny. Methods: In this study, we amplified and sequenced the chloroplast DNA regions (matk+rbcl of Solanum nigrum, Euphorbia helioscopia and Dalbergia sissoo to study the functional annotation, homology modeling and sequence analysis to allow a more efficient utilization of these sequences among different plant species. These three species represent three families; Solanaceae, Euphorbiaceae and Fabaceae respectively. Biological sequence homology and divergence of amplified sequences was studied using Basic Local Alignment Tool (BLAST. Results: Both primers (matk+rbcl showed good amplification in three species. The sequenced regions reveled conserved genome information for future identification of different medicinal plants belonging to these species. The amplified conserved barcodes revealed different levels of biological homology after sequence analysis. The results clearly showed that the use of these conserved DNA sequences as barcode primers would be an accurate way for species identification and discrimination. Conclusion: The amplification and sequencing of conserved genome regions identified a novel sequence of matK in native species of Solanum nigrum. The findings of the study would be applicable in medicinal industry to establish DNA based identification of different medicinal plant species to monitor adulteration.
The Heterogeneity of the Internal Transcribed Spacers (ITS of rDNAs in Imperata cylindrica in Taiwan
Directory of Open Access Journals (Sweden)
Chi-Chu Tsai
2000-09-01
Full Text Available Ribosomal DNA for internal transcribed spacers ITS, ITS1, 5.8S rRNA gene, ITS2 and the adjoining regions of the 17S and 25S rRNA genes were obtained from 45 individuals of Imperata cylindrica (Cogongrass in Taiwan via PCR amplification. The length of each PCR product was 692 bp, except for one sample (about 702 bp. All ITS DNA fragments were digested with EcoRV, CfoI, BanI, HaeIII, MspI, HinfI, BstOI, Sau96I, StyI and Eco109I, respectively. The ITS, including ITS1, 5.8S rRNA gene and ITS2, were very heterogeneous within an individual of Cogongrass in Taiwan. Of 45 individuals of Cogongrass in Taiwan, the ITS1 and ITS2 regions showed at least eight type variants, and 5.8S rRNA gene showed at least five type variants among Cogongrass population in Taiwan based on PCR-amplified RFLP. In conclusion, the ITS repeat sequences from Cogongrass in Taiwan was very high heterogeneous.
Beyhan, Yunus E; Karakus, Mehmet; Karagoz, Alper; Mungan, Mesut; Ozkan, Aysegul T; Hokelek, Murat
2017-09-01
To characterize the cutaneous leishmaniasis (CL) isolates of Syrian and Central Anatolia patients at species levels. Methods: Skin scrapings of 3 patients (2 Syrian, 1 Turkish) were taken and examined by direct examination, culture in Novy-MacNeal-Nicole (NNN) medium, internal transcribed spacer polymerase chain reaction and sequence analysis (PCR). Results:According to microscopic examination, culture and PCR methods, 3 samples were detected positive. The sequencing results of all isolates in the study were identified as Leishmania tropica. The same genotypes were detected in the 3 isolates and nucleotide sequence submitted into GenBank with the accession number: KP689599. Conclusion: This finding could give information about the transmission of CL between Turkey and Syria. Because of the Syrian civil war, most of the Syrian citizens circulating in Turkey and different part of Europe, this can be increase the risk of spreading the disease. So, prevention measurements must be taken urgently.
Directory of Open Access Journals (Sweden)
Yunus E. Beyhan
2017-09-01
Full Text Available Objectives: To characterize the cutaneous leishmaniasis (CL isolates of Syrian and Central Anatolia patients at species levels. Methods: Skin scrapings of 3 patients (2 Syrian, 1 Turkish were taken and examined by direct examination, culture in Novy-MacNeal-Nicole (NNN medium, internal transcribed spacer polymerase chain reaction and sequence analysis (PCR. Results:According to microscopic examination, culture and PCR methods, 3 samples were detected positive. The sequencing results of all isolates in the study were identified as Leishmania tropica. The same genotypes were detected in the 3 isolates and nucleotide sequence submitted into GenBank with the accession number: KP689599. Conclusion: This finding could give information about the transmission of CL between Turkey and Syria. Because of the Syrian civil war, most of the Syrian citizens circulating in Turkey and different part of Europe, this can be increase the risk of spreading the disease. So, prevention measurements must be taken urgently.
Liu, Yong; Cao, Yu; Li, Yaxiong; Lei, Dongyun; Li, Lin; Hou, Zong Liu; Han, Shen; Meng, Mingyao; Shi, Jianlin; Zhang, Yayong; Wang, Yi; Niu, Zhaoyi; Xie, Yanhua; Xiao, Benshan; Wang, Yuanfei; Li, Xiao; Yang, Lirong; Wang, Wenju; Jiang, Lihong
2018-03-05
BACKGROUND Recently, mutations in several genes have been described to be associated with sporadic ASD, but some genetic variants remain to be identified. The aim of this study was to use whole-exome sequencing (WES) combined with bioinformatics analysis to identify novel genetic variants in cases of sporadic congenital ASD, followed by validation by Sanger sequencing. MATERIAL AND METHODS Five Han patients with secundum ASD were recruited, and their tissue samples were analyzed by WES, followed by verification by Sanger sequencing of tissue and blood samples. Further evaluation using blood samples included 452 additional patients with sporadic secundum ASD (212 male and 240 female patients) and 519 healthy subjects (252 male and 267 female subjects) for further verification by a multiplexed MassARRAY system. Bioinformatic analyses were performed to identify novel genetic variants associated with sporadic ASD. RESULTS From five patients with sporadic ASD, a total of 181,762 genomic variants in 33 exon loci, validated by Sanger sequencing, were selected and underwent MassARRAY analysis in 452 patients with ASD and 519 healthy subjects. Three loci with high mutation frequencies, the 138665410 FOXL2 gene variant, the 23862952 MYH6 gene variant, and the 71098693 HYDIN gene variant were found to be significantly associated with sporadic ASD (PASD (PASD, and supported the use of WES and bioinformatics analysis to identify disease-associated mutations.
Chen, Jun; Källman, Thomas; Ma, Xiao-Fei; Zaina, Giusi; Morgante, Michele; Lascoux, Martin
2016-07-07
The joint inference of selection and past demography remain a costly and demanding task. We used next generation sequencing of two pools of 48 Norway spruce mother trees, one corresponding to the Fennoscandian domain, and the other to the Alpine domain, to assess nucleotide polymorphism at 88 nuclear genes. These genes are candidate genes for phenological traits, and most belong to the photoperiod pathway. Estimates of population genetic summary statistics from the pooled data are similar to previous estimates, suggesting that pooled sequencing is reliable. The nonsynonymous SNPs tended to have both lower frequency differences and lower FST values between the two domains than silent ones. These results suggest the presence of purifying selection. The divergence between the two domains based on synonymous changes was around 5 million yr, a time similar to a recent phylogenetic estimate of 6 million yr, but much larger than earlier estimates based on isozymes. Two approaches, one of them novel and that considers both FST and difference in allele frequencies between the two domains, were used to identify SNPs potentially under diversifying selection. SNPs from around 20 genes were detected, including genes previously identified as main target for selection, such as PaPRR3 and PaGI. Copyright © 2016 Chen et al.
Chaudhary, Sakshi; Mishra, Bharat Kumar; Vivek, Thiruvettai; Magadum, Santoshkumar; Yasin, Jeshima Khan
2016-01-01
Simple Sequence Repeats or microsatellites are resourceful molecular genetic markers. There are only few reports of SSR identification and development in pineapple. Complete genome sequence of pineapple available in the public domain can be used to develop numerous novel SSRs. Therefore, an attempt was made to identify SSRs from genomic, chloroplast, mitochondrial and EST sequences of pineapple which will help in deciphering genetic makeup of its germplasm resources. A total of 359511 SSRs were identified in pineapple (356385 from genome sequence, 45 from chloroplast sequence, 249 in mitochondrial sequence and 2832 from EST sequences). The list of EST-SSR markers and their details are available in the database. PineElm_SSRdb is an open source database available for non-commercial academic purpose at http://app.bioelm.com/ with a mapping tool which can develop circular maps of selected marker set. This database will be of immense use to breeders, researchers and graduates working on Ananas spp. and to others working on cross-species transferability of markers, investigating diversity, mapping and DNA fingerprinting.
A wing expressed sequence tag resource for Bicyclus anynana butterflies, an evo-devo model
Directory of Open Access Journals (Sweden)
Gruber Jonathan D
2006-05-01
Full Text Available Abstract Background Butterfly wing color patterns are a key model for integrating evolutionary developmental biology and the study of adaptive morphological evolution. Yet, despite the biological, economical and educational value of butterflies they are still relatively under-represented in terms of available genomic resources. Here, we describe an Expression Sequence Tag (EST project for Bicyclus anynana that has identified the largest available collection to date of expressed genes for any butterfly. Results By targeting cDNAs from developing wings at the stages when pattern is specified, we biased gene discovery towards genes potentially involved in pattern formation. Assembly of 9,903 ESTs from a subtracted library allowed us to identify 4,251 genes of which 2,461 were annotated based on BLAST analyses against relevant gene collections. Gene prediction software identified 2,202 peptides, of which 215 longer than 100 amino acids had no homology to any known proteins and, thus, potentially represent novel or highly diverged butterfly genes. We combined gene and Single Nucleotide Polymorphism (SNP identification by constructing cDNA libraries from pools of outbred individuals, and by sequencing clones from the 3' end to maximize alignment depth. Alignments of multi-member contigs allowed us to identify over 14,000 putative SNPs, with 316 genes having at least one high confidence double-hit SNP. We furthermore identified 320 microsatellites in transcribed genes that can potentially be used as genetic markers. Conclusion Our project was designed to combine gene and sequence polymorphism discovery and has generated the largest gene collection available for any butterfly and many potential markers in expressed genes. These resources will be invaluable for exploring the potential of B. anynana in particular, and butterflies in general, as models in ecological, evolutionary, and developmental genetics.
DEFF Research Database (Denmark)
2015-01-01
Data from: "Diagnostic SNPs for inferring population structure in American mink (Neovison vison) identified through RAD sequencing" in Genomic Resources Notes accepted 1 October 2014 to 30 November 2014....
Identification of Clinical Staphylococcal Isolates from Humans by Internal Transcribed Spacer PCR
Couto, Isabel; Pereira, Sandro; Miragaia, Maria; Sanches, Ilda Santos; de Lencastre, Hermínia
2001-01-01
The emergence of coagulase-negative staphylococci not only as human pathogens but also as reservoirs of antibiotic resistance determinants requires the deployment and development of methods for their rapid and reliable identification. Internal transcribed spacer-PCR (ITS-PCR) was used to identify a collection of 617 clinical staphylococcal isolates. The amplicons were resolved in high-resolution agarose gels and visually compared with the patterns obtained for the control strains of 29 staphylococcal species. Of the 617 isolates studied, 592 (95.95%) were identified by ITS-PCR and included 11 species: 302 isolates of Staphylococcus epidermidis, 157 of S. haemolyticus, 79 of S. aureus, 21 of S. hominis, 14 of S. saprophyticus, 8 of S. warneri, 6 of S. simulans, 2 of S. lugdunensis, and 1 each of S. caprae, S. carnosus, and S. cohnii. All species analyzed had unique ITS-PCR patterns, although some were very similar, namely, the group S. saprophyticus, S. cohnii, S. gallinarum, S. xylosus, S. lentus, S. equorum, and S. chromogenes, the pair S. schleiferi and S. vitulus, and the pair S. piscifermentans and S. carnosus. Four species, S. aureus, S. caprae, S. haemolyticus, and S. lugdunensis, showed polymorphisms on their ITS-PCR patterns. ITS-PCR proved to be a valuable alternative for the identification of staphylococci, offering, within the same response time and at lower cost, higher reliability than the currently available commercial systems. PMID:11526135
Identification of clinical staphylococcal isolates from humans by internal transcribed spacer PCR.
Couto, I; Pereira, S; Miragaia, M; Sanches, I S; de Lencastre, H
2001-09-01
The emergence of coagulase-negative staphylococci not only as human pathogens but also as reservoirs of antibiotic resistance determinants requires the deployment and development of methods for their rapid and reliable identification. Internal transcribed spacer-PCR (ITS-PCR) was used to identify a collection of 617 clinical staphylococcal isolates. The amplicons were resolved in high-resolution agarose gels and visually compared with the patterns obtained for the control strains of 29 staphylococcal species. Of the 617 isolates studied, 592 (95.95%) were identified by ITS-PCR and included 11 species: 302 isolates of Staphylococcus epidermidis, 157 of S. haemolyticus, 79 of S. aureus, 21 of S. hominis, 14 of S. saprophyticus, 8 of S. warneri, 6 of S. simulans, 2 of S. lugdunensis, and 1 each of S. caprae, S. carnosus, and S. cohnii. All species analyzed had unique ITS-PCR patterns, although some were very similar, namely, the group S. saprophyticus, S. cohnii, S. gallinarum, S. xylosus, S. lentus, S. equorum, and S. chromogenes, the pair S. schleiferi and S. vitulus, and the pair S. piscifermentans and S. carnosus. Four species, S. aureus, S. caprae, S. haemolyticus, and S. lugdunensis, showed polymorphisms on their ITS-PCR patterns. ITS-PCR proved to be a valuable alternative for the identification of staphylococci, offering, within the same response time and at lower cost, higher reliability than the currently available commercial systems.
DEFF Research Database (Denmark)
Ren, Shancheng; Wei, Gong-Hong; Liu, Dongbing
2018-01-01
BACKGROUND: Global disparities in prostate cancer (PCa) incidence highlight the urgent need to identify genomic abnormalities in prostate tumors in different ethnic populations including Asian men. OBJECTIVE: To systematically explore the genomic complexity and define disease-driven genetic......-scale and comprehensive genomic data of prostate cancer from Asian population. Identification of these genetic alterations may help advance prostate cancer diagnosis, prognosis, and treatment....... alterations in PCa. DESIGN, SETTING, AND PARTICIPANTS: The study sequenced whole-genome and transcriptome of tumor-benign paired tissues from 65 treatment-naive Chinese PCa patients. Subsequent targeted deep sequencing of 293 PCa-relevant genes was performed in another cohort of 145 prostate tumors. OUTCOME...
Similar Ratios of Introns to Intergenic Sequence across Animal Genomes.
Francis, Warren R; Wörheide, Gert
2017-06-01
One central goal of genome biology is to understand how the usage of the genome differs between organisms. Our knowledge of genome composition, needed for downstream inferences, is critically dependent on gene annotations, yet problems associated with gene annotation and assembly errors are usually ignored in comparative genomics. Here, we analyze the genomes of 68 species across 12 animal phyla and some single-cell eukaryotes for general trends in genome composition and transcription, taking into account problems of gene annotation. We show that, regardless of genome size, the ratio of introns to intergenic sequence is comparable across essentially all animals, with nearly all deviations dominated by increased intergenic sequence. Genomes of model organisms have ratios much closer to 1:1, suggesting that the majority of published genomes of nonmodel organisms are underannotated and consequently omit substantial numbers of genes, with likely negative impact on evolutionary interpretations. Finally, our results also indicate that most animals transcribe half or more of their genomes arguing against differences in genome usage between animal groups, and also suggesting that the transcribed portion is more dependent on genome size than previously thought. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Directory of Open Access Journals (Sweden)
Marinela eCapanu
2015-05-01
Full Text Available Identifying the small number of rare causal variants contributing to disease has beena major focus of investigation in recent years, but represents a formidable statisticalchallenge due to the rare frequencies with which these variants are observed. In thiscommentary we draw attention to a formal statistical framework, namely hierarchicalmodeling, to combine functional genomic annotations with sequencing data with theobjective of enhancing our ability to identify rare causal variants. Using simulations weshow that in all configurations studied, the hierarchical modeling approach has superiordiscriminatory ability compared to a recently proposed aggregate measure of deleteriousness,the Combined Annotation-Dependent Depletion (CADD score, supportingour premise that aggregate functional genomic measures can more accurately identifycausal variants when used in conjunction with sequencing data through a hierarchicalmodeling approach
Exome sequencing identifies recurrent somatic RAC1 mutations in melanoma
Energy Technology Data Exchange (ETDEWEB)
Krauthammer, Michael; Kong, Yong; Ha, Byung Hak; Evans, Perry; Bacchiocchi, Antonella; McCusker, James P.; Cheng, Elaine; Davis, Matthew J.; Goh, Gerald; Choi, Murim; Ariyan, Stephan; Narayan, Deepak; Dutton-Regester, Ken; Capatana, Ana; Holman, Edna C.; Bosenberg, Marcus; Sznol, Mario; Kluger, Harriet M.; Brash, Douglas E.; Stern, David F.; Materin, Miguel A.; Lo, Roger S.; Mane, Shrikant; Ma, Shuangge; Kidd, Kenneth K.; Hayward, Nicholas K.; Lifton, Richard P.; Schlessinger, Joseph; Boggon, Titus J.; Halaban, Ruth (Yale-MED); (UCLA); (Queens)
2012-10-11
We characterized the mutational landscape of melanoma, the form of skin cancer with the highest mortality rate, by sequencing the exomes of 147 melanomas. Sun-exposed melanomas had markedly more ultraviolet (UV)-like C>T somatic mutations compared to sun-shielded acral, mucosal and uveal melanomas. Among the newly identified cancer genes was PPP6C, encoding a serine/threonine phosphatase, which harbored mutations that clustered in the active site in 12% of sun-exposed melanomas, exclusively in tumors with mutations in BRAF or NRAS. Notably, we identified a recurrent UV-signature, an activating mutation in RAC1 in 9.2% of sun-exposed melanomas. This activating mutation, the third most frequent in our cohort of sun-exposed melanoma after those of BRAF and NRAS, changes Pro29 to serine (RAC1{sup P29S}) in the highly conserved switch I domain. Crystal structures, and biochemical and functional studies of RAC1{sup P29S} showed that the alteration releases the conformational restraint conferred by the conserved proline, causes an increased binding of the protein to downstream effectors, and promotes melanocyte proliferation and migration. These findings raise the possibility that pharmacological inhibition of downstream effectors of RAC1 signaling could be of therapeutic benefit.
Revollo, Javier R; Crabtree, Nathaniel M; Pearce, Mason G; Pacheco-Martinez, M Monserrat; Dobrovolsky, Vasily N
2016-03-01
Identification of mutations induced by xenotoxins is a common task in the field of genetic toxicology. Mutations are often detected by clonally expanding potential mutant cells and genotyping each viable clone by Sanger sequencing. Such a "clone-by-clone" approach requires significant time and effort, and sometimes is even impossible to implement. Alternative techniques for efficient mutation identification would greatly benefit both basic and regulatory genetic toxicology research. Here, we report the development of Mutation Analysis with Random DNA Identifiers (MARDI), a novel high-fidelity Next Generation Sequencing (NGS) approach that circumvents clonal expansion and directly catalogs mutations in pools of mutant cells. MARDI uses oligonucleotides carrying Random DNA Identifiers (RDIs) to tag progenitor DNA molecules before PCR amplification, enabling clustering of descendant DNA molecules and eliminating NGS- and PCR-induced sequencing artifacts. When applied to the Pig-a cDNA analysis of heterogeneous pools of CD48-deficient T cells derived from DMBA-treated rats, MARDI detected nearly all Pig-a mutations that were previously identified by conventional clone-by-clone analysis and discovered many additional ones consistent with DMBA exposure: mostly A to T transversions, with the mutated A located on the non-transcribed DNA strand. © 2015 Wiley Periodicals, Inc.
Directory of Open Access Journals (Sweden)
Paul G. Nevill
2013-05-01
Full Text Available Premise of the study: Microsatellite primers were developed for Eucalyptus victrix (Myrtaceae to evaluate the population and spatial genetic structure of this widespread northwestern Australian riparian tree species, which may be impacted by hydrological changes associated with mining activity. Methods and Results: 454 GS-FLX shotgun sequencing was used to obtain 1895 sequences containing putative microsatellite motifs. Ten polymorphic microsatellite loci were identified and screened for variation in individuals from two populations in the Pilbara region. Observed heterozygosities ranged from 0.44 to 0.91 (mean: 0.66 and the number of alleles per locus ranged from five to 25 (average: 11. Conclusions: These microsatellite loci will be useful in future studies of population and spatial genetic structure in E. victrix, and inform the development of seed sourcing strategies for the species.
Dingman, Douglas W
2012-07-01
Paenibacillus larvae is the causative agent of American foulbrood in honey bee (Apis mellifera) larvae. PCR amplification of the 16S-23S ribosomal DNA (rDNA) intergenic transcribed spacer (ITS) regions, and agarose gel electrophoresis of the amplified DNA, was performed using genomic DNA collected from 134 P. larvae strains isolated in Connecticut, six Northern Regional Research Laboratory stock strains, four strains isolated in Argentina, and one strain isolated in Chile. Following electrophoresis of amplified DNA, all isolates exhibited a common migratory profile (i.e., ITS-PCR fingerprint pattern) of six DNA bands. This profile represented a unique ITS-PCR DNA fingerprint that was useful as a fast, simple, and accurate procedure for identification of P. larvae. Digestion of ITS-PCR amplified DNA, using mung bean nuclease prior to electrophoresis, characterized only three of the six electrophoresis bands as homoduplex DNA and indicating three true ITS regions. These three ITS regions, DNA migratory band sizes of 915, 1010, and 1474 bp, signify a minimum of three types of rrn operons within P. larvae. DNA sequence analysis of ITS region DNA, using P. larvae NRRL B-3553, identified the 3' terminal nucleotides of the 16S rRNA gene, 5' terminal nucleotides of the 23S rRNA gene, and the complete DNA sequences of the 5S rRNA, tRNA(ala), and tRNA(ile) genes. Gene organization within the three rrn operon types was 16S-23S, 16S-tRNA(ala)-23S, and l6S-5S-tRNA(ile)-tRNA(ala)-23S and these operons were named rrnA, rrnF, and rrnG, respectively. The 23S rRNA gene was shown by I-CeuI digestion and pulsed-field gel electrophoresis of genomic DNA to be present as seven copies. This was suggestive of seven rrn operon copies within the P. larvae genome. Investigation of the 16S-23S rDNA regions of this bacterium has aided the development of a diagnostic procedure and has helped genomic mapping investigations via characterization of the ITS regions. Copyright © 2012 Elsevier Inc
Cridland, Julie M; Thornton, Kevin R
2010-01-13
Several recent studies have focused on the evolution of recently duplicated genes in Drosophila. Currently, however, little is known about the evolutionary forces acting upon duplications that are segregating in natural populations. We used a high-throughput, paired-end sequencing platform (Illumina) to identify structural variants in a population sample of African D. melanogaster. Polymerase chain reaction and sequencing confirmation of duplications detected by multiple, independent paired-ends showed that paired-end sequencing reliably uncovered the break points of structural rearrangements and allowed us to identify a number of tandem duplications segregating within a natural population. Our confirmation experiments show that rates of confirmation are very high, even at modest coverage. Our results also compare well with previous studies using microarrays (Emerson J, Cardoso-Moreira M, Borevitz JO, Long M. 2008. Natural selection shapes genome wide patterns of copy-number polymorphism in Drosophila melanogaster. Science. 320:1629-1631. and Dopman EB, Hartl DL. 2007. A portrait of copy-number polymorphism in Drosophila melanogaster. Proc Natl Acad Sci U S A. 104:19920-19925.), which both gives us confidence in the results of this study as well as confirms previous microarray results.We were also able to identify whole-gene duplications, such as a novel duplication of Or22a, an olfactory receptor, and identify copy-number differences in genes previously known to be under positive selection, like Cyp6g1, which confers resistance to dichlorodiphenyltrichloroethane. Several "hot spots" of duplications were detected in this study, which indicate that particular regions of the genome may be more prone to generating duplications. Finally, population frequency analysis of confirmed events also showed an excess of rare variants in our population, which indicates that duplications segregating in the population may be deleterious and ultimately destined to be lost from the
Mukherjee, Kalpataru; Bowman, Kimberly S; Rainey, Fred A; Siddaramappa, Shivakumara; Challacombe, Jean F; Moe, William M
2014-05-01
The genome sequence of the organohalide-respiring bacterium Dehalogenimonas lykanthroporepellensBL-DC-9(T) contains numerous loci annotated as reductive dehalogenase homologous (rdh) genes based on inferred protein sequence identity with functional dehalogenases of other bacterial species. Many of these genes are truncated, lack adjacent regulatory elements, or lack cognate genes coding for membrane-anchoring proteins typical of the functionally characterized active reductive dehalogenases of organohalide-respiring bacteria. To investigate the expression patterns of the rdh genes in D. lykanthroporepellensBL-DC-9(T), oligonucleotide primers were designed to uniquely target 25 rdh genes present in the genome as well as four putative regulatory genes. RNA extracts from cultures of strain BL-DC-9(T) actively dechlorinating three different electron acceptors, 1,2-dichloroethane, 1,2-dichloropropane, and 1,2,3-trichloropropane were reverse-transcribed and subjected to PCR amplification using rdh-specific primers. Nineteen rdh gene transcripts, including 13 full-length rdhA genes, six truncated rdhA genes, and five rdhA genes having cognate rdhB genes were consistently detected during the dechlorination of all three of the polychlorinated alkanes tested. Transcripts from all four of the putative regulatory genes were also consistently detected. Results reported here expand the diversity of bacteria known to simultaneously transcribe multiple rdh genes and provide insights into the transcription factors associated with rdh gene expression. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.
Bentley, Kirsten; Keep, Sarah May; Armesto, Maria; Britton, Paul
2013-02-01
Coronavirus subgenomic mRNA (sgmRNA) synthesis occurs via a process of discontinuous transcription involving transcription regulatory sequences (TRSs) located in the 5' leader sequence (TRS-L) and upstream of each structural and group-specific gene (TRS-B). Several gammacoronaviruses including infectious bronchitis virus (IBV) contain a putative open reading frame (ORF), localized between the M gene and gene 5, which is controversial due to the perceived absence of a TRS. We have studied the transcription of a novel sgmRNA associated with this potential ORF and found it to be transcribed via a previously unidentified noncanonical TRS-B. Using an IBV reverse genetics system, we demonstrated that the template-switching event during intergenic region (IR) sgmRNA synthesis occurs at the 5' end of the noncanonical TRS-B and recombines between nucleotides 5 and 6 of the 8-nucleotide consensus TRS-L. Introduction of a complete TRS-B showed that higher transcription levels are achieved by increasing the number of nucleotide matches between TRS-L and TRS-B. Translation of a protein from the sgmRNA was demonstrated using enhanced green fluorescent protein, suggesting the translation of a fifth, novel, group-specific protein for IBV. This study has resolved an issue concerning the number of ORFs expressed by members of the Gammacoronavirus genus and proposes the existence of a fifth IBV accessory protein. We confirmed previous reports that coronaviruses can produce sgmRNAs from noncanonical TRS-Bs, which may expand their repertoire of proteins. We also demonstrated that noncanonical TRS-Bs may provide a mechanism by which coronaviruses can control protein expression levels by reducing sgmRNA synthesis.
Valdés-Alemán, Javier; Téllez-Sosa, Juan; Ovilla-Muñoz, Marbella; Godoy-Lozano, Elizabeth; Velázquez-Ramírez, Daniel; Valdovinos-Torres, Humberto; Gómez-Barreto, Rosa E; Martinez-Barnetche, Jesús
2014-01-01
High-throughput sequencing of the antibody repertoire is enabling a thorough analysis of B cell diversity and clonal selection, which may improve the novel antibody discovery process. Theoretically, an adequate bioinformatic analysis could allow identification of candidate antigen-specific antibodies, requiring their recombinant production for experimental validation of their specificity. Gene synthesis is commonly used for the generation of recombinant antibodies identified in silico. Novel strategies that bypass gene synthesis could offer more accessible antibody identification and validation alternatives. We developed a hybridization-based recovery strategy that targets the complementarity-determining region 3 (CDRH3) for the enrichment of cDNA of candidate antigen-specific antibody sequences. Ten clonal groups of interest were identified through bioinformatic analysis of the heavy chain antibody repertoire of mice immunized with hen egg white lysozyme (HEL). cDNA from eight of the targeted clonal groups was recovered efficiently, leading to the generation of recombinant antibodies. One representative heavy chain sequence from each clonal group recovered was paired with previously reported anti-HEL light chains to generate full antibodies, later tested for HEL-binding capacity. The recovery process proposed represents a simple and scalable molecular strategy that could enhance antibody identification and specificity assessment, enabling a more cost-efficient generation of recombinant antibodies.
Lea, Amanda J.
2015-01-01
Identifying sources of variation in DNA methylation levels is important for understanding gene regulation. Recently, bisulfite sequencing has become a popular tool for investigating DNA methylation levels. However, modeling bisulfite sequencing data is complicated by dramatic variation in coverage across sites and individual samples, and because of the computational challenges of controlling for genetic covariance in count data. To address these challenges, we present a binomial mixed model and an efficient, sampling-based algorithm (MACAU: Mixed model association for count data via data augmentation) for approximate parameter estimation and p-value computation. This framework allows us to simultaneously account for both the over-dispersed, count-based nature of bisulfite sequencing data, as well as genetic relatedness among individuals. Using simulations and two real data sets (whole genome bisulfite sequencing (WGBS) data from Arabidopsis thaliana and reduced representation bisulfite sequencing (RRBS) data from baboons), we show that our method provides well-calibrated test statistics in the presence of population structure. Further, it improves power to detect differentially methylated sites: in the RRBS data set, MACAU detected 1.6-fold more age-associated CpG sites than a beta-binomial model (the next best approach). Changes in these sites are consistent with known age-related shifts in DNA methylation levels, and are enriched near genes that are differentially expressed with age in the same population. Taken together, our results indicate that MACAU is an efficient, effective tool for analyzing bisulfite sequencing data, with particular salience to analyses of structured populations. MACAU is freely available at www.xzlab.org/software.html. PMID:26599596
Whole-exome sequencing identified a variant in EFTUD2 gene in establishing a genetic diagnosis.
Rengasamy Venugopalan, S; Farrow, E G; Lypka, M
2017-06-01
Craniofacial anomalies are complex and have an overlapping phenotype. Mandibulofacial Dysostosis and Oculo-Auriculo-Vertebral Spectrum are conditions that share common craniofacial phenotype and present a challenge in arriving at a diagnosis. In this report, we present a case of female proband who was given a differential diagnosis of Treacher Collins syndrome or Hemifacial Microsomia without certainty. Prior genetic testing reported negative for 22q deletion and FGFR screenings. The objective of this study was to demonstrate the critical role of whole-exome sequencing in establishing a genetic diagnosis of the proband. The participants were 14½-year-old affected female proband/parent trio. Proband/parent trio were enrolled in the study. Surgical tissue sample from the proband and parental blood samples were collected and prepared for whole-exome sequencing. Illumina HiSeq 2500 instrument was used for sequencing (125 nucleotide reads/84X coverage). Analyses of variants were performed using custom-developed software, RUNES and VIKING. Variant analyses following whole-exome sequencing identified a heterozygous de novo pathogenic variant, c.259C>T (p.Gln87*), in EFTUD2 (NM_004247.3) gene in the proband. Previous studies have reported that the variants in EFTUD2 gene were associated with Mandibulofacial Dysostosis with Microcephaly. Patients with facial asymmetry, micrognathia, choanal atresia and microcephaly should be analyzed for variants in EFTUD2 gene. Next-generation sequencing techniques, such as whole-exome sequencing offer great promise to improve the understanding of etiologies of sporadic genetic diseases. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Liu, Lin; Wang, Hong-Dan; Cui, Cun-Ying; Qin, Yun-Yun; Fan, Tai-Bing; Peng, Bang-Tian; Zhang, Lian-Zhong; Wang, Cheng-Zeng
2017-12-05
Tetralogy of Fallot is the most common cyanotic congenital heart disease. However, its pathogenesis remains to be clarified. The purpose of this study was to identify the genetic variants in Tetralogy of Fallot by whole exome sequencing. Whole exome sequencing was performed among eight small families with Tetralogy of Fallot. Differential single nucleotide polymorphisms and small InDels were found by alignment within families and between families and then were verified by Sanger sequencing. Tetralogy of Fallot-related genes were determined by analysis using Gene Ontology /pathway, Online Mendelian Inheritance in Man, PubMed and other databases. A total of sixteen differential single nucleotide polymorphisms loci and eight differential small InDels were discovered. The sixteen differential single nucleotide polymorphisms loci were located on Chr 1, 2, 4, 5, 11, 12, 15, 22 and X. Among the sixteen single nucleotide polymorphisms loci, six has not been reported. The eight differential small InDels were located on Chr 2, 4, 9, 12, 17, 19 and X, whereas of the eight differential small InDels, two has not been reported. Analysis using Gene Ontology /pathway, Online Mendelian Inheritance in Man, PubMed and other databases revealed that PEX5 , NACA , ATXN2 , CELA1 , PCDHB4 and CTBP1 were associated with Tetralogy of Fallot. Our findings identify PEX5 , NACA , ATXN2 , CELA1 , PCDHB4 and CTBP1 mutations as underlying genetic causes of isolated tetralogy of Fallot.
Ali, M A; Al-Hemaid, F M; Lee, J; Hatamleh, A A; Gyulai, G; Rahman, M O
2015-10-02
The present study explored the systematic inventory of Echinops L. (Asteraceae) of Saudi Arabia, with special reference to the molecular typing of Echinops abuzinadianus Chaudhary, an endemic species to Saudi Arabia, based on the internal transcribed spacer (ITS) sequences (ITS1-5.8S-ITS2) of nuclear ribosomal DNA. A sequence similarity search using BLAST and a phylogenetic analysis of the ITS sequence of E. abuzinadianus revealed a high level of sequence similarity with E. glaberrimus DC. (section Ritropsis). The novel primary sequence and the secondary structure of ITS2 of E. abuzinadianus could potentially be used for molecular genotyping.
Nouri, Shahideh; Salem, Nidá; Nigg, Jared C; Falk, Bryce W
2015-12-16
The Asian citrus psyllid, Diaphorina citri, is the natural vector of the causal agent of Huanglongbing (HLB), or citrus greening disease. Together; HLB and D. citri represent a major threat to world citrus production. As there is no cure for HLB, insect vector management is considered one strategy to help control the disease, and D. citri viruses might be useful. In this study, we used a metagenomic approach to analyze viral sequences associated with the global population of D. citri. By sequencing small RNAs and the transcriptome coupled with bioinformatics analysis, we showed that the virus-like sequences of D. citri are diverse. We identified novel viral sequences belonging to the picornavirus superfamily, the Reoviridae, Parvoviridae, and Bunyaviridae families, and an unclassified positive-sense single-stranded RNA virus. Moreover, a Wolbachia prophage-related sequence was identified. This is the first comprehensive survey to assess the viral community from worldwide populations of an agricultural insect pest. Our results provide valuable information on new putative viruses, some of which may have the potential to be used as biocontrol agents. Insects have the most species of all animals, and are hosts to, and vectors of, a great variety of known and unknown viruses. Some of these most likely have the potential to be important fundamental and/or practical resources. In this study, we used high-throughput next-generation sequencing (NGS) technology and bioinformatics analysis to identify putative viruses associated with Diaphorina citri, the Asian citrus psyllid. D. citri is the vector of the bacterium causing Huanglongbing (HLB), currently the most serious threat to citrus worldwide. Here, we report several novel viral sequences associated with D. citri. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
Gubser, Caroline; Smith, Geoffrey L
2002-04-01
Camelpox virus (CMPV) and variola virus (VAR) are orthopoxviruses (OPVs) that share several biological features and cause high mortality and morbidity in their single host species. The sequence of a virulent CMPV strain was determined; it is 202182 bp long, with inverted terminal repeats (ITRs) of 6045 bp and has 206 predicted open reading frames (ORFs). As for other poxviruses, the genes are tightly packed with little non-coding sequence. Most genes within 25 kb of each terminus are transcribed outwards towards the terminus, whereas genes within the centre of the genome are transcribed from either DNA strand. The central region of the genome contains genes that are highly conserved in other OPVs and 87 of these are conserved in all sequenced chordopoxviruses. In contrast, genes towards either terminus are more variable and encode proteins involved in host range, virulence or immunomodulation. In some cases, these are broken versions of genes found in other OPVs. The relationship of CMPV to other OPVs was analysed by comparisons of DNA and predicted protein sequences, repeats within the ITRs and arrangement of ORFs within the terminal regions. Each comparison gave the same conclusion: CMPV is the closest known virus to variola virus, the cause of smallpox.
Jazayeri, Roshanak; Hu, Hao; Fattahi, Zohreh; Musante, Luciana; Abedini, Seyedeh Sedigheh; Hosseini, Masoumeh; Wienker, Thomas F; Ropers, Hans Hilger; Najmabadi, Hossein; Kahrizi, Kimia
2015-10-01
Intellectual disability (ID) is a neuro-developmental disorder which causes considerable socio-economic problems. Some ID individuals are also affected by ataxia, and the condition includes different mutations affecting several genes. We used whole exome sequencing (WES) in combination with homozygosity mapping (HM) to identify the genetic defects in five consanguineous families among our cohort study, with two affected children with ID and ataxia as major clinical symptoms. We identified three novel candidate genes, RIPPLY1, MRPL10, SNX14, and a new mutation in known gene SURF1. All are autosomal genes, except RIPPLY1, which is located on the X chromosome. Two are housekeeping genes, implicated in transcription and translation regulation and intracellular trafficking, and two encode mitochondrial proteins. The pathogenesis of these variants was evaluated by mutation classification, bioinformatic methods, review of medical and biological relevance, co-segregation studies in the particular family, and a normal population study. Linkage analysis and exome sequencing of a small number of affected family members is a powerful new technique which can be used to decrease the number of candidate genes in heterogenic disorders such as ID, and may even identify the responsible gene(s).
Directory of Open Access Journals (Sweden)
Yoshida Takuhiro
2008-06-01
Full Text Available Abstract Background The recent rapid accumulation of sequence resources of various crop species ensures an improvement in the genetics approach, including quantitative trait loci (QTL analysis as well as the holistic population analysis and association mapping of natural variations. Because the tribe Triticeae includes important cereals such as wheat and barley, integration of information on the genetic markers in these crops should effectively accelerate map-based genetic studies on Triticeae species and lead to the discovery of key loci involved in plant productivity, which can contribute to sustainable food production. Therefore, informatics applications and a semantic knowledgebase of genome-wide markers are required for the integration of information on and further development of genetic markers in wheat and barley in order to advance conventional marker-assisted genetic analyses and population genomics of Triticeae species. Description The Triticeae mapped expressed sequence tag (EST database (TriMEDB provides information, along with various annotations, regarding mapped cDNA markers that are related to barley and their homologues in wheat. The current version of TriMEDB provides map-location data for barley and wheat ESTs that were retrieved from 3 published barley linkage maps (the barley single nucleotide polymorphism database of the Scottish Crop Research Institute, the barley transcript map of Leibniz Institute of Plant Genetics and Crop Plant Research, and HarvEST barley ver. 1.63 and 1 diploid wheat map. These data were imported to CMap to allow the visualization of the map positions of the ESTs and interrelationships of these ESTs with public gene models and representative cDNA sequences. The retrieved cDNA sequences corresponding to each EST marker were assigned to the rice genome to predict an exon-intron structure. Furthermore, to generate a unique set of EST markers in Triticeae plants among the public domain, 3472 markers were
Linking Maternal and Somatic 5S rRNA types with Different Sequence-Specific Non-LTR Retrotransposons
Locati, M.D.; Pagano, J.F.B.; Ensink, W.A.; van Olst, M.; van Leeuwen, S.; Nehrdich, U.; Zhu, K.; Spaink, H.P.; Girard, G.; Rauwerda, H.; Jonker, M.J.; Dekker, R.J.; Breit, T.M.
5S rRNA is a ribosomal core component, transcribed from many gene copies organized in genomic repeats. Some eukaryotic species have two 5S rRNA types defined by their predominant expression in oogenesis or adult tissue. Our next-generation sequencing study on zebrafish egg, embryo and adult tissue,
Waldram, Alison; Dolan, Gayle; Ashton, Philip M; Jenkins, Claire; Dallman, Timothy J
2018-05-01
The unprecedented level of bacterial strain discrimination provided by whole genome sequencing (WGS) presents new challenges with respect to the utility and interpretation of the data. Whole genome sequences from 1445 isolates of Salmonella belonging to the most commonly identified serotypes in England and Wales isolated between April and August 2014 were analysed. Single linkage single nucleotide polymorphism thresholds at the 10, 5 and 0 level were explored for evidence of epidemiological links between clustered cases. Analysis of the WGS data organised 566 of the 1445 isolates into 32 clusters of five or more. A statistically significant epidemiological link was identified for 17 clusters. The clusters were associated with foreign travel (n = 8), consumption of Chinese takeaways (n = 4), chicken eaten at home (n = 2), and one each of the following; eating out, contact with another case in the home and contact with reptiles. In the same time frame, one cluster was detected using traditional outbreak detection methods. WGS can be used for the highly specific and highly sensitive detection of biologically related isolates when epidemiological links are obscured. Improvements in the collection of detailed, standardised exposure information would enhance cluster investigations. Copyright © 2017 Elsevier Ltd. All rights reserved.
Chaillou, S.; Lokman, B.C.; Leer, R.J.; Posthuma, C.; Postma, P.W.; Pouwels, P.H.
1998-01-01
Two genes, xylP and xylQ, from the xylose regulon of Lactobacillus pentosus were cloned and sequenced. Together with the repressor gene of the regulon, xylR, the xylPQ genes form an operon which is inducible by xylose and which is transcribed from a promoter located 145 bp upstream of xylP. A
microRNA expression profiling in fetal single ventricle malformation identified by deep sequencing.
Yu, Zhang-Bin; Han, Shu-Ping; Bai, Yun-Fei; Zhu, Chun; Pan, Ya; Guo, Xi-Rong
2012-01-01
microRNAs (miRNAs) have emerged as key regulators in many biological processes, particularly cardiac growth and development, although the specific miRNA expression profile associated with this process remains to be elucidated. This study aimed to characterize the cellular microRNA profile involved in the development of congenital heart malformation, through the investigation of single ventricle (SV) defects. Comprehensive miRNA profiling in human fetal SV cardiac tissue was performed by deep sequencing. Differential expression of 48 miRNAs was revealed by sequencing by oligonucleotide ligation and detection (SOLiD) analysis. Of these, 38 were down-regulated and 10 were up-regulated in differentiated SV cardiac tissue, compared to control cardiac tissue. This was confirmed by real-time quantitative reverse transcription-polymerase chain reaction (qRT-PCR) analysis. Predicted target genes of the 48 differentially expressed miRNAs were analyzed by gene ontology and categorized according to cellular process, regulation of biological process and metabolic process. Pathway-Express analysis identified the WNT and mTOR signaling pathways as the most significant processes putatively affected by the differential expression of these miRNAs. The candidate genes involved in cardiac development were identified as potential targets for these differentially expressed microRNAs and the collaborative network of microRNAs and cardiac development related-mRNAs was constructed. These data provide the basis for future investigation of the mechanism of the occurrence and development of fetal SV malformations.
Motamayor, Juan C; Mockaitis, Keithanne; Schmutz, Jeremy; Haiminen, Niina; Livingstone, Donald; Cornejo, Omar; Findley, Seth D; Zheng, Ping; Utro, Filippo; Royaert, Stefan; Saski, Christopher; Jenkins, Jerry; Podicheti, Ram; Zhao, Meixia; Scheffler, Brian E; Stack, Joseph C; Feltus, Frank A; Mustiga, Guiliana M; Amores, Freddy; Phillips, Wilbert; Marelli, Jean Philippe; May, Gregory D; Shapiro, Howard; Ma, Jianxin; Bustamante, Carlos D; Schnell, Raymond J; Main, Dorrie; Gilbert, Don; Parida, Laxmi; Kuhn, David N
2013-06-03
Theobroma cacao L. cultivar Matina 1-6 belongs to the most cultivated cacao type. The availability of its genome sequence and methods for identifying genes responsible for important cacao traits will aid cacao researchers and breeders. We describe the sequencing and assembly of the genome of Theobroma cacao L. cultivar Matina 1-6. The genome of the Matina 1-6 cultivar is 445 Mbp, which is significantly larger than a sequenced Criollo cultivar, and more typical of other cultivars. The chromosome-scale assembly, version 1.1, contains 711 scaffolds covering 346.0 Mbp, with a contig N50 of 84.4 kbp, a scaffold N50 of 34.4 Mbp, and an evidence-based gene set of 29,408 loci. Version 1.1 has 10x the scaffold N50 and 4x the contig N50 as Criollo, and includes 111 Mb more anchored sequence. The version 1.1 assembly has 4.4% gap sequence, while Criollo has 10.9%. Through a combination of haplotype, association mapping and gene expression analyses, we leverage this robust reference genome to identify a promising candidate gene responsible for pod color variation. We demonstrate that green/red pod color in cacao is likely regulated by the R2R3 MYB transcription factor TcMYB113, homologs of which determine pigmentation in Rosaceae, Solanaceae, and Brassicaceae. One SNP within the target site for a highly conserved trans-acting siRNA in dicots, found within TcMYB113, seems to affect transcript levels of this gene and therefore pod color variation. We report a high-quality sequence and annotation of Theobroma cacao L. and demonstrate its utility in identifying candidate genes regulating traits.
Directory of Open Access Journals (Sweden)
Rawnak Laila
2017-01-01
Full Text Available Clubroot is a soil-borne disease caused by the protist Plasmodiophora brassicae (P. brassicae. It is one of the most economically important diseases of Brassica rapa and other cruciferous crops as it can cause remarkable yield reductions. Understanding P. brassicae genetics, and developing efficient molecular markers, is essential for effective detection of harmful races of this pathogen. Samples from 11 Korean field populations of P. brassicae (geographic isolates, collected from nine different locations in South Korea, were used in this study. Genomic DNA was extracted from the clubroot-infected samples to sequence the ribosomal DNA. Primers and probes for P. brassicae were designed using a ribosomal DNA gene sequence from a Japanese strain available in GenBank (accession number AB526843; isolate NGY. The nuclear ribosomal DNA (rDNA sequence of P. brassicae, comprising 6932 base pairs (bp, was cloned and sequenced and found to include the small subunits (SSUs and a large subunit (LSU, internal transcribed spacers (ITS1 and ITS2, and a 5.8s. Sequence variation was observed in both the SSU and LSU. Four markers showed useful differences in high-resolution melting analysis to identify nucleotide polymorphisms including single- nucleotide polymorphisms (SNPs, oligonucleotide polymorphisms, and insertions/deletions (InDels. A combination of three markers was able to distinguish the geographical isolates into two groups.
Somatic mutations in histiocytic sarcoma identified by next generation sequencing.
Liu, Qingqing; Tomaszewicz, Keith; Hutchinson, Lloyd; Hornick, Jason L; Woda, Bruce; Yu, Hongbo
2016-08-01
Histiocytic sarcoma is a rare malignant neoplasm of presumed hematopoietic origin showing morphologic and immunophenotypic evidence of histiocytic differentiation. Somatic mutation importance in the pathogenesis or disease progression of histiocytic sarcoma was largely unknown. To identify somatic mutations in histiocytic sarcoma, we studied 5 histiocytic sarcomas [3 female and 2 male patients; mean age 54.8 (20-72), anatomic sites include lymph node, uterus, and pleura] and matched normal tissues from each patient as germ line controls. Somatic mutations in 50 "Hotspot" oncogenes and tumor suppressor genes were examined using next generation sequencing. Three (out of five) histiocytic sarcoma cases carried somatic mutations in BRAF. Among them, G464V [variant frequency (VF) of 43.6 %] and G466R (VF of 29.6 %) located at the P loop potentially interfere with the hydrophobic interaction between P and activating loops and ultimately activation of BRAF. Also detected was BRAF somatic mutation N581S (VF of 7.4 %), which was located at the catalytic loop of BRAF kinase domain: its role in modifying kinase activity was unclear. A similar mutational analysis was also performed on nine acute monocytic/monoblastic leukemia cases, which did not identify any BRAF somatic mutations. Our study detected several BRAF mutations in histiocytic sarcomas, which may be important in understanding the tumorigenesis of this rare neoplasm and providing mechanisms for potential therapeutical opportunities.
An improved high throughput sequencing method for studying oomycete communities
DEFF Research Database (Denmark)
Sapkota, Rumakanta; Nicolaisen, Mogens
2015-01-01
the usefulness of the method not only in soil DNA but also in a plant DNA background. In conclusion, we demonstrate a successful approach for pyrosequencing of oomycete communities using ITS1 as the barcode sequence with well-known primers for oomycete DNA amplification....... communities. Thewell-known primer sets ITS4, ITS6 and ITS7were used in the study in a semi-nested PCR approach to target the internal transcribed spacer (ITS) 1 of ribosomal DNA in a next generation sequencing protocol. These primers have been used in similar studies before, butwith limited success.......Wewere able to increase the proportion of retrieved oomycete sequences dramaticallymainly by increasing the annealing temperature during PCR. The optimized protocol was validated using three mock communities and the method was further evaluated using total DNA from 26 soil samples collected from different...
DEFF Research Database (Denmark)
Leekitcharoenphon, Pimlapas; Raufu, Ibrahim; Thorup Nielsen, Mette
2016-01-01
Twenty-six Salmonella enterica serovar Eko isolated from various sources in Nigeria were investigated by whole genome sequencing to identify the source of human infections. Diversity among the isolates was observed and camel and cattle were identified as the primary reservoirs and the most likely...
