WorldWideScience

Sample records for human pathogen vibrio

  1. Genome sequence of the human pathogen Vibrio cholerae Amazonia.

    NARCIS (Netherlands)

    Thompson, C.C.; Marin, M.A.; Dias, G.M.; Dutilh, B.E.; Edwards, R.A.; Iida, T.; Thompson, F.L.; Vicente, A.C.

    2011-01-01

    Vibrio cholerae O1 Amazonia is a pathogen that was isolated from cholera-like diarrhea cases in at least two countries, Brazil and Ghana. Based on multilocus sequence analysis, this lineage belongs to a distinct profile compared to strains from El Tor and classical biotypes. The genomic analysis

  2. Occurrences of pathogenic Vibrio parahaemolyticus from Vellar ...

    African Journals Online (AJOL)

    Vibrio parahaemolyticus is the predominant seafood pathogen associated with human gastroenteritis. Samples were collected from Vellar estuary, shrimp ponds and shrimp for characterization of V. parahaemolyticus. A total of 26 blue green centre (BG) Vibrio strains were isolated and characterized through biochemical ...

  3. Forecasting the Human Pathogen Vibrio Parahaemolyticus in Shellfish Tissue within Long Island Sound

    Science.gov (United States)

    Whitney, M. M.; DeRosia-Banick, K.

    2016-02-01

    Vibrio parahaemolyticus (Vp) is a marine bacterium that occurs naturally in brackish and saltwater environments and may be found in higher concentrations in the warmest months. Vp is a growing threat to producing safe seafood. Consumption of shellfish with high Vp levels can result in gastrointestinal human illnesses. Management response to Vp-related illness outbreaks includes closure of shellfish growing areas. Water quality observations, Vp measurements, and model forecasts are key components to effective management of shellfish growing areas. There is a clear need for observations within the growing area themselves. These areas are offshore of coastal stations and typically inshore of the observing system moorings. New field observations in Long Island Sound (LIS) shellfish growing areas are described and their agreement with high-resolution satellite sea surface temperature data is discussed. A new dataset of Vp concentrations in shellfish tissue is used to determine the LIS-specific Vp vs. temperature relationship following methods in the FDA pre-harvest Vp risk model. This information is combined with output from a high-resolution hydrodynamic model of LIS to make daily forecasts of Vp levels. The influence of river inflows, the role of heat waves, and predictions for future warmer climates are discussed. The key elements of this observational-modeling approach to pathogen forecasting are extendable to other coastal systems.

  4. Galleria mellonella is low cost and suitable surrogate host for studying virulence of human pathogenic Vibrio cholerae.

    Science.gov (United States)

    Bokhari, Habib; Ali, Amjad; Noreen, Zobia; Thomson, Nicholas; Wren, Brendan W

    2017-09-10

    Vibrio cholerae causes a severe diarrheal disease affecting millions of people worldwide, particularly in low income countries. V. cholerae successfully persist in aquatic environment and its pathogenic strains results in sever enteric disease in humans. This dual life style contributes towards its better survival and persistence inside host gut and in the environment. Alternative animal replacement models are of great value in studying host-pathogen interaction and for quick screening of various pathogenic strains. One such model is Galleria mellonella, a wax moth which has a complex innate immune system and here we investigate its suitability as a model for clinical human isolates of O1 El TOR, Ogawa serotype belonging to two genetically distinct subclades found in Pakistan (PSC-1 and PSC-2). We demonstrate that the PSC-2 strain D59 frequently isolated from inland areas, was more virulent than PSC-1 strain K7 mainly isolated from coastal areas (p=0.0001). In addition, we compared the relative biofilm capability of the representative strains as indicators of their survival and persistence in the environment and K7 showed enhanced biofilm forming capabilities (p=0.004). Finally we present the annotated genomes of the strains D59 and K7, and compared them with the reference strain N16961. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Bacteriophage interactions with marine pathogenic Vibrios

    DEFF Research Database (Denmark)

    Kalatzis, Panagiotis

    Incidents of Vibrio-associated diseases in marine aquaculture are increasingly reported on a global scale, incited also by the world’s rising temperature. Administration of antibiotics has been the most commonly applied remedy used for facing vibriosis outbreaks, giving rise to concerns about...... pathogens. The combinatory administration of virulent bacteriophages φSt2 and φGrn1, isolated against Vibrio alginolyticus significantly reduced the Vibrio load in cultures of Artemia salina live prey, decreasing subsequently the risk of a vibriosis outbreak in the marine hatchery. During infection...... to studying the interactions between marine pathogenic Vibrio and their corresponding bacteriophages, while discussing the potential and limitations of phage therapy application in the biological control of vibriosis....

  6. Genome-wide SNP-genotyping array to study the evolution of the human pathogen Vibrio vulnificus biotype 3.

    Science.gov (United States)

    Raz, Nili; Danin-Poleg, Yael; Hayman, Ryan B; Bar-On, Yudi; Linetsky, Alex; Shmoish, Michael; Sanjuán, Eva; Amaro, Carmen; Walt, David R; Kashi, Yechezkel

    2014-01-01

    Vibrio vulnificus is an aquatic bacterium and an important human pathogen. Strains of V. vulnificus are classified into three different biotypes. The newly emerged biotype 3 has been found to be clonal and restricted to Israel. In the family Vibrionaceae, horizontal gene transfer is the main mechanism responsible for the emergence of new pathogen groups. To better understand the evolution of the bacterium, and in particular to trace the evolution of biotype 3, we performed genome-wide SNP genotyping of 254 clinical and environmental V. vulnificus isolates with worldwide distribution recovered over a 30-year period, representing all phylogeny groups. A custom single-nucleotide polymorphism (SNP) array implemented on the Illumina GoldenGate platform was developed based on 570 SNPs randomly distributed throughout the genome. In general, the genotyping results divided the V. vulnificus species into three main phylogenetic lineages and an additional subgroup, clade B, consisting of environmental and clinical isolates from Israel. Data analysis suggested that 69% of biotype 3 SNPs are similar to SNPs from clade B, indicating that biotype 3 and clade B have a common ancestor. The rest of the biotype 3 SNPs were scattered along the biotype 3 genome, probably representing multiple chromosomal segments that may have been horizontally inserted into the clade B recipient core genome from other phylogroups or bacterial species sharing the same ecological niche. Results emphasize the continuous evolution of V. vulnificus and support the emergence of new pathogenic groups within this species as a recurrent phenomenon. Our findings contribute to a broader understanding of the evolution of this human pathogen.

  7. Genome-Wide SNP-Genotyping Array to Study the Evolution of the Human Pathogen Vibrio vulnificus Biotype 3

    Science.gov (United States)

    Hayman, Ryan B.; Bar-On, Yudi; Linetsky, Alex; Shmoish, Michael; Sanjuán, Eva; Amaro, Carmen; Walt, David R.; Kashi, Yechezkel

    2014-01-01

    Vibrio vulnificus is an aquatic bacterium and an important human pathogen. Strains of V. vulnificus are classified into three different biotypes. The newly emerged biotype 3 has been found to be clonal and restricted to Israel. In the family Vibrionaceae, horizontal gene transfer is the main mechanism responsible for the emergence of new pathogen groups. To better understand the evolution of the bacterium, and in particular to trace the evolution of biotype 3, we performed genome-wide SNP genotyping of 254 clinical and environmental V. vulnificus isolates with worldwide distribution recovered over a 30-year period, representing all phylogeny groups. A custom single-nucleotide polymorphism (SNP) array implemented on the Illumina GoldenGate platform was developed based on 570 SNPs randomly distributed throughout the genome. In general, the genotyping results divided the V. vulnificus species into three main phylogenetic lineages and an additional subgroup, clade B, consisting of environmental and clinical isolates from Israel. Data analysis suggested that 69% of biotype 3 SNPs are similar to SNPs from clade B, indicating that biotype 3 and clade B have a common ancestor. The rest of the biotype 3 SNPs were scattered along the biotype 3 genome, probably representing multiple chromosomal segments that may have been horizontally inserted into the clade B recipient core genome from other phylogroups or bacterial species sharing the same ecological niche. Results emphasize the continuous evolution of V. vulnificus and support the emergence of new pathogenic groups within this species as a recurrent phenomenon. Our findings contribute to a broader understanding of the evolution of this human pathogen. PMID:25526263

  8. Benthic ecology of Vibrio spp. and pathogenic Vibrio species in a coastal Mediterranean environment (La Spezia Gulf, Italy).

    Science.gov (United States)

    Vezzulli, Luigi; Pezzati, Elisabetta; Moreno, Mariapaola; Fabiano, Mauro; Pane, Luigi; Pruzzo, Carla

    2009-11-01

    We carried out a 16-month in situ study to investigate the ecology of Vibrio spp. and pathogenic Vibrio species in coastal sediments of the Mediterranean Sea, employing multiple-regression analysis to reveal the major environmental factors controlling their occurrence in the benthic environment. In addition, association between vibrios and sediment-inhabiting meiofauna, which is a major component of benthic ecosystems, was investigated. Culturable and total Vibrio spp. estimates by most-probable-number technique coupled with standard polymerase chain reaction (PCR) and real-time PCR methods, respectively, were at least one order of magnitude higher in sediment than in seawater. In addition, potential human pathogenic species Vibrio cholerae, Vibrio vulnificus and Vibrio parahaemolyticus occurred in the sediment with V. parahaemolyticus being the most frequently found. In the pelagic environment, 60% of total variance in culturable Vibrio data was explained by sea surface temperature (40%), salinity (13%) and organic matter concentration (7%). In the benthic environment, sea surface temperature was the only factor that significantly affected culturable Vibrio occurrence although it explained only 25% of total variance, suggesting that additional unexplored factors may play a role as well. No correlation was found between culturable Vibrio spp. concentrations and the abundance of harpacticoid copepods in the sediment whilst a negative correlation was found between Vibrio spp. and nematode abundance which accounted for almost 90% of the total meiofaunal density. Taxonomic analysis revealed that selective bacterial feeders accounted for nearly 50% of the total nematode community and included genera such as Terschellingia, Molgolaimus and Halalaimus, suggesting that top-down control by nematode grazing may be an important factor affecting Vibrio occurrence in these sediments. It is concluded that the benthic marine environment may function as a reservoir of Vibrio spp

  9. Antimicrobial susceptibilty of potentially pathogenic halophilic Vibrio ...

    African Journals Online (AJOL)

    Surveillance of antimicrobial resistance is indispensable for empirical treatment of infections and in preventing the spread of antimicrobial resistant microorganisms. This study is aimed at determining the antibiotic susceptibility of potentially pathogenic halophylic Vibrio species isolated in Lagos, Nigeria. Susceptibility ...

  10. Vibrio parahaemolyticus- An emerging foodborne pathogen

    Directory of Open Access Journals (Sweden)

    S Nelapati

    2012-02-01

    Full Text Available Vibrio parahaemolyticus is a halophilic gram negative, motile, oxidase positive, straight or curved rod-shaped, facultative anaerobic bacteria that occur naturally in the marine environment. They form part of the indigenous microflora of aquatic habitats of various salinity and are the major causative agents for some of the most serious diseases in fish, shellfish and penacid shrimp. This human pathogen causes acute gastroenteritis characterized by diarrhea, vomiting and abdominal cramps through consumption of contaminated raw fish or shellfish. V. parahaemolyticus is the leading cause of gastroenteritis due to the consumption of seafood worldwide. The incidence of V. parahaemolyticus infection has been increasing in many parts of the world, due to the emergence of O3:K6 serotype carrying the tdh gene which is responsible for most outbreaks worldwide. The pathogenicity of this organism is closely correlated with the Kanagawa phenomenon (KP + due to production of Kanagawa hemolysin or the thermostable direct hemolysin (TDH. The TDH and TRH (TDH-related hemolysin encoded by tdh and trh genes are considered to be important virulence factors. [Vet. World 2012; 5(1.000: 48-63

  11. Impact of milk fish farming in the tropics on potentially pathogenic vibrios.

    Science.gov (United States)

    Reichardt, W T; Reyes, J M; Pueblos, M J; Lluisma, A O

    2013-12-15

    Ratios of sucrose-negative to sucrose-positive vibrios on TCBS agar (suc-/suc+) indicate the abundance of potential human pathogenic non-cholera vibrios in coastal mariculture environments of the Lingayen Gulf (Philippines. In guts of adult maricultured milkfish (Chanos chanos) of suc- vibrios reached extreme peak values ranging between 2 and 545 million per g wet weight. Suc- vibrios outnumbered suc+ vibrios in anoxic sediments, too, and were rarely predominant in coastal waters or in oxidized sediments. Suc-/suc+ ratios in sediments increased toward the mariculture areas with distance from the open sea at decreasing redox potentials. There is circumstantial evidence that suc- vibrios can be dispersed from mariculture areas to adjacent environments including coral reefs. An immediate human health risk by pathogenic Vibrio species is discounted, since milkfish guts contained mainly members of the Enterovibrio group. A representative isolate of these contained proteolytic and other virulence factors, but no genes encoding toxins characteristic of clinical Vibrio species. Copyright © 2013 Elsevier Ltd. All rights reserved.

  12. Occurrences of pathogenic Vibrio parahaemolyticus from Vellar ...

    African Journals Online (AJOL)

    user

    2013-04-03

    2001). Vibrio vulnificus as a health hazard for shrimp consumers. Revista do Instituto de Medicina Tropical de Sao Paulo. 43: 263- 266. Sambrook J, Fritsch EF, Maniatis T (1989). Molecular Cloning: A. Laboratory Manual, 2nd ed.

  13. Vibriophages and Their Interactions with the Fish Pathogen Vibrio anguillarum

    DEFF Research Database (Denmark)

    Tan, Demeng; Gram, Lone; Middelboe, Mathias

    2014-01-01

    Vibrio anguillarum is an important pathogen in aquaculture, responsible for the disease vibriosis in many fish and invertebrate species. Disease control by antibiotics is a concern due to potential development and spread of antibiotic resistance. The use of bacteriophages to control the pathogen...

  14. Ocean warming and spread of pathogenic vibrios in the aquatic environment.

    Science.gov (United States)

    Vezzulli, Luigi; Colwell, Rita R; Pruzzo, Carla

    2013-05-01

    Vibrios are among the most common bacteria that inhabit surface waters throughout the world and are responsible for a number of severe infections both in humans and animals. Several reports recently showed that human Vibrio illnesses are increasing worldwide including fatal acute diarrheal diseases, such as cholera, gastroenteritis, wound infections, and septicemia. Many scientists believe this increase may be associated with global warming and rise in sea surface temperature (SST), although not enough evidence is available to support a causal link between emergence of Vibrio infections and climate warming. The effect of increased SST in promoting spread of vibrios in coastal and brackish waters is considered a causal factor explaining this trend. Field and laboratory studies carried out over the past 40 years supported this hypothesis, clearly showing temperature promotes Vibrio growth and persistence in the aquatic environment. Most recently, a long-term retrospective microbiological study carried out in the coastal waters of the southern North Sea provided the first experimental evidence for a positive and significant relationship between SST and Vibrio occurrence over a multidecadal time scale. As a future challenge, macroecological studies of the effects of ocean warming on Vibrio persistence and spread in the aquatic environment over large spatial and temporal scales would conclusively support evidence acquired to date combined with studies of the impact of global warming on epidemiologically relevant variables, such as host susceptibility and exposure. Assessing a causal link between ongoing climate change and enhanced growth and spread of vibrios and related illness is expected to improve forecast and mitigate future outbreaks associated with these pathogens.

  15. Characterization of the secretomes of two vibrios pathogenic to mollusks.

    Science.gov (United States)

    Madec, Stéphanie; Pichereau, Vianney; Jacq, Annick; Paillard, Mathieu; Boisset, Claire; Guérard, Fabienne; Paillard, Christine; Nicolas, Jean-Louis

    2014-01-01

    Vibrio tapetis causes the brown ring disease in the Japanese clam Ruditapes philippinarum while Vibrio aestuarianus is associated with massive oyster mortalities. As extracellular proteins are often associated with the virulence of pathogenic bacteria, we undertook a proteomic approach to characterize the secretomes of both vibrios. The extracellular proteins (ECPs) of both species were fractionated by SEC-FPLC and in vitro assays were performed to measure the effects of each fraction on hemocyte cellular parameters (phagocytosis and adhesion). Fractions showing a significant effect were subjected to SDS-PAGE, and proteins were identified by nano LC-MS/MS. 45 proteins were identified for V. aestuarianus and 87 for V. tapetis. Most of them belonged to outer membrane or were periplasmic, including porins or adhesins that were already described as virulence factors in other bacterial species. Others were transporter components, flagella proteins, or proteins of unknown function (14 and 15 respectively). Interestingly, for V. aestuarianus, we noted the secretion of 3 extracellular enzymes including the Vam metalloprotease and two other enzymes (one putative lipase and one protease). For V. tapetis, we identified five extracellular enymes, i.e. two different endochitinases, one protease, one lipase and an adhesin. A comparison of both secretomes also showed that only the putative extracellular lipase was common to both secretomes, underscoring the difference in pathogenicity mechanisms between these two species. Overall, these results characterize for the first time the secretomes of these two marine pathogenic vibrios and constitute a useful working basis to further analyze the contribution of specific proteins in the virulence mechanisms of these species.

  16. Genome analysis of the coral bleaching pathogen Vibrio shiloi.

    Science.gov (United States)

    Reshef, Leah; Ron, Eliora; Rosenberg, Eugene

    2008-08-01

    The past few decades have seen a world-wide increase in coral diseases, yet little is known about coral pathogens. In this study, techniques commonly used in pathogenomic research were applied to the coral pathogen Vibrio shiloi in order to identify genetic elements involved in its virulence. Suppressive subtractive hybridization was used to compare the gene content of V. shiloi to that of a closely related but non-pathogenic bacterium, Vibrio mediterranei, resulting in identification of several putative virulence factors and of three novel genomic islands. The entire genome of V. shiloi was further screened for genes related to previously characterized steps in infection: adhesion, superoxide dismutase production and toxin production. Exposure of pure cultures of V. shiloi to crushed coral tissues strongly affected the expression of seven genes encoding pili, zona occludins toxin (Zot) and a superoxide dismutase. Analysis of eight V. shiloi strains isolated in the last decade shows a shift of the natural population from strains carrying all three genomic islands to strains carrying none of them. This shift occurred following appearance of resistance in the coral Oculina patagonica to infection by V. shiloi. The relevance of these findings to the bleaching disease caused by V. shiloi is discussed.

  17. Vibrio Pathogens: A Public Health Concern in Rural Water Resources in Sub-Saharan Africa.

    Science.gov (United States)

    Osunla, Charles A; Okoh, Anthony I

    2017-10-07

    Members of the Vibrio genus are autochthonous inhabitants of aquatic environments and play vital roles in sustaining the aquatic milieu. The genus comprises about 100 species, which are mostly of marine or freshwater origin, and their classification is frequently updated due to the continuous discovery of novel species. The main route of transmission of Vibrio pathogens to man is through drinking of contaminated water and consumption inadequately cooked aquatic food products. In sub-Saharan Africa and much of the developing world, some rural dwellers use freshwater resources such as rivers for domestic activities, bathing, and cultural and religious purposes. This review describes the impact of inadequately treated sewage effluents on the receiving freshwater resources and the associated risk to the rural dwellers that depends on the water. Vibrio infections remain a threat to public health. In the last decade, Vibrio disease outbreaks have created alertness on the personal, economic, and public health uncertainties associated with the impact of contaminated water in the aquatic environment of sub-Saharan Africa. In this review, we carried out an overview of Vibrio pathogens in rural water resources in Sub-Saharan Africa and the implication of Vibrio pathogens on public health. Continuous monitoring of Vibrio pathogens among environmental freshwater and treated effluents is expected to help reduce the risk associated with the early detection of sources of infection, and also aid our understanding of the natural ecology and evolution of Vibrio pathogens.

  18. Vibrio Pathogens: A Public Health Concern in Rural Water Resources in Sub-Saharan Africa

    Directory of Open Access Journals (Sweden)

    Charles A. Osunla

    2017-10-01

    Full Text Available Members of the Vibrio genus are autochthonous inhabitants of aquatic environments and play vital roles in sustaining the aquatic milieu. The genus comprises about 100 species, which are mostly of marine or freshwater origin, and their classification is frequently updated due to the continuous discovery of novel species. The main route of transmission of Vibrio pathogens to man is through drinking of contaminated water and consumption inadequately cooked aquatic food products. In sub-Saharan Africa and much of the developing world, some rural dwellers use freshwater resources such as rivers for domestic activities, bathing, and cultural and religious purposes. This review describes the impact of inadequately treated sewage effluents on the receiving freshwater resources and the associated risk to the rural dwellers that depends on the water. Vibrio infections remain a threat to public health. In the last decade, Vibrio disease outbreaks have created alertness on the personal, economic, and public health uncertainties associated with the impact of contaminated water in the aquatic environment of sub-Saharan Africa. In this review, we carried out an overview of Vibrio pathogens in rural water resources in Sub-Saharan Africa and the implication of Vibrio pathogens on public health. Continuous monitoring of Vibrio pathogens among environmental freshwater and treated effluents is expected to help reduce the risk associated with the early detection of sources of infection, and also aid our understanding of the natural ecology and evolution of Vibrio pathogens.

  19. Onderzoek pathogene vibrio soorten in Nederlandse mosselen en oesters in augustus en september 2003

    NARCIS (Netherlands)

    Aalberts, C.H.J.

    2003-01-01

    Naar aanleiding van de hoge weerstemperatuur in augustus 2003 zijn in de kweek- en verwatergebieden van mosselen en oesters in Nederland enkele monsters onderzocht op de aanwezigheid van voor de mens pathogene vibrio soorten. In geen van de 18 monsters is Vibrio parahaemolyticus, vulnificus of

  20. Complete genome sequence for the shellfish pathogen Vibrio coralliilyticus RE98 isolated from a shellfish hatchery

    Science.gov (United States)

    Vibrio coralliilyticus is a pathogen of corals and larval shellfish. Publications on strain RE98 list it as a Vibrio tubiashii; however, whole genome sequencing confirms RE98 as V. coralliilyticus containing a total of 6,037,824 bp consisting of two chromosomes (3,420,228 and 1,917,482 bp), and two...

  1. Reclassification of the larval pathogen for marine bivalves Vibrio tubiashii subsp. europaeus as Vibrio europaeus sp. nov.

    Science.gov (United States)

    Dubert, Javier; Romalde, Jesús L; Spinard, Edward J; Nelson, David R; Gomez-Chiarri, Marta; Barja, Juan L

    2016-11-01

    The Orientalis clade has a relevant significance for bivalve aquaculture since it includes the pathogens Vibrio bivalvicida, Vibrio tubiashii subsp. tubiashii and Vibrio tubiashii subsp. europaeus. However, the previous taxonomic description of the subspecies of V. tubiashii shows some incongruities that should be emended. In the genomic age, the comparison between genome assemblies is the key to clarify the taxonomic position of both subspecies. With this purpose, we have tested the ability of multilocus sequence analysis based on eight housekeeping gene sequences (gapA, gyrB, ftsZ, mreB, pyrH, recA, rpoA and topA), different in silico genome-to-genome comparisons, chemotaxonomic features and phenotypic traits to reclassify the subspecies V. tubiashii subsp. europaeus within the Orientalis clade. This polyphasic approach clearly demonstrated that this subspecies is phylogenetically and phenotypically distinct from V. tubiashii and should be elevated to the rank of species as Vibrio europaeus sp. nov. This reclassification allows us to update the Orientalis clade (V. bivalvicida,V. brasiliensis, V. crosai, V. hepatarius, V. orientalis, V. sinaloensis, V. tubiashii and V. europaeus sp. nov.) and reconstruct a better phylogeny of the genus Vibrio. An emended description of V. tubiashii is provided. Finally, the proposed novel species is represented by emergent bivalve pathogens [type strain PP-638T (=CECT 8136T=DSM 27349T), PP2-843 and 07/118 T2] responsible for high mortalities in Spanish and French hatcheries.

  2. Urea hydrolysis can predict the potential pathogenicity of Vibrio parahaemolyticus strains isolated in the Pacific Northwest.

    Science.gov (United States)

    Kaysner, C A; Abeyta, C; Trost, P A; Wetherington, J H; Jinneman, K C; Hill, W E; Wekell, M M

    1994-01-01

    The ability of some strains of Vibrio parahaemolyticus to hydrolyze urea (uh+) can be used as a marker to predict which strains isolated from molluscan shellfish harvested in the Pacific Northwest are potentially pathogenic. The thermostable direct hemolysin-producing (TDH+) characteristic is a marker that is correlated with potential pathogenicity, and all of the TDH+ strains that we have isolated have been found to be uh+. Most of the uh+ strains belong to somatic antigen groups O3, O4 and O5. TDH+ strains are usually members of groups O4 and O5. The strains most often associated with human illness are members of the uh+, O4 group. The test for urease production is a simple screening test that can be helpful in predicting which strains are potentially pathogenic. PMID:8085837

  3. Complete Genome Sequence of Vibrio fischeri: A Symbiotic Bacterium with Pathogenic Congeners

    National Research Council Canada - National Science Library

    E. G. Ruby; M. Urbanowski; J. Campbell; A. Dunn; M. Faini; R. Gunsalus; P. Lostroh; C. Lupp; J. McCann; D. Millikan; A. Schaefer; E. Stabb; A. Stevens; K. Visick; C. Whistler; E. P. Greenberg

    2005-01-01

    Vibrio fischeri belongs to the Vibrionaceae, a large family of marine γ-proteobacteria that includes several dozen species known to engage in a diversity of beneficial or pathogenic interactions with animal tissue...

  4. The emergence of Vibrio pathogens in Europe: ecology, evolution, and pathogenesis (Paris, 11-12th March 2015).

    Science.gov (United States)

    Le Roux, Frédérique; Wegner, K Mathias; Baker-Austin, Craig; Vezzulli, Luigi; Osorio, Carlos R; Amaro, Carmen; Ritchie, Jennifer M; Defoirdt, Tom; Destoumieux-Garzón, Delphine; Blokesch, Melanie; Mazel, Didier; Jacq, Annick; Cava, Felipe; Gram, Lone; Wendling, Carolin C; Strauch, Eckhard; Kirschner, Alexander; Huehn, Stephan

    2015-01-01

    Global change has caused a worldwide increase in reports of Vibrio-associated diseases with ecosystem-wide impacts on humans and marine animals. In Europe, higher prevalence of human infections followed regional climatic trends with outbreaks occurring during episodes of unusually warm weather. Similar patterns were also observed in Vibrio-associated diseases affecting marine organisms such as fish, bivalves and corals. Basic knowledge is still lacking on the ecology and evolutionary biology of these bacteria as well as on their virulence mechanisms. Current limitations in experimental systems to study infection and the lack of diagnostic tools still prevent a better understanding of Vibrio emergence. A major challenge is to foster cooperation between fundamental and applied research in order to investigate the consequences of pathogen emergence in natural Vibrio populations and answer federative questions that meet societal needs. Here we report the proceedings of the first European workshop dedicated to these specific goals of the Vibrio research community by connecting current knowledge to societal issues related to ocean health and food security.

  5. The Emergence of Vibrio pathogens in Europe: Ecology, Evolution and Pathogenesis (Paris, 11-12 March 2015

    Directory of Open Access Journals (Sweden)

    Frederique eLe Roux

    2015-08-01

    Full Text Available Global change has caused a worldwide increase in reports of Vibrio-associated diseases with ecosystem-wide impacts on humans and marine animals. In Europe, higher prevalence of human infections followed regional climatic trends with outbreaks occurring during episodes of unusually warm weather. Similar patterns were also observed in Vibrio-associated diseases affecting marine organisms such as fish, bivalves and corals. Basic knowledge is still lacking on the ecology and evolutionary biology of these bacteria as well as on their virulence mechanisms. Current limitations in experimental systems to study infection and the lack of diagnostic tools still prevent a better understanding of Vibrio emergence. A major challenge is to foster cooperation between fundamental and applied research in order to investigate the consequences of pathogen emergence in natural Vibrio populations and answer federative questions that meet societal needs. Here we report the proceedings of the first European workshop dedicated to these specific goals of the Vibrio research community by connecting current knowledge to societal issues related to ocean health and food security.

  6. The emergence of Vibrio pathogens in Europe: ecology, evolution, and pathogenesis (Paris, 11–12th March 2015)

    Science.gov (United States)

    Roux, Frédérique Le; Wegner, K. Mathias; Baker-Austin, Craig; Vezzulli, Luigi; Osorio, Carlos R.; Amaro, Carmen; Ritchie, Jennifer M.; Defoirdt, Tom; Destoumieux-Garzón, Delphine; Blokesch, Melanie; Mazel, Didier; Jacq, Annick; Cava, Felipe; Gram, Lone; Wendling, Carolin C.; Strauch, Eckhard; Kirschner, Alexander; Huehn, Stephan

    2015-01-01

    Global change has caused a worldwide increase in reports of Vibrio-associated diseases with ecosystem-wide impacts on humans and marine animals. In Europe, higher prevalence of human infections followed regional climatic trends with outbreaks occurring during episodes of unusually warm weather. Similar patterns were also observed in Vibrio-associated diseases affecting marine organisms such as fish, bivalves and corals. Basic knowledge is still lacking on the ecology and evolutionary biology of these bacteria as well as on their virulence mechanisms. Current limitations in experimental systems to study infection and the lack of diagnostic tools still prevent a better understanding of Vibrio emergence. A major challenge is to foster cooperation between fundamental and applied research in order to investigate the consequences of pathogen emergence in natural Vibrio populations and answer federative questions that meet societal needs. Here we report the proceedings of the first European workshop dedicated to these specific goals of the Vibrio research community by connecting current knowledge to societal issues related to ocean health and food security. PMID:26322036

  7. Glucose- but not rice-based oral rehydration therapy enhances the production of virulence determinants in the human pathogen Vibrio cholerae.

    Directory of Open Access Journals (Sweden)

    Juliane Kühn

    2014-12-01

    Full Text Available Despite major attempts to prevent cholera transmission, millions of people worldwide still must address this devastating disease. Cholera research has so far mainly focused on the causative agent, the bacterium Vibrio cholerae, or on disease treatment, but rarely were results from both fields interconnected. Indeed, the treatment of this severe diarrheal disease is mostly accomplished by oral rehydration therapy (ORT, whereby water and electrolytes are replenished. Commonly distributed oral rehydration salts also contain glucose. Here, we analyzed the effects of glucose and alternative carbon sources on the production of virulence determinants in the causative agent of cholera, the bacterium Vibrio cholerae during in vitro experimentation. We demonstrate that virulence gene expression and the production of cholera toxin are enhanced in the presence of glucose or similarly transported sugars in a ToxR-, TcpP- and ToxT-dependent manner. The virulence genes were significantly less expressed if alternative non-PTS carbon sources, including rice-based starch, were utilized. Notably, even though glucose-based ORT is commonly used, field studies indicated that rice-based ORT performs better. We therefore used a spatially explicit epidemiological model to demonstrate that the better performing rice-based ORT could have a significant impact on epidemic progression based on the recent outbreak of cholera in Haiti. Our results strongly support a change of carbon source for the treatment of cholera, especially in epidemic settings.

  8. Glucose- but not rice-based oral rehydration therapy enhances the production of virulence determinants in the human pathogen Vibrio cholerae.

    Science.gov (United States)

    Kühn, Juliane; Finger, Flavio; Bertuzzo, Enrico; Borgeaud, Sandrine; Gatto, Marino; Rinaldo, Andrea; Blokesch, Melanie

    2014-12-01

    Despite major attempts to prevent cholera transmission, millions of people worldwide still must address this devastating disease. Cholera research has so far mainly focused on the causative agent, the bacterium Vibrio cholerae, or on disease treatment, but rarely were results from both fields interconnected. Indeed, the treatment of this severe diarrheal disease is mostly accomplished by oral rehydration therapy (ORT), whereby water and electrolytes are replenished. Commonly distributed oral rehydration salts also contain glucose. Here, we analyzed the effects of glucose and alternative carbon sources on the production of virulence determinants in the causative agent of cholera, the bacterium Vibrio cholerae during in vitro experimentation. We demonstrate that virulence gene expression and the production of cholera toxin are enhanced in the presence of glucose or similarly transported sugars in a ToxR-, TcpP- and ToxT-dependent manner. The virulence genes were significantly less expressed if alternative non-PTS carbon sources, including rice-based starch, were utilized. Notably, even though glucose-based ORT is commonly used, field studies indicated that rice-based ORT performs better. We therefore used a spatially explicit epidemiological model to demonstrate that the better performing rice-based ORT could have a significant impact on epidemic progression based on the recent outbreak of cholera in Haiti. Our results strongly support a change of carbon source for the treatment of cholera, especially in epidemic settings.

  9. Vibrio ecology - Identifying Environmental Determinants Favorable for the Presence and Transmission of Pathogenic Vibrios

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — In a tri-coastal collaborative study, the population densities of vibrios are being determined in the Mississippi Sound, Puget Sound, Chesapeake Bay, and Timbalier...

  10. Persistence, seasonal dynamics and pathogenic potential of Vibrio communities from Pacific oyster hemolymph.

    Science.gov (United States)

    Wendling, Carolin C; Batista, Frederico M; Wegner, K Mathias

    2014-01-01

    Bacteria of the genus Vibrio occur at a continuum from free-living to symbiotic life forms, including opportunists and pathogens, that can contribute to severe diseases, for instance summer mortality events of Pacific oysters Crassostrea gigas. While most studies focused on Vibrio isolated from moribund oysters during mortality outbreaks, investigations of the Vibrio community in healthy oysters are rare. Therefore, we characterized the persistence, diversity, seasonal dynamics, and pathogenicity of the Vibrio community isolated from healthy Pacific oysters. In a reciprocal transplant experiment we repeatedly sampled hemolymph from adult Pacific oysters to differentiate population from site-specific effects during six months of in situ incubation in the field. We characterized virulence phenotypes and genomic diversity based on multilocus sequence typing in a total of 70 Vibrio strains. Based on controlled infection experiments we could show that strains with the ability to colonize healthy adult oysters can also have the potential to induce high mortality rates on larvae. Diversity and abundance of Vibrio varied significantly over time with highest values during and after spawning season. Vibrio communities from transplanted and stationary oysters converged over time, indicating that communities were not population specific, but rather assemble from the surrounding environment forming communities, some of which can persist over longer periods.

  11. Power plays: iron transport and energy transduction in pathogenic vibrios.

    Science.gov (United States)

    Kustusch, Ryan J; Kuehl, Carole J; Crosa, Jorge H

    2011-06-01

    The Vibrios are a unique group of bacteria inhabiting a vast array of aquatic environments. Many Vibrio species are capable of infecting a wide assortment of hosts. Some of these species include V. parahaemolyticus, V. alginolyticus, V. vulnificus, V. anguillarum, and V. cholerae. The ability of these organisms to utilize iron is essential in establishing both an infection in their hosts as well as surviving in the environment. Bacteria are able to sequester iron through the secretion of low molecular weight iron chelators termed siderophores. The iron-siderophore complexes are bound by specific outer membrane receptors and are brought through both the outer and inner membranes of the cell. The energy needed to drive this active transport is achieved through the TonB energy transduction system. When first elucidated in E. coli, the TonB system was shown to be a three protein complex consisting of TonB, ExbB and ExbD. Most Vibrio species carry two TonB systems. The second TonB system includes a fourth protein; TtpC, which is essential for TonB2 mediated iron transport. Some Vibrio species have been shown to carry a third TonB system that also includes a TtpC protein.

  12. Relationships between environmental factors and pathogenic Vibrios in the Northern Gulf of Mexico.

    Science.gov (United States)

    Johnson, C N; Flowers, A R; Noriea, N F; Zimmerman, A M; Bowers, J C; DePaola, A; Grimes, D J

    2010-11-01

    Although autochthonous vibrio densities are known to be influenced by water temperature and salinity, little is understood about other environmental factors associated with their abundance and distribution. Densities of culturable Vibrio vulnificus containing vvh (V. vulnificus hemolysin gene) and V. parahaemolyticus containing tlh (thermolabile hemolysin gene, ubiquitous in V. parahaemolyticus), tdh (thermostable direct hemolysin gene, V. parahaemolyticus pathogenicity factor), and trh (tdh-related hemolysin gene, V. parahaemolyticus pathogenicity factor) were measured in coastal waters of Mississippi and Alabama. Over a 19-month sampling period, vibrio densities in water, oysters, and sediment varied significantly with sea surface temperature (SST). On average, tdh-to-tlh ratios were significantly higher than trh-to-tlh ratios in water and oysters but not in sediment. Although tlh densities were lower than vvh densities in water and in oysters, the opposite was true in sediment. Regression analysis indicated that SST had a significant association with vvh and tlh densities in water and oysters, while salinity was significantly related to vibrio densities in the water column. Chlorophyll a levels in the water were correlated significantly with vvh in sediment and oysters and with pathogenic V. parahaemolyticus (tdh and trh) in the water column. Furthermore, turbidity was a significant predictor of V. parahaemolyticus density in all sample types (water, oyster, and sediment), and its role in predicting the risk of V. parahaemolyticus illness may be more important than previously realized. This study identified (i) culturable vibrios in winter sediment samples, (ii) niche-based differences in the abundance of vibrios, and (iii) predictive signatures resulting from correlations between environmental parameters and vibrio densities.

  13. Vibrio bivalvicida sp. nov., a novel larval pathogen for bivalve molluscs reared in a hatchery.

    Science.gov (United States)

    Dubert, Javier; Romalde, Jesús L; Prado, Susana; Barja, Juan L

    2016-02-01

    Three isolates were obtained from cultures of carpet shell clam (Ruditapes decussatus) reared in a bivalve hatchery (Galicia, NW Spain) from different sources: healthy broodstock, moribund larvae and the seawater corresponding to the larval tank. All isolates were studied by a polyphasic approach, including a phylogenetic analysis based on concatenated sequences of the five housekeeping genes ftsZ, gyrB, pyrH, recA and rpoA. The analysis supported their inclusion in the Orientalis clade of the genus Vibrio, and they formed a tight group separated from the closest relatives: Vibrio tubiashii subsp. europaensis, Vibrio tubiashii subsp. tubiashii and Vibrio orientalis. The percentages of genomic resemblance, including average nucleotide identity, DNA-DNA hybridization and in silico genome-to-genome comparison, between the type strain and the closest relatives were below values for species delineation and confirmed the taxonomic position of the new species, which could be differentiated from the related taxa on the basis of several phenotypic and chemotaxonomic features, including FAME and MALDI-TOF-MS. The pathogenicity of the new species was demonstrated in larvae of R. decussatus, Ruditapes philippinarum, Ostrea edulis and Donax trunculus. The results demonstrated that the strains analyzed represented a novel species in the Orientalis clade of the genus Vibrio, for which the name Vibrio bivalvicida sp. nov. is proposed, with 605(T) (= CECT 8855(T)=CAIM 1904(T)) designated as the type strain. Copyright © 2015 Elsevier GmbH. All rights reserved.

