WorldWideScience

Sample records for identify important parameters

  1. Identifying important parameters for a continuous bioscouring process

    NARCIS (Netherlands)

    Lenting, H.B.M.; Lenting, H.B.M.; Zwier, E.; Nierstrasz, Vincent

    2002-01-01

    Compared to a bioscouring process in the batch mode, a continuously operating process requires relatively short processing steps. This study focusses on minimizing the required enzymatic incubation time. It is clear that the presence of a sufficient level of surfactant is of major importance in

  2. Reducing uncertainty at minimal cost: a method to identify important input parameters and prioritize data collection

    NARCIS (Netherlands)

    Uwizeye, U.A.; Groen, E.A.; Gerber, P.J.; Schulte, Rogier P.O.; Boer, de I.J.M.

    2016-01-01

    The study aims to illustrate a method to identify important input parameters that explain most of the output variance ofenvironmental assessment models. The method is tested for the computation of life-cycle nitrogen (N) use efficiencyindicators among mixed dairy production systems in Rwanda. We

  3. Global sensitivity analysis for identifying important parameters of nitrogen nitrification and denitrification under model uncertainty and scenario uncertainty

    Science.gov (United States)

    Chen, Zhuowei; Shi, Liangsheng; Ye, Ming; Zhu, Yan; Yang, Jinzhong

    2018-06-01

    Nitrogen reactive transport modeling is subject to uncertainty in model parameters, structures, and scenarios. By using a new variance-based global sensitivity analysis method, this paper identifies important parameters for nitrogen reactive transport with simultaneous consideration of these three uncertainties. A combination of three scenarios of soil temperature and two scenarios of soil moisture creates a total of six scenarios. Four alternative models describing the effect of soil temperature and moisture content are used to evaluate the reduction functions used for calculating actual reaction rates. The results show that for nitrogen reactive transport problem, parameter importance varies substantially among different models and scenarios. Denitrification and nitrification process is sensitive to soil moisture content status rather than to the moisture function parameter. Nitrification process becomes more important at low moisture content and low temperature. However, the changing importance of nitrification activity with respect to temperature change highly relies on the selected model. Model-averaging is suggested to assess the nitrification (or denitrification) contribution by reducing the possible model error. Despite the introduction of biochemical heterogeneity or not, fairly consistent parameter importance rank is obtained in this study: optimal denitrification rate (Kden) is the most important parameter; reference temperature (Tr) is more important than temperature coefficient (Q10); empirical constant in moisture response function (m) is the least important one. Vertical distribution of soil moisture but not temperature plays predominant role controlling nitrogen reaction. This study provides insight into the nitrogen reactive transport modeling and demonstrates an effective strategy of selecting the important parameters when future temperature and soil moisture carry uncertainties or when modelers face with multiple ways of establishing nitrogen

  4. Identifying parameter regions for multistationarity

    DEFF Research Database (Denmark)

    Conradi, Carsten; Feliu, Elisenda; Mincheva, Maya

    2017-01-01

    is the avoidance of numerical analysis and parameter sampling. The procedure consists of a number of steps. Each of these steps might be addressed algorithmically using various computer programs and available software, or manually. We demonstrate our procedure on several models of gene transcription and cell...

  5. Phenomena and parameters important to burnup credit

    International Nuclear Information System (INIS)

    Parks, C.V.; Dehart, M.D.; Wagner, J.C.

    2001-01-01

    Since the mid-1980s, a significant number of studies have been directed at understanding the phenomena and parameters important to implementation of burnup credit in out-of-reactor applications involving pressurized-water- reactor (PWR) spent fuel. The efforts directed at burnup credit involving boiling-water-reactor (BWR) spent fuel have been more limited. This paper reviews the knowledge and experience gained from work performed in the United States and other countries in the study of burnup credit. Relevant physics and analysis phenomenon are identified, and an assessment of their importance to burnup credit implementation for transport and dry cask storage is given. (author)

  6. Parameter identifiability and redundancy: theoretical considerations.

    Directory of Open Access Journals (Sweden)

    Mark P Little

    Full Text Available BACKGROUND: Models for complex biological systems may involve a large number of parameters. It may well be that some of these parameters cannot be derived from observed data via regression techniques. Such parameters are said to be unidentifiable, the remaining parameters being identifiable. Closely related to this idea is that of redundancy, that a set of parameters can be expressed in terms of some smaller set. Before data is analysed it is critical to determine which model parameters are identifiable or redundant to avoid ill-defined and poorly convergent regression. METHODOLOGY/PRINCIPAL FINDINGS: In this paper we outline general considerations on parameter identifiability, and introduce the notion of weak local identifiability and gradient weak local identifiability. These are based on local properties of the likelihood, in particular the rank of the Hessian matrix. We relate these to the notions of parameter identifiability and redundancy previously introduced by Rothenberg (Econometrica 39 (1971 577-591 and Catchpole and Morgan (Biometrika 84 (1997 187-196. Within the widely used exponential family, parameter irredundancy, local identifiability, gradient weak local identifiability and weak local identifiability are shown to be largely equivalent. We consider applications to a recently developed class of cancer models of Little and Wright (Math Biosciences 183 (2003 111-134 and Little et al. (J Theoret Biol 254 (2008 229-238 that generalize a large number of other recently used quasi-biological cancer models. CONCLUSIONS/SIGNIFICANCE: We have shown that the previously developed concepts of parameter local identifiability and redundancy are closely related to the apparently weaker properties of weak local identifiability and gradient weak local identifiability--within the widely used exponential family these concepts largely coincide.

  7. MXLKID: a maximum likelihood parameter identifier

    International Nuclear Information System (INIS)

    Gavel, D.T.

    1980-07-01

    MXLKID (MaXimum LiKelihood IDentifier) is a computer program designed to identify unknown parameters in a nonlinear dynamic system. Using noisy measurement data from the system, the maximum likelihood identifier computes a likelihood function (LF). Identification of system parameters is accomplished by maximizing the LF with respect to the parameters. The main body of this report briefly summarizes the maximum likelihood technique and gives instructions and examples for running the MXLKID program. MXLKID is implemented LRLTRAN on the CDC7600 computer at LLNL. A detailed mathematical description of the algorithm is given in the appendices. 24 figures, 6 tables

  8. Exploiting intrinsic fluctuations to identify model parameters.

    Science.gov (United States)

    Zimmer, Christoph; Sahle, Sven; Pahle, Jürgen

    2015-04-01

    Parameterisation of kinetic models plays a central role in computational systems biology. Besides the lack of experimental data of high enough quality, some of the biggest challenges here are identification issues. Model parameters can be structurally non-identifiable because of functional relationships. Noise in measured data is usually considered to be a nuisance for parameter estimation. However, it turns out that intrinsic fluctuations in particle numbers can make parameters identifiable that were previously non-identifiable. The authors present a method to identify model parameters that are structurally non-identifiable in a deterministic framework. The method takes time course recordings of biochemical systems in steady state or transient state as input. Often a functional relationship between parameters presents itself by a one-dimensional manifold in parameter space containing parameter sets of optimal goodness. Although the system's behaviour cannot be distinguished on this manifold in a deterministic framework it might be distinguishable in a stochastic modelling framework. Their method exploits this by using an objective function that includes a measure for fluctuations in particle numbers. They show on three example models, immigration-death, gene expression and Epo-EpoReceptor interaction, that this resolves the non-identifiability even in the case of measurement noise with known amplitude. The method is applied to partially observed recordings of biochemical systems with measurement noise. It is simple to implement and it is usually very fast to compute. This optimisation can be realised in a classical or Bayesian fashion.

  9. Parameter identifiability of linear dynamical systems

    Science.gov (United States)

    Glover, K.; Willems, J. C.

    1974-01-01

    It is assumed that the system matrices of a stationary linear dynamical system were parametrized by a set of unknown parameters. The question considered here is, when can such a set of unknown parameters be identified from the observed data? Conditions for the local identifiability of a parametrization are derived in three situations: (1) when input/output observations are made, (2) when there exists an unknown feedback matrix in the system and (3) when the system is assumed to be driven by white noise and only output observations are made. Also a sufficient condition for global identifiability is derived.

  10. Importance theory for lumped-parameter systems

    International Nuclear Information System (INIS)

    Cady, K.B.; Kenton, M.A.; Ward, J.C.; Piepho, M.G.

    1981-01-01

    A general sensitivity theory has been developed for nonlinear lumped parameter system simulations. The point of departure is general perturbation theory for nonlinear systems. Importance theory as developed here allows the calculation of the sensitivity of a response function to any physical or design parameter; importance of any equation or term or physical effect in the system model on the response function; variance of the response function caused by the variances and covariances of all physical parameters; and approximate effect on the response function of missing physical phenomena or incorrect parameters

  11. The Importance of Vocal Parameters Correlation

    Directory of Open Access Journals (Sweden)

    Valentin Ghisa

    2016-06-01

    Full Text Available To analyze communication we need to study the main parameters that describe the vocal sounds from the point of view of information content transfer efficiency. In this paper we analyze the physical quality of the “on air" information transfer, according to the audio streaming parameters and from the particular phonetic nature of the human factor. Applying this statistical analysis we aim to identify and record the correlation level of the acoustical parameters with the vocal ones and the impact which the presence of this cross-correlation can have on communication structures’ improvement.

  12. Iterative importance sampling algorithms for parameter estimation

    OpenAIRE

    Morzfeld, Matthias; Day, Marcus S.; Grout, Ray W.; Pau, George Shu Heng; Finsterle, Stefan A.; Bell, John B.

    2016-01-01

    In parameter estimation problems one computes a posterior distribution over uncertain parameters defined jointly by a prior distribution, a model, and noisy data. Markov Chain Monte Carlo (MCMC) is often used for the numerical solution of such problems. An alternative to MCMC is importance sampling, which can exhibit near perfect scaling with the number of cores on high performance computing systems because samples are drawn independently. However, finding a suitable proposal distribution is ...

  13. Identifying crucial parameter correlations maintaining bursting activity.

    Directory of Open Access Journals (Sweden)

    Anca Doloc-Mihu

    2014-06-01

    Full Text Available Recent experimental and computational studies suggest that linearly correlated sets of parameters (intrinsic and synaptic properties of neurons allow central pattern-generating networks to produce and maintain their rhythmic activity regardless of changing internal and external conditions. To determine the role of correlated conductances in the robust maintenance of functional bursting activity, we used our existing database of half-center oscillator (HCO model instances of the leech heartbeat CPG. From the database, we identified functional activity groups of burster (isolated neuron and half-center oscillator model instances and realistic subgroups of each that showed burst characteristics (principally period and spike frequency similar to the animal. To find linear correlations among the conductance parameters maintaining functional leech bursting activity, we applied Principal Component Analysis (PCA to each of these four groups. PCA identified a set of three maximal conductances (leak current, [Formula: see text]Leak; a persistent K current, [Formula: see text]K2; and of a persistent Na+ current, [Formula: see text]P that correlate linearly for the two groups of burster instances but not for the HCO groups. Visualizations of HCO instances in a reduced space suggested that there might be non-linear relationships between these parameters for these instances. Experimental studies have shown that period is a key attribute influenced by modulatory inputs and temperature variations in heart interneurons. Thus, we explored the sensitivity of period to changes in maximal conductances of [Formula: see text]Leak, [Formula: see text]K2, and [Formula: see text]P, and we found that for our realistic bursters the effect of these parameters on period could not be assessed because when varied individually bursting activity was not maintained.

  14. Identifying the important factors in simulation models with many factors

    NARCIS (Netherlands)

    Bettonvil, B.; Kleijnen, J.P.C.

    1994-01-01

    Simulation models may have many parameters and input variables (together called factors), while only a few factors are really important (parsimony principle). For such models this paper presents an effective and efficient screening technique to identify and estimate those important factors. The

  15. Identifying tectonic parameters that influence tsunamigenesis

    Science.gov (United States)

    van Zelst, Iris; Brizzi, Silvia; van Dinther, Ylona; Heuret, Arnauld; Funiciello, Francesca

    2017-04-01

    The role of tectonics in tsunami generation is at present poorly understood. However, the fact that some regions produce more tsunamis than others indicates that tectonics could influence tsunamigenesis. Here, we complement a global earthquake database that contains geometrical, mechanical, and seismicity parameters of subduction zones with tsunami data. We statistically analyse the database to identify the tectonic parameters that affect tsunamigenesis. The Pearson's product-moment correlation coefficients reveal high positive correlations of 0.65 between, amongst others, the maximum water height of tsunamis and the seismic coupling in a subduction zone. However, these correlations are mainly caused by outliers. The Spearman's rank correlation coefficient results in more robust correlations of 0.60 between the number of tsunamis in a subduction zone and subduction velocity (positive correlation) and the sediment thickness at the trench (negative correlation). Interestingly, there is a positive correlation between the latter and tsunami magnitude. In an effort towards multivariate statistics, a binary decision tree analysis is conducted with one variable. However, this shows that the amount of data is too scarce. To complement this limited amount of data and to assess physical causality of the tectonic parameters with regard to tsunamigenesis, we conduct a numerical study of the most promising parameters using a geodynamic seismic cycle model. We show that an increase in sediment thickness on the subducting plate results in a shift in seismic activity from outerrise normal faults to splay faults. We also show that the splay fault is the preferred rupture path for a strongly velocity strengthening friction regime in the shallow part of the subduction zone, which increases the tsunamigenic potential. A larger updip limit of the seismogenic zone results in larger vertical surface displacement.

  16. The Importance of identifiers: IWGSC Meeting 20170720

    OpenAIRE

    Haak, Laurel

    2017-01-01

    Presentation by Laure Haak at the 20 July 2017 meeting of the IWGSC, about use of identifiers in connecting researchers, funding, facilities, and publications. Description of approach and initial results of User Facilities and Publications Working Group, and applications for Scientific Collections.

  17. Importance and sensitivity of parameters affecting the Zion Seismic Risk

    International Nuclear Information System (INIS)

    George, L.L.; O'Connell, W.J.

    1985-06-01

    This report presents the results of a study on the importance and sensitivity of structures, systems, equipment, components and design parameters used in the Zion Seismic Risk Calculations. This study is part of the Seismic Safety Margins Research Program (SSMRP) supported by the NRC Office of Nuclear Regulatory Research. The objective of this study is to provide the NRC with results on the importance and sensitivity of parameters used to evaluate seismic risk. These results can assist the NRC in making decisions dealing with the allocation of research resources on seismic issues. This study uses marginal analysis in addition to importance and sensitivity analysis to identify subject areas (input parameter areas) for improvements that reduce risk, estimate how much the improvement dfforts reduce risk, and rank the subject areas for improvements. Importance analysis identifies the systems, components, and parameters that are important to risk. Sensitivity analysis estimates the change in risk per unit improvement. Marginal analysis indicates the reduction in risk or uncertainty for improvement effort made in each subject area. The results described in this study were generated using the SEISIM (Systematic Evaluation of Important Safety Improvement Measures) and CHAIN computer codes. Part 1 of the SEISIM computer code generated the failure probabilities and risk values. Part 2 of SEISIM, along with the CHAIN computer code, generated the importance and sensitivity measures

  18. Importance and sensitivity of parameters affecting the Zion Seismic Risk

    Energy Technology Data Exchange (ETDEWEB)

    George, L.L.; O' Connell, W.J.

    1985-06-01

    This report presents the results of a study on the importance and sensitivity of structures, systems, equipment, components and design parameters used in the Zion Seismic Risk Calculations. This study is part of the Seismic Safety Margins Research Program (SSMRP) supported by the NRC Office of Nuclear Regulatory Research. The objective of this study is to provide the NRC with results on the importance and sensitivity of parameters used to evaluate seismic risk. These results can assist the NRC in making decisions dealing with the allocation of research resources on seismic issues. This study uses marginal analysis in addition to importance and sensitivity analysis to identify subject areas (input parameter areas) for improvements that reduce risk, estimate how much the improvement dfforts reduce risk, and rank the subject areas for improvements. Importance analysis identifies the systems, components, and parameters that are important to risk. Sensitivity analysis estimates the change in risk per unit improvement. Marginal analysis indicates the reduction in risk or uncertainty for improvement effort made in each subject area. The results described in this study were generated using the SEISIM (Systematic Evaluation of Important Safety Improvement Measures) and CHAIN computer codes. Part 1 of the SEISIM computer code generated the failure probabilities and risk values. Part 2 of SEISIM, along with the CHAIN computer code, generated the importance and sensitivity measures.

  19. Numerical identifiability of the parameters of induction machines

    Energy Technology Data Exchange (ETDEWEB)

    Corcoles, F.; Pedra, J.; Salichs, M. [Dep. d' Eng. Electrica ETSEIB. UPC, Barcelona (Spain)

    2000-08-01

    This paper analyses the numerical identifiability of the electrical parameters of induction machines. Relations between parameters and the impossibility to estimate all of them - when only external measures are used: voltage, current, speed and torque - are shown. Formulations of the single and double-cage induction machine, with and without core losses in both models, are developed. The proposed solution is the formulation of machine equations by using the minimum number of parameters (which are identifiable parameters). As an application example, the parameters of a double-cage induction machine are identified using steady-state measurements corresponding to different angular speeds. (orig.)

  20. Biased sampling, over-identified parameter problems and beyond

    CERN Document Server

    Qin, Jing

    2017-01-01

    This book is devoted to biased sampling problems (also called choice-based sampling in Econometrics parlance) and over-identified parameter estimation problems. Biased sampling problems appear in many areas of research, including Medicine, Epidemiology and Public Health, the Social Sciences and Economics. The book addresses a range of important topics, including case and control studies, causal inference, missing data problems, meta-analysis, renewal process and length biased sampling problems, capture and recapture problems, case cohort studies, exponential tilting genetic mixture models etc. The goal of this book is to make it easier for Ph. D students and new researchers to get started in this research area. It will be of interest to all those who work in the health, biological, social and physical sciences, as well as those who are interested in survey methodology and other areas of statistical science, among others. .

  1. Structural parameter identifiability analysis for dynamic reaction networks

    DEFF Research Database (Denmark)

    Davidescu, Florin Paul; Jørgensen, Sten Bay

    2008-01-01

    method based on Lie derivatives. The proposed systematic two phase methodology is illustrated on a mass action based model for an enzymatically catalyzed reaction pathway network where only a limited set of variables is measured. The methodology clearly pinpoints the structurally identifiable parameters...... where for a given set of measured variables it is desirable to investigate which parameters may be estimated prior to spending computational effort on the actual estimation. This contribution addresses the structural parameter identifiability problem for the typical case of reaction network models....... The proposed analysis is performed in two phases. The first phase determines the structurally identifiable reaction rates based on reaction network stoichiometry. The second phase assesses the structural parameter identifiability of the specific kinetic rate expressions using a generating series expansion...

  2. Identifying the connective strength between model parameters and performance criteria

    Directory of Open Access Journals (Sweden)

    B. Guse

    2017-11-01

    Full Text Available In hydrological models, parameters are used to represent the time-invariant characteristics of catchments and to capture different aspects of hydrological response. Hence, model parameters need to be identified based on their role in controlling the hydrological behaviour. For the identification of meaningful parameter values, multiple and complementary performance criteria are used that compare modelled and measured discharge time series. The reliability of the identification of hydrologically meaningful model parameter values depends on how distinctly a model parameter can be assigned to one of the performance criteria. To investigate this, we introduce the new concept of connective strength between model parameters and performance criteria. The connective strength assesses the intensity in the interrelationship between model parameters and performance criteria in a bijective way. In our analysis of connective strength, model simulations are carried out based on a latin hypercube sampling. Ten performance criteria including Nash–Sutcliffe efficiency (NSE, Kling–Gupta efficiency (KGE and its three components (alpha, beta and r as well as RSR (the ratio of the root mean square error to the standard deviation for different segments of the flow duration curve (FDC are calculated. With a joint analysis of two regression tree (RT approaches, we derive how a model parameter is connected to different performance criteria. At first, RTs are constructed using each performance criterion as the target variable to detect the most relevant model parameters for each performance criterion. Secondly, RTs are constructed using each parameter as the target variable to detect which performance criteria are impacted by changes in the values of one distinct model parameter. Based on this, appropriate performance criteria are identified for each model parameter. In this study, a high bijective connective strength between model parameters and performance criteria

  3. Two statistics for evaluating parameter identifiability and error reduction

    Science.gov (United States)

    Doherty, John; Hunt, Randall J.

    2009-01-01

    Two statistics are presented that can be used to rank input parameters utilized by a model in terms of their relative identifiability based on a given or possible future calibration dataset. Identifiability is defined here as the capability of model calibration to constrain parameters used by a model. Both statistics require that the sensitivity of each model parameter be calculated for each model output for which there are actual or presumed field measurements. Singular value decomposition (SVD) of the weighted sensitivity matrix is then undertaken to quantify the relation between the parameters and observations that, in turn, allows selection of calibration solution and null spaces spanned by unit orthogonal vectors. The first statistic presented, "parameter identifiability", is quantitatively defined as the direction cosine between a parameter and its projection onto the calibration solution space. This varies between zero and one, with zero indicating complete non-identifiability and one indicating complete identifiability. The second statistic, "relative error reduction", indicates the extent to which the calibration process reduces error in estimation of a parameter from its pre-calibration level where its value must be assigned purely on the basis of prior expert knowledge. This is more sophisticated than identifiability, in that it takes greater account of the noise associated with the calibration dataset. Like identifiability, it has a maximum value of one (which can only be achieved if there is no measurement noise). Conceptually it can fall to zero; and even below zero if a calibration problem is poorly posed. An example, based on a coupled groundwater/surface-water model, is included that demonstrates the utility of the statistics. ?? 2009 Elsevier B.V.

  4. Identifying Importance-Performance Matrix Analysis (IPMA) of ...

    African Journals Online (AJOL)

    Identifying Importance-Performance Matrix Analysis (IPMA) of intellectual capital and Islamic work ethics in Malaysian SMES. ... capital and Islamic work ethics significantly influenced business performance. ... AJOL African Journals Online.

  5. Parameters of importance to determine during geoscientific site investigation

    Energy Technology Data Exchange (ETDEWEB)

    Andersson, Johan [QuantiSci AB (Sweden); Almen, K.E. [KEA GEO-Konsult AB (Sweden); Ericsson, Lars O.; Karlsson, Fred; Stroem, A. [Swedish Nuclear Fuel and Waste Management Co., Stockholm (Sweden); Fredriksson, Anders [ADG Grundteknik AB (Sweden); Stanfors, R. [Roy Stanfors Consulting AB (Sweden)

    1998-06-01

    This document identifies and describes geo-scientific parameters that are of importance in order to carry out performance and safety assessments of a deep repository for spent nuclear fuel, based on the information that can be obtained from a site investigation. The document also discusses data needs for planning and design of the rock works and for description of other environmental aspects. Evaluation of the different parameters is discussed in the document as well. The document was produced by a working group consisting of the authors and various SKB staff and consultants, and comprises a step in the planning of a geo-scientific investigation programme at the sites where site investigations will be conducted. The goals of the work presented in this report can be derived directly from SKBs ongoing RD and D Programme. The programme stipulates that a geo-scientific site investigation programme must be available before a site investigation begins. This programme is supposed to specify the goals, measurement methods and evaluation methodology, as well as the acceptance criteria against which the site is evaluated. It is pointed out that site evaluation is a collective term for an interactive process consisting of different parts 65 refs, 15 figs, 12 tabs

  6. Identifiability and error minimization of receptor model parameters with PET

    International Nuclear Information System (INIS)

    Delforge, J.; Syrota, A.; Mazoyer, B.M.

    1989-01-01

    The identifiability problem and the general framework for experimental design optimization are presented. The methodology is applied to the problem of the receptor-ligand model parameter estimation with dynamic positron emission tomography data. The first attempts to identify the model parameters from data obtained with a single tracer injection led to disappointing numerical results. The possibility of improving parameter estimation using a new experimental design combining an injection of the labelled ligand and an injection of the cold ligand (displacement experiment) has been investigated. However, this second protocol led to two very different numerical solutions and it was necessary to demonstrate which solution was biologically valid. This has been possible by using a third protocol including both a displacement and a co-injection experiment. (authors). 16 refs.; 14 figs

  7. Parameter trajectory analysis to identify treatment effects of pharmacological interventions.

    Directory of Open Access Journals (Sweden)

    Christian A Tiemann

    Full Text Available The field of medical systems biology aims to advance understanding of molecular mechanisms that drive disease progression and to translate this knowledge into therapies to effectively treat diseases. A challenging task is the investigation of long-term effects of a (pharmacological treatment, to establish its applicability and to identify potential side effects. We present a new modeling approach, called Analysis of Dynamic Adaptations in Parameter Trajectories (ADAPT, to analyze the long-term effects of a pharmacological intervention. A concept of time-dependent evolution of model parameters is introduced to study the dynamics of molecular adaptations. The progression of these adaptations is predicted by identifying necessary dynamic changes in the model parameters to describe the transition between experimental data obtained during different stages of the treatment. The trajectories provide insight in the affected underlying biological systems and identify the molecular events that should be studied in more detail to unravel the mechanistic basis of treatment outcome. Modulating effects caused by interactions with the proteome and transcriptome levels, which are often less well understood, can be captured by the time-dependent descriptions of the parameters. ADAPT was employed to identify metabolic adaptations induced upon pharmacological activation of the liver X receptor (LXR, a potential drug target to treat or prevent atherosclerosis. The trajectories were investigated to study the cascade of adaptations. This provided a counter-intuitive insight concerning the function of scavenger receptor class B1 (SR-B1, a receptor that facilitates the hepatic uptake of cholesterol. Although activation of LXR promotes cholesterol efflux and -excretion, our computational analysis showed that the hepatic capacity to clear cholesterol was reduced upon prolonged treatment. This prediction was confirmed experimentally by immunoblotting measurements of SR-B1

  8. Simultaneous Parameters Identifiability and Estimation of an E. coli Metabolic Network Model

    Directory of Open Access Journals (Sweden)

    Kese Pontes Freitas Alberton

    2015-01-01

    Full Text Available This work proposes a procedure for simultaneous parameters identifiability and estimation in metabolic networks in order to overcome difficulties associated with lack of experimental data and large number of parameters, a common scenario in the modeling of such systems. As case study, the complex real problem of parameters identifiability of the Escherichia coli K-12 W3110 dynamic model was investigated, composed by 18 differential ordinary equations and 35 kinetic rates, containing 125 parameters. With the procedure, model fit was improved for most of the measured metabolites, achieving 58 parameters estimated, including 5 unknown initial conditions. The results indicate that simultaneous parameters identifiability and estimation approach in metabolic networks is appealing, since model fit to the most of measured metabolites was possible even when important measures of intracellular metabolites and good initial estimates of parameters are not available.

  9. Parameters of importance to determine in geoscientific site studies

    International Nuclear Information System (INIS)

    Andersson, Johan; Almen, K.E.; Ericsson, L.O.; Karlsson, Fred; Stroem, A.; Fredriksson, Anders; Stanfors, R.

    1996-12-01

    This report identifies and describes parameters, that may be determined in a site characterization study, for performing functional and safety analyses of a deep rock repository for radioactive wastes. The report discusses data needs for rock engineering and for description of other environmental aspects. It is intended that the report be used as a basis for formulating the criteria of acceptance in evaluating a candidate site. The report describes how different parameters influence the safety function, and how they are evaluated in practice. The logical order of performing measurements, due to the need of in-data and influence on other measurements is also discussed. 65 refs

  10. Learning about physical parameters: the importance of model discrepancy

    International Nuclear Information System (INIS)

    Brynjarsdóttir, Jenný; O'Hagan, Anthony

    2014-01-01

    Science-based simulation models are widely used to predict the behavior of complex physical systems. It is also common to use observations of the physical system to solve the inverse problem, that is, to learn about the values of parameters within the model, a process which is often called calibration. The main goal of calibration is usually to improve the predictive performance of the simulator but the values of the parameters in the model may also be of intrinsic scientific interest in their own right. In order to make appropriate use of observations of the physical system it is important to recognize model discrepancy, the difference between reality and the simulator output. We illustrate through a simple example that an analysis that does not account for model discrepancy may lead to biased and over-confident parameter estimates and predictions. The challenge with incorporating model discrepancy in statistical inverse problems is being confounded with calibration parameters, which will only be resolved with meaningful priors. For our simple example, we model the model-discrepancy via a Gaussian process and demonstrate that through accounting for model discrepancy our prediction within the range of data is correct. However, only with realistic priors on the model discrepancy do we uncover the true parameter values. Through theoretical arguments we show that these findings are typical of the general problem of learning about physical parameters and the underlying physical system using science-based mechanistic models. (paper)

  11. Importance of Nonperturbative QCD Parameters for Bottom Mesons

    Directory of Open Access Journals (Sweden)

    A. Upadhyay

    2014-01-01

    Full Text Available The importance of nonperturbative quantum chromodynamics (QCD parameters is discussed in context to the predicting power for bottom meson masses and isospin splitting. In the framework of heavy quark effective theory, the work presented here focuses on the different allowed values of the two nonperturbative QCD parameters used in heavy quark effective theory formula, and using the best fitted parameter, masses of the excited bottom meson states in jp=1/2+ doublet in strange and nonstrange sectors are calculated here. The calculated masses are found to be matching well with experiments and other phenomenological models. The mass splitting and hyperfine splitting have also been analyzed for both strange and nonstrange heavy mesons with respect to spin and flavor symmetries.

  12. Identifying important nodes by adaptive LeaderRank

    Science.gov (United States)

    Xu, Shuang; Wang, Pei

    2017-03-01

    Spreading process is a common phenomenon in complex networks. Identifying important nodes in complex networks is of great significance in real-world applications. Based on the spreading process on networks, a lot of measures have been proposed to evaluate the importance of nodes. However, most of the existing measures are appropriate to static networks, which are fragile to topological perturbations. Many real-world complex networks are dynamic rather than static, meaning that the nodes and edges of such networks may change with time, which challenge numerous existing centrality measures. Based on a new weighted mechanism and the newly proposed H-index and LeaderRank (LR), this paper introduces a variant of the LR measure, called adaptive LeaderRank (ALR), which is a new member of the LR-family. Simulations on six real-world networks reveal that the new measure can well balance between prediction accuracy and robustness. More interestingly, the new measure can better adapt to the adjustment or local perturbations of network topologies, as compared with the existing measures. By discussing the detailed properties of the measures from the LR-family, we illustrate that the ALR has its competitive advantages over the other measures. The proposed algorithm enriches the measures to understand complex networks, and may have potential applications in social networks and biological systems.

  13. Identifying important motivational factors for professionals in Greek hospitals

    Science.gov (United States)

    Kontodimopoulos, Nick; Paleologou, Victoria; Niakas, Dimitris

    2009-01-01

    Background The purpose of this study was to identify important motivational factors according to the views of health-care professionals in Greek hospitals and particularly to determine if these might differ in the public and private sectors. Methods A previously developed -and validated- instrument addressing four work-related motivators (job attributes, remuneration, co-workers and achievements) was used. Three categories of health care professionals, doctors (N = 354), nurses (N = 581) and office workers (N = 418), working in public and private hospitals, participated and motivation was compared across socio-demographic and occupational variables. Results The range of reported motivational factors was mixed and Maslow's conclusions that lower level motivational factors must be met before ascending to the next level were not confirmed. The highest ranked motivator for the entire sample, and by professional subgroup, was achievements (P motivators were similar, and only one significant difference was observed, namely between doctors and nurses in respect to co-workers (P motivated by all factors significantly more than their public-hospital counterparts. Conclusion The results are in agreement with the literature which focuses attention to management approaches employing both monetary and non-monetary incentives to motivate health care workers. This study showed that intrinsic factors are particularly important and should become a target for effective employee motivation. PMID:19754968

  14. Formulation of eb-curable epoxy resin : some important parameters

    International Nuclear Information System (INIS)

    Dahlan bin Haji Mohd; Hosoi, Fumio; Sasaki, Takashi

    1989-01-01

    The works on the electron-beam curing of surface coatings using epoxy acrylic-based resins were discussed. The works covered among other things the effect of molecular weights of the resins on the physical properties of coatings and their physical and chemical characterizations. The emphasis was given to formulating the resins applicable to surface coatings. Curings were done on a low-energy electron beam accelerator operating at 250 kV. A number of parameters deemed important to formulations, such as the molecular weights of the oligomers and monomers, monomer ratios, and HEA additions were explored. It was found that one could modify the physical properties of the coatings by changing or adjusting those parameters. (author)

  15. Identifying the role of initial wave parameters on tsunami focusing

    Science.gov (United States)

    Aydın, Baran

    2018-04-01

    Unexpected local tsunami amplification, which is referred to as tsunami focusing, is attributed to two different mechanisms: bathymetric features of the ocean bottom such as underwater ridges and dipolar shape of the initial wave itself. In this study, we characterize the latter; that is, we explore how amplitude and location of the focusing point vary with certain geometric parameters of the initial wave such as its steepness and crest length. Our results reveal two important features of tsunami focusing: for mild waves maximum wave amplitude increases significantly with transverse length of wave crest, while location of the focusing point is almost invariant. For steep waves, on the other hand, increasing crest length dislocates focusing point significantly, while it causes a rather small increase in wave maximum.

  16. Identifiability of altimetry-based rating curve parameters in function of river morphological parameters

    Science.gov (United States)

    Paris, Adrien; André Garambois, Pierre; Calmant, Stéphane; Paiva, Rodrigo; Walter, Collischonn; Santos da Silva, Joecila; Medeiros Moreira, Daniel; Bonnet, Marie-Paule; Seyler, Frédérique; Monnier, Jérôme

    2016-04-01

    Estimating river discharge for ungauged river reaches from satellite measurements is not straightforward given the nonlinearity of flow behavior with respect to measurable and non measurable hydraulic parameters. As a matter of facts, current satellite datasets do not give access to key parameters such as river bed topography and roughness. A unique set of almost one thousand altimetry-based rating curves was built by fit of ENVISAT and Jason-2 water stages with discharges obtained from the MGB-IPH rainfall-runoff model in the Amazon basin. These rated discharges were successfully validated towards simulated discharges (Ens = 0.70) and in-situ discharges (Ens = 0.71) and are not mission-dependent. The rating curve writes Q = a(Z-Z0)b*sqrt(S), with Z the water surface elevation and S its slope gained from satellite altimetry, a and b power law coefficient and exponent and Z0 the river bed elevation such as Q(Z0) = 0. For several river reaches in the Amazon basin where ADCP measurements are available, the Z0 values are fairly well validated with a relative error lower than 10%. The present contribution aims at relating the identifiability and the physical meaning of a, b and Z0given various hydraulic and geomorphologic conditions. Synthetic river bathymetries sampling a wide range of rivers and inflow discharges are used to perform twin experiments. A shallow water model is run for generating synthetic satellite observations, and then rating curve parameters are determined for each river section thanks to a MCMC algorithm. Thanks to twin experiments, it is shown that rating curve formulation with water surface slope, i.e. closer from Manning equation form, improves parameter identifiability. The compensation between parameters is limited, especially for reaches with little water surface variability. Rating curve parameters are analyzed for riffle and pools for small to large rivers, different river slopes and cross section shapes. It is shown that the river bed

  17. Assessing the importance of terrain parameters on glide avalanche release

    Science.gov (United States)

    Peitzsch, Erich H.; Hendrikx, Jordy; Fagre, Daniel B.

    2014-01-01

    avalanches failed as cohesive slabs on this bedrock surface. Consequently, surface roughness proved to be a useful descriptive variable to discriminate between slopes that avalanched and those that did not. Annual 'repeat offender' glide avalanche paths were characterized by smooth outcropping rock plates with stratification planes parallel to the slope. Combined with aspect these repeat offenders were also members of the highest glide category. Using this understanding of the role of topographic parameters on glide avalanche activity, a spatial terrain based model was developed to identify other areas with high glide avalanche potential outside of our immediate observation area.

  18. Assessing the importance of terrain parameters on glide avalanche release

    Science.gov (United States)

    Peitzsch, E.; Hendrikx, J.; Fagre, D. B.

    2013-12-01

    avalanches failed as cohesive slabs on this bedrock surface. Consequently, surface roughness proved to be a useful descriptive variable to discriminate between slopes that avalanched and those that did not. Annual 'repeat offender' glide avalanche paths were characterized by smooth outcropping rock plates with stratification planes parallel to the slope. Combined with aspect these repeat offenders were also members of the highest glide category. Using this understanding of the role of topographic parameters on glide avalanche activity, a spatial terrain based model was developed to identify other areas with high glide avalanche potential outside of our immediate observation area.

  19. Assessing parameter importance of the Common Land Model based on qualitative and quantitative sensitivity analysis

    Directory of Open Access Journals (Sweden)

    J. Li

    2013-08-01

    Full Text Available Proper specification of model parameters is critical to the performance of land surface models (LSMs. Due to high dimensionality and parameter interaction, estimating parameters of an LSM is a challenging task. Sensitivity analysis (SA is a tool that can screen out the most influential parameters on model outputs. In this study, we conducted parameter screening for six output fluxes for the Common Land Model: sensible heat, latent heat, upward longwave radiation, net radiation, soil temperature and soil moisture. A total of 40 adjustable parameters were considered. Five qualitative SA methods, including local, sum-of-trees, multivariate adaptive regression splines, delta test and Morris methods, were compared. The proper sampling design and sufficient sample size necessary to effectively screen out the sensitive parameters were examined. We found that there are 2–8 sensitive parameters, depending on the output type, and about 400 samples are adequate to reliably identify the most sensitive parameters. We also employed a revised Sobol' sensitivity method to quantify the importance of all parameters. The total effects of the parameters were used to assess the contribution of each parameter to the total variances of the model outputs. The results confirmed that global SA methods can generally identify the most sensitive parameters effectively, while local SA methods result in type I errors (i.e., sensitive parameters labeled as insensitive or type II errors (i.e., insensitive parameters labeled as sensitive. Finally, we evaluated and confirmed the screening results for their consistency with the physical interpretation of the model parameters.

  20. A simple method for identifying parameter correlations in partially observed linear dynamic models.

    Science.gov (United States)

    Li, Pu; Vu, Quoc Dong

    2015-12-14

    Parameter estimation represents one of the most significant challenges in systems biology. This is because biological models commonly contain a large number of parameters among which there may be functional interrelationships, thus leading to the problem of non-identifiability. Although identifiability analysis has been extensively studied by analytical as well as numerical approaches, systematic methods for remedying practically non-identifiable models have rarely been investigated. We propose a simple method for identifying pairwise correlations and higher order interrelationships of parameters in partially observed linear dynamic models. This is made by derivation of the output sensitivity matrix and analysis of the linear dependencies of its columns. Consequently, analytical relations between the identifiability of the model parameters and the initial conditions as well as the input functions can be achieved. In the case of structural non-identifiability, identifiable combinations can be obtained by solving the resulting homogenous linear equations. In the case of practical non-identifiability, experiment conditions (i.e. initial condition and constant control signals) can be provided which are necessary for remedying the non-identifiability and unique parameter estimation. It is noted that the approach does not consider noisy data. In this way, the practical non-identifiability issue, which is popular for linear biological models, can be remedied. Several linear compartment models including an insulin receptor dynamics model are taken to illustrate the application of the proposed approach. Both structural and practical identifiability of partially observed linear dynamic models can be clarified by the proposed method. The result of this method provides important information for experimental design to remedy the practical non-identifiability if applicable. The derivation of the method is straightforward and thus the algorithm can be easily implemented into a

  1. A landscape ecology approach identifies important drivers of urban biodiversity.

    Science.gov (United States)

    Turrini, Tabea; Knop, Eva

    2015-04-01

    Cities are growing rapidly worldwide, yet a mechanistic understanding of the impact of urbanization on biodiversity is lacking. We assessed the impact of urbanization on arthropod diversity (species richness and evenness) and abundance in a study of six cities and nearby intensively managed agricultural areas. Within the urban ecosystem, we disentangled the relative importance of two key landscape factors affecting biodiversity, namely the amount of vegetated area and patch isolation. To do so, we a priori selected sites that independently varied in the amount of vegetated area in the surrounding landscape at the 500-m scale and patch isolation at the 100-m scale, and we hold local patch characteristics constant. As indicator groups, we used bugs, beetles, leafhoppers, and spiders. Compared to intensively managed agricultural ecosystems, urban ecosystems supported a higher abundance of most indicator groups, a higher number of bug species, and a lower evenness of bug and beetle species. Within cities, a high amount of vegetated area increased species richness and abundance of most arthropod groups, whereas evenness showed no clear pattern. Patch isolation played only a limited role in urban ecosystems, which contrasts findings from agro-ecological studies. Our results show that urban areas can harbor a similar arthropod diversity and abundance compared to intensively managed agricultural ecosystems. Further, negative consequences of urbanization on arthropod diversity can be mitigated by providing sufficient vegetated space in the urban area, while patch connectivity is less important in an urban context. This highlights the need for applying a landscape ecological approach to understand the mechanisms shaping urban biodiversity and underlines the potential of appropriate urban planning for mitigating biodiversity loss. © 2015 John Wiley & Sons Ltd.

  2. The importance of variables and parameters in radiolytic chemical kinetics modeling

    International Nuclear Information System (INIS)

    Piepho, M.G.; Turner, P.J.; Reimus, P.W.

    1989-01-01

    Many of the pertinent radiochemical reactions are not completely understood, and most of the associated rate constants are poorly characterized. To help identify the important radiochemical reactions, rate constants, species, and environmental conditions, an importance theory code, SWATS (Sensitivitiy With Adjoint Theory-Sparse version)-LOOPCHEM, has been developed for the radiolytic chemical kinetics model in the radiolysis code LOOPCHEM. The LOOPCHEM code calculates the concentrations of various species in a radiolytic field over time. The SWATS-LOOPCHEM code efficiently calculates: the importance (relative to a defined response of interest) of each species concentration over time, the sensitivity of each parameter of interest, and the importance of each equation in the radiolysis model. The calculated results will be used to guide future experimental and modeling work for determining the importance of radiolysis on waste package performance. A demonstration (the importance of selected concentrations and the sensitivities of selected parameters) of the SWATS-LOOPCHEM code is provided for illustrative purposes

  3. Capillary density: An important parameter in nailfold capillaroscopy.

    Science.gov (United States)

    Emrani, Zahra; Karbalaie, Abdolamir; Fatemi, Alimohammad; Etehadtavakol, Mahnaz; Erlandsson, Björn-Erik

    2017-01-01

    Nailfold capillaroscopy is one of the various noninvasive bioengineering methods used to investigate skin microcirculation. It is an effective examination for assessing microvascular changes in the peripheral circulation; hence it has a significant role for the diagnosis of Systemic sclerosis with the classic changes of giant capillaries as well as the decline in capillary density with capillary dropout. The decline in capillary density is one of microangiopathic features existing in connective tissue disease. It is detectable with nailfold capillaroscopy. This parameter is assessed by applying quantitative measurement. In this article, we reviewed a common method for calculating the capillary density and the relation between the number of capillaries as well as the existence of digital ulcers, pulmonary arterial hypertension, autoantibodies, scleroderma patterns and different scoring system. Copyright © 2016 Elsevier Inc. All rights reserved.

  4. The important parameters of polyurethane's properties and preparation

    International Nuclear Information System (INIS)

    Rad, A.S.

    2009-01-01

    Polyurethane (PU) is a type of plastic rind is formed by reacting a polyol (a polymeric alcohol with more than. two reactive hydroxyl groups per molecule) with diisocyanates or polymeric isocyanate in the presence of suitable catalysts and additives. Variations in the number of substitutions and the spacing between and within branch chains produce PUs ranging from linear to branched and flexible to rigid. Linear PUs are used for the manufacture of fibers and molding. The structure of polyurethane can be medley containing 'hard' and 'soft' sect, which contribute to the harmony between rigid and elastomeric properties. The chemical composition and molecular weight distribution (MWD)- of the incorporated soft block influence the macroscopic properties of the resulting coating. In modifying the backbone structure of PU coatings it is necessary to consider the end use for the coating and the cost of modification: The properties of the modified PU coating, The resistance of the coating towards mechanical and The compatibility of the coating and the substrate over the temperature range of expected application and The between the benefits to be gained and the additional cost are the parameters that must be A surface functionalization of a synthetic polyurethane was carried out by using biofunctional moieties to obtain a material with the appropriate mechanical properties and processing conditions. (author)

  5. Osmoregulation – an important parameter of bacterial growth

    Directory of Open Access Journals (Sweden)

    Marta Sochocka

    2011-11-01

    Full Text Available Environmental conditions such as temperature, pH, radiation and osmotic pressure are important factors limiting the growth and multiplication of bacteria. Regular structure and metabolism of bacterial cells are maintained through a stable arrangement of the water-electrolyte system, regulated by osmosis. The rapid changes caused by osmotic shock (dehydration, rehydration might lead to modifications of the phospholipid structure of the cell membrane and even cell death. Advances disturbing the osmosis, which are a natural part of living cells, may appear for example in colloid systems. The biological identification of the osmotic pressure is connected with an increase or decrease in the environmental osmotic strength of microorganisms’ habitat. Cells exposed to osmotic stress, such as an increase in osmotic pressure, initiate mechanisms of active coping with the adverse consequences of its effects. Osmoregulatory processes are designed to maintain cell turgor, hence ensuring proper conditions for bacterial growth. Osmoregulation, which consists of maintaining fluid and electrolyte balance of cells, raising concerns accumulation of specific compatible solutes (osmolytes. Osmolytes are small, soluble organic molecules with a positive influence on membrane stabilization and proteins, without disrupting cellular functions. Storage of compatible solutes takes place by synthesis or by downregulation from the medium by means of special transport systems, activated by mechanical stimuli. Knowledge of the impact of osmotic pressure on microbial cells and the regulation of its activity led to the appropriate use of bacteria in various branches of the biotechnology industry.

  6. Parameter sensitivity and identifiability for a biogeochemical model of hypoxia in the northern Gulf of Mexico

    Science.gov (United States)

    Local sensitivity analyses and identifiable parameter subsets were used to describe numerical constraints of a hypoxia model for bottom waters of the northern Gulf of Mexico. The sensitivity of state variables differed considerably with parameter changes, although most variables ...

  7. Ranking of input parameters importance for BWR stability based on Ringhals-1

    International Nuclear Information System (INIS)

    Gajev, Ivan; Kozlowski, Tomasz; Xu, Yunlin; Downar, Thomas

    2011-01-01

    Unstable behavior of Boiling Water Reactors (BWRs) is known to occur during operation at certain power and flow conditions. Uncertainty calculations for BWR stability, based on the Wilks' formula, have been already done for the Ringhals-1 benchmark. In this work, these calculations have been used to identify and rank the most important parameters affecting the stability of the Ringhals-1 plant. The ranking has been done in two different ways and a comparison of these two methods has been demonstrated. Results show that the methods provide different, but meaningful evaluations of the ranking. (author)

  8. The Importance of Hematological Parameters in Acute Respiratory Viral Infections in Children

    Directory of Open Access Journals (Sweden)

    L. A. Alekseeva

    2013-01-01

    Full Text Available Hematological studies are basic and mandatory in diagnostics and laboratory monitoring of infectious diseases, which led to their inclusion in the modern standards of laboratory examinations of children. Assessment of hematological parameters used for the provisional differential diagnosis of viral or bacterial nature of the disease. For research currently being used increasingly Hematology analyzers, which allows to facilitate and standardize the results. In this paper a comparison and differences hematological parameters practically healthy children and children with respiratory infections. Identified some changes in indicators of haemogram depending on the etiology and character of the clinical course of the disease. On the basis of the leukocyte formula defined leukocyte indices of intoxication and illustrates their importance in assessing the severity of the infection process.

  9. Information sensitivity functions to assess parameter information gain and identifiability of dynamical systems.

    Science.gov (United States)

    Pant, Sanjay

    2018-05-01

    A new class of functions, called the 'information sensitivity functions' (ISFs), which quantify the information gain about the parameters through the measurements/observables of a dynamical system are presented. These functions can be easily computed through classical sensitivity functions alone and are based on Bayesian and information-theoretic approaches. While marginal information gain is quantified by decrease in differential entropy, correlations between arbitrary sets of parameters are assessed through mutual information. For individual parameters, these information gains are also presented as marginal posterior variances, and, to assess the effect of correlations, as conditional variances when other parameters are given. The easy to interpret ISFs can be used to (a) identify time intervals or regions in dynamical system behaviour where information about the parameters is concentrated; (b) assess the effect of measurement noise on the information gain for the parameters; (c) assess whether sufficient information in an experimental protocol (input, measurements and their frequency) is available to identify the parameters; (d) assess correlation in the posterior distribution of the parameters to identify the sets of parameters that are likely to be indistinguishable; and (e) assess identifiability problems for particular sets of parameters. © 2018 The Authors.

  10. On the identifiability of linear dynamical systems. [parameters observation in presence of white noise

    Science.gov (United States)

    Glover, K.; Willems, J. C.

    1973-01-01

    Consider the situation in which the unknown parameters of a stationary linear system may be parametrized by a set of unknown parameters. The question thus arises of when such a set of parameters can be uniquely identified on the basis of observed data. This problem is considered here both in the case of input and output observations and in the case of output observations in the presence of a white noise input. Conditions for local identifiability are derived for both situations and a sufficient condition for global identifiability is given for the former situation, i.e., when simultaneous input and output observations are available.

  11. Focusing on a Probability Element: Parameter Selection of Message Importance Measure in Big Data

    OpenAIRE

    She, Rui; Liu, Shanyun; Dong, Yunquan; Fan, Pingyi

    2017-01-01

    Message importance measure (MIM) is applicable to characterize the importance of information in the scenario of big data, similar to entropy in information theory. In fact, MIM with a variable parameter can make an effect on the characterization of distribution. Furthermore, by choosing an appropriate parameter of MIM,it is possible to emphasize the message importance of a certain probability element in a distribution. Therefore, parametric MIM can play a vital role in anomaly detection of bi...

  12. Comment on “Two statistics for evaluating parameter identifiability and error reduction” by John Doherty and Randall J. Hunt

    Science.gov (United States)

    Hill, Mary C.

    2010-01-01

    Doherty and Hunt (2009) present important ideas for first-order-second moment sensitivity analysis, but five issues are discussed in this comment. First, considering the composite-scaled sensitivity (CSS) jointly with parameter correlation coefficients (PCC) in a CSS/PCC analysis addresses the difficulties with CSS mentioned in the introduction. Second, their new parameter identifiability statistic actually is likely to do a poor job of parameter identifiability in common situations. The statistic instead performs the very useful role of showing how model parameters are included in the estimated singular value decomposition (SVD) parameters. Its close relation to CSS is shown. Third, the idea from p. 125 that a suitable truncation point for SVD parameters can be identified using the prediction variance is challenged using results from Moore and Doherty (2005). Fourth, the relative error reduction statistic of Doherty and Hunt is shown to belong to an emerging set of statistics here named perturbed calculated variance statistics. Finally, the perturbed calculated variance statistics OPR and PPR mentioned on p. 121 are shown to explicitly include the parameter null-space component of uncertainty. Indeed, OPR and PPR results that account for null-space uncertainty have appeared in the literature since 2000.

  13. Life cycle assessment and residue leaching: The importance of parameter, scenario and leaching data selection

    Energy Technology Data Exchange (ETDEWEB)

    Allegrini, E., E-mail: elia@env.dtu.dk [Technical University of Denmark, Department of Environmental Engineering, Building 115, 2800 Lyngby (Denmark); Butera, S. [Technical University of Denmark, Department of Environmental Engineering, Building 115, 2800 Lyngby (Denmark); Kosson, D.S. [Vanderbilt University, Department of Civil and Environmental Engineering, Box 1831 Station B, Nashville, TN 37235 (United States); Van Zomeren, A. [Energy Research Centre of the Netherlands (ECN), Department of Environmental Risk Assessment, P.O. Box 1, 1755 ZG Petten (Netherlands); Van der Sloot, H.A. [Hans van der Sloot Consultancy, Dorpsstraat 216, 1721 BV Langedijk (Netherlands); Astrup, T.F. [Technical University of Denmark, Department of Environmental Engineering, Building 115, 2800 Lyngby (Denmark)

    2015-04-15

    Highlights: • Relevance of metal leaching in waste management system LCAs was assessed. • Toxic impacts from leaching could not be disregarded. • Uncertainty of toxicity, due to background activities, determines LCA outcomes. • Parameters such as pH and L/S affect LCA results. • Data modelling consistency and coverage within an LCA are crucial. - Abstract: Residues from industrial processes and waste management systems (WMSs) have been increasingly reutilised, leading to landfilling rate reductions and the optimisation of mineral resource utilisation in society. Life cycle assessment (LCA) is a holistic methodology allowing for the analysis of systems and products and can be applied to waste management systems to identify environmental benefits and critical aspects thereof. From an LCA perspective, residue utilisation provides benefits such as avoiding the production and depletion of primary materials, but it can lead to environmental burdens, due to the potential leaching of toxic substances. In waste LCA studies where residue utilisation is included, leaching has generally been neglected. In this study, municipal solid waste incineration bottom ash (MSWI BA) was used as a case study into three LCA scenarios having different system boundaries. The importance of data quality and parameter selection in the overall LCA results was evaluated, and an innovative method to assess metal transport into the environment was applied, in order to determine emissions to the soil and water compartments for use in an LCA. It was found that toxic impacts as a result of leaching were dominant in systems including only MSWI BA utilisation, while leaching appeared negligible in larger scenarios including the entire waste system. However, leaching could not be disregarded a priori, due to large uncertainties characterising other activities in the scenario (e.g. electricity production). Based on the analysis of relevant parameters relative to leaching, and on general results

  14. Methodology for identifying boundaries of systems important to safety in CANDU nuclear power plants

    International Nuclear Information System (INIS)

    Therrien, S.; Komljenovic, D.; Therrien, P.; Ruest, C.; Prevost, P.; Vaillancourt, R.

    2007-01-01

    This paper presents a methodology developed to identify the boundaries of the systems important to safety (SIS) at the Gentilly-2 Nuclear Power Plant (NPP), Hydro-Quebec. The SIS boundaries identification considers nuclear safety only. Components that are not identified as important to safety are systematically identified as related to safety. A global assessment process such as WANO/INPO AP-913 'Equipment Reliability Process' will be needed to implement adequate changes in the management rules of those components. The paper depicts results in applying the methodology to the Shutdown Systems 1 and 2 (SDS 1, 2), and to the Emergency Core Cooling System (ECCS). This validation process enabled fine tuning the methodology, performing a better estimate of the effort required to evaluate a system, and identifying components important to safety of these systems. (author)

  15. Calculation of parameter failure probability of thermodynamic system by response surface and importance sampling method

    International Nuclear Information System (INIS)

    Shang Yanlong; Cai Qi; Chen Lisheng; Zhang Yangwei

    2012-01-01

    In this paper, the combined method of response surface and importance sampling was applied for calculation of parameter failure probability of the thermodynamic system. The mathematics model was present for the parameter failure of physics process in the thermodynamic system, by which the combination arithmetic model of response surface and importance sampling was established, then the performance degradation model of the components and the simulation process of parameter failure in the physics process of thermodynamic system were also present. The parameter failure probability of the purification water system in nuclear reactor was obtained by the combination method. The results show that the combination method is an effective method for the calculation of the parameter failure probability of the thermodynamic system with high dimensionality and non-linear characteristics, because of the satisfactory precision with less computing time than the direct sampling method and the drawbacks of response surface method. (authors)

  16. A modified Leslie-Gower predator-prey interaction model and parameter identifiability

    Science.gov (United States)

    Tripathi, Jai Prakash; Meghwani, Suraj S.; Thakur, Manoj; Abbas, Syed

    2018-01-01

    In this work, bifurcation and a systematic approach for estimation of identifiable parameters of a modified Leslie-Gower predator-prey system with Crowley-Martin functional response and prey refuge is discussed. Global asymptotic stability is discussed by applying fluctuation lemma. The system undergoes into Hopf bifurcation with respect to parameters intrinsic growth rate of predators (s) and prey reserve (m). The stability of Hopf bifurcation is also discussed by calculating Lyapunov number. The sensitivity analysis of the considered model system with respect to all variables is performed which also supports our theoretical study. To estimate the unknown parameter from the data, an optimization procedure (pseudo-random search algorithm) is adopted. System responses and phase plots for estimated parameters are also compared with true noise free data. It is found that the system dynamics with true set of parametric values is similar to the estimated parametric values. Numerical simulations are presented to substantiate the analytical findings.

  17. Identifying criteria and establishing parameters for forest-based ecotourism in Northern Ontario, Canada

    Science.gov (United States)

    Stephen W. Boyd; Richard W. Butler; Wolfgang Haider

    1995-01-01

    This paper identifies the following criteria as indicators for ecotourism suitability within a Northern Ontario context: naturalness, wildlife, cultural heritage, landscape and community. A methodology is proposed which uses Geographical Information Systems (GIS) to identify ecotourism sites by linking criteria deemed important with actual landscape characteristics of...

  18. Genes Important for Schizosaccharomyces pombe Meiosis Identified Through a Functional Genomics Screen

    Science.gov (United States)

    Blyth, Julie; Makrantoni, Vasso; Barton, Rachael E.; Spanos, Christos; Rappsilber, Juri; Marston, Adele L.

    2018-01-01

    Meiosis is a specialized cell division that generates gametes, such as eggs and sperm. Errors in meiosis result in miscarriages and are the leading cause of birth defects; however, the molecular origins of these defects remain unknown. Studies in model organisms are beginning to identify the genes and pathways important for meiosis, but the parts list is still poorly defined. Here we present a comprehensive catalog of genes important for meiosis in the fission yeast, Schizosaccharomyces pombe. Our genome-wide functional screen surveyed all nonessential genes for roles in chromosome segregation and spore formation. Novel genes important at distinct stages of the meiotic chromosome segregation and differentiation program were identified. Preliminary characterization implicated three of these genes in centrosome/spindle pole body, centromere, and cohesion function. Our findings represent a near-complete parts list of genes important for meiosis in fission yeast, providing a valuable resource to advance our molecular understanding of meiosis. PMID:29259000

  19. Life cycle assessment and residue leaching: the importance of parameter, scenario and leaching data selection.

    Science.gov (United States)

    Allegrini, E; Butera, S; Kosson, D S; Van Zomeren, A; Van der Sloot, H A; Astrup, T F

    2015-04-01

    Residues from industrial processes and waste management systems (WMSs) have been increasingly reutilised, leading to landfilling rate reductions and the optimisation of mineral resource utilisation in society. Life cycle assessment (LCA) is a holistic methodology allowing for the analysis of systems and products and can be applied to waste management systems to identify environmental benefits and critical aspects thereof. From an LCA perspective, residue utilisation provides benefits such as avoiding the production and depletion of primary materials, but it can lead to environmental burdens, due to the potential leaching of toxic substances. In waste LCA studies where residue utilisation is included, leaching has generally been neglected. In this study, municipal solid waste incineration bottom ash (MSWI BA) was used as a case study into three LCA scenarios having different system boundaries. The importance of data quality and parameter selection in the overall LCA results was evaluated, and an innovative method to assess metal transport into the environment was applied, in order to determine emissions to the soil and water compartments for use in an LCA. It was found that toxic impacts as a result of leaching were dominant in systems including only MSWI BA utilisation, while leaching appeared negligible in larger scenarios including the entire waste system. However, leaching could not be disregarded a priori, due to large uncertainties characterising other activities in the scenario (e.g. electricity production). Based on the analysis of relevant parameters relative to leaching, and on general results of the study, recommendations are provided regarding the use of leaching data in LCA studies. Copyright © 2014 Elsevier Ltd. All rights reserved.

  20. Identifying the effects of parameter uncertainty on the reliability of riverbank stability modelling

    Science.gov (United States)

    Samadi, A.; Amiri-Tokaldany, E.; Darby, S. E.

    2009-05-01

    Bank retreat is a key process in fluvial dynamics affecting a wide range of physical, ecological and socioeconomic issues in the fluvial environment. To predict the undesirable effects of bank retreat and to inform effective measures to prevent it, a wide range of bank stability models have been presented in the literature. These models typically express bank stability by defining a factor of safety as the ratio of driving and resisting forces acting on the incipient failure block. These forces are affected by a range of controlling factors that include such aspects as the bank profile (bank height and angle), the geotechnical properties of the bank materials, as well as the hydrological status of the riverbanks. In this paper we evaluate the extent to which uncertainties in the parameterization of these controlling factors feed through to influence the reliability of the resulting bank stability estimate. This is achieved by employing a simple model of riverbank stability with respect to planar failure (which is the most common type of bank stability model) in a series of sensitivity tests and Monte Carlo analyses to identify, for each model parameter, the range of values that induce significant changes in the simulated factor of safety. These identified parameter value ranges are compared to empirically derived parameter uncertainties to determine whether they are likely to confound the reliability of the resulting bank stability calculations. Our results show that parameter uncertainties are typically high enough that the likelihood of generating unreliable predictions is typically very high (> ˜ 80% for predictions requiring a precision of < ± 15%). Because parameter uncertainties are derived primarily from the natural variability of the parameters, rather than measurement errors, much more careful attention should be paid to field sampling strategies, such that the parameter uncertainties and consequent prediction unreliabilities can be quantified more

  1. Geochemical sensitivity analysis: Identification of important geochemical parameters for performance assessment studies

    International Nuclear Information System (INIS)

    Siegel, M.; Guzowski, R.; Rechard, R.; Erickson, K.

    1986-01-01

    The EPA Standard for geologic disposal of high level waste requires demonstration that the cumulative discharge of individual radioisotopes over a 10,000 year period at points 5 kilometers from the engineered barrier system will not exceed the limits prescribed in 40 CFR Part 191. The roles of the waste package, engineered facility, hydrogeology and geochemical processes in limiting radionuclide releases all must be considered in calculations designed to assess compliance of candidate repositories with the EPA Standard. In this talk, they will discuss the geochemical requirements of calculations used in these compliance assessments. In addition, they will describe the complementary roles of (1) simple models designed to bound the radionuclide discharge over the widest reasonable range of geochemical conditions and scenarios and (2) detailed geochemical models which can provide insights into the actual behavior of the radionuclides in the ground water. Finally, they will discuss development of sensitivity/uncertainty techniques designed to identify important site-specific geochemical parameters and processes using data from a basalt formation

  2. On finding and using identifiable parameter combinations in nonlinear dynamic systems biology models and COMBOS: a novel web implementation.

    Science.gov (United States)

    Meshkat, Nicolette; Kuo, Christine Er-zhen; DiStefano, Joseph

    2014-01-01

    Parameter identifiability problems can plague biomodelers when they reach the quantification stage of development, even for relatively simple models. Structural identifiability (SI) is the primary question, usually understood as knowing which of P unknown biomodel parameters p1,…, pi,…, pP are-and which are not-quantifiable in principle from particular input-output (I-O) biodata. It is not widely appreciated that the same database also can provide quantitative information about the structurally unidentifiable (not quantifiable) subset, in the form of explicit algebraic relationships among unidentifiable pi. Importantly, this is a first step toward finding what else is needed to quantify particular unidentifiable parameters of interest from new I-O experiments. We further develop, implement and exemplify novel algorithms that address and solve the SI problem for a practical class of ordinary differential equation (ODE) systems biology models, as a user-friendly and universally-accessible web application (app)-COMBOS. Users provide the structural ODE and output measurement models in one of two standard forms to a remote server via their web browser. COMBOS provides a list of uniquely and non-uniquely SI model parameters, and-importantly-the combinations of parameters not individually SI. If non-uniquely SI, it also provides the maximum number of different solutions, with important practical implications. The behind-the-scenes symbolic differential algebra algorithms are based on computing Gröbner bases of model attributes established after some algebraic transformations, using the computer-algebra system Maxima. COMBOS was developed for facile instructional and research use as well as modeling. We use it in the classroom to illustrate SI analysis; and have simplified complex models of tumor suppressor p53 and hormone regulation, based on explicit computation of parameter combinations. It's illustrated and validated here for models of moderate complexity, with

  3. Use of amplified fragment length polymorphism analysis to identify medically important Candida spp., including C. dubliniensis.

    NARCIS (Netherlands)

    Borst, A; Theelen, B; Reinders, E; Boekhout, T; Fluit, AC; Savelkoul, P.H.M.

    2003-01-01

    Non-Candida albicans Candida species are increasingly being isolated. These species show differences in levels of resistance to antimycotic agents and mortality. Therefore, it is important to be able to correctly identify the causative organism to the species level. Identification of C. dubliniensis

  4. Pre-Analytical Parameters Affecting Vascular Endothelial Growth Factor Measurement in Plasma: Identifying Confounders.

    Directory of Open Access Journals (Sweden)

    Johanna M Walz

    Full Text Available Vascular endothelial growth factor-A (VEGF-A is intensively investigated in various medical fields. However, comparing VEGF-A measurements is difficult because sample acquisition and pre-analytic procedures differ between studies. We therefore investigated which variables act as confounders of VEGF-A measurements.Following a standardized protocol, blood was taken at three clinical sites from six healthy participants (one male and one female participant at each center twice one week apart. The following pre-analytical parameters were varied in order to analyze their impact on VEGF-A measurements: analyzing center, anticoagulant (EDTA vs. PECT / CTAD, cannula (butterfly vs. neonatal, type of centrifuge (swing-out vs. fixed-angle, time before and after centrifugation, filling level (completely filled vs. half-filled tubes and analyzing method (ELISA vs. multiplex bead array. Additionally, intrapersonal variations over time and sex differences were explored. Statistical analysis was performed using a linear regression model.The following parameters were identified as statistically significant independent confounders of VEGF-A measurements: analyzing center, anticoagulant, centrifuge, analyzing method and sex of the proband. The following parameters were no significant confounders in our data set: intrapersonal variation over one week, cannula, time before and after centrifugation and filling level of collection tubes.VEGF-A measurement results can be affected significantly by the identified pre-analytical parameters. We recommend the use of CTAD anticoagulant, a standardized type of centrifuge and one central laboratory using the same analyzing method for all samples.

  5. Pre-Analytical Parameters Affecting Vascular Endothelial Growth Factor Measurement in Plasma: Identifying Confounders.

    Science.gov (United States)

    Walz, Johanna M; Boehringer, Daniel; Deissler, Heidrun L; Faerber, Lothar; Goepfert, Jens C; Heiduschka, Peter; Kleeberger, Susannah M; Klettner, Alexa; Krohne, Tim U; Schneiderhan-Marra, Nicole; Ziemssen, Focke; Stahl, Andreas

    2016-01-01

    Vascular endothelial growth factor-A (VEGF-A) is intensively investigated in various medical fields. However, comparing VEGF-A measurements is difficult because sample acquisition and pre-analytic procedures differ between studies. We therefore investigated which variables act as confounders of VEGF-A measurements. Following a standardized protocol, blood was taken at three clinical sites from six healthy participants (one male and one female participant at each center) twice one week apart. The following pre-analytical parameters were varied in order to analyze their impact on VEGF-A measurements: analyzing center, anticoagulant (EDTA vs. PECT / CTAD), cannula (butterfly vs. neonatal), type of centrifuge (swing-out vs. fixed-angle), time before and after centrifugation, filling level (completely filled vs. half-filled tubes) and analyzing method (ELISA vs. multiplex bead array). Additionally, intrapersonal variations over time and sex differences were explored. Statistical analysis was performed using a linear regression model. The following parameters were identified as statistically significant independent confounders of VEGF-A measurements: analyzing center, anticoagulant, centrifuge, analyzing method and sex of the proband. The following parameters were no significant confounders in our data set: intrapersonal variation over one week, cannula, time before and after centrifugation and filling level of collection tubes. VEGF-A measurement results can be affected significantly by the identified pre-analytical parameters. We recommend the use of CTAD anticoagulant, a standardized type of centrifuge and one central laboratory using the same analyzing method for all samples.

  6. On the identifiability of inertia parameters of planar Multi-Body Space Systems

    Science.gov (United States)

    Nabavi-Chashmi, Seyed Yaser; Malaek, Seyed Mohammad-Bagher

    2018-04-01

    This work describes a new formulation to study the identifiability characteristics of Serially Linked Multi-body Space Systems (SLMBSS). The process exploits the so called "Lagrange Formulation" to develop a linear form of Equations of Motion w.r.t the system Inertia Parameters (IPs). Having developed a specific form of regressor matrix, we aim to expedite the identification process. The new approach allows analytical as well as numerical identification and identifiability analysis for different SLMBSSs' configurations. Moreover, the explicit forms of SLMBSSs identifiable parameters are derived by analyzing the identifiability characteristics of the robot. We further show that any SLMBSS designed with Variable Configurations Joint allows all IPs to be identifiable through comparing two successive identification outcomes. This feature paves the way to design new class of SLMBSS for which accurate identification of all IPs is at hand. Different case studies reveal that proposed formulation provides fast and accurate results, as required by the space applications. Further studies might be necessary for cases where planar-body assumption becomes inaccurate.

  7. Methodology for identifying parameters for the TRNSYS model Type 210 - wood pellet stoves and boilers

    Energy Technology Data Exchange (ETDEWEB)

    Persson, Tomas; Fiedler, Frank; Nordlander, Svante

    2006-05-15

    This report describes a method how to perform measurements on boilers and stoves and how to identify parameters from the measurements for the boiler/stove-model TRNSYS Type 210. The model can be used for detailed annual system simulations using TRNSYS. Experience from measurements on three different pellet stoves and four boilers were used to develop this methodology. Recommendations for the set up of measurements are given and the required combustion theory for the data evaluation and data preparation are given. The data evaluation showed that the uncertainties are quite large for the measured flue gas flow rate and for boilers and stoves with high fraction of energy going to the water jacket also the calculated heat rate to the room may have large uncertainties. A methodology for the parameter identification process and identified parameters for two different stoves and three boilers are given. Finally the identified models are compared with measured data showing that the model generally agreed well with measured data during both stationary and dynamic conditions.