Dog Y chromosomal DNA sequence: identification, sequencing and SNP discovery
Directory of Open Access Journals (Sweden)
Kirkness Ewen
2006-10-01
Full Text Available Abstract Background Population genetic studies of dogs have so far mainly been based on analysis of mitochondrial DNA, describing only the history of female dogs. To get a picture of the male history, as well as a second independent marker, there is a need for studies of biallelic Y-chromosome polymorphisms. However, there are no biallelic polymorphisms reported, and only 3200 bp of non-repetitive dog Y-chromosome sequence deposited in GenBank, necessitating the identification of dog Y chromosome sequence and the search for polymorphisms therein. The genome has been only partially sequenced for one male dog, disallowing mapping of the sequence into specific chromosomes. However, by comparing the male genome sequence to the complete female dog genome sequence, candidate Y-chromosome sequence may be identified by exclusion. Results The male dog genome sequence was analysed by Blast search against the human genome to identify sequences with a best match to the human Y chromosome and to the female dog genome to identify those absent in the female genome. Candidate sequences were then tested for male specificity by PCR of five male and five female dogs. 32 sequences from the male genome, with a total length of 24 kbp, were identified as male specific, based on a match to the human Y chromosome, absence in the female dog genome and male specific PCR results. 14437 bp were then sequenced for 10 male dogs originating from Europe, Southwest Asia, Siberia, East Asia, Africa and America. Nine haplotypes were found, which were defined by 14 substitutions. The genetic distance between the haplotypes indicates that they originate from at least five wolf haplotypes. There was no obvious trend in the geographic distribution of the haplotypes. Conclusion We have identified 24159 bp of dog Y-chromosome sequence to be used for population genetic studies. We sequenced 14437 bp in a worldwide collection of dogs, identifying 14 SNPs for future SNP analyses, and
Vujaklija, Ivan; Bielen, Ana; Paradžik, Tina; Biđin, Siniša; Goldstein, Pavle; Vujaklija, Dušica
2016-02-18
The massive accumulation of protein sequences arising from the rapid development of high-throughput sequencing, coupled with automatic annotation, results in high levels of incorrect annotations. In this study, we describe an approach to decrease annotation errors of protein families characterized by low overall sequence similarity. The GDSL lipolytic family comprises proteins with multifunctional properties and high potential for pharmaceutical and industrial applications. The number of proteins assigned to this family has increased rapidly over the last few years. In particular, the natural abundance of GDSL enzymes reported recently in plants indicates that they could be a good source of novel GDSL enzymes. We noticed that a significant proportion of annotated sequences lack specific GDSL motif(s) or catalytic residue(s). Here, we applied motif-based sequence analyses to identify enzymes possessing conserved GDSL motifs in selected proteomes across the plant kingdom. Motif-based HMM scanning (Viterbi decoding-VD and posterior decoding-PD) and the here described PD/VD protocol were successfully applied on 12 selected plant proteomes to identify sequences with GDSL motifs. A significant number of identified GDSL sequences were novel. Moreover, our scanning approach successfully detected protein sequences lacking at least one of the essential motifs (171/820) annotated by Pfam profile search (PfamA) as GDSL. Based on these analyses we provide a curated list of GDSL enzymes from the selected plants. CLANS clustering and phylogenetic analysis helped us to gain a better insight into the evolutionary relationship of all identified GDSL sequences. Three novel GDSL subfamilies as well as unreported variations in GDSL motifs were discovered in this study. In addition, analyses of selected proteomes showed a remarkable expansion of GDSL enzymes in the lycophyte, Selaginella moellendorffii. Finally, we provide a general motif-HMM scanner which is easily accessible through
Directory of Open Access Journals (Sweden)
Jonathan A Scolnick
Full Text Available Fusion genes are known to be key drivers of tumor growth in several types of cancer. Traditionally, detecting fusion genes has been a difficult task based on fluorescent in situ hybridization to detect chromosomal abnormalities. More recently, RNA sequencing has enabled an increased pace of fusion gene identification. However, RNA-Seq is inefficient for the identification of fusion genes due to the high number of sequencing reads needed to detect the small number of fusion transcripts present in cells of interest. Here we describe a method, Single Primer Enrichment Technology (SPET, for targeted RNA sequencing that is customizable to any target genes, is simple to use, and efficiently detects gene fusions. Using SPET to target 5701 exons of 401 known cancer fusion genes for sequencing, we were able to identify known and previously unreported gene fusions from both fresh-frozen and formalin-fixed paraffin-embedded (FFPE tissue RNA in both normal tissue and cancer cells.
Baldo, A M; Les, D H; Strausbaugh, L D
1999-11-01
Simplified DNA sequence acquisition has provided many new data sets that are useful for phylogenetic reconstruction, including single- and multiple-copy nuclear and organellar genes. Although transcribed regions receive much attention, nontranscribed regions have recently been added to the repertoire of sequences suitable for phylogenetic studies, especially for closely related taxa. We evaluated the efficacy of a small portion of the histone repeat for phylogenetic reconstruction among Drosophila species. Histone repeats in invertebrates offer distinct advantages similar to those of widely used ribosomal repeats. First, the units are tandemly repeated and undergo concerted evolution. Second, histone repeats include both highly conserved coding and variable intergenic regions. This composition facilitates application of "universal" primers spanning potentially informative sites. We examined a small region of the histone repeat, including the intergenic spacer segments of coding regions from the divergently transcribed H2A and H2B histone genes. The spacer (about 230 bp) exists as a mosaic with highly conserved functional motifs interspersed with rapidly diverging regions; the former aid in alignment of the spacer. There are no ambiguities in alignment of coding regions. Coding and noncoding regions were analyzed together and separately for phylogenetic information. Parsimony, distance, and maximum-likelihood methods successfully retrieve the corroborated phylogeny for the taxa examined. This study demonstrates the resolving power of a small histone region which may now be added to the growing collection of phylogenetically useful DNA sequences.
Directory of Open Access Journals (Sweden)
Zhongyi Yu
2016-11-01
Full Text Available Blown pack spoilage (BPS is a major issue for the beef industry. Aetiological agents of BPS involve members of a group of Clostridium species, including Clostridium estertheticum which has the ability to produce gas, mostly carbon dioxide, under anaerobic psychotrophic growth conditions. This spore-forming bacterium grows slowly under laboratory conditions, and it can take up to 3 months to produce a workable culture. These characteristics have limited the study of this commercially challenging bacterium. Consequently information on this bacterium is limited and no effective controls are currently available to confidently detect and manage this production risk. In this study the complete genome of Clostridium estertheticum DSM 8809 was determined by SMRT® sequencing. The genome consists of a circular chromosome of 4.7 Mbp along with a single plasmid carrying a potential tellurite resistance gene tehB and a Tn3-like resolvase-encoding gene tnpR. The genome sequence was searched for central metabolic pathways that would support its biochemical profile and several enzymes contributing to this phenotype were identified. Several putative antibiotic/biocide/metal resistance-encoding genes and virulence factors were also identified in the genome, a feature that requires further research. The availability of the genome sequence will provide a basic blueprint from which to develop valuable biomarkers that could support and improve the detection and control of this bacterium along the beef production chain.
Bauer, Bianca S; Forsyth, George W; Sandmeyer, Lynne S; Grahn, Bruce H
2011-04-01
Mitochondrial transcription factor A (Tfam) has been implicated in the pathogenesis of retinal dysplasia in miniature schnauzer dogs and it has been proposed that affected dogs have altered mitochondrial numbers, size, and morphology. To test these hypotheses the Tfam gene of affected and normal miniature schnauzer dogs with retinal dysplasia was sequenced and lymphocyte mitochondria were quantified, measured, and the morphology was compared in normal and affected dogs using transmission electron microscopy. For Tfam sequencing, retina, retinal pigment epithelium (RPE), and whole blood samples were collected. Total RNA was isolated from the retina and RPE and reverse transcribed to make cDNA. Genomic DNA was extracted from white blood cell pellets obtained from the whole blood samples. The Tfam coding sequence, 5' promoter region, intron1 and the 3' non-coding sequence of normal and affected dogs were amplified using polymerase chain reaction (PCR), cloned and sequenced. For electron microscopy, lymphocytes from affected and normal dogs were photographed and the mitochondria within each cross-section were identified, quantified, and the mitochondrial area (μm²) per lymphocyte cross-section was calculated. Lastly, using a masked technique, mitochondrial morphology was compared between the 2 groups. Sequencing of the miniature schnauzer Tfam gene revealed no functional sequence variation between affected and normal dogs. Lymphocyte and mitochondrial area, mitochondrial quantification, and morphology assessment also revealed no significant difference between the 2 groups. Further investigation into other candidate genes or factors causing retinal dysplasia in the miniature schnauzer is warranted.
Molecular identification based on ITS sequences for Kappaphycus and Eucheuma cultivated in China
Zhao, Sufen; He, Peimin
2011-11-01
The systematic classification of the Eucheumatoideae is difficult because of their variable morphology and interpretation of reproductive structures. Kappaphycus and Eucheuma specimens cultivated on the Hainan and Fujian coast of China were introduced from Vietnam, the Philippines and Indonesia. Combined with morphological characteristics, all Kappaphycus and Eucheuma cultivated strains were identified by internal transcribed spacer (ITS) sequences. The phylogenetic tree was constructed using neighbor-joining and maximum likelihood methods. The results indicate that different ITS sequence lengths occurred in the different genera and species. An obvious difference in morphology could be found in the protuberance shape between Kappaphycus and Eucheuma. The protuberance in Eucheuma was thorn-like and in Kappaphycus was wartlike or papillate. Their ITS sequence lengths differed significantly in nucleotide variation rates up to 58.55%-63.90%. All nucleotide variations occurred in the ITS1 and ITS2 regions except for five nucleotide transversions in the 5.8S rDNA region. In addition, the difference was at the branches among congeneric species. Kappaphycus sp. had branches with small buds, while K. alvarezii did not have such a feature. The nucleotide variation rates varied from 7.02% to 7.48% among species; within the same species of the clades it was K. alvarezii, Kappaphycus sp., and E. denticulatum. The results indicate that ITS sequence analysis was an effective way for identification of interspecies and intraspecies phylogenetic relationships and might provide a clue for molecular identification of algal Eucheumatoideae.
Directory of Open Access Journals (Sweden)
Topik Hidayat
2016-04-01
Full Text Available Withania somnifera (family Solanaceae, known commonly as Ashwaganda, is one of the important medicinal plants, and recent studies reported that Withanone, one of the chemical components in this plant, has ability to kill cancer cell. Because of endemic state of this plant to South Asia, exploring plant species under the same family which grow well in Indonesia has been of interest. The purpose of this study was to screen the Indonesian plant which has strong phylogenetic relationship with Ashwaganda. Thus, phylogenetic analysis using DNA sequences of internal transcribed spacer (ITS region was conducted. Thus, 19 species of Solanaceae and two species of Convolvulaceae as outgroup were examined. Five ITS regions of Ashwaganda retrieved from GenBank were included in the phylogenetic analysis. Parsimony analysis showed that Indonesia Solanaceae comprises seven groups which is consistent with the global Solanaceae relationship as previously reported. Furthermore, our study revealed that two species, Physalis angulata and Physalis peruviana, are relative to W. somnifera. Morphologically, they share characters of flower and fruit. This result indicated that these two species are potential to have similar chemical properties as Ashwaganda, thus we can have new variants of Withanone originated from Indonesia with similar effect.
Directory of Open Access Journals (Sweden)
Majewski Jacek
2006-08-01
Full Text Available Abstract Background Complementary single-nucleotide polymorphisms (SNPs may not be distributed equally between two DNA strands if the strands are functionally distinct, such as in transcribed genes. In introns, an excess of A↔G over the complementary C↔T substitutions had previously been found and attributed to transcription-coupled repair (TCR, demonstrating the valuable functional clues that can be obtained by studying such asymmetry. Here we studied asymmetry of human synonymous SNPs (sSNPs in the fourfold degenerate (FFD sites as compared to intronic SNPs (iSNPs. Results The identities of the ancestral bases and the direction of mutations were inferred from human-chimpanzee genomic alignment. After correction for background nucleotide composition, excess of A→G over the complementary T→C polymorphisms, which was observed previously and can be explained by TCR, was confirmed in FFD SNPs and iSNPs. However, when SNPs were separately examined according to whether they mapped to a CpG dinucleotide or not, an excess of C→T over G→A polymorphisms was found in non-CpG site FFD SNPs but was absent from iSNPs and CpG site FFD SNPs. Conclusion The genome-wide discrepancy of human FFD SNPs provides novel evidence for widespread selective pressure due to functional effects of sSNPs. The similar asymmetry pattern of FFD SNPs and iSNPs that map to a CpG can be explained by transcription-coupled mechanisms, including TCR and transcription-coupled mutation. Because of the hypermutability of CpG sites, more CpG site FFD SNPs are relatively younger and have confronted less selection effect than non-CpG FFD SNPs, which can explain the asymmetric discrepancy of CpG site FFD SNPs vs. non-CpG site FFD SNPs.
International Nuclear Information System (INIS)
Klimov, Eugene; Vinokourova, Svetlana; Moisjak, Elena; Rakhmanaliev, Elian; Kobseva, Vera; Laimins, Laimonis; Kisseljov, Fjodor; Sulimova, Galina
2002-01-01
In cervical tumours the integration of human papilloma viruses (HPV) transcripts often results in the generation of transcripts that consist of hybrids of viral and cellular sequences. Mapping data using a variety of techniques has demonstrated that HPV integration occurred without obvious specificity into human genome. However, these techniques could not demonstrate whether integration resulted in the generation of transcripts encoding viral or viral-cellular sequences. The aim of this work was to map the integration sites of HPV DNA and to analyse the adjacent cellular sequences. Amplification of the INTs was done by the APOT technique. The APOT products were sequenced according to standard protocols. The analysis of the sequences was performed using BLASTN program and public databases. To localise the INTs PCR-based screening of GeneBridge4-RH-panel was used. Twelve cellular sequences adjacent to integrated HPV16 (INT markers) expressed in squamous cell cervical carcinomas were isolated. For 11 INT markers homologous human genomic sequences were readily identified and 9 of these showed significant homologies to known genes/ESTs. Using the known locations of homologous cDNAs and the RH-mapping techniques, mapping studies showed that the INTs are distributed among different human chromosomes for each tumour sample and are located in regions with the high levels of expression. Integration of HPV genomes occurs into the different human chromosomes but into regions that contain highly transcribed genes. One interpretation of these studies is that integration of HPV occurs into decondensed regions, which are more accessible for integration of foreign DNA
Mahato, Ajay Kumar; Sharma, Nimisha; Singh, Akshay; Srivastav, Manish; Jaiprakash; Singh, Sanjay Kumar; Singh, Anand Kumar; Sharma, Tilak Raj; Singh, Nagendra Kumar
2016-01-01
Mango (Mangifera indica L.) is called "king of fruits" due to its sweetness, richness of taste, diversity, large production volume and a variety of end usage. Despite its huge economic importance genomic resources in mango are scarce and genetics of useful horticultural traits are poorly understood. Here we generated deep coverage leaf RNA sequence data for mango parental varieties 'Neelam', 'Dashehari' and their hybrid 'Amrapali' using next generation sequencing technologies. De-novo sequence assembly generated 27,528, 20,771 and 35,182 transcripts for the three genotypes, respectively. The transcripts were further assembled into a non-redundant set of 70,057 unigenes that were used for SSR and SNP identification and annotation. Total 5,465 SSR loci were identified in 4,912 unigenes with 288 type I SSR (n ≥ 20 bp). One hundred type I SSR markers were randomly selected of which 43 yielded PCR amplicons of expected size in the first round of validation and were designated as validated genic-SSR markers. Further, 22,306 SNPs were identified by aligning high quality sequence reads of the three mango varieties to the reference unigene set, revealing significantly enhanced SNP heterozygosity in the hybrid Amrapali. The present study on leaf RNA sequencing of mango varieties and their hybrid provides useful genomic resource for genetic improvement of mango.
Callejón, R; Halajian, A; de Rojas, M; Marrugal, A; Guevara, D; Cutillas, C
2012-05-25
Comparative morphological, biometrical and molecular studies of Trichuris discolor isolated from Bos taurus from Spain and Iran was carried out. Furthermore, Trichuris ovis isolated from B. taurus and Capra hircus from Spain has been, molecularly, analyzed. Morphological studies revealed clear differences between T. ovis and T. discolor isolated from B. taurus but differences were not observed between populations of T. discolor isolated from different geographical regions. Nevertheless, the molecular studies based on the amplification and sequencing of the internal transcribed spacers 1 and 2 ribosomal DNA and 16S partial gene mitochondrial DNA showed clear differences between both populations of T. discolor from Spain and Iran suggesting two cryptic species. Phylogenetic studies corroborated these data. Thus, phylogenetic trees based on ITS1, ITS2 and 16S partial gene sequences showed that individuals of T. discolor from B. taurus from Iran clustered together and separated, with high bootstrap values, of T. discolor isolated from B. taurus from Spain, while populations of T. ovis from B. taurus and C. hircus from Spain clustered together but separated with high bootstrap values of both populations of T. discolor. Furthermore, a comparative phylogenetic study has been carried out with the ITS1and ITS2 sequences of Trichuris species from different hosts. Three clades were observed: the first clustered all the species of Trichuris parasitizing herbivores (T. discolor, T. ovis, Trichuris leporis and Trichuris skrjabini), the second clustered all the species of Trichuris parasitizing omnivores (Trichuris trichiura and Trichuris suis) and finally, the third clustered species of Trichuris parasitizing carnivores (Trichuris muris, Trichuris arvicolae and Trichuris vulpis). Copyright © 2011 Elsevier B.V. All rights reserved.
Bunawan, Hamidun; Yen, Choong Chee; Yaakop, Salmah; Noor, Normah Mohd
2017-01-01
Background The chloroplastic trnL intron and the nuclear internal transcribed spacer (ITS) region were sequenced for 11 Nepenthes species recorded in Peninsular Malaysia to examine their phylogenetic relationship and to evaluate the usage of trnL intron and ITS sequences for phylogenetic reconstruction of this genus. Results Phylogeny reconstruction was carried out using neighbor-joining, maximum parsimony and Bayesian analyses. All the trees revealed two major clusters, a lowland group consi...
Purba, H.; Musu, J. T.; Diria, S. A.; Permono, W.; Sadjati, O.; Sopandi, I.; Ruzi, F.
2018-03-01
Well logging data provide many geological information and its trends resemble nonlinear or non-stationary signals. As long well log data recorded, there will be external factors can interfere or influence its signal resolution. A sensitive signal analysis is required to improve the accuracy of logging interpretation which it becomes an important thing to determine sequence stratigraphy. Complete Ensemble Empirical Mode Decomposition (CEEMD) is one of nonlinear and non-stationary signal analysis method which decomposes complex signal into a series of intrinsic mode function (IMF). Gamma Ray and Spontaneous Potential well log parameters decomposed into IMF-1 up to IMF-10 and each of its combination and correlation makes physical meaning identification. It identifies the stratigraphy and cycle sequence and provides an effective signal treatment method for sequence interface. This method was applied to BRK- 30 and BRK-13 well logging data. The result shows that the combination of IMF-5, IMF-6, and IMF-7 pattern represent short-term and middle-term while IMF-9 and IMF-10 represent the long-term sedimentation which describe distal front and delta front facies, and inter-distributary mouth bar facies, respectively. Thus, CEEMD clearly can determine the different sedimentary layer interface and better identification of the cycle of stratigraphic base level.
Raibaud, O; Débarbouillé, M; Cossart, P
1982-01-01
A 5,800-bp (base pair) HindIII-EcoRI DNA fragment containing malT, the positive regulator gene of the maltose regulon, and most of malP, the structural gene for maltodextrin phosphorylase, was cloned into pBR322. A sequence of 802 bp was established in a DNA segment containing the promotor for malPQ and the promoter for malT. A total of 611 bp separates the initiation codons for these two genes, which are transcribed in opposite directions. The malT product was identified as a 94,000 dalton polypeptide.
Theodorus H. de Koker; Karen K. Nakasone; Jacques Haarhof; Harold H. Burdsall; Bernard J.H. Janse
2003-01-01
Phanerochaete is a genus of resupinate homobasidiomycetes that are saprophytic on woody debris and logs. Morphological studies in the past indicated that Phanerochaete is a heterogeneous assemblage of species. In this study the internal transcribed spacer (ITS) region of the nuclear ribosomal DNA was used to test the monophyly of the genus Phanerochaete and to infer...
2013-01-01
Background Theobroma cacao L. cultivar Matina 1-6 belongs to the most cultivated cacao type. The availability of its genome sequence and methods for identifying genes responsible for important cacao traits will aid cacao researchers and breeders. Results We describe the sequencing and assembly of the genome of Theobroma cacao L. cultivar Matina 1-6. The genome of the Matina 1-6 cultivar is 445 Mbp, which is significantly larger than a sequenced Criollo cultivar, and more typical of other cultivars. The chromosome-scale assembly, version 1.1, contains 711 scaffolds covering 346.0 Mbp, with a contig N50 of 84.4 kbp, a scaffold N50 of 34.4 Mbp, and an evidence-based gene set of 29,408 loci. Version 1.1 has 10x the scaffold N50 and 4x the contig N50 as Criollo, and includes 111 Mb more anchored sequence. The version 1.1 assembly has 4.4% gap sequence, while Criollo has 10.9%. Through a combination of haplotype, association mapping and gene expression analyses, we leverage this robust reference genome to identify a promising candidate gene responsible for pod color variation. We demonstrate that green/red pod color in cacao is likely regulated by the R2R3 MYB transcription factor TcMYB113, homologs of which determine pigmentation in Rosaceae, Solanaceae, and Brassicaceae. One SNP within the target site for a highly conserved trans-acting siRNA in dicots, found within TcMYB113, seems to affect transcript levels of this gene and therefore pod color variation. Conclusions We report a high-quality sequence and annotation of Theobroma cacao L. and demonstrate its utility in identifying candidate genes regulating traits. PMID:23731509
Identifying Students' Conceptions of Basic Principles in Sequence Stratigraphy
Herrera, Juan S.; Riggs, Eric M.
2013-01-01
Sequence stratigraphy is a major research subject in the geosciences academia and the oil industry. However, the geoscience education literature addressing students' understanding of the basic concepts of sequence stratigraphy is relatively thin, and the topic has not been well explored. We conducted an assessment of 27 students' conceptions of…
A software pipeline for processing and identification of fungal ITS sequences
Directory of Open Access Journals (Sweden)
Kristiansson Erik
2009-01-01
Full Text Available Abstract Background Fungi from environmental samples are typically identified to species level through DNA sequencing of the nuclear ribosomal internal transcribed spacer (ITS region for use in BLAST-based similarity searches in the International Nucleotide Sequence Databases. These searches are time-consuming and regularly require a significant amount of manual intervention and complementary analyses. We here present software – in the form of an identification pipeline for large sets of fungal ITS sequences – developed to automate the BLAST process and several additional analysis steps. The performance of the pipeline was evaluated on a dataset of 350 ITS sequences from fungi growing as epiphytes on building material. Results The pipeline was written in Perl and uses a local installation of NCBI-BLAST for the similarity searches of the query sequences. The variable subregion ITS2 of the ITS region is extracted from the sequences and used for additional searches of higher sensitivity. Multiple alignments of each query sequence and its closest matches are computed, and query sequences sharing at least 50% of their best matches are clustered to facilitate the evaluation of hypothetically conspecific groups. The pipeline proved to speed up the processing, as well as enhance the resolution, of the evaluation dataset considerably, and the fungi were found to belong chiefly to the Ascomycota, with Penicillium and Aspergillus as the two most common genera. The ITS2 was found to indicate a different taxonomic affiliation than did the complete ITS region for 10% of the query sequences, though this figure is likely to vary with the taxonomic scope of the query sequences. Conclusion The present software readily assigns large sets of fungal query sequences to their respective best matches in the international sequence databases and places them in a larger biological context. The output is highly structured to be easy to process, although it still needs
Kiel, Mark J; Velusamy, Thirunavukkarasu; Betz, Bryan L; Zhao, Lili; Weigelin, Helmut G; Chiang, Mark Y; Huebner-Chan, David R; Bailey, Nathanael G; Yang, David T; Bhagat, Govind; Miranda, Roberto N; Bahler, David W; Medeiros, L Jeffrey; Lim, Megan S; Elenitoba-Johnson, Kojo S J
2012-08-27
Splenic marginal zone lymphoma (SMZL), the most common primary lymphoma of spleen, is poorly understood at the genetic level. In this study, using whole-genome DNA sequencing (WGS) and confirmation by Sanger sequencing, we observed mutations identified in several genes not previously known to be recurrently altered in SMZL. In particular, we identified recurrent somatic gain-of-function mutations in NOTCH2, a gene encoding a protein required for marginal zone B cell development, in 25 of 99 (∼25%) cases of SMZL and in 1 of 19 (∼5%) cases of nonsplenic MZLs. These mutations clustered near the C-terminal proline/glutamate/serine/threonine (PEST)-rich domain, resulting in protein truncation or, rarely, were nonsynonymous substitutions affecting the extracellular heterodimerization domain (HD). NOTCH2 mutations were not present in other B cell lymphomas and leukemias, such as chronic lymphocytic leukemia/small lymphocytic lymphoma (CLL/SLL; n = 15), mantle cell lymphoma (MCL; n = 15), low-grade follicular lymphoma (FL; n = 44), hairy cell leukemia (HCL; n = 15), and reactive lymphoid hyperplasia (n = 14). NOTCH2 mutations were associated with adverse clinical outcomes (relapse, histological transformation, and/or death) among SMZL patients (P = 0.002). These results suggest that NOTCH2 mutations play a role in the pathogenesis and progression of SMZL and are associated with a poor prognosis.
Directory of Open Access Journals (Sweden)
Bo Gong
2015-01-01
Full Text Available Retinitis pigmentosa (RP is the most important hereditary retinal disease caused by progressive degeneration of the photoreceptor cells. This study is to identify gene mutations responsible for autosomal recessive retinitis pigmentosa (arRP in a Chinese family using next-generation sequencing technology. A Chinese family with 7 members including two individuals affected with severe early-onset RP was studied. All patients underwent a complete ophthalmic examination. Exome sequencing was performed on a single RP patient (the proband of this family and direct Sanger sequencing on other family members and normal controls was followed to confirm the causal mutations. A homozygous mutation c.437Tidentified as being related to the phenotype of this arRP family. This homozygous mutation was detected in the two affected patients, but not present in other family members and 600 normal controls. Another three normal members in the family were found to carry this heterozygous missense mutation. Our results emphasize the importance of c.437T
Targeted sequencing of large genomic regions with CATCH-Seq.
Directory of Open Access Journals (Sweden)
Kenneth Day
Full Text Available Current target enrichment systems for large-scale next-generation sequencing typically require synthetic oligonucleotides used as capture reagents to isolate sequences of interest. The majority of target enrichment reagents are focused on gene coding regions or promoters en masse. Here we introduce development of a customizable targeted capture system using biotinylated RNA probe baits transcribed from sheared bacterial artificial chromosome clone templates that enables capture of large, contiguous blocks of the genome for sequencing applications. This clone adapted template capture hybridization sequencing (CATCH-Seq procedure can be used to capture both coding and non-coding regions of a gene, and resolve the boundaries of copy number variations within a genomic target site. Furthermore, libraries constructed with methylated adapters prior to solution hybridization also enable targeted bisulfite sequencing. We applied CATCH-Seq to diverse targets ranging in size from 125 kb to 3.5 Mb. Our approach provides a simple and cost effective alternative to other capture platforms because of template-based, enzymatic probe synthesis and the lack of oligonucleotide design costs. Given its similarity in procedure, CATCH-Seq can also be performed in parallel with commercial systems.
Directory of Open Access Journals (Sweden)
Jianfeng WANG
2011-08-01
Full Text Available Aphids of the subtribe Aphidina are found mainly in the North Temperate Zone. The relative lack of diagnostic morphological characteristics has obscured the identification of species in this group. However, DNA-based taxonomic methods can clarify species relationships within this group. Sequence variation in a partial segment of the mitochondrial COI gene was highly effective for resolving species relationships within Aphidina. Forty-five species were correctly identified in a neighbor-joining tree. Mean intraspecific sequence divergence was 0.17%, with a range of 0.00% to 1.54%. Mean interspecific divergence within previously recognized genera or morphologically similar species groups was 4.54%, with variation mainly in the range of 3.50% to 8.00%. Possible reasons for anomalous levels of mean nucleotide divergence within or between some taxa are discussed.
Directory of Open Access Journals (Sweden)
Shanshan Xu
2017-10-01
Full Text Available Abstract Background Noonan syndrome (NS and Noonan syndrome with multiple lentigines (NSML are autosomal dominant developmental disorders. NS and NSML are caused by abnormalities in genes that encode proteins related to the RAS-MAPK pathway, including PTPN11, RAF1, BRAF, and MAP2K. In this study, we diagnosed ten NS or NSML patients via targeted sequencing or whole exome sequencing (TS/WES. Methods TS/WES was performed to identify mutations in ten Chinese patients who exhibited the following manifestations: potential facial dysmorphisms, short stature, congenital heart defects, and developmental delay. Sanger sequencing was used to confirm the suspected pathological variants in the patients and their family members. Results TS/WES revealed three mutations in the PTPN11 gene, three mutations in RAF1 gene, and four mutations in BRAF gene in the NS and NSML patients who were previously diagnosed based on the abovementioned clinical features. All the identified mutations were determined to be de novo mutations. However, two patients who carried the same mutation in the RAF1 gene presented different clinical features. One patient with multiple lentigines was diagnosed with NSML, while the other patient without lentigines was diagnosed with NS. In addition, a patient who carried a hotspot mutation in the BRAF gene was diagnosed with NS instead of cardiofaciocutaneous syndrome (CFCS. Conclusions TS/WES has emerged as a useful tool for definitive diagnosis and accurate genetic counseling of atypical cases. In this study, we analyzed ten Chinese patients diagnosed with NS and related disorders and identified their correspondingPTPN11, RAF1, and BRAF mutations. Among the target genes, BRAF showed the same degree of correlation with NS incidence as that of PTPN11 or RAF1.
Kukita, Yoji; Matoba, Ryo; Uchida, Junji; Hamakawa, Takuya; Doki, Yuichiro; Imamura, Fumio; Kato, Kikuya
2015-08-01
Circulating tumour DNA (ctDNA) is an emerging field of cancer research. However, current ctDNA analysis is usually restricted to one or a few mutation sites due to technical limitations. In the case of massively parallel DNA sequencers, the number of false positives caused by a high read error rate is a major problem. In addition, the final sequence reads do not represent the original DNA population due to the global amplification step during the template preparation. We established a high-fidelity target sequencing system of individual molecules identified in plasma cell-free DNA using barcode sequences; this system consists of the following two steps. (i) A novel target sequencing method that adds barcode sequences by adaptor ligation. This method uses linear amplification to eliminate the errors introduced during the early cycles of polymerase chain reaction. (ii) The monitoring and removal of erroneous barcode tags. This process involves the identification of individual molecules that have been sequenced and for which the number of mutations have been absolute quantitated. Using plasma cell-free DNA from patients with gastric or lung cancer, we demonstrated that the system achieved near complete elimination of false positives and enabled de novo detection and absolute quantitation of mutations in plasma cell-free DNA. © The Author 2015. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.
ITS-2 sequences-based identification of Trichogramma species in South America
Directory of Open Access Journals (Sweden)
R. P. Almeida
Full Text Available Abstract ITS2 (Internal transcribed spacer 2 sequences have been used in systematic studies and proved to be useful in providing a reliable identification of Trichogramma species. DNAr sequences ranged in size from 379 to 632 bp. In eleven T. pretiosum lines Wolbachia-induced parthenogenesis was found for the first time. These thelytokous lines were collected in Peru (9, Colombia (1 and USA (1. A dichotomous key for species identification was built based on the size of the ITS2 PCR product and restriction analysis using three endonucleases (EcoRI, MseI and MaeI. This molecular technique was successfully used to distinguish among seventeen native/introduced Trichogramma species collected in South America.
Directory of Open Access Journals (Sweden)
Pimlapas Leekitcharoenphon
Full Text Available Twenty-six Salmonella enterica serovar Eko isolated from various sources in Nigeria were investigated by whole genome sequencing to identify the source of human infections. Diversity among the isolates was observed and camel and cattle were identified as the primary reservoirs and the most likely source of the human infections.
3D MR cisternography to identify distal dural rings. Comparison of 3D-CISS and 3D-SPACE sequences
International Nuclear Information System (INIS)
Watanabe, Yoshiyuki; Makidono, Akari; Nakamura, Miho; Saida, Yukihisa
2011-01-01
The distal dural ring (DDR) is an anatomical landmark used to distinguish intra- and extradural aneurysms. We investigated identification of the DDR using 2 three-dimensional (3D) magnetic resonance (MR) cisternography sequences-3D constructive interference in steady state (CISS) and 3D sampling perfection with application optimized contrasts using different flip angle evolutions (SPACE)-at 3.0 tesla. Ten healthy adult volunteers underwent imaging with 3D-CISS, 3D-SPACE, and time-of-flight (TOF) MR angiography (TOF-MRA) sequences at 3.0T. We analyzed DDR identification and internal carotid artery (ICA) signal intensity and classified the shape of the carotid cave. We identified the DDR using both 3D-SPACE and 3D-CISS, with no significant difference between the sequences. Visualization of the outline of the ICA in the cavernous sinus (CS) was significantly clearer with 3D-SPACE than 3D-CISS. In the CS and petrous portions, signal intensity was lower with 3D-SPACE, and the flow void was poor with 3D-CISS in some subjects. We identified the DDR with both 3D-SPACE and 3D-CISS, but the superior contrast of the ICA in the CS using 3D-SPACE suggests the superiority of this sequence for evaluating the DDR. (author)
Liu, Xiaoying; Mody, Kabir; de Abreu, Francine B; Pipas, J Marc; Peterson, Jason D; Gallagher, Torrey L; Suriawinata, Arief A; Ripple, Gregory H; Hourdequin, Kathryn C; Smith, Kerrington D; Barth, Richard J; Colacchio, Thomas A; Tsapakos, Michael J; Zaki, Bassem I; Gardner, Timothy B; Gordon, Stuart R; Amos, Christopher I; Wells, Wendy A; Tsongalis, Gregory J
2014-07-01
Some epithelial neoplasms of the appendix, including low-grade appendiceal mucinous neoplasm and adenocarcinoma, can result in pseudomyxoma peritonei (PMP). Little is known about the mutational spectra of these tumor types and whether mutations may be of clinical significance with respect to therapeutic selection. In this study, we identified somatic mutations using the Ion Torrent AmpliSeq Cancer Hotspot Panel v2. Specimens consisted of 3 nonneoplastic retention cysts/mucocele, 15 low-grade mucinous neoplasms (LAMNs), 8 low-grade/well-differentiated mucinous adenocarcinomas with pseudomyxoma peritonei, and 12 adenocarcinomas with/without goblet cell/signet ring cell features. Barcoded libraries were prepared from up to 10 ng of extracted DNA and multiplexed on single 318 chips for sequencing. Data analysis was performed using Golden Helix SVS. Variants that remained after the analysis pipeline were individually interrogated using the Integrative Genomics Viewer. A single Janus kinase 3 (JAK3) mutation was detected in the mucocele group. Eight mutations were identified in the V-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog (KRAS) and GNAS complex locus (GNAS) genes among LAMN samples. Additional gene mutations were identified in the AKT1 (v-akt murine thymoma viral oncogene homolog 1), APC (adenomatous polyposis coli), JAK3, MET (met proto-oncogene), phosphatidylinositol-4,5-bisphosphate 3-kinase (PIK3CA), RB1 (retinoblastoma 1), STK11 (serine/threonine kinase 11), and tumor protein p53 (TP53) genes. Among the PMPs, 6 mutations were detected in the KRAS gene and also in the GNAS, TP53, and RB1 genes. Appendiceal cancers showed mutations in the APC, ATM (ataxia telangiectasia mutated), KRAS, IDH1 [isocitrate dehydrogenase 1 (NADP+)], NRAS [neuroblastoma RAS viral (v-ras) oncogene homolog], PIK3CA, SMAD4 (SMAD family member 4), and TP53 genes. Our results suggest molecular heterogeneity among epithelial tumors of the appendix. Next generation sequencing efforts
Locati, Mauro D; Pagano, Johanna F B; Ensink, Wim A; van Olst, Marina; van Leeuwen, Selina; Nehrdich, Ulrike; Zhu, Kongju; Spaink, Herman P; Girard, Geneviève; Rauwerda, Han; Jonker, Martijs J; Dekker, Rob J; Breit, Timo M
2017-04-01
5S rRNA is a ribosomal core component, transcribed from many gene copies organized in genomic repeats. Some eukaryotic species have two 5S rRNA types defined by their predominant expression in oogenesis or adult tissue. Our next-generation sequencing study on zebrafish egg, embryo, and adult tissue identified maternal-type 5S rRNA that is exclusively accumulated during oogenesis, replaced throughout the embryogenesis by a somatic-type, and thus virtually absent in adult somatic tissue. The maternal-type 5S rDNA contains several thousands of gene copies on chromosome 4 in tandem repeats with small intergenic regions, whereas the somatic-type is present in only 12 gene copies on chromosome 18 with large intergenic regions. The nine-nucleotide variation between the two 5S rRNA types likely affects TFIII binding and riboprotein L5 binding, probably leading to storage of maternal-type rRNA. Remarkably, these sequence differences are located exactly at the sequence-specific target site for genome integration by the 5S rRNA-specific Mutsu retrotransposon family. Thus, we could define maternal- and somatic-type MutsuDr subfamilies. Furthermore, we identified four additional maternal-type and two new somatic-type MutsuDr subfamilies, each with their own target sequence. This target-site specificity, frequently intact maternal-type retrotransposon elements, plus specific presence of Mutsu retrotransposon RNA and piRNA in egg and adult tissue, suggest an involvement of retrotransposons in achieving the differential copy number of the two types of 5S rDNA loci. © 2017 Locati et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.
Taylor, Robin L; Bailey, Jeffrey Craig; Freshwater, David Wilson
2017-06-01
Identification of Cladophora species is challenging due to conservation of gross morphology, few discrete autapomorphies, and environmental influences on morphology. Twelve species of marine Cladophora were reported from North Carolina waters. Cladophora specimens were collected from inshore and offshore marine waters for DNA sequence and morphological analyses. The nuclear-encoded rRNA internal transcribed spacer regions (ITS) were sequenced for 105 specimens and used in molecular assisted identification. The ITS1 and ITS2 region was highly variable, and sequences were sorted into ITS Sets of Alignable Sequences (SASs). Sequencing of short hyper-variable ITS1 sections from Cladophora type specimens was used to positively identify species represented by SASs when the types were made available. Secondary structures for the ITS1 locus were also predicted for each specimen and compared to predicted structures from Cladophora sequences available in GenBank. Nine ITS SASs were identified and representative specimens chosen for phylogenetic analyses of 18S and 28S rRNA gene sequences to reveal relationships with other Cladophora species. Phylogenetic analyses indicated that marine Cladophorales were polyphyletic and separated into two clades, the Cladophora clade and the "Siphonocladales" clade. Morphological analyses were performed to assess the consistency of character states within species, and complement the DNA sequence analyses. These analyses revealed intra- and interspecific character state variation, and that combined molecular and morphological analyses were required for the identification of species. One new report, Cladophora dotyana, and one new species Cladophora subtilissima sp. nov., were revealed, and increased the biodiversity of North Carolina marine Cladophora to 14 species. © 2017 Phycological Society of America.
Directory of Open Access Journals (Sweden)
Alexander C Outhred
Full Text Available Improved tuberculosis control and the need to contain the spread of drug-resistant strains provide a strong rationale for exploring tuberculosis transmission dynamics at the population level. Whole-genome sequencing provides optimal strain resolution, facilitating detailed mapping of potential transmission pathways.We sequenced 22 isolates from a Mycobacterium tuberculosis cluster in New South Wales, Australia, identified during routine 24-locus mycobacterial interspersed repetitive unit typing. Following high-depth paired-end sequencing using the Illumina HiSeq 2000 platform, two independent pipelines were employed for analysis, both employing read mapping onto reference genomes as well as de novo assembly, to control biases in variant detection. In addition to single-nucleotide polymorphisms, the analyses also sought to identify insertions, deletions and structural variants.Isolates were highly similar, with a distance of 13 variants between the most distant members of the cluster. The most sensitive analysis classified the 22 isolates into 18 groups. Four of the isolates did not appear to share a recent common ancestor with the largest clade; another four isolates had an uncertain ancestral relationship with the largest clade.Whole genome sequencing, with analysis of single-nucleotide polymorphisms, insertions, deletions, structural variants and subpopulations, enabled the highest possible level of discrimination between cluster members, clarifying likely transmission pathways and exposing the complexity of strain origin. The analysis provides a basis for targeted public health intervention and enhanced classification of future isolates linked to the cluster.
Transcribed DNA is preferentially located in the perichromatin region of mammalian cell nuclei
Energy Technology Data Exchange (ETDEWEB)
Niedojadlo, Janusz [Centre of Electron Microscopy, University of Lausanne, Bugnon 27, CH-1005 Lausanne (Switzerland); Department of Cell Biology, Institute of General and Molecular Biology, Nicolaus Copernicus University, PL-87-100 Torun (Poland); Perret-Vivancos, Cecile [Centre of Electron Microscopy, University of Lausanne, Bugnon 27, CH-1005 Lausanne (Switzerland); Kalland, Karl-Henning [Centre for Research in Virology, The Gade Institute, University of Bergen, Jonas Liesv. 91, N-5009 Bergen (Norway); Cmarko, Dusan [Centre of Electron Microscopy, University of Lausanne, Bugnon 27, CH-1005 Lausanne (Switzerland); Charles University in Prague, First Faculty of Medicine, Institute of Cellular Biology and Pathology, and Department of Cell Biology, Institute of Physiology, Academy of Sciences of the Czech Republic, v.v.i., Albertov 4, CZ-12801 Prague (Czech Republic); Cremer, Thomas [Department of Biology II, LMU Biozentrum, Grosshaderner Strasse 2, D-82152 Planegg-Martinsried (Germany); Center for Integrated Protein Science Munich (CIPSM), LMU Munich, Munich (Germany); Driel, Roel van, E-mail: r.vandriel@uva.nl [Swammerdam Institute for Life Sciences, University of Amsterdam, P.O. Box 94215, 1090GE Amsterdam (Netherlands); Fakan, Stanislav, E-mail: sfakan@lrz.uni-muenchen.de [Centre of Electron Microscopy, University of Lausanne, Bugnon 27, CH-1005 Lausanne (Switzerland); Department of Biology II, LMU Biozentrum, Grosshaderner Strasse 2, D-82152 Planegg-Martinsried (Germany); Center for Integrated Protein Science Munich (CIPSM), LMU Munich, Munich (Germany)
2011-02-15
The precise localization of transcribed DNA and resulting RNA is an important aspect of the functional architecture of the nucleus. To this end we have developed a novel in situ hybridization approach in combination with immunoelectron microscopy, using sense and anti-sense RNA probes that are derived from total cellular or cytoplasmic poly(A+) RNA. This new technology is much more gentle than classical in situ hybridization using DNA probes and shows excellent preservation of nuclear structure. Carried out on ultrathin sections of fixed and resin-embedded COS-7 cells, it revealed at high resolution the localization of the genes that code for the cellular mRNAs. Quantitative analysis shows that most transcribed DNA is concentrated in the perichromatin region, i.e. the interface between subchromosomal compact chromatin domains and the interchromatin space essentially devoid of DNA. The RNA that is produced is found mainly in the perichromatin region and the interchromatin space. These results imply that in the mammalian nucleus the chromatin fiber is folded so that active genes are predominantly present in the perichromatin region, which is the most prominent site of transcription.
International Nuclear Information System (INIS)
Leadon, S.A.; Copper, P.K.
1993-01-01
Cells from patients with Cockayne syndrome (CS), which are sensitive to killing by UV although overall damage removal appears normal, are specifically defective in repair of UV damage in actively transcribe genes. Because several CS strains display cross-sensitivity to killing by ionizing radiation, the authors examined whether ionizing radiation-induced damage in active genes is preferentially repaired by normal cells and whether the radiosensitivity of CS cells can be explained by a defect in this process. They found that ionizing radiation-induced damage was repaired more rapidly in the transcriptionally active metallothionein IIA (MTIIA) gene than in the inactive MTIIB gene or in the genome overall in normal cells as a result of faster repair on the transcribed strand of MTIIA. Cells of the radiosensitive CS strain CS1AN are completely defective in this strand-selective repair of ionizing radiation-induced damage, although their overall repair rate appears normal. CS3BE cells, which are intermediate in radiosensitivity, do exhibit more rapid repair of the transcribed strand but at a reduced rate compared to normal cells. Xeroderma pigmentosum complementation group A cells, which are hypersensitive to UV light because of a defect in the nucleotide excision repair pathway but do not show increased sensitivity to ionizing radiation, preferentially repair ionizing radiation-induced damage on the transcribed strand of MTIIA. Thus, the ability to rapidly repair ionizing radiation-induced damage in actively transcribing genes correlates with cell survival. The results extend the generality of preferential repair in active genes to include damage other than bulky lesions
Zhang, Tianxiao; Hou, Liping; Chen, David T; McMahon, Francis J; Wang, Jen-Chyong; Rice, John P
2018-03-01
Bipolar disorder is a mental illness with lifetime prevalence of about 1%. Previous genetic studies have identified multiple chromosomal linkage regions and candidate genes that might be associated with bipolar disorder. The present study aimed to identify potential susceptibility variants for bipolar disorder using 6 related case samples from a four-generation family. A combination of exome sequencing and linkage analysis was performed to identify potential susceptibility variants for bipolar disorder. Our study identified a list of five potential candidate genes for bipolar disorder. Among these five genes, GRID1(Glutamate Receptor Delta-1 Subunit), which was previously reported to be associated with several psychiatric disorders and brain related traits, is particularly interesting. Variants with functional significance in this gene were identified from two cousins in our bipolar disorder pedigree. Our findings suggest a potential role for these genes and the related rare variants in the onset and development of bipolar disorder in this one family. Additional research is needed to replicate these findings and evaluate their patho-biological significance. Copyright © 2017 Elsevier B.V. All rights reserved.
Gini, Beatrice; Mischel, Paul S
2014-08-01
Single-cell sequencing approaches are needed to characterize the genomic diversity of complex tumors, shedding light on their evolutionary paths and potentially suggesting more effective therapies. In this issue of Cancer Discovery, Francis and colleagues develop a novel integrative approach to identify distinct tumor subpopulations based on joint detection of clonal and subclonal events from bulk tumor and single-nucleus whole-genome sequencing, allowing them to infer a subclonal architecture. Surprisingly, the authors identify convergent evolution of multiple, mutually exclusive, independent EGFR gain-of-function variants in a single tumor. This study demonstrates the value of integrative single-cell genomics and highlights the biologic primacy of EGFR as an actionable target in glioblastoma. ©2014 American Association for Cancer Research.
Hirvonen, Elina A M; Pitkänen, Esa; Hemminki, Kari; Aaltonen, Lauri A; Kilpivaara, Outi
2017-04-20
Polycythemia vera (PV), characterized by massive production of erythrocytes, is one of the myeloproliferative neoplasms. Most patients carry a somatic gain-of-function mutation in JAK2, c.1849G > T (p.Val617Phe), leading to constitutive activation of JAK-STAT signaling pathway. Familial clustering is also observed occasionally, but high-penetrance predisposition genes to PV have remained unidentified. We studied the predisposition to PV by exome sequencing (three cases) in a Finnish PV family with four patients. The 12 shared variants (maximum allowed minor allele frequency G (p.Phe418Leu) in ZXDC, c.1931C > G (p.Pro644Arg) in ATN1, and c.701G > A (p.Arg234Gln) in LRRC3. We also observed a rare, predicted benign germline variant c.2912C > G (p.Ala971Gly) in BCORL1 in all four patients. Somatic mutations in BCORL1 have been reported in myeloid malignancies. We further screened the variants in eight PV patients in six other Finnish families, but no other carriers were found. Exome sequencing provides a powerful tool for the identification of novel variants, and understanding the familial predisposition of diseases. This is the first report on Finnish familial PV cases, and we identified three novel candidate variants that may predispose to the disease.
Wei, Xiaoming; Sun, Yan; Xie, Jiansheng; Shi, Quan; Qu, Ning; Yang, Guanghui; Cai, Jun; Yang, Yi; Liang, Yu; Wang, Wei; Yi, Xin
2012-11-20
Targeted enrichment and next-generation sequencing (NGS) have been employed for detection of genetic diseases. The purpose of this study was to validate the accuracy and sensitivity of our method for comprehensive mutation detection of hereditary hearing loss, and identify inherited mutations involved in human deafness accurately and economically. To make genetic diagnosis of hereditary hearing loss simple and timesaving, we designed a 0.60 MB array-based chip containing 69 nuclear genes and mitochondrial genome responsible for human deafness and conducted NGS toward ten patients with five known mutations and a Chinese family with hearing loss (never genetically investigated). Ten patients with five known mutations were sequenced using next-generation sequencing to validate the sensitivity of the method. We identified four known mutations in two nuclear deafness causing genes (GJB2 and SLC26A4), one in mitochondrial DNA. We then performed this method to analyze the variants in a Chinese family with hearing loss and identified compound heterozygosity for two novel mutations in gene MYO7A. The compound heterozygosity identified in gene MYO7A causes Usher Syndrome 1B with severe phenotypes. The results support that the combination of enrichment of targeted genes and next-generation sequencing is a valuable molecular diagnostic tool for hereditary deafness and suitable for clinical application. Copyright © 2012 Elsevier B.V. All rights reserved.