  14. Draft Genome Sequences of the Fish Pathogen Vibrio harveyi Strains VH2 and VH5

    DEFF Research Database (Denmark)

    Castillo, Daniel; D'Alvise, Paul; Middelboe, Mathias

    2015-01-01

    Vibrio harveyi is an important marine pathogen that is responsible for vibriosis outbreaks in cultured fish and invertebrates worldwide. Here, we announce the draft genome sequences of V. harveyi strains VH2 and VH5, isolated from farmed juvenile Seriola dumerili during outbreaks of vibriosis...

  15. Comparative Genome Analyses of Vibrio anguillarum Strains Reveal a Link with Pathogenicity Traits

    DEFF Research Database (Denmark)

    Castillo, Daniel; D'Alvise, Paul; Xu, Ruiqi

    2017-01-01

    Vibrio anguillarum is a marine bacterium that can cause vibriosis in many fish and shellfish species, leading to high mortalities and economic losses in aquaculture. Although putative virulence factors have been identified, the mechanism of pathogenesis of V. anguillarum is not fully understood...... a link between genotype and virulence characteristics of Vibrio anguillarum, which can be used to unravel the molecular evolution of V. anguillarum and can also be important from survey and diagnostic perspectives. Importance : Comparative genome analysis of strains of a pathogenic bacterial species can...

  16. Adverse Effects of Immobilised Pseudoalteromonas on the Fish Pathogenic Vibrio anguillarum: An In Vitro Study

    Directory of Open Access Journals (Sweden)

    Wiebke Wesseling

    2016-01-01

    Full Text Available As a prerequisite for use in marine aquaculture, two immobilisation systems were developed by employing the probiotic bacterium Pseudoalteromonas sp. strain MLms_gA3. Their impact on the survivability of the fish pathogen Vibrio anguillarum was explored. Probiotic bacteria either grown as a biofilm on ceramic tiles or embedded in alginate beads were added to sterile artificial seawater that contained the fish pathogen. While immobilisation on ceramics followed a recently developed protocol, a medium allowing for alginate microencapsulation was newly developed. Anti-Vibrio activities were obtained with both immobilisation systems. The viable cell counts of V. anguillarum constantly decreased within the first two weeks of the treatments evidencing the potential of the immobilisation systems for providing probiotic-based protection against this pathogen.

  17. Antagonistic effect of Pseudomonas aeruginosa isolates from various ecological niches on Vibrio species pathogenic to crustaceans

    Directory of Open Access Journals (Sweden)

    Prabhakaran Priyaja

    2014-01-01

    Full Text Available Objective: To abrogate pathogenic vibrios in aquaculture by testing the potential of Pseudomonas isolates from fresh water, brackish and marine environments as probiotics. Methods: Purification and structural elucidation of antagonistic compound were carried out. Antagonistic activity of the compound against 7 Vibrio spp. was performed. Influence of salinity on the production of pyocyanin and the toxicity was done through the compound using brine shrimp lethality assay. Molecular characterization was performed to confirm that the isolates were Pseudomonas aeruginosa. Results: Salinity was found to regulate the levels of pyocyanin production, with 5-10 g/L as the optimum. All Pseudomonas isolates grew at salinities ranging from 5 to 70 g/L. Isolates of marine origin produced detectable levels of pyocyanin up to 45 g/L salinity. Brackish and freshwater isolates ceased to produce pyocyanin at salinities above 30 g/L and 20 g/L, respectively. Culture supernatants of all 5 Pseudomonas isolates possessed the ability to restrict the growth of Vibrio spp. and maximum antagonistic effect on Vibrio harveyi was obtained when they were grown at salinities of 5 to 10 g/L. The marine isolate MCCB117, even when grown at a salinity of 45 g/L possessed the ability to inhibit Vibrio spp. Conclusions: The present investigation showed that Pseudomonas aeruginosa MCCB119 would be ideal for application in freshwater, MCCB102 and MCCB103 in brackish water and MCCB117 and MCCB118 in marine aquaculture systems as putative probiotics in the management of vibrios.

  18. Occurrence and distribution of bacteria indicators, chemical tracers and pathogenic vibrios in Singapore coastal waters.

    Science.gov (United States)

    Goh, Shin Giek; Bayen, Stéphane; Burger, David; Kelly, Barry C; Han, Ping; Babovic, Vladan; Gin, Karina Yew-Hoong

    2017-01-15

    Water quality in Singapore's coastal area was evaluated with microbial indicators, pathogenic vibrios, chemical tracers and physico-chemical parameters. Sampling sites were grouped into two clusters (coastal sites at (i) northern and (ii) southern part of Singapore). The coastal sites located at northern part of Singapore along the Johor Straits exhibited greater pollution. Principal component analysis revealed that sampling sites at Johor Straits have greater loading on carbamazepine, while turbidity poses greater influence on sampling sites at Singapore Straits. Detection of pathogenic vibrios was also more prominent at Johor Straits than the Singapore Straits. This study examined the spatial variations in Singapore's coastal water quality and provided the baseline information for health risk assessment and future pollution management. Copyright © 2016 Elsevier Ltd. All rights reserved.

  19. Immune response of shrimp (Penaeus monodon against Vibrios furnissii pathogen

    Directory of Open Access Journals (Sweden)

    Kumaran Subramanian

    2014-04-01

    Full Text Available Objective: To analyse experimental infection and immune system of shrimp (Penaeus monodon against Vibrios furnissii (V. furnissii. Methods: Experimental animals were collected and acclimatized by maintaining specific temperature, pH and salinity to avoid mortality. Shrimps were experimentally infected with V. furnissii and their immune responses were monitored. After the infection all the shrimps were monitored for any symptoms, death rate in 0, 12, 24, 36, 48 h. Then haemolymph were collected and tetrahydrocannabinol, phenol oxidase, nitroblue tetrazolium and lysozyme were monitored in every 12 h at the interval of 48 h. Results: Shrimps infected by live V. furnissii had showed gradual increase in tetrahydrocannabinol, phenol oxidase activity, nitro-blue-tetrazolium and lysozyme activity comparing with the killed and control. Conclusions: The live V. furnissii had showed infection in the shrimp immune system. The live V. furnissii shows infection in experimental shrimps comparing with killed V. furnissii. So the V. furnissii in nature cause the infection in shrimp Penaeus monodon immune system. This report could be applied to control of the infection in shrimp hatchery.

  20. A single regulatory gene is sufficient to alter Vibrio aestuarianus pathogenicity in oysters.

    Science.gov (United States)

    Goudenège, David; Travers, Marie Agnès; Lemire, Astrid; Petton, Bruno; Haffner, Philippe; Labreuche, Yannick; Tourbiez, Delphine; Mangenot, Sophie; Calteau, Alexandra; Mazel, Didier; Nicolas, Jean Louis; Jacq, Annick; Le roux, Frédérique

    2015-11-01

    Oyster diseases caused by pathogenic vibrios pose a major challenge to the sustainability of oyster farming. In France, since 2012 a disease affecting specifically adult oysters has been associated with the presence of Vibrio aestuarianus. Here, by combining genome comparison, phylogenetic analyses and high-throughput infections of strains isolated before or during the recent outbreaks, we show that virulent strains cluster into two V. aestuarianus lineages independently of the sampling dates. The bacterial lethal dose was not different between strains isolated before or after 2012. Hence, the emergence of a new highly virulent clonal strain is unlikely. Each lineage comprises nearly identical strains, the majority of them being virulent, suggesting that within these phylogenetically coherent virulent lineages a few strains have lost their pathogenicity. Comparative genomics allowed the identification of a single frameshift in a non-virulent strain. This mutation affects the varS gene that codes for a signal transduction histidine-protein kinase. Genetic analyses confirmed that varS is necessary for infection of oysters and for a secreted metalloprotease expression. For the first time in a Vibrio species, we show here that VarS is a key factor of pathogenicity. © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.

  1. [Pathogenicity island region of clinical and environmental strains of Vibrio parahaemolyticus, isolated in Chile].

    Science.gov (United States)

    Núñez, Harold; Ulloa, María Teresa; Guerra, Fabiola; Osorio, Carlos G

    2009-02-01

    Most clinical isolates of Vibrio parahaemolyticus produce a major virulence factor known as the thermostable direct hemolysin (TDH). TDH is encoded by the tdh gene which is located in a genomic pathogenicity island (PAI). Most environmental isolates are described as tdh negative. To assess if environmental strains lack the full pathogenicity island or if only the tdh gene is deleted. Thirty eight clinical and 66 environmental strains of Vibrio parahaemolyticus were studied. PAI was characterized by polymerase chain reaction (PCR). The presence of tdhA and tdhS genes, was determined by Southern blot. Fifty three environmental strains (80%) lacked a full PAI when compared with clinical strains. In environmental strains, Southern blot and sequence analysis showed that a genetic region of 80 kilobase pairs including genes from VPA1310 to VPA1396 was missing. These results highlight the genetic dynamism of Vibrio parahaemolyticus pathogenecity island region and suggest that new pathogenic strains could appear by horizontal transfer of the island between toxigenic and non-toxigenic strains.

  2. Human diseases associated with fish pathogens

    Directory of Open Access Journals (Sweden)

    VATSOS N. Ioannis

    2011-09-01

    Full Text Available Until recently, most cases of humans been affected by fish pathogens, bacterial and parasitic, were limited in certain countries, either due to the inappropriate sanitary measures used in those areas, or due to the local habit of eating raw or undercooked fish. However, as new reliable methods to identify fish pathogens in samples collected from sick humans have been developed, the confirmed cases worldwide have increased. The most common fish bacterial pathogens that can affect humans belong to the genera: Mycobacterium spp. (mainly M. marinum, M. chelonei, M. fortuitum, Nocardia spp., Streptococcus spp (S. iniae, Vibrio spp. (mainly V. vulnificus, V. alginolyticus and V. parahaemolyticus and Aeromonas spp. (mainly A. hydrophila and rarely A. sorbia and A. caviae. Less often, infections of humans with Edwardsiella tarda and Photobacterium damselae sbsp. damselae have been reported. Fish usually act as intermediate hosts to many important parasites of human, as for example the tapeworm Diphyllobothrium latum. To fish, these parasites cause no or little damage, as they are usually found encysted in many fish tissues. Of particular interest are someanisakids (e.g. Anisakis simplex and Pseudoterranova decipiens which can produce some thermostable allergens. Most of the above pathogens can infect humans through skin wounds or after ingesting infected fish. Compromised immune system of the infected humans may result in extensive spread of the pathogens within the body, often causing death.There are no fish viruses or fungi that can affect humans. Fish can also act as carriers for human pathogens, such as Salmonella spp., Escherichia coli and Listeria spp. Recently, few human pathogens have also been isolated from the internal organs of fish, as for example Brucella melitensis. The effects of these human pathogens to fish are still not known.

  3. A comparative epizootiologic study of the two fish-pathogenic serovars of Vibrio vulnificus biotype 2.

    Science.gov (United States)

    Fouz, B; Llorens, A; Valiente, E; Amaro, C

    2010-05-01

    Vibrio vulnificus biotype 2 is subdivided into two main serovars, serovar E, able to infect fish and humans, and serovar A, only virulent for fish. Serovar E emerged in 1976 as the causative agent of a haemorrhagic septicaemia (warm-water vibriosis) affecting eels cultured in brackish water. Serovar A emerged in 2000 in freshwater-cultured eels vaccinated against serovar E, causing warm-water vibriosis with fish showing a haemorrhagic intestine as the main differential sign. The aim of the present work was to compare the disease caused by both serovars in terms of transmission routes, portals of entry and host range. Results of bath, patch-contact and oral-anal challenges demonstrated that both serovars spread through water and infect healthy eels, serovar A entering mainly by the anus and serovar E by the gills. The course of the disease under laboratory conditions was similar for both serovars in terms of transmission and dependence of degree of virulence on water parameters (temperature and salinity). However, the decrease in degree of virulence in fresh water was significantly greater in serovar E than in serovar A. Finally, both serovars proved pathogenic for tilapia, sea bass and rainbow trout, but not for sea bream, with significant differences in degree of virulence only in rainbow trout. In conclusion, serovar A seems to represent a new antigenic form of V. vulnificus biotype 2 with an unusual portal of entry and is better adapted to fresh water than serovar E.

  4. The Vibrio cholerae cytolysin promotes chloride secretion from intact human intestinal mucosa.

    Directory of Open Access Journals (Sweden)

    Lucantonio Debellis

    Full Text Available BACKGROUND: The pathogenicity of the Vibrio cholerae strains belonging to serogroup O1 and O139 is due to the production of virulence factors such as cholera toxin (CT and the toxin-coregulated pilus (TCP. The remaining serogroups, which mostly lack CT and TCP, are more frequently isolated from aquatic environmental sources than from clinical samples; nevertheless, these strains have been reported to cause human disease, such as sporadic outbreaks of watery diarrhoea and inflammatory enterocolitis. This evidence suggested the possibility that other virulence factor(s than cholera toxin might be crucial in the pathogenesis of Vibrio cholerae-induced diarrhoea, but their nature remains unknown. VCC, the hemolysin produced by virtually all Vibrio cholerae strains, has been proposed as a possible candidate, though a clear-cut demonstration attesting VCC as crucial in the pathogenesis of Vibrio cholerae-induced diarrhoea is still lacking. METHODOLOGY/PRINCIPAL FINDINGS: Electrophysiological parameters and paracellular permeability of stripped human healthy colon tissues, obtained at subtotal colectomy, mounted in Ussing chamber were studied in the presence or absence of VCC purified from culture supernatants of V. cholerae O1 El Tor strain. Short circuit current (I(SC and transepithelial resistance (R(T were measured by a computerized voltage clamp system. The exposure of sigmoid colon specimens to 1 nM VCC resulted in an increase of I(SC by 20.7%, with respect to the basal values, while R(T was reduced by 12.3%. Moreover, increase in I(SC was abolished by bilateral Cl(- reduction. CONCLUSION/SIGNIFICANCE: Our results demonstrate that VCC, by forming anion channels on the apical membrane of enterocytes, triggers an outward transcellular flux of chloride. Such an ion movement, associated with the outward movement of Na(+ and water, might be responsible for the diarrhoea caused by the non-toxigenic strains of Vibrio cholerae.

  5. Molecular Detection of the Three Major Pathogenic Vibrio Species from Seafood Products and Sediments in Tunisia Using Real-Time PCR.

    Science.gov (United States)

    Gdoura, Morsi; Sellami, Hanen; Nasfi, Hanen; Trabelsi, Rahma; Mansour, Sabeur; Attia, Touraya; Nsaibia, Siwar; Vallaeys, Tatiana; Gdoura, Radhouane; Siala, Mariam

    2016-12-01

    Vibrio spp. have emerged as a serious threat to human health worldwide. V. parahaemolyticus , V. cholerae , and V. vulnificus pose a considerable public health risk in Tunisia because they cause sporadic and epidemic foodborne infections associated with the consumption of raw or undercooked contaminated seafood. More recently, toxR-positive V. alginolyticus was also reported to be a potential source of contaminated seafood. A total of 247 samples, including 113 fishes ( Labrus viridis , Penaeus kerathurus , Diplodus annularis , Diplodus sparaillon , Scorparna porcus , Sarpa salpa , Dentex dentex , Scorparna scrofa , Sardinella aurita , Trachurus trachurus , Synodus saurus , Pagellus erythrinus , and Metapenaeus monoceros ), 83 clams ( Ruditapes decussatus species), 30 seawater samples, and 21 sediment samples were analyzed using traditional culture methods (ISO/TS 21872-1; International Organization for Standardization 2007) and a conventional PCR method for Vibrio spp. A rapid, sensitive, and highly reproducible real-time PCR assay was developed to detect the three major Vibrio spp. pathogenic for humans in Tunisian seafood products and sediments. A conventional culture method found 102 (41.3%) of 247 analyzed samples positive for Vibrio spp.; a conventional PCR method found 126 (51%) of the 247 samples positive. Real-time PCR assay found 126 (51.1%) samples positive; V. alginolyticus toxR was the most common, found in 99 (78.57%) of samples, followed by V. parahaemolyticus in 26 (20.63%) and V. cholerae in 1 (0.7%). All culture-positive samples were PCR positive. However, 24 samples that were positive by conventional PCR and real-time PCR were culture negative. Our findings indicate that retail seafood is commonly contaminated with Vibrio spp. and presents a potential risk to human health in Tunisia. These data also indicate that real-time PCR can provide sensitive species-specific detection of Vibrio spp. in seafood without prior isolation and characterization

  6. Sigma E regulators control hemolytic activity and virulence in a shrimp pathogenic Vibrio harveyi.

    Directory of Open Access Journals (Sweden)

    Pimonsri Rattanama

    Full Text Available Members of the genus Vibrio are important marine and aquaculture pathogens. Hemolytic activity has been identified as a virulence factor in many pathogenic vibrios including V. cholerae, V. parahaemolyticus, V. alginolyticus, V. harveyi and V. vulnificus. We have used transposon mutagenesis to identify genes involved in the hemolytic activity of shrimp-pathogenic V. harveyi strain PSU3316. Out of 1,764 mutants screened, five mutants showed reduced hemolytic activity on sheep blood agar and exhibited virulence attenuation in shrimp (Litopenaeus vannamei. Mutants were identified by comparing transposon junction sequences to a draft of assembly of the PSU3316 genome. Surprisingly none of the disrupted open reading frames or gene neighborhoods contained genes annotated as hemolysins. The gene encoding RseB, a negative regulator of the sigma factor (σ(E, was interrupted in 2 out of 5 transposon mutants, in addition, the transcription factor CytR, a threonine synthetase, and an efflux-associated cytoplasmic protein were also identified. Knockout mutations introduced into the rpoE operon at the rseB gene exhibited low hemolytic activity in sheep blood agar, and were 3-to 7-fold attenuated for colonization in shrimp. Comparison of whole cell extracted proteins in the rseB mutant (PSU4030 to the wild-type by 2-D gel electrophoresis revealed 6 differentially expressed proteins, including two down-regulated porins (OmpC-like and OmpN and an upregulated protease (DegQ which have been associated with σ(E in other organisms. Our study is the first report linking hemolytic activity to the σ(E regulators in pathogenic Vibrio species and suggests expression of this virulence-linked phenotype is governed by multiple regulatory pathways within the V. harveyi.

  7. Vibrio cholerae Infection of Drosophilamelanogaster Mimics the Human Disease Cholera.

    Directory of Open Access Journals (Sweden)

    2005-09-01

    Full Text Available Cholera, the pandemic diarrheal disease caused by the gram-negative bacterium Vibrio cholerae, continues to be a major public health challenge in the developing world. Cholera toxin, which is responsible for the voluminous stools of cholera, causes constitutive activation of adenylyl cyclase, resulting in the export of ions into the intestinal lumen. Environmental studies have demonstrated a close association between V. cholerae and many species of arthropods including insects. Here we report the susceptibility of the fruit fly, Drosophila melanogaster, to oral V. cholerae infection through a process that exhibits many of the hallmarks of human disease: (i death of the fly is dependent on the presence of cholera toxin and is preceded by rapid weight loss; (ii flies harboring mutant alleles of either adenylyl cyclase, Gsalpha, or the Gardos K channel homolog SK are resistant to V. cholerae infection; and (iii ingestion of a K channel blocker along with V. cholerae protects wild-type flies against death. In mammals, ingestion of as little as 25 mug of cholera toxin results in massive diarrhea. In contrast, we found that ingestion of cholera toxin was not lethal to the fly. However, when cholera toxin was co-administered with a pathogenic strain of V. cholerae carrying a chromosomal deletion of the genes encoding cholera toxin, death of the fly ensued. These findings suggest that additional virulence factors are required for intoxication of the fly that may not be essential for intoxication of mammals. Furthermore, we demonstrate for the first time the mechanism of action of cholera toxin in a whole organism and the utility of D. melanogaster as an accurate, inexpensive model for elucidation of host susceptibility to cholera.

  8. Comparative genomics of pathogenic lineages of Vibrio nigripulchritudo identifies virulence-associated traits.

    Science.gov (United States)

    Goudenège, David; Labreuche, Yannick; Krin, Evelyne; Ansquer, Dominique; Mangenot, Sophie; Calteau, Alexandra; Médigue, Claudine; Mazel, Didier; Polz, Martin F; Le Roux, Frédérique

    2013-10-01

    Vibrio nigripulchritudo is an emerging pathogen of farmed shrimp in New Caledonia and other regions in the Indo-Pacific. The molecular determinants of V. nigripulchritudo pathogenicity are unknown; however, molecular epidemiological studies have suggested that pathogenicity is linked to particular lineages. Here, we performed high-throughput sequencing-based comparative genome analysis of 16 V. nigripulchritudo strains to explore the genomic diversity and evolutionary history of pathogen-containing lineages and to identify pathogen-specific genetic elements. Our phylogenetic analysis revealed three pathogen-containing V. nigripulchritudo clades, including two clades previously identified from New Caledonia and one novel clade comprising putatively pathogenic isolates from septicemic shrimp in Madagascar. The similar genetic distance between the three clades indicates that they have diverged from an ancestral population roughly at the same time and recombination analysis indicates that these genomes have, in the past, shared a common gene pool and exchanged genes. As each contemporary lineage is comprised of nearly identical strains, comparative genomics allowed differentiation of genetic elements specific to shrimp pathogenesis of varying severity. Notably, only a large plasmid present in all highly pathogenic (HP) strains encodes a toxin. Although less/non-pathogenic strains contain related plasmids, these are differentiated by a putative toxin locus. Expression of this gene by a non-pathogenic V. nigripulchritudo strain resulted in production of toxic culture supernatant, normally an exclusive feature of HP strains. Thus, this protein, here termed 'nigritoxin', is implicated to an extent that remains to be precisely determined in the toxicity of V. nigripulchritudo.

  9. Differential specificity of selective culture media for enumeration of pathogenic vibrios: advantages and limitations of multi-plating methods.

    Science.gov (United States)

    Nigro, Olivia D; Steward, Grieg F

    2015-04-01

    Plating environmental samples on vibrio-selective chromogenic media is a commonly used technique that allows one to quickly estimate concentrations of putative vibrio pathogens or to isolate them for further study. Although this approach is convenient, its usefulness depends directly on how well the procedure selects against false positives. We tested whether a chromogenic medium, CHROMagar Vibrio (CaV), used alone (single-plating) or in combination (double-plating) with a traditional medium thiosulfate-citrate-bile-salts (TCBS), could improve the discrimination among three pathogenic vibrio species (Vibrio cholerae, Vibrio parahaemolyticus, and Vibrio vulnificus) and thereby decrease the number of false-positive colonies that must be screened by molecular methods. Assays were conducted on water samples from two estuarine environments (one subtropical, one tropical) in a variety of seasonal conditions. The results of the double-plating method were confirmed by PCR and 16S rRNA sequencing. Our data indicate that there is no significant difference in the false-positive rate between CaV and TCBS when using a single-plating technique, but determining color changes on the two media sequentially (double-plating) reduced the rate of false positive identification in most cases. The improvement achieved was about two-fold on average, but varied greatly (from 0- to 5-fold) and depended on the sampling time and location. The double-plating method was most effective for V. vulnificus in warm months, when overall V. vulnificus abundance is high (false positive rates as low as 2%, n=178). Similar results were obtained for V. cholerae (minimum false positive rate of 16%, n=146). In contrast, the false positive rate for V. parahaemolyticus was always high (minimum of 59%, n=109). Sequence analysis of false-positive isolates indicated that the majority of confounding isolates are from the Vibrionaceae family, however, members of distantly related bacterial groups were also able to

  10. Virulence of an emerging pathogenic lineage of Vibrio nigripulchritudo is dependent on two plasmids.

    Science.gov (United States)

    Le Roux, Frédérique; Labreuche, Yannick; Davis, Brigid M; Iqbal, Naeem; Mangenot, Sophie; Goarant, Cyrille; Mazel, Didier; Waldor, Matthew K

    2011-02-01

    Vibrioses are the predominant bacterial infections in marine shrimp farms. Vibrio nigripulchritudo is an emerging pathogen of the cultured shrimp Litopenaeus stylirostris in New Caledonia and other regions in the Indo-Pacific. The molecular determinants of V. nigripulchritudo pathogenicity are unknown; however, molecular epidemiological studies have revealed that recent pathogenic V. nigripulchritudo isolates from New Caledonia all cluster into a monophyletic clade and contain a small plasmid, pB1067. Here, we report that a large plasmid, pA1066 (247 kb), can also serve as a marker for virulent V. nigripulchritudo, and that an ancestral version of this plasmid was likely acquired prior to other virulence-linked markers. Additionally, we demonstrate that pA1066 is critical for the full virulence of V. nigripulchritudo in several newly developed experimental models of infection. Plasmid pB1067 also contributes to virulence; only strains containing both plasmids induced the highest level of shrimp mortality. Thus, it appears that these plasmids, which are absent from non-pathogenic isolates, may be driving forces, as well as markers, for the emergence of a pathogenic lineage of V. nigripulchritudo.

  11. Transoceanic spreading of pathogenic strains of Vibrio parahaemolyticus with distinctive genetic signatures in the recA gene.

    Directory of Open Access Journals (Sweden)

    Narjol González-Escalona

    Full Text Available Vibrio parahaemolyticus is an important human pathogen whose transmission is associated with the consumption of contaminated seafood. Consistent multilocus sequence typing for V. parahaemolyticus has shown difficulties in the amplification of the recA gene by PCR associated with a lack of amplification or a larger PCR product than expected. In one strain (090-96, Peru, 1996, the produced PCR product was determined to be composed of two recA fragments derived from different Vibrio species. To better understand this phenomenon, we sequenced the whole genome of this strain. The hybrid recA gene was found to be the result of a fragmentation of the original lineage-specific recA gene resulting from a DNA insertion of approximately 30 kb in length. This insert had a G+C content of 38.8%, lower than that of the average G+C content of V. parahaemolyticus (45.2%, and contained 19 ORFs, including a complete recA gene. This new acquired recA gene deviated 24% in sequence from the original recA and was distantly related to recA genes from bacteria of the Vibrionaceae family. The reconstruction of the original recA gene (recA3 identified the precursor as belonging to ST189, a sequence type reported previously only in Asian countries. The identification of this singular genetic feature in strains from Asia reveals new evidence for genetic connectivity between V. parahaemolyticus populations at both sides of the Pacific Ocean that, in addition to the previously described pandemic clone, supports the existence of a recurrent transoceanic spreading of pathogenic V. parahaemolyticus with the corresponding potential risk of pandemic expansion.

  12. Sialic acid catabolism confers a competitive advantage to pathogenic vibrio cholerae in the mouse intestine.

    Science.gov (United States)

    Almagro-Moreno, Salvador; Boyd, E Fidelma

    2009-09-01

    Sialic acids comprise a family of nine-carbon ketosugars that are ubiquitous on mammalian mucous membranes. However, sialic acids have a limited distribution among Bacteria and are confined mainly to pathogenic and commensal species. Vibrio pathogenicity island 2 (VPI-2), a 57-kb region found exclusively among pathogenic strains of Vibrio cholerae, contains a cluster of genes (nan-nag) putatively involved in the scavenging (nanH), transport (dctPQM), and catabolism (nanA, nanE, nanK, and nagA) of sialic acid. The capacity to utilize sialic acid as a carbon and energy source might confer an advantage to V. cholerae in the mucus-rich environment of the gut, where sialic acid availability is extensive. In this study, we show that V. cholerae can utilize sialic acid as a sole carbon source. We demonstrate that the genes involved in the utilization of sialic acid are located within the nan-nag region of VPI-2 by complementation of Escherichia coli mutants and gene knockouts in V. cholerae N16961. We show that nanH, dctP, nanA, and nanK are highly expressed in V. cholerae grown on sialic acid. By using the infant mouse model of infection, we show that V. cholerae DeltananA strain SAM1776 is defective in early intestinal colonization stages. In addition, SAM1776 shows a decrease in the competitive index in colonization-competition assays comparing the mutant strain with both O1 El Tor and classical strains. Our data indicate an important relationship between the catabolism of sialic acid and bacterial pathogenesis, stressing the relevance of the utilization of the resources found in the host's environment.

  13. Sialic Acid Catabolism Confers a Competitive Advantage to Pathogenic Vibrio cholerae in the Mouse Intestine▿

    Science.gov (United States)

    Almagro-Moreno, Salvador; Boyd, E. Fidelma

    2009-01-01

    Sialic acids comprise a family of nine-carbon ketosugars that are ubiquitous on mammalian mucous membranes. However, sialic acids have a limited distribution among Bacteria and are confined mainly to pathogenic and commensal species. Vibrio pathogenicity island 2 (VPI-2), a 57-kb region found exclusively among pathogenic strains of Vibrio cholerae, contains a cluster of genes (nan-nag) putatively involved in the scavenging (nanH), transport (dctPQM), and catabolism (nanA, nanE, nanK, and nagA) of sialic acid. The capacity to utilize sialic acid as a carbon and energy source might confer an advantage to V. cholerae in the mucus-rich environment of the gut, where sialic acid availability is extensive. In this study, we show that V. cholerae can utilize sialic acid as a sole carbon source. We demonstrate that the genes involved in the utilization of sialic acid are located within the nan-nag region of VPI-2 by complementation of Escherichia coli mutants and gene knockouts in V. cholerae N16961. We show that nanH, dctP, nanA, and nanK are highly expressed in V. cholerae grown on sialic acid. By using the infant mouse model of infection, we show that V. cholerae ΔnanA strain SAM1776 is defective in early intestinal colonization stages. In addition, SAM1776 shows a decrease in the competitive index in colonization-competition assays comparing the mutant strain with both O1 El Tor and classical strains. Our data indicate an important relationship between the catabolism of sialic acid and bacterial pathogenesis, stressing the relevance of the utilization of the resources found in the host's environment. PMID:19564383

  14. Climate influence on Vibrio and associated human diseases during the past half-century in the coastal North Atlantic.

    Science.gov (United States)

    Vezzulli, Luigi; Grande, Chiara; Reid, Philip C; Hélaouët, Pierre; Edwards, Martin; Höfle, Manfred G; Brettar, Ingrid; Colwell, Rita R; Pruzzo, Carla

    2016-08-23

    Climate change is having a dramatic impact on marine animal and plant communities but little is known of its influence on marine prokaryotes, which represent the largest living biomass in the world oceans and play a fundamental role in maintaining life on our planet. In this study, for the first time to our knowledge, experimental evidence is provided on the link between multidecadal climatic variability in the temperate North Atlantic and the presence and spread of an important group of marine prokaryotes, the vibrios, which are responsible for several infections in both humans and animals. Using archived formalin-preserved plankton samples collected by the Continuous Plankton Recorder survey over the past half-century (1958-2011), we assessed retrospectively the relative abundance of vibrios, including human pathogens, in nine areas of the North Atlantic and North Sea and showed correlation with climate and plankton changes. Generalized additive models revealed that long-term increase in Vibrio abundance is promoted by increasing sea surface temperatures (up to ∼1.5 °C over the past 54 y) and is positively correlated with the Northern Hemisphere Temperature (NHT) and Atlantic Multidecadal Oscillation (AMO) climatic indices (P < 0.001). Such increases are associated with an unprecedented occurrence of environmentally acquired Vibrio infections in the human population of Northern Europe and the Atlantic coast of the United States in recent years.

  15. Visualization of coral host-pathogen interactions using a stable GFP-labeled Vibrio coralliilyticus strain

    Science.gov (United States)

    Pollock, F. Joseph; Krediet, Cory J.; Garren, Melissa; Stocker, Roman; Winn, Karina; Wilson, Bryan; Huete-Stauffer, Carla; Willis, Bette L.; Bourne, David G.

    2015-06-01

    The bacterium Vibrio coralliilyticus has been implicated as the causative agent of coral tissue loss diseases (collectively known as white syndromes) at sites across the Indo-Pacific and represents an emerging model pathogen for understanding the mechanisms linking bacterial infection and coral disease. In this study, we used a mini-Tn7 transposon delivery system to chromosomally label a strain of V. coralliilyticus isolated from a white syndrome disease lesion with a green fluorescent protein gene (GFP). We then tested the utility of this modified strain as a research tool for studies of coral host-pathogen interactions. A suite of biochemical assays and experimental infection trials in a range of model organisms confirmed that insertion of the GFP gene did not interfere with the labeled strain's virulence. Using epifluorescence video microscopy, the GFP-labeled strain could be reliably distinguished from non-labeled bacteria present in the coral holobiont, and the pathogen's interactions with the coral host could be visualized in real time. This study demonstrates that chromosomal GFP labeling is a useful technique for visualization and tracking of coral pathogens and provides a novel tool to investigate the role of V. coralliilyticus in coral disease pathogenesis.

  16. Ocean acidification and host-pathogen interactions: blue mussels, Mytilus edulis, encountering Vibrio tubiashii.

    Science.gov (United States)

    Asplund, Maria E; Baden, Susanne P; Russ, Sarah; Ellis, Robert P; Gong, Ningping; Hernroth, Bodil E

    2014-04-01

    Ocean acidification (OA) can shift the ecological balance between interacting organisms. In this study, we have used a model system to illustrate the interaction between a calcifying host organism, the blue mussel Mytilus edulis and a common bivalve bacterial pathogen, Vibrio tubiashii, with organisms being exposed to a level of acidification projected to occur by the end of the 21st century. OA exposures of the mussels were carried out in relative long-term (4 months) and short-term (4 days) experiments. We found no effect of OA on the culturability of V. tubiashii, in broth or in seawater. OA inhibited mussel shell growth and impaired crystalline shell structures but did not appear to affect mussel immune parameters (i.e haemocyte counts and phagocytotic capacity). Despite no evident impact on host immunity or growth and virulence of the pathogen, V. tubiashii was clearly more successful in infecting mussels exposed to long-term OA compared to those maintained under ambient conditions. Moreover, OA exposed V. tubiashii increased their viability when exposed to haemocytes of OA-treated mussel. Our findings suggest that even though host organisms may have the capacity to cope with periods of OA, these conditions may alter the outcome of host-pathogen interactions, favouring the success of the latter. © 2013 Society for Applied Microbiology and John Wiley & Sons Ltd.

  17. Molecular Epidemiology and Genetic Variation of Pathogenic Vibrio parahaemolyticus in Peru

    Science.gov (United States)

    Gavilan, Ronnie G.; Zamudio, Maria L.; Martinez-Urtaza, Jaime

    2013-01-01

    Vibrio parahaemolyticus is a foodborne pathogen that has become a public health concern at the global scale. The epidemiological significance of V. parahaemolyticus infections in Latin America received little attention until the winter of 1997 when cases related to the pandemic clone were detected in the region, changing the epidemic dynamics of this pathogen in Peru. With the aim to assess the impact of the arrival of the pandemic clone on local populations of pathogenic V. parahaemolyticus in Peru, we investigated the population genetics and genomic variation in a complete collection of non-pandemic strains recovered from clinical sources in Peru during the pre- and post-emergence periods of the pandemic clone. A total of 56 clinical strains isolated in Peru during the period 1994 to 2007, 13 strains from Chile and 20 strains from Asia were characterized by Multilocus Sequence Typing (MLST) and checked for the presence of Variable Genomic Regions (VGRs). The emergence of O3:K6 cases in Peru implied a drastic disruption of the seasonal dynamics of infections and a shift in the serotype dominance of pathogenic V. parahaemolyticus. After the arrival of the pandemic clone, a great diversity of serovars not previously reported was detected in the country, which supports the introduction of additional populations cohabitating with the pandemic group. Moreover, the presence of genomic regions characteristic of the pandemic clone in other non-pandemic strains may represent early evidence of genetic transfer from the introduced population to the local communities. Finally, the results of this study stress the importance of population admixture, horizontal genetic transfer and homologous recombination as major events shaping the structure and diversity of pathogenic V. parahaemolyticus. PMID:23696906

  18. Antiadhesive activity of poly-hydroxy butyrate biopolymer from a marine Brevibacterium casei MSI04 against shrimp pathogenic vibrios.

    Science.gov (United States)

    Kiran, George Seghal; Lipton, Anuj Nishanth; Priyadharshini, Sethu; Anitha, Kumar; Suárez, Lucia Elizabeth Cruz; Arasu, Mariadhas Valan; Choi, Ki Choon; Selvin, Joseph; Al-Dhabi, Naif Abdullah

    2014-08-13

    Vibrio pathogens are causative agents of mid-culture outbreaks, and early mortality syndrome and secondary aetiology of most dreadful viral outbreaks in shrimp aquaculture. Among the pathogenic vibrios group, Vibrio alginolyticus and V. harveyi are considered as the most significant ones in the grow-out ponds of giant black tiger shrimp Penaeus monodon in India. Use of antibiotics was banned in many countries due to the emergence of antibiotic-resistant strains and accumulation of residual antibiotics in harvested shrimp. There is an urgent need to consider the use of alternative antibiotics for the control of vibriosis in shrimp aquaculture. Biofilm formation is a pathogenic and/or establishment mechanism of Vibrio spp. This study aims to develop novel safe antibiofilm and/or antiadhesive process using PHB to contain vibrios outbreaks in shrimp aquaculture. In this study a poly-hydroxy butyrate (PHB) polymer producing bacterium Brevibacterium casei MSI04 was isolated from a marine sponge Dendrilla nigra and production of PHB was optimized under submerged-fermentation (SmF) conditions. The effect of carbon, nitrogen and mineral sources on PHB production and enhanced production of PHB by response surface methods were demonstrated. The maximum PHB accumulation obtained was 6.74 g/L in the optimized media containing 25 g/L starch as carbon source, 96 h of incubation, 35°C and 3% NaCl. The highest antiadhesive activity upto 96% was recorded against V. vulnificus, and V. fischeri, followed by 92% against V. parahaemolyticus and V. alginolyticus and 88% inhibition was recorded against V. harveyi. In this study, a thermostable biopolymer was chemically characterized as PHB based on 1HNMR spectra, FT-IR and GC-MS spectra. The NMR spectra revealed that the polymer was an isocratic homopolymer and it also confirmed that the compound was PHB. The antiadhesive activity of PHB was determined in microtitre plate assay and an effective concentration (EC) of PHB (200

  19. Real-time PCR detection and quantification of fish probiotic Phaeobacter strain 27-4 and fish pathogenic Vibrio in microalgae, rotifer, Artemia and first feeding turbot (Psetta maxima) larvae

    DEFF Research Database (Denmark)

    Prol, M.J.; Bruhn, Jesper Bartholin; Pintado, J.

    2009-01-01

    To develop a SYBR Green quantitative real-time PCR protocol enabling detection and quantification of a fish probiotic and two turbot pathogenic Vibrio spp. in microcosms. Phaeobacter 27-4, Vibrio anguillarum 90-11-287 and Vibrio splendidus DMC-1 were quantified as pure and mixed cultures and in p......To develop a SYBR Green quantitative real-time PCR protocol enabling detection and quantification of a fish probiotic and two turbot pathogenic Vibrio spp. in microcosms. Phaeobacter 27-4, Vibrio anguillarum 90-11-287 and Vibrio splendidus DMC-1 were quantified as pure and mixed cultures...