  8. Important parameters in the performance of a potential repository at Yucca Mountain (TSPA-1995)

    International Nuclear Information System (INIS)

    Atkins, J.E.; Sevougian, S.D.; Lee, J.H.; Andrews, R.W.; McNeish, J.A.

    1996-01-01

    A total system performance assessment (TSPA) was conducted to determine how a potential repository at Yucca Mountain would behave. Using the results of this TSPA, regression was done to determine which parameters had the most important effect on the repository performance. These results were consistent with the current conceptual understanding of the repository

  9. Study of a methodology of identifying important research problems by the PIRT process

    International Nuclear Information System (INIS)

    Aoki, Takayuki; Takagi, Toshiyuki; Urayama, Ryoichi; Komura, Ichiro; Furukawa, Takashi; Yusa, Noritaka

    2014-01-01

    In this paper, we propose a new methodology of identifying important research problems to be solved to improve the performance of some specific scientific technologies by the phenomena identification and ranking table (PIRT) process which has been used as a methodology for demonstrating the validity of the best estimate simulation codes in US Nuclear Regulatory Commission (USNRC) licensing of nuclear power plants. The new methodology makes it possible to identify important factors affecting the performance of the technologies from the viewpoint of the figure of merit and problems associated with them while it keeps the fundamental concepts of the original PIRT process. Also in this paper, we demonstrate the effectiveness of the new methodology by applying it to a task of extracting research problems for improving an inspection accuracy of ultrasonic testing or eddy current testing in the inspection of objects having cracks due to fatigue or stress corrosion cracking. (author)

  10. Study of a methodology of identifying important research problems by the PIRT process

    International Nuclear Information System (INIS)

    Aoki, Takayuki; Takagi, Toshiyuki; Urayama, Ryoichi; Komura, Ichiro; Furukawa, Takashi; Yusa, Noritaka

    2013-01-01

    In this paper, we propose a new methodology of identifying important research problems to be solved to improve the performance of some specific scientific technologies by the phenomena identification and ranking table (PIRT) process, which has been used as a methodology for demonstrating the validity of the best estimate simulation codes in USNRC licensing of nuclear power plants. It keeps the fundamental concepts of the original PIRT process but makes it possible to identify important factors affecting the performance of the technologies from the viewpoint of the figure of merit and problems associated with them, which need to be solved to improve the performance. Also in this paper, we demonstrate the effectiveness of the developed method by showing a specific example of the application to physical events or phenomena in objects having fatigue or SCC crack(s) under ultrasonic testing and eddy current testing. (author)

  11. Comparative analysis of partial imaging performance parameters of home and imported X-ray machines

    International Nuclear Information System (INIS)

    Cao Yunxi; Wang Xianyun; Liu Huiqin; Guo Yongxin

    2002-01-01

    Objective: To compare and analyze the performance indexes and the imaging quality of the home and imported X-ray machines through testing their partial imaging performance parameters. Methods: By separate sampling from 10 home and 10 imported X-ray machines, the parameters including tube current, time of exposure, machine total exposure, and repeatability were tested, and the imaging performance was evaluated according to the national standard. Results: All the performance indexes met the standard of GB4505-84. The first sampling tests showed the maximum changing coefficient of imaging performance repeatability of the home X-ray machines was Δmax1 = 0.025, while that of the imported X-ray machine was Δmax1 = 0.016. In the second sampling tests, the maximum changing coefficients of the two were Δmax2 = 0.048 and Δmax2 = 0.022, respectively. Conclusion: The 2 years' follow-up tests indicate that there is no significant difference between the above-mentioned parameters of the elaborately adjusted home X-ray machines and imported ones, but the home X-ray machines are no better than the imported X-ray machines in stability and consistency

  12. Importance of resonance parameters of fertile nuclei and of 239Pu isotope for fast power reactors

    International Nuclear Information System (INIS)

    Barre, J.Y.; Khairallah, A.

    1975-01-01

    The importance of resonance parameters of fertile nuclei and of 239 Pu isotope for fast power reactors will be restricted, in this presentation, to mixed oxide-uranium-plutonium fuelled sodium-cooled and uranium-oxide-sodium reflected fast reactors. The power range lies between 200 and 2000 MWe. Among the topics of this specialist meeting, the isotopes to be considered are, primarly 239 Pu then 238 U and 240 Pu. Resonance parameters are mainly used in fast power reactor calculations through the well-known concept of self shielding factors. After a short description of the determination and the use of these self-shielding factors, their sensitivities to resonance parameters are characterized from some specific examples: those sensitivities are small. Then, the main design parameters sensitive to the amplitude of self-shielding factors are considered: critical enrichment, global breeding gain. The relative importance of isotope, reaction rate and energy range are mentionned. In a third part, the Doppler effect, sensitive to the temperature variation of self-shielding factors, is considered in the same way. Finally, it is concluded that the present knowledge of resonance parameters for 238 U, 239 Pu and 240 Pu is sufficient for fast power reactors from a designer point of view [fr

  13. The Early Eocene equable climate problem: can perturbations of climate model parameters identify possible solutions?

    Science.gov (United States)

    Sagoo, Navjit; Valdes, Paul; Flecker, Rachel; Gregoire, Lauren J

    2013-10-28

    Geological data for the Early Eocene (56-47.8 Ma) indicate extensive global warming, with very warm temperatures at both poles. However, despite numerous attempts to simulate this warmth, there are remarkable data-model differences in the prediction of these polar surface temperatures, resulting in the so-called 'equable climate problem'. In this paper, for the first time an ensemble with a perturbed climate-sensitive model parameters approach has been applied to modelling the Early Eocene climate. We performed more than 100 simulations with perturbed physics parameters, and identified two simulations that have an optimal fit with the proxy data. We have simulated the warmth of the Early Eocene at 560 ppmv CO2, which is a much lower CO2 level than many other models. We investigate the changes in atmospheric circulation, cloud properties and ocean circulation that are common to these simulations and how they differ from the remaining simulations in order to understand what mechanisms contribute to the polar warming. The parameter set from one of the optimal Early Eocene simulations also produces a favourable fit for the last glacial maximum boundary climate and outperforms the control parameter set for the present day. Although this does not 'prove' that this model is correct, it is very encouraging that there is a parameter set that creates a climate model able to simulate well very different palaeoclimates and the present-day climate. Interestingly, to achieve the great warmth of the Early Eocene this version of the model does not have a strong future climate change Charney climate sensitivity. It produces a Charney climate sensitivity of 2.7(°)C, whereas the mean value of the 18 models in the IPCC Fourth Assessment Report (AR4) is 3.26(°)C±0.69(°)C. Thus, this value is within the range and below the mean of the models included in the AR4.

  14. Time-varying parameter models for catchments with land use change: the importance of model structure

    Science.gov (United States)

    Pathiraja, Sahani; Anghileri, Daniela; Burlando, Paolo; Sharma, Ashish; Marshall, Lucy; Moradkhani, Hamid

    2018-05-01

    Rapid population and economic growth in Southeast Asia has been accompanied by extensive land use change with consequent impacts on catchment hydrology. Modeling methodologies capable of handling changing land use conditions are therefore becoming ever more important and are receiving increasing attention from hydrologists. A recently developed data-assimilation-based framework that allows model parameters to vary through time in response to signals of change in observations is considered for a medium-sized catchment (2880 km2) in northern Vietnam experiencing substantial but gradual land cover change. We investigate the efficacy of the method as well as the importance of the chosen model structure in ensuring the success of a time-varying parameter method. The method was used with two lumped daily conceptual models (HBV and HyMOD) that gave good-quality streamflow predictions during pre-change conditions. Although both time-varying parameter models gave improved streamflow predictions under changed conditions compared to the time-invariant parameter model, persistent biases for low flows were apparent in the HyMOD case. It was found that HyMOD was not suited to representing the modified baseflow conditions, resulting in extreme and unrealistic time-varying parameter estimates. This work shows that the chosen model can be critical for ensuring the time-varying parameter framework successfully models streamflow under changing land cover conditions. It can also be used to determine whether land cover changes (and not just meteorological factors) contribute to the observed hydrologic changes in retrospective studies where the lack of a paired control catchment precludes such an assessment.

  15. Time-varying parameter models for catchments with land use change: the importance of model structure

    Directory of Open Access Journals (Sweden)

    S. Pathiraja

    2018-05-01

    Full Text Available Rapid population and economic growth in Southeast Asia has been accompanied by extensive land use change with consequent impacts on catchment hydrology. Modeling methodologies capable of handling changing land use conditions are therefore becoming ever more important and are receiving increasing attention from hydrologists. A recently developed data-assimilation-based framework that allows model parameters to vary through time in response to signals of change in observations is considered for a medium-sized catchment (2880 km2 in northern Vietnam experiencing substantial but gradual land cover change. We investigate the efficacy of the method as well as the importance of the chosen model structure in ensuring the success of a time-varying parameter method. The method was used with two lumped daily conceptual models (HBV and HyMOD that gave good-quality streamflow predictions during pre-change conditions. Although both time-varying parameter models gave improved streamflow predictions under changed conditions compared to the time-invariant parameter model, persistent biases for low flows were apparent in the HyMOD case. It was found that HyMOD was not suited to representing the modified baseflow conditions, resulting in extreme and unrealistic time-varying parameter estimates. This work shows that the chosen model can be critical for ensuring the time-varying parameter framework successfully models streamflow under changing land cover conditions. It can also be used to determine whether land cover changes (and not just meteorological factors contribute to the observed hydrologic changes in retrospective studies where the lack of a paired control catchment precludes such an assessment.

  16. Maximum Likelihood Estimates of Parameters in Various Types of Distribution Fitted to Important Data Cases.

    OpenAIRE

    HIROSE,Hideo

    1998-01-01

    TYPES OF THE DISTRIBUTION:13;Normal distribution (2-parameter)13;Uniform distribution (2-parameter)13;Exponential distribution ( 2-parameter)13;Weibull distribution (2-parameter)13;Gumbel Distribution (2-parameter)13;Weibull/Frechet Distribution (3-parameter)13;Generalized extreme-value distribution (3-parameter)13;Gamma distribution (3-parameter)13;Extended Gamma distribution (3-parameter)13;Log-normal distribution (3-parameter)13;Extended Log-normal distribution (3-parameter)13;Generalized ...

  17. Identifying Generalizable Image Segmentation Parameters for Urban Land Cover Mapping through Meta-Analysis and Regression Tree Modeling

    Directory of Open Access Journals (Sweden)

    Brian A. Johnson

    2018-01-01

    Full Text Available The advent of very high resolution (VHR satellite imagery and the development of Geographic Object-Based Image Analysis (GEOBIA have led to many new opportunities for fine-scale land cover mapping, especially in urban areas. Image segmentation is an important step in the GEOBIA framework, so great time/effort is often spent to ensure that computer-generated image segments closely match real-world objects of interest. In the remote sensing community, segmentation is frequently performed using the multiresolution segmentation (MRS algorithm, which is tuned through three user-defined parameters (the scale, shape/color, and compactness/smoothness parameters. The scale parameter (SP is the most important parameter and governs the average size of generated image segments. Existing automatic methods to determine suitable SPs for segmentation are scene-specific and often computationally intensive, so an approach to estimating appropriate SPs that is generalizable (i.e., not scene-specific could speed up the GEOBIA workflow considerably. In this study, we attempted to identify generalizable SPs for five common urban land cover types (buildings, vegetation, roads, bare soil, and water through meta-analysis and nonlinear regression tree (RT modeling. First, we performed a literature search of recent studies that employed GEOBIA for urban land cover mapping and extracted the MRS parameters used, the image properties (i.e., spatial and radiometric resolutions, and the land cover classes mapped. Using this data extracted from the literature, we constructed RT models for each land cover class to predict suitable SP values based on the: image spatial resolution, image radiometric resolution, shape/color parameter, and compactness/smoothness parameter. Based on a visual and quantitative analysis of results, we found that for all land cover classes except water, relatively accurate SPs could be identified using our RT modeling results. The main advantage of our

  18. Resequencing 50 accessions of cultivated and wild rice yields markers for identifying agronomically important genes

    DEFF Research Database (Denmark)

    Xu, Xun; Liu, Xin; Ge, Song

    2012-01-01

    Rice is a staple crop that has undergone substantial phenotypic and physiological changes during domestication. Here we resequenced the genomes of 40 cultivated accessions selected from the major groups of rice and 10 accessions of their wild progenitors (Oryza rufipogon and Oryza nivara) to >15 x...... diversity in cultivated but not wild rice, which represent candidate regions selected during domestication. Some of these variants are associated with important biological features, whereas others have yet to be functionally characterized. The molecular markers we have identified should be valuable...... raw data coverage. We investigated genome-wide variation patterns in rice and obtained 6.5 million high-quality single nucleotide polymorphisms (SNPs) after excluding sites with missing data in any accession. Using these population SNP data, we identified thousands of genes with significantly lower...

  19. On the importance of identifying, characterizing, and predicting fundamental phenomena towards microbial electrochemistry applications.

    Science.gov (United States)

    Torres, César Iván

    2014-06-01

    The development of microbial electrochemistry research toward technological applications has increased significantly in the past years, leading to many process configurations. This short review focuses on the need to identify and characterize the fundamental phenomena that control the performance of microbial electrochemical cells (MXCs). Specifically, it discusses the importance of recent efforts to discover and characterize novel microorganisms for MXC applications, as well as recent developments to understand transport limitations in MXCs. As we increase our understanding of how MXCs operate, it is imperative to continue modeling efforts in order to effectively predict their performance, design efficient MXC technologies, and implement them commercially. Thus, the success of MXC technologies largely depends on the path of identifying, understanding, and predicting fundamental phenomena that determine MXC performance. Copyright © 2013 Elsevier Ltd. All rights reserved.

  20. Statistical Analyses of Scatterplots to Identify Important Factors in Large-Scale Simulations

    Energy Technology Data Exchange (ETDEWEB)

    Kleijnen, J.P.C.; Helton, J.C.

    1999-04-01

    The robustness of procedures for identifying patterns in scatterplots generated in Monte Carlo sensitivity analyses is investigated. These procedures are based on attempts to detect increasingly complex patterns in the scatterplots under consideration and involve the identification of (1) linear relationships with correlation coefficients, (2) monotonic relationships with rank correlation coefficients, (3) trends in central tendency as defined by means, medians and the Kruskal-Wallis statistic, (4) trends in variability as defined by variances and interquartile ranges, and (5) deviations from randomness as defined by the chi-square statistic. The following two topics related to the robustness of these procedures are considered for a sequence of example analyses with a large model for two-phase fluid flow: the presence of Type I and Type II errors, and the stability of results obtained with independent Latin hypercube samples. Observations from analysis include: (1) Type I errors are unavoidable, (2) Type II errors can occur when inappropriate analysis procedures are used, (3) physical explanations should always be sought for why statistical procedures identify variables as being important, and (4) the identification of important variables tends to be stable for independent Latin hypercube samples.

  1. Using the Developmental Gene Bicoid to Identify Species of Forensically Important Blowflies (Diptera: Calliphoridae

    Directory of Open Access Journals (Sweden)

    Seong Hwan Park

    2013-01-01

    Full Text Available Identifying species of insects used to estimate postmortem interval (PMI is a major subject in forensic entomology. Because forensic insect specimens are morphologically uniform and are obtained at various developmental stages, DNA markers are greatly needed. To develop new autosomal DNA markers to identify species, partial genomic sequences of the bicoid (bcd genes, containing the homeobox and its flanking sequences, from 12 blowfly species (Aldrichina grahami, Calliphora vicina, Calliphora lata, Triceratopyga calliphoroides, Chrysomya megacephala, Chrysomya pinguis, Phormia regina, Lucilia ampullacea, Lucilia caesar, Lucilia illustris, Hemipyrellia ligurriens and Lucilia sericata; Calliphoridae: Diptera were determined and analyzed. This study first sequenced the ten blowfly species other than C. vicina and L. sericata. Based on the bcd sequences of these 12 blowfly species, a phylogenetic tree was constructed that discriminates the subfamilies of Calliphoridae (Luciliinae, Chrysomyinae, and Calliphorinae and most blowfly species. Even partial genomic sequences of about 500 bp can distinguish most blowfly species. The short intron 2 and coding sequences downstream of the bcd homeobox in exon 3 could be utilized to develop DNA markers for forensic applications. These gene sequences are important in the evolution of insect developmental biology and are potentially useful for identifying insect species in forensic science.

  2. Using the Developmental Gene Bicoid to Identify Species of Forensically Important Blowflies (Diptera: Calliphoridae)

    Science.gov (United States)

    Park, Seong Hwan; Park, Chung Hyun; Zhang, Yong; Piao, Huguo; Chung, Ukhee; Kim, Seong Yoon; Ko, Kwang Soo; Yi, Cheong-Ho; Jo, Tae-Ho; Hwang, Juck-Joon

    2013-01-01

    Identifying species of insects used to estimate postmortem interval (PMI) is a major subject in forensic entomology. Because forensic insect specimens are morphologically uniform and are obtained at various developmental stages, DNA markers are greatly needed. To develop new autosomal DNA markers to identify species, partial genomic sequences of the bicoid (bcd) genes, containing the homeobox and its flanking sequences, from 12 blowfly species (Aldrichina grahami, Calliphora vicina, Calliphora lata, Triceratopyga calliphoroides, Chrysomya megacephala, Chrysomya pinguis, Phormia regina, Lucilia ampullacea, Lucilia caesar, Lucilia illustris, Hemipyrellia ligurriens and Lucilia sericata; Calliphoridae: Diptera) were determined and analyzed. This study first sequenced the ten blowfly species other than C. vicina and L. sericata. Based on the bcd sequences of these 12 blowfly species, a phylogenetic tree was constructed that discriminates the subfamilies of Calliphoridae (Luciliinae, Chrysomyinae, and Calliphorinae) and most blowfly species. Even partial genomic sequences of about 500 bp can distinguish most blowfly species. The short intron 2 and coding sequences downstream of the bcd homeobox in exon 3 could be utilized to develop DNA markers for forensic applications. These gene sequences are important in the evolution of insect developmental biology and are potentially useful for identifying insect species in forensic science. PMID:23586044

  3. Finding identifiable parameter combinations in nonlinear ODE models and the rational reparameterization of their input-output equations.

    Science.gov (United States)

    Meshkat, Nicolette; Anderson, Chris; Distefano, Joseph J

    2011-09-01

    When examining the structural identifiability properties of dynamic system models, some parameters can take on an infinite number of values and yet yield identical input-output data. These parameters and the model are then said to be unidentifiable. Finding identifiable combinations of parameters with which to reparameterize the model provides a means for quantitatively analyzing the model and computing solutions in terms of the combinations. In this paper, we revisit and explore the properties of an algorithm for finding identifiable parameter combinations using Gröbner Bases and prove useful theoretical properties of these parameter combinations. We prove a set of M algebraically independent identifiable parameter combinations can be found using this algorithm and that there exists a unique rational reparameterization of the input-output equations over these parameter combinations. We also demonstrate application of the procedure to a nonlinear biomodel. Copyright © 2011 Elsevier Inc. All rights reserved.

  4. Analysis of the importance for the doses of varying parameters in the BIOPATH-program

    International Nuclear Information System (INIS)

    Bergstroem, U.

    1981-01-01

    The doses to individuals and populations from water-borne nuclides leaked from a repository have been calculated earlier using the computer program BIOPATH. The turnover of nuclides in the biosphere is thereby simulated by the application of compartment theory. For the dominant nuclides in the disposal an analysis of the importance of varying parameters has been done, to decide how strongly uncertainties in data will affect resulting doses. The essential part has been the transfer coefficients but also the uptake in the food-chains has been studied. The purpose of the study has also been to make proposals for forthcoming efforts to improve the basis for such calculations. The study shows the great importance of the surface water-soil-groundwater-drinking water system for the dose. Thereby the most important question is the solubility of the nuclides in the different water reservoirs. (Auth.)

  5. Effect of important operating parameters on product properties and operation of HDPE slurry reactor

    International Nuclear Information System (INIS)

    Soltanieh, M.; Remezani Saadat Abadi, A.; Dashti, A.; Mokhtari, J.

    2007-01-01

    In this article, a complete model for the mixed flow slurry reactor for polymerization of ethylene to high density polyethylene in the presence of Ziegler-Natta catalyst is presented. In addition to the effects of the multiple active sites, the effect of other important parameters such as the catalyst concentration, co-catalyst, hydrogen, monomer, impurities and pressure on the mass-average and number-average polymer product chain length, the average product distribution index and the required residence time for the reactor were investigated. The simulation results show that as the catalyst, hydrogen and solvent concentrations increase, the mass and number-average polymer chain length decrease, whereas with increasing monomer concentration and pressure, the average molecular weight increases. The effects of these parameters on the polydispersity index and residence time do not follow the same trend and their relationship changes in some of these variables

  6. An estimation of crude oil import demand in Turkey: Evidence from time-varying parameters approach

    International Nuclear Information System (INIS)

    Ozturk, Ilhan; Arisoy, Ibrahim

    2016-01-01

    The aim of this study is to model crude oil import demand and estimate the price and income elasticities of imported crude oil in Turkey based on a time-varying parameters (TVP) approach with the aim of obtaining accurate and more robust estimates of price and income elasticities. This study employs annual time series data of domestic oil consumption, real GDP, and oil price for the period 1966–2012. The empirical results indicate that both the income and price elasticities are in line with the theoretical expectations. However, the income elasticity is statistically significant while the price elasticity is statistically insignificant. The relatively high value of income elasticity (1.182) from this study suggests that crude oil import in Turkey is more responsive to changes in income level. This result indicates that imported crude oil is a normal good and rising income levels will foster higher consumption of oil based equipments, vehicles and services by economic agents. The estimated income elasticity of 1.182 suggests that imported crude oil consumption grows at a higher rate than income. This in turn reduces oil intensity over time. Therefore, crude oil import during the estimation period is substantially driven by income. - Highlights: • We estimated the price and income elasticities of imported crude oil in Turkey. • Income elasticity is statistically significant and it is 1.182. • The price elasticity is statistically insignificant. • Crude oil import in Turkey is more responsive to changes in income level. • Crude oil import during the estimation period is substantially driven by income.

  7. Identifying mechanisms that structure ecological communities by snapping model parameters to empirically observed tradeoffs.

    Science.gov (United States)

    Thomas Clark, Adam; Lehman, Clarence; Tilman, David

    2018-04-01

    Theory predicts that interspecific tradeoffs are primary determinants of coexistence and community composition. Using information from empirically observed tradeoffs to augment the parametrisation of mechanism-based models should therefore improve model predictions, provided that tradeoffs and mechanisms are chosen correctly. We developed and tested such a model for 35 grassland plant species using monoculture measurements of three species characteristics related to nitrogen uptake and retention, which previous experiments indicate as important at our site. Matching classical theoretical expectations, these characteristics defined a distinct tradeoff surface, and models parameterised with these characteristics closely matched observations from experimental multi-species mixtures. Importantly, predictions improved significantly when we incorporated information from tradeoffs by 'snapping' characteristics to the nearest location on the tradeoff surface, suggesting that the tradeoffs and mechanisms we identify are important determinants of local community structure. This 'snapping' method could therefore constitute a broadly applicable test for identifying influential tradeoffs and mechanisms. © 2018 The Authors. Ecology Letters published by CNRS and John Wiley & Sons Ltd.

  8. Identify the Important Decision Factors of Online Shopping Adoption in Indonesia

    Directory of Open Access Journals (Sweden)

    Lailatul HIJRAH

    2017-12-01

    Full Text Available The objective of this study is to identify factors encouraging a consumer to engage in online shopping activities. The expected contribution of this study is for online entrepreneurs, in order to develop the most suitable business strategy, so that it will be clearly identified and sorted out which factors are the most important and the main motivation of Indonesian consumers to shop via online by using responses from respondents who usually shop online and offline in 3 cities in Indonesia, Jakarta, Surabaya and Samarinda. The research instruments were developed by conducting FGDs on relevant groups, either academics, online shopping activists, suppliers and courier businessmen in Jakarta, Surabaya and Samarinda Cities in effort to extract any information that encourages consumers to online shopping. After conducting FGD, the researcher produced 48 items proposed for factor analysis and after extracted to form eleven constructs, some items were removed because they had less loading factors. The eleven constructs or dimensions are trust, risk, consumer factors, website factors, price, service quality, convenience, subjective norm, product guarantee, variety of products and lifestyle. The implications of this study provide valuable insights about consumer decisions to online shopping or not online shopping.

  9. Systematic reviews identify important methodological flaws in stroke rehabilitation therapy primary studies: review of reviews.

    Science.gov (United States)

    Santaguida, Pasqualina; Oremus, Mark; Walker, Kathryn; Wishart, Laurie R; Siegel, Karen Lohmann; Raina, Parminder

    2012-04-01

    A "review of reviews" was undertaken to assess methodological issues in studies evaluating nondrug rehabilitation interventions in stroke patients. MEDLINE, CINAHL, PsycINFO, and the Cochrane Database of Systematic Reviews were searched from January 2000 to January 2008 within the stroke rehabilitation setting. Electronic searches were supplemented by reviews of reference lists and citations identified by experts. Eligible studies were systematic reviews; excluded citations were narrative reviews or reviews of reviews. Review characteristics and criteria for assessing methodological quality of primary studies within them were extracted. The search yielded 949 English-language citations. We included a final set of 38 systematic reviews. Cochrane reviews, which have a standardized methodology, were generally of higher methodological quality than non-Cochrane reviews. Most systematic reviews used standardized quality assessment criteria for primary studies, but not all were comprehensive. Reviews showed that primary studies had problems with randomization, allocation concealment, and blinding. Baseline comparability, adverse events, and co-intervention or contamination were not consistently assessed. Blinding of patients and providers was often not feasible and was not evaluated as a source of bias. The eligible systematic reviews identified important methodological flaws in the evaluated primary studies, suggesting the need for improvement of research methods and reporting. Copyright © 2012 Elsevier Inc. All rights reserved.

  10. The importance of consumption of the epidermis in malignant melanoma and correlation with clinicopathological prognostic parameters.

    Science.gov (United States)

    Seçkin, Selda; Ozgũn, Elmas

    2011-01-01

    The aim of the study was to investigate the importance of consumption of the epidermis as an additional diagnostic criteria for malignant melanoma and to evaluate its relationship to clinicopathological findings. The age, gender, localization of the lesion and the histopathological parameters such as tumor type, Breslow thickness, ulceration, Clark's level, mitosis/mm2, lymphocytic infiltration were noted in 40 malignant melanoma cases. Consumption of the epidermis was evaluated in tumor sections. Consumption of the epidermis (COE) due to thinning of the epidermis and loss of rete ridges was noted as (+) or (-). Furthermore, COE was compared with clinical and histopathological parameters. The Shapiro Wilk and Logistic Regression tests were used for statistical analysis. The results were accepted as significant if the p value was correlation was present between COE and head and neck localization (p = 0,698), superficial spreading melanoma (p = 0,341), ulceration (p = 0,097) and brisk lymphocytic infiltration (p = 0,200) but the results were not statistically significant. COE was frequently detected in males but the difference was not statistically significant (p = 0.796). There was no correlation or significant statistical association between COE and age, Breslow thickness, Clark's level or the mitotic index. The detection of COE in most of the patients suggests that COE could be a histopathological criterion in the diagnosis of malignant melanoma. The frequent association between COE and the presence of ulceration could also direct attention to COE as regards prognostic importance.

  11. Pneumophonic coordination impairments in parkinsonian dysarthria: importance of aerodynamic parameters measurements.

    Science.gov (United States)

    Moustapha, S M; Alain, G; Robert, E; Bernard, T; Mourtalla, Kâ M; Lamine, G; François, V

    2012-01-01

    Among Parkinsonian axial signs, dysarthria represents an important disabling symptom able to lead towards a significant reduction of oral communication. Several methods of dysarthria assessment have been used but aerodynamic evaluation is rare in the literature. To highlight the importance of aerodynamic parameters measurements in assessment of parkinsonian dysarthria. Using a dedicated system (EVA2), 24 parkinsonian patients were recorded after withdrawal of L-dopa for at least 12 h (condition called OFF DOPA) in order to evaluate intra-oral pressure (IOP), mean oral air flow (MOAF) and laryngeal resistance (LR) on six /p/ during realization of the sentence "Papa ne m'a pas parle' de beau-papa" ("Daddy did not speak to me about daddy-in-law") which corresponds to a breath group. 50 control subjects were recorded in parallel in order to define reference measurements. It appeared that there is in Parkinson's disease aerodynamic impairments which were evidenced by the fall in IOP and that of MOAF in patients compared with control subjects. The difference between the two groups was statistically significant. In addition a greater instability of LR in patients compared with control subjects was also noted. Our results show that measurements of aerodynamics parameters, by reflecting the dysfunction induced by disease, may well be relevant factors in parkinsonian dysarthria evaluation.

  12. Identifying selectively important amino acid positions associated with alternative habitat environments in fish mitochondrial genomes.

    Science.gov (United States)

    Xia, Jun Hong; Li, Hong Lian; Zhang, Yong; Meng, Zi Ning; Lin, Hao Ran

    2018-05-01

    Fish species inhabitating seawater (SW) or freshwater (FW) habitats have to develop genetic adaptations to alternative environment factors, especially salinity. Functional consequences of the protein variations associated with habitat environments in fish mitochondrial genomes have not yet received much attention. We analyzed 829 complete fish mitochondrial genomes and compared the amino acid differences of 13 mitochondrial protein families between FW and SW fish groups. We identified 47 specificity determining sites (SDS) that associated with FW or SW environments from 12 mitochondrial protein families. Thirty-two (68%) of the SDS sites are hydrophobic, 13 (28%) are neutral, and the remaining sites are acidic or basic. Seven of those SDS from ND1, ND2 and ND5 were scored as probably damaging to the protein structures. Furthermore, phylogenetic tree based Bayes Empirical Bayes analysis also detected 63 positive sites associated with alternative habitat environments across ten mtDNA proteins. These signatures could be important for studying mitochondrial genetic variation relevant to fish physiology and ecology.

  13. PCR-RFLP Method to Identify Salmonid Species of Economic Importance

    Directory of Open Access Journals (Sweden)

    Andreea Dudu

    2011-05-01

    Full Text Available The identification of different fish species by molecular methods has become necessary to avoid both the incorrect labelling of individuals involved in repopulation programmes and the commercial frauds on the fish market. Different fish species of great economical importance, like the salmonids, which are very much requested for their meat, can be identified using molecular techniques such as PCR-RFLP. The method is based on the amplification of a target region from the genome by PCR reaction followed by endonucleases digestion to detect the polymorphism of restriction fragments. In our study we analysed the following salmonid species from Romania: Salmo trutta fario, Salmo labrax, Salvelinus fontinalis, Onchorhynchus mykiss, Thymallus thymallus and Hucho hucho. In order to discriminate between the analysed species we amplified a fragment of mitochondrial genome comprising tRNAGlu/ cytochrome b/ tRNAThr/ tRNAPro/ D-loop/ tRNAPhe, followed by digestion with a specific restriction enzyme. The direct digestion of unpurified PCR products generated species-specific restriction patterns and proved to be a simple, reliable, inexpensive and fast method. Thus, it may be successfully utilized in specialized laboratories for the correct identification of the fish species for multiple purposes, including the traceability of fish food products.

  14. Integrating retention soil filters into urban hydrologic models - Relevant processes and important parameters

    Science.gov (United States)

    Bachmann-Machnik, Anna; Meyer, Daniel; Waldhoff, Axel; Fuchs, Stephan; Dittmer, Ulrich

    2018-04-01

    Retention Soil Filters (RSFs), a form of vertical flow constructed wetlands specifically designed for combined sewer overflow (CSO) treatment, have proven to be an effective tool to mitigate negative impacts of CSOs on receiving water bodies. Long-term hydrologic simulations are used to predict the emissions from urban drainage systems during planning of stormwater management measures. So far no universally accepted model for RSF simulation exists. When simulating hydraulics and water quality in RSFs, an appropriate level of detail must be chosen for reasonable balancing between model complexity and model handling, considering the model input's level of uncertainty. The most crucial parameters determining the resultant uncertainties of the integrated sewer system and filter bed model were identified by evaluating a virtual drainage system with a Retention Soil Filter for CSO treatment. To determine reasonable parameter ranges for RSF simulations, data of 207 events from six full-scale RSF plants in Germany were analyzed. Data evaluation shows that even though different plants with varying loading and operation modes were examined, a simple model is sufficient to assess relevant suspended solids (SS), chemical oxygen demand (COD) and NH4 emissions from RSFs. Two conceptual RSF models with different degrees of complexity were assessed. These models were developed based on evaluation of data from full scale RSF plants and column experiments. Incorporated model processes are ammonium adsorption in the filter layer and degradation during subsequent dry weather period, filtration of SS and particulate COD (XCOD) to a constant background concentration and removal of solute COD (SCOD) by a constant removal rate during filter passage as well as sedimentation of SS and XCOD in the filter overflow. XCOD, SS and ammonium loads as well as ammonium concentration peaks are discharged primarily via RSF overflow not passing through the filter bed. Uncertainties of the integrated

  15. Predicting the wheel rolling resistance regarding important motion parameters using the artificial neural network

    Directory of Open Access Journals (Sweden)

    F Gheshlaghi

    2016-04-01

    Full Text Available Introduction: Rolling resistance is one of the most substantial energy losses when the wheel moves on soft soil. Rolling resistance value optimization will help to improve energy efficiency. Accurate modeling of the interaction soil-tire is an important key to this optimization and has eliminated the need for costly field tests and has reduced the time required to test. Rolling resistance will change because of the tire and wheel motion parameters and characteristics of the ground surface. Some tire design parameters are more important such as the tire diameter, width, tire aspect ratio, lugs form, inflation pressure and mechanical properties of tire structure. On the other hand, the soil or ground surface characteristics include soil type; moisture content and bulk density have an important role in this phenomenon. In addition, the vertical load and the wheel motion parameters such as velocity and tire slip are the other factors which impact on tire rolling resistance. According to same studies about the rolling resistance of the wheel, the wheel is significantly affected by the dynamic load. Tire inflation pressure impacted on rolling resistance of tires that were moving on hard surfaces. Studies showed that the rolling resistance of tires with low inflation pressure (less than 100 kPa was too high. According to Zoz and Griss researches, increasing the tire pressure increases rolling resistance on soft soil but reduces the rolling resistance of on-road tires and tire-hard surface interaction. Based on these reports, the effect of velocity on tire rolling resistance for tractors and vehicles with low velocity (less than 5 meters per second is usually insignificant. According to Self and Summers studies, rolling resistance of the wheel is dramatically affected by dynamic load on the wheel. Artificial Neural Network is one of the best computational methods capable of complex regression estimation which is an advantage of this method compared with

  16. Importance of helical pitch parameter in LHD-type heliotron reactor designs

    International Nuclear Information System (INIS)

    Goto, T.; Suzuki, Y.; Yanagi, N.; Watanabe, K.Y.; Imagawa, S.; Sagara, A.

    2010-11-01

    In the design studies of the LHD-type heliotron reactors, one of the key issues is to secure sufficient blanket spaces. In this respect, helical pitch parameter γ is quite important because it significantly affects both the coil and plasma shapes. In order to understand the effect of helical pitch parameter on the design window quantitatively, a system design code for the LHD-type heliotron reactors has been developed and parametric scans were carried out with 3 cases of γ=1.15, 1.20 and 1.25. It becomes clear that the possible design window of heliotron reactors strongly depends on the engineering constraints: stored magnetic energy of coil system, blanket space, and neutron wall load. γ=1.20 is optimum from the viewpoint of moderating the physics requirements, but γ=1.15 has a robustness to the change in the physics and engineering conditions. Since the design windows are quite sensitive to the engineering constraints and physics conditions, the further detailed study on design feasibility of advanced engineering components and the effect of γ on the physics conditions is expected to optimize the value of γ. (author)

  17. Prediction of changes in important physical parameters during composting of separated animal slurry solid fractions

    DEFF Research Database (Denmark)

    Chowdhury, Md Albarune; de Neergaard, Andreas; Jensen, Lars Stoumann

    2014-01-01

    Solid-liquid separation of animal slurry, with solid fractions used for composting, has gained interest recently. However, efficient composting of separated animal slurry solid fractions (SSFs) requires a better understanding of the process dynamics in terms of important physical parameters...... and their interacting physical relationships in the composting matrix. Here we monitored moisture content, bulk density, particle density and air-filled porosity (AFP) during composting of SSF collected from four commercially available solid-liquid separators. Composting was performed in laboratory-scale reactors...... for 30 days (d) under forced aeration and measurements were conducted on the solid samples at the beginning of composting and at 10-d intervals during composting. The results suggest that differences in initial physical properties of SSF influence the development of compost maximum temperatures (40...

  18. Identifying Important Atlantic Areas for the conservation of Balearic shearwaters: Spatial overlap with conservation areas

    Science.gov (United States)

    Pérez-Roda, Amparo; Delord, Karine; Boué, Amélie; Arcos, José Manuel; García, David; Micol, Thierry; Weimerskirch, Henri; Pinaud, David; Louzao, Maite

    2017-07-01

    Marine protected areas (MPAs) are considered one of the main tools in both fisheries and conservation management to protect threatened species and their habitats around the globe. However, MPAs are underrepresented in marine environments compared to terrestrial environments. Within this context, we studied the Atlantic non-breeding distribution of the southern population of Balearic shearwaters (Puffinus mauretanicus) breeding in Eivissa during the 2011-2012 period based on global location sensing (GLS) devices. Our objectives were (1) to identify overall Important Atlantic Areas (IAAs) from a southern population, (2) to describe spatio-temporal patterns of oceanographic habitat use, and (3) to assess whether existing conservation areas (Natura 2000 sites and marine Important Bird Areas (IBAs)) cover the main IAAs of Balearic shearwaters. Our results highlighted that the Atlantic staging (from June to October in 2011) dynamic of the southern population was driven by individual segregation at both spatial and temporal scales. Individuals ranged in the North-East Atlantic over four main IAAs (Bay of Biscay: BoB, Western Iberian shelf: WIS, Gulf of Cadiz: GoC, West of Morocco: WoM). While most individuals spent more time on the WIS or in the GoC, a small number of birds visited IAAs at the extremes of their Atlantic distribution range (i.e., BoB and WoM). The chronology of the arrivals to the IAAs showed a latitudinal gradient with northern areas reached earlier during the Atlantic staging. The IAAs coincided with the most productive areas (higher chlorophyll a values) in the NE Atlantic between July and October. The spatial overlap between IAAs and conservation areas was higher for Natura 2000 sites than marine IBAs (areas with and without legal protection, respectively). Concerning the use of these areas, a slightly higher proportion of estimated positions fell within marine IBAs compared to designated Natura 2000 sites, with Spanish and Portuguese conservation

  19. Testing the new stochastic neutronic code ANET in simulating safety important parameters

    International Nuclear Information System (INIS)

    Xenofontos, T.; Delipei, G.-K.; Savva, P.; Varvayanni, M.; Maillard, J.; Silva, J.; Catsaros, N.

    2017-01-01

    Highlights: • ANET is a new neutronics stochastic code. • Criticality calculations in both subcritical and critical nuclear systems of conventional design were conducted. • Simulations of thermal, lower epithermal and fast neutron fluence rates were performed. • Axial fission rate distributions in standard and MOX fuel pins were computed. - Abstract: ANET (Advanced Neutronics with Evolution and Thermal hydraulic feedback) is an under development Monte Carlo code for simulating both GEN II/III reactors as well as innovative nuclear reactor designs, based on the high energy physics code GEANT3.21 of CERN. ANET is built through continuous GEANT3.21 applicability amplifications, comprising the simulation of particles’ transport and interaction in low energy along with the accessibility of user-provided libraries and tracking algorithms for energies below 20 MeV, as well as the simulation of elastic and inelastic collision, capture and fission. Successive testing applications performed throughout the ANET development have been utilized to verify the new code capabilities. In this context the ANET reliability in simulating certain reactor parameters important to safety is here examined. More specifically the reactor criticality as well as the neutron fluence and fission rates are benchmarked and validated. The Portuguese Research Reactor (RPI) after its conversion to low enrichment in U-235 and the OECD/NEA VENUS-2 MOX international benchmark were considered appropriate for the present study, the former providing criticality and neutron flux data and the latter reaction rates. Concerning criticality benchmarking, the subcritical, Training Nuclear Reactor of the Aristotle University of Thessaloniki (TNR-AUTh) was also analyzed. The obtained results are compared with experimental data from the critical infrastructures and with computations performed by two different, well established stochastic neutronics codes, i.e. TRIPOLI-4.8 and MCNP5. Satisfactory agreement

  20. To Identify the Important Soil Properties Affecting Dinoseb Adsorption with Statistical Analysis

    Directory of Open Access Journals (Sweden)

    Yiqing Guan

    2013-01-01

    Full Text Available Investigating the influences of soil characteristic factors on dinoseb adsorption parameter with different statistical methods would be valuable to explicitly figure out the extent of these influences. The correlation coefficients and the direct, indirect effects of soil characteristic factors on dinoseb adsorption parameter were analyzed through bivariate correlation analysis, and path analysis. With stepwise regression analysis the factors which had little influence on the adsorption parameter were excluded. Results indicate that pH and CEC had moderate relationship and lower direct effect on dinoseb adsorption parameter due to the multicollinearity with other soil factors, and organic carbon and clay contents were found to be the most significant soil factors which affect the dinoseb adsorption process. A regression is thereby set up to explore the relationship between the dinoseb adsorption parameter and the two soil factors: the soil organic carbon and clay contents. A 92% of the variation of dinoseb sorption coefficient could be attributed to the variation of the soil organic carbon and clay contents.

  1. EVALUATION OF THE IMPORTANCE OF BIOCHEMICAL PARAMETERS IN RELATION TO ULTRASONOGRAPHIC FINDING IN ECTOPIC PREGNANCY DIAGNOSIS

    Directory of Open Access Journals (Sweden)

    Dragan Lončar

    2011-09-01

    Full Text Available The implantation of the fertilized egg outside the uterine cavity leads to the development of ectopic pregnancy. The incidence of ectopic pregnancy is 1/100 births. The most common place of ectopic implantation of the fertilized ovum is the oviduct (98% with predilection for the ampullar part of the Fallopian tube. The aim of this study was to determine the predictive importance of beta-hCG and progesterone concentration compared to ultrasonographic finding in the ectopic pregnancy diagnosis.We examined 24 patients with ectopic pregnancies which we divided according to the days of amenorrhea into two groups: the first group with the total of 28 patients from 16–42 days and another group of 8 patients with amenorrhea longer than 42 days. The control group was comprised of 20 patients with vital intrauterine pregnancy, gestational age of 42-52 days. Blood samples for quantitative determination of hormones were collected on three occasions after 48 hours in the forenoon time in the examined and control group of pregnant women. Ultrasonographic examinations of all pregnant women were carried out immediately after blood sampling, with the trans-vaginal approach using "make loop" option, and measurements with an accuracy of 0.1 mm.Mean values for beta-hCG range from 698-1774 mlU/ml in the first group of pregnant women, and in the second group of 1896 mlU/ml to 4410 mlU/ml with a statistically significant difference compared to the values in the control group (p <0.001. The concentration of progesterone in the first group of women ranging from 41-70 nmol/l, and in the second group of 76-94 nmol/l which is also the statistically significant difference compared to the control group (p<0.002. We have shown that ultrasonographic finding with its parameters reliably predicts the values of biochemical parameters both in normal intrauterine pregnancy and in the case of ectopic pregnancy.Embryo viability and implantation place condition the values of

  2. Importance of hydrological parameters in contaminant transport modeling in a terrestrial environment

    International Nuclear Information System (INIS)

    Tsuduki, Katsunori; Matsunaga, Takeshi

    2007-01-01

    A grid type multi-layered distributed parameter model for calculating discharge in a watershed was described. Model verification with our field observation resulted in different sets of hydrological parameter values, all of which reproduced the observed discharge. The effect of those varied hydrological parameters on contaminant transport calculation was examined and discussed by simulation of event water transfer. (author)

  3. Important parameters affecting the cell voltage of aqueous electrical double-layer capacitors

    Science.gov (United States)

    Wu, Tzu-Ho; Hsu, Chun-Tsung; Hu, Chi-Chang; Hardwick, Laurence J.

    2013-11-01

    This study discusses and demonstrates how the open-circuit potential and charges stored in the working potential window on positive and negative electrodes affect the cell voltage of carbon-based electrical double-layer capacitors (EDLCs) in aqueous electrolytes. An EDLC consisting of two activated carbon electrodes is employed as the model system for identifying these key parameters although the potential window of water decomposition can be simply determined by voltammetric methods. First, the capacitive performances of an EDLC with the same charge on positive and negative electrodes are evaluated by cyclic voltammetric, charge-discharge, electrochemical impedance spectroscopic (EIS) analyses, and inductance-capacitance-resistance meter (LCR meter). The principles for obtaining the highest acceptable cell voltage of such symmetric ECs with excellent reversibility and capacitor-like behaviour are proposed. Aqueous charge-balanced EDLCs can be operated as high as 2.0 V with high energy efficiency (about 90%) and only 4% capacitance loss after the 600-cycle stability checking. The necessity of charge balance (but not capacitance balance) for positive and negative electrodes is substantiated from the lower acceptable cell voltage of charge-unbalanced EDLCs.

  4. Statistical Evaluation of the Identified Structural Parameters of an idling Offshore Wind Turbine

    International Nuclear Information System (INIS)

    Kramers, Hendrik C.; Van der Valk, Paul L.C.; Van Wingerden, Jan-Willem

    2016-01-01

    With the increased need for renewable energy, new offshore wind farms are being developed at an unprecedented scale. However, as the costs of offshore wind energy are still too high, design optimization and new innovations are required for lowering its cost. The design of modern day offshore wind turbines relies on numerical models for estimating ultimate and fatigue loads of the turbines. The dynamic behavior and the resulting structural loading of the turbines is determined for a large part by its structural properties, such as the natural frequencies and damping ratios. Hence, it is important to obtain accurate estimates of these modal properties. For this purpose stochastic subspace identification (SSI), in combination with clustering and statistical evaluation methods, is used to obtain the variance of the identified modal properties of an installed 3.6MW offshore wind turbine in idling conditions. It is found that one is able to obtain confidence intervals for the means of eigenfrequencies and damping ratios of the fore-aft and side-side modes of the wind turbine. (paper)

  5. Parameter importance and uncertainty in predicting runoff pesticide reduction with filter strips.

    Science.gov (United States)

    Muñoz-Carpena, Rafael; Fox, Garey A; Sabbagh, George J

    2010-01-01

    Vegetative filter strips (VFS) are an environmental management tool used to reduce sediment and pesticide transport from surface runoff. Numerical models of VFS such as the Vegetative Filter Strip Modeling System (VFSMOD-W) are capable of predicting runoff, sediment, and pesticide reduction and can be useful tools to understand the effectiveness of VFS and environmental conditions under which they may be ineffective. However, as part of the modeling process, it is critical to identify input factor importance and quantify uncertainty in predicted runoff, sediment, and pesticide reductions. This research used state-of-the-art global sensitivity and uncertainty analysis tools, a screening method (Morris) and a variance-based method (extended Fourier Analysis Sensitivity Test), to evaluate VFSMOD-W under a range of field scenarios. The three VFS studies analyzed were conducted on silty clay loam and silt loam soils under uniform, sheet flow conditions and included atrazine, chlorpyrifos, cyanazine, metolachlor, pendimethalin, and terbuthylazine data. Saturated hydraulic conductivity was the most important input factor for predicting infiltration and runoff, explaining >75% of the total output variance for studies with smaller hydraulic loading rates ( approximately 100-150 mm equivalent depths) and approximately 50% for the higher loading rate ( approximately 280-mm equivalent depth). Important input factors for predicting sedimentation included hydraulic conductivity, average particle size, and the filter's Manning's roughness coefficient. Input factor importance for pesticide trapping was controlled by infiltration and, therefore, hydraulic conductivity. Global uncertainty analyses suggested a wide range of reductions for runoff (95% confidence intervals of 7-93%), sediment (84-100%), and pesticide (43-100%) . Pesticide trapping probability distributions fell between runoff and sediment reduction distributions as a function of the pesticides' sorption. Seemingly

  6. Identification of Important Parameter from Leachate Solid Waste Landfill on Water Quality, Case Study of Pesanggrahan River

    Science.gov (United States)

    Yanidar, R.; Hartono, D. M.; Moersidik, S. S.

    2018-03-01

    Cipayung Landfill takes waste generation from Depok City approximately ± 750 tons/day of solid waste. The south and west boundaries of the landfill is Pesanggarahan River which 200m faraway. The objectives of this study are to indicate an important parameter which greatly affects the water quality of Pesanggrahan River and purpose the dynamic model for improving our understanding of the dynamic behavior that captures the interactions and feedbacks important parameter in river in order to identify and assess the effects of the treated leachate from final solid waste disposal activity as it responds to changes over time in the river. The high concentrations of BOD and COD are not the only cause significantly affect the quality of the pesanggrahan water, it also because the river has been contaminated in the upstream area. It need the water quality model to support the effectiveness calculation of activities for preventing a selected the pollutant sources the model should be developed for simulating and predicting the trend of water quality performance in Pesanggrahan River which can potentially be used by policy makers in strategic management to sustain river water quality as raw drinking water.

  7. Photosynthetic limitations in two Antarctic vascular plants: importance of leaf anatomical traits and Rubisco kinetic parameters.

    Science.gov (United States)

    Sáez, Patricia L; Bravo, León A; Cavieres, Lohengrin A; Vallejos, Valentina; Sanhueza, Carolina; Font-Carrascosa, Marcel; Gil-Pelegrín, Eustaquio; Javier Peguero-Pina, José; Galmés, Jeroni

    2017-05-17

    Particular physiological traits allow the vascular plants Deschampsia antarctica Desv. and Colobanthus quitensis (Kunth) Bartl. to inhabit Antarctica. The photosynthetic performance of these species was evaluated in situ, focusing on diffusive and biochemical constraints to CO2 assimilation. Leaf gas exchange, Chl a fluorescence, leaf ultrastructure, and Rubisco catalytic properties were examined in plants growing on King George and Lagotellerie islands. In spite of the species- and population-specific effects of the measurement temperature on the main photosynthetic parameters, CO2 assimilation was highly limited by CO2 diffusion. In particular, the mesophyll conductance (gm)-estimated from both gas exchange and leaf chlorophyll fluorescence and modeled from leaf anatomy-was remarkably low, restricting CO2 diffusion and imposing the strongest constraint to CO2 acquisition. Rubisco presented a high specificity for CO2 as determined in vitro, suggesting a tight co-ordination between CO2 diffusion and leaf biochemistry that may be critical ultimately to optimize carbon balance in these species. Interestingly, both anatomical and biochemical traits resembled those described in plants from arid environments, providing a new insight into plant functional acclimation to extreme conditions. Understanding what actually limits photosynthesis in these species is important to anticipate their responses to the ongoing and predicted rapid warming in the Antarctic Peninsula. © The Author 2017. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  8. Identifying dominant controls on hydrologic parameter transfer from gauged to ungauged catchments: a comparative hydrology approach

    Science.gov (United States)

    Singh, R.; Archfield, S.A.; Wagener, T.

    2014-01-01

    Daily streamflow information is critical for solving various hydrologic problems, though observations of continuous streamflow for model calibration are available at only a small fraction of the world’s rivers. One approach to estimate daily streamflow at an ungauged location is to transfer rainfall–runoff model parameters calibrated at a gauged (donor) catchment to an ungauged (receiver) catchment of interest. Central to this approach is the selection of a hydrologically similar donor. No single metric or set of metrics of hydrologic similarity have been demonstrated to consistently select a suitable donor catchment. We design an experiment to diagnose the dominant controls on successful hydrologic model parameter transfer. We calibrate a lumped rainfall–runoff model to 83 stream gauges across the United States. All locations are USGS reference gauges with minimal human influence. Parameter sets from the calibrated models are then transferred to each of the other catchments and the performance of the transferred parameters is assessed. This transfer experiment is carried out both at the scale of the entire US and then for six geographic regions. We use classification and regression tree (CART) analysis to determine the relationship between catchment similarity and performance of transferred parameters. Similarity is defined using physical/climatic catchment characteristics, as well as streamflow response characteristics (signatures such as baseflow index and runoff ratio). Across the entire US, successful parameter transfer is governed by similarity in elevation and climate, and high similarity in streamflow signatures. Controls vary for different geographic regions though. Geology followed by drainage, topography and climate constitute the dominant similarity metrics in forested eastern mountains and plateaus, whereas agricultural land use relates most strongly with successful parameter transfer in the humid plains.

  9. Competence Description for Personal Recommendations: The Importance of Identifying the Complexity of Learning and Performance Situations

    Science.gov (United States)

    Prins, Frans J.; Nadolski, Rob J.; Berlanga, Adriana J.; Drachsler, Hendrik; Hummel, Hans G. K.; Koper, Rob

    2008-01-01

    For competences development of learners and professionals, target competences and corresponding competence development opportunities have to be identified. Personal Recommender Systems (PRS) provide personal recommendations for learners aimed at finding and selecting learning activities that best match their needs. This article argues that a…

  10. Important parameters in the detection of left main trunk disease using stress myocardial perfusion imaging

    International Nuclear Information System (INIS)

    Shiba, Chie; Chikamori, Taishiro; Hida, Satoshi

    2009-01-01

    We sought noninvasively to diagnose left main trunk (LMT) disease using myocardial perfusion imaging (MPI). Five hundred and eight patients with suspected coronary artery disease (CAD) underwent both stress MPI and coronary angiography. The extent and severity of perfusion abnormalities were assessed using a 20-segment model. In addition, perfusion defects in both left anterior descending and left circumflex arterial territories were defined as a left main (LM) pattern defect, and those in 3-coronary arterial territories as a 3-vessel pattern defect. In 42 patients with LMT disease, a summed stress score (19.4±10.0 vs. 13.5±10.0; p<0.0001) and a summed rest score (12.1±9.7 vs. 7.0±7.8; p=0.002) were greater than in 466 patients without LMT disease, while a summed difference score was similar (7.3±7.7 vs. 6.5±6.1; p=NS). The prevalence of an LM-pattern defect was low in both groups (12% vs. 8%; p=NS). However, a 3-vessel pattern defect (33% vs. 7%; p<0.0001), lung uptake of radiotracers (38% vs. 11%; p<0.0001), and transient ischemic dilation (31% vs. 13%; p=0.003) were more frequently observed in patients with LMT disease than in those without. Logistic regression analysis showed that a 3-vessel pattern defect (odds ratio (OR)=3.5, 95% confidence interval (CI)=1.4-8.8; p=0.007), lung uptake of radiotracers (OR=2.5, 95% CI=1.1-5.7; p=0.03), and previous myocardial infarction (MI) (OR=2.4, 95% CI=1.0-5.7; p=0.05) were the most important parameters to detect LMT disease. After excluding 163 patients with previous MI, a repeat analysis revealed that lung uptake of radiotracers (OR=8.2, 95% CI=2.3-29.2; p=0.001) and an LM-pattern defect (OR=6.3, 95% CI=1.4-27.2; p<0.02) were independent predictors for LMT disease. In the identification of LMT disease, lung uptake of radiotracers was a single best parameter, which was independent of the presence or absence of previous MI. (author)

  11. Identifiability of parameters and behaviour of the MCMC chains: a case study using the reaction norm model

    DEFF Research Database (Denmark)

    Shariati, M M; Korsgaard, I R; Sorensen, D

    2009-01-01

    model with unknown covariates (RNUC) is a model in which unknown environmental effects can be inferred jointly with the remaining parameters. The problem of identifiability of parameters at the level of the likelihood and the associated behaviour of MCMC chains were discussed using the RNUC...... as fixed and there are other fixed factors in the model, the contrasts involving environmental effects, the variance of environmental sensitivities (genetic slopes) and the residual variance are the only identifiable parameters. These different identifiability scenarios were generated by changing...... as an example. It was shown theoretically that when environmental effects (covariates) are considered as random effects, estimable functions of the fixed effects, (co)variance components and genetic effects are identifiable as well as the environmental effects. When the environmental effects are treated...

  12. Identifying Important Career Indicators of Undergraduate Geoscience Students Upon Completion of Their Degree

    Science.gov (United States)

    Wilson, C. E.; Keane, C. M.; Houlton, H. R.

    2012-12-01

    The American Geosciences Institute (AGI) decided to create the National Geoscience Student Exit Survey in order to identify the initial pathways into the workforce for these graduating students, as well as assess their preparedness for entering the workforce upon graduation. The creation of this survey stemmed from a combination of experiences with the AGI/AGU Survey of Doctorates and discussions at the following Science Education Research Center (SERC) workshops: "Developing Pathways to Strong Programs for the Future", "Strengthening Your Geoscience Program", and "Assessing Geoscience Programs". These events identified distinct gaps in understanding the experiences and perspectives of geoscience students during one of their most profound professional transitions. Therefore, the idea for the survey arose as a way to evaluate how the discipline is preparing and educating students, as well as identifying the students' desired career paths. The discussions at the workshops solidified the need for this survey and created the initial framework for the first pilot of the survey. The purpose of this assessment tool is to evaluate student preparedness for entering the geosciences workforce; identify student decision points for entering geosciences fields and remaining in the geosciences workforce; identify geosciences fields that students pursue in undergraduate and graduate school; collect information on students' expected career trajectories and geosciences professions; identify geosciences career sectors that are hiring new graduates; collect information about salary projections; overall effectiveness of geosciences departments regionally and nationally; demonstrate the value of geosciences degrees to future students, the institutions, and employers; and establish a benchmark to perform longitudinal studies of geosciences graduates to understand their career pathways and impacts of their educational experiences on these decisions. AGI's Student Exit Survey went through

  13. The importance of correct specification of tribological parameters in dynamical systems modelling

    Science.gov (United States)

    Alaci, S.; Ciornei, F. C.; Romanu, I. C.; Ciornei, M. C.

    2018-01-01

    When modelling the behaviour of dynamical systems, the friction phenomenon cannot be neglected. Dry and fluid friction may occur, but dry friction has more severe effects upon the behaviour of the systems, based on the fact that the introduced discontinuities are more important. In the modelling of dynamical systems, dry friction is the main cause of occurrence of the bifurcation phenomenon. These aspects become more complex if, in the case of dry friction, static and dynamic frictions are put forward. The behaviour of a simple dynamical system is studied, consisting in a prismatic body linked to the ground by a spring, placed on a conveyor belt. The theoretical model is described by a nonlinear differential equation which after numerical integration leads to the conclusion that the steady motion of the prism is an un-damped oscillatory motion. The system was qualitatively modelled using specialised software for dynamical analysis. It was impractical to obtain a steady uniform translational motion of a rigid, therefore the conveyor belt was replaced by a metallic disc in uniform rotation motion. The attempts to compare the CAD model to the theoretical model were unsuccessful because the efforts of selecting the tribological parameters directed to the conclusion that the motion of the prism is a damped oscillation. To decide which of the methods depicts reality, a test-rig was assembled and it indicated a sustained oscillation. The conclusion is that the model employed by the dynamical analysis software cannot describe the actual model and a more complex model is required in the description of the friction phenomenon.

  14. Prediction of changes in important physical parameters during composting of separated animal slurry solid fractions.

    Science.gov (United States)

    Chowdhury, Md Albarune; de Neergaard, Andreas; Jensen, Lars Stoumann

    2014-01-01

    Solid-liquid separation of animal slurry, with solid fractions used for composting, has gained interest recently. However, efficient composting of separated animal slurry solid fractions (SSFs) requires a better understanding of the process dynamics in terms of important physical parameters and their interacting physical relationships in the composting matrix. Here we monitored moisture content, bulk density, particle density and air-filled porosity (AFP) during composting of SSF collected from four commercially available solid-liquid separators. Composting was performed in laboratory-scale reactors for 30 days (d) under forced aeration and measurements were conducted on the solid samples at the beginning of composting and at 10-d intervals during composting. The results suggest that differences in initial physical properties of SSF influence the development of compost maximum temperatures (40-70 degreeC). Depending on SSF, total wet mass and volume losses (expressed as % of initial value) were up to 37% and 34%, respectively. After 30 d of composting, relative losses of total solids varied from 17.9% to 21.7% and of volatile solids (VS) from 21.3% to 27.5%, depending on SSF. VS losses in all composts showed different dynamics as described by the first-order kinetic equation. The estimated component particle density of 1441 kg m-3 for VS and 2625 kg m-3 for fixed solids can be used to improve estimates of AFP for SSF within the range tested. The linear relationship between wet bulk density and AFP reported by previous researchers held true for SSF.

  15. An effective automatic procedure for testing parameter identifiability of HIV/AIDS models.

    Science.gov (United States)

    Saccomani, Maria Pia

    2011-08-01

    Realistic HIV models tend to be rather complex and many recent models proposed in the literature could not yet be analyzed by traditional identifiability testing techniques. In this paper, we check a priori global identifiability of some of these nonlinear HIV models taken from the recent literature, by using a differential algebra algorithm based on previous work of the author. The algorithm is implemented in a software tool, called DAISY (Differential Algebra for Identifiability of SYstems), which has been recently released (DAISY is freely available on the web site http://www.dei.unipd.it/~pia/ ). The software can be used to automatically check global identifiability of (linear and) nonlinear models described by polynomial or rational differential equations, thus providing a general and reliable tool to test global identifiability of several HIV models proposed in the literature. It can be used by researchers with a minimum of mathematical background.

  16. Genome-wide association study identified copy number variants important for appendicular lean mass.

    Science.gov (United States)

    Ran, Shu; Liu, Yong-Jun; Zhang, Lei; Pei, Yufang; Yang, Tie-Lin; Hai, Rong; Han, Ying-Ying; Lin, Yong; Tian, Qing; Deng, Hong-Wen

    2014-01-01

    Skeletal muscle is a major component of the human body. Age-related loss of muscle mass and function contributes to some public health problems such as sarcopenia and osteoporosis. Skeletal muscle, mainly composed of appendicular lean mass (ALM), is a heritable trait. Copy number variation (CNV) is a common type of human genome variant which may play an important role in the etiology of many human diseases. In this study, we performed genome-wide association analyses of CNV for ALM in 2,286 Caucasian subjects. We then replicated the major findings in 1,627 Chinese subjects. Two CNVs, CNV1191 and CNV2580, were detected to be associated with ALM (p = 2.26×10(-2) and 3.34×10(-3), respectively). In the Chinese replication sample, the two CNVs achieved p-values of 3.26×10(-2) and 0.107, respectively. CNV1191 covers a gene, GTPase of the immunity-associated protein family (GIMAP1), which is important for skeletal muscle cell survival/death in humans. CNV2580 is located in the Serine hydrolase-like protein (SERHL) gene, which plays an important role in normal peroxisome function and skeletal muscle growth in response to mechanical stimuli. In summary, our study suggested two novel CNVs and the related genes that may contribute to variation in ALM.

  17. Genome-wide association study identified copy number variants important for appendicular lean mass.

    Directory of Open Access Journals (Sweden)

    Shu Ran

    Full Text Available Skeletal muscle is a major component of the human body. Age-related loss of muscle mass and function contributes to some public health problems such as sarcopenia and osteoporosis. Skeletal muscle, mainly composed of appendicular lean mass (ALM, is a heritable trait. Copy number variation (CNV is a common type of human genome variant which may play an important role in the etiology of many human diseases. In this study, we performed genome-wide association analyses of CNV for ALM in 2,286 Caucasian subjects. We then replicated the major findings in 1,627 Chinese subjects. Two CNVs, CNV1191 and CNV2580, were detected to be associated with ALM (p = 2.26×10(-2 and 3.34×10(-3, respectively. In the Chinese replication sample, the two CNVs achieved p-values of 3.26×10(-2 and 0.107, respectively. CNV1191 covers a gene, GTPase of the immunity-associated protein family (GIMAP1, which is important for skeletal muscle cell survival/death in humans. CNV2580 is located in the Serine hydrolase-like protein (SERHL gene, which plays an important role in normal peroxisome function and skeletal muscle growth in response to mechanical stimuli. In summary, our study suggested two novel CNVs and the related genes that may contribute to variation in ALM.

  18. Identifying faecal impaction is important for ensuring the timely diagnosis of childhood functional constipation

    DEFF Research Database (Denmark)

    Modin, Line; Walsted, Anne-Mette; Jakobsen, Marianne Skytte

    2015-01-01

    AIM: Most research on functional constipation has been carried out at a tertiary level. We focused this study on a secondary-level hospital outpatients' department, assessing the distribution of diagnostic criteria for childhood functional constipation and evaluating the consequences of current...... diagnostic practice based on current guidelines. METHODS: We enrolled 235 children, aged two to 16 years of age, with functional constipation according to the Rome III criteria and assessed them using medical histories and physical examinations, including rectal examinations and ultrasound measurements...... the timely diagnosis of childhood functional constipation at the secondary care level. Ultrasound examination proved a reliable alternative to rectal examination or abdominal radiography when identifying faecal impaction....

  19. A Particle Smoother with Sequential Importance Resampling for soil hydraulic parameter estimation: A lysimeter experiment

    Science.gov (United States)

    Montzka, Carsten; Hendricks Franssen, Harrie-Jan; Moradkhani, Hamid; Pütz, Thomas; Han, Xujun; Vereecken, Harry

    2013-04-01

    An adequate description of soil hydraulic properties is essential for a good performance of hydrological forecasts. So far, several studies showed that data assimilation could reduce the parameter uncertainty by considering soil moisture observations. However, these observations and also the model forcings were recorded with a specific measurement error. It seems a logical step to base state updating and parameter estimation on observations made at multiple time steps, in order to reduce the influence of outliers at single time steps given measurement errors and unknown model forcings. Such outliers could result in erroneous state estimation as well as inadequate parameters. This has been one of the reasons to use a smoothing technique as implemented for Bayesian data assimilation methods such as the Ensemble Kalman Filter (i.e. Ensemble Kalman Smoother). Recently, an ensemble-based smoother has been developed for state update with a SIR particle filter. However, this method has not been used for dual state-parameter estimation. In this contribution we present a Particle Smoother with sequentially smoothing of particle weights for state and parameter resampling within a time window as opposed to the single time step data assimilation used in filtering techniques. This can be seen as an intermediate variant between a parameter estimation technique using global optimization with estimation of single parameter sets valid for the whole period, and sequential Monte Carlo techniques with estimation of parameter sets evolving from one time step to another. The aims are i) to improve the forecast of evaporation and groundwater recharge by estimating hydraulic parameters, and ii) to reduce the impact of single erroneous model inputs/observations by a smoothing method. In order to validate the performance of the proposed method in a real world application, the experiment is conducted in a lysimeter environment.

  20. A case study of identify importance of land use planning in road safety, Benidorm

    Energy Technology Data Exchange (ETDEWEB)

    Casares Blanco, J.; Sanchez Galiano, J.C.; Fernandez Aracil, P.; Ortuño Padilla, A.

    2016-07-01

    This research analyses how urban form, land use and urban density, may influence the incidence of traffic-related crashes injuries and deaths. It begins with a theoretical overview of studies which deal with the study of the relationship between urban patterns and road safety. Next, it details the development of a database of crash incidence and urban form at the district level for the city of Benidorm (Alicante, Spain) in 2010. Subsequently, it is developed a negative binomial approach for intra-city motor vehicle crash analysis. One-year crash data for Benidorm (the fourth largest tourism destination of Spain, after Barcelona, Madrid and San Bartolomé de Tirajana, and exclusively tourist-oriented city) are analyzed using a geographic information system (GIS) to generate relevant inputs for the analysis. In general, the study finds that a strong land use mix results on fewer road accidents, whereas accidents are more common but less severe in areas of high urban density. Finally, pedestrian accidents research showed that rural and low density environment is related to an important road accident numbers unlike tourism-oriented zones, much more safe for them. Based on these findings, the paper discusses the implications for urban design practice. (Author)

  1. Spider Transcriptomes Identify Ancient Large-Scale Gene Duplication Event Potentially Important in Silk Gland Evolution.

    Science.gov (United States)

    Clarke, Thomas H; Garb, Jessica E; Hayashi, Cheryl Y; Arensburger, Peter; Ayoub, Nadia A

    2015-06-08

    The evolution of specialized tissues with novel functions, such as the silk synthesizing glands in spiders, is likely an influential driver of adaptive success. Large-scale gene duplication events and subsequent paralog divergence are thought to be required for generating evolutionary novelty. Such an event has been proposed for spiders, but not tested. We de novo assembled transcriptomes from three cobweb weaving spider species. Based on phylogenetic analyses of gene families with representatives from each of the three species, we found numerous duplication events indicative of a whole genome or segmental duplication. We estimated the age of the gene duplications relative to several speciation events within spiders and arachnids and found that the duplications likely occurred after the divergence of scorpions (order Scorpionida) and spiders (order Araneae), but before the divergence of the spider suborders Mygalomorphae and Araneomorphae, near the evolutionary origin of spider silk glands. Transcripts that are expressed exclusively or primarily within black widow silk glands are more likely to have a paralog descended from the ancient duplication event and have elevated amino acid replacement rates compared with other transcripts. Thus, an ancient large-scale gene duplication event within the spider lineage was likely an important source of molecular novelty during the evolution of silk gland-specific expression. This duplication event may have provided genetic material for subsequent silk gland diversification in the true spiders (Araneomorphae). © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  2. Classical vs. evolved quenching parameters and procedures in scintillation measurements: The importance of ionization quenching

    International Nuclear Information System (INIS)

    Bagan, H.; Tarancon, A.; Rauret, G.; Garcia, J.F.