Mahato, Ajay Kumar; Sharma, Nimisha; Singh, Akshay; Srivastav, Manish; Jaiprakash; Singh, Sanjay Kumar; Singh, Anand Kumar; Sharma, Tilak Raj; Singh, Nagendra Kumar
2016-01-01
Mango (Mangifera indica L.) is called “king of fruits” due to its sweetness, richness of taste, diversity, large production volume and a variety of end usage. Despite its huge economic importance genomic resources in mango are scarce and genetics of useful horticultural traits are poorly understood. Here we generated deep coverage leaf RNA sequence data for mango parental varieties ‘Neelam’, ‘Dashehari’ and their hybrid ‘Amrapali’ using next generation sequencing technologies. De-novo sequence assembly generated 27,528, 20,771 and 35,182 transcripts for the three genotypes, respectively. The transcripts were further assembled into a non-redundant set of 70,057 unigenes that were used for SSR and SNP identification and annotation. Total 5,465 SSR loci were identified in 4,912 unigenes with 288 type I SSR (n ≥ 20 bp). One hundred type I SSR markers were randomly selected of which 43 yielded PCR amplicons of expected size in the first round of validation and were designated as validated genic-SSR markers. Further, 22,306 SNPs were identified by aligning high quality sequence reads of the three mango varieties to the reference unigene set, revealing significantly enhanced SNP heterozygosity in the hybrid Amrapali. The present study on leaf RNA sequencing of mango varieties and their hybrid provides useful genomic resource for genetic improvement of mango. PMID:27736892
Ye, Wei; Wu, Hongqing; He, Xin; Wang, Lei; Zhang, Weimin; Li, Haohua; Fan, Yunfei; Tan, Guohui; Liu, Taomei; Gao, Xiaoxia
2016-01-01
Agarwood is a traditional Chinese medicine used as a clinical sedative, carminative, and antiemetic drug. Agarwood is formed in Aquilaria sinensis when A. sinensis trees are threatened by external physical, chemical injury or endophytic fungal irritation. However, the mechanism of agarwood formation via chemical induction remains unclear. In this study, we characterized the transcriptome of different parts of a chemically induced A. sinensis trunk sample with agarwood. The Illumina sequencing platform was used to identify the genes involved in agarwood formation. A five-year-old Aquilaria sinensis treated by formic acid was selected. The white wood part (B1 sample), the transition part between agarwood and white wood (W2 sample), the agarwood part (J3 sample), and the rotten wood part (F5 sample) were collected for transcriptome sequencing. Accordingly, 54,685,634 clean reads, which were assembled into 83,467 unigenes, were obtained with a Q20 value of 97.5%. A total of 50,565 unigenes were annotated using the Nr, Nt, SWISS-PROT, KEGG, COG, and GO databases. In particular, 171,331,352 unigenes were annotated by various pathways, including the sesquiterpenoid (ko00909) and plant-pathogen interaction (ko03040) pathways. These pathways were related to sesquiterpenoid biosynthesis and defensive responses to chemical stimulation. The transcriptome data of the different parts of the chemically induced A. sinensis trunk provide a rich source of materials for discovering and identifying the genes involved in sesquiterpenoid production and in defensive responses to chemical stimulation. This study is the first to use de novo sequencing and transcriptome assembly for different parts of chemically induced A. sinensis. Results demonstrate that the sesquiterpenoid biosynthesis pathway and WRKY transcription factor play important roles in agarwood formation via chemical induction. The comparative analysis of the transcriptome data of agarwood and A. sinensis lays the foundation
Mitsui, Jun; Fukuda, Yoko; Azuma, Kyo; Tozaki, Hirokazu; Ishiura, Hiroyuki; Takahashi, Yuji; Goto, Jun; Tsuji, Shoji
2010-07-01
We have recently found that multiple rare variants of the glucocerebrosidase gene (GBA) confer a robust risk for Parkinson disease, supporting the 'common disease-multiple rare variants' hypothesis. To develop an efficient method of identifying rare variants in a large number of samples, we applied multiplexed resequencing using a next-generation sequencer to identification of rare variants of GBA. Sixteen sets of pooled DNAs from six pooled DNA samples were prepared. Each set of pooled DNAs was subjected to polymerase chain reaction to amplify the target gene (GBA) covering 6.5 kb, pooled into one tube with barcode indexing, and then subjected to extensive sequence analysis using the SOLiD System. Individual samples were also subjected to direct nucleotide sequence analysis. With the optimization of data processing, we were able to extract all the variants from 96 samples with acceptable rates of false-positive single-nucleotide variants.
Cai, Shao-hang; Lu, Shi-xun; Liu, Li-li; Zhang, Chris Zhiyi; Yun, Jing-ping
2017-01-01
Background: Hepatocyte nuclear factor 4 alpha (HNF4α) plays an important role in tumourigenesis. There is growing evidence indicating that HNF4α transcribed by promoter 1 (P1-HNF4α) is expressed at relatively low levels in HCC and its presence predicts a favourable outcome for hepatocellular carcinoma (HCC) patients. However, the role of HNF4α transcribed by promoter 2 (P2-HNF4α) in HCC remains unclear. Methods: A total of 615 HCC specimens were obtained to construct tissue microarrays and pe...
RePS: a sequence assembler that masks exact repeats identified from the shotgun data
DEFF Research Database (Denmark)
Wang, Jun; Wong, Gane Ka-Shu; Ni, Peixiang
2002-01-01
We describe a sequence assembler, RePS (repeat-masked Phrap with scaffolding), that explicitly identifies exact 20mer repeats from the shotgun data and removes them prior to the assembly. The established software is used to compute meaningful error probabilities for each base. Clone......-end-pairing information is used to construct scaffolds that order and orient the contigs. We show with real data for human and rice that reasonable assemblies are possible even at coverages of only 4x to 6x, despite having up to 42.2% in exact repeats. Udgivelsesdato: 2002-May...
Identification, variation and transcription of pneumococcal repeat sequences
2011-01-01
Background Small interspersed repeats are commonly found in many bacterial chromosomes. Two families of repeats (BOX and RUP) have previously been identified in the genome of Streptococcus pneumoniae, a nasopharyngeal commensal and respiratory pathogen of humans. However, little is known about the role they play in pneumococcal genetics. Results Analysis of the genome of S. pneumoniae ATCC 700669 revealed the presence of a third repeat family, which we have named SPRITE. All three repeats are present at a reduced density in the genome of the closely related species S. mitis. However, they are almost entirely absent from all other streptococci, although a set of elements related to the pneumococcal BOX repeat was identified in the zoonotic pathogen S. suis. In conjunction with information regarding their distribution within the pneumococcal chromosome, this suggests that it is unlikely that these repeats are specialised sequences performing a particular role for the host, but rather that they constitute parasitic elements. However, comparing insertion sites between pneumococcal sequences indicates that they appear to transpose at a much lower rate than IS elements. Some large BOX elements in S. pneumoniae were found to encode open reading frames on both strands of the genome, whilst another was found to form a composite RNA structure with two T box riboswitches. In multiple cases, such BOX elements were demonstrated as being expressed using directional RNA-seq and RT-PCR. Conclusions BOX, RUP and SPRITE repeats appear to have proliferated extensively throughout the pneumococcal chromosome during the species' past, but novel insertions are currently occurring at a relatively slow rate. Through their extensive secondary structures, they seem likely to affect the expression of genes with which they are co-transcribed. Software for annotation of these repeats is freely available from ftp://ftp.sanger.ac.uk/pub/pathogens/strep_repeats/. PMID:21333003
LENUS (Irish Health Repository)
2011-08-30
Abstract Background The genus Lactobacillus is characterized by an extraordinary degree of phenotypic and genotypic diversity, which recent genomic analyses have further highlighted. However, the choice of species for sequencing has been non-random and unequal in distribution, with only a single representative genome from the L. salivarius clade available to date. Furthermore, there is no data to facilitate a functional genomic analysis of motility in the lactobacilli, a trait that is restricted to the L. salivarius clade. Results The 2.06 Mb genome of the bovine isolate Lactobacillus ruminis ATCC 27782 comprises a single circular chromosome, and has a G+C content of 44.4%. In silico analysis identified 1901 coding sequences, including genes for a pediocin-like bacteriocin, a single large exopolysaccharide-related cluster, two sortase enzymes, two CRISPR loci and numerous IS elements and pseudogenes. A cluster of genes related to a putative pilin was identified, and shown to be transcribed in vitro. A high quality draft assembly of the genome of a second L. ruminis strain, ATCC 25644 isolated from humans, suggested a slightly larger genome of 2.138 Mb, that exhibited a high degree of synteny with the ATCC 27782 genome. In contrast, comparative analysis of L. ruminis and L. salivarius identified a lack of long-range synteny between these closely related species. Comparison of the L. salivarius clade core proteins with those of nine other Lactobacillus species distributed across 4 major phylogenetic groups identified the set of shared proteins, and proteins unique to each group. Conclusions The genome of L. ruminis provides a comparative tool for directing functional analyses of other members of the L. salivarius clade, and it increases understanding of the divergence of this distinct Lactobacillus lineage from other commensal lactobacilli. The genome sequence provides a definitive resource to facilitate investigation of the genetics, biochemistry and host
Tuteja, Reetu; Saxena, Rachit K; Davila, Jaime; Shah, Trushar; Chen, Wenbin; Xiao, Yong-Li; Fan, Guangyi; Saxena, K B; Alverson, Andrew J; Spillane, Charles; Town, Christopher; Varshney, Rajeev K
2013-10-01
The hybrid pigeonpea (Cajanus cajan) breeding technology based on cytoplasmic male sterility (CMS) is currently unique among legumes and displays major potential for yield increase. CMS is defined as a condition in which a plant is unable to produce functional pollen grains. The novel chimeric open reading frames (ORFs) produced as a results of mitochondrial genome rearrangements are considered to be the main cause of CMS. To identify these CMS-related ORFs in pigeonpea, we sequenced the mitochondrial genomes of three C. cajan lines (the male-sterile line ICPA 2039, the maintainer line ICPB 2039, and the hybrid line ICPH 2433) and of the wild relative (Cajanus cajanifolius ICPW 29). A single, circular-mapping molecule of length 545.7 kb was assembled and annotated for the ICPA 2039 line. Sequence annotation predicted 51 genes, including 34 protein-coding and 17 RNA genes. Comparison of the mitochondrial genomes from different Cajanus genotypes identified 31 ORFs, which differ between lines within which CMS is present or absent. Among these chimeric ORFs, 13 were identified by comparison of the related male-sterile and maintainer lines. These ORFs display features that are known to trigger CMS in other plant species and to represent the most promising candidates for CMS-related mitochondrial rearrangements in pigeonpea.
Theoretical evaluation of transcriptional pausing effect on the attenuation in trp leader sequence
Suzuki, H.; Kunisawa, T.; Otsuka, J.
1986-01-01
The effect of transcriptional pausing on attenuation is investigated theoretically on the basis of the attenuation control mechanism presented by Oxender et al. (Oxender, D. L., G. Zurawski, and C. Yanofsky, 1979, Proc. Natl. Acad. Sci. USA. 76:5524-5528). An extended stochastic model including the RNA polymerase pausing in the leader region is developed to calculate the probability of relative position between the RNA polymerase transcribing the trp leader sequence and the ribosome translati...
Hall, Miquette; Chattaway, Marie A.; Reuter, Sandra; Savin, Cyril; Strauch, Eckhard; Carniel, Elisabeth; Connor, Thomas; Van Damme, Inge; Rajakaruna, Lakshani; Rajendram, Dunstan; Jenkins, Claire; Thomson, Nicholas R.
2014-01-01
The genus Yersinia is a large and diverse bacterial genus consisting of human-pathogenic species, a fish-pathogenic species, and a large number of environmental species. Recently, the phylogenetic and population structure of the entire genus was elucidated through the genome sequence data of 241 strains encompassing every known species in the genus. Here we report the mining of this enormous data set to create a multilocus sequence typing-based scheme that can identify Yersinia strains to the species level to a level of resolution equal to that for whole-genome sequencing. Our assay is designed to be able to accurately subtype the important human-pathogenic species Yersinia enterocolitica to whole-genome resolution levels. We also report the validation of the scheme on 386 strains from reference laboratory collections across Europe. We propose that the scheme is an important molecular typing system to allow accurate and reproducible identification of Yersinia isolates to the species level, a process often inconsistent in nonspecialist laboratories. Additionally, our assay is the most phylogenetically informative typing scheme available for Y. enterocolitica. PMID:25339391
Directory of Open Access Journals (Sweden)
Eva Hřibová
2011-03-01
Full Text Available Genes coding for 45S ribosomal RNA are organized in tandem arrays of up to several thousand copies and contain 18S, 5.8S and 26S rRNA units separated by internal transcribed spacers ITS1 and ITS2. While the rRNA units are evolutionary conserved, ITS show high level of interspecific divergence and have been used frequently in genetic diversity and phylogenetic studies. In this work we report on the structure and diversity of the ITS region in 87 representatives of the family Musaceae. We provide the first detailed information on ITS sequence diversity in the genus Musa and describe the presence of more than one type of ITS sequence within individual species. Both Sanger sequencing of amplified ITS regions and whole genome 454 sequencing lead to similar phylogenetic inferences. We show that it is necessary to identify putative pseudogenic ITS sequences, which may have negative effect on phylogenetic reconstruction at lower taxonomic levels. Phylogenetic reconstruction based on ITS sequence showed that the genus Musa is divided into two distinct clades--Callimusa and Australimusa and Eumusa and Rhodochlamys. Most of the intraspecific banana hybrids analyzed contain conserved parental ITS sequences, indicating incomplete concerted evolution of rDNA loci. Independent evolution of parental rDNA in hybrids enables determination of genomic constitution of hybrids using ITS. The observation of only one type of ITS sequence in some of the presumed interspecific hybrid clones warrants further study to confirm their hybrid origin and to unravel processes leading to evolution of their genomes.
DEFF Research Database (Denmark)
Lyskova, Pavlina; Hubka, Vit; Kolarik, Miroslav
2014-01-01
The identity of nine clinical isolates recovered from Czech patients and presumptively identified as Aspergillus sp. section Candidi based on colony morphology was revised using sequences of beta-tubulin, calmodulin gene sequence, and internal transcribed spacer rDNA. Six isolates were from suspe...
Exome sequencing in amyotrophic lateral sclerosis identifies risk genes and pathways
Cirulli, Elizabeth T.; Lasseigne, Brittany N.; Petrovski, Slavé; Sapp, Peter C.; Dion, Patrick A.; Leblond, Claire S.; Couthouis, Julien; Lu, Yi-Fan; Wang, Quanli; Krueger, Brian J.; Ren, Zhong; Keebler, Jonathan; Han, Yujun; Levy, Shawn E.; Boone, Braden E.; Wimbish, Jack R.; Waite, Lindsay L.; Jones, Angela L.; Carulli, John P.; Day-Williams, Aaron G.; Staropoli, John F.; Xin, Winnie W.; Chesi, Alessandra; Raphael, Alya R.; McKenna-Yasek, Diane; Cady, Janet; de Jong, J. M. B. Vianney; Kenna, Kevin P.; Smith, Bradley N.; Topp, Simon; Miller, Jack; Gkazi, Athina; Al-Chalabi, Ammar; van den Berg, Leonard H.; Veldink, Jan; Silani, Vincenzo; Ticozzi, Nicola; Shaw, Christopher E.; Baloh, Robert H.; Appel, Stanley; Simpson, Ericka; Lagier-Tourenne, Clotilde; Pulst, Stefan M.; Gibson, Summer; Trojanowski, John Q.; Elman, Lauren; McCluskey, Leo; Grossman, Murray; Baas, Frank; ten Asbroek, Anneloor L. M. A.
2015-01-01
Amyotrophic lateral sclerosis (ALS) is a devastating neurological disease with no effective treatment. We report the results of a moderate-scale sequencing study aimed at increasing the number of genes known to contribute to predisposition for ALS. We performed whole-exome sequencing of 2869 ALS
Hu, Hao; Wienker, Thomas F; Musante, Luciana; Kalscheuer, Vera M; Kahrizi, Kimia; Najmabadi, Hossein; Ropers, H Hilger
2014-12-01
Next-generation sequencing has greatly accelerated the search for disease-causing defects, but even for experts the data analysis can be a major challenge. To facilitate the data processing in a clinical setting, we have developed a novel medical resequencing analysis pipeline (MERAP). MERAP assesses the quality of sequencing, and has optimized capacity for calling variants, including single-nucleotide variants, insertions and deletions, copy-number variation, and other structural variants. MERAP identifies polymorphic and known causal variants by filtering against public domain databases, and flags nonsynonymous and splice-site changes. MERAP uses a logistic model to estimate the causal likelihood of a given missense variant. MERAP considers the relevant information such as phenotype and interaction with known disease-causing genes. MERAP compares favorably with GATK, one of the widely used tools, because of its higher sensitivity for detecting indels, its easy installation, and its economical use of computational resources. Upon testing more than 1,200 individuals with mutations in known and novel disease genes, MERAP proved highly reliable, as illustrated here for five families with disease-causing variants. We believe that the clinical implementation of MERAP will expedite the diagnostic process of many disease-causing defects. © 2014 WILEY PERIODICALS, INC.
Targeted exome sequencing identified novel USH2A mutations in Usher syndrome families.
Directory of Open Access Journals (Sweden)
Xiu-Feng Huang
Full Text Available Usher syndrome (USH is a leading cause of deaf-blindness in autosomal recessive trait. Phenotypic and genetic heterogeneities in USH make molecular diagnosis much difficult. This is a pilot study aiming to develop an approach based on next-generation sequencing to determine the genetic defects in patients with USH or allied diseases precisely and effectively. Eight affected patients and twelve unaffected relatives from five unrelated Chinese USH families, including 2 pseudo-dominant ones, were recruited. A total of 144 known genes of inherited retinal diseases were selected for deep exome resequencing. Through systematic data analysis using established bioinformatics pipeline and segregation analysis, a number of genetic variants were released. Eleven mutations, eight of them were novel, in the USH2A gene were identified. Biparental mutations in USH2A were revealed in 2 families with pseudo-dominant inheritance. A proband was found to have triple mutations, two of them were supposed to locate in the same chromosome. In conclusion, this study revealed the genetic defects in the USH2A gene and demonstrated the robustness of targeted exome sequencing to precisely and rapidly determine genetic defects. The methodology provides a reliable strategy for routine gene diagnosis of USH.
Chen, Nian; Lai, Xiao-Ping
2010-07-01
We obtained the complete mitochondrial genome of King Cobra(GenBank accession number: EU_921899) by Ex Taq-PCR, TA-cloning and primer-walking methods. This genome is very similar to other vertebrate, which is 17 267 bp in length and encodes 38 genes (including 13 protein-coding, 2 ribosomal RNA and 23 transfer RNA genes) and two long non-coding regions. The duplication of tRNA-Ile gene forms a new mitochondrial gene rearrangement model. Eight tRNA genes and one protein genes were transcribed from L strand, and the other genes were transcribed genes from H strand. Genes on the H strand show a fairly similar content of Adenosine and Thymine respectively, whereas those on the L strand have higher proportion of A than T. Combined rDNA sequence data (12S+16S rRNA) were used to reconstruct the phylogeny of 21 snake species for which complete mitochondrial genome sequences were available in the public databases. This large data set and an appropriate range of outgroup taxa demonstrated that Elapidae is more closely related to colubridae than viperidae, which supports the traditional viewpoints.
Novel expressed sequence tag- simple sequence repeats (EST ...
African Journals Online (AJOL)
Using different bioinformatic criteria, the SUCEST database was used to mine for simple sequence repeat (SSR) markers. Among 42,189 clusters, 1,425 expressed sequence tag- simple sequence repeats (EST-SSRs) were identified in silico. Trinucleotide repeats were the most abundant SSRs detected. Of 212 primer pairs ...
Wei, Yu-Jie; Wu, Yun; Yan, Yin-Zhuo; Zou, Wan; Xue, Jie; Ma, Wen-Rui; Wang, Wei; Tian, Ge; Wang, Li-Ye
2018-01-01
In this study Illumina MiSeq was performed to investigate microbial diversity in soil, leaves, grape, grape juice and wine. A total of 1,043,102 fungal Internal Transcribed Spacer (ITS) reads and 2,422,188 high quality bacterial 16S rDNA sequences were used for taxonomic classification, revealed five fungal and eight bacterial phyla. At the genus level, the dominant fungi were Ascomycota, Sordariales, Tetracladium and Geomyces in soil, Aureobasidium and Pleosporaceae in grapes leaves, Aureobasidium in grape and grape juice. The dominant bacteria were Kaistobacter, Arthrobacter, Skermanella and Sphingomonas in soil, Pseudomonas, Acinetobacter and Kaistobacter in grape and grapes leaves, and Oenococcus in grape juice and wine. Principal coordinate analysis showed structural separation between the composition of fungi and bacteria in all samples. This is the first study to understand microbiome population in soil, grape, grapes leaves, grape juice and wine in Xinjiang through High-throughput Sequencing and identify microorganisms like Saccharomyces cerevisiae and Oenococcus spp. that may contribute to the quality and flavor of wine.
Yan, Yin-zhuo; Zou, Wan; Ma, Wen-rui; Wang, Wei; Tian, Ge; Wang, Li-ye
2018-01-01
In this study Illumina MiSeq was performed to investigate microbial diversity in soil, leaves, grape, grape juice and wine. A total of 1,043,102 fungal Internal Transcribed Spacer (ITS) reads and 2,422,188 high quality bacterial 16S rDNA sequences were used for taxonomic classification, revealed five fungal and eight bacterial phyla. At the genus level, the dominant fungi were Ascomycota, Sordariales, Tetracladium and Geomyces in soil, Aureobasidium and Pleosporaceae in grapes leaves, Aureobasidium in grape and grape juice. The dominant bacteria were Kaistobacter, Arthrobacter, Skermanella and Sphingomonas in soil, Pseudomonas, Acinetobacter and Kaistobacter in grape and grapes leaves, and Oenococcus in grape juice and wine. Principal coordinate analysis showed structural separation between the composition of fungi and bacteria in all samples. This is the first study to understand microbiome population in soil, grape, grapes leaves, grape juice and wine in Xinjiang through High-throughput Sequencing and identify microorganisms like Saccharomyces cerevisiae and Oenococcus spp. that may contribute to the quality and flavor of wine. PMID:29565999
Directory of Open Access Journals (Sweden)
Jiang Liu
2017-05-01
Full Text Available Continuous rain and an abnormally wet climate during harvest can easily lead to soybean plants being damaged by field mold (FM, which can reduce seed yield and quality. However, to date, the underlying pathogen and its resistance mechanism have remained unclear. The objective of the present study was to investigate the fungal diversity of various soybean varieties and to identify and confirm the FM pathogenic fungi. A total of 62,382 fungal ITS1 sequences clustered into 164 operational taxonomic units (OTUs with 97% sequence similarity; 69 taxa were recovered from the samples by internal transcribed spacer (ITS region sequencing. The fungal community compositions differed among the tested soybeans, with 42 OTUs being amplified from all varieties. The quadratic relationships between fungal diversity and organ-specific mildew indexes were analyzed, confirming that mildew on soybean pods can mitigate FM damage to the seeds. In addition, four potentially pathogenic fungi were isolated from FM-damaged soybean fruits; morphological and molecular identification confirmed these fungi as Aspergillus flavus, A. niger, Fusarium moniliforme, and Penicillium chrysogenum. Further re-inoculation experiments demonstrated that F. moniliforme is dominant among these FM pathogenic fungi. These results lay the foundation for future studies on mitigating or preventing FM damage to soybean.
An Observational Study of Children's Involvement in Informed Consent for Exome Sequencing Research.
Miller, Victoria A; Werner-Lin, Allison; Walser, Sarah A; Biswas, Sawona; Bernhardt, Barbara A
2017-02-01
The goal of this study was to examine children's involvement in consent sessions for exome sequencing research and associations of involvement with provider and parent communication. Participants included 44 children (8-17 years) from five cohorts who were offered participation in an exome sequencing study. The consent sessions were audiotaped, transcribed, and coded. Providers attempted to facilitate the child's involvement in the majority (73%) of sessions, and most (75%) children also verbally participated. Provider facilitation was strongly associated with likelihood of child participation. These findings underscore that strategies such as asking for children's opinions and soliciting their questions show respect for children and may increase the likelihood that they are engaged and involved in decisions about research participation.
Exome sequencing in 53 sporadic cases of schizophrenia identifies 18 putative candidate genes.
Directory of Open Access Journals (Sweden)
Michel Guipponi
Full Text Available Schizophrenia (SCZ is a severe, debilitating mental illness which has a significant genetic component. The identification of genetic factors related to SCZ has been challenging and these factors remain largely unknown. To evaluate the contribution of de novo variants (DNVs to SCZ, we sequenced the exomes of 53 individuals with sporadic SCZ and of their non-affected parents. We identified 49 DNVs, 18 of which were predicted to alter gene function, including 13 damaging missense mutations, 2 conserved splice site mutations, 2 nonsense mutations, and 1 frameshift deletion. The average number of exonic DNV per proband was 0.88, which corresponds to an exonic point mutation rate of 1.7×10(-8 per nucleotide per generation. The non-synonymous-to-synonymous mutation ratio of 2.06 did not differ from neutral expectations. Overall, this study provides a list of 18 putative candidate genes for sporadic SCZ, and when combined with the results of similar reports, identifies a second proband carrying a non-synonymous DNV in the RGS12 gene.
Properties and distribution of pure GA-sequences of mammalian genomes.
Directory of Open Access Journals (Sweden)
Guenter Albrecht-Buehler
Full Text Available The article describes DNA sequences of mammalian genomes that are longer than 50 bases, but consist exclusively of G's and A's ('pure GA-sequences'. Although their frequency of incidence should be 10(-16 or smaller, the chromosomes of human, chimpanzee, dog, cat, rat, and mouse contained many tens of thousands of them ubiquitously located along the chromosomes with a species-dependent density, reaching sizes of up to 1300 [b]. With the exception of a small number of poly-A-, poly-G-, poly-GA-, and poly-GAAA-sequences (combined <0.5%, all pure GA-sequences of the mammals tested were unique individuals, contained several repeated short GA-containing motifs, and shared a common hexa-nucleotide spectrum. At most 2% of the human GA-sequences were transcribed into mRNAs; all others were not coding for proteins. Although this could have made them less subject to natural selection, they contained many [corrected] times fewer point mutations than one should expect from the genome at large. As to the presence of other sequences with similarly restricted base contents, there were approximately as many pure TC-sequences as pure GA-sequences, but many fewer pure AC-, TA, and TG-sequences. There were practically no pure GC-sequences. The functions of pure GA-sequences are not known. Supported by a number of observations related to heat shock phenomena, the article speculates that they serve as genomic sign posts which may help guide polymerases and transcription factors to their proper targets, and/or as spatial linkers that help generate the 3-dimensional organization of chromatin.
Directory of Open Access Journals (Sweden)
Yanara Marincevic-Zuniga
2017-08-01
Full Text Available Abstract Background Structural chromosomal rearrangements that lead to expressed fusion genes are a hallmark of acute lymphoblastic leukemia (ALL. In this study, we performed transcriptome sequencing of 134 primary ALL patient samples to comprehensively detect fusion transcripts. Methods We combined fusion gene detection with genome-wide DNA methylation analysis, gene expression profiling, and targeted sequencing to determine molecular signatures of emerging ALL subtypes. Results We identified 64 unique fusion events distributed among 80 individual patients, of which over 50% have not previously been reported in ALL. Although the majority of the fusion genes were found only in a single patient, we identified several recurrent fusion gene families defined by promiscuous fusion gene partners, such as ETV6, RUNX1, PAX5, and ZNF384, or recurrent fusion genes, such as DUX4-IGH. Our data show that patients harboring these fusion genes displayed characteristic genome-wide DNA methylation and gene expression signatures in addition to distinct patterns in single nucleotide variants and recurrent copy number alterations. Conclusion Our study delineates the fusion gene landscape in pediatric ALL, including both known and novel fusion genes, and highlights fusion gene families with shared molecular etiologies, which may provide additional information for prognosis and therapeutic options in the future.
Screening of whole genome sequences identified high-impact variants for stallion fertility.
Schrimpf, Rahel; Gottschalk, Maren; Metzger, Julia; Martinsson, Gunilla; Sieme, Harald; Distl, Ottmar
2016-04-14
g.37455302G>A in NOTCH1 with the de-regressed estimated breeding values of the paternal component of the pregnancy rate per estrus (EBV-PAT). For 9 high-impact variants within the genes CFTR, OVGP1, FBXO43, TSSK6, PKD1, FOXP1, TCP11, SPATA31E1 and NOTCH1 (g.37453246G>C) absence of the homozygous mutant genotype in the validation sample of all 337 fertile stallions was obvious. Therefore, these variants were considered as potentially deleterious factors for stallion fertility. In conclusion, this study revealed 17 genetic variants with a predicted high damaging effect on protein structure and missing homozygous mutant genotype. The g.37455302G>A NOTCH1 variant was identified as a significant stallion fertility locus in Hanoverian stallions and further 9 candidate fertility loci with missing homozygous mutant genotypes were validated in a panel including 19 horse breeds. To our knowledge this is the first study in horses using next generation sequencing data to uncover strong candidate factors for stallion fertility.
Faucon, Frederic; Dusfour, Isabelle; Gaude, Thierry; Navratil, Vincent; Boyer, Frederic; Chandre, Fabrice; Sirisopa, Patcharawan; Thanispong, Kanutcharee; Juntarajumnong, Waraporn; Poupardin, Rodolphe; Chareonviriyaphap, Theeraphap; Girod, Romain; Corbel, Vincent; Reynaud, Stephane; David, Jean-Philippe
2015-01-01
The capacity of mosquitoes to resist insecticides threatens the control of diseases such as dengue and malaria. Until alternative control tools are implemented, characterizing resistance mechanisms is crucial for managing resistance in natural populations. Insecticide biodegradation by detoxification enzymes is a common resistance mechanism; however, the genomic changes underlying this mechanism have rarely been identified, precluding individual resistance genotyping. In particular, the role of copy number variations (CNVs) and polymorphisms of detoxification enzymes have never been investigated at the genome level, although they can represent robust markers of metabolic resistance. In this context, we combined target enrichment with high-throughput sequencing for conducting the first comprehensive screening of gene amplifications and polymorphisms associated with insecticide resistance in mosquitoes. More than 760 candidate genes were captured and deep sequenced in several populations of the dengue mosquito Ae. aegypti displaying distinct genetic backgrounds and contrasted resistance levels to the insecticide deltamethrin. CNV analysis identified 41 gene amplifications associated with resistance, most affecting cytochrome P450s overtranscribed in resistant populations. Polymorphism analysis detected more than 30,000 variants and strong selection footprints in specific genomic regions. Combining Bayesian and allele frequency filtering approaches identified 55 nonsynonymous variants strongly associated with resistance. Both CNVs and polymorphisms were conserved within regions but differed across continents, confirming that genomic changes underlying metabolic resistance to insecticides are not universal. By identifying novel DNA markers of insecticide resistance, this study opens the way for tracking down metabolic changes developed by mosquitoes to resist insecticides within and among populations. PMID:26206155
3' terminal diversity of MRP RNA and other human noncoding RNAs revealed by deep sequencing.
Goldfarb, Katherine C; Cech, Thomas R
2013-09-21
Post-transcriptional 3' end processing is a key component of RNA regulation. The abundant and essential RNA subunit of RNase MRP has been proposed to function in three distinct cellular compartments and therefore may utilize this mode of regulation. Here we employ 3' RACE coupled with high-throughput sequencing to characterize the 3' terminal sequences of human MRP RNA and other noncoding RNAs that form RNP complexes. The 3' terminal sequence of MRP RNA from HEK293T cells has a distinctive distribution of genomically encoded termini (including an assortment of U residues) with a portion of these selectively tagged by oligo(A) tails. This profile contrasts with the relatively homogenous 3' terminus of an in vitro transcribed MRP RNA control and the differing 3' terminal profiles of U3 snoRNA, RNase P RNA, and telomerase RNA (hTR). 3' RACE coupled with deep sequencing provides a valuable framework for the functional characterization of 3' terminal sequences of noncoding RNAs.
DEFF Research Database (Denmark)
Durkin, M E; Jäger, A C; Khurana, T S
1999-01-01
The laminin beta2 chain is an important constituent of certain kidney and muscle basement membranes. We have generated a detailed physical map of a 110-kb genomic DNA segment surrounding the human laminin beta2 chain gene (LAMB2) on chromosome 3p21.3-->p21.2, a region paralogous with the chromosome...... 7q22-->q31 region that contains the laminin beta1 chain gene locus (LAMB1). Several CpG islands and a novel polymorphic microsatellite marker (D3S4594) were identified. The 3' end of LAMB2 lies 16 kb from the 5' end of the glutaminyl tRNA synthetase gene (QARS). About 20 kb upstream of LAMB2 we...... found a gene encoding a transcribed, non-processed LAMB2-like pseudogene (LAMB2L). The sequence of 1.75 kb of genomic DNA at the 3' end of LAMB2L was similar to exons 8-12 of the laminin beta2 chain gene. The LAMB2L-LAMB2-QARS cluster lies telomeric to the gene encoding the laminin-binding protein...
Kim, W J; Ji, Y; Choi, G; Kang, Y M; Yang, S; Moon, B C
2016-08-05
This study was performed to identify and analyze the phylogenetic relationship among four herbaceous species of the genus Paeonia, P. lactiflora, P. japonica, P. veitchii, and P. suffruticosa, using DNA barcodes. These four species, which are commonly used in traditional medicine as Paeoniae Radix and Moutan Radicis Cortex, are pharmaceutically defined in different ways in the national pharmacopoeias in Korea, Japan, and China. To authenticate the different species used in these medicines, we evaluated rDNA-internal transcribed spacers (ITS), matK and rbcL regions, which provide information capable of effectively distinguishing each species from one another. Seventeen samples were collected from different geographic regions in Korea and China, and DNA barcode regions were amplified using universal primers. Comparative analyses of these DNA barcode sequences revealed species-specific nucleotide sequences capable of discriminating the four Paeonia species. Among the entire sequences of three barcodes, marker nucleotides were identified at three positions in P. lactiflora, eleven in P. japonica, five in P. veitchii, and 25 in P. suffruticosa. Phylogenetic analyses also revealed four distinct clusters showing homogeneous clades with high resolution at the species level. The results demonstrate that the analysis of these three DNA barcode sequences is a reliable method for identifying the four Paeonia species and can be used to authenticate Paeoniae Radix and Moutan Radicis Cortex at the species level. Furthermore, based on the assessment of amplicon sizes, inter/intra-specific distances, marker nucleotides, and phylogenetic analysis, rDNA-ITS was the most suitable DNA barcode for identification of these species.
Revollo, Javier; Wang, Yiying; McKinzie, Page; Dad, Azra; Pearce, Mason; Heflich, Robert H; Dobrovolsky, Vasily N
2017-12-01
We used Sanger sequencing and next generation sequencing (NGS) for analysis of mutations in the endogenous X-linked Pig-a gene of clonally expanded L5178YTk +/- cells. The clones developed from single cells that were sorted on a flow cytometer based upon the expression pattern of the GPI-anchored marker, CD90, on their surface. CD90-deficient and CD90-proficient cells were sorted from untreated cultures and CD90-deficient cells were sorted from cultures treated with benzo[a]pyrene (B[a]P). Pig-a mutations were identified in all clones developed from CD90-deficient cells; no Pig-a mutations were found in clones of CD90-proficient cells. The spectrum of B[a]P-induced Pig-a mutations was dominated by basepair substitutions, small insertions and deletions at G:C, or at sequences rich in G:C content. We observed high concordance between Pig-a mutations determined by Sanger sequencing and by NGS, but NGS was able to identify mutations in samples that were difficult to analyze by Sanger sequencing (e.g., mixtures of two mutant clones). Overall, the NGS method is a cost and labor efficient high throughput approach for analysis of a large number of mutant clones. Published by Elsevier B.V.
Thaker, Vidhu V; Esteves, Kristyn M; Towne, Meghan C; Brownstein, Catherine A; James, Philip M; Crowley, Laura; Hirschhorn, Joel N; Elsea, Sarah H; Beggs, Alan H; Picker, Jonathan; Agrawal, Pankaj B
2015-05-01
The current obesity epidemic is attributed to complex interactions between genetic and environmental factors. However, a limited number of cases, especially those with early-onset severe obesity, are linked to single gene defects. Rapid-onset obesity with hypothalamic dysfunction, hypoventilation and autonomic dysregulation (ROHHAD) is one of the syndromes that presents with abrupt-onset extreme weight gain with an unknown genetic basis. To identify the underlying genetic etiology in a child with morbid early-onset obesity, hypoventilation, and autonomic and behavioral disturbances who was clinically diagnosed with ROHHAD syndrome. Design/Setting/Intervention: The index patient was evaluated at an academic medical center. Whole-exome sequencing was performed on the proband and his parents. Genetic variants were validated by Sanger sequencing. We identified a novel de novo nonsense mutation, c.3265 C>T (p.R1089X), in the retinoic acid-induced 1 (RAI1) gene in the proband. Mutations in the RAI1 gene are known to cause Smith-Magenis syndrome (SMS). On further evaluation, his clinical features were not typical of either SMS or ROHHAD syndrome. This study identifies a de novo RAI1 mutation in a child with morbid obesity and a clinical diagnosis of ROHHAD syndrome. Although extreme early-onset obesity, autonomic disturbances, and hypoventilation are present in ROHHAD, several of the clinical findings are consistent with SMS. This case highlights the challenges in the diagnosis of ROHHAD syndrome and its potential overlap with SMS. We also propose RAI1 as a candidate gene for children with morbid obesity.
Keel, B N; Nonneman, D J; Rohrer, G A
2017-08-01
Genetic variants detected from sequence have been used to successfully identify causal variants and map complex traits in several organisms. High and moderate impact variants, those expected to alter or disrupt the protein coded by a gene and those that regulate protein production, likely have a more significant effect on phenotypic variation than do other types of genetic variants. Hence, a comprehensive list of these functional variants would be of considerable interest in swine genomic studies, particularly those targeting fertility and production traits. Whole-genome sequence was obtained from 72 of the founders of an intensely phenotyped experimental swine herd at the U.S. Meat Animal Research Center (USMARC). These animals included all 24 of the founding boars (12 Duroc and 12 Landrace) and 48 Yorkshire-Landrace composite sows. Sequence reads were mapped to the Sscrofa10.2 genome build, resulting in a mean of 6.1 fold (×) coverage per genome. A total of 22 342 915 high confidence SNPs were identified from the sequenced genomes. These included 21 million previously reported SNPs and 79% of the 62 163 SNPs on the PorcineSNP60 BeadChip assay. Variation was detected in the coding sequence or untranslated regions (UTRs) of 87.8% of the genes in the porcine genome: loss-of-function variants were predicted in 504 genes, 10 202 genes contained nonsynonymous variants, 10 773 had variation in UTRs and 13 010 genes contained synonymous variants. Approximately 139 000 SNPs were classified as loss-of-function, nonsynonymous or regulatory, which suggests that over 99% of the variation detected in our pigs could potentially be ignored, allowing us to focus on a much smaller number of functional SNPs during future analyses. Published 2017. This article is a U.S. Government work and is in the public domain in the USA.
Chen, Peng
2014-12-03
Background Protein-ligand binding is important for some proteins to perform their functions. Protein-ligand binding sites are the residues of proteins that physically bind to ligands. Despite of the recent advances in computational prediction for protein-ligand binding sites, the state-of-the-art methods search for similar, known structures of the query and predict the binding sites based on the solved structures. However, such structural information is not commonly available. Results In this paper, we propose a sequence-based approach to identify protein-ligand binding residues. We propose a combination technique to reduce the effects of different sliding residue windows in the process of encoding input feature vectors. Moreover, due to the highly imbalanced samples between the ligand-binding sites and non ligand-binding sites, we construct several balanced data sets, for each of which a random forest (RF)-based classifier is trained. The ensemble of these RF classifiers forms a sequence-based protein-ligand binding site predictor. Conclusions Experimental results on CASP9 and CASP8 data sets demonstrate that our method compares favorably with the state-of-the-art protein-ligand binding site prediction methods.
Directory of Open Access Journals (Sweden)
Miri eMichaeli
2012-12-01
Full Text Available High throughput sequencing (HTS yields tens of thousands to millions of sequences that require a large amount of pre-processing work to clean various artifacts. Such cleaning cannot be performed manually. Existing programs are not suitable for immunoglobulin (Ig genes, which are variable and often highly mutated. This paper describes Ig-HTS-Cleaner (Ig High Throughput Sequencing Cleaner, a program containing a simple cleaning procedure that successfully deals with pre-processing of Ig sequences derived from HTS, and Ig-Indel-Identifier (Ig Insertion – Deletion Identifier, a program for identifying legitimate and artifact insertions and/or deletions (indels. Our programs were designed for analyzing Ig gene sequences obtained by 454 sequencing, but they are applicable to all types of sequences and sequencing platforms. Ig-HTS-Cleaner and Ig-Indel-Identifier have been implemented in Java and saved as executable JAR files, supported on Linux and MS Windows. No special requirements are needed in order to run the programs, except for correctly constructing the input files as explained in the text. The programs' performance has been tested and validated on real and simulated data sets.
International Nuclear Information System (INIS)
Okamura, K; Hisada, T; Takata, K; Hiraishi, A
2013-01-01
Rapid and accurate identification of microbial species is essential task in microbiology and biotechnology. In prokaryotic systematics, genomic DNA-DNA hybridization is the ultimate tool to determine genetic relationships among bacterial strains at the species level. However, a practical problem in this assay is that the experimental procedure is laborious and time-consuming. In recent years, information on the 16S-23S rRNA gene internal transcribed spacer (ITS) region has been used to classify bacterial strains at the species and intraspecies levels. It is unclear how much information on the ITS region can reflect the genome that contain it. In this study, therefore, we evaluate the quantitative relationship between ITS DNA and entire genomic DNA similarities. For this, we determined ITS sequences of several species of anoxygenic phototrophic bacteria belonging to the order Rhizobiales, and compared with DNA-DNA relatedness among these species. There was a high correlation between the two genetic markers. Based on the regression analysis of this relationship, 70% DNA-DNA relatedness corresponded to 92% ITS sequence similarity. This suggests the usefulness of the ITS sequence similarity as a criterion for determining the genospecies of the phototrophic bacteria. To avoid the effects of polymorphism bias of ITS on similarities, PCR products from all loci of ITS were used directly as genetic probes for comparison. The results of ITS DNA-DNA hybridization coincided well with those of genomic DNA-DNA relatedness. These collective data indicate that the whole ITS DNA-DNA similarity can be used as an alternative to genomic DNA-DNA similarity.
Méndez-Vidal, Cristina; González-Del Pozo, María; Vela-Boza, Alicia; Santoyo-López, Javier; López-Domingo, Francisco J; Vázquez-Marouschek, Carmen; Dopazo, Joaquin; Borrego, Salud; Antiñolo, Guillermo
2013-01-01
Retinitis pigmentosa (RP) is an inherited retinal dystrophy characterized by extreme genetic and clinical heterogeneity. Thus, the diagnosis is not always easily performed due to phenotypic and genetic overlap. Current clinical practices have focused on the systematic evaluation of a set of known genes for each phenotype, but this approach may fail in patients with inaccurate diagnosis or infrequent genetic cause. In the present study, we investigated the genetic cause of autosomal recessive RP (arRP) in a Spanish family in which the causal mutation has not yet been identified with primer extension technology and resequencing. We designed a whole-exome sequencing (WES)-based approach using NimbleGen SeqCap EZ Exome V3 sample preparation kit and the SOLiD 5500×l next-generation sequencing platform. We sequenced the exomes of both unaffected parents and two affected siblings. Exome analysis resulted in the identification of 43,204 variants in the index patient. All variants passing filter criteria were validated with Sanger sequencing to confirm familial segregation and absence in the control population. In silico prediction tools were used to determine mutational impact on protein function and the structure of the identified variants. Novel Usher syndrome type 2A (USH2A) compound heterozygous mutations, c.4325T>C (p.F1442S) and c.15188T>G (p.L5063R), located in exons 20 and 70, respectively, were identified as probable causative mutations for RP in this family. Family segregation of the variants showed the presence of both mutations in all affected members and in two siblings who were apparently asymptomatic at the time of family ascertainment. Clinical reassessment confirmed the diagnosis of RP in these patients. Using WES, we identified two heterozygous novel mutations in USH2A as the most likely disease-causing variants in a Spanish family diagnosed with arRP in which the cause of the disease had not yet been identified with commonly used techniques. Our data
Nallaseth, Ferez Soli
The Y-chromosome presents a unique cytogenetic framework for the evolution of nucleotide sequences. Alignment of nine Y-chromosomal fragments in their increasing Y-specific/non Y-specific (male/female) sequence divergence ratios was directly and inversely related to their interspersion on these two respective genomic fractions. Sequence analysis confirmed a direct relationship between divergence ratios and the Alu, LINE-1, Satellite and their derivative oligonucleotide contents. Thus their relocation on the Y-chromosome is followed by sequence divergence rather than the well documented concerted evolution of these non-coding progenitor repeated sequences. Five of the nine Y-chromosomal fragments are non-pseudoautosomal and transcribed into heterogeneous PolyA^+ RNA and thus can be retrotransposed. Evolutionary and computer analysis identified homologous oligonucleotide tracts in several human loci suggesting common and random mechanistic origins. Dysgenic genomes represent the accelerated evolution driving sequence divergence (McClintock, 1984). Sex reversal and sterility characterizing dysgenesis occurs in C57BL/6JY ^{rm Pos} but not in 129/SvY^{rm Pos} derivative strains. High frequency, random, multi-locus deletion products of the feral Y^{ rm Pos}-chromosome are generated in the germlines of F1(C57BL/6J X 129/SvY^{ rm Pos})(male) and C57BL/6JY ^{rm Pos}(male) but not in 129/SvY^{rm Pos}(male). Equal, 10^{-1}, 10^ {-2}, and 0 copies (relative to males) of Y^{rm Pos}-specific deletion products respectively characterize C57BL/6JY ^{rm Pos} (HC), (LC), (T) and (F) females. The testes determining loci of inactive Y^{rm Pos}-chromosomes in C57BL/6JY^{rm Pos} HC females are the preferentially deleted/rearranged Y ^{rm Pos}-sequences. Disruption of regulation of plasma testosterone and hepatic MUP-A mRNA levels, TRD of a 4.7 Kbp EcoR1 fragment suggest disruption of autosomal/X-chromosomal sequences. These data and the highly repeated progenitor (Alu, GATA, LINE-1
The CRISPR Spacer Space Is Dominated by Sequences from Species-Specific Mobilomes.
Shmakov, Sergey A; Sitnik, Vassilii; Makarova, Kira S; Wolf, Yuri I; Severinov, Konstantin V; Koonin, Eugene V
2017-09-19
Clustered regularly interspaced short palindromic repeats and CRISPR-associated protein (CRISPR-Cas) systems store the memory of past encounters with foreign DNA in unique spacers that are inserted between direct repeats in CRISPR arrays. For only a small fraction of the spacers, homologous sequences, called protospacers, are detectable in viral, plasmid, and microbial genomes. The rest of the spacers remain the CRISPR "dark matter." We performed a comprehensive analysis of the spacers from all CRISPR- cas loci identified in bacterial and archaeal genomes, and we found that, depending on the CRISPR-Cas subtype and the prokaryotic phylum, protospacers were detectable for 1% to about 19% of the spacers (~7% global average). Among the detected protospacers, the majority, typically 80 to 90%, originated from viral genomes, including proviruses, and among the rest, the most common source was genes that are integrated into microbial chromosomes but are involved in plasmid conjugation or replication. Thus, almost all spacers with identifiable protospacers target mobile genetic elements (MGE). The GC content, as well as dinucleotide and tetranucleotide compositions, of microbial genomes, their spacer complements, and the cognate viral genomes showed a nearly perfect correlation and were almost identical. Given the near absence of self-targeting spacers, these findings are most compatible with the possibility that the spacers, including the dark matter, are derived almost completely from the species-specific microbial mobilomes. IMPORTANCE The principal function of CRISPR-Cas systems is thought to be protection of bacteria and archaea against viruses and other parasitic genetic elements. The CRISPR defense function is mediated by sequences from parasitic elements, known as spacers, that are inserted into CRISPR arrays and then transcribed and employed as guides to identify and inactivate the cognate parasitic genomes. However, only a small fraction of the CRISPR spacers
Chen, Jin-Jin; Zhao, Qing-Sheng; Liu, Yi-Lan; Zha, Sheng-Hua; Zhao, Bing
2015-09-01
Maca (Lepidium meyenii) is an herbaceous plant that grows in high plateaus and has been used as both food and folk medicine for centuries because of its benefits to human health. In the present study, ITS (internal transcribed spacer) sequences of forty-three maca samples, collected from different regions or vendors, were amplified and analyzed. The ITS sequences of nineteen potential adulterants of maca were also collected and analyzed. The results indicated that the ITS sequence of maca was consistent in all samples and unique when compared with its adulterants. Therefore, this DNA-barcoding approach based on the ITS sequence can be used for the molecular identification of maca and its adulterants. Copyright © 2015 China Pharmaceutical University. Published by Elsevier B.V. All rights reserved.
Next-generation sequencing identifies transportin 3 as the causative gene for LGMD1F.