  20. The emergence of Vibrio pathogens in Europe: ecology, evolution, and pathogenesis (Paris, 11-12th March 2015)

    DEFF Research Database (Denmark)

    LeRoux, Frederique; Wegner, K. Mathias; Baker-Austin, Craig

    2015-01-01

    Global change has caused a worldwide increase in reports of Vibrio-associated diseases with ecosystem-wide impacts on humans and marine animals. In Europe, higher prevalence of human infections followed regional climatic trends with outbreaks occurring during episodes of unusually warm weather...

  1. Marine Lactobacillus pentosus H16 protects Artemia franciscana from Vibrio alginolyticus pathogenic effects.

    Science.gov (United States)

    Garcés, M E; Sequeiros, C; Olivera, N L

    2015-02-10

    Vibrio alginolyticus is an opportunistic pathogen which may affect different aquatic organisms. The aim of this study was to assess the probiotic properties and the protective mode of action of Lactobacillus pentosus H16 against V. alginolyticus 03/8525, through in vitro and in vivo studies using Artemia franciscana (hereafter Artemia). This strain showed antimicrobial activity against V. alginolyticus 03/8525 and Aeromonas salmonicida subsp. salmonicida ATCC33658 possibly related to lactobacilli organic acid production. It was able to survive at high rainbow trout bile concentrations and showed high selective adhesion to rainbow trout mucus (1.2×10(5)±8.0×10(3) cells cm(-2)). H16 outcompeted V. alginolyticus 03/8525 and A. salmonicida subsp. salmonicida ATCC33658, greatly reducing their adherence to rainbow trout mucus (64.8 and 74.1%, respectively). Moreover, H16 produced a cell-bound biosurfactant which caused an important decrease in the surface tension. H16 also protected Artemia nauplii against mortality when it was administered previous to V. alginolyticus 03/8525 inoculation. Furthermore, H16 bioencapsulated in Artemia, suggesting that it is possible to use live carriers in its administration. We conclude that the ability of L. pentosus H16 to selectively adhere to mucosal surfaces and produce cell-bound biosurfactants, displacing pathogenic strains, in addition to its antimicrobial activity, confer H16 competitive advantages against pathogens as demonstrated in in vivo challenge experiments. Thus, L. pentosus H16, a marine bacterium from the intestinal tract of hake, is an interesting probiotic for Artemia culture and also has the potential to prevent vibriosis in other aquaculture activities such as larvae culture and fish farming.

  2. FIRST ISOLATION OF VIBRIO PROBIOTICUS FROM THE GUT OF PORTUNUS PELAGICUS (LINNAEUS, 1758 AND ITS PROBIOTIC COMPETENCY AGAINST SHELLFISH PATHOGENS

    Directory of Open Access Journals (Sweden)

    Mhd Ikhwanuddin

    2012-09-01

    Full Text Available In this study, the Vibrio probioticus was isolated from the gut of female Portunus pleagicus, identified through 16S rDNA gene sequencing, and was evaluated for its probiotic features. The probiont was tested in co-culture assay at various concentrations against three target shellfish pathogens including V. harveyi, V. parahaemolyticus and Pseudoalteromonas piscicida. In a co-culture assay it was apparent that the V. probioticus had shown to outcompete the growth of tested pathogenic bacteria due to its antibacteriocin properties. Different ratios produced different effect on tested pathogens, however, the highest ratio (pathogen:probiont was more effective in suppressing the pathogen. A maximum inhibition growth was recorded for V. harveyi and P. piscicida. The probionts could further be tested in vivo culture environment to understand the effectiveness in microbial control of P. pelagicus larviculture and other aquaculture species.

  3. Human pathogen avoidance adaptations

    NARCIS (Netherlands)

    Tybur, J.M.; Lieberman, D.

    2016-01-01

    Over the past few decades, researchers have become increasingly interested in the adaptations guiding the avoidance of disease-causing organisms. Here we discuss the latest developments in this area, including a recently developed information-processing model of the adaptations underlying pathogen

  4. Vibrio cholerae pathogen from the freshwater-cultured whiteleg shrimp Penaeus vannamei and control with Bdellovibrio bacteriovorus.

    Science.gov (United States)

    Cao, Haipeng; An, Jian; Zheng, Weidong; He, Shan

    2015-09-01

    Vibriosis has become a major global economic problem in freshwater-farmed whiteleg shrimp (Penaeus vannamei). The prevention and control of vibriosis are now priority research topics. In this study, a pathogenic strain (QH) was isolated from vibriosis-infected freshwater-farmed P. vannamei that resulted in leg yellowing and was identified as a Vibrio cholerae isolate through phylogenetic analysis and the API 32GN system. A phylogenetic tree that was constructed using the neighbor-joining method further confirmed the QH isolate as a V. cholerae strain. A virulent outer membrane protein (ompU) gene was found to be present in the QH isolate, which further confirmed its pathogenicity. In addition, Bdellovibrio bacteriovorus conferred significant protection against V. cholerae: B. bacteriovorus exhibited significant bacteriolytic effects on the V. cholerae pathogen, possessed a wide prey range that included Vibrio pathogens, and displayed a positive protective efficacy against experimental V. cholerae infection in P. vannamei. To the best of our knowledge, this is the first report of the control of shrimp pathogen V. cholerae with B. bacteriovorus. Copyright © 2015 Elsevier Inc. All rights reserved.

  5. Following the infection process of vibriosis in Manila clam (Ruditapes philippinarum) larvae through GFP-tagged pathogenic Vibrio species.

    Science.gov (United States)

    Dubert, Javier; Nelson, David R; Spinard, Edward J; Kessner, Linda; Gomez-Chiarri, Marta; da Costa, Fiz; Prado, Susana; Barja, Juan L

    2016-01-01

    Vibriosis represents the main bottleneck for the larval production process in shellfish aquaculture. While the signs of this disease in bivalve larvae are well known, the infection process by pathogenic Vibrio spp. during episodes of vibriosis has not been elucidated. To investigate the infection process in bivalves, the pathogens of larvae as V. tubiashii subsp. europaensis, V. neptunius and V. bivalvicida were tagged with green fluorescent protein (GFP). Larvae of Manila clam (Ruditapes philippinarum) were inoculated with the GFP-labeled pathogens in different infection assays and monitored by microscopy. Manila clam larvae infected by distinct GFP-tagged Vibrio spp. in different challenges showed the same progression in the infection process, defining three infection stages. GFP-tagged Vibrio spp. were filtered by the larvae through the vellum and entered in the digestive system through the esophagus and stomach and colonized the digestive gland and particularly the intestine, where they proliferated during the first 2h of contact (Stage I), suggesting a chemotactic response. Then, GFP-tagged Vibrio spp. expanded rapidly to the surrounding organs in the body cavity from the dorsal to ventral region (Stage II; 6-8h), colonizing the larvae completely at the peak of infection (Stage III) (14-24h). Results demonstrated for the first time that the vibriosis is asymptomatic in Manila clam larvae during the early infection stages. Thus, the early colonization and the rapid proliferation of Vibrio pathogens within the body cavity supported the sudden and fatal effect of the vibriosis, since the larvae exhibited the first signs of disease when the infection process is advanced. As a first step in the elucidation of the potential mechanisms of bacterial pathogenesis in bivalve larvae the enzymatic activities of the extracellular products released from the wild type V. neptunius, V. tubiashii subsp. europaensis and V. bivalvicida were determined and their cytotoxicity was

  6. A novel protein, TtpC, is a required component of the TonB2 complex for specific iron transport in the pathogens Vibrio anguillarum and Vibrio cholerae.

    NARCIS (Netherlands)

    Stork, M.; Otto, B.R.; Crosa, J.H.

    2007-01-01

    Active transport across the outer membrane in gram-negative bacteria requires the energy that is generated by the proton motive force in the inner membrane. This energy is transduced to the outer membrane by the TonB protein in complex with the proteins ExbB and ExbB. In the pathogen Vibrio

  7. Members of the human gut microbiota involved in recovery from Vibrio cholerae infection.

    Science.gov (United States)

    Hsiao, Ansel; Ahmed, A M Shamsir; Subramanian, Sathish; Griffin, Nicholas W; Drewry, Lisa L; Petri, William A; Haque, Rashidul; Ahmed, Tahmeed; Gordon, Jeffrey I

    2014-11-20

    Given the global burden of diarrhoeal diseases, it is important to understand how members of the gut microbiota affect the risk for, course of, and recovery from disease in children and adults. The acute, voluminous diarrhoea caused by Vibrio cholerae represents a dramatic example of enteropathogen invasion and gut microbial community disruption. Here we conduct a detailed time-series metagenomic study of faecal microbiota collected during the acute diarrhoeal and recovery phases of cholera in a cohort of Bangladeshi adults living in an area with a high burden of disease. We find that recovery is characterized by a pattern of accumulation of bacterial taxa that shows similarities to the pattern of assembly/maturation of the gut microbiota in healthy Bangladeshi children. To define the underlying mechanisms, we introduce into gnotobiotic mice an artificial community composed of human gut bacterial species that directly correlate with recovery from cholera in adults and are indicative of normal microbiota maturation in healthy Bangladeshi children. One of the species, Ruminococcus obeum, exhibits consistent increases in its relative abundance upon V. cholerae infection of the mice. Follow-up analyses, including mono- and co-colonization studies, establish that R. obeum restricts V. cholerae colonization, that R. obeum luxS (autoinducer-2 (AI-2) synthase) expression and AI-2 production increase significantly with V. cholerae invasion, and that R. obeum AI-2 causes quorum-sensing-mediated repression of several V. cholerae colonization factors. Co-colonization with V. cholerae mutants discloses that R. obeum AI-2 reduces Vibrio colonization/pathogenicity through a novel pathway that does not depend on the V. cholerae AI-2 sensor, LuxP. The approach described can be used to mine the gut microbiota of Bangladeshi or other populations for members that use autoinducers and/or other mechanisms to limit colonization with V. cholerae, or conceivably other enteropathogens.

  8. Temporal and spatial variability in culturable pathogenic Vibrio spp. in Lake Pontchartrain, Louisiana, following hurricanes Katrina and Rita.

    Science.gov (United States)

    Nigro, Olivia D; Hou, Aixin; Vithanage, Gayatri; Fujioka, Roger S; Steward, Grieg F

    2011-08-01

    We investigated the abundance, distribution, and virulence gene content of Vibrio cholerae, V. parahaemolyticus, and V. vulnificus in the waters of southern Lake Pontchartrain in Louisiana on four occasions from October 2005 to September 2006, using selective cultivation and molecular assays. The three targeted pathogenic vibrios were generally below the detection level in January 2006, when the water was cold (13°C), and most abundant in September 2006, when the lake water was warmest (30°C). The maximum values for these species were higher than reported previously for the lake by severalfold to orders of magnitude. The only variable consistently correlated with total vibrio abundance within a single sampling was distance from shore (P = 0.000). Multiple linear regression of the entire data set revealed that distance from shore, temperature, and turbidity together explained 82.1% of the variability in total vibrio CFU. The log-transformed mean abundance of V. vulnificus CFU in the lake was significantly correlated with temperature (P = 0.014), but not salinity (P = 0.625). Virulence-associated genes of V. cholerae (ctx) and V. parahaemolyticus (trh and tdh) were not detected in any isolates of these species (n = 128 and n = 20, respectively). In contrast, 16S rRNA typing of V. vulnificus (n = 298) revealed the presence of both environmental (type A) and clinical (type B) strains. The percentage of the B-type V. vulnificus was significantly higher in the lake in October 2005 (35.8% of the total) than at other sampling times (P ≤ 0.004), consistent with the view that these strains represent distinct ecotypes.

  9. Essential oils of Nigella sativa protects Artemia from the pathogenic effect of Vibrio parahaemolyticus Dahv2.

    Science.gov (United States)

    Manju, Sivalingam; Malaikozhundan, Balasubramanian; Withyachumnarnkul, Boonsirm; Vaseeharan, Baskaralingam

    2016-05-01

    The anti-Vibrio activity of essential oils (EOs) of nine medicinal plants was tested against 28 Vibrio spp. isolated from diseased Fenneropenaeus indicus. EO of Nigella sativa exhibited anti-Vibrio activity against all Vibrio spp. and greater inhibition was noted for the isolate V2 which was identified as Vibrio parahaemolyticus Dahv2. Further, EO of N. sativa effectively inhibited V. parahaemolyticus Dahv2 with an inhibition zone of 23.9mm at 101.2μgml(-1). Moreover, EO of N. sativa revealed anti-biofilm activity at 101.2μgml(-1) against V. parahaemolyticus Dahv2 and inhibited the growth of V. parahaemolyticus Dahv2 at 100μgml(-1).In vivo experimental infection studies showed that the survival of Artemia spp. infected with V. parahaemolyticus Dahv2 at 1×10(3)cfuml(-1) was only 40%. However, the survival of Artemia spp. was significantly increased after challenge with 100μgml(-1) of EO of N. sativa. EO of N. sativa showed higher anti-oxidant potential and total phenol content than other EOs tested. The anti-oxidant activity of EO of N. sativa was highly correlated to their total phenolic contents (r=0.836, PArtemia spp. after experimental infection of V. parahaemolyticus Dahv2. Copyright © 2016 Elsevier Inc. All rights reserved.

  10. Molecular detection of human bacterial pathogens

    National Research Council Canada - National Science Library

    Liu, Dongyou

    2011-01-01

    .... Molecular Detection of Human Bacterial Pathogens addresses this issue, with international scientists in respective bacterial pathogen research and diagnosis providing expert summaries on current...

  11. Lectins in human pathogenic fungi.

    Science.gov (United States)

    Gallegos, Belém; Martínez, Ruth; Pérez, Laura; Del Socorro Pina, María; Perez, Eduardo; Hernández, Pedro

    2014-01-01

    Lectins are carbohydrate-binding proteins widely distributed in nature. They constitute a highly diverse group of proteins consisting of many different protein families that are, in general, structurally unrelated. In the last few years, mushroom and other fungal lectins have attracted wide attention due to their antitumour, antiproliferative and immunomodulatory activities. The present mini-review provides concise information about recent developments in understanding lectins from human pathogenic fungi. A bibliographic search was performed in the Science Direct and PubMed databases, using the following keywords "lectin", "fungi", "human" and "pathogenic". Lectins present in fungi have been classified; however, the role played by lectins derived from human pathogenic fungi in infectious processes remains uncertain; thus, this is a scientific field requiring more research. This manuscript is part of the series of works presented at the "V International Workshop: Molecular genetic approaches to the study of human pathogenic fungi" (Oaxaca, Mexico, 2012). Copyright © 2013 Revista Iberoamericana de Micología. Published by Elsevier Espana. All rights reserved.

  12. Exposure to the Paralytic Shellfish Toxin Producer Alexandrium catenella Increases the Susceptibility of the Oyster Crassostrea gigas to Pathogenic Vibrios

    Directory of Open Access Journals (Sweden)

    Celina Abi-Khalil

    2016-01-01

    Full Text Available The multifactorial etiology of massive Crassostrea gigas summer mortalities results from complex interactions between oysters, opportunistic pathogens and environmental factors. In a field survey conducted in 2014 in the Mediterranean Thau Lagoon (France, we evidenced that the development of the toxic dinoflagellate Alexandrium catenella, which produces paralytic shellfish toxins (PSTs, was concomitant with the accumulation of PSTs in oyster flesh and the occurrence of C. gigas mortalities. In order to investigate the possible role of toxic algae in this complex disease, we experimentally infected C. gigas oyster juveniles with Vibrio tasmaniensis strain LGP32, a strain associated with oyster summer mortalities, after oysters were exposed to Alexandrium catenella. Exposure of oysters to A. catenella significantly increased the susceptibility of oysters to V. tasmaniensis LGP32. On the contrary, exposure to the non-toxic dinoflagellate Alexandrium tamarense or to the haptophyte Tisochrysis lutea used as a foraging alga did not increase susceptibility to V. tasmaniensis LGP32. This study shows for the first time that A. catenella increases the susceptibility of Crassostrea gigas to pathogenic vibrios. Therefore, in addition to complex environmental factors explaining the mass mortalities of bivalve mollusks, feeding on neurotoxic dinoflagellates should now be considered as an environmental factor that potentially increases the severity of oyster mortality events.

  13. Comparative Genomic Analysis of Two Vibrio toranzoniae Strains with Different Virulence Capacity Reveals Clues on Its Pathogenicity for Fish.

    Science.gov (United States)

    Lasa, Aide; Gibas, Cynthia J; Romalde, Jesús L

    2017-01-01

    Vibrio toranzoniae is a Gram-negative bacterium of the Splendidus clade within the Vibrio genus. V. toranzoniae was first isolated from healthy clams in Galicia (Spain) but recently was also identified associated to disease outbreaks of red conger eel in Chile. Experimental challenges showed that the Chilean isolates were able to produce fish mortalities but not the strains isolated from clams. The aim of the present study was to determine the differences at the genomic level between the type strain of the species (CECT 7225(T)) and the strain R17, isolated from red conger eel in Chile, which could explain their different virulent capacity. The genome-based comparison showed high homology between both strains but differences were observed in certain gene clusters that include some virulence factors. Among these, we found that iron acquisition systems and capsule synthesis genes were the main differential features between both genomes that could explain the differences in the pathogenicity of the strains. Besides, the studied genomes presented genomic islands and toxins, and the R17 strain presented CRISPR sequences that are absent on the type strain. Taken together, this analysis provided important insights into virulence factors of V. toranzoniae that will lead to a better understanding of the pathogenic process.

  14. Exposure to the Paralytic Shellfish Toxin Producer Alexandrium catenella Increases the Susceptibility of the Oyster Crassostrea gigas to Pathogenic Vibrios.

    Science.gov (United States)

    Abi-Khalil, Celina; Lopez-Joven, Carmen; Abadie, Eric; Savar, Veronique; Amzil, Zouher; Laabir, Mohamed; Rolland, Jean-Luc

    2016-01-15

    The multifactorial etiology of massive Crassostrea gigas summer mortalities results from complex interactions between oysters, opportunistic pathogens and environmental factors. In a field survey conducted in 2014 in the Mediterranean Thau Lagoon (France), we evidenced that the development of the toxic dinoflagellate Alexandrium catenella, which produces paralytic shellfish toxins (PSTs), was concomitant with the accumulation of PSTs in oyster flesh and the occurrence of C. gigas mortalities. In order to investigate the possible role of toxic algae in this complex disease, we experimentally infected C. gigas oyster juveniles with Vibrio tasmaniensis strain LGP32, a strain associated with oyster summer mortalities, after oysters were exposed to Alexandrium catenella. Exposure of oysters to A. catenella significantly increased the susceptibility of oysters to V. tasmaniensis LGP32. On the contrary, exposure to the non-toxic dinoflagellate Alexandrium tamarense or to the haptophyte Tisochrysis lutea used as a foraging alga did not increase susceptibility to V. tasmaniensis LGP32. This study shows for the first time that A. catenella increases the susceptibility of Crassostrea gigas to pathogenic vibrios. Therefore, in addition to complex environmental factors explaining the mass mortalities of bivalve mollusks, feeding on neurotoxic dinoflagellates should now be considered as an environmental factor that potentially increases the severity of oyster mortality events.

  15. Isolation and Characterization of Bacteria Colonizing Acartia tonsa Copepod Eggs and Displaying Antagonist Effects against Vibrio anguillarum, Vibrio alginolyticus and Other Pathogenic Strains

    Directory of Open Access Journals (Sweden)

    Mahammed Zidour

    2017-10-01

    Full Text Available Copepods represent a major source of food for many aquatic species of commercial interest for aquaculture such as mysis shrimp and early stages of fishes. For the purpose of this study, the culturable mesophilic bacterial flora colonizing Acartia tonsa copepod eggs was isolated and identified. A total of 175 isolates were characterized based on their morphological and biochemical traits. The majority of these isolates (70% were Gram-negative bacteria. Matrix-assisted laser desorption/ionization-time of flight-mass spectrometry (MALDI-TOF-MS was used for rapid identification of bacterial isolates. Here, 58% of isolates were successfully identified at the genus level and among them, 54% were identified at the species level. These isolates belong to 12 different genera and 29 species. Five strains, identified as Bacillus pumilus, named 18 COPS, 35A COPS, 35R COPS, 38 COPS, and 40A COPS, showed strong antagonisms against several potential fish pathogens including Vibrio alginolyticus, V. anguillarum, Listeria monocytogenes, and Staphylococcus aureus. Furthermore, using a differential approach, we show that the antimicrobial activity of the 35R COPS strain is linked primarily to the production of antimicrobial compounds of the amicoumacin family, as demonstrated by the specific UV-absorbance and the MS/MS fragmentation patterns of these compounds.

  16. The ability of algal organic matter and surface runoff to promote the abundance of pathogenic and non-pathogenic strains of Vibrio parahaemolyticus in Long Island Sound, USA.

    Directory of Open Access Journals (Sweden)

    Jake D Thickman

    Full Text Available Food safety is a major concern in the shellfish industry, as severe illness can result from consuming shellfish that have accumulated waterborne pathogens. Shellfish harvesting areas are typically monitored for indicator bacteria such as fecal coliforms that serve as proxies for enteric pathogens although these indicators have shown little relation to some naturally occurring pathogenic bacteria such as Vibrio parahaemolyticus. To examine the dynamics and ecology of pathogenic and non-pathogenic strains of V. parahaemolyticus and address the relevance of indicator bacteria in predicting V. parahaemolyticus concentrations, field surveys and experiments were carried out in western Long Island Sound, NY, USA, a region that has experienced recent outbreaks of shellfish contaminated with V. parahaemolyticus. Pathogenic and non-pathogenic strains were quantified via PCR detection of marker genes and most probable number techniques. Field survey data showed little correspondence between fecal coliforms and V. parahaemolyticus, but significant correlations between V. parahaemolyticus and an alternative indicator, enterococci, and between V. parahaemolyticus and short-term (48 h rainfall were observed. Experiments demonstrated that enrichment of seawater with phytoplankton-derived dissolved organic matter significantly increased the concentration of total V. parahaemolyticus and the presence pathogenic V. parahaemolyticus, but higher temperatures did not. Collectively, these study results suggest that fecal coliforms may fail to account for the full suite of important shellfish pathogens but that enterococci could provide a potential alternative or supplement to shellfish sanitation monitoring. Given the ability of algal-derived dissolved organic matter to promote the growth of pathogenic V. parahaemolyticus, restricting nutrient inputs into coastal water bodies that promote algal blooms may indirectly decrease the proliferation of V. parahaemolyticus

  17. Evaluation of Cholera Toxin Expression in Different Populations of Vibrio cholera

    OpenAIRE

    Sedigheh Ebrahimi Kasgari; Mahnaz Nourani; Yousef Yahyapour; Seyed Ehsanollah Mousavi; Enayatollah Kalantar; Hami Kaboosi; Seyed Mahmoud Amin Marashi

    2015-01-01

    Background: Cholera is one of the most diseases of human. Cholera toxin is the most important pathogenic factor in humans that causes diarrhea. The cholera toxin is produced by V. cholerae and CTXфPhage. Objectives: In this study, we have investigated the production cholera toxin with different density of Vibrio cholerae. Materials and Methods: With this propose we inoculated classical strain O1 of Vibrio cholerae ATCC 14035 and Vibrio cholerae O1biovar El Tor N16961 into th...

  18. New Insights into Pathogenic Vibrios Affecting Bivalves in Hatcheries: Present and Future Prospects

    Directory of Open Access Journals (Sweden)

    Javier Dubert

    2017-05-01

    Full Text Available Hatcheries constitute nowadays the only viable solution to support the husbandry of bivalve molluscs due to the depletion and/or overexploitation of their natural beds. Hatchery activities include the broodstock conditioning and spawning, rearing larvae and spat, and the production of microalgae to feed all stages of the production cycle. However, outbreaks of disease continue to be the main bottleneck for successful larval and spat production, most of them caused by different representatives of the genus Vibrio. Therefore, attention must be paid on preventive and management measures that allow the control of such undesirable bacterial populations. The present review provides an updated picture of the recently characterized Vibrio species associated with disease of bivalve molluscs during early stages of development, including the controversial taxonomic affiliation of some of them and relevant advances in the knowledge of their virulence determinants. The problematic use of antibiotics, as well as its eco-friendly alternatives are also critically discussed.

  19. Plankton composition and environmental factors contribute to Vibrio seasonality.

    Science.gov (United States)

    Turner, Jeffrey W; Good, Brooks; Cole, Dana; Lipp, Erin K

    2009-09-01

    Plankton represent a nutrient-rich reservoir capable of enriching Vibrio species, which can include human pathogens, at higher densities than the surrounding water column. To better understand the relationship between vibrios and plankton, the partitioning of culturable vibrios, on TCBS, between free living and plankton associated (63-200- and >200-microm-size fractions) was monitored over a 1-year period in coastal waters of Georgia, USA. Seasonal changes in the total Vibrio concentration were then compared with changes in environmental parameters as well as changes in the relative composition of the plankton community. Using univariate analyses, Vibrio concentrations were strongly associated with temperature, especially when those vibrios were plankton associated (R(2)=0.69 and 0.88 for the water and both plankton fractions; respectively) (Pplankton fractions were also correlated to shifts in the relative abundance of specific plankton taxa. In the 63-200-micro fraction, Vibrio concentrations were inversely associated with copepods, cyanobacteria and diatoms. In the >200-micro fraction, Vibrio concentrations were positively associated with copepods and negatively associated with decapod larvae. Our results confirm the role of temperature in Vibrio seasonality and highlight an important and independent role for plankton composition in explaining seasonal changes in Vibrio concentration.

  20. First characterization of bacterial pathogen, Vibrio alginolyticus, for Porites andrewsi White syndrome in the South China Sea.

    Directory of Open Access Journals (Sweden)

    Xie Zhenyu

    Full Text Available BACKGROUND: White syndrome, a term for scleractinian coral disease with progressive tissue loss, is known to cause depressed growth and increased morality of coral reefs in the major oceans around the world, and the occurrence of this disease has been frequently reported in the past few decades. Investigations during April to September in both 2010 and 2011 identified widespread Porites andrewsi White syndrome (PAWS in Xisha Archipelago, South China Sea. However, the causes and etiology of PAWS have been unknown. METHODOLOGY/PRINCIPAL FINDINGS: A transmission experiment was performed on P. andrewsi in the Qilianyu Subgroup (QLY. The results showed that there was a significant (P ≤ 0.05 difference between test and control groups after 28 days if the invalid replicates were excluded. Rates of tissue loss ranged from 0.90-10.76 cm(2 d(-1 with a mean of 5.40 ± 3.34 cm(2 d(-1 (mean ± SD. Bacterial strains were isolated from the PAWS corals at the disease outbreak sites in QLY of the Xisha Archipelago, South China Sea, and included in laboratory-based infection trials to satisfy Koch's postulates for establishing causality. Following exposure to bacterial concentrations of 10(5 cells mL(-1, the infected colonies exhibited similar signs to those observed in the field. Using phylogenetic 16S rRNA gene analysis, classical phenotypic trait comparison, Biolog automatic identification system, MALDI-TOF mass spectrometry and MALDI Biotyper method, two pathogenic strains were identified as Vibrio alginolyticus . CONCLUSION/SIGNIFICANCE: This is the first report of V. alginolyticus as a pathogenic agent of PAWS in the South China Sea. Our results point out an urgent need to develop sensitive detection methods for V. alginolyticus virulence strains and robust diagnostics for coral disease caused by this and Vibrio pathogenic bacterium in the South China Sea.

  1. First characterization of bacterial pathogen, Vibrio alginolyticus, for Porites andrewsi White syndrome in the South China Sea.

    Science.gov (United States)

    Zhenyu, Xie; Shaowen, Ke; Chaoqun, Hu; Zhixiong, Zhu; Shifeng, Wang; Yongcan, Zhou

    2013-01-01

    White syndrome, a term for scleractinian coral disease with progressive tissue loss, is known to cause depressed growth and increased morality of coral reefs in the major oceans around the world, and the occurrence of this disease has been frequently reported in the past few decades. Investigations during April to September in both 2010 and 2011 identified widespread Porites andrewsi White syndrome (PAWS) in Xisha Archipelago, South China Sea. However, the causes and etiology of PAWS have been unknown. A transmission experiment was performed on P. andrewsi in the Qilianyu Subgroup (QLY). The results showed that there was a significant (P ≤ 0.05) difference between test and control groups after 28 days if the invalid replicates were excluded. Rates of tissue loss ranged from 0.90-10.76 cm(2) d(-1) with a mean of 5.40 ± 3.34 cm(2) d(-1) (mean ± SD). Bacterial strains were isolated from the PAWS corals at the disease outbreak sites in QLY of the Xisha Archipelago, South China Sea, and included in laboratory-based infection trials to satisfy Koch's postulates for establishing causality. Following exposure to bacterial concentrations of 10(5) cells mL(-1), the infected colonies exhibited similar signs to those observed in the field. Using phylogenetic 16S rRNA gene analysis, classical phenotypic trait comparison, Biolog automatic identification system, MALDI-TOF mass spectrometry and MALDI Biotyper method, two pathogenic strains were identified as Vibrio alginolyticus . This is the first report of V. alginolyticus as a pathogenic agent of PAWS in the South China Sea. Our results point out an urgent need to develop sensitive detection methods for V. alginolyticus virulence strains and robust diagnostics for coral disease caused by this and Vibrio pathogenic bacterium in the South China Sea.

  2. Role of iron, capsule, and toxins in the pathogenicity of Vibrio vulnificus biotype 2 for mice.

    OpenAIRE

    Amaro, C; Biosca, E G; Fouz, B; Toranzo, A E; Garay, E

    1994-01-01

    The virulence mechanisms of Vibrio vulnificus biotype 2 have been studied and compared with those of biotype 1 in mice as the experimental animals. Biotype 2 isolates from European eels were as virulent for mice as biotype 1 strains (50% lethal dose, about 10(5) CFU per mouse); a septicemic infection developed in less than 24 h. These strains had several properties in common with biotype 1 organisms including capsule expression, uptake of various iron sources, and production of exoproteins, w...

  3. Mortality event involving larvae of the carpet shell clam Ruditapes decussatus in a hatchery: isolation of the pathogen Vibrio tubiashii subsp. europaeus.

    Science.gov (United States)

    Dubert, J; Aranda-Burgos, J A; Ojea, J; Barja, J L; Prado, S

    2017-09-01

    Diseases caused by bacteria belonging to the genus Vibrio are a common, as yet unresolved, cause of mortality in shellfish hatcheries. In this study, we report the results of routine microbiological monitoring of larval cultures of the carpet shell clam Ruditapes decussatus in a hatchery in Galicia (NW Spain). Previous episodes of mortality with signs similar to those of vibriosis affecting other species in the installation indicated the possibility of bacterial infection and led to division of the culture at the early D-veliger larval stage. One batch was cultured under routine conditions, and the other was experimentally treated with antibiotic (chloramphenicol). Differences in larval survival were assessed, and culturable bacterial population in clams and sea water was evaluated, with particular attention given to vibrios. Severe mortalities were recorded from the first stages of culture onwards. The pathogen Vibrio tubiashii subsp. europaeus was detected in both batches, mainly associated with larvae. Moreover, initial detection of the pathogen in the eggs suggested the vertical transmission from broodstock as a possible source. Experimental use of antibiotic reduced the presence and diversity of vibrios in sea water, but proved inefficient in controlling vibrios associated with larvae from early stages and it did not stop mortalities. © 2017 John Wiley & Sons Ltd.

  4. Laboratory simulation reveals significant impacts of ocean acidification on microbial community composition and host-pathogen interactions between the blood clam and Vibrio harveyi.

    Science.gov (United States)

    Zha, Shanjie; Liu, Saixi; Su, Wenhao; Shi, Wei; Xiao, Guoqiang; Yan, Maocang; Liu, Guangxu

    2017-12-01

    It has been suggested that climate change may promote the outbreaks of diseases in the sea through altering the host susceptibility, the pathogen virulence, and the host-pathogen interaction. However, the impacts of ocean acidification (OA) on the pathogen components of bacterial community and the host-pathogen interaction of marine bivalves are still poorly understood. Therefore, 16S rRNA high-throughput sequencing and host-pathogen interaction analysis between blood clam (Tegillarca granosa) and Vibrio harveyi were conducted in the present study to gain a better understanding of the ecological impacts of ocean acidification. The results obtained revealed a significant impact of ocean acidification on the composition of microbial community at laboratory scale. Notably, the abundance of Vibrio, a major group of pathogens to many marine organisms, was significantly increased under ocean acidification condition. In addition, the survival rate and haemolytic activity of V. harveyi were significantly higher in the presence of haemolymph of OA treated T. granosa, indicating a compromised immunity of the clam and enhanced virulence of V. harveyi under future ocean acidification scenarios. Conclusively, the results obtained in this study suggest that future ocean acidification may increase the risk of Vibrio pathogen infection for marine bivalve species, such as blood clams. Copyright © 2017 Elsevier Ltd. All rights reserved.

  5. The phytoplankton Nannochloropsis oculata enhances the ability of Roseobacter clade bacteria to inhibit the growth of fish pathogen Vibrio anguillarum.

    Directory of Open Access Journals (Sweden)

    Emilia Noor Sharifah

    Full Text Available BACKGROUND: Phytoplankton cultures are widely used in aquaculture for a variety of applications, especially as feed for fish larvae. Phytoplankton cultures are usually grown in outdoor tanks using natural seawater and contain probiotic or potentially pathogenic bacteria. Some Roseobacter clade isolates suppress growth of the fish pathogen Vibrio anguillarum. However, most published information concerns interactions between probiotic and pathogenic bacteria, and little information is available regarding the importance of phytoplankton in these interactions. The objectives of this study, therefore, were to identify probiotic Roseobacter clade members in phytoplankton cultures used for rearing fish larvae and to investigate their inhibitory activity towards bacterial fish pathogens in the presence of the phytoplankton Nannochloropsis oculata. METHODOLOGY/PRINCIPAL FINDINGS: The fish pathogen V. anguillarum, was challenged with 6 Roseobacter clade isolates (Sulfitobacter sp. (2 strains, Thalassobius sp., Stappia sp., Rhodobacter sp., and Antarctobacter sp. from phytoplankton cultures under 3 different nutritional conditions. In an organic nutrient-rich medium (VNSS, 6 Roseobacter clade isolates, as well as V. anguillarum, grew well (10(9 CFU/ml, even when cocultured. In contrast, in a phytoplankton culture medium (ESM based on artificial seawater, coculture with the 6 isolates decreased the viability of V. anguillarum by approximately more than 10-fold. Excreted substances in media conditioned by growth of the phytoplankton N. oculata (NCF medium resulted in the complete eradication of V. anguillarum when cocultured with the roseobacters. Autoclaved NCF had the same inhibitory effect. Furthermore, Sulfitobacter sp. much more efficiently incorporated (14C- photosynthetic metabolites ((14C-EPM excreted by N. oculata than did V. anguillarum. CONCLUSION/SIGNIFICANCE: Cocultures of a phytoplankton species and Roseobacter clade members exhibited a greater

  6. The Phytoplankton Nannochloropsis oculata Enhances the Ability of Roseobacter Clade Bacteria to Inhibit the Growth of Fish Pathogen Vibrio anguillarum

    Science.gov (United States)

    Sharifah, Emilia Noor; Eguchi, Mitsuru

    2011-01-01

    Background Phytoplankton cultures are widely used in aquaculture for a variety of applications, especially as feed for fish larvae. Phytoplankton cultures are usually grown in outdoor tanks using natural seawater and contain probiotic or potentially pathogenic bacteria. Some Roseobacter clade isolates suppress growth of the fish pathogen Vibrio anguillarum. However, most published information concerns interactions between probiotic and pathogenic bacteria, and little information is available regarding the importance of phytoplankton in these interactions. The objectives of this study, therefore, were to identify probiotic Roseobacter clade members in phytoplankton cultures used for rearing fish larvae and to investigate their inhibitory activity towards bacterial fish pathogens in the presence of the phytoplankton Nannochloropsis oculata. Methodology/Principal Findings The fish pathogen V. anguillarum, was challenged with 6 Roseobacter clade isolates (Sulfitobacter sp. (2 strains), Thalassobius sp., Stappia sp., Rhodobacter sp., and Antarctobacter sp.) from phytoplankton cultures under 3 different nutritional conditions. In an organic nutrient-rich medium (VNSS), 6 Roseobacter clade isolates, as well as V. anguillarum, grew well (109 CFU/ml), even when cocultured. In contrast, in a phytoplankton culture medium (ESM) based on artificial seawater, coculture with the 6 isolates decreased the viability of V. anguillarum by approximately more than 10-fold. Excreted substances in media conditioned by growth of the phytoplankton N. oculata (NCF medium) resulted in the complete eradication of V. anguillarum when cocultured with the roseobacters. Autoclaved NCF had the same inhibitory effect. Furthermore, Sulfitobacter sp. much more efficiently incorporated 14C- photosynthetic metabolites (14C-EPM) excreted by N. oculata than did V. anguillarum. Conclusion/Significance Cocultures of a phytoplankton species and Roseobacter clade members exhibited a greater antibacterial

  7. Competitive growth advantage of nontoxigenic mutants in the stationary phase in archival cultures of pathogenic Vibrio cholerae strains.

    Science.gov (United States)

    Paul, Kalidas; Ghosh, Amalendu; Sengupta, Nilanjan; Chowdhury, Rukhsana

    2004-09-01

    Spontaneous nontoxigenic mutants of highly pathogenic Vibrio cholerae O1 strains accumulate in large numbers during long-term storage of the cultures in agar stabs. In these mutants, production of the transcriptional regulator ToxR was reduced due to the presence of a mutation in the ribosome-binding site immediately upstream of the toxR open reading frame. Consequently, the ToxR-dependent virulence regulon was turned off, with concomitant reduction in the expression of cholera toxin and toxin-coregulated pilus. An intriguing feature of these mutants is that they have a competitive fitness advantage when grown in competition with the parent strains in stationary-phase cocultures which is independent of RpoS, the only locus known to be primarily associated with acquisition of a growth advantage phenotype in bacteria.

  8. Suspension of oysters reduces the populations of Vibrio parahaemolyticus and Vibrio vulnificus.

    Science.gov (United States)

    Cole, K M; Supan, J; Ramirez, A; Johnson, C N

    2015-09-01

    Vibrio parahaemolyticus (Vp) and Vibrio vulnificus (Vv) are associated with the consumption of raw oysters and cause illnesses ranging from simple gastroenteritis to life-threatening septicaemia. These halophilic bacteria are frequently found in marine and estuarine systems, accumulating within the tissues of a number of aquatic organisms and passing on to humans after consumption, through contaminated water, or via open wounds. As benthic organisms capable of filtering 40 gallons of water per hour, sediment is an important source of potentially pathogenic vibrios in oysters destined for raw consumption. This research used off-bottom oyster culture to reduce vibrio concentrations in oysters. Colony hybridization was used to enumerate Vp and Vv in bottom and suspended oysters. Vv and Vp concentrations were generally lower in oysters suspended off-bottom, and suspension decreased vibrio loads in oysters by an average of 13%. Suspension of oysters reduced vibrio concentrations. This study found that oyster suspension significantly reduced some populations of potentially pathogenic vibrios. These results indicate that oyster suspension could be a viable approach for preharvest treatment to reduce illness in consumers of raw oysters. © 2015 The Society for Applied Microbiology.