    2008-01-01

    The quenching parameters used to model detection efficiency variations in scintillation measurements have not evolved since the decade of 1970s. Meanwhile, computer capabilities have increased enormously and ionization quenching has appeared in practical measurements using plastic scintillation. This study compares the results obtained in activity quantification by plastic scintillation of 14 C samples that contain colour and ionization quenchers, using classical (SIS, SCR-limited, SCR-non-limited, SIS(ext), SQP(E)) and evolved (MWA-SCR and WDW) parameters and following three calibration approaches: single step, which does not take into account the quenching mechanism; two steps, which takes into account the quenching phenomena; and multivariate calibration. Two-step calibration (ionization followed by colour) yielded the lowest relative errors, which means that each quenching phenomenon must be specifically modelled. In addition, the sample activity was quantified more accurately when the evolved parameters were used. Multivariate calibration-PLS also yielded better results than those obtained using classical parameters, which confirms that the quenching phenomena must be taken into account. The detection limits for each calibration method and each parameter were close to those obtained theoretically using the Currie approach

  3. On the necessity of identifying the true parameter in adaptive LQ control

    NARCIS (Netherlands)

    Polderman, Jan W.

    1986-01-01

    In adaptive control problems one may drop the requirement of identifying the true system in order to simplify the problem of control. It will be shown that in the adaptive LQ control problem this does not at all lead to an easier problem.

  4. Promoting wellbeing in young unemployed adults: the importance of identifying meaningful patterns of time use.

    Science.gov (United States)

    Scanlan, Justin Newton; Bundy, Anita C; Matthews, Lynda R

    2011-04-01

    This study set out to explore the differences in time use between 'unemployed', 'unemployed but in education' and part-time and full-time employed 18- to 25-year-old Australians. Unemployed individuals generally experience poor health and this may be related to the way they use their time. Activity-based interventions may be one health-promoting strategy. This knowledge is important for all occupational therapists, as many service users are likely to be unemployed. Time use of unemployed 18- to 25-year-olds (measured using the Modified Occupational Questionnaire) was compared with the time use of part- and full-time employed 18- to 25-year-olds (from the 2006 Australian Time Use Survey). Individuals in the 'unemployed' groups spent significantly less time engaged in work-related activities than their employed peers. This time was reallocated mainly to recreation and leisure and household work (for both men and women) and child care and sleeping (women only). Recreation and leisure activities were generally passive, home-based activities such as watching television or 'doing nothing'. Individuals in the 'unemployed but in education' groups also spent less time in employment-related activities, but the majority of this time was reallocated to education activities. Individuals in the 'unemployed' groups spent large amounts of time engaged in potentially non-directed use of time (e.g. watching television or 'doing nothing'). Such patterns of time use have previously been associated with poor health. To support the health of unemployed individuals more effectively, occupational therapy interventions must focus on enhancing the quality of time use for this population. © 2010 The Authors. Australian Occupational Therapy Journal © 2010 Australian Association of Occupational Therapists.

  5. Bayesian importance parameter modeling of misaligned predictors: soil metal measures related to residential history and intellectual disability in children.

    Science.gov (United States)

    Onicescu, Georgiana; Lawson, Andrew B; McDermott, Suzanne; Aelion, C Marjorie; Cai, Bo

    2014-09-01

    In this paper, we propose a novel spatial importance parameter hierarchical logistic regression modeling approach that includes measurement error from misalignment. We apply this model to study the relationship between the estimated concentration of soil metals at the residence of mothers and the development of intellectual disability (ID) in their children. The data consist of monthly computerized claims data about the prenatal experience of pregnant women living in nine areas within South Carolina and insured by Medicaid during January 1, 1996 and December 31, 2001 and the outcome of ID in their children during early childhood. We excluded mother-child pairs if the mother moved to an unknown location during pregnancy. We identified an association of the ID outcome with arsenic (As) and mercury (Hg) concentration in soil during pregnancy, controlling for infant sex, maternal race, mother's age, and gestational weeks at delivery. There is some indication that Hg has a slightly higher importance in the third and fourth months of pregnancy, while As has a more uniform effect over all the months with a suggestion of a slight increase in risk in later months.

  6. Sensitivity analysis of parameters important to nuclear criticality safety of Castor X/28F spent nuclear fuel cask

    Energy Technology Data Exchange (ETDEWEB)

    Leotlela, Mosebetsi J. [Witwatersrand Univ., Johannesburg (South Africa). School of Physics; Koeberg Operating Unit, Johannesburg (South Africa). Regulations and Licensing; Malgas, Isaac [Koeberg Nuclear Power Station, Duinefontein (South Africa). Nuclear Engineering Analysis; Taviv, Eugene [ASARA consultants (PTY) LTD, Johannesburg (South Africa)

    2015-11-15

    In nuclear criticality safety analysis it is essential to ascertain how various components of the nuclear system will perform under certain conditions they may be subjected to, particularly if the components of the system are likely to be affected by environmental factors such as temperature, radiation or material composition. It is therefore prudent that a sensitivity analysis is performed to determine and quantify the response of the output to variation in any of the input parameters. In a fissile system, the output parameter of importance is the k{sub eff}. Therefore, in attempting to prevent reactivity-induced accidents, it is important for the criticality safety analyst to have a quantified degree of response for the neutron multiplication factor to perturbation in a given input parameter. This article will present the results of the perturbation of the parameters that are important to nuclear criticality safety analysis and their respective correlation equations for deriving the sensitivity coefficients.

  7. Identifying parameters in active magnetic bearing system using LFT formulation and Youla factorization

    DEFF Research Database (Denmark)

    Lauridsen, Jonas; Sekunda, André Krabdrup; Santos, Ilmar

    2015-01-01

    the LFT matrices represent the mapping of the uncertainties in and out of the full and reduced FE system matrices. Scaling the LFT matrices easily leads to the amplitudes of the uncertainty parameters., Youla Parametrization method is applied to transform the identification problem into an open...... for model-based control design and fast identification., The paper elucidates how nodal parametric uncertainties, which are easily represented in the full FE coordinate system, can be represented in the new coordinate system of the reduced model. The uncertainty is described as a single column vector...... of the system matrix A of the full FE model while it is represented as several elements spread over multiple rows and columns of the system matrix of the reduced model. The parametric uncertainty, for both the full and reduced FE model, is represented using Linear Fractional Transformation (LFT). In this way...

  8. Identifying and Prioritizing the Effective Parameters on Lack of Timeliness of Operations of Sugarcane Production using Analytical Hierarchy Process (AHP

    Directory of Open Access Journals (Sweden)

    N Monjezi

    2017-10-01

    Full Text Available Introduction Planning and scheduling of farming mechanized operations is very important. If the operation is not performed on time, yield will be reduced. Also for sugarcane, any delay in crop planting and harvesting operations reduces the yield. The most useful priority setting method for agricultural projects is the analytic hierarchy process (AHP. So, this article presents an introductry application manner of the Analytical Hierarchy Process (AHP as a mostly common method of setting agricultural projects priorities. Analytic Hierarchy process (AHP is a decision making algorithm developed by Dr. Saatyin 1980. It has many applications as documented in Decision Support System literature. Currently, this technique is widely used in complicated management decision makings which AHP was preferred from other established methodologies as it does not demand prior knowledge of the utility function; it is based on a hierarchy of criteria and attributes reflecting the understanding of the problem, and finally, because it allows relative and absolute comparisons, thus making this method a very robust tool. The purpose of this research is to identify and prioritize the effective parameters on lack of timeliness of operations of sugarcane production using AHP in Khuzestan province of Iran. Materials and Methods The effective parameters effecting on lack of timeliness of operations have been defined based on expert’s opinions. A questionnaire and personal interviews have formed the basis of this research. The study was applied to a panel of qualified informants made up of fourteen experts. Those interviewed were distributed in Sugarcane Development and By-products Company in 2013-2014. Then, by using the Analytical hierarchy process, a questionnaire was designed for defining the weight and importance of parameters affecting on lack of timeliness of operations. For this method of evaluation, three main criteria considered were yield criteria, cost criteria

  9. Importance of optimizing chromatographic conditions and mass spectrometric parameters for supercritical fluid chromatography/mass spectrometry.

    Science.gov (United States)

    Fujito, Yuka; Hayakawa, Yoshihiro; Izumi, Yoshihiro; Bamba, Takeshi

    2017-07-28

    Supercritical fluid chromatography/mass spectrometry (SFC/MS) has great potential in high-throughput and the simultaneous analysis of a wide variety of compounds, and it has been widely used in recent years. The use of MS for detection provides the advantages of high sensitivity and high selectivity. However, the sensitivity of MS detection depends on the chromatographic conditions and MS parameters. Thus, optimization of MS parameters corresponding to the SFC condition is mandatory for maximizing performance when connecting SFC to MS. The aim of this study was to reveal a way to decide the optimum composition of the mobile phase and the flow rate of the make-up solvent for MS detection in a wide range of compounds. Additionally, we also showed the basic concept for determination of the optimum values of the MS parameters focusing on the MS detection sensitivity in SFC/MS analysis. To verify the versatility of these findings, a total of 441 pesticides with a wide polarity range (logP ow from -4.21 to 7.70) and pKa (acidic, neutral and basic). In this study, a new SFC-MS interface was used, which can transfer the entire volume of eluate into the MS by directly coupling the SFC with the MS. This enabled us to compare the sensitivity or optimum MS parameters for MS detection between LC/MS and SFC/MS for the same sample volume introduced into the MS. As a result, it was found that the optimum values of some MS parameters were completely different from those of LC/MS, and that SFC/MS-specific optimization of the analytical conditions is required. Lastly, we evaluated the sensitivity of SFC/MS using fully optimized analytical conditions. As a result, we confirmed that SFC/MS showed much higher sensitivity than LC/MS when the analytical conditions were fully optimized for SFC/MS; and the high sensitivity also increase the number of the compounds that can be detected with good repeatability in real sample analysis. This result indicates that SFC/MS has potential for

  10. Histogram analysis parameters identify multiple associations between DWI and DCE MRI in head and neck squamous cell carcinoma.

    Science.gov (United States)

    Meyer, Hans Jonas; Leifels, Leonard; Schob, Stefan; Garnov, Nikita; Surov, Alexey

    2018-01-01

    Nowadays, multiparametric investigations of head and neck squamous cell carcinoma (HNSCC) are established. These approaches can better characterize tumor biology and behavior. Diffusion weighted imaging (DWI) can by means of apparent diffusion coefficient (ADC) quantitatively characterize different tissue compartments. Dynamic contrast-enhanced magnetic resonance imaging (DCE MRI) reflects perfusion and vascularization of tissues. Recently, a novel approach of data acquisition, namely histogram analysis of different images is a novel diagnostic approach, which can provide more information of tissue heterogeneity. The purpose of this study was to analyze possible associations between DWI, and DCE parameters derived from histogram analysis in patients with HNSCC. Overall, 34 patients, 9 women and 25 men, mean age, 56.7±10.2years, with different HNSCC were involved in the study. DWI was obtained by using of an axial echo planar imaging sequence with b-values of 0 and 800s/mm 2 . Dynamic T1w DCE sequence after intravenous application of contrast medium was performed for estimation of the following perfusion parameters: volume transfer constant (K trans ), volume of the extravascular extracellular leakage space (Ve), and diffusion of contrast medium from the extravascular extracellular leakage space back to the plasma (Kep). Both ADC and perfusion parameters maps were processed offline in DICOM format with custom-made Matlab-based application. Thereafter, polygonal ROIs were manually drawn on the transferred maps on each slice. For every parameter, mean, maximal, minimal, and median values, as well percentiles 10th, 25th, 75th, 90th, kurtosis, skewness, and entropy were estimated. Сorrelation analysis identified multiple statistically significant correlations between the investigated parameters. Ve related parameters correlated well with different ADC values. Especially, percentiles 10 and 75, mode, and median values showed stronger correlations in comparison to other

  11. MANIPULATION, PROFESSIONAL PRACTICES AND DEONTOLOGY IN INFORMATIONAL PHOTOGRAPHY: IDENTIFYING NEW PARAMETERS

    Directory of Open Access Journals (Sweden)

    Paulo Munhoz

    2014-06-01

    Full Text Available This paper investigates impacts of digital technologies on photographic post-production and image manipulation in information photography. An attempt is made to assess the extent to which ethical codes and conventions are being modified concerning the digital treatment of photographic images. We sought to assess whether one can identify, in the rules of photographic competitions, an embryonic process of establishment of new boundaries as to what constitutes content manipulation and what is acceptable as technical adjustments.  We observed that, in a large proportion of cases, competition rules consist of very generic guidelines regarding the acceptable procedures for photo editing, without clear distinctions between technical adjustment and manipulation. Despite such limitations, we conclude that the analysis of photographic competitions can lead to identification of observable regularities that may act as ethical standards in relation to post-production images.

  12. Manipulation, professional practices and deontology in informational photography: identifying new parameters

    Directory of Open Access Journals (Sweden)

    Paulo Munhoz

    2014-06-01

    Full Text Available This paper investigates impacts of digital technologies on photographic post-production and image manipulation in information photography. An attempt is made to assess the extent to which ethical codes and conventions are being modified concerning the digital treatment of photographic images. We sought to assess whether one can identify, in the rules of photographic competitions, an embryonic process of establishment of new boundaries as to what constitutes content manipulation and what is acceptable as technical adjustments.  We observed that, in a large proportion of cases, competition rules consist of very generic guidelines regarding the acceptable procedures for photo editing, without clear distinctions between technical adjustment and manipulation. Despite such limitations, we conclude that the analysis of photographic competitions can lead to identification of observable regularities that may act as ethical standards in relation to post-production images.

  13. On conditions and parameters important to model sensitivity for unsaturated flow through layered, fractured tuff

    International Nuclear Information System (INIS)

    Prindle, R.W.; Hopkins, P.L.

    1990-10-01

    The Hydrologic Code Intercomparison Project (HYDROCOIN) was formed to evaluate hydrogeologic models and computer codes and their use in performance assessment for high-level radioactive-waste repositories. This report describes the results of a study for HYDROCOIN of model sensitivity for isothermal, unsaturated flow through layered, fractured tuffs. We investigated both the types of flow behavior that dominate the performance measures and the conditions and model parameters that control flow behavior. We also examined the effect of different conceptual models and modeling approaches on our understanding of system behavior. The analyses included single- and multiple-parameter variations about base cases in one-dimensional steady and transient flow and in two-dimensional steady flow. The flow behavior is complex even for the highly simplified and constrained system modeled here. The response of the performance measures is both nonlinear and nonmonotonic. System behavior is dominated by abrupt transitions from matrix to fracture flow and by lateral diversion of flow. The observed behaviors are strongly influenced by the imposed boundary conditions and model constraints. Applied flux plays a critical role in determining the flow type but interacts strongly with the composite-conductivity curves of individual hydrologic units and with the stratigraphy. One-dimensional modeling yields conservative estimates of distributions of groundwater travel time only under very limited conditions. This study demonstrates that it is wrong to equate the shortest possible water-travel path with the fastest path from the repository to the water table. 20 refs., 234 figs., 10 tabs

  14. MODELING OF WATER DISTRIBUTION SYSTEM PARAMETERS AND THEIR PARTICULAR IMPORTANCE IN ENVIRONMENT ENGINEERING PROCESSES

    Directory of Open Access Journals (Sweden)

    Agnieszka Trębicka

    2016-05-01

    Full Text Available The object of this study is to present a mathematical model of water-supply network and the analysis of basic parameters of water distribution system with a digital model. The reference area is Kleosin village, municipality Juchnowiec Kościelny in podlaskie province, located at the border with Białystok. The study focused on the significance of every change related to the quality and quantity of water delivered to WDS through modeling the basic parameters of water distribution system in different variants of work in order to specify new, more rational ways of exploitation (decrease in pressure value and to define conditions for development and modernization of the water-supply network, with special analysis of the scheme, in frames of specification of the most dangerous places in the network. The analyzed processes are based on copying and developing the existing state of water distribution sub-system (the WDS with the use of mathematical modeling that includes the newest accessible computer techniques.

  15. Hidden but important parameters in Ga{sub 0.5}In{sub 0.5}P cell growth

    Energy Technology Data Exchange (ETDEWEB)

    Kurtz, S.R.; Olson, J.M.; Bertness, K.A. [National Renewable Energy Lab., Golden, CO (United States)] [and others

    1996-05-01

    Despite their best intentions, authors often omit from publications many important technical details. These omissions can lead to contradictions in the literature and inhibit {open_quotes}researchers{close_quotes} abilities to duplicate published results. Here, the authors explore {open_quote}hidden{close_quote} parameters that are usually not reported, either because they are unknown (e.g., impurity levels) or because they are considered to be of little importance. Specifically the authors focus on the effects - and how to reduce the effects - of growth parameters in nearby layers (diffusion), impurities (oxygen), and the cooldown atmosphere (hydrogen passivation).

  16. The importance of risk-aversion as a measurable psychological parameter governing risk-taking behaviour

    Science.gov (United States)

    Thomas, P. J.

    2013-09-01

    A utility function with risk-aversion as its sole parameter is developed and used to examine the well-known psychological phenomenon, whereby risk averse people adopt behavioural strategies that are extreme and apparently highly risky. The pioneering work of the psychologist, John W. Atkinson, is revisited, and utility theory is used to extend his mathematical model. His explanation of the psychology involved is improved by regarding risk-aversion not as a discrete variable with three possible states: risk averse, risk neutral and risk confident, but as continuous and covering a large range. A probability distribution is derived, the "motivational density", to describe the process of selecting tasks of different degrees of difficulty. An assessment is then made of practicable methods for measuring risk-aversion.

  17. The importance of risk-aversion as a measurable psychological parameter governing risk-taking behaviour

    International Nuclear Information System (INIS)

    Thomas, P J

    2013-01-01

    A utility function with risk-aversion as its sole parameter is developed and used to examine the well-known psychological phenomenon, whereby risk averse people adopt behavioural strategies that are extreme and apparently highly risky. The pioneering work of the psychologist, John W. Atkinson, is revisited, and utility theory is used to extend his mathematical model. His explanation of the psychology involved is improved by regarding risk-aversion not as a discrete variable with three possible states: risk averse, risk neutral and risk confident, but as continuous and covering a large range. A probability distribution is derived, the m otivational density , to describe the process of selecting tasks of different degrees of difficulty. An assessment is then made of practicable methods for measuring risk-aversion

  18. Structural, spectroscopic and energetic parameters of P-bearing species having astrophysical importance

    Directory of Open Access Journals (Sweden)

    Kevin Gooniah

    2015-12-01

    Full Text Available Molecular parameters such as equilibrium structure, dipole moment, rotational constant, harmonic frequency, IR intensity, adiabatic electron affinity, atomisation energy and ionisation potential of some P-bearing molecules PS, PO and HC3P in their neutral, cationic and anionic forms were investigated using the popular B3LYP hybrid density functional with four basis sets 6-311++G(2df,2pd, 6-311++G(3df,3pd, cc-pVTZ and aug-cc-pVTZ. The computed data conform well to those existing in the literature. Therefore, the predicted data for those molecules or ions which are not available in the literature should be reliable.

  19. The SSI TOOLBOX Source Term Model SOSIM - Screening for important radionuclides and parameter sensitivity analysis

    Energy Technology Data Exchange (ETDEWEB)

    Avila Moreno, R.; Barrdahl, R.; Haegg, C.

    1995-05-01

    The main objective of the present study was to carry out a screening and a sensitivity analysis of the SSI TOOLBOX source term model SOSIM. This model is a part of the SSI TOOLBOX for radiological impact assessment of the Swedish disposal concept for high-level waste KBS-3. The outputs of interest for this purpose were: the total released fraction, the time of total release, the time and value of maximum release rate, the dose rates after direct releases of the biosphere. The source term equations were derived and simple equations and methods were proposed for calculation of these. A literature survey has been performed in order to determine a characteristic variation range and a nominal value for each model parameter. In order to reduce the model uncertainties the authors recommend a change in the initial boundary condition for solution of the diffusion equation for highly soluble nuclides. 13 refs.

  20. Use of amplified fragment length polymorphism analysis to identify medically important Candida spp., including C-dubliniensis

    NARCIS (Netherlands)

    Borst, A; Theelen, B; Reinders, E; Boekhout, T; Fluit, AC; Savelkoul, PHM

    Non-Candida albicans Candida species are increasingly being isolated. These species show differences in levels of resistance to antimycotic agents and mortality. Therefore, it is important to be able to correctly identify the causative organism to the species level. Identification of C. dubliniensis

  1. The sodium level. An inconspicuous but very important parameter in all-volatile treatment

    Energy Technology Data Exchange (ETDEWEB)

    Bursik, Albert [PowerPlant Chemistry GmbH, Neulussheim (Germany)

    2011-07-15

    Boiler tube failure due to ''lack of sodium''? This is certainly not a common concern, yet this contribution stresses the importance of the presence of sodium in the boiler water even when applying all-volatile treatment (AVT) as a method of boiler water treatment. Sodium in the cycle (either unintentionally via sodium-contaminated makeup or intentionally through sodium hydroxide additions) may neutralize the possible acidic contaminations and help to avoid boiler tube failures due to hydrogen damage. (orig.)

  2. Life cycle assessment and residue leaching: The importance of parameter, scenario and leaching data selection

    DEFF Research Database (Denmark)

    Allegrini, Elisa; Butera, Stefania; Kosson, D.S.

    2015-01-01

    of systems and products and can be applied to waste management systems to identify environmental benefits and critical aspects thereof. From an LCA perspective, residue utilisation provides benefits such as avoiding the production and depletion of primary materials, but it can lead to environmental burdens......Residues from industrial processes and waste management systems (WMSs) have been increasingly reutilised, leading to landfilling rate reductions and the optimisation of mineral resource utilisation in society. Life cycle assessment (LCA) is a holistic methodology allowing for the analysis......, due to the potential leaching of toxic substances. In waste LCA studies where residue utilisation is included, leaching has generally been neglected. In this study, municipal solid waste incineration bottom ash (MSWI BA) was used as a case study into three LCA scenarios having different system...

  3. Preliminary study of reasonableness of important parameters used in deriving OILs for PWR accidents

    International Nuclear Information System (INIS)

    Yongsheng, L.; Shongqi, S.

    2004-01-01

    Institute of nuclear energy technology, Tsinghua university, Beijing , China ,100084 Body of Abstract: This paper introduced the definition of operational intervention level (OIL) and the derived process of default OILs recommended by IAEA firstly. Then the paper focused on the reasonableness of two parameters, R1 and R2, which is assumed in derived process of default OIL1 and OIL2 in a reactor accident. The values of R1 and R2 were calculated by the calculating program of InterRas. The source item for computing includes the accidents PWR described in Wash-1400 and France severe accident source items, and furthermore the meteorological conditions for computing are classified to three classes, which are D stability class, A stability class, and F stability class with the mixing heights of 400 meters and 4 hour exposure to the plume. The wind speed is 3m/s, 2m/s and 1m/s correspond to the stability classes. The results show that the average values of R1 and R2 in the same accident series and different meteorological conditions derived by the calculating program of InterRas are close to the presumptive values. The results also indicated the rationalization of the default OIL1 and OIL2. On the other hand, the calculating results of different accidents have considerable disparity with the presumptive values in different distances and meteorological conditions, but the mutative trends are very well-regulated on distance and meteorological conditions. So the OILs recommended by IAEA are applicable to some specified conditions. At last the paper introduced the method of revising the default OILs in terms of measurement results. (Author)

  4. The hierarchy-by-interval approach to identifying important models that need improvement in severe-accident simulation codes

    International Nuclear Information System (INIS)

    Heames, T.J.; Khatib-Rahbar, M.; Kelly, J.E.

    1995-01-01

    The hierarchy-by-interval (HBI) methodology was developed to determine an appropriate phenomena identification and ranking table for an independent peer review of severe-accident computer codes. The methodology is described, and the results of a specific code review are presented. Use of this systematic and structured approach ensures that important code models that need improvement are identified and prioritized, which allows code sponsors to more effectively direct limited resources in future code development. In addition, critical phenomenological areas that need more fundamental work, such as experimentation, are identified

  5. Dynamic Contrast-Enhanced MRI of Cervical Cancers: Temporal Percentile Screening of Contrast Enhancement Identifies Parameters for Prediction of Chemoradioresistance

    International Nuclear Information System (INIS)

    Andersen, Erlend K.F.; Hole, Knut Håkon; Lund, Kjersti V.; Sundfør, Kolbein; Kristensen, Gunnar B.; Lyng, Heidi; Malinen, Eirik

    2012-01-01

    Purpose: To systematically screen the tumor contrast enhancement of locally advanced cervical cancers to assess the prognostic value of two descriptive parameters derived from dynamic contrast-enhanced magnetic resonance imaging (DCE-MRI). Methods and Materials: This study included a prospectively collected cohort of 81 patients who underwent DCE-MRI with gadopentetate dimeglumine before chemoradiotherapy. The following descriptive DCE-MRI parameters were extracted voxel by voxel and presented as histograms for each time point in the dynamic series: normalized relative signal increase (nRSI) and normalized area under the curve (nAUC). The first to 100th percentiles of the histograms were included in a log-rank survival test, resulting in p value and relative risk maps of all percentile–time intervals for each DCE-MRI parameter. The maps were used to evaluate the robustness of the individual percentile–time pairs and to construct prognostic parameters. Clinical endpoints were locoregional control and progression-free survival. The study was approved by the institutional ethics committee. Results: The p value maps of nRSI and nAUC showed a large continuous region of percentile–time pairs that were significantly associated with locoregional control (p < 0.05). These parameters had prognostic impact independent of tumor stage, volume, and lymph node status on multivariate analysis. Only a small percentile–time interval of nRSI was associated with progression-free survival. Conclusions: The percentile–time screening identified DCE-MRI parameters that predict long-term locoregional control after chemoradiotherapy of cervical cancer.

  6. Froude Number is the Single Most Important Hydraulic Parameter for Salmonid Spawning Habitat.

    Science.gov (United States)

    Gillies, E.; Moir, H. J.

    2015-12-01

    Many gravel-bed rivers exhibit historic straightening or embanking, reducing river complexity and the available habitat for key species such as salmon. A defensible method for predicting salmonid spawning habitat is an important tool for anyone engaged in assessing a river restoration. Most empirical methods to predict spawning habitat use lookup tables of depth, velocity and substrate. However, natural site selection is different: salmon must pick a location where they can successfully build a redd, and where eggs have a sufficient survival rate. Also, using dimensional variables, such as depth and velocity, is problematic: spawning occurs in rivers of differing size, depth and velocity range. Non-dimensional variables have proven useful in other branches of fluid dynamics, and instream habitat is no different. Empirical river data has a high correlation between observed salmon redds and Froude number, without insight into why. Here we present a physics based model of spawning and bedform evolution, which shows that Froude number is indeed a rational choice for characterizing the bedform, substrate, and flow necessary for spawning. It is familiar for Froude to characterize surface waves, but Froude also characterizes longitudinal bedform in a mobile bed river. We postulate that these bedforms and their hydraulics perform two roles in salmonid spawning: allowing transport of clasts during redd building, and oxygenating eggs. We present an example of this Froude number and substrate based habitat characterization on a Scottish river for which we have detailed topography at several stages during river restoration and subsequent evolution of natural processes. We show changes to the channel Froude regime as a result of natural process and validate habitat predictions against redds observed during 2014 and 2015 spawning seasons, also relating this data to the Froude regime in other, nearby, rivers. We discuss the use of the Froude spectrum in providing an indicator of

  7. Identifying the optimal HVOF spray parameters to attain minimum porosity and maximum hardness in iron based amorphous metallic coatings

    Directory of Open Access Journals (Sweden)

    S. Vignesh

    2017-04-01

    Full Text Available Flow based Erosion – corrosion problems are very common in fluid handling equipments such as propellers, impellers, pumps in warships, submarine. Though there are many coating materials available to combat erosion–corrosion damage in the above components, iron based amorphous coatings are considered to be more effective to combat erosion–corrosion problems. High velocity oxy-fuel (HVOF spray process is considered to be a better process to coat the iron based amorphous powders. In this investigation, iron based amorphous metallic coating was developed on 316 stainless steel substrate using HVOF spray technique. Empirical relationships were developed to predict the porosity and micro hardness of iron based amorphous coating incorporating HVOF spray parameters such as oxygen flow rate, fuel flow rate, powder feed rate, carrier gas flow rate, and spray distance. Response surface methodology (RSM was used to identify the optimal HVOF spray parameters to attain coating with minimum porosity and maximum hardness.

  8. Imaging-Based Screen Identifies Laminin 411 as a Physiologically Relevant Niche Factor with Importance for i-Hep Applications

    Directory of Open Access Journals (Sweden)

    John Ong

    2018-03-01

    Full Text Available Summary: Use of hepatocytes derived from induced pluripotent stem cells (i-Heps is limited by their functional differences in comparison with primary cells. Extracellular niche factors likely play a critical role in bridging this gap. Using image-based characterization (high content analysis; HCA of freshly isolated hepatocytes from 17 human donors, we devised and validated an algorithm (Hepatocyte Likeness Index; HLI for comparing the hepatic properties of cells against a physiological gold standard. The HLI was then applied in a targeted screen of extracellular niche factors to identify substrates driving i-Heps closer to the standard. Laminin 411, the top hit, was validated in two additional induced pluripotent stem cell (iPSC lines, primary tissue, and an in vitro model of α1-antitrypsin deficiency. Cumulatively, these data provide a reference method to control and screen for i-Hep differentiation, identify Laminin 411 as a key niche protein, and underscore the importance of combining substrates, soluble factors, and HCA when developing iPSC applications. : Rashid and colleagues demonstrate the utility of a high-throughput imaging platform for identification of physiologically relevant extracellular niche factors to advance i-Heps closer to their primary tissue counterparts. The extracellular matrix (ECM protein screen identified Laminin 411 as an important niche factor facilitating i-Hep-based disease modeling in vitro. Keywords: iPS hepatocytes, extracellular niche, image-based screening, disease modeling, laminin

  9. NRC Information No. 90-01: Importance of proper response to self-identified violations by licensees

    International Nuclear Information System (INIS)

    Cunningham, R.E.

    1992-01-01

    NRC expects a high standard of compliance by its licensees and requires that licensees provide NRC accurate and complete information and that required records will also be complete and accurate in all material respects. Licensees should be aware of the importance placed by NRC on licensee programs for self detection, correction and reporting of violations or errors related to regulatory requirements. The General Statement of Policy and Procedures for NRC Enforcement Actions in Appendix C to 10 CFR Part 2 underscores the importance of licensees responding promptly and properly to self-identified violations in two ways. It is suggested that when a licensee identifies a violation involving an NRC-required record, the licensee should make a dated notation indicating identification, either on the record itself or other appropriate documentation retrievable for NRC review. The record with the self-identified violation noted should not be altered in any way to mask the correction. The licensee should determine the cause of the violation, correct the root cause of the violation, and document such findings in an appropriate manner. Licensees should also assure that if a report of the violation is required, the report is submitted to NRC in a timely manner. These actions will be considered by NRC in making any enforcement decision, and generally lead to lesser or no civil penalty

  10. Statistical analyses of scatterplots to identify important factors in large-scale simulations, 1: Review and comparison of techniques

    International Nuclear Information System (INIS)

    Kleijnen, J.P.C.; Helton, J.C.

    1999-01-01

    Procedures for identifying patterns in scatterplots generated in Monte Carlo sensitivity analyses are described and illustrated. These procedures attempt to detect increasingly complex patterns in scatterplots and involve the identification of (i) linear relationships with correlation coefficients, (ii) monotonic relationships with rank correlation coefficients, (iii) trends in central tendency as defined by means, medians and the Kruskal-Wallis statistic, (iv) trends in variability as defined by variances and interquartile ranges, and (v) deviations from randomness as defined by the chi-square statistic. A sequence of example analyses with a large model for two-phase fluid flow illustrates how the individual procedures can differ in the variables that they identify as having effects on particular model outcomes. The example analyses indicate that the use of a sequence of procedures is a good analysis strategy and provides some assurance that an important effect is not overlooked

  11. Statistical analyses of scatterplots to identify important factors in large-scale simulations, 2: robustness of techniques

    International Nuclear Information System (INIS)

    Kleijnen, J.P.C.; Helton, J.C.

    1999-01-01

    The robustness of procedures for identifying patterns in scatterplots generated in Monte Carlo sensitivity analyses is investigated. These procedures are based on attempts to detect increasingly complex patterns in the scatterplots under consideration and involve the identification of (i) linear relationships with correlation coefficients, (ii) monotonic relationships with rank correlation coefficients, (iii) trends in central tendency as defined by means, medians and the Kruskal-Wallis statistic, (iv) trends in variability as defined by variances and interquartile ranges, and (v) deviations from randomness as defined by the chi-square statistic. The following two topics related to the robustness of these procedures are considered for a sequence of example analyses with a large model for two-phase fluid flow: the presence of Type I and Type II errors, and the stability of results obtained with independent Latin hypercube samples. Observations from analysis include: (i) Type I errors are unavoidable, (ii) Type II errors can occur when inappropriate analysis procedures are used, (iii) physical explanations should always be sought for why statistical procedures identify variables as being important, and (iv) the identification of important variables tends to be stable for independent Latin hypercube samples

  12. Methods to develop site specific spectra and a review of the important parameters that influence the spectra

    International Nuclear Information System (INIS)

    Bernreuter, D.L.

    1979-05-01

    Problems with using risk analysis methodologies to estimate the seismic hazard at a site are discussed in the context of the U.S. Nuclear Regulatory Commission's Systematic Evaluation Program (SEP). Various methodologies that may reasonably define seismic hazard are outlined. The major assumptions that can lead to significant variations in the predicted hazard are identified. Guidance is provided to appropriate choices of parameters, and possible corrections that can extend the meager earthquake data base for sites located in the eastern United States are presented. A method that incorporates various interpretations of the same data is recommended

  13. Crowd-sourced Ontology for Photoleukocoria: Identifying Common Internet Search Terms for a Potentially Important Pediatric Ophthalmic Sign.

    Science.gov (United States)

    Staffieri, Sandra E; Kearns, Lisa S; Sanfilippo, Paul G; Craig, Jamie E; Mackey, David A; Hewitt, Alex W

    2018-02-01

    Leukocoria is the most common presenting sign for pediatric eye disease including retinoblastoma and cataract, with worse outcomes if diagnosis is delayed. We investigated whether individuals could identify leukocoria in photographs (photoleukocoria) and examined their subsequent Internet search behavior. Using a web-based questionnaire, in this cross-sectional study we invited adults aged over 18 years to view two photographs of a child with photoleukocoria, and then search the Internet to determine a possible diagnosis and action plan. The most commonly used search terms and websites accessed were recorded. The questionnaire was completed by 1639 individuals. Facebook advertisement was the most effective recruitment strategy. The mean age of all respondents was 38.95 ± 14.59 years (range, 18-83), 94% were female, and 59.3% had children. An abnormality in the images presented was identified by 1613 (98.4%) participants. The most commonly used search terms were: "white," "pupil," "photo," and "eye" reaching a variety of appropriate websites or links to print or social media articles. Different words or phrases were used to describe the same observation of photoleukocoria leading to a range of websites. Variations in the description of observed signs and search words influenced the sites reached, information obtained, and subsequent help-seeking intentions. Identifying the most commonly used search terms for photoleukocoria is an important step for search engine optimization. Being directed to the most appropriate websites informing of the significance of photoleukocoria and the appropriate actions to take could improve delays in diagnosis of important pediatric eye disease such as retinoblastoma or cataract.

  14. Assessment of quantitative FDG PET data in primary colorectal tumours: which parameters are important with respect to tumour detection?

    International Nuclear Information System (INIS)

    Strauss, Ludwig G.; Pan, Leyun; Dimitrakopoulou-Strauss, Antonia; Klippel, Sven; Schoenleben, Klaus; Haberkorn, Uwe

    2007-01-01

    The impact of quantitative parameters on the differentiation of primary colorectal tumours from normal colon tissue was assessed. Dynamic PET data (DPET) were acquired, and compartment and non-compartment modelling applied. The discriminant power of single parameters and the combination of PET parameters was assessed. All lesions were confirmed by histology. FDG DPET studies were acquired in 22 patients with colorectal tumours prior to surgery. Five of these patients also had liver metastases at the time of the PET study. The SUV 56-60 min p.i. was included in the evaluation. A two-tissue compartment model was applied and the parameters k 1 -k 4 as well as the fractional blood volume (V B ) were obtained. The FDG influx was calculated from the compartment data. Non-compartment modelling was used to calculate the fractal dimension (FD) of the time-activity data. FD, SUV, influx and k 3 were the most important single parameters for lesion differentiation. The highest accuracy was achieved for FD (88.78%). The overall tracer uptake was mainly dependent on k 3 and not on k 1 or V B . The support vector machines (SVM) algorithm was used to predict the classification based on the combination of individual PET parameters. The overall accuracy was 97.3%, with only one false positive case and no false negative results. The analysis of the subgroup of five patients with primary tumours and synchronous metastases revealed no significant differences for the individual PET parameters. However, V B tended to be lower while k 1 and k 2 were higher in patients with synchronous metastases. The SVM classification analysis predicted the presence of metastases based on the PET data of the primary tumour in three of five patients. Quantitative FDG PET studies provide very accurate data for the differentiation of primary colorectal tumours from normal tissue. The use of quantitative data has the advantage that the detection of a colorectal tumour is not primarily dependent on the

  15. On-line use of personal computers to monitor and evaluate important parameters in the research reactor DHRUVA

    International Nuclear Information System (INIS)

    Sharma, S.K.; Sengupta, S.N.; Darbhe, M.D.; Agarwal, S.K.

    1998-01-01

    The on-line use of Personal Computers in research reactors, with custom made applications for aiding the operators in analysing plant conditions under normal and abnormal situations, has become extremely popular. A system has been developed to monitor and evaluate important parameters for the research reactor DHRUVA, a 100 MW research reactor located at the Bhabha Atomic Research Centre, Trombay. The system was essentially designed for on-line computation of the following parameters: reactor thermal power, reactivity load due to Xenon, core reactivity balance and performance monitoring of shut-down devices. Apart from the on-line applications, the system has also been developed to cater some off-line applications with Local Area Network in the Dhruva complex. The microprocessor based system is designed to function as an independent unit, parallel dumping the acquired data to a PC for application programmes. The user interface on the personal computer is menu driven application software written in 'C' language. The main input parameters required for carrying out the options given in the above menu are: Reactor power, Moderator level, Coolant inlet temperature to the core, Secondary coolant flow rate, temperature rise of secondary coolant across the heat exchangers, heavy water level in the Dump tank and Drop time of individual shut off rods. (author)

  16. Identifying and Characterizing Important Trembling Aspen Competitors with Juvenile Lodgepole Pine in Three South-Central British Columbia Ecosystems

    Directory of Open Access Journals (Sweden)

    Teresa A. Newsome

    2012-01-01

    Full Text Available Critical height ratios for predicting competition between trembling aspen and lodgepole pine were identified in six juvenile stands in three south-central British Columbia ecosystems. We used a series of regression analyses predicting pine stem diameter from the density of neighbouring aspen in successively shorter relative height classes to identify the aspen-pine height ratio that maximized R2. Critical height ratios varied widely among sites when stands were 8–12 years old but, by age 14–19, had converged at 1.25–1.5. Maximum R2 values at age 14–19 ranged from 13.4% to 69.8%, demonstrating that the importance of aspen competition varied widely across a relatively small geographic range. Logistic regression also indicated that the risk of poor pine vigour in the presence of aspen varied between sites. Generally, the degree of competition, risk to pine vigour, and size of individual aspen contributing to the models declined along a gradient of decreasing ecosystem productivity.

  17. Use of DNA sequences to identify forensically important fly species and their distribution in the coastal region of Central California.

    Science.gov (United States)

    Nakano, Angie; Honda, Jeff

    2015-08-01

    Forensic entomology has gained prominence in recent years, as improvements in DNA technology and molecular methods have allowed insect and other arthropod evidence to become increasingly useful in criminal and civil investigations. However, comprehensive faunal inventories are still needed, including cataloging local DNA sequences for forensically significant Diptera. This multi-year fly-trapping study was built upon and expanded a previous survey of these flies in Santa Clara County, including the addition of genetic barcoding data from collected species of flies. Flies from the families Calliphoridae, Sarcophagidae, and Muscidae were trapped in meat-baited traps set in a variety of locations throughout the county. Flies were identified using morphological features and confirmed by molecular analysis. A total of 16 calliphorid species, 11 sarcophagid species, and four muscid species were collected and differentiated. This study found more species of flies than previous area surveys and established new county records for two calliphorid species: Cynomya cadaverina and Chrysomya rufifacies. Differences were found in fly fauna in different areas of the county, indicating the importance of microclimates in the distribution of these flies. Molecular analysis supported the use of DNA barcoding as an effective method of identifying cryptic fly species. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  18. Combining Methods to Describe Important Marine Habitats for Top Predators: Application to Identify Biological Hotspots in Tropical Waters.

    Science.gov (United States)

    Thiers, Laurie; Louzao, Maite; Ridoux, Vincent; Le Corre, Matthieu; Jaquemet, Sébastien; Weimerskirch, Henri

    2014-01-01

    In tropical waters resources are usually scarce and patchy, and predatory species generally show specific adaptations for foraging. Tropical seabirds often forage in association with sub-surface predators that create feeding opportunities by bringing prey close to the surface, and the birds often aggregate in large multispecific flocks. Here we hypothesize that frigatebirds, a tropical seabird adapted to foraging with low energetic costs, could be a good predictor of the distribution of their associated predatory species, including other seabirds (e.g. boobies, terns) and subsurface predators (e.g., dolphins, tunas). To test this hypothesis, we compared distribution patterns of marine predators in the Mozambique Channel based on a long-term dataset of both vessel- and aerial surveys, as well as tracking data of frigatebirds. By developing species distribution models (SDMs), we identified key marine areas for tropical predators in relation to contemporaneous oceanographic features to investigate multi-species spatial overlap areas and identify predator hotspots in the Mozambique Channel. SDMs reasonably matched observed patterns and both static (e.g. bathymetry) and dynamic (e.g. Chlorophyll a concentration and sea surface temperature) factors were important explaining predator distribution patterns. We found that the distribution of frigatebirds included the distributions of the associated species. The central part of the channel appeared to be the best habitat for the four groups of species considered in this study (frigatebirds, brown terns, boobies and sub-surface predators).

  19. Combining Methods to Describe Important Marine Habitats for Top Predators: Application to Identify Biological Hotspots in Tropical Waters.

    Directory of Open Access Journals (Sweden)

    Laurie Thiers

    Full Text Available In tropical waters resources are usually scarce and patchy, and predatory species generally show specific adaptations for foraging. Tropical seabirds often forage in association with sub-surface predators that create feeding opportunities by bringing prey close to the surface, and the birds often aggregate in large multispecific flocks. Here we hypothesize that frigatebirds, a tropical seabird adapted to foraging with low energetic costs, could be a good predictor of the distribution of their associated predatory species, including other seabirds (e.g. boobies, terns and subsurface predators (e.g., dolphins, tunas. To test this hypothesis, we compared distribution patterns of marine predators in the Mozambique Channel based on a long-term dataset of both vessel- and aerial surveys, as well as tracking data of frigatebirds. By developing species distribution models (SDMs, we identified key marine areas for tropical predators in relation to contemporaneous oceanographic features to investigate multi-species spatial overlap areas and identify predator hotspots in the Mozambique Channel. SDMs reasonably matched observed patterns and both static (e.g. bathymetry and dynamic (e.g. Chlorophyll a concentration and sea surface temperature factors were important explaining predator distribution patterns. We found that the distribution of frigatebirds included the distributions of the associated species. The central part of the channel appeared to be the best habitat for the four groups of species considered in this study (frigatebirds, brown terns, boobies and sub-surface predators.

  20. The comparison of dairy performance and some reproductive parameters of holstein cows imported from Sweden and their Polish age mates

    Directory of Open Access Journals (Sweden)

    Ewa Czerniawska-Piątkowska

    2007-01-01

    Full Text Available The general aim of the present work was to compare dairy performance and some reproductive parameters of Holstein-Friesian (HF cows imported from Sweden as an in-calf heifers, and their age mates in Poland. The animals were kept freely on the deep litter on the farm owned by Agro-company “Witkowo” and feeding was based on TMR (total mixed ration system during whole year. All ration’s ingredients (bulky feed, concentrate, miscellaneous additives were mixed and fed as all-mash. The feed ration depended from the physiological condition of a cow and it was composed of corn and grass ensilage, mash concentrate, crushed corn meal, brewer’s grains and beet pulp.Cows imported from Sweden as in-calf heifers obtained higher milk, fat and protein yield in both lactations comparing to home cows. Significant statistical differences were observed for kg of milk, kg of protein, for FCM (P<0.01 and for kg of fat (P<0.05 in 2nd lactation. Fat and protein content in milk was in average higher for home cows (P<0.01. Big differences (P<0.01 were observed in SBT (proportion of protein to fat content and RTB (difference between concentration of fat and protein at imported cows in 2nd lactation. As far as reproduction parameters (gestation interval, calving interval, insemination index are concerned was cows from Sweden better too. Heifers from Sweden calved earlier. The usage of high genetic potential of imported cows is possible only with providing them optimum living conditions suitable to their needs.

  1. Identifying the effects of parameter uncertainty on the reliability of modeling the stability of overhanging, multi-layered, river banks

    Science.gov (United States)

    Samadi, A.; Amiri-Tokaldany, E.; Davoudi, M. H.; Darby, S. E.

    2011-11-01

    Composite river banks consist of a basal layer of non-cohesive material overlain by a cohesive layer of fine-grained material. In such banks, fluvial erosion of the lower, non-cohesive, layer typically occurs at a much higher rate than erosion of the upper part of the bank. Consequently, such banks normally develop a cantilevered bank profile, with bank retreat of the upper part of the bank taking place predominantly by the failure of these cantilevers. To predict the undesirable impacts of this type of bank retreat, a number of bank stability models have been presented in the literature. These models typically express bank stability by defining a factor of safety as the ratio of resisting and driving forces acting on the incipient failure block. These forces are affected by a range of controlling factors that include such aspects as the overhanging block geometry, and the geotechnical properties of the bank materials. In this paper, we introduce a new bank stability relation (for shear-type cantilever failures) that considers the hydrological status of cantilevered riverbanks, while beam-type failures are analyzed using a previously proposed relation. We employ these stability models to evaluate the effects of parameter uncertainty on the reliability of riverbank stability modeling of overhanging banks. This is achieved by employing a simple model of overhanging failure with respect to shear and beam failure mechanisms in a series of sensitivity tests and Monte Carlo analyses to identify, for each model parameter, the range of values that induce significant changes in the simulated factor of safety. The results show that care is required in parameterising (i) the geometrical shape of the overhanging-block and (ii) the bank material cohesion and unit weight, as predictions of bank stability are sensitive to variations of these factors.

  2. Molecular characterization of NRXN1 deletions from 19,263 clinical microarray cases identifies exons important for neurodevelopmental disease expression

    Science.gov (United States)

    Lowther, Chelsea; Speevak, Marsha; Armour, Christine M.; Goh, Elaine S.; Graham, Gail E.; Li, Chumei; Zeesman, Susan; Nowaczyk, Malgorzata J.M.; Schultz, Lee-Anne; Morra, Antonella; Nicolson, Rob; Bikangaga, Peter; Samdup, Dawa; Zaazou, Mostafa; Boyd, Kerry; Jung, Jack H.; Siu, Victoria; Rajguru, Manjulata; Goobie, Sharan; Tarnopolsky, Mark A.; Prasad, Chitra; Dick, Paul T.; Hussain, Asmaa S.; Walinga, Margreet; Reijenga, Renske G.; Gazzellone, Matthew; Lionel, Anath C.; Marshall, Christian R.; Scherer, Stephen W.; Stavropoulos, Dimitri J.; McCready, Elizabeth; Bassett, Anne S.

    2016-01-01

    Purpose The purpose of the current study was to assess the penetrance of NRXN1 deletions. Methods We compared the prevalence and genomic extent of NRXN1 deletions identified among 19,263 clinically referred cases to that of 15,264 controls. The burden of additional clinically relevant CNVs was used as a proxy to estimate the relative penetrance of NRXN1 deletions. Results We identified 41 (0.21%) previously unreported exonic NRXN1 deletions ascertained for developmental delay/intellectual disability, significantly greater than in controls [OR=8.14 (95% CI 2.91–22.72), p< 0.0001)]. Ten (22.7%) of these had a second clinically relevant CNV. Subjects with a deletion near the 3′ end of NRXN1 were significantly more likely to have a second rare CNV than subjects with a 5′ NRXN1 deletion [OR=7.47 (95% CI 2.36–23.61), p=0.0006]. The prevalence of intronic NRXN1 deletions was not statistically different between cases and controls (p=0.618). The majority (63.2%) of intronic NRXN1 deletion cases had a second rare CNV, a two-fold greater prevalence than for exonic NRXN1 deletion cases (p=0.0035). Conclusions The results support the importance of exons near the 5′ end of NRXN1 in the expression of neurodevelopmental disorders. Intronic NRXN1 deletions do not appear to substantially increase the risk for clinical phenotypes. PMID:27195815

  3. Gene Expression Profiling Identifies Important Genes Affected by R2 Compound Disrupting FAK and P53 Complex

    International Nuclear Information System (INIS)

    Golubovskaya, Vita M.; Ho, Baotran; Conroy, Jeffrey; Liu, Song; Wang, Dan; Cance, William G.

    2014-01-01

    Focal Adhesion Kinase (FAK) is a non-receptor kinase that plays an important role in many cellular processes: adhesion, proliferation, invasion, angiogenesis, metastasis and survival. Recently, we have shown that Roslin 2 or R2 (1-benzyl-15,3,5,7-tetraazatricyclo[3.3.1.1~3,7~]decane) compound disrupts FAK and p53 proteins, activates p53 transcriptional activity, and blocks tumor growth. In this report we performed a microarray gene expression analysis of R2-treated HCT116 p53 +/+ and p53 −/− cells and detected 1484 genes that were significantly up- or down-regulated (p < 0.05) in HCT116 p53 +/+ cells but not in p53 −/− cells. Among up-regulated genes in HCT p53 +/+ cells we detected critical p53 targets: Mdm-2, Noxa-1, and RIP1. Among down-regulated genes, Met, PLK2, KIF14, BIRC2 and other genes were identified. In addition, a combination of R2 compound with M13 compound that disrupts FAK and Mmd-2 complex or R2 and Nutlin-1 that disrupts Mdm-2 and p53 decreased clonogenicity of HCT116 p53 +/+ colon cancer cells more significantly than each agent alone in a p53-dependent manner. Thus, the report detects gene expression profile in response to R2 treatment and demonstrates that the combination of drugs targeting FAK, Mdm-2, and p53 can be a novel therapy approach

  4. DNA-SIP identifies sulfate-reducing Clostridia as important toluene degraders in tar-oil-contaminated aquifer sediment

    Energy Technology Data Exchange (ETDEWEB)

    Winderl, C.; Penning, H.; von Netzer, F.; Meckenstock, R.U.; Lueders, T. [Helmholtz Zentrum Munchen, Neuherberg (Germany)

    2010-10-15

    Global groundwater resources are constantly challenged by a multitude of contaminants such as aromatic hydrocarbons. Especially in anaerobic habitats, a large diversity of unrecognized microbial populations may be responsible for their degradation. Still, our present understanding of the respective microbiota and their ecophysiology is almost exclusively based on a small number of cultured organisms, mostly within the Proteobacteria. Here, by DNA-based stable isotope probing (SIP), we directly identified the most active sulfate-reducing toluene degraders in a diverse sedimentary microbial community originating from a tar-oil-contaminated aquifer at a former coal gasification plant. On incubation of fresh sediments with {sup 13}C{sub 7}-toluene, the production of both sulfide and (CS{sub 2}){sup 13}CO{sub 2} was clearly coupled to the {sup 13}Clabeling of DNA of microbes related to Desulfosporosinus spp. within the Peptococcaceae (Clostridia). The screening of labeled DNA fractions also suggested a novel benzylsuccinate synthase alpha-subunit (bssA) sequence type previously only detected in the environment to be tentatively affiliated with these degraders. However, carbon flow from the contaminant into degrader DNA was only similar to 50%, pointing toward high ratios of heterotrophic CS{sub 2}-fixation during assimilation of acetyl-CoA originating from the contaminant by these degraders. These findings demonstrate that the importance of non-proteobacterial populations in anaerobic aromatics degradation, as well as their specific ecophysiology in the subsurface may still be largely ungrasped.

  5. Evaluation of bentonite alteration due to interactions with iron. Sensitivity analyses to identify the important factors for the bentonite alteration

    International Nuclear Information System (INIS)

    Sasamoto, Hiroshi; Wilson, James; Sato, Tsutomu

    2013-01-01

    Performance assessment of geological disposal systems for high-level radioactive waste requires a consideration of long-term systems behaviour. It is possible that the alteration of swelling clay present in bentonite buffers might have an impact on buffer functions. In the present study, iron (as a candidate overpack material)-bentonite (I-B) interactions were evaluated as the main buffer alteration scenario. Existing knowledge on alteration of bentonite during I-B interactions was first reviewed, then the evaluation methodology was developed considering modeling techniques previously used overseas. A conceptual model for smectite alteration during I-B interactions was produced. The following reactions and processes were selected: 1) release of Fe 2+ due to overpack corrosion; 2) diffusion of Fe 2+ in compacted bentonite; 3) sorption of Fe 2+ on smectite edge and ion exchange in interlayers; 4) dissolution of primary phases and formation of alteration products. Sensitivity analyses were performed to identify the most important factors for the alteration of bentonite by I-B interactions. (author)

  6. Importance of (n,xn) reactions in evaluating kinetic parameters of subcritical assemblies: from classic to modern formalism

    Energy Technology Data Exchange (ETDEWEB)

    Talamo, Alberto; Gohar, Yousry, E-mail: alby@anl.gov [Argonne National Laboratory, Lemont, IL (United States); Dulla, Sandra; Ravetto, Piero [Politecnico di Torino (Italy)

    2011-07-01

    The importance of (n,xn) reactions must be taken into consideration while calculating the kinetic parameters of subcritical assemblies driven by an external neutron source. This study is divided into two parts, the first part is dedicated to the classic definition of the neutron source multiplication factor and two alternative calculation methodologies are compared. The second part considers a new definition of the kinetic parameters for subcritical assemblies, with particular emphasis on the delayed neutron fraction and generation time. This new definition has been modified to take into account the external neutron source and (n,xn) reactions, which increase the fraction of prompt neutrons. The developed theoretical framework has been applied by Monte Carlo and deterministic calculations to the YALINA Thermal subcritical assembly in Belarus. This facility can be driven by californium, deuterium-deuterium (D-D), or deuterium-tritium (D-T) external neutron sources. For the D-T neutron source, (n,xn) reactions must be taken into account in order to produce accurate results because the average energy of D-T source neutrons is 14.1 MeV, a value much higher than the threshold energy of the (n,2n) cross section of uranium isotopes. (author)

  7. Importance of (n,xn) reactions in evaluating kinetic parameters of subcritical assemblies: from classic to modern formalism

    International Nuclear Information System (INIS)

    Talamo, Alberto; Gohar, Yousry; Dulla, Sandra; Ravetto, Piero

    2011-01-01

    The importance of (n,xn) reactions must be taken into consideration while calculating the kinetic parameters of subcritical assemblies driven by an external neutron source. This study is divided into two parts, the first part is dedicated to the classic definition of the neutron source multiplication factor and two alternative calculation methodologies are compared. The second part considers a new definition of the kinetic parameters for subcritical assemblies, with particular emphasis on the delayed neutron fraction and generation time. This new definition has been modified to take into account the external neutron source and (n,xn) reactions, which increase the fraction of prompt neutrons. The developed theoretical framework has been applied by Monte Carlo and deterministic calculations to the YALINA Thermal subcritical assembly in Belarus. This facility can be driven by californium, deuterium-deuterium (D-D), or deuterium-tritium (D-T) external neutron sources. For the D-T neutron source, (n,xn) reactions must be taken into account in order to produce accurate results because the average energy of D-T source neutrons is 14.1 MeV, a value much higher than the threshold energy of the (n,2n) cross section of uranium isotopes. (author)

  8. Calculation of the number of branches of multi-valued decision trees in computer aided importance rank of parameters

    Directory of Open Access Journals (Sweden)

    Tiszbierek Agnieszka

    2017-01-01

    Full Text Available An elaborated digital computer programme supporting the time-consuming process of selecting the importance rank of construction and operation parameters by means of stating optimum sets is based on the Quine – McCluskey algorithm of minimizing individual partial multi-valued logic functions. The example with real time data, calculated by means of the programme, showed that among the obtained optimum sets there were such which had a different number of real branches after being presented on the multi-valued logic decision tree. That is why an idea of elaborating another functionality of the programme – a module calculating the number of branches of real, multi-valued logic decision trees presenting optimum sets chosen by the programme was pursued. This paper presents the idea and the method for developing a module calculating the number of branches, real for each of optimum sets indicated by the programme, as well as to the calculation process.

  9. Identifying important and feasible policies and actions for health at community sports clubs: a consensus-generating approach.

    Science.gov (United States)

    Kelly, Bridget; King, Lesley; Bauman, Adrian E; Baur, Louise A; Macniven, Rona; Chapman, Kathy; Smith, Ben J

    2014-01-01

    Children's high participation in organised sport in Australia makes sport an ideal setting for health promotion. This study aimed to generate consensus on priority health promotion objectives for community sports clubs, based on informed expert judgements. Delphi survey using three structured questionnaires. Forty-six health promotion, nutrition, physical activity and sport management/delivery professionals were approached to participate in the survey. Questionnaires used an iterative process to determine aspects of sports clubs deemed necessary for developing healthy sporting environments for children. Initially, participants were provided with a list of potential standards for a range of health promotion areas and asked to rate standards based on their importance and feasibility, and any barriers to implementation. Subsequently, participants were provided with information that summarised ratings for each standard to indicate convergence of the group, and asked to review and potentially revise their responses where they diverged. In a third round, participants ranked confirmed standards by priority. 26 professionals completed round 1, 21 completed round 2, and 18 completed round 3. The highest ranked standards related to responsible alcohol practices, availability of healthy food and drinks at sports canteens, smoke-free club facilities, restricting the sale and consumption of alcohol during junior sporting activities, and restricting unhealthy food and beverage company sponsorship. Identifying and prioritising health promotion areas that are relevant to children's sports clubs assists in focusing public health efforts and may guide future engagement of sports clubs. Approaches for providing informational and financial support to clubs to operationalise these standards are proposed. Copyright © 2013 Sports Medicine Australia. Published by Elsevier Ltd. All rights reserved.

  10. Identifying organisational principles and management practices important to the quality of health care services for chronic conditions.

    Science.gov (United States)

    Frølich, Anne

    2012-02-01

    effect of financial incentives and public performance reporting on the behaviour of professionals and quality of care. Using secondary data, KP and the Danish health care system were compared in terms of six central dimensions: population, health care professionals, health care organisations, utilization patterns, quality measurements, and costs. Differences existed between the two systems on all dimensions, complicating the interpretation of findings. For instance, observed differences might be due to similar tendencies in the two health care systems that were observed at different times, rather than true structural differences. The expenses in the two health care systems were corrected for differences in the populations served and the purchasing power of currencies. However, no validated methods existed to correct for observed differences in case-mixes of chronic conditions. Data from a population of about half a million patients with diabetes in a large U.S. integrated health care delivery system affiliated with 41 medical centers employing 15 different CCM management practices was the basis for identifying effective management practices. Through the use of statistical modelling, the management practice of provider alerts was identified as most effective for promoting screening for hemoglobin A1c and lipid profile. The CCM was used as a framework for implementing four rehabilitation programs. The model promoted continuity of care and quality of health care services. New management practices were developed in the study, and known practices were further developed. However, the observational nature of the study limited the generalisability of the findings. In a structured literature survey focusing on the effect of financial incentives and public performance reporting on the quality of health care services, few studies documenting an effect were identified. The results varied, and important program aspects or contextual variables were often omitted. A model describing

  11. Surgeon Reported Outcome Measure for Spine Trauma an International Expert Survey Identifying Parameters Relevant for The Outcome of Subaxial Cervical Spine Injuries

    NARCIS (Netherlands)

    Sadiqi, Said; Verlaan, Jorrit Jan; Lehr, A. M.; Dvorak, Marcel F.; Kandziora, Frank; Rajasekaran, S.; Schnake, Klaus J.; Vaccaro, Alexander R.; Oner, F. C.

    2016-01-01

    STUDY DESIGN.: International web-based survey OBJECTIVE.: To identify clinical and radiological parameters that spine surgeons consider most relevant when evaluating clinical and functional outcomes of subaxial cervical spine trauma patients. SUMMARY OF BACKGROUND DATA.: While an outcome instrument

  12. Mango (Mangifera indica L.) cv. Kent fruit mesocarp de novo transcriptome assembly identifies gene families important for ripening

    Science.gov (United States)

    Fruit ripening is a physiological and biochemical process genetically programmed to regulate fruit quality parameters like firmness, flavor, odor and color, as well as production of ethylene in climacteric fruit. In this study, a transcriptomic analysis of mango (Mangifera indica L.) mesocarp cv. "K...

  13. Identifying Important Gaps in Randomized Controlled Trials of Adult Cardiac Arrest Treatments: A Systematic Review of the Published Literature

    Science.gov (United States)

    Sinha, Shashank S.; Sukul, Devraj; Lazarus, John J.; Polavarapu, Vivek; Chan, Paul S.; Neumar, Robert W.; Nallamothu, Brahmajee K.

    2016-01-01

    Background Cardiac arrests are a major public health concern worldwide. The extent and types of randomized controlled trials (RCTs) – our most reliable source of clinical evidence – conducted in these high-risk patients over recent years are largely unknown. Methods and Results We performed a systematic review, identifying all RCTs published in PubMed, EMBASE, Scopus, Web of Science, and the Cochrane Library from 1995 to 2014 that focused on acute treatment of non-traumatic cardiac arrest in adults. We then extracted data on the setting of study populations, types and timing of interventions studied, risk of bias, outcomes reported and how these factors have changed over time. Over this twenty-year period, 92 RCTs were published containing 64,309 patients (median, 225.5 per trial). Of these, 81 RCTs (88.0%) involved out-of-hospital cardiac arrest whereas 4 (4.3%) involved in-hospital cardiac arrest and 7 (7.6%) included both. Eighteen RCTs (19.6%) were performed in the U.S., 68 (73.9%) were performed outside the U.S., and 6 (6.5%) were performed in both settings. Thirty-eight RCTs (41.3%) evaluated drug therapy, 39 (42.4%) evaluated device therapy, and 15 (16.3%) evaluated protocol improvements. Seventy-four RCTs (80.4%) examined interventions during the cardiac arrest, 15 (16.3%) examined post-cardiac arrest treatment, and 3 (3.3%) studied both. Overall, reporting of risk of bias was limited. The most common outcome reported was ROSC: 86 (93.5%) with only 22 (23.9%) reporting survival beyond 6 months. Fifty-three RCTs (57.6%) reported global ordinal outcomes whereas 15 (16.3%) reported quality-of-life. RCTs in the last 5 years were more likely to be focused on protocol improvement and post-cardiac arrest care. Conclusions Important gaps in RCTs of cardiac arrest treatments exist, especially those examining in-hospital cardiac arrest, protocol improvement, post-cardiac arrest care, and long-term or quality-of-life outcomes. PMID:27756794

  14. Correlations between blood lead levels and some physiological and biochemical parameters of nutritional importance in some Nigerian women

    International Nuclear Information System (INIS)

    Ojo, J.O.; Oketayo, O.O.; Salawu, A.A.

    2011-01-01

    Lead is one of the common toxic materials widely occurring in the Nigerian environment. Even with the change to unleaded petrol, other significant sources still remain to be addressed. The deleterious impact of lead on human health, is well documented. The effects range from attention-grabbing mass mortality - as happened in Zamfara State recently, to no less serious but grossly neglected neurocognitive and neurodevelopmental effects, including lowered intelligence quotient scores. All these impacts are most serious in children, especially fetuses who receive their burden from their mothers. Ninety percent of lead in most adults resides in the bones with a half-life measured in decades. Therefore, fetuses and breast-fed children in this generation will remain seriously at risk of exposure to damaging lead levels no matter the efforts to rid our external environment of lead in the years to come. In this work, we have investigated the correlation between Blood Lead Levels (BLL) and up to 35 physiological and biochemical parameters of nutritional importance in 62 women of child-bearing age from lIe-lfe, Nigeria. BLL was determined in venous blood using Inductively- coupled plasma Mass Spectrometry. Our results show that BLL significantly correlates with Packed Cell Volume (PCV), Creatine Clearance, and the ratio of Low-density Lipids to High density Lipids in these women. When the subjects were stratified into different Nutritional Status group based on their Body Mass Index, significant correlation was found between BLL and Age but only in Obese subjects.

  15. Applying data mining techniques to determine important parameters in chronic kidney disease and the relations of these parameters to each other.

    Science.gov (United States)

    Tahmasebian, Shahram; Ghazisaeedi, Marjan; Langarizadeh, Mostafa; Mokhtaran, Mehrshad; Mahdavi-Mazdeh, Mitra; Javadian, Parisa

    2017-01-01

    Introduction: Chronic kidney disease (CKD) includes a wide range of pathophysiological processes which will be observed along with abnormal function of kidneys and progressive decrease in glomerular filtration rate (GFR). According to the definition decreasing GFR must have been present for at least three months. CKD will eventually result in end-stage kidney disease. In this process different factors play role and finding the relations between effective parameters in this regard can help to prevent or slow progression of this disease. There are always a lot of data being collected from the patients' medical records. This huge array of data can be considered a valuable source for analyzing, exploring and discovering information. Objectives: Using the data mining techniques, the present study tries to specify the effective parameters and also aims to determine their relations with each other in Iranian patients with CKD. Material and Methods: The study population includes 31996 patients with CKD. First, all of the data is registered in the database. Then data mining tools were used to find the hidden rules and relationships between parameters in collected data. Results: After data cleaning based on CRISP-DM (Cross Industry Standard Process for Data Mining) methodology and running mining algorithms on the data in the database the relationships between the effective parameters was specified. Conclusion: This study was done using the data mining method pertaining to the effective factors on patients with CKD.

  16. Monitoring early hydration of reinforced concrete structures using structural parameters identified by piezo sensors via electromechanical impedance technique

    Science.gov (United States)

    Talakokula, Visalakshi; Bhalla, Suresh; Gupta, Ashok

    2018-01-01

    Concrete is the most widely used material in civil engineering construction. Its life begins when the hydration process is activated after mixing the cement granulates with water. In this paper, a non-dimensional hydration parameter, obtained from piezoelectric ceramic (PZT) patches bonded to rebars embedded inside concrete, is employed to monitor the early age hydration of concrete. The non-dimensional hydration parameter is derived from the equivalent stiffness determined from the piezo-impedance transducers using the electro-mechanical impedance (EMI) technique. The focus of the study is to monitor the hydration process of cementitious materials commencing from the early hours and continue till 28 days using single non-dimensional parameter. The experimental results show that the proposed piezo-based non-dimensional hydration parameter is very effective in monitoring the early age hydration, as it has been derived from the refined structural impedance parameters, obtained by eliminating the PZT contribution, and using both the real and imaginary components of the admittance signature.

  17. Copper corrosion in bentonite: Studying of parameters (pH, Eh/O2) of importance for Cu corrosion

    International Nuclear Information System (INIS)

    Carlsson, T.; Muurinen, A.

    2007-06-01

    The report describes the development of methods and equipment for studying the parameters (pH, Eh/O 2 ) of importance for copper corrosion. The work involved the fabrication of electrodes for determining Eh and pH in compacted water-saturated bentonite. MX-80 and the Indian Asha 505 bentonites were used in the study. The redox-measurements were carried out by using electrodes prepared of Au and Pt wires. The pH measurements were carried out by using solid IrO x electrodes. The report describes testing of electrodes in different solutions and in bentonite. A destructive method for determining oxygen content in compacted bentonite was tested, too. The electrodes were used in measurements inside compacted bentonite with about the same density as is intended to be used in the Finnish repository for spent nuclear fuel. The results indicate that Au and Pt redox-electrodes and IrO x pH electrodes function in compacted bentonite. The oxygen measurement in bentonite seems to work, too, and can complement the Eh measurements. Eh-values in originally aerobic bentonite samples having a dry densitiy of ≤1.5 g/cm 3 , exhibit mostly a decrease during the first days, which may mainly be ascribed to the depletion of oxygen. The Eh-decrease thereafter is probably associated with redox-reactions involving other species than oxygen. In samples with a dry density of 1.8 g/cm 3 , the observed Eh-decrease is mostly slower. No significant difference between the Eh and pH measurements in MX-80 and Asha 505 could be observed. (orig.)

  18. Identifying organisational principles and management practices important to the quality of health care services for chronic conditions

    DEFF Research Database (Denmark)

    Frølich, Anne

    2012-01-01

    are limited, it is necessary to identify efficient methods to improve the quality of care. Comparing health care systems is a well-known method for identifying new knowledge regarding, for instance, organisational methods and principles. Kaiser Permanente (KP), an integrated health care delivery system...... in the U.S., is recognized as providing high-quality chronic care; to some extent, this is due to KP's implementation of the chronic care model (CCM). This model recommends a range of evidence-based management practices that support the implementation of evidence-based medicine. However, it is not clear...... which management practices in the CCM are most efficient and in what combinations. In addition, financial incentives and public reporting of performance are often considered effective at improving the quality of health care services, but this has not yet been definitively proved....