Directory of Open Access Journals (Sweden)
Annalaura Torella
Full Text Available Limb-girdle muscular dystrophies (LGMD are genetically and clinically heterogeneous conditions. We investigated a large family with autosomal dominant transmission pattern, previously classified as LGMD1F and mapped to chromosome 7q32. Affected members are characterized by muscle weakness affecting earlier the pelvic girdle and the ileopsoas muscles. We sequenced the whole exome of four family members and identified a shared heterozygous frame-shift variant in the Transportin 3 (TNPO3 gene, encoding a member of the importin-β super-family. The TNPO3 gene is mapped within the LGMD1F critical interval and its 923-amino acid human gene product is also expressed in skeletal muscle. In addition, we identified an isolated case of LGMD with a new missense mutation in the same gene. We localized the mutant TNPO3 around the nucleus, but not inside. The involvement of gene related to the nuclear transport suggests a novel disease mechanism leading to muscular dystrophy.
Amor, Nabil; Farjallah, Sarra; Salem, Mohamed; Lamine, Dia Mamadou; Merella, Paolo; Said, Khaled; Ben Slimane, Badreddine
2011-10-01
Fasciolosis caused by Fasciola hepatica and Fasciola gigantica (Platyhelminthes: Trematoda: Digenea) is considered the most important helminth infection of ruminants in tropical countries, causing considerable socioeconomic problems. From Africa, F. gigantica has been previously characterized from Burkina Faso, Senegal, Kenya, Zambia and Mali, while F. hepatica has been reported from Morocco and Tunisia, and both species have been observed from Ethiopia and Egypt on the basis of morphometric differences, while the use of molecular markers is necessary to distinguish exactly between species. Samples identified morphologically as F. gigantica (n=60) from sheep and cattle from different geographical localities of Mauritania were genetically characterized by sequences of the first (ITS-1), the 5.8S, and second (ITS-2) Internal Transcribed Spacers (ITS) of nuclear ribosomal DNA (rDNA) genes and the mitochondrial Cytochrome c Oxidase I (COI) gene. Comparison of the sequences of the Mauritanian samples with sequences of Fasciola spp. from GenBank confirmed that all samples belong to the species F. gigantica. The nucleotide sequencing of ITS rDNA of F. gigantica showed no nucleotide variation in the ITS-1, 5.8S, and ITS-2 rDNA sequences among all samples examined and those from Burkina Faso, Kenya, Egypt and Iran. The phylogenetic trees based on the ITS-1 and ITS-2 sequences showed a close relationship of the Mauritanian samples with isolates of F. gigantica from different localities of Africa and Asia. The COI genotypes of the Mauritanian specimens of F. gigantica had a high level of diversity, and they belonged to the F. gigantica phylogenically distinguishable clade. The present study is the first molecular characterization of F. gigantica in sheep and cattle from Mauritania, allowing a reliable approach for the genetic differentiation of Fasciola spp. and providing basis for further studies on liver flukes in the African countries. Copyright © 2011 Elsevier Inc. All
Directory of Open Access Journals (Sweden)
Leterrier Christine
2010-07-01
Full Text Available Abstract Background SNP (Single Nucleotide Polymorphism discovery is now routinely performed using high-throughput sequencing of reduced representation libraries. Our objective was to adapt 454 GS FLX based sequencing methodologies in order to obtain the largest possible dataset from two reduced representations libraries, produced by AFLP (Amplified Fragment Length Polymorphism for genomic DNA, and EST (Expressed Sequence Tag for the transcribed fraction of the genome. Findings The expressed fraction was obtained by preparing cDNA libraries without PCR amplification from quail embryo and brain. To optimize the information content for SNP analyses, libraries were prepared from individuals selected in three quail lines and each individual in the AFLP library was tagged. Sequencing runs produced 399,189 sequence reads from cDNA and 373,484 from genomic fragments, covering close to 250 Mb of sequence in total. Conclusions Both methods used to obtain reduced representations for high-throughput sequencing were successful after several improvements. The protocols may be used for several sequencing applications, such as de novo sequencing, tagged PCR fragments or long fragment sequencing of cDNA.
Gholami, Akram; Subramaniam, Shweta; Geeta, R; Pandey, Arun K
2017-06-01
Alysicarpus Necker ex Desvaux (Fabaceae, Desmodieae) consists of ~30 species that are distributed in tropical and subtropical regions of theworld. In India, the genus is represented by ca. 18 species, ofwhich seven are endemic. Sequences of the nuclear Internal transcribed spacer from38 accessions representing 16 Indian specieswere subjected to phylogenetic analyses. The ITS sequence data strongly support the monophyly of the genus Alysicarpus. Analyses revealed four major well-supported clades within Alysicarpus. Ancestral state reconstructions were done for two morphological characters, namely calyx length in relation to pod (macrocalyx and microcalyx) and pod surface ornamentation (transversely rugose and nonrugose). The present study is the first report on molecular systematics of Indian Alysicarpus.
Differences in a ribosomal DNA sequence of Strongylus species allows identification of single eggs.
Campbell, A J; Gasser, R B; Chilton, N B
1995-03-01
In the current study, molecular techniques were evaluated for the species identification of individual strongyle eggs. Adult worms of Strongylus edentatus, S. equinus and S. vulgaris were collected at necropsy from horses from Australia and the U.S.A. Genomic DNA was isolated and a ribosomal transcribed spacer (ITS-2) amplified and sequenced using polymerase chain reaction (PCR) techniques. The length of the ITS-2 sequence of S. edentatus, S. equinus and S. vulgaris ranged between 217 and 235 nucleotides. Extensive sequence analysis demonstrated a low degree (0-0.9%) of intraspecific variation in the ITS-2 for the Strongylus species examined, whereas the levels of interspecific differences (13-29%) were significantly greater. Interspecific differences in the ITS-2 sequences allowed unequivocal species identification of single worms and eggs using PCR-linked restriction fragment length polymorphism. These results demonstrate the potential of the ribosomal spacers as genetic markers for species identification of single strongyle eggs from horse faeces.
Directory of Open Access Journals (Sweden)
Maria Lodovica Gullino
2012-01-01
Full Text Available A collection of 356 isolates of Aspergillus spp. collected during 2006 and 2007 from grapevines in northern Italy were identified through Internal Transcribed Spacer based Restriction Fragment Length Polymorphism (ITS-RFLP and tested for ochratoxin A (OTA production. Restriction endonuclease digestion of the ITS products using the endonucleases HhaI, HinfI and RsaI, distinguished five different RFLPs. From each pattern, three samples were sequenced and the nucleotide sequences showed different species corresponding to Aspergillus niger, A. carbonarius, A. tubingensis, A. japonicus and A. aculeatus. By comparing the sequences of the ITS regions, also the uniseriate species A. japonicus and A. aculeatus could be differentiated by HinfI digestion of the ITS products. Among the aspergilli, A. niger was the major species associated with grapes during 2006 (57.4%, while A. carbonarius was the major species during 2007 (46.6%. All the strains of Aspergillus were tested for their ability to produce OTA on Yeast extract sucrose medium (YES, as it was tested as an optimal substrate for the evaluation of OTA production by black aspergilli. Out of 356 isolates, 63 (17.7% isolates produced OTA ranging from 0.05 to 3.0 µg mL−1. Most of the ochratoxigenic isolates were A. carbonarius (46 in both years, but also some strains of A. tubingensis (11 and A. japonicus (6 produced lower amounts of OTA.
DEFF Research Database (Denmark)
Martinussen, Jan; Hammer, Karin
1998-01-01
The biosynthesis of carbamoylphosphate is catalysed by the heterodimeric enzyme carbamoylphosphate synthetase (CPSase). The genes encoding the two subunits in procaryotes are normally transcribed as an operon, whereas in Lactococcus lactis, the gene encoding the large subunit (carB) is shown...
Directory of Open Access Journals (Sweden)
Ella R Thompson
2012-09-01
Full Text Available Despite intensive efforts using linkage and candidate gene approaches, the genetic etiology for the majority of families with a multi-generational breast cancer predisposition is unknown. In this study, we used whole-exome sequencing of thirty-three individuals from 15 breast cancer families to identify potential predisposing genes. Our analysis identified families with heterozygous, deleterious mutations in the DNA repair genes FANCC and BLM, which are responsible for the autosomal recessive disorders Fanconi Anemia and Bloom syndrome. In total, screening of all exons in these genes in 438 breast cancer families identified three with truncating mutations in FANCC and two with truncating mutations in BLM. Additional screening of FANCC mutation hotspot exons identified one pathogenic mutation among an additional 957 breast cancer families. Importantly, none of the deleterious mutations were identified among 464 healthy controls and are not reported in the 1,000 Genomes data. Given the rarity of Fanconi Anemia and Bloom syndrome disorders among Caucasian populations, the finding of multiple deleterious mutations in these critical DNA repair genes among high-risk breast cancer families is intriguing and suggestive of a predisposing role. Our data demonstrate the utility of intra-family exome-sequencing approaches to uncover cancer predisposition genes, but highlight the major challenge of definitively validating candidates where the incidence of sporadic disease is high, germline mutations are not fully penetrant, and individual predisposition genes may only account for a tiny proportion of breast cancer families.
Directory of Open Access Journals (Sweden)
Yingying Li
Full Text Available Quinclorac is a widely used herbicide in rice filed. Unfortunately, quinclorac residues are phytotoxic to many crops/vegetables. The degradation of quinclorac in nature is very slow. On the other hand, degradation of quinclorac using bacteria can be an effective and efficient method to reduce its contamination. In this study, we isolated a quinclorac bioremediation bacterium strain F4 from quinclorac contaminated soils. Based on morphological characteristics and 16S rRNA gene sequence analysis, we identified strain F4 as Mycobacterium sp. We investigated the effects of temperature, pH, inoculation size and initial quinclorac concentration on growth and degrading efficiency of F4 and determined the optimal quinclorac degrading condition of F4. Under optimal degrading conditions, F4 degraded 97.38% of quinclorac from an initial concentration of 50 mg/L in seven days. Our indoor pot experiment demonstrated that the degradation products were non-phytotoxic to tobacco. After analyzing the quinclorac degradation products of F4, we proposed that F4 could employ two pathways to degrade quinclorac: one is through methylation, the other is through dechlorination. Furthermore, we reconstructed the whole genome of F4 through single molecular sequencing and de novo assembly. We identified 77 methyltransferases and eight dehalogenases in the F4 genome to support our hypothesized degradation path.
Li, Yingying; Chen, Wu; Wang, Yunsheng; Luo, Kun; Li, Yue; Bai, Lianyang; Luo, Feng
2017-01-01
Quinclorac is a widely used herbicide in rice filed. Unfortunately, quinclorac residues are phytotoxic to many crops/vegetables. The degradation of quinclorac in nature is very slow. On the other hand, degradation of quinclorac using bacteria can be an effective and efficient method to reduce its contamination. In this study, we isolated a quinclorac bioremediation bacterium strain F4 from quinclorac contaminated soils. Based on morphological characteristics and 16S rRNA gene sequence analysis, we identified strain F4 as Mycobacterium sp. We investigated the effects of temperature, pH, inoculation size and initial quinclorac concentration on growth and degrading efficiency of F4 and determined the optimal quinclorac degrading condition of F4. Under optimal degrading conditions, F4 degraded 97.38% of quinclorac from an initial concentration of 50 mg/L in seven days. Our indoor pot experiment demonstrated that the degradation products were non-phytotoxic to tobacco. After analyzing the quinclorac degradation products of F4, we proposed that F4 could employ two pathways to degrade quinclorac: one is through methylation, the other is through dechlorination. Furthermore, we reconstructed the whole genome of F4 through single molecular sequencing and de novo assembly. We identified 77 methyltransferases and eight dehalogenases in the F4 genome to support our hypothesized degradation path.
Energy Technology Data Exchange (ETDEWEB)
Faulon, Jean-Loup Michel; Heffelfinger, Grant S.
2009-06-01
A novel experimental and computational technique based on multiple enzymatic digestion of a protein or protein mixture that reconstructs protein sequences from sequences of overlapping peptides is described in this SAND report. This approach, analogous to shotgun sequencing of DNA, is to be used to sequence alternative spliced proteins, to identify post-translational modifications, and to sequence genetically engineered proteins.
Liu, Junlong; Guan, Guiquan; Liu, Aihong; Li, Youquan; Yin, Hong; Luo, Jianxun
2014-03-01
In this study, two pairs of oligonucleotide primers were designed according to the nucleotide sequence of the internal transcribed spacers (ITSs) of Babesia bigemina and B. bovis isolates from China. The primers were used in a multiplex PCR to detect parasite DNA in blood samples from cattle. There was no cross reactions with B. ovata, B. major, B. sp. Kashi, Theileria annulata, T. sergenti, T. sinensis or normal bovine DNA. The sensitivity of multiplex PCR assay was 1 pg and 10 pg DNA for B. bigemina and B. bovis, respectively. A total of 260 field blood samples collected from cattle in five provinces of China were analyzed by multiplex PCR and light microscopy. PCR testing revealed that 7.3% (19/260) and 5.8% (15/260) of cattle were positive for B. bigemina and B. bovis and 1.2% (3/260) of cattle were co-infected with B. bigemina and B. bovis. Using light microscopy, 2.3% (6/260) and 1.5% (4/260) of cattle were infected by B. bigemina and B. bovis, respectively, and no co-infection was found. The results showed that the multiplex PCR developed in the present study could be an alternative diagnostic tool for the detection of B. bovis and B. bigemina infection in cattle.
Directory of Open Access Journals (Sweden)
Dong Ding
Full Text Available Integration of the viral DNA into host chromosomes was found in most of the hepatitis B virus (HBV-related hepatocellular carcinomas (HCCs. Here we devised a massive anchored parallel sequencing (MAPS method using next-generation sequencing to isolate and sequence HBV integrants. Applying MAPS to 40 pairs of HBV-related HCC tissues (cancer and adjacent tissues, we identified 296 HBV integration events corresponding to 286 unique integration sites (UISs with precise HBV-Human DNA junctions. HBV integration favored chromosome 17 and preferentially integrated into human transcript units. HBV targeted genes were enriched in GO terms: cAMP metabolic processes, T cell differentiation and activation, TGF beta receptor pathway, ncRNA catabolic process, and dsRNA fragmentation and cellular response to dsRNA. The HBV targeted genes include 7 genes (PTPRJ, CNTN6, IL12B, MYOM1, FNDC3B, LRFN2, FN1 containing IPR003961 (Fibronectin, type III domain, 7 genes (NRG3, MASP2, NELL1, LRP1B, ADAM21, NRXN1, FN1 containing IPR013032 (EGF-like region, conserved site, and three genes (PDE7A, PDE4B, PDE11A containing IPR002073 (3', 5'-cyclic-nucleotide phosphodiesterase. Enriched pathways include hsa04512 (ECM-receptor interaction, hsa04510 (Focal adhesion, and hsa04012 (ErbB signaling pathway. Fewer integration events were found in cancers compared to cancer-adjacent tissues, suggesting a clonal expansion model in HCC development. Finally, we identified 8 genes that were recurrent target genes by HBV integration including fibronectin 1 (FN1 and telomerase reverse transcriptase (TERT1, two known recurrent target genes, and additional novel target genes such as SMAD family member 5 (SMAD5, phosphatase and actin regulator 4 (PHACTR4, and RNA binding protein fox-1 homolog (C. elegans 1 (RBFOX1. Integrating analysis with recently published whole-genome sequencing analysis, we identified 14 additional recurrent HBV target genes, greatly expanding the HBV recurrent target list
5. international workshop on the identification of transcribed sequences
Energy Technology Data Exchange (ETDEWEB)
NONE
1995-12-31
This workshop was held November 5--8, 1995 in Les Embiez, France. The purpose of this conference was to provide a multidisciplinary forum for exchange of state-of-the-art information on mapping the human genome. Attention is focused on the following topics: transcriptional maps; functional analysis; techniques; model organisms; and tissue specific libraries and genes. Abstracts are included of the papers that were presented.
Nucleotide sequences of cDNAs for human papillomavirus type 18 transcripts in HeLa cells
International Nuclear Information System (INIS)
Inagaki, Yutaka; Tsunokawa, Youko; Takebe, Naoko; Terada, Masaaki; Sugimura, Takashi; Nawa, Hiroyuki; Nakanishi, Shigetada
1988-01-01
HeLa cells expressed 3.4- and 1.6-kilobase (kb) transcripts of the integrated human papillomavirus (HPV) type 18 genome. Two types of cDNA clones representing each size of HPV type 18 transcript were isolated. Sequence analysis of these two types of cDNA clones revealed that the 3.4-kb transcript contained E6, E7, the 5' portion of E1, and human sequence and that the 1.6-kb transcript contained spliced and frameshifted E6 (E6 * ), E7, and human sequence. There was a common human sequence containing a poly(A) addition signal in the 3' end portions of both transcripts, indicating that they were transcribed from the HPV genome at the same integration site with different splicing. Furthermore, the 1.6-kb transcript contained both of the two viral TATA boxes upstream of E6, strongly indicating that a cellular promoter was used for its transcription
Park, Doori; Park, Su-Hyun; Ban, Yong Wook; Kim, Youn Shic; Park, Kyoung-Cheul; Kim, Nam-Soo; Kim, Ju-Kon; Choi, Ik-Young
2017-08-15
Genetically modified crops (GM crops) have been developed to improve the agricultural traits of modern crop cultivars. Safety assessments of GM crops are of paramount importance in research at developmental stages and before releasing transgenic plants into the marketplace. Sequencing technology is developing rapidly, with higher output and labor efficiencies, and will eventually replace existing methods for the molecular characterization of genetically modified organisms. To detect the transgenic insertion locations in the three GM rice gnomes, Illumina sequencing reads are mapped and classified to the rice genome and plasmid sequence. The both mapped reads are classified to characterize the junction site between plant and transgene sequence by sequence alignment. Herein, we present a next generation sequencing (NGS)-based molecular characterization method, using transgenic rice plants SNU-Bt9-5, SNU-Bt9-30, and SNU-Bt9-109. Specifically, using bioinformatics tools, we detected the precise insertion locations and copy numbers of transfer DNA, genetic rearrangements, and the absence of backbone sequences, which were equivalent to results obtained from Southern blot analyses. NGS methods have been suggested as an effective means of characterizing and detecting transgenic insertion locations in genomes. Our results demonstrate the use of a combination of NGS technology and bioinformatics approaches that offers cost- and time-effective methods for assessing the safety of transgenic plants.
Redberg, G.L.; Hibbett, D.S.; Ammirati, J.F.; Rodriguez, R.J.
2003-01-01
The genetic diversity and phylogeny of Bridgeoporus nobilissimus have been analyzed. DNA was extracted from spores collected from individual fruiting bodies representing six geographically distinct populations in Oregon and Washington. Spore samples collected contained low levels of bacteria, yeast and a filamentous fungal species. Using taxon-specific PCR primers, it was possible to discriminate among rDNA from bacteria, yeast, a filamentous associate and B. nobilissimus. Nuclear rDNA internal transcribed spacer (ITS) region sequences of B. nobilissimus were compared among individuals representing six populations and were found to have less than 2% variation. These sequences also were used to design dual and nested PCR primers for B. nobilissimus-specific amplification. Mitochondrial small-subunit rDNA sequences were used in a phylogenetic analysis that placed B. nobilissimus in the hymenochaetoid clade, where it was associated with Oxyporus and Schizopora.
Application of small RNA sequencing to identify microRNAs in acute kidney injury and fibrosis
Energy Technology Data Exchange (ETDEWEB)
Pellegrini, Kathryn L. [Department of Medicine, Renal Division, Brigham and Women' s Hospital, Harvard Medical School, Boston, MA (United States); Gerlach, Cory V. [Department of Medicine, Renal Division, Brigham and Women' s Hospital, Harvard Medical School, Boston, MA (United States); Department of Environmental Health, Harvard T.H. Chan School of Public Health, Boston, MA (United States); Laboratory of Systems Pharmacology, Harvard Program in Therapeutic Sciences, Harvard Medical School, Boston, MA (United States); Craciun, Florin L.; Ramachandran, Krithika [Department of Medicine, Renal Division, Brigham and Women' s Hospital, Harvard Medical School, Boston, MA (United States); Bijol, Vanesa [Department of Pathology, Brigham and Women' s Hospital, Harvard Medical School, Boston, MA (United States); Kissick, Haydn T. [Department of Surgery, Urology Division, Beth Israel Deaconess Medical Center, Harvard Medical School, Boston, MA (United States); Vaidya, Vishal S., E-mail: vvaidya@bwh.harvard.edu [Department of Medicine, Renal Division, Brigham and Women' s Hospital, Harvard Medical School, Boston, MA (United States); Department of Environmental Health, Harvard T.H. Chan School of Public Health, Boston, MA (United States); Laboratory of Systems Pharmacology, Harvard Program in Therapeutic Sciences, Harvard Medical School, Boston, MA (United States)
2016-12-01
Establishing a microRNA (miRNA) expression profile in affected tissues provides an important foundation for the discovery of miRNAs involved in the development or progression of pathologic conditions. We conducted small RNA sequencing to generate a temporal profile of miRNA expression in the kidneys using a mouse model of folic acid-induced (250 mg/kg i.p.) kidney injury and fibrosis. From the 103 miRNAs that were differentially expressed over the time course (> 2-fold, p < 0.05), we chose to further investigate miR-18a-5p, which is expressed during the acute stage of the injury; miR-132-3p, which is upregulated during transition between acute and fibrotic injury; and miR-146b-5p, which is highly expressed at the peak of fibrosis. Using qRT-PCR, we confirmed the increased expression of these candidate miRNAs in the folic acid model as well as in other established mouse models of acute injury (ischemia/reperfusion injury) and fibrosis (unilateral ureteral obstruction). In situ hybridization confirmed high expression of miR-18a-5p, miR-132-3p and miR-146b-5p throughout the kidney cortex in mice and humans with severe kidney injury or fibrosis. When primary human proximal tubular epithelial cells were treated with model nephrotoxicants such as cadmium chloride (CdCl{sub 2}), arsenic trioxide, aristolochic acid (AA), potassium dichromate (K{sub 2}Cr{sub 2}O{sub 7}) and cisplatin, miRNA-132-3p was upregulated 4.3-fold after AA treatment and 1.5-fold after K{sub 2}Cr{sub 2}O{sub 7} and CdCl{sub 2} treatment. These results demonstrate the application of temporal small RNA sequencing to identify miR-18a, miR-132 and miR-146b as differentially expressed miRNAs during distinct phases of kidney injury and fibrosis progression. - Highlights: • We used small RNA sequencing to identify differentially expressed miRNAs in kidney. • Distinct patterns were found for acute injury and fibrotic stages in the kidney. • Upregulation of miR-18a, -132 and -146b was confirmed in mice
Yu, Long-Xi; Liu, Xinchun; Boge, William; Liu, Xiang-Ping
2016-01-01
Salinity is one of major abiotic stresses limiting alfalfa (Medicago sativa L.) production in the arid and semi-arid regions in US and other counties. In this study, we used a diverse panel of alfalfa accessions previously described by Zhang et al. (2015) to identify molecular markers associated with salt tolerance during germination using genome-wide association study (GWAS) and genotyping-by-sequencing (GBS). Phenotyping was done by germinating alfalfa seeds under different levels of salt stress. Phenotypic data of adjusted germination rates and SNP markers generated by GBS were used for marker-trait association. Thirty six markers were significantly associated with salt tolerance in at least one level of salt treatments. Alignment of sequence tags to the Medicago truncatula genome revealed genetic locations of the markers on all chromosomes except chromosome 3. Most significant markers were found on chromosomes 1, 2, and 4. BLAST search using the flanking sequences of significant markers identified 14 putative candidate genes linked to 23 significant markers. Most of them were repeatedly identified in two or three salt treatments. Several loci identified in the present study had similar genetic locations to the reported QTL associated with salt tolerance in M. truncatula. A locus identified on chromosome 6 by this study overlapped with that by drought in our previous study. To our knowledge, this is the first report on mapping loci associated with salt tolerance during germination in autotetraploid alfalfa. Further investigation on these loci and their linked genes would provide insight into understanding molecular mechanisms by which salt and drought stresses affect alfalfa growth. Functional markers closely linked to the resistance loci would be useful for MAS to improve alfalfa cultivars with enhanced resistance to drought and salt stresses. PMID:27446182
Directory of Open Access Journals (Sweden)
Nedenia Bonvino Stafuzza
Full Text Available Whole-genome re-sequencing, alignment and annotation analyses were undertaken for 12 sires representing four important cattle breeds in Brazil: Guzerat (multi-purpose, Gyr, Girolando and Holstein (dairy production. A total of approximately 4.3 billion reads from an Illumina HiSeq 2000 sequencer generated for each animal 10.7 to 16.4-fold genome coverage. A total of 27,441,279 single nucleotide variations (SNVs and 3,828,041 insertions/deletions (InDels were detected in the samples, of which 2,557,670 SNVs and 883,219 InDels were novel. The submission of these genetic variants to the dbSNP database significantly increased the number of known variants, particularly for the indicine genome. The concordance rate between genotypes obtained using the Bovine HD BeadChip array and the same variants identified by sequencing was about 99.05%. The annotation of variants identified numerous non-synonymous SNVs and frameshift InDels which could affect phenotypic variation. Functional enrichment analysis was performed and revealed that variants in the olfactory transduction pathway was over represented in all four cattle breeds, while the ECM-receptor interaction pathway was over represented in Girolando and Guzerat breeds, the ABC transporters pathway was over represented only in Holstein breed, and the metabolic pathways was over represented only in Gyr breed. The genetic variants discovered here provide a rich resource to help identify potential genomic markers and their associated molecular mechanisms that impact economically important traits for Gyr, Girolando, Guzerat and Holstein breeding programs.
Schoch, Conrad L; Seifert, Keith A; Huhndorf, Sabine; Robert, Vincent; Spouge, John L; Levesque, C André; Chen, Wen
2012-04-17
Six DNA regions were evaluated as potential DNA barcodes for Fungi, the second largest kingdom of eukaryotic life, by a multinational, multilaboratory consortium. The region of the mitochondrial cytochrome c oxidase subunit 1 used as the animal barcode was excluded as a potential marker, because it is difficult to amplify in fungi, often includes large introns, and can be insufficiently variable. Three subunits from the nuclear ribosomal RNA cistron were compared together with regions of three representative protein-coding genes (largest subunit of RNA polymerase II, second largest subunit of RNA polymerase II, and minichromosome maintenance protein). Although the protein-coding gene regions often had a higher percent of correct identification compared with ribosomal markers, low PCR amplification and sequencing success eliminated them as candidates for a universal fungal barcode. Among the regions of the ribosomal cistron, the internal transcribed spacer (ITS) region has the highest probability of successful identification for the broadest range of fungi, with the most clearly defined barcode gap between inter- and intraspecific variation. The nuclear ribosomal large subunit, a popular phylogenetic marker in certain groups, had superior species resolution in some taxonomic groups, such as the early diverging lineages and the ascomycete yeasts, but was otherwise slightly inferior to the ITS. The nuclear ribosomal small subunit has poor species-level resolution in fungi. ITS will be formally proposed for adoption as the primary fungal barcode marker to the Consortium for the Barcode of Life, with the possibility that supplementary barcodes may be developed for particular narrowly circumscribed taxonomic groups.
Directory of Open Access Journals (Sweden)
Paula Paulo
2018-04-01
Full Text Available Considering that mutations in known prostate cancer (PrCa predisposition genes, including those responsible for hereditary breast/ovarian cancer and Lynch syndromes, explain less than 5% of early-onset/familial PrCa, we have sequenced 94 genes associated with cancer predisposition using next generation sequencing (NGS in a series of 121 PrCa patients. We found monoallelic truncating/functionally deleterious mutations in seven genes, including ATM and CHEK2, which have previously been associated with PrCa predisposition, and five new candidate PrCa associated genes involved in cancer predisposing recessive disorders, namely RAD51C, FANCD2, FANCI, CEP57 and RECQL4. Furthermore, using in silico pathogenicity prediction of missense variants among 18 genes associated with breast/ovarian cancer and/or Lynch syndrome, followed by KASP genotyping in 710 healthy controls, we identified "likely pathogenic" missense variants in ATM, BRIP1, CHEK2 and TP53. In conclusion, this study has identified putative PrCa predisposing germline mutations in 14.9% of early-onset/familial PrCa patients. Further data will be necessary to confirm the genetic heterogeneity of inherited PrCa predisposition hinted in this study.
Awan, Ali R; Manfredo, Amanda; Pleiss, Jeffrey A
2013-07-30
Alternative splicing is a potent regulator of gene expression that vastly increases proteomic diversity in multicellular eukaryotes and is associated with organismal complexity. Although alternative splicing is widespread in vertebrates, little is known about the evolutionary origins of this process, in part because of the absence of phylogenetically conserved events that cross major eukaryotic clades. Here we describe a lariat-sequencing approach, which offers high sensitivity for detecting splicing events, and its application to the unicellular fungus, Schizosaccharomyces pombe, an organism that shares many of the hallmarks of alternative splicing in mammalian systems but for which no previous examples of exon-skipping had been demonstrated. Over 200 previously unannotated splicing events were identified, including examples of regulated alternative splicing. Remarkably, an evolutionary analysis of four of the exons identified here as subject to skipping in S. pombe reveals high sequence conservation and perfect length conservation with their homologs in scores of plants, animals, and fungi. Moreover, alternative splicing of two of these exons have been documented in multiple vertebrate organisms, making these the first demonstrations of identical alternative-splicing patterns in species that are separated by over 1 billion y of evolution.
Directory of Open Access Journals (Sweden)
Hong Liu
Full Text Available As a genetic disorder of abnormal pigmentation, the molecular basis of dyschromatosis universalis hereditaria (DUH had remained unclear until recently when ABCB6 was reported as a causative gene of DUH.We performed genome-wide linkage scan using Illumina Human 660W-Quad BeadChip and exome sequencing analyses using Agilent SureSelect Human All Exon Kits in a multiplex Chinese DUH family to identify the pathogenic mutations and verified the candidate mutations using Sanger sequencing. Quantitative RT-PCR and Immunohistochemistry was performed to verify the expression of the pathogenic gene, Zebrafish was also used to confirm the functional role of ABCB6 in melanocytes and pigmentation.Genome-wide linkage (assuming autosomal dominant inheritance mode and exome sequencing analyses identified ABCB6 as the disease candidate gene by discovering a coding mutation (c.1358C>T; p.Ala453Val that co-segregates with the disease phenotype. Further mutation analysis of ABCB6 in four other DUH families and two sporadic cases by Sanger sequencing confirmed the mutation (c.1358C>T; p.Ala453Val and discovered a second, co-segregating coding mutation (c.964A>C; p.Ser322Lys in one of the four families. Both mutations were heterozygous in DUH patients and not present in the 1000 Genome Project and dbSNP database as well as 1,516 unrelated Chinese healthy controls. Expression analysis in human skin and mutagenesis interrogation in zebrafish confirmed the functional role of ABCB6 in melanocytes and pigmentation. Given the involvement of ABCB6 mutations in coloboma, we performed ophthalmological examination of the DUH carriers of ABCB6 mutations and found ocular abnormalities in them.Our study has advanced our understanding of DUH pathogenesis and revealed the shared pathological mechanism between pigmentary DUH and ocular coloboma.
Transcriptome analysis of the model protozoan, Tetrahymena thermophila, using Deep RNA sequencing.
Directory of Open Access Journals (Sweden)
Jie Xiong
Full Text Available BACKGROUND: The ciliated protozoan Tetrahymena thermophila is a well-studied single-celled eukaryote model organism for cellular and molecular biology. However, the lack of extensive T. thermophila cDNA libraries or a large expressed sequence tag (EST database limited the quality of the original genome annotation. METHODOLOGY/PRINCIPAL FINDINGS: This RNA-seq study describes the first deep sequencing analysis of the T. thermophila transcriptome during the three major stages of the life cycle: growth, starvation and conjugation. Uniquely mapped reads covered more than 96% of the 24,725 predicted gene models in the somatic genome. More than 1,000 new transcribed regions were identified. The great dynamic range of RNA-seq allowed detection of a nearly six order-of-magnitude range of measurable gene expression orchestrated by this cell. RNA-seq also allowed the first prediction of transcript untranslated regions (UTRs and an updated (larger size estimate of the T. thermophila transcriptome: 57 Mb, or about 55% of the somatic genome. Our study identified nearly 1,500 alternative splicing (AS events distributed over 5.2% of T. thermophila genes. This percentage represents a two order-of-magnitude increase over previous EST-based estimates in Tetrahymena. Evidence of stage-specific regulation of alternative splicing was also obtained. Finally, our study allowed us to completely confirm about 26.8% of the genes originally predicted by the gene finder, to correct coding sequence boundaries and intron-exon junctions for about a third, and to reassign microarray probes and correct earlier microarray data. CONCLUSIONS/SIGNIFICANCE: RNA-seq data significantly improve the genome annotation and provide a fully comprehensive view of the global transcriptome of T. thermophila. To our knowledge, 5.2% of T. thermophila genes with AS is the highest percentage of genes showing AS reported in a unicellular eukaryote. Tetrahymena thus becomes an excellent unicellular
József Geml; Gary A. Laursen; Ian C. Herriott; Jack M. McFarland; Michael G. Booth; Niall Lennon; H. Chad Nusbaum; D. Lee Taylor
2010-01-01
Although critical for the functioning of ecosystems, fungi are poorly known in high-latitude regions. Here, we provide the first genetic diversity assessment of one of the most diverse and abundant ectomycorrhizal genera in Alaska: Russula. We analyzed internal transcribed spacer rDNA sequences from sporocarps and soil samples using phylogenetic...
DEFF Research Database (Denmark)
Rasmussen, M; Sunde, L; Nielsen, M L
2018-01-01
Identification of fetal kidney anomalies invites questions about underlying causes and recurrence risk in future pregnancies. We therefore investigated the diagnostic yield of next-generation sequencing in fetuses with bilateral kidney anomalies and the correlation between disrupted genes and fetal...... phenotypes. Fetuses with bilateral kidney anomalies were screened using an in-house-designed kidney-gene panel. In families where candidate variants were not identified, whole-exome sequencing was performed. Genes uncovered by this analysis were added to our kidney-panel. We identified likely deleterious...... of nephronophthisis. Exome sequencing identified ROBO1 variants in one family and a GREB1L variant in another family. GREB1L and ROBO1 were added to our kidney-gene panel and additional variants were identified. Next-generation sequencing substantially contributes to identifying causes of fetal kidney anomalies...
Menkis, Audrius; Vasiliauskas, Rimvydas; Taylor, Andrew F S; Stenlid, Jan; Finlay, Roger
2005-12-01
Fungi colonising root tips of Pinus sylvestris and Picea abies grown under four different seedling cultivation systems were assessed by morphotyping, direct sequencing and isolation methods. Roots were morphotyped using two approaches: (1) 10% of the whole root system from 30 seedlings of each species and (2) 20 randomly selected tips per plant from 300 seedlings of each species. The first approach yielded 15 morphotypes, the second yielded 27, including 18 new morphotypes. The overall community consisted of 33 morphotypes. The level of mycorrhizal colonisation of roots determined by each approach was about 50%. The cultivation system had a marked effect on the level of mycorrhizal colonisation. In pine, the highest level of colonisation (48%) was observed in bare-root systems, while in spruce, colonisation was highest in polyethylene rolls (71%). Direct internal transcribed spacer ribosomal DNA sequencing and isolation detected a total of 93 fungal taxa, including 27 mycorrhizal. A total of 71 (76.3%) fungi were identified at least to a genus level. The overlap between the two methods was low. Only 13 (13.9%) of taxa were both sequenced and isolated, 47 (50.5%) were detected exclusively by sequencing and 33 (35.5%) exclusively by isolation. All isolated mycorrhizal fungi were also detected by direct sequencing. Characteristic mycorrhizas were Phialophora finlandia, Amphinema byssoides, Rhizopogon rubescens, Suillus luteus and Thelephora terrestris. There was a moderate similarity in mycorrhizal communities between pine and spruce and among different cultivation systems.
Directory of Open Access Journals (Sweden)
Yun Wang
Full Text Available Retinitis pigmentosa (RP is a heterogeneous group of progressive retinal degenerations characterized by pigmentation and atrophy in the mid-periphery of the retina. Twenty two subjects from a four-generation Chinese family with RP and thin cornea, congenital cataract and high myopia is reported in this study. All family members underwent complete ophthalmologic examinations. Patients of the family presented with bone spicule-shaped pigment deposits in retina, retinal vascular attenuation, retinal and choroidal dystrophy, as well as punctate opacity of the lens, reduced cornea thickness and high myopia. Peripheral venous blood was obtained from all patients and their family members for genetic analysis. After mutation analysis in a few known RP candidate genes, exome sequencing was used to analyze the exomes of 3 patients III2, III4, III6 and the unaffected mother II2. A total of 34,693 variations shared by 3 patients were subjected to several filtering steps against existing variation databases. Identified variations were verified in the rest family members by PCR and Sanger sequencing. Compound heterozygous c.802-8_810del17insGC and c.1091-2A>G mutations of the CYP4V2 gene, known as genetic defects for Bietti crystalline corneoretinal dystrophy, were identified as causative mutations for RP of this family.
A novel TBP-TAF complex on RNA polymerase II-transcribed snRNA genes.
Zaborowska, Justyna; Taylor, Alice; Roeder, Robert G; Murphy, Shona
2012-01-01
Initiation of transcription of most human genes transcribed by RNA polymerase II (RNAP II) requires the formation of a preinitiation complex comprising TFIIA, B, D, E, F, H and RNAP II. The general transcription factor TFIID is composed of the TATA-binding protein and up to 13 TBP-associated factors. During transcription of snRNA genes, RNAP II does not appear to make the transition to long-range productive elongation, as happens during transcription of protein-coding genes. In addition, recognition of the snRNA gene-type specific 3' box RNA processing element requires initiation from an snRNA gene promoter. These characteristics may, at least in part, be driven by factors recruited to the promoter. For example, differences in the complement of TAFs might result in differential recruitment of elongation and RNA processing factors. As precedent, it already has been shown that the promoters of some protein-coding genes do not recruit all the TAFs found in TFIID. Although TAF5 has been shown to be associated with RNAP II-transcribed snRNA genes, the full complement of TAFs associated with these genes has remained unclear. Here we show, using a ChIP and siRNA-mediated approach, that the TBP/TAF complex on snRNA genes differs from that found on protein-coding genes. Interestingly, the largest TAF, TAF1, and the core TAFs, TAF10 and TAF4, are not detected on snRNA genes. We propose that this snRNA gene-specific TAF subset plays a key role in gene type-specific control of expression.
Strope, Pooja K; Chaverri, Priscila; Gazis, Romina; Ciufo, Stacy; Domrachev, Michael; Schoch, Conrad L
2017-01-01
Abstract The ITS (nuclear ribosomal internal transcribed spacer) RefSeq database at the National Center for Biotechnology Information (NCBI) is dedicated to the clear association between name, specimen and sequence data. This database is focused on sequences obtained from type material stored in public collections. While the initial ITS sequence curation effort together with numerous fungal taxonomy experts attempted to cover as many orders as possible, we extended our latest focus to the family and genus ranks. We focused on Trichoderma for several reasons, mainly because the asexual and sexual synonyms were well documented, and a list of proposed names and type material were recently proposed and published. In this case study the recent taxonomic information was applied to do a complete taxonomic audit for the genus Trichoderma in the NCBI Taxonomy database. A name status report is available here: https://www.ncbi.nlm.nih.gov/Taxonomy/TaxIdentifier/tax_identifier.cgi. As a result, the ITS RefSeq Targeted Loci database at NCBI has been augmented with more sequences from type and verified material from Trichoderma species. Additionally, to aid in the cross referencing of data from single loci and genomes we have collected a list of quality records of the RPB2 gene obtained from type material in GenBank that could help validate future submissions. During the process of curation misidentified genomes were discovered, and sequence records from type material were found hidden under previous classifications. Source metadata curation, although more cumbersome, proved to be useful as confirmation of the type material designation. Database URL: http://www.ncbi.nlm.nih.gov/bioproject/PRJNA177353 PMID:29220466
Brütting, Christine; Narasimhan, Harini; Hoffmann, Frank; Kornhuber, Malte E; Staege, Martin S; Emmer, Alexander
2018-01-01
Human endogenous retroviruses (ERVs) have been found to be associated with different diseases, e.g., multiple sclerosis (MS). Most human ERVs integrated in our genome are not competent to replicate and these sequences are presumably silent. However, transcription of human ERVs can be reactivated, e.g., by hypoxia. Interestingly, MS has been linked to hypoxia since decades. As some patterns of demyelination are similar to white matter ischemia, hypoxic damage is discussed. Therefore, we are interested in the association between hypoxia and ERVs. As a model, we used human SH-SY5Y neuroblastoma cells after treatment with the hypoxia-mimetic cobalt chloride and analyzed differences in the gene expression profiles in comparison to untreated cells. The vicinity of up-regulated genes was scanned for endogenous retrovirus-derived sequences. Five genes were found to be strongly up-regulated in SH-SY5Y cells after treatment with cobalt chloride: clusterin, glutathione peroxidase 3, insulin-like growth factor 2, solute carrier family 7 member 11, and neural precursor cell expressed developmentally down-regulated protein 9. In the vicinity of these genes we identified large (>1,000 bp) open reading frames (ORFs). Most of these ORFs showed only low similarities to proteins from retro-transcribing viruses. However, we found very high similarity between retrovirus envelope sequences and a sequence in the vicinity of neural precursor cell expressed developmentally down-regulated protein 9. This sequence encodes the human endogenous retrovirus group FRD member 1, the encoded protein product is called syncytin 2. Transfection of syncytin 2 into the well-characterized Ewing sarcoma cell line A673 was not able to modulate the low immunostimulatory activity of this cell line. Future research is needed to determine whether the identified genes and the human endogenous retrovirus group FRD member 1 might play a role in the etiology of MS.
3′ terminal diversity of MRP RNA and other human noncoding RNAs revealed by deep sequencing
2013-01-01
Background Post-transcriptional 3′ end processing is a key component of RNA regulation. The abundant and essential RNA subunit of RNase MRP has been proposed to function in three distinct cellular compartments and therefore may utilize this mode of regulation. Here we employ 3′ RACE coupled with high-throughput sequencing to characterize the 3′ terminal sequences of human MRP RNA and other noncoding RNAs that form RNP complexes. Results The 3′ terminal sequence of MRP RNA from HEK293T cells has a distinctive distribution of genomically encoded termini (including an assortment of U residues) with a portion of these selectively tagged by oligo(A) tails. This profile contrasts with the relatively homogenous 3′ terminus of an in vitro transcribed MRP RNA control and the differing 3′ terminal profiles of U3 snoRNA, RNase P RNA, and telomerase RNA (hTR). Conclusions 3′ RACE coupled with deep sequencing provides a valuable framework for the functional characterization of 3′ terminal sequences of noncoding RNAs. PMID:24053768
Quantum-Sequencing: Fast electronic single DNA molecule sequencing
Casamada Ribot, Josep; Chatterjee, Anushree; Nagpal, Prashant
2014-03-01
A major goal of third-generation sequencing technologies is to develop a fast, reliable, enzyme-free, high-throughput and cost-effective, single-molecule sequencing method. Here, we present the first demonstration of unique ``electronic fingerprint'' of all nucleotides (A, G, T, C), with single-molecule DNA sequencing, using Quantum-tunneling Sequencing (Q-Seq) at room temperature. We show that the electronic state of the nucleobases shift depending on the pH, with most distinct states identified at acidic pH. We also demonstrate identification of single nucleotide modifications (methylation here). Using these unique electronic fingerprints (or tunneling data), we report a partial sequence of beta lactamase (bla) gene, which encodes resistance to beta-lactam antibiotics, with over 95% success rate. These results highlight the potential of Q-Seq as a robust technique for next-generation sequencing.
Lo, David; Weng, Jingning; Liu, xiaohong; Yang, Juhua; He, Fen; Wang, Yun; Liu, Xuyang
2016-01-01
PURPOSE To detect the disease-causing gene in a Chinese pedigree with autosomal-recessive retinitis pigmentosa (ARRP). METHODS All subjects in this family underwent a complete ophthalmic examination. Targeted-capture next generation sequencing (NGS) was performed on the proband to detect variants. All variants were verified in the remaining family members by PCR amplification and Sanger sequencing. RESULTS All the affected subjects in this pedigree were diagnosed with retinitis pigmentosa (RP). The compound heterozygous c.138delA (p.Asp47IlefsX24) and c.1841G>T (p.Gly614Val) mutations in the Crumbs homolog 1 (CRB1) gene were identified in all the affected patients but not in the unaffected individuals in this family. These mutations were inherited from their parents, respectively. CONCLUSION The novel compound heterozygous mutations in CRB1 were identified in a Chinese pedigree with ARRP using targeted-capture next generation sequencing. After evaluating the significant heredity and impaired protein function, the compound heterozygous c.138delA (p.Asp47IlefsX24) and c.1841G>T (p.Gly614Val) mutations are the causal genes of early onset ARRP in this pedigree. To the best of our knowledge, there is no previous report regarding the compound mutations. PMID:27806333
Whole genome sequencing resource identifies 18 new candidate genes for autism spectrum disorder
Yuen, Ryan K C; Merico, Daniele; Bookman, Matt; Howe, Jennifer L.; Thiruvahindrapuram, Bhooma; Patel, Rohan V.; Whitney, Joe; Deflaux, Nicole; Bingham, Jonathan; Wang, Zhuozhi; Pellecchia, Giovanna; Buchanan, Janet A.; Walker, Susan; Marshall, Christian R.; Uddin, Mohammed; Zarrei, Mehdi; Deneault, Eric; D'Abate, Lia; Chan, Ada J S; Koyanagi, Stephanie; Paton, Tara; Pereira, Sergio L.; Hoang, Ny; Engchuan, Worrawat; Higginbotham, Edward J.; Ho, Karen; Lamoureux, Sylvia; Li, Weili; MacDonald, Jeffrey R.; Nalpathamkalam, Thomas; Sung, Wilson W L; Tsoi, Fiona J.; Wei, John; Xu, Lizhen; Tasse, Anne Marie; Kirby, Emily; Van Etten, William; Twigger, Simon; Roberts, Wendy; Drmic, Irene; Jilderda, Sanne; Modi, Bonnie Mackinnon; Kellam, Barbara; Szego, Michael; Cytrynbaum, Cheryl; Weksberg, Rosanna; Zwaigenbaum, Lonnie; Woodbury-Smith, Marc; Brian, Jessica; Senman, Lili; Iaboni, Alana; Doyle-Thomas, Krissy; Thompson, Ann; Chrysler, Christina; Leef, Jonathan; Savion-Lemieux, Tal; Smith, Isabel M.; Liu, Xudong; Nicolson, Rob; Seifer, Vicki; Fedele, Angie; Cook, Edwin H.; Dager, Stephen; Estes, Annette; Gallagher, Louise; Malow, Beth A.; Parr, Jeremy R.; Spence, Sarah J.; Vorstman, Jacob; Frey, Brendan J.; Robinson, James T.; Strug, Lisa J.; Fernandez, Bridget A.; Elsabbagh, Mayada; Carter, Melissa T.; Hallmayer, Joachim; Knoppers, Bartha M.; Anagnostou, Evdokia; Szatmari, Peter; Ring, Robert H.; Glazer, David; Pletcher, Mathew T.; Scherer, Stephen W.
2017-01-01
We are performing whole-genome sequencing of families with autism spectrum disorder (ASD) to build a resource (MSSNG) for subcategorizing the phenotypes and underlying genetic factors involved. Here we report sequencing of 5,205 samples from families with ASD, accompanied by clinical information,
SEQATOMS: a web tool for identifying missing regions in PDB in sequence context
Brandt, B.W.; Heringa, J.; Leunissen, J.A.M.
2008-01-01
With over 46 000 proteins, the Protein Data Bank (PDB) is the most important database with structural information of biological macromolecules. PDB files contain sequence and coordinate information. Residues present in the sequence can be absent from the coordinate section, which means their
Directory of Open Access Journals (Sweden)
Luís França
Full Text Available Over a period of ten months a total of 5618 cord blood units (CBU were screened for microbial contamination under routine conditions. The antibiotic resistance profile for all isolates was also examined using ATB strips. The detection rate for culture positive units was 7.5%, corresponding to 422 samples.16S rRNA sequence analysis and identification with API test system were used to identify the culturable aerobic, microaerophilic and anaerobic bacteria from CBUs. From these samples we recovered 485 isolates (84 operational taxonomic units, OTUs assigned to the classes Bacteroidia, Actinobacteria, Clostridia, Bacilli, Betaproteobacteria and primarily to the Gammaproteobacteria. Sixty-nine OTUs, corresponding to 447 isolates, showed 16S rRNA sequence similarities above 99.0% with known cultured bacteria. However, 14 OTUs had 16S rRNA sequence similarities between 95 and 99% in support of genus level identification and one OTU with 16S rRNA sequence similarity of 90.3% supporting a family level identification only. The phenotypic identification formed 29 OTUs that could be identified to the species level and 9 OTUs that could be identified to the genus level by API test system. We failed to obtain identification for 14 OTUs, while 32 OTUs comprised organisms producing mixed identifications. Forty-two OTUs covered species not included in the API system databases. The API test system Rapid ID 32 Strep and Rapid ID 32 E showed the highest proportion of identifications to the species level, the lowest ratio of unidentified results and the highest agreement to the results of 16S rRNA assignments. Isolates affiliated to the Bacilli and Bacteroidia showed the highest antibiotic multi-resistance indices and microorganisms of the Clostridia displayed the most antibiotic sensitive phenotypes.