  9. Vaccines for viral and bacterial pathogens causing acute gastroenteritis: Part I: Overview, vaccines for enteric viruses and Vibrio cholerae

    Science.gov (United States)

    O’Ryan, Miguel; Vidal, Roberto; del Canto, Felipe; Salazar, Juan Carlos; Montero, David

    2015-01-01

    Efforts to develop vaccines for prevention of acute diarrhea have been going on for more than 40 y with partial success. The myriad of pathogens, more than 20, that have been identified as a cause of acute diarrhea throughout the years pose a significant challenge for selecting and further developing the most relevant vaccine candidates. Based on pathogen distribution as identified in epidemiological studies performed mostly in low-resource countries, rotavirus, Cryptosporidium, Shigella, diarrheogenic E. coli and V. cholerae are predominant, and thus the main targets for vaccine development and implementation. Vaccination against norovirus is most relevant in middle/high-income countries and possibly in resource-deprived countries, pending a more precise characterization of disease impact. Only a few licensed vaccines are currently available, of which rotavirus vaccines have been the most outstanding in demonstrating a significant impact in a short time period. This is a comprehensive review, divided into 2 articles, of nearly 50 vaccine candidates against the most relevant viral and bacterial pathogens that cause acute gastroenteritis. In order to facilitate reading, sections for each pathogen are organized as follows: i) a discussion of the main epidemiological and pathogenic features; and ii) a discussion of vaccines based on their stage of development, moving from current licensed vaccines to vaccines in advanced stage of development (in phase IIb or III trials) to vaccines in early stages of clinical development (in phase I/II) or preclinical development in animal models. In this first article we discuss rotavirus, norovirus and Vibrio cholerae. In the following article we will discuss Shigella, Salmonella (non-typhoidal), diarrheogenic E. coli (enterotoxigenic and enterohemorragic), and Campylobacter jejuni. PMID:25715048

  10. Vaccines for viral and bacterial pathogens causing acute gastroenteritis: Part I: Overview, vaccines for enteric viruses and Vibrio cholerae.

    Science.gov (United States)

    O'Ryan, Miguel; Vidal, Roberto; del Canto, Felipe; Salazar, Juan Carlos; Montero, David

    2015-01-01

    Efforts to develop vaccines for prevention of acute diarrhea have been going on for more than 40 y with partial success. The myriad of pathogens, more than 20, that have been identified as a cause of acute diarrhea throughout the years pose a significant challenge for selecting and further developing the most relevant vaccine candidates. Based on pathogen distribution as identified in epidemiological studies performed mostly in low-resource countries, rotavirus, Cryptosporidium, Shigella, diarrheogenic E. coli and V. cholerae are predominant, and thus the main targets for vaccine development and implementation. Vaccination against norovirus is most relevant in middle/high-income countries and possibly in resource-deprived countries, pending a more precise characterization of disease impact. Only a few licensed vaccines are currently available, of which rotavirus vaccines have been the most outstanding in demonstrating a significant impact in a short time period. This is a comprehensive review, divided into 2 articles, of nearly 50 vaccine candidates against the most relevant viral and bacterial pathogens that cause acute gastroenteritis. In order to facilitate reading, sections for each pathogen are organized as follows: i) a discussion of the main epidemiological and pathogenic features; and ii) a discussion of vaccines based on their stage of development, moving from current licensed vaccines to vaccines in advanced stage of development (in phase IIb or III trials) to vaccines in early stages of clinical development (in phase I/II) or preclinical development in animal models. In this first article we discuss rotavirus, norovirus and Vibrio cholerae. In the following article we will discuss Shigella, Salmonella (non-typhoidal), diarrheogenic E. coli (enterotoxigenic and enterohemorragic), and Campylobacter jejuni.

  11. Marine Bacillus spp. associated with the egg capsule of Concholepas concholepas (common name "loco") have an inhibitory activity toward the pathogen Vibrio parahaemolyticus.

    Science.gov (United States)

    Leyton, Yanett; Riquelme, Carlos

    2010-10-01

    The pandemic bacterium Vibrio parahaemolyticus, isolated from seawater, sediment, and marine organisms, is responsible for gastroenteric illnesses in humans and also cause diseases in aquaculture industry in Chile and other countries around the world. In this study, bacterial flora with inhibitory activity against pathogenic V. parahaemolyticus were collected from egg capsules of Concholepas concholepas and evaluated. The 16S rRNA fragment was sequenced from each isolated strain to determine its identity using the GenBank database. A phylogenetic analysis was made, and tests for the productions of antibacterial substance were performed using the double-layer method. Forty-five morphotypes of bacterial colonies were isolated, 8 of which presented an inhibitory effect on the growth of V. parahaemolyticus. 16S rRNA sequence and phylogenetic analysis show that these strains constitute taxa that are phylogenetically related to the Bacillus genus and are probably sister species or strains of the species Bacillus pumilus, Bacillus licheniform, or Bacillus sp. It is important to determine the nature of the antibacterial substance to evaluate their potential for use against the pathogen species V. parahaemolyticus.

  12. Complete genome sequence and comparative genomics of the golden pompano (Trachinotus ovatus pathogen, Vibrio harveyi strain QT520

    Directory of Open Access Journals (Sweden)

    Zhigang Tu

    2017-12-01

    Full Text Available Vibrio harveyi is a Gram-negative, halophilic bacterium that is an opportunistic pathogen of commercially farmed marine vertebrate species. To understand the pathogenicity of this species, the genome of V. harveyi QT520 was analyzed and compared to that of other strains. The results showed the genome of QT520 has two unique circular chromosomes and three endogenous plasmids, totaling 6,070,846 bp with a 45% GC content, 5,701 predicted ORFs, 134 tRNAs and 37 rRNAs. Common virulence factors, including ACF, IlpA, OmpU, Flagellin, Cya, Hemolysin and MARTX, were detected in the genome, which are likely responsible for the virulence of QT520. The results of genomes comparisons with strains ATCC 33843 (392 (MAV and ATCC 43516 showed that greater numbers genes associated with types I, II, III, IV and VI secretion systems were detected in QT520 than in other strains, suggesting that QT520 is a highly virulent strain. In addition, three plasmids were only observed in the complete genome sequence of strain QT520. In plasmid p1 of QT520, specific virulence factors (cyaB, hlyB and rtxA were identified, suggesting that the pathogenicity of this strain is plasmid-associated. Phylogenetic analysis of 12 complete Vibrio sp. genomes using ANI values, core genes and MLST revealed that QT520 was most closely related to ATCC 33843 (392 (MAV and ATCC 43516, suggesting that QT520 belongs to the species V. harveyi. This report is the first to describe the complete genome sequence of a V. harveyi strain isolated from an outbreak in a fish species in China. In addition, to the best of our knowledge, this report is the first to compare the V. harveyi genomes of several strains. The results of this study will expand our understanding of the genome, genetic characteristics, and virulence factors of V. harveyi, setting the stage for studies of pathogenesis, diagnostics, and disease prevention.

  13. A case of Vibrio vulnificus infection complicated with fulminant purpura: gene and biotype analysis of the pathogen.

    Science.gov (United States)

    Hori, Masatoshi; Nakayama, Akifumi; Kitagawa, Daisuke; Fukushima, Hidetada; Asai, Hideki; Kawai, Yasuyuki; Okuchi, Kazuo

    2017-05-01

    Introduction.Vibrio vulnificus (V. vulnificus) causes a severe infection that develops in the compromised host. Its pathophysiology is classified into three types: (1) primary septicaemia, (2) gastrointestinal illness pattern and (3) wound infection pattern. Of these, primary septicaemia is critical. V. vulnificus can be classified into three biotypes and two genotypes and its pathogenicity is type-dependent. Case presentation. A 47-year-old man presented to a local hospital with chief complaints of fever, bilateral lower limb pain and diarrhoea. He had no history of foreign travel or known medical problems. He was in septic shock and developed fulminant purpura within 24 h of the onset. High-dose vasopressor and antibiotic administration failed to alter his status and he died 3 days after the onset of symptoms. V. vulnificus was isolated from blood, skin and nasal discharge cultures. Biotype and gene analysis of the microbe isolated identified it as Biotype 3, mainly reported in Israel in wound infections, and Genotype E, implicating an environmental isolate. These typing analyses indicated that the microbe isolated could be classified as a type with low pathogenicity. Conclusion. This case highlighted that Biotype 3 and Genotype E can also cause primary septicaemia. Although the majority of reports on Biotype 3 have been from the Middle East, this experience with the present case provided evidence that the habitat of Biotype 3 V. vulnificus has been extending to East Asia as well.

  14. Seasonal abundance of total and pathogenic Vibrio parahaemolyticus isolated from American oysters harvested in the Mandinga Lagoon System, Veracruz, Mexico: implications for food safety.

    Science.gov (United States)

    Flores-Primo, Argel; Pardío-Sedas, Violeta; Lizárraga-Partida, Leonardo; López-Hernández, Karla; Uscanga-Serrano, Roxana; Flores-Hernández, Reyna

    2014-07-01

    The abundance of total and pathogenic Vibrio parahaemolyticus (Vp) strains in American oysters (Crassostrea virginica) harvested in two different harvest sites from the Mandinga lagoon System was evaluated monthly for 1 year (January through December 2012). Frequencies of species-specific genes and pathogenic genes exhibited a seasonal distribution. The annual occurrence of Vp with the species-specific tlh gene (tlh(+)) was significantly higher during the winter windy season (32.50%) and spring dry season (15.0%), with the highest densities observed during spring dry season at 283.50 most probable number (MPN)/g (lagoon bank A, near human settlements), indicating the highest risk of infection during warmer months. Pathogenic Vp tlh(+)/tdh(+) frequency was significantly higher during the winter windy and the spring dry seasons at 22.50 and 10.00%, respectively, with highest densities of 16.22 and 41.05 MPN/g (bank A), respectively. The tlh/trh and tdh/trh gene combinations were also found in Vp isolates during the spring dry season at 1.25 and 1.3%, respectively, with densities of 1.79 and 0.4 MPN/g (bank A), respectively. The orf8 genes were detected during the winter windy season (1.25%) with highest densities of 5.96 MPN/g (bank A) and 3.21 MPN/g (bank B, near mangrove islands and a heron nesting area). Densities of Vp tdh(+) were correlated (R(2) = 0.245, P < 0.015) with those of Vp orf8(+). The seasonal dynamics of Vp harboring pathogenic genes varied with seasonal changes, with very high proportions of Vp tdh(+) and Vp orf8(+) isolates in the winter windy season at 46.2 and 17.0%, respectively, which suggests that environmental factors may differentially affect the abundance of pathogenic subpopulations. Although all densities of total Vp (Vp tlh(+)) were lower than 10(4) MPN/g, thus complying with Mexican regulations, the presence of pathogenic strains is a public health concern. Our results suggest that total Vp densities may not be appropriate for assessing

  15. Vibrio cholerae infection of Drosophila melanogaster mimics the human disease cholera.

    Directory of Open Access Journals (Sweden)

    Nathan S Blow

    2005-09-01

    Full Text Available Cholera, the pandemic diarrheal disease caused by the gram-negative bacterium Vibrio cholerae, continues to be a major public health challenge in the developing world. Cholera toxin, which is responsible for the voluminous stools of cholera, causes constitutive activation of adenylyl cyclase, resulting in the export of ions into the intestinal lumen. Environmental studies have demonstrated a close association between V. cholerae and many species of arthropods including insects. Here we report the susceptibility of the fruit fly, Drosophila melanogaster, to oral V. cholerae infection through a process that exhibits many of the hallmarks of human disease: (i death of the fly is dependent on the presence of cholera toxin and is preceded by rapid weight loss; (ii flies harboring mutant alleles of either adenylyl cyclase, Gsalpha, or the Gardos K channel homolog SK are resistant to V. cholerae infection; and (iii ingestion of a K channel blocker along with V. cholerae protects wild-type flies against death. In mammals, ingestion of as little as 25 mug of cholera toxin results in massive diarrhea. In contrast, we found that ingestion of cholera toxin was not lethal to the fly. However, when cholera toxin was co-administered with a pathogenic strain of V. cholerae carrying a chromosomal deletion of the genes encoding cholera toxin, death of the fly ensued. These findings suggest that additional virulence factors are required for intoxication of the fly that may not be essential for intoxication of mammals. Furthermore, we demonstrate for the first time the mechanism of action of cholera toxin in a whole organism and the utility of D. melanogaster as an accurate, inexpensive model for elucidation of host susceptibility to cholera.

  16. Inhibition of enterotoxin from Escherichia coli and Vibrio cholerae by gangliosides from human milk.

    OpenAIRE

    Otnaess, A B; Laegreid, A; Ertresvåg, K

    1983-01-01

    Inhibitory activity of enterotoxin from Escherichia coli and Vibrio cholerae was associated with the ganglioside fraction of human milk. Both the milk fat and skim milk contained gangliosides that inhibited the toxins. The most purified milk fraction contained three glycolipid components, of which two migrated close to ganglioside GM1 on thin-layer chromatography plates. A component with a slightly different mobility from GM1 appeared to be associated with the inhibitory activity. Milk gangli...

  17. Human diseases associated with fish pathogens

    OpenAIRE

    VATSOS N. Ioannis; ANGELIDIS Panagiotis

    2011-01-01

    Until recently, most cases of humans been affected by fish pathogens, bacterial and parasitic, were limited in certain countries, either due to the inappropriate sanitary measures used in those areas, or due to the local habit of eating raw or undercooked fish. However, as new reliable methods to identify fish pathogens in samples collected from sick humans have been developed, the confirmed cases worldwide have increased. The most common fish bacterial pathogens that can affect humans belong...

  18. Distinct roles of an alternative sigma factor during both free-swimming and colonizing phases of the Vibrio cholerae pathogenic cycle.

    Science.gov (United States)

    Klose, K E; Mekalanos, J J

    1998-05-01

    Vibrio cholerae, the bacterium that causes cholera, has a pathogenic cycle consisting of a free-swimming phase outside its host, and a sessile virulent phase when colonizing the human small intestine. We have cloned the V. cholerae homologue of the rpoN gene (encoding sigma54) and determined its role in the cholera pathogenic cycle by constructing an rpoN null mutant. The V. cholerae rpoN mutant is non-motile; examination of this mutant by electron microscopy revealed that it lacks a flagellum. In addition to flagellar synthesis, sigma54 is involved in glutamine synthetase expression. Moreover, the rpoN mutant is defective for colonization in an infant mouse model of cholera. We present evidence that the colonization defect is distinct from the non-motile and Gln phenotypes of the rpoN mutant, implicating multiple and distinct roles of sigma54 during the V. cholerae pathogenic cycle. RNA polymerase containing sigma54 (sigma54-holoenzyme) has an absolute requirement for an activator protein to initiate transcription. We have identified three regulatory genes, flrABC (flagellar regulatory proteins ABC) that are additionally required for flagellar synthesis. The flrA and flrC gene products are sigma54-activators and form a flagellar transcription cascade. flrA and flrC mutants are also defective for colonization; this phenotype is probably independent of non-motility. An flrC constitutive mutation (M114-->I) was isolated that is independent of its cognate kinase FlrB. Expression of the constitutive FlrCM114-->I from the cholera toxin promoter resulted in a change in cell morphology, implicating involvement of FlrC in cell division. Thus, sigma54 holoenzyme, FlrA and FlrC transcribe genes for flagellar synthesis and possibly cell division during the free-swimming phase of the V. cholerae life cycle, and some as yet unidentified gene(s) that aid colonization within the host.

  19. Pathogenicity profile of Vibrio parahaemolyticus in farmed Pacific white shrimp, Penaeus vannamei.

    Science.gov (United States)

    Ananda Raja, R; Sridhar, R; Balachandran, C; Palanisammi, A; Ramesh, S; Nagarajan, K

    2017-08-01

    A pathobiological study was conducted using Vibrio parahaemolyticus (VP) strain isolated from vibriosis affected shrimp (Penaeus vannamei) farms in Kancheepuram and Thiruvallur districts of Tamil Nadu during August 2014 to February 2015. The isolate was identified based on the morphological, physiological, biochemical and molecular characters. LD50 value with intramuscular injection was determined as 2.6 × 104 cfu/shrimp and sequential pathology was studied giving 6.1 × 103 cfu/shrimp (LD25). Total plate count (TPC) and total Vibrio count (TVC) in water, pond sediment, haemolymph, muscle, HP and gut were found significantly (P vannamei. Major histopathological manifestations observed were haemocyte infiltration/nodule in the epidermis, skeletal and cardiac muscles, atrophy of the excretory organ, and disrupted HP tubules with diffuse interstitial edema and haemocytic infiltration. Further HP showed that there was thickening of intertubular space, karyomegaly with prominent nucleoli, rounding and sloughing of HP tubular epithelium, many mitotic figures with bacterial colonies and apoptotic bodies, separation of shrunken tubule epithelium from myoepithelial fibers, regeneration of tubules, cystic, dilated and vacuolated appearance of HP tubules, hypoplastic changes in the tubules with no B, R and F cells, granuloma formation, concretions in tubules, calcification, necrosis, and washed out appearance with complete loss of architecture. The progression of the degenerative changes in the HP tubular epithelial cells was from proximal to distal end. In haematopoietic organ, increased mitotic activities with focal to extensive depletion and degeneration were observed. Degeneration of the stromal matrix with spheroid formation in lymphoid organ was observed among the Vp infected natural and experimental animals. Degeneration of glandular structures in the prehensile appendages with bacterial colonies, melanization and loss of epithelial layer in oesophagus

  20. Temporal and Spatial Variation in the Abundance of Total and Pathogenic Vibrio parahaemolyticus in Shellfish in China.

    Directory of Open Access Journals (Sweden)

    Haihong Han

    Full Text Available We investigated the abundance of total and pathogenic Vibrio parahaemolyticus in shellfish sampled from four provinces in China during May 2013 and March 2014 using the most probable number-polymerase chain reaction (MPN-PCR method. Total V. parahaemolyticus was detected in 67.7% of 496 samples. A total of 38.1% and 10.1% of samples exceeded 1,000 MPN g(-1 and 10,000 MPN g(-1, respectively. V. parahaemolyticus densities followed a seasonal and geographical trend, with Guangxi and Sichuan shellfish possessing total V. parahaemolyticus levels that were 100-fold higher than those of the Liaoning and Shandong regions. Moreover, the levels of V. parahaemolyticus were at least 10-fold higher in the summer and autumn than in the cooler seasons. Pathogenic V. parahaemolyticus levels were generally lower than total V. parahaemolyticus levels by several log units and tended to be high in samples contaminated with high total V. parahaemolyticus levels. The aqua farms had a lower prevalence but higher abundance of total V. parahaemolyticus compared to retail markets. The catering markets showed the lowest levels of total V. parahaemolyticus, but 20.0% of samples exceeded 1,000 MPN g(-1. The levels of both total and pathogenic V. parahaemolyticus in oysters were higher than in clams. The log-transformed abundance of V. parahaemolyticus was significantly correlated with both water temperature and air temperature but not water salinity. These results provide baseline contamination data of V. parahaemolyticus in shellfish in China, which can be applied to local risk assessments to prioritize risk control to key sectors and evaluate the effectiveness of future control measures.

  1. Exposure of gnotobiotic Artemia franciscana larvae to abiotic stress promotes heat shock protein 70 synthesis and enhances resistance to pathogenic Vibrio campbellii

    Science.gov (United States)

    Pineda, Carlos; MacRae, Thomas H.; Sorgeloos, Patrick; Bossier, Peter

    2008-01-01

    Larvae of the brine shrimp Artemia franciscana serve as important feed in fish and shellfish larviculture; however, they are subject to bacterial diseases that devastate entire populations and consequently hinder their use in aquaculture. Exposure to abiotic stress was shown previously to shield Artemia larvae against infection by pathogenic Vibrio, with the results suggesting a mechanistic role for heat shock protein 70. In the current report, combined hypothermic/hyperthermic shock followed by recovery at ambient temperature induced Hsp70 synthesis in Artemia larvae. Thermotolerance was also increased as was protection against infection by Vibrio campbellii, the latter indicated by reduced mortality and lower bacterial load in challenge tests. Resistance to Vibrio improved in the face of declining body mass as demonstrated by measurement of ash-free dry weight. Hypothermic stress only and acute osmotic insult did not promote Hsp70 expression and thermotolerance in Artemia larvae nor was resistance to Vibrio challenge augmented. The data support a causal link between Hsp70 accumulation induced by abiotic stress and enhanced resistance to infection by V. campbellii, perhaps via stimulation of the Artemia immune system. This possibility is now under investigation, and the work may reveal fundamental properties of crustacean immunity. Additionally, the findings are important in aquaculture where development of procedures to prevent bacterial infection of feed stock such as Artemia larvae is a priority. PMID:18347942

  2. Temperature-regulated bleaching and lysis of the coral Pocillopora damicornis by the novel pathogen Vibrio coralliilyticus.

    Science.gov (United States)

    Ben-Haim, Yael; Zicherman-Keren, Maya; Rosenberg, Eugene

    2003-07-01

    Coral bleaching is the disruption of symbioses between coral animals and their photosynthetic microalgal endosymbionts (zooxanthellae). It has been suggested that large-scale bleaching episodes are linked to global warming. The data presented here demonstrate that Vibrio coralliilyticus is an etiological agent of bleaching of the coral Pocillopora damicornis. This bacterium was present at high levels in bleached P. damicornis but absent from healthy corals. The bacterium was isolated in pure culture, characterized microbiologically, and shown to cause bleaching when it was inoculated onto healthy corals at 25 degrees C. The pathogen was reisolated from the diseased tissues of the infected corals. The zooxanthella concentration in the bacterium-bleached corals was less than 12% of the zooxanthella concentration in healthy corals. When P. damicornis was infected with V. coralliilyticus at higher temperatures (27 and 29 degrees C), the corals lysed within 2 weeks, indicating that the seawater temperature is a critical environmental parameter in determining the outcome of infection. A large increase in the level of the extracellular protease activity of V. coralliilyticus occurred at the same temperature range (24 to 28 degrees C) as the transition from bleaching to lysis of the corals. We suggest that bleaching of P. damicornis results from an attack on the algae, whereas bacterium-induced lysis and death are promoted by bacterial extracellular proteases. The data presented here support the bacterial hypothesis of coral bleaching.

  3. Genome-Wide Mutation Rate Response to pH Change in the Coral Reef Pathogen Vibrio shilonii AK1

    Directory of Open Access Journals (Sweden)

    Chloe Strauss

    2017-08-01

    Full Text Available Recent application of mutation accumulation techniques combined with whole-genome sequencing (MA/WGS has greatly promoted studies of spontaneous mutation. However, such explorations have rarely been conducted on marine organisms, and it is unclear how marine habitats have influenced genome stability. This report resolves the mutation rate and spectrum of the coral reef pathogen Vibrio shilonii, which causes coral bleaching and endangers the biodiversity maintained by coral reefs. We found that its mutation rate and spectrum are highly similar to those of other studied bacteria from various habitats, despite the saline environment. The mutational properties of this marine bacterium are thus controlled by other general evolutionary forces such as natural selection and genetic drift. We also found that as pH drops, the mutation rate decreases and the mutation spectrum is biased in the direction of generating G/C nucleotides. This implies that evolutionary features of this organism and perhaps other marine microbes might be altered by the increasingly acidic ocean water caused by excess CO2 emission. Nonetheless, further exploration is needed as the pH range tested in this study was rather narrow and many other possible mutation determinants, such as carbonate increase, are associated with ocean acidification.

  4. Isolation of TDA-producing Phaeobacter strains from sea bass larval rearing units and their probiotic effect against pathogenic Vibrio spp. in Artemia cultures.

    Science.gov (United States)

    Grotkjær, Torben; Bentzon-Tilia, Mikkel; D'Alvise, Paul; Dourala, Nancy; Nielsen, Kristian Fog; Gram, Lone

    2016-05-01

    Fish-pathogenic Vibrio can cause large-scale crashes in marine larval rearing units and, since the use of antibiotics can result in bacterial antibiotic resistance, new strategies for disease prevention are needed. Roseobacter-clade bacteria from turbot larval rearing facilities can antagonize Vibrio anguillarum and reduce mortality in V. anguillarum-infected cod and turbot larvae. In this study, it was demonstrated that antagonistic Roseobacter-clade bacteria could be isolated from sea bass larval rearing units. In addition, it was shown that they not only antagonized V. anguillarum but also V. harveyi, which is the major bacterial pathogen in crustaceans and Mediterranean sea bass larvae cultures. Concomitantly, they significantly improved survival of V. harveyi-infected brine shrimp. 16S rRNA gene sequence homology identified the antagonists as Phaeobacter sp., and in silico DNA-DNA hybridization indicated that they could belong to a new species. The genomes contained genes involved in synthesis of the antibacterial compound tropodithietic acid (TDA), and its production was confirmed by UHPLC-TOFMS. The new Phaeobacter colonized live feed (Artemia) cultures and reduced Vibrio counts significantly, since they reached only 10(4)CFUmL(-1), as opposed to 10(8)CFUmL(-1) in non-Phaeobacter treated controls. Survival of V. anguillarum-challenged Artemia nauplii was enhanced by the presence of wild type Phaeobacter compared to challenged control cultures (89±1.0% vs 8±3.2%). In conclusion, TDA-producing Phaeobacter isolated from Mediterranean marine larviculture are promising probiotic bacteria against pathogenic Vibrio in crustacean live-feed cultures for marine fish larvae. Copyright © 2016 Elsevier GmbH. All rights reserved.

  5. Complete Sequence of Virulence Plasmid pJM1 from the Marine Fish Pathogen Vibrio anguillarum Strain 775

    Science.gov (United States)

    Di Lorenzo, Manuela; Stork, Michiel; Tolmasky, Marcelo E.; Actis, Luis A.; Farrell, David; Welch, Timothy J.; Crosa, Lidia M.; Wertheimer, Anne M.; Chen, Qian; Salinas, Patricia; Waldbeser, Lillian; Crosa, Jorge H.

    2003-01-01

    The virulence plasmid pJM1 enables the fish pathogen Vibrio anguillarum, a gram-negative polarly flagellated comma-shaped rod bacterium, to cause a highly fatal hemorrhagic septicemic disease in salmonids and other fishes, leading to epizootics throughout the world. The pJM1 plasmid 65,009-nucleotide sequence, with an overall G+C content of 42.6%, revealed genes and open reading frames (ORFs) encoding iron transporters, nonribosomal peptide enzymes, and other proteins essential for the biosynthesis of the siderophore anguibactin. Of the 59 ORFs, approximately 32% were related to iron metabolic functions. The plasmid pJM1 confers on V. anguillarum the ability to take up ferric iron as a complex with anguibactin from a medium in which iron is chelated by transferrin, ethylenediamine-di(o-hydroxyphenyl-acetic acid), or other iron-chelating compounds. The fatDCBA-angRT operon as well as other downstream biosynthetic genes is bracketed by the homologous ISV-A1 and ISV-A2 insertion sequences. Other clusters on the plasmid also show an insertion element-flanked organization, including ORFs homologous to genes involved in the biosynthesis of 2,3-dihydroxybenzoic acid. Homologues of replication and partition genes are also identified on pJM1 adjacent to this region. ORFs with no known function represent approximately 30% of the pJM1 sequence. The insertion sequence elements in the composite transposon-like structures, corroborated by the G+C content of the pJM1 sequence, suggest a modular composition of plasmid pJM1, biased towards acquisition of modules containing genes related to iron metabolic functions. We also show that there is considerable microheterogeneity in pJM1-like plasmids from virulent strains of V. anguillarum isolated from different geographical sources. PMID:13129954

  6. Detection of Total and Pathogenic Vibrio parahaemolyticus in Shellfish Growing along the South Yellow Sea and the East China Sea.

    Science.gov (United States)

    Han, Feng; Gu, Run-Run; Shen, Xiao-Sheng; Chen, Yuan-Ge; Tian, Liang-Liang; Zhou, Wei-Feng; Cai, You-Qiong

    2017-10-17

    This study was conducted to monitor the densities of total and pathogenic Vibrio parahaemolyticus in 300 samples of nine shellfish species harvested from the coasts of the South Yellow Sea and the East China Sea (N 23° to 34°, E 116° to 124°), People's Republic of China, between May and October 2015. Total V. parahaemolyticus densities were measured, and V. parahaemolyticus isolates were biochemically identified with probes for the thermostable direct hemolysin gene (tdh) and the thermostable direct hemolysin-related hemolysin gene (trh). We found that 202 of the 300 samples were positive for V. parahaemolyticus from all the sites: 58 of the 100 samples from the Fujian province, 71 of the 100 samples from the Zhejiang province, and 73 of the 100 samples from the Jiangsu province. In most (170) of the 300 samples, V. parahaemolyticus densities were 0.3 to 10 most probable number (MPN)/g; five lots exceeded 110 MPN/g, and two lots were estimated at 110 MPN/g. Among the 202 V. parahaemolyticus strains, only one was trh positive. Densities of V. parahaemolyticus in these shellfish were temperature dependent, with highest densities in June and July. Among the nine mollusk species, V. parahaemolyticus was most abundant in the agemaki clam (Sinonovacula constricta). The highest and lowest V. parahaemolyticus prevalences were found in oriental cyclina (Cyclina sinensis, 93.8%) and mussels (Mytilus edulis, 28.1%), respectively. Overall, although V. parahaemolyticus is widely distributed in marine environments, the density of V. parahaemolyticus was low and the prevalence of the main virulence factor was very low in shellfish along the coasts of the South Yellow Sea and East China Sea, which is important from a public health perspective. Data presented here will be useful for correlational research and can be utilized for developing risk management plans that establish food safety guidelines for V. parahaemolyticus in Chinese shellfish.

  7. Vibrio Parahaemolyticus: The Threat of Another Vibrio Acquiring Pandemic Potential

    Digital Repository Service at National Institute of Oceanography (India)

    Ramamurthy, T.; Nair, G.B.

    or indirectly via contaminated food and water. Food-borne Vibrio infections tend to occur more frequently in developed countries while transmission of Vibrio infections in developing countries is, by and large, water-borne. Further, the magnitude of food... and pandemics mainly due to poor water supply and personal hygiene. The other important and most common seafood-borne halophilic Vibrio is V. parahaemolyticus. Since its discovery in 1953 (Fujino et al., 1953), many aspects on this pathogen were explored...

  8. Non-Cholera Vibrios: The Microbial Barometer of Climate Change.

    Science.gov (United States)

    Baker-Austin, Craig; Trinanes, Joaquin; Gonzalez-Escalona, Narjol; Martinez-Urtaza, Jaime

    2017-01-01

    There is a growing interest in the role of climate change in driving the spread of waterborne infectious diseases, such as those caused by bacterial pathogens. One particular group of pathogenic bacteria - vibrios - are a globally important cause of diseases in humans and aquatic animals. These Gram-negative bacteria, including the species Vibrio vulnificus, Vibrio parahaemolyticus and Vibrio cholerae, grow in warm, low-salinity waters, and their abundance in the natural environment mirrors ambient environmental temperatures. In a rapidly warming marine environment, there are greater numbers of human infections, and most notably outbreaks linked to extreme weather events such as heatwaves in temperate regions such as Northern Europe. Because the growth of pathogenic vibrios in the natural environment is largely dictated by temperature, we argue that this group of pathogens represents an important and tangible barometer of climate change in marine systems. We provide a number of specific examples of the impacts of climate change on this group of bacteria and their associated diseases, and discuss advanced strategies to improve our understanding of these emerging waterborne diseases through the integration of microbiological, genomic, epidemiological, climatic, and ocean sciences. Crown Copyright © 2016. Published by Elsevier Ltd. All rights reserved.

  9. Inhibition of enterotoxin from Escherichia coli and Vibrio cholerae by gangliosides from human milk.

    Science.gov (United States)

    Otnaess, A B; Laegreid, A; Ertresvåg, K

    1983-05-01

    Inhibitory activity of enterotoxin from Escherichia coli and Vibrio cholerae was associated with the ganglioside fraction of human milk. Both the milk fat and skim milk contained gangliosides that inhibited the toxins. The most purified milk fraction contained three glycolipid components, of which two migrated close to ganglioside GM1 on thin-layer chromatography plates. A component with a slightly different mobility from GM1 appeared to be associated with the inhibitory activity. Milk ganglioside fraction, derived from 2 ml of human milk, contained 1 to 4 micrograms of lipid-bound sialic acid and completely inhibited 0.1 micrograms of cholera toxin in rabbit intestinal loop experiments. It is suggested that human milk gangliosides, although present only in trace amounts, may be important in protecting infants against enterotoxin-induced diarrhea.

  10. Environmental occurrence and clinical impact of Vibrio vulnificus and Vibrio parahaemolyticus: a European perspective.

    Science.gov (United States)

    Baker-Austin, Craig; Stockley, Louise; Rangdale, Rachel; Martinez-Urtaza, Jaime

    2010-02-01

    Vibrio vulnificus and Vibrio parahaemolyticus are ubiquitous Gram-negative bacterial pathogens found naturally in marine and estuarine waters, and are a leading cause of seafood-associated bacterial illness. These pathogens are commonly reported in the USA and in many Asian countries, including China, Japan and Taiwan; however, there is growing concern that V. vulnificus and V. parahaemolyticus may represent an important and increasing clinical problem in Europe. Several factors underlie the need for a greater understanding of these non-cholera vibrios within a European context. First, there is a growing body of evidence to suggest that V. vulnificus and V. parahaemolyticus infections are increasing, and tend to follow regional climatic trends, with outbreaks typically following episodes of unusually warm weather. Such findings are especially alarming given current predictions regarding warming of marine waters as a result of global climatic change. Second, a myriad of epidemiological factors may greatly increase the incidence as well as clinical burden of these pathogens - including increasing global consumption and trade of seafood produce coupled to an increase in the number of susceptible individuals consuming seafood produce. Finally, there is currently a lack of detailed surveillance information regarding non-cholerae Vibrio infections in Europe, as these pathogens are not notifiable in many countries, which probably masks the true clinical burden of many human infections. This review will present a pertinent overview of both the environmental occurrence and clinical impact of V. vulnificus and V. parahaemolyticus in Europe. © 2010 Crown copyright.

  11. Rapid proliferation of Vibrio parahaemolyticus, Vibrio vulnificus, and Vibrio cholerae during freshwater flash floods in French Mediterranean coastal lagoons.

    Science.gov (United States)

    Esteves, Kevin; Hervio-Heath, Dominique; Mosser, Thomas; Rodier, Claire; Tournoud, Marie-George; Jumas-Bilak, Estelle; Colwell, Rita R; Monfort, Patrick

    2015-11-01

    Vibrio parahaemolyticus, Vibrio vulnificus, and Vibrio cholerae of the non-O1/non-O139 serotype are present in coastal lagoons of southern France. In these Mediterranean regions, the rivers have long low-flow periods followed by short-duration or flash floods during and after heavy intense rainstorms, particularly at the end of the summer and in autumn. These floods bring large volumes of freshwater into the lagoons, reducing their salinity. Water temperatures recorded during sampling (15 to 24°C) were favorable for the presence and multiplication of vibrios. In autumn 2011, before heavy rainfalls and flash floods, salinities ranged from 31.4 to 36.1‰ and concentrations of V. parahaemolyticus, V. vulnificus, and V. cholerae varied from 0 to 1.5 × 10(3) most probable number (MPN)/liter, 0.7 to 2.1 × 10(3) MPN/liter, and 0 to 93 MPN/liter, respectively. Following heavy rainstorms that generated severe flash flooding and heavy discharge of freshwater, salinity decreased, reaching 2.2 to 16.4‰ within 15 days, depending on the site, with a concomitant increase in Vibrio concentration to ca. 10(4) MPN/liter. The highest concentrations were reached with salinities between 10 and 20‰ for V. parahaemolyticus, 10 and 15‰ for V. vulnificus, and 5 and 12‰ for V. cholerae. Thus, an abrupt decrease in salinity caused by heavy rainfall and major flooding favored growth of human-pathogenic Vibrio spp. and their proliferation in the Languedocian lagoons. Based on these results, it is recommended that temperature and salinity monitoring be done to predict the presence of these Vibrio spp. in shellfish-harvesting areas of the lagoons. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  12. Occurrence and Diversity of Clinically Important Vibrio Species in the Aquatic Environment of Georgia.

    Science.gov (United States)

    Kokashvili, Tamar; Whitehouse, Chris A; Tskhvediani, Ana; Grim, Christopher J; Elbakidze, Tinatin; Mitaishvili, Nino; Janelidze, Nino; Jaiani, Ekaterine; Haley, Bradd J; Lashkhi, Nino; Huq, Anwar; Colwell, Rita R; Tediashvili, Marina

    2015-01-01

    Among the more than 70 different Vibrio species inhabiting marine, estuarine, and freshwater ecosystems, 12 are recognized as human pathogens. The warm subtropical climate of the Black Sea coastal area and inland regions of Georgia likely provides a favorable environment for various Vibrio species. From 2006 to 2009, the abundance, ecology, and diversity of clinically important Vibrio species were studied in different locations in Georgia and across seasons. Over a 33-month period, 1,595 presumptive Vibrio isolates were collected from the Black Sea (n = 657) and freshwater lakes around Tbilisi (n = 938). Screening of a subset of 440 concentrated and enriched water samples by PCR-electrospray ionization/mass spectrometry (PCR-ESI/MS) detected the presence of DNA from eight clinically important Vibrio species: V. cholerae, V. parahaemolyticus, V. vulnificus, V. mimicus, V. alginolyticus, V. harveyi, V. metschnikovii, and V. cincinnatiensis. Almost 90% of PCR/ESI-MS samples positive for Vibrio species were collected from June through November. Three important human-pathogenic Vibrio species (V. cholerae, V. parahaemolyticus, and V. vulnificus) were detected in 62.8, 37.8, and 21.4% of samples testing positive for Vibrios, respectively. The results of these activities suggest that natural reservoirs for human-pathogenic Vibrios exist in Georgian aquatic environments. Water temperature at all sampling sites was positively correlated with the abundance of clinically important Vibrio spp. (except V. metschnikovii), and salinity was correlated with species composition at particular Black Sea sites as well as inland reservoirs.

  13. Human metapneumovirus: a new respiratory pathogen

    Indian Academy of Sciences (India)

    2008-10-15

    Oct 15, 2008 ... Home; Journals; Journal of Biosciences; Volume 33; Issue 4. Human metapneumovirus: a new respiratory ... Human metapneumovirus is a recently recognized pathogen of acute respiratory tract infection (ARI) in children as well as elderly and immunocompromised adults. The virus belongs to the family ...