  19. Integrated physiological, biochemical and molecular analysis identifies important traits and mechanisms associated with differential response of rice genotypes to elevated temperature

    Directory of Open Access Journals (Sweden)

    Boghireddy eSailaja

    2015-11-01

    Full Text Available In changing climate, heat stress caused by high temperature poses a serious threat to rice cultivation. A multiple organizational analysis at physiological, biochemical and molecular level is required to fully understand the impact of elevated temperature in rice. This study was aimed at deciphering the elevated temperature response in eleven popular and mega rice cultivars widely grown in India. Physiological and biochemical traits specifically membrane thermostability (MTS, antioxidants, and photosynthesis were studied at vegetative and reproductive phases which were used to establish a correlation with grain yield under stress. Several useful traits in different genotypes were identified which will be important resource to develop high temperature tolerant rice cultivars. Interestingly, Nagina22 emerged as best performer in terms of yield as well as expression of physiological and biochemical traits at elevated temperature. It showed lesser relative injury, lesser reduction in chlorophyll content, increased super oxide dismutase, catalase and peroxidase activity, lesser reduction in net photosynthetic rate (PN, high transpiration rate (E and other photosynthetic/ fluorescence parameters contributing to least reduction in spikelet fertility and grain yield at elevated temperature. Further, expression of 14 genes including heat shock transcription factors and heat shock proteins was analyzed in Nagina22 (tolerant and Vandana (susceptible at flowering phase, strengthening the fact that N22 performs better at molecular level also during elevated temperature. This study shows that elevated temperature response is complex and involves multiple biological processes which are needed to be characterized to address the challenges of future climate extreme conditions.

  20. Comparative Mapping of Soil Physical-Chemical and Structural Parameters at Field Scale to Identify Zones of Enhanced Leaching Risk

    DEFF Research Database (Denmark)

    Nørgaard, Trine; Møldrup, Per; Olsen, Preben

    2013-01-01

    Preferential flow and particle-facilitated transport through macropores contributes significantly to the transport of strongly sorbing substances such as pesticides and phosphorus. The aim of this study was to perform a field-scale characterization of basic soil physical properties like clay...... and organic carbon content and investigate whether it was possible to relate these to derived structural parameters such as bulk density and conservative tracer parameters and to actual particle and phosphorus leaching patterns obtained from laboratory leaching experiments. Sixty-five cylindrical soil columns...... of 20 cm height and 20 cm diameter and bulk soil were sampled from the topsoil in a 15 m  15 m grid in an agricultural loamy field. Highest clay contents and highest bulk densities were found in the northern part of the field. Leaching experiments with a conservative tracer showed fast 5% tracer...

  1. Application of Multi-Valued Weighting Logical Functions in the Analysis of a Degree of Importance of Construction Parameters on the Example of Hydraulic Valves

    Science.gov (United States)

    Deptuła, A.

    2014-08-01

    In the optimization process, changes in the construction parameters value influence the behaviour of functions depending on time. Weighting logical coefficients for the stabilisation time are taken into consideration here, i.e., a shorter (better) stabilisation time has a more important (bigger) value of the weighting coefficient. An example of applying weighting logical functions in the analysis of a degree of importance of construction parameters of a hydraulic valve is presented in the paper

  2. Assessing the relative importance of parameter and forcing uncertainty and their interactions in conceptual hydrological model simulations

    Science.gov (United States)

    Mockler, E. M.; Chun, K. P.; Sapriza-Azuri, G.; Bruen, M.; Wheater, H. S.

    2016-11-01

    Predictions of river flow dynamics provide vital information for many aspects of water management including water resource planning, climate adaptation, and flood and drought assessments. Many of the subjective choices that modellers make including model and criteria selection can have a significant impact on the magnitude and distribution of the output uncertainty. Hydrological modellers are tasked with understanding and minimising the uncertainty surrounding streamflow predictions before communicating the overall uncertainty to decision makers. Parameter uncertainty in conceptual rainfall-runoff models has been widely investigated, and model structural uncertainty and forcing data have been receiving increasing attention. This study aimed to assess uncertainties in streamflow predictions due to forcing data and the identification of behavioural parameter sets in 31 Irish catchments. By combining stochastic rainfall ensembles and multiple parameter sets for three conceptual rainfall-runoff models, an analysis of variance model was used to decompose the total uncertainty in streamflow simulations into contributions from (i) forcing data, (ii) identification of model parameters and (iii) interactions between the two. The analysis illustrates that, for our subjective choices, hydrological model selection had a greater contribution to overall uncertainty, while performance criteria selection influenced the relative intra-annual uncertainties in streamflow predictions. Uncertainties in streamflow predictions due to the method of determining parameters were relatively lower for wetter catchments, and more evenly distributed throughout the year when the Nash-Sutcliffe Efficiency of logarithmic values of flow (lnNSE) was the evaluation criterion.

  3. Identifying criteria and establishing parameters for forest-based ecotourism in northern Ontario, Canada. NODA note No. 7

    Energy Technology Data Exchange (ETDEWEB)

    Boyd, S.W.; Butler, R.W.; Haider, W.

    1995-12-31

    Describes a methodology for identifying ecotourism destination sites based first on determining the criteria and attributes of ecotourism, and secondly by matching the value range of these criteria to the region`s resource base inventory. The paper discusses problems in defining ecotourism and in identifying linkages between this and other forms of tourism and related environmental management concepts in the context of explaining difficulties in selecting appropriate ecotourism criteria. Elements of ecotourism suitable to northern Ontario area also presented along with the criteria and the methodology, which is based on the use of geographic information systems technology. A final section addresses implications of the methodology for resource managers and tourism operators.

  4. Identifying diabetes-related important protein targets with few interacting partners with the PageRank algorithm.

    Science.gov (United States)

    Grolmusz, Vince I

    2015-04-01

    Diabetes is a growing concern for the developed nations worldwide. New genomic, metagenomic and gene-technologic approaches may yield considerable results in the next several years in its early diagnosis, or in advances in therapy and management. In this work, we highlight some human proteins that may serve as new targets in the early diagnosis and therapy. With the help of a very successful mathematical tool for network analysis that formed the basis of the early successes of Google(TM), Inc., we analyse the human protein-protein interaction network gained from the IntAct database with a mathematical algorithm. The novelty of our approach is that the new protein targets suggested do not have many interacting partners (so, they are not hubs or super-hubs), so their inhibition or promotion probably will not have serious side effects. We have identified numerous possible protein targets for diabetes therapy and/or management; some of these have been well known for a long time (these validate our method), some of them appeared in the literature in the last 12 months (these show the cutting edge of the algorithm), and the remainder are still unknown to be connected with diabetes, witnessing completely new hits of the method.

  5. Gene expression profiling and candidate gene resequencing identifies pathways and mutations important for malignant transformation caused by leukemogenic fusion genes.

    Science.gov (United States)

    Novak, Rachel L; Harper, David P; Caudell, David; Slape, Christopher; Beachy, Sarah H; Aplan, Peter D

    2012-12-01

    NUP98-HOXD13 (NHD13) and CALM-AF10 (CA10) are oncogenic fusion proteins produced by recurrent chromosomal translocations in patients with acute myeloid leukemia (AML). Transgenic mice that express these fusions develop AML with a long latency and incomplete penetrance, suggesting that collaborating genetic events are required for leukemic transformation. We employed genetic techniques to identify both preleukemic abnormalities in healthy transgenic mice as well as collaborating events leading to leukemic transformation. Candidate gene resequencing revealed that 6 of 27 (22%) CA10 AMLs spontaneously acquired a Ras pathway mutation and 8 of 27 (30%) acquired an Flt3 mutation. Two CA10 AMLs acquired an Flt3 internal-tandem duplication, demonstrating that these mutations can be acquired in murine as well as human AML. Gene expression profiles revealed a marked upregulation of Hox genes, particularly Hoxa5, Hoxa9, and Hoxa10 in both NHD13 and CA10 mice. Furthermore, mir196b, which is embedded within the Hoxa locus, was overexpressed in both CA10 and NHD13 samples. In contrast, the Hox cofactors Meis1 and Pbx3 were differentially expressed; Meis1 was increased in CA10 AMLs but not NHD13 AMLs, whereas Pbx3 was consistently increased in NHD13 but not CA10 AMLs. Silencing of Pbx3 in NHD13 cells led to decreased proliferation, increased apoptosis, and decreased colony formation in vitro, suggesting a previously unexpected role for Pbx3 in leukemic transformation. Published by Elsevier Inc.

  6. Identifying Combination of Friction Stir Welding Parameters to Maximize Strength of Lap Joints of AA2014-T6 Aluminum Alloy

    Directory of Open Access Journals (Sweden)

    Rajendrana C.

    2017-01-01

    Full Text Available AA2014 aluminum alloy (Al-Cu alloy has been widely utilized in fabrication of lightweight structures like aircraft structures, demanding high strength to weight ratio and good corrosion resistance. The fusion welding of these alloys will lead to solidification problems such as hot cracking. Friction stir welding is a new solid state welding process, in which the material being welded does not melt and recast. Lot of research works have been carried out by many researchers to optimize process parameters and establish empirical relationships to predict tensile strength of friction stir welded butt joints of aluminum alloys. However, very few investigations have been carried out on friction stir welded lap joints of aluminum alloys. Hence, in this investigation, an attempt has been made to optimize friction stir lap welding (FSLW parameters to attain maximum tensile strength using statistical tools such as design of experiment (DoE, analysis of variance (ANOVA, response graph and contour plots. By this method, it is found that maximum tensile shear fracture load of 12.76 kN can be achieved if a joint is made using tool rotational speed of 900 rpm, welding speed of 110 mm/min, tool shoulder diameter of 12 mm and tool tilt angle of 1.5°.

  7. Phase analysis for the assessment of left ventricular dyssynchrony by Gated Myocardial Perfusion SPECT. Importance of clinical and technical parameters

    Directory of Open Access Journals (Sweden)

    Víctor Marín-Oyaga

    2017-07-01

    Conclusions: The new PA tool of nuclear medicine is feasible in our context. The type of stress, the administered dose, the study phase or the gamma camera used did not affect the parameters. However, gender, interventricular conduction disorders, necrosis and systolic dysfunction did have an impact on them.

  8. Using the apparent diffusion coefficient to identifying MGMT promoter methylation status early in glioblastoma: importance of analytical method

    Energy Technology Data Exchange (ETDEWEB)

    Rundle-Thiele, Dayle [Centre for Clinical Research, University of Queensland, Brisbane, Queensland (Australia); Day, Bryan; Stringer, Brett [Brain Cancer Research Unit, Queensland Institute of Medical Research, Brisbane, Queensland (Australia); Fay, Michael [Department of Radiation Oncology, Royal Brisbane and Women' s Hospital, Brisbane, Queensland (Australia); Martin, Jennifer [Discipline of Clinical Pharmacology, School of Medicine and Public Health, University of Newcastle, Newcastle, New South Wales (Australia); Jeffree, Rosalind L [Department of Neurosurgery, Royal Brisbane and Women' s Hospital, Brisbane, Queensland (Australia); Thomas, Paul [Queensland PET Service, Royal Brisbane and Women' s Hospital, Brisbane, Queensland (Australia); Bell, Christopher [Centre for Clinical Research, University of Queensland, Brisbane, Queensland (Australia); Salvado, Olivier [CSIRO Digital Productivity Flagship, CSIRO, Herston, Queensland (Australia); Gal, Yaniv [Centre for Medical Diagnostic Technologies in Queensland, University of Queensland, Brisbane, Queensland (Australia); Coulthard, Alan [Discipline of Medical Imaging, University of Queensland, St Lucia, Queensland (Australia); Department of Medical Imaging, Royal Brisbane and Women' s Hospital, Brisbane, Queensland (Australia); Crozier, Stuart [Centre for Medical Diagnostic Technologies in Queensland, University of Queensland, Brisbane, Queensland (Australia); Rose, Stephen, E-mail: stephen.rose@csiro.au [CSIRO Digital Productivity Flagship, CSIRO, Herston, Queensland (Australia); Centre for Clinical Research, University of Queensland, Brisbane, Queensland (Australia)

    2015-06-15

    Accurate knowledge of O{sup 6}-methylguanine methyltransferase (MGMT) gene promoter subtype in patients with glioblastoma (GBM) is important for treatment. However, this test is not always available. Pre-operative diffusion MRI (dMRI) can be used to probe tumour biology using the apparent diffusion coefficient (ADC); however, its ability to act as a surrogate to predict MGMT status has shown mixed results. We investigated whether this was due to variations in the method used to analyse ADC. We undertook a retrospective study of 32 patients with GBM who had MGMT status measured. Matching pre-operative MRI data were used to calculate the ADC within contrast enhancing regions of tumour. The relationship between ADC and MGMT was examined using two published ADC methods. A strong trend between a measure of ‘minimum ADC’ and methylation status was seen. An elevated minimum ADC was more likely in the methylated compared to the unmethylated MGMT group (U = 56, P = 0.0561). In contrast, utilising a two-mixture model histogram approach, a significant reduction in mean measure of the ‘low ADC’ component within the histogram was associated with an MGMT promoter methylation subtype (P < 0.0246). This study shows that within the same patient cohort, the method selected to analyse ADC measures has a significant bearing on the use of that metric as a surrogate marker of MGMT status. Thus for dMRI data to be clinically useful, consistent methods of data analysis need to be established prior to establishing any relationship with genetic or epigenetic profiling.

  9. Using the apparent diffusion coefficient to identifying MGMT promoter methylation status early in glioblastoma: importance of analytical method

    International Nuclear Information System (INIS)

    Rundle-Thiele, Dayle; Day, Bryan; Stringer, Brett; Fay, Michael; Martin, Jennifer; Jeffree, Rosalind L; Thomas, Paul; Bell, Christopher; Salvado, Olivier; Gal, Yaniv; Coulthard, Alan; Crozier, Stuart; Rose, Stephen

    2015-01-01

    Accurate knowledge of O 6 -methylguanine methyltransferase (MGMT) gene promoter subtype in patients with glioblastoma (GBM) is important for treatment. However, this test is not always available. Pre-operative diffusion MRI (dMRI) can be used to probe tumour biology using the apparent diffusion coefficient (ADC); however, its ability to act as a surrogate to predict MGMT status has shown mixed results. We investigated whether this was due to variations in the method used to analyse ADC. We undertook a retrospective study of 32 patients with GBM who had MGMT status measured. Matching pre-operative MRI data were used to calculate the ADC within contrast enhancing regions of tumour. The relationship between ADC and MGMT was examined using two published ADC methods. A strong trend between a measure of ‘minimum ADC’ and methylation status was seen. An elevated minimum ADC was more likely in the methylated compared to the unmethylated MGMT group (U = 56, P = 0.0561). In contrast, utilising a two-mixture model histogram approach, a significant reduction in mean measure of the ‘low ADC’ component within the histogram was associated with an MGMT promoter methylation subtype (P < 0.0246). This study shows that within the same patient cohort, the method selected to analyse ADC measures has a significant bearing on the use of that metric as a surrogate marker of MGMT status. Thus for dMRI data to be clinically useful, consistent methods of data analysis need to be established prior to establishing any relationship with genetic or epigenetic profiling

  10. A procedure to identify and to assess risk parameters in a SCR (Steel Catenary Riser) due to the fatigue failure

    Energy Technology Data Exchange (ETDEWEB)

    Stefane, Wania [Universidade Estadual de Campinas (UNICAMP), Campinas, SP (Brazil). Faculdade de Engenharia Mecanica; Morooka, Celso K. [Universidade Estadual de Campinas (UNICAMP), Campinas, SP (Brazil). Dept. de Engenharia de Petroleo. Centro de Estudos de Petroleo; Pezzi Filho, Mario [PETROBRAS S.A., Rio de Janeiro, RJ (Brazil). E and P. ENGP/IPMI/ES; Matt, Cyntia G.C.; Franciss, Ricardo [PETROBRAS S.A., Rio de Janeiro, RJ (Brazil). Centro de Pesquisas (CENPES)

    2009-12-19

    The discovery of offshore fields in ultra deep water and the presence of reservoirs located in great depths below the seabed requires innovative solutions for offshore oil production systems. Many riser configurations have emerged as economically viable technological solutions for these scenarios. Therefore the study and the development of methodologies applied to riser design and procedures to calculate and to dimension production risers, taken into account the effects of mete ocean conditions, such as waves, current and platform motion in the fatigue failure is fundamental. The random nature of these conditions as well as the mechanical characteristics of the riser components are critical to a probabilistic treatment to ensure the greatest reliability for risers and minimum risks associated to different aspects of the operation like the safety of the installation, economical concerns and the environment. The current work presents a procedure of the identification and the assessment of main parameters of risk when considering fatigue failure. Static and dynamic behavior of Steel Catenary Riser (SCR) under the effects of mete ocean conditions and uncertainties related to total cumulative damage (Miner-Palmgren's rule) are taken into account. The methodology adopted is probabilistic and the approach is analytical. The procedure is based on the First Order Reliability Method (FORM) which usually presents low computational effort and acceptable accuracy. The procedure suggested is applied for two practical cases, one using data available from the literature and the second with data collected from an actual Brazilian offshore field operation. For both cases, results of the probability of failure due to fatigue were obtained for different locations along the SCR length connected to a semi-submersible platform. From these results, the sensitivity of the probability of failure due to fatigue for a SCR could be verified, and the most effective parameter could also be

  11. Identifying design parameters controlling damage behaviors of continuous fiber-reinforced thermoplastic composites using micromechanics as a virtual testing tool

    KAUST Repository

    Pulungan, Ditho Ardiansyah; Lubineau, Gilles; Yudhanto, Arief; Yaldiz, Recep; Schijve, Warden

    2017-01-01

    In this paper, we propose a micromechanical approach to predict damage mechanisms and their interactions in glass fibers/polypropylene thermoplastic composites. First, a representative volume element (RVE) of such materials was rigorously determined using a geometrical two-point probability function and the eigenvalue stabilization of homogenized elastic tensor obtained by Hill-Mandel kinematic homogenization. Next, the 3D finite element models of the RVE were developed accordingly. The fibers were modeled with an isotropic linear elastic material. The matrix was modeled with an isotropic linear elastic, rate-independent hyperbolic Drucker-Prager plasticity coupled with a ductile damage model that is able to show pressure dependency of the yield and damage behavior often found in a thermoplastic material. In addition, cohesive elements were inserted into the fiber-matrix interfaces to simulate debonding. The RVE faces are imposed with periodical boundary conditions to minimize the edge effect. The RVE was then subjected to transverse tensile loading in accordance with experimental tensile tests on [90]8 laminates. The model prediction was found to be in very good agreement with the experimental results in terms of the global stress-strain curves, including the linear and nonlinear portion of the response and also the failure point, making it a useful virtual testing tool for composite material design. Furthermore, the effect of tailoring the main parameters of thermoplastic composites is investigated to provide guidelines for future improvements of these materials.

  12. Identifying design parameters controlling damage behaviors of continuous fiber-reinforced thermoplastic composites using micromechanics as a virtual testing tool

    KAUST Repository

    Pulungan, Ditho Ardiansyah

    2017-03-31

    In this paper, we propose a micromechanical approach to predict damage mechanisms and their interactions in glass fibers/polypropylene thermoplastic composites. First, a representative volume element (RVE) of such materials was rigorously determined using a geometrical two-point probability function and the eigenvalue stabilization of homogenized elastic tensor obtained by Hill-Mandel kinematic homogenization. Next, the 3D finite element models of the RVE were developed accordingly. The fibers were modeled with an isotropic linear elastic material. The matrix was modeled with an isotropic linear elastic, rate-independent hyperbolic Drucker-Prager plasticity coupled with a ductile damage model that is able to show pressure dependency of the yield and damage behavior often found in a thermoplastic material. In addition, cohesive elements were inserted into the fiber-matrix interfaces to simulate debonding. The RVE faces are imposed with periodical boundary conditions to minimize the edge effect. The RVE was then subjected to transverse tensile loading in accordance with experimental tensile tests on [90]8 laminates. The model prediction was found to be in very good agreement with the experimental results in terms of the global stress-strain curves, including the linear and nonlinear portion of the response and also the failure point, making it a useful virtual testing tool for composite material design. Furthermore, the effect of tailoring the main parameters of thermoplastic composites is investigated to provide guidelines for future improvements of these materials.

  13. Identifying consumer preferences for specific beef flavor characteristics in relation to cattle production and postmortem processing parameters.

    Science.gov (United States)

    O'Quinn, T G; Woerner, D R; Engle, T E; Chapman, P L; Legako, J F; Brooks, J C; Belk, K E; Tatum, J D

    2016-02-01

    Sensory analysis of ground LL samples representing 12 beef product categories was conducted in 3 different regions of the U.S. to identify flavor preferences of beef consumers. Treatments characterized production-related flavor differences associated with USDA grade, cattle type, finishing diet, growth enhancement, and postmortem aging method. Consumers (N=307) rated cooked samples for 12 flavors and overall flavor desirability. Samples were analyzed to determine fatty acid content. Volatile compounds produced by cooking were extracted and quantified. Overall, consumers preferred beef that rated high for beefy/brothy, buttery/beef fat, and sweet flavors and disliked beef with fishy, livery, gamey, and sour flavors. Flavor attributes of samples higher in intramuscular fat with greater amounts of monounsaturated fatty acids and lesser proportions of saturated, odd-chain, omega-3, and trans fatty acids were preferred by consumers. Of the volatiles identified, diacetyl and acetoin were most closely correlated with desirable ratings for overall flavor and dimethyl sulfide was associated with an undesirable sour flavor. Copyright © 2015 Elsevier Ltd. All rights reserved.

  14. Identifying key demographic parameters of a small island–associated population of Indo-Pacific bottlenose dolphins (Reunion, Indian Ocean)

    Science.gov (United States)

    Estrade, Vanessa; Fayan, Jacques

    2017-01-01

    Photo-identification surveys of Indo-Pacific bottlenose dolphins were conducted from 2009 to 2014 off Reunion Island (55°E33’/21°S07’), in the Indian Ocean. Robust Design models were applied to produce the most reliable estimate of population abundance and survival rate, while accounting for temporary emigration from the survey area (west coast). The sampling scheme consisted of a five-month (June–October) sampling period in each year of the study. The overall population size at Reunion was estimated to be 72 individuals (SE = 6.17, 95%CI = 61–85), based on a random temporary emigration (γ”) of 0.096 and a proportion of 0.70 (SE = 0.03) distinct individuals. The annual survival rate was 0.93 (±0.018 SE, 95%CI = 0.886–0.958) and was constant over time and between sexes. Models considering gender groups indicated different movement patterns between males and females. Males showed null or quasi-null temporary emigration (γ” = γ’ < 0.01), while females showed a random temporary emigration (γ”) of 0.10, suggesting that a small proportion of females was outside the survey area during each primary sampling period. Sex-specific temporary migration patterns were consistent with movement and residency patterns observed in other areas. The Robust Design approach provided an appropriate sampling scheme for deriving island-associated population parameters, while allowing to restrict survey effort both spatially (i.e. west coast only) and temporally (five months per year). Although abundance and survival were stable over the six years, the small population size of fewer than 100 individuals suggested that this population is highly vulnerable. Priority should be given to reducing any potential impact of human activity on the population and its habitat. PMID:28640918

  15. Identifying key demographic parameters of a small island-associated population of Indo-Pacific bottlenose dolphins (Reunion, Indian Ocean).

    Science.gov (United States)

    Dulau, Violaine; Estrade, Vanessa; Fayan, Jacques

    2017-01-01

    Photo-identification surveys of Indo-Pacific bottlenose dolphins were conducted from 2009 to 2014 off Reunion Island (55°E33'/21°S07'), in the Indian Ocean. Robust Design models were applied to produce the most reliable estimate of population abundance and survival rate, while accounting for temporary emigration from the survey area (west coast). The sampling scheme consisted of a five-month (June-October) sampling period in each year of the study. The overall population size at Reunion was estimated to be 72 individuals (SE = 6.17, 95%CI = 61-85), based on a random temporary emigration (γ") of 0.096 and a proportion of 0.70 (SE = 0.03) distinct individuals. The annual survival rate was 0.93 (±0.018 SE, 95%CI = 0.886-0.958) and was constant over time and between sexes. Models considering gender groups indicated different movement patterns between males and females. Males showed null or quasi-null temporary emigration (γ" = γ' < 0.01), while females showed a random temporary emigration (γ") of 0.10, suggesting that a small proportion of females was outside the survey area during each primary sampling period. Sex-specific temporary migration patterns were consistent with movement and residency patterns observed in other areas. The Robust Design approach provided an appropriate sampling scheme for deriving island-associated population parameters, while allowing to restrict survey effort both spatially (i.e. west coast only) and temporally (five months per year). Although abundance and survival were stable over the six years, the small population size of fewer than 100 individuals suggested that this population is highly vulnerable. Priority should be given to reducing any potential impact of human activity on the population and its habitat.

  16. Identifying key demographic parameters of a small island-associated population of Indo-Pacific bottlenose dolphins (Reunion, Indian Ocean.

    Directory of Open Access Journals (Sweden)

    Violaine Dulau

    Full Text Available Photo-identification surveys of Indo-Pacific bottlenose dolphins were conducted from 2009 to 2014 off Reunion Island (55°E33'/21°S07', in the Indian Ocean. Robust Design models were applied to produce the most reliable estimate of population abundance and survival rate, while accounting for temporary emigration from the survey area (west coast. The sampling scheme consisted of a five-month (June-October sampling period in each year of the study. The overall population size at Reunion was estimated to be 72 individuals (SE = 6.17, 95%CI = 61-85, based on a random temporary emigration (γ" of 0.096 and a proportion of 0.70 (SE = 0.03 distinct individuals. The annual survival rate was 0.93 (±0.018 SE, 95%CI = 0.886-0.958 and was constant over time and between sexes. Models considering gender groups indicated different movement patterns between males and females. Males showed null or quasi-null temporary emigration (γ" = γ' < 0.01, while females showed a random temporary emigration (γ" of 0.10, suggesting that a small proportion of females was outside the survey area during each primary sampling period. Sex-specific temporary migration patterns were consistent with movement and residency patterns observed in other areas. The Robust Design approach provided an appropriate sampling scheme for deriving island-associated population parameters, while allowing to restrict survey effort both spatially (i.e. west coast only and temporally (five months per year. Although abundance and survival were stable over the six years, the small population size of fewer than 100 individuals suggested that this population is highly vulnerable. Priority should be given to reducing any potential impact of human activity on the population and its habitat.

  17. Important operational parameters of membrane bioreactor-sludge disintegration (MBR-SD) system for zero excess sludge production.

    Science.gov (United States)

    Yoon, Seong-Hoon

    2003-04-01

    In order to prevent excess sludge production during wastewater treatment, a membrane bioreactor-sludge disintegration (MBR-SD) system has been introduced, where the disintegrated sludge is recycled to the bioreactor as a feed solution. In this study, a mathematical model was developed by incorporating a sludge disintegration term into the conventional activated sludge model and the relationships among the operational parameters were investigated. A new definition of F/M ratio for the MBR-SD system was suggested to evaluate the actual organic loading rate. The actual F/M ratio was expected to be much higher than the apparent F/M ratio in MBR-SD. The kinetic parameters concerning the biodegradability of organics hardly affect the system performance. Instead, sludge solubilization ratio (alpha) in the SD process and particulate hydrolysis rate constant (k(h)) in biological reaction determine the sludge disintegration number (SDN), which is related with the overall economics of the MBR-SD system. Under reasonable alpha and k(h) values, SDN would range between 3 and 5 which means the amount of sludge required to be disintegrated would be 3-5 times higher for preventing a particular amount of sludge production. Finally, normalized sludge disintegration rate (q/V) which is needed to maintain a certain level of MLSS in the MBR-SD system was calculated as a function of F/V ratio.

  18. Flexibility, stroke, and dimensionless parameters: the importance of telling the whole story for swimming micro-organisms in complex fluids

    Science.gov (United States)

    Thomases, Becca; Guy, Robert

    2015-11-01

    The question of how fluid elasticity affects the swimming performance of micro-organisms is complicated and has been the subject of many recent experimental and theoretical studies. The Deborah number, De = λω , is typically used to characterize the strength of the fluid elasticity in these studies, and for swimmers is expressed as the product of the elastic relaxation time and the frequency of the swimmer stroke. In simulations of undulatory flexible swimmers in an Oldroyd-B-type fluid, we find that varying the frequency of the stroke and varying the relaxation time separately results in a significantly different dependence of swimming speed for the same De . Thus the elastic effects on swimming cannot be characterized by a single dimensionless number. The Weissenberg number, defined as the product of elastic relaxation time and characteristic strain rate (Wi = λγ˙), is another dimensionless parameter useful for describing complex fluids. For a fixed swimmer frequency, varying the relaxation time will also vary the Weissenberg number. We conjecture that the different behavior is a consequence of a Weissenberg-number transition in the fluid, which additionally depends on the amplitude of the swimmer stroke.

  19. Triangulating Principal Effectiveness: How Perspectives of Parents, Teachers, and Assistant Principals Identify the Central Importance of Managerial Skills. Working Paper 35

    Science.gov (United States)

    Grissom, Jason A.; Loeb, Susanna

    2009-01-01

    While the importance of effective principals is undisputed, few studies have addressed what specific skills principals need to promote school success. This study draws on unique data combining survey responses from principals, assistant principals, teachers and parents with rich administrative data to identify which principal skills matter most…

  20. Cost-effectiveness modeling for neuropathic pain treatments: investigating the relative importance of parameters using an open-source model.

    Science.gov (United States)

    Hirst, Matthew; Bending, Matthew W; Baio, Gianluca; Yesufu-Udechuku, Amina; Dunlop, William C N

    2018-06-08

    The study objective was to develop an open-source replicate of a cost-effectiveness model developed by National Institute for Health and Care (NICE) in order to explore uncertainties in health economic modeling of novel pharmacological neuropathic pain treatments. The NICE model, consisting of a decision tree with branches for discrete levels of pain relief and adverse event (AE) severities, was replicated using R and used to compare a hypothetical neuropathic pain drug to pregabalin. Model parameters were sourced from NICE's clinical guidelines and associated with probability distributions to account for underlying uncertainty. A simulation-based scenario analysis was conducted to assess how uncertainty in efficacy and AEs affected the net monetary benefit (NMB) for the hypothetical treatment at a cost-effectiveness threshold of £20,000 per QALY. Relative to pregabalin, an increase in efficacy was associated with greater NMB than an improvement in tolerability. A greater NMB was observed when efficacy was marginally higher than that of pregabalin while maintaining the same level of AEs than when efficacy was equivalent to pregabalin but with a more substantial reduction in AEs. In the latter scenario, the NMB was only positive at a low cost-effectiveness threshold. The replicate model shares the limitations described in the NICE guidelines. There is a lack of support in scientific literature for the assumption that increased efficacy is associated with a greater reduction in tolerability. The replicate model also included a single comparator, unlike the NICE model. Pain relief is a stronger driver of NMB than tolerability at a cost-effectiveness threshold of £20,000 per QALY. Health technology assessment decisions which are influenced by NICE's model may reward efficacy gains even if they are associated with more severe AEs. This contrasts with recommendations from clinical guidelines for neuropathic pain which place more equal weighting on improvements in

  1. Willingness to Use Microbicides Is Affected by the Importance of Product Characteristics, Use Parameters, and Protective Properties

    Science.gov (United States)

    Morrow, Kathleen M.; Fava, Joseph L.; Rosen, Rochelle K.; Vargas, Sara; Barroso, Candelaria; Christensen, Anna L.; Woodsong, Cynthia; Severy, Lawrence

    2008-01-01

    Background Along with efficacy, a microbicide’s acceptability will be integral to its impact on the pandemic. Understanding Product Characteristics that users find most acceptable and determining who will use which type of product are key to optimizing use effectiveness. Objectives To evaluate psychometrically the Important Microbicide Characteristics (IMC) instrument and examine its relationship to willingness to use microbicides. Results Exploratory and confirmatory factor analyses revealed 2 IMC subscales (Cronbach’s coefficient α: Product Characteristics subscale (α = 0.84) and Protective Properties subscale (α = 0.89)). Significant differences on Product Characteristics subscale scores were found for history of douching (P = 0.002) and employment status (P = 0.001). Whether a woman used a method to prevent pregnancy or sexually transmitted disease (STD) in the last 3 months (P IMC instrument serves as a template for future studies of candidate microbicides. PMID:17325607

  2. COMPARISON OF PRODUCTION PARAMETERS BETWEEN THE FIRST GENERATION OF A-LINE IMPORTED AND BRED GILTS ON THE NUCLEUS FARM VELIKA BRANJEVINA

    Directory of Open Access Journals (Sweden)

    Dragica Dubravac

    2013-06-01

    Full Text Available Comparison of productive parameters of two analyzed groups (the first generation of imported gilts and the gilts born on the domestic farm was conducted on a nucleus farm that imported the gilt lines from the TOPIGS breeding program. For the purposes of the nucleus pig farm, TOPIGS gilts were imported from Netherlands. The nucleus farm where the analysis of the two groups’ productive parameters was conducted imported the ancestral and grandfather lines to produce the parenting generation TOPIGS 40 sows which are bred with a Pietrain line of boars. The TOPIGS 40 sow is an animal based on A-line and B-line characterized by high fertility rate, excellent maternal characteristics, good capacity for growth, and quality meaty body. The analysis of productive parameters of the two observed groups of gilts (the first generation of 105 imported gilts and 88 gilts born on the domestic farm resulted in significantly higher number of total born, born alive and weaned piglets after the first farrowing (P<0.001 as well as significantly higher number of total born and born alive piglets at third farrowing (P<0.05. The results of the observed qualities confirm the fact that, apart from the unquestionable genetic potential, other factors such as adaptation, accommodation conditions, microclimate, nutrition, and management have a significant effect on the increase of production results.

  3. Leaching of polycyclic aromatic hydrocarbons from power plant lignite ash--influence of parameters important for environmental pollution.

    Science.gov (United States)

    Pergal, Miodrag M; Relić, Dubravka; Tešić, Zivoslav Lj; Popović, Aleksandar R

    2014-03-01

    Nikola Tesla B power plant (TENT B), located at the Sava River, in Obrenovac, 50 km west from the Serbian's capital, Belgrade, is the second largest coal-fired power plant in the country, consisting of two blocks, each of 620 MW capacity. In order to investigate the threat polycyclic aromatic hydrocarbons (PAHs) from deposited coal ash, obtained by coal combustion in this power plant, can represent for the surrounding environment, samples of coal ash were submitted to extraction with river water used for transport of coal ash to the dump, as well as with water of different ionic strength and acidity. It was found that, out of 16 EPA priority PAHs, only naphthalene, acenaphthylene, fluorene, phenantrene, fluoranthene, and pyrene were found in measurable concentrations in the different extracts. Their combined concentration was around 0.1 μg/L, so they do not, in terms of leached concentrations, represent serious danger for the surrounding environment. In all cases of established (and leached) PAH compounds, changes of ionic strength, acidity, or the presence of organic compounds in river water may to some extent influence the leached concentrations. However, under the examined conditions, similar to those present in the environment, leached concentrations were not more than 50 % greater than the concentrations leached by distilled water. Therefore, water desorption is likely the most important mechanism responsible for leaching of PAH compounds from filter coal ash.

  4. Importance of Physical and Physiological Parameters in Simulated Particle Transport in the Alveolar Zone of the Human Lung

    Directory of Open Access Journals (Sweden)

    Dogan Ciloglu

    2017-01-01

    Full Text Available The trajectory and deposition efficiency of micron-sized (1–5 µm particles, inhaled into the pulmonary system, are accurately determined with the aid of a newly developed model and modified simulation techniques. This alveolar model, which has a simple but physiologically appropriate geometry, and the utilized fluid structure interaction (FSI methods permit the precise simulation of tissue wall deformation and particle fluid interactions. The relation between tissue movement and airflow in the alveolated duct is solved by a two-way fluid structure interaction simulation technique, using ANSYS Workbench (Release 16.0, ANSYS INC., Pittsburgh, PA, USA, 2015. The dynamic transport of particles and their deposition are investigated as a function of aerodynamic particle size, tissue visco-elasticity, tidal breathing period, gravity orientation and particle–fluid interactions. It is found that the fluid flows and streamlines differ between the present flexible model and rigid models, and the two-way coupling particle trajectories vary relative to one-way particle coupling. In addition, the results indicate that modelling the two-way coupling particle system is important because the two-way discrete phase method (DPM approach despite its complexity provides more extensive particle interactions and is more reliable than transport results from the one-way DPM approach. The substantial difference between the results of the two approaches is likely due to particle–fluid interactions, which re-suspend the sediment particles in the airway stream and hence pass from the current generation.

  5. Genome-Wide Association Study Identifying Candidate Genes Influencing Important Agronomic Traits of Flax (Linum usitatissimum L.) Using SLAF-seq.

    Science.gov (United States)

    Xie, Dongwei; Dai, Zhigang; Yang, Zemao; Sun, Jian; Zhao, Debao; Yang, Xue; Zhang, Liguo; Tang, Qing; Su, Jianguang

    2017-01-01

    Flax ( Linum usitatissimum L.) is an important cash crop, and its agronomic traits directly affect yield and quality. Molecular studies on flax remain inadequate because relatively few flax genes have been associated with agronomic traits or have been identified as having potential applications. To identify markers and candidate genes that can potentially be used for genetic improvement of crucial agronomic traits, we examined 224 specimens of core flax germplasm; specifically, phenotypic data for key traits, including plant height, technical length, number of branches, number of fruits, and 1000-grain weight were investigated under three environmental conditions before specific-locus amplified fragment sequencing (SLAF-seq) was employed to perform a genome-wide association study (GWAS) for these five agronomic traits. Subsequently, the results were used to screen single nucleotide polymorphism (SNP) loci and candidate genes that exhibited a significant correlation with the important agronomic traits. Our analyses identified a total of 42 SNP loci that showed significant correlations with the five important agronomic flax traits. Next, candidate genes were screened in the 10 kb zone of each of the 42 SNP loci. These SNP loci were then analyzed by a more stringent screening via co-identification using both a general linear model (GLM) and a mixed linear model (MLM) as well as co-occurrences in at least two of the three environments, whereby 15 final candidate genes were obtained. Based on these results, we determined that UGT and PL are candidate genes for plant height, GRAS and XTH are candidate genes for the number of branches, Contig1437 and LU0019C12 are candidate genes for the number of fruits, and PHO1 is a candidate gene for the 1000-seed weight. We propose that the identified SNP loci and corresponding candidate genes might serve as a biological basis for improving crucial agronomic flax traits.

  6. Genome-Wide Association Study Identifying Candidate Genes Influencing Important Agronomic Traits of Flax (Linum usitatissimum L. Using SLAF-seq

    Directory of Open Access Journals (Sweden)

    Dongwei Xie

    2018-01-01

    Full Text Available Flax (Linum usitatissimum L. is an important cash crop, and its agronomic traits directly affect yield and quality. Molecular studies on flax remain inadequate because relatively few flax genes have been associated with agronomic traits or have been identified as having potential applications. To identify markers and candidate genes that can potentially be used for genetic improvement of crucial agronomic traits, we examined 224 specimens of core flax germplasm; specifically, phenotypic data for key traits, including plant height, technical length, number of branches, number of fruits, and 1000-grain weight were investigated under three environmental conditions before specific-locus amplified fragment sequencing (SLAF-seq was employed to perform a genome-wide association study (GWAS for these five agronomic traits. Subsequently, the results were used to screen single nucleotide polymorphism (SNP loci and candidate genes that exhibited a significant correlation with the important agronomic traits. Our analyses identified a total of 42 SNP loci that showed significant correlations with the five important agronomic flax traits. Next, candidate genes were screened in the 10 kb zone of each of the 42 SNP loci. These SNP loci were then analyzed by a more stringent screening via co-identification using both a general linear model (GLM and a mixed linear model (MLM as well as co-occurrences in at least two of the three environments, whereby 15 final candidate genes were obtained. Based on these results, we determined that UGT and PL are candidate genes for plant height, GRAS and XTH are candidate genes for the number of branches, Contig1437 and LU0019C12 are candidate genes for the number of fruits, and PHO1 is a candidate gene for the 1000-seed weight. We propose that the identified SNP loci and corresponding candidate genes might serve as a biological basis for improving crucial agronomic flax traits.

  7. The strategic importance of identifying knowledge-based and intangible assets for generating value, competitiveness and innovation in sub-Saharan Africa

    Directory of Open Access Journals (Sweden)

    Nicoline Ondari-Okemwa

    2011-01-01

    Full Text Available This article discusses the strategic importance of identifying intangible assets for creating value and enhancing competitiveness and innovation in science and technology in a knowledge economy with particular reference to the sub- Saharan Africa region. It has always been difficult to gather the prerequisite information to manage such assets and create value from them. The paper discusses the nature of intangible assets, the characteristics of a knowledge economy and the role of knowledge workers in a knowledge economy. The paper also discusses the importance of identifying intangible assets in relation to capturing the value of such assets, the transfer of intangible assets to other owners and the challenges of managing organizational intangible assets. Objectives of the article include: underscoring the strategic importance of identifying intangible assets in sub-Saharan Africa; examining the performance of intangible assets in a knowledge economy; how intangible assets may generate competitiveness, economic growth and innovation; and assess how knowledge workers are becoming a dominant factor in the knowledge economy. An extensive literature review was employed to collect data for this article. It is concluded in the article that organizations and governments in sub-Saharan Africa should look at knowledge-based assets as strategic resources, even though the traditional accounting systems may still be having problems in determining the exact book value of such assets. It is recommended that organizations and government departments in sub-Saharan Africa should implement a system of the reporting of the value of intangible organizational assets just like the reporting of the value of tangible assets; and that organizations in sub-Saharan Africa should use knowledge to produce “smart products and services” which command premium prices.

  8. The importance of parameter variances, correlations lengths, and cross-correlations in reactive transport models: key considerations for assessing the need for microscale information

    Energy Technology Data Exchange (ETDEWEB)

    Reimus, Paul W [Los Alamos National Laboratory

    2010-12-08

    A process-oriented modeling approach is implemented to examine the importance of parameter variances, correlation lengths, and especially cross-correlations in contaminant transport predictions over large scales. It is shown that the most important consideration is the correlation between flow rates and retardation processes (e.g., sorption, matrix diffusion) in the system. lf flow rates are negatively correlated with retardation factors in systems containing multiple flow pathways, then characterizing these negative correlation(s) may have more impact on reactive transport modeling than microscale information. Such negative correlations are expected in porous-media systems where permeability is negatively correlated with clay content and rock alteration (which are usually associated with increased sorption). Likewise, negative correlations are expected in fractured rocks where permeability is positively correlated with fracture apertures, which in turn are negatively correlated with sorption and matrix diffusion. Parameter variances and correlation lengths are also shown to have important effects on reactive transport predictions, but they are less important than parameter cross-correlations. Microscale information pertaining to contaminant transport has become more readily available as characterization methods and spectroscopic instrumentation have achieved lower detection limits, greater resolution, and better precision. Obtaining detailed mechanistic insights into contaminant-rock-water interactions is becoming a routine practice in characterizing reactive transport processes in groundwater systems (almost necessary for high-profile publications). Unfortunately, a quantitative link between microscale information and flow and transport parameter distributions or cross-correlations has not yet been established. One reason for this is that quantitative microscale information is difficult to obtain in complex, heterogeneous systems. So simple systems that lack the

  9. Identifying obstacles and ranking common biological control research priorities for Europe to manage most economically important pests in arable, vegetable and perennial crops.

    Science.gov (United States)

    Lamichhane, Jay Ram; Bischoff-Schaefer, Monika; Bluemel, Sylvia; Dachbrodt-Saaydeh, Silke; Dreux, Laure; Jansen, Jean-Pierre; Kiss, Jozsef; Köhl, Jürgen; Kudsk, Per; Malausa, Thibaut; Messéan, Antoine; Nicot, Philippe C; Ricci, Pierre; Thibierge, Jérôme; Villeneuve, François

    2017-01-01

    EU agriculture is currently in transition from conventional crop protection to integrated pest management (IPM). Because biocontrol is a key component of IPM, many European countries recently have intensified their national efforts on biocontrol research and innovation (R&I), although such initiatives are often fragmented. The operational outputs of national efforts would benefit from closer collaboration among stakeholders via transnationally coordinated approaches, as most economically important pests are similar across Europe. This paper proposes a common European framework on biocontrol R&I. It identifies generic R&I bottlenecks and needs as well as priorities for three crop types (arable, vegetable and perennial crops). The existing gap between the market offers of biocontrol solutions and the demand of growers, the lengthy and expensive registration process for biocontrol solutions and their varying effectiveness due to variable climatic conditions and site-specific factors across Europe are key obstacles hindering the development and adoption of biocontrol solutions in Europe. Considering arable, vegetable and perennial crops, a dozen common target pests are identified for each type of crop and ranked by order of importance at European level. Such a ranked list indicates numerous topics on which future joint transnational efforts would be justified. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

  10. Evaluation of yield and identifying potential regions for Saffron (Crocus sativus L. cultivation in Khorasan Razavi province according to temperature parameters

    Directory of Open Access Journals (Sweden)

    Moein Tosan

    2015-04-01

    Full Text Available Saffron is cultivated in most part of Iran, because of low water requirement and well adaptation to diverse environmental condition. In recent years, for many reasons such as low water requirement, saffron cultivation areas has been increased especially in Khorasan Razavi province. Temperature is one of the most important factors in saffron flowering phenomena. The aim of this research was to evaluate the response of saffron to temperature in Khorasan Razavi province counties (Torbat-e-Heydarieh, Gonabad, Nishabour, Sabzevar and Ghoochan. Climatic data (monthly minimum, average, maximum temperatures and diurnal temperature range and saffron yield data were collected for past 20 years period. The stepwise regression methods were used to remove extra parameters and only keep the most important ones. By using these equations and ArcGIS software zoning, Spline method was find the best for saffron crop zoning. The results of linear regression in Gonabad showed that minimum, maximum and average temperature and also diurnal temperature range in March and April months had the greatest impact on saffron yield. For each of the four indices (the minimum, maximum and average temperature and also diurnal temperature range the best area for saffron cultivation was the southern part of the province (particularly Gonabad; so by increasing distance from this area to north areas (such as Kashmar, Torbat-e-Heydarieh, Sabzevar, Nishabour, Mashhad and finally Ghoochan saffron yield reduced by 30 to 50 percent. Therefore, the northern areas of the province had relatively low saffron yield. According to result of this research, saffron yield in Khorasan Razavi province was significantly influenced by temperature parameters. Flowering which basically is the most important stage of plant growth, is directly setting up with temperature.

  11. Linking the Salt Transcriptome with Physiological Responses of a Salt-Resistant Populus Species as a Strategy to Identify Genes Important for Stress Acclimation1[W][OA

    Science.gov (United States)

    Brinker, Monika; Brosché, Mikael; Vinocur, Basia; Abo-Ogiala, Atef; Fayyaz, Payam; Janz, Dennis; Ottow, Eric A.; Cullmann, Andreas D.; Saborowski, Joachim; Kangasjärvi, Jaakko; Altman, Arie; Polle, Andrea

    2010-01-01

    To investigate early salt acclimation mechanisms in a salt-tolerant poplar species (Populus euphratica), the kinetics of molecular, metabolic, and physiological changes during a 24-h salt exposure were measured. Three distinct phases of salt stress were identified by analyses of the osmotic pressure and the shoot water potential: dehydration, salt accumulation, and osmotic restoration associated with ionic stress. The duration and intensity of these phases differed between leaves and roots. Transcriptome analysis using P. euphratica-specific microarrays revealed clusters of coexpressed genes in these phases, with only 3% overlapping salt-responsive genes in leaves and roots. Acclimation of cellular metabolism to high salt concentrations involved remodeling of amino acid and protein biosynthesis and increased expression of molecular chaperones (dehydrins, osmotin). Leaves suffered initially from dehydration, which resulted in changes in transcript levels of mitochondrial and photosynthetic genes, indicating adjustment of energy metabolism. Initially, decreases in stress-related genes were found, whereas increases occurred only when leaves had restored the osmotic balance by salt accumulation. Comparative in silico analysis of the poplar stress regulon with Arabidopsis (Arabidopsis thaliana) orthologs was used as a strategy to reduce the number of candidate genes for functional analysis. Analysis of Arabidopsis knockout lines identified a lipocalin-like gene (AtTIL) and a gene encoding a protein with previously unknown functions (AtSIS) to play roles in salt tolerance. In conclusion, by dissecting the stress transcriptome of tolerant species, novel genes important for salt endurance can be identified. PMID:20959419

  12. Linking the salt transcriptome with physiological responses of a salt-resistant Populus species as a strategy to identify genes important for stress acclimation.

    Science.gov (United States)

    Brinker, Monika; Brosché, Mikael; Vinocur, Basia; Abo-Ogiala, Atef; Fayyaz, Payam; Janz, Dennis; Ottow, Eric A; Cullmann, Andreas D; Saborowski, Joachim; Kangasjärvi, Jaakko; Altman, Arie; Polle, Andrea

    2010-12-01

    To investigate early salt acclimation mechanisms in a salt-tolerant poplar species (Populus euphratica), the kinetics of molecular, metabolic, and physiological changes during a 24-h salt exposure were measured. Three distinct phases of salt stress were identified by analyses of the osmotic pressure and the shoot water potential: dehydration, salt accumulation, and osmotic restoration associated with ionic stress. The duration and intensity of these phases differed between leaves and roots. Transcriptome analysis using P. euphratica-specific microarrays revealed clusters of coexpressed genes in these phases, with only 3% overlapping salt-responsive genes in leaves and roots. Acclimation of cellular metabolism to high salt concentrations involved remodeling of amino acid and protein biosynthesis and increased expression of molecular chaperones (dehydrins, osmotin). Leaves suffered initially from dehydration, which resulted in changes in transcript levels of mitochondrial and photosynthetic genes, indicating adjustment of energy metabolism. Initially, decreases in stress-related genes were found, whereas increases occurred only when leaves had restored the osmotic balance by salt accumulation. Comparative in silico analysis of the poplar stress regulon with Arabidopsis (Arabidopsis thaliana) orthologs was used as a strategy to reduce the number of candidate genes for functional analysis. Analysis of Arabidopsis knockout lines identified a lipocalin-like gene (AtTIL) and a gene encoding a protein with previously unknown functions (AtSIS) to play roles in salt tolerance. In conclusion, by dissecting the stress transcriptome of tolerant species, novel genes important for salt endurance can be identified.

  13. Experimental assessment of the importance of amino acid positions identified by an entropy-based correlation analysis of multiple-sequence alignments.

    Science.gov (United States)

    Dietrich, Susanne; Borst, Nadine; Schlee, Sandra; Schneider, Daniel; Janda, Jan-Oliver; Sterner, Reinhard; Merkl, Rainer

    2012-07-17

    The analysis of a multiple-sequence alignment (MSA) with correlation methods identifies pairs of residue positions whose occupation with amino acids changes in a concerted manner. It is plausible to assume that positions that are part of many such correlation pairs are important for protein function or stability. We have used the algorithm H2r to identify positions k in the MSAs of the enzymes anthranilate phosphoribosyl transferase (AnPRT) and indole-3-glycerol phosphate synthase (IGPS) that show a high conn(k) value, i.e., a large number of significant correlations in which k is involved. The importance of the identified residues was experimentally validated by performing mutagenesis studies with sAnPRT and sIGPS from the archaeon Sulfolobus solfataricus. For sAnPRT, five H2r mutant proteins were generated by replacing nonconserved residues with alanine or the prevalent residue of the MSA. As a control, five residues with conn(k) values of zero were chosen randomly and replaced with alanine. The catalytic activities and conformational stabilities of the H2r and control mutant proteins were analyzed by steady-state enzyme kinetics and thermal unfolding studies. Compared to wild-type sAnPRT, the catalytic efficiencies (k(cat)/K(M)) were largely unaltered. In contrast, the apparent thermal unfolding temperature (T(M)(app)) was lowered in most proteins. Remarkably, the strongest observed destabilization (ΔT(M)(app) = 14 °C) was caused by the V284A exchange, which pertains to the position with the highest correlation signal [conn(k) = 11]. For sIGPS, six H2r mutant and four control proteins with alanine exchanges were generated and characterized. The k(cat)/K(M) values of four H2r mutant proteins were reduced between 13- and 120-fold, and their T(M)(app) values were decreased by up to 5 °C. For the sIGPS control proteins, the observed activity and stability decreases were much less severe. Our findings demonstrate that positions with high conn(k) values have an

  14. Critical modeling parameters identified for 3D CFD modeling of rectangular final settling tanks for New York City wastewater treatment plants.

    Science.gov (United States)

    Ramalingam, K; Xanthos, S; Gong, M; Fillos, J; Beckmann, K; Deur, A; McCorquodale, J A

    2012-01-01

    New York City Environmental Protection is in the process of incorporating biological nitrogen removal (BNR) in its wastewater treatment plants (WWTPs) which entails operating the aeration tanks with higher levels of mixed liquor suspended solids (MLSS) than a conventional activated sludge process. The objective of this paper is to discuss two of the important parameters introduced in the 3D CFD model that has been developed by the City College of New York (CCNY) group: (a) the development of the 'discrete particle' measurement technique to carry out the fractionation of the solids in the final settling tank (FST) which has critical implications in the prediction of the effluent quality; and (b) the modification of the floc aggregation (K(A)) and floc break-up (K(B)) coefficients that are found in Parker's flocculation equation (Parker et al. 1970, 1971) used in the CFD model. The dependence of these parameters on the predictions of the CFD model will be illustrated with simulation results on one of the FSTs at the 26th Ward WWTP in Brooklyn, NY.

  15. Diagnostic importance of 18F-FDG PET/CT parameters and total lesion glycolysis in differentiating between benign and malignant adrenal lesions.

    Science.gov (United States)

    Ciftci, Esra; Turgut, Bulent; Cakmakcilar, Ali; Erturk, Seyit A

    2017-09-01

    Benign adrenal lesions are prevalent in oncologic imaging and make metastatic disease diagnoses difficult. This study evaluates the diagnostic importance of metabolic, volumetric, and metabolovolumetric parameters measured by fluorine-18-fluorodeoxyglucose (F-FDG) PET/CT in differentiating between benign and malignant adrenal lesions in cancer patients. In this retrospective study, we evaluated F-FDG PET/CT parameters of adrenal lesions of follow-up cancer patients referred to our clinic between January 2012 and November 2016. The diagnosis of adrenal malignant lesions was made on the basis of interval growth or reduction after chemotherapy. Patient demographics, analysis of metabolic parameters such as maximum standard uptake value (SUVmax), tumor SUVmax/liver SUVmean ratio (T/LR), morphologic parameters such as size, Hounsfield Units, and computed tomography (CT) volume, and metabolovolumetric parameters such as metabolic tumor volume and total lesion glycolysis (TLG) of adrenal lesions were calculated. PET/CT parameters were assessed using the Mann-Whitney U-test and receiving operating characteristic analysis. In total, 186 adrenal lesions in 163 cancer patients (108 men/54 women; mean±SD age: 64±10.9 years) were subjected to F-FDG PET/CT for tumor evaluation. SUVmax values (mean±SD) were 2.8±0.8 and 10.6±6; TLG were 10.8±9.2 and 124.4±347.9; and T/LR were 1±0.3 and 4.1±2.6 in benign and malignant adrenal lesions, respectively. On the basis of the area under the curve, adrenal lesion SUVmax and T/LR had similar highest diagnostic performance for predicting malignant lesions (area under the curve: 0.993 and 0.991, respectively, P<0.001). Multivariate logistic regression analysis showed that T/LR, adrenal lesion SUVmax, and Hounsfield Units were independent predictive factors for malignancy rather than TLG. Irrespective of whether TLG was statistically highly significant for differentiating benign from malignant adrenal lesions, it did not reach the

  16. High throughput phenotypic selection of Mycobacterium tuberculosis mutants with impaired resistance to reactive oxygen species identifies genes important for intracellular growth.

    Directory of Open Access Journals (Sweden)

    Olga Mestre

    Full Text Available Mycobacterium tuberculosis has the remarkable capacity to survive within the hostile environment of the macrophage, and to resist potent antibacterial molecules such as reactive oxygen species (ROS. Thus, understanding mycobacterial resistance mechanisms against ROS may contribute to the development of new anti-tuberculosis therapies. Here we identified genes involved in such mechanisms by screening a high-density transposon mutant library, and we show that several of them are involved in the intracellular lifestyle of the pathogen. Many of these genes were found to play a part in cell envelope functions, further strengthening the important role of the mycobacterial cell envelope in protection against aggressions such as the ones caused by ROS inside host cells.

  17. Which are the most important parameters for modelling carbon assimilation in boreal Norway spruce under elevated [CO(2)] and temperature conditions?

    Science.gov (United States)

    Hall, Marianne; Medlyn, Belinda E; Abramowitz, Gab; Franklin, Oskar; Räntfors, Mats; Linder, Sune; Wallin, Göran

    2013-11-01

    Photosynthesis is highly responsive to environmental and physiological variables, including phenology, foliage nitrogen (N) content, atmospheric CO2 concentration ([CO2]), irradiation (Q), air temperature (T) and vapour pressure deficit (D). Each of these responses is likely to be modified by long-term changes in climatic conditions such as rising air temperature and [CO2]. When modelling photosynthesis under climatic changes, which parameters are then most important to calibrate for future conditions? To assess this, we used measurements of shoot carbon assimilation rates and microclimate conditions collected at Flakaliden, northern Sweden. Twelve 40-year-old Norway spruce trees were enclosed in whole-tree chambers and exposed to elevated [CO2] and elevated air temperature, separately and in combination. The treatments imposed were elevated temperature, +2.8 °C in July/August and +5.6 °C in December above ambient, and [CO2] (ambient CO2 ∼370 μ mol mol(-1), elevated CO2 ∼700 μ mol mol(-1)). The relative importance of parameterization of Q, T and D responses for effects on the photosynthetic rate, expressed on a projected needle area, and the annual shoot carbon uptake was quantified using an empirical shoot photosynthesis model, which was developed and fitted to the measurements. The functional form of the response curves was established using an artificial neural network. The [CO2] treatment increased annual shoot carbon (C) uptake by 50%. Most important was effects on the light response curve, with a 67% increase in light-saturated photosynthetic rate, and a 52% increase in the initial slope of the light response curve. An interactive effect of light saturated photosynthetic rate was found with foliage N status, but no interactive effect for high temperature and high CO2. The air temperature treatment increased the annual shoot C uptake by 44%. The most important parameter was the seasonality, with an elongation of the growing season by almost 4

  18. Study of important parameters on the irradiation of 124Xe, to improve the production of 123I with high purity using the Cyclone-30 cyclotron at IPEN-CNEN/SP

    International Nuclear Information System (INIS)

    Sumiya, Luiz Carlos do Amaral

    2006-01-01

    The development of diagnosis equipment and therapy procedures in nuclear medicine depends on the availability of commercial radioisotopes. IPEN is the most important institution that provides radioisotopes for national market. In order to achieve this function, IPEN had invested in the acquisition of a 30 MeV Cyclone-30 cyclotron to produce mainly 18 F, 67 Ga, 201 Tl and 123 I. The 123 I production is the aim of the present work. With the 123 I routine production data obtained by proton irradiation of Xe targets with an enrichment greater than 99.8%, it was possible to identify the important parameters that have direct influence on the production yield of high purity degree 123 I. Even though the methodology for the commercial production of 123 I, there are an scarcity of operational parameters data for this task. In this work the evaluated parameters were: 124 Xe pressure, proton beam quality, irradiation time, operational temperature of the irradiation system under irradiation, waiting time to obtain 123 I, temperature of washing solution and the impact of the internal Ni coating in the target. With the obtained results it was possible to modify the operational conditions for routine production and increasing the efficiency in about 30%. (author)

  19. Integrated analysis of oral tongue squamous cell carcinoma identifies key variants and pathways linked to risk habits, HPV, clinical parameters and tumor recurrence [version 1; referees: 2 approved

    Directory of Open Access Journals (Sweden)

    Neeraja Krishnan

    2015-11-01

    Full Text Available Oral tongue squamous cell carcinomas (OTSCC are a homogeneous group of tumors characterized by aggressive behavior, early spread to lymph nodes and a higher rate of regional failure. Additionally, the incidence of OTSCC among younger population (<50yrs is on the rise; many of whom lack the typical associated risk factors of alcohol and/or tobacco exposure. We present data on single nucleotide variations (SNVs, indels, regions with loss of heterozygosity (LOH, and copy number variations (CNVs from fifty-paired oral tongue primary tumors and link the significant somatic variants with clinical parameters, epidemiological factors including human papilloma virus (HPV infection and tumor recurrence. Apart from the frequent somatic variants harbored in TP53, CASP8, RASA1, NOTCH and CDKN2A genes, significant amplifications and/or deletions were detected in chromosomes 6-9, and 11 in the tumors. Variants in CASP8 and CDKN2A were mutually exclusive. CDKN2A, PIK3CA, RASA1 and DMD variants were exclusively linked to smoking, chewing, HPV infection and tumor stage. We also performed a whole-genome gene expression study that identified matrix metalloproteases to be highly expressed in tumors and linked pathways involving arachidonic acid and NF-k-B to habits and distant metastasis, respectively. Functional knockdown studies in cell lines demonstrated the role of CASP8 in a HPV-negative OTSCC cell line. Finally, we identified a 38-gene minimal signature that predicts tumor recurrence using an ensemble machine-learning method. Taken together, this study links molecular signatures to various clinical and epidemiological factors in a homogeneous tumor population with a relatively high HPV prevalence.

  20. Systemic analysis of different colorectal cancer cell lines and TCGA datasets identified IGF-1R/EGFR-PPAR-CASPASE axis as important indicator for radiotherapy sensitivity.

    Science.gov (United States)

    Chen, Lin; Zhu, Zhe; Gao, Wei; Jiang, Qixin; Yu, Jiangming; Fu, Chuangang

    2017-09-05

    Insulin-like growth factor 1 receptor (IGF-1R) is proved to contribute the development of many types of cancers. But, little is known about its roles in radio-resistance of colorectal cancer (CRC). Here, we demonstrated that low IGF-1R expression value was associated with the better radiotherapy sensitivity of CRC. Besides, through Quantitative Real-time PCR (qRT-PCR), the elevated expression value of epidermal growth factor receptor (EGFR) was observed in CRC cell lines (HT29, RKO) with high radio-sensitivity compared with those with low sensitivity (SW480, LOVO). The irradiation induced apoptosis rates of wild type and EGFR agonist (EGF) or IGF-1R inhibitor (NVP-ADW742) treated HT29 and SW480 cells were quantified by flow cytometry. As a result, the apoptosis rate of EGF and NVP-ADW742 treated HT29 cells was significantly higher than that of those wild type ones, which indicated that high EGFR and low IGF-1R expression level in CRC was associated with the high sensitivity to radiotherapy. We next conducted systemic bioinformatics analysis of genome-wide expression profiles of CRC samples from the Cancer Genome Atlas (TCGA). Differential expression analysis between IGF-1R and EGFR abnormal CRC samples, i.e. CRC samples with higher IGF-1R and lower EGFR expression levels based on their median expression values, and the rest of CRC samples identified potential genes contribute to radiotherapy sensitivity. Functional enrichment of analysis of those differential expression genes (DEGs) in the Database for Annotation, Visualization and Integrated Discovery (DAVID) indicated PPAR signaling pathway as an important pathway for the radio-resistance of CRC. Our study identified the potential biomarkers for the rational selection of radiotherapy for CRC patients. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. Whole-exome sequencing of muscle-invasive bladder cancer identifies recurrent mutations of UNC5C and prognostic importance of DNA repair gene mutations on survival.

    Science.gov (United States)

    Yap, Kai Lee; Kiyotani, Kazuma; Tamura, Kenji; Antic, Tatjana; Jang, Miran; Montoya, Magdeline; Campanile, Alexa; Yew, Poh Yin; Ganshert, Cory; Fujioka, Tomoaki; Steinberg, Gary D; O'Donnell, Peter H; Nakamura, Yusuke

    2014-12-15

    Because of suboptimal outcomes in muscle-invasive bladder cancer even with multimodality therapy, determination of potential genetic drivers offers the possibility of improving therapeutic approaches and discovering novel prognostic indicators. Using pTN staging, we case-matched 81 patients with resected ≥pT2 bladder cancers for whom perioperative chemotherapy use and disease recurrence status were known. Whole-exome sequencing was conducted in 43 cases to identify recurrent somatic mutations and targeted sequencing of 10 genes selected from the initial screening in an additional 38 cases was completed. Mutational profiles along with clinicopathologic information were correlated with recurrence-free survival (RFS) in the patients. We identified recurrent novel somatic mutations in the gene UNC5C (9.9%), in addition to TP53 (40.7%), KDM6A (21.0%), and TSC1 (12.3%). Patients who were carriers of somatic mutations in DNA repair genes (one or more of ATM, ERCC2, FANCD2, PALB2, BRCA1, or BRCA2) had a higher overall number of somatic mutations (P = 0.011). Importantly, after a median follow-up of 40.4 months, carriers of somatic mutations (n = 25) in any of these six DNA repair genes had significantly enhanced RFS compared with noncarriers [median, 32.4 vs. 14.8 months; hazard ratio of 0.46, 95% confidence interval (CI), 0.22-0.98; P = 0.0435], after adjustment for pathologic pTN staging and independent of adjuvant chemotherapy usage. Better prognostic outcomes of individuals carrying somatic mutations in DNA repair genes suggest these mutations as favorable prognostic events in muscle-invasive bladder cancer. Additional mechanistic investigation into the previously undiscovered role of UNC5C in bladder cancer is warranted. ©2014 American Association for Cancer Research.

  2. Machine Learning Analysis Identifies Drosophila Grunge/Atrophin as an Important Learning and Memory Gene Required for Memory Retention and Social Learning.

    Science.gov (United States)

    Kacsoh, Balint Z; Greene, Casey S; Bosco, Giovanni

    2017-11-06

    High-throughput experiments are becoming increasingly common, and scientists must balance hypothesis-driven experiments with genome-wide data acquisition. We sought to predict novel genes involved in Drosophila learning and long-term memory from existing public high-throughput data. We performed an analysis using PILGRM, which analyzes public gene expression compendia using machine learning. We evaluated the top prediction alongside genes involved in learning and memory in IMP, an interface for functional relationship networks. We identified Grunge/Atrophin ( Gug/Atro ), a transcriptional repressor, histone deacetylase, as our top candidate. We find, through multiple, distinct assays, that Gug has an active role as a modulator of memory retention in the fly and its function is required in the adult mushroom body. Depletion of Gug specifically in neurons of the adult mushroom body, after cell division and neuronal development is complete, suggests that Gug function is important for memory retention through regulation of neuronal activity, and not by altering neurodevelopment. Our study provides a previously uncharacterized role for Gug as a possible regulator of neuronal plasticity at the interface of memory retention and memory extinction. Copyright © 2017 Kacsoh et al.

  3. Optimization of the most important operational parameters of a pneumatic seeder using real-time monitoring for Cucumber and Watermelon seeds

    Directory of Open Access Journals (Sweden)

    Z Abdolahzare

    2016-04-01

    Full Text Available Introduction: Since the application of pneumatic planters for seeds with different physical properties is growing, it is essential to evaluation the performance of these machines to improve the operating parameters under different pressures and forward speeds. To evaluate the performance of precision vacuum seeders numerous procedures of laboratory and field have been developed and their feed mechanism evaluation is of great importance. The use of instrumentation is essential in laboratory procedures. Many systems have been designed, using instrumentation, to be able to monitor seed falling trajectory and as a result, in those systems the precise place of falling seed in the seed bed could be determined. In this study, the uniformity of seed spacing of a seed drill was determined using of high speed camera with a frame rate of 480 frames s-1. So that, the uniformity of planting was statistically significant under the influence of the speed of seed metering rollers (Karayel et al., 2006. Singh et al. (2005 studied the effects of disk rotation speed, vacuum pressure and shape of seed entrance hole on planting spacing uniformity using uniformity indices under laboratory and field conditions. They reported miss index values were reduced as the pressure was increased but they were increased with increasing of the speed. The multiple indices on the other hand were low at higher speed but they were increased as the pressure was increased. Ground speed was affected by changes in engine speed and gear selection, both of which effect on amount of fan rotation speed for different pressures. The aim of this study was to identify and determine the effects of forward speed and optimum vacuum pressure amount of the pneumatic seeder. Materials and Methods: The pneumatic planter (Unissem was mounted on a tractor (MF399 and passed over the soil bin. Thus, the acquired data would be more reliable and practical. To do so, the tractor was equipped with electronic

  4. Transcriptional profiling of Medicago truncatula under salt stress identified a novel CBF transcription factor MtCBF4 that plays an important role in abiotic stress responses

    Directory of Open Access Journals (Sweden)

    Su Zhen

    2011-07-01

    Full Text Available Abstract Background Salt stress hinders the growth of plants and reduces crop production worldwide. However, different plant species might possess different adaptive mechanisms to mitigate salt stress. We conducted a detailed pathway analysis of transcriptional dynamics in the roots of Medicago truncatula seedlings under salt stress and selected a transcription factor gene, MtCBF4, for experimental validation. Results A microarray experiment was conducted using root samples collected 6, 24, and 48 h after application of 180 mM NaCl. Analysis of 11 statistically significant expression profiles revealed different behaviors between primary and secondary metabolism pathways in response to external stress. Secondary metabolism that helps to maintain osmotic balance was induced. One of the highly induced transcription factor genes was successfully cloned, and was named MtCBF4. Phylogenetic analysis revealed that MtCBF4, which belongs to the AP2-EREBP transcription factor family, is a novel member of the CBF transcription factor in M. truncatula. MtCBF4 is shown to be a nuclear-localized protein. Expression of MtCBF4 in M. truncatula was induced by most of the abiotic stresses, including salt, drought, cold, and abscisic acid, suggesting crosstalk between these abiotic stresses. Transgenic Arabidopsis over-expressing MtCBF4 enhanced tolerance to drought and salt stress, and activated expression of downstream genes that contain DRE elements. Over-expression of MtCBF4 in M. truncatula also enhanced salt tolerance and induced expression level of corresponding downstream genes. Conclusion Comprehensive transcriptomic analysis revealed complex mechanisms exist in plants in response to salt stress. The novel transcription factor gene MtCBF4 identified here played an important role in response to abiotic stresses, indicating that it might be a good candidate gene for genetic improvement to produce stress-tolerant plants.