França, Luís; Simões, Catarina; Taborda, Marco; Diogo, Catarina; da Costa, Milton S
2015-01-01
Over a period of ten months a total of 5618 cord blood units (CBU) were screened for microbial contamination under routine conditions. The antibiotic resistance profile for all isolates was also examined using ATB strips. The detection rate for culture positive units was 7.5%, corresponding to 422 samples.16S rRNA sequence analysis and identification with API test system were used to identify the culturable aerobic, microaerophilic and anaerobic bacteria from CBUs. From these samples we recovered 485 isolates (84 operational taxonomic units, OTUs) assigned to the classes Bacteroidia, Actinobacteria, Clostridia, Bacilli, Betaproteobacteria and primarily to the Gammaproteobacteria. Sixty-nine OTUs, corresponding to 447 isolates, showed 16S rRNA sequence similarities above 99.0% with known cultured bacteria. However, 14 OTUs had 16S rRNA sequence similarities between 95 and 99% in support of genus level identification and one OTU with 16S rRNA sequence similarity of 90.3% supporting a family level identification only. The phenotypic identification formed 29 OTUs that could be identified to the species level and 9 OTUs that could be identified to the genus level by API test system. We failed to obtain identification for 14 OTUs, while 32 OTUs comprised organisms producing mixed identifications. Forty-two OTUs covered species not included in the API system databases. The API test system Rapid ID 32 Strep and Rapid ID 32 E showed the highest proportion of identifications to the species level, the lowest ratio of unidentified results and the highest agreement to the results of 16S rRNA assignments. Isolates affiliated to the Bacilli and Bacteroidia showed the highest antibiotic multi-resistance indices and microorganisms of the Clostridia displayed the most antibiotic sensitive phenotypes.
Directory of Open Access Journals (Sweden)
Millaray D Salas
2015-10-01
Full Text Available This paper reports the preliminary results of the first phase of an ongoing educational intervention conducted with students enrolled in an ELT training program at PUCV. The study set out to explore the feasibility and effectiveness of the recording and self-transcription methodology (Lynch, 2001, 2007; Mennim, 2003, 2012 as a route to noticing the gap and defossilization. Students (N=20 transcribed the oral texts they produced during the speaking section of the diagnostic test for English 5. The tasks were: (1 transcribing three minutes of their speaking time, (2 highlighting all the errors they identified in their own speech (3 coding them (e.g. grammatical, lexical, phonological and (4 sending the annotated transcript to the instructor by email. Drawing on the theory of questionnaire design and processing (Dörnyei, 2003, a survey was designed and posted online (GoogleForm and emailed to the students. The questionnaire asked students to evaluate the perceived benefits of the self-transcription methodology. The study data consist of the annotated transcripts and the questionnaire responses. The results of this study were much less positive than what has been reported in the literature (Willis & Willis, 1996, Burns & Joyce, 1997; Lynch, 2001, 2007; Mennim, 2003, 2012; Thornbury & Slade, 2006; Boettinger, Park & Timmis 2010; Stillwell et al., 2010, so an attempt is made to see why this might have been the case. Some pedagogical implications of this approach in the Chilean context are discussed.
Directory of Open Access Journals (Sweden)
Xuan Xiao
Full Text Available Nuclear receptors (NRs form a family of ligand-activated transcription factors that regulate a wide variety of biological processes, such as homeostasis, reproduction, development, and metabolism. Human genome contains 48 genes encoding NRs. These receptors have become one of the most important targets for therapeutic drug development. According to their different action mechanisms or functions, NRs have been classified into seven subfamilies. With the avalanche of protein sequences generated in the postgenomic age, we are facing the following challenging problems. Given an uncharacterized protein sequence, how can we identify whether it is a nuclear receptor? If it is, what subfamily it belongs to? To address these problems, we developed a predictor called iNR-PhysChem in which the protein samples were expressed by a novel mode of pseudo amino acid composition (PseAAC whose components were derived from a physical-chemical matrix via a series of auto-covariance and cross-covariance transformations. It was observed that the overall success rate achieved by iNR-PhysChem was over 98% in identifying NRs or non-NRs, and over 92% in identifying NRs among the following seven subfamilies: NR1--thyroid hormone like, NR2--HNF4-like, NR3--estrogen like, NR4--nerve growth factor IB-like, NR5--fushi tarazu-F1 like, NR6--germ cell nuclear factor like, and NR0--knirps like. These rates were derived by the jackknife tests on a stringent benchmark dataset in which none of protein sequences included has ≥60% pairwise sequence identity to any other in a same subset. As a user-friendly web-server, iNR-PhysChem is freely accessible to the public at either http://www.jci-bioinfo.cn/iNR-PhysChem or http://icpr.jci.edu.cn/bioinfo/iNR-PhysChem. Also a step-by-step guide is provided on how to use the web-server to get the desired results without the need to follow the complicated mathematics involved in developing the predictor. It is anticipated that iNR-PhysChem may
Simple sequence repeat (SSR) markers are effective for identifying ...
African Journals Online (AJOL)
DNA was extracted from newly formed leaves and amplified using 21 simple sequence repeat (SSR) markers (NH001c, NH002b, NH005b, NH007b, NH008b, NH009b, NH011b, NH013b, NH012a, NH014a, NH015a, NH017a, KA4b, KA5, KA14, KA16, KB16, KU10, BGA35, BGT23b and HGA8b). The data was analyzed by ...
Poulter, James A; El-Sayed, Walid; Shore, Roger C; Kirkham, Jennifer; Inglehearn, Chris F; Mighell, Alan J
2014-01-01
The conventional approach to identifying the defective gene in a family with an inherited disease is to find the disease locus through family studies. However, the rapid development and decreasing cost of next generation sequencing facilitates a more direct approach. Here, we report the identification of a frameshift mutation in LAMB3 as a cause of dominant hypoplastic amelogenesis imperfecta (AI). Whole-exome sequencing of three affected family members and subsequent filtering of shared variants, without prior genetic linkage, sufficed to identify the pathogenic variant. Simultaneous analysis of multiple family members confirms segregation, enhancing the power to filter the genetic variation found and leading to rapid identification of the pathogenic variant. LAMB3 encodes a subunit of Laminin-5, one of a family of basement membrane proteins with essential functions in cell growth, movement and adhesion. Homozygous LAMB3 mutations cause junctional epidermolysis bullosa (JEB) and enamel defects are seen in JEB cases. However, to our knowledge, this is the first report of dominant AI due to a LAMB3 mutation in the absence of JEB.
DEFF Research Database (Denmark)
Pundhir, Sachin; Hannibal, Tine Dahlbæk; Bang-Berthelsen, Claus Heiner
2014-01-01
. In this study, we have utilized the wealth of high-throughput sequencing data produced during the Encyclopedia of DNA Elements (ENCODE) project to identify spatially conserved regulatory elements within the Cd247 gene from human and mouse. We show the presence of two transcription factor binding sites...
Directory of Open Access Journals (Sweden)
Byeong Cheol Moon
2017-06-01
Full Text Available Determining the precise botanical origin of a traditional herbal medicine is important for basic quality control. In both the Chinese and Korean herbal pharmacopoeia, authentic Adenophorae Radix is defined as the roots of Adenophora stricta and Adenophora triphylla. However, the roots of Codonopsis lanceolata, Codonopsis pilosula, and Glehnia littoralis are frequently distributed as Adenophorae Radix in Korean herbal markets. Unfortunately, correctly identifying dried roots is difficult using conventional methods because the roots of those species are morphologically similar. Therefore, we developed DNA-based markers for the identification of authentic Adenophorae Radix and its common adulterants in commercially-processed samples. To develop a reliable method to discriminate between Adenophorae Radix and its adulterants, we sequenced the nuclear ribosomal DNA internal transcribed spacers (nrDNA-ITS and designed sequence-characterized amplified region (SCAR primers specific to the authentic and adulterant species. Using these primers, we developed SCAR markers for each species and established a multiplex-PCR method that can authenticate the four herbal medicines in a single PCR reaction. Furthermore, we confirmed that commercially-processed herbal medicines, which often have degraded DNA, could be assessed with our method. Therefore, our method is a reliable genetic tool to protect against adulteration and to standardize the quality of Adenophorae Radix.
miRanalyzer: a microRNA detection and analysis tool for next-generation sequencing experiments.
Hackenberg, Michael; Sturm, Martin; Langenberger, David; Falcón-Pérez, Juan Manuel; Aransay, Ana M
2009-07-01
Next-generation sequencing allows now the sequencing of small RNA molecules and the estimation of their expression levels. Consequently, there will be a high demand of bioinformatics tools to cope with the several gigabytes of sequence data generated in each single deep-sequencing experiment. Given this scene, we developed miRanalyzer, a web server tool for the analysis of deep-sequencing experiments for small RNAs. The web server tool requires a simple input file containing a list of unique reads and its copy numbers (expression levels). Using these data, miRanalyzer (i) detects all known microRNA sequences annotated in miRBase, (ii) finds all perfect matches against other libraries of transcribed sequences and (iii) predicts new microRNAs. The prediction of new microRNAs is an especially important point as there are many species with very few known microRNAs. Therefore, we implemented a highly accurate machine learning algorithm for the prediction of new microRNAs that reaches AUC values of 97.9% and recall values of up to 75% on unseen data. The web tool summarizes all the described steps in a single output page, which provides a comprehensive overview of the analysis, adding links to more detailed output pages for each analysis module. miRanalyzer is available at http://web.bioinformatics.cicbiogune.es/microRNA/.
The prophages of Lactobacillus johnsonii NCC 533: comparative genomics and transcription analysis
International Nuclear Information System (INIS)
Ventura, Marco; Canchaya, Carlos; Pridmore, R. David; Bruessow, Harald
2004-01-01
Two non-inducible, but apparently complete prophages were identified in the genome of the sequenced Lactobacillus johnsonii strain NCC 533. The 38- and 40-kb-long prophages Lj928 and Lj965 represent distinct lineages of Sfi11-like pac-site Siphoviridae unrelated at the DNA sequence level. The deduced structural proteins from Lj928 demonstrated aa sequence identity with Lactococcus lactis phage TP901-1, while Lj965 shared sequence links with Streptococcus thermophilus phage O1205. With the exception of tRNA genes, inserted between DNA replication and DNA packaging genes, the transcription of the prophage was restricted to the genome segments near both attachment sites. Transcribed genes unrelated to phage functions were inserted between the phage repressor and integrase genes; one group of genes shared sequence relatedness with a mobile DNA element in Staphylococcus aureus. A short, but highly transcribed region was located between the phage lysin and right attachment site; it lacked a protein-encoding function in one prophage
McTaggart, Lisa R; Doucet, Jennifer; Witkowska, Maria; Richardson, Susan E
2015-01-01
Antimicrobial susceptibility patterns of 112 clinical isolates, 28 type strains, and 9 reference strains of Nocardia were determined using the Sensititre Rapmyco microdilution panel (Thermo Fisher, Inc.). Isolates were identified by highly discriminatory multilocus sequence analysis and were chosen to represent the diversity of species recovered from clinical specimens in Ontario, Canada. Susceptibility to the most commonly used drug, trimethoprim-sulfamethoxazole, was observed in 97% of isolates. Linezolid and amikacin were also highly effective; 100% and 99% of all isolates demonstrated a susceptible phenotype. For the remaining antimicrobials, resistance was species specific with isolates of Nocardia otitidiscaviarum, N. brasiliensis, N. abscessus complex, N. nova complex, N. transvalensis complex, N. farcinica, and N. cyriacigeorgica displaying the traditional characteristic drug pattern types. In addition, the antimicrobial susceptibility profiles of a variety of rarely encountered species isolated from clinical specimens are reported for the first time and were categorized into four additional drug pattern types. Finally, MICs for the control strains N. nova ATCC BAA-2227, N. asteroides ATCC 19247(T), and N. farcinica ATCC 23826 were robustly determined to demonstrate method reproducibility and suitability of the commercial Sensititre Rapmyco panel for antimicrobial susceptibility testing of Nocardia spp. isolated from clinical specimens. The reported values will facilitate quality control and standardization among laboratories. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Pchelin, Ivan M; Zlatogursky, Vasily V; Rudneva, Mariya V; Chilina, Galina A; Rezaei-Matehkolaei, Ali; Lavnikevich, Dmitry M; Vasilyeva, Natalya V; Taraskina, Anastasia E
2016-09-01
Trichophyton spp. are important causative agents of superficial mycoses. The phylogeny of the genus and accurate strain identification, based on the ribosomal ITS region sequencing, are still under development. The present work is aimed at (i) inferring the genus phylogeny from partial ITS, LSU and BT2 sequences (ii) description of ribosomal ITS region polymorphism in 15 strains of Trichophyton interdigitale. We performed DNA sequence-based species identification and phylogenetic analysis on 48 strains belonging to the genus Trichophyton. Phylogenetic relationships were inferred by maximum likelihood and Bayesian methods on concatenated ITS, LSU and BT2 sequences. Ribosomal ITS region polymorphisms were assessed directly on the alignment. By phylogenetic reconstruction, we reveal major anthropophilic and zoophilic species clusters in the genus Trichophyton. We describe several sequences of the ITS region of T. interdigitale, which do not fit in the traditional polymorphism scheme and propose emendations in this scheme for discrimination between ITS sequence types in T. interdigitale. The new polymorphism scheme will allow inclusion of a wider spectrum of isolates while retaining its explanatory power. This scheme was also found to be partially congruent with NTS typing technique. © 2016 Blackwell Verlag GmbH.
Directory of Open Access Journals (Sweden)
Bernd Timmermann
Full Text Available BACKGROUND: Colorectal cancer (CRC is with approximately 1 million cases the third most common cancer worldwide. Extensive research is ongoing to decipher the underlying genetic patterns with the hope to improve early cancer diagnosis and treatment. In this direction, the recent progress in next generation sequencing technologies has revolutionized the field of cancer genomics. However, one caveat of these studies remains the large amount of genetic variations identified and their interpretation. METHODOLOGY/PRINCIPAL FINDINGS: Here we present the first work on whole exome NGS of primary colon cancers. We performed 454 whole exome pyrosequencing of tumor as well as adjacent not affected normal colonic tissue from microsatellite stable (MSS and microsatellite instable (MSI colon cancer patients and identified more than 50,000 small nucleotide variations for each tissue. According to predictions based on MSS and MSI pathomechanisms we identified eight times more somatic non-synonymous variations in MSI cancers than in MSS and we were able to reproduce the result in four additional CRCs. Our bioinformatics filtering approach narrowed down the rate of most significant mutations to 359 for MSI and 45 for MSS CRCs with predicted altered protein functions. In both CRCs, MSI and MSS, we found somatic mutations in the intracellular kinase domain of bone morphogenetic protein receptor 1A, BMPR1A, a gene where so far germline mutations are associated with juvenile polyposis syndrome, and show that the mutations functionally impair the protein function. CONCLUSIONS/SIGNIFICANCE: We conclude that with deep sequencing of tumor exomes one may be able to predict the microsatellite status of CRC and in addition identify potentially clinically relevant mutations.
Directory of Open Access Journals (Sweden)
Mokrini Fouad
2017-09-01
Full Text Available Morphological and molecular diversity among 11 populations of cereal cyst nematodes from different wheat production areas in Morocco was investigated using light microscopy, species-specific primers, complemented by the ITS-rDNA sequences. Morphometrics of cysts and second-stage juveniles (J2s were generally within the expected ranges for Heterodera avenae; only the isolate from Aïn Jmaa showed morphometrics conforming to those of H. latipons. When using species-specific primers for H. avenae and H. latipons, the specific bands of 109 bp and 204 bp, respectively, confirmed the morphological identification. In addition, the internal transcribed spacer (ITS regions were sequenced to study the diversity of the 11 populations. These sequences were compared with those of Heterodera species available in the GenBank database (www.ncbi.nlm.nih.gov and confirmed again the identity of the species. Ten sequences of the ITS-rDNA were similar (99–100% to the sequences of H. avenae published in GenBank and three sequences, corresponding with one population, were similar (97–99% to H. latipons.
Cryer, Heather; Home, Sarah; Morley Wilkins, Sarah
2013-01-01
To inform decision-making around the adoption of the Unified English Braille (UEB) code in the United Kingdom, a suite of research was carried out. This study involved a variety of braille stakeholders--student braille readers (in full time education), adult braille readers, braille teachers, and braille transcribers. Participants were sent…
Molecular cloning and sequence of the B880 holochrome gene from Rhodospirillum rubrum
International Nuclear Information System (INIS)
Anon.
1986-01-01
Restriction fragments of genomic Rhodospirillum rubrum DNA were selected according to size by electrophoresis followed by hybridization with [ 32 P]mRNA encoding the two B880 holochrome polypeptides. The fragments were cloned into Escherchia coli C600 with plasmid pBR327 as a vector. The clones were selected by colony hybridization with 32 P-holochrome-mRNA and counter selected by hybridization with Rs. rubrum ribosomal RNA, a minor contaminant of the mRNA preparation. Chimeric plasmid pRR22 was shown to contain the B880 genes by hybrid selection of B880 holochrome-mRNA. A restriction map of its 2.2-kilobase insert and the sequence of a 430 base pair fragment thereof is reported. Genes α and β are nearly contiguous, indicating that they are transcribed as a single operon. The predicted amino acid sequences coincide with the sequences of the α and β polypeptides established in other laboratories, except for additional C-terminal tails of 10 and 13 amino acid residues, respectively
Directory of Open Access Journals (Sweden)
Wu Xiwei
2012-03-01
Full Text Available Abstract Background MicroRNAs (miRNAs have been recently detected in the circulation of cancer patients, where they are associated with clinical parameters. Discovery profiling of circulating small RNAs has not been reported in breast cancer (BC, and was carried out in this study to identify blood-based small RNA markers of BC clinical outcome. Methods The pre-treatment sera of 42 stage II-III locally advanced and inflammatory BC patients who received neoadjuvant chemotherapy (NCT followed by surgical tumor resection were analyzed for marker identification by deep sequencing all circulating small RNAs. An independent validation cohort of 26 stage II-III BC patients was used to assess the power of identified miRNA markers. Results More than 800 miRNA species were detected in the circulation, and observed patterns showed association with histopathological profiles of BC. Groups of circulating miRNAs differentially associated with ER/PR/HER2 status and inflammatory BC were identified. The relative levels of selected miRNAs measured by PCR showed consistency with their abundance determined by deep sequencing. Two circulating miRNAs, miR-375 and miR-122, exhibited strong correlations with clinical outcomes, including NCT response and relapse with metastatic disease. In the validation cohort, higher levels of circulating miR-122 specifically predicted metastatic recurrence in stage II-III BC patients. Conclusions Our study indicates that certain miRNAs can serve as potential blood-based biomarkers for NCT response, and that miR-122 prevalence in the circulation predicts BC metastasis in early-stage patients. These results may allow optimized chemotherapy treatments and preventive anti-metastasis interventions in future clinical applications.
West, Claire; James, Stephen A; Davey, Robert P; Dicks, Jo; Roberts, Ian N
2014-07-01
The ribosomal RNA encapsulates a wealth of evolutionary information, including genetic variation that can be used to discriminate between organisms at a wide range of taxonomic levels. For example, the prokaryotic 16S rDNA sequence is very widely used both in phylogenetic studies and as a marker in metagenomic surveys and the internal transcribed spacer region, frequently used in plant phylogenetics, is now recognized as a fungal DNA barcode. However, this widespread use does not escape criticism, principally due to issues such as difficulties in classification of paralogous versus orthologous rDNA units and intragenomic variation, both of which may be significant barriers to accurate phylogenetic inference. We recently analyzed data sets from the Saccharomyces Genome Resequencing Project, characterizing rDNA sequence variation within multiple strains of the baker's yeast Saccharomyces cerevisiae and its nearest wild relative Saccharomyces paradoxus in unprecedented detail. Notably, both species possess single locus rDNA systems. Here, we use these new variation datasets to assess whether a more detailed characterization of the rDNA locus can alleviate the second of these phylogenetic issues, sequence heterogeneity, while controlling for the first. We demonstrate that a strong phylogenetic signal exists within both datasets and illustrate how they can be used, with existing methodology, to estimate intraspecies phylogenies of yeast strains consistent with those derived from whole-genome approaches. We also describe the use of partial Single Nucleotide Polymorphisms, a type of sequence variation found only in repetitive genomic regions, in identifying key evolutionary features such as genome hybridization events and show their consistency with whole-genome Structure analyses. We conclude that our approach can transform rDNA sequence heterogeneity from a problem to a useful source of evolutionary information, enabling the estimation of highly accurate phylogenies of
Allele Re-sequencing Technologies
DEFF Research Database (Denmark)
Byrne, Stephen; Farrell, Jacqueline Danielle; Asp, Torben
2013-01-01
The development of next-generation sequencing technologies has made sequencing an affordable approach for detection of genetic variations associated with various traits. However, the cost of whole genome re-sequencing still remains too high to be feasible for many plant species with large...... alternative to whole genome re-sequencing to identify causative genetic variations in plants. One challenge, however, will be efficient bioinformatics strategies for data handling and analysis from the increasing amount of sequence information....
Schuster, W; Brennicke, A
1987-01-01
We describe an open reading frame (ORF) with high homology to reverse transcriptase in the mitochondrial genome of Oenothera. This ORF displays all the characteristics of an active plant mitochondrial gene with a possible ribosome binding site and 39% T in the third codon position. It is located between a sequence fragment from the plastid genome and one of nuclear origin downstream from the gene encoding subunit 5 of the NADH dehydrogenase. The nuclear derived sequence consists of 528 nucleotides from the small ribosomal RNA and contains an expansion segment unique to nuclear rRNAs. The plastid sequence contains part of the ribosomal protein S4 and the complete tRNA(Ser). The observation that only transcribed sequences have been found i more than one subcellular compartment in higher plants suggests that interorganellar transfer of genetic information may occur via RNA and subsequent local reverse transcription and genomic integration. PMID:14650433
Directory of Open Access Journals (Sweden)
Julie A J Clément
Full Text Available BACKGROUND: The trematode flatworms of the genus Schistosoma, the causative agents of schistosomiasis, are among the most prevalent parasites in humans, affecting more than 200 million people worldwide. In this study, we focused on two well-characterized strains of S. mansoni, to explore signatures of selection. Both strains are highly inbred and exhibit differences in life history traits, in particular in their compatibility with the intermediate host Biomphalaria glabrata. METHODOLOGY/PRINCIPAL FINDINGS: We performed high throughput sequencing of DNA from pools of individuals of each strain using Illumina technology and identified single nucleotide polymorphisms (SNP and copy number variations (CNV. In total, 708,898 SNPs were identified and roughly 2,000 CNVs. The SNPs revealed low nucleotide diversity (π = 2 × 10(-4 within each strain and a high differentiation level (Fst = 0.73 between them. Based on a recently developed in-silico approach, we further detected 12 and 19 private (i.e. specific non-overlapping selective sweeps among the 121 and 151 sweeps found in total for each strain. CONCLUSIONS/SIGNIFICANCE: Functional annotation of transcripts lying in the private selective sweeps revealed specific selection for functions related to parasitic interaction (e.g. cell-cell adhesion or redox reactions. Despite high differentiation between strains, we identified evolutionary convergence of genes related to proteolysis, known as a key virulence factor and a potential target of drug and vaccine development. Our data show that pool-sequencing can be used for the detection of selective sweeps in parasite populations and enables one to identify biological functions under selection.
Mycobacterium tuberculosis infection of domesticated Asian elephants, Thailand.
2011-01-01
Four Asian elephants were confirmed to be infected with Mycobacterium tuberculosis by bacterial culture, other diagnostic procedures, and sequencing of 16S–23S rDNA internal transcribed spacer region, 16S rRNA, and gyrase B gene sequences. Genotyping showed that the infectious agents originated from 4 sources in Thailand. To identify infections, a combination of diagnostic assays is essential.
Davidson, Christina
2010-01-01
The development of transcripts is central to the work of many researchers yet questions of what and how researchers transcribe, and why, receive little attention in research literature. Conversation analysis is one research approach that has consistently addressed the integral relationship between theoretical and methodological perspectives,…
Mixed Sequence Reader: A Program for Analyzing DNA Sequences with Heterozygous Base Calling
Chang, Chun-Tien; Tsai, Chi-Neu; Tang, Chuan Yi; Chen, Chun-Houh; Lian, Jang-Hau; Hu, Chi-Yu; Tsai, Chia-Lung; Chao, Angel; Lai, Chyong-Huey; Wang, Tzu-Hao; Lee, Yun-Shien
2012-01-01
The direct sequencing of PCR products generates heterozygous base-calling fluorescence chromatograms that are useful for identifying single-nucleotide polymorphisms (SNPs), insertion-deletions (indels), short tandem repeats (STRs), and paralogous genes. Indels and STRs can be easily detected using the currently available Indelligent or ShiftDetector programs, which do not search reference sequences. However, the detection of other genomic variants remains a challenge due to the lack of appropriate tools for heterozygous base-calling fluorescence chromatogram data analysis. In this study, we developed a free web-based program, Mixed Sequence Reader (MSR), which can directly analyze heterozygous base-calling fluorescence chromatogram data in .abi file format using comparisons with reference sequences. The heterozygous sequences are identified as two distinct sequences and aligned with reference sequences. Our results showed that MSR may be used to (i) physically locate indel and STR sequences and determine STR copy number by searching NCBI reference sequences; (ii) predict combinations of microsatellite patterns using the Federal Bureau of Investigation Combined DNA Index System (CODIS); (iii) determine human papilloma virus (HPV) genotypes by searching current viral databases in cases of double infections; (iv) estimate the copy number of paralogous genes, such as β-defensin 4 (DEFB4) and its paralog HSPDP3. PMID:22778697
International Nuclear Information System (INIS)
Yagi, A.; Sato, Y.; Miwa, Y.; Kabbash, A.; Moustafa, S.; Shimomura, K.; El-Bassuony, A.
2006-01-01
A comparison of the sequences in an internally transcribed spacer (ITS) 1 region of rDNA between clonally regenerated A.vera and same species in Japan, USA and Egypt revealed the presence of two types of nucleotide sequences, 252 and 254 bps. Based on the findings in the ITS 1 region, A.vera having 252 and 254 bps clearly showed a stable sequence similarity, suggesting high conversation of the base peak sequence in the ITS 1 region. However, frequent base substitutions in the 252 bps samples leaves that came from callus tissue and micropropagated plants were observed around the regions of nucleotide positions 66, 99 and 199-201. The minor deviation in clonally regenerated A.vera may be due to the stage of regeneration and cell specification in cases of the callus tissue. In the present study, the base peak sequence of the Its 1 region of rDNA was adopted as a molecular marker for differentiating A.vera plants from geographically distributed and clonally regenerated A.vera plants and it was suggested that the base peak substitutions in the ITS 1 region may arise from the different nutritional and environmental factors in cultivation and plant growth stages. (author)
Whole genome sequencing resource identifies 18 new candidate genes for autism spectrum disorder
Yuen, Ryan KC; Merico, Daniele; Bookman, Matt; Howe, Jennifer L; Thiruvahindrapuram, Bhooma; Patel, Rohan V; Whitney, Joe; Deflaux, Nicole; Bingham, Jonathan; Wang, Zhuozhi; Pellecchia, Giovanna; Buchanan, Janet A; Walker, Susan; Marshall, Christian R; Uddin, Mohammed; Zarrei, Mehdi; Deneault, Eric; D’Abate, Lia; Chan, Ada JS; Koyanagi, Stephanie; Paton, Tara; Pereira, Sergio L; Hoang, Ny; Engchuan, Worrawat; Higginbotham, Edward J; Ho, Karen; Lamoureux, Sylvia; Li, Weili; MacDonald, Jeffrey R; Nalpathamkalam, Thomas; Sung, Wilson WL; Tsoi, Fiona J; Wei, John; Xu, Lizhen; Tasse, Anne-Marie; Kirby, Emily; Van Etten, William; Twigger, Simon; Roberts, Wendy; Drmic, Irene; Jilderda, Sanne; Modi, Bonnie MacKinnon; Kellam, Barbara; Szego, Michael; Cytrynbaum, Cheryl; Weksberg, Rosanna; Zwaigenbaum, Lonnie; Woodbury-Smith, Marc; Brian, Jessica; Senman, Lili; Iaboni, Alana; Doyle-Thomas, Krissy; Thompson, Ann; Chrysler, Christina; Leef, Jonathan; Savion-Lemieux, Tal; Smith, Isabel M; Liu, Xudong; Nicolson, Rob; Seifer, Vicki; Fedele, Angie; Cook, Edwin H; Dager, Stephen; Estes, Annette; Gallagher, Louise; Malow, Beth A; Parr, Jeremy R; Spence, Sarah J; Vorstman, Jacob; Frey, Brendan J; Robinson, James T; Strug, Lisa J; Fernandez, Bridget A; Elsabbagh, Mayada; Carter, Melissa T; Hallmayer, Joachim; Knoppers, Bartha M; Anagnostou, Evdokia; Szatmari, Peter; Ring, Robert H; Glazer, David; Pletcher, Mathew T; Scherer, Stephen W
2017-01-01
We are performing whole genome sequencing (WGS) of families with Autism Spectrum Disorder (ASD) to build a resource, named MSSNG, to enable the sub-categorization of phenotypes and underlying genetic factors involved. Here, we report WGS of 5,205 samples from families with ASD, accompanied by clinical information, creating a database accessible in a cloud platform, and through an internet portal with controlled access. We found an average of 73.8 de novo single nucleotide variants and 12.6 de novo insertion/deletions (indels) or copy number variations (CNVs) per ASD subject. We identified 18 new candidate ASD-risk genes such as MED13 and PHF3, and found that participants bearing mutations in susceptibility genes had significantly lower adaptive ability (p=6×10−4). In 294/2,620 (11.2%) of ASD cases, a molecular basis could be determined and 7.2% of these carried CNV/chromosomal abnormalities, emphasizing the importance of detecting all forms of genetic variation as diagnostic and therapeutic targets in ASD. PMID:28263302
Directory of Open Access Journals (Sweden)
Evgeny A Glazov
2011-03-01
Full Text Available Recent advances in DNA sequencing have enabled mapping of genes for monogenic traits in families with small pedigrees and even in unrelated cases. We report the identification of disease-causing mutations in a rare, severe, skeletal dysplasia, studying a family of two healthy unrelated parents and two affected children using whole-exome sequencing. The two affected daughters have clinical and radiographic features suggestive of anauxetic dysplasia (OMIM 607095, a rare form of dwarfism caused by mutations of RMRP. However, mutations of RMRP were excluded in this family by direct sequencing. Our studies identified two novel compound heterozygous loss-of-function mutations in POP1, which encodes a core component of the RNase mitochondrial RNA processing (RNase MRP complex that directly interacts with the RMRP RNA domains that are affected in anauxetic dysplasia. We demonstrate that these mutations impair the integrity and activity of this complex and that they impair cell proliferation, providing likely molecular and cellular mechanisms by which POP1 mutations cause this severe skeletal dysplasia.
Spotin, Adel; Gholami, Shirzad; Nasab, Abbas Najafi; Fallah, Esmaeil; Oskouei, Mahmoud Mahami; Semnani, Vahid; Shariatzadeh, Seyyed Ali; Shahbazi, Abbas
2015-04-01
The definitive identification of Echinococcus species is currently carried out by sequencing and phylogenetic strategies. However, the application of polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) patterns is not broadly used as a result of heterogeneity traits of Echinococcus genome in different regions of the world. Therefore, designing and conducting a standardized pattern should indigenously be considered in under-studied areas. In this investigation, an in silico mapping was designed and developed for eight Echinococcus spp. on the basis of regional sequences in Iran and the world. The numbers of 60 Echinococcus isolates were collected from the liver and lungs of 15 human, 15 sheep, 15 cattle, and 15 camel cases in Semnan province, Central Iran. DNA samples were extracted and examined by polymerase chain reaction of ribosomal DNA (rDNA) internal transcribed spacer 1 (ITS1) and PCR-RFLP via Rsa1 endonuclease enzyme. Moreover, 15 amplicons of cytochrome oxidase 1 (Cox1) were directly sequenced in order to identify the strains/haplotypes. PCR-RFLP and phylogenetic analyses revealed firmly the presence of the G1 and G6 genotypes with heterogeneity (three novel haplotypes) of Cox1 gene although no other expected genotypes were found in the region. Finding shows that the identification of novel haplotypes along with discrimination of Echinococcus spp. through regional patterns can unambiguously illustrate the real taxonomic status of parasite in Central Iran.
Sharpe, Richard A; Cocq, Kate Le; Nikolaou, Vasilis; Osborne, Nicholas J; Thornton, Christopher R
2016-01-01
The aim of this study was to determine the accuracy of monoclonal antibodies (mAbs) in identifying culturable allergenic fungi present in visible mould growth in energy efficient homes, and to identify risk factors for exposure to these known allergenic fungi. Swabs were taken from fungal contaminated surfaces and culturable yeasts and moulds isolated by using mycological culture. Soluble antigens from cultures were tested by ELISA using mAbs specific to the culturable allergenic fungi Aspergillus and Penicillium spp., Ulocladium, Alternaria, and Epicoccum spp., Cladosporium spp., Fusarium spp., and Trichoderma spp. Diagnostic accuracies of the ELISA tests were determined by sequencing of the internally transcribed spacer 1 (ITS1)-5.8S-ITS2-encoding regions of recovered fungi following ELISA. There was 100% concordance between the two methods, with ELISAs providing genus-level identity and ITS sequencing providing species-level identities (210 out of 210 tested). Species of Aspergillus/Penicillium, Cladosporium, Ulocladium/Alternaria/Epicoccum, Fusarium and Trichoderma were detected in 82% of the samples. The presence of condensation was associated with an increased risk of surfaces being contaminated by Aspergillus/Penicillium spp. and Cladosporium spp., whereas moisture within the building fabric (water ingress/rising damp) was only associated with increased risk of Aspergillus/Penicillium spp. Property type and energy efficiency levels were found to moderate the risk of indoor surfaces becoming contaminated with Aspergillus/Penicillium and Cladosporium which in turn was modified by the presence of condensation, water ingress and rising damp, consistent with previous literature. Copyright © 2015 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
E.-C. Lin
2011-06-01
Full Text Available Many bird species, for example: Crested Serpent Eagle (Spilornis cheela hoya, Collared Scops (Owl Otus bakkamoena, Tawny Fish Owl (Ketupa flavipes, Crested Goshawk (Accipiter trivirgatus, and Grass Owl (Tyto longimembris... etc, are monomorphic, which is difficult to identify their sex simply by their outward appearance. Especially for those monomorphic endangered species, finding an effective tool to identify their sex beside outward appearance is needed for further captive breeding programs or other conservation plans. In this study, we collected samples of Black Swan (Cygmus atratus and Nicobar Pigeon (Caloenas nicobarica, two aviaries introduced monomorphic species served as control group, and Crested Serpent Eagle, Collared Scops Owl, Tawny Fish Owl, Crested Goshawk, and Grass Owl, five protected monomorphic species in Taiwan. We used sex-specific primers of avian CHD1 (chromo-helicase-DNA-binding gene and EE0.6 (EcoRI 0.6-kb fragment sequences to identify the sex of these birds. The results showed that CHD1 gene primers could be used to correctly identify the sex of Black Swans, Nicobar Pigeons and Crested Serpent Eagles, but it could not be used to correctly identify sex in Collared Scops Owls, Tawny Fish Owls, and Crested Goshawks. In the sex identification using EE0.6 sequence fragment, A, C, D and E primer sets could be used for sexing Black Swans; A, B, C, and D primer sets could be used for sexing Crested Serpent Eagles; and E primer set could be used for sexing Nicobar Pigeons and the two owl species. Correct determination of sex is the first step if a captive breeding measure is required. We have demonstrated that several of the existing primer sets can be used for sex determination of several captive breeding and indigenous bird species.
Prevalence of transcription promoters within archaeal operons and coding sequences.
Koide, Tie; Reiss, David J; Bare, J Christopher; Pang, Wyming Lee; Facciotti, Marc T; Schmid, Amy K; Pan, Min; Marzolf, Bruz; Van, Phu T; Lo, Fang-Yin; Pratap, Abhishek; Deutsch, Eric W; Peterson, Amelia; Martin, Dan; Baliga, Nitin S
2009-01-01
Despite the knowledge of complex prokaryotic-transcription mechanisms, generalized rules, such as the simplified organization of genes into operons with well-defined promoters and terminators, have had a significant role in systems analysis of regulatory logic in both bacteria and archaea. Here, we have investigated the prevalence of alternate regulatory mechanisms through genome-wide characterization of transcript structures of approximately 64% of all genes, including putative non-coding RNAs in Halobacterium salinarum NRC-1. Our integrative analysis of transcriptome dynamics and protein-DNA interaction data sets showed widespread environment-dependent modulation of operon architectures, transcription initiation and termination inside coding sequences, and extensive overlap in 3' ends of transcripts for many convergently transcribed genes. A significant fraction of these alternate transcriptional events correlate to binding locations of 11 transcription factors and regulators (TFs) inside operons and annotated genes-events usually considered spurious or non-functional. Using experimental validation, we illustrate the prevalence of overlapping genomic signals in archaeal transcription, casting doubt on the general perception of rigid boundaries between coding sequences and regulatory elements.
DEFF Research Database (Denmark)
Huang, Mingtao; Bai, Yunpeng; Sjostrom, Staffan L.
2015-01-01
There is an increasing demand for biotech-based production of recombinant proteins for use as pharmaceuticals in the food and feed industry and in industrial applications. Yeast Saccharomyces cerevisiae is among preferred cell factories for recombinant protein production, and there is increasing...... interest in improving its protein secretion capacity. Due to the complexity of the secretory machinery in eukaryotic cells, it is difficult to apply rational engineering for construction of improved strains. Here we used high-throughput microfluidics for the screening of yeast libraries, generated by UV...... mutagenesis. Several screening and sorting rounds resulted in the selection of eight yeast clones with significantly improved secretion of recombinant a-amylase. Efficient secretion was genetically stable in the selected clones. We performed whole-genome sequencing of the eight clones and identified 330...
Daniel L. Lindner; Tor Carlsen; Henrik Nilsson; Marie Davey; Trond Schumacher; Havard. Kauserud
2013-01-01
The rDNA internal transcribed spacer (ITS) region has been accepted as a DNA barcoding marker for fungi and is widely used in phylogenetic studies; however, intragenomic ITS variability has been observed in a broad range of taxa, including prokaryotes, plants, animals, and fungi, and this variability has the potential to inflate species richness estimates in molecular...
Exome Sequencing in Suspected Monogenic Dyslipidemias
Stitziel, Nathan O.; Peloso, Gina M.; Abifadel, Marianne; Cefalu, Angelo B.; Fouchier, Sigrid; Motazacker, M. Mahdi; Tada, Hayato; Larach, Daniel B.; Awan, Zuhier; Haller, Jorge F.; Pullinger, Clive R.; Varret, Mathilde; Rabès, Jean-Pierre; Noto, Davide; Tarugi, Patrizia; Kawashiri, Masa-aki; Nohara, Atsushi; Yamagishi, Masakazu; Risman, Marjorie; Deo, Rahul; Ruel, Isabelle; Shendure, Jay; Nickerson, Deborah A.; Wilson, James G.; Rich, Stephen S.; Gupta, Namrata; Farlow, Deborah N.; Neale, Benjamin M.; Daly, Mark J.; Kane, John P.; Freeman, Mason W.; Genest, Jacques; Rader, Daniel J.; Mabuchi, Hiroshi; Kastelein, John J.P.; Hovingh, G. Kees; Averna, Maurizio R.; Gabriel, Stacey; Boileau, Catherine; Kathiresan, Sekar
2015-01-01
Background Exome sequencing is a promising tool for gene mapping in Mendelian disorders. We utilized this technique in an attempt to identify novel genes underlying monogenic dyslipidemias. Methods and Results We performed exome sequencing on 213 selected family members from 41 kindreds with suspected Mendelian inheritance of extreme levels of low-density lipoprotein (LDL) cholesterol (after candidate gene sequencing excluded known genetic causes for high LDL cholesterol families) or high-density lipoprotein (HDL) cholesterol. We used standard analytic approaches to identify candidate variants and also assigned a polygenic score to each individual in order to account for their burden of common genetic variants known to influence lipid levels. In nine families, we identified likely pathogenic variants in known lipid genes (ABCA1, APOB, APOE, LDLR, LIPA, and PCSK9); however, we were unable to identify obvious genetic etiologies in the remaining 32 families despite follow-up analyses. We identified three factors that limited novel gene discovery: (1) imperfect sequencing coverage across the exome hid potentially causal variants; (2) large numbers of shared rare alleles within families obfuscated causal variant identification; and (3) individuals from 15% of families carried a significant burden of common lipid-related alleles, suggesting complex inheritance can masquerade as monogenic disease. Conclusions We identified the genetic basis of disease in nine of 41 families; however, none of these represented novel gene discoveries. Our results highlight the promise and limitations of exome sequencing as a discovery technique in suspected monogenic dyslipidemias. Considering the confounders identified may inform the design of future exome sequencing studies. PMID:25632026
Directory of Open Access Journals (Sweden)
Marc W Schmid
Full Text Available The acquisition of distinct cell fates is central to the development of multicellular organisms and is largely mediated by gene expression patterns specific to individual cells and tissues. A spatially and temporally resolved analysis of gene expression facilitates the elucidation of transcriptional networks linked to cellular identity and function. We present an approach that allows cell type-specific transcriptional profiling of distinct target cells, which are rare and difficult to access, with unprecedented sensitivity and resolution. We combined laser-assisted microdissection (LAM, linear amplification starting from <1 ng of total RNA, and RNA-sequencing (RNA-Seq. As a model we used the central cell of the Arabidopsis thaliana female gametophyte, one of the female gametes harbored in the reproductive organs of the flower. We estimated the number of expressed genes to be more than twice the number reported previously in a study using LAM and ATH1 microarrays, and identified several classes of genes that were systematically underrepresented in the transcriptome measured with the ATH1 microarray. Among them are many genes that are likely to be important for developmental processes and specific cellular functions. In addition, we identified several intergenic regions, which are likely to be transcribed, and describe a considerable fraction of reads mapping to introns and regions flanking annotated loci, which may represent alternative transcript isoforms. Finally, we performed a de novo assembly of the transcriptome and show that the method is suitable for studying individual cell types of organisms lacking reference sequence information, demonstrating that this approach can be applied to most eukaryotic organisms.
Directory of Open Access Journals (Sweden)
Javier Villacreses
2015-04-01
Full Text Available Here, we report the genome sequence and evidence for transcriptional activity of a virus-like element in the native Chilean berry tree Aristotelia chilensis. We propose to name the endogenous sequence as Aristotelia chilensis Virus 1 (AcV1. High-throughput sequencing of the genome of this tree uncovered an endogenous viral element, with a size of 7122 bp, corresponding to the complete genome of AcV1. Its sequence contains three open reading frames (ORFs: ORFs 1 and 2 shares 66%–73% amino acid similarity with members of the Caulimoviridae virus family, especially the Petunia vein clearing virus (PVCV, Petuvirus genus. ORF1 encodes a movement protein (MP; ORF2 a Reverse Transcriptase (RT and a Ribonuclease H (RNase H domain; and ORF3 showed no amino acid sequence similarity with any other known virus proteins. Analogous to other known endogenous pararetrovirus sequences (EPRVs, AcV1 is integrated in the genome of Maqui Berry and showed low viral transcriptional activity, which was detected by deep sequencing technology (DNA and RNA-seq. Phylogenetic analysis of AcV1 and other pararetroviruses revealed a closer resemblance with Petuvirus. Overall, our data suggests that AcV1 could be a new member of Caulimoviridae family, genus Petuvirus, and the first evidence of this kind of virus in a fruit plant.
Universal sequence map (USM of arbitrary discrete sequences
Directory of Open Access Journals (Sweden)
Almeida Jonas S
2002-02-01
Full Text Available Abstract Background For over a decade the idea of representing biological sequences in a continuous coordinate space has maintained its appeal but not been fully realized. The basic idea is that any sequence of symbols may define trajectories in the continuous space conserving all its statistical properties. Ideally, such a representation would allow scale independent sequence analysis – without the context of fixed memory length. A simple example would consist on being able to infer the homology between two sequences solely by comparing the coordinates of any two homologous units. Results We have successfully identified such an iterative function for bijective mappingψ of discrete sequences into objects of continuous state space that enable scale-independent sequence analysis. The technique, named Universal Sequence Mapping (USM, is applicable to sequences with an arbitrary length and arbitrary number of unique units and generates a representation where map distance estimates sequence similarity. The novel USM procedure is based on earlier work by these and other authors on the properties of Chaos Game Representation (CGR. The latter enables the representation of 4 unit type sequences (like DNA as an order free Markov Chain transition table. The properties of USM are illustrated with test data and can be verified for other data by using the accompanying web-based tool:http://bioinformatics.musc.edu/~jonas/usm/. Conclusions USM is shown to enable a statistical mechanics approach to sequence analysis. The scale independent representation frees sequence analysis from the need to assume a memory length in the investigation of syntactic rules.
Epitope Sequences in Dengue Virus NS1 Protein Identified by Monoclonal Antibodies
Directory of Open Access Journals (Sweden)
Leticia Barboza Rocha
2017-10-01
Full Text Available Dengue nonstructural protein 1 (NS1 is a multi-functional glycoprotein with essential functions both in viral replication and modulation of host innate immune responses. NS1 has been established as a good surrogate marker for infection. In the present study, we generated four anti-NS1 monoclonal antibodies against recombinant NS1 protein from dengue virus serotype 2 (DENV2, which were used to map three NS1 epitopes. The sequence 193AVHADMGYWIESALNDT209 was recognized by monoclonal antibodies 2H5 and 4H1BC, which also cross-reacted with Zika virus (ZIKV protein. On the other hand, the sequence 25VHTWTEQYKFQPES38 was recognized by mAb 4F6 that did not cross react with ZIKV. Lastly, a previously unidentified DENV2 NS1-specific epitope, represented by the sequence 127ELHNQTFLIDGPETAEC143, is described in the present study after reaction with mAb 4H2, which also did not cross react with ZIKV. The selection and characterization of the epitope, specificity of anti-NS1 mAbs, may contribute to the development of diagnostic tools able to differentiate DENV and ZIKV infections.
Antibacterial activity of the endophytic fungi from medicinal herb ...
African Journals Online (AJOL)
Nine distinct isolates (Macof01 to Macof09) were selected for further taxonomical identification by morphological traits and internal transcribed spacer (ITS) rRNA gene sequence analysis. Seven genera namely Acremonium, Alternaria, Aspergillus, Bionectria, Cladosporium, Neosartorya and Penicillium were identified on ...
Gregg, Jacob; Thompson, Rachel L.; Purcell, Maureen; Friedman, Carolyn S.; Hershberger, Paul
2016-01-01
Despite their widespread, global impact in both wild and cultured fishes, little is known of the diversity, transmission patterns, and phylogeography of parasites generally identified as Ichthyophonus. This study constructed a phylogeny based on the structural alignment of internal transcribed spacer (ITS) rDNA sequences to compare Ichthyophonus isolates from fish hosts in the Atlantic and Pacific oceans, and several rivers and aquaculture sites in North America, Europe, and Japan. Structure of the Ichthyophonus ITS1–5.8S–ITS2 transcript exhibited several homologies with other eukaryotes, and 6 distinct clades were identified within Ichthyophonus. A single clade contained a majority (71 of 98) of parasite isolations. This ubiquitous Ichthyophonus type occurred in 13 marine and anadromous hosts and was associated with epizootics in Atlantic herring, Chinook salmon, and American shad. A second clade contained all isolates from aquaculture, despite great geographic separation of the freshwater hosts. Each of the 4 remaining clades contained isolates from single host species. This study is the first to evaluate the genetic relationships among Ichthyophonus species across a significant portion of their host and geographic range. Additionally, parasite infection prevalence is reported in 16 fish species.
Gregg, Jacob L; Powers, Rachel L; Purcell, Maureen K; Friedman, Carolyn S; Hershberger, Paul K
2016-07-07
Despite their widespread, global impact in both wild and cultured fishes, little is known of the diversity, transmission patterns, and phylogeography of parasites generally identified as Ichthyophonus. This study constructed a phylogeny based on the structural alignment of internal transcribed spacer (ITS) rDNA sequences to compare Ichthyophonus isolates from fish hosts in the Atlantic and Pacific oceans, and several rivers and aquaculture sites in North America, Europe, and Japan. Structure of the Ichthyophonus ITS1-5.8S-ITS2 transcript exhibited several homologies with other eukaryotes, and 6 distinct clades were identified within Ichthyophonus. A single clade contained a majority (71 of 98) of parasite isolations. This ubiquitous Ichthyophonus type occurred in 13 marine and anadromous hosts and was associated with epizootics in Atlantic herring, Chinook salmon, and American shad. A second clade contained all isolates from aquaculture, despite great geographic separation of the freshwater hosts. Each of the 4 remaining clades contained isolates from single host species. This study is the first to evaluate the genetic relationships among Ichthyophonus species across a significant portion of their host and geographic range. Additionally, parasite infection prevalence is reported in 16 fish species.