  14. Effects of Global Warming on Vibrio Ecology.

    Science.gov (United States)

    Vezzulli, Luigi; Pezzati, Elisabetta; Brettar, Ingrid; Höfle, Manfred; Pruzzo, Carla

    2015-06-01

    Vibrio-related infections are increasing worldwide both in humans and aquatic animals. Rise in global sea surface temperature (SST), which is approximately 1 °C higher now than 140 years ago and is one of the primary physical impacts of global warming, has been linked to such increases. In this chapter, major known effects of increasing SST on the biology and ecology of vibrios are described. They include the effects on bacterial growth rate, both in the field and in laboratory, culturability, expression of pathogenicity traits, and interactions with aquatic organisms and abiotic surfaces. Special emphasis is given to the effect of ocean warming on Vibrio interactions with zooplankters, which represent one of the most important aquatic reservoirs for these bacteria. The reported findings highlight the biocomplexity of the interactions between vibrios and their natural environment in a climate change scenario, posing the need for interdisciplinary studies to properly understand the connection between ocean warming and persistence and spread of vibrios in sea waters and the epidemiology of the diseases they cause.

  15. Vibrio cholerae cytolysin causes an inflammatory response in human intestinal epithelial cells that is modulated by the PrtV protease.

    Directory of Open Access Journals (Sweden)

    Gangwei Ou

    Full Text Available BACKGROUND: Vibrio cholerae is the causal intestinal pathogen of the diarrheal disease cholera. It secretes the protease PrtV, which protects the bacterium from invertebrate predators but reduces the ability of Vibrio-secreted factor(s to induce interleukin-8 (IL-8 production by human intestinal epithelial cells. The aim was to identify the secreted component(s of V. cholerae that induces an epithelial inflammatory response and to define whether it is a substrate for PrtV. METHODOLOGY/PRINCIPAL FINDINGS: Culture supernatants of wild type V. cholerae O1 strain C6706, its derivatives and pure V. cholerae cytolysin (VCC were analyzed for the capacity to induce changes in cytokine mRNA expression levels, IL-8 and tumor necrosis factor-alpha (TNF-alpha secretion, permeability and cell viability when added to the apical side of polarized tight monolayer T84 cells used as an in vitro model for human intestinal epithelium. Culture supernatants were also analyzed for hemolytic activity and for the presence of PrtV and VCC by immunoblot analysis. CONCLUSIONS/SIGNIFICANCE: We suggest that VCC is capable of causing an inflammatory response characterized by increased permeability and production of IL-8 and TNF-alpha in tight monolayers. Pure VCC at a concentration of 160 ng/ml caused an inflammatory response that reached the magnitude of that caused by Vibrio-secreted factors, while higher concentrations caused epithelial cell death. The inflammatory response was totally abolished by treatment with PrtV. The findings suggest that low doses of VCC initiate a local immune defense reaction while high doses lead to intestinal epithelial lesions. Furthermore, VCC is indeed a substrate for PrtV and PrtV seems to execute an environment-dependent modulation of the activity of VCC that may be the cause of V. cholerae reactogenicity.

  16. Isolation of bioactive compound from marine seaweeds against fish pathogenic bacteria Vibrio alginolyticus (VA09 and characterisation by FTIR

    Directory of Open Access Journals (Sweden)

    Rajasekar Thirunavukkarasu

    2013-08-01

    Full Text Available Objective: Fresh marine seaweeds Gracilaria edulis, Gracillaria verrcosa, Acanthospora spicifera, Ulva facita, Ulva lacta (U. lacta, Kappaphycus spicifera, Sargassum ilicifolium, Sargassum wightii (S. wightii, Padina tetramatica and Padina gymonospora were collected from Mandapam (Rameshwaram, Tamil Nadu of South East coast of India and were screened for antibacterial activity. Methods: All the collected seaweeds were extracted by using five different solvent (methanol, isopropanol, acetone, chloroform, diethyl ether to study their extracts against fish pathogenic bacteria V. alginolyticus (VA09 purchased from MTCC. And minimum inhibition carried out by using Resazurin micro-titre assay. Crude extract of S. wightii analysied by FTIR. Results: The methanolic extract of S. wightii produced a maximum zone of inhibition (1.95±0.11 cm, isopropanol extract maximum inhibition was produced by S. wightii (1.93±0.78 cm, Acetone extract of Gracilaria verrcosa showed maximum zone of inhibition (1.36±0.05 cm, chloroform extract of S. wightii produced a maximum zone (1.56±0.25 cm and diethyl ether extract of S. wightii produced maximum zone of inhibition(1.86±0.11 cm. Based on the antibacterial activity S. wightii, U. lacta and Padina tetramatica showed best antibacterial activity against Vibrio harveyi. In this three seaweeds were taken for MIC study. The S. wightii methanolic extract, U. lacta diethyl ether extract and Padina tetramatica methanolic extract showed a higher MIC values, and despectively were 25 mg/mL, 50 mg/mL and 50 mg/mL. FTIR result showed that mostly phenolic compounds were present in the S. wightii. Conclusions: Based on the FTIR result S. wightii have high amount of phenolic compound. Phenolic compound have the good antimicrobial activity. The results clearly show that seaweed S. wightii is an interesting source for biologically active compounds that may be applied for prophylaxis and therapy of bacterial fish diseases and it should

  17. Sexual Reproduction of Human Fungal Pathogens

    Science.gov (United States)

    Heitman, Joseph; Carter, Dee A.; Dyer, Paul S.; Soll, David R.

    2014-01-01

    We review here recent advances in our understanding of sexual reproduction in fungal pathogens that commonly infect humans, including Candida albicans, Cryptococcus neoformans/gattii, and Aspergillus fumigatus. Where appropriate or relevant, we introduce findings on other species associated with human infections. In particular, we focus on rapid advances involving genetic, genomic, and population genetic approaches that have reshaped our view of how fungal pathogens evolve. Rather than being asexual, mitotic, and largely clonal, as was thought to be prevalent as recently as a decade ago, we now appreciate that the vast majority of pathogenic fungi have retained extant sexual, or parasexual, cycles. In some examples, sexual and parasexual unions of pathogenic fungi involve closely related individuals, generating diversity in the population but with more restricted recombination than expected from fertile, sexual, outcrossing and recombining populations. In other cases, species and isolates participate in global outcrossing populations with the capacity for considerable levels of gene flow. These findings illustrate general principles of eukaryotic pathogen emergence with relevance for other fungi, parasitic eukaryotic pathogens, and both unicellular and multicellular eukaryotic organisms. PMID:25085958

  18. Sexual reproduction of human fungal pathogens.

    Science.gov (United States)

    Heitman, Joseph; Carter, Dee A; Dyer, Paul S; Soll, David R

    2014-08-01

    We review here recent advances in our understanding of sexual reproduction in fungal pathogens that commonly infect humans, including Candida albicans, Cryptococcus neoformans/gattii, and Aspergillus fumigatus. Where appropriate or relevant, we introduce findings on other species associated with human infections. In particular, we focus on rapid advances involving genetic, genomic, and population genetic approaches that have reshaped our view of how fungal pathogens evolve. Rather than being asexual, mitotic, and largely clonal, as was thought to be prevalent as recently as a decade ago, we now appreciate that the vast majority of pathogenic fungi have retained extant sexual, or parasexual, cycles. In some examples, sexual and parasexual unions of pathogenic fungi involve closely related individuals, generating diversity in the population but with more restricted recombination than expected from fertile, sexual, outcrossing and recombining populations. In other cases, species and isolates participate in global outcrossing populations with the capacity for considerable levels of gene flow. These findings illustrate general principles of eukaryotic pathogen emergence with relevance for other fungi, parasitic eukaryotic pathogens, and both unicellular and multicellular eukaryotic organisms. Copyright © 2014 Cold Spring Harbor Laboratory Press; all rights reserved.

  19. Thermally Dimorphic Human Fungal Pathogens--Polyphyletic Pathogens with a Convergent Pathogenicity Trait.

    Science.gov (United States)

    Sil, Anita; Andrianopoulos, Alex

    2014-11-10

    Fungi are adept at changing their cell shape and developmental program in response to signals in their surroundings. Here we focus on a group of evolutionarily related fungal pathogens of humans known as the thermally dimorphic fungi. These organisms grow in a hyphal form in the environment but shift their morphology drastically within a mammalian host. Temperature is one of the main host signals that initiates their conversion to the "host" form and is sufficient in the laboratory to trigger establishment of this host-adapted developmental program. Here we discuss the major human pathogens in this group, which are Blastomyces dermatiditis, Coccidioides immitis/posadasii, Histoplasma capsulatum, Paracoccidioides brasiliensis/lutzii, Sporothrix schenckii, and Talaromyces marneffei (formerly known as Penicillium marneffei). The majority of these organisms are primary pathogens, with the ability to cause disease in healthy humans who encounter them in endemic areas. Copyright © 2015 Cold Spring Harbor Laboratory Press; all rights reserved.

  20. Highly diverse recombining populations of Vibrio cholerae and Vibrio parahaemolyticus in French Mediterranean coastal lagoons

    Science.gov (United States)

    Esteves, Kévin; Mosser, Thomas; Aujoulat, Fabien; Hervio-Heath, Dominique; Monfort, Patrick; Jumas-Bilak, Estelle

    2015-01-01

    Vibrio parahaemolyticus and Vibrio cholerae are ubiquitous to estuarine and marine environments. These two species found in Mediterranean coastal systems can induce infections in humans. Environmental isolates of V. cholerae (n = 109) and V. parahaemolyticus (n = 89) sampled at different dates, stations and water salinities were investigated for virulence genes and by a multilocus sequence-based analysis (MLSA). V. cholerae isolates were all ctxA negative and only one isolate of V. parahaemolyticus displayed trh2 gene. Most Sequence Types (ST) corresponded to unique ST isolated at one date or one station. Frequent recombination events were detected among different pathogenic species, V. parahaemolyticus, V. cholerae, Vibrio mimicus, and Vibrio metoecus. Recombination had a major impact on the diversification of lineages. The genetic diversity assessed by the number of ST/strain was higher in low salinity condition for V. parahaemolyticus and V. cholerae whereas the frequency of recombination events in V. cholerae was lower in low salinity condition. Mediterranean coastal lagoon systems housed V. cholerae and V. parahaemolyticus with genetic diversities equivalent to the worldwide diversity described so far. The presence of STs found in human infections as well as the frequency of recombination events in environmental vibrios populations could predict a potential epidemiological risk. PMID:26236294

  1. Discrimination and numerical analysis of human pathogenic ...

    African Journals Online (AJOL)

    Discrimination and numerical analysis of human pathogenic Candida albicans strains based on SDSPAGE protein profiles. ... obtaining a correct identification, both the commercial yeast kit system and the numerical analysis of whole-cell protein patterns can be useful for the more reliable identification of C. albicans strains.

  2. Diversity of Vibrio navarrensis Revealed by Genomic Comparison: Veterinary Isolates Are Related to Strains Associated with Human Illness and Sewage Isolates While Seawater Strains Are More Distant.

    Science.gov (United States)

    Schwartz, Keike; Kukuc, Cindy; Bier, Nadja; Taureck, Karin; Hammerl, Jens A; Strauch, Eckhard

    2017-01-01

    Strains of Vibrio navarrensis are present in aquatic environments like seawater, rivers, and sewage. Recently, strains of this species were identified in human clinical specimens. In this study, V. navarrensis strains isolated from livestock in Germany were characterized that were found in aborted fetuses and/or placentas after miscarriages. The veterinary strains were analyzed using phenotypical and genotypical methods and compared to isolates from marine environments of the Baltic Sea and North Sea. The investigated phenotypical traits were similar in all German strains. Whole genome sequencing (WGS) was used to evaluate a phylogenetic relationship by performing a single nucleotide polymorphism (SNP) analysis. For the SNP analysis, WGS data of two American human pathogenic strains and two Spanish environmental isolates from sewage were included. A phylogenetic analysis of concatenated sequences of five protein-coding housekeeping genes (gyrB, pyrH, recA, atpA, and rpoB), was additionally performed. Both phylogenetic analyses reveal a greater distance of the environmental seawater strains to the other strains. The phylogenetic tree constructed from concatenated sequences of housekeeping genes places veterinary, human pathogenic and Spanish sewage strains into one cluster. Presence and absence of virulence-associated genes were investigated based on WGS data and confirmed by PCR. However, this analysis showed no clear pattern for the potentially pathogenic strains. The detection of V. navarrensis in human clinical specimens strongly suggests that this species should be regarded as a potential human pathogen. The identification of V. navarrensis strains in domestic animals implicates a zoonotic potential of this species. This could indicate a potential threat for humans, as according to the "One Health" concept, human, animal, and environmental health are linked. Future studies are necessary to search for reservoirs of these bacteria in the environment and/or in

  3. Identification and Characterization of a Putative Manganese Export Protein in Vibrio cholerae

    OpenAIRE

    Fisher, Carolyn R.; Wyckoff, Elizabeth E.; Peng, Eric D.; Payne, Shelley M.

    2016-01-01

    Manganese plays an important role in the cellular physiology and metabolism of bacterial species, including the human pathogen Vibrio cholerae. The intracellular level of manganese ions is controlled through coordinated regulation of the import and export of this element. We have identified a putative manganese exporter (VC0022), named mneA (manganese exporter A), which is highly conserved among Vibrio spp. An mneA mutant exhibited sensitivity to manganese but not to other cations. Under high...

  4. Horizontal gene transfer in human pathogens.

    Science.gov (United States)

    Juhas, Mario

    2015-02-01

    Horizontal gene transfer has a tremendous impact on the genome plasticity, adaptation and evolution of bacteria. Horizontally transferred mobile genetic elements are involved in the dissemination of antibiotic resistance and virulence genes, thus contributing to the emergence of novel "superbugs". This review provides update on various mechanisms of horizontal gene transfer and examines how horizontal gene transfer contributes to the evolution of pathogenic bacteria. Special focus is paid to the role horizontal gene transfer plays in pathogenicity of the emerging human pathogens: hypervirulent Clostridium difficile and Escherichia coli (including the most recent haemolytic uraemic syndrome outbreak strain) and methicillin-resistant Staphylococcus aureus (MRSA), which have been associated with largest outbreaks of infection recently.

  5. Human to human transmission of arthropod-borne pathogens

    NARCIS (Netherlands)

    Martina, Byron E.; Barzon, Luisa; Pijlman, Gorben P.; Fuente, de la José; Rizzoli, Annapaola; Wammes, Linda J.; Takken, Willem; Rij, van Ronald P.; Papa, Anna

    2017-01-01

    Human-to-human (H2H) transmitted arthropod-borne pathogens are a growing burden worldwide, with malaria and dengue being the most common mosquito-borne H2H transmitted diseases. The ability of vectors to get infected by humans during a blood meal to further propel an epidemic depends on complex

  6. Human to human transmission of arthropod-borne pathogens

    NARCIS (Netherlands)

    Martina, B.E.; Barzon, L.; Pijlman, G.P.; Fuente, J. de la; Rizzoli, A.; Wammes, L.J.; Takken, W.; Rij, R.P. van; Papa, A.

    2017-01-01

    Human-to-human (H2H) transmitted arthropod-borne pathogens are a growing burden worldwide, with malaria and dengue being the most common mosquito-borne H2H transmitted diseases. The ability of vectors to get infected by humans during a blood meal to further propel an epidemic depends on complex

  7. 1-(2-aminophenyl)-1H-1,2,3-triazole-4-carboxylic acid: activity against Gram-positive and Gram-negative pathogens including Vibrio cholerae

    Science.gov (United States)

    Maji, Krishnendu; Haldar, Debasish

    2017-10-01

    We report a new synthetic aromatic ε-amino acid containing a triazole moiety with antimicrobial potential against Gram-positive, Gram-negative and pathogenic bacteria including Vibrio cholerae. Structure-property relationship studies revealed that all the functional groups are essential to enhance the antimicrobial activity. The 1-(2-aminophenyl)-1H-1,2,3-triazole-4-carboxylic acid was synthesized by click chemistry. From X-ray crystallography, the amino acid adopts a kink-like structure where the phenyl and triazole rings are perpendicular to each other and the amine and acid groups maintain an angle of 60°. The agar diffusion test shows that the amino acid has significant antibacterial activity. The liquid culture test exhibits that the minimum inhibitory concentration (MIC) value for Bacillus subtilis and Vibrio cholerae is 59.5 µg ml-1. FE-SEM experiments were performed to study the morphological changes of bacterial shape after treatment with compound 1. The antimicrobial activity of the amino acid was further studied by DNA binding and degradation study, protein binding, dye-binding assay and morphological analysis. Moreover, the amino acid does not have any harmful effect on eukaryotes.

  8. Human pathogen subversion of antigen presentation.

    Science.gov (United States)

    Brodsky, F M; Lem, L; Solache, A; Bennett, E M

    1999-04-01

    Many pathogens have co-evolved with their human hosts to develop strategies for immune evasion that involve disruption of the intracellular pathways by which antigens are bound by class I and class II molecules of the major histocompatibility complex (MHC) for presentation to T cells. Here the molecular events in these pathways are reviewed and pathogen interference is documented for viruses, extracellular and intracellular bacteria and intracellular parasites. In addition to a general review, data from our studies of adenovirus, Chlamydia trachomatis and Coxiella burnetii are summarized. Adenovirus E19 is the first viral gene product described that affects class I MHC molecule expression by two separate mechanisms, intracellular retention of the class I heavy chain by direct binding and by binding to the TAP transporter involved in class I peptide loading. Coxiella and Chlamydia both affect peptide presentation by class II MHC molecules as a result of their residence in endocytic compartments, although the properties of the parasitophorous vacuoles they form are quite different. These examples of active interference with antigen presentation by viral gene products and passive interference by rickettsiae and bacteria are typical of the strategies used by these different classes of pathogens, which need to evade different types of immune responses. Pathogen-host co-evolution is evident in these subversion tactics for which the pathogen crime seems tailored to fit the immune system punishment.

  9. Vibrio cholerae Detection in Water and Wastewater by Polymerase Chain Reaction Assay

    Directory of Open Access Journals (Sweden)

    Behnaz Barzamini

    2014-11-01

    Full Text Available Background: Vibrio cholerae is a significant human pathogen worldwide and annually causes some cases of deaths. Contaminated water plays an important role in transmission of this pathogen, which indicates the importance of early diagnosis. Objectives: The current study aimed to perform Polymerase Chain Reaction (PCR on water and wastewater samples to determine the detection limit for Vibrio cholerae. Materials and Methods: PCR was performed on the DNA extracted from Vibrio cholerae of the contaminated water and wastewater using ctxA gene specific primers. The accuracy of PCR method to detect these bacteria was also assessed. Results: The result of PCR performed on the extracted DNA showed a specific 241 base pair band. The limit of bacterial detection for water and wastewater were 40 cfu/mL and 81 cfu/mL, respectively. Conclusions: In the current study, PCR performance using the ctxA gene specific primers to detect Vibrio cholerae was found highly accurate and specific.

  10. Pathogenic human viruses in coastal waters

    Science.gov (United States)

    Griffin, Dale W.; Donaldson, Kim A.; Paul, J.H.; Rose, Joan B.

    2003-01-01

    This review addresses both historical and recent investigations into viral contamination of marine waters. With the relatively recent emergence of molecular biology-based assays, a number of investigations have shown that pathogenic viruses are prevalent in marine waters being impacted by sewage. Research has shown that this group of fecal-oral viral pathogens (enteroviruses, hepatitis A viruses, Norwalk viruses, reoviruses, adenoviruses, rotaviruses, etc.) can cause a broad range of asymptomatic to severe gastrointestinal, respiratory, and eye, nose, ear, and skin infections in people exposed through recreational use of the water. The viruses and the nucleic acid signature survive for an extended period in the marine environment. One of the primary concerns of public health officials is the relationship between the presence of pathogens and the recreational risk to human health in polluted marine environments. While a number of studies have attempted to address this issue, the relationship is still poorly understood. A contributing factor to our lack of progress in the field has been the lack of sensitive methods to detect the broad range of both bacterial and viral pathogens. The application of new and advanced molecular methods will continue to contribute to our current state of knowledge in this emerging and

  11. Draft genome sequence of pathogenic bacteria Vibrio parahaemolyticus strain Ba94C2, associated with acute hepatopancreatic necrosis disease isolate from South America

    Directory of Open Access Journals (Sweden)

    Leda Restrepo

    2016-09-01

    Full Text Available Vibrio parahaemolyticus is a pathogenic bacteria which has been associated to the early mortality syndrome (EMS also known as hepatopancreatic necrosis disease (AHPND causing high mortality in shrimp farms. Pathogenic strains contain two homologous genes related to insecticidal toxin genes, PirA and PirB, these toxin genes are located on a plasmid contained within the bacteria. Genomic sequences have allowed the finding of two strains with a divergent structure related to the geographic region from where they were found. The isolates from the geographic collection of Southeast Asia and Mexico show variable regions on the plasmid genome, indicating that even though they are not alike they still conserve the toxin genes. In this paper, we report for the first time, a pathogenic V. parahaemolyticus strain in shrimp from South America that showed symptoms of AHPND. The genomic analysis revealed that this strain of V. parahaemolyticus found in South America appears to be more related to the Southeast Asia as compared to the Mexican strains. This finding is of major importance for the shrimp industry, especially in regards to the urgent need for disease control strategies to avoid large EMS outbreaks and economic loss, and to determine its dispersion in South America. The whole-genome shotgun project of V. parahaemolyticus strain Ba94C2 have been deposited at DDBJ/EMBL/GenBank under the accession PRJNA335761.

  12. Draft genome sequence of pathogenic bacteria Vibrio parahaemolyticus strain Ba94C2, associated with acute hepatopancreatic necrosis disease isolate from South America.

    Science.gov (United States)

    Restrepo, Leda; Bayot, Bonny; Betancourt, Irma; Pinzón, Andres

    2016-09-01

    Vibrio parahaemolyticus is a pathogenic bacteria which has been associated to the early mortality syndrome (EMS) also known as hepatopancreatic necrosis disease (AHPND) causing high mortality in shrimp farms. Pathogenic strains contain two homologous genes related to insecticidal toxin genes, PirA and PirB, these toxin genes are located on a plasmid contained within the bacteria. Genomic sequences have allowed the finding of two strains with a divergent structure related to the geographic region from where they were found. The isolates from the geographic collection of Southeast Asia and Mexico show variable regions on the plasmid genome, indicating that even though they are not alike they still conserve the toxin genes. In this paper, we report for the first time, a pathogenic V. parahaemolyticus strain in shrimp from South America that showed symptoms of AHPND. The genomic analysis revealed that this strain of V. parahaemolyticus found in South America appears to be more related to the Southeast Asia as compared to the Mexican strains. This finding is of major importance for the shrimp industry, especially in regards to the urgent need for disease control strategies to avoid large EMS outbreaks and economic loss, and to determine its dispersion in South America. The whole-genome shotgun project of V. parahaemolyticus strain Ba94C2 have been deposited at DDBJ/EMBL/GenBank under the accession PRJNA335761.

  13. Probing the protective mechanism of poly-ß-hydroxybutyrate against vibriosis by using gnotobiotic Artemia franciscana and Vibrio campbellii as host-pathogen model.

    Science.gov (United States)

    Baruah, Kartik; Huy, Tran T; Norouzitallab, Parisa; Niu, Yufeng; Gupta, Sanjay K; De Schryver, Peter; Bossier, Peter

    2015-03-30

    The compound poly-ß-hydroxybutyrate (PHB), a polymer of the short chain fatty acid ß-hydroxybutyrate, was shown to protect experimental animals against a variety of bacterial diseases, (including vibriosis in farmed aquatic animals), albeit through undefined mechanisms. Here we aimed at unraveling the underlying mechanism behind the protective effect of PHB against bacterial disease using gnotobiotically-cultured brine shrimp Artemia franciscana and pathogenic Vibrio campbellii as host-pathogen model. The gnotobiotic model system is crucial for such studies because it eliminates any possible microbial interference (naturally present in any type of aquatic environment) in these mechanistic studies and furthermore facilitates the interpretation of the results in terms of a cause effect relationship. We showed clear evidences indicating that PHB conferred protection to Artemia host against V. campbellii by a mechanism of inducing heat shock protein (Hsp) 70. Additionally, our results also showed that this salutary effect of PHB was associated with the generation of protective innate immune responses, especially the prophenoloxidase and transglutaminase immune systems - phenomena possibly mediated by PHB-induced Hsp70. From overall results, we conclude that PHB induces Hsp70 and this induced Hsp70 might contribute in part to the protection of Artemia against pathogenic V. campbellii.

  14. Insights into bacteriophage application in controlling Vibrio species

    Directory of Open Access Journals (Sweden)

    Vengadesh Letchumanan

    2016-07-01

    Full Text Available Bacterial infections from various organisms including Vibrio sp. pose a serious hazard to humans in many forms from clinical infection to affecting the yield of agriculture and aquaculture via infection of livestock. Vibrio sp. is one of the main foodborne pathogens causing human infection and is also a common cause of losses in the aquaculture industry. Prophylactic and therapeutic usage of antibiotics has become the mainstay of managing this problem, however this in turn led to the emergence of multidrug resistant strains of bacteria in the environment; which has raised awareness of the critical need for alternative non antibiotic based methods of preventing and treating bacterial infections. Bacteriophages - viruses that infect and result in the death of bacteria – are currently of great interest as a highly viable alternative to antibiotics. This article provides an insight into bacteriophage application in controlling Vibrio species as well underlining the advantages and drawbacks of phage therapy.

  15. Stumbling across the Same Phage: Comparative Genomics of Widespread Temperate Phages Infecting the Fish Pathogen Vibrio anguillarum

    Directory of Open Access Journals (Sweden)

    Panos G. Kalatzis

    2017-05-01

    Full Text Available Nineteen Vibrio anguillarum-specific temperate bacteriophages isolated across Europe and Chile from aquaculture and environmental sites were genome sequenced and analyzed for host range, morphology and life cycle characteristics. The phages were classified as Siphoviridae with genome sizes between 46,006 and 54,201 bp. All 19 phages showed high genetic similarity, and 13 phages were genetically identical. Apart from sporadically distributed single nucleotide polymorphisms (SNPs, genetic diversifications were located in three variable regions (VR1, VR2 and VR3 in six of the phage genomes. Identification of specific genes, such as N6-adenine methyltransferase and lambda like repressor, as well as the presence of a tRNAArg, suggested a both mutualistic and parasitic interaction between phages and hosts. During short term phage exposure experiments, 28% of a V. anguillarum host population was lysogenized by the temperate phages and a genomic analysis of a collection of 31 virulent V. anguillarum showed that the isolated phages were present as prophages in >50% of the strains covering large geographical distances. Further, phage sequences were widely distributed among CRISPR-Cas arrays of publicly available sequenced Vibrios. The observed distribution of these specific temperate Vibriophages across large geographical scales may be explained by efficient dispersal of phages and bacteria in the marine environment combined with a mutualistic interaction between temperate phages and their hosts which selects for co-existence rather than arms race dynamics.

  16. Prevalence of Vibrio vulnificus and Vibrio parahaemolyticus in the Maryland Coastal Bays

    Science.gov (United States)

    De Pascuale, V. O.

    2016-02-01

    The bacterial family of Vibrionaceae is indigenous in the marine estuarine environments such as the Maryland Coastal Bays. Vibrio vulnificus and Vibrio parahaemolyticus are both pathogenic bacteria. Understanding the distribution of Vibrio species is crucial because of the health concerns associated with the bacteria. The aim of this study was to evaluate the overall abundance of bacteria with a focus on Vibrio species in the Maryland Coastal Bays. Seawater samples were collected from 10 different sites that differ with regard to water quality. The total bacteria count (TBC) was determined by two methods: Total plate count and Epifluorescence microscopy. The most-probable-number (MPN) methodology was used to estimate the population of Vibrio parahaemolyticus and Vibrio vulnificus. In addition to the bacteriological analysis, the environmental parameters of temperature and salinity were measured using YSI 6600 multiparameter meter. The average total bacteria count was 2.21 log CFU ml-1. Vibrio vulnificus comprised 5% of the total bacteria count while Vibrio parahaemolyticus comprised only 2% of the total bacteria count. Vibrio vulnificus ranged from 0.30 to 2.48 log MPN ml-1 at the sites tested. Lower Vibrio parahaemolyticus count was observed at the sites with a range of 0.30 to 1.97 log MPN ml-1. There was no significant correlation between the environmental parameters and the Vibrio spp. Since both Vibrio vulnificus and Vibrio parahaemolyticus peak in the summer, there is a potential for a risk of wound infections and gastrointestinal illness based on this data.

  17. Hatchery mortalities of larval oysters caused by Vibrio tubiashii and Vibrio coralliilyticus

    Science.gov (United States)

    Hatchery production of bivalve shellfish has been hampered by the occasional presence of opportunistic pathogens, particularly Vibrio coralliilyticus and Vibrio tubiashii. The present study reports the results of several avenues of research to better define these pathogens and the roles they play i...

  18. Human Milk Glycoproteins Protect Infants Against Human Pathogens

    Science.gov (United States)

    Liu, Bo

    2013-01-01

    Abstract Breastfeeding protects the neonate against pathogen infection. Major mechanisms of protection include human milk glycoconjugates functioning as soluble receptor mimetics that inhibit pathogen binding to the mucosal cell surface, prebiotic stimulation of gut colonization by favorable microbiota, immunomodulation, and as a substrate for bacterial fermentation products in the gut. Human milk proteins are predominantly glycosylated, and some biological functions of these human milk glycoproteins (HMGPs) have been reported. HMGPs range in size from 14 kDa to 2,000 kDa and include mucins, secretory immunoglobulin A, bile salt-stimulated lipase, lactoferrin, butyrophilin, lactadherin, leptin, and adiponectin. This review summarizes known biological roles of HMGPs that may contribute to the ability of human milk to protect neonates from disease. PMID:23697737

  19. Vibrio and Pregnancy

    Science.gov (United States)

    ... 2013. Vibrio Infection. [Accessed January 2015]. Available at URL: http: / / www. cdc. gov/ vibrio/ index. html Centers for ... 2013. Vibrio parahaemolyticus. [Accessed January 2015]. Available at URL: http: / / www. cdc. gov/ vibrio/ vibriop. html Centers for ...

  20. Isolation and characterization of a N4-like lytic bacteriophage infecting Vibrio splendidus, a pathogen of fish and bivalves.

    Directory of Open Access Journals (Sweden)

    Pantelis Katharios

    Full Text Available A novel virulent bacteriophage, vB_VspP_pVa5, infecting a strain of Vibrio splendidus was isolated from a sea-cage aquaculture farm in Greece, and characterized using microbiological methods and genomic analysis. Bacteriophage vB_VspP_pVa5 is a N4-like podovirus with an icosahedral head measuring 85 nm in length and a short non-contractile tail. The phage had a narrow host range infecting only the bacterial host, a latent period of 30 min and a burst size of 24 virions per infected bacterium. Its genome size was 78,145 bp and genomic analysis identified 107 densely-packed genes, 40 of which could be annotated. In addition to the very large virion encapsulated DNA-dependent RNA polymerase which is the signature of the N4-like genus, an interesting feature of the novel phage is the presence of a self-splicing group I intron in the thymidylate synthase gene. A tRNAStop interrupted by a ~2.5kb open reading frame-containing area was also identified. The absence of genes related to lysogeny along with the high efficacy observed during in vitro cell lysis trials, indicate that the vB_VspP_pVa5 is a potential candidate component in a bacteriophage cocktail suitable for the biological control of V. splendidus in aquaculture.

  1. The Fish Pathogen Vibrio vulnificus Biotype 2: Epidemiology, Phylogeny, and Virulence Factors Involved in Warm-Water Vibriosis.

    Science.gov (United States)

    Amaro, Carmen; Sanjuán, Eva; Fouz, Belén; Pajuelo, David; Lee, Chung-Te; Hor, Lien-I; Barrera, Rodolfo

    2015-06-01

    Vibrio vulnificus biotype 2 is the etiological agent of warm-water vibriosis, a disease that affects eels and other teleosts, especially in fish farms. Biotype 2 is polyphyletic and probably emerged from aquatic bacteria by acquisition of a transferable virulence plasmid that encodes resistance to innate immunity of eels and other teleosts. Interestingly, biotype 2 comprises a zoonotic clonal complex designated as serovar E that has extended worldwide. One of the most interesting virulence factors produced by serovar E is RtxA13, a multifunctional protein that acts as a lethal factor for fish, an invasion factor for mice, and a survival factor outside the host. Two practically identical copies of rtxA13 are present in all biotype 2 strains regardless of the serovar, one in the virulence plasmid and the other in chromosome II. The plasmid also contains other genes involved in survival and growth in eel blood: vep07, a gene for an outer membrane (OM) lipoprotein involved in resistance to eel serum and vep20, a gene for an OM receptor specific for eel-transferrin and, probably, other related fish transferrins. All the three genes are highly conserved within biotype 2, which suggests that they are under a strong selective pressure. Interestingly, the three genes are related with transferable plasmids, which emphasizes the role of horizontal gene transfer in the evolution of V. vulnificus in nutrient-enriched aquatic environments, such as fish farms.

  2. Susceptibility of the brine shrimp Artemia and its pathogen Vibrio parahaemolyticus to chlorine dioxide in contaminated sea-water.

    Science.gov (United States)

    Puente, M E; Vega-Villasante, F; Holguin, G; Bashan, Y

    1992-12-01

    Adults and nauplii of the brine shrimp, Artemia, together with Vibrio parahaemolyticus, were placed in sewage-contaminated sea-water which had been treated with chlorine dioxide (Hallox E-100TM) to test its potential as a disinfectant for salt water aquaculture. The nauplii were very susceptible to low concentrations of chlorine dioxide (47 micrograms/l Cl-), but the adults were slightly more resistant. Sterile sea-water treated with lower concentrations of chlorine dioxide (less than 47 micrograms/l Cl-) had no effect on the shrimp, but inhibited the growth of V. parahaemolyticus. In sewage-contaminated sea-water, chlorine dioxide levels of 285-2850 micrograms/l, necessary for the inactivation of V. parahaemolyticus and any native bacteria, destroyed the Artemia culture. Hallox E-100TM persisted in sea-water for 18 h, but later decayed. We conclude that: (i) Artemia nauplii are a sensitive and convenient test-organism to determine low concentrations of chlorine dioxide in sea-water; (ii) chlorine dioxide is efficient for controlling V. parahaemolyticus in sea-water; and (iii) chlorine dioxide should be further evaluated as a potential disinfectant for aquaculture, but, for higher organisms than Artemia.

  3. Isolation and characterization of a N4-like lytic bacteriophage infecting Vibrio splendidus, a pathogen of fish and bivalves.

    Science.gov (United States)

    Katharios, Pantelis; Kalatzis, Panos G; Kokkari, Constantina; Sarropoulou, Elena; Middelboe, Mathias

    2017-01-01

    A novel virulent bacteriophage, vB_VspP_pVa5, infecting a strain of Vibrio splendidus was isolated from a sea-cage aquaculture farm in Greece, and characterized using microbiological methods and genomic analysis. Bacteriophage vB_VspP_pVa5 is a N4-like podovirus with an icosahedral head measuring 85 nm in length and a short non-contractile tail. The phage had a narrow host range infecting only the bacterial host, a latent period of 30 min and a burst size of 24 virions per infected bacterium. Its genome size was 78,145 bp and genomic analysis identified 107 densely-packed genes, 40 of which could be annotated. In addition to the very large virion encapsulated DNA-dependent RNA polymerase which is the signature of the N4-like genus, an interesting feature of the novel phage is the presence of a self-splicing group I intron in the thymidylate synthase gene. A tRNAStop interrupted by a ~2.5kb open reading frame-containing area was also identified. The absence of genes related to lysogeny along with the high efficacy observed during in vitro cell lysis trials, indicate that the vB_VspP_pVa5 is a potential candidate component in a bacteriophage cocktail suitable for the biological control of V. splendidus in aquaculture.

  4. Characterization of the Hemorrhagic Reaction Caused by Vibrio vulnificus Metalloprotease, a Member of the Thermolysin Family

    OpenAIRE

    Miyoshi, Shin-ichi; Nakazawa, Hiromi; Kawata, Koji; Tomochika, Ken-ichi; Tobe, Kazuo; Shinoda, Sumio

    1998-01-01

    Vibrio vulnificus is an opportunistic human pathogen causing wound infections and septicemia, characterized by hemorrhagic and edematous damage to the skin. This human pathogen secretes a metalloprotease (V. vulnificus protease [VVP]) as an important virulence determinant. When several bacterial metalloproteases including VVP were injected intradermally into dorsal skin, VVP showed the greatest hemorrhagic activity. The level of the in vivo hemorrhagic activity of the bacterial metalloproteas...

  5. Invertebrates as a source of emerging human pathogens.

    Science.gov (United States)

    Waterfield, Nicholas R; Wren, Brendan W; Ffrench-Constant, Richard H

    2004-10-01

    Despite their importance, little is known about the origins of many emerging human pathogens. However, given the age and current predominance of invertebrates, it is likely that bacteria-invertebrate interactions are not only a present source of human pathogens but have also shaped their evolution. Pathogens of invertebrate and unicellular organisms represent an extensive reservoir of bacterial strains equipped with virulence factors that evolved to overcome the innate immune responses of their hosts. This reservoir might represent a source of new human pathogenic strains and might also foster the spread of novel virulence factors into existing human commensal or pathogenic bacteria. This article examines the available evidence for this concept by examining pairs of closely related bacteria, one of which is benign, but insect associated, and one of which is a human pathogen.