  5. A method to identify important dynamical states in Boolean models of regulatory networks: application to regulation of stomata closure by ABA in A. thaliana.

    Science.gov (United States)

    Bugs, Cristhian A; Librelotto, Giovani R; Mombach, José C M

    2011-12-22

    We introduce a method to analyze the states of regulatory Boolean models that identifies important network states and their biological influence on the global network dynamics. It consists in (1) finding the states of the network that are most frequently visited and (2) the identification of variable and frozen nodes of the network. The method, along with a simulation that includes random features, is applied to the study of stomata closure by abscisic acid (ABA) in A. thaliana proposed by Albert and coworkers. We find that for the case of study, that the dynamics of wild and mutant networks have just two states that are highly visited in their space of states and about a third of all nodes of the wild network are variable while the rest remain frozen in True or False states. This high number of frozen elements explains the low cardinality of the space of states of the wild network. Similar results are observed in the mutant networks. The application of the method allowed us to explain how wild and mutants behave dynamically in the SS and determined an essential feature of the activation of the closure node (representing stomata closure), i.e. its synchronization with the AnionEm node (representing anion efflux at the plasma membrane). The dynamics of this synchronization explains the efficiency reached by the wild and each of the mutant networks. For the biological problem analyzed, our method allows determining how wild and mutant networks differ 'phenotypically'. It shows that the different efficiencies of stomata closure reached among the simulated wild and mutant networks follow from a dynamical behavior of two nodes that are always synchronized. Additionally, we predict that the involvement of the anion efflux at the plasma membrane is crucial for the plant response to ABA. The algorithm used in the simulations is available upon request.

  6. Transcriptional profiling of Medicago truncatula under salt stress identified a novel CBF transcription factor MtCBF4 that plays an important role in abiotic stress responses

    Science.gov (United States)

    2011-01-01

    Background Salt stress hinders the growth of plants and reduces crop production worldwide. However, different plant species might possess different adaptive mechanisms to mitigate salt stress. We conducted a detailed pathway analysis of transcriptional dynamics in the roots of Medicago truncatula seedlings under salt stress and selected a transcription factor gene, MtCBF4, for experimental validation. Results A microarray experiment was conducted using root samples collected 6, 24, and 48 h after application of 180 mM NaCl. Analysis of 11 statistically significant expression profiles revealed different behaviors between primary and secondary metabolism pathways in response to external stress. Secondary metabolism that helps to maintain osmotic balance was induced. One of the highly induced transcription factor genes was successfully cloned, and was named MtCBF4. Phylogenetic analysis revealed that MtCBF4, which belongs to the AP2-EREBP transcription factor family, is a novel member of the CBF transcription factor in M. truncatula. MtCBF4 is shown to be a nuclear-localized protein. Expression of MtCBF4 in M. truncatula was induced by most of the abiotic stresses, including salt, drought, cold, and abscisic acid, suggesting crosstalk between these abiotic stresses. Transgenic Arabidopsis over-expressing MtCBF4 enhanced tolerance to drought and salt stress, and activated expression of downstream genes that contain DRE elements. Over-expression of MtCBF4 in M. truncatula also enhanced salt tolerance and induced expression level of corresponding downstream genes. Conclusion Comprehensive transcriptomic analysis revealed complex mechanisms exist in plants in response to salt stress. The novel transcription factor gene MtCBF4 identified here played an important role in response to abiotic stresses, indicating that it might be a good candidate gene for genetic improvement to produce stress-tolerant plants. PMID:21718548

  7. The hydrogen concentration as parameter to identify natural attenuation processes of volatile chlorinated hydrocarbons in ground water; Die Wasserstoffkonzentration als Parameter zur Identifizierung des natuerlichen Abbaus von leichtfluechtigen Chlorkohlenwasserstoffen (LCKW) im Grundwasser

    Energy Technology Data Exchange (ETDEWEB)

    Alter, M.D.

    2006-06-15

    In this study, the hydrogen concentration as parameter to identify natural attenuation processes of volatile chlorinated hydrocarbons was investigated. The currently accepted and recommended bubble strip method for hydrogen sampling was optimized, and a storage method for hydrogen samples was developed. Furthermore batch experiments with a dechlorinating mixed culture and pure cultures were carried out to study H{sub 2}-concentrations of competing redox processes. The extraction of hydrogen from ground water was optimized by a reduced inlet diameter of the usually applied gas sampling bulbs, allowing a maximal turbulent ow and gas transfer. With a gas volume of 10 ml and flow rates of 50 to 140 ml/min, the course of extraction almost followed the theoretical course of equilibration. At flow rates > 100 ml/min a equilibrium of 98% was achieved within 20 min. Until recently it was generally accepted that hydrogen samples can be stored only for 2 hours and therefore have to be analyzed immediately in the eld. Here, it was shown that eld samples can be stored for 1-3 days until analysis. For the dechlorination of tetrachloroethene (PCE), a hydrogen threshold concentration of 1-2 nM was found with the dechlorinating mixed culture as well as with a pure culture of Sulfurospirillum multivorans in combination with another pure culture Methanosarcina mazei. No dechlorination was detectable below this concentration. With the dechlorinating mixed culture, this finding is valid for all successive dechlorination steps until ethene. The hydrogen threshold concentration for denitrification were below the detection limit of 0,2 nM with the dechlorinating mixed culture. A threshold concentration of 3,1-3,5 nM was found for sulphate reduction and a threshold of 7-9 nM H{sub 2} for hydrogenotrophic methanogenesis. This implies that the natural dechlorination at contaminated sites is preferred to competing processes like sulphate reduction and methanogenesis. The threshold

  8. The importance of Foxp3 antibody and fixation/permeabilization buffer combinations in identifying CD4+CD25+Foxp3+ regulatory T cells.

    Science.gov (United States)

    Law, Jacqueline P; Hirschkorn, Dale F; Owen, Rachel E; Biswas, Hope H; Norris, Philip J; Lanteri, Marion C

    2009-12-01

    Foxp3 is a key marker for CD4(+) regulatory T cells (T(regs)) and was used in developing a multiparameter flow cytometric panel to identify T(regs). Achieving reproducible staining and analysis first required optimization of Foxp3 staining. We present a comparative study of PCH101, 236A/E7, 3G3, 206D, 150D, and 259D/C7 clones of anti-human-Foxp3 antibodies used in combination with five different fixation/permeabilization buffers. Staining for CD25, CD152, and CD127 was also compared between fixation/permeabilization treatments. Promising antibody/buffer combinations were tested in a panel of peripheral blood mononuclear cells from 10 individuals, and then on fresh versus frozen cells from four individuals. Finally, different fluorochromes coupled to two representative antibodies were compared to optimize separation of Foxp3(+) from Foxp3(-) events. Foxp3 gates were set using two gating strategies based on CD127(+)CD25(-) "non-T(regs)" or based on isotype controls. For Foxp3 staining, the best conditions for fixation/permeabilization were obtained using the eBioscience Foxp3, Imgenex, BioLegend, and BD Foxp3 buffers. Comparing results from 10 subjects, 259D/C7, PCH101, 236A/E7, and 206D antibodies yielded statistically higher levels of Foxp3 cells than those by 150D and 3G3 antibodies (mean = 6.9, 5.1, 4.7, and 3.7% compared with 1.7, and 0.3% of CD25(+)Foxp3(+) events within CD4(+) cells, respectively). Importantly, the "nonspecificity" of some antibodies observed with a Foxp3 gate based on isotype controls could be eliminated by setting the Foxp3 gate on "non-T(regs)". Better separation of Foxp3(+) and Foxp3(-) populations was observed using the PCH101 clone coupled to Alexa647 compared with FITC or the 259D/C7 clone coupled to PE compared with Alexa488 fluorochrome. Foxp3 staining can be highly variable and depends on the choice of antibody/buffer pair and the fluorochrome used. Selecting the correct population for setting the Foxp3 gate is critical to avoid

  9. A novel screening method for cell wall mutants in Aspergillus niger identifies UDP-galactopyranose mutase as an important protein in fungal cell wall biosynthesis

    NARCIS (Netherlands)

    Damveld, R.A.; Franken, A.; Arentshorst, M.; Punt, P.J.; Klis, F.M.; van den Hondel, C.A.M.J.J.; Ram, A.F.J.

    2008-01-01

    To identify cell wall biosynthetic genes in filamentous fungi and thus potential targets for the discovery of new antifungals, we developed a novel screening method for cell wall mutants. It is based on our earlier observation that the Aspergillus niger agsA gene, which encodes a putative

  10. Gene expression profiling identifies FYN as an important molecule in tamoxifen resistance and a predictor of early recurrence in patients treated with endocrine therapy

    DEFF Research Database (Denmark)

    Elias, D; (Hansen) Vever, Henriette; Lænkholm, A-V

    2015-01-01

    To elucidate the molecular mechanisms of tamoxifen resistance in breast cancer, we performed gene array analyses and identified 366 genes with altered expression in four unique tamoxifen-resistant (TamR) cell lines vs the parental tamoxifen-sensitive MCF-7/S0.5 cell line. Most of these genes were...

  11. A novel screening method for cell wall mutants in Aspergillus niger identifies UDP-galactopyranose mutase as an important protein in fungal cell wall biosynthesis

    NARCIS (Netherlands)

    Damveld, R.A.; Franken, A.; Arentshorst, M.; Punt, P.J.; Klis, F.M.; Hondel, C.A.M.J.J. van den; Ram, A.F.J.

    2008-01-01

    To identify cell wall biosynthetic genes in filamentous fungi and thus potential targets for the discovery of new antifungals, we developed a novel screening method for cell wall mutants. It is based on our earlier observation that the Aspergillus niger agsA gene, which encodes a putative a-glucan

  12. Prevalence and Clinical Import of Thoracic Injury Identified by Chest Computed Tomography but Not Chest Radiography in Blunt Trauma: Multicenter Prospective Cohort Study.

    Science.gov (United States)

    Langdorf, Mark I; Medak, Anthony J; Hendey, Gregory W; Nishijima, Daniel K; Mower, William R; Raja, Ali S; Baumann, Brigitte M; Anglin, Deirdre R; Anderson, Craig L; Lotfipour, Shahram; Reed, Karin E; Zuabi, Nadia; Khan, Nooreen A; Bithell, Chelsey A; Rowther, Armaan A; Villar, Julian; Rodriguez, Robert M

    2015-12-01

    Chest computed tomography (CT) diagnoses more injuries than chest radiography, so-called occult injuries. Wide availability of chest CT has driven substantial increase in emergency department use, although the incidence and clinical significance of chest CT findings have not been fully described. We determine the frequency, severity, and clinical import of occult injury, as determined by changes in management. These data will better inform clinical decisions, need for chest CT, and odds of intervention. Our sample included prospective data (2009 to 2013) on 5,912 patients at 10 Level I trauma center EDs with both chest radiography and chest CT at physician discretion. These patients were 40.6% of 14,553 enrolled in the parent study who had either chest radiography or chest CT. Occult injuries were pneumothorax, hemothorax, sternal or greater than 2 rib fractures, pulmonary contusion, thoracic spine or scapula fracture, and diaphragm or great vessel injury found on chest CT but not on preceding chest radiography. A priori, we categorized thoracic injuries as major (having invasive procedures), minor (observation or inpatient pain control >24 hours), or of no clinical significance. Primary outcome was prevalence and proportion of occult injury with major interventions of chest tube, mechanical ventilation, or surgery. Secondary outcome was minor interventions of admission rate or observation hours because of occult injury. Two thousand forty-eight patients (34.6%) had chest injury on chest radiography or chest CT, whereas 1,454 of these patients (71.0%, 24.6% of all patients) had occult injury. Of these, in 954 patients (46.6% of injured, 16.1% of total), chest CT found injuries not observed on immediately preceding chest radiography. In 500 more patients (24.4% of injured patients, 8.5% of all patients), chest radiography found some injury, but chest CT found occult injury. Chest radiography found all injuries in only 29.0% of injured patients. Two hundred and two

  13. What Does It Take to Change an Editor's Mind? Identifying Minimally Important Difference Thresholds for Peer Reviewer Rating Scores of Scientific Articles.

    Science.gov (United States)

    Callaham, Michael; John, Leslie K

    2018-01-05

    We define a minimally important difference for the Likert-type scores frequently used in scientific peer review (similar to existing minimally important differences for scores in clinical medicine). The magnitude of score change required to change editorial decisions has not been studied, to our knowledge. Experienced editors at a journal in the top 6% by impact factor were asked how large a change of rating in "overall desirability for publication" was required to trigger a change in their initial decision on an article. Minimally important differences were assessed twice for each editor: once assessing the rating change required to shift the editor away from an initial decision to accept, and the other assessing the magnitude required to shift away from an initial rejection decision. Forty-one editors completed the survey (89% response rate). In the acceptance frame, the median minimally important difference was 0.4 points on a scale of 1 to 5. Editors required a greater rating change to shift from an initial rejection decision; in the rejection frame, the median minimally important difference was 1.2 points. Within each frame, there was considerable heterogeneity: in the acceptance frame, 38% of editors did not change their decision within the maximum available range; in the rejection frame, 51% did not. To our knowledge, this is the first study to determine the minimally important difference for Likert-type ratings of research article quality, or in fact any nonclinical scientific assessment variable. Our findings may be useful for future research assessing whether changes to the peer review process produce clinically meaningful differences in editorial decisionmaking. Copyright © 2017 American College of Emergency Physicians. Published by Elsevier Inc. All rights reserved.

  14. Parameter Estimation

    DEFF Research Database (Denmark)

    Sales-Cruz, Mauricio; Heitzig, Martina; Cameron, Ian

    2011-01-01

    of optimisation techniques coupled with dynamic solution of the underlying model. Linear and nonlinear approaches to parameter estimation are investigated. There is also the application of maximum likelihood principles in the estimation of parameters, as well as the use of orthogonal collocation to generate a set......In this chapter the importance of parameter estimation in model development is illustrated through various applications related to reaction systems. In particular, rate constants in a reaction system are obtained through parameter estimation methods. These approaches often require the application...... of algebraic equations as the basis for parameter estimation.These approaches are illustrated using estimations of kinetic constants from reaction system models....

  15. Cilengitide-induced temporal variations in transvascular transfer parameters of tumor vasculature in a rat glioma model: identifying potential MRI biomarkers of acute effects.

    Directory of Open Access Journals (Sweden)

    Tavarekere N Nagaraja

    Full Text Available Increased efficacy of radiotherapy (RT 4-8 h after Cilengitide treatment has been reported. We hypothesized that the effects of Cilengitide on tumor transvascular transfer parameters might underlie, and thus predict, this potentiation. Athymic rats with orthotopic U251 glioma were studied at ~21 days after implantation using dynamic contrast-enhanced (DCE-MRI. Vascular parameters, viz: plasma volume fraction (v(p, forward volume transfer constant (K(trans and interstitial volume fraction (v(e of a contrast agent, were determined in tumor vasculature once before, and again in cohorts 2, 4, 8, 12 and 24 h after Cilengitide administration (4 mg/kg; N = 31; 6-7 per cohort. Perfusion-fixed brain sections were stained for von Willebrand factor to visualize vascular segments. A comparison of pre- and post-treatment parameters showed that the differences between MR indices before and after Cilengitide treatment pivoted around the 8 h time point, with 2 and 4 h groups showing increases, 12 and 24 h groups showing decreases, and values at the 8 h time point close to the baseline. The vascular parameter differences between group of 2 and 4 h and group of 12 and 24 h were significant for K(trans (p = 0.0001 and v(e (p = 0,0271. Vascular staining showed little variation with time after Cilengitide. The vascular normalization occurring 8 h after Cilengitide treatment coincided with similar previous reports of increased treatment efficacy when RT followed Cilengitide by 8 h. Pharmacological normalization of vasculature has the potential to increase sensitivity to RT. Evaluating acute temporal responses of tumor vasculature to putative anti-angiogenic drugs may help in optimizing their combination with other treatment modalities.

  16. Comparison of Spot Urine Protein to Creatinine Ratio to 24-Hour Proteinuria to Identify Important Change Over Time in Proteinuria in Lupus.

    Science.gov (United States)

    Medina-Rosas, Jorge; Su, Jiandong; Cook, Richard J; Sabapathy, Arthy; Touma, Zahi

    2017-09-01

    The aim of this study was to determine whether spot urine protein-to-creatinine ratio (PCR) accurately measures the change in proteinuria compared with 24-hour proteinuria (24H-P). This was a retrospective analysis on patients' paired visits and paired urine samples for PCR and 24H-P. Patients with both abnormal 24H-P (>0.5 g/d) and PCR (>0.05 g/mmol) or both normal 24H-P (≤0.5 g/d) and PCR (≤0.05 g/mmol) at baseline visit were identified.The first follow-up visit with partial recovery (50% decrease in proteinuria) or complete recovery (≤0.5 g/d) was identified for those with abnormal baseline 24H-P, and new proteinuria (>0.5 g/d) was identified for those with normal 24H-P. Twenty-four-hour urine collection and PCR end-point frequencies were compared. Twenty-four-hour urine collection results were converted to 24H-PCR. Twenty-four-hour PCR and PCR were utilized to measure the magnitude of change (by standardized response mean [SRM]) in patients who achieved the end points. Of 230 patients, at baseline, 95 patients had abnormal and 109 had normal 24H-P and PCR. On follow-up, 57 achieved partial recovery, and 53 achieved complete recovery by 24H-P. Standardized response mean was -1.03 and -1.10 for 24H-PCR and PCR, respectively. By PCR, 53 patients had partial recovery, and 27 had complete recovery. Standardized response mean was -1.25 and -0.86 by 24H-PCR and PCR, respectively.For new proteinuria, 28 patients were identified by 24H-P and 21 by PCR. Twenty-four-hour PCR SRM was 0.80, and PCR SRM was 0.68. Protein-to-creatinine ratio does not have sufficient accuracy compared with 24H-P for improvement and worsening to be used in lieu of 24H-P.

  17. Identifying most important skills for PhD students in Food Science and Technology: a comparison between industry and academic stakeholders

    Directory of Open Access Journals (Sweden)

    Chelo González-Martínez

    2015-10-01

    Full Text Available Nowadays, there is an increasing need of new skills for PhD students to face the future labour market prospects. PhD graduates must have qualities attractive not only in academia but also outside, in both manufacture and service-oriented enterprises, in small innovative companies, and in the civil services and public administration, among others. To know what the needs of these future employees are, is of great importance to be able to improve their personal and academic formation. The aim of this work was, in the framework of the EC-funded ISEKI_Food 4 network, to evaluate the most desirable specific and soft skills that PhD students should acquire by the end of their doctoral studies. To this aim, several surveys were conducted and sent to the different stakeholders (academia and food industry partners in order to collect the information needed. Results showed that competences related to research skills and techniques, research management, personal effectiveness and communication skills were considered to be the most valuable skills to be acquired by our PhD students to meet the future needs of the labour market.  The importance of these skills was appreciated differently, depending on the stakeholder. To sum up, some recommendations to integrate such valuable skills into the curricula of the PhD student are given.

  18. Validation of SMOS L1C and L2 Products and Important Parameters of the Retrieval Algorithm in the Skjern River Catchment, Western Denmark

    DEFF Research Database (Denmark)

    Bircher, Simone; Skou, Niels; Kerr, Yann H.

    2013-01-01

    -band Microwave Emission of the Biosphere (L-MEB) model with initial guesses on the two parameters (derived from ECMWF products and ECOCLIMAP Leaf Area Index, respectively) and other auxiliary input. This paper presents the validation work carried out in the Skjern River Catchment, Denmark. L1C/L2 data...

  19. Post-hoc principal component analysis on a largely illiterate elderly population from North-west India to identify important elements of mini-mental state examination

    Directory of Open Access Journals (Sweden)

    Sunil Kumar Raina

    2016-01-01

    Full Text Available Background: Mini-mental state examination (MMSE scale measures cognition using specific elements that can be isolated, defined, and subsequently measured. This study was conducted with the aim to analyze the factorial structure of MMSE in a largely, illiterate, elderly population in India and to reduce the number of variables to a few meaningful and interpretable combinations. Methodology: Principal component analysis (PCA was performed post-hoc on the data generated by a research project conducted to estimate the prevalence of dementia in four geographically defined habitations in Himachal Pradesh state of India. Results: Questions on orientation and registration account for high percentage of cumulative variance in comparison to other questions. Discussion: The PCA conducted on the data derived from a largely, illiterate population reveals that the most important components to consider for the estimation of cognitive impairment in illiterate Indian population are temporal orientation, spatial orientation, and immediate memory.

  20. Post-hoc principal component analysis on a largely illiterate elderly population from North-west India to identify important elements of mini-mental state examination.

    Science.gov (United States)

    Raina, Sunil Kumar; Chander, Vishav; Raina, Sujeet; Grover, Ashoo

    2016-01-01

    Mini-mental state examination (MMSE) scale measures cognition using specific elements that can be isolated, defined, and subsequently measured. This study was conducted with the aim to analyze the factorial structure of MMSE in a largely, illiterate, elderly population in India and to reduce the number of variables to a few meaningful and interpretable combinations. Principal component analysis (PCA) was performed post-hoc on the data generated by a research project conducted to estimate the prevalence of dementia in four geographically defined habitations in Himachal Pradesh state of India. Questions on orientation and registration account for high percentage of cumulative variance in comparison to other questions. The PCA conducted on the data derived from a largely, illiterate population reveals that the most important components to consider for the estimation of cognitive impairment in illiterate Indian population are temporal orientation, spatial orientation, and immediate memory.

  1. Bipolar disorder: The importance of clinical assessment in identifying prognostic factors - An Audit. Part 1: An analysis of potential prognostic factors.

    Science.gov (United States)

    Verdolini, Norma; Dean, Jonathon; Elisei, Sandro; Quartesan, Roberto; Zaman, Rashid; Agius, Mark

    2014-11-01

    Prognostic factors of bipolar disorder must be identified to assist in staging and treatment, and this may be done primarily during the initial psychiatric assessment. In fact, most of the prognostic factors, which determine disease outcome, could be detected from simple but often-unrecorded questions asked during the psychiatric clinic visit. We collected data from the clinical notes of 70 bipolar outpatients seen at the initial psychiatric assessment clinic about socio-demographic and clinical factors to determine whether various factors had relevance to prevalence, prognosis, or outcome. The sample comprised 16 bipolar I (22.9%) and 54 bipolar II (77.1%) outpatients; a psychiatric comorbidity was noted in 26 patients (37.1%). 60.9% (42 patients) reported anxiety features and 12 patients (17.6%) were noted to have obsessive-compulsive characteristics. Percentages reported in our results are of the sample for which the data was available. Anhedonia is a depressive feature that was present in most of the population where this data was available (92.2%, 59 patients) and 81.8% (54 patients) reported suicidal thoughts during a depressive episode. 74.6% (47 patients) had a family history of bipolar disorder, depression, suicide or psychosis. 27 patients (39.7%) reported current alcohol use and 14 patients (22.6%) current illicit drug use. A comparison between 10 prognostic factors found that only the correlations between current illicit drug use/previous illicit drug use (χ(2)=11.471, Palcohol use/previous alcohol use (χ(2)=31.510, Palcohol use (χ(2)=5.071, P=0.023) and previous alcohol use/family history (χ(2)=4.309, P=0.037) were almost statistically significant. 17 patients (24.3%) of the 70 bipolar patients were assigned to a care coordinator; we have evaluated the possible differences between the patients with or without a care coordinator on the basis of the presence of 10 possible prognostic factors and found no statistically significant differences between

  2. Improving a full-text search engine: the importance of negation detection and family history context to identify cases in a biomedical data warehouse.

    Science.gov (United States)

    Garcelon, Nicolas; Neuraz, Antoine; Benoit, Vincent; Salomon, Rémi; Burgun, Anita

    2017-05-01

    The repurposing of electronic health records (EHRs) can improve clinical and genetic research for rare diseases. However, significant information in rare disease EHRs is embedded in the narrative reports, which contain many negated clinical signs and family medical history. This paper presents a method to detect family history and negation in narrative reports and evaluates its impact on selecting populations from a clinical data warehouse (CDW). We developed a pipeline to process 1.6 million reports from multiple sources. This pipeline is part of the load process of the Necker Hospital CDW. We identified patients with "Lupus and diarrhea," "Crohn's and diabetes," and "NPHP1" from the CDW. The overall precision, recall, specificity, and F-measure were 0.85, 0.98, 0.93, and 0.91, respectively. The proposed method generates a highly accurate identification of cases from a CDW of rare disease EHRs. © The Author 2016. Published by Oxford University Press on behalf of the American Medical Informatics Association. All rights reserved. For Permissions, please email: journals.permissions@oup.com

  3. Proteome analysis identifies the Dpr protein of Streptococcus mutans as an important factor in the presence of early streptococcal colonizers of tooth surfaces.

    Directory of Open Access Journals (Sweden)

    Akihiro Yoshida

    Full Text Available Oral streptococci are primary colonizers of tooth surfaces and Streptococcus mutans is the principal causative agent of dental caries in humans. A number of proteins are involved in the formation of monospecies biofilms by S. mutans. This study analyzed the protein expression profiles of S. mutans biofilms formed in the presence or absence of S. gordonii, a pioneer colonizer of the tooth surface, by two-dimensional gel electrophoresis (2-DE. After identifying S. mutans proteins by Mass spectrometric analysis, their expression in the presence of S. gordonii was analyzed. S. mutans was inoculated with or without S. gordonii DL1. The two species were compartmentalized using 0.2-μl Anopore membranes. The biofilms on polystyrene plates were harvested, and the solubilized proteins were separated by 2-DE. When S. mutans biofilms were formed in the presence of S. gordonii, the peroxide resistance protein Dpr of the former showed 4.3-fold increased expression compared to biofilms that developed in the absence of the pioneer colonizer. In addition, we performed a competition assay using S. mutans antioxidant protein mutants together with S. gordonii and other initial colonizers. Growth of the dpr-knockout S. mutans mutant was significantly inhibited by S. gordonii, as well as by S. sanguinis. Furthermore, a cell viability assay revealed that the viability of the dpr-defective mutant was significantly attenuated compared to the wild-type strain when co-cultured with S. gordonii. Therefore, these results suggest that Dpr might be one of the essential proteins for S. mutans survival on teeth in the presence of early colonizing oral streptococci.

  4. Proteome Analysis Identifies the Dpr Protein of Streptococcus mutans as an Important Factor in the Presence of Early Streptococcal Colonizers of Tooth Surfaces

    Science.gov (United States)

    Yoshida, Akihiro; Niki, Mamiko; Yamamoto, Yuji; Yasunaga, Ai; Ansai, Toshihiro

    2015-01-01

    Oral streptococci are primary colonizers of tooth surfaces and Streptococcus mutans is the principal causative agent of dental caries in humans. A number of proteins are involved in the formation of monospecies biofilms by S. mutans. This study analyzed the protein expression profiles of S. mutans biofilms formed in the presence or absence of S. gordonii, a pioneer colonizer of the tooth surface, by two-dimensional gel electrophoresis (2-DE). After identifying S. mutans proteins by Mass spectrometric analysis, their expression in the presence of S. gordonii was analyzed. S. mutans was inoculated with or without S. gordonii DL1. The two species were compartmentalized using 0.2-μl Anopore membranes. The biofilms on polystyrene plates were harvested, and the solubilized proteins were separated by 2-DE. When S. mutans biofilms were formed in the presence of S. gordonii, the peroxide resistance protein Dpr of the former showed 4.3-fold increased expression compared to biofilms that developed in the absence of the pioneer colonizer. In addition, we performed a competition assay using S. mutans antioxidant protein mutants together with S. gordonii and other initial colonizers. Growth of the dpr-knockout S. mutans mutant was significantly inhibited by S. gordonii, as well as by S. sanguinis. Furthermore, a cell viability assay revealed that the viability of the dpr-defective mutant was significantly attenuated compared to the wild-type strain when co-cultured with S. gordonii. Therefore, these results suggest that Dpr might be one of the essential proteins for S. mutans survival on teeth in the presence of early colonizing oral streptococci. PMID:25816242

  5. The role of the experimental data base used to identify material parameters in predicting the cyclic plastic response of an austenitic steel

    International Nuclear Information System (INIS)

    Djimli, Lynda; Taleb, Lakhdar; Meziani, Salim

    2010-01-01

    The first objective of this paper investigates the influence of the previous strain history on ratcheting. New tests were performed where different strain-controlled histories have been applied prior to ratcheting tests. It is demonstrated that under the same conditions, one can observe ratcheting, plastic shakedown or elasticity according to the prior strain-controlled history. The second objective points out the correlation between the experimental data base devoted to the identification of the material parameters and the quality of the predictions in cyclic plasticity. The results suggest that the choice of the tests should be closely linked to the capabilities of the model. In particular, the presence of non proportional strain-controlled tests in the data base may be not a good choice if the model itself is not able to represent explicitly such a character. All tests considered here were performed on 304L SS at room temperature.

  6. The analytic hierarchy process as a systematic approach to the identification of important parameters for the reliability assessment of passive systems

    International Nuclear Information System (INIS)

    Zio, E.; Cantarella, M.; Cammi, A.

    2003-01-01

    Passive systems play a crucial role in the development of future solutions for nuclear plant technology. A fundamental issue still to be resolved is the quantification of the reliability of such systems. In this paper, we firstly illustrate a systematic methodology to guide the definition of the failure criteria of a passive system and the evaluation of its probability of occurrence, through the identification of the relevant system parameters and the propagation of their associated uncertainties. Within this methodology, we propose the use of the analytic hierarchy process as a structured and reproducible tool for the decomposition of the problem and the identification of the dominant system parameters. An example of its application to a real passive system is illustrated in details

  7. Foxtail millet NF-Y families: genome-wide survey and evolution analyses identified two functional genes important in abiotic stresses

    Directory of Open Access Journals (Sweden)

    Zhi-Juan eFeng

    2015-12-01

    Full Text Available It was reported that Nuclear Factor Y (NF-Y genes were involved in abiotic stress in plants. Foxtail millet (Setaria italica, an elite stress tolerant crop, provided an impetus for the investigation of the NF-Y families in abiotic responses. In the present study, a total of 39 NF-Y genes were identified in foxtail millet. Synteny analyses suggested that foxtail millet NF-Y genes had experienced rapid expansion and strong purifying selection during the process of plant evolution. De novo transcriptome assembly of foxtail millet revealed 11 drought up-regulated NF-Y genes. SiNF-YA1 and SiNF-YB8 were highly activated in leaves and/or roots by drought and salt stresses. Abscisic acid (ABA and H2O2 played positive roles in the induction of SiNF-YA1 and SiNF-YB8 under stress treatments. Transient luciferase (LUC expression assays revealed that SiNF-YA1 and SiNF-YB8 could activate the LUC gene driven by the tobacco (Nicotiana tobacam NtERD10, NtLEA5, NtCAT, NtSOD or NtPOD promoter under normal or stress conditions. Overexpression of SiNF-YA1 enhanced drought and salt tolerance by activating stress-related genes NtERD10 and NtCAT1 and by maintaining relatively stable relative water content (RWC and contents of chlorophyll, superoxide dismutase (SOD, peroxidase (POD, catalase (CAT and malondialdehyde (MDA in transgenic lines under stresses. SiNF-YB8 regulated expression of NtSOD, NtPOD, NtLEA5 and NtERD10 and conferred relatively high RWC and chlorophyll contents and low MDA content, resulting in drought and osmotic tolerance in transgenic lines under stresses. Therefore, SiNF-YA1 and SiNF-YB8 could activate stress-related genes and improve physiological traits, resulting in tolerance to abiotic stresses in plants. All these results will facilitate functional characterization of foxtail millet NF-Ys in future studies.

  8. Identifying the spatial parameters for differences in gender behaviour in built environments The flâneur and flâneuse of the 21st century

    Directory of Open Access Journals (Sweden)

    Akkelies van Ness

    2013-06-01

    Full Text Available The aim of this research is to show how the spatial features of urban environments affect women and men’s behaviour pattern. The paper’s first part reveals the concept flâneuse in the relationship with the flâneur. Then the spatial parameters of built environments are discussed. As the results from this inquiry show, correlations between the spatial configurative structures and how men and women use urban space were found on the one hand. In spatially integrated streets, an equal number of women and men were found. The more segregated the streets tend to be the more they were dominated by men. On the other hand, as soon as the shops were closed, men dominated the streets. Women are using the street as corridor and not as a destination itself. When women are using the squares in the evening or at night, they are usually accompanied by others. The use of space syntax showed that liveliness could be predicted by the structure of the city. Not only do the crowd provide the flâneuse a valid excuse to wander around the streets, a sense of security, but it’s also a component of flânerie: to see and to be seen. Namely, for the flâneuse liveliness is one of the conditions to stroll around. Hence, knowledge provided from research seems to be essential for designing urban environment attractive for women as well for men. 

  9. Identifying Pollutants in the Siret River Basin by Applying New Assessment Tools on Monitoring Data: the Correlation of Land Use and Physicochemical Parameter of Water Quality Analysis

    Directory of Open Access Journals (Sweden)

    Mănescu Andreea

    2014-10-01

    Full Text Available The Siret River are used as raw water source for different municipal water supply systems, yet the Siret River are used as receiving bodies by some inhabitants and industry. In the study the quality of the Siret River water was determinate using a Water Quality Index (WQI. Results are presented from a field study performed on the Bistrita, Moldova, Suceava, Siret, Şomuzu Mare, Trotuş and Tributary River in the study area Siret Basin Romania. The main objective of this study was to determine is to find correlations land use to indicators physical-chemical of water quality, to investigate pollution source is more responsible for river water quality. This is of interest not only research context, but also for supporting and facilitating the application analysis postullend in the Water Framework Directive (WFD (2000/60/CE for the establishment of programmers of measures. For this purpose a slightly impact pollution source municipal wastewater treatment, land uses, urban, forest, agriculture and mining was selected and intensively monitored during six years January 2006 - December 2011, sampling was determined to meet the WFD standards for confidence in twenty two different control section of the Siret Basin. The main measures to reduce emissions to the Siret River were calcium, ammonium, sulfate, residue fixed (RF, sodium, chloride, free detergent and municipal wastewater treatment, concentrated on point emission. The main contributor to diffuse this parameters increased when more percentage of land was dedicated to industry and urban and less to forest and mining.

  10. A Systematic Approach of Employing Quality by Design Principles: Risk Assessment and Design of Experiments to Demonstrate Process Understanding and Identify the Critical Process Parameters for Coating of the Ethylcellulose Pseudolatex Dispersion Using Non-Conventional Fluid Bed Process.

    Science.gov (United States)

    Kothari, Bhaveshkumar H; Fahmy, Raafat; Claycamp, H Gregg; Moore, Christine M V; Chatterjee, Sharmista; Hoag, Stephen W

    2017-05-01

    The goal of this study was to utilize risk assessment techniques and statistical design of experiments (DoE) to gain process understanding and to identify critical process parameters for the manufacture of controlled release multiparticulate beads using a novel disk-jet fluid bed technology. The material attributes and process parameters were systematically assessed using the Ishikawa fish bone diagram and failure mode and effect analysis (FMEA) risk assessment methods. The high risk attributes identified by the FMEA analysis were further explored using resolution V fractional factorial design. To gain an understanding of the processing parameters, a resolution V fractional factorial study was conducted. Using knowledge gained from the resolution V study, a resolution IV fractional factorial study was conducted; the purpose of this IV study was to identify the critical process parameters (CPP) that impact the critical quality attributes and understand the influence of these parameters on film formation. For both studies, the microclimate, atomization pressure, inlet air volume, product temperature (during spraying and curing), curing time, and percent solids in the coating solutions were studied. The responses evaluated were percent agglomeration, percent fines, percent yield, bead aspect ratio, median particle size diameter (d50), assay, and drug release rate. Pyrobuttons® were used to record real-time temperature and humidity changes in the fluid bed. The risk assessment methods and process analytical tools helped to understand the novel disk-jet technology and to systematically develop models of the coating process parameters like process efficiency and the extent of curing during the coating process.

  11. Volatile organic compounds and good laboratory practices in the in vitro fertilization laboratory: the important parameters for successful outcome in extended culture.

    Science.gov (United States)

    Agarwal, Nupur; Chattopadhyay, Ratna; Ghosh, Sanghamitra; Bhoumik, Arpita; Goswami, S K; Chakravarty, Baidyanath

    2017-08-01

    This study aims to describe the role of implementing good laboratory practices to improve in vitro fertilization (IVF) outcomes which are of great interest for practitioners dealing with infertility. Certain modifications were introduced in May 2015 in our IVF laboratory like high-efficiency particulate air CODA system, steel furniture instead of wooden, use of new disinfectants like oosafe, and restriction of personnel entry along with avoidance of cosmetics like perfume to improve pregnancy rates. Volatile organic compound (VOC) meter reading was monitored at two time points and five different places in the laboratory to compare the embryonic development parameters before (group A: July 2014-April 2015) and after (group B: July 2015-April 2016) remodeling. The IVF outcomes from 1036 cycles were associated in this study. Reduction in VOC meter readings, enhanced air quality, improvement in blastocyst formation rate, implantation, and clinical pregnancy rate were observed in the laboratory after implementation of new facilities. Results illustrated that the attention must be focused on potential hazards which expose laboratories to elevated VOC levels. Blastocyst formation rate increased around 18%. Implantation rate, clinical pregnancy rate, and live birth rate increased by around 11, 10, and 8%, respectively. In conclusion, with proper engineering and material selection, we have been able to reduce chemical contamination and adverse effects on culture with optimized IVF results. None.

  12. Physician Rating Websites: What Aspects Are Important to Identify a Good Doctor, and Are Patients Capable of Assessing Them? A Mixed-Methods Approach Including Physicians' and Health Care Consumers' Perspectives.

    Science.gov (United States)

    Rothenfluh, Fabia; Schulz, Peter J

    2017-05-01

    Physician rating websites (PRWs) offer health care consumers the opportunity to evaluate their doctor anonymously. However, physicians' professional training and experience create a vast knowledge gap in medical matters between physicians and patients. This raises ethical concerns about the relevance and significance of health care consumers' evaluation of physicians' performance. To identify the aspects physician rating websites should offer for evaluation, this study investigated the aspects of physicians and their practice relevant for identifying a good doctor, and whether health care consumers are capable of evaluating these aspects. In a first step, a Delphi study with physicians from 4 specializations was conducted, testing various indicators to identify a good physician. These indicators were theoretically derived from Donabedian, who classifies quality in health care into pillars of structure, process, and outcome. In a second step, a cross-sectional survey with health care consumers in Switzerland (N=211) was launched based on the indicators developed in the Delphi study. Participants were asked to rate the importance of these indicators to identify a good physician and whether they would feel capable to evaluate those aspects after the first visit to a physician. All indicators were ordered into a 4×4 grid based on evaluation and importance, as judged by the physicians and health care consumers. Agreement between the physicians and health care consumers was calculated applying Holsti's method. In the majority of aspects, physicians and health care consumers agreed on what facets of care were important and not important to identify a good physician and whether patients were able to evaluate them, yielding a level of agreement of 74.3%. The two parties agreed that the infrastructure, staff, organization, and interpersonal skills are both important for a good physician and can be evaluated by health care consumers. Technical skills of a doctor and outcomes

  13. Important Parameters and Applications for Nickel Electroforming

    DEFF Research Database (Denmark)

    Tang, Peter Torben; Benzon, Michael Eis; Rasmussen, J.P.

    1996-01-01

    H-value, temperature and the use of pulse plating and additives will be examined with respect to mechanical properties such as internal stress, material distribution and hardness. Pulse plating in a chloride and Watts nickel bath and DC plating in sulphamate bath will be discussed, as well as different methods...... for measuring internal stress and material distribution....

  14. Principal component analysis of normalized full spectrum mass spectrometry data in multiMS-toolbox: An effective tool to identify important factors for classification of different metabolic patterns and bacterial strains.

    Science.gov (United States)

    Cejnar, Pavel; Kuckova, Stepanka; Prochazka, Ales; Karamonova, Ludmila; Svobodova, Barbora

    2018-06-15

    Explorative statistical analysis of mass spectrometry data is still a time-consuming step. We analyzed critical factors for application of principal component analysis (PCA) in mass spectrometry and focused on two whole spectrum based normalization techniques and their application in the analysis of registered peak data and, in comparison, in full spectrum data analysis. We used this technique to identify different metabolic patterns in the bacterial culture of Cronobacter sakazakii, an important foodborne pathogen. Two software utilities, the ms-alone, a python-based utility for mass spectrometry data preprocessing and peak extraction, and the multiMS-toolbox, an R software tool for advanced peak registration and detailed explorative statistical analysis, were implemented. The bacterial culture of Cronobacter sakazakii was cultivated on Enterobacter sakazakii Isolation Agar, Blood Agar Base and Tryptone Soya Agar for 24 h and 48 h and applied by the smear method on an Autoflex speed MALDI-TOF mass spectrometer. For three tested cultivation media only two different metabolic patterns of Cronobacter sakazakii were identified using PCA applied on data normalized by two different normalization techniques. Results from matched peak data and subsequent detailed full spectrum analysis identified only two different metabolic patterns - a cultivation on Enterobacter sakazakii Isolation Agar showed significant differences to the cultivation on the other two tested media. The metabolic patterns for all tested cultivation media also proved the dependence on cultivation time. Both whole spectrum based normalization techniques together with the full spectrum PCA allow identification of important discriminative factors in experiments with several variable condition factors avoiding any problems with improper identification of peaks or emphasis on bellow threshold peak data. The amounts of processed data remain still manageable. Both implemented software utilities are available

  15. Formal consensus to identify clinically important changes in management resulting from the use of cardiovascular magnetic resonance (CMR) in patients who activate the primary percutaneous coronary intervention (PPCI) pathway.

    Science.gov (United States)

    Pufulete, Maria; Brierley, Rachel C; Bucciarelli-Ducci, Chiara; Greenwood, John P; Dorman, Stephen; Anderson, Richard A; Harris, Jessica; McAlindon, Elisa; Rogers, Chris A; Reeves, Barnaby C

    2017-06-22

    To define important changes in management arising from the use of cardiovascular magnetic resonance (CMR) in patients who activate the primary percutaneous coronary intervention (PPCI) pathway. Formal consensus study using literature review and cardiologist expert opinion to formulate consensus statements and setting up a consensus panel to review the statements (by completing a web-based survey, attending a face-to-face meeting to discuss survey results and modify the survey to reflect group discussion and completing the modified survey to determine which statements were in consensus). Formulation of consensus statements: four cardiologists (two CMR and two interventional) and six non-clinical researchers. Formal consensus: seven cardiologists (two CMR and three interventional, one echocardiography and one heart failure). Forty-nine additional cardiologists completed the modified survey. Thirty-seven draft statements describing changes in management following CMR were generated; these were condensed into 12 statements and reviewed through the formal consensus process. Three of 12 statements were classified in consensus in the first survey; these related to the role of CMR in identifying the cause of out-of-hospital cardiac arrest, providing a definitive diagnosis in patients found to have unobstructed arteries on angiography and identifying patients with left ventricular thrombus. Two additional statements were in consensus in the modified survey, relating to the ability of CMR to identify patients who have a poor prognosis after PPCI and assess ischaemia and viability in patients with multivessel disease. There was consensus that CMR leads to clinically important changes in management in five subgroups of patients who activate the PPCI pathway. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  16. MicroRNAs regulate T-cell production of interleukin-9 and identify hypoxia-inducible factor-2α as an important regulator of T helper 9 and regulatory T-cell differentiation.

    Science.gov (United States)

    Singh, Yogesh; Garden, Oliver A; Lang, Florian; Cobb, Bradley S

    2016-09-01

    MicroRNAs (miRNAs) regulate many aspects of helper T cell (Th) development and function. Here we found that they are required for the suppression of interleukin-9 (IL-9) expression in Th9 cells and other Th subsets. Two highly related miRNAs (miR-15b and miR-16) that we previously found to play an important role in regulatory T (Treg) cell differentiation were capable of suppressing IL-9 expression when they were over-expressed in Th9 cells. We used these miRNAs as tools to identify novel regulators of IL-9 expression and found that they could regulate the expression of Epas1, which encodes hypoxia-inducible factor (HIF)-2α. HIF proteins regulate metabolic pathway usage that is important in determining appropriate Th differentiation. The related protein, HIF-1α enhances Th17 differentiation and inhibits Treg cell differentiation. Here we found that HIF-2α was required for IL-9 expression in Th9 cells, but its expression was not sufficient in other Th subsets. Furthermore, HIF-2α suppressed Treg cell differentiation like HIF-1α, demonstrating both similar and distinct roles of the HIF proteins in Th differentiation and adding a further dimension to their function. Ironically, even though miR-15b and miR-16 suppressed HIF-2α expression in Treg cells, inhibiting their function in Treg cells did not lead to an increase in IL-9 expression. Therefore, the physiologically relevant miRNAs that regulate IL-9 expression in Treg cells and other subsets remain unknown. Nevertheless, the analysis of miR-15b and miR-16 function led to the discovery of the importance of HIF-2α so this work demonstrated the utility of studying miRNA function to identify novel regulatory pathways in helper T-cell development. © 2016 John Wiley & Sons Ltd.

  17. Study of important parameters on the irradiation of {sup 124}Xe, to improve the production of {sup 123}I with high purity using the Cyclone-30 cyclotron at IPEN-CNEN/SP; Estudo de parametros relevantes na irradiacao de {sup 124}Xe, visando a otimizacao na obtencao de {sup 123}I ultra puro no ciclotron Cyclone-30 do IPEN-CNEN/SP

    Energy Technology Data Exchange (ETDEWEB)

    Sumiya, Luiz Carlos do Amaral

    2006-07-01

    The development of diagnosis equipment and therapy procedures in nuclear medicine depends on the availability of commercial radioisotopes. IPEN is the most important institution that provides radioisotopes for national market. In order to achieve this function, IPEN had invested in the acquisition of a 30 MeV Cyclone-30 cyclotron to produce mainly {sup 18}F, {sup 67}Ga, {sup 201}Tl and {sup 123}I. The {sup 123}I production is the aim of the present work. With the {sup 123}I routine production data obtained by proton irradiation of Xe targets with an enrichment greater than 99.8%, it was possible to identify the important parameters that have direct influence on the production yield of high purity degree {sup 123}I. Even though the methodology for the commercial production of {sup 123}I, there are an scarcity of operational parameters data for this task. In this work the evaluated parameters were: {sup 124}Xe pressure, proton beam quality, irradiation time, operational temperature of the irradiation system under irradiation, waiting time to obtain {sup 123}I, temperature of washing solution and the impact of the internal Ni coating in the target. With the obtained results it was possible to modify the operational conditions for routine production and increasing the efficiency in about 30%. (author)

  18. Neutron importance calculation in an equivalent cell using the age approximation and differential thermalization models. Determination of the cross section sensitivity to the parameters of a differential model in the thermal range

    International Nuclear Information System (INIS)

    Sidorenko, V.D.

    1978-01-01

    The equations are discussed for calculating the importance of neutron function in heterogeneous media obtained with the integral transport theory method. The thermalization effect in the thermal range is described using the differential model. The account of neutron slowing-down in the epithermal range is accomplished in the age approximation. The fast range is described in the 3-group approximation. On the basis of the equations derived the share of delayed neutrons and lifetimes of prompt neutrons are calculated and compared with available experimental data. In the thermal range the sensitivity of cross sections to some parameters of the differential model is analyzed for reactor cells typical for WWER type reactor cores. The models and approximations used are found to be adequate for the calculations

  19. Importance measures

    International Nuclear Information System (INIS)

    Gomez Cobo, A.

    1997-01-01

    The presentation discusses the following: general concepts of importance measures; example fault tree, used to illustrate importance measures; Birnbaum's structural importance; criticality importance; Fussel-Vesely importance; upgrading function; risk achievement worth; risk reduction worth

  20. Uncertainty of Modal Parameters Estimated by ARMA Models

    DEFF Research Database (Denmark)

    Jensen, Jakob Laigaard; Brincker, Rune; Rytter, Anders

    In this paper the uncertainties of identified modal parameters such as eigenfrequencies and damping ratios are assessed. From the measured response of dynamic excited structures the modal parameters may be identified and provide important structural knowledge. However the uncertainty of the param...

  1. A putative biomarker signature for clinically effective AKT inhibition: correlation of in vitro, in vivo and clinical data identifies the importance of modulation of the mTORC1 pathway.

    Science.gov (United States)

    Cheraghchi-Bashi, Azadeh; Parker, Christine A; Curry, Ed; Salazar, Jean-Frederic; Gungor, Hatice; Saleem, Azeem; Cunnea, Paula; Rama, Nona; Salinas, Cristian; Mills, Gordon B; Morris, Shannon R; Kumar, Rakesh; Gabra, Hani; Stronach, Euan A

    2015-12-08

    Our identification of dysregulation of the AKT pathway in ovarian cancer as a platinum resistance specific event led to a comprehensive analysis of in vitro, in vivo and clinical behaviour of the AKT inhibitor GSK2141795. Proteomic biomarker signatures correlating with effects of GSK2141795 were developed using in vitro and in vivo models, well characterised for related molecular, phenotypic and imaging endpoints. Signatures were validated in temporally paired biopsies from patients treated with GSK2141795 in a clinical study. GSK2141795 caused growth-arrest as single agent in vitro, enhanced cisplatin-induced apoptosis in vitro and reduced tumour volume in combination with platinum in vivo. GSK2141795 treatment in vitro and in vivo resulted in ~50-90% decrease in phospho-PRAS40 and 20-80% decrease in fluoro-deoxyglucose (FDG) uptake. Proteomic analysis of GSK2141795 in vitro and in vivo identified a signature of pathway inhibition including changes in AKT and p38 phosphorylation and total Bim, IGF1R, AR and YB1 levels. In patient biopsies, prior to treatment with GSK2141795 in a phase 1 clinical trial, this signature was predictive of post-treatment changes in the response marker CA125. Development of this signature represents an opportunity to demonstrate the clinical importance of AKT inhibition for re-sensitisation of platinum resistant ovarian cancer to platinum.

  2. Bipolar disorder: The importance of clinical assessment in identifying prognostic factors - An Audit. Part 3: A comparison between Italian and English mental health services and a survey of bipolar disorder.

    Science.gov (United States)

    Verdolini, Norma; Dean, Jonathon; Massucci, Giampaolo; Elisei, Sandro; Quartesan, Roberto; Zaman, Rashid; Agius, Mark

    2014-11-01

    Most of the prognostic factors of bipolar disorder, which determine disease course and outcome, could be detected from simple but often-unrecorded questions asked during the psychiatric clinic assessments. In previous parts of this research, we analysed various prognostic factors and focused on mixed states and rapid cycling subsets. We now compare our sample in England with a small sample from Italy to demonstrate the utility of focused prognostic questioning and of international comparison. We collected data from the clinical notes of 70 English bipolar and 8 Italian bipolar outpatients seen at the initial psychiatric assessment clinic about socio-demographic and clinical factors to determine whether various factors had relevance to prevalence, prognosis, or outcome. The sample comprised 16 bipolar I (22.9%) and 54 bipolar II (77.1%) English outpatients and 7 bipolar I (87.5%) and 1 bipolar II (12.5%) Italian outpatients. Differences between the groups are seen mainly in terms of age of onset, duration of both depressive and hypomanic episodes, presence of psychiatric family history, incidence of mixed state features and rapid cycling, presence of elated mood in response to past antidepressant treatment, and misuse of illicit drugs and alcohol. In order to promote improved mental health primary care, mental health systems in all countries should develop standardized epidemiological tools that are shared between countries. We recommend the use of a questionnaire that reminds clinicians of potentially prognostic information and suggest that this might identify important components of a potential standardized diagnostic and prognostic tool.

  3. Tension-free vaginal tape versus lata fascia sling: The importance of transvulvar ultrasound in the assessment of relevant anatomical parameters in treatment of women with stress urinary incontinence

    Directory of Open Access Journals (Sweden)

    Frederico Teixeira Brandt

    2009-01-01

    Full Text Available Objective: To describe the relevance of transvulvar ultrasound in the assessment of anatomical differences induced by the lata fascia sling (LFS and tension-free vaginal tape (TVT procedures. Materials and Methods: Forty women with stress urinary incontinence (SUI, aged 30 to 60 years, have been treated with either LFS (20 patients or TVT (20 patients. The transvulvar ultrasound of the urethrovesical junction (UVJ and proximal urethra (PU has been used as the main investigational tool both pre- and post-operatively. The studied parameters were the vertical (VUVJD and horizontal (HUVJD UVJ distances, the pubourethral distance (PUD and the PU length. Results: The VUVJD did not vary significantly after the LFS surgery (P=0.10. The PUD became shorter (P=0.001 and the HUVJD became shorter only at rest (P=0.03 after the correction by LFS. The TVT procedure has led to shortening of the VUVJ displacement (P=0.0005 and of the PU length (P=0.02. Conclusions: The transvulvar ultrasound was of utmost importance in the demonstration that both the LFS and TVT surgical procedures elongate the PU, even though the LFS technique does it more efficiently. The LFS technique focus more on shortening the PUD and the TVT procedure focus more on the correction of the vertical UVJ displacement.

  4. Physiological parameters

    International Nuclear Information System (INIS)

    Natera, E.S.

    1998-01-01

    The physiological characteristics of man depend on the intake, metabolism and excretion of stable elements from food, water, and air. The physiological behavior of natural radionuclides and radionuclides from nuclear weapons testing and from the utilization of nuclear energy is believed to follow the pattern of stable elements. Hence information on the normal physiological processes occurring in the human body plays an important role in the assessment of the radiation dose received by man. Two important physiological parameters needed for internal dose determination are the pulmonary function and the water balance. In the Coordinated Research Programme on the characterization of Asian population, five participants submitted data on these physiological characteristics - China, India, Japan, Philippines and Viet Nam. During the CRP, data on other pertinent characteristics such as physical and dietary were simultaneously being collected. Hence, the information on the physiological characteristics alone, coming from the five participants were not complete and are probably not sufficient to establish standard values for the Reference Asian Man. Nonetheless, the data collected is a valuable contribution to this research programme

  5. STARTING BLOCK PERFORMANCE IN SPRINTERS: A STATISTICAL METHOD FOR IDENTIFYING DISCRIMINATIVE PARAMETERS OF THE PERFORMANCE AND AN ANALYSIS OF THE EFFECT OF PROVIDING FEEDBACK OVER A 6-WEEK PERIOD

    Directory of Open Access Journals (Sweden)

    Sylvie Fortier

    2005-06-01

    Full Text Available The purpose of this study was twofold: (a to examine if kinetic and kinematic parameters of the sprint start could differentiate elite from sub-elite sprinters and, (b to investigate whether providing feedback (FB about selected parameters could improve starting block performance of intermediate sprinters over a 6-week training period. Twelve male sprinters, assigned to an elite or a sub-elite group, participated in Experiment 1. Eight intermediate sprinters participated in Experiment 2. All athletes were required to perform three sprint starts at maximum intensity followed by a 10-m run. To detect differences between elite and sub-elite groups, comparisons were made using t-tests for independent samples. Parameters reaching a significant group difference were retained for the linear discriminant analysis (LDA. The LDA yielded four discriminative kinetic parameters. Feedback about these selected parameters was given to sprinters in Experiment 2. For this experiment, data acquisition was divided into three periods. The first six sessions were without specific FB, whereas the following six sessions were enriched by kinetic FB. Finally, athletes underwent a retention session (without FB 4 weeks after the twelfth session. Even though differences were found in the time to front peak force, the time to rear peak force, and the front peak force in the retention session, the results of the present study showed that providing FB about selected kinetic parameters differentiating elite from sub-elite sprinters did not improve the starting block performance of intermediate sprinters

  6. Cellular signaling identifiability analysis: a case study.

    Science.gov (United States)

    Roper, Ryan T; Pia Saccomani, Maria; Vicini, Paolo

    2010-05-21

    Two primary purposes for mathematical modeling in cell biology are (1) simulation for making predictions of experimental outcomes and (2) parameter estimation for drawing inferences from experimental data about unobserved aspects of biological systems. While the former purpose has become common in the biological sciences, the latter is less common, particularly when studying cellular and subcellular phenomena such as signaling-the focus of the current study. Data are difficult to obtain at this level. Therefore, even models of only modest complexity can contain parameters for which the available data are insufficient for estimation. In the present study, we use a set of published cellular signaling models to address issues related to global parameter identifiability. That is, we address the following question: assuming known time courses for some model variables, which parameters is it theoretically impossible to estimate, even with continuous, noise-free data? Following an introduction to this problem and its relevance, we perform a full identifiability analysis on a set of cellular signaling models using DAISY (Differential Algebra for the Identifiability of SYstems). We use our analysis to bring to light important issues related to parameter identifiability in ordinary differential equation (ODE) models. We contend that this is, as of yet, an under-appreciated issue in biological modeling and, more particularly, cell biology. Copyright (c) 2010 Elsevier Ltd. All rights reserved.

  7. Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations.

    Science.gov (United States)

    Tan, Jin-Ai M A; Chin, Saw-Sian; Ong, Gek-Bee; Mohamed Unni, Mohamed N; Soosay, Ashley E R; Gudum, Henry R; Kho, Siew-Leng; Chua, Kek-Heng; Chen, Jang J; George, Elizabeth

    2015-01-01

    Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak. Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing. Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients. The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations. © 2014 S. Karger AG, Basel.

  8. IMPORTANT NOTIFICATION

    CERN Multimedia

    HR Department

    2009-01-01

    Green plates, removals and importation of personal effects Please note that, as from 1 April 2009, formalities relating to K and CD special series French vehicle plates (green plates), removals and importation of personal effects into France and Switzerland will be dealt with by GS Department (Building 73/3-014, tel. 73683/74407). Importation and purchase of tax-free vehicles in Switzerland, as well as diplomatic privileges, will continue to be dealt with by the Installation Service of HR Department (Building 33/1-011, tel. 73962). HR and GS Departments

  9. Using Matrix-Assisted Laser Desorption Ionization-Time of Flight (MALDI-TOF) Complemented with Selected 16S rRNA and gyrB Genes Sequencing to Practically Identify Clinical Important Viridans Group Streptococci (VGS).

    Science.gov (United States)

    Zhou, Menglan; Yang, Qiwen; Kudinha, Timothy; Zhang, Li; Xiao, Meng; Kong, Fanrong; Zhao, Yupei; Xu, Ying-Chun

    2016-01-01

    There are challenges in viridans group streptococci (VGS) identification especially for the mitis group. Few studies have investigated the performance of MALDI-TOF MS system in VGS identification. Using 16S rRNA gene and gyrB gene sequencing as a gold standard, the performance of two MALDI-TOF MS instruments in the identification of 181 VGS clinical isolates was studied. The Bruker Biotyper and Vitek MS IVD systems correctly identified 88.4% and 98.9% of the 181 isolates, respectively. The Vitek MS RUO system was the least reliable, only correctly identifying 38.7% of the isolates to species level with several misidentifications and invalid results. The Bruker Biotyper system was very unreliable in the identification of species within the mitis group. Among 22 non-pneumococci isolates (S. mitis/S. oralis/S. pseudopneumoniae), Biotyper misidentified 21 of them as S. pneumoniae leading to a low sensitivity and low positive predictive value in these species. In contrast, the Vitek MS IVD demonstrated a better resolution for pneumococci and non-pneumococci despite the inability to distinguish between S. mitis/S. oralis. For more accurate species-level identification, further improvements in the VGS spectra databases are needed. Based on MALDI-TOF analysis and selected 16S rRNA gene plus gyrB genes sequencing, we designed a practical VGS identification algorithm.

  10. Inventory parameters

    CERN Document Server

    Sharma, Sanjay

    2017-01-01

    This book provides a detailed overview of various parameters/factors involved in inventory analysis. It especially focuses on the assessment and modeling of basic inventory parameters, namely demand, procurement cost, cycle time, ordering cost, inventory carrying cost, inventory stock, stock out level, and stock out cost. In the context of economic lot size, it provides equations related to the optimum values. It also discusses why the optimum lot size and optimum total relevant cost are considered to be key decision variables, and uses numerous examples to explain each of these inventory parameters separately. Lastly, it provides detailed information on parameter estimation for different sectors/products. Written in a simple and lucid style, it offers a valuable resource for a broad readership, especially Master of Business Administration (MBA) students.

  11. Process Damping Parameters

    International Nuclear Information System (INIS)

    Turner, Sam

    2011-01-01

    The phenomenon of process damping as a stabilising effect in milling has been encountered by machinists since milling and turning began. It is of great importance when milling aerospace alloys where maximum surface speed is limited by excessive tool wear and high speed stability lobes cannot be attained. Much of the established research into regenerative chatter and chatter avoidance has focussed on stability lobe theory with different analytical and time domain models developed to expand on the theory first developed by Trusty and Tobias. Process damping is a stabilising effect that occurs when the surface speed is low relative to the dominant natural frequency of the system and has been less successfully modelled and understood. Process damping is believed to be influenced by the interference of the relief face of the cutting tool with the waveform traced on the cut surface, with material properties and the relief geometry of the tool believed to be key factors governing performance. This study combines experimental trials with Finite Element (FE) simulation in an attempt to identify and understand the key factors influencing process damping performance in titanium milling. Rake angle, relief angle and chip thickness are the variables considered experimentally with the FE study looking at average radial and tangential forces and surface compressive stress. For the experimental study a technique is developed to identify the critical process damping wavelength as a means of measuring process damping performance. For the range of parameters studied, chip thickness is found to be the dominant factor with maximum stable parameters increased by a factor of 17 in the best case. Within the range studied, relief angle was found to have a lesser effect than expected whilst rake angle had an influence.

  12. Importance classification

    International Nuclear Information System (INIS)

    Mizumachi, Wataru; Kobayashi, Masahide

    2008-01-01

    Conventionally, the design of a nuclear reactor has been performed from a viewpoint of a safety function and the importance on earthquake-proof on the basis of not giving off the mainly included radioactivity outside. In this Niigataken-Chuetsuoki earthquake, there is almost no damage to the system, components and structure on safe also in the earthquake beyond assumption, and the validity of the design was checked. But, the situation peculiar to a big earthquake was also generated. The emergency plan room which should serve as a connection center with the exterior was not able to open a door and use at the beginning. Fire-extinguishing system piping fractured and self-defense fire fighting was not made. And so on. Discussion from the following three viewpoints was performed. 1st: The importance from a viewpoint which should maintain a function also with the disaster in case of an earthquake like an emergency plan room etc. 2nd: In the earthquake, since the safe system and un-safe system was influenced, the importance from a viewpoint which may have influence safely inquired when the un-safe system broke down. 3rd: Although it was not directly related safely, discussion from a viewpoint which influences fear of insecurity, such as taking out smoke, for example, was performed (author)

  13. Thoughts on identifiers

    CERN Multimedia

    CERN. Geneva

    2005-01-01

    As business processes and information transactions have become an inextricably intertwined with the Web, the importance of assignment, registration, discovery, and maintenance of identifiers has increased. In spite of this, integrated frameworks for managing identifiers have been slow to emerge. Instead, identification systems arise (quite naturally) from immediate business needs without consideration for how they fit into larger information architectures. In addition, many legacy identifier systems further complicate the landscape, making it difficult for content managers to select and deploy identifier systems that meet both the business case and long term information management objectives. This presentation will outline a model for evaluating identifier applications and the functional requirements of the systems necessary to support them. The model is based on a layered analysis of the characteristics of identifier systems, including: * Functional characteristics * Technology * Policy * Business * Social T...

  14. Infrared Drying Parameter Optimization

    Science.gov (United States)

    Jackson, Matthew R.

    In recent years, much research has been done to explore direct printing methods, such as screen and inkjet printing, as alternatives to the traditional lithographic process. The primary motivation is reduction of the material costs associated with producing common electronic devices. Much of this research has focused on developing inkjet or screen paste formulations that can be printed on a variety of substrates, and which have similar conductivity performance to the materials currently used in the manufacturing of circuit boards and other electronic devices. Very little research has been done to develop a process that would use direct printing methods to manufacture electronic devices in high volumes. This study focuses on developing and optimizing a drying process for conductive copper ink in a high volume manufacturing setting. Using an infrared (IR) dryer, it was determined that conductive copper prints could be dried in seconds or minutes as opposed to tens of minutes or hours that it would take with other drying devices, such as a vacuum oven. In addition, this study also identifies significant parameters that can affect the conductivity of IR dried prints. Using designed experiments and statistical analysis; the dryer parameters were optimized to produce the best conductivity performance for a specific ink formulation and substrate combination. It was determined that for an ethylene glycol, butanol, 1-methoxy 2- propanol ink formulation printed on Kapton, the optimal drying parameters consisted of a dryer height of 4 inches, a temperature setting between 190 - 200°C, and a dry time of 50-65 seconds depending on the printed film thickness as determined by the number of print passes. It is important to note that these parameters are optimized specifically for the ink formulation and substrate used in this study. There is still much research that needs to be done into optimizing the IR dryer for different ink substrate combinations, as well as developing a

  15. Unconventional imports

    International Nuclear Information System (INIS)

    Yamaguchi, N.D.

    2001-01-01

    This article focuses on bitumens and bitumen products from Canadian oil sands and explores how they will affect the Canadian oil industry and the US refining industry. The falling production of crude, the growing demand for it, and the stagnating refining capacity in the US are reported, and Canadian and Mexican exports to the US, the definition of bitumens and bitumen quality, and the position of Canada as world leader in bitumen resources are considered. Bitumen production techniques, sales of bitumens and synthetic crude, the production outlook, and the quality and refining of bitumen and synthetic crude are examined. Plots illustrating North American crude refining capacity, production and demand for 1980-2000; US crude imports from Canada and Mexico (1981-2000), world proven oil reserves (2001), world bitumen resources, and Canadian oil production (1998-2000) are provided. Details of the composition of crudes and bitumens, and recent synthetic crude production are tabulated

  16. Bomb parameters

    International Nuclear Information System (INIS)

    Kerr, George D.; Young, Rebert W.; Cullings, Harry M.; Christry, Robert F.

    2005-01-01

    The reconstruction of neutron and gamma-ray doses at Hiroshima and Nagasaki begins with a determination of the parameters describing the explosion. The calculations of the air transported radiation fields and survivor doses from the Hiroshima and Nagasaki bombs require knowledge of a variety of parameters related to the explosions. These various parameters include the heading of the bomber when the bomb was released, the epicenters of the explosions, the bomb yields, and the tilt of the bombs at time of explosion. The epicenter of a bomb is the explosion point in air that is specified in terms of a burst height and a hypocenter (or the point on the ground directly below the epicenter of the explosion). The current reassessment refines the energy yield and burst height for the Hiroshima bomb, as well as the locations of the Hiroshima and Nagasaki hypocenters on the modern city maps used in the analysis of the activation data for neutrons and TLD data for gamma rays. (J.P.N.)

  17. Uncertainty of Modal Parameters Estimated by ARMA Models

    DEFF Research Database (Denmark)

    Jensen, Jacob Laigaard; Brincker, Rune; Rytter, Anders

    1990-01-01

    In this paper the uncertainties of identified modal parameters such as eidenfrequencies and damping ratios are assed. From the measured response of dynamic excited structures the modal parameters may be identified and provide important structural knowledge. However the uncertainty of the parameters...... by simulation study of a lightly damped single degree of freedom system. Identification by ARMA models has been choosen as system identification method. It is concluded that both the sampling interval and number of sampled points may play a significant role with respect to the statistical errors. Furthermore......, it is shown that the model errors may also contribute significantly to the uncertainty....

  18. Methodology for Evaluating Safety System Operability using Virtual Parameter Network

    International Nuclear Information System (INIS)

    Park, Sukyoung; Heo, Gyunyoung; Kim, Jung Taek; Kim, Tae Wan

    2014-01-01

    KAERI (Korea Atomic Energy Research Institute) and UTK (University of Tennessee Knoxville) are working on the I-NERI project to suggest complement of this problem. This research propose the methodology which provide the alternative signal in case of unable guaranteed reliability of some instrumentation with KAERI. Proposed methodology is assumed that several instrumentations are working normally under the power supply condition because we do not consider the instrumentation survivability itself. Thus, concept of the Virtual Parameter Network (VPN) is used to identify the associations between plant parameters. This paper is extended version of the paper which was submitted last KNS meeting by changing the methodology and adding the result of the case study. In previous research, we used Artificial Neural Network (ANN) inferential technique for estimation model but every time this model showed different estimate value due to random bias each time. Therefore Auto-Associative Kernel Regression (AAKR) model which have same number of inputs and outputs is used to estimate. Also the importance measures in the previous method depend on estimation model but importance measure of improved method independent on estimation model. Also importance index of previous method depended on estimation model but importance index of improved method is independent on estimation model. In this study, we proposed the methodology to identify the internal state of power plant when severe accident happens also it has been validated through case study. SBLOCA which has large contribution to severe accident is considered as initiating event and relationship amongst parameter has been identified. VPN has ability to identify that which parameter has to be observed and which parameter can be alternative to the missing parameter when some instruments are failed in severe accident. In this study we have identified through results that commonly number 2, 3, 4 parameter has high connectivity while

  19. Methodology for Evaluating Safety System Operability using Virtual Parameter Network

    Energy Technology Data Exchange (ETDEWEB)

    Park, Sukyoung; Heo, Gyunyoung [Kyung Hee Univ., Yongin (Korea, Republic of); Kim, Jung Taek [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of); Kim, Tae Wan [Kepco International Nuclear Graduate School, Ulsan (Korea, Republic of)

    2014-05-15

    KAERI (Korea Atomic Energy Research Institute) and UTK (University of Tennessee Knoxville) are working on the I-NERI project to suggest complement of this problem. This research propose the methodology which provide the alternative signal in case of unable guaranteed reliability of some instrumentation with KAERI. Proposed methodology is assumed that several instrumentations are working normally under the power supply condition because we do not consider the instrumentation survivability itself. Thus, concept of the Virtual Parameter Network (VPN) is used to identify the associations between plant parameters. This paper is extended version of the paper which was submitted last KNS meeting by changing the methodology and adding the result of the case study. In previous research, we used Artificial Neural Network (ANN) inferential technique for estimation model but every time this model showed different estimate value due to random bias each time. Therefore Auto-Associative Kernel Regression (AAKR) model which have same number of inputs and outputs is used to estimate. Also the importance measures in the previous method depend on estimation model but importance measure of improved method independent on estimation model. Also importance index of previous method depended on estimation model but importance index of improved method is independent on estimation model. In this study, we proposed the methodology to identify the internal state of power plant when severe accident happens also it has been validated through case study. SBLOCA which has large contribution to severe accident is considered as initiating event and relationship amongst parameter has been identified. VPN has ability to identify that which parameter has to be observed and which parameter can be alternative to the missing parameter when some instruments are failed in severe accident. In this study we have identified through results that commonly number 2, 3, 4 parameter has high connectivity while

  20. Near Identifiability of Dynamical Systems

    Science.gov (United States)

    Hadaegh, F. Y.; Bekey, G. A.