Andersson, Emmi; Shao, Wei; Bontell, Irene; Cham, Fatim; Cuong, Do Duy; Wondwossen, Amogne; Morris, Lynn; Hunt, Gillian; Sönnerborg, Anders; Bertagnolio, Silvia; Maldarelli, Frank; Jordan, Michael R
2013-08-01
Identification of recent HIV infection within populations is a public health priority for accurate estimation of HIV incidence rates and transmitted drug resistance at population level. Determining HIV incidence rates by prospective follow-up of HIV-uninfected individuals is challenging and serological assays have important limitations. HIV diversity within an infected host increases with duration of infection. We explore a simple bioinformatics approach to assess viral diversity by determining the percentage of ambiguous base calls in sequences derived from standard genotyping of HIV-1 protease and reverse transcriptase. Sequences from 691 recently infected (≤1 year) and chronically infected (>1 year) individuals from Sweden, Vietnam and Ethiopia were analyzed for ambiguity. A significant difference (p<0.0001) in the proportion of ambiguous bases was observed between sequences from individuals with recent and chronic infection in both HIV-1 subtype B and non-B infection, consistent with previous studies. In our analysis, a cutoff of <0.47% ambiguous base calls identified recent infection with a sensitivity and specificity of 88.8% and 74.6% respectively. 1,728 protease and reverse transcriptase sequences from 36 surveys of transmitted HIV drug resistance performed following World Health Organization guidance were analyzed for ambiguity. The 0.47% ambiguity cutoff was applied and survey sequences were classified as likely derived from recently or chronically infected individuals. 71% of patients were classified as likely to have been infected within one year of genotyping but results varied considerably amongst surveys. This bioinformatics approach may provide supporting population-level information to identify recent infection but its application is limited by infection with more than one viral variant, decreasing viral diversity in advanced disease and technical aspects of population based sequencing. Standardization of sequencing techniques and base calling
Stam, Remco; Scheikl, Daniela; Tellier, Aurélien
2016-01-01
Nod-like receptors (NLRs) are nucleotide-binding domain and leucine-rich repeats containing proteins that are important in plant resistance signaling. Many of the known pathogen resistance (R) genes in plants are NLRs and they can recognize pathogen molecules directly or indirectly. As such, divergence and copy number variants at these genes are found to be high between species. Within populations, positive and balancing selection are to be expected if plants coevolve with their pathogens. In order to understand the complexity of R-gene coevolution in wild nonmodel species, it is necessary to identify the full range of NLRs and infer their evolutionary history. Here we investigate and reveal polymorphism occurring at 220 NLR genes within one population of the partially selfing wild tomato species Solanum pennellii. We use a combination of enrichment sequencing and pooling ten individuals, to specifically sequence NLR genes in a resource and cost-effective manner. We focus on the effects which different mapping and single nucleotide polymorphism calling software and settings have on calling polymorphisms in customized pooled samples. Our results are accurately verified using Sanger sequencing of polymorphic gene fragments. Our results indicate that some NLRs, namely 13 out of 220, have maintained polymorphism within our S. pennellii population. These genes show a wide range of πN/πS ratios and differing site frequency spectra. We compare our observed rate of heterozygosity with expectations for this selfing and bottlenecked population. We conclude that our method enables us to pinpoint NLR genes which have experienced natural selection in their habitat. PMID:27189991
DEFF Research Database (Denmark)
Madsen, Hans Peter Lynge; Hammer, Karin
1998-01-01
to a phage repressor, a single-stranded DNA-binding protein, a topoisomerase, a Cro-like protein and two other phage proteins of unknown function were detected. The gene arrangement in the early transcribed region of TP901-1 thus consists of two transcriptional units: one from PR containing four genes......, of which at least two (the integrase gene and putative repressor) are needed for lysogeny, and the divergent and longer transcriptional unit from PL, presumably encoding functions required for the lytic life cycle. ORFs with homology to proteins involved in DNA replication were identified on the latter......Transcriptional analysis by Northern blotting identified clusters of early, middle and late transcribed regions of the temperate lactococcal bacteriophage TP901-1 during one-step growth experiments. The latent period was found to be 65 min and the burst size 40 +/- 10. The eight early transcripts...
Directory of Open Access Journals (Sweden)
Hironobu Yanagisawa
2016-03-01
Full Text Available The presence of high molecular weight double-stranded RNA (dsRNA within plant cells is an indicator of infection with RNA viruses as these possess genomic or replicative dsRNA. DECS (dsRNA isolation, exhaustive amplification, cloning, and sequencing analysis has been shown to be capable of detecting unknown viruses. We postulated that a combination of DECS analysis and next-generation sequencing (NGS would improve detection efficiency and usability of the technique. Here, we describe a model case in which we efficiently detected the presumed genome sequence of Blueberry shoestring virus (BSSV, a member of the genus Sobemovirus, which has not so far been reported. dsRNAs were isolated from BSSV-infected blueberry plants using the dsRNA-binding protein, reverse-transcribed, amplified, and sequenced using NGS. A contig of 4,020 nucleotides (nt that shared similarities with sequences from other Sobemovirus species was obtained as a candidate of the BSSV genomic sequence. Reverse transcription (RT-PCR primer sets based on sequences from this contig enabled the detection of BSSV in all BSSV-infected plants tested but not in healthy controls. A recombinant protein encoded by the putative coat protein gene was bound by the BSSV-antibody, indicating that the candidate sequence was that of BSSV itself. Our results suggest that a combination of DECS analysis and NGS, designated here as “DECS-C,” is a powerful method for detecting novel plant viruses.
Quantitative phenotyping via deep barcode sequencing.
Smith, Andrew M; Heisler, Lawrence E; Mellor, Joseph; Kaper, Fiona; Thompson, Michael J; Chee, Mark; Roth, Frederick P; Giaever, Guri; Nislow, Corey
2009-10-01
Next-generation DNA sequencing technologies have revolutionized diverse genomics applications, including de novo genome sequencing, SNP detection, chromatin immunoprecipitation, and transcriptome analysis. Here we apply deep sequencing to genome-scale fitness profiling to evaluate yeast strain collections in parallel. This method, Barcode analysis by Sequencing, or "Bar-seq," outperforms the current benchmark barcode microarray assay in terms of both dynamic range and throughput. When applied to a complex chemogenomic assay, Bar-seq quantitatively identifies drug targets, with performance superior to the benchmark microarray assay. We also show that Bar-seq is well-suited for a multiplex format. We completely re-sequenced and re-annotated the yeast deletion collection using deep sequencing, found that approximately 20% of the barcodes and common priming sequences varied from expectation, and used this revised list of barcode sequences to improve data quality. Together, this new assay and analysis routine provide a deep-sequencing-based toolkit for identifying gene-environment interactions on a genome-wide scale.
Shang, Yanfang; Duan, Zhibing; Hu, Xiao; Xie, Xue-Qin; Zhou, Gang; Peng, Guoxiong; Luo, Zhibing; Huang, Wei; Wang, Bing; Fang, Weiguo; Wang, Sibao; Zhong, Yi; Ma, Li-Jun; St. Leger, Raymond J.; Zhao, Guo-Ping; Pei, Yan; Feng, Ming-Guang; Xia, Yuxian; Wang, Chengshu
2011-01-01
Metarhizium spp. are being used as environmentally friendly alternatives to chemical insecticides, as model systems for studying insect-fungus interactions, and as a resource of genes for biotechnology. We present a comparative analysis of the genome sequences of the broad-spectrum insect pathogen Metarhizium anisopliae and the acridid-specific M. acridum. Whole-genome analyses indicate that the genome structures of these two species are highly syntenic and suggest that the genus Metarhizium evolved from plant endophytes or pathogens. Both M. anisopliae and M. acridum have a strikingly larger proportion of genes encoding secreted proteins than other fungi, while ∼30% of these have no functionally characterized homologs, suggesting hitherto unsuspected interactions between fungal pathogens and insects. The analysis of transposase genes provided evidence of repeat-induced point mutations occurring in M. acridum but not in M. anisopliae. With the help of pathogen-host interaction gene database, ∼16% of Metarhizium genes were identified that are similar to experimentally verified genes involved in pathogenicity in other fungi, particularly plant pathogens. However, relative to M. acridum, M. anisopliae has evolved with many expanded gene families of proteases, chitinases, cytochrome P450s, polyketide synthases, and nonribosomal peptide synthetases for cuticle-degradation, detoxification, and toxin biosynthesis that may facilitate its ability to adapt to heterogenous environments. Transcriptional analysis of both fungi during early infection processes provided further insights into the genes and pathways involved in infectivity and specificity. Of particular note, M. acridum transcribed distinct G-protein coupled receptors on cuticles from locusts (the natural hosts) and cockroaches, whereas M. anisopliae transcribed the same receptor on both hosts. This study will facilitate the identification of virulence genes and the development of improved biocontrol strains
Directory of Open Access Journals (Sweden)
Jonathon Blake
Full Text Available Balanced chromosome abnormalities (BCAs occur at a high frequency in healthy and diseased individuals, but cost-efficient strategies to identify BCAs and evaluate whether they contribute to a phenotype have not yet become widespread. Here we apply genome-wide mate-pair library sequencing to characterize structural variation in a patient with unclear neurodevelopmental disease (NDD and complex de novo BCAs at the karyotype level. Nucleotide-level characterization of the clinically described BCA breakpoints revealed disruption of at least three NDD candidate genes (LINC00299, NUP205, PSMD14 that gave rise to abnormal mRNAs and could be assumed as disease-causing. However, unbiased genome-wide analysis of the sequencing data for cryptic structural variation was key to reveal an additional submicroscopic inversion that truncates the schizophrenia- and bipolar disorder-associated brain transcription factor ZNF804A as an equally likely NDD-driving gene. Deep sequencing of fluorescent-sorted wild-type and derivative chromosomes confirmed the clinically undetected BCA. Moreover, deep sequencing further validated a high accuracy of mate-pair library sequencing to detect structural variants larger than 10 kB, proposing that this approach is powerful for clinical-grade genome-wide structural variant detection. Our study supports previous evidence for a role of ZNF804A in NDD and highlights the need for a more comprehensive assessment of structural variation in karyotypically abnormal individuals and patients with neurocognitive disease to avoid diagnostic deception.
Blake, Jonathon; Riddell, Andrew; Theiss, Susanne; Gonzalez, Alexis Perez; Haase, Bettina; Jauch, Anna; Janssen, Johannes W. G.; Ibberson, David; Pavlinic, Dinko; Moog, Ute; Benes, Vladimir; Runz, Heiko
2014-01-01
Balanced chromosome abnormalities (BCAs) occur at a high frequency in healthy and diseased individuals, but cost-efficient strategies to identify BCAs and evaluate whether they contribute to a phenotype have not yet become widespread. Here we apply genome-wide mate-pair library sequencing to characterize structural variation in a patient with unclear neurodevelopmental disease (NDD) and complex de novo BCAs at the karyotype level. Nucleotide-level characterization of the clinically described BCA breakpoints revealed disruption of at least three NDD candidate genes (LINC00299, NUP205, PSMD14) that gave rise to abnormal mRNAs and could be assumed as disease-causing. However, unbiased genome-wide analysis of the sequencing data for cryptic structural variation was key to reveal an additional submicroscopic inversion that truncates the schizophrenia- and bipolar disorder-associated brain transcription factor ZNF804A as an equally likely NDD-driving gene. Deep sequencing of fluorescent-sorted wild-type and derivative chromosomes confirmed the clinically undetected BCA. Moreover, deep sequencing further validated a high accuracy of mate-pair library sequencing to detect structural variants larger than 10 kB, proposing that this approach is powerful for clinical-grade genome-wide structural variant detection. Our study supports previous evidence for a role of ZNF804A in NDD and highlights the need for a more comprehensive assessment of structural variation in karyotypically abnormal individuals and patients with neurocognitive disease to avoid diagnostic deception. PMID:24625750
Rebello, George; Ramesar, Rajkumar; Vorster, Alvera; Roberts, Lisa; Ehrenreich, Liezle; Oppon, Ekow; Gama, Dumisani; Bardien, Soraya; Greenberg, Jacquie; Bonapace, Giuseppe; Waheed, Abdul; Shah, Gul N.; Sly, William S.
2004-01-01
Genetic and physical mapping of the RP17 locus on 17q identified a 3.6-megabase candidate region that includes the gene encoding carbonic anhydrase IV (CA4), a glycosylphosphatidylinositol-anchored protein that is highly expressed in the choriocapillaris of the human eye. By sequencing candidate genes in this region, we identified a mutation that causes replacement of an arginine with a tryptophan (R14W) in the signal sequence of the CA4 gene at position -5 relative to the signal sequence cleavage site. This mutation was found to cosegregate with the disease phenotype in two large families and was not found in 36 unaffected family members or 100 controls. Expression of the mutant cDNA in COS-7 cells produced several findings, suggesting a mechanism by which the mutation can explain the autosomal dominant disease. In transfected COS-7 cells, the R14W mutation (i) reduced the steady-state level of carbonic anhydrase IV activity expressed by 28% due to a combination of decreased synthesis and accelerated turnover; (ii) led to up-regulation of immunoglobulin-binding protein, double-stranded RNA-regulated protein kinase-like ER kinase, and CCAAT/enhancer-binding protein homologous protein, markers of the unfolded protein response and endoplasmic reticulum stress; and (iii) induced apoptosis, as evidenced by annexin V binding and terminal deoxynucleotidyltransferase-mediated dUTP nick end labeling staining, in most cells expressing the mutant, but not the WT, protein. We suggest that a high level of expression of the mutant allele in the endothelial cells of the choriocapillaris leads to apoptosis, leading in turn to ischemia in the overlying retina and producing autosomal dominant retinitis pigmentosa. PMID:15090652
Directory of Open Access Journals (Sweden)
Ching-Ping Lin
Full Text Available We performed deep sequencing of the nuclear and organellar genomes of three mungbean genotypes: Vigna radiata ssp. sublobata TC1966, V. radiata var. radiata NM92 and the recombinant inbred line RIL59 derived from a cross between TC1966 and NM92. Moreover, we performed deep sequencing of the RIL59 transcriptome to investigate transcript variability. The mungbean chloroplast genome has a quadripartite structure including a pair of inverted repeats separated by two single copy regions. A total of 213 simple sequence repeats were identified in the chloroplast genomes of NM92 and RIL59; 78 single nucleotide variants and nine indels were discovered in comparing the chloroplast genomes of TC1966 and NM92. Analysis of the mungbean chloroplast transcriptome revealed mRNAs that were affected by transcriptional slippage and RNA editing. Transcriptional slippage frequency was positively correlated with the length of simple sequence repeats of the mungbean chloroplast genome (R2=0.9911. In total, 41 C-to-U editing sites were found in 23 chloroplast genes and in one intergenic spacer. No editing site that swapped U to C was found. A combination of bioinformatics and experimental methods revealed that the plastid-encoded RNA polymerase-transcribed genes psbF and ndhA are affected by transcriptional slippage in mungbean and in main lineages of land plants, including three dicots (Glycine max, Brassica rapa, and Nicotiana tabacum, two monocots (Oryza sativa and Zea mays, two gymnosperms (Pinus taeda and Ginkgo biloba and one moss (Physcomitrella patens. Transcript analysis of the rps2 gene showed that transcriptional slippage could affect transcripts at single sequence repeat regions with poly-A runs. It showed that transcriptional slippage together with incomplete RNA editing may cause sequence diversity of transcripts in chloroplasts of land plants.
Directory of Open Access Journals (Sweden)
Zhang Guojie
2011-07-01
Full Text Available Abstract The recent publication of the draft genome sequences of the Neanderthal and a ~50,000-year-old archaic hominin from Denisova Cave in southern Siberia has ushered in a new age in molecular archaeology. We previously cross-compared the human, chimpanzee and Neanderthal genome sequences with respect to a set of disease-causing/disease-associated missense and regulatory mutations (Human Gene Mutation Database and succeeded in identifying genetic variants which, although apparently pathogenic in humans, may represent a 'compensated' wild-type state in at least one of the other two species. Here, in an attempt to identify further 'potentially compensated mutations' (PCMs of interest, we have compared our dataset of disease-causing/disease-associated mutations with their corresponding nucleotide positions in the Denisovan hominin, Neanderthal and chimpanzee genomes. Of the 15 human putatively disease-causing mutations that were found to be compensated in chimpanzee, Denisovan or Neanderthal, only a solitary F5 variant (Val1736Met was specific to the Denisovan. In humans, this missense mutation is associated with activated protein C resistance and an increased risk of thromboembolism and recurrent miscarriage. It is unclear at this juncture whether this variant was indeed a PCM in the Denisovan or whether it could instead have been associated with disease in this ancient hominin.
Liu, An; Yi, Zhenzhen; Lin, Xiaofeng; Hu, Xiaozhong; Al-Farraj, Saleh A.; Al-Rasheid, Khaled A. S.
2015-08-01
Prostomates and haptorians are two basal groups of ciliates with limited morphological characteristics available for taxonomy. Morphologically, the structures used to identify prostomates and haptorians are similar or even identical, which generate heavy taxonomic and phylogenetic confusion. In present work, phylogenetic positions lineage of two rare genera, Plagiopogon and Askenasia, were investigated. Three genes including small subunit ribosomal RNA gene (hereafter SSU rDNA), internal transcribed spacer region (ITS region), and large subunit ribosomal RNA gene (LSU rDNA) were analyzed, 10 new sequences five species each. Our findings included 1) class Prostomatea and order Haptorida are multiphyletic; 2) it may not be appropriate to place order Cyclotrichiida in subclass Haptoria, and the systematic lineage of order Cyclotrichiida needs to be verified further; 3) genus Plagiopogon branches consistently within a clade covering most prostomes and is basal of clade Colepidae, implying its close lineage to Prostomatea; and 4) Askenasia is phylogenetically distant from the subclass Haptoria but close to classes Prostomatea, Plagiopylea and Oligohymenophorea. We supposed that the toxicyst of Askenasia may be close to taxa of prostomes instead of haptorians, and the dorsal brush is a more typical morphological characteristics of haptorians than toxicysts.
Ping, Zheng; Siegal, Gene P.; Almeida, Jonas S.; Schnitt, Stuart J.; Shen, Dejun
2014-01-01
Background: Genetics and genomics have radically altered our understanding of breast cancer progression. However, the genomic basis of various histopathologic features of breast cancer is not yet well-defined. Materials and Methods: The Cancer Genome Atlas (TCGA) is an international database containing a large collection of human cancer genome sequencing data. cBioPortal is a web tool developed for mining these sequencing data. We performed mining of TCGA sequencing data in an attempt to characterize the genomic features correlated with breast cancer histopathology. We first assessed the quality of the TCGA data using a group of genes with known alterations in various cancers. Both genome-wide gene mutation and copy number changes as well as a group of genes with a high frequency of genetic changes were then correlated with various histopathologic features of invasive breast cancer. Results: Validation of TCGA data using a group of genes with known alterations in breast cancer suggests that the TCGA has accurately documented the genomic abnormalities of multiple malignancies. Further analysis of TCGA breast cancer sequencing data shows that accumulation of specific genomic defects is associated with higher tumor grade, larger tumor size and receptor negativity. Distinct groups of genomic changes were found to be associated with the different grades of invasive ductal carcinoma. The mutator role of the TP53 gene was validated by genomic sequencing data of invasive breast cancer and TP53 mutation was found to play a critical role in defining high tumor grade. Conclusions: Data mining of the TCGA genome sequencing data is an innovative and reliable method to help characterize the genomic abnormalities associated with histopathologic features of invasive breast cancer. PMID:24672738
Directory of Open Access Journals (Sweden)
Zheng Ping
2014-01-01
Full Text Available Background: Genetics and genomics have radically altered our understanding of breast cancer progression. However, the genomic basis of various histopathologic features of breast cancer is not yet well-defined. Materials and Methods: The Cancer Genome Atlas (TCGA is an international database containing a large collection of human cancer genome sequencing data. cBioPortal is a web tool developed for mining these sequencing data. We performed mining of TCGA sequencing data in an attempt to characterize the genomic features correlated with breast cancer histopathology. We first assessed the quality of the TCGA data using a group of genes with known alterations in various cancers. Both genome-wide gene mutation and copy number changes as well as a group of genes with a high frequency of genetic changes were then correlated with various histopathologic features of invasive breast cancer. Results: Validation of TCGA data using a group of genes with known alterations in breast cancer suggests that the TCGA has accurately documented the genomic abnormalities of multiple malignancies. Further analysis of TCGA breast cancer sequencing data shows that accumulation of specific genomic defects is associated with higher tumor grade, larger tumor size and receptor negativity. Distinct groups of genomic changes were found to be associated with the different grades of invasive ductal carcinoma. The mutator role of the TP53 gene was validated by genomic sequencing data of invasive breast cancer and TP53 mutation was found to play a critical role in defining high tumor grade. Conclusions: Data mining of the TCGA genome sequencing data is an innovative and reliable method to help characterize the genomic abnormalities associated with histopathologic features of invasive breast cancer.
Directory of Open Access Journals (Sweden)
Qing-bo Zhao
2018-02-01
Full Text Available The Dongxiang Blue-shelled chicken is one of the most valuable Chinese indigenous poultry breeds. However, compared to the Italian native White Leghorn, although this Chinese breed possesses numerous favorable characteristics, it also exhibits lower growth performance and fertility. Here, we utilized genotyping sequencing data obtained via genome reduction on a sequencing platform to detect 100,114 single nucleotide polymorphisms and perform further biological analysis and functional annotation. We employed cross-population extended haplotype homozygosity, eigenvector decomposition combined with genome-wide association studies (EigenGWAS, and efficient mixed-model association expedited methods to detect areas of the genome that are potential selected regions (PSR in both chicken breeds, and performed gene ontology (GO enrichment and quantitative trait loci (QTL analyses annotating using the Kyoto Encyclopedia of Genes and Genomes. The results of this study revealed a total of 2424 outlier loci (p-value <0.01, of which 2144 occur in the White Leghorn breed and 280 occur in the Dongxiang Blue-shelled chicken. These correspond to 327 and 94 PSRs containing 297 and 54 genes, respectively. The most significantly selected genes in Blue-shelled chicken are TMEM141 and CLIC3, while the SLCO1B3 gene, related to eggshell color, was identified via EigenGWAS. We show that the White Leghorn genes JARID2, RBMS3, GPC3, TRIB2, ROBO1, SAMSN1, OSBP2, and IGFALS are involved in immunity, reproduction, and growth, and thus might represent footprints of the selection process. In contrast, we identified six significantly enriched pathways in the Dongxiang Blue-shelled chicken that are related to amino acid and lipid metabolism as well as signal transduction. Our results also reveal the presence of a GO term associated with cell metabolism that occurs mainly in the White Leghorn breed, while the most significant QTL regions mapped to the Chicken QTL Database (GG_4
Directory of Open Access Journals (Sweden)
Samuele Bovo
2015-01-01
Full Text Available The aim of this study was to identify single nucleotide polymorphisms (SNPs that could be associated with back fat thickness (BFT in pigs. To achieve this goal, we evaluated the potential and limits of an experimental design that combined several methodologies. DNA samples from two groups of Italian Large White pigs with divergent estimating breeding value (EBV for BFT were separately pooled and sequenced, after preparation of reduced representation libraries (RRLs, on the Ion Torrent technology. Taking advantage from SNAPE for SNPs calling in sequenced DNA pools, 39,165 SNPs were identified; 1/4 of them were novel variants not reported in dbSNP. Combining sequencing data with Illumina PorcineSNP60 BeadChip genotyping results on the same animals, 661 genomic positions overlapped with a good approximation of minor allele frequency estimation. A total of 54 SNPs showing enriched alleles in one or in the other RRLs might be potential markers associated with BFT. Some of these SNPs were close to genes involved in obesity related phenotypes.
Extended exome sequencing identifies BACH2 as a novel major risk locus for Addison's disease.
Eriksson, D; Bianchi, M; Landegren, N; Nordin, J; Dalin, F; Mathioudaki, A; Eriksson, G N; Hultin-Rosenberg, L; Dahlqvist, J; Zetterqvist, H; Karlsson, Å; Hallgren, Å; Farias, F H G; Murén, E; Ahlgren, K M; Lobell, A; Andersson, G; Tandre, K; Dahlqvist, S R; Söderkvist, P; Rönnblom, L; Hulting, A-L; Wahlberg, J; Ekwall, O; Dahlqvist, P; Meadows, J R S; Bensing, S; Lindblad-Toh, K; Kämpe, O; Pielberg, G R
2016-12-01
Autoimmune disease is one of the leading causes of morbidity and mortality worldwide. In Addison's disease, the adrenal glands are targeted by destructive autoimmunity. Despite being the most common cause of primary adrenal failure, little is known about its aetiology. To understand the genetic background of Addison's disease, we utilized the extensively characterized patients of the Swedish Addison Registry. We developed an extended exome capture array comprising a selected set of 1853 genes and their potential regulatory elements, for the purpose of sequencing 479 patients with Addison's disease and 1394 controls. We identified BACH2 (rs62408233-A, OR = 2.01 (1.71-2.37), P = 1.66 × 10 -15 , MAF 0.46/0.29 in cases/controls) as a novel gene associated with Addison's disease development. We also confirmed the previously known associations with the HLA complex. Whilst BACH2 has been previously reported to associate with organ-specific autoimmune diseases co-inherited with Addison's disease, we have identified BACH2 as a major risk locus in Addison's disease, independent of concomitant autoimmune diseases. Our results may enable future research towards preventive disease treatment. © 2016 The Authors. Journal of Internal Medicine published by John Wiley & Sons Ltd on behalf of Association for Publication of The Journal of Internal Medicine.
Bipolaris oryzae, a novel fungal opportunist causing keratitis
Al-Hatmi, Abdullah
2015-01-01
We report a case of mycotic keratitis caused by Bipolaris oryzae with predisposing trauma from a foreign body. The fungus was identified by sequencing the internal transcribed spacer (ITS) region, translation elongation factor 1α (TEF1) gene and partial glyceraldehyde-3-phosphate dehydrogenase
Molecular Epidemiology of Fonsecaea Species
Najafzadeh, M.J.; Sun, J.; Vicente, V.A.; Klaassen, C.H.W.; Bonifaz, A.; Gerrits van den Ende, A.H.G.; Menken, S.B.J.; de Hoog, G.S.
2011-01-01
To assess population diversities among 81 strains of fungi in the genus Fonsecaea that had been identified down to species level, we applied amplified fragment-length polymorphism (AFLP) technology and sequenced the internal transcribed spacer regions and the partial cell division cycle, β-tubulin,
Genome-wide transcription analyses in rice using tiling microarrays
DEFF Research Database (Denmark)
Li, Lei; Wang, Xiangfeng; Stolc, Viktor
2006-01-01
. We report here a full-genome transcription analysis of the indica rice subspecies using high-density oligonucleotide tiling microarrays. Our results provided expression data support for the existence of 35,970 (81.9%) annotated gene models and identified 5,464 unique transcribed intergenic regions...... that share similar compositional properties with the annotated exons and have significant homology to other plant proteins. Elucidating and mapping of all transcribed regions revealed an association between global transcription and cytological chromosome features, and an overall similarity of transcriptional......Sequencing and computational annotation revealed several features, including high gene numbers, unusual composition of the predicted genes and a large number of genes lacking homology to known genes, that distinguish the rice (Oryza sativa) genome from that of other fully sequenced model species...
Bunawan, Hamidun; Yen, Choong Chee; Yaakop, Salmah; Noor, Normah Mohd
2017-01-26
The chloroplastic trnL intron and the nuclear internal transcribed spacer (ITS) region were sequenced for 11 Nepenthes species recorded in Peninsular Malaysia to examine their phylogenetic relationship and to evaluate the usage of trnL intron and ITS sequences for phylogenetic reconstruction of this genus. Phylogeny reconstruction was carried out using neighbor-joining, maximum parsimony and Bayesian analyses. All the trees revealed two major clusters, a lowland group consisting of N. ampullaria, N. mirabilis, N. gracilis and N. rafflesiana, and another containing both intermediately distributed species (N. albomarginata and N. benstonei) and four highland species (N. sanguinea, N. macfarlanei, N. ramispina and N. alba). The trnL intron and ITS sequences proved to provide phylogenetic informative characters for deriving a phylogeny of Nepenthes species in Peninsular Malaysia. To our knowledge, this is the first molecular phylogenetic study of Nepenthes species occurring along an altitudinal gradient in Peninsular Malaysia.
Stam, Remco; Scheikl, Daniela; Tellier, Aurélien
2016-06-02
Nod-like receptors (NLRs) are nucleotide-binding domain and leucine-rich repeats containing proteins that are important in plant resistance signaling. Many of the known pathogen resistance (R) genes in plants are NLRs and they can recognize pathogen molecules directly or indirectly. As such, divergence and copy number variants at these genes are found to be high between species. Within populations, positive and balancing selection are to be expected if plants coevolve with their pathogens. In order to understand the complexity of R-gene coevolution in wild nonmodel species, it is necessary to identify the full range of NLRs and infer their evolutionary history. Here we investigate and reveal polymorphism occurring at 220 NLR genes within one population of the partially selfing wild tomato species Solanum pennellii. We use a combination of enrichment sequencing and pooling ten individuals, to specifically sequence NLR genes in a resource and cost-effective manner. We focus on the effects which different mapping and single nucleotide polymorphism calling software and settings have on calling polymorphisms in customized pooled samples. Our results are accurately verified using Sanger sequencing of polymorphic gene fragments. Our results indicate that some NLRs, namely 13 out of 220, have maintained polymorphism within our S. pennellii population. These genes show a wide range of πN/πS ratios and differing site frequency spectra. We compare our observed rate of heterozygosity with expectations for this selfing and bottlenecked population. We conclude that our method enables us to pinpoint NLR genes which have experienced natural selection in their habitat. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Zhang, Xiao-Yong; Wang, Guang-Hua; Xu, Xin-Ya; Nong, Xu-Hua; Wang, Jie; Amin, Muhammad; Qi, Shu-Hua
2016-10-01
The present study investigated the fungal diversity in four different deep-sea sediments from Okinawa Trough using high-throughput Illumina sequencing of the nuclear ribosomal internal transcribed spacer-1 (ITS1). A total of 40,297 fungal ITS1 sequences clustered into 420 operational taxonomic units (OTUs) with 97% sequence similarity and 170 taxa were recovered from these sediments. Most ITS1 sequences (78%) belonged to the phylum Ascomycota, followed by Basidiomycota (17.3%), Zygomycota (1.5%) and Chytridiomycota (0.8%), and a small proportion (2.4%) belonged to unassigned fungal phyla. Compared with previous studies on fungal diversity of sediments from deep-sea environments by culture-dependent approach and clone library analysis, the present result suggested that Illumina sequencing had been dramatically accelerating the discovery of fungal community of deep-sea sediments. Furthermore, our results revealed that Sordariomycetes was the most diverse and abundant fungal class in this study, challenging the traditional view that the diversity of Sordariomycetes phylotypes was low in the deep-sea environments. In addition, more than 12 taxa accounted for 21.5% sequences were found to be rarely reported as deep-sea fungi, suggesting the deep-sea sediments from Okinawa Trough harbored a plethora of different fungal communities compared with other deep-sea environments. To our knowledge, this study is the first exploration of the fungal diversity in deep-sea sediments from Okinawa Trough using high-throughput Illumina sequencing.
A Third Approach to Gene Prediction Suggests Thousands of Additional Human Transcribed Regions
Glusman, Gustavo; Qin, Shizhen; El-Gewely, M. Raafat; Siegel, Andrew F; Roach, Jared C; Hood, Leroy; Smit, Arian F. A
2006-01-01
The identification and characterization of the complete ensemble of genes is a main goal of deciphering the digital information stored in the human genome. Many algorithms for computational gene prediction have been described, ultimately derived from two basic concepts: (1) modeling gene structure and (2) recognizing sequence similarity. Successful hybrid methods combining these two concepts have also been developed. We present a third orthogonal approach to gene prediction, based on detecting the genomic signatures of transcription, accumulated over evolutionary time. We discuss four algorithms based on this third concept: Greens and CHOWDER, which quantify mutational strand biases caused by transcription-coupled DNA repair, and ROAST and PASTA, which are based on strand-specific selection against polyadenylation signals. We combined these algorithms into an integrated method called FEAST, which we used to predict the location and orientation of thousands of putative transcription units not overlapping known genes. Many of the newly predicted transcriptional units do not appear to code for proteins. The new algorithms are particularly apt at detecting genes with long introns and lacking sequence conservation. They therefore complement existing gene prediction methods and will help identify functional transcripts within many apparent “genomic deserts.” PMID:16543943
Kang, Daoxian; Ran, Yuping; Li, Conghui; Dai, Yaling; Lama, Jebina
2013-01-01
We report a case of Arthroderma vanbreuseghemii (a teleomorph of Trichophyton interdigitale) infection around the nostrils in a 3-year-old girl. The culture was negative, so the pathogenic agent was identified using polymerase chain reaction-based sequencing of the crusts taken from the lesion on the nostril. Treatment with oral itraconazole and topical 1% naftifine/0.25% ketoconazole cream after a topical wash with ketoconazole shampoo was effective. © 2012 Wiley Periodicals, Inc.
Bottacini, Francesca; Zomer, Aldert; Milani, Christian; Ferrario, Chiara; Lugli, Gabriele Andrea; Egan, Muireann; Ventura, Marco; van Sinderen, Douwe
2017-12-28
Bifidobacterium breve represents a common member of the infant gut microbiota and its presence in the gut has been associated with host well being. For this reason it is relevant to investigate and understand the molecular mechanisms underlying the establishment, persistence and activities of this gut commensal in the host environment. The assessment of vegetative promoters in the bifidobacterial prototype Bifidobacterium breve UCC2003 was performed employing a combination of RNA tiling array analysis and cDNA sequencing. Canonical -10 (TATAAT) and -35 (TTGACA) sequences were identified upstream of transcribed genes or operons, where deviations from this consensus correspond to transcription level variations. A Random Forest analysis assigned the -10 region of B. breve promoters as the element most impacting on the level of transcription, followed by the spacer length and the 5'-UTR length of transcripts. Furthermore, our transcriptome study also identified rho-independent termination as the most common and effective termination signal of highly and moderately transcribed operons in B. breve. The present study allowed us to identify genes and operons that are actively transcribed in this organism during logarithmic growth, and link promoter elements with levels of transcription of essential genes in this organism. As homologs of many of our identified genes are present across the whole genus Bifidobacterium, our dataset constitutes a transcriptomic reference to be used for future investigations of gene expression in members of this genus.
Beausang, John F; Wheeler, Amanda J; Chan, Natalie H; Hanft, Violet R; Dirbas, Frederick M; Jeffrey, Stefanie S; Quake, Stephen R
2017-11-28
Tumor-infiltrating T cells play an important role in many cancers, and can improve prognosis and yield therapeutic targets. We characterized T cells infiltrating both breast cancer tumors and the surrounding normal breast tissue to identify T cells specific to each, as well as their abundance in peripheral blood. Using immune profiling of the T cell beta-chain repertoire in 16 patients with early-stage breast cancer, we show that the clonal structure of the tumor is significantly different from adjacent breast tissue, with the tumor containing ∼2.5-fold greater density of T cells and higher clonality compared with normal breast. The clonal structure of T cells in blood and normal breast is more similar than between blood and tumor, and could be used to distinguish tumor from normal breast tissue in 14 of 16 patients. Many T cell sequences overlap between tissue and blood from the same patient, including ∼50% of T cells between tumor and normal breast. Both tumor and normal breast contain high-abundance "enriched" sequences that are absent or of low abundance in the other tissue. Many of these T cells are either not detected or detected with very low frequency in the blood, suggesting the existence of separate compartments of T cells in both tumor and normal breast. Enriched T cell sequences are typically unique to each patient, but a subset is shared between many different patients. We show that many of these are commonly generated sequences, and thus unlikely to play an important role in the tumor microenvironment. Copyright © 2017 the Author(s). Published by PNAS.
Wang, He; Xiao, Meng; Kong, Fanrong; Chen, Sharon; Dou, Hong-Tao; Sorrell, Tania; Li, Ruo-Yu; Xu, Ying-Chun
2011-01-01
Eleven reference and 25 clinical isolates of Fusarium were subject to multilocus DNA sequence analysis to determine the species and haplotypes of the fusarial isolates from Beijing and Shandong, China. Seven loci were analyzed: the translation elongation factor 1 alpha gene (EF-1α); the nuclear rRNA internal transcribed spacer (ITS), large subunit (LSU), and intergenic spacer (IGS) regions; the second largest subunit of the RNA polymerase gene (RPB2); the calmodulin gene (CAM); and the mitochondrial small subunit (mtSSU) rRNA gene. We also evaluated an IGS-targeted PCR/reverse line blot (RLB) assay for species/haplotype identification of Fusarium. Twenty Fusarium species and seven species complexes were identified. Of 25 clinical isolates (10 species), the Gibberella (Fusarium) fujikuroi species complex was the commonest (40%) and was followed by the Fusarium solani species complex (FSSC) (36%) and the F. incarnatum-F. equiseti species complex (12%). Six FSSC isolates were identified to the species level as FSSC-3+4, and three as FSSC-5. Twenty-nine IGS, 27 EF-1α, 26 RPB2, 24 CAM, 18 ITS, 19 LSU, and 18 mtSSU haplotypes were identified; 29 were unique, and haplotypes for 24 clinical strains were novel. By parsimony informative character analysis, the IGS locus was the most phylogenetically informative, and the rRNA gene regions were the least. Results by RLB were concordant with multilocus sequence analysis for all isolates. Amphotericin B was the most active drug against all species. Voriconazole MICs were high (>8 μg/ml) for 15 (42%) isolates, including FSSC. Analysis of larger numbers of isolates is required to determine the clinical utility of the seven-locus sequence analysis and RLB assay in species classification of fusaria. PMID:21389150
Kjaersgård, I V; Jespersen, H M; Rasmussen, S K; Welinder, K G
1997-03-01
cDNA clones encoding two new Arabidopsis thaliana peroxidases, ATP 1a and ATP 2a, have been identified by searching the Arabidopsis database of expressed sequence tags (dbEST). They represent a novel branch of hitherto uncharacterized plant peroxidases which is only 35% identical in amino acid sequence to the well characterized group of basic plant peroxidases represented by the horseradish (Armoracia rusticana) isoperoxidases HRP C, HRP E5 and the similar Arabidopsis isoperoxidases ATP Ca, ATP Cb, and ATP Ea. However ATP 1a is 87% identical in amino acid sequence to a peroxidase encoded by an mRNA isolated from cotton (Gossypium hirsutum). As cotton and Arabidopsis belong to rather diverse families (Malvaceae and Crucifereae, respectively), in contrast with Arabidopsis and horseradish (both Crucifereae), the high degree of sequence identity indicates that this novel type of peroxidase, albeit of unknown function, is likely to be widespread in plant species. The atp 1 and atp 2 types of cDNA sequences were the most redundant among the 28 different isoperoxidases identified among about 200 peroxidase encoding ESTs. Interestingly, 8 out of totally 38 EST sequences coding for ATP 1 showed three identical nucleotide substitutions. This variant form is designated ATP 1b. Similarly, six out of totally 16 EST sequences coding for ATP 2 showed a number of deletions and nucleotide changes. This variant form is designated ATP 2b. The selected EST clones are full-length and contain coding regions of 993 nucleotides for atp 1a, and 984 nucleotides for atp 2a. These regions show 61% DNA sequence identity. The predicted mature proteins ATP 1a, and ATP 2a are 57% identical in sequence and contain the structurally and functionally important residues, characteristic of the plant peroxidase superfamily. However, they do show two differences of importance to peroxidase catalysis: (1) the asparagine residue linked with the active site distal histidine via hydrogen bonding is absent
Deep-sequencing protocols influence the results obtained in small-RNA sequencing.
Directory of Open Access Journals (Sweden)
Joern Toedling
Full Text Available Second-generation sequencing is a powerful method for identifying and quantifying small-RNA components of cells. However, little attention has been paid to the effects of the choice of sequencing platform and library preparation protocol on the results obtained. We present a thorough comparison of small-RNA sequencing libraries generated from the same embryonic stem cell lines, using different sequencing platforms, which represent the three major second-generation sequencing technologies, and protocols. We have analysed and compared the expression of microRNAs, as well as populations of small RNAs derived from repetitive elements. Despite the fact that different libraries display a good correlation between sequencing platforms, qualitative and quantitative variations in the results were found, depending on the protocol used. Thus, when comparing libraries from different biological samples, it is strongly recommended to use the same sequencing platform and protocol in order to ensure the biological relevance of the comparisons.
DEFF Research Database (Denmark)
Als, Thomas Damm; Lescai, Francesco; Dahl, Hans
to map risk variants involved in complex traits. We aim at utilizing samples of cases and controls of the isolated population of the Faroe Islands to conduct whole-genome-sequence analysis in order to identify rare genetic variants associated with schizophrenia. We will search for rare genetic variants...... of developing SZ. However, these studies are designed to examining only “the common variant” proportion of the genomic landscape of SZ. Due to increased genetic drift during founding and potential bottlenecks, followed by population expansion, isolated populations may be particularly useful in identifying rare...... disease variants, that may appear at higher frequencies and/or within a more clearly distinct haplotype structure compared to outbred populations. Small isolated populations also typically show reduced phenotypic, genetic and environmental heterogeneity, thus making them advantageous in studies aiming...
Directory of Open Access Journals (Sweden)
Michael V Zaragoza
Full Text Available The goals are to understand the primary genetic mechanisms that cause Sick Sinus Syndrome and to identify potential modifiers that may result in intrafamilial variability within a multigenerational family. The proband is a 63-year-old male with a family history of individuals (>10 with sinus node dysfunction, ventricular arrhythmia, cardiomyopathy, heart failure, and sudden death. We used exome sequencing of a single individual to identify a novel LMNA mutation and demonstrated the importance of Sanger validation and family studies when evaluating candidates. After initial single-gene studies were negative, we conducted exome sequencing for the proband which produced 9 gigabases of sequencing data. Bioinformatics analysis showed 94% of the reads mapped to the reference and identified 128,563 unique variants with 108,795 (85% located in 16,319 genes of 19,056 target genes. We discovered multiple variants in known arrhythmia, cardiomyopathy, or ion channel associated genes that may serve as potential modifiers in disease expression. To identify candidate mutations, we focused on ~2,000 variants located in 237 genes of 283 known arrhythmia, cardiomyopathy, or ion channel associated genes. We filtered the candidates to 41 variants in 33 genes using zygosity, protein impact, database searches, and clinical association. Only 21 of 41 (51% variants were validated by Sanger sequencing. We selected nine confirmed variants with minor allele frequencies G, a novel heterozygous splice-site mutation as the primary mutation with rare or novel variants in HCN4, MYBPC3, PKP4, TMPO, TTN, DMPK and KCNJ10 as potential modifiers and a mechanism consistent with haploinsufficiency.
Luesink, Evert J.; Herpen, René E.M.A. van; Grossiord, Benoît P.; Kuipers, Oscar P.; Vos, Willem M. de
1998-01-01
The Lactococcus lactis ccpA gene, encoding the global regulatory protein CcpA, was identified and characterized. Northern blot and primer extension analyses showed that the L. lactis ccpA gene is constitutively transcribed from a promoter that does not contain a cre sequence. Inactivation of the
Bruijnesteijn van Coppenraet, E. S.; Lindeboom, J. A.; Prins, J. M.; Peeters, M. F.; Claas, E. C. J.; Kuijper, E. J.
2004-01-01
A real-time PCR assay was developed to diagnose and identify the causative agents of suspected mycobacterial lymphadenitis. Primers and probes for the real-time PCR were designed on the basis of the internal transcribed spacer sequence, enabling the recognition of the genus Mycobacterium and the
Olson, Nathan D.; Lund, Steven P.; Zook, Justin M.; Rojas-Cornejo, Fabiola; Beck, Brian; Foy, Carole; Huggett, Jim; Whale, Alexandra S.; Sui, Zhiwei; Baoutina, Anna; Dobeson, Michael; Partis, Lina; Morrow, Jayne B.
2015-01-01
This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA) sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing®, or Ion Torrent PGM®. The sequencing data were evaluated on three levels: (1) identity of biologically conserved position, (2) ratio of 16S rRNA gene copies featuring identified variants, and (3) the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies. PMID:27077030
Directory of Open Access Journals (Sweden)
Nathan D. Olson
2015-03-01
Full Text Available This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing®, or Ion Torrent PGM®. The sequencing data were evaluated on three levels: (1 identity of biologically conserved position, (2 ratio of 16S rRNA gene copies featuring identified variants, and (3 the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies.
Guo, Xingyi; Shi, Jiajun; Cai, Qiuyin; Shu, Xiao-Ou; He, Jing; Wen, Wanqing; Allen, Jamie; Pharoah, Paul; Dunning, Alison; Hunter, David J; Kraft, Peter; Easton, Douglas F; Zheng, Wei; Long, Jirong
2018-03-01
Functional disruptions of susceptibility genes by large genomic structure variant (SV) deletions in germlines are known to be associated with cancer risk. However, few studies have been conducted to systematically search for SV deletions in breast cancer susceptibility genes. We analysed deep (> 30x) whole-genome sequencing (WGS) data generated in blood samples from 128 breast cancer patients of Asian and European descent with either a strong family history of breast cancer or early cancer onset disease. To identify SV deletions in known or suspected breast cancer susceptibility genes, we used multiple SV calling tools including Genome STRiP, Delly, Manta, BreakDancer and Pindel. SV deletions were detected by at least three of these bioinformatics tools in five genes. Specifically, we identified heterozygous deletions covering a fraction of the coding regions of BRCA1 (with approximately 80kb in two patients), and TP53 genes (with ∼1.6 kb in two patients), and of intronic regions (∼1 kb) of the PALB2 (one patient), PTEN (three patients) and RAD51C genes (one patient). We confirmed the presence of these deletions using real-time quantitative PCR (qPCR). Our study identified novel SV deletions in breast cancer susceptibility genes and the identification of such SV deletions may improve clinical testing.
Saelens, Joseph W; Lau-Bonilla, Dalia; Moller, Anneliese; Medina, Narda; Guzmán, Brenda; Calderón, Maylena; Herrera, Raúl; Sisk, Dana M; Xet-Mull, Ana M; Stout, Jason E; Arathoon, Eduardo; Samayoa, Blanca; Tobin, David M
2015-12-01
Limited data are available regarding the molecular epidemiology of Mycobacterium tuberculosis (Mtb) strains circulating in Guatemala. Beijing-lineage Mtb strains have gained prevalence worldwide and are associated with increased virulence and drug resistance, but there have been only a few cases reported in Central America. Here we report the first whole genome sequencing of Central American Beijing-lineage strains of Mtb. We find that multiple Beijing-lineage strains, derived from independent founding events, are currently circulating in Guatemala, but overall still represent a relatively small proportion of disease burden. Finally, we identify a specific Beijing-lineage outbreak centered on a poor neighborhood in Guatemala City. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.
Directory of Open Access Journals (Sweden)
Donna S Mackay
Full Text Available Primary open-angle glaucoma (POAG is a clinically important and genetically heterogeneous cause of progressive vision loss as a result of retinal ganglion cell death. Here we have utilized trio-based, whole-exome sequencing to identify the genetic defect underlying an autosomal dominant form of adult-onset POAG segregating in an African-American family. Exome sequencing identified a novel missense variant (c.418C>T, p.Arg140Trp in exon-5 of the gene coding for epidermal growth factor (EGF containing fibulin-like extracellular matrix protein 1 (EFEMP1 that co-segregated with disease in the family. Linkage and haplotype analyses with microsatellite markers indicated that the disease interval overlapped a known POAG locus (GLC1H on chromosome 2p. The p.Arg140Trp substitution was predicted in silico to have damaging effects on protein function and transient expression studies in cultured cells revealed that the Trp140-mutant protein exhibited increased intracellular accumulation compared with wild-type EFEMP1. In situ hybridization of the mouse eye with oligonucleotide probes detected the highest levels of EFEMP1 transcripts in the ciliary body, cornea, inner nuclear layer of the retina, and the optic nerve head. The recent finding that a common variant near EFEMP1 was associated with optic nerve-head morphology supports the possibility that the EFEMP1 variant identified in this POAG family may be pathogenic.
Nucleotide sequence preservation of human mitochondrial DNA
International Nuclear Information System (INIS)
Monnat, R.J. Jr.; Loeb, L.A.
1985-01-01
Recombinant DNA techniques have been used to quantitate the amount of nucleotide sequence divergence in the mitochondrial DNA population of individual normal humans. Mitochondrial DNA was isolated from the peripheral blood lymphocytes of five normal humans and cloned in M13 mp11; 49 kilobases of nucleotide sequence information was obtained from 248 independently isolated clones from the five normal donors. Both between- and within-individual differences were identified. Between-individual differences were identified in approximately = to 1/200 nucleotides. In contrast, only one within-individual difference was identified in 49 kilobases of nucleotide sequence information. This high degree of mitochondrial nucleotide sequence homogeneity in human somatic cells is in marked contrast to the rapid evolutionary divergence of human mitochondrial DNA and suggests the existence of mechanisms for the concerted preservation of mammalian mitochondrial DNA sequences in single organisms
Chen, Guiqian; Qiu, Yuan; Zhuang, Qingye; Wang, Suchun; Wang, Tong; Chen, Jiming; Wang, Kaicheng
2018-05-09
Next generation sequencing (NGS) is a powerful tool for the characterization, discovery, and molecular identification of RNA viruses. There were multiple NGS library preparation methods published for strand-specific RNA-seq, but some methods are not suitable for identifying and characterizing RNA viruses. In this study, we report a NGS library preparation method to identify RNA viruses using the Ion Torrent PGM platform. The NGS sequencing adapters were directly inserted into the sequencing library through reverse transcription and polymerase chain reaction, without fragmentation and ligation of nucleic acids. The results show that this method is simple to perform, able to identify multiple species of RNA viruses in clinical samples.