  6. Inhibitory Activity of Lactid Acid Bacteria Isolated from Tape Waterlily Seed to Enteric Pathogenic Bacteria (Vibrio cholera, Salmonella typhi, Shigella disentri, and E.coli and Its’ Susceptibility to Antibiotic, Bile Salt and Acidic Condition

    Directory of Open Access Journals (Sweden)

    Iin Khusnul Khotimah

    2012-03-01

    Full Text Available The aim of this research was to observe inhibitory activity of LAB isolated from tape waterlily seed to enteric pathogenic bacteria (Vibrio cholera, Salmonella typhi, Shigella disentri, E.coli ATCC 25922 and it’s susceptibility to antibiotic, in bile salt and under acidic condition. Microbia in the tape ( a fermented product of waterlily seed to showed were Streptococcus thermophilus (IKH-1, Pediococcus pentosaceus (IKH-2 and Leuconostoc mesentroides (IKH-8. Streptococcus thermophillus showed inhibition against the growth of Shigella disentri with inhibition zones 16,28 mm, but did not against the growth of V. Cholera, S. typhi, E.coli. Pediococcus pentosaceus inhibit Vibrio cholera, dan Salmonella thypi with inhibition zones 18,59 mm dan 7,91 mm. So that, Leuconostoc mesenteroides inhibit Salmonella thypi with zones inhibits average 8,25 mm. Chloramfenicol at 0.05 mg concentrations did not show inhibition against the growth of isolated Streptococcus thermophillus, Pediococcus pentosaceus and Leuconostoc mesentroides. These isolates could survive too in bile salt (2% and acidified media (pH 3.   Keyword : The tape of  waterlily seed, LAB, probiotic and enteric pathogenic   KEMAMPUAN PENGHAMBATAN BAKTERI ASAM LAKTAT DARI TAPE BIJI TERATAI TERHADAP PATOGENIK ENTERIK (VIBRIO CHOLERA, SALMONELLA THYPI, SHIGELLA DISENTRI, E. COLI, ANTIBIOTIK, KETAHANANNYA TERHADAP BILE SALT DAN ASAM   ABSTRAK   Penelitian ini bertujuan untuk menguji kemampuan penghambatan bakteri asam laktat yang diisolasi dari tape biji teratai terhadap patogenik enterik (Vibrio cholera, Salmonella thypi, Shigella disentri, E. Coli ATCC 25922, antibiotik, bile salt dan asam. Jenis bakteri yang diketahui tumbuh selama fermentasi tape biji teratai adalah Streptococcus thermopilus (IKH-1, Pediococcus pentosaceus(IKH-2, dan Leuconostoc mesentroides (IKH-8. Pengamatan terhadap uji penghambatan patogenik enterik (Vibrio cholera, Salmonella thypi, Shigella disentri, dan E. Coli ATCC

  7. O34-pathogen sensing by human odontoblasts.

    Science.gov (United States)

    Fargues, J-C; Keller, J-F; Carrouel, F; Kufer, T A; Baudouin, C; Msika, P; Bleicher, F; Staquet, M-J

    2011-04-11

    Human odontoblasts are neural crest-derived, dentin-producing mesenchymal cells aligned at the periphery of the dental pulp. They become exposed to cariogenic oral bacteria as these progressively demineralise enamel then dentin to gain access to the pulp. Due to their situation at the dentin-pulp interface, odontoblasts are the first cells encountered by invading pathogens and/or their released components, and represent, in the tooth, the first line of defence for the host. Previous studies have shown that odontoblasts are able to sense pathogens and elicit innate immunity. In particular, they express several pathogen recognition receptors of the Toll-like receptor (TLR) and nucleotide-binding oligomerisation domain (NOD) families, which allow them to recognize specific bacterial and viral components. So far, most studies aiming at elucidating the role of odontoblasts in the dental pulp innate response have focused on Gram-positive bacteria, as these largely dominate the carious microflora in initial and moderate dentin caries lesions. In vitro, odontoblasts were found to be sensitive to Gram-positive bacteria-derived components, mainly lipoteichoic acid which is recognized through cell membrane TLR2. Our studies have shown that engagement of odontoblast TLR2 by LTA triggers TLR2 and NOD2 up-regulation, NF-B nuclear translocation, production of various chemokines including CCL2, CXCL1, CXCL2, CXCL8 and CXCL10, while promoting immature dendritic cell recruitment. Conversely, LTA down-regulates major dentin matrix components, including collagen type I and dentin sialophosphoprotein, as well as TGF-b1, a known inducer of dentin formation. We provide here additional data showing the fine localization of NOD2 in healthy dental pulps, as well as differential regulation of TLR2, TLR4, NOD2, CCL2 and CXCL8 genes by LTA and the synthetic TLR2 agonists Pam2CSK4 and Pam3CSK4. It appears from the aforementioned data that odontoblast-triggered immune events constitute

  8. Diversity and Antagonistic Activity of Actinomycete Strains From Myristica Swamp Soils Against Human Pathogens

    Directory of Open Access Journals (Sweden)

    Varghese Rlnoy

    2014-05-01

    Full Text Available Under the present investigation Actinomycetes were isolated from the soils of Myristica swamps of southern Western Ghats and the antagonistic activity against different human bacterial pathogens was evaluated. Results of the present study revealed that Actinomycetes population in the soils of Myristica swamp was spatially and seasonally varied. Actinomycetes load was varied from 24×104 to 71×103, from 129×103 to 40×103 and from 31×104 to 84×103 in post monsoon, monsoon and pre monsoon respectively. A total of 23 Actinomycetes strains belonging to six genera were isolated from swamp soils. Identification of the isolates showed that most of the isolates belonged to the genus Streptomyces (11, followed by Nocardia (6, Micromonospora (3, Pseudonocardia (1, Streptosporangium (1, and Nocardiopsis (1. Antagonistic studies revealed that 91.3% of Actinomycete isolates were active against one or more tested pathogens, of that 56.52% exhibited activity against Gram negative and 86.95% showed activity against Gram positive bacteria. 39.13% isolates were active against all the bacterial pathogens selected and its inhibition zone diameter was also high. 69.5% of Actinomycetes were exhibited antibacterial activity against Listeria followed by Bacillus cereus (65.21%, Staphylococcus (60.86%, Vibrio cholera (52.17%, Salmonella (52.17% and E. coli (39.13%. The results indicate that the Myristica swamp soils of Southern Western Ghats might be a remarkable reserve of Actinomycetes with potential antagonistic activity.

  9. Antibacterial activity of different extracts of prawn shell (Macrobrachium nipponense against human bacterial pathogens

    Directory of Open Access Journals (Sweden)

    Katayoon Karimzadeh

    2017-01-01

    Full Text Available Aims: Bioactive compounds existing in crustacean shells have the potential to inhibit the growth of some pathogenic microorganism. The purpose of this study is to evaluate the antibacterial effects of different extracts of prawn shells (Macrobrachium nipponense on some human pathogenic bacteria. Materials and Methods: Sampling (prawn was conducted in summer 2014 from Anzali wetland in southern coast of Caspian Sea. Then, the hydroalcoholic, methanolic, and acetone extracts of prawn shells were applied for this purpose. Two Gram-positive (Bacillus subtilis Staphylococcus aureus and three Gram-negative (Klebsiella pneumoniae, Vibrio cholerae, and Escherichia coli were used as test organisms. The antibacterial activity was determined by paper disk diffusion. Results: The prawn shell extracts showed activity against pathogenic bacteria. The highest antibacterial activities were measured in B. subtilis, S. aureus, and V. cholerae with the zone of inhibition being 12.12 ± 0.32 mm, 12.51 ± 0.14 mm, and 12.35 ± 0.27 mm, respectively. Among all the strains, S. aureus exhibits a significant zone of inhibition against all extracts (P < 0.05. Conclusion: The findings of this research showed that different prawn shell extracts, particularly hydroalcoholic, have bactericidal effect on B. subtilis, S. aureus, and V. cholerae species.

  10. Molecular Analysis and Toxigenic Potential of Vibrio cholerae Isolated from Hilsha fish (Tenualosa ilisha), Bangladesh

    DEFF Research Database (Denmark)

    Hossain, Zenat Zebin; Farhana, Israt; Tulsiani, Suhella

    Exposure to contaminated fish may upsurge the virulent strains of Vibrio cholerae, the deadly human pathogen in the households of rural and urban Bangladesh. Since V. cholerae spreading was reported from the Bay of Bengal, this study hypothesized that Hilsha (Tenualosa ilisha), a marine and fresh...

  11. Vibrio vulnificus outbreaks in Dutch eel farms since 1996: strain diversity and impact.

    NARCIS (Netherlands)

    Haenen, O.L.M.; Zanten, van E.; Jansen, R.; Roozenburg, I.; Engelsma, M.Y.; Dijkstra, A.; Boers, S.A.; Voorbergen-Laarman, M.; Möller, A.V.M.

    2014-01-01

    Vibrio vulnificus is a potentially zoonotic bacterial pathogen of fish, which can infect humans (causing necrotic fasciitis). We analysed 24 V. vulnificus isolates (from 23 severe eel disease outbreaks in 8 Dutch eel farms during 1996 to 2009, and 1 clinical strain from an eel farmer) for genetic

  12. Epidemiological evidence of lesser role of thermostable direct hemolysin (TDH)-related hemolysin (TRH) than TDH on Vibrio parahaemolyticus pathogenicity.

    Science.gov (United States)

    Saito, Shioko; Iwade, Yoshito; Tokuoka, Eisuke; Nishio, Tomohiro; Otomo, Yoshimitsu; Araki, Emiko; Konuma, Hirotaka; Nakagawa, Hiroshi; Tanaka, Hiroyuki; Sugiyama, Kanji; Hasegawa, Akio; Sugita-Konishi, Yoshiko; Hara-Kudo, Yukiko

    2015-02-01

    Vibrio parahaemolyticus carrying the tdh gene, encoding the thermostable direct hemolysin (TDH), or the trh gene, encoding the TDH-related hemolysin (TRH), are both considered virulent strains. There are, however, disproportionally fewer reports of infections caused by seafood contaminated with trh-positive strains than by seafood contaminated with tdh-positive strains. Bivalves such as clams and oysters are the major seafood varieties associated with the infections. In this study, the prevalence of strains possessing the tdh and trh genes was investigated in Japan in 74 samples collected in 2007-2008 and in 177 samples collected in 2010 of domestic bivalves, bloody clams, hen clams, short-neck clams, and rock oysters. The tdh-positive and trh-negative, tdh-negative and trh-positive, and tdh-positive and trh-positive samples represented 5.4%, 12.2%, and 4.1% of all samples collected in 2007-2008, and 5.1%, 18.6%, and 5.6% of all samples collected in 2010, respectively. As determined by polymerase chain reaction, the prevalence of tdh negative and trh positive in all samples was two to four times higher than that of tdh positive and trh negative. In the samples collected in 2010, the tdh-negative and trh-positive V. parahaemolyticus (20 samples) was more often isolated than tdh-positive and trh-negative V. parahaemolyticus (7 samples). The most common serotype of tdh-positive isolates (22 of 24 strains) was pandemic O3:K6. The trh-positive isolates (61 strains) were various serotypes including OUT:KUT. In 330 V. parahaemolyticus outbreaks and sporadic infections in Japan, most outbreaks and sporadic infections were caused by tdh-positive and trh-negative strains (89.4%). The frequencies of infections caused by tdh-negative and trh-positive, and both tdh- and trh-positive strains were 1.2% and 3.0%, respectively. This finding suggests that the virulence of trh might be less than that of tdh, although trh-positive V. parahaemolyticus frequently contaminated bivalves.

  13. Vibrio cholerae Infection of Drosophila melanogaster Mimics the Human Disease Cholera

    OpenAIRE

    Blow, Nathan S.; Salomon, Robert N.; Kerry Garrity; Isabelle Reveillaud; Alan Kopin; F Rob Jackson; Watnick, Paula I.

    2005-01-01

    Cholera, the pandemic diarrheal disease caused by the gram-negative bacterium Vibrio cholerae, continues to be a major public health challenge in the developing world. Cholera toxin, which is responsible for the voluminous stools of cholera, causes constitutive activation of adenylyl cyclase, resulting in the export of ions into the intestinal lumen. Environmental studies have demonstrated a close association between V. cholerae and many species of arthropods including insects. Here we report...

  14. Autecology of Vibrio vulnificus and Vibrio parahaemolyticus in tropical waters

    Energy Technology Data Exchange (ETDEWEB)

    Rivera, S.; Lugo, T.; Hazen, T.C. [Univ. of Puerto Rico, Rio Piedras (Puerto Rico)

    1988-12-31

    Water and shellfish samples collected from estuaries, mangroves, and beaches along the coast of Puerto Rico were examined for Vibrio vulnificus and Vibrio parahaemolyticus. An array of water quality parameters were also measured simultaneous with bacteria sampling. Both species of vibrio were associated with estuary and mangrove locations, and neither was isolated from sandy beaches. Densities of V. vulnificus were negatively correlated with salinity, 10--15 ppt being optimal. V. parahaemolyticus was isolated from sites with salinities between 20 and 35 ppt, the highest densities occurring at 20 ppt. Densities of Vibrio spp. and V. parahaemolyticus for a tropical estuary surpassed those reported for temperate estuaries by several orders of magnitude. Both densities of total Vibrio spp. and V. parahaemolyticus in the water were directly related to densities of fecal coliforms, unlike V. vulnificus. The incidence of ONPG(+) strains among sucrose({minus}) Vibrio spp. served as an indicator of the frequency of V. vulnificus in this group. More than 63% of the V. vulnificus isolated were pathogenic. V. vulnificus and V. parahaemolyticus occupy clearly separate niches within the tropical estuarine-marine ecosystem.

  15. Long-term effects of ocean warming on vibrios

    Science.gov (United States)

    Pruzzo, C.; Pezzati, E.; Brettar, I.; Reid, P. C.; Colwell, R.; Höfle, M. G.; vezzulli, L.

    2012-12-01

    Vibrios are a major source of human disease, play an important role in the ecology and health of marine animals and are regarded as an abundant fraction of culturable bacteria of the ocean. There has been a considerable global effort to reduce the risk of Vibrio infections and yet in most countries both human and non-human illnesses associated with these bacteria are increasing. The cause of this increase is not known, but since vibrios are strongly thermodependant there is good reason to believe that global warming may have contributed. To investigate this possibility we examined historical samples from the Continuous Plankton Recorder (CPR) archive using advanced molecular analysis and pyrosequencing. For the first time we were able to recover environmental DNA from CPR samples that had been stored for up to ~50 years in a formalin-fixed format, which is suitable for molecular analyses of the associated prokaryotic community. To overcome the problem of DNA degradation due to the sample age and storage in formalin we develop an unbiased index of abundance for Vibrio quantification in CPR samples termed a 'relative Vibrio Abundance Index' (VAI). VAI is defined as the ratio of Vibrio spp. cells to total bacterial cells assessed by Real-Time PCR using genus-specific and universal primers, respectively, producing small amplicons of similar size (~100bp). We assessed VAI index on 55 samples (each representing 10 nautical miles tow equal to 3 m3 of filtered sewater) collected in August by the CPR survey in the North Sea from off the Rhine and Humber estuaries between 1961 to 2005 showing that the genus Vibrio has increased in prevalence in the last 44 years and that this increase is correlated significantly, during the same period, with warming sea surface temperature. In addition, by applying deep sequencing analysis of a subset of these samples we provide evidence that bacteria belonging to the genus Vibrio, including the human pathogen V. cholerae, not only increased

  16. Exploration of Phage-Host Interactions in Fish Pathogen Vibrio anguillarum and Anti-Phage Defense Strategies

    DEFF Research Database (Denmark)

    Tan, Demeng

    T to repress ompK expression. It was demonstrated that QS controls the choice of anti-phage defense strategies in the V. anguillarum strain PF430-3, suggesting the presence of dynamic, temporary adaptations to phage infection pressure, while still securing the ability to produce a functional OmpK receptor...... of bacterial pathogenicity development. Therefore, successful application of phage therapy in the treatment of vibriosis requires a detailed understanding of phage-host interactions, especially with regards to anti-phage defense mechanisms in the host. Part I. As a first approach, 24 V. anguillarum and 13....... In conclusion, this thesis provides a first insight into the dynamic vibriophage-host interactions, indicating the complexity of phage therapy in the treatment of vibriosis, regarding the evolution of anti-phage defense mechanisms, gene regulation, quorum sensing, biofilm formation, as well as pathogenesis...

  17. Epidemiology of pathogenic enterobacteria in humans, livestock, and peridomestic rodents in rural Madagascar.

    Science.gov (United States)

    Bublitz, DeAnna C; Wright, Patricia C; Bodager, Jonathan R; Rasambainarivo, Fidisoa T; Bliska, James B; Gillespie, Thomas R

    2014-01-01

    Among the families of enteric bacteria are globally important diarrheal agents. Despite their potential for zoonotic and environmental transmission, few studies have examined the epidemiology of these pathogens in rural systems characterized by extensive overlap among humans, domesticated and peridomestic animals. We investigated patterns of infection with Enterotoxigenic Escherichia coli, Shigella spp., Salmonella enterica, Vibrio cholerae, and Yersinia spp. (enterocolitica, and pseudotuberculosis) in Southeastern Madagascar where the potential for the aforementioned interactions is high. In this pilot project we conducted surveys to examine behaviors potentially associated with risk of infection and if infection with specific enterobacteria species was associated with diarrheal disease. PCR was conducted on DNA from human, livestock, and rodent fecal samples from three villages. Overall, human prevalence was highest (77%), followed by rodents (51%) and livestock (18%). Rodents were ∼2.8 times more likely than livestock to carry one of the bacteria. The incidence of individual species varied between villages, with the observation that, E. coli and Shigella spp. were consistently associated with co-infections. As an aggregate, there was a significant risk of infection linked to a water source in one village. Individually, different pathogens were associated with certain behaviors, including: those who had used medication, experienced diarrhea in the past four weeks, or do not use toilets. Different bacteria were associated with an elevated risk of infection for various human activities or characteristics. Certain bacteria may also predispose people to co-infections. These data suggest that a high potential for transmission among these groups, either directly or via contaminated water sources. As these bacteria were most prevalent in humans, it is possible that they are maintained in humans and that transmission to other species is infrequent. Further studies are

  18. Epidemiology of pathogenic enterobacteria in humans, livestock, and peridomestic rodents in rural Madagascar.

    Directory of Open Access Journals (Sweden)

    DeAnna C Bublitz

    Full Text Available BACKGROUND: Among the families of enteric bacteria are globally important diarrheal agents. Despite their potential for zoonotic and environmental transmission, few studies have examined the epidemiology of these pathogens in rural systems characterized by extensive overlap among humans, domesticated and peridomestic animals. We investigated patterns of infection with Enterotoxigenic Escherichia coli, Shigella spp., Salmonella enterica, Vibrio cholerae, and Yersinia spp. (enterocolitica, and pseudotuberculosis in Southeastern Madagascar where the potential for the aforementioned interactions is high. In this pilot project we conducted surveys to examine behaviors potentially associated with risk of infection and if infection with specific enterobacteria species was associated with diarrheal disease. METHODOLOGY/PRINCIPAL FINDINGS: PCR was conducted on DNA from human, livestock, and rodent fecal samples from three villages. Overall, human prevalence was highest (77%, followed by rodents (51% and livestock (18%. Rodents were ∼2.8 times more likely than livestock to carry one of the bacteria. The incidence of individual species varied between villages, with the observation that, E. coli and Shigella spp. were consistently associated with co-infections. As an aggregate, there was a significant risk of infection linked to a water source in one village. Individually, different pathogens were associated with certain behaviors, including: those who had used medication, experienced diarrhea in the past four weeks, or do not use toilets. CONCLUSIONS/SIGNIFICANCE: Different bacteria were associated with an elevated risk of infection for various human activities or characteristics. Certain bacteria may also predispose people to co-infections. These data suggest that a high potential for transmission among these groups, either directly or via contaminated water sources. As these bacteria were most prevalent in humans, it is possible that they are

  19. Allelochemicals Produced by Brown Macroalgae of the Lobophora Genus Are Active against Coral Larvae and Associated Bacteria, Supporting Pathogenic Shifts to Vibrio Dominance.

    Science.gov (United States)

    Morrow, Kathleen M; Bromhall, Katrina; Motti, Cherie A; Munn, Colin B; Bourne, David G

    2017-01-01

    Pervasive environmental stressors on coral reefs are attributed with shifting the competitive balance in favor of alternative dominants, such as macroalgae. Previous studies have demonstrated that macroalgae compete with corals via a number of mechanisms, including the production of potent primary and secondary metabolites that can influence coral-associated microbial communities. The present study investigates the effects of the Pacific brown macroalga Lobophora sp. (due to the shifting nature of the Lobophora species complex, it will be referred to here as Lobophora sp.) on coral bacterial isolates, coral larvae, and the microbiome associated with the coral Porites cylindrica. Crude aqueous and organic macroalgal extracts were found to inhibit the growth of coral-associated bacteria. Extracts and fractions were also shown to inhibit coral larval settlement and cause mortality at concentrations lower (coral tissues exposed to aqueous (e.g., hydrophilic) crude extracts demonstrated a significant shift to Vibrio dominance and a loss of sequences related to the putative coral bacterial symbiont, Endozoicomonas sp., based on 16S rRNA amplicon sequencing. This study contributes to growing evidence that macroalgal allelochemicals, dissolved organic material, and native macroalgal microbial assemblages all play a role in shifting the microbial equilibrium of the coral holobiont away from a beneficial state, contributing to a decline in coral fitness and a shift in ecosystem structure. Diverse microbial communities associate with coral tissues and mucus, providing important protective and nutritional services, but once disturbed, the microbial equilibrium may shift from a beneficial state to one that is detrimental or pathogenic. Macroalgae (e.g., seaweeds) can physically and chemically interact with corals, causing abrasion, bleaching, and overall stress. This study contributes to a growing body of evidence suggesting that macroalgae play a critical role in shifting the

  20. Trh (tdh-/trh+) gene analysis of clinical, environmental and food isolates of Vibrio parahaemolyticus as a tool for investigating pathogenicity.

    Science.gov (United States)

    Leoni, Francesca; Talevi, Giulia; Masini, Laura; Ottaviani, Donatella; Rocchegiani, Elena

    2016-05-16

    Sequencing analysis of the trh gene encoding the TDH-related haemolysin of tdh-/trh+ Vibrio parahaemolyticus isolated in Italy between 2002 and 2011 from clinical, environmental, and food samples revealed the presence of the trh2 variant in all isolates. The trh2 of the clinical isolate was 100% identical to other clinical tdh-/trh2 V. parahaemolyticus from Europe. Nucleotide and amino acid differences in the trh2 sequences of clinical isolates from Italy and other countries allowed a differentiation of the clinical strains from the majority of environmental or food strains isolated in Italy. Aspartic acid and isoleucine at positions 113 and 115, encoded by nucleotide triplets GAT and ATT at positions 337-339 and 343-345 of the complete trh gene sequence, were present in clinical strains from Europe (Italy, Norway and Germany), Asia and the United States. Only 35.5% of the tdh-/trh2 V. parahaemolyticus of environmental or food origin from Italy shared the same triplets/amino acid detected in clinical isolates, while 64.5% of isolates from the marine environment were different from those of clinical origins, demonstrating that differences occur amongst the trh2 sequences of strains from the environment and these polymorphisms may differentiate potentially pathogenic from less or non-pathogenic cultures found in the environment and seafood. In addition the distribution of T3SS2 genes was investigated in this group of tdh-/trh+ V. parahaemolyticus from different sources and in three clinical tdh+/trh- V. parahaemolyticus isolates. All tdh-/trh+ V. parahaemolyticus of environmental or food source, independent of year of isolation or geographical origin, amplified all the screened T3SS2β genes and tested negative to PCR assays for all five T3SS2α genes, as the tdh-/trh+ clinical V. parahaemolyticus isolate. The vopC genes, encoding for one of the effector proteins of T3SS2, were partially sequenced and compared to clinical tdh-/trh+ and tdh+/trh+ V. parahaemolyticus

  1. Oligotyping reveals community level habitat selection within the genus Vibrio

    Directory of Open Access Journals (Sweden)

    Victor Thomas Schmidt

    2014-11-01

    Full Text Available The genus Vibrio is a metabolically and genetically diverse group of facultative anaerobic Bacteria, common in aquatic environments and marine hosts. The genus contains several species of importance to human health and aquaculture, including the causative agents of human cholera and fish vibriosis. Vibrios display a wide variety of known life histories, from opportunistic pathogens to long-standing symbioses with individual host species. Studying Vibrio ecology has been challenging as individual species often display a wide range of habitat preferences, and groups of vibrios can act as socially cohesive groups. Although strong associations with salinity, temperature and other environmental variables have been established, the degree of habitat or host specificity at both the individual and community levels is unknown. Here we use oligotyping analyses in combination with a large collection of existing Vibrio 16S ribosomal RNA (rRNA gene sequence data to reveal patterns of Vibrio ecology across a wide range of environmental, host, and abiotic substrate associated habitats. Our data show that individual taxa often display a wide range of habitat preferences yet tend to be highly abundant in either substrate-associated or free-living environments. Our analyses show that Vibrio communities share considerable overlap between two distinct hosts (i.e., sponge and fish yet are distinct from the abiotic plastic substrates. Lastly, evidence for habitat specificity at the community level exists in some habitats, despite considerable stochasticity in others. In addition to providing insights into Vibrio ecology across a broad range of habitats, our study shows the utility of oligotyping as a facile, high-throughput and unbiased method for large scale analyses of publicly available sequence data repositories and suggests its wide application could greatly extend the range of possibilities to explore microbial ecology.

  2. Automated evaluation of pharmaceutically active ionic liquids' (eco)toxicity through the inhibition of human carboxylesterase and Vibrio fischeri.

    Science.gov (United States)

    Costa, Susana P F; Justina, Vanessa D; Bica, Katharina; Vasiloiu, Maria; Pinto, Paula C A G; Saraiva, M Lúcia M F S

    2014-01-30

    The toxicity of 16 pharmaceutical active ionic liquids (IL-APIs) was evaluated by automated approaches based on sequential injection analysis (SIA). The implemented bioassays were centered on the inhibition of human carboxylesterase 2 and Vibrio fischeri, in the presence of the tested compounds. The inhibitory effects were quantified by calculating the inhibitor concentration required to cause 50% of inhibition (EC50). The EC50 values demonstrated that the cetylpyridinium group was one of the most toxic cations and that the imidazolium group was the less toxic. The obtained results provide important information about the safety of the studied IL-APIs and their possible use as pharmaceutical drugs. The developed automated SIA methodologies are robust screening bioassays, and can be used as a generic tools to identify the (eco)toxicity of the structural elements of ILs, contributing to a sustainable development of drugs. Copyright © 2013 Elsevier B.V. All rights reserved.

  3. Discrimination and numerical analysis of human pathogenic ...

    African Journals Online (AJOL)

    SERVER

    2008-02-19

    Feb 19, 2008 ... pathogenic Candida albicans strains based on SDS-. PAGE protein profiles ... SDS-PAGE of polypeptides of whole-cell extracts can provide more valuable taxonomic information than conventional yeast test kits at the ... data for classification (Höfling et al., 2001; Rodrigues et al., 2004). In several cases ...

  4. Pathogen reduction in human plasma using an ultrashort pulsed laser.

    Science.gov (United States)

    Tsen, Shaw-Wei D; Kingsley, David H; Kibler, Karen; Jacobs, Bert; Sizemore, Sara; Vaiana, Sara M; Anderson, Jeanne; Tsen, Kong-Thon; Achilefu, Samuel

    2014-01-01

    Pathogen reduction is a viable approach to ensure the continued safety of the blood supply against emerging pathogens. However, the currently licensed pathogen reduction techniques are ineffective against non-enveloped viruses such as hepatitis A virus, and they introduce chemicals with concerns of side effects which prevent their widespread use. In this report, we demonstrate the inactivation of both enveloped and non-enveloped viruses in human plasma using a novel chemical-free method, a visible ultrashort pulsed laser. We found that laser treatment resulted in 2-log, 1-log, and 3-log reductions in human immunodeficiency virus, hepatitis A virus, and murine cytomegalovirus in human plasma, respectively. Laser-treated plasma showed ≥70% retention for most coagulation factors tested. Furthermore, laser treatment did not alter the structure of a model coagulation factor, fibrinogen. Ultrashort pulsed lasers are a promising new method for chemical-free, broad-spectrum pathogen reduction in human plasma.

  5. Pathogen reduction in human plasma using an ultrashort pulsed laser.

    Directory of Open Access Journals (Sweden)

    Shaw-Wei D Tsen

    Full Text Available Pathogen reduction is a viable approach to ensure the continued safety of the blood supply against emerging pathogens. However, the currently licensed pathogen reduction techniques are ineffective against non-enveloped viruses such as hepatitis A virus, and they introduce chemicals with concerns of side effects which prevent their widespread use. In this report, we demonstrate the inactivation of both enveloped and non-enveloped viruses in human plasma using a novel chemical-free method, a visible ultrashort pulsed laser. We found that laser treatment resulted in 2-log, 1-log, and 3-log reductions in human immunodeficiency virus, hepatitis A virus, and murine cytomegalovirus in human plasma, respectively. Laser-treated plasma showed ≥70% retention for most coagulation factors tested. Furthermore, laser treatment did not alter the structure of a model coagulation factor, fibrinogen. Ultrashort pulsed lasers are a promising new method for chemical-free, broad-spectrum pathogen reduction in human plasma.

  6. Evaluation of Cholera Toxin Expression in Different Populations of Vibrio cholera

    Directory of Open Access Journals (Sweden)

    Sedigheh Ebrahimi Kasgari

    2015-02-01

    Full Text Available Background: Cholera is one of the most diseases of human. Cholera toxin is the most important pathogenic factor in humans that causes diarrhea. The cholera toxin is produced by V. cholerae and CTXфPhage. Objectives: In this study, we have investigated the production cholera toxin with different density of Vibrio cholerae. Materials and Methods: With this propose we inoculated classical strain O1 of Vibrio cholerae ATCC 14035 and Vibrio cholerae O1biovar El Tor N16961 into the AKI medium. Then, the total mRNA was determined by standard procedure which was converted into total cDNA. Results: Cholra toxin production was determined by qPCR and maximum production of cholera toxin was at 1010 cfu/mL. Conclusions: In conclusion, production of cholera toxin was minimized almost up to zero at 1010.5 cfu/mL; which could be due to presence of high level concentration of autoinducer.

  7. Disruption of Cell-to-Cell Signaling Does Not Abolish the Antagonism of Phaeobacter gallaeciensis toward the Fish Pathogen Vibrio anguillarum in Algal Systems

    DEFF Research Database (Denmark)

    Prol García, María Jesús; D'Alvise, Paul; Gram, Lone

    2013-01-01

    Quorum sensing (QS) regulates Phaeobacter gallaeciensis antagonism in broth systems; however, we demonstrate here that QS is not important for antagonism in algal cultures. QS mutants reduced Vibrio anguillarum to the same extent as the wild type. Consequently, a combination of probiotic Phaeobac......Quorum sensing (QS) regulates Phaeobacter gallaeciensis antagonism in broth systems; however, we demonstrate here that QS is not important for antagonism in algal cultures. QS mutants reduced Vibrio anguillarum to the same extent as the wild type. Consequently, a combination of probiotic...

  8. Pathogens and host immunity in the ancient human oral cavity

    Science.gov (United States)

    Warinner, Christina; Matias Rodrigues, João F.; Vyas, Rounak; Trachsel, Christian; Shved, Natallia; Grossmann, Jonas; Radini, Anita; Hancock, Y.; Tito, Raul Y.; Fiddyment, Sarah; Speller, Camilla; Hendy, Jessica; Charlton, Sophy; Luder, Hans Ulrich; Salazar-García, Domingo C.; Eppler, Elisabeth; Seiler, Roger; Hansen, Lars; Samaniego Castruita, José Alfredo; Barkow-Oesterreicher, Simon; Teoh, Kai Yik; Kelstrup, Christian; Olsen, Jesper V.; Nanni, Paolo; Kawai, Toshihisa; Willerslev, Eske; von Mering, Christian; Lewis, Cecil M.; Collins, Matthew J.; Gilbert, M. Thomas P.; Rühli, Frank; Cappellini, Enrico

    2014-01-01

    Calcified dental plaque (dental calculus) preserves for millennia and entraps biomolecules from all domains of life and viruses. We report the first high-resolution taxonomic and protein functional characterization of the ancient oral microbiome and demonstrate that the oral cavity has long served as a reservoir for bacteria implicated in both local and systemic disease. We characterize: (i) the ancient oral microbiome in a diseased state, (ii) 40 opportunistic pathogens, (iii) the first evidence of ancient human-associated putative antibiotic resistance genes, (iv) a genome reconstruction of the periodontal pathogen Tannerella forsythia, (v) 239 bacterial and 43 human proteins, allowing confirmation of a long-term association between host immune factors, “red-complex” pathogens, and periodontal disease, and (vi) DNA sequences matching dietary sources. Directly datable and nearly ubiquitous, dental calculus permits the simultaneous investigation of pathogen activity, host immunity, and diet, thereby extending the direct investigation of common diseases into the human evolutionary past. PMID:24562188

  9. Reactive oxygen species generated by a heat shock protein (Hsp) inducing product contributes to Hsp70 production and Hsp70-mediated protective immunity in Artemia franciscana against pathogenic vibrios.

    Science.gov (United States)

    Baruah, Kartik; Norouzitallab, Parisa; Linayati, Linayati; Sorgeloos, Patrick; Bossier, Peter

    2014-10-01

    The cytoprotective role of heat shock protein (Hsp70) described in a variety of animal disease models, including vibriosis in farmed aquatic animals, suggests that new protective strategies relying upon the use of compounds that selectively turn on Hsp genes could be developed. The product Tex-OE® (hereafter referred to as Hspi), an extract from the skin of the prickly pear fruit, Opuntia ficus indica, was previously shown to trigger Hsp70 synthesis in a non-stressful situation in a variety of animals, including in a gnotobiotically (germ-free) cultured brine shrimp Artemia franciscana model system. This model system offers great potential for carrying out high-throughput, live-animal screens of compounds that have health benefit effects. By using this model system, we aimed to disclose the underlying cause behind the induction of Hsp70 by Hspi in the shrimp host, and to determine whether the product affects the shrimp in inducing resistance towards pathogenic vibrios. We provide unequivocal evidences indicating that during the pretreatment period with Hspi, there is an initial release of reactive oxygen species (hydrogen peroxide and/or superoxide anion), generated by the added product, in the rearing water and associated with the host. The reactive molecules generated are the triggering factors responsible for causing Hsp70 induction within Artemia. We have also shown that Hspi acts prophylactically at an optimum dose regimen to confer protection against pathogenic vibrios. This salutary effect was associated with upregulation of two important immune genes, prophenoloxidase and transglutaminase of the innate immune system. These findings suggest that inducers of stress protein (e.g. Hsp70) are potentially important modulator of immune responses and might be exploited to confer protection to cultured shrimp against Vibrio infection. Copyright © 2014 Elsevier Ltd. All rights reserved.

  10. Vibrio diseases of marine fish populations

    Science.gov (United States)

    Colwell, R. R.; Grimes, D. J.

    1984-03-01

    Several Vibrio spp. cause disease in marine fish populations, both wild and cultured. The most common disease, vibriosis, is caused by V. anguillarum. However, increase in the intensity of mariculture, combined with continuing improvements in bacterial systematics, expands the list of Vibrio spp. that cause fish disease. The bacterial pathogens, species of fish affected, virulence mechanisms, and disease treatment and prevention are included as topics of emphasis in this review.

  11. Human metapneumovirus: a new respiratory pathogen

    Indian Academy of Sciences (India)

    PRAKASH KUMAR

    tion; SARS, severe acute respiratory syndrome; SH, small hydrophobic. Human metapneumovirus: a new respiratory .... In fragile elderly hMPV causes more severe disease than in healthy elderly or young adults ..... Ebihara T, Endo R, Ma X, Ishiguro N and Kikuta H 2005 Detection of human metapneumovirus antigens in ...

  12. The human fungal pathogen Cryptococcus can complete its sexual cycle during a pathogenic association with plants.

    Science.gov (United States)

    Xue, Chaoyang; Tada, Yasuomi; Dong, Xinnian; Heitman, Joseph

    2007-06-14

    Cryptococcus is a globally distributed human fungal pathogen that primarily afflicts immunocompromised individuals. How and why this human fungal pathogen associates with plants and how this environmental niche influences its life cycle remains a mystery. We established Cryptococcus-Arabidopsis and Cryptococcus-Eucalyptus systems and discovered that Cryptococcus proliferates and mates on plant surfaces. Mating efficiency of C. gattii was markedly enhanced on plants and myo-inositol and indole acetic acid were specific plant products that stimulated mating. On Arabidopsis, dwarfing and chlorosis were observed following infection with a fungal mixture of two opposite mating-type strains, but not with either mating-type alone. This infection process is countered by the plant jasmonate-mediated defense mechanism. These findings reveal that Cryptococcus can parasitically interact with plants to complete its sexual cycle, which may impact an understanding of the origin and evolution of both plant and animal fungal pathogens in nature.

  13. Organic metabolites produced by Vibrio parahaemolyticus strain ...

    African Journals Online (AJOL)

    Identification and action of several antibacterial metabolites produced by a fish pathogen Vibrio parahaemolyticus strain An3 from marine ecosystem of Goa has been demonstrated. Antibacterial activity of the crude cell extract of the test bacterium has been evaluated against indicator pathogenic bacterial strains such as ...

  14. Automated evaluation of pharmaceutically active ionic liquids’ (eco)toxicity through the inhibition of human carboxylesterase and Vibrio fischeri

    Energy Technology Data Exchange (ETDEWEB)

    Costa, Susana P.F.; Justina, Vanessa D. [REQUIMTE, Departamento de Ciências Químicas, Faculdade de Farmácia, Universidade do Porto, Rua Jorge Viterbo Ferreira, n° 228, 4050-313 Porto (Portugal); Bica, Katharina; Vasiloiu, Maria [Vienna University of Technology, Institute of Applied and Synthetic Chemistry, A-1060 Vienna (Austria); Pinto, Paula C.A.G., E-mail: ppinto@ff.up.pt [REQUIMTE, Departamento de Ciências Químicas, Faculdade de Farmácia, Universidade do Porto, Rua Jorge Viterbo Ferreira, n° 228, 4050-313 Porto (Portugal); Saraiva, M. Lúcia M.F.S., E-mail: lsaraiva@ff.up.pt [REQUIMTE, Departamento de Ciências Químicas, Faculdade de Farmácia, Universidade do Porto, Rua Jorge Viterbo Ferreira, n° 228, 4050-313 Porto (Portugal)

    2014-01-30

    Highlights: • IL-APIs toxicity on humans and aquatic environment was evaluated by inhibition assays. • The inhibition assays were implemented through automated screening bioassays. • Automation of bioassays enabled a rigorous control of the reaction conditions. • EC{sub 50} obtained provide vital information on IL-APIs safety and potential use as drugs. -- Abstract: The toxicity of 16 pharmaceutical active ionic liquids (IL-APIs) was evaluated by automated approaches based on sequential injection analysis (SIA). The implemented bioassays were centered on the inhibition of human carboxylesterase 2 and Vibrio fischeri, in the presence of the tested compounds. The inhibitory effects were quantified by calculating the inhibitor concentration required to cause 50% of inhibition (EC{sub 50}). The EC{sub 50} values demonstrated that the cetylpyridinium group was one of the most toxic cations and that the imidazolium group was the less toxic. The obtained results provide important information about the safety of the studied IL-APIs and their possible use as pharmaceutical drugs. The developed automated SIA methodologies are robust screening bioassays, and can be used as a generic tools to identify the (eco)toxicity of the structural elements of ILs, contributing to a sustainable development of drugs.

  15. A factor converting viable but nonculturable Vibrio cholerae to a culturable state in eukaryotic cells is a human catalase.