    1987-01-01

    Concepts regarding approximate mathematical models treated rigorously. Paper presents new results in analysis of structural identifiability, equivalence, and near equivalence between mathematical models and physical processes they represent. Helps establish rigorous mathematical basis for concepts related to structural identifiability and equivalence revealing fundamental requirements, tacit assumptions, and sources of error. "Structural identifiability," as used by workers in this field, loosely translates as meaning ability to specify unique mathematical model and set of model parameters that accurately predict behavior of corresponding physical system.

  1. General image acquisition parameters

    International Nuclear Information System (INIS)

    Teissier, J.M.; Lopez, F.M.; Langevin, J.F.

    1993-01-01

    The general parameters are of primordial importance to achieve image quality in terms of spatial resolution and contrast. They also play a role in the acquisition time for each sequence. We describe them separately, before associating them in a decision tree gathering the various options that are possible for diagnosis

  2. A new importance measure for sensitivity analysis

    International Nuclear Information System (INIS)

    Liu, Qiao; Homma, Toshimitsu

    2010-01-01

    Uncertainty is an integral part of risk assessment of complex engineering systems, such as nuclear power plants and space crafts. The aim of sensitivity analysis is to identify the contribution of the uncertainty in model inputs to the uncertainty in the model output. In this study, a new importance measure that characterizes the influence of the entire input distribution on the entire output distribution was proposed. It represents the expected deviation of the cumulative distribution function (CDF) of the model output that would be obtained when one input parameter of interest were known. The applicability of this importance measure was tested with two models, a nonlinear nonmonotonic mathematical model and a risk model. In addition, a comparison of this new importance measure with several other importance measures was carried out and the differences between these measures were explained. (author)

  3. Important parameters in ORIGEN2 calculations of spent fuel compositions

    International Nuclear Information System (INIS)

    Welch, T.D.; Notz, K.J.; Andermann, R.J. Jr.

    1990-01-01

    The Department of Energy (DOE) Office of Civilian Radioactive Waste Management (OCRWM) is responsible for implementing federal policy for the management and permanent disposal of spent nuclear fuel from civilian nuclear power reactors and of high-level radioactive waste. The Characteristics Data Base (CDB) provides an extensive collection of data on the four waste steams that may require long-term isolation: LWR spent fuel, high-level waste, non-LWR spent fuel, and miscellaneous wastes (such as greater-than-class-C). The eight-volume report and the five supplemental menu-driven PC data bases encompass radiological characteristics, chemical compositions, physical descriptions, inventories, and projections. An overview of these data bases, which are available through the Oak Ridge National Laboratory, is provided by Notz. This paper reports that the radiological characteristics in the CDB are calculated using ORIGEN2

  4. Use of importance measures in risk-informed regulatory applications

    International Nuclear Information System (INIS)

    Cheok, Michael C.; Parry, Gareth W.; Sherry, Richard R.

    1998-01-01

    The use of importance measures to analyze PRA results is discussed. Commonly used importance measures are defined. Some issues that have been identified as potentially limiting their usefulness are addressed, namely: there is no simple relationship between importance measures evaluated at the single component level and those evaluated at the level of a group of components, and, as a result, some of the commonly used importance measures are not realistic measures of the sensitivity of the overall risk to parameter value changes; and, importance measures do not typically take into account parameter uncertainties which raises the question of the robustness of conclusions drawn from importance analyses. The issues are explored in the context of both ranking and categorization of structures, systems, and components (SSCs) with respect to risk-significance and safety-significance for use in risk-informed regulatory analyses

  5. Radiation portal evaluation parameters

    International Nuclear Information System (INIS)

    York, R.L.

    1998-01-01

    The detection of the unauthorized movement of radioactive materials is one of the most effective nonproliferation measures. Automatic special nuclear material (SNM) portal monitors are designed to detect this unauthorized movement and are an important part of the safeguard systems at US nuclear facilities. SNM portals differ from contamination monitors because they are designed to have high sensitivity for the low energy gamma-rays associated with highly enriched uranium (HEU) and plutonium. These instruments are now being installed at international borders to prevent the spread of radioactive contamination an SNM. In this paper the parameters important to evaluating radiation portal monitors are discussed. (author)

  6. A parameter tree approach to estimating system sensitivities to parameter sets

    International Nuclear Information System (INIS)

    Jarzemba, M.S.; Sagar, B.

    2000-01-01

    Total System Performance Assessment Code called TPA, realizations are obtained and analyzed. In the examples presented, groups of five important parameters, one for each level of the tree, are used to identify branches of the tree and construct the bins. In the first example, the five important parameters are selected by more traditional sensitivity analysis techniques. This example shows that relatively few branches of the tree dominate system performance. In another example, the same realizations are used but the most important five-parameter set is determined in a stepwise manner (using the parameter tree technique) and it is found that these five parameters do not match the five of the first example. This important result shows that sensitivities based on individual parameters (i.e. one parameter at a time) may differ from sensitivities estimated based on joint sets of parameters (i.e. two or more parameters at a time). The technique is extended using subsystem outputs to define the branches of the tree. The subsystem outputs used in this example are the total cumulative radionuclide release (TCR) from the engineered barriers, unsaturated zone, and saturated zone over 10,000 yr. The technique is found to be successful in estimating the relative influence of each of these three subsystems on the overall system behavior

  7. Calculation of shielding parameters

    International Nuclear Information System (INIS)

    Montoya Z, J.

    1994-01-01

    With the propose of reduce the hazard to radiation, exist three basic factors: a) time, the time to exposition to working person inside to area, from exist determined speed the doses, is proportional of the time permanence; b) distance, the reduce to doses is inverse square of the distance to exposition point; c) building, consist to interpose between source and exposition point to material. The main aspect development to the analysis of parameters distance and building. The analysis consist to development of the mathematical implicit, in the model of source radioactive, beginning with the geometry to source, distance to exposition source, and configuration building. In the final part was realize one comparative studied to calculus of parameters to blinding, employs two codes CPBGAM and MICROSHIELD, the first made as part to work thesis. The point source its a good approximation to any one real source, but in the majority of the time to propose analysis the spatial distribution of the source must realized in explicit way. The buildings calculus in volumetry's source can be approximate begin's of plan as source adaptations. It's important to have present that not only the building exist the exposition to the radiation, and the parameters time and distance plays an important paper too. (Author)

  8. Analysis of sagittal spinopelvic parameters in achondroplasia.

    Science.gov (United States)

    Hong, Jae-Young; Suh, Seung-Woo; Modi, Hitesh N; Park, Jong-Woong; Park, Jung-Ho

    2011-08-15

    Prospective radiological analysis of patients with achondroplasia. To analyze sagittal spinal alignment and pelvic orientation in achondroplasia patients. Knowledge of sagittal spinopelvic parameters is important for the treatment of achondroplasia, because they differ from those of the normal population and can induce pain. The study and control groups were composed of 32 achondroplasia patients and 24 healthy volunteers, respectively. All underwent lateral radiography of the whole spine including hip joints. The radiographic parameters examined were sacral slope (SS), pelvic tilt, pelvic incidence (PI), S1 overhang, thoracic kyphosis, T10-L2 kyphosis, lumbar lordosis (LL1, LL2), and sagittal balance. Statistical analysis was performed to identify significant differences between the two groups. In addition, correlations between parameters and symptoms were sought. Sagittal spinopelvic parameters, namely, pelvic tilt, pelvic incidence, S1 overhang, thoracic kyphosis, T10-L2 kyphosis, lumbar lordosis 1 and sagittal balance were found to be significantly different in the patient and control groups (P achondroplasia patients and normal healthy controls. The present study shows that sagittal spinal and pelvic parameters can assist the treatment of spinal disorders in achondroplasia patients.

  9. Simple method for quick estimation of aquifer hydrogeological parameters

    Science.gov (United States)

    Ma, C.; Li, Y. Y.

    2017-08-01

    Development of simple and accurate methods to determine the aquifer hydrogeological parameters was of importance for groundwater resources assessment and management. Aiming at the present issue of estimating aquifer parameters based on some data of the unsteady pumping test, a fitting function of Theis well function was proposed using fitting optimization method and then a unitary linear regression equation was established. The aquifer parameters could be obtained by solving coefficients of the regression equation. The application of the proposed method was illustrated, using two published data sets. By the error statistics and analysis on the pumping drawdown, it showed that the method proposed in this paper yielded quick and accurate estimates of the aquifer parameters. The proposed method could reliably identify the aquifer parameters from long distance observed drawdowns and early drawdowns. It was hoped that the proposed method in this paper would be helpful for practicing hydrogeologists and hydrologists.

  10. LMFBR plant parameters 1991

    International Nuclear Information System (INIS)

    1991-03-01

    The document has been prepared on the basis of information provided by the members of the IAEA International Working Group on Fast Reactors (IWGFR). It contains updated parameters of 27 experimental, prototype and commercial size liquid metal fast breeder reactors (LMFBRs). Most of the reactors are currently in operation, under construction or in an advanced planning stage. Parameters of the Clinch River Breeder Reactor (USA), PEC (Italy), RAPSODIE (France), DFR (UK) and EFFBR (USA) are included in the report because of their important role in the development of LMFBR technology from first LMFBRs to the prototype size fast reactors. Two more reactors appeared in the list: European Fast Reactor (EFR) and PRISM (USA). Parameters of these reactors included in this publication are based on the data from the papers presented at the 23rd Annual Meeting of the IWGFR. All in all more than four hundred corrections and additions have been made to update the document. The report is intended for specialists and institutions in industrialized and developing countries who are responsible for the design and operation of liquid metal fast breeder reactors

  11. Comparison of Parameter Identification Techniques

    Directory of Open Access Journals (Sweden)

    Eder Rafael

    2016-01-01

    Full Text Available Model-based control of mechatronic systems requires excellent knowledge about the physical behavior of each component. For several types of components of a system, e.g. mechanical or electrical ones, the dynamic behavior can be described by means of a mathematic model consisting of a set of differential equations, difference equations and/or algebraic constraint equations. The knowledge of a realistic mathematic model and its parameter values is essential to represent the behaviour of a mechatronic system. Frequently it is hard or impossible to obtain all required values of the model parameters from the producer, so an appropriate parameter estimation technique is required to compute missing parameters. A manifold of parameter identification techniques can be found in the literature, but their suitability depends on the mathematic model. Previous work dealt with the automatic assembly of mathematical models of serial and parallel robots with drives and controllers within the dynamic multibody simulation code HOTINT as fully-fledged mechatronic simulation. Several parameters of such robot models were identified successfully by our embedded algorithm. The present work proposes an improved version of the identification algorithm with higher performance. The quality of the identified parameter values and the computation effort are compared with another standard technique.

  12. GPS User Devices Parameter Control Methods

    OpenAIRE

    Klūga, A; Kuļikovs, M; Beļinska, V; Zeļenkovs, A

    2007-01-01

    In our day’s wide assortment of GPS user devices is manufacture. How to verify that parameters of the real device corresponds to parameters that manufacture shows. How to verify that parameters have not been changed during the operation time. The last one is very important for aviation GPS systems, which must be verified before the flight, but the values of parameter in time of repair works. This work analyses GPS user devices parameters control methods.

  13. Parameter Uncertainty for Repository Thermal Analysis

    Energy Technology Data Exchange (ETDEWEB)

    Hardin, Ernest [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Hadgu, Teklu [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Greenberg, Harris [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Dupont, Mark [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL)

    2015-10-01

    This report is one follow-on to a study of reference geologic disposal design concepts (Hardin et al. 2011a). Based on an analysis of maximum temperatures, that study concluded that certain disposal concepts would require extended decay storage prior to emplacement, or the use of small waste packages, or both. The study used nominal values for thermal properties of host geologic media and engineered materials, demonstrating the need for uncertainty analysis to support the conclusions. This report is a first step that identifies the input parameters of the maximum temperature calculation, surveys published data on measured values, uses an analytical approach to determine which parameters are most important, and performs an example sensitivity analysis. Using results from this first step, temperature calculations planned for FY12 can focus on only the important parameters, and can use the uncertainty ranges reported here. The survey of published information on thermal properties of geologic media and engineered materials, is intended to be sufficient for use in generic calculations to evaluate the feasibility of reference disposal concepts. A full compendium of literature data is beyond the scope of this report. The term “uncertainty” is used here to represent both measurement uncertainty and spatial variability, or variability across host geologic units. For the most important parameters (e.g., buffer thermal conductivity) the extent of literature data surveyed samples these different forms of uncertainty and variability. Finally, this report is intended to be one chapter or section of a larger FY12 deliverable summarizing all the work on design concepts and thermal load management for geologic disposal (M3FT-12SN0804032, due 15Aug2012).

  14. How important is importance for prospective memory? A review

    Directory of Open Access Journals (Sweden)

    Stefan eWalter

    2014-06-01

    Full Text Available Forgetting to carry out an intention as planned can have serious consequences in everyday life. People sometimes even forget intentions that they consider as very important. Here, we review the literature on the impact of importance on prospective memory performance. We highlight different methods used to manipulate the importance of a prospective memory task such as providing rewards, importance relative to other ongoing activities, absolute importance, and providing social motives. Moreover, we address the relationship between importance and other factors known to affect prospective memory and ongoing task performance such as type of prospective memory task (time-, event- or activity-based, cognitive loads, and cue focality. Finally, we provide a connection to motivation, we summarize the effects of task importance and we identify important venues for future research.

  15. How important is importance for prospective memory? A review

    Science.gov (United States)

    Walter, Stefan; Meier, Beat

    2014-01-01

    Forgetting to carry out an intention as planned can have serious consequences in everyday life. People sometimes even forget intentions that they consider as very important. Here, we review the literature on the impact of importance on prospective memory performance. We highlight different methods used to manipulate the importance of a prospective memory task such as providing rewards, importance relative to other ongoing activities, absolute importance, and providing social motives. Moreover, we address the relationship between importance and other factors known to affect prospective memory and ongoing task performance such as type of prospective memory task (time-, event-, or activity-based), cognitive loads, and processing overlaps. Finally, we provide a connection to motivation, we summarize the effects of task importance and we identify important venues for future research. PMID:25018743

  16. Biosphere dose conversion Factor Importance and Sensitivity Analysis

    International Nuclear Information System (INIS)

    M. Wasiolek

    2004-01-01

    This report presents importance and sensitivity analysis for the environmental radiation model for Yucca Mountain, Nevada (ERMYN). ERMYN is a biosphere model supporting the total system performance assessment (TSPA) for the license application (LA) for the Yucca Mountain repository. This analysis concerns the output of the model, biosphere dose conversion factors (BDCFs) for the groundwater, and the volcanic ash exposure scenarios. It identifies important processes and parameters that influence the BDCF values and distributions, enhances understanding of the relative importance of the physical and environmental processes on the outcome of the biosphere model, includes a detailed pathway analysis for key radionuclides, and evaluates the appropriateness of selected parameter values that are not site-specific or have large uncertainty

  17. Parameter setting and input reduction

    NARCIS (Netherlands)

    Evers, A.; van Kampen, N.J.|info:eu-repo/dai/nl/126439737

    2008-01-01

    The language acquisition procedure identifies certain properties of the target grammar before others. The evidence from the input is processed in a stepwise order. Section 1 equates that order and its typical effects with an order of parameter setting. The question is how the acquisition procedure

  18. Parameters for characterizing sites for disposal of low-level radioactive waste

    International Nuclear Information System (INIS)

    Lutton, R.J.; Malone, P.G.; Meade, R.B.; Patrick, D.M.

    1982-05-01

    Sixty-seven site parameters and parameter groups are identified as important characteristics of sites for disposal of low-level radioactive waste and require detailed evaluation. Several of the most important parameters are needed for hydrological analysis while others are needed for facility design, construction, and operation. Still others are needed for baseline and detection stages of monitoring. It is recommended that all parameters be evaluated by technically qualified personnel. Appropriate tests and documentation methods are discussed in a second report, which will follow. However, site-specific testing or elaborate field measurement will not always be necessary, i.e., where indicated to be unnecessary on a technical basis. Much of this report, Appendices A through G, is directed to explaining the importances of parameters and to establishing site-specific limitations

  19. LMFBR plant parameters

    International Nuclear Information System (INIS)

    1985-07-01

    This document has been prepared on the basis of information compiled by the members of the IAEA International Working Group on Fast Reactors (IWGFR). It contains parameters of 25 experimental, prototype and commercial size liquid metal fast breeder reactors (LMFBR). Most of the reactors are currently in operation, under construction or in an advanced planning stage. Parameters of the Clinch River Breeder Reactor (USA) are presented because its design was nearly finished and most of the components were fabricated at the time when the project was terminated. Three reactors (RAPSODIE (France), DFR (UK) and EFFBR (USA)) have been shut down. However, they are included in the report because of their important role in the development of LMFBR technology from first LMFBRs to the prototype size fast reactors. The first LMFBRs (CLEMENTINE (USA), EBR-1 (USA), BR-2 (USSR), BR-5 (USSR)) and very special reactors (LAMPRE (USA), SEFOR (USA)) were not recommended by the members of the IWGFR to be included in the report

  20. Booster parameter list

    International Nuclear Information System (INIS)

    Parsa, Z.

    1986-10-01

    The AGS Booster is designed to be an intermediate synchrotron injector for the AGS, capable of accelerating protons from 200 MeV to 1.5 GeV. The parameters listed include beam and operational parameters and lattice parameters, as well as parameters pertaining to the accelerator's magnets, vacuum system, radio frequency acceleration system, and the tunnel. 60 refs., 41 figs

  1. Lumped-parameter models

    Energy Technology Data Exchange (ETDEWEB)

    Ibsen, Lars Bo; Liingaard, M.

    2006-12-15

    A lumped-parameter model represents the frequency dependent soil-structure interaction of a massless foundation placed on or embedded into an unbounded soil domain. In this technical report the steps of establishing a lumped-parameter model are presented. Following sections are included in this report: Static and dynamic formulation, Simple lumped-parameter models and Advanced lumped-parameter models. (au)

  2. Probabilistic parameter estimation of activated sludge processes using Markov Chain Monte Carlo.

    Science.gov (United States)

    Sharifi, Soroosh; Murthy, Sudhir; Takács, Imre; Massoudieh, Arash

    2014-03-01

    One of the most important challenges in making activated sludge models (ASMs) applicable to design problems is identifying the values of its many stoichiometric and kinetic parameters. When wastewater characteristics data from full-scale biological treatment systems are used for parameter estimation, several sources of uncertainty, including uncertainty in measured data, external forcing (e.g. influent characteristics), and model structural errors influence the value of the estimated parameters. This paper presents a Bayesian hierarchical modeling framework for the probabilistic estimation of activated sludge process parameters. The method provides the joint probability density functions (JPDFs) of stoichiometric and kinetic parameters by updating prior information regarding the parameters obtained from expert knowledge and literature. The method also provides the posterior correlations between the parameters, as well as a measure of sensitivity of the different constituents with respect to the parameters. This information can be used to design experiments to provide higher information content regarding certain parameters. The method is illustrated using the ASM1 model to describe synthetically generated data from a hypothetical biological treatment system. The results indicate that data from full-scale systems can narrow down the ranges of some parameters substantially whereas the amount of information they provide regarding other parameters is small, due to either large correlations between some of the parameters or a lack of sensitivity with respect to the parameters. Copyright © 2013 Elsevier Ltd. All rights reserved.

  3. Sparse Linear Identifiable Multivariate Modeling

    DEFF Research Database (Denmark)

    Henao, Ricardo; Winther, Ole

    2011-01-01

    and bench-marked on artificial and real biological data sets. SLIM is closest in spirit to LiNGAM (Shimizu et al., 2006), but differs substantially in inference, Bayesian network structure learning and model comparison. Experimentally, SLIM performs equally well or better than LiNGAM with comparable......In this paper we consider sparse and identifiable linear latent variable (factor) and linear Bayesian network models for parsimonious analysis of multivariate data. We propose a computationally efficient method for joint parameter and model inference, and model comparison. It consists of a fully...

  4. Identifiability in stochastic models

    CERN Document Server

    1992-01-01

    The problem of identifiability is basic to all statistical methods and data analysis, occurring in such diverse areas as Reliability Theory, Survival Analysis, and Econometrics, where stochastic modeling is widely used. Mathematics dealing with identifiability per se is closely related to the so-called branch of ""characterization problems"" in Probability Theory. This book brings together relevant material on identifiability as it occurs in these diverse fields.

  5. Permutation importance: a corrected feature importance measure.

    Science.gov (United States)

    Altmann, André; Toloşi, Laura; Sander, Oliver; Lengauer, Thomas

    2010-05-15

    In life sciences, interpretability of machine learning models is as important as their prediction accuracy. Linear models are probably the most frequently used methods for assessing feature relevance, despite their relative inflexibility. However, in the past years effective estimators of feature relevance have been derived for highly complex or non-parametric models such as support vector machines and RandomForest (RF) models. Recently, it has been observed that RF models are biased in such a way that categorical variables with a large number of categories are preferred. In this work, we introduce a heuristic for normalizing feature importance measures that can correct the feature importance bias. The method is based on repeated permutations of the outcome vector for estimating the distribution of measured importance for each variable in a non-informative setting. The P-value of the observed importance provides a corrected measure of feature importance. We apply our method to simulated data and demonstrate that (i) non-informative predictors do not receive significant P-values, (ii) informative variables can successfully be recovered among non-informative variables and (iii) P-values computed with permutation importance (PIMP) are very helpful for deciding the significance of variables, and therefore improve model interpretability. Furthermore, PIMP was used to correct RF-based importance measures for two real-world case studies. We propose an improved RF model that uses the significant variables with respect to the PIMP measure and show that its prediction accuracy is superior to that of other existing models. R code for the method presented in this article is available at http://www.mpi-inf.mpg.de/ approximately altmann/download/PIMP.R CONTACT: altmann@mpi-inf.mpg.de, laura.tolosi@mpi-inf.mpg.de Supplementary data are available at Bioinformatics online.

  6. Hecke algebras with unequal parameters

    CERN Document Server

    Lusztig, G

    2003-01-01

    Hecke algebras arise in representation theory as endomorphism algebras of induced representations. One of the most important classes of Hecke algebras is related to representations of reductive algebraic groups over p-adic or finite fields. In 1979, in the simplest (equal parameter) case of such Hecke algebras, Kazhdan and Lusztig discovered a particular basis (the KL-basis) in a Hecke algebra, which is very important in studying relations between representation theory and geometry of the corresponding flag varieties. It turned out that the elements of the KL-basis also possess very interesting combinatorial properties. In the present book, the author extends the theory of the KL-basis to a more general class of Hecke algebras, the so-called algebras with unequal parameters. In particular, he formulates conjectures describing the properties of Hecke algebras with unequal parameters and presents examples verifying these conjectures in particular cases. Written in the author's precise style, the book gives rese...

  7. A new uncertainty importance measure

    International Nuclear Information System (INIS)

    Borgonovo, E.

    2007-01-01

    Uncertainty in parameters is present in many risk assessment problems and leads to uncertainty in model predictions. In this work, we introduce a global sensitivity indicator which looks at the influence of input uncertainty on the entire output distribution without reference to a specific moment of the output (moment independence) and which can be defined also in the presence of correlations among the parameters. We discuss its mathematical properties and highlight the differences between the present indicator, variance-based uncertainty importance measures and a moment independent sensitivity indicator previously introduced in the literature. Numerical results are discussed with application to the probabilistic risk assessment model on which Iman [A matrix-based approach to uncertainty and sensitivity analysis for fault trees. Risk Anal 1987;7(1):22-33] first introduced uncertainty importance measures

  8. Reduction of robot base parameters

    Energy Technology Data Exchange (ETDEWEB)

    Vandanjon, P O [CEA Centre d` Etudes de Saclay, 91 - Gif-sur-Yvette (France). Dept. des Procedes et Systemes Avances; Gautier, M [Nantes Univ., 44 (France)

    1996-12-31

    This paper is a new step in the search of minimum dynamic parameters of robots. In spite of planing exciting trajectories and using base parameters, some parameters remain not identifiable due to the perturbation effects. In this paper, we propose methods to reduce the set of base parameters in order to get an essential set of parameters. This new set defines a simplified identification model witch improves the noise immunity of the estimation process. It contributes also in reducing the computation burden of a simplified dynamic model. Different methods are proposed and are classified in two parts: methods, witch perform reduction and identification together, come from statistical field and methods, witch reduces the model before the identification thanks to a priori information, come from numerical field like the QR factorization. Statistical tools and QR reduction are shown to be efficient and adapted to determine the essential parameters. They can be applied to open-loop, or graph structured rigid robot, as well as flexible-link robot. Application for the PUMA 560 robot is given. (authors). 9 refs., 4 tabs.

  9. Reduction of robot base parameters

    International Nuclear Information System (INIS)

    Vandanjon, P.O.

    1995-01-01

    This paper is a new step in the search of minimum dynamic parameters of robots. In spite of planing exciting trajectories and using base parameters, some parameters remain not identifiable due to the perturbation effects. In this paper, we propose methods to reduce the set of base parameters in order to get an essential set of parameters. This new set defines a simplified identification model witch improves the noise immunity of the estimation process. It contributes also in reducing the computation burden of a simplified dynamic model. Different methods are proposed and are classified in two parts: methods, witch perform reduction and identification together, come from statistical field and methods, witch reduces the model before the identification thanks to a priori information, come from numerical field like the QR factorization. Statistical tools and QR reduction are shown to be efficient and adapted to determine the essential parameters. They can be applied to open-loop, or graph structured rigid robot, as well as flexible-link robot. Application for the PUMA 560 robot is given. (authors). 9 refs., 4 tabs

  10. Voltage stability, bifurcation parameters and continuation methods

    Energy Technology Data Exchange (ETDEWEB)

    Alvarado, F L [Wisconsin Univ., Madison, WI (United States)

    1994-12-31

    This paper considers the importance of the choice of bifurcation parameter in the determination of the voltage stability limit and the maximum power load ability of a system. When the bifurcation parameter is power demand, the two limits are equivalent. However, when other types of load models and bifurcation parameters are considered, the two concepts differ. The continuation method is considered as a method for determination of voltage stability margins. Three variants of the continuation method are described: the continuation parameter is the bifurcation parameter the continuation parameter is initially the bifurcation parameter, but is free to change, and the continuation parameter is a new `arc length` parameter. Implementations of voltage stability software using continuation methods are described. (author) 23 refs., 9 figs.

  11. Bootstrap analysis of designed experiments for reliability improvement with a non-constant scale parameter

    International Nuclear Information System (INIS)

    Wang, Guodong; He, Zhen; Xue, Li; Cui, Qingan; Lv, Shanshan; Zhou, Panpan

    2017-01-01

    Factors which significantly affect product reliability are of great interest to reliability practitioners. This paper proposes a bootstrap-based methodology for identifying significant factors when both location and scale parameters of the smallest extreme value distribution vary over experimental factors. An industrial thermostat experiment is presented, analyzed, and discussed as an illustrative example. The analysis results show that 1) the misspecification of a constant scale parameter may lead to misidentify spurious effects; 2) the important factors identified by different bootstrap methods (i.e., percentile bootstrapping, bias-corrected percentile bootstrapping, and bias-corrected and accelerated percentile bootstrapping) are different; 3) the number of factors affecting 10th percentile lifetime significantly is less than the number of important factors identified at 63.21th percentile. - Highlights: • Product reliability is improved by design of experiments under both scale and location parameters of smallest extreme value distribution vary with experimental factors. • A bootstrap-based methodology is proposed to identify important factors which affect 100pth lifetime percentile significantly. • Bootstrapping confidence intervals associating experimental factors are obtained by using three bootstrap methods (i.e., percentile bootstrapping, bias-corrected percentile bootstrapping, and bias-corrected and accelerated percentile bootstrapping). • The important factors identified by different bootstrap methods are different. • The number of factors affecting 10th percentile significantly is less than the number of important factors identified at 63.21th percentile.

  12. Structural identifiability of cyclic graphical models of biological networks with latent variables.

    Science.gov (United States)

    Wang, Yulin; Lu, Na; Miao, Hongyu

    2016-06-13

    Graphical models have long been used to describe biological networks for a variety of important tasks such as the determination of key biological parameters, and the structure of graphical model ultimately determines whether such unknown parameters can be unambiguously obtained from experimental observations (i.e., the identifiability problem). Limited by resources or technical capacities, complex biological networks are usually partially observed in experiment, which thus introduces latent variables into the corresponding graphical models. A number of previous studies have tackled the parameter identifiability problem for graphical models such as linear structural equation models (SEMs) with or without latent variables. However, the limited resolution and efficiency of existing approaches necessarily calls for further development of novel structural identifiability analysis algorithms. An efficient structural identifiability analysis algorithm is developed in this study for a broad range of network structures. The proposed method adopts the Wright's path coefficient method to generate identifiability equations in forms of symbolic polynomials, and then converts these symbolic equations to binary matrices (called identifiability matrix). Several matrix operations are introduced for identifiability matrix reduction with system equivalency maintained. Based on the reduced identifiability matrices, the structural identifiability of each parameter is determined. A number of benchmark models are used to verify the validity of the proposed approach. Finally, the network module for influenza A virus replication is employed as a real example to illustrate the application of the proposed approach in practice. The proposed approach can deal with cyclic networks with latent variables. The key advantage is that it intentionally avoids symbolic computation and is thus highly efficient. Also, this method is capable of determining the identifiability of each single parameter and

  13. Structural Identifiability of Dynamic Systems Biology Models.

    Science.gov (United States)

    Villaverde, Alejandro F; Barreiro, Antonio; Papachristodoulou, Antonis

    2016-10-01

    A powerful way of gaining insight into biological systems is by creating a nonlinear differential equation model, which usually contains many unknown parameters. Such a model is called structurally identifiable if it is possible to determine the values of its parameters from measurements of the model outputs. Structural identifiability is a prerequisite for parameter estimation, and should be assessed before exploiting a model. However, this analysis is seldom performed due to the high computational cost involved in the necessary symbolic calculations, which quickly becomes prohibitive as the problem size increases. In this paper we show how to analyse the structural identifiability of a very general class of nonlinear models by extending methods originally developed for studying observability. We present results about models whose identifiability had not been previously determined, report unidentifiabilities that had not been found before, and show how to modify those unidentifiable models to make them identifiable. This method helps prevent problems caused by lack of identifiability analysis, which can compromise the success of tasks such as experiment design, parameter estimation, and model-based optimization. The procedure is called STRIKE-GOLDD (STRuctural Identifiability taKen as Extended-Generalized Observability with Lie Derivatives and Decomposition), and it is implemented in a MATLAB toolbox which is available as open source software. The broad applicability of this approach facilitates the analysis of the increasingly complex models used in systems biology and other areas.

  14. Effect of Equilibrium Flow on Plasma Parameters

    International Nuclear Information System (INIS)

    Mukhopadhyay, S.; Lahiri, S.; Sakanaka, P.H.; Dasgupta, B.

    2003-01-01

    The transition to high confinement modes have been identified with the occurrence of strong shear flow near the plasma boundary. Plasma flow has also been associated with various instabilities, heating and other physical processes. As a result, it has become very important to study the effect of such flows on various plasma parameters. In this paper, we present the numerical solution of plasma equilibrium with incompressible toroidal and poloidal flows in several magnetic confinement configurations including tokamaks. The code, which was reported in the last conference, has been used to solve the problem in both circular and D-shaped devices. A parametric study on the generation of shear flow due to radial electric fields has been carried out. Through this study, it has been possible to generate plasma equilibria having sharp pressure gradients which are remarkably close to those reported in various H-mode experiments. The effects of flow on reverse shear equilibria and on the position of the magnetic axis has been studied. Finally, a detailed study has been carried out to understand the effect of flows on important plasma parameters, such as the poloidal flux function, β, energy confinement time

  15. Disorder parameter of confinement

    International Nuclear Information System (INIS)

    Nakamura, N.; Ejiri, S.; Matsubara, Y.; Suzuki, T.

    1996-01-01

    The disorder parameter of confinement-deconfinement phase transition based on the monopole action determined previously in SU(2) QCD are investigated. We construct an operator which corresponds to the order parameter defined in the abelian Higgs model. The operator shows proper behaviors as the disorder parameter in the numerical simulations of finite temperature QCD. (orig.)

  16. Identifying Strategic Scientific Opportunities

    Science.gov (United States)

    As NCI's central scientific strategy office, CRS collaborates with the institute's divisions, offices, and centers to identify research opportunities to advance NCI's vision for the future of cancer research.

  17. Identifying Breast Cancer Oncogenes

    Science.gov (United States)

    2011-10-01

    cells we observed that it promoted transformation of HMLE cells, suggesting a tumor suppressive role of Merlin in breast cancer (Figure 4B). A...08-1-0767 TITLE: Identifying Breast Cancer Oncogenes PRINCIPAL INVESTIGATOR: Yashaswi Shrestha...Standard Form 298 (Rev. 8-98) Prescribed by ANSI Std. Z39.18 W81XWH-08-1-0767 Identifying Breast Cancer Oncogenes Yashaswi Shrestha Dana-Farber

  18. IDENTIFIABILITY VERSUS HETEROGENEITY IN GROUNDWATER MODELING SYSTEMS

    Directory of Open Access Journals (Sweden)

    A M BENALI

    2003-06-01

    Full Text Available Review of history matching of reservoirs parameters in groundwater flow raises the problem of identifiability of aquifer systems. Lack of identifiability means that there exists parameters to which the heads are insensitive. From the guidelines of the study of the homogeneous case, we inspect the identifiability of the distributed transmissivity field of heterogeneous groundwater aquifers. These are derived from multiple realizations of a random function Y = log T  whose probability distribution function is normal. We follow the identifiability of the autocorrelated block transmissivities through the measure of the sensitivity of the local derivatives DTh = (∂hi  ∕ ∂Tj computed for each sample of a population N (0; σY, αY. Results obtained from an analysis of Monte Carlo type suggest that the more a system is heterogeneous, the less it is identifiable.

  19. [Acoustical parameters of toys].

    Science.gov (United States)

    Harazin, Barbara

    2010-01-01

    Toys play an important role in the development of the sight and hearing concentration in children. They also support the development of manipulation, gently influence a child and excite its emotional activities. A lot of toys emit various sounds. The aim of the study was to assess sound levels produced by sound-emitting toys used by young children. Acoustical parameters of noise were evaluated for 16 sound-emitting plastic toys in laboratory conditions. The noise level was recorded at four different distances, 10, 20, 25 and 30 cm, from the toy. Measurements of A-weighted sound pressure levels and noise levels in octave band in the frequency range from 31.5 Hz to 16 kHz were performed at each distance. Taking into consideration the highest equivalent A-weighted sound levels produced by tested toys, they can be divided into four groups: below 70 dB (6 toys), from 70 to 74 dB (4 toys), from 75 to 84 dB (3 toys) and from 85 to 94 dB (3 toys). The majority of toys (81%) emitted dominant sound levels in octave band at the frequency range from 2 kHz to 4 kHz. Sound-emitting toys produce the highest acoustic energy at the frequency range of the highest susceptibility of the auditory system. Noise levels produced by some toys can be dangerous to children's hearing.

  20. Identifying Knowledge and Communication

    Directory of Open Access Journals (Sweden)

    Eduardo Coutinho Lourenço de Lima

    2006-12-01

    Full Text Available In this paper, I discuss how the principle of identifying knowledge which Strawson advances in ‘Singular Terms and Predication’ (1961, and in ‘Identifying Reference and Truth-Values’ (1964 turns out to constrain communication. The principle states that a speaker’s use of a referring expression should invoke identifying knowledge on the part of the hearer, if the hearer is to understand what the speaker is saying, and also that, in so referring, speakers are attentive to hearers’ epistemic states. In contrasting it with Russell’s Principle (Evans 1982, as well as with the principle of identifying descriptions (Donnellan 1970, I try to show that the principle of identifying knowledge, ultimately a condition for understanding, makes sense only in a situation of conversation. This allows me to conclude that the cooperative feature of communication (Grice 1975 and reference (Clark andWilkes-Gibbs 1986 holds also at the understanding level. Finally, I discuss where Strawson’s views seem to be unsatisfactory, and suggest how they might be improved.

  1. Identifying suitable sites for Florida panther reintroduction

    Science.gov (United States)

    Thatcher, Cindy A.; van Manen, Frank T.; Clark, Joseph D.

    2006-01-01

    A major objective of the 1995 Florida Panther (Puma concolor cory) Recovery Plan is the establishment of 2 additional panther populations within the historic range. Our goal was to identify prospective sites for Florida panther reintroduction within the historic range based on quantitative landscape assessments. First, we delineated 86 panther home ranges using telemetry data collected from 1981 to 2001 in south Florida to develop a Mahalanobis distance (D2) habitat model, using 4 anthropogenic variables and 3 landscape variables mapped at a 500-m resolution. From that analysis, we identified 9 potential reintroduction sites of sufficient size to support a panther population. We then developed a similar D2 model at a higher spatial resolution to quantify the area of favorable panther habitat at each site. To address potential for the population to expand, we calculated the amount of favorable habitat adjacent to each prospective reintroduction site within a range of dispersal distances of female panthers. We then added those totals to the contiguous patches to estimate the total amount of effective panther habitat at each site. Finally, we developed an expert-assisted model to rank and incorporate potentially important habitat variables that were not appropriate for our empirical analysis (e.g., area of public lands, livestock density). Anthropogenic factors heavily influenced both the landscape and the expert-assisted models. Of the 9 areas we identified, the Okefenokee National Wildlife Refuge, Ozark National Forest, and Felsenthal National Wildlife Refuge regions had the highest combination of effective habitat area and expert opinion scores. Sensitivity analyses indicated that variability among key model parameters did not affect the high ranking of those sites. Those sites should be considered as starting points for the field evaluation of potential reintroduction sites.

  2. Prediction of chemical, physical and sensory data from process parameters for frozen cod using multivariate analysis

    DEFF Research Database (Denmark)

    Bechmann, Iben Ellegaard; Jensen, H.S.; Bøknæs, Niels

    1998-01-01

    Physical, chemical and sensory quality parameters were determined for 115 cod (Gadus morhua) samples stored under varying frozen storage conditions. Five different process parameters (period of frozen storage, frozen storage. temperature, place of catch, season for catching and state of rigor) were...... varied systematically at two levels. The data obtained were evaluated using the multivariate methods, principal component analysis (PCA) and partial least squares (PLS) regression. The PCA models were used to identify which process parameters were actually most important for the quality of the frozen cod....... PLS models that were able to predict the physical, chemical and sensory quality parameters from the process parameters of the frozen raw material were generated. The prediction abilities of the PLS models were good enough to give reasonable results even when the process parameters were characterised...

  3. HEDIS Research Identifiable Files

    Data.gov (United States)

    U.S. Department of Health & Human Services — The Healthcare Effectiveness Data and Information Set (HEDIS) is a tool used by more than 90 percent of Americas health plans to measure performance on important...

  4. Influential input parameters for reflood model of MARS code

    Energy Technology Data Exchange (ETDEWEB)

    Oh, Deog Yeon; Bang, Young Seok [Korea Institute of Nuclear Safety, Daejeon (Korea, Republic of)

    2012-10-15

    Best Estimate (BE) calculation has been more broadly used in nuclear industries and regulations to reduce the significant conservatism for evaluating Loss of Coolant Accident (LOCA). Reflood model has been identified as one of the problems in BE calculation. The objective of the Post BEMUSE Reflood Model Input Uncertainty Methods (PREMIUM) program of OECD/NEA is to make progress the issue of the quantification of the uncertainty of the physical models in system thermal hydraulic codes, by considering an experimental result especially for reflood. It is important to establish a methodology to identify and select the parameters influential to the response of reflood phenomena following Large Break LOCA. For this aspect, a reference calculation and sensitivity analysis to select the dominant influential parameters for FEBA experiment are performed.

  5. Catalogue of HI PArameters (CHIPA)

    Science.gov (United States)

    Saponara, J.; Benaglia, P.; Koribalski, B.; Andruchow, I.

    2015-08-01

    The catalogue of HI parameters of galaxies HI (CHIPA) is the natural continuation of the compilation by M.C. Martin in 1998. CHIPA provides the most important parameters of nearby galaxies derived from observations of the neutral Hydrogen line. The catalogue contains information of 1400 galaxies across the sky and different morphological types. Parameters like the optical diameter of the galaxy, the blue magnitude, the distance, morphological type, HI extension are listed among others. Maps of the HI distribution, velocity and velocity dispersion can also be display for some cases. The main objective of this catalogue is to facilitate the bibliographic queries, through searching in a database accessible from the internet that will be available in 2015 (the website is under construction). The database was built using the open source `` mysql (SQL, Structured Query Language, management system relational database) '', while the website was built with ''HTML (Hypertext Markup Language)'' and ''PHP (Hypertext Preprocessor)''.

  6. Identifying and Managing Risk.

    Science.gov (United States)

    Abraham, Janice M.

    1999-01-01

    The role of the college or university chief financial officer in institutional risk management is (1) to identify risk (physical, casualty, fiscal, business, reputational, workplace safety, legal liability, employment practices, general liability), (2) to develop a campus plan to reduce and control risk, (3) to transfer risk, and (4) to track and…

  7. Distributed Persistent Identifiers System Design

    Directory of Open Access Journals (Sweden)

    Pavel Golodoniuc

    2017-06-01

    Full Text Available The need to identify both digital and physical objects is ubiquitous in our society. Past and present persistent identifier (PID systems, of which there is a great variety in terms of technical and social implementation, have evolved with the advent of the Internet, which has allowed for globally unique and globally resolvable identifiers. PID systems have, by in large, catered for identifier uniqueness, integrity, and persistence, regardless of the identifier’s application domain. Trustworthiness of these systems has been measured by the criteria first defined by Bütikofer (2009 and further elaborated by Golodoniuc 'et al'. (2016 and Car 'et al'. (2017. Since many PID systems have been largely conceived and developed by a single organisation they faced challenges for widespread adoption and, most importantly, the ability to survive change of technology. We believe that a cause of PID systems that were once successful fading away is the centralisation of support infrastructure – both organisational and computing and data storage systems. In this paper, we propose a PID system design that implements the pillars of a trustworthy system – ensuring identifiers’ independence of any particular technology or organisation, implementation of core PID system functions, separation from data delivery, and enabling the system to adapt for future change. We propose decentralisation at all levels — persistent identifiers and information objects registration, resolution, and data delivery — using Distributed Hash Tables and traditional peer-to-peer networks with information replication and caching mechanisms, thus eliminating the need for a central PID data store. This will increase overall system fault tolerance thus ensuring its trustworthiness. We also discuss important aspects of the distributed system’s governance, such as the notion of the authoritative source and data integrity

  8. DIA-datasnooping and identifiability

    Science.gov (United States)

    Zaminpardaz, S.; Teunissen, P. J. G.

    2018-04-01

    In this contribution, we present and analyze datasnooping in the context of the DIA method. As the DIA method for the detection, identification and adaptation of mismodelling errors is concerned with estimation and testing, it is the combination of both that needs to be considered. This combination is rigorously captured by the DIA estimator. We discuss and analyze the DIA-datasnooping decision probabilities and the construction of the corresponding partitioning of misclosure space. We also investigate the circumstances under which two or more hypotheses are nonseparable in the identification step. By means of a theorem on the equivalence between the nonseparability of hypotheses and the inestimability of parameters, we demonstrate that one can forget about adapting the parameter vector for hypotheses that are nonseparable. However, as this concerns the complete vector and not necessarily functions of it, we also show that parameter functions may exist for which adaptation is still possible. It is shown how this adaptation looks like and how it changes the structure of the DIA estimator. To demonstrate the performance of the various elements of DIA-datasnooping, we apply the theory to some selected examples. We analyze how geometry changes in the measurement setup affect the testing procedure, by studying their partitioning of misclosure space, the decision probabilities and the minimal detectable and identifiable biases. The difference between these two minimal biases is highlighted by showing the difference between their corresponding contributing factors. We also show that if two alternative hypotheses, say Hi and Hj , are nonseparable, the testing procedure may have different levels of sensitivity to Hi -biases compared to the same Hj -biases.

  9. Internally readable identifying tag

    International Nuclear Information System (INIS)

    Jefferts, K.B.; Jefferts, E.R.

    1980-01-01

    A method of identifying non-metallic objects by means of X-ray equipment is described in detail. A small metal pin with a number of grooves cut in a pre-determined equi-spaced pattern is implanted into the non-metallic object and by decoding the groove patterns using X-ray equipment, the object is uniquely identified. A specific example of such an application is in studying the migratory habits of fish. The pin inserted into the snout of the fish is 0.010 inch in diameter, 0.040 inch in length with 8 possible positions for grooves if spaced 0.005 inch apart. With 6 of the groove positions available for data, the capacity is 2 6 or 64 combinations; clearly longer pins would increase the data capacity. This method of identification is a major advance over previous techniques which necessitated destruction of the fish in order to recover the identification tag. (UK)

  10. Identifying Breast Cancer Oncogenes

    Science.gov (United States)

    2010-10-01

    tyrosine kinases with an SH3, SH2 and catalytic domain, it lacks a native myristylation signal shared by most members of this class [14], [38]. The...therapeutics and consequently, improve clinical outcomes. We aim to identify novel drivers of breast oncogenesis. We hypothesize that a kinase gain-of...human mammary epithelial cells. A pBabe-Puro-Myr-Flag kinase open reading frame (ORF) library was screened in immortalized human mammary epithelial

  11. Rock disposal problems identified

    Energy Technology Data Exchange (ETDEWEB)

    Knox, R

    1978-06-01

    Mathematical models are the only way of examining the return of radioactivity from nuclear waste to the environment over long periods of time. Work in Britain has helped identify areas where more basic data is required, but initial results look very promising for final disposal of high level waste in hard rock repositories. A report by the National Radiological Protection Board of a recent study, is examined.

  12. Cosmological Parameters 2000

    OpenAIRE

    Primack, Joel R.

    2000-01-01

    The cosmological parameters that I emphasize are the age of the universe $t_0$, the Hubble parameter $H_0 \\equiv 100 h$ km s$^{-1}$ Mpc$^{-1}$, the average matter density $\\Omega_m$, the baryonic matter density $\\Omega_b$, the neutrino density $\\Omega_\

  13. Estimating Convection Parameters in the GFDL CM2.1 Model Using Ensemble Data Assimilation

    Science.gov (United States)

    Li, Shan; Zhang, Shaoqing; Liu, Zhengyu; Lu, Lv; Zhu, Jiang; Zhang, Xuefeng; Wu, Xinrong; Zhao, Ming; Vecchi, Gabriel A.; Zhang, Rong-Hua; Lin, Xiaopei

    2018-04-01

    Parametric uncertainty in convection parameterization is one major source of model errors that cause model climate drift. Convection parameter tuning has been widely studied in atmospheric models to help mitigate the problem. However, in a fully coupled general circulation model (CGCM), convection parameters which impact the ocean as well as the climate simulation may have different optimal values. This study explores the possibility of estimating convection parameters with an ensemble coupled data assimilation method in a CGCM. Impacts of the convection parameter estimation on climate analysis and forecast are analyzed. In a twin experiment framework, five convection parameters in the GFDL coupled model CM2.1 are estimated individually and simultaneously under both perfect and imperfect model regimes. Results show that the ensemble data assimilation method can help reduce the bias in convection parameters. With estimated convection parameters, the analyses and forecasts for both the atmosphere and the ocean are generally improved. It is also found that information in low latitudes is relatively more important for estimating convection parameters. This study further suggests that when important parameters in appropriate physical parameterizations are identified, incorporating their estimation into traditional ensemble data assimilation procedure could improve the final analysis and climate prediction.

  14. Optimization of importance factors in inverse planning

    International Nuclear Information System (INIS)

    Xing, L.

    1999-01-01

    Inverse treatment planning starts with a treatment objective and obtains the solution by optimizing an objective function. The clinical objectives are usually multifaceted and potentially incompatible with one another. A set of importance factors is often incorporated in the objective function to parametrize trade-off strategies and to prioritize the dose conformality in different anatomical structures. Whereas the general formalism remains the same, different sets of importance factors characterize plans of obviously different flavour and thus critically determine the final plan. Up to now, the determination of these parameters has been a 'guessing' game based on empirical knowledge because the final dose distribution depends on the parameters in a complex and implicit way. The influence of these parameters is not known until the plan optimization is completed. In order to compromise properly the conflicting requirements of the target and sensitive structures, the parameters are usually adjusted through a trial-and-error process. In this paper, a method to estimate these parameters computationally is proposed and an iterative computer algorithm is described to determine these parameters numerically. The treatment plan selection is done in two steps. First, a set of importance factors are chosen and the corresponding beam parameters (e.g. beam profiles) are optimized under the guidance of a quadratic objective function using an iterative algorithm reported earlier. The 'optimal' plan is then evaluated by an additional scoring function. The importance factors in the objective function are accordingly adjusted to improve the ranking of the plan. For every change in the importance factors, the beam parameters need to be re-optimized. This process continues in an iterative fashion until the scoring function is saturated. The algorithm was applied to two clinical cases and the results demonstrated that it has the potential to improve significantly the existing method of

  15. ORCID: Author Identifiers for Librarians

    Directory of Open Access Journals (Sweden)

    Robyn B. Reed

    2017-10-01

    Full Text Available Generating accurate publication lists by researchers can be challenging when faced with scholars who have common names or who have published under name variations. This article describes ORCID and the goal of generating author identifiers for scholars to connect their research outputs. Included are the reasons for having author identifiers as well as the types of information within individual profiles. This article includes information on how academic libraries are playing a role with ORCID initiatives as well as describing how publishers, institutions, and funders are employing ORCID in their workflows. Highlighted is material on academic institutions in Pennsylvania using ORCID. The purpose of the article is to provide an overview of ORCID and its uses to inform librarians about this important initiative.

  16. Parameter identification of civil engineering structures

    Science.gov (United States)

    Juang, J. N.; Sun, C. T.

    1980-01-01

    This paper concerns the development of an identification method required in determining structural parameter variations for systems subjected to an extended exposure to the environment. The concept of structural identifiability of a large scale structural system in the absence of damping is presented. Three criteria are established indicating that a large number of system parameters (the coefficient parameters of the differential equations) can be identified by a few actuators and sensors. An eight-bay-fifteen-story frame structure is used as example. A simple model is employed for analyzing the dynamic response of the frame structure.

  17. Identifying phenomenal consciousness.

    Science.gov (United States)

    Schier, Elizabeth

    2009-03-01

    This paper examines the possibility of finding evidence that phenomenal consciousness is independent of access. The suggestion reviewed is that we should look for isomorphisms between phenomenal and neural activation spaces. It is argued that the fact that phenomenal spaces are mapped via verbal report is no problem for this methodology. The fact that activation and phenomenal space are mapped via different means does not mean that they cannot be identified. The paper finishes by examining how data addressing this theoretical question could be obtained.

  18. Are All Pixels Equally Important?

    CERN Multimedia

    CERN. Geneva

    2015-01-01

    When we look at our environment, we primarily pay attention to visually distinctive objects. We refer to these objects as visually important or salient. For efficient visual processing, the human visual system identifies salients objects and dedicates most of its processing resources to them. An analogous resource allocation can be performed by salient-object detection algorithms, which identify objects of interest in an image. Consequently, thanks to salient-object detection, complex visual computing operations can focus on the important parts of the visual data and can save time and resources. About the speaker Dr. Gokhan Yildirim is a research assistant in the School of Computer and Communication Sciences (IC) at the École Polytechnique Fédérale de Lausanne (EPFL). His research interests include image understanding, multimedia, pattern recognition, machine learning, salient-object detection on images & videos and its applications on image proces...

  19. QUALITY PARAMETERS IN NANOTECHNOLOGIC APPLICATIONS

    Directory of Open Access Journals (Sweden)

    Ayşegül Akdoğan Eker

    2013-06-01

    Full Text Available Nanotechnology concept which has added a new dimension to our lives in recent years, is finding a place in every sector day by day. The combined effect of nanotechnology is almost equal to the industrial revolution of last 200 years and have is able to fill all developments in a few years. However this development should be taken under control. Otherwise unstoppable new structures will not ease life but will be a problem for humanity. For this purpose, the main parameters (from the start up stage of nano-technologic applications to the obtained product should be checked. These parameters are actually not different than the adaptation of the classical quality indicators for nanotechnology applications. Especially it plays an important role in obtaining a uniform distribution and regarding the features of the end product in nano-technological ceramic and etc. applications. The most important problem faced in particles of that size is the accumulation they create. Another problem is the increasing friction force as size gets smaller. The friction force of asubstance increases proportionally with the cube of its surface area. Another problem is surface tension. The increasing surface tension due to increasing surface area will cause the particles to attract and stick to each other. The structures aimed to be obtained are mostly complex and especially in upwards approach, it is thermodynamically very hard for the atoms to get into that order. Therefore in this announcement, we stated the quality parameters that will be taken into consideration in nano-technological applications and the methods for obtaining those parameters. The aim is to explain these parameters with all dimensions so that they will lead the way to the future nano-technological applications.

  20. Elastic orthorhombic anisotropic parameter inversion: An analysis of parameterization

    KAUST Repository

    Oh, Juwon; Alkhalifah, Tariq Ali

    2016-01-01

    The resolution of a multiparameter full-waveform inversion (FWI) is highly influenced by the parameterization used in the inversion algorithm, as well as the data quality and the sensitivity of the data to the elastic parameters because the scattering patterns of the partial derivative wavefields (PDWs) vary with parameterization. For this reason, it is important to identify an optimal parameterization for elastic orthorhombic FWI by analyzing the radiation patterns of the PDWs for many reasonable model parameterizations. We have promoted a parameterization that allows for the separation of the anisotropic properties in the radiation patterns. The central parameter of this parameterization is the horizontal P-wave velocity, with an isotropic scattering potential, influencing the data at all scales and directions. This parameterization decouples the influence of the scattering potential given by the P-wave velocity perturbation fromthe polar changes described by two dimensionless parameter perturbations and from the azimuthal variation given by three additional dimensionless parameters perturbations. In addition, the scattering potentials of the P-wave velocity perturbation are also decoupled from the elastic influences given by one S-wave velocity and two additional dimensionless parameter perturbations. The vertical S-wave velocity is chosen with the best resolution obtained from S-wave reflections and converted waves, little influence on P-waves in conventional surface seismic acquisition. The influence of the density on observed data can be absorbed by one anisotropic parameter that has a similar radiation pattern. The additional seven dimensionless parameters describe the polar and azimuth variations in the P- and S-waves that we may acquire, with some of the parameters having distinct influences on the recorded data on the earth's surface. These characteristics of the new parameterization offer the potential for a multistage inversion from high symmetry

  1. Elastic orthorhombic anisotropic parameter inversion: An analysis of parameterization

    KAUST Repository

    Oh, Juwon

    2016-09-15

    The resolution of a multiparameter full-waveform inversion (FWI) is highly influenced by the parameterization used in the inversion algorithm, as well as the data quality and the sensitivity of the data to the elastic parameters because the scattering patterns of the partial derivative wavefields (PDWs) vary with parameterization. For this reason, it is important to identify an optimal parameterization for elastic orthorhombic FWI by analyzing the radiation patterns of the PDWs for many reasonable model parameterizations. We have promoted a parameterization that allows for the separation of the anisotropic properties in the radiation patterns. The central parameter of this parameterization is the horizontal P-wave velocity, with an isotropic scattering potential, influencing the data at all scales and directions. This parameterization decouples the influence of the scattering potential given by the P-wave velocity perturbation fromthe polar changes described by two dimensionless parameter perturbations and from the azimuthal variation given by three additional dimensionless parameters perturbations. In addition, the scattering potentials of the P-wave velocity perturbation are also decoupled from the elastic influences given by one S-wave velocity and two additional dimensionless parameter perturbations. The vertical S-wave velocity is chosen with the best resolution obtained from S-wave reflections and converted waves, little influence on P-waves in conventional surface seismic acquisition. The influence of the density on observed data can be absorbed by one anisotropic parameter that has a similar radiation pattern. The additional seven dimensionless parameters describe the polar and azimuth variations in the P- and S-waves that we may acquire, with some of the parameters having distinct influences on the recorded data on the earth\\'s surface. These characteristics of the new parameterization offer the potential for a multistage inversion from high symmetry

  2. Cosmological parameter estimation using Particle Swarm Optimization

    Science.gov (United States)

    Prasad, J.; Souradeep, T.

    2014-03-01

    Constraining parameters of a theoretical model from observational data is an important exercise in cosmology. There are many theoretically motivated models, which demand greater number of cosmological parameters than the standard model of cosmology uses, and make the problem of parameter estimation challenging. It is a common practice to employ Bayesian formalism for parameter estimation for which, in general, likelihood surface is probed. For the standard cosmological model with six parameters, likelihood surface is quite smooth and does not have local maxima, and sampling based methods like Markov Chain Monte Carlo (MCMC) method are quite successful. However, when there are a large number of parameters or the likelihood surface is not smooth, other methods may be more effective. In this paper, we have demonstrated application of another method inspired from artificial intelligence, called Particle Swarm Optimization (PSO) for estimating cosmological parameters from Cosmic Microwave Background (CMB) data taken from the WMAP satellite.

  3. Cosmological parameter estimation using Particle Swarm Optimization

    International Nuclear Information System (INIS)

    Prasad, J; Souradeep, T

    2014-01-01

    Constraining parameters of a theoretical model from observational data is an important exercise in cosmology. There are many theoretically motivated models, which demand greater number of cosmological parameters than the standard model of cosmology uses, and make the problem of parameter estimation challenging. It is a common practice to employ Bayesian formalism for parameter estimation for which, in general, likelihood surface is probed. For the standard cosmological model with six parameters, likelihood surface is quite smooth and does not have local maxima, and sampling based methods like Markov Chain Monte Carlo (MCMC) method are quite successful. However, when there are a large number of parameters or the likelihood surface is not smooth, other methods may be more effective. In this paper, we have demonstrated application of another method inspired from artificial intelligence, called Particle Swarm Optimization (PSO) for estimating cosmological parameters from Cosmic Microwave Background (CMB) data taken from the WMAP satellite

  4. ECOPHARMACOVIGILANCE: ITS IMPORTANCE AND CHALLENGES

    OpenAIRE

    Dr. Bhavana Srivastava

    2014-01-01

    Active pharmaceutical ingredients represent a group of emerging environmental contamination. Even in trace amounts, they are of great concern due to then continuous introduction into the environment, their impact an ecosystem and human and vetenery health is of great importance. This has given birth to the science of Ecopharmacovigilance (EPV). It aims to ensure that significant environmental issues associated with pharmaceuticals in the environment are identified and managed appropriately. ...

  5. Review of 241 Pu resonance parameters

    International Nuclear Information System (INIS)

    Derrien, H.

    1981-10-01

    The status of 241 Pu resonance parameters is reviewed. The most important recent results are compared in some energy ranges, both from single level and multilevel point of view. It appears that an accurate set of resonance parameters is not still obtained for a general description of the cross-sections in the resonance region. Some recommendations are given for further experiments or evaluations

  6. The importance of coughs

    African Journals Online (AJOL)

    2012-03-14

    Mar 14, 2012 ... how important it can be. It is at best ... e. rise of intrathoracic pressure up to 200mm Hg., f. glottic opening and ... The differential diagnosis may be reviewed from knowledge .... cigarette smoking is an important example. 3.

  7. Magnetic S-parameter

    DEFF Research Database (Denmark)

    Sannino, Francesco

    2010-01-01

    We propose a direct test of the existence of gauge duals for nonsupersymmetric asymptotically free gauge theories developing an infrared fixed point by computing the S-parameter in the electric and dual magnetic description. In particular we show that at the lower bound of the conformal window...... the magnetic S-parameter, i.e. the one determined via the dual magnetic gauge theory, assumes a simple expression in terms of the elementary magnetic degrees of freedom. The results further support our recent conjecture of the existence of a universal lower bound on the S parameter and indicates...

  8. Structural identifiability of polynomial and rational systems

    NARCIS (Netherlands)

    J. Nemcová (Jana)

    2010-01-01

    htmlabstractSince analysis and simulation of biological phenomena require the availability of their fully specified models, one needs to be able to estimate unknown parameter values of the models. In this paper we deal with identifiability of parametrizations which is the property of one-to-one

  9. List identifies threatened ecosystems

    Science.gov (United States)

    Showstack, Randy

    2012-09-01

    The International Union for Conservation of Nature (IUCN) announced on 9 September that it will develop a new Red List of Ecosystems that will identify which ecosystems are vulnerable or endangered. The list, which is modeled on the group's Red List of Threatened Species™, could help to guide conservation activities and influence policy processes such as the Convention on Biological Diversity, according to the group. “We will assess the status of marine, terrestrial, freshwater, and subterranean ecosystems at local, regional, and global levels,” stated Jon Paul Rodriguez, leader of IUCN's Ecosystems Red List Thematic Group. “The assessment can then form the basis for concerted implementation action so that we can manage them sustainably if their risk of collapse is low or restore them if they are threatened and then monitor their recovery.”

  10. Global Microbial Identifier

    DEFF Research Database (Denmark)

    Wielinga, Peter; Hendriksen, Rene S.; Aarestrup, Frank Møller

    2017-01-01

    ) will likely also enable a much better understanding of the pathogenesis of the infection and the molecular basis of the host response to infection. But the full potential of these advances will only transpire if the data in this area become transferable and thereby comparable, preferably in open-source...... of microorganisms, for the identification of relevant genes and for the comparison of genomes to detect outbreaks and emerging pathogens. To harness the full potential of WGS, a shared global database of genomes linked to relevant metadata and the necessary software tools needs to be generated, hence the global...... microbial identifier (GMI) initiative. This tool will ideally be used in amongst others in the diagnosis of infectious diseases in humans and animals, in the identification of microorganisms in food and environment, and to track and trace microbial agents in all arenas globally. This will require...

  11. Physical characteristics and resistance parameters of typical urban cyclists.

    Science.gov (United States)

    Tengattini, Simone; Bigazzi, Alexander York

    2018-03-30

    This study investigates the rolling and drag resistance parameters and bicycle and cargo masses of typical urban cyclists. These factors are important for modelling of cyclist speed, power and energy expenditure, with applications including exercise performance, health and safety assessments and transportation network analysis. However, representative values for diverse urban travellers have not been established. Resistance parameters were measured utilizing a field coast-down test for 557 intercepted cyclists in Vancouver, Canada. Masses were also measured, along with other bicycle attributes such as tire pressure and size. The average (standard deviation) of coefficient of rolling resistance, effective frontal area, bicycle plus cargo mass, and bicycle-only mass were 0.0077 (0.0036), 0.559 (0.170) m 2 , 18.3 (4.1) kg, and 13.7 (3.3) kg, respectively. The range of measured values is wider and higher than suggested in existing literature, which focusses on sport cyclists. Significant correlations are identified between resistance parameters and rider and bicycle attributes, indicating higher resistance parameters for less sport-oriented cyclists. The findings of this study are important for appropriately characterising the full range of urban cyclists, including commuters and casual riders.

  12. SATELLITE CONSTELLATION DESIGN PARAMETER

    Indian Academy of Sciences (India)

    First page Back Continue Last page Overview Graphics. SATELLITE CONSTELLATION DESIGN PARAMETER. 1. ORBIT CHARACTERISTICS. ORBITAL HEIGHT >= 20,000 KM. LONGER VISIBILITY; ORBITAL PERIOD. PERTURBATIONS(MINIMUM). SOLAR RADIATION PRESSURE (IMPACTS ECCENTRICITY); LUNI ...

  13. Reassessment of safeguards parameters

    Energy Technology Data Exchange (ETDEWEB)

    Hakkila, E.A.; Richter, J.L.; Mullen, M.F.

    1994-07-01

    The International Atomic Energy Agency is reassessing the timeliness and goal quantity parameters that are used in defining safeguards approaches. This study reviews technology developments since the parameters were established in the 1970s and concludes that there is no reason to relax goal quantity or conversion time for reactor-grade plutonium relative to weapons-grade plutonium. For low-enriched uranium, especially in countries with advanced enrichment capability there may be an incentive to shorten the detection time.

  14. Identification of metabolic system parameters using global optimization methods

    Directory of Open Access Journals (Sweden)

    Gatzke Edward P

    2006-01-01

    Full Text Available Abstract Background The problem of estimating the parameters of dynamic models of complex biological systems from time series data is becoming increasingly important. Methods and results Particular consideration is given to metabolic systems that are formulated as Generalized Mass Action (GMA models. The estimation problem is posed as a global optimization task, for which novel techniques can be applied to determine the best set of parameter values given the measured responses of the biological system. The challenge is that this task is nonconvex. Nonetheless, deterministic optimization techniques can be used to find a global solution that best reconciles the model parameters and measurements. Specifically, the paper employs branch-and-bound principles to identify the best set of model parameters from observed time course data and illustrates this method with an existing model of the fermentation pathway in Saccharomyces cerevisiae. This is a relatively simple yet representative system with five dependent states and a total of 19 unknown parameters of which the values are to be determined. Conclusion The efficacy of the branch-and-reduce algorithm is illustrated by the S. cerevisiae example. The method described in this paper is likely to be widely applicable in the dynamic modeling of metabolic networks.

  15. Safeguards systems parameters

    International Nuclear Information System (INIS)

    Avenhaus, R.; Heil, J.

    1979-01-01

    In this paper analyses are made of the values of those parameters that characterize the present safeguards system that is applied to a national fuel cycle; those values have to be fixed quantitatively so that all actions of the safeguards authority are specified precisely. The analysis starts by introducing three categories of quantities: The design parameters (number of MBAs, inventory frequency, variance of MUF, verification effort and false-alarm probability) describe those quantities whose values have to be specified before the safeguards system can be implemented. The performance criteria (probability of detection, expected detection time, goal quantity) measure the effectiveness of a safeguards system; and the standards (threshold amount and critical time) characterize the magnitude of the proliferation problem. The means by which the values of the individual design parameters can be determined with the help of the performance criteria; which qualitative arguments can narrow down the arbitrariness of the choice of values of the remaining parameters; and which parameter values have to be fixed more or less arbitrarily, are investigated. As a result of these considerations, which include the optimal allocation of a given inspection effort, the problem of analysing the structure of the safeguards system is reduced to an evaluation of the interplay of only a few parameters, essentially the quality of the measurement system (variance of MUF), verification effort, false-alarm probability, goal quantity and probability of detection

  16. Imprecise system reliability and component importance based on survival signature

    International Nuclear Information System (INIS)

    Feng, Geng; Patelli, Edoardo; Beer, Michael; Coolen, Frank P.A.

    2016-01-01

    The concept of the survival signature has recently attracted increasing attention for performing reliability analysis on systems with multiple types of components. It opens a new pathway for a structured approach with high computational efficiency based on a complete probabilistic description of the system. In practical applications, however, some of the parameters of the system might not be defined completely due to limited data, which implies the need to take imprecisions of component specifications into account. This paper presents a methodology to include explicitly the imprecision, which leads to upper and lower bounds of the survival function of the system. In addition, the approach introduces novel and efficient component importance measures. By implementing relative importance index of each component without or with imprecision, the most critical component in the system can be identified depending on the service time of the system. Simulation method based on survival signature is introduced to deal with imprecision within components, which is precise and efficient. Numerical example is presented to show the applicability of the approach for systems. - Highlights: • Survival signature is a novel way for system reliability and component importance • High computational efficiency based on a complete description of system. • Include explicitly the imprecision, which leads to bounds of the survival function. • A novel relative importance index is proposed as importance measure. • Allows to identify critical components depending on the service time of the system.

  17. Optimising import phytosanitary inspection

    NARCIS (Netherlands)

    Surkov, I.

    2007-01-01

    Keywords: quarantine pest, plant health policy, optimization, import phytosanitary inspection, ‘reduced checks’, optimal allocation of resources, multinomial logistic regression, the Netherlands World trade is a major vector of spread of quarantine plant pests. Border phytosanitary inspection

  18. Identification of parameters underlying emotions and a classification of emotions

    OpenAIRE

    Kumar, N. Arvind

    2008-01-01

    The standard classification of emotions involves categorizing the expression of emotions. In this paper, parameters underlying some emotions are identified and a new classification based on these parameters is suggested.