Kim, Daniel Seung; Burt, Amber A; Ranchalis, Jane E; Wilmot, Beth; Smith, Joshua D; Patterson, Karynne E; Coe, Bradley P; Li, Yatong K; Bamshad, Michael J; Nikolas, Molly; Eichler, Evan E; Swanson, James M; Nigg, Joel T; Nickerson, Deborah A; Jarvik, Gail P
2017-06-01
Attention-Deficit Hyperactivity Disorder (ADHD) has high heritability; however, studies of common variation account for ADHD variance. Using data from affected participants without a family history of ADHD, we sought to identify de novo variants that could account for sporadic ADHD. Considering a total of 128 families, two analyses were conducted in parallel: first, in 11 unaffected parent/affected proband trios (or quads with the addition of an unaffected sibling) we completed exome sequencing. Six de novo missense variants at highly conserved bases were identified and validated from four of the 11 families: the brain-expressed genes TBC1D9, DAGLA, QARS, CSMD2, TRPM2, and WDR83. Separately, in 117 unrelated probands with sporadic ADHD, we sequenced a panel of 26 genes implicated in intellectual disability (ID) and autism spectrum disorder (ASD) to evaluate whether variation in ASD/ID-associated genes were also present in participants with ADHD. Only one putative deleterious variant (Gln600STOP) in CHD1L was identified; this was found in a single proband. Notably, no other nonsense, splice, frameshift, or highly conserved missense variants in the 26 gene panel were identified and validated. These data suggest that de novo variant analysis in families with independently adjudicated sporadic ADHD diagnosis can identify novel genes implicated in ADHD pathogenesis. Moreover, that only one of the 128 cases (0.8%, 11 exome, and 117 MIP sequenced participants) had putative deleterious variants within our data in 26 genes related to ID and ASD suggests significant independence in the genetic pathogenesis of ADHD as compared to ASD and ID phenotypes. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.
Whole-genome sequencing identifies EN1 as a determinant of bone density and fracture
DEFF Research Database (Denmark)
Zheng, Hou-Feng; Forgetta, Vincenzo; Hsu, Yi-Hsiang
2015-01-01
. Associations for BMD were derived from whole-genome sequencing (n = 2,882 from UK10K (ref. 10); a population-based genome sequencing consortium), whole-exome sequencing (n = 3,549), deep imputation of genotyped samples using a combined UK10K/1000 Genomes reference panel (n = 26,534), and de novo replication...
Geoseq: a tool for dissecting deep-sequencing datasets
Directory of Open Access Journals (Sweden)
Homann Robert
2010-10-01
Full Text Available Abstract Background Datasets generated on deep-sequencing platforms have been deposited in various public repositories such as the Gene Expression Omnibus (GEO, Sequence Read Archive (SRA hosted by the NCBI, or the DNA Data Bank of Japan (ddbj. Despite being rich data sources, they have not been used much due to the difficulty in locating and analyzing datasets of interest. Results Geoseq http://geoseq.mssm.edu provides a new method of analyzing short reads from deep sequencing experiments. Instead of mapping the reads to reference genomes or sequences, Geoseq maps a reference sequence against the sequencing data. It is web-based, and holds pre-computed data from public libraries. The analysis reduces the input sequence to tiles and measures the coverage of each tile in a sequence library through the use of suffix arrays. The user can upload custom target sequences or use gene/miRNA names for the search and get back results as plots and spreadsheet files. Geoseq organizes the public sequencing data using a controlled vocabulary, allowing identification of relevant libraries by organism, tissue and type of experiment. Conclusions Analysis of small sets of sequences against deep-sequencing datasets, as well as identification of public datasets of interest, is simplified by Geoseq. We applied Geoseq to, a identify differential isoform expression in mRNA-seq datasets, b identify miRNAs (microRNAs in libraries, and identify mature and star sequences in miRNAS and c to identify potentially mis-annotated miRNAs. The ease of using Geoseq for these analyses suggests its utility and uniqueness as an analysis tool.
Transcriptome sequencing in prostate cancer identifies inter-tumor heterogeneity
Directory of Open Access Journals (Sweden)
Janet Mendonca
2015-06-01
Full Text Available Given the dearth of gene mutations in prostate cancer, [1] ,[2] it is likely that genomic rearrangements play a significant role in the evolution of prostate cancer. However, in the search for recurrent genomic alterations, "private alterations" have received less attention. Such alterations may provide insights into the evolution, behavior, and clinical outcome of an individual tumor. In a recent report in "Genome Biology" Wyatt et al. [3] defines unique alterations in a cohort of high-risk prostate cancer patient with a lethal phenotype. Utilizing a transcriptome sequencing approach they observe high inter-tumor heterogeneity; however, the genes altered distill into three distinct cancer-relevant pathways. Their analysis reveals the presence of several non-ETS fusions, which may contribute to the phenotype of individual tumors, and have significance for disease progression.
Directory of Open Access Journals (Sweden)
Graner Andreas
2008-10-01
Full Text Available Abstract Background Barley has one of the largest and most complex genomes of all economically important food crops. The rise of new short read sequencing technologies such as Illumina/Solexa permits such large genomes to be effectively sampled at relatively low cost. Based on the corresponding sequence reads a Mathematically Defined Repeat (MDR index can be generated to map repetitive regions in genomic sequences. Results We have generated 574 Mbp of Illumina/Solexa sequences from barley total genomic DNA, representing about 10% of a genome equivalent. From these sequences we generated an MDR index which was then used to identify and mark repetitive regions in the barley genome. Comparison of the MDR plots with expert repeat annotation drawing on the information already available for known repetitive elements revealed a significant correspondence between the two methods. MDR-based annotation allowed for the identification of dozens of novel repeat sequences, though, which were not recognised by hand-annotation. The MDR data was also used to identify gene-containing regions by masking of repetitive sequences in eight de-novo sequenced bacterial artificial chromosome (BAC clones. For half of the identified candidate gene islands indeed gene sequences could be identified. MDR data were only of limited use, when mapped on genomic sequences from the closely related species Triticum monococcum as only a fraction of the repetitive sequences was recognised. Conclusion An MDR index for barley, which was obtained by whole-genome Illumina/Solexa sequencing, proved as efficient in repeat identification as manual expert annotation. Circumventing the labour-intensive step of producing a specific repeat library for expert annotation, an MDR index provides an elegant and efficient resource for the identification of repetitive and low-copy (i.e. potentially gene-containing sequences regions in uncharacterised genomic sequences. The restriction that a particular
Aswad, Amr; Katzourakis, Aris
2014-01-01
Herpesviridae is a diverse family of large and complex pathogens whose genomes are extremely difficult to sequence. This is particularly true for clinical samples, and if the virus, host, or both genomes are being sequenced for the first time. Although herpesviruses are known to occasionally integrate in host genomes, and can also be inherited in a Mendelian fashion, they are notably absent from the genomic fossil record comprised of endogenous viral elements (EVEs). Here, we combine paleovirological and metagenomic approaches to both explore the constituent viral diversity of mammalian genomes and search for endogenous herpesviruses. We describe the first endogenous herpesvirus from the genome of the Philippine tarsier, belonging to the Roseolovirus genus, and characterize its highly defective genome that is integrated and flanked by unambiguous host DNA. From a draft assembly of the aye-aye genome, we use bioinformatic tools to reveal over 100,000 bp of a novel rhadinovirus that is the first lemur gammaherpesvirus, closely related to Kaposi's sarcoma-associated virus. We also identify 58 genes of Pan paniscus lymphocryptovirus 1, the bonobo equivalent of human Epstein-Barr virus. For each of the viruses, we postulate gene function via comparative analysis to known viral relatives. Most notably, the evidence from gene content and phylogenetics suggests that the aye-aye sequences represent the most basal known rhadinovirus, and indicates that tumorigenic herpesviruses have been infecting primates since their emergence in the late Cretaceous. Overall, these data show that a genomic fossil record of herpesviruses exists despite their extremely large genomes, and expands the known diversity of Herpesviridae, which will aid the characterization of pathogenesis. Our analytical approach illustrates the benefit of intersecting evolutionary approaches with metagenomics, genetics and paleovirology. PMID:24945689
Oyebola, Kolapo M; Idowu, Emmanuel T; Olukosi, Yetunde A; Awolola, Taiwo S; Amambua-Ngwa, Alfred
2017-06-29
The burden of falciparum malaria is especially high in sub-Saharan Africa. Differences in pressure from host immunity and antimalarial drugs lead to adaptive changes responsible for high level of genetic variations within and between the parasite populations. Population-specific genetic studies to survey for genes under positive or balancing selection resulting from drug pressure or host immunity will allow for refinement of interventions. We performed a pooled sequencing (pool-seq) of the genomes of 100 Plasmodium falciparum isolates from Nigeria. We explored allele-frequency based neutrality test (Tajima's D) and integrated haplotype score (iHS) to identify genes under selection. Fourteen shared iHS regions that had at least 2 SNPs with a score > 2.5 were identified. These regions code for genes that were likely to have been under strong directional selection. Two of these genes were the chloroquine resistance transporter (CRT) on chromosome 7 and the multidrug resistance 1 (MDR1) on chromosome 5. There was a weak signature of selection in the dihydrofolate reductase (DHFR) gene on chromosome 4 and MDR5 genes on chromosome 13, with only 2 and 3 SNPs respectively identified within the iHS window. We observed strong selection pressure attributable to continued chloroquine and sulfadoxine-pyrimethamine use despite their official proscription for the treatment of uncomplicated malaria. There was also a major selective sweep on chromosome 6 which had 32 SNPs within the shared iHS region. Tajima's D of circumsporozoite protein (CSP), erythrocyte-binding antigen (EBA-175), merozoite surface proteins - MSP3 and MSP7, merozoite surface protein duffy binding-like (MSPDBL2) and serine repeat antigen (SERA-5) were 1.38, 1.29, 0.73, 0.84 and 0.21, respectively. We have demonstrated the use of pool-seq to understand genomic patterns of selection and variability in P. falciparum from Nigeria, which bears the highest burden of infections. This investigation identified known
High-Throughput Block Optical DNA Sequence Identification.
Sagar, Dodderi Manjunatha; Korshoj, Lee Erik; Hanson, Katrina Bethany; Chowdhury, Partha Pratim; Otoupal, Peter Britton; Chatterjee, Anushree; Nagpal, Prashant
2018-01-01
Optical techniques for molecular diagnostics or DNA sequencing generally rely on small molecule fluorescent labels, which utilize light with a wavelength of several hundred nanometers for detection. Developing a label-free optical DNA sequencing technique will require nanoscale focusing of light, a high-throughput and multiplexed identification method, and a data compression technique to rapidly identify sequences and analyze genomic heterogeneity for big datasets. Such a method should identify characteristic molecular vibrations using optical spectroscopy, especially in the "fingerprinting region" from ≈400-1400 cm -1 . Here, surface-enhanced Raman spectroscopy is used to demonstrate label-free identification of DNA nucleobases with multiplexed 3D plasmonic nanofocusing. While nanometer-scale mode volumes prevent identification of single nucleobases within a DNA sequence, the block optical technique can identify A, T, G, and C content in DNA k-mers. The content of each nucleotide in a DNA block can be a unique and high-throughput method for identifying sequences, genes, and other biomarkers as an alternative to single-letter sequencing. Additionally, coupling two complementary vibrational spectroscopy techniques (infrared and Raman) can improve block characterization. These results pave the way for developing a novel, high-throughput block optical sequencing method with lossy genomic data compression using k-mer identification from multiplexed optical data acquisition. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Molecular marker to identify radiolarian species -toward establishment of paleo-environmental proxy-
Ishitani, Y.
2017-12-01
Marine fossilized unicellular plankton are known to have many genetically divergent species (biological species) in the single morphological species and these biological species show the species-specific environments much more precisely than that of morphological species. Among these plankton, Radiolaria are one of the best candidates for time- and environmental-indicators in the modern and past oceans, because radiolarians are the only group which represent entire water column from shallow to deep waters. However, the ecology and evolution of radiolarian were traditionally studied in paleontology and paleoceanography by morphological species. Even Radiolaria has a huge potential for novel proxy of wide and deep environments, there is no criterion to identify the biological species. The motivation for this study is setting the quantitative delimitation to establish the biological species of radiolarians based on molecular data, for leading the future ecological and paleo-environmental study. Identification of the biological species by ribosomal DNA sequences are mainly based on two ways: one is the evolutionary distance of the small subunit (SSU) rDNA, the internal transcribed spacer region of ribosomal DNA (ITS1 and 2), and the large subunit (LSU) rDNA; and the other is the secondary structure of ITS2. In the present study, all four possible genetic markers (SSU, ITS1, ITS2, and LSU rDNA) were amplified from 232 individuals of five radiolarian morphological species and applied to examine the evolutionary distance and secondary structure of rDNA. Comprehensive survey clearly shows that evolutionary distance of ITS1 rDNA and the secondary structure of ITS2 is good to identify the species. Notably, evolutionary distance of ITS1 rDNA is possible to set the common delimitation to identify the biological species, as 0.225 substitution per site. The results show that the ITS1 and ITS 2 rDNA could be the criterion for radiolarian species identification.
Flores, María D; Gonzalez, Luis M; Hurtado, Carolina; Motta, Yamileth Monje; Domínguez-Hidalgo, Cristina; Merino, Francisco Jesús; Perteguer, María J; Gárate, Teresa
2018-02-27
Taenia solium, T. asiatica and T. saginata tapeworms cause human taeniasis and are the origin of porcine and bovine cysticercosis. Furthermore, T. solium eggs can cause human cysticercosis, with neurocysticercosis being the most serious form of the disease. These helminth infections are neglected tropical diseases and are endemic in several countries in the Americas, Asia and Africa. As a result of globalization, migration in particular, the infections have been extending to non-endemic territories. Species-specific diagnosis of taeniasis is subject to drawbacks that could be resolved using molecular approaches. In the present study, conventional and real-time amplification protocols (cPCR and qPCR) based on the T. saginata HDP2 sequence were applied in the differential diagnosis of taeniasis (T. saginata, T. solium) in both fecal samples and proglottids expelled by patients. The HDP2 homolog in T. solium was cloned and characterized. Semi-nested cPCR and qPCR (Sn-HDP2 cPCR and Sn-HDP2 qPCR) amplified T. saginata and T. solium DNA, with an analytical sensitivity of 40 and 400 fg, respectively, and identically in both protocols. Eighteen taeniasis patients were diagnosed directly with T. saginata or T. solium, either from proglottids or fecal samples with/without eggs (detected using microscopy), based on the optimized Sn-HDP2 qPCR. After cloning, the T. solium HDP2 homolog sequence was confirmed to be a ribosomal sequence. The HDP2 fragment corresponded to a non-transcribed sequence/external transcribed repeat (NTS/ETS) of ribosomal DNA. Compared with the T. saginata HDP2 homolog, the T solium HDP2 sequence lacked the first 900 nt at the 5' end and showed nucleotide substitutions and small deletions. Sn-HDP2 cPCR and Sn-HDP2 qPCR were set up for the diagnosis of human taeniasis, using proglottids and fecal samples from affected patients. The new Sn-HDP2 qPCR protocol was the best option, as it directly differentiated T. saginata from T. solium. The diagnosis of
Reis, António M C; Mills, Wilbur K; Ramachandran, Ilangovan; Friedberg, Errol C; Thompson, David; Queimado, Lurdes
2012-01-01
Endogenous DNA damage is removed mainly via base excision repair (BER), however, whether there is preferential strand repair of endogenous DNA damage is still under intense debate. We developed a highly sensitive primer-anchored DNA damage detection assay (PADDA) to map and quantify in vivo endogenous DNA damage. Using PADDA, we documented significantly higher levels of endogenous damage in Saccharomyces cerevisiae cells in stationary phase than in exponential phase. We also documented that yeast BER-defective cells have significantly higher levels of endogenous DNA damage than isogenic wild-type cells at any phase of growth. PADDA provided detailed fingerprint analysis at the single-nucleotide level, documenting for the first time that persistent endogenous nucleotide damage in CAN1 co-localizes with previously reported spontaneous CAN1 mutations. To quickly and reliably quantify endogenous strand-specific DNA damage in the constitutively expressed CAN1 gene, we used PADDA on a real-time PCR setting. We demonstrate that wild-type cells repair endogenous damage preferentially on the CAN1 transcribed strand. In contrast, yeast BER-defective cells accumulate endogenous damage preferentially on the CAN1 transcribed strand. These data provide the first direct evidence for preferential strand repair of endogenous DNA damage and documents the major role of BER in this process.
Asadzadeh, Mohammad; Ahmad, Suhail; Hagen, Ferry; Meis, Jacques F; Al-Sweih, Noura; Khan, Ziauddin
2015-01-01
Candida parapsilosis has now emerged as the second or third most important cause of healthcare-associated Candida infections. Molecular studies have shown that phenotypically identified C. parapsilosis isolates represent a complex of three species, namely, C. parapsilosis, C. orthopsilosis and C. metapsilosis. Lodderomyces elongisporus is another species phenotypically closely related to the C. parapsilosis-complex. The aim of this study was to develop a simple, low cost multiplex (m) PCR assay for species-specific identification of C. parapsilosis complex isolates and to study genetic relatedness of C. orthopsilosis isolates in Kuwait. Species-specific amplicons from C. parapsilosis (171 bp), C. orthopsilosis (109 bp), C. metapsilosis (217 bp) and L. elongisporus (258 bp) were obtained in mPCR. Clinical isolates identified as C. parapsilosis (n = 380) by Vitek2 in Kuwait and an international collection of 27 C. parapsilosis complex and L. elongisporus isolates previously characterized by rDNA sequencing were analyzed to evaluate mPCR. Species-specific PCR and DNA sequencing of internal transcribed spacer (ITS) region of rDNA were performed to validate the results of mPCR. Fingerprinting of 19 clinical C. orthopsilosis isolates (including 4 isolates from a previous study) was performed by amplified fragment length polymorphism (AFLP) analysis. Phenotypically identified C. parapsilosis isolates (n = 380) were identified as C. parapsilosis sensu stricto (n = 361), C. orthopsilosis (n = 15), C. metapsilosis (n = 1) and L. elongisporus (n = 3) by mPCR. The mPCR also accurately detected all epidemiologically unrelated C. parapsilosis complex and L. elongisporus isolates. The 19 C. orthopsilosis isolates obtained from 16 patients were divided into 3 haplotypes based on ITS region sequence data. Seven distinct genotypes were identified among the 19 C. orthopsilosis isolates by AFLP including a dominant genotype (AFLP1) comprising 11 isolates recovered from 10 patients. A
Liu, Miaomiao; Zhu, Jinhang; Wu, Shengbing; Wang, Chenkai; Guo, Xingyi; Wu, Jiawen; Zhou, Meiqi
2018-04-11
Artemisia argyi Lev. et Vant. (A. argyi) is widely utilized for moxibustion in Chinese medicine, and the mechanism underlying terpenoid biosynthesis in its leaves is suggested to play an important role in its medicinal use. However, the A. argyi transcriptome has not been sequenced. Herein, we performed RNA sequencing for A. argyi leaf, root and stem tissues to identify as many as possible of the transcribed genes. In total, 99,807 unigenes were assembled by analysing the expression profiles generated from the three tissue types, and 67,446 of those unigenes were annotated in public databases. We further performed differential gene expression analysis to compare leaf tissue with the other two tissue types and identified numerous genes that were specifically expressed or up-regulated in leaf tissue. Specifically, we identified multiple genes encoding significant enzymes or transcription factors related to terpenoid synthesis. This study serves as a valuable resource for transcriptome information, as many transcribed genes related to terpenoid biosynthesis were identified in the A. argyi transcriptome, providing a functional genomic basis for additional studies on molecular mechanisms underlying the medicinal use of A. argyi.
Recurrent chimeric RNAs enriched in human prostate cancer identified by deep sequencing
Kannan, Kalpana; Wang, Liguo; Wang, Jianghua; Ittmann, Michael M.; Li, Wei; Yen, Laising
2011-01-01
Transcription-induced chimeric RNAs, possessing sequences from different genes, are expected to increase the proteomic diversity through chimeric proteins or altered regulation. Despite their importance, few studies have focused on chimeric RNAs especially regarding their presence/roles in human cancers. By deep sequencing the transcriptome of 20 human prostate cancer and 10 matched benign prostate tissues, we obtained 1.3 billion sequence reads, which led to the identification of 2,369 chimeric RNA candidates. Chimeric RNAs occurred in significantly higher frequency in cancer than in matched benign samples. Experimental investigation of a selected 46 set led to the confirmation of 32 chimeric RNAs, of which 27 were highly recurrent and previously undescribed in prostate cancer. Importantly, a subset of these chimeras was present in prostate cancer cell lines, but not detectable in primary human prostate epithelium cells, implying their associations with cancer. These chimeras contain discernable 5′ and 3′ splice sites at the RNA junction, indicating that their formation is mediated by splicing. Their presence is also largely independent of the expression of parental genes, suggesting that other factors are involved in their production and regulation. One chimera, TMEM79-SMG5, is highly differentially expressed in human cancer samples and therefore a potential biomarker. The prevalence of chimeric RNAs may allow the limited number of human genes to encode a substantially larger number of RNAs and proteins, forming an additional layer of cellular complexity. Together, our results suggest that chimeric RNAs are widespread, and increased chimeric RNA events could represent a unique class of molecular alteration in cancer. PMID:21571633
Ramaraj, Vijayakumar; Vijayaraman, Rajyoganandh S; Elavarashi, Elangovan; Rangarajan, Sudha; Kindo, Anupma Jyoti
2017-05-01
Dermatophytes are a group of fungi which infect keratinized tissues and causes superficial mycoses in humans and animals. The group comprises of three major genera, Trichophyton , Microsporum and Epidermophyton . Among them Trichophyton rubrum is a predominant anthropophilic fungi which causes chronic infections. Although, the infection is superficial and treatable, reinfection/coinfection causes inflation in the treatment cost. Identifying the source and mode of transmission is essential to prevent its transmission. Accurate discrimination is required to understand the clinical (relapse or reinfection) and epidemiological implications of the genetic heterogeneity of this species. Polymorphism in the Non Transcribed Spacer (NTS) region of ribosomal DNA (rDNA) clusters renders an effective way to discriminate strains among T. rubrum . To carry out the strain typing of the clinical isolates, Trichophyton rubrum using NTS as a molecular marker. Seventy T.rubrum clinical isolates obtained from April-2011-March 2013, from Sri Ramachandra Medical Centre, Chennai, Tamil Nadu, India, were identified by conventional phenotypic methods and included in this prospective study. The isolates were then subjected to Polymerase Chain Reaction (PCR) targeting two subrepeat elements (SREs), TRS-1 and TRS-2 of the NTS region. Strain-specific polymorphism was observed in both subrepeat loci. Total, nine different strains were obtained on combining both TRS-1 and TRS-2, SREs. The outcome has given a strong representation for using NTS region amplification in discriminating the T. rubrum clinical isolates. The method can be adapted as a tool for conducting epidemiology and population based study in T. rubrum infections. This will help in future exploration of the epidemiology of T. rubrum .
We are attempting to identify specific root fragments from soil cores with individual trees. We successfully used Inter Simple Sequence Repeats (ISSR) to distinguish neighboring old-growth Douglas-fir trees from one another, while maintaining identity among each tree's parts. W...
Directory of Open Access Journals (Sweden)
Silva-Pinhati A.C.O.
2004-01-01
Full Text Available Leaf-cutting ants of the genera Atta and Acromyrmex (tribe Attini are symbiotic with basidiomycete fungi of the genus Leucoagaricus (tribe Leucocoprineae, which they cultivate on vegetable matter inside their nests. We determined the variation of the 28S, 18S, and 5.8S ribosomal DNA (rDNA gene loci and the rapidly evolving internal transcribed spacers 1 and 2 (ITS1 and ITS2 of 15 sympatric and allopatric fungi associated with colonies of 11 species of leafcutter ants living up to 2,600 km apart in Brazil. We found that the fungal rDNA and ITS sequences from different species of ants were identical (or nearly identical to each other, whereas 10 GenBank Leucoagaricus species showed higher ITS variation. Our findings suggest that Atta and Acromyrmex leafcutters living in geographic sites that are very distant from each other cultivate a single fungal species made up of closely related lineages of Leucoagaricus gongylophorus. We discuss the strikingly high similarity in the ITS1 and ITS2 regions of the Atta and Acromyrmex symbiotic L. gongylophorus studied by us, in contrast to the lower similarity displayed by their non-symbiotic counterparts. We suggest that the similarity of our L. gongylophorus isolates is an indication of the recent association of the fungus with these ants, and propose that both the intense lateral transmission of fungal material within leafcutter nests and the selection of more adapted fungal strains are involved in the homogenization of the symbiotic fungal stock.
Directory of Open Access Journals (Sweden)
Zamri Zainal
2012-02-01
Full Text Available P. minus is an aromatic plant, the leaf of which is widely used as a food additive and in the perfume industry. The leaf also accumulates secondary metabolites that act as active ingredients such as flavonoid. Due to limited genomic and transcriptomic data, the biosynthetic pathway of flavonoids is currently unclear. Identification of candidate genes involved in the flavonoid biosynthetic pathway will significantly contribute to understanding the biosynthesis of active compounds. We have constructed a standard cDNA library from P. minus leaves, and two normalized full-length enriched cDNA libraries were constructed from stem and root organs in order to create a gene resource for the biosynthesis of secondary metabolites, especially flavonoid biosynthesis. Thus, large‑scale sequencing of P. minus cDNA libraries identified 4196 expressed sequences tags (ESTs which were deposited in dbEST in the National Center of Biotechnology Information (NCBI. From the three constructed cDNA libraries, 11 ESTs encoding seven genes were mapped to the flavonoid biosynthetic pathway. Finally, three flavonoid biosynthetic pathway-related ESTs chalcone synthase, CHS (JG745304, flavonol synthase, FLS (JG705819 and leucoanthocyanidin dioxygenase, LDOX (JG745247 were selected for further examination by quantitative RT-PCR (qRT-PCR in different P. minus organs. Expression was detected in leaf, stem and root. Gene expression studies have been initiated in order to better understand the underlying physiological processes.
ReRep: Computational detection of repetitive sequences in genome survey sequences (GSS
Directory of Open Access Journals (Sweden)
Alves-Ferreira Marcelo
2008-09-01
Full Text Available Abstract Background Genome survey sequences (GSS offer a preliminary global view of a genome since, unlike ESTs, they cover coding as well as non-coding DNA and include repetitive regions of the genome. A more precise estimation of the nature, quantity and variability of repetitive sequences very early in a genome sequencing project is of considerable importance, as such data strongly influence the estimation of genome coverage, library quality and progress in scaffold construction. Also, the elimination of repetitive sequences from the initial assembly process is important to avoid errors and unnecessary complexity. Repetitive sequences are also of interest in a variety of other studies, for instance as molecular markers. Results We designed and implemented a straightforward pipeline called ReRep, which combines bioinformatics tools for identifying repetitive structures in a GSS dataset. In a case study, we first applied the pipeline to a set of 970 GSSs, sequenced in our laboratory from the human pathogen Leishmania braziliensis, the causative agent of leishmaniosis, an important public health problem in Brazil. We also verified the applicability of ReRep to new sequencing technologies using a set of 454-reads of an Escheria coli. The behaviour of several parameters in the algorithm is evaluated and suggestions are made for tuning of the analysis. Conclusion The ReRep approach for identification of repetitive elements in GSS datasets proved to be straightforward and efficient. Several potential repetitive sequences were found in a L. braziliensis GSS dataset generated in our laboratory, and further validated by the analysis of a more complete genomic dataset from the EMBL and Sanger Centre databases. ReRep also identified most of the E. coli K12 repeats prior to assembly in an example dataset obtained by automated sequencing using 454 technology. The parameters controlling the algorithm behaved consistently and may be tuned to the properties
The complete genomic sequence of a tentative new polerovirus identified in barley in South Korea.
Zhao, Fumei; Lim, Seungmo; Yoo, Ran Hee; Igori, Davaajargal; Kim, Sang-Min; Kwak, Do Yeon; Kim, Sun Lim; Lee, Bong Choon; Moon, Jae Sun
2016-07-01
The complete nucleotide sequence of a new barley polerovirus, tentatively named barley virus G (BVG), which was isolated in Gimje, South Korea, has been determined using an RNA sequencing technique combined with polymerase chain reaction methods. The viral genomic RNA of BVG is 5,620 nucleotides long and contains six typical open reading frames commonly observed in other poleroviruses. Sequence comparisons revealed that BVG is most closely related to maize yellow dwarf virus-RMV, with the highest amino acid identities being less than 90 % for all of the corresponding proteins. These results suggested that BVG is a member of a new species in the genus Polerovirus.
Kondo, Yukiko; Koshimizu, Eriko; Megarbane, Andre; Hamanoue, Haruka; Okada, Ippei; Nishiyama, Kiyomi; Kodera, Hirofumi; Miyatake, Satoko; Tsurusaki, Yoshinori; Nakashima, Mitsuko; Doi, Hiroshi; Miyake, Noriko; Saitsu, Hirotomo; Matsumoto, Naomichi
2013-07-01
Microphthalmia with limb anomalies (MLA), also known as Waardenburg anophthalmia syndrome or ophthalmoacromelic syndrome, is a rare autosomal recessive disorder. Recently, we and others successfully identified SMOC1 as the causative gene for MLA. However, there are several MLA families without SMOC1 abnormality, suggesting locus heterogeneity in MLA. We aimed to identify a pathogenic mutation in one Lebanese family having an MLA-like condition without SMOC1 mutation by whole-exome sequencing (WES) combined with homozygosity mapping. A c.683C>T (p.Thr228Met) in FNBP4 was found as a primary candidate, drawing the attention that FNBP4 and SMOC1 may potentially modulate BMP signaling. Copyright © 2013 Wiley Periodicals, Inc.
Shu, Fan-Fan; Lv, Rui-Qing; Zhang, Yi-Fang; Duan, Gang; Wu, Ding-Yu; Li, Bi-Feng; Yang, Jian-Fa; Zou, Feng-Cai
2012-08-01
On mainland China, liver flukes of Fasciola spp. (Digenea: Fasciolidae) can cause serious acute and chronic morbidity in numerous species of mammals such as sheep, goats, cattle, and humans. The objective of the present study was to examine the taxonomic identity of Fasciola species in Yunnan province by sequences of the first and second internal transcribed spacers (ITS-1 and ITS-2) of nuclear ribosomal DNA (rDNA). The ITS rDNA was amplified from 10 samples representing Fasciola species in cattle from 2 geographical locations in Yunnan Province, by polymerase chain reaction (PCR), and the products were sequenced directly. The lengths of the ITS-1 and ITS-2 sequences were 422 and 361-362 base pairs, respectively, for all samples sequenced. Using ITS sequences, 2 Fasciola species were revealed, namely Fasciola hepatica and Fasciola gigantica. This is the first demonstration of F. gigantica in cattle in Yunnan Province, China using a molecular approach; our findings have implications for studying the population genetic characterization of the Chinese Fasciola species and for the prevention and control of Fasciola spp. in this province.
Directory of Open Access Journals (Sweden)
Bingfu Guo
2016-07-01
Full Text Available Molecular characterization of sequences flanking exogenous fragment insertions is essential for safety assessment and labeling of genetically modified organisms (GMO. In this study, the T-DNA insertion sites and flanking sequences were identified in two newly developed transgenic glyphosate-tolerant soybeans GE-J16 and ZH10-6 based on whole genome sequencing (WGS method. About 21 Gb sequence data (~21× coverage for each line was generated on Illumina HiSeq 2500 platform. The junction reads mapped to boundary of T-DNA and flanking sequences in these two events were identified by comparing all sequencing reads with soybean reference genome and sequence of transgenic vector. The putative insertion loci and flanking sequences were further confirmed by PCR amplification, Sanger sequencing, and co-segregation analysis. All these analyses supported that exogenous T-DNA fragments were integrated in positions of Chr19: 50543767-50543792 and Chr17: 7980527-7980541 in these two transgenic lines. Identification of the genomic insertion site of the G2-EPSPS and GAT transgenes will facilitate the use of their glyphosate-tolerant traits in soybean breeding program. These results also demonstrated that WGS is a cost-effective and rapid method of identifying sites of T-DNA insertions and flanking sequences in soybean.
Hafskjold, L.; Eide, T.; Holmström, I.K.; Sundling, V.; Dulmen, S. van; Eide, H.
2016-01-01
Objective: Little is known about how older persons in home care express their concerns. Emotional cues and concerns can be identified by the Verona coding definitions of emotional sequences (VR-CoDES), but the method gives no insight into what causes the distress and the emotions involved. The aims
Directory of Open Access Journals (Sweden)
Zhewei Song
2017-07-01
Full Text Available Fermentation microbiota is specific microorganisms that generate different types of metabolites in many productions. In traditional solid-state fermentation, the structural composition and functional capacity of the core microbiota determine the quality and quantity of products. As a typical example of food fermentation, Chinese Maotai-flavor liquor production involves a complex of various microorganisms and a wide variety of metabolites. However, the microbial succession and functional shift of the core microbiota in this traditional food fermentation remain unclear. Here, high-throughput amplicons (16S rRNA gene amplicon sequencing and internal transcribed space amplicon sequencing and metatranscriptomics sequencing technologies were combined to reveal the structure and function of the core microbiota in Chinese soy sauce aroma type liquor production. In addition, ultra-performance liquid chromatography and headspace-solid phase microextraction-gas chromatography-mass spectrometry were employed to provide qualitative and quantitative analysis of the major flavor metabolites. A total of 10 fungal and 11 bacterial genera were identified as the core microbiota. In addition, metatranscriptomic analysis revealed pyruvate metabolism in yeasts (genera Pichia, Schizosaccharomyces, Saccharomyces, and Zygosaccharomyces and lactic acid bacteria (genus Lactobacillus classified into two stages in the production of flavor components. Stage I involved high-level alcohol (ethanol production, with the genus Schizosaccharomyces serving as the core functional microorganism. Stage II involved high-level acid (lactic acid and acetic acid production, with the genus Lactobacillus serving as the core functional microorganism. The functional shift from the genus Schizosaccharomyces to the genus Lactobacillus drives flavor component conversion from alcohol (ethanol to acid (lactic acid and acetic acid in Chinese Maotai-flavor liquor production. Our findings provide
Song, Zhewei; Du, Hai; Zhang, Yan; Xu, Yan
2017-01-01
Fermentation microbiota is specific microorganisms that generate different types of metabolites in many productions. In traditional solid-state fermentation, the structural composition and functional capacity of the core microbiota determine the quality and quantity of products. As a typical example of food fermentation, Chinese Maotai-flavor liquor production involves a complex of various microorganisms and a wide variety of metabolites. However, the microbial succession and functional shift of the core microbiota in this traditional food fermentation remain unclear. Here, high-throughput amplicons (16S rRNA gene amplicon sequencing and internal transcribed space amplicon sequencing) and metatranscriptomics sequencing technologies were combined to reveal the structure and function of the core microbiota in Chinese soy sauce aroma type liquor production. In addition, ultra-performance liquid chromatography and headspace-solid phase microextraction-gas chromatography-mass spectrometry were employed to provide qualitative and quantitative analysis of the major flavor metabolites. A total of 10 fungal and 11 bacterial genera were identified as the core microbiota. In addition, metatranscriptomic analysis revealed pyruvate metabolism in yeasts (genera Pichia, Schizosaccharomyces, Saccharomyces , and Zygosaccharomyces ) and lactic acid bacteria (genus Lactobacillus ) classified into two stages in the production of flavor components. Stage I involved high-level alcohol (ethanol) production, with the genus Schizosaccharomyces serving as the core functional microorganism. Stage II involved high-level acid (lactic acid and acetic acid) production, with the genus Lactobacillus serving as the core functional microorganism. The functional shift from the genus Schizosaccharomyces to the genus Lactobacillus drives flavor component conversion from alcohol (ethanol) to acid (lactic acid and acetic acid) in Chinese Maotai-flavor liquor production. Our findings provide insight into
MicroRNA repertoire for functional genome research in tilapia identified by deep sequencing.
Yan, Biao; Wang, Zhen-Hua; Zhu, Chang-Dong; Guo, Jin-Tao; Zhao, Jin-Liang
2014-08-01
The Nile tilapia (Oreochromis niloticus; Cichlidae) is an economically important species in aquaculture and occupies a prominent position in the aquaculture industry. MicroRNAs (miRNAs) are a class of noncoding RNAs that post-transcriptionally regulate gene expression involved in diverse biological and metabolic processes. To increase the repertoire of miRNAs characterized in tilapia, we used the Illumina/Solexa sequencing technology to sequence a small RNA library using pooled RNA sample isolated from the different developmental stages of tilapia. Bioinformatic analyses suggest that 197 conserved and 27 novel miRNAs are expressed in tilapia. Sequence alignments indicate that all tested miRNAs and miRNAs* are highly conserved across many species. In addition, we characterized the tissue expression patterns of five miRNAs using real-time quantitative PCR. We found that miR-1/206, miR-7/9, and miR-122 is abundantly expressed in muscle, brain, and liver, respectively, implying a potential role in the regulation of tissue differentiation or the maintenance of tissue identity. Overall, our results expand the number of tilapia miRNAs, and the discovery of miRNAs in tilapia genome contributes to a better understanding the role of miRNAs in regulating diverse biological processes.
Jenise M. Bauman; Carolyn H. Keiffer; Shiv. Hiremath
2012-01-01
This study evaluated the influence of planting sites on the establishment and ectomycorrhizal (ECM) colonization of American chestnut (Castanea denetata (Marsh.) Borkh.) on an abandoned coal mine in an Appalachian region of the United States. Root morphotyping and sequencing of the fungal internal transcribed spacer (ITS) region were used to identify...
Directory of Open Access Journals (Sweden)
Guido W. Grimm
2006-01-01
Full Text Available The multi-copy internal transcribed spacer (ITS region of nuclear ribosomal DNA is widely used to infer phylogenetic relationships among closely related taxa. Here we use maximum likelihood (ML and splits graph analyses to extract phylogenetic information from ~ 600 mostly cloned ITS sequences, representing 81 species and subspecies of Acer, and both species of its sister Dipteronia. Additional analyses compared sequence motifs in Acer and several hundred Anacardiaceae, Burseraceae, Meliaceae, Rutaceae, and Sapindaceae ITS sequences in GenBank. We also assessed the effects of using smaller data sets of consensus sequences with ambiguity coding (accounting for within-species variation instead of the full (partly redundant original sequences. Neighbor-nets and bipartition networks were used to visualize conflict among character state patterns. Species clusters observed in the trees and networks largely agree with morphology-based classifications; of de Jong’s (1994 16 sections, nine are supported in neighbor-net and bipartition networks, and ten by sequence motifs and the ML tree; of his 19 series, 14 are supported in networks, motifs, and the ML tree. Most nodes had higher bootstrap support with matrices of 105 or 40 consensus sequences than with the original matrix. Within-taxon ITS divergence did not differ between diploid and polyploid Acer, and there was little evidence of differentiated parental ITS haplotypes, suggesting that concerted evolution in Acer acts rapidly.
Grimm, Guido W.; Renner, Susanne S.; Stamatakis, Alexandros; Hemleben, Vera
2007-01-01
The multi-copy internal transcribed spacer (ITS) region of nuclear ribosomal DNA is widely used to infer phylogenetic relationships among closely related taxa. Here we use maximum likelihood (ML) and splits graph analyses to extract phylogenetic information from ~ 600 mostly cloned ITS sequences, representing 81 species and subspecies of Acer, and both species of its sister Dipteronia. Additional analyses compared sequence motifs in Acer and several hundred Anacardiaceae, Burseraceae, Meliaceae, Rutaceae, and Sapindaceae ITS sequences in GenBank. We also assessed the effects of using smaller data sets of consensus sequences with ambiguity coding (accounting for within-species variation) instead of the full (partly redundant) original sequences. Neighbor-nets and bipartition networks were used to visualize conflict among character state patterns. Species clusters observed in the trees and networks largely agree with morphology-based classifications; of de Jong’s (1994) 16 sections, nine are supported in neighbor-net and bipartition networks, and ten by sequence motifs and the ML tree; of his 19 series, 14 are supported in networks, motifs, and the ML tree. Most nodes had higher bootstrap support with matrices of 105 or 40 consensus sequences than with the original matrix. Within-taxon ITS divergence did not differ between diploid and polyploid Acer, and there was little evidence of differentiated parental ITS haplotypes, suggesting that concerted evolution in Acer acts rapidly. PMID:19455198
Energy Technology Data Exchange (ETDEWEB)
Tanzi, R.E.; Romano, D.M.; Crowley, A.C. [Harvard Medical School, Charlestown, MA (United States)] [and others
1994-09-01
Genetic studies of kindreds displaying evidence for familial AD (FAD) have led to the localization of gene defects responsible for this disorder on chromosomes 14, 19, and 21. A minor early-onset FAD gene on chromosome 21 has been identified to enode the amyloid precursor protein (APP), and the late-onset FAD susceptibility locus on chromosome 19 has been shown to be in linkage disequilibrium with the E4 allele of the APOE gene. Meanwhile, the locus responsible for the major form of early-onset FAD on chromosome 14q24 has not yet been identified. By recombinational analysis, we have refined the minimal candidate region containing the gene defect to approximately 3 megabases in 14q24. We will describe our laboratory`s progress on attempts to finely localize this locus, as well as test known candidate genes from this region for either inclusion in the minimal candidate region or the presence of pathogenic mutations. Candidate genes that have been tested so far include cFOS, heat shock protein 70 member (HSF2A), transforming growth factor beta (TGFB3), the trifunctional protein C1-THF synthase (MTHFD), bradykinin receptor (BR), and the E2k component of a-ketoglutarate dehydrogenase. HSP2A, E2k, MTHFD, and BR do not map to the current defined minimal candidate region; however, sequence analysis must be performed to confirm exclusion of these genes as true candidates. Meanwhile, no pathogenic mutations have yet been found in cFOS or TGFB3. We have also isolated a large number of novel transcribed sequences from the minimal candidate region in the form of {open_quotes}trapped exons{close_quotes} from cosmids identified by hybridization to select YAC clones; we are currently in the process of searching for pathogenic mutations in these exons in affected individuals from FAD families.
International Nuclear Information System (INIS)
Venema, J.; van Hoffen, A.; Karcagi, V.; Natarajan, A.T.; van Zeeland, A.A.; Mullenders, L.H.
1991-01-01
The authors have measured the removal of UV-induced pyrimidine dimers from DNA fragments of the adenosine deaminase (ADA) and dihydrofolate reductase (DHFR) genes in primary normal human and xeroderma pigmentosum complementation group C (XP-C) cells. Using strand-specific probes, we show that in normal cells, preferential repair of the 5' part of the ADA gene is due to the rapid and efficient repair of the transcribed strand. Within 8 h after irradiation with UV at 10 J m-2, 70% of the pyrimidine dimers in this strand are removed. The nontranscribed strand is repaired at a much slower rate, with 30% dimers removed after 8 h. Repair of the transcribed strand in XP-C cells occurs at a rate indistinguishable from that in normal cells, but the nontranscribed strand is not repaired significantly in these cells. Similar results were obtained for the DHFR gene. In the 3' part of the ADA gene, however, both normal and XP-C cells perform fast and efficient repair of either strand, which is likely to be caused by the presence of transcription units on both strands. The factor defective in XP-C cells is apparently involved in the processing of DNA damage in inactive parts of the genome, including nontranscribed strands of active genes. These findings have important implications for the understanding of the mechanism of UV-induced excision repair and mutagenesis in mammalian cells
Zhong, Chao; Sun, Suli; Li, Yinping; Duan, Canxing; Zhu, Zhendong
2018-03-01
A novel Phytophthora sojae resistance gene RpsHC18 was identified and finely mapped on soybean chromosome 3. Two NBS-LRR candidate genes were identified and two diagnostic markers of RpsHC18 were developed. Phytophthora root rot caused by Phytophthora sojae is a destructive disease of soybean. The most effective disease-control strategy is to deploy resistant cultivars carrying Phytophthora-resistant Rps genes. The soybean cultivar Huachun 18 has a broad and distinct resistance spectrum to 12 P. sojae isolates. Quantitative trait loci sequencing (QTL-seq), based on the whole-genome resequencing (WGRS) of two extreme resistant and susceptible phenotype bulks from an F 2:3 population, was performed, and one 767-kb genomic region with ΔSNP-index ≥ 0.9 on chromosome 3 was identified as the RpsHC18 candidate region in Huachun 18. The candidate region was reduced to a 146-kb region by fine mapping. Nonsynonymous SNP and haplotype analyses were carried out in the 146-kb region among ten soybean genotypes using WGRS. Four specific nonsynonymous SNPs were identified in two nucleotide-binding sites-leucine-rich repeat (NBS-LRR) genes, RpsHC18-NBL1 and RpsHC18-NBL2, which were considered to be the candidate genes. Finally, one specific SNP marker in each candidate gene was successfully developed using a tetra-primer ARMS-PCR assay, and the two markers were verified to be specific for RpsHC18 and to effectively distinguish other known Rps genes. In this study, we applied an integrated genomic-based strategy combining WGRS with traditional genetic mapping to identify RpsHC18 candidate genes and develop diagnostic markers. These results suggest that next-generation sequencing is a precise, rapid and cost-effective way to identify candidate genes and develop diagnostic markers, and it can accelerate Rps gene cloning and marker-assisted selection for breeding of P. sojae-resistant soybean cultivars.
LENUS (Irish Health Repository)
Weissenmayer, Barbara A
2011-01-01
Second generation sequencing has prompted a number of groups to re-interrogate the transcriptomes of several bacterial and archaeal species. One of the central findings has been the identification of complex networks of small non-coding RNAs that play central roles in transcriptional regulation in all growth conditions and for the pathogen\\'s interaction with and survival within host cells. Legionella pneumophila is a gram-negative facultative intracellular human pathogen with a distinct biphasic lifestyle. One of its primary environmental hosts in the free-living amoeba Acanthamoeba castellanii and its infection by L. pneumophila mimics that seen in human macrophages. Here we present analysis of strand specific sequencing of the transcriptional response of L. pneumophila during exponential and post-exponential broth growth and during the replicative and transmissive phase of infection inside A. castellanii. We extend previous microarray based studies as well as uncovering evidence of a complex regulatory architecture underpinned by numerous non-coding RNAs. Over seventy new non-coding RNAs could be identified; many of them appear to be strain specific and in configurations not previously reported. We discover a family of non-coding RNAs preferentially expressed during infection conditions and identify a second copy of 6S RNA in L. pneumophila. We show that the newly discovered putative 6S RNA as well as a number of other non-coding RNAs show evidence for antisense transcription. The nature and extent of the non-coding RNAs and their expression patterns suggests that these may well play central roles in the regulation of Legionella spp. specific traits and offer clues as to how L. pneumophila adapts to its intracellular niche. The expression profiles outlined in the study have been deposited into Genbank\\'s Gene Expression Omnibus (GEO) database under the series accession GSE27232.
Directory of Open Access Journals (Sweden)
Biaoyang Lin
Full Text Available BACKGROUND: A comprehensive network-based understanding of molecular pathways abnormally altered in glioblastoma multiforme (GBM is essential for developing effective therapeutic approaches for this deadly disease. METHODOLOGY/PRINCIPAL FINDINGS: Applying a next generation sequencing technology, massively parallel signature sequencing (MPSS, we identified a total of 4535 genes that are differentially expressed between normal brain and GBM tissue. The expression changes of three up-regulated genes, CHI3L1, CHI3L2, and FOXM1, and two down-regulated genes, neurogranin and L1CAM, were confirmed by quantitative PCR. Pathway analysis revealed that TGF- beta pathway related genes were significantly up-regulated in GBM tumor samples. An integrative pathway analysis of the TGF beta signaling network identified two alternative TGF-beta signaling pathways mediated by SOX4 (sex determining region Y-box 4 and TGFBI (Transforming growth factor beta induced. Quantitative RT-PCR and immunohistochemistry staining demonstrated that SOX4 and TGFBI expression is elevated in GBM tissues compared with normal brain tissues at both the RNA and protein levels. In vitro functional studies confirmed that TGFBI and SOX4 expression is increased by TGF-beta stimulation and decreased by a specific inhibitor of TGF-beta receptor 1 kinase. CONCLUSIONS/SIGNIFICANCE: Our MPSS database for GBM and normal brain tissues provides a useful resource for the scientific community. The identification of non-SMAD mediated TGF-beta signaling pathways acting through SOX4 and TGFBI (GENE ID:7045 in GBM indicates that these alternative pathways should be considered, in addition to the canonical SMAD mediated pathway, in the development of new therapeutic strategies targeting TGF-beta signaling in GBM. Finally, the construction of an extended TGF-beta signaling network with overlaid gene expression changes between GBM and normal brain extends our understanding of the biology of GBM.
Whole-exome sequencing and high throughput genotyping identified KCNJ11 as the thirteenth MODY gene.
Bonnefond, Amélie; Philippe, Julien; Durand, Emmanuelle; Dechaume, Aurélie; Huyvaert, Marlène; Montagne, Louise; Marre, Michel; Balkau, Beverley; Fajardy, Isabelle; Vambergue, Anne; Vatin, Vincent; Delplanque, Jérôme; Le Guilcher, David; De Graeve, Franck; Lecoeur, Cécile; Sand, Olivier; Vaxillaire, Martine; Froguel, Philippe
2012-01-01
Maturity-onset of the young (MODY) is a clinically heterogeneous form of diabetes characterized by an autosomal-dominant mode of inheritance, an onset before the age of 25 years, and a primary defect in the pancreatic beta-cell function. Approximately 30% of MODY families remain genetically unexplained (MODY-X). Here, we aimed to use whole-exome sequencing (WES) in a four-generation MODY-X family to identify a new susceptibility gene for MODY. WES (Agilent-SureSelect capture/Illumina-GAIIx sequencing) was performed in three affected and one non-affected relatives in the MODY-X family. We then performed a high-throughput multiplex genotyping (Illumina-GoldenGate assay) of the putative causal mutations in the whole family and in 406 controls. A linkage analysis was also carried out. By focusing on variants of interest (i.e. gains of stop codon, frameshift, non-synonymous and splice-site variants not reported in dbSNP130) present in the three affected relatives and not present in the control, we found 69 mutations. However, as WES was not uniform between samples, a total of 324 mutations had to be assessed in the whole family and in controls. Only one mutation (p.Glu227Lys in KCNJ11) co-segregated with diabetes in the family (with a LOD-score of 3.68). No KCNJ11 mutation was found in 25 other MODY-X unrelated subjects. Beyond neonatal diabetes mellitus (NDM), KCNJ11 is also a MODY gene ('MODY13'), confirming the wide spectrum of diabetes related phenotypes due to mutations in NDM genes (i.e. KCNJ11, ABCC8 and INS). Therefore, the molecular diagnosis of MODY should include KCNJ11 as affected carriers can be ideally treated with oral sulfonylureas.