    Science.gov (United States)

    Senoh, Mitsutoshi; Hamabata, Takashi; Takeda, Yoshifumi

    2015-08-01

    In our previous work, we demonstrated that viable but nonculturable (VBNC) Vibrio cholerae O1 and O139 were converted to culturable by coculture with eukaryotic cells. Furthermore, we isolated a factor converting VBNC V. cholerae to culturable (FCVC) from a eukaryotic cell line, HT-29. In this study, we purified FCVC by successive column chromatographies comprising UNO Q-6 anion exchange, Bio-Scale CHT2-1 hydroxyapatite, and Superdex 200 10/300 GL. Homogeneity of the purified FCVC was demonstrated by SDS-PAGE. Nano-LC MS/MS analysis showed that the purified FCVC was a human catalase. An experiment of RNAi knockdown of catalase mRNA from HT-29 cells and treatment of the purified FCVC with a catalase inhibitor, 3-amino-1,2,4-triazole confirmed that the FCVC was a catalase. A possible role of the catalase in converting a VBNC V. cholerae to a culturable state in the human intestine is discussed. © 2015 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.

  16. Equivalent T cell epitope promiscuity in ecologically diverse human pathogens.

    Directory of Open Access Journals (Sweden)

    Kirsten E Wiens

    Full Text Available The HLA (human leukocyte antigen molecules that present pathogen-derived epitopes to T cells are highly diverse. Correspondingly, many pathogens such as HIV evolve epitope variants in order to evade immune recognition. In contrast, another persistent human pathogen, Mycobacterium tuberculosis, has highly conserved epitope sequences. This raises the question whether there is also a difference in the ability of these pathogens' epitopes to bind diverse HLA alleles, referred to as an epitope's binding promiscuity. To address this question, we compared the in silico HLA binding promiscuity of T cell epitopes from pathogens with distinct infection strategies and outcomes of human exposure.We used computer algorithms to predict the binding affinity of experimentally-verified microbial epitope peptides to diverse HLA-DR, HLA-A and HLA-B alleles. We then analyzed binding promiscuity of epitopes derived from HIV and M. tuberculosis. We also analyzed promiscuity of epitopes from Streptococcus pyogenes, which is known to exhibit epitope diversity, and epitopes of Bacillus anthracis and Clostridium tetani toxins, as these bacteria do not depend on human hosts for their survival or replication, and their toxin antigens are highly immunogenic human vaccines.We found that B. anthracis and C. tetani epitopes were the most promiscuous of the group that we analyzed. However, there was no consistent difference or trend in promiscuity in epitopes contained in HIV, M. tuberculosis, and S. pyogenes.Our results show that human pathogens with distinct immune evasion strategies and epitope diversities exhibit equivalent levels of T cell epitope promiscuity. These results indicate that differences in epitope promiscuity do not account for the observed differences in epitope variation and conservation.

  17. Equivalent T cell epitope promiscuity in ecologically diverse human pathogens.

    Science.gov (United States)

    Wiens, Kirsten E; Swaminathan, Harish; Copin, Richard; Lun, Desmond S; Ernst, Joel D

    2013-01-01

    The HLA (human leukocyte antigen) molecules that present pathogen-derived epitopes to T cells are highly diverse. Correspondingly, many pathogens such as HIV evolve epitope variants in order to evade immune recognition. In contrast, another persistent human pathogen, Mycobacterium tuberculosis, has highly conserved epitope sequences. This raises the question whether there is also a difference in the ability of these pathogens' epitopes to bind diverse HLA alleles, referred to as an epitope's binding promiscuity. To address this question, we compared the in silico HLA binding promiscuity of T cell epitopes from pathogens with distinct infection strategies and outcomes of human exposure. We used computer algorithms to predict the binding affinity of experimentally-verified microbial epitope peptides to diverse HLA-DR, HLA-A and HLA-B alleles. We then analyzed binding promiscuity of epitopes derived from HIV and M. tuberculosis. We also analyzed promiscuity of epitopes from Streptococcus pyogenes, which is known to exhibit epitope diversity, and epitopes of Bacillus anthracis and Clostridium tetani toxins, as these bacteria do not depend on human hosts for their survival or replication, and their toxin antigens are highly immunogenic human vaccines. We found that B. anthracis and C. tetani epitopes were the most promiscuous of the group that we analyzed. However, there was no consistent difference or trend in promiscuity in epitopes contained in HIV, M. tuberculosis, and S. pyogenes. Our results show that human pathogens with distinct immune evasion strategies and epitope diversities exhibit equivalent levels of T cell epitope promiscuity. These results indicate that differences in epitope promiscuity do not account for the observed differences in epitope variation and conservation.

  18. Factors determining human-to-human transmissibility of zoonotic pathogens via contact.

    Science.gov (United States)

    Richard, Mathilde; Knauf, Sascha; Lawrence, Philip; Mather, Alison E; Munster, Vincent J; Müller, Marcel A; Smith, Derek; Kuiken, Thijs

    2017-02-01

    The pandemic potential of zoonotic pathogens lies in their ability to become efficiently transmissible amongst humans. Here, we focus on contact-transmitted pathogens and discuss the factors, at the pathogen, host and environmental levels that promote or hinder their human-to-human transmissibility via the following modes of contact transmission: skin contact, sexual contact, respiratory contact and multiple route contact. Factors common to several modes of transmission were immune evasion, high viral load, low infectious dose, crowding, promiscuity, and co-infections; other factors were specific for a pathogen or mode of contact transmission. The identification of such factors will lead to a better understanding of the requirements for human-to-human spread of pathogens, as well as improving risk assessment of newly emerging pathogens. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  19. Responses of human endothelial cells to pathogenic and non-pathogenic Leptospira species.

    Directory of Open Access Journals (Sweden)

    Denise G Martinez-Lopez

    2010-12-01

    Full Text Available Leptospirosis is a widespread zoonotic infection that primarily affects residents of tropical regions, but causes infections in animals and humans in temperate regions as well. The agents of leptospirosis comprise several members of the genus Leptospira, which also includes non-pathogenic, saprophytic species. Leptospirosis can vary in severity from a mild, non-specific illness to severe disease that includes multi-organ failure and widespread endothelial damage and hemorrhage. To begin to investigate how pathogenic leptospires affect endothelial cells, we compared the responses of two endothelial cell lines to infection by pathogenic versus non-pathogenic leptospires. Microarray analyses suggested that pathogenic L. interrogans and non-pathogenic L. biflexa triggered changes in expression of genes whose products are involved in cellular architecture and interactions with the matrix, but that the changes were in opposite directions, with infection by L. biflexa primarily predicted to increase or maintain cell layer integrity, while L. interrogans lead primarily to changes predicted to disrupt cell layer integrity. Neither bacterial strain caused necrosis or apoptosis of the cells even after prolonged incubation. The pathogenic L. interrogans, however, did result in significant disruption of endothelial cell layers as assessed by microscopy and the ability of the bacteria to cross the cell layers. This disruption of endothelial layer integrity was abrogated by addition of the endothelial protective drug lisinopril at physiologically relevant concentrations. These results suggest that, through adhesion of L. interrogans to endothelial cells, the bacteria may disrupt endothelial barrier function, promoting dissemination of the bacteria and contributing to severe disease manifestations. In addition, supplementing antibiotic therapy with lisinopril or derivatives with endothelial protective activities may decrease the severity of leptospirosis.

  20. Human pathogens in plant biofilms: Formation, physiology, and detection

    Science.gov (United States)

    Fresh produce, viewed as an essential part of a healthy life style is usually consumed in the form of raw or minimally processed fruits and vegetables, and is a potentially important source of food-borne human pathogenic bacteria and viruses. These are passed on to the consumer since the bacteria ca...

  1. Human pathogenic bacteria as contaminants in freshly consumed vegetables

    NARCIS (Netherlands)

    Waalwijk, C.; Tongeren, van C.A.M.; Zouwen, van der P.S.; Overbeek, van L.S.

    2014-01-01

    The 2011 enterohaemorrhagic Escherichia coli (EHEC) outbreak in Germany casted new light on the potential reservoirs of human pathogenic bacteria (HUPA) other than the ones commonly recognized in animal production chains. Soil, plants and water systems were demonstrated to be environments where HUPA

  2. Natural soil reservoirs for human pathogenic and fecal indicator bacteria

    Science.gov (United States)

    Boschiroli, Maria L; Falkinham, Joseph; Favre-Bonte, Sabine; Nazaret, Sylvie; Piveteau, Pascal; Sadowsky, Michael J.; Byappanahalli, Muruleedhara; Delaquis, Pascal; Hartmann, Alain

    2016-01-01

    Soils receive inputs of human pathogenic and indicator bacteria through land application of animal manures or sewage sludge, and inputs by wildlife. Soil is an extremely heterogeneous substrate and contains meso- and macrofauna that may be reservoirs for bacteria of human health concern. The ability to detect and quantify bacteria of human health concern is important in risk assessments and in evaluating the efficacy of agricultural soil management practices that are protective of crop quality and protective of adjacent water resources. The present chapter describes the distribution of selected Gram-positive and Gram-negative bacteria in soils. Methods for detecting and quantifying soilborne bacteria including extraction, enrichment using immunomagnetic capture, culturing, molecular detection and deep sequencing of metagenomic DNA to detect pathogens are overviewed. Methods for strain phenotypic and genotypic characterization are presented, as well as how comparison with clinical isolates can inform the potential for human health risk.

  3. Comparative genomics and the evolution of pathogenicity in human pathogenic fungi.

    LENUS (Irish Health Repository)

    Moran, Gary P

    2011-01-01

    Because most fungi have evolved to be free-living in the environment and because the infections they cause are usually opportunistic in nature, it is often difficult to identify specific traits that contribute to fungal pathogenesis. In recent years, there has been a surge in the number of sequenced genomes of human fungal pathogens, and comparison of these sequences has proved to be an excellent resource for exploring commonalities and differences in how these species interact with their hosts. In order to survive in the human body, fungi must be able to adapt to new nutrient sources and environmental stresses. Therefore, genes involved in carbohydrate and amino acid metabolism and transport and genes encoding secondary metabolites tend to be overrepresented in pathogenic species (e.g., Aspergillus fumigatus). However, it is clear that human commensal yeast species such as Candida albicans have also evolved a range of specific factors that facilitate direct interaction with host tissues. The evolution of virulence across the human pathogenic fungi has occurred largely through very similar mechanisms. One of the most important mechanisms is gene duplication and the expansion of gene families, particularly in subtelomeric regions. Unlike the case for prokaryotic pathogens, horizontal transfer of genes between species and other genera does not seem to have played a significant role in the evolution of fungal virulence. New sequencing technologies promise the prospect of even greater numbers of genome sequences, facilitating the sequencing of multiple genomes and transcriptomes within individual species, and will undoubtedly contribute to a deeper insight into fungal pathogenesis.

  4. Galleria mellonella as a model host for human pathogens

    Science.gov (United States)

    Junqueira, Juliana Campos

    2012-01-01

    The number of studies using G. mellonella as a model host for human pathogens has increased significantly in the last few years. Important studies were published from different countries for evaluating the pathogenesis of bacterial and fungal infections and for exploring the host defenses against pathogens. Therefore, standardized conditions for the use of G. melonella larvae need to be established. Recent research showed that the deprivation of G. mellonella larvae of food during the experiment caused a reduction in immune responses and an increased susceptibility to infection, suggesting that incubating of larvae in the presence or absence of nutrition may affect the results and comparisons among different laboratories. PMID:23211681

  5. Human pathogenic bacteria, fungi, and viruses in Drosophila

    Science.gov (United States)

    Panayidou, Stavria; Ioannidou, Eleni; Apidianakis, Yiorgos

    2014-01-01

    Drosophila has been the invertebrate model organism of choice for the study of innate immune responses during the past few decades. Many Drosophila–microbe interaction studies have helped to define innate immunity pathways, and significant effort has been made lately to decipher mechanisms of microbial pathogenesis. Here we catalog 68 bacterial, fungal, and viral species studied in flies, 43 of which are relevant to human health. We discuss studies of human pathogens in flies revealing not only the elicitation and avoidance of immune response but also mechanisms of tolerance, host tissue homeostasis, regeneration, and predisposition to cancer. Prominent among those is the emerging pattern of intestinal regeneration as a defense response induced by pathogenic and innocuous bacteria. Immunopathology mechanisms and many microbial virulence factors have been elucidated, but their relevance to human health conventionally necessitates validation in mammalian models of infection. PMID:24398387

  6. Isolation and characterization of a N4-like lytic bacteriophage infecting Vibrio splendidus, a pathogen of fish and bivalves

    DEFF Research Database (Denmark)

    Katharios, Pantelis; Kalatzis, Panagiotis; Kokkari, Constantina

    2017-01-01

    A novel virulent bacteriophage, vB_VspP_pVa5, infecting a strain of Vibrio splendidus was isolated from a sea-cage aquaculture farm in Greece, and characterized using microbiological methods and genomic analysis. Bacteriophage vB_VspP_pVa5 is a N4-like podovirus with an icosahedral head measuring...... open reading frame–containing area was also identified. The absence of genes related to lysogeny along with the high efficacy observed during in vitro cell lysis trials, indicate that the vB_VspP_pVa5 is a potential candidate component in a bacteriophage cocktail suitable for the biological control...

  7. Isolation of TDA-producing Phaeobacter strains from sea bass larval rearing units and their probiotic effect against pathogenic Vibrio spp. in Artemia cultures

    DEFF Research Database (Denmark)

    Grotkjær, Torben; Bentzon-Tilia, Mikkel; D'Alvise, Paul

    2016-01-01

    -DNA hybridization indicated that they could belong to a new species. The genomes contained genes involved in synthesis of the antibacterial compound tropodithietic acid (TDA), and its production was confirmed by UHPLC-TOFMS. The new Phaeobacter colonized live feed (Artemia) cultures and reduced Vibrio counts...... significantly, since they reached only 104 CFUmL-1, as opposed to 108 CFUmL-1 in non-Phaeobacter treated controls. Survival of V. anguillarum-challenged Artemia nauplii was enhanced by the presence of wild type Phaeobacter compared to challenged control cultures (89±1.0% vs 8±3.2%). In conclusion, TDA...

  8. Effects of triclosan on bacterial community composition and 'Vibrio' populations in natural seawater microcosms

    Directory of Open Access Journals (Sweden)

    Keri Ann Lydon

    2017-05-01

    Full Text Available Pharmaceuticals and personal care products, including antimicrobials, can be found at trace levels in treated wastewater effluent. Impacts of chemical contaminants on coastal aquatic microbial community structure and pathogen abundance are unknown despite the potential for selection through antimicrobial resistance. In particular, 'Vibrio', a marine bacterial genus that includes several human pathogens, displays resistance to the ubiquitous antimicrobial compound triclosan. Here we demonstrated through use of natural seawater microcosms that triclosan (at a concentration of ~5 ppm can induce a significant 'Vibrio' growth response (68–1,700 fold increases in comparison with no treatment controls for three distinct coastal ecosystems: Looe Key Reef (Florida Keys National Marine Sanctuary, Doctors Arm Canal (Big Pine Key, FL, and Clam Bank Landing (North Inlet Estuary, Georgetown, SC. Additionally, microbial community analysis by 16 S rRNA gene sequencing for Looe Key Reef showed distinct changes in microbial community structure with exposure to 5 ppm triclosan, with increases observed in the relative abundance of 'Vibrio'naceae (17-fold, Pseudoalteromonadaceae (65-fold, Alteromonadaceae (108-fold, Colwelliaceae (430-fold, and Oceanospirillaceae (1,494-fold. While the triclosan doses tested were above concentrations typically observed in coastal surface waters, results identify bacterial families that are potentially resistant to triclosan and/or adapted to use triclosan as a carbon source. The results further suggest the potential for selection of 'Vibrio' in coastal environments, especially sediments, where triclosan may accumulate at high levels.

  9. Pathogen-Driven Selection in the Human Genome

    Directory of Open Access Journals (Sweden)

    Rachele Cagliani

    2013-01-01

    Full Text Available Infectious diseases and epidemics have always accompanied and characterized human history, representing one of the main causes of death. Even today, despite progress in sanitation and medical research, infections are estimated to account for about 15% of deaths. The hypothesis whereby infectious diseases have been acting as a powerful selective pressure was formulated long ago, but it was not until the availability of large-scale genetic data and the development of novel methods to study molecular evolution that we could assess how pervasively infectious agents have shaped human genetic diversity. Indeed, recent evidences indicated that among the diverse environmental factors that acted as selective pressures during the evolution of our species, pathogen load had the strongest influence. Beside the textbook example of the major histocompatibility complex, selection signatures left by pathogen-exerted pressure can be identified at several human loci, including genes not directly involved in immune response. In the future, high-throughput technologies and the availability of genetic data from different populations are likely to provide novel insights into the evolutionary relationships between the human host and its pathogens. Hopefully, this will help identify the genetic determinants modulating the susceptibility to infectious diseases and will translate into new treatment strategies.

  10. Survival of foodborne pathogens (Escherichia coli O157:H7, Salmonella Typhimurium, Staphylococcus aureus, Listeria monocytogenes, and Vibrio parahaemolyticus) in raw ready-to-eat crab marinated in soy sauce.

    Science.gov (United States)

    Cho, T J; Kim, N H; Kim, S A; Song, J H; Rhee, M S

    2016-12-05

    Knowing the survival characteristics of foodborne pathogens in raw ready-to-eat (RTE) seafood is the key to predicting whether they pose a microbiological hazard. The present study examined the survival of Escherichia coli O157:H7, Salmonella Typhimurium, Vibrio parahaemoliticus, Listeria monocytogenes, and Staphylococcus aureus in raw RTE crab marinated in soy sauce. Inoculated crabs (initial bacterial population=4.1-4.4logCFU/g) were immersed in soy sauce and then stored at refrigeration (5°C) or room temperature (22°C) for up to 28days. At 5°C, all bacteria (except V. parahaemolyticus) survived in crab samples until Day 28 (counts of 1.4, 1.6, 3.1, 3.2 log CFU/g for E. coli O157:H7, S. Typhimurium, L. monocytogenes, and S. aureus, respectively). However, at 22°C, all tested bacteria were more susceptible to the antimicrobial effects of marination. Regardless of temperature, foodborne pathogens attached to crab samples were more resistant to marination than those suspended in soy sauce samples; however, the survival pattern for each species was different. Gram-positive bacteria were most resistant to marination conditions (high salinity, low pH), whereas V. parahaemolyticus was extremely susceptible. Marination is the only antibacterial step in the manufacturing processes; however, the results presented herein reveal that this is not sufficient to inactivate foodborne pathogens. In particular, the survival of pathogens on crabs at refrigeration temperature may pose a major hazard for the consumption of raw RTE seafood. Thus, appropriate decontamination methods and implementation of safety management practices are needed. This study provides predictive microbiological information of foodborne pathogens in raw RTE seafood with marination. Copyright © 2016 Elsevier B.V. All rights reserved.

  11. Catechol Siderophore Transport by Vibrio cholerae.

    Science.gov (United States)

    Wyckoff, Elizabeth E; Allred, Benjamin E; Raymond, Kenneth N; Payne, Shelley M

    2015-09-01

    Siderophores, small iron-binding molecules secreted by many microbial species, capture environmental iron for transport back into the cell. Vibrio cholerae synthesizes and uses the catechol siderophore vibriobactin and also uses siderophores secreted by other species, including enterobactin produced by Escherichia coli. E. coli secretes both canonical cyclic enterobactin and linear enterobactin derivatives likely derived from its cleavage by the enterobactin esterase Fes. We show here that V. cholerae does not use cyclic enterobactin but instead uses its linear derivatives. V. cholerae lacked both a receptor for efficient transport of cyclic enterobactin and enterobactin esterase to promote removal of iron from the ferrisiderophore complex. To further characterize the transport of catechol siderophores, we show that the linear enterobactin derivatives were transported into V. cholerae by either of the catechol siderophore receptors IrgA and VctA, which also transported the synthetic siderophore MECAM [1,3,5-N,N',N″-tris-(2,3-dihydroxybenzoyl)-triaminomethylbenzene]. Vibriobactin is transported via the additional catechol siderophore receptor ViuA, while the Vibrio fluvialis siderophore fluvibactin was transported by all three catechol receptors. ViuB, a putative V. cholerae siderophore-interacting protein (SIP), functionally substituted for the E. coli ferric reductase YqjH, which promotes the release of iron from the siderophore in the bacterial cytoplasm. In V. cholerae, ViuB was required for the use of vibriobactin but was not required for the use of MECAM, fluvibactin, ferrichrome, or the linear derivatives of enterobactin. This suggests the presence of another protein in V. cholerae capable of promoting the release of iron from these siderophores. Vibrio cholerae is a major human pathogen and also serves as a model for the Vibrionaceae, which include other serious human and fish pathogens. The ability of these species to persist and acquire essential

  12. Looking in apes as a source of human pathogens.

    Science.gov (United States)

    Keita, Mamadou B; Hamad, Ibrahim; Bittar, Fadi

    2014-12-01

    Because of the close genetic relatedness between apes and humans, apes are susceptible to many human infectious agents and can serve as carriers of these pathogens. Consequently, they present a serious health hazard to humans. Moreover, many emerging infectious diseases originate in wildlife and continue to threaten human populations, especially vector-borne diseases described in great apes, such as malaria and rickettsiosis. These wild primates may be permanent reservoirs and important sources of human pathogens. In this special issue, we report that apes, including chimpanzees (Pan troglodytes), bonobos (Pan paniscus), gorillas (Gorilla gorilla and Gorilla beringei), orangutans (Pongo pygmaeus and Pongo abelii), gibbons (Hylobates spp., Hoolock spp. and Nomascus spp) and siamangs (Symphalangus syndactylus syndactylus and Symphalangus continentis), have many bacterial, viral, fungal and parasitic species that are capable of infecting humans. Serious measures should be adopted in tropical forests and sub-tropical areas where habitat overlaps are frequent to survey and prevent infectious diseases from spreading from apes to people. Copyright © 2014 Elsevier Ltd. All rights reserved.

  13. Sediment composition influences spatial variation in the abundance of human pathogen indicator bacteria within an estuarine environment.

    Directory of Open Access Journals (Sweden)

    Tracy L Perkins

    Full Text Available Faecal contamination of estuarine and coastal waters can pose a risk to human health, particularly in areas used for shellfish production or recreation. Routine microbiological water quality testing highlights areas of faecal indicator bacteria (FIB contamination within the water column, but fails to consider the abundance of FIB in sediments, which under certain hydrodynamic conditions can become resuspended. Sediments can enhance the survival of FIB in estuarine environments, but the influence of sediment composition on the ecology and abundance of FIB is poorly understood. To determine the relationship between sediment composition (grain size and organic matter and the abundance of pathogen indicator bacteria (PIB, sediments were collected from four transverse transects of the Conwy estuary, UK. The abundance of culturable Escherichia coli, total coliforms, enterococci, Campylobacter, Salmonella and Vibrio spp. in sediments was determined in relation to sediment grain size, organic matter content, salinity, depth and temperature. Sediments that contained higher proportions of silt and/or clay and associated organic matter content showed significant positive correlations with the abundance of PIB. Furthermore, the abundance of each bacterial group was positively correlated with the presence of all other groups enumerated. Campylobacter spp. were not isolated from estuarine sediments. Comparisons of the number of culturable E. coli, total coliforms and Vibrio spp. in sediments and the water column revealed that their abundance was 281, 433 and 58-fold greater in sediments (colony forming units (CFU/100g when compared with the water column (CFU/100ml, respectively. These data provide important insights into sediment compositions that promote the abundance of PIB in estuarine environments, with important implications for the modelling and prediction of public health risk based on sediment resuspension and transport.

  14. Sediment composition influences spatial variation in the abundance of human pathogen indicator bacteria within an estuarine environment.

    Science.gov (United States)

    Perkins, Tracy L; Clements, Katie; Baas, Jaco H; Jago, Colin F; Jones, Davey L; Malham, Shelagh K; McDonald, James E

    2014-01-01

    Faecal contamination of estuarine and coastal waters can pose a risk to human health, particularly in areas used for shellfish production or recreation. Routine microbiological water quality testing highlights areas of faecal indicator bacteria (FIB) contamination within the water column, but fails to consider the abundance of FIB in sediments, which under certain hydrodynamic conditions can become resuspended. Sediments can enhance the survival of FIB in estuarine environments, but the influence of sediment composition on the ecology and abundance of FIB is poorly understood. To determine the relationship between sediment composition (grain size and organic matter) and the abundance of pathogen indicator bacteria (PIB), sediments were collected from four transverse transects of the Conwy estuary, UK. The abundance of culturable Escherichia coli, total coliforms, enterococci, Campylobacter, Salmonella and Vibrio spp. in sediments was determined in relation to sediment grain size, organic matter content, salinity, depth and temperature. Sediments that contained higher proportions of silt and/or clay and associated organic matter content showed significant positive correlations with the abundance of PIB. Furthermore, the abundance of each bacterial group was positively correlated with the presence of all other groups enumerated. Campylobacter spp. were not isolated from estuarine sediments. Comparisons of the number of culturable E. coli, total coliforms and Vibrio spp. in sediments and the water column revealed that their abundance was 281, 433 and 58-fold greater in sediments (colony forming units (CFU)/100g) when compared with the water column (CFU/100ml), respectively. These data provide important insights into sediment compositions that promote the abundance of PIB in estuarine environments, with important implications for the modelling and prediction of public health risk based on sediment resuspension and transport.

  15. Probiotic Activity of Saccharomyces cerevisiae var. boulardii Against Human Pathogens

    Directory of Open Access Journals (Sweden)

    Katarzyna Rajkowska

    2012-01-01

    Full Text Available Infectious diarrhoea is associated with a modification of the intestinal microflora and colonization of pathogenic bacteria. Tests were performed for seven probiotic yeast strains of Saccharomyces cerevisiae var. boulardii, designated for the prevention and treatment of diarrhoea. To check their possible effectiveness against diarrhoea of different etiologies, the activity against a variety of human pathogenic or opportunistic bacteria was investigated in vitro. In mixed cultures with S. cerevisiae var. boulardii, a statistically significant reduction was observed in the number of cells of Listeria monocytogenes, Pseudomonas aeruginosa and Staphylococcus aureus, by even 55.9 % in the case of L. monocytogenes compared with bacterial monocultures. The influence of yeasts was mostly associated with the shortening of the bacterial lag phase duration, more rapid achievement of the maximum growth rates, and a decrease by 4.4–57.1 % (L. monocytogenes, P. aeruginosa, or an increase by 1.4–70.6 % (Escherichia coli, Enterococcus faecalis, Salmonella Typhimurium in the exponential growth rates. Another issue included in the research was the ability of S. cerevisiae var. boulardii to bind pathogenic bacteria to its cell surface. Yeasts have shown binding capacity of E. coli, S. Typhimurium and additionally of S. aureus, Campylobacter jejuni and E. faecalis. However, no adhesion of L. monocytogenes and P. aeruginosa to the yeast cell wall was noted. The probiotic activity of S. cerevisiae var. boulardii against human pathogens is related to a decrease in the number of viable and active cells of bacteria and the binding capacity of yeasts. These processes may limit bacterial invasiveness and prevent bacterial adherence and translocation in the human intestines.

  16. Comparison of classifications of aptamers against Vibrio ...

    African Journals Online (AJOL)

    As a novel method to detect the pathogen Vibrio alginolyticus, 45 aptamers were previously selected and tested. In order to better understand the properties of these aptamers, it was essential to classify these aptamers based on appropriate criteria. The primary structure of 45 aptamers against V. alginolyticus was analyzed ...

  17. Role of Vibrio polysaccharide (vps) genes in VPS production, biofilm formation and Vibrio cholerae pathogenesis.

    Science.gov (United States)

    Fong, Jiunn C N; Syed, Khalid A; Klose, Karl E; Yildiz, Fitnat H

    2010-09-01

    Biofilm formation enhances the survival and persistence of the facultative human pathogen Vibrio cholerae in natural ecosystems and its transmission during seasonal cholera outbreaks. A major component of the V. cholerae biofilm matrix is the Vibrio polysaccharide (VPS), which is essential for development of three-dimensional biofilm structures. The vps genes are clustered in two regions, the vps-I cluster (vpsU, vpsA-K, VC0916-27) and the vps-II cluster (vpsL-Q, VC0934-39), separated by an intergenic region containing the rbm gene cluster that encodes biofilm matrix proteins. In-frame deletions of the vps clusters and genes encoding matrix proteins drastically altered biofilm formation phenotypes. To determine which genes within the vps gene clusters are required for biofilm formation and VPS synthesis, we generated in-frame deletion mutants for all the vps genes. Many of these mutants exhibited reduced capacity to produce VPS and biofilms. Infant mouse colonization assays revealed that mutants lacking either vps clusters or rbmA (encoding secreted matrix protein RbmA) exhibited a defect in intestinal colonization compared to the wild-type. Understanding the roles of the various vps gene products will aid in the biochemical characterization of the VPS biosynthetic pathway and elucidate how vps gene products contribute to VPS biosynthesis, biofilm formation and virulence in V. cholerae.

  18. The high prevalence of pathogenic Vibrio harveyi with multiple antibiotic resistance in scale drop and muscle necrosis disease of the hybrid grouper, Epinephelus fuscoguttatus (♀) × E. lanceolatus (♂), in China.

    Science.gov (United States)

    Zhu, Z M; Dong, C F; Weng, S P; He, J G

    2017-11-28

    Scale drop and muscle necrosis disease with high mortality widely occurred recently in the hybrid grouper (Epinephelus fuscoguttatus ♀ × E. lanceolatus ♂), a crucial cultured marine fish species in China. In this study, 30 Harveyi clade isolates of 27 Vibrio harveyi strains were isolated from diseased hybrid groupers in the south-east and north-east coastal areas of China. A total of 22 V. harveyi strains were determined to be pathogenic, and most challenged fish died within 2 days of infection; surviving individuals exhibited scale drop and deep dermal lesions as naturally diseased fish. Although five typical virulence genes, including luxR, toxRVh , chiA, serine protease and vhh widely existed in V. harveyi, no obvious correlation was established between virulent strains and virulence genes harboured in them. Furthermore, multiple antibiotic resistance was widely exhibited in Harveyi clade strains, particularly for penicillins, polypeptides, lincomycins, acetylspiramycin, streptomycin, metronidazole and bacitracin. And the multiple antibiotic resistance indices were gradually decreased from southern to northern areas of China. This study demonstrated that the pathogenic V. harveyi with multiple antibiotic resistance is highly prevalent in hybrid grouper in China, which requires particular attention. © 2017 John Wiley & Sons Ltd.

  19. Genome-Wide Biases in the Rate and Molecular Spectrum of Spontaneous Mutations in Vibrio cholerae and Vibrio fischeri.

    Science.gov (United States)

    Dillon, Marcus M; Sung, Way; Sebra, Robert; Lynch, Michael; Cooper, Vaughn S

    2017-01-01

    The vast diversity in nucleotide composition and architecture among bacterial genomes may be partly explained by inherent biases in the rates and spectra of spontaneous mutations. Bacterial genomes with multiple chromosomes are relatively unusual but some are relevant to human health, none more so than the causative agent of cholera, Vibrio cholerae Here, we present the genome-wide mutation spectra in wild-type and mismatch repair (MMR) defective backgrounds of two Vibrio species, the low-%GC squid symbiont V. fischeri and the pathogen V. cholerae, collected under conditions that greatly minimize the efficiency of natural selection. In apparent contrast to their high diversity in nature, both wild-type V. fischeri and V. cholerae have among the lowest rates for base-substitution mutations (bpsms) and insertion-deletion mutations (indels) that have been measured, below 10(-)(3)/genome/generation. Vibrio fischeri and V. cholerae have distinct mutation spectra, but both are AT-biased and produce a surprising number of multi-nucleotide indels. Furthermore, the loss of a functional MMR system caused the mutation spectra of these species to converge, implying that the MMR system itself contributes to species-specific mutation patterns. Bpsm and indel rates varied among genome regions, but do not explain the more rapid evolutionary rates of genes on chromosome 2, which likely result from weaker purifying selection. More generally, the very low mutation rates of Vibrio species correlate inversely with their immense population sizes and suggest that selection may not only have maximized replication fidelity but also optimized other polygenic traits relative to the constraints of genetic drift. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  20. Vibrio population structure - Genetic and population structure analysis of clinical and environmental Vibrio parahaemolyticus strains

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Vibrio parahaemolyticus (Vp) is a marine bacterium capable of causing severe gastroenteritis in humans, usually through the consumption of raw shellfish. Before...

  1. Remote sensing measurements of sea surface temperature as an indicator of Vibrio parahaemolyticus in oyster meat and human illnesses.

    Science.gov (United States)

    Konrad, Stephanie; Paduraru, Peggy; Romero-Barrios, Pablo; Henderson, Sarah B; Galanis, Eleni

    2017-08-31

    Vibrio parahaemolyticus (Vp) is a naturally occurring bacterium found in marine environments worldwide. It can cause gastrointestinal illness in humans, primarily through raw oyster consumption. Water temperatures, and potentially other environmental factors, play an important role in the growth and proliferation of Vp in the environment. Quantifying the relationships between environmental variables and indicators or incidence of Vp illness is valuable for public health surveillance to inform and enable suitable preventative measures. This study aimed to assess the relationship between environmental parameters and Vp in British Columbia (BC), Canada. The study used Vp counts in oyster meat from 2002-2015 and laboratory confirmed Vp illnesses from 2011-2015 for the province of BC. The data were matched to environmental parameters from publicly available sources, including remote sensing measurements of nighttime sea surface temperature (SST) obtained from satellite readings at a spatial resolution of 1 km. Using three separate models, this paper assessed the relationship between (1) daily SST and Vp counts in oyster meat, (2) weekly mean Vp counts in oysters and weekly Vp illnesses, and (3) weekly mean SST and weekly Vp illnesses. The effects of salinity and chlorophyll a were also evaluated. Linear regression was used to quantify the relationship between SST and Vp, and piecewise regression was used to identify SST thresholds of concern. A total of 2327 oyster samples and 293 laboratory confirmed illnesses were included. In model 1, both SST and salinity were significant predictors of log(Vp) counts in oyster meat. In model 2, the mean log(Vp) count in oyster meat was a significant predictor of Vp illnesses. In model 3, weekly mean SST was a significant predictor of weekly Vp illnesses. The piecewise regression models identified a SST threshold of approximately 14 o C for both model 1 and 3, indicating increased risk of Vp in oyster meat and Vp illnesses at higher

  2. The Vibrio parahaemolyticus Type III Secretion Systems manipulate host cell MAPK for critical steps in pathogenesis.

    LENUS (Irish Health Repository)

    Matlawska-Wasowska, Ksenia

    2010-12-01

    Vibrio parahaemolyticus is a food-borne pathogen causing inflammation of the gastrointestinal epithelium. Pathogenic strains of this bacterium possess two Type III Secretion Systems (TTSS) that deliver effector proteins into host cells. In order to better understand human host cell responses to V. parahaemolyticus, the modulation of Mitogen Activated Protein Kinase (MAPK) activation in epithelial cells by an O3:K6 clinical isolate, RIMD2210633, was investigated. The importance of MAPK activation for the ability of the bacterium to be cytotoxic and to induce secretion of Interleukin-8 (IL-8) was determined.

  3. The Role of Vibrios in Diseases of Corals.

    Science.gov (United States)

    Munn, Colin B

    2015-08-01

    The tissue, skeleton, and secreted mucus of corals supports a highly dynamic and diverse community of microbes, which play a major role in the health status of corals such as the provision of essential nutrients or the metabolism of waste products. However, members of the Vibrio genus are prominent as causative agents of disease in corals. The aim of this chapter is to review our understanding of the spectrum of disease effects displayed by coral-associated vibrios, with a particular emphasis on the few species where detailed studies of pathogenicity have been conducted. The role of Vibrio shilonii in seasonal bleaching of Oculina patagonica and the development of the coral probiotic hypothesis is reviewed, pointing to unanswered questions about this phenomenon. Detailed consideration is given to studies of V. coralliilyticus and related pathogens and changes in the dominance of vibrios associated with coral bleaching. Other Vibrio-associated disease syndromes discussed include yellow band/blotch disease and tissue necrosis in temperate gorgonian corals. The review includes analysis of the role of enzymes, resistance to oxidative stress, and quorum sensing in virulence of coral-associated vibrios. The review concludes that we should probably regard most-possibly all-vibrios as "opportunistic" pathogens which, under certain environmental conditions, are capable of overwhelming the defense mechanisms of appropriate hosts, leading to rapid growth and tissue destruction.

  4. Human pathogens in plant biofilms: Formation, physiology, and detection.

    Science.gov (United States)

    Ximenes, Eduardo; Hoagland, Lori; Ku, Seockmo; Li, Xuan; Ladisch, Michael

    2017-07-01

    Fresh produce, viewed as an essential part of a healthy life style is usually consumed in the form of raw or minimally processed fruits and vegetables, and is a potentially important source of food-borne human pathogenic bacteria and viruses. These are passed on to the consumer since the bacteria can form biofilms or otherwise populate plant tissues, thereby using plants as vectors to infect animal hosts. The life cycle of the bacteria in plants differs from those in animals or humans and results in altered physiochemical and biological properties (e.g., physiology, immunity, native microflora, physical barriers, mobility, and temperature). Mechanisms by which healthy plants may become contaminated by microorganisms, develop biofilms, and then pass on their pathogenic burden to people are explored in the context of hollow fiber microfiltration by which plant-derived microorganisms may be recovered and rapidly concentrated to facilitate study of their properties. Enzymes, when added to macerated plant tissues, hydrolyze or alter macromolecules that would otherwise foul hollow-fiber microfiltration membranes. Hence, microfiltration may be used to quickly increase the concentration of microorganisms to detectable levels. This review discusses microbial colonization of vegetables, formation and properties of biofilms, and how hollow fiber microfiltration may be used to concentrate microbial targets to detectable levels. The use of added enzymes helps to disintegrate biofilms and minimize hollow fiber membrane fouling, thereby providing a new tool for more time effectively elucidating mechanisms by which biofilms develop and plant tissue becomes contaminated with human pathogens. Biotechnol. Bioeng. 2017;114: 1403-1418. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  5. Interaction of Vibrio spp. with the Inner Surface of the Digestive Tract of Penaeus monodon.

    Directory of Open Access Journals (Sweden)

    Wipasiri Soonthornchai

    Full Text Available Several species of Vibrio are the causative agent of gastroenteritis in humans. In aquaculture, Vibrio harveyi (Vh and V. parahaemolyticus (Vp have long been considered as shrimp pathogens in freshwater, brackish and marine environments. Here we show by using scanning electron microscopy (SEM that Penaeus monodon orally inoculated with each of these two pathogens via an Artemia diet had numerous bacteria attached randomly across the stomach surface, in single and in large biofilm-like clusters 6 h post-infection. A subsequent marked proliferation in the number of V. harveyi within the biofilm-like formations resulted in the development of infections in the stomach, the upper and middle midgut, but neither in the posterior midgut nor the hindgut. SEM also revealed the induced production of peritrichous pili-like structures by the Vp attaching to the stomach lining, whilst only a single polar fibre was seen forming an apparent physical bridge between Vh and the host's epithelium. In contrast to these observations, no such adherences or linkages were seen when trials were conducted with non-pathogenic Vibrio spp. or with Micrococcus luteus, with no obvious resultant changes to the host's gut surface. In naive shrimp, the hindgut was found to be a favorable site for bacteria notably curved, short-rod shaped bacteria which probably belong to Vibrio spp. Data from the current study suggests that pathogens of P. monodon must be able to colonize the digestive tract, particularly the stomach, where chitin is present, and then they use an array of virulent factors and enzymes to infect their host resulting in disease. Oral infection is a better way of mimicking natural routes of infection; investigating the host-bacteria interactions occurring in the digestive tract may lead to new strategies for the prevention or control of bacterial infections in penaeids.