  19. Selection of Near Optimal Laser Cutting Parameters in CO2 Laser Cutting by the Taguchi Method

    Directory of Open Access Journals (Sweden)

    Miloš MADIĆ

    2013-12-01

    Full Text Available Identification of laser cutting conditions that are insensitive to parameter variations and noise is of great importance. This paper demonstrates the application of Taguchi method for optimization of surface roughness in CO2 laser cutting of stainless steel. The laser cutting experiment was planned and conducted according to the Taguchi’s experimental design using the L27 orthogonal array. Four laser cutting parameters such as laser power, cutting speed, assist gas pressure, and focus position were considered in the experiment. Using the analysis of means and analysis of variance, the significant laser cutting parameters were identified, and subsequently the optimal combination of laser cutting parameter levels was determined. The results showed that the cutting speed is the most significant parameter affecting the surface roughness whereas the influence of the assist gas pressure can be neglected. It was observed, however, that interaction effects have predominant influence over the main effects on the surface roughness.

  20. Sensitivity Analysis and Identification of Parameters to the Van Genuchten Equation

    Directory of Open Access Journals (Sweden)

    Guangzhou Chen

    2016-01-01

    Full Text Available Van Genuchten equation is the soil water characteristic curve equation used commonly, and identifying (estimating accurately its parameters plays an important role in the study on the movement of soil water. Selecting the desorption and absorption experimental data of silt loam from a northwest region in China as an instance, Monte-Carlo method was firstly applied to analyze sensitivity of the parameters and uncertainty of model so as to get the key parameters and posteriori parameter distribution to guide subsequent parameter identification. Then, the optimization model of the parameters was set up, and a new type of intelligent algorithm-difference search algorithm was employed to identify them. In order to overcome the fault that the base difference search algorithm needed more iterations and to further enhance the optimization performance, a hybrid algorithm, which coupled the difference search algorithm with simplex method, was employed to identification of the parameters. By comparison with other optimization algorithms, the results show that the difference search algorithm has the following characteristics: good optimization performance, the simple principle, easy implement, short program code, and less control parameters required to run the algorithm. In addition, the proposed hybrid algorithm outperforms the basic difference search algorithm on the comprehensive performance of algorithm.

  1. Radiograph identifying means

    International Nuclear Information System (INIS)

    Sheldon, A.D.

    1983-01-01

    A flexible character-indentable plastics embossing tape is backed by and bonded to a lead strip, not more than 0.025 inches thick, to form a tape suitable for identifying radiographs. The lead strip is itself backed by a relatively thin and flimsy plastics or fabric strip which, when removed, allows the lead plastic tape to be pressure-bonded to the surface to be radiographed. A conventional tape-embossing gun is used to indent the desired characters in succession into the lead-backed tape, without necessarily severing the lead; and then the backing strip is peeled away to expose the layer of adhesive which pressure-bonds the indented tape to the object to be radiographed. X-rays incident on the embossed tape will cause the raised characters to show up dark on the subsequently-developed film, whilst the raised side areas will show up white. Each character will thus stand out on the developed film. (author)

  2. Parameter Uncertainty on AGCM-simulated Tropical Cyclones

    Science.gov (United States)

    He, F.

    2015-12-01

    This work studies the parameter uncertainty on tropical cyclone (TC) simulations in Atmospheric General Circulation Models (AGCMs) using the Reed-Jablonowski TC test case, which is illustrated in Community Atmosphere Model (CAM). It examines the impact from 24 parameters across the physical parameterization schemes that represent the convection, turbulence, precipitation and cloud processes in AGCMs. The one-at-a-time (OAT) sensitivity analysis method first quantifies their relative importance on TC simulations and identifies the key parameters to the six different TC characteristics: intensity, precipitation, longwave cloud radiative forcing (LWCF), shortwave cloud radiative forcing (SWCF), cloud liquid water path (LWP) and ice water path (IWP). Then, 8 physical parameters are chosen and perturbed using the Latin-Hypercube Sampling (LHS) method. The comparison between OAT ensemble run and LHS ensemble run shows that the simulated TC intensity is mainly affected by the parcel fractional mass entrainment rate in Zhang-McFarlane (ZM) deep convection scheme. The nonlinear interactive effect among different physical parameters is negligible on simulated TC intensity. In contrast, this nonlinear interactive effect plays a significant role in other simulated tropical cyclone characteristics (precipitation, LWCF, SWCF, LWP and IWP) and greatly enlarge their simulated uncertainties. The statistical emulator Extended Multivariate Adaptive Regression Splines (EMARS) is applied to characterize the response functions for nonlinear effect. Last, we find that the intensity uncertainty caused by physical parameters is in a degree comparable to uncertainty caused by model structure (e.g. grid) and initial conditions (e.g. sea surface temperature, atmospheric moisture). These findings suggest the importance of using the perturbed physics ensemble (PPE) method to revisit tropical cyclone prediction under climate change scenario.

  3. Identifiability of PBPK Models with Applications to ...

    Science.gov (United States)

    Any statistical model should be identifiable in order for estimates and tests using it to be meaningful. We consider statistical analysis of physiologically-based pharmacokinetic (PBPK) models in which parameters cannot be estimated precisely from available data, and discuss different types of identifiability that occur in PBPK models and give reasons why they occur. We particularly focus on how the mathematical structure of a PBPK model and lack of appropriate data can lead to statistical models in which it is impossible to estimate at least some parameters precisely. Methods are reviewed which can determine whether a purely linear PBPK model is globally identifiable. We propose a theorem which determines when identifiability at a set of finite and specific values of the mathematical PBPK model (global discrete identifiability) implies identifiability of the statistical model. However, we are unable to establish conditions that imply global discrete identifiability, and conclude that the only safe approach to analysis of PBPK models involves Bayesian analysis with truncated priors. Finally, computational issues regarding posterior simulations of PBPK models are discussed. The methodology is very general and can be applied to numerous PBPK models which can be expressed as linear time-invariant systems. A real data set of a PBPK model for exposure to dimethyl arsinic acid (DMA(V)) is presented to illustrate the proposed methodology. We consider statistical analy

  4. Identifi cation of Sectarianism

    Directory of Open Access Journals (Sweden)

    Martinovich Vladimir

    2016-03-01

    Full Text Available «New religious movements and society» is traditionally one of the most sophisticated topics in the area of new religions studies. Its problem field is so huge that up to now by far not all important research themes where even touched by scientists from all over the world. The problem of the process of the identification of sectarianism by diff erent societal institutions is one of such untouched themes that is taken as the main subject of this article. This process by itself is an inseparable part of the every societal deliberate reaction to the very existence of unconventional religiosity, its unstructured and mainly structured types. The focal point of the article is step-by-step analysis of the general structure elements of the process of the identification of sectarianism without any reference to the specific time and place of its flow. Special attention is paid to the analysis of the subjects of the identification of sectarianism, to the criteria for religious groups to be qualified as new religious movements, and to the specific features of the process of documents filtration. The causes of selective perception of sectarianism are disclosed. Some main consequences and unpredictable outcomes of the process of the identification of sectarianism are described.

  5. Induction Motor Parameter Identification Using a Gravitational Search Algorithm

    Directory of Open Access Journals (Sweden)

    Omar Avalos

    2016-04-01

    Full Text Available The efficient use of electrical energy is a topic that has attracted attention for its environmental consequences. On the other hand, induction motors represent the main component in most industries. They consume the highest energy percentages in industrial facilities. This energy consumption depends on the operation conditions of the induction motor imposed by its internal parameters. Since the internal parameters of an induction motor are not directly measurable, an identification process must be conducted to obtain them. In the identification process, the parameter estimation is transformed into a multidimensional optimization problem where the internal parameters of the induction motor are considered as decision variables. Under this approach, the complexity of the optimization problem tends to produce multimodal error surfaces for which their cost functions are significantly difficult to minimize. Several algorithms based on evolutionary computation principles have been successfully applied to identify the optimal parameters of induction motors. However, most of them maintain an important limitation: They frequently obtain sub-optimal solutions as a result of an improper equilibrium between exploitation and exploration in their search strategies. This paper presents an algorithm for the optimal parameter identification of induction motors. To determine the parameters, the proposed method uses a recent evolutionary method called the gravitational search algorithm (GSA. Different from most of the existent evolutionary algorithms, the GSA presents a better performance in multimodal problems, avoiding critical flaws such as the premature convergence to sub-optimal solutions. Numerical simulations have been conducted on several models to show the effectiveness of the proposed scheme.

  6. Optimal coal import strategy

    International Nuclear Information System (INIS)

    Chen, C.Y.; Shih, L.H.

    1992-01-01

    Recently, the main power company in Taiwan has shifted the primary energy resource from oil to coal and tried to diversify the coal supply from various sources. The company wants to have the imported coal meet the environmental standards and operation requirements as well as to have high heating value. In order to achieve these objectives, establishment of a coal blending system for Taiwan is necessary. A mathematical model using mixed integer programming technique is used to model the import strategy and the blending system. 6 refs., 1 tab

  7. Electroweak interaction parameters

    International Nuclear Information System (INIS)

    Marciano, W.J.

    1984-01-01

    After a presentation of the experimentally determined parameters of the standard SU(3) x SU(2) x U(1) model the author discusses the definition of the Weinberg angle. Then masses and widths of the intermediate vector bosons are considered in the framework of the Weinberg-Salam theory with radiative corrections. Furthermore the radiative decays of these bosons are discussed. Then the relations between the masses of the Higgs boson and the top quark are considered. Thereafter grand unification is briefly discussed with special regards to the SU(5) prediction of some observable parameters. Finally some speculations are made concerning the observation of radiative decays in the UA1 experiments. (HSI)

  8. Band parameters of phosphorene

    International Nuclear Information System (INIS)

    Lew Yan Voon, L C; Wang, J; Zhang, Y; Willatzen, M

    2015-01-01

    Phosphorene is a two-dimensional nanomaterial with a direct band-gap at the Brillouin zone center. In this paper, we present a recently derived effective-mass theory of the band structure in the presence of strain and electric field, based upon group theory. Band parameters for this theory are computed using a first-principles theory based upon the generalized-gradient approximation to the density-functional theory. These parameters and Hamiltonian will be useful for modeling physical properties of phosphorene. (paper)

  9. Band parameters of phosphorene

    DEFF Research Database (Denmark)

    Lew Yan Voon, L. C.; Wang, J.; Zhang, Y.

    2015-01-01

    Phosphorene is a two-dimensional nanomaterial with a direct band-gap at the Brillouin zone center. In this paper, we present a recently derived effective-mass theory of the band structure in the presence of strain and electric field, based upon group theory. Band parameters for this theory...... are computed using a first-principles theory based upon the generalized-gradient approximation to the density-functional theory. These parameters and Hamiltonian will be useful for modeling physical properties of phosphorene....

  10. Tension-compression asymmetry modelling: strategies for anisotropy parameters identification.

    Directory of Open Access Journals (Sweden)

    Barros Pedro

    2016-01-01

    Full Text Available This work presents details concerning the strategies and algorithms adopted in the fully implicit FE solver DD3IMP to model the orthotropic behavior of metallic sheets and the procedure for anisotropy parameters identification. The work is focused on the yield criterion developed by Cazacu, Plunkett and Barlat, 2006 [1], which accounts for both tension–compression asymmetry and orthotropic plastic behavior. The anisotropy parameters for a 2090-T3 aluminum alloy are identified accounting, or not, for the tension-compression asymmetry. The numerical simulation of a cup drawing is performed for this material, highlighting the importance of considering tension-compression asymmetry in the prediction of the earing profile, for materials with cubic structure, even if this phenomenon is relatively small.

  11. Sea surface stability parameters

    International Nuclear Information System (INIS)

    Weber, A.H.; Suich, J.E.

    1978-01-01

    A number of studies dealing with climatology of the Northwest Atlantic Ocean have been published in the last ten years. These published studies have dealt with directly measured meteorological parameters, e.g., wind speed, temperature, etc. This information has been useful because of the increased focus on the near coastal zone where man's activities are increasing in magnitude and scope, e.g., offshore power plants, petroleum production, and the subsequent environmental impacts of these activities. Atmospheric transport of passive or nonpassive material is significantly influenced by the turbulence structure of the atmosphere in the region of the atmosphere-ocean interface. This research entails identification of the suitability of standard atmospheric stability parameters which can be used to determine turbulence structure; the calculation of these parameters for the near-shore and continental shelf regions of the U.S. east coast from Cape Hatteras to Miami, Florida; and the preparation of a climatology of these parameters. In addition, a climatology for average surface stress for the same geographical region is being prepared

  12. Measuring the chargino parameters

    Indian Academy of Sciences (India)

    by measuring the cross-sections with polarized beams at e+e- collider ... is given by the fundamental SUSY parameters: the SU(2) gaugino mass Е¾, the higgsino .... two points in the plane which are symmetric under the interchange ¾Д ° ¾К.

  13. Quantization of physical parameters

    International Nuclear Information System (INIS)

    Jackiw, R.; Massachusetts Inst. of Tech., Cambridge; Massachusetts Inst. of Tech., Cambridge

    1984-01-01

    Dynamical models are described with parameters (mass, coupling strengths) which must be quantized for quantum mechanical consistency. These and related topological ideas have physical application to phenomenological descriptions of high temperature and low energy quantum chromodynamics, to the nonrelativistic dynamics of magnetic monopoles, and to the quantum Hall effect. (author)

  14. Parameter sensitivity and uncertainty of the forest carbon flux model FORUG : a Monte Carlo analysis

    Energy Technology Data Exchange (ETDEWEB)

    Verbeeck, H.; Samson, R.; Lemeur, R. [Ghent Univ., Ghent (Belgium). Laboratory of Plant Ecology; Verdonck, F. [Ghent Univ., Ghent (Belgium). Dept. of Applied Mathematics, Biometrics and Process Control

    2006-06-15

    The FORUG model is a multi-layer process-based model that simulates carbon dioxide (CO{sub 2}) and water exchange between forest stands and the atmosphere. The main model outputs are net ecosystem exchange (NEE), total ecosystem respiration (TER), gross primary production (GPP) and evapotranspiration. This study used a sensitivity analysis to identify the parameters contributing to NEE uncertainty in the FORUG model. The aim was to determine if it is necessary to estimate the uncertainty of all parameters of a model to determine overall output uncertainty. Data used in the study were the meteorological and flux data of beech trees in Hesse. The Monte Carlo method was used to rank sensitivity and uncertainty parameters in combination with a multiple linear regression. Simulations were run in which parameters were assigned probability distributions and the effect of variance in the parameters on the output distribution was assessed. The uncertainty of the output for NEE was estimated. Based on the arbitrary uncertainty of 10 key parameters, a standard deviation of 0.88 Mg C per year per NEE was found, which was equal to 24 per cent of the mean value of NEE. The sensitivity analysis showed that the overall output uncertainty of the FORUG model could be determined by accounting for only a few key parameters, which were identified as corresponding to critical parameters in the literature. It was concluded that the 10 most important parameters determined more than 90 per cent of the output uncertainty. High ranking parameters included soil respiration; photosynthesis; and crown architecture. It was concluded that the Monte Carlo technique is a useful tool for ranking the uncertainty of parameters of process-based forest flux models. 48 refs., 2 tabs., 2 figs.

  15. [Diagnosing imported helminthiasis].

    Science.gov (United States)

    Pardo, Javier; Pérez-Arellano, José Luis; Galindo, Inmaculada; Belhassen, Moncef; Cordero, Miguel; Muro, Antonio

    2007-05-01

    In recent years, there has been an increase in cases of imported helminthiasis in Spain because of two complementary causes: immigration and international travel. Although the prevalence of helminthiasis is high in the immigrant population, the risk of transmission to the Spanish population is low. In this review, we provide clues to aid in the diagnosis of the helminthiasis, highlighting the geographic characteristics, clinical findings and analytical results of the most frequent types. The low sensitivity of the classic parasitological diagnostic test, mainly in tissue helminthiasis, is described. In addition, the advantages and limitations of the common serological methods for detecting related circulating antigens and antibodies are presented. Certain molecular methods used in the diagnosis of imported helminthiasis and the best strategies for screening of this condition are discussed.

  16. Modifying factors for metabolic parameters

    International Nuclear Information System (INIS)

    Inaba, Jiro

    1990-01-01

    Studies on factors which influence the metabolic parameter for calculation of radiation doses from intakes of radionuclides are very important for estimation of the doses for the general public, because the present procedures recommended by the International Commission on Radiological Protection is for occupationally exposed workers and the underlying metabolic and dosimetric models have been developed from studies on adult man and experiments on adult animals and from observations on radionuclides in physico-chemically simple form. Many factors have been reported to influence the metabolic parameters. Among them, the food-chain involvement of radionuclides and the age-dependence in humans and animals are most significant as environmental and physiological factor, respectively. In connection with the age-dependence of dose calculation, the ICRP started a new programme. They organized a Task Group on Age-Dependent Dose-Factors where relevant information on metabolic and biokinetic parameters are presently being reviewed for development of a set of dose factors for the following age-groups: infant, 1-year-old, 5-year-old, 10-year-old, 15-year-old, and ICRP Reference Man. The first stage of the work is for age-dependent integrated organ and effective dose factors for radioisotopes of the following elements: hydrogen, carbon, iodine, cesium, strontium, plutonium and americium. (author)

  17. Reliability importance measures and their calculation

    International Nuclear Information System (INIS)

    Andsten, R.; Vaurio, J.K.

    1989-01-01

    The importance of a component to the system reliability or availability and to the system failure rate can be measured by a number of importance measures. Such measures can be used to guide the system design improvement actions as well as the diagnostic and repair actions. This report develops relationships between several importance measures, illustrates their meaning with interpretations and applications, and describes the computer program called IMPO that calculates importance measures when the system minimum cat sets and component parameters are given. A user's manual is included with illustrative examples

  18. Effects of measurement noise on modal parameter identification

    International Nuclear Information System (INIS)

    Dorvash, S; Pakzad, S N

    2012-01-01

    In the past decade, much research has been conducted on data-driven structural health monitoring (SHM) algorithms with use of sensor measurements. A fundamental step in this SHM application is to identify the dynamic characteristics of structures. Despite the significant efforts devoted to development and enhancement of the modal parameter identification algorithms, there are still substantial uncertainties in the results obtained in real-life deployments. One of the sources of uncertainties in the results is the existence of noise in the measurement data. Depending on the subsequent application of the system identification, the level of uncertainty in the results and, consequently, the level of noise contamination can be very important. As an effort towards understanding the effect of measurement noise on the modal identification, this paper presents parameters that quantify the effects of measurement noise on the modal identification process and determine their influence on the accuracy of results. The performance of these parameters is validated by a numerically simulated example. They are then used to investigate the accuracy of identified modal properties of the Golden Gate Bridge using ambient data collected by wireless sensors. The vibration monitoring tests of the Golden Gate Bridge provided two synchronized data sets collected by two different sensor types. The influence of the sensor noise level on the accuracy of results is investigated throughout this work and it is shown that high quality sensors provide more accurate results as the physical contribution of response in their measured data is significantly higher. Additionally, higher purity and consistency of modal parameters, identified by higher quality sensors, is observed in the results. (paper)

  19. Complexity, parameter sensitivity and parameter transferability in the modelling of floodplain inundation

    Science.gov (United States)

    Bates, P. D.; Neal, J. C.; Fewtrell, T. J.

    2012-12-01

    In this we paper we consider two related questions. First, we address the issue of how much physical complexity is necessary in a model in order to simulate floodplain inundation to within validation data error. This is achieved through development of a single code/multiple physics hydraulic model (LISFLOOD-FP) where different degrees of complexity can be switched on or off. Different configurations of this code are applied to four benchmark test cases, and compared to the results of a number of industry standard models. Second we address the issue of how parameter sensitivity and transferability change with increasing complexity using numerical experiments with models of different physical and geometric intricacy. Hydraulic models are a good example system with which to address such generic modelling questions as: (1) they have a strong physical basis; (2) there is only one set of equations to solve; (3) they require only topography and boundary conditions as input data; and (4) they typically require only a single free parameter, namely boundary friction. In terms of complexity required we show that for the problem of sub-critical floodplain inundation a number of codes of different dimensionality and resolution can be found to fit uncertain model validation data equally well, and that in this situation Occam's razor emerges as a useful logic to guide model selection. We find also find that model skill usually improves more rapidly with increases in model spatial resolution than increases in physical complexity, and that standard approaches to testing hydraulic models against laboratory data or analytical solutions may fail to identify this important fact. Lastly, we find that in benchmark testing studies significant differences can exist between codes with identical numerical solution techniques as a result of auxiliary choices regarding the specifics of model implementation that are frequently unreported by code developers. As a consequence, making sound

  20. About the identification of behaviour law parameters of clayey rocks

    International Nuclear Information System (INIS)

    Lecampion, B.

    2002-09-01

    This work aims at developing identification methods for clayey rock parameters. These methods are necessary for the interpretation of the numerous data obtained at the ANDRA's Meuse/Haute-Marne underground laboratory. Two main rheological aspects have been considered: the poro-elastic behaviour and the elasto-visco-plastic behaviour. The first part of the study focusses on the poro-elastic parameters. Chapter 2 recalls the direct problem and discusses some important points of the identification inverse problem. Chapter 3 deals with the formulation of gradient calculation techniques for the linear poro-elastic case. The resolution using the finite-element method is discussed. The direct and associated state differentiation methods are validated for a 2D numerical example using the finite-element code Cast3M. The identification of poro-elastic coefficients of the Meuse/Haute-Marne argillaceous rocks is discussed in detail in chapter 4. The use of approximate semi-explicit solutions of the direct problems allows to obtain a fast identification method. The second part deals with the identification of elasto-visco-plastic parameters. The visco-plastic behaviour of Meuse/Haute-Marne rocks is discussed in chapter 5 and a visco-plastic model with nonlinear isotropic cold-drawing is proposed which allows to reproduce the tests. The parameters of this behaviour law are identified on a 1D creep test in drained conditions. Thus, the delayed deformations come from the poro-elastic and visco-plastic behaviour of the rock. It is shown that both phenomena can be separated. All poro-elasto-visco-plastic parameters are identified and a semi-explicit solution of the creep test is used. Chapter 6 presents an identification method of the elasto-visco-plastic parameters for the general case. The identification is equivalent to the minimization of a cost functional. The gradient of the functional is calculated by direct differentiation. The direct differentiation method is developed in

  1. Assessing the Impact of Model Parameter Uncertainty in Simulating Grass Biomass Using a Hybrid Carbon Allocation Strategy

    Science.gov (United States)

    Reyes, J. J.; Adam, J. C.; Tague, C.

    2016-12-01

    Grasslands play an important role in agricultural production as forage for livestock; they also provide a diverse set of ecosystem services including soil carbon (C) storage. The partitioning of C between above and belowground plant compartments (i.e. allocation) is influenced by both plant characteristics and environmental conditions. The objectives of this study are to 1) develop and evaluate a hybrid C allocation strategy suitable for grasslands, and 2) apply this strategy to examine the importance of various parameters related to biogeochemical cycling, photosynthesis, allocation, and soil water drainage on above and belowground biomass. We include allocation as an important process in quantifying the model parameter uncertainty, which identifies the most influential parameters and what processes may require further refinement. For this, we use the Regional Hydro-ecologic Simulation System, a mechanistic model that simulates coupled water and biogeochemical processes. A Latin hypercube sampling scheme was used to develop parameter sets for calibration and evaluation of allocation strategies, as well as parameter uncertainty analysis. We developed the hybrid allocation strategy to integrate both growth-based and resource-limited allocation mechanisms. When evaluating the new strategy simultaneously for above and belowground biomass, it produced a larger number of less biased parameter sets: 16% more compared to resource-limited and 9% more compared to growth-based. This also demonstrates its flexible application across diverse plant types and environmental conditions. We found that higher parameter importance corresponded to sub- or supra-optimal resource availability (i.e. water, nutrients) and temperature ranges (i.e. too hot or cold). For example, photosynthesis-related parameters were more important at sites warmer than the theoretical optimal growth temperature. Therefore, larger values of parameter importance indicate greater relative sensitivity in

  2. Optomechanical parameter estimation

    International Nuclear Information System (INIS)

    Ang, Shan Zheng; Tsang, Mankei; Harris, Glen I; Bowen, Warwick P

    2013-01-01

    We propose a statistical framework for the problem of parameter estimation from a noisy optomechanical system. The Cramér–Rao lower bound on the estimation errors in the long-time limit is derived and compared with the errors of radiometer and expectation–maximization (EM) algorithms in the estimation of the force noise power. When applied to experimental data, the EM estimator is found to have the lowest error and follow the Cramér–Rao bound most closely. Our analytic results are envisioned to be valuable to optomechanical experiment design, while the EM algorithm, with its ability to estimate most of the system parameters, is envisioned to be useful for optomechanical sensing, atomic magnetometry and fundamental tests of quantum mechanics. (paper)

  3. Critical parameters for ammonia

    International Nuclear Information System (INIS)

    Sato, M.; Masui, G.; Uematsu, M.

    2005-01-01

    (p, ρ, T) measurements and visual observations of the meniscus for ammonia were carried out carefully in the critical region over the range of temperatures: -1 K (T - T c ) 0.04 K, and of densities: -19 kg . m -3 (ρ - ρ c ) 19 kg . m -3 by a metal-bellows volumometer with an optical cell. Vapor pressures were also measured at T = (310, 350, and 400) K. The critical parameters of T c and ρ c were determined based on the results of observation of the critical opalescence. The critical pressure p c was determined from the present measurements at T c on the vapor pressure curve. Comparisons of the critical parameters with values given in the literature are presented

  4. Critical parameters for ammonia

    Energy Technology Data Exchange (ETDEWEB)

    Sato, M. [Center for Mechanical Engineering and Applied Mechanics, Keio University, Hiyoshi 3-14-1, Kohoku-ku, Yokohama 223-8522 (Japan); Masui, G. [Center for Mechanical Engineering and Applied Mechanics, Keio University, Hiyoshi 3-14-1, Kohoku-ku, Yokohama 223-8522 (Japan); Uematsu, M. [Center for Mechanical Engineering and Applied Mechanics, Keio University, Hiyoshi 3-14-1, Kohoku-ku, Yokohama 223-8522 (Japan)]. E-mail: uematsu@mech.keio.ac.jp

    2005-09-15

    (p, {rho}, T) measurements and visual observations of the meniscus for ammonia were carried out carefully in the critical region over the range of temperatures: -1 K (T - T {sub c}) 0.04 K, and of densities: -19 kg . m{sup -3} ({rho} - {rho} {sub c}) 19 kg . m{sup -3} by a metal-bellows volumometer with an optical cell. Vapor pressures were also measured at T = (310, 350, and 400) K. The critical parameters of T {sub c} and {rho} {sub c} were determined based on the results of observation of the critical opalescence. The critical pressure p {sub c} was determined from the present measurements at T {sub c} on the vapor pressure curve. Comparisons of the critical parameters with values given in the literature are presented.

  5. LMFBR plant parameters

    International Nuclear Information System (INIS)

    1979-03-01

    This document contains up-to-date data on existing or firmly decided prototype or demonstration LMFBR reactors (Table I), on planned commercial size LMFBR according to the present status of design (Table II) and on experimental fast reactors such as BOR-60, DFR, EBR-II, FERMI, FFTF, JOYO, KNK-II, PEC, RAPSODIE-FORTISSIMO (Table III). Only corrected and revised parameters submitted by the countries participating in the IWGFR are included in this document

  6. Ranking as parameter estimation

    Czech Academy of Sciences Publication Activity Database

    Kárný, Miroslav; Guy, Tatiana Valentine

    2009-01-01

    Roč. 4, č. 2 (2009), s. 142-158 ISSN 1745-7645 R&D Projects: GA MŠk 2C06001; GA AV ČR 1ET100750401; GA MŠk 1M0572 Institutional research plan: CEZ:AV0Z10750506 Keywords : ranking * Bayesian estimation * negotiation * modelling Subject RIV: BB - Applied Statistics, Operational Research http://library.utia.cas.cz/separaty/2009/AS/karny- ranking as parameter estimation.pdf

  7. A review of parameters and heuristics for guiding metabolic pathfinding.

    Science.gov (United States)

    Kim, Sarah M; Peña, Matthew I; Moll, Mark; Bennett, George N; Kavraki, Lydia E

    2017-09-15

    Recent developments in metabolic engineering have led to the successful biosynthesis of valuable products, such as the precursor of the antimalarial compound, artemisinin, and opioid precursor, thebaine. Synthesizing these traditionally plant-derived compounds in genetically modified yeast cells introduces the possibility of significantly reducing the total time and resources required for their production, and in turn, allows these valuable compounds to become cheaper and more readily available. Most biosynthesis pathways used in metabolic engineering applications have been discovered manually, requiring a tedious search of existing literature and metabolic databases. However, the recent rapid development of available metabolic information has enabled the development of automated approaches for identifying novel pathways. Computer-assisted pathfinding has the potential to save biochemists time in the initial discovery steps of metabolic engineering. In this paper, we review the parameters and heuristics used to guide the search in recent pathfinding algorithms. These parameters and heuristics capture information on the metabolic network structure, compound structures, reaction features, and organism-specificity of pathways. No one metabolic pathfinding algorithm or search parameter stands out as the best to use broadly for solving the pathfinding problem, as each method and parameter has its own strengths and shortcomings. As assisted pathfinding approaches continue to become more sophisticated, the development of better methods for visualizing pathway results and integrating these results into existing metabolic engineering practices is also important for encouraging wider use of these pathfinding methods.

  8. Risk communication importance

    Energy Technology Data Exchange (ETDEWEB)

    Cunha, Raquel Dalledone Siqueira da; Andrade, Delvonei Alves de, E-mail: raqueldalledonesiqueira@gmail.com, E-mail: delvonei@ipen.br [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil)

    2013-07-01

    Risk Communication has shown its importance in the elaboration of emergency plans in the Chemical industry. In the 90's, the UNEP developed the APELL (Awareness and Preparedness for Emergency at Local Level) plan, a risk management methodology used by dangerous chemical facilities. The methodology comprises the commitment of both Government and the community located in the risk area in the development of the emergency plan. In the nuclear sector, there is no similar methodology developed so far. However, establishing a communication channel between the nuclear segment and the community is essential. In Brazil, the construction of Angra 3 and the RMB (Multi Purpose Reactor) project stand as nuclear initiatives that improve the importance of a good communication to the public. Security issues of these projects are natural sources of concernment to the public, which is aggravated by events such as the Fukushima disaster. Without an effective communication about what means the presence of nuclear plants and reactors in a specific area, the interested public will only have an alarmist vision of the subject, given by those against these facilities. (author)

  9. Risk communication importance

    International Nuclear Information System (INIS)

    Cunha, Raquel Dalledone Siqueira da; Andrade, Delvonei Alves de

    2013-01-01

    Risk Communication has shown its importance in the elaboration of emergency plans in the Chemical industry. In the 90's, the UNEP developed the APELL (Awareness and Preparedness for Emergency at Local Level) plan, a risk management methodology used by dangerous chemical facilities. The methodology comprises the commitment of both Government and the community located in the risk area in the development of the emergency plan. In the nuclear sector, there is no similar methodology developed so far. However, establishing a communication channel between the nuclear segment and the community is essential. In Brazil, the construction of Angra 3 and the RMB (Multi Purpose Reactor) project stand as nuclear initiatives that improve the importance of a good communication to the public. Security issues of these projects are natural sources of concernment to the public, which is aggravated by events such as the Fukushima disaster. Without an effective communication about what means the presence of nuclear plants and reactors in a specific area, the interested public will only have an alarmist vision of the subject, given by those against these facilities. (author)

  10. SPARQL-enabled identifier conversion with Identifiers.org

    Science.gov (United States)

    Wimalaratne, Sarala M.; Bolleman, Jerven; Juty, Nick; Katayama, Toshiaki; Dumontier, Michel; Redaschi, Nicole; Le Novère, Nicolas; Hermjakob, Henning; Laibe, Camille

    2015-01-01

    Motivation: On the semantic web, in life sciences in particular, data is often distributed via multiple resources. Each of these sources is likely to use their own International Resource Identifier for conceptually the same resource or database record. The lack of correspondence between identifiers introduces a barrier when executing federated SPARQL queries across life science data. Results: We introduce a novel SPARQL-based service to enable on-the-fly integration of life science data. This service uses the identifier patterns defined in the Identifiers.org Registry to generate a plurality of identifier variants, which can then be used to match source identifiers with target identifiers. We demonstrate the utility of this identifier integration approach by answering queries across major producers of life science Linked Data. Availability and implementation: The SPARQL-based identifier conversion service is available without restriction at http://identifiers.org/services/sparql. Contact: sarala@ebi.ac.uk PMID:25638809

  11. SPARQL-enabled identifier conversion with Identifiers.org.

    Science.gov (United States)

    Wimalaratne, Sarala M; Bolleman, Jerven; Juty, Nick; Katayama, Toshiaki; Dumontier, Michel; Redaschi, Nicole; Le Novère, Nicolas; Hermjakob, Henning; Laibe, Camille

    2015-06-01

    On the semantic web, in life sciences in particular, data is often distributed via multiple resources. Each of these sources is likely to use their own International Resource Identifier for conceptually the same resource or database record. The lack of correspondence between identifiers introduces a barrier when executing federated SPARQL queries across life science data. We introduce a novel SPARQL-based service to enable on-the-fly integration of life science data. This service uses the identifier patterns defined in the Identifiers.org Registry to generate a plurality of identifier variants, which can then be used to match source identifiers with target identifiers. We demonstrate the utility of this identifier integration approach by answering queries across major producers of life science Linked Data. The SPARQL-based identifier conversion service is available without restriction at http://identifiers.org/services/sparql. © The Author 2015. Published by Oxford University Press.

  12. Integral data analysis for resonance parameters determination

    International Nuclear Information System (INIS)

    Larson, N.M.; Leal, L.C.; Derrien, H.

    1997-09-01

    Neutron time-of-flight experiments have long been used to determine resonance parameters. Those resonance parameters have then been used in calculations of integral quantities such as Maxwellian averages or resonance integrals, and results of those calculations in turn have been used as a criterion for acceptability of the resonance analysis. However, the calculations were inadequate because covariances on the parameter values were not included in the calculations. In this report an effort to correct for that deficiency is documented: (1) the R-matrix analysis code SAMMY has been modified to include integral quantities of importance, (2) directly within the resonance parameter analysis, and (3) to determine the best fit to both differential (microscopic) and integral (macroscopic) data simultaneously. This modification was implemented because it is expected to have an impact on the intermediate-energy range that is important for criticality safety applications

  13. ATLAS parameter study

    International Nuclear Information System (INIS)

    Adler, R.J.

    1994-01-01

    The purpose of this study is to make an independent assessment on the parameters chosen for the ATLAS capacitor bank at LANL. The contractor will perform a study of the basic pulsed power parameters of the ATLAS device with baseline functional parameters of >25 MA implosion current and <2.5 microsecond current risetime. Nominal circuit parameters held fixed will be the 14 nH from the vacuum interface to the load, and the nominal load impedances of 1 milliohm for slow loads and 10 milliohms for fast loads. Single Ended designs, as opposed to bipolar designs, will be studied in detail. The ATLAS pulsed power design problem is about inductance. The reason that a 36 MJ bank is required is that such a bank has enough individual capacitors so that the parallel inductance is acceptably low. Since about half the inductance is in the bank, and the inductance and time constant of the submodules is fixed, the variation of output with a given parameter will generally be a weak one. In general, the dl/dt calculation demonstrates that for the real system inductances, 700 kV is the optimum voltage for the bank to drive X-ray loads. The optimum is broad, and there is little reduction in performance at voltages as low as 450 kV. The direct drive velocity analysis also shows that the optimum velocity is between 480 and 800 kV for a variety of assumptions, and that there is less than a 10% variation in velocity over this range. Voltages in the 120 kV--600 kV range are desirable for driving heavy liners. A compromise optimum operating point might be 480 kV, at which all X-ray operation scenarios are within 10% of their velocity optimum, and heavy liners can be configured to be near optimum if small enough. Based on very preliminary studies the author believes that the choice of a single operating voltage point (say, 480 kV) is unnecessary, and that a bank engineered for dual operation at 480 and 240 kV will be the best solution to the ATLAS problem

  14. Order parameter fluctuations and collective modes in superconductors

    International Nuclear Information System (INIS)

    Carlson, R.V.

    1975-06-01

    Measurements of the frequency and wave vector dependence of the pair-field susceptibility and the dynamical structure factor of homogeneous, short mean free path aluminum films have been carried out. These measurements critically probe the dynamical nature of order parameter fluctuations in the vicinity of the superconducting phase transition. Two important results are found. The first is that at temperatures higher than the transition temperature of the aluminum film, the fluctuations of the order parameter can be described by a diffusive time-dependent generalization of the Ginzburg-Landau equation. Detailed comparison of the data to the results of theoretical calculations of Scalapino, and Shenoy and Lee is carried out. Except in the immediate vicinity of the transition, there is excellent agreement with the theories. A major discrepancy between theory and experiment does exist in the vicinity of the superconducting transition, in that the pair relaxation frequency falls well below the theoretical predictions. Possible explanations of this behavior are discussed. Below the transition temperature measurements of the structure factor (Fourier transform of the order parameter-order parameter correlation function) provide the first clear cut demonstration of the existence of a propagating, low frequency, order parameter collective mode which appears as a finite frequency peak in the structure factor. This mode has been identified with fluctuations in the phase of the order parameter and has a linear dispersion relation over the range in which it is observed. A detailed comparison to some of the theoretical explanations is made, with the conclusion that at this time, existing theories do not adequately explain the behavior of the mode over the range of temperature and magnetic field in which it is observed. (4 figures, 4 tables, 86 references) (U.S.)

  15. Most important human aluminoses

    Energy Technology Data Exchange (ETDEWEB)

    Avtsyn, A P

    1986-01-01

    Aluminoses are widespread forms of trace element deficiency of various severity. The organism is protected against a possible pathogenic influence of aluminum by a number of physiological mechanisms the most important among which is a regular urine excretion. A complex of pathological symptoms develops if serious homeostasis disturbances take place e. g. when renal deficiency or direct penetration of the trace element occur. The following forms of aluminosis should be distinguished: 1) simple accumulation in central nervous system which occurs in persons over 65 years; 2) aluminum accumulation in Alzheimer disease, in severe form of presenile and senile dementia; 3) dialysis aluminum encephalopathy; 4) non-dialysis infantile encephalopathy; 5) aluminum encephalopathy in total parenteral nutrition; 6) iatrogenic dialysis aluminum osteodystrophy; 7) jatrogenic peritoneal aluminosis; 8) aluminum pneumoconiosis of an occupational origin; 9) bronchospastic syndrome in aluminum smelter workers.

  16. Importance of Grid Center Arrangement

    Science.gov (United States)

    Pasaogullari, O.; Usul, N.

    2012-12-01

    In Digital Elevation Modeling, grid size is accepted to be the most important parameter. Despite the point density and/or scale of the source data, it is freely decided by the user. Most of the time, arrangement of the grid centers are ignored, even most GIS packages omit the choice of grid center coordinate selection. In our study; importance of the arrangement of grid centers is investigated. Using the analogy between "Raster Grid DEM" and "Bitmap Image", importance of placement of grid centers in DEMs are measured. The study has been conducted on four different grid DEMs obtained from a half ellipsoid. These grid DEMs are obtained in such a way that they are half grid size apart from each other. Resulting grid DEMs are investigated through similarity measures. Image processing scientists use different measures to investigate the dis/similarity between the images and the amount of different information they carry. Grid DEMs are projected to a finer grid in order to co-center. Similarity measures are then applied to each grid DEM pairs. These similarity measures are adapted to DEM with band reduction and real number operation. One of the measures gives function graph and the others give measure matrices. Application of similarity measures to six grid DEM pairs shows interesting results. These four different grid DEMs are created with the same method for the same area, surprisingly; thirteen out of 14 measures state that, the half grid size apart grid DEMs are different from each other. The results indicated that although grid DEMs carry mutual information, they have also additional individual information. In other words, half grid size apart constructed grid DEMs have non-redundant information.; Joint Probability Distributions Function Graphs

  17. Mexico: Imports or exports?

    International Nuclear Information System (INIS)

    Estrada, J.

    2002-01-01

    This presentation provides an overview of Mexico's energy sector. Proven oil reserves place Mexico in ninth position in the world and fourth largest in natural gas reserves. Energy is one of the most important economic activities of the country, representing 3 per cent of Gross Domestic Product (GDP). Oil exports represent 8.4 per cent of total exports. Approximately 40 per cent of total public investment is earmarked for energy projects. The author discusses energy resources and energy sector limitations. The energy sector plan for the period 2001-2006 is discussed. Its goals are to ensure energy supply, to develop the energy sector, to stimulate participation of Mexican enterprises, to promote renewable energy sources, and to strengthen international energy cooperation. The regulatory framework is being adapted to increase private investment. Some graphs are presented, displaying the primary energy production and primary energy consumption. Energy sector reforms are reviewed, as are electricity and natural gas reforms. The energy sector demand for 2000-2010 and investment requirements are reviewed, as well as fuel consumption for power generation. The author discusses the National Pipeline System (SNG) and the bottlenecks caused by pressure efficiency in the northeast, flow restriction on several pipeline segments, variability of the Petroleos Mexicanos (PEMEX) own use, and pressure drop on central regions. The entire prospect for natural gas in the country is reviewed, along with the Strategic Gas Program (PEG) consisting of 20 projects, including 4 non-associated natural gas, 9 exploration and 7 optimization. A section dealing with multiple service contracts is included in the presentation. The authors conclude by stating that the priority is a national energy policy to address Mexico's energy security requirements, to increase natural gas production while promoting the diversification of imports, and a regulatory framework to be updated in light of current

  18. Bayesian estimation of Weibull distribution parameters

    International Nuclear Information System (INIS)

    Bacha, M.; Celeux, G.; Idee, E.; Lannoy, A.; Vasseur, D.

    1994-11-01

    In this paper, we expose SEM (Stochastic Expectation Maximization) and WLB-SIR (Weighted Likelihood Bootstrap - Sampling Importance Re-sampling) methods which are used to estimate Weibull distribution parameters when data are very censored. The second method is based on Bayesian inference and allow to take into account available prior informations on parameters. An application of this method, with real data provided by nuclear power plants operation feedback analysis has been realized. (authors). 8 refs., 2 figs., 2 tabs

  19. Matrix parameters and storage conditions of manure

    Energy Technology Data Exchange (ETDEWEB)

    Weinfurtner, Karlheinz [Fraunhofer Institute for Molecular Biology and Applied Ecology (IME), Schmallenberg (Germany)

    2011-01-15

    The literature study presents an overview of storage conditions for manure and information about important matrix parameters of manure such as dry matter content, pH value, total organic carbon, total nitrogen and ammonium nitrogen. The presented results show that for matrix parameters a dissimilarity of cattle and pig manure can be observed but no difference within the species for different production types occurred with exception of calves. A scenario for western and central European countries is derived. (orig.)

  20. Selecting Design Parameters for Flying Vehicles

    Science.gov (United States)

    Makeev, V. I.; Strel'nikova, E. A.; Trofimenko, P. E.; Bondar', A. V.

    2013-09-01

    Studying the influence of a number of design parameters of solid-propellant rockets on the longitudinal and lateral dispersion is an important applied problem. A mathematical model of a rigid body of variable mass moving in a disturbed medium exerting both wave drag and friction is considered. The model makes it possible to determine the coefficients of aerodynamic forces and moments, which affect the motion of vehicles, and to assess the effect of design parameters on their accuracy

  1. Inverse modeling of hydrologic parameters using surface flux and runoff observations in the Community Land Model

    Science.gov (United States)

    Sun, Y.; Hou, Z.; Huang, M.; Tian, F.; Leung, L. Ruby

    2013-12-01

    This study demonstrates the possibility of inverting hydrologic parameters using surface flux and runoff observations in version 4 of the Community Land Model (CLM4). Previous studies showed that surface flux and runoff calculations are sensitive to major hydrologic parameters in CLM4 over different watersheds, and illustrated the necessity and possibility of parameter calibration. Both deterministic least-square fitting and stochastic Markov-chain Monte Carlo (MCMC)-Bayesian inversion approaches are evaluated by applying them to CLM4 at selected sites with different climate and soil conditions. The unknowns to be estimated include surface and subsurface runoff generation parameters and vadose zone soil water parameters. We find that using model parameters calibrated by the sampling-based stochastic inversion approaches provides significant improvements in the model simulations compared to using default CLM4 parameter values, and that as more information comes in, the predictive intervals (ranges of posterior distributions) of the calibrated parameters become narrower. In general, parameters that are identified to be significant through sensitivity analyses and statistical tests are better calibrated than those with weak or nonlinear impacts on flux or runoff observations. Temporal resolution of observations has larger impacts on the results of inverse modeling using heat flux data than runoff data. Soil and vegetation cover have important impacts on parameter sensitivities, leading to different patterns of posterior distributions of parameters at different sites. Overall, the MCMC-Bayesian inversion approach effectively and reliably improves the simulation of CLM under different climates and environmental conditions. Bayesian model averaging of the posterior estimates with different reference acceptance probabilities can smooth the posterior distribution and provide more reliable parameter estimates, but at the expense of wider uncertainty bounds.

  2. Multilevel resonance parameters of 241Pu

    International Nuclear Information System (INIS)

    Weston, L.W.; Todd, J.H.

    1978-01-01

    The data previously reported by the authors on the neutron fission and capture cross sections of 241 Pu were simultaneously fit with the Adler formalism to obtain multilevel resonance parameters. The neutron energy range of the fit was 0.01 to 100 eV. The 241 Pu cross sections in the resonance region of neutron energies are complex, and the Adler parameters present an efficient method of representing these cross sections, which are important for plutonium-fueled reactors. The parameters represent the data to an accuracy within the quoted experimental errors. 5 figures, 2 tables

  3. Parameter extraction with neural networks

    Science.gov (United States)

    Cazzanti, Luca; Khan, Mumit; Cerrina, Franco

    1998-06-01

    In semiconductor processing, the modeling of the process is becoming more and more important. While the ultimate goal is that of developing a set of tools for designing a complete process (Technology CAD), it is also necessary to have modules to simulate the various technologies and, in particular, to optimize specific steps. This need is particularly acute in lithography, where the continuous decrease in CD forces the technologies to operate near their limits. In the development of a 'model' for a physical process, we face several levels of challenges. First, it is necessary to develop a 'physical model,' i.e. a rational description of the process itself on the basis of know physical laws. Second, we need an 'algorithmic model' to represent in a virtual environment the behavior of the 'physical model.' After a 'complete' model has been developed and verified, it becomes possible to do performance analysis. In many cases the input parameters are poorly known or not accessible directly to experiment. It would be extremely useful to obtain the values of these 'hidden' parameters from experimental results by comparing model to data. This is particularly severe, because the complexity and costs associated with semiconductor processing make a simple 'trial-and-error' approach infeasible and cost- inefficient. Even when computer models of the process already exists, obtaining data through simulations may be time consuming. Neural networks (NN) are powerful computational tools to predict the behavior of a system from an existing data set. They are able to adaptively 'learn' input/output mappings and to act as universal function approximators. In this paper we use artificial neural networks to build a mapping from the input parameters of the process to output parameters which are indicative of the performance of the process. Once the NN has been 'trained,' it is also possible to observe the process 'in reverse,' and to extract the values of the inputs which yield outputs

  4. Practice parameter on disaster preparedness.

    Science.gov (United States)

    Pfefferbaum, Betty; Shaw, Jon A

    2013-11-01

    This Practice Parameter identifies best approaches to the assessment and management of children and adolescents across all phases of a disaster. Delivered within a disaster system of care, many interventions are appropriate for implementation in the weeks and months after a disaster. These include psychological first aid, family outreach, psychoeducation, social support, screening, and anxiety reduction techniques. The clinician should assess and monitor risk and protective factors across all phases of a disaster. Schools are a natural site for conducting assessments and delivering services to children. Multimodal approaches using social support, psychoeducation, and cognitive behavioral techniques have the strongest evidence base. Psychopharmacologic interventions are not generally used but may be necessary as an adjunct to other interventions for children with severe reactions or coexisting psychiatric conditions. Copyright © 2013. Published by Elsevier Inc.

  5. Measures of risk importance and their applications

    International Nuclear Information System (INIS)

    Vesely, W.E.; Davis, T.C.; Denning, R.S.; Saltos, N.

    1983-07-01

    This work is part of a project being conducted for the Division of Risk Analysis (DRA) of the Nuclear Regulatory Commission (NRC). The objectives of the project are to evaluate the importances of containment, the different safety functions, and other various contributers as assessed in probabilistic risk analyses and to identify generic conclusions regarding the importances. Effective display of the importances is an important part of these objectives. To address these objectives, measures of risk importance need to be first identified and then they need to be evaluated for the different risk analyses which have been performed. This report describes the risk importance measures that were defined and were applied to the risk analyses which were performed as part of the Reactor Safety Study Methodology Applications Program (RSSMAP). The risk importance measures defined in this report measure the importance of features not only with regard to risk reduction but also with regard to reliability assurance, or risk maintenance. The goal of this report is not to identify new mathematical formulas for risk importance but to show how importance measures can be interpreted and can be applied

  6. Buncher system parameter optimization

    International Nuclear Information System (INIS)

    Wadlinger, E.A.

    1981-01-01

    A least-squares algorithm is presented to calculate the RF amplitudes and cavity spacings for a series of buncher cavities each resonating at a frequency that is a multiple of a fundamental frequency of interest. The longitudinal phase-space distribution, obtained by particle tracing through the bunching system, is compared to a desired distribution function of energy and phase. The buncher cavity parameters are adjusted to minimize the difference between these two distributions. Examples are given for zero space charge. The manner in which the method can be extended to include space charge using the 3-D space-charge calculation procedure is indicated

  7. A simple and fast method to determine the parameters for fuzzy c-means cluster analysis

    DEFF Research Database (Denmark)

    Schwämmle, Veit; Jensen, Ole Nørregaard

    2010-01-01

    MOTIVATION: Fuzzy c-means clustering is widely used to identify cluster structures in high-dimensional datasets, such as those obtained in DNA microarray and quantitative proteomics experiments. One of its main limitations is the lack of a computationally fast method to set optimal values...... of algorithm parameters. Wrong parameter values may either lead to the inclusion of purely random fluctuations in the results or ignore potentially important data. The optimal solution has parameter values for which the clustering does not yield any results for a purely random dataset but which detects cluster...... formation with maximum resolution on the edge of randomness. RESULTS: Estimation of the optimal parameter values is achieved by evaluation of the results of the clustering procedure applied to randomized datasets. In this case, the optimal value of the fuzzifier follows common rules that depend only...

  8. Imported coenurosis in sheep

    International Nuclear Information System (INIS)

    Schweizer, G.; Grünenfelder, F.; Sydler, T.; Rademacher, N.; Braun, U.; Deplazes, P.

    2006-01-01

    Thirteen sheep from a milk producing farm in the Canton of Grisons that presented chronic coenurosis were examined and subjected to treatment trials at the veterinary hospital in Zurich. Symptoms were first observed around two months after the import of two dogs from Italy (Abruzza) of which one was infected with Taenia multiceps and Echinococcus granulosus. The most frequently observed clinical symptoms of the sheep were reduced general condition, circling, reduced menace reflex, apathy, unsteady gait and head tilt. Analyses of cerebrospinal fluid revealed an increased leucocyte count in 3 sheep and eosinophilia in 4 sheep. In 4 animals that underwent computertomography, one or more hypodense, definable lesions were found in the brain. In 2 sheep surgical treatment and in 10 animals medical treatment with either Praziquantel (n=8) or Oxfendazol (n=2) was attempted. Only one animal treated with Praziquantel needed not to be euthanized. At necropsy, one or two coenurus cysts could be found either in a side ventricle (n=2), in the cerebellum (n=3) or in the cerebrum (n=7). The locations corresponded with the clinical findings. Despite Praziquantel or Oxfendazol treatment, living protoscoleces could be found in the parasite cysts [de

  9. Parameter estimation and determinability analysis applied to Drosophila gap gene circuits

    Directory of Open Access Journals (Sweden)

    Jaeger Johannes

    2008-09-01

    Full Text Available Abstract Background Mathematical modeling of real-life processes often requires the estimation of unknown parameters. Once the parameters are found by means of optimization, it is important to assess the quality of the parameter estimates, especially if parameter values are used to draw biological conclusions from the model. Results In this paper we describe how the quality of parameter estimates can be analyzed. We apply our methodology to assess parameter determinability for gene circuit models of the gap gene network in early Drosophila embryos. Conclusion Our analysis shows that none of the parameters of the considered model can be determined individually with reasonable accuracy due to correlations between parameters. Therefore, the model cannot be used as a tool to infer quantitative regulatory weights. On the other hand, our results show that it is still possible to draw reliable qualitative conclusions on the regulatory topology of the gene network. Moreover, it improves previous analyses of the same model by allowing us to identify those interactions for which qualitative conclusions are reliable, and those for which they are ambiguous.

  10. Buying Imported Products Online : A quantitative study about Chinese Online consumer behavior towards imported products

    OpenAIRE

    Chen, Qianqian; Wang, Yuren

    2015-01-01

    With the fast growing Chinese online marketplace and the increasing popularity of shopping imported products online in China, more and more practitioners and researchers are interested in understanding the cues that Chinese consumers use to evaluate imported products consumption online. Our quantitative study aims to identify what factors affect the behavior of Chinese online consumers towards imported products and the relationships between the identified factors and purchase intention, and t...

  11. Parameter identification in multinomial processing tree models

    NARCIS (Netherlands)

    Schmittmann, V.D.; Dolan, C.V.; Raijmakers, M.E.J.; Batchelder, W.H.

    2010-01-01

    Multinomial processing tree models form a popular class of statistical models for categorical data that have applications in various areas of psychological research. As in all statistical models, establishing which parameters are identified is necessary for model inference and selection on the basis

  12. What Clinical and Laboratory Parameters Distinguish Between ...

    African Journals Online (AJOL)

    Introduction: In developing countries, a large number of patients presenting acutely in renal failure are indeed cases of advanced chronic renal failure. In this study, we compared clinical and laboratory parameters between patients with acute renal failure (ARF) and chronic renal failure (CRF), to identify discriminatory ...

  13. Modified mean generation time parameter in the neutron point kinetics equations

    Energy Technology Data Exchange (ETDEWEB)

    Diniz, Rodrigo C.; Gonçalves, Alessandro C.; Rosa, Felipe S.S., E-mail: alessandro@nuclear.ufrj.br, E-mail: frosa@if.ufrj.br [Coordenacao de Pos-Graduacao e Pesquisa de Engenharia (PEN/COPPE/UFRJ), Rio de Janeiro, RJ (Brazil)

    2017-07-01

    This paper proposes an approximation for the modified point kinetics equations proposed by NUNES et. al, 2015, through the adjustment of a kinetic parameter. This approximation consists of analyzing the terms of the modified point kinetics equations in order to identify the least important ones for the solution, resulting in a modification of the mean generation time parameter that incorporates all influences of the additional terms of the modified kinetics. This approximation is applied on the inverse kinetics, to compare the results with the inverse kinetics from the modified kinetics in order to validate the proposed model. (author)

  14. Modified mean generation time parameter in the neutron point kinetics equations

    International Nuclear Information System (INIS)

    Diniz, Rodrigo C.; Gonçalves, Alessandro C.; Rosa, Felipe S.S.

    2017-01-01

    This paper proposes an approximation for the modified point kinetics equations proposed by NUNES et. al, 2015, through the adjustment of a kinetic parameter. This approximation consists of analyzing the terms of the modified point kinetics equations in order to identify the least important ones for the solution, resulting in a modification of the mean generation time parameter that incorporates all influences of the additional terms of the modified kinetics. This approximation is applied on the inverse kinetics, to compare the results with the inverse kinetics from the modified kinetics in order to validate the proposed model. (author)

  15. Five important advances in hematopathology.

    Science.gov (United States)

    Shi, Min; Xiao, Ruobing; Woda, Bruce A; Yu, Hongbo

    2014-03-01

    Hematopathology is a dynamic field that has always been on the frontier of clinical research within the scope of pathology. Several recent developments in hematopathology will likely affect its practice clinically. To review 5 important recent advances in hematopathology: (1) detection and prognostic implication of MYC in diffuse large B-cell lymphomas, (2) determining origin and prognosis through immunoglobulin gene usage in mature B-cell neoplasms, (3)detecting minimal residual disease in multiple myeloma, (4) using genome-wide analysis in myelodysplastic syndromes, and (5) employing whole-genome sequencing in acute myeloid leukemias. Literature review and the authors' experiences in an academic center. These advances will bring hematopathology into a new molecular era and help us to better understand the molecular, pathologic mechanisms of lymphomas, leukemias, myelomas, and myelodysplastic syndromes. They will help us to identify diagnostic and prognostic markers and eventually provide new therapeutic targets and treatments for these diseases.

  16. Resonance parameter analysis with SAMMY

    International Nuclear Information System (INIS)

    Larson, N.M.; Perey, F.G.

    1988-01-01

    The multilevel R-matrix computer code SAMMY has evolved over the past decade to become an important analysis tool for neutron data. SAMMY uses the Reich-Moore approximation to the multilevel R-matrix and includes an optional logarithmic parameterization of the external R-function. Doppler broadening is simulated either by numerical integration using the Gaussian approximation to the free gas model or by a more rigorous solution of the partial differential equation equivalent to the exact free gas model. Resolution broadening of cross sections and derivatives also has new options that more accurately represent the experimental situation. SAMMY treats constant normalization and some types of backgrounds directly and treats other normalizations and/or backgrounds with the introduction of user-generated partial derivatives. The code uses Bayes' method as an efficient alternative to least squares for fitting experimental data. SAMMY allows virtually any parameter to be varied and outputs values, uncertainties, and covariance matrix for all varied parameters. Versions of SAMMY exist for VAX, FPS, and IBM computers

  17. Coherence method of identifying signal noise model

    International Nuclear Information System (INIS)

    Vavrin, J.

    1981-01-01

    The noise analysis method is discussed in identifying perturbance models and their parameters by a stochastic analysis of the noise model of variables measured on a reactor. The analysis of correlations is made in the frequency region using coherence analysis methods. In identifying an actual specific perturbance, its model should be determined and recognized in a compound model of the perturbance system using the results of observation. The determination of the optimum estimate of the perturbance system model is based on estimates of related spectral densities which are determined from the spectral density matrix of the measured variables. Partial and multiple coherence, partial transfers, the power spectral densities of the input and output variables of the noise model are determined from the related spectral densities. The possibilities of applying the coherence identification methods were tested on a simple case of a simulated stochastic system. Good agreement was found of the initial analytic frequency filters and the transfers identified. (B.S.)

  18. Display Parameters and Requirements

    Science.gov (United States)

    Bahadur, Birendra

    The following sections are included: * INTRODUCTION * HUMAN FACTORS * Anthropometry * Sensory * Cognitive * Discussions * THE HUMAN VISUAL SYSTEM - CAPABILITIES AND LIMITATIONS * Cornea * Pupil and Iris * Lens * Vitreous Humor * Retina * RODS - NIGHT VISION * CONES - DAY VISION * RODS AND CONES - TWILIGHT VISION * VISUAL PIGMENTS * MACULA * BLOOD * CHOROID COAT * Visual Signal Processing * Pathways to the Brain * Spatial Vision * Temporal Vision * Colour Vision * Colour Blindness * DICHROMATISM * Protanopia * Deuteranopia * Tritanopia * ANOMALOUS TRICHROMATISM * Protanomaly * Deuteranomaly * Tritanomaly * CONE MONOCHROMATISM * ROD MONOCHROMATISM * Using Colour Effectively * COLOUR MIXTURES AND THE CHROMATICITY DIAGRAM * Colour Matching Functions and Chromaticity Co-ordinates * CIE 1931 Colour Space * CIE PRIMARIES * CIE COLOUR MATCHING FUNCTIONS AND CHROMATICITY CO-ORDINATES * METHODS FOR DETERMINING TRISTIMULUS VALUES AND COLOUR CO-ORDINATES * Spectral Power Distribution Method * Filter Method * CIE 1931 CHROMATICITY DIAGRAM * ADDITIVE COLOUR MIXTURE * CIE 1976 Chromaticity Diagram * CIE Uniform Colour Spaces and Colour Difference Formulae * CIELUV OR L*u*v* * CIELAB OR L*a*b* * CIE COLOUR DIFFERENCE FORMULAE * Colour Temperature and CIE Standard Illuminants and source * RADIOMETRIC AND PHOTOMETRIC QUANTITIES * Photopic (Vλ and Scotopic (Vλ') Luminous Efficiency Function * Photometric and Radiometric Flux * Luminous and Radiant Intensities * Incidence: Illuminance and Irradiance * Exitance or Emittance (M) * Luminance and Radiance * ERGONOMIC REQUIREMENTS OF DISPLAYS * ELECTRO-OPTICAL PARAMETERS AND REQUIREMENTS * Contrast and Contrast Ratio * Luminance and Brightness * Colour Contrast and Chromaticity * Glare * Other Aspects of Legibility * SHAPE AND SIZE OF CHARACTERS * DEFECTS AND BLEMISHES * FLICKER AND DISTORTION * ANGLE OF VIEW * Switching Speed * Threshold and Threshold Characteristic * Measurement Techniques For Electro-optical Parameters * RADIOMETRIC

  19. 27 CFR 478.92 - How must licensed manufacturers and licensed importers identify firearms, armor piercing...

    Science.gov (United States)

    2010-04-01

    ... section will be measured as the distance between the latitudinal ends of the character impression bottoms... the effective administration of this part. (Approved by the Office of Management and Budget under...

  20. Development of a framework identifying domains and elements of importance for arthritis rehabilitation

    DEFF Research Database (Denmark)

    Klokkerud, Mari; Hagen, Kåre Birger; Kjeken, Ingvild

    2012-01-01

    Rehabilitation is effective and beneficial for patients with arthritis. The lack of a common structure for describing the content of rehabilitation makes it difficult to compare, transfer and implement research evidence into clinical practice....

  1. Pattern check of TLD disc readings - an important tool to identify abnormal conditions in workplace

    International Nuclear Information System (INIS)

    Pradhan, S.M.; Sneha, C.; Bhattacharya, M.; Sahai, M.K.; Pradeep, Ratna; Datta, D.; Bhatnagar, Amit

    2016-01-01

    Personnel monitoring for external radiation using CaSO 4 :Dy based TLD badge is well established in Indian radiation protection program. TLD badge enables evaluation of occupational dose based on the pattern and values of the three disc readings. Different patterns of disc readings are obtained depending on the type and energy of radiation in the workplace. Pattern not conforming to the radiation in the workplace also called as improper pattern can be a useful tool for investigation of any deviation / abnormality in workplace or monitoring practices. The paper presents different examples of improper pattern observed in monitoring that has helped to find out the deviations in the workplace or monitoring practices. Results of the experiments conducted to simulate some of the observed pattern are also presented in the paper

  2. Mechanical and mechanobiological influences on bone fracture repair : identifying important cellular characteristics

    NARCIS (Netherlands)

    Isaksson, H.E.

    2007-01-01

    Fracture repair is a complex and multifactorial process, which involves a well-programmed series of cellular and molecular events that result in a combination of intramembranous and endochondral bone formation. The vast majority of fractures is treated successfully. They heal through ‘secondary

  3. Population pharmacokinetic analysis of oxaliplatin in adults and children identifies important covariates for dosing.

    Science.gov (United States)

    Nikanjam, Mina; Stewart, Clinton F; Takimoto, Chris H; Synold, Timothy W; Beaty, Orren; Fouladi, Maryam; Capparelli, Edmund V

    2015-03-01

    To characterize the determinants of variability for oxaliplatin pharmacokinetics including age, renal function, and hepatic function in children and adults. Oxaliplatin pharmacokinetic data were combined from phase I and II clinical trials: three pediatric trials (Peds1-3) and two adult NCI organ dysfunction studies (Hepatic and Renal). A population pharmacokinetic model was developed utilizing platinum ultrafiltrate concentrations to characterize changes in oxaliplatin disposition with age and organ dysfunction along with other potential sources of oxaliplatin pharmacokinetic variability. A total of 1,508 concentrations from 186 children and adults were used in the study. The data were well described by a three-compartment model. Serum creatinine (SCR) was an independent predictor of clearance (CL) while age was an independent predictor of volume of distribution. Although age was a significant covariate on CL in the univariate analysis, age effects on CL were entirely accounted for by SCR. Gender, hepatic function, and race had no effect on CL or volume of distribution. Median CL values were 0.58 (Hepatic), 0.34 (Renal), 0.78 (Peds1), 0.74 (Peds2), and 0.81 (Peds3) (L/h/kg(0.75)). Monte Carlo simulations of the final model with 130 mg/m(2) yielded median AUC values of: 14.2 (2-6 years), 16.8 (6-12 years), 16.5 (12-18 years), and 17.3 (>18 years) (µg h/mL). Renal function had the greatest effect on CL with a small age effect seen on the distribution of oxaliplatin. Young pediatric patients had higher CL values than adults as a result of better renal function.

  4. Identifying Computer-Generated Portraits: The Importance of Training and Incentives.

    Science.gov (United States)

    Mader, Brandon; Banks, Martin S; Farid, Hany

    2017-09-01

    The past two decades have seen remarkable advances in photo-realistic rendering of everything from inanimate objects to landscapes, animals, and humans. We previously showed that despite these tremendous advances, human observers remain fairly good at distinguishing computer-generated from photographic images. Building on these results, we describe a series of follow-up experiments that reveal how to improve observer performance. Of general interest to anyone performing psychophysical studies on Mechanical Turk or similar platforms, we find that observer performance can be significantly improved with the proper incentives.

  5. Overfat Adults and Children in Developed Countries: The Public Health Importance of Identifying Excess Body Fat

    Directory of Open Access Journals (Sweden)

    Philip B. Maffetone

    2017-07-01

    Full Text Available The global overfat pandemic is a serious public health crisis that places a substantial burden on economic resources in developed countries. The term overfat refers to the presence of excess body fat that can impair health, even for normal weight non-obese individuals. Excess body fat is associated with cardiometabolic dysfunction, a clinical situation that can progressively worsen, potentially leading to various common disease risk factors, chronic diseases, increased morbidity and mortality, and reduced quality of life. The prevalence of overfat populations in 30 of the world’s most developed countries is substantially higher than recent global estimations, with the largest growth due to a relatively recent increased number of people with excess abdominal fat. Abdominal overfat is the most unhealthful form of this condition, so it is concerning that average waist circumference measures, generally indicative of abdominal overfat, have increased. Despite a leveling off appearance of being overweight and/or obese in some developed countries, the overfat pandemic continues to grow.

  6. Timetable Attractiveness Parameters

    DEFF Research Database (Denmark)

    Schittenhelm, Bernd

    2008-01-01

    Timetable attractiveness is influenced by a set of key parameters that are described in this article. Regarding the superior structure of the timetable, the trend in Europe goes towards periodic regular interval timetables. Regular departures and focus on optimal transfer possibilities make...... these timetables attractive. The travel time in the timetable depends on the characteristics of the infrastructure and rolling stock, the heterogeneity of the planned train traffic and the necessary number of transfers on the passenger’s journey. Planned interdependencies between trains, such as transfers...... and heterogeneous traffic, add complexity to the timetable. The risk of spreading initial delays to other trains and parts of the network increases with the level of timetable complexity....

  7. Parameter measurement of target

    International Nuclear Information System (INIS)

    Gao Dangzhong

    2001-01-01

    The progress of parameter measurement of target (ICF-15) in 1999 are presented, including the design and contract of the microsphere equator profiler, the precise air bearing manufacturing, high-resolution X-ray image of multi-layer shells and the X-ray photos processed with special image and data software, some plastic shells measured in precision of 0.3 μm, the high-resolution observation and photograph system of 'dew-point method', special fixture of target and its temperature distribution measuring, the dew-point temperature and fuel gas pressure of shells measuring with internal pressure of 5 - 15 (x10 5 ) Pa D 2 and wall thickness of 1.5∼3 μm

  8. Safety Parameters Graphical Interface

    International Nuclear Information System (INIS)

    Canamero, B.

    1998-01-01

    Nuclear power plant data are received at the Operations Center of the Consejo de Seguridad Nuclear in emergency situations. In order to achieve the required interface and to prepare those data to perform simulation and forecasting with already existing computer codes a Safety Parameters Graphical Interface (IGPS) has been developed. The system runs in a UNIX environment and use the Xwindows capabilities. The received data are stored in such a way that it can be easily used for further analysis and training activities. The system consists of task-oriented modules (processes) which communicate each other using well known UNIX mechanisms (signals, sockets and shared memory segments). IGPS conceptually have two different parts: Data collection and preparation, and Data monitorization. (Author)

  9. varying elastic parameters distributions

    KAUST Repository

    Moussawi, Ali

    2014-12-01

    The experimental identication of mechanical properties is crucial in mechanics for understanding material behavior and for the development of numerical models. Classical identi cation procedures employ standard shaped specimens, assume that the mechanical elds in the object are homogeneous, and recover global properties. Thus, multiple tests are required for full characterization of a heterogeneous object, leading to a time consuming and costly process. The development of non-contact, full- eld measurement techniques from which complex kinematic elds can be recorded has opened the door to a new way of thinking. From the identi cation point of view, suitable methods can be used to process these complex kinematic elds in order to recover multiple spatially varying parameters through one test or a few tests. The requirement is the development of identi cation techniques that can process these complex experimental data. This thesis introduces a novel identi cation technique called the constitutive compatibility method. The key idea is to de ne stresses as compatible with the observed kinematic eld through the chosen class of constitutive equation, making possible the uncoupling of the identi cation of stress from the identi cation of the material parameters. This uncoupling leads to parametrized solutions in cases where 5 the solution is non-unique (due to unknown traction boundary conditions) as demonstrated on 2D numerical examples. First the theory is outlined and the method is demonstrated in 2D applications. Second, the method is implemented within a domain decomposition framework in order to reduce the cost for processing very large problems. Finally, it is extended to 3D numerical examples. Promising results are shown for 2D and 3D problems.