Whole-exome sequencing and high throughput genotyping identified KCNJ11 as the thirteenth MODY gene.
Directory of Open Access Journals (Sweden)
Amélie Bonnefond
Full Text Available BACKGROUND: Maturity-onset of the young (MODY is a clinically heterogeneous form of diabetes characterized by an autosomal-dominant mode of inheritance, an onset before the age of 25 years, and a primary defect in the pancreatic beta-cell function. Approximately 30% of MODY families remain genetically unexplained (MODY-X. Here, we aimed to use whole-exome sequencing (WES in a four-generation MODY-X family to identify a new susceptibility gene for MODY. METHODOLOGY: WES (Agilent-SureSelect capture/Illumina-GAIIx sequencing was performed in three affected and one non-affected relatives in the MODY-X family. We then performed a high-throughput multiplex genotyping (Illumina-GoldenGate assay of the putative causal mutations in the whole family and in 406 controls. A linkage analysis was also carried out. PRINCIPAL FINDINGS: By focusing on variants of interest (i.e. gains of stop codon, frameshift, non-synonymous and splice-site variants not reported in dbSNP130 present in the three affected relatives and not present in the control, we found 69 mutations. However, as WES was not uniform between samples, a total of 324 mutations had to be assessed in the whole family and in controls. Only one mutation (p.Glu227Lys in KCNJ11 co-segregated with diabetes in the family (with a LOD-score of 3.68. No KCNJ11 mutation was found in 25 other MODY-X unrelated subjects. CONCLUSIONS/SIGNIFICANCE: Beyond neonatal diabetes mellitus (NDM, KCNJ11 is also a MODY gene ('MODY13', confirming the wide spectrum of diabetes related phenotypes due to mutations in NDM genes (i.e. KCNJ11, ABCC8 and INS. Therefore, the molecular diagnosis of MODY should include KCNJ11 as affected carriers can be ideally treated with oral sulfonylureas.
Wang, Xia; Wang, Hui; Cao, Ming; Li, Zhe; Chen, Xianfeng; Patenia, Claire; Gore, Athurva; Abboud, Emad B.; Al-Rajhi, Ali A.; Lewis, Richard A.; Lupski, James R.; Mardon, Graeme; Zhang, Kun; Muzny, Donna; Gibbs, Richard A.
2011-01-01
It has been well documented that mutations in the same retinal disease gene can result in different clinical phenotypes due to difference in the mutant allele and/or genetic background. To evaluate this, a set of consanguineous patient families with Leber congenital amaurosis (LCA) that do not carry mutations in known LCA disease genes was characterized through homozygosity mapping followed by targeted exon/whole-exome sequencing to identify genetic variations. Among these families, a total o...
Gao, Wei; Shi, Wei; Chen, Chang-hui; Wen, De-nian; Tian, Jin; Yao, Kai-hu
2016-10-20
There were some limitation in the current interpretation about the penicillin resistance mechanism of clinical Streptococcus pneumoniae isolates at the strain level. To explore the possibilities of studying the mechanism based on the sequence types (ST) of this bacteria, 488 isolates collected in Beijing from 1997-2014 and 88 isolates collected in Youyang County, Chongqing and Zhongjiang County, Sichuan in 2015 were analyzed by penicillin minimum inhibitory concentration (MIC) distribution and annual distribution. The results showed that the penicillin MICs of the all isolates covering by the given ST in Beijing have a defined range, either penicillin MIC penicillin MICs in the first few years after it was identified. The penicillin MIC of isolates identified as common STs and collected in Youyang County, Chongqing and Sichuan Zhongjiang County, including the ST271, ST320 and ST81, was around 0.25~2 mg/L (≥0.25 mg/L). Our study revealed the epidemiological distribution of penicillin MICs of the given STs determined in clinical S. pneumoniae isolates, suggesting that it is reasonable to research the penicillin resistance mechanism based on the STs of this bacteria.
Bousfiha, Amale; Bakhchane, Amina; Charoute, Hicham; Detsouli, Mustapha; Rouba, Hassan; Charif, Majida; Lenaers, Guy; Barakat, Abdelhamid
2017-10-01
In the present work, we identified two novel compound heterozygote mutations in the GPR98 (G protein-coupled receptor 98) gene causing Usher syndrome. Whole-exome sequencing was performed to study the genetic causes of Usher syndrome in a Moroccan family with three affected siblings. We identify two novel compound heterozygote mutations (c.1054C > A, c.16544delT) in the GPR98 gene in the three affected siblings carrying post-linguale bilateral moderate hearing loss with normal vestibular functions and before installing visual disturbances. This is the first time that mutations in the GPR98 gene are described in the Moroccan deaf patients.
PACCMIT/PACCMIT-CDS: identifying microRNA targets in 3' UTRs and coding sequences.
Šulc, Miroslav; Marín, Ray M; Robins, Harlan S; Vaníček, Jiří
2015-07-01
The purpose of the proposed web server, publicly available at http://paccmit.epfl.ch, is to provide a user-friendly interface to two algorithms for predicting messenger RNA (mRNA) molecules regulated by microRNAs: (i) PACCMIT (Prediction of ACcessible and/or Conserved MIcroRNA Targets), which identifies primarily mRNA transcripts targeted in their 3' untranslated regions (3' UTRs), and (ii) PACCMIT-CDS, designed to find mRNAs targeted within their coding sequences (CDSs). While PACCMIT belongs among the accurate algorithms for predicting conserved microRNA targets in the 3' UTRs, the main contribution of the web server is 2-fold: PACCMIT provides an accurate tool for predicting targets also of weakly conserved or non-conserved microRNAs, whereas PACCMIT-CDS addresses the lack of similar portals adapted specifically for targets in CDS. The web server asks the user for microRNAs and mRNAs to be analyzed, accesses the precomputed P-values for all microRNA-mRNA pairs from a database for all mRNAs and microRNAs in a given species, ranks the predicted microRNA-mRNA pairs, evaluates their significance according to the false discovery rate and finally displays the predictions in a tabular form. The results are also available for download in several standard formats. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
A recently identified ovine Babesia in China: serology and sero-epidemiology.
Guan, Guiquan; Ma, Miling; Liu, Aihong; Ren, Qiaoyun; Wang, Jinming; Yang, Jifei; Li, Anyan; Liu, Zhijie; Du, Pengfei; Li, Youquan; Liu, Qing; Zhu, Hai; Yin, Hong; Luo, Jianxun
2012-12-01
Babesia sp. in Xinjiang, transmitted by Hyalomma, is a large Babesia that is infective for small ruminants, but it has almost no pathogenicity in healthy sheep. On the basis of the sequences of the 18S rRNA and internal transcribed spacer (ITS) genes, morphological characteristics, vector tick species and pathogenicity it was identified recently as a novel Babesia species. In the present study, an enzyme-linked immunosorbent assay (ELISA) was developed using soluble merozoite antigens of Babesia sp. in Xinjiang (BXJMA) derived from in vitro culture. When the positive threshold was chosen as 24.65% of the specific mean antibody rate, the specificity and sensitivity were both 97.3%. There was no cross-reaction between BXJMA and positive sera from sheep infected with other Chinese ovine piroplasms or Anaplasma ovis in the ELISA and western blotting. Specific antibodies against Babesia sp. in Xinjiang could be detected 2 weeks post infection and a high level of antibodies persisted for more than 12 weeks in experimentally infected sheep. The ELISA was tested on 3857 sera collected from small ruminants in 50 prefectures of 22 provinces to evaluate the sero-epidemiology of Babesia sp. in Xinjiang infection, and the average positive rate was 31.66%. These data provide that the developed ELISA is a powerful tool for the sero-diagnosis of Babesia sp. in Xinjiang and confirm that it is a novel species. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.
DNA sequence modeling based on context trees
Kusters, C.J.; Ignatenko, T.; Roland, J.; Horlin, F.
2015-01-01
Genomic sequences contain instructions for protein and cell production. Therefore understanding and identification of biologically and functionally meaningful patterns in DNA sequences is of paramount importance. Modeling of DNA sequences in its turn can help to better understand and identify such
MacKellar, Drew C; Vaughan, Ashley M; Aly, Ahmed S I; DeLeon, Sasha; Kappe, Stefan H I
2011-11-01
The early transcribed membrane proteins (ETRAMPs) are a family of small, highly charged transmembrane proteins unique to malaria parasites. Some members of the ETRAMP family have been localized to the parasitophorous vacuole membrane that separates the intracellular parasite from the host cell and thus presumably have a role in host-parasite interactions. Although it was previously shown that two ETRAMPs are critical for rodent malaria parasite liver-stage development, the importance of most ETRAMPs during the parasite life cycle remains unknown. Here, we comprehensively identify nine new etramps in the genome of the rodent malaria parasite Plasmodium yoelii, and elucidate their conservation in other malaria parasites. etramp expression profiles are diverse throughout the parasite life cycle as measured by RT-PCR. Epitope tagging of two ETRAMPs demonstrates protein expression in blood and liver stages, and reveals differences in both their timing of expression and their subcellular localization. Gene targeting studies of each of the nine uncharacterized etramps show that two are refractory to deletion and thus likely essential for blood-stage replication. Seven etramps are not essential for any life cycle stage. Systematic characterization of the members of the ETRAMP family reveals the diversity in importance of each family member at the interface between host and parasite throughout the developmental cycle of the malaria parasite. © 2011 Blackwell Publishing Ltd.
High-Throughput Sequencing of Microbial Community Diversity and Dynamics during Douchi Fermentation
Tu, Zong-cai; Wang, Xiao-lan
2016-01-01
Douchi is a type of Chinese traditional fermented food that is an important source of protein and is used in flavouring ingredients. The end product is affected by the microbial community present during fermentation, but exactly how microbes influence the fermentation process remains poorly understood. We used an Illumina MiSeq approach to investigate bacterial and fungal community diversity during both douchi-koji making and fermentation. A total of 181,443 high quality bacterial 16S rRNA sequences and 221,059 high quality fungal internal transcribed spacer reads were used for taxonomic classification, revealing eight bacterial and three fungal phyla. Firmicutes, Actinobacteria and Proteobacteria were the dominant bacterial phyla, while Ascomycota and Zygomycota were the dominant fungal phyla. At the genus level, Staphylococcus and Weissella were the dominant bacteria, while Aspergillus and Lichtheimia were the dominant fungi. Principal coordinate analysis showed structural separation between the composition of bacteria in koji making and fermentation. However, multivariate analysis of variance based on unweighted UniFrac distances did identify distinct differences (p fermentation. This is the first investigation to integrate douchi fermentation and koji making and fermentation processes through this technological approach. The results provide insight into the microbiome of the douchi fermentation process, and reveal a structural separation that may be stratified by the environment during the production of this traditional fermented food. PMID:27992473
International Nuclear Information System (INIS)
Belinsky, Martin G.; Rink, Lori; Cai, Kathy Q.; Capuzzi, Stephen J.; Hoang, Yen; Chien, Jeremy; Godwin, Andrew K.; Mehren, Margaret von
2015-01-01
Approximately 10–15 % of gastrointestinal stromal tumors (GISTs) lack gain of function mutations in the KIT and platelet-derived growth factor receptor alpha (PDGFRA) genes. An alternate mechanism of oncogenesis through loss of function of the succinate-dehydrogenase (SDH) enzyme complex has been identified for a subset of these “wild type” GISTs. Paired tumor and normal DNA from an SDH-intact wild-type GIST case was subjected to whole exome sequencing to identify the pathogenic mechanism(s) in this tumor. Selected findings were further investigated in panels of GIST tumors through Sanger DNA sequencing, quantitative real-time PCR, and immunohistochemical approaches. A hemizygous frameshift mutation (p.His2261Leufs*4), in the neurofibromin 1 (NF1) gene was identified in the patient’s GIST; however, no germline NF1 mutation was found. A somatic frameshift mutation (p.Lys54Argfs*31) in the MYC associated factor X (MAX) gene was also identified. Immunohistochemical analysis for MAX on a large panel of GISTs identified loss of MAX expression in the MAX-mutated GIST and in a subset of mainly KIT-mutated tumors. This study suggests that inactivating NF1 mutations outside the context of neurofibromatosis may be the oncogenic mechanism for a subset of sporadic GIST. In addition, loss of function mutation of the MAX gene was identified for the first time in GIST, and a broader role for MAX in GIST progression was suggested. The online version of this article (doi:10.1186/s12885-015-1872-y) contains supplementary material, which is available to authorized users
Iaria, Domenico; Chiappetta, Adriana; Muzzalupo, Innocenzo
2016-01-01
In olive (Olea europaea L.), the processes controlling self-incompatibility are still unclear and the molecular basis underlying this process are still not fully characterized. In order to determine compatibility relationships, using next-generation sequencing techniques and a de novo transcriptome assembly strategy, we show that pollen tubes from different olive plants, grown in vitro in a medium containing its own pistil and in combination pollen/pistil from self-sterile and self-fertile cultivars, have a distinct gene expression profile and many of the differentially expressed sequences between the samples fall within gene families involved in the development of the pollen tube, such as lipase, carboxylesterase, pectinesterase, pectin methylesterase, and callose synthase. Moreover, different genes involved in signal transduction, transcription, and growth are overrepresented. The analysis also allowed us to identify members in actin and actin depolymerization factor and fibrin gene family and member of the Ca(2+) binding gene family related to the development and polarization of pollen apical tip. The whole transcriptomic analysis, through the identification of the differentially expressed transcripts set and an extended functional annotation analysis, will lead to a better understanding of the mechanisms of pollen germination and pollen tube growth in the olive.
Energy Technology Data Exchange (ETDEWEB)
Sharpe, Richard A. [European Centre for Environment and Human Health, University of Exeter Medical School, Truro TR1 3HD (United Kingdom); Cocq, Kate Le [Rothamsted Research, North Wyke, Okehampton EX20 2SB (United Kingdom); Nikolaou, Vasilis [University of Exeter Medical School, The Veysey Building, Salmon Pool Lane, Exeter EX2 4SG (United Kingdom); Osborne, Nicholas J. [European Centre for Environment and Human Health, University of Exeter Medical School, Truro TR1 3HD (United Kingdom); Clinical Pharmacology and Toxicology Research Group, Discipline of Pharmacology, Sydney Medical School, The University of Sydney, NSW (Australia); Thornton, Christopher R., E-mail: c.r.thornton@exeter.ac.uk [Biosciences, College of Life and Environmental Sciences, University of Exeter, Exeter EX4 4QD (United Kingdom)
2016-01-15
The aim of this study was to determine the accuracy of monoclonal antibodies (mAbs) in identifying culturable allergenic fungi present in visible mould growth in energy efficient homes, and to identify risk factors for exposure to these known allergenic fungi. Swabs were taken from fungal contaminated surfaces and culturable yeasts and moulds isolated by using mycological culture. Soluble antigens from cultures were tested by ELISA using mAbs specific to the culturable allergenic fungi Aspergillus and Penicillium spp., Ulocladium, Alternaria, and Epicoccum spp., Cladosporium spp., Fusarium spp., and Trichoderma spp. Diagnostic accuracies of the ELISA tests were determined by sequencing of the internally transcribed spacer 1 (ITS1)-5.8S-ITS2-encoding regions of recovered fungi following ELISA. There was 100% concordance between the two methods, with ELISAs providing genus-level identity and ITS sequencing providing species-level identities (210 out of 210 tested). Species of Aspergillus/Penicillium, Cladosporium, Ulocladium/Alternaria/Epicoccum, Fusarium and Trichoderma were detected in 82% of the samples. The presence of condensation was associated with an increased risk of surfaces being contaminated by Aspergillus/Penicillium spp. and Cladosporium spp., whereas moisture within the building fabric (water ingress/rising damp) was only associated with increased risk of Aspergillus/Penicillium spp. Property type and energy efficiency levels were found to moderate the risk of indoor surfaces becoming contaminated with Aspergillus/Penicillium and Cladosporium which in turn was modified by the presence of condensation, water ingress and rising damp, consistent with previous literature. - Highlights: • Monoclonal antibodies were used to track culturable allergenic moulds in homes. • Allergenic moulds were recovered from 82% of swabs from contaminated surfaces. • The mAbs were highly specific with 100% agreement to PCR of recovered fungi. • Improvements to energy
International Nuclear Information System (INIS)
Sharpe, Richard A.; Cocq, Kate Le; Nikolaou, Vasilis; Osborne, Nicholas J.; Thornton, Christopher R.
2016-01-01
The aim of this study was to determine the accuracy of monoclonal antibodies (mAbs) in identifying culturable allergenic fungi present in visible mould growth in energy efficient homes, and to identify risk factors for exposure to these known allergenic fungi. Swabs were taken from fungal contaminated surfaces and culturable yeasts and moulds isolated by using mycological culture. Soluble antigens from cultures were tested by ELISA using mAbs specific to the culturable allergenic fungi Aspergillus and Penicillium spp., Ulocladium, Alternaria, and Epicoccum spp., Cladosporium spp., Fusarium spp., and Trichoderma spp. Diagnostic accuracies of the ELISA tests were determined by sequencing of the internally transcribed spacer 1 (ITS1)-5.8S-ITS2-encoding regions of recovered fungi following ELISA. There was 100% concordance between the two methods, with ELISAs providing genus-level identity and ITS sequencing providing species-level identities (210 out of 210 tested). Species of Aspergillus/Penicillium, Cladosporium, Ulocladium/Alternaria/Epicoccum, Fusarium and Trichoderma were detected in 82% of the samples. The presence of condensation was associated with an increased risk of surfaces being contaminated by Aspergillus/Penicillium spp. and Cladosporium spp., whereas moisture within the building fabric (water ingress/rising damp) was only associated with increased risk of Aspergillus/Penicillium spp. Property type and energy efficiency levels were found to moderate the risk of indoor surfaces becoming contaminated with Aspergillus/Penicillium and Cladosporium which in turn was modified by the presence of condensation, water ingress and rising damp, consistent with previous literature. - Highlights: • Monoclonal antibodies were used to track culturable allergenic moulds in homes. • Allergenic moulds were recovered from 82% of swabs from contaminated surfaces. • The mAbs were highly specific with 100% agreement to PCR of recovered fungi. • Improvements to energy
Cribb, Thomas H; Crespo-Picazo, Jose L; Cutmore, Scott C; Stacy, Brian A; Chapman, Phoebe A; García-Párraga, Daniel
2017-01-01
Blood flukes of the family Spirorchiidae are significant pathogens of both free-ranging and captive marine turtles. Despite a significant proportion of marine turtle mortality being attributable to spirorchiid infections, details of their life cycles remain almost entirely unknown. Here we report on the molecular elucidation of the complete life cycle of a marine spirorchiid, identified as Amphiorchis sp., infecting vermetid gastropods and captive hatched neonate Caretta caretta in the Oceanogràfic Aquarium, in Valencia, Spain. Specimens of a vermetid gastropod, Thylaeodus cf. rugulosus (Monterosato, 1878), collected from the aquarium filtration system housing diseased C. caretta, were infected with sporocysts and cercariae consistent with the family Spirorchiidae. We generated rDNA sequence data [internal transcribed spacer 2 (ITS2) and partial 28S rDNA] from infections from the vermetid which were identical to sequences generated from eggs from the serosa of the intestine of neonate C. caretta, and an adult spirorchiid from the liver of a C. caretta from Florida, USA. Given the reliability of these markers in the delineation of trematode species, we consider all three stages to represent the same species and tentatively identify it as a species of Amphiorchis Price, 1934. The source of infection at the Oceanogràfic Foundation Rehabilitation Centre, Valencia, Spain, is inferred to be an adult C. caretta from the western Mediterranean being rehabilitated in the same facility. Phylogenetic analysis suggests that this Amphiorchis sp. is closely related to other spirorchiids of marine turtles (species of Carettacola Manter & Larson, 1950, Hapalotrema Looss, 1899 and Learedius Price, 1934). We discuss implications of the present findings for the control of spirorchiidiasis in captivity, for the better understanding of epidemiology in wild individuals, and the elucidation of further life cycles. Copyright © 2016 Australian Society for Parasitology. Published by
Exome sequencing identifies highly recurrent MED12 somatic mutations in breast fibroadenoma.
Lim, Weng Khong; Ong, Choon Kiat; Tan, Jing; Thike, Aye Aye; Ng, Cedric Chuan Young; Rajasegaran, Vikneswari; Myint, Swe Swe; Nagarajan, Sanjanaa; Nasir, Nur Diyana Md; McPherson, John R; Cutcutache, Ioana; Poore, Gregory; Tay, Su Ting; Ooi, Wei Siong; Tan, Veronique Kiak Mien; Hartman, Mikael; Ong, Kong Wee; Tan, Benita K T; Rozen, Steven G; Tan, Puay Hoon; Tan, Patrick; Teh, Bin Tean
2014-08-01
Fibroadenomas are the most common breast tumors in women under 30 (refs. 1,2). Exome sequencing of eight fibroadenomas with matching whole-blood samples revealed recurrent somatic mutations solely in MED12, which encodes a Mediator complex subunit. Targeted sequencing of an additional 90 fibroadenomas confirmed highly frequent MED12 exon 2 mutations (58/98, 59%) that are probably somatic, with 71% of mutations occurring in codon 44. Using laser capture microdissection, we show that MED12 fibroadenoma mutations are present in stromal but not epithelial mammary cells. Expression profiling of MED12-mutated and wild-type fibroadenomas revealed that MED12 mutations are associated with dysregulated estrogen signaling and extracellular matrix organization. The fibroadenoma MED12 mutation spectrum is nearly identical to that of previously reported MED12 lesions in uterine leiomyoma but not those of other tumors. Benign tumors of the breast and uterus, both of which are key target tissues of estrogen, may thus share a common genetic basis underpinned by highly frequent and specific MED12 mutations.
Population genetic analysis of Enterocytozoon bieneusi in humans.
Li, Wei; Cama, Vitaliano; Feng, Yaoyu; Gilman, Robert H; Bern, Caryn; Zhang, Xichen; Xiao, Lihua
2012-01-01
Genotyping based on sequence analysis of the ribosomal internal transcribed spacer has revealed significant genetic diversity in Enterocytozoonbieneusi. Thus far, the population genetics of E. bieneusi and its significance in the epidemiology of microsporidiosis have not been examined. In this study, a multilocus sequence typing of E. bieneusi in AIDS patients in Lima, Peru was conducted, using 72 specimens previously genotyped as A, D, IV, EbpC, WL11, Peru7, Peru8, Peru10 and Peru11 at the internal transcribed spacer locus. Altogether, 39 multilocus genotypes were identified among the 72 specimens. The observation of strong intragenic linkage disequilibria and limited genetic recombination among markers were indicative of an overall clonal population structure of E. bieneusi. Measures of pair-wise intergenic linkage disequilibria and a standardised index of association (IAS) based on allelic profile data further supported this conclusion. Both sequence-based and allelic profile-based phylogenetic analyses showed the presence of two genetically isolated groups in the study population, one (group 1) containing isolates of the anthroponotic internal transcribed spacer genotype A, and the other (group 2) containing isolates of multiple internal transcribed spacer genotypes (mainly genotypes D and IV) with zoonotic potential. The measurement of linkage disequilibria and recombination indicated group 2 had a clonal population structure, whereas group 1 had an epidemic population structure. The formation of the two sub-populations was confirmed by STRUCTURE and Wright's fixation index (FST) analyses. The data highlight the power of MLST in understanding the epidemiology of E. bieneusi. Published by Elsevier Ltd.
Li, Zhongshan; Liu, Zhenwei; Jiang, Yi; Chen, Denghui; Ran, Xia; Sun, Zhong Sheng; Wu, Jinyu
2017-01-01
Exome sequencing has been widely used to identify the genetic variants underlying human genetic disorders for clinical diagnoses, but the identification of pathogenic sequence variants among the huge amounts of benign ones is complicated and challenging. Here, we describe a new Web server named mirVAFC for pathogenic sequence variants prioritizations from clinical exome sequencing (CES) variant data of single individual or family. The mirVAFC is able to comprehensively annotate sequence variants, filter out most irrelevant variants using custom criteria, classify variants into different categories as for estimated pathogenicity, and lastly provide pathogenic variants prioritizations based on classifications and mutation effects. Case studies using different types of datasets for different diseases from publication and our in-house data have revealed that mirVAFC can efficiently identify the right pathogenic candidates as in original work in each case. Overall, the Web server mirVAFC is specifically developed for pathogenic sequence variant identifications from family-based CES variants using classification-based prioritizations. The mirVAFC Web server is freely accessible at https://www.wzgenomics.cn/mirVAFC/. © 2016 WILEY PERIODICALS, INC.
DEFF Research Database (Denmark)
Karlskov-Mortensen, Peter; Hu, Z.L.; Gorodkin, Jan
2007-01-01
the human genome (BLAST cut-off threshold = 1 x 10-5). All microsatellite sequences placed on the comparative map are accessible at http://www.animalgenome.org/QTLdb/pig.html . These sequences increase the number of identified microsatellites in the porcine genome by several orders of magnitude...
Directory of Open Access Journals (Sweden)
Kari A Dilley
Full Text Available Ebola virus and Marburg virus are members of the Filovirdae family and causative agents of hemorrhagic fever with high fatality rates in humans. Filovirus virulence is partially attributed to the VP35 protein, a well-characterized inhibitor of the RIG-I-like receptor pathway that triggers the antiviral interferon (IFN response. Prior work demonstrates the ability of VP35 to block potent RIG-I activators, such as Sendai virus (SeV, and this IFN-antagonist activity is directly correlated with its ability to bind RNA. Several structural studies demonstrate that VP35 binds short synthetic dsRNAs; yet, there are no data that identify viral immunostimulatory RNAs (isRNA or host RNAs bound to VP35 in cells. Utilizing a SeV infection model, we demonstrate that both viral isRNA and host RNAs are bound to Ebola and Marburg VP35s in cells. By deep sequencing the purified VP35-bound RNA, we identified the SeV copy-back defective interfering (DI RNA, previously identified as a robust RIG-I activator, as the isRNA bound by multiple filovirus VP35 proteins, including the VP35 protein from the West African outbreak strain (Makona EBOV. Moreover, RNAs isolated from a VP35 RNA-binding mutant were not immunostimulatory and did not include the SeV DI RNA. Strikingly, an analysis of host RNAs bound by wild-type, but not mutant, VP35 revealed that select host RNAs are preferentially bound by VP35 in cell culture. Taken together, these data support a model in which VP35 sequesters isRNA in virus-infected cells to avert RIG-I like receptor (RLR activation.
Dilley, Kari A; Voorhies, Alexander A; Luthra, Priya; Puri, Vinita; Stockwell, Timothy B; Lorenzi, Hernan; Basler, Christopher F; Shabman, Reed S
2017-01-01
Ebola virus and Marburg virus are members of the Filovirdae family and causative agents of hemorrhagic fever with high fatality rates in humans. Filovirus virulence is partially attributed to the VP35 protein, a well-characterized inhibitor of the RIG-I-like receptor pathway that triggers the antiviral interferon (IFN) response. Prior work demonstrates the ability of VP35 to block potent RIG-I activators, such as Sendai virus (SeV), and this IFN-antagonist activity is directly correlated with its ability to bind RNA. Several structural studies demonstrate that VP35 binds short synthetic dsRNAs; yet, there are no data that identify viral immunostimulatory RNAs (isRNA) or host RNAs bound to VP35 in cells. Utilizing a SeV infection model, we demonstrate that both viral isRNA and host RNAs are bound to Ebola and Marburg VP35s in cells. By deep sequencing the purified VP35-bound RNA, we identified the SeV copy-back defective interfering (DI) RNA, previously identified as a robust RIG-I activator, as the isRNA bound by multiple filovirus VP35 proteins, including the VP35 protein from the West African outbreak strain (Makona EBOV). Moreover, RNAs isolated from a VP35 RNA-binding mutant were not immunostimulatory and did not include the SeV DI RNA. Strikingly, an analysis of host RNAs bound by wild-type, but not mutant, VP35 revealed that select host RNAs are preferentially bound by VP35 in cell culture. Taken together, these data support a model in which VP35 sequesters isRNA in virus-infected cells to avert RIG-I like receptor (RLR) activation.
Yan, Hong-Bin; Lou, Zhong-Zi; Li, Li; Brindley, Paul J; Zheng, Yadong; Luo, Xuenong; Hou, Junling; Guo, Aijiang; Jia, Wan-Zhong; Cai, Xuepeng
2014-06-04
Cysticercosis remains a major neglected tropical disease of humanity in many regions, especially in sub-Saharan Africa, Central America and elsewhere. Owing to the emerging drug resistance and the inability of current drugs to prevent re-infection, identification of novel vaccines and chemotherapeutic agents against Taenia solium and related helminth pathogens is a public health priority. The T. solium genome and the predicted proteome were reported recently, providing a wealth of information from which new interventional targets might be identified. In order to characterize and classify the entire repertoire of protease-encoding genes of T. solium, which act fundamental biological roles in all life processes, we analyzed the predicted proteins of this cestode through a combination of bioinformatics tools. Functional annotation was performed to yield insights into the signaling processes relevant to the complex developmental cycle of this tapeworm and to highlight a suite of the proteases as potential intervention targets. Within the genome of this helminth parasite, we identified 200 open reading frames encoding proteases from five clans, which correspond to 1.68% of the 11,902 protein-encoding genes predicted to be present in its genome. These proteases include calpains, cytosolic, mitochondrial signal peptidases, ubiquitylation related proteins, and others. Many not only show significant similarity to proteases in the Conserved Domain Database but have conserved active sites and catalytic domains. KEGG Automatic Annotation Server (KAAS) analysis indicated that ~60% of these proteases share strong sequence identities with proteins of the KEGG database, which are involved in human disease, metabolic pathways, genetic information processes, cellular processes, environmental information processes and organismal systems. Also, we identified signal peptides and transmembrane helices through comparative analysis with classes of important regulatory proteases
Directory of Open Access Journals (Sweden)
Marta Brozynska
Full Text Available Direct sequencing of total plant DNA using next generation sequencing technologies generates a whole chloroplast genome sequence that has the potential to provide a barcode for use in plant and food identification. Advances in DNA sequencing platforms may make this an attractive approach for routine plant identification. The HiSeq (Illumina and Ion Torrent (Life Technology sequencing platforms were used to sequence total DNA from rice to identify polymorphisms in the whole chloroplast genome sequence of a wild rice plant relative to cultivated rice (cv. Nipponbare. Consensus chloroplast sequences were produced by mapping sequence reads to the reference rice chloroplast genome or by de novo assembly and mapping of the resulting contigs to the reference sequence. A total of 122 polymorphisms (SNPs and indels between the wild and cultivated rice chloroplasts were predicted by these different sequencing and analysis methods. Of these, a total of 102 polymorphisms including 90 SNPs were predicted by both platforms. Indels were more variable with different sequencing methods, with almost all discrepancies found in homopolymers. The Ion Torrent platform gave no apparent false SNP but was less reliable for indels. The methods should be suitable for routine barcoding using appropriate combinations of sequencing platform and data analysis.
Diagnostics of Primary Immunodeficiencies through Next Generation Sequencing
Directory of Open Access Journals (Sweden)
Vera Gallo
2016-11-01
Full Text Available Background: Recently, a growing number of novel genetic defects underlying primary immunodeficiencies (PID have been identified, increasing the number of PID up to more than 250 well-defined forms. Next-generation sequencing (NGS technologies and proper filtering strategies greatly contributed to this rapid evolution, providing the possibility to rapidly and simultaneously analyze large numbers of genes or the whole exome. Objective: To evaluate the role of targeted next-generation sequencing and whole exome sequencing in the diagnosis of a case series, characterized by complex or atypical clinical features suggesting a PID, difficult to diagnose using the current diagnostic procedures.Methods: We retrospectively analyzed genetic variants identified through targeted next-generation sequencing or whole exome sequencing in 45 patients with complex PID of unknown etiology. Results: 40 variants were identified using targeted next-generation sequencing, while 5 were identified using whole exome sequencing. Newly identified genetic variants were classified into 4 groups: I variations associated with a well-defined PID; II variations associated with atypical features of a well-defined PID; III functionally relevant variations potentially involved in the immunological features; IV non-diagnostic genotype, in whom the link with phenotype is missing. We reached a conclusive genetic diagnosis in 7/45 patients (~16%. Among them, 4 patients presented with a typical well-defined PID. In the remaining 3 cases, mutations were associated with unexpected clinical features, expanding the phenotypic spectrum of typical PIDs. In addition, we identified 31 variants in 10 patients with complex phenotype, individually not causative per se of the disorder.Conclusion: NGS technologies represent a cost-effective and rapid first-line genetic approaches for the evaluation of complex PIDs. Whole exome sequencing, despite a moderate higher cost compared to targeted, is
Database-driven primary analysis of raw sequencing data
DEFF Research Database (Denmark)
2014-01-01
The present invention relates to methods for identifying the source of a biological sequence containing sample from raw sequencing reads. The method may be used to identify the source of unknown DNA and can be used for diagnostic, biodefense, food safety and quality, and hygiene applications...
Riahi, Zied; Bonnet, Crystel; Zainine, Rim; Lahbib, Saida; Bouyacoub, Yosra; Bechraoui, Rym; Marrakchi, Jihène; Hardelin, Jean-Pierre; Louha, Malek; Largueche, Leila; Ben Yahia, Salim; Kheirallah, Moncef; Elmatri, Leila; Besbes, Ghazi; Abdelhak, Sonia; Petit, Christine
2015-01-01
Usher syndrome (USH) is an autosomal recessive disorder characterized by combined deafness-blindness. It accounts for about 50% of all hereditary deafness blindness cases. Three clinical subtypes (USH1, USH2, and USH3) are described, of which USH1 is the most severe form, characterized by congenital profound deafness, constant vestibular dysfunction, and a prepubertal onset of retinitis pigmentosa. We performed whole exome sequencing in four unrelated Tunisian patients affected by apparently isolated, congenital profound deafness, with reportedly normal ocular fundus examination. Four biallelic mutations were identified in two USH1 genes: a splice acceptor site mutation, c.2283-1G>T, and a novel missense mutation, c.5434G>A (p.Glu1812Lys), in MYO7A, and two previously unreported mutations in USH1G, i.e. a frameshift mutation, c.1195_1196delAG (p.Leu399Alafs*24), and a nonsense mutation, c.52A>T (p.Lys18*). Another ophthalmological examination including optical coherence tomography actually showed the presence of retinitis pigmentosa in all the patients. Our findings provide evidence that USH is under-diagnosed in Tunisian deaf patients. Yet, early diagnosis of USH is of utmost importance because these patients should undergo cochlear implant surgery in early childhood, in anticipation of the visual loss.
Directory of Open Access Journals (Sweden)
Zied Riahi
Full Text Available Usher syndrome (USH is an autosomal recessive disorder characterized by combined deafness-blindness. It accounts for about 50% of all hereditary deafness blindness cases. Three clinical subtypes (USH1, USH2, and USH3 are described, of which USH1 is the most severe form, characterized by congenital profound deafness, constant vestibular dysfunction, and a prepubertal onset of retinitis pigmentosa. We performed whole exome sequencing in four unrelated Tunisian patients affected by apparently isolated, congenital profound deafness, with reportedly normal ocular fundus examination. Four biallelic mutations were identified in two USH1 genes: a splice acceptor site mutation, c.2283-1G>T, and a novel missense mutation, c.5434G>A (p.Glu1812Lys, in MYO7A, and two previously unreported mutations in USH1G, i.e. a frameshift mutation, c.1195_1196delAG (p.Leu399Alafs*24, and a nonsense mutation, c.52A>T (p.Lys18*. Another ophthalmological examination including optical coherence tomography actually showed the presence of retinitis pigmentosa in all the patients. Our findings provide evidence that USH is under-diagnosed in Tunisian deaf patients. Yet, early diagnosis of USH is of utmost importance because these patients should undergo cochlear implant surgery in early childhood, in anticipation of the visual loss.
Rapid and Accurate Sequencing of Enterovirus Genomes Using MinION Nanopore Sequencer.
Wang, Ji; Ke, Yue Hua; Zhang, Yong; Huang, Ke Qiang; Wang, Lei; Shen, Xin Xin; Dong, Xiao Ping; Xu, Wen Bo; Ma, Xue Jun
2017-10-01
Knowledge of an enterovirus genome sequence is very important in epidemiological investigation to identify transmission patterns and ascertain the extent of an outbreak. The MinION sequencer is increasingly used to sequence various viral pathogens in many clinical situations because of its long reads, portability, real-time accessibility of sequenced data, and very low initial costs. However, information is lacking on MinION sequencing of enterovirus genomes. In this proof-of-concept study using Enterovirus 71 (EV71) and Coxsackievirus A16 (CA16) strains as examples, we established an amplicon-based whole genome sequencing method using MinION. We explored the accuracy, minimum sequencing time, discrimination and high-throughput sequencing ability of MinION, and compared its performance with Sanger sequencing. Within the first minute (min) of sequencing, the accuracy of MinION was 98.5% for the single EV71 strain and 94.12%-97.33% for 10 genetically-related CA16 strains. In as little as 14 min, 99% identity was reached for the single EV71 strain, and in 17 min (on average), 99% identity was achieved for 10 CA16 strains in a single run. MinION is suitable for whole genome sequencing of enteroviruses with sufficient accuracy and fine discrimination and has the potential as a fast, reliable and convenient method for routine use. Copyright © 2017 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.
Ramos, Antonio M.; Crooijmans, Richard P. M. A.; Affara, Nabeel A.; Amaral, Andreia J.; Archibald, Alan L.; Beever, Jonathan E.; Bendixen, Christian; Churcher, Carol; Clark, Richard; Dehais, Patrick; Hansen, Mark S.; Hedegaard, Jakob; Hu, Zhi-Liang; Kerstens, Hindrik H.; Law, Andy S.; Megens, Hendrik-Jan; Milan, Denis; Nonneman, Danny J.; Rohrer, Gary A.; Rothschild, Max F.; Smith, Tim P. L.; Schnabel, Robert D.; Van Tassell, Curt P.; Taylor, Jeremy F.; Wiedmann, Ralph T.; Schook, Lawrence B.; Groenen, Martien A. M.
2009-01-01
Background The dissection of complex traits of economic importance to the pig industry requires the availability of a significant number of genetic markers, such as single nucleotide polymorphisms (SNPs). This study was conducted to discover several hundreds of thousands of porcine SNPs using next generation sequencing technologies and use these SNPs, as well as others from different public sources, to design a high-density SNP genotyping assay. Methodology/Principal Findings A total of 19 reduced representation libraries derived from four swine breeds (Duroc, Landrace, Large White, Pietrain) and a Wild Boar population and three restriction enzymes (AluI, HaeIII and MspI) were sequenced using Illumina's Genome Analyzer (GA). The SNP discovery effort resulted in the de novo identification of over 372K SNPs. More than 549K SNPs were used to design the Illumina Porcine 60K+SNP iSelect Beadchip, now commercially available as the PorcineSNP60. A total of 64,232 SNPs were included on the Beadchip. Results from genotyping the 158 individuals used for sequencing showed a high overall SNP call rate (97.5%). Of the 62,621 loci that could be reliably scored, 58,994 were polymorphic yielding a SNP conversion success rate of 94%. The average minor allele frequency (MAF) for all scorable SNPs was 0.274. Conclusions/Significance Overall, the results of this study indicate the utility of using next generation sequencing technologies to identify large numbers of reliable SNPs. In addition, the validation of the PorcineSNP60 Beadchip demonstrated that the assay is an excellent tool that will likely be used in a variety of future studies in pigs. PMID:19654876
Meason-Smith, Courtney; Diesel, Alison; Patterson, Adam P; Older, Caitlin E; Johnson, Timothy J; Mansell, Joanne M; Suchodolski, Jan S; Rodrigues Hoffmann, Aline
2017-02-01
Next generation sequencing (NGS) studies have demonstrated a diverse skin-associated microbiota and microbial dysbiosis associated with atopic dermatitis in people and in dogs. The skin of cats has yet to be investigated using NGS techniques. We hypothesized that the fungal microbiota of healthy feline skin would be similar to that of dogs, with a predominance of environmental fungi, and that fungal dysbiosis would be present on the skin of allergic cats. Eleven healthy cats and nine cats diagnosed with one or more cutaneous hypersensitivity disorders, including flea bite, food-induced and nonflea nonfood-induced hypersensitivity. Healthy cats were sampled at twelve body sites and allergic cats at six sites. DNA was isolated and Illumina sequencing was performed targeting the internal transcribed spacer region of fungi. Sequences were processed using the bioinformatics software QIIME. The most abundant fungal sequences from the skin of all cats were classified as Cladosporium and Alternaria. The mucosal sites, including nostril, conjunctiva and reproductive tracts, had the fewest number of fungi, whereas the pre-aural space had the most. Allergic feline skin had significantly greater amounts of Agaricomycetes and Sordariomycetes, and significantly less Epicoccum compared to healthy feline skin. The skin of healthy cats appears to have a more diverse fungal microbiota compared to previous studies, and a fungal dysbiosis is noted in the skin of allergic cats. Future studies assessing the temporal stability of the skin microbiota in cats will be useful in determining whether the microbiota sequenced using NGS are colonizers or transient microbes. © 2016 ESVD and ACVD.
Exome sequencing identifies a novel SMCHD1 mutation in facioscapulohumeral muscular dystrophy 2.
Mitsuhashi, Satomi; Boyden, Steven E; Estrella, Elicia A; Jones, Takako I; Rahimov, Fedik; Yu, Timothy W; Darras, Basil T; Amato, Anthony A; Folkerth, Rebecca D; Jones, Peter L; Kunkel, Louis M; Kang, Peter B
2013-12-01
FSHD2 is a rare form of facioscapulohumeral muscular dystrophy (FSHD) characterized by the absence of a contraction in the D4Z4 macrosatellite repeat region on chromosome 4q35 that is the hallmark of FSHD1. However, hypomethylation of this region is common to both subtypes. Recently, mutations in SMCHD1 combined with a permissive 4q35 allele were reported to cause FSHD2. We identified a novel p.Lys275del SMCHD1 mutation in a family affected with FSHD2 using whole-exome sequencing and linkage analysis. This mutation alters a highly conserved amino acid in the ATPase domain of SMCHD1. Subject III-11 is a male who developed asymmetrical muscle weakness characteristic of FSHD at 13 years. Physical examination revealed marked bilateral atrophy at biceps brachii, bilateral scapular winging, some asymmetrical weakness at tibialis anterior and peroneal muscles, and mild lower facial weakness. Biopsy of biceps brachii in subject II-5, the father of III-11, demonstrated lobulated fibers and dystrophic changes. Endomysial and perivascular inflammation was found, which has been reported in FSHD1 but not FSHD2. Given the previous report of SMCHD1 mutations in FSHD2 and the clinical presentations consistent with the FSHD phenotype, we conclude that the SMCHD1 mutation is the likely cause of the disease in this family. Copyright © 2013 Elsevier B.V. All rights reserved.
LENUS (Irish Health Repository)
Palige, Katja
2013-04-15
Candida albicans and Candida dubliniensis are pathogenic fungi that are highly related but differ in virulence and in some phenotypic traits. During in vitro growth on certain nutrient-poor media, C. albicans and C. dubliniensis are the only yeast species which are able to produce chlamydospores, large thick-walled cells of unknown function. Interestingly, only C. dubliniensis forms pseudohyphae with abundant chlamydospores when grown on Staib medium, while C. albicans grows exclusively as a budding yeast. In order to further our understanding of chlamydospore development and assembly, we compared the global transcriptional profile of both species during growth in liquid Staib medium by RNA sequencing. We also included a C. albicans mutant in our study which lacks the morphogenetic transcriptional repressor Nrg1. This strain, which is characterized by its constitutive pseudohyphal growth, specifically produces masses of chlamydospores in Staib medium, similar to C. dubliniensis. This comparative approach identified a set of putatively chlamydospore-related genes. Two of the homologous C. albicans and C. dubliniensis genes (CSP1 and CSP2) which were most strongly upregulated during chlamydospore development were analysed in more detail. By use of the green fluorescent protein as a reporter, the encoded putative cell wall related proteins were found to exclusively localize to C. albicans and C. dubliniensis chlamydospores. Our findings uncover the first chlamydospore specific markers in Candida species and provide novel insights in the complex morphogenetic development of these important fungal pathogens.
Tan, Jin-Ai M A; Chin, Saw-Sian; Ong, Gek-Bee; Mohamed Unni, Mohamed N; Soosay, Ashley E R; Gudum, Henry R; Kho, Siew-Leng; Chua, Kek-Heng; Chen, Jang J; George, Elizabeth
2015-01-01
Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak. Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing. Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients. The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations. © 2014 S. Karger AG, Basel.
Exome sequencing identifies mutations in ABCD1 and DACH2 in two brothers with a distinct phenotype
Zhang, Yanliang; Liu, Yanhui; Li, Ya; Duan, Yong; Zhang, Keyun; Wang, Junwang; Dai, Yong
2014-01-01
Background We report on two brothers with a distinct syndromic phenotype and explore the potential pathogenic cause. Methods Cytogenetic tests and exome sequencing were performed on the two brothers and their parents. Variants detected by exome sequencing were validated by Sanger sequencing. Results The main phenotype of the two brothers included congenital language disorder, growth retardation, intellectual disability, difficulty in standing and walking, and urinary and fecal incontinence. T...
Massouras, Andreas; Decouttere, Frederik; Hens, Korneel; Deplancke, Bart
2010-07-01
High-throughput sequencing (HTS) is revolutionizing our ability to obtain cheap, fast and reliable sequence information. Many experimental approaches are expected to benefit from the incorporation of such sequencing features in their pipeline. Consequently, software tools that facilitate such an incorporation should be of great interest. In this context, we developed WebPrInSeS, a web server tool allowing automated full-length clone sequence identification and verification using HTS data. WebPrInSeS encompasses two separate software applications. The first is WebPrInSeS-C which performs automated sequence verification of user-defined open-reading frame (ORF) clone libraries. The second is WebPrInSeS-E, which identifies positive hits in cDNA or ORF-based library screening experiments such as yeast one- or two-hybrid assays. Both tools perform de novo assembly using HTS data from any of the three major sequencing platforms. Thus, WebPrInSeS provides a highly integrated, cost-effective and efficient way to sequence-verify or identify clones of interest. WebPrInSeS is available at http://webprinses.epfl.ch/ and is open to all users.
Directory of Open Access Journals (Sweden)
Andrea Ariani
Full Text Available Populus x canadensis clone I-214 exhibits a general indicator phenotype in response to excess Zn, and a higher metal uptake in roots than in shoots with a reduced translocation to aerial parts under hydroponic conditions. This physiological adaptation seems mainly regulated by roots, although the molecular mechanisms that underlie these processes are still poorly understood. Here, differential expression analysis using RNA-sequencing technology was used to identify the molecular mechanisms involved in the response to excess Zn in root. In order to maximize specificity of detection of differentially expressed (DE genes, we consider the intersection of genes identified by three distinct statistical approaches (61 up- and 19 down-regulated and validate them by RT-qPCR, yielding an agreement of 93% between the two experimental techniques. Gene Ontology (GO terms related to oxidation-reduction processes, transport and cellular iron ion homeostasis were enriched among DE genes, highlighting the importance of metal homeostasis in adaptation to excess Zn by P. x canadensis clone I-214. We identified the up-regulation of two Populus metal transporters (ZIP2 and NRAMP1 probably involved in metal uptake, and the down-regulation of a NAS4 gene involved in metal translocation. We identified also four Fe-homeostasis transcription factors (two bHLH38 genes, FIT and BTS that were differentially expressed, probably for reducing Zn-induced Fe-deficiency. In particular, we suggest that the down-regulation of FIT transcription factor could be a mechanism to cope with Zn-induced Fe-deficiency in Populus. These results provide insight into the molecular mechanisms involved in adaption to excess Zn in Populus spp., but could also constitute a starting point for the identification and characterization of molecular markers or biotechnological targets for possible improvement of phytoremediation performances of poplar trees.
Exome sequencing identifies NBEAL2 as the causative gene for gray platelet syndrome
Albers, Cornelis A.; Cvejic, Ana; Favier, Rémi; Bouwmans, Evelien E.; Alessi, Marie-Christine; Bertone, Paul; Jordan, Gregory; Kettleborough, Ross N. W.; Kiddle, Graham; Kostadima, Myrto; Read, Randy J.; Sipos, Botond; Sivapalaratnam, Suthesh; Smethurst, Peter A.; Stephens, Jonathan; Voss, Katrin; Nurden, Alan; Rendon, Augusto; Nurden, Paquita; Ouwehand, Willem H.
2011-01-01
Gray platelet syndrome (GPS) is a predominantly recessive platelet disorder that is characterized by mild thrombocytopenia with large platelets and a paucity of α-granules; these abnormalities cause mostly moderate but in rare cases severe bleeding. We sequenced the exomes of four unrelated