  10. Aircraft parameter estimation

    Indian Academy of Sciences (India)

    With the evolution of high performance modern aircraft and spiraling developmental and experimental costs, the importance of flight validated databases for flight control design applications and for flight simulators has increased significantly in the recent past. Ground-based and in-flight simulators are increasingly used not ...

  11. Parameter identification and global sensitivity analysis of Xin'anjiang model using meta-modeling approach

    Directory of Open Access Journals (Sweden)

    Xiao-meng Song

    2013-01-01

    Full Text Available Parameter identification, model calibration, and uncertainty quantification are important steps in the model-building process, and are necessary for obtaining credible results and valuable information. Sensitivity analysis of hydrological model is a key step in model uncertainty quantification, which can identify the dominant parameters, reduce the model calibration uncertainty, and enhance the model optimization efficiency. There are, however, some shortcomings in classical approaches, including the long duration of time and high computation cost required to quantitatively assess the sensitivity of a multiple-parameter hydrological model. For this reason, a two-step statistical evaluation framework using global techniques is presented. It is based on (1 a screening method (Morris for qualitative ranking of parameters, and (2 a variance-based method integrated with a meta-model for quantitative sensitivity analysis, i.e., the Sobol method integrated with the response surface model (RSMSobol. First, the Morris screening method was used to qualitatively identify the parameters' sensitivity, and then ten parameters were selected to quantify the sensitivity indices. Subsequently, the RSMSobol method was used to quantify the sensitivity, i.e., the first-order and total sensitivity indices based on the response surface model (RSM were calculated. The RSMSobol method can not only quantify the sensitivity, but also reduce the computational cost, with good accuracy compared to the classical approaches. This approach will be effective and reliable in the global sensitivity analysis of a complex large-scale distributed hydrological model.

  12. A new qualitative acoustic emission parameter based on Shannon's entropy for damage monitoring

    Science.gov (United States)

    Chai, Mengyu; Zhang, Zaoxiao; Duan, Quan

    2018-02-01

    An important objective of acoustic emission (AE) non-destructive monitoring is to accurately identify approaching critical damage and to avoid premature failure by means of the evolutions of AE parameters. One major drawback of most parameters such as count and rise time is that they are strongly dependent on the threshold and other settings employed in AE data acquisition system. This may hinder the correct reflection of original waveform generated from AE sources and consequently bring difficulty for the accurate identification of the critical damage and early failure. In this investigation, a new qualitative AE parameter based on Shannon's entropy, i.e. AE entropy is proposed for damage monitoring. Since it derives from the uncertainty of amplitude distribution of each AE waveform, it is independent of the threshold and other time-driven parameters and can characterize the original micro-structural deformations. Fatigue crack growth test on CrMoV steel and three point bending test on a ductile material are conducted to validate the feasibility and effectiveness of the proposed parameter. The results show that the new parameter, compared to AE amplitude, is more effective in discriminating the different damage stages and identifying the critical damage.

  13. On the identification of behavior laws parameters of argillaceous rocks

    International Nuclear Information System (INIS)

    Lecampion, Brice

    2002-01-01

    This work aims to develop methods for identification of constitutive parameters of argillaceous rocks. Under the proposed underground research laboratory of the ANDRA, it is necessary to develop such methods for the interpretation of many steps to be performed on site. We focused on two major aspects of the rheological behavior of this type of rock: poro-elastic behavior on the one hand and the elasto-viscoplastic other. The first part focuses on the identification of poro-elastic parameters. Chapter 2 refers to the direct problem and discusses a number of important points concerning the inverse problem of identification. The third chapter is dedicated to the formulation of techniques for calculating gradient for linear poro-elastic case. The numerical finite element is discussed. The methods of direct differentiation and adjoint state are validated on a two-dimensional numerical example using the code of finite element Cast3M. Identification of poro-elastic coefficients argillaceous rocks of the Meuse Haute-Marne from laboratory tests is discussed in detail in Chapter 4. The use of semi-explicit approximate solution of problems provides a direct method for quick identification. The second part of the dissertation on the identification of elasto-viscoplastic parameters. The features of visco-plastic behaviours argillaceous rocks Meuse Haute-Marne are discussed in Chapter 5 on the basis of experimental results. Modeling this behavior is considered. It proposes a model isotropic nonlinear viscoplastic strain hardening to duplicate tests. The parameters of this law of behavior are identified on a creep test unidimensional drained conditions. The deformations arise when poro-elastic and viscoplastic behavior of the rock. We show that it is possible to separate these two phenomena. All parameters are identified poro-elastic viscoplastic, a semi-explicit solution of the creep test is used. Chapter 6 presents a method for identifying parameters elasto-viscoplastic in the

  14. Estimativas de parâmetros e tendências genéticas para algumas características de importância econômica em linhagem paterna de frangos de corte sob seleção Estimates of genetic parameters and trends for performance traits in paternal broiler lineages under selection

    Directory of Open Access Journals (Sweden)

    Stela Adami Vayego

    2008-07-01

    Full Text Available Estimativas dos parâmetros genéticos e fenotípicos de algumas características produtivas em linhagem paterna de matrizes de frango de corte foram obtidas utilizando-se a metodologia de modelos mistos. Utilizaram-se dados de aproximadamente 46.000 aves, originados de 12 gerações no período de 1992 a 2003, fornecidos pela EMBRAPA Suínos e aves. Nos machos foram avaliadas as características peso corporal aos 42 dias de idade (P42, comprimento de peito (CPeito, largura maior do peito (Larg1 e largura menor do peito (Larg2 aos 42 dias de idade. Os componentes de variância e co-variância foram estimados utilizando-se o programa DFREML. As estimativas de herdabilidade obtidas foram moderadas e variaram de 0,29 a 0,53. As correlações genéticas foram: 0,68 entre P42 e CPeito; 0,65 entre P42 e Larg1; 0,48 entre P42 e Larg2. O estudo da tendência genética das características indicou que progresso genético está sendo obtido.Estimates of genetic and phenotypic parameters for performance traits in paternal broiler lineages selected during 12 generations were obtained through mixed models methodology. Data consisting of body weight (P42, breast length (CPeito, largest (Larg1 and smallest (Larg2 breast widths recorded at 42 days of age in approximately 46,000 birds between 1992 and 2003 provided by CNPSA/EMBRAPA were used to estimate (covariances by REML. The heritability estimates were moderate, ranging from 0.29 to 0.53. Genetic correlations estimates between P42 and CPeito, Larg1 and Larg2 were 0.68, 0.65 and 0.48 respectively. Genetic trend estimates indicate that progress has been obtained by selection on the performance traits.

  15. The influence of source term release parameters on health effects

    International Nuclear Information System (INIS)

    Jeong, Jong Tae; Ha, Jae Joo

    1998-08-01

    In this study, the influence of source term release parameters on the health effects was examined. This is very useful in identifying the relative importance of release parameters and can be an important factor in developing a strategy for reducing offsite risks. The release parameters investigated in this study are release height, heat content, fuel burnup, release time, release duration, and warning time. The health effects affected by the change of release parameters are early fatalities, cancer fatalities, early injuries, cancer injuries, early fatality risk, population weighted early fatality risk, population weighted cancer fatality risk, effective whole body population dose, population exceeding an early acute red bone marrow dose of 1.5 Sv, and distance at which early fatalities are expected to occur. As release height increases, the values of early health effects such as early fatalities and injuries decrease. However, the release height dose not have significant influences on late health effects. The values of both early and late health effects decrease as heat content increases. The increase fuel burnup, i.e., the increase of core inventories increases the late health effects, however, has small influence on the early health effects. But, the number of early injuries increases as the fuel burnup increases. The effects of release time increase shows very similar influence on both the early and late health effects. As the release time increases to 2 hours, the values of health effects increase and then decrease rapidly. As release duration increases, the values of late health effects increase slightly, however, the values of early health effects decrease. As warning time increases to 2 hours, the values of late health effects decrease and then shows no variation. The number of early injuries decreases rapidly as the warning time increases to 2 hours. However, the number of early fatalities and the early fatality risk increase as the warning time increases

  16. Hardrock Elastic Physical Properties: Birch's Seismic Parameter Revisited

    Science.gov (United States)

    Wu, M.; Milkereit, B.

    2014-12-01

    Identifying rock composition and properties is imperative in a variety of fields including geotechnical engineering, mining, and petroleum exploration, in order to accurately make any petrophysical calculations. Density is, in particular, an important parameter that allows us to differentiate between lithologies and estimate or calculate other petrophysical properties. It is well established that compressional and shear wave velocities of common crystalline rocks increase with increasing densities (i.e. the Birch and Nafe-Drake relationships). Conventional empirical relations do not take into account S-wave velocity. Physical properties of Fe-oxides and massive sulfides, however, differ significantly from the empirical velocity-density relationships. Currently, acquiring in-situ density data is challenging and problematic, and therefore, developing an approximation for density based on seismic wave velocity and elastic moduli would be beneficial. With the goal of finding other possible or better relationships between density and the elastic moduli, a database of density, P-wave velocity, S-wave velocity, bulk modulus, shear modulus, Young's modulus, and Poisson's ratio was compiled based on a multitude of lab samples. The database is comprised of isotropic, non-porous metamorphic rock. Multi-parameter cross plots of the various elastic parameters have been analyzed in order to find a suitable parameter combination that reduces high density outliers. As expected, the P-wave velocity to S-wave velocity ratios show no correlation with density. However, Birch's seismic parameter, along with the bulk modulus, shows promise in providing a link between observed compressional and shear wave velocities and rock densities, including massive sulfides and Fe-oxides.

  17. Utilising temperature differences as constraints for estimating parameters in a simple climate model

    International Nuclear Information System (INIS)

    Bodman, Roger W; Karoly, David J; Enting, Ian G

    2010-01-01

    Simple climate models can be used to estimate the global temperature response to increasing greenhouse gases. Changes in the energy balance of the global climate system are represented by equations that necessitate the use of uncertain parameters. The values of these parameters can be estimated from historical observations, model testing, and tuning to more complex models. Efforts have been made at estimating the possible ranges for these parameters. This study continues this process, but demonstrates two new constraints. Previous studies have shown that land-ocean temperature differences are only weakly correlated with global mean temperature for natural internal climate variations. Hence, these temperature differences provide additional information that can be used to help constrain model parameters. In addition, an ocean heat content ratio can also provide a further constraint. A pulse response technique was used to identify relative parameter sensitivity which confirmed the importance of climate sensitivity and ocean vertical diffusivity, but the land-ocean warming ratio and the land-ocean heat exchange coefficient were also found to be important. Experiments demonstrate the utility of the land-ocean temperature difference and ocean heat content ratio for setting parameter values. This work is based on investigations with MAGICC (Model for the Assessment of Greenhouse-gas Induced Climate Change) as the simple climate model.

  18. Multiplicity distributions in impact parameter space

    International Nuclear Information System (INIS)

    Wakano, Masami

    1976-01-01

    A definition for the average multiplicity of pions as a function of momentum transfer and total energy in the high energy proton-proton collisions is proposed by using the n-pion production differential cross section with the given momentum transfer from a proton to other final products and the given energy of the latter. Contributions from nondiffractive and diffractive processes are formulated in a multi-Regge model. We define a relationship between impact parameter and momentum transfer in the sense of classical theory for inelastic processes and we obtain the average multiplicity of pions as a function of impact parameter and total energy from the corresponding quantity afore-mentioned. By comparing this quantity with the square root of the opaqueness at given impact parameter, we conclude that the overlap of localized constituents is important in determining the opaqueness at given impact parameter in a collision of two hadrons. (auth.)

  19. Assessing Reliability of Cellulose Hydrolysis Models to Support Biofuel Process Design – Identifiability and Uncertainty Analysis

    DEFF Research Database (Denmark)

    Sin, Gürkan; Meyer, Anne S.; Gernaey, Krist

    2010-01-01

    The reliability of cellulose hydrolysis models is studied using the NREL model. An identifiability analysis revealed that only 6 out of 26 parameters are identifiable from the available data (typical hydrolysis experiments). Attempting to identify a higher number of parameters (as done in the ori......The reliability of cellulose hydrolysis models is studied using the NREL model. An identifiability analysis revealed that only 6 out of 26 parameters are identifiable from the available data (typical hydrolysis experiments). Attempting to identify a higher number of parameters (as done...

  20. Perceived cultural importance and actual self-importance of values in cultural identification.

    Science.gov (United States)

    Wan, Ching; Chiu, Chi-yue; Tam, Kim-pong; Lee, Sau-lai; Lau, Ivy Yee-man; Peng, Siqing

    2007-02-01

    Cross-cultural psychologists assume that core cultural values define to a large extent what a culture is. Typically, core values are identified through an actual self-importance approach, in which core values are those that members of the culture as a group strongly endorse. In this article, the authors propose a perceived cultural importance approach to identifying core values, in which core values are values that members of the culture as a group generally believe to be important in the culture. In 5 studies, the authors examine the utility of the perceived cultural importance approach. Results consistently showed that, compared with values of high actual self-importance, values of high perceived cultural importance play a more important role in cultural identification. These findings have important implications for conceptualizing and measuring cultures. ((c) 2007 APA, all rights reserved).

  1. Environmental Transport Input Parameters for the Biosphere Model

    International Nuclear Information System (INIS)

    Wasiolek, M. A.

    2003-01-01

    This analysis report is one of the technical reports documenting the Environmental Radiation Model for Yucca Mountain Nevada (ERMYN), a biosphere model supporting the total system performance assessment (TSPA) for the geologic repository at Yucca Mountain. A graphical representation of the documentation hierarchy for the ERMYN is presented in Figure 1-1. This figure shows relationships among the reports developed for biosphere modeling and biosphere abstraction products for the TSPA, as identified in the ''Technical Work Plan: for Biosphere Modeling and Expert Support'' (TWP) (BSC 2003 [163602]). Some documents in Figure 1-1 may be under development and not available when this report is issued. This figure provides an understanding of how this report contributes to biosphere modeling in support of the license application (LA), but access to the listed documents is not required to understand the contents of this report. This report is one of the reports that develops input parameter values for the biosphere model. The ''Biosphere Model Report'' (BSC 2003 [160699]) describes the conceptual model, the mathematical model, and the input parameters. The purpose of this analysis is to develop biosphere model parameter values related to radionuclide transport and accumulation in the environment. These parameters support calculations of radionuclide concentrations in the environmental media (e.g., soil, crops, animal products, and air) resulting from a given radionuclide concentration at the source of contamination (i.e., either in groundwater or volcanic ash). The analysis was performed in accordance with the TWP (BSC 2003 [163602]). This analysis develops values of parameters associated with many features, events, and processes (FEPs) applicable to the reference biosphere (DTN: M00303SEPFEPS2.000 [162452]), which are addressed in the biosphere model (BSC 2003 [160699]). The treatment of these FEPs is described in BSC (2003 [160699], Section 6.2). Parameter values

  2. Environmental Transport Input Parameters for the Biosphere Model

    Energy Technology Data Exchange (ETDEWEB)

    M. A. Wasiolek

    2003-06-27

    This analysis report is one of the technical reports documenting the Environmental Radiation Model for Yucca Mountain Nevada (ERMYN), a biosphere model supporting the total system performance assessment (TSPA) for the geologic repository at Yucca Mountain. A graphical representation of the documentation hierarchy for the ERMYN is presented in Figure 1-1. This figure shows relationships among the reports developed for biosphere modeling and biosphere abstraction products for the TSPA, as identified in the ''Technical Work Plan: for Biosphere Modeling and Expert Support'' (TWP) (BSC 2003 [163602]). Some documents in Figure 1-1 may be under development and not available when this report is issued. This figure provides an understanding of how this report contributes to biosphere modeling in support of the license application (LA), but access to the listed documents is not required to understand the contents of this report. This report is one of the reports that develops input parameter values for the biosphere model. The ''Biosphere Model Report'' (BSC 2003 [160699]) describes the conceptual model, the mathematical model, and the input parameters. The purpose of this analysis is to develop biosphere model parameter values related to radionuclide transport and accumulation in the environment. These parameters support calculations of radionuclide concentrations in the environmental media (e.g., soil, crops, animal products, and air) resulting from a given radionuclide concentration at the source of contamination (i.e., either in groundwater or volcanic ash). The analysis was performed in accordance with the TWP (BSC 2003 [163602]). This analysis develops values of parameters associated with many features, events, and processes (FEPs) applicable to the reference biosphere (DTN: M00303SEPFEPS2.000 [162452]), which are addressed in the biosphere model (BSC 2003 [160699]). The treatment of these FEPs is described in BSC (2003 [160699

  3. Identifying ELIXIR Core Data Resources.

    Science.gov (United States)

    Durinx, Christine; McEntyre, Jo; Appel, Ron; Apweiler, Rolf; Barlow, Mary; Blomberg, Niklas; Cook, Chuck; Gasteiger, Elisabeth; Kim, Jee-Hyub; Lopez, Rodrigo; Redaschi, Nicole; Stockinger, Heinz; Teixeira, Daniel; Valencia, Alfonso

    2016-01-01

    The core mission of ELIXIR is to build a stable and sustainable infrastructure for biological information across Europe. At the heart of this are the data resources, tools and services that ELIXIR offers to the life-sciences community, providing stable and sustainable access to biological data. ELIXIR aims to ensure that these resources are available long-term and that the life-cycles of these resources are managed such that they support the scientific needs of the life-sciences, including biological research. ELIXIR Core Data Resources are defined as a set of European data resources that are of fundamental importance to the wider life-science community and the long-term preservation of biological data. They are complete collections of generic value to life-science, are considered an authority in their field with respect to one or more characteristics, and show high levels of scientific quality and service. Thus, ELIXIR Core Data Resources are of wide applicability and usage. This paper describes the structures, governance and processes that support the identification and evaluation of ELIXIR Core Data Resources. It identifies key indicators which reflect the essence of the definition of an ELIXIR Core Data Resource and support the promotion of excellence in resource development and operation. It describes the specific indicators in more detail and explains their application within ELIXIR's sustainability strategy and science policy actions, and in capacity building, life-cycle management and technical actions. The identification process is currently being implemented and tested for the first time. The findings and outcome will be evaluated by the ELIXIR Scientific Advisory Board in March 2017. Establishing the portfolio of ELIXIR Core Data Resources and ELIXIR Services is a key priority for ELIXIR and publicly marks the transition towards a cohesive infrastructure.

  4. Exploration of DGVM Parameter Solution Space Using Simulated Annealing: Implications for Forecast Uncertainties

    Science.gov (United States)

    Wells, J. R.; Kim, J. B.

    2011-12-01

    multiple acceptable parameter sets exist. Further we expect to demonstrate that the multiple parameter sets produce significantly divergent future forecasts in NEP, C storage, and ET and runoff; and thereby identify a highly important source of DGVM uncertainty

  5. Parameter Estimation and Sensitivity Analysis of an Urban Surface Energy Balance Parameterization at a Tropical Suburban Site

    Science.gov (United States)

    Harshan, S.; Roth, M.; Velasco, E.

    2014-12-01

    Forecasting of the urban weather and climate is of great importance as our cities become more populated and considering the combined effects of global warming and local land use changes which make urban inhabitants more vulnerable to e.g. heat waves and flash floods. In meso/global scale models, urban parameterization schemes are used to represent the urban effects. However, these schemes require a large set of input parameters related to urban morphological and thermal properties. Obtaining all these parameters through direct measurements are usually not feasible. A number of studies have reported on parameter estimation and sensitivity analysis to adjust and determine the most influential parameters for land surface schemes in non-urban areas. Similar work for urban areas is scarce, in particular studies on urban parameterization schemes in tropical cities have so far not been reported. In order to address above issues, the town energy balance (TEB) urban parameterization scheme (part of the SURFEX land surface modeling system) was subjected to a sensitivity and optimization/parameter estimation experiment at a suburban site in, tropical Singapore. The sensitivity analysis was carried out as a screening test to identify the most sensitive or influential parameters. Thereafter, an optimization/parameter estimation experiment was performed to calibrate the input parameter. The sensitivity experiment was based on the "improved Sobol's global variance decomposition method" . The analysis showed that parameters related to road, roof and soil moisture have significant influence on the performance of the model. The optimization/parameter estimation experiment was performed using the AMALGM (a multi-algorithm genetically adaptive multi-objective method) evolutionary algorithm. The experiment showed a remarkable improvement compared to the simulations using the default parameter set. The calibrated parameters from this optimization experiment can be used for further model

  6. Monogenic functions with parameters in Clifford analysis

    International Nuclear Information System (INIS)

    Le Hung Son.

    1990-02-01

    In this paper we study some properties of monogenic functions taking values in a Clifford algebra and depending on several parameters. It is proved that the Hartogs extension theorems are valid for these functions and for the multi-monogenic functions, which contain solutions of many important systems of partial differential equations in Theoretical Physics. (author). 4 refs

  7. Important radionuclides and their sensitivity for groundwater pathway of a hypothetical near-surface disposal facility

    Energy Technology Data Exchange (ETDEWEB)

    Park, J. W.; Chang, K.; Kim, C. L. [Nuclear Enviroment Technology Institute, Taejon (Korea, Republic of)

    2001-04-01

    A radiological safety assessment was performed for a hypothetical near-surface radioactive waste repository as a simple screening calculation to identify important nuclides and to provide insights on the data needs for a successful demonstration of compliance. Individual effective doses were calculated for a conservative groundwater pathway scenario considering well drilling near the site boundary. Sensitivity of resulting ingestion dose to input parameter values was also analyzed using Monte Carlo sampling. Considering peak dose rate and assessment timescale, C-14 and I-129 were identified as important nuclides and U-235 and U-238 as potentially important nuclides. For C-14, the does was most sensitive to Darcy velocity in aquifer. The distribution coefficient showed high degree of sensitivity for I-129 release.

  8. Important radionuclides and their sensitivity for groundwater pathway of a hypothetical near-surface disposal facility

    International Nuclear Information System (INIS)

    Park, J. W.; Chang, K.; Kim, C. L.

    2001-01-01

    A radiological safety assessment was performed for a hypothetical near-surface radioactive waste repository as a simple screening calculation to identify important nuclides and to provide insights on the data needs for a successful demonstration of compliance. Individual effective doses were calculated for a conservative groundwater pathway scenario considering well drilling near the site boundary. Sensitivity of resulting ingestion dose to input parameter values was also analyzed using Monte Carlo sampling. Considering peak dose rate and assessment timescale, C-14 and I-129 were identified as important nuclides and U-235 and U-238 as potentially important nuclides. For C-14, the does was most sensitive to Darcy velocity in aquifer. The distribution coefficient showed high degree of sensitivity for I-129 release

  9. Algorithm sensitivity analysis and parameter tuning for tissue image segmentation pipelines

    Science.gov (United States)

    Kurç, Tahsin M.; Taveira, Luís F. R.; Melo, Alba C. M. A.; Gao, Yi; Kong, Jun; Saltz, Joel H.

    2017-01-01

    Abstract Motivation: Sensitivity analysis and parameter tuning are important processes in large-scale image analysis. They are very costly because the image analysis workflows are required to be executed several times to systematically correlate output variations with parameter changes or to tune parameters. An integrated solution with minimum user interaction that uses effective methodologies and high performance computing is required to scale these studies to large imaging datasets and expensive analysis workflows. Results: The experiments with two segmentation workflows show that the proposed approach can (i) quickly identify and prune parameters that are non-influential; (ii) search a small fraction (about 100 points) of the parameter search space with billions to trillions of points and improve the quality of segmentation results (Dice and Jaccard metrics) by as much as 1.42× compared to the results from the default parameters; (iii) attain good scalability on a high performance cluster with several effective optimizations. Conclusions: Our work demonstrates the feasibility of performing sensitivity analyses, parameter studies and auto-tuning with large datasets. The proposed framework can enable the quantification of error estimations and output variations in image segmentation pipelines. Availability and Implementation: Source code: https://github.com/SBU-BMI/region-templates/. Contact: teodoro@unb.br Supplementary information: Supplementary data are available at Bioinformatics online. PMID:28062445

  10. Development of Parameter Network for Accident Management Applications

    Energy Technology Data Exchange (ETDEWEB)

    Pak, Sukyoung; Ahemd, Rizwan; Heo, Gyunyoung [Kyung Hee Univ., Yongin (Korea, Republic of); Kim, Jung Taek; Park, Soo Yong; Ahn, Kwang Il [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of)

    2013-10-15

    When a severe accident happens, it is hard to obtain the necessary information to understand of internal status because of the failure or damage of instrumentation and control systems. We learned the lessons from Fukushima accident that internal instrumentation system should be secured and must have ability to react in serious conditions. While there might be a number of methods to reinforce the integrity of instrumentation systems, we focused on the use of redundant behavior of plant parameters without additional hardware installation. Specifically, the objective of this study is to estimate the replaced value which is able to identify internal status by using set of available signals when it is impossible to use instrumentation information in a severe accident, which is the continuation of the paper which was submitted at the last KNS meeting. The concept of the VPN was suggested to improve the quality of parameters particularly to be logged during severe accidents in NPPs using a software based approach, and quantize the importance of each parameter for further maintenance. In the future, we will continue to perform the same analysis to other accident scenarios and extend the spectrum of initial conditions so that we are able to get more sets of VPNs and ANN models to predict the behavior of accident scenarios. The suggested method has the uncertainty underlain in the analysis code for severe accidents. However, In case of failure to the safety critical instrumentation, the information from the VPN would be available to carry out safety management operation.

  11. Mathematical determination of setup parameters for carcinoma breast cases

    International Nuclear Information System (INIS)

    Prasad, P.B.L.D.; Suresh, P.; Sridhar, A.

    2008-01-01

    Determining proper patient set up parameters like IFD, Gantry angles and field width in Ca Breast are prime important to achieve precise treatment. In a center where 3D Treatment Planning Systems (TPS) and simulator are not available to determine the set up parameters, contouring of target region is essential which is time consuming. The mathematical formula described here provides instant patient set up parameters using machine parameters. (author)

  12. Optimization of surface roughness parameters in dry turning

    OpenAIRE

    R.A. Mahdavinejad; H. Sharifi Bidgoli

    2009-01-01

    Purpose: The precision of machine tools on one hand and the input setup parameters on the other hand, are strongly influenced in main output machining parameters such as stock removal, toll wear ratio and surface roughnes.Design/methodology/approach: There are a lot of input parameters which are effective in the variations of these output parameters. In CNC machines, the optimization of machining process in order to predict surface roughness is very important.Findings: From this point of view...

  13. Tables of nuclear level density parameters

    International Nuclear Information System (INIS)

    Chatterjee, A.; Ghosh, S.K.; Majumdar, H.

    1976-03-01

    The Renormalized Gas Model (RGM) has been used to calculate single particle level density parameters for more than 2000 nucleides over the range 9<=Z<=126 (15<=A<=338). Three separate tables present the elements on or near the valley of beta stability, neutron-rich fission fragment nucleides, and transitional nuclei, actinides and light-mass super heavy elements. Each table identifies the nucleus in terms of Z and N and presents the RGM deformation energy of binding, the total RGM structural energy correction over the free gas Fermi surface, and the level density parameter

  14. Uncertainties of Molecular Structural Parameters

    International Nuclear Information System (INIS)

    Császár, Attila G.

    2014-01-01

    performed. Simply, there are significant disagreements between the same bond lengths measured by different techniques. These disagreements are, however, systematic and can be computed via techniques of quantum chemistry which deal not only with the motions of the electrons (electronic structure theory) but also with the often large amplitude motions of the nuclei. As to the relevant quantum chemical computations, since about 1970 electronic structure theory has become able to make quantitative predictions and thus challenge (or even overrule) many experiments. Nevertheless, quantitative agreement of quantum chemical results with experiment can only be expected when the motions of the atoms are also considered. In the fourth age of quantum chemistry we are living in an era where one can bridge quantitatively the gap between ‘effective’, experimental and ‘equilibrium’, computed structures at even elevated temperatures of interest thus minimizing any real uncertainties of structural parameters. The connections mentioned are extremely important as they help to understand the true uncertainty of measured structural parameters. Traditionally it is microwave (MW) and millimeterwave (MMW) spectroscopy, as well as gas-phase electron diffraction (GED), which yielded the most accurate structural parameters of molecules. The accuracy of the MW and GED experiments approached about 0.001Å and 0.1º under ideal circumstances, worse, sometimes considerably worse, in less than ideal and much more often encountered situations. Quantum chemistry can define both highly accurate equilibrium (so-called Born-Oppenheimer, r_e"B"O, and semiexperimental, r_e"S"E) structures and, via detailed investigation of molecular motions, accurate temperature-dependent rovibrationally averaged structures. Determining structures is still a rich field for research, understanding the measured or computed uncertainties of structures and structural parameters is still a challenge but there are firm and well

  15. AND/OR Importance Sampling

    OpenAIRE

    Gogate, Vibhav; Dechter, Rina

    2012-01-01

    The paper introduces AND/OR importance sampling for probabilistic graphical models. In contrast to importance sampling, AND/OR importance sampling caches samples in the AND/OR space and then extracts a new sample mean from the stored samples. We prove that AND/OR importance sampling may have lower variance than importance sampling; thereby providing a theoretical justification for preferring it over importance sampling. Our empirical evaluation demonstrates that AND/OR importance sampling is ...

  16. A new importance measure for risk-informed decision making

    International Nuclear Information System (INIS)

    Borgonovo, E.; Apostolakis, G.E.

    2000-01-01

    Recently, several authors pointed out that the traditional importance measures had limitations. In this study, the problem through an analysis at the parameter level was investigated and a new measure was introduced. The measure was based on small parameter variations and is capable of accounting for the importance of a group of components/parameters. The definition, computational steps, and an application of a new importance measure for risk-informed decision making were presented here. Unlike traditional importance measures, differential importance measure (DIM) deals with changes in the various parameters that determine the unavailability/unreliability of a component, e.g., failure rates, common-cause failure rates, individual human errors. The importance of the component unavailability/unreliability can be calculated from the importance of the parameters. DIM can be calculated for the frequency of initiating events, while risk achievement worth (RAW) is limited to binary events, e.g., component unavailability. The changes in parameters are 'small'. This is more realistic than the drastic assumption in RAW that the component is always down. DIM is additive. This allows the evaluation of the impact of changes, such as the relaxation of quality assurance requirements, which affect groups of parameters, e.g., the failure rates of a group of pumps. (M.N.)

  17. Identification of sex using lateral cephalogram: Role of cephalofacial parameters

    Directory of Open Access Journals (Sweden)

    Almas Binnal

    2012-01-01

    Full Text Available Introduction: Recognition of sex is an important aspect of identification of an individual. Apart from pelvis, skull exhibits highest sexual dimorphism in the human body- Lateral cephalograms are an invaluable tool in identification of sex as they reveal architectural and morphological details of the skull on a single radiograph- The equipment required for lateral cephalometry is readily available and the technique is cost-effective, easy to perform, offers quick results, reproducible and can be implemented in any special training for the forensic examiner. The present study was undertaken to evaluate the role of lateral cephalograms and the nine cephalometric variables in the identification of sex and also to derive a discriminant function equation for identification of sex. Materials and methods: A total of 100 lateral cephalograms were taken of 50 male and 50 female subjects aged between 25 and 54 years belonging to South Indian population. The nine derived cephabmetnc parameters were used to arrive at a discriminant function equation which was further assessed for its reliability among the study subjects. Results: Among nine cephalometric parameters used, seven were reliable in the identification of sex. The derived discriminant function equation accurately identified 88% of the male study subjects as males and 84% of the female subjects as females. Conclusion: The lateral cephalograms and the nine cephalometric variables employed in the study are simple and reliable tools of sexual discrimination. The derived discriminant functional equation can be used to accurately identify sex of an individual belonging to South Indian population

  18. Evaluations and utilizations of risk importances

    International Nuclear Information System (INIS)

    Vesely, W.E.; Davis, T.C.

    1985-08-01

    This report presents approaches for utilizing Probabilistic Risk Analyses (PRA's) to determine risk importances. Risk importances are determined for design features, plant operations, and other factors that can affect risk. PRA's can be used to identify the importances of risk contributors or proposed changes to designs or operations. The objective of this report is to serve as a handbook and guide in evaluating and applying risk importances. The utilization of both qualitative risk importances and quantitative risk importances is described in this report. Qualitative risk importances are based on the logic models in the PRA, while quantitative risk importances are based on the quantitative results of the PRA. Both types of importances are among the most robust and meaningful information a PRA can provide. A wide variety of risk importance evaluations are described including evaluations of the importances of design changes, testing, maintenance, degrading environments, and aging. Specific utilizations are described in inspection and in reliability assurance programs, however the general approaches have widespread applicability. The role of personal computers and decision support programs in applying risk importance evaluations is also described

  19. A decision-oriented measure of uncertainty importance for use in PSA

    International Nuclear Information System (INIS)

    Poern, Kurt

    1997-01-01

    For the interpretation of the results of probabilistic risk assessments it is important to have measures which identify the basic events that contribute most to the frequency of the top event but also to identify basic events that are the main contributors to the uncertainty in this frequency. Both types of measures, often called Importance Measure and Measure of Uncertainty Importance, respectively, have been the subject of interest for many researchers in the reliability field. The most frequent mode of uncertainty analysis in connection with probabilistic risk assessment has been to propagate the uncertainty of all model parameters up to an uncertainty distribution for the top event frequency. Various uncertainty importance measures have been proposed in order to point out the parameters that in some sense are the main contributors to the top event distribution. The new measure of uncertainty importance suggested here goes a step further in that it has been developed within a decision theory framework, thereby providing an indication of on what basic event it would be most valuable, from the decision-making point of view, to procure more information

  20. Biological transfer of radionuclides in marine environments - Identifying and filling knowledge gaps for environmental impact assessments

    International Nuclear Information System (INIS)

    Brown, J.E.; Borretzen, P.; Hosseini, A.; Iosjpe, M.

    2004-01-01

    A review on concentration factors (CF) for the marine environment was conducted in order to consider the relevance of existing data from the perspective of environmental protection and to identify areas of data paucity. Data have been organised in a format compatible with a reference organism approach, for selected radionuclides, and efforts have been taken to identify the factors that may be of importance in the context of dosimetric and dose-effects analyses. These reference organism categories had been previously selected by identifying organism groups that were likely to experience the highest levels of radiation exposure, owing to high uptake levels or residence in a particular habitat, for defined scenarios. Significant data gaps in the CF database have been identified, notably for marine mammals and birds. Most empirical information pertains to a limit suite of radionuclides, particularly 137 Cs, 210 Po and 99 Tc. A methodology has been developed to help bridge this information deficit. This has been based on simple dynamic, biokinetic models that mainly use parameters derived from laboratory-based study and field observation. In some cases, allometric relationships have been employed to allow further model parameterization. Initial testing of the model by comparing model output with empirical data sets suggest that the models provide sensible equilibrium CFs. Furthermore, analyses of modelling results suggest that for some radionuclides, in particularly those with long effective half-lives, the time to equilibrium can be far greater than the life-time of an organism. This clearly emphasises the limitations of applying a universal equilibrium approach. The methodology, therefore, has an added advantage that non-equilibrium scenarios can be considered in a more rigorous manner. Further refinements to the modelling approach might be attained by exploring the importance of various model parameters, through sensitivity analyses, and by identifying those

  1. The global equilibrium method and its hybrid implementation for identifying heterogeneous elastic material parameters

    KAUST Repository

    Lubineau, Gilles

    2011-04-01

    New identification strategies have to be developed in order to perform the identification quickly and at very-low cost. A popular class of approaches relies on full-field measurement obtained through digital image correlation. We propose here a global equilibrium approach. It is based on the virtual field method in case specific virtual fields are used. It can also be seen as a generalization of the equilibrium gap method. This approach is easy to implement and we prove that it provides better or comparable results to the constitutive equation gap method that is known to be a very accurate reference. © 2010 Elsevier B.V.

  2. Need to Identify Parameters of Concrete in the Weakest Zone of the Industrial Floor

    Science.gov (United States)

    Stawiski, Bohdan; Radzik, Łukasz

    2017-10-01

    The ways in which industrial floors are exploited leads to the requirement for the highest strength of their upper zone. Physical phenomena occurring during the compaction and hardening of the concrete cause different strength distributions. In the top zone of industrial floors, the strength is significantly lower (over a dozen MPa) than the strength in the bottom zone (several dozen MPa). Standard tests of control samples do not detect this fact. Processes for the application and finishing of embedded mineral-aggregate hardeners (dry shakes) can be regarded as uncontrolled. The effects of the use of dry shakes are not evaluated. In combination with the phenomenon of bleeding, they often fail by delamination. This paper presents the results of industrial floor testing. The ultrasonic pulse velocity method with dry point contact transducers was used. The results show how upper layer strength was reduced, and how dry shakes application affected the strength of the floor. The strength distribution in hardened concrete, which delaminated from the rest of the floor was presented as well. The extension of compulsory control tests of concrete samples was proposed. In the authors’ opinion, particular attention should be paid to 3 centimetres of the upper layer.

  3. A Method for Identifying the Mechanical Parameters in Resistance Spot Welding Machines

    DEFF Research Database (Denmark)

    Wu, Pei; Zhang, Wenqi; Bay, Niels

    2003-01-01

    Mechanical dynamic responses of resistance welding machine have a significant influence on weld quality and electrode service life, it must be considered when the real welding production is carried out or the welding process is stimulated. The mathematical models for characterizing the mechanical...

  4. Emulation of a complex global aerosol model to quantify sensitivity to uncertain parameters

    Directory of Open Access Journals (Sweden)

    L. A. Lee

    2011-12-01

    Full Text Available Sensitivity analysis of atmospheric models is necessary to identify the processes that lead to uncertainty in model predictions, to help understand model diversity through comparison of driving processes, and to prioritise research. Assessing the effect of parameter uncertainty in complex models is challenging and often limited by CPU constraints. Here we present a cost-effective application of variance-based sensitivity analysis to quantify the sensitivity of a 3-D global aerosol model to uncertain parameters. A Gaussian process emulator is used to estimate the model output across multi-dimensional parameter space, using information from a small number of model runs at points chosen using a Latin hypercube space-filling design. Gaussian process emulation is a Bayesian approach that uses information from the model runs along with some prior assumptions about the model behaviour to predict model output everywhere in the uncertainty space. We use the Gaussian process emulator to calculate the percentage of expected output variance explained by uncertainty in global aerosol model parameters and their interactions. To demonstrate the technique, we show examples of cloud condensation nuclei (CCN sensitivity to 8 model parameters in polluted and remote marine environments as a function of altitude. In the polluted environment 95 % of the variance of CCN concentration is described by uncertainty in the 8 parameters (excluding their interaction effects and is dominated by the uncertainty in the sulphur emissions, which explains 80 % of the variance. However, in the remote region parameter interaction effects become important, accounting for up to 40 % of the total variance. Some parameters are shown to have a negligible individual effect but a substantial interaction effect. Such sensitivities would not be detected in the commonly used single parameter perturbation experiments, which would therefore underpredict total uncertainty. Gaussian process

  5. Determination of parameters for successful spray coating of silicon microneedle arrays.

    Science.gov (United States)

    McGrath, Marie G; Vrdoljak, Anto; O'Mahony, Conor; Oliveira, Jorge C; Moore, Anne C; Crean, Abina M

    2011-08-30

    Coated microneedle patches have demonstrated potential for effective, minimally invasive, drug and vaccine delivery. To facilitate cost-effective, industrial-scale production of coated microneedle patches, a continuous coating method which utilises conventional pharmaceutical processes is an attractive prospect. Here, the potential of spray-coating silicon microneedle patches using a conventional film-coating process was evaluated and the key process parameters which impact on coating coalescence and weight were identified by employing a fractional factorial design to coat flat silicon patches. Processing parameters analysed included concentration of coating material, liquid input rate, duration of spraying, atomisation air pressure, gun-to-surface distance and air cap setting. Two film-coating materials were investigated; hydroxypropylmethylcellulose (HPMC) and carboxymethylcellulose (CMC). HPMC readily formed a film-coat on silicon when suitable spray coating parameter settings were determined. CMC films required the inclusion of a surfactant (1%, w/w Tween 80) to facilitate coalescence of the sprayed droplets on the silicon surface. Spray coating parameters identified by experimental design, successfully coated 280μm silicon microneedle arrays, producing an intact film-coat, which follows the contours of the microneedle array without occlusion of the microneedle shape. This study demonstrates a novel method of coating microneedle arrays with biocompatible polymers using a conventional film-coating process. It is the first study to indicate the thickness and roughness of coatings applied to microneedle arrays. The study also highlights the importance of identifying suitable processing parameters when film coating substrates of micron dimensions. The ability of a fractional factorial design to identify these critical parameters is also demonstrated. The polymer coatings applied in this study can potentially be drug loaded for intradermal drug and vaccine delivery

  6. Importance Sampling for Stochastic Timed Automata

    DEFF Research Database (Denmark)

    Jegourel, Cyrille; Larsen, Kim Guldstrand; Legay, Axel

    2016-01-01

    We present an importance sampling framework that combines symbolic analysis and simulation to estimate the probability of rare reachability properties in stochastic timed automata. By means of symbolic exploration, our framework first identifies states that cannot reach the goal. A state-wise cha......We present an importance sampling framework that combines symbolic analysis and simulation to estimate the probability of rare reachability properties in stochastic timed automata. By means of symbolic exploration, our framework first identifies states that cannot reach the goal. A state...

  7. Parameters of care for craniosynostosis

    DEFF Research Database (Denmark)

    McCarthy, Joseph G; Warren, Stephen M; Bernstein, Joseph

    2012-01-01

    A multidisciplinary meeting was held from March 4 to 6, 2010, in Atlanta, Georgia, entitled "Craniosynostosis: Developing Parameters for Diagnosis, Treatment, and Management." The goal of this meeting was to create parameters of care for individuals with craniosynostosis.......A multidisciplinary meeting was held from March 4 to 6, 2010, in Atlanta, Georgia, entitled "Craniosynostosis: Developing Parameters for Diagnosis, Treatment, and Management." The goal of this meeting was to create parameters of care for individuals with craniosynostosis....

  8. Subsurface Geotechnical Parameters Report

    International Nuclear Information System (INIS)

    Rigby, D.; Mrugala, M.; Shideler, G.; Davidsavor, T.; Leem, J.; Buesch, D.; Sun, Y.; Potyondy, D.; Christianson, M.

    2003-01-01

    The Yucca Mountain Project is entering a the license application (LA) stage in its mission to develop the nation's first underground nuclear waste repository. After a number of years of gathering data related to site characterization, including activities ranging from laboratory and site investigations, to numerical modeling of processes associated with conditions to be encountered in the future repository, the Project is realigning its activities towards the License Application preparation. At the current stage, the major efforts are directed at translating the results of scientific investigations into sets of data needed to support the design, and to fulfill the licensing requirements and the repository design activities. This document addresses the program need to address specific technical questions so that an assessment can be made about the suitability and adequacy of data to license and construct a repository at the Yucca Mountain Site. In July 2002, the U.S. Nuclear Regulatory Commission (NRC) published an Integrated Issue Resolution Status Report (NRC 2002). Included in this report were the Repository Design and Thermal-Mechanical Effects (RDTME) Key Technical Issues (KTI). Geotechnical agreements were formulated to resolve a number of KTI subissues, in particular, RDTME KTIs 3.04, 3.05, 3.07, and 3.19 relate to the physical, thermal and mechanical properties of the host rock (NRC 2002, pp. 2.1.1-28, 2.1.7-10 to 2.1.7-21, A-17, A-18, and A-20). The purpose of the Subsurface Geotechnical Parameters Report is to present an accounting of current geotechnical information that will help resolve KTI subissues and some other project needs. The report analyzes and summarizes available qualified geotechnical data. It evaluates the sufficiency and quality of existing data to support engineering design and performance assessment. In addition, the corroborative data obtained from tests performed by a number of research organizations is presented to reinforce

  9. Subsurface Geotechnical Parameters Report

    Energy Technology Data Exchange (ETDEWEB)

    D. Rigby; M. Mrugala; G. Shideler; T. Davidsavor; J. Leem; D. Buesch; Y. Sun; D. Potyondy; M. Christianson

    2003-12-17

    The Yucca Mountain Project is entering a the license application (LA) stage in its mission to develop the nation's first underground nuclear waste repository. After a number of years of gathering data related to site characterization, including activities ranging from laboratory and site investigations, to numerical modeling of processes associated with conditions to be encountered in the future repository, the Project is realigning its activities towards the License Application preparation. At the current stage, the major efforts are directed at translating the results of scientific investigations into sets of data needed to support the design, and to fulfill the licensing requirements and the repository design activities. This document addresses the program need to address specific technical questions so that an assessment can be made about the suitability and adequacy of data to license and construct a repository at the Yucca Mountain Site. In July 2002, the U.S. Nuclear Regulatory Commission (NRC) published an Integrated Issue Resolution Status Report (NRC 2002). Included in this report were the Repository Design and Thermal-Mechanical Effects (RDTME) Key Technical Issues (KTI). Geotechnical agreements were formulated to resolve a number of KTI subissues, in particular, RDTME KTIs 3.04, 3.05, 3.07, and 3.19 relate to the physical, thermal and mechanical properties of the host rock (NRC 2002, pp. 2.1.1-28, 2.1.7-10 to 2.1.7-21, A-17, A-18, and A-20). The purpose of the Subsurface Geotechnical Parameters Report is to present an accounting of current geotechnical information that will help resolve KTI subissues and some other project needs. The report analyzes and summarizes available qualified geotechnical data. It evaluates the sufficiency and quality of existing data to support engineering design and performance assessment. In addition, the corroborative data obtained from tests performed by a number of research organizations is presented to reinforce

  10. Application of spreadsheet to estimate infiltration parameters

    Directory of Open Access Journals (Sweden)

    Mohammad Zakwan

    2016-09-01

    Full Text Available Infiltration is the process of flow of water into the ground through the soil surface. Soil water although contributes a negligible fraction of total water present on earth surface, but is of utmost importance for plant life. Estimation of infiltration rates is of paramount importance for estimation of effective rainfall, groundwater recharge, and designing of irrigation systems. Numerous infiltration models are in use for estimation of infiltration rates. The conventional graphical approach for estimation of infiltration parameters often fails to estimate the infiltration parameters precisely. The generalised reduced gradient (GRG solver is reported to be a powerful tool for estimating parameters of nonlinear equations and it has, therefore, been implemented to estimate the infiltration parameters in the present paper. Field data of infiltration rate available in literature for sandy loam soils of Umuahia, Nigeria were used to evaluate the performance of GRG solver. A comparative study of graphical method and GRG solver shows that the performance of GRG solver is better than that of conventional graphical method for estimation of infiltration rates. Further, the performance of Kostiakov model has been found to be better than the Horton and Philip's model in most of the cases based on both the approaches of parameter estimation.

  11. Triplet ultrasound growth parameters.

    Science.gov (United States)

    Vora, Neeta L; Ruthazer, Robin; House, Michael; Chelmow, David

    2006-03-01

    To create ultrasound growth curves for normal growth of fetal triplets using statistical methodology that properly accounts for similarities of growth of fetuses within a mother as well as repeated measurements over time for each fetus. In this longitudinal study, all triplet pregnancies managed at a single tertiary center from 1992-2004 were reviewed. Fetuses with major anomalies, prior selective reduction, or fetal demise were excluded. Data from early and late gestation in which there were fewer than 30 fetal measurements available for analysis were excluded. We used multilevel models to account for variation in growth within a single fetus over time, variations in growth between multiple fetuses within a single mother, and variations in fetal growth between mothers. Medians (50th), 10th, and 90th percentiles were estimated by the creation of multiple quadratic growth models from bootstrap samples adapting a previously published method to compute prediction intervals. Estimated fetal weight was derived from Hadlock's formula. One hundred fifty triplet pregnancies were identified. Twenty-seven pregnancies were excluded for the following reasons: missing records (23), fetal demise (3), and fetal anomaly (1). The study group consisted of 123 pregnancies. The gestational age range was restricted to 14-34 weeks. Figures and tables were developed showing medians, 10th and 90th percentiles for estimated fetal weight, femur length, biparietal diameter, abdominal circumference, and head circumference. Growth curves for triplet pregnancies were derived. These may be useful for identification of abnormal growth in triplet fetuses. III.

  12. Examples of testing global identifiability of biological and biomedical models with the DAISY software.

    Science.gov (United States)

    Saccomani, Maria Pia; Audoly, Stefania; Bellu, Giuseppina; D'Angiò, Leontina

    2010-04-01

    DAISY (Differential Algebra for Identifiability of SYstems) is a recently developed computer algebra software tool which can be used to automatically check global identifiability of (linear and) nonlinear dynamic models described by differential equations involving polynomial or rational functions. Global identifiability is a fundamental prerequisite for model identification which is important not only for biological or medical systems but also for many physical and engineering systems derived from first principles. Lack of identifiability implies that the parameter estimation techniques may not fail but any obtained numerical estimates will be meaningless. The software does not require understanding of the underlying mathematical principles and can be used by researchers in applied fields with a minimum of mathematical background. We illustrate the DAISY software by checking the a priori global identifiability of two benchmark nonlinear models taken from the literature. The analysis of these two examples includes comparison with other methods and demonstrates how identifiability analysis is simplified by this tool. Thus we illustrate the identifiability analysis of other two examples, by including discussion of some specific aspects related to the role of observability and knowledge of initial conditions in testing identifiability and to the computational complexity of the software. The main focus of this paper is not on the description of the mathematical background of the algorithm, which has been presented elsewhere, but on illustrating its use and on some of its more interesting features. DAISY is available on the web site http://www.dei.unipd.it/ approximately pia/. 2010 Elsevier Ltd. All rights reserved.

  13. Morfofunctional parameters in judo's fight

    Directory of Open Access Journals (Sweden)

    Ítalo Sérgio Lopes Campos

    2017-12-01

    Full Text Available Considering the complexity of judo and the ample energy and neuromuscular demands, a whole process of competitive preparation must be directed to different physical capacities allowing the athlete to perform his combat actions with the best suitability possible. Mapping the  behaviour of a judo athlete from observations of behaviour units  in a real fighting situation would be a way of trying to identify the best topography or the best "aptitude" to achieve victory. The present investigation analysed the judo from the interactions of a real competition situation, aiming to verify, between winners and losers, possible differences or correlations between anthropometric parameters, motor performance and functional behaviours in a competitive situation. The results showed that: a the experience is decisive between winning or losing; b leg techniques are the most used between winners and losers, and losers use them more frequently; c there are different strategies between fights; d The energy cost in judo depends on the configuration of the fights. It is believed that such results can help coaches and athletes in guiding and rationalizing the training process in relation to performance determinants in judo.

  14. Approaches to automatic parameter fitting in a microscopy image segmentation pipeline: An exploratory parameter space analysis.

    Science.gov (United States)

    Held, Christian; Nattkemper, Tim; Palmisano, Ralf; Wittenberg, Thomas

    2013-01-01

    Research and diagnosis in medicine and biology often require the assessment of a large amount of microscopy image data. Although on the one hand, digital pathology and new bioimaging technologies find their way into clinical practice and pharmaceutical research, some general methodological issues in automated image analysis are still open. In this study, we address the problem of fitting the parameters in a microscopy image segmentation pipeline. We propose to fit the parameters of the pipeline's modules with optimization algorithms, such as, genetic algorithms or coordinate descents, and show how visual exploration of the parameter space can help to identify sub-optimal parameter settings that need to be avoided. This is of significant help in the design of our automatic parameter fitting framework, which enables us to tune the pipeline for large sets of micrographs. The underlying parameter spaces pose a challenge for manual as well as automated parameter optimization, as the parameter spaces can show several local performance maxima. Hence, optimization strategies that are not able to jump out of local performance maxima, like the hill climbing algorithm, often result in a local maximum.

  15. Approaches to automatic parameter fitting in a microscopy image segmentation pipeline: An exploratory parameter space analysis

    Directory of Open Access Journals (Sweden)

    Christian Held

    2013-01-01

    Full Text Available Introduction: Research and diagnosis in medicine and biology often require the assessment of a large amount of microscopy image data. Although on the one hand, digital pathology and new bioimaging technologies find their way into clinical practice and pharmaceutical research, some general methodological issues in automated image analysis are still open. Methods: In this study, we address the problem of fitting the parameters in a microscopy image segmentation pipeline. We propose to fit the parameters of the pipeline′s modules with optimization algorithms, such as, genetic algorithms or coordinate descents, and show how visual exploration of the parameter space can help to identify sub-optimal parameter settings that need to be avoided. Results: This is of significant help in the design of our automatic parameter fitting framework, which enables us to tune the pipeline for large sets of micrographs. Conclusion: The underlying parameter spaces pose a challenge for manual as well as automated parameter optimization, as the parameter spaces can show several local performance maxima. Hence, optimization strategies that are not able to jump out of local performance maxima, like the hill climbing algorithm, often result in a local maximum.

  16. Spatio-temporal modeling of nonlinear distributed parameter systems

    CERN Document Server

    Li, Han-Xiong

    2011-01-01

    The purpose of this volume is to provide a brief review of the previous work on model reduction and identifi cation of distributed parameter systems (DPS), and develop new spatio-temporal models and their relevant identifi cation approaches. In this book, a systematic overview and classifi cation on the modeling of DPS is presented fi rst, which includes model reduction, parameter estimation and system identifi cation. Next, a class of block-oriented nonlinear systems in traditional lumped parameter systems (LPS) is extended to DPS, which results in the spatio-temporal Wiener and Hammerstein s

  17. Seismic stochastic inversion identify river channel sand body

    Science.gov (United States)

    He, Z.

    2015-12-01

    The technology of seismic inversion is regarded as one of the most important part of geophysics. By using the technology of seismic inversion and the theory of stochastic simulation, the concept of seismic stochastic inversion is proposed.Seismic stochastic inversion can play an significant role in the identifying river channel sand body. Accurate sand body description is a crucial parameter to measure oilfield development and oilfield stimulation during the middle and later periods. Besides, rational well spacing density is an essential condition for efficient production. Based on the geological knowledge of a certain oilfield, in line with the use of seismic stochastic inversion, the river channel sand body in the work area is identified. In this paper, firstly, the single river channel body from the composite river channel body is subdivided. Secondly, the distribution of river channel body is ascertained in order to ascertain the direction of rivers. Morever, the superimposed relationship among the sand body is analyzed, especially among the inter-well sand body. The last but not at the least, via the analysis of inversion results of first vacuating the wells and continuous infilling later, it is meeted the most needs well spacing density that can obtain the optimal inversion result. It would serve effective guidance for oilfield stimulation.

  18. Identifying Chaotic FitzHugh–Nagumo Neurons Using Compressive Sensing

    Directory of Open Access Journals (Sweden)

    Ri-Qi Su

    2014-07-01

    Full Text Available We develop a completely data-driven approach to reconstructing coupled neuronal networks that contain a small subset of chaotic neurons. Such chaotic elements can be the result of parameter shift in their individual dynamical systems and may lead to abnormal functions of the network. To accurately identify the chaotic neurons may thus be necessary and important, for example, applying appropriate controls to bring the network to a normal state. However, due to couplings among the nodes, the measured time series, even from non-chaotic neurons, would appear random, rendering inapplicable traditional nonlinear time-series analysis, such as the delay-coordinate embedding method, which yields information about the global dynamics of the entire network. Our method is based on compressive sensing. In particular, we demonstrate that identifying chaotic elements can be formulated as a general problem of reconstructing the nodal dynamical systems, network connections and all coupling functions, as well as their weights. The working and efficiency of the method are illustrated by using networks of non-identical FitzHugh–Nagumo neurons with randomly-distributed coupling weights.

  19. Identifying desertification risk areas using fuzzy membership and geospatial technique - A case study, Kota District, Rajasthan

    Science.gov (United States)

    Dasgupta, Arunima; Sastry, K. L. N.; Dhinwa, P. S.; Rathore, V. S.; Nathawat, M. S.

    2013-08-01

    Desertification risk assessment is important in order to take proper measures for its prevention. Present research intends to identify the areas under risk of desertification along with their severity in terms of degradation in natural parameters. An integrated model with fuzzy membership analysis, fuzzy rule-based inference system and geospatial techniques was adopted, including five specific natural parameters namely slope, soil pH, soil depth, soil texture and NDVI. Individual parameters were classified according to their deviation from mean. Membership of each individual values to be in a certain class was derived using the normal probability density function of that class. Thus if a single class of a single parameter is with mean μ and standard deviation σ, the values falling beyond μ + 2 σ and μ - 2 σ are not representing that class, but a transitional zone between two subsequent classes. These are the most important areas in terms of degradation, as they have the lowest probability to be in a certain class, hence highest probability to be extended or narrowed down in next or previous class respectively. Eventually, these are the values which can be easily altered, under extrogenic influences, hence are identified as risk areas. The overall desertification risk is derived by incorporating the different risk severity of each parameter using fuzzy rule-based interference system in GIS environment. Multicriteria based geo-statistics are applied to locate the areas under different severity of desertification risk. The study revealed that in Kota, various anthropogenic pressures are accelerating land deterioration, coupled with natural erosive forces. Four major sources of desertification in Kota are, namely Gully and Ravine erosion, inappropriate mining practices, growing urbanization and random deforestation.

  20. How important is importance for prospective memory? A review

    OpenAIRE

    Walter, Stefan; Meier, Beat

    2014-01-01

    Forgetting to carry out an intention as planned can have serious consequences in everyday life. People sometimes even forget intentions that they consider as very important. Here, we review the literature on the impact of importance on prospective memory performance. We highlight different methods used to manipulate the importance of a prospective memory task such as providing rewards, importance relative to other ongoing activities, absolute importance, and providing social motives. Moreover...

  1. WIPP Compliance Certification Application calculations parameters. Part 1: Parameter development

    International Nuclear Information System (INIS)

    Howarth, S.M.

    1997-01-01

    The Waste Isolation Pilot Plant (WIPP) in southeast New Mexico has been studied as a transuranic waste repository for the past 23 years. During this time, an extensive site characterization, design, construction, and experimental program was completed, which provided in-depth understanding of the dominant processes that are most likely to influence the containment of radionuclides for 10,000 years. Nearly 1,500 parameters were developed using information gathered from this program; the parameters were input to numerical models for WIPP Compliance Certification Application (CCA) Performance Assessment (PA) calculations. The CCA probabilistic codes frequently require input values that define a statistical distribution for each parameter. Developing parameter distributions begins with the assignment of an appropriate distribution type, which is dependent on the type, magnitude, and volume of data or information available. The development of the parameter distribution values may require interpretation or statistical analysis of raw data, combining raw data with literature values, scaling of lab or field data to fit code grid mesh sizes, or other transformation. Parameter development and documentation of the development process were very complicated, especially for those parameters based on empirical data; they required the integration of information from Sandia National Laboratories (SNL) code sponsors, parameter task leaders (PTLs), performance assessment analysts (PAAs), and experimental principal investigators (PIs). This paper, Part 1 of two parts, contains a discussion of the parameter development process, roles and responsibilities, and lessons learned. Part 2 will discuss parameter documentation, traceability and retrievability, and lessons learned from related audits and reviews

  2. Estimating RASATI scores using acoustical parameters

    International Nuclear Information System (INIS)

    Agüero, P D; Tulli, J C; Moscardi, G; Gonzalez, E L; Uriz, A J

    2011-01-01

    Acoustical analysis of speech using computers has reached an important development in the latest years. The subjective evaluation of a clinician is complemented with an objective measure of relevant parameters of voice. Praat, MDVP (Multi Dimensional Voice Program) and SAV (Software for Voice Analysis) are some examples of software for speech analysis. This paper describes an approach to estimate the subjective characteristics of RASATI scale given objective acoustical parameters. Two approaches were used: linear regression with non-negativity constraints, and neural networks. The experiments show that such approach gives correct evaluations with ±1 error in 80% of the cases.

  3. Leading change: 1--identifying the issue.

    Science.gov (United States)

    Kerridge, Joanna

    To enable sustainable change, nurses need to take the lead in managing it. Recent national initiatives have emphasised the importance of frontline staff in service improvement. The ability to influence and manage change has been identified as an essential skill for delivering new models of care. This article is the first in a three-part series designed to help nurses at all levels develop the knowledge and skills they will need to initiate and manage change. This article focuses on identifying what needs to be changed and why.

  4. The NOAA Dataset Identifier Project

    Science.gov (United States)

    de la Beaujardiere, J.; Mccullough, H.; Casey, K. S.

    2013-12-01

    The US National Oceanic and Atmospheric Administration (NOAA) initiated a project in 2013 to assign persistent identifiers to datasets archived at NOAA and to create informational landing pages about those datasets. The goals of this project are to enable the citation of datasets used in products and results in order to help provide credit to data producers, to support traceability and reproducibility, and to enable tracking of data usage and impact. A secondary goal is to encourage the submission of datasets for long-term preservation, because only archived datasets will be eligible for a NOAA-issued identifier. A team was formed with representatives from the National Geophysical, Oceanographic, and Climatic Data Centers (NGDC, NODC, NCDC) to resolve questions including which identifier scheme to use (answer: Digital Object Identifier - DOI), whether or not to embed semantics in identifiers (no), the level of granularity at which to assign identifiers (as coarsely as reasonable), how to handle ongoing time-series data (do not break into chunks), creation mechanism for the landing page (stylesheet from formal metadata record preferred), and others. Decisions made and implementation experience gained will inform the writing of a Data Citation Procedural Directive to be issued by the Environmental Data Management Committee in 2014. Several identifiers have been issued as of July 2013, with more on the way. NOAA is now reporting the number as a metric to federal Open Government initiatives. This paper will provide further details and status of the project.

  5. Parameters affecting mechanical and thermal responses in bone drilling: A review.

    Science.gov (United States)

    Lee, JuEun; Chavez, Craig L; Park, Joorok

    2018-04-11

    Surgical bone drilling is performed variously to correct bone fractures, install prosthetics, or for therapeutic treatment. The primary concern in bone drilling is to extract donor bone sections and create receiving holes without damaging the bone tissue either mechanically or thermally. We review current results from experimental and theoretical studies to investigate the parameters related to such effects. This leads to a comprehensive understanding of the mechanical and thermal aspects of bone drilling to reduce their unwanted complications. This review examines the important bone-drilling parameters of bone structure, drill-bit geometry, operating conditions, and material evacuation, and considers the current techniques used in bone drilling. We then analyze the associated mechanical and thermal effects and their contributions to bone-drilling performance. In this review, we identify a favorable range for each parameter to reduce unwanted complications due to mechanical or thermal effects. Copyright © 2018 Elsevier Ltd. All rights reserved.

  6. Application of Novel Lateral Tire Force Sensors to Vehicle Parameter Estimation of Electric Vehicles

    Directory of Open Access Journals (Sweden)

    Kanghyun Nam

    2015-11-01

    Full Text Available This article presents methods for estimating lateral vehicle velocity and tire cornering stiffness, which are key parameters in vehicle dynamics control, using lateral tire force measurements. Lateral tire forces acting on each tire are directly measured by load-sensing hub bearings that were invented and further developed by NSK Ltd. For estimating the lateral vehicle velocity, tire force models considering lateral load transfer effects are used, and a recursive least square algorithm is adapted to identify the lateral vehicle velocity as an unknown parameter. Using the estimated lateral vehicle velocity, tire cornering stiffness, which is an important tire parameter dominating the vehicle’s cornering responses, is estimated. For the practical implementation, the cornering stiffness estimation algorithm based on a simple bicycle model is developed and discussed. Finally, proposed estimation algorithms were evaluated using experimental test data.

  7. Application of Novel Lateral Tire Force Sensors to Vehicle Parameter Estimation of Electric Vehicles.

    Science.gov (United States)

    Nam, Kanghyun

    2015-11-11

    This article presents methods for estimating lateral vehicle velocity and tire cornering stiffness, which are key parameters in vehicle dynamics control, using lateral tire force measurements. Lateral tire forces acting on each tire are directly measured by load-sensing hub bearings that were invented and further developed by NSK Ltd. For estimating the lateral vehicle velocity, tire force models considering lateral load transfer effects are used, and a recursive least square algorithm is adapted to identify the lateral vehicle velocity as an unknown parameter. Using the estimated lateral vehicle velocity, tire cornering stiffness, which is an important tire parameter dominating the vehicle's cornering responses, is estimated. For the practical implementation, the cornering stiffness estimation algorithm based on a simple bicycle model is developed and discussed. Finally, proposed estimation algorithms were evaluated using experimental test data.

  8. Summary of the DREAM8 Parameter Estimation Challenge: Toward Parameter Identification for Whole-Cell Models.

    Directory of Open Access Journals (Sweden)

    Jonathan R Karr

    2015-05-01

    Full Text Available Whole-cell models that explicitly represent all cellular components at the molecular level have the potential to predict phenotype from genotype. However, even for simple bacteria, whole-cell models will contain thousands of parameters, many of which are poorly characterized or unknown. New algorithms are needed to estimate these parameters and enable researchers to build increasingly comprehensive models. We organized the Dialogue for Reverse Engineering Assessments and Methods (DREAM 8 Whole-Cell Parameter Estimation Challenge to develop new parameter estimation algorithms for whole-cell models. We asked participants to identify a subset of parameters of a whole-cell model given the model's structure and in silico "experimental" data. Here we describe the challenge, the best performing methods, and new insights into the identifiability of whole-cell models. We also describe several valuable lessons we learned toward improving future challenges. Going forward, we believe that collaborative efforts supported by inexpensive cloud computing have the potential to solve whole-cell model parameter estimation.

  9. Identifying variables that influence manufacturing product quality

    Directory of Open Access Journals (Sweden)

    Marek Krynke

    2014-10-01

    Full Text Available In the article a risk analysis of the production process of selected products in a plant producing votive candles was conducted. The Pareto-Lorenz diagram and FMEA method were used which indicated the most important areas affecting the production of selected elements of candles. The synthesis of intangible factors affecting production in the audited company was also carried out with particular emphasis on the operation of the production system. The factors determining the validity of studies was examined, describing the principle of BOST 14 Toyota management. The most important areas of the company were identified, positively affecting the production process.

  10. Rational Design of Molecular Gelator - Solvent Systems Guided by Solubility Parameters

    Science.gov (United States)

    Lan, Yaqi

    Self-assembled architectures, such as molecular gels, have attracted wide interest among chemists, physicists and engineers during the past decade. However, the mechanism behind self-assembly remains largely unknown and no capability exists to predict a priori whether a small molecule will gelate a specific solvent or not. The process of self-assembly, in molecular gels, is intricate and must balance parameters influencing solubility and those contrasting forces that govern epitaxial growth into axially symmetric elongated aggregates. Although the gelator-gelator interactions are of paramount importance in understanding gelation, the solvent-gelator specific (i.e., H-bonding) and nonspecific (dipole-dipole, dipole-induced and instantaneous dipole induced forces) intermolecular interactions are equally important. Solvent properties mediate the self-assembly of molecular gelators into their self-assembled fibrillar networks. Herein, solubility parameters of solvents, ranging from partition coefficients (logP), to Henry's law constants (HLC), to solvatochromic ET(30) parameters, to Kamlet-Taft parameters (beta, alpha and pi), to Hansen solubility parameters (deltap, deltad, deltah), etc., are correlated with the gelation ability of numerous classes of molecular gelators. Advanced solvent clustering techniques have led to the development of a priori tools that can identify the solvents that will be gelled and not gelled by molecular gelators. These tools will greatly aid in the development of novel gelators without solely relying on serendipitous discoveries.

  11. On Approaches to Analyze the Sensitivity of Simulated Hydrologic Fluxes to Model Parameters in the Community Land Model

    Directory of Open Access Journals (Sweden)

    Jie Bao

    2015-12-01

    Full Text Available Effective sensitivity analysis approaches are needed to identify important parameters or factors and their uncertainties in complex Earth system models composed of multi-phase multi-component phenomena and multiple biogeophysical-biogeochemical processes. In this study, the impacts of 10 hydrologic parameters in the Community Land Model on simulations of runoff and latent heat flux are evaluated using data from a watershed. Different metrics, including residual statistics, the Nash–Sutcliffe coefficient, and log mean square error, are used as alternative measures of the deviations between the simulated and field observed values. Four sensitivity analysis (SA approaches, including analysis of variance based on the generalized linear model, generalized cross validation based on the multivariate adaptive regression splines model, standardized regression coefficients based on a linear regression model, and analysis of variance based on support vector machine, are investigated. Results suggest that these approaches show consistent measurement of the impacts of major hydrologic parameters on response variables, but with differences in the relative contributions, particularly for the secondary parameters. The convergence behaviors of the SA with respect to the number of sampling points are also examined with different combinations of input parameter sets and output response variables and their alternative metrics. This study helps identify the optimal SA approach, provides guidance for the calibration of the Community Land Model parameters to improve the model simulations of land surface fluxes, and approximates the magnitudes to be adjusted in the parameter values during parametric model optimization.

  12. IDENTIFYING COLLISIONAL FAMILIES IN THE KUIPER BELT

    International Nuclear Information System (INIS)

    Marcus, Robert A.; Ragozzine, Darin; Murray-Clay, Ruth A.; Holman, Matthew J.

    2011-01-01

    The identification and characterization of numerous collisional families-clusters of bodies with a common collisional origin-in the asteroid belt has added greatly to the understanding of asteroid belt formation and evolution. More recent study has also led to an appreciation of physical processes that had previously been neglected (e.g., the Yarkovsky effect). Collisions have certainly played an important role in the evolution of the Kuiper Belt as well, though only one collisional family has been identified in that region to date, around the dwarf planet Haumea. In this paper, we combine insights into collisional families from numerical simulations with the current observational constraints on the dynamical structure of the Kuiper Belt to