  6. Interaction of Vibrio spp. with the Inner Surface of the Digestive Tract of Penaeus monodon

    Science.gov (United States)

    Soonthornchai, Wipasiri; Chaiyapechara, Sage; Jarayabhand, Padermsak; Söderhäll, Kenneth; Jiravanichpaisal, Pikul

    2015-01-01

    Several species of Vibrio are the causative agent of gastroenteritis in humans. In aquaculture, Vibrio harveyi (Vh) and V. parahaemolyticus (Vp) have long been considered as shrimp pathogens in freshwater, brackish and marine environments. Here we show by using scanning electron microscopy (SEM) that Penaeus monodon orally inoculated with each of these two pathogens via an Artemia diet had numerous bacteria attached randomly across the stomach surface, in single and in large biofilm-like clusters 6 h post-infection. A subsequent marked proliferation in the number of V. harveyi within the biofilm-like formations resulted in the development of infections in the stomach, the upper and middle midgut, but neither in the posterior midgut nor the hindgut. SEM also revealed the induced production of peritrichous pili-like structures by the Vp attaching to the stomach lining, whilst only a single polar fibre was seen forming an apparent physical bridge between Vh and the host’s epithelium. In contrast to these observations, no such adherences or linkages were seen when trials were conducted with non-pathogenic Vibrio spp. or with Micrococcus luteus, with no obvious resultant changes to the host’s gut surface. In naive shrimp, the hindgut was found to be a favorable site for bacteria notably curved, short-rod shaped bacteria which probably belong to Vibrio spp. Data from the current study suggests that pathogens of P. monodon must be able to colonize the digestive tract, particularly the stomach, where chitin is present, and then they use an array of virulent factors and enzymes to infect their host resulting in disease. Oral infection is a better way of mimicking natural routes of infection; investigating the host-bacteria interactions occurring in the digestive tract may lead to new strategies for the prevention or control of bacterial infections in penaeids. PMID:26285030

  7. Human microbiome versus food-borne pathogens: friend or foe.

    Science.gov (United States)

    Josephs-Spaulding, Jonathan; Beeler, Erik; Singh, Om V

    2016-06-01

    As food safety advances, there is a great need to maintain, distribute, and provide high-quality food to a much broader consumer base. There is also an ever-growing "arms race" between pathogens and humans as food manufacturers. The human microbiome is a collective organ of microbes that have found community niches while associating with their host and other microorganisms. Humans play an important role in modifying the environment of these organisms through their life choices, especially through individual diet. The composition of an individual's diet influences the digestive system-an ecosystem with the greatest number and largest diversity of organisms currently known. Organisms living on and within food have the potential to be either friends or foes to the consumer. Maintenance of this system can have multiple benefits, but lack of maintenance can lead to a host of chronic and preventable diseases. Overall, this dynamic system is influenced by intense competition from food-borne pathogens, lifestyle, overall diet, and presiding host-associated microbiota.

  8. Detection of Blastocystis hominis: a controversial human pathogen.

    Science.gov (United States)

    Basak, Silpi; Rajurkar, Monali N; Mallick, Sanjay Kumar

    2014-01-01

    Blastocystis hominis has been reclassified as a protozoan parasite. Its role as a human pathogen is somewhat controversial. There has been a dramatic increase in the frequency of B. hominis infection in association with diarrhea especially in immunocompromised hosts like AIDS patients, travelers, homosexuals, day care children, animal handlers especially zoo keepers, etc. Recent reports suggest that B. hominis is an emerging pathogen; hence, we have undertaken this study to detect B. hominis from stool samples of patients attending our hospital. About 200 stool samples were tested by light microscopic examination, for observing wet mounts with saline and Lugol's iodine. Permanent staining of fecal smear by Gram's staining and modified acid fast staining was done. The stool sample which was microscopically positive for B. hominis was cultured on Lowenstein-Jensen's (LJ) medium. In one patient, the vacuolated form of B. hominis was observed in wet mount with saline preparation of stool sample. This was very clearly seen in wet mount with Lugol's iodine. In Gram's stained preparation, also the vacuolated form was observed. Detection of B. hominis was not possible by modified acid fast staining. B. hominis was also grown on LJ medium which is an egg-containing medium. Clinical microbiology laboratories should start screening of stool samples for B. hominis as it is an emerging pathogen.

  9. Pathogenic Neisseria hitchhike on the uropod of human neutrophils.

    Directory of Open Access Journals (Sweden)

    Niklas Söderholm

    Full Text Available Polymorphonuclear neutrophils (PMNs are important components of the human innate immune system and are rapidly recruited at the site of bacterial infection. Despite the effective phagocytic activity of PMNs, Neisseria gonorrhoeae infections are characterized by high survival within PMNs. We reveal a novel type IV pilus-mediated adherence of pathogenic Neisseria to the uropod (the rear of polarized PMNs. The direct pilus-uropod interaction was visualized by scanning electron microscopy and total internal reflection fluorescence (TIRF microscopy. We showed that N. meningitidis adhesion to the PMN uropod depended on both pilus-associated proteins PilC1 and PilC2, while N. gonorrhoeae adhesion did not. Bacterial adhesion elicited accumulation of the complement regulator CD46, but not I-domain-containing integrins, beneath the adherent bacterial microcolony. Electrographs and live-cell imaging of PMNs suggested that bacterial adherence to the uropod is followed by internalization into PMNs via the uropod. We also present data showing that pathogenic Neisseria can hitchhike on PMNs to hide from their phagocytic activity as well as to facilitate the spread of the pathogen through the epithelial cell layer.

  10. Pathogens and host immunity in the ancient human oral cavity

    DEFF Research Database (Denmark)

    Warinner, Christina; Rodrigues, João F Matias; Vyas, Rounak

    2014-01-01

    cavity has long served as a reservoir for bacteria implicated in both local and systemic disease. We characterize (i) the ancient oral microbiome in a diseased state, (ii) 40 opportunistic pathogens, (iii) ancient human-associated putative antibiotic resistance genes, (iv) a genome reconstruction......Calcified dental plaque (dental calculus) preserves for millennia and entraps biomolecules from all domains of life and viruses. We report the first, to our knowledge, high-resolution taxonomic and protein functional characterization of the ancient oral microbiome and demonstrate that the oral...

  11. Standardized Metadata for Human Pathogen/Vector Genomic Sequences

    Science.gov (United States)

    Dugan, Vivien G.; Emrich, Scott J.; Giraldo-Calderón, Gloria I.; Harb, Omar S.; Newman, Ruchi M.; Pickett, Brett E.; Schriml, Lynn M.; Stockwell, Timothy B.; Stoeckert, Christian J.; Sullivan, Dan E.; Singh, Indresh; Ward, Doyle V.; Yao, Alison; Zheng, Jie; Barrett, Tanya; Birren, Bruce; Brinkac, Lauren; Bruno, Vincent M.; Caler, Elizabet; Chapman, Sinéad; Collins, Frank H.; Cuomo, Christina A.; Di Francesco, Valentina; Durkin, Scott; Eppinger, Mark; Feldgarden, Michael; Fraser, Claire; Fricke, W. Florian; Giovanni, Maria; Henn, Matthew R.; Hine, Erin; Hotopp, Julie Dunning; Karsch-Mizrachi, Ilene; Kissinger, Jessica C.; Lee, Eun Mi; Mathur, Punam; Mongodin, Emmanuel F.; Murphy, Cheryl I.; Myers, Garry; Neafsey, Daniel E.; Nelson, Karen E.; Nierman, William C.; Puzak, Julia; Rasko, David; Roos, David S.; Sadzewicz, Lisa; Silva, Joana C.; Sobral, Bruno; Squires, R. Burke; Stevens, Rick L.; Tallon, Luke; Tettelin, Herve; Wentworth, David; White, Owen; Will, Rebecca; Wortman, Jennifer; Zhang, Yun; Scheuermann, Richard H.

    2014-01-01

    High throughput sequencing has accelerated the determination of genome sequences for thousands of human infectious disease pathogens and dozens of their vectors. The scale and scope of these data are enabling genotype-phenotype association studies to identify genetic determinants of pathogen virulence and drug/insecticide resistance, and phylogenetic studies to track the origin and spread of disease outbreaks. To maximize the utility of genomic sequences for these purposes, it is essential that metadata about the pathogen/vector isolate characteristics be collected and made available in organized, clear, and consistent formats. Here we report the development of the GSCID/BRC Project and Sample Application Standard, developed by representatives of the Genome Sequencing Centers for Infectious Diseases (GSCIDs), the Bioinformatics Resource Centers (BRCs) for Infectious Diseases, and the U.S. National Institute of Allergy and Infectious Diseases (NIAID), part of the National Institutes of Health (NIH), informed by interactions with numerous collaborating scientists. It includes mapping to terms from other data standards initiatives, including the Genomic Standards Consortium’s minimal information (MIxS) and NCBI’s BioSample/BioProjects checklists and the Ontology for Biomedical Investigations (OBI). The standard includes data fields about characteristics of the organism or environmental source of the specimen, spatial-temporal information about the specimen isolation event, phenotypic characteristics of the pathogen/vector isolated, and project leadership and support. By modeling metadata fields into an ontology-based semantic framework and reusing existing ontologies and minimum information checklists, the application standard can be extended to support additional project-specific data fields and integrated with other data represented with comparable standards. The use of this metadata standard by all ongoing and future GSCID sequencing projects will provide a

  12. Standardized metadata for human pathogen/vector genomic sequences.

    Directory of Open Access Journals (Sweden)

    Vivien G Dugan

    Full Text Available High throughput sequencing has accelerated the determination of genome sequences for thousands of human infectious disease pathogens and dozens of their vectors. The scale and scope of these data are enabling genotype-phenotype association studies to identify genetic determinants of pathogen virulence and drug/insecticide resistance, and phylogenetic studies to track the origin and spread of disease outbreaks. To maximize the utility of genomic sequences for these purposes, it is essential that metadata about the pathogen/vector isolate characteristics be collected and made available in organized, clear, and consistent formats. Here we report the development of the GSCID/BRC Project and Sample Application Standard, developed by representatives of the Genome Sequencing Centers for Infectious Diseases (GSCIDs, the Bioinformatics Resource Centers (BRCs for Infectious Diseases, and the U.S. National Institute of Allergy and Infectious Diseases (NIAID, part of the National Institutes of Health (NIH, informed by interactions with numerous collaborating scientists. It includes mapping to terms from other data standards initiatives, including the Genomic Standards Consortium's minimal information (MIxS and NCBI's BioSample/BioProjects checklists and the Ontology for Biomedical Investigations (OBI. The standard includes data fields about characteristics of the organism or environmental source of the specimen, spatial-temporal information about the specimen isolation event, phenotypic characteristics of the pathogen/vector isolated, and project leadership and support. By modeling metadata fields into an ontology-based semantic framework and reusing existing ontologies and minimum information checklists, the application standard can be extended to support additional project-specific data fields and integrated with other data represented with comparable standards. The use of this metadata standard by all ongoing and future GSCID sequencing projects will

  13. Neutralization of radical toxicity by temperature-dependent modulation of extracellular SOD activity in coral bleaching pathogen Vibrio shiloi and its role as a virulence factor.

    Science.gov (United States)

    Murali, Malliga Raman; Raja, Subramaniya Bharathi; Devaraj, Sivasitambaram Niranjali

    2010-08-01

    Vibrio shiloi is the first and well-documented bacterium which causes coral bleaching, particularly, during summer, when seawater temperature is between 26 and 31 degrees C. Coral bleaching is the disruption of the symbiotic association between coral hosts and their photosynthetic microalgae zooxanthellae. This is either due to lowered resistance in corals to infection or increased virulence of the bacterium at the higher sea surface temperature. The concentration of the oxygen and resulting oxygen radicals produced by the zooxanthellae during photosynthesis are highly toxic to bacteria, which also assist corals in resisting the infection. Hence, in this study we examined the effect of different temperatures on the activity of a novel extracellular SOD in V. shiloi. We also partially characterized the SOD and clearly confirmed that the extracellular SOD produced by V. shiloi is Mn-SOD type, as it was not inhibited by H2O2 or KCN. Performing chemical susceptibility killing assay, we confirmed that extracellular SOD may act as first line of defense for the bacteria against the reactive oxygen species. Since, increased activity of novel Mn-SOD at higher temperature, leads to the neutralization of radical toxicity and facilitates the survival of V. shiloi. Hence, the extracellular Mn-SOD may be considered as a virulence factor.

  14. Genetic recombination between human and animal parasites creates novel strains of human pathogen.

    Directory of Open Access Journals (Sweden)

    Wendy Gibson

    2015-03-01

    Full Text Available Genetic recombination between pathogens derived from humans and livestock has the potential to create novel pathogen strains, highlighted by the influenza pandemic H1N1/09, which was derived from a re-assortment of swine, avian and human influenza A viruses. Here we investigated whether genetic recombination between subspecies of the protozoan parasite, Trypanosoma brucei, from humans and animals can generate new strains of human pathogen, T. b. rhodesiense (Tbr responsible for sleeping sickness (Human African Trypanosomiasis, HAT in East Africa. The trait of human infectivity in Tbr is conferred by a single gene, SRA, which is potentially transferable to the animal pathogen Tbb by sexual reproduction. We tracked the inheritance of SRA in crosses of Tbr and Tbb set up by co-transmitting genetically-engineered fluorescent parental trypanosome lines through tsetse flies. SRA was readily transferred into new genetic backgrounds by sexual reproduction between Tbr and Tbb, thus creating new strains of the human pathogen, Tbr. There was no evidence of diminished growth or transmissibility of hybrid trypanosomes carrying SRA. Although expression of SRA is critical to survival of Tbr in the human host, we show that the gene exists as a single copy in a representative collection of Tbr strains. SRA was found on one homologue of chromosome IV in the majority of Tbr isolates examined, but some Ugandan Tbr had SRA on both homologues. The mobility of SRA by genetic recombination readily explains the observed genetic variability of Tbr in East Africa. We conclude that new strains of the human pathogen Tbr are being generated continuously by recombination with the much larger pool of animal-infective trypanosomes. Such novel recombinants present a risk for future outbreaks of HAT.

  15. [Detection of Salmonella, Listeria spp., Vibrio spp., and Yersinia enterocolitica in frozen seafood and comparison with enumeration for faecal indicators: implication for public health].

    Science.gov (United States)

    Ripabelli, G; Sammarco, M L; Fanelli, I; Grasso, G M

    2004-01-01

    Infections transmitted through consumption of contaminated seafood is a significant source of human morbidity. The aim of this study was to compare the detection of Salmonella, Listeria, Vibrio, and Yersinia enterocolitica in frozen seafood with results from enumeration of conventional faecal indicators. A total of 213 crustaceans or molluscs were purchased from local vendors in Italy: 74% were harvested in Italy, 25% from other European countries and 1% from outside Europe. Listeria spp. was isolated from 20% of samples, Vibrio spp. from 11%, Salmonella from 3% and Y. enterocolitica from 1%. Listeria species isolated were L. monocytogenes, L. innocua, L. welshimeri, L. ivanovii and L. seeligeri. Vibrio species isolated were V. alginolyticus and V. fluvialis. The most contaminated shellfish for both faecal indicator microrganism and pathogens were hen clams (6% contained Salmonella, 27% Listeria spp. and 3% Y. enterocolitica), while from 27% of shrimps Vibrio spp. was recovered. Higher levels of faecal indicators were recovered from samples harvested outside Europe, and 66% of samples harvested in Thailand were contaminated from Salmonella. Significant differences were found in the levels of contamination of seafoods depending upon the freezing regime, but there was a limited association between presence of potential pathogens (particularly Vibrio spp.) and conventional faecal indicators. Hence, we suggest reconsideration of current legal parameters to evaluate microbiological quality of seafood.

  16. The Vibrio parahaemolyticus-infecting bacteriophage qdvp001: genome sequence and endolysin with a modular structure.

    Science.gov (United States)

    Wang, Weiyu; Li, Mengzhe; Lin, Hong; Wang, Jingxue; Mao, Xiangzhao

    2016-10-01

    Vibrio parahaemolyticus, a marine pathogen, is a causative agent of gastroenteritis in humans after consumption of contaminated seafood. In recent years, infections with V. parahaemolyticus have become an increasingly frequent factor in microbial food poisoning; therefore, it is urgent to figure out ways to control Vibrio parahaemolyticus. Endolysins, lytic enzymes encoded by bacteriophages, have been regarded as a therapeutic alternative to antibiotics in control of bacterial growth and have been successfully utilized in various areas. Here, we report the full genome sequence of the novel phage qdvp001, which lyses Vibrio parahaemolyticus 17802. The qdvp001 genome consists of a 134,742-bp DNA with a G+C content of 35.35 % and 227 putative open reading frames. Analysis revealed that the qdvp001 open reading frames encoded various putative functional proteins with a putative endolysin gene (ORF 60). No holin genes were identified in qdvp001. ORF 60 was cloned and expressed. The results showed that the purified endolysin Lysqdvp001 had a high hydrolytic activity toward Vibrio parahaemolyticus and a broader spectrum compared to that of the parental bacteriophage qdvp001. Thus, purified endolysin Lysqdvp001 has a potential to be used as an antibacterial agent in the future.

  17. Pathogenesis of Infection by Clinical and Environmental Strains of Vibrio vulnificus in Iron-Dextran-Treated Mice

    OpenAIRE

    Starks, Angela M.; Schoeb, Trenton R.; Tamplin, Mark L.; Parveen, Salina; Doyle, Thomas J.; Bomeisl, Philip E.; Escudero, Gloria M.; Gulig, Paul A.

    2000-01-01

    Vibrio vulnificus is an opportunistic pathogen that contaminates oysters harvested from the Gulf of Mexico. In humans with compromising conditions, especially excess levels of iron in plasma and tissues, consumption of contaminated seafood or exposure of wounds to contaminated water can lead to systemic infection and disfiguring skin infection with extremely high mortality. V. vulnificus-associated diseases are noted for the rapid replication of the bacteria in host tissues, with extensive ti...

  18. Oxidative Stress Responses in the Human Fungal Pathogen, Candida albicans

    Science.gov (United States)

    da Silva Dantas, Alessandra; Day, Alison; Ikeh, Mélanie; Kos, Iaroslava; Achan, Beatrice; Quinn, Janet

    2015-01-01

    Candida albicans is a major fungal pathogen of humans, causing approximately 400,000 life-threatening systemic infections world-wide each year in severely immunocompromised patients. An important fungicidal mechanism employed by innate immune cells involves the generation of toxic reactive oxygen species (ROS), such as superoxide and hydrogen peroxide. Consequently, there is much interest in the strategies employed by C. albicans to evade the oxidative killing by macrophages and neutrophils. Our understanding of how C. albicans senses and responds to ROS has significantly increased in recent years. Key findings include the observations that hydrogen peroxide triggers the filamentation of this polymorphic fungus and that a superoxide dismutase enzyme with a novel mode of action is expressed at the cell surface of C. albicans. Furthermore, recent studies have indicated that combinations of the chemical stresses generated by phagocytes can actively prevent C. albicans oxidative stress responses through a mechanism termed the stress pathway interference. In this review, we present an up-date of our current understanding of the role and regulation of oxidative stress responses in this important human fungal pathogen. PMID:25723552

  19. Drosophila as a genetic model for studying pathogenic human viruses.

    Science.gov (United States)

    Hughes, Tamara T; Allen, Amanda L; Bardin, Joseph E; Christian, Megan N; Daimon, Kansei; Dozier, Kelsey D; Hansen, Caom L; Holcomb, Lisa M; Ahlander, Joseph

    2012-02-05

    Viruses are infectious particles whose viability is dependent on the cells of living organisms, such as bacteria, plants, and animals. It is of great interest to discover how viruses function inside host cells in order to develop therapies to treat virally infected organisms. The fruit fly Drosophila melanogaster is an excellent model system for studying the molecular mechanisms of replication, amplification, and cellular consequences of human viruses. In this review, we describe the advantages of using Drosophila as a model system to study human viruses, and highlight how Drosophila has been used to provide unique insight into the gene function of several pathogenic viruses. We also propose possible directions for future research in this area. Copyright © 2011 Elsevier Inc. All rights reserved.

  20. Appraisal of Microbial Evolution to Commensalism and Pathogenicity in Humans

    Directory of Open Access Journals (Sweden)

    Asit Ranjan Ghosh

    2013-01-01

    Full Text Available The human body is host to a number of microbes occurring in various forms of host-microbe associations, such as commensals, mutualists, pathogens and opportunistic symbionts. While this association with microbes in certain cases is beneficial to the host, in many other cases it seems to offer no evident benefit or motive. The emergence and re-emergence of newer varieties of infectious diseases with causative agents being strains that were once living in the human system makes it necessary to study the environment and the dynamics under which this host microbe relationship thrives. The present discussion examines this interaction while tracing the origins of this association, and attempts to hypothesize a possible framework of selective pressures that could have lead microbes to inhabit mammalian host systems.

  1. Targeting human pathogenic bacteria by siderophores: A proteomics review.

    Science.gov (United States)

    Ferreira, Daniela; Seca, Ana M L; C G A, Diana; Silva, Artur M S

    2016-08-11

    Human bacterial infections are still a major public health problem throughout the world. Therefore it is fundamental to understand how pathogenic bacteria interact with their human host and to develop more advanced drugs or vaccines in response to the increasing bacterial resistance. Since iron is essential to bacterial survival and growth inside the host tissues, these microorganisms have developed highly efficient iron-acquisition systems; the most common one involves the secretion of iron chelators into the extracellular environment, known as siderophores, and the corresponding siderophore-membrane receptors or transporters responsible for the iron uptake. In the past few decades, several biochemical methods and genetic screens have been employed to track down and identify these iron-scavenging molecules. However, compared with the previous "static" approaches, proteomic identification is revealing far more molecules through full protein mapping and becoming more rapid and selective, leading the scientific and medical community to consider standardizing proteomic tools for clinical biomarker detection of bacterial infectious diseases. In this review, we focus on human pathogenic Gram-negative bacteria and discuss the importance of siderophores in their virulence and the available proteomic strategies to identify siderophore-related proteins and their expression level under different growth conditions. The promising use of siderophore antibiotics to overcome bacterial resistance and the future of proteomics in the routine clinical care are also mentioned. Proteomic strategies to identify siderophore-related proteins and their expression level can be helpful to control and/or find a cure of infectious deseases especially if related with multidrug resistance. Siderophores are low-molecular-weight compounds produced by bacteria which can become clinical biomarkers and/or antibiotics used mainly in "Trojan horse" type strategies. Due to the above mention we think

  2. Human Pathogens on Plants: Designing a Multidisciplinary Strategy for Research.

    Science.gov (United States)

    Fletcher, Jacqueline; Leach, Jan E; Eversole, Kellye; Tauxe, Robert

    2014-10-15

    Recent efforts to address concerns about microbial contamination of food plants and resulting foodborne illness have prompted new collaboration and interactions between the scientific communities of plant pathology and food safety. This article provides perspectives from scientists of both disciplines and presents selected research results and concepts that highlight existing and possible future synergisms for audiences of both disciplines. Plant pathology is a complex discipline that encompasses studies of the dissemination, colonization, and infection of plants by microbes such as bacteria, viruses, fungi, and oomycetes. Plant pathologists study plant diseases as well as host plant defense responses and disease management strategies with the goal of minimizing disease occurrences and impacts. Repeated outbreaks of human illness attributed to the contamination of fresh produce, nuts and seeds, and other plant-derived foods by human enteric pathogens such as Shiga toxin-producing Escherichia coli and Salmonella spp. have led some plant pathologists to broaden the application of their science in the past two decades, to address problems of human pathogens on plants (HPOPs). Food microbiology, which began with the study of microbes that spoil foods and those that are critical to produce food, now also focuses study on how foods become contaminated with pathogens and how this can be controlled or prevented. Thus, at the same time, public health researchers and food microbiologists have become more concerned about plant-microbe interactions before and after harvest. New collaborations are forming between members of the plant pathology and food safety communities, leading to enhanced research capacity and greater understanding of the issues for which research is needed. The two communities use somewhat different vocabularies and conceptual models. For example, traditional plant pathology concepts such as the disease triangle and the disease cycle can help to define

  3. The graphene oxide contradictory effects against human pathogens

    Science.gov (United States)

    Palmieri, Valentina; Carmela Lauriola, Maria; Ciasca, Gabriele; Conti, Claudio; De Spirito, Marco; Papi, Massimiliano

    2017-04-01

    Standing out as the new wonder bidimensional material, graphene oxide (GO) has aroused an exceptional interest in biomedical research by holding promise for being the antibacterial of future. First, GO possesses a specific interaction with microorganisms combined with a mild toxicity for human cells. Additionally, its antibacterial action seems to be directed to multiple targets in pathogens, causing both membranes mechanical injury and oxidative stress. Lastly, compared to other carbon materials, GO has easy and low-cost processing and is environment-friendly. This remarkable specificity and multi-targeting antibacterial activity come at a time when antibiotic resistance represents the major health challenge. Unfortunately, a comprehensive framework to understand how to effectively utilize this material against microorganisms is still lacking. In the last decade, several groups tried to define the mechanisms of interaction between GO flakes and pathogens but conflicting results have been reported. This review is focused on all the contradictions of GO antimicrobial properties in solution. Flake size, incubation protocol, time of exposure and species considered are examples of factors influencing results. These parameters will be summarized and analyzed with the aim of defining the causes of contradictions, to allow fast GO clinical application.

  4. Trichomonas vaginalis: pathogenicity and potential role in human reproductive failure.

    Science.gov (United States)

    Mielczarek, Ewelina; Blaszkowska, Joanna

    2016-08-01

    Trichomonas vaginalis, which colonizes the genitourinary tract of men and women, is a sexually transmitted parasite causing symptomatic or asymptomatic trichomoniasis. The host-parasite relationship is very complex, and clinical symptoms cannot likely be attributed to a single pathogenic effect. Among the many factors responsible for interactions between T. vaginalis and host tissues, contact-dependent and contact-independent mechanisms are important in pathogenicity, as is the immune response. This review focuses on the potential virulence properties of T. vaginalis and its role in female and male infertility. It highlights the association between T. vaginalis infection and serious adverse health consequences experienced by women, including infertility, preterm birth and low-birth-weight infants. Long-term clinical observations and results of in vitro experimental studies indicate that in men, trichomoniasis has been also associated with infertility through inflammatory damage to the genitourinary tract or interference with sperm function. These results contribute significantly to improving our knowledge of the role of parasitic virulence factors in the development of infection and its role in human infertility.

  5. Inactivation of Vibrio anguillarum by attached and planktonic Roseobacter cells

    DEFF Research Database (Denmark)

    D'Alvise, Paul; Melchiorsen, Jette; Porsby, Cisse Hedegaard

    2010-01-01

    The purpose of the present study was to investigate inhibition of Vibrio by Roseobacter in a combined liquid-surface system. Exposure of Vibrio anguillarum to surface-attached roseobacters (10e7 cfu/cm2) resulted in significant reduction or complete killing of the pathogen inoculated at 10e2 – 10...... cfu/ml. The effect was likely associated with production of tropodithietic acid (TDA), as a TDA-negative mutant did not affect survival or growth of V. anguillarum....

  6. Gene cloning and prokaryotic expression of recombinant flagellin A from Vibrio parahaemolyticus

    Science.gov (United States)

    Yuan, Ye; Wang, Xiuli; Guo, Sheping; Liu, Yang; Ge, Hui; Qiu, Xuemei

    2010-11-01

    The Gram-negative Vibrio parahaemolyticus is a common pathogen in humans and marine animals. Bacteria flagellins play an important role during infection and induction of the host immune response. Thus, flagellin proteins are an ideal target for vaccines. We amplified the complete flagellin subunit gene ( flaA) from V. parahaemolyticus ATCC 17802. We then cloned and expressed the gene into Escherichia coli BL21 (DE3) cells. The gene coded for a protein that was 62.78 kDa. We purified and characterized the protein using Ni-NTA affinity chromatography and Anti-His antibody Western blotting, respectively. Our results provide a basis for further studies into the utility of the FlaA protein as a vaccine candidate against infection by Vibrio parahaemolyticus. In addition, the purified FlaA protein can be used for further functional and structural studies.

  7. Siderocalin outwits the coordination chemistry of vibriobactin, a siderophore of Vibrio cholerae.

    Science.gov (United States)

    Allred, Benjamin E; Correnti, Colin; Clifton, Matthew C; Strong, Roland K; Raymond, Kenneth N

    2013-09-20

    The human protein siderocalin (Scn) inhibits bacterial iron acquisition by binding catechol siderophores. Several pathogenic bacteria respond by making stealth siderophores that are not recognized by Scn. Fluvibactin and vibriobactin, respectively of Vibrio fluvialis and Vibrio cholerae , include an oxazoline adjacent to a catechol. This chelating unit binds iron either in a catecholate or a phenolate-oxazoline coordination mode. The latter has been suggested to make vibriobactin a stealth siderophore without directly identifying the coordination mode in relation to Scn binding. We use Scn binding assays with the two siderophores and two oxazoline-substituted analogs and the crystal structure of Fe-fluvibactin:Scn to show that the oxazoline does not prevent Scn binding; hence, vibriobactin is not a stealth siderophore. We show that the phenolate-oxazoline coordination mode is present at physiological pH and is not bound by Scn. However, Scn binding shifts the coordination to the catecholate mode and thereby inactivates this siderophore.

  8. Factores ambientales vinculados con la aparición y dispersión de las epidemias de Vibrio en América del Sur Environmental drivers of emergence and spreading of Vibrio epidemics in South America

    Directory of Open Access Journals (Sweden)

    Ronnie G. Gavilán

    2011-03-01

    Full Text Available El Vibrio cholerae y el V. parahaemolyticus son las principales especies de Vibrio que ocasionan infecciones en seres humanos. Las infecciones causadas por estos dos patógenos están teniendo una creciente importancia debido a su imparable expansión a nivel mundial. En el presente artículo se resumen los aspectos ecológicos asociados con la llegada y dispersión de las epidemias por V. parahaemolyticus y V. cholera en Perú desde una perspectiva sudamericana. De igual forma, se discute las similitudes en la aparición del cólera en 1991 y las infecciones por V. parahaemolyticus en 1997 en Perú, que sirvieron como experimentos únicos para analizar la relación entre las epidemias de Vibrio y los cambios en el medio ambiente. Estas dos radiaciones epidémicas constituyen unos claros ejemplos que apoyan la teoría de la dispersión oceánica de vibrios patógenos y permiten identificar a los episodios de El Niño como un mecanismo potencial de transmisión de enfermedades a través del océano.Vibrio cholerae and V. parahaemolyticus are the two Vibrio species with a major impact on human health. Diseases caused by both pathogens are acquiring increasing relevance due to their expansion at global scale. In this paper, we resume the ecological aspects associated with the arrival and spreading of infections caused by V. parahaemolyticus and V. cholerae in Peru from a South American perspective. Moreover, we discuss the similarities in the emergence in Peru of cholera cases in 1991 and V. parahaemolyticus infections in 1997. These constituted exceptional experiments to evaluate the relationships between the Vibrio epidemics and changes in the environment. The epidemic radiations of V. cholerae and V. parahaemolyticus constitute to clear examples supporting the oceanic dispersion of pathogenic vibrios and have enabled the identification of El Niño events as a potential mechanism for the spreading of diseases through the ocean.

  9. Draft genome sequence of the first human isolate of the ruminant pathogen Mycoplasma capricolum subsp. capricolum

    DEFF Research Database (Denmark)

    Seersholm, Frederik Valeur; Fischer, Anne; Heller, Martin

    2015-01-01

    Mycoplasma capricolum subsp. capricolum is a well-known pathogen of small ruminants. A recent human case of septicemia involving this agent raised the question of its potential pathogenicity to humans. We present the first draft genome sequence of a human Mycoplasma capricolum subsp. capricolum...

  10. [Prophage CTXphi genome variability and its role in alteration of Vibrio cholerae El Tor virulence characteristics].

    Science.gov (United States)

    Smirnova, N I; Osin, A V; Nefedov, K S; Kul'shan', T A; Zadnova, S P; Livanova, L F; Toporkov, A V; Kutyrev, V V

    2007-01-01

    Comparative analysis of CTXphi prophage genome of 366 V. cholerae El Tor strains isolated from infected people and water was carried out using the polymerase chain reaction. Four groups of vibrios, which carry different combinations of ctxA, zot, and ace genes from core region of CTXphi prophage coding key (cholera enterotoxin) and accessory (Zot and Ace toxins) pathogenicity factors, were determined: ctxA(+) zot(-) ace(+), ctxA(-) zot(+) ace(+), ctxA(-) zot(+) ace(-), ctxA(-) zot(-) ace(+). Vibrios that had lost all tested genes were also revealed. Genomic rearrangements occurring in water environment in virulent V. cholerae strains, which acquired foreign pathogenicity genes necessary for their existence in human organism, were proposed as one of the mechanisms of formation of clones with an incomplete or no prophage. Infection process in model animals challenged with wild and isogenic strains of V. cholerae differing in the set of the phage genes (ctxA, zot, and ace) was comparatively analyzed. It was shown that variability of CTXphi prophage genome was an important factor of modification of cholera vibrios virulent characteristics. Obtained data point to usefulness of ctxA, zot, and ace phage genes detection in wild V. cholerae isolates as it could permit evaluation of their virulent potential determining the severity of the infection.

  11. Prevalence study of Vibrio species and frequency of the virulence genes of Vibrio parahaemolyticus isolated from fresh and salted shrimps in Genaveh seaport

    Directory of Open Access Journals (Sweden)

    S Hosseini

    2014-08-01

    Full Text Available Vibrio species are important seafood-borne pathogens that are responsible for 50-70% of gasteroenteritis. The present study was carried out in order to determine the prevalence of Vibrio species and the distribution of tdh, tlh and trh virulence genes in Vibrio parahaemolyticus isolated from fresh and salted shrimp samples. Totally, 60 fresh and salted shrimp samples were collected from the Genaveh seaport. Microbial culture was used to isolate Vibrio species. In addition, the presences of Vibrio parahaemolyticus, Vibrio cholera, Vibrio vulnificus and Vibrio harveyi and the virulence genes of V. parahaemolyticus were studied using the PCR method. Results showed that 20% of fresh and 23.33% of salted shrimp samples were positive for Vibrio species. In studied samples, V. vulnificus had the highest prevalence rate (8.33%, while V. cholera had the lowest prevalence rate (1.66%. From a total of 4 detected V. parahaemolyticus, all of them had tlh gene (100%. The distribution of tdh and trh genes in isolated V. parahaemolyticus strains were 50% and 25%, respectively. High prevalence of Vibrio species and especially virulent V. parahaemolyticus in samples confirmed the lack of hygienic condition in the production and distribution centers of shrimp.

  12. Systems biology of pathogen-host interaction: networks of protein-protein interaction within pathogens and pathogen-human interactions in the post-genomic era.

    Science.gov (United States)

    Durmuş Tekir, Saliha D; Ülgen, Kutlu Ö

    2013-01-01

    Infectious diseases comprise some of the leading causes of death and disability worldwide. Interactions between pathogen and host proteins underlie the process of infection. Improved understanding of pathogen-host molecular interactions will increase our knowledge of the mechanisms involved in infection, and allow novel therapeutic solutions to be devised. Complete genome sequences for a number of pathogenic microorganisms, as well as the human host, has led to the revelation of their protein-protein interaction (PPI) networks. In this post-genomic era, pathogen-host interactions (PHIs) operating during infection can also be mapped. Detailed systematic analyses of PPI and PHI data together are required for a complete understanding of pathogenesis of infections. Here we review the striking results recently obtained during the construction and investigation of these networks. Emphasis is placed on studies producing large-scale interaction data by high-throughput experimental techniques. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Antimicrobial properties of marine seaweed, Sargassum muticum against human pathogens

    Directory of Open Access Journals (Sweden)

    Puthamohan Vinayaga Moorthi

    2015-02-01

    Full Text Available Objective: To evaluate the antibacterial efficiency of the seaweed, Sargassum muticum (S. muticum collected from Pudumadam, Ramanathapuram, Tamil Nadu, India. Methods: Crude solvent extracts of S. muticum were obtained by using Soxhlet extraction and the solvents like acetone, methanol and chloroform. These different extracts were tested against different human bacterial pathogens such as Micrococcus sp., Staphylococcus aureus (methicillin resistance, Salmonella paratyphi B, Staphylococcus epidermis (3615, Enterobacter aerogenus (111, Klebsiella pneumonia (109, Shigella fleschneri (1457 (S. fleschneri, Proteus vulgaris (1771, Staphylococcus aureus (96 and Salmonella typhymurium (SP7 which were obtained from Microbial Type Culture Collection, Indian Institute of Microbial Technology, Chandigarh, India. Results: The results revealed that acetone extract had unveiled the maximum of 11 mm zone of inhibition at 40 µL against S. fleschneri. Similar zone of inhibition (11 mm was also observed at 50 µL against Micrococcus sp. and S. fleschneri. Followed by acetone extract, chloroform extract also contributed 11 mm zone of inhibition against S. fleschneri and Salmonella paratyphi B at 40 and 50 µL respectively. Besides, methanol extracts revealed meager antibacterial activity (9 mm. Conclusions: The present investigation suggests that the phytochemical constituent of the S. muticum might be suitable agents for the control of human deadly diseases.

  14. Purine Acquisition and Synthesis by Human Fungal Pathogens

    Directory of Open Access Journals (Sweden)

    Jessica L. Chitty

    2017-06-01

    Full Text Available While members of the Kingdom Fungi are found across many of the world’s most hostile environments, only a limited number of species can thrive within the human host. The causative agents of the most common invasive fungal infections are Candida albicans, Aspergillus fumigatus, and Cryptococcus neoformans. During the infection process, these fungi must not only combat the host immune system while adapting to dramatic changes in temperature and pH, but also acquire sufficient nutrients to enable growth and dissemination in the host. One class of nutrients required by fungi, which is found in varying concentrations in their environmental niches and the human host, is the purines. These nitrogen-containing heterocycles are one of the most abundant organic molecules in nature and are required for roles as diverse as signal transduction, energy metabolism and DNA synthesis. The most common life-threatening fungal pathogens can degrade, salvage and synthesize de novo purines through a number of enzymatic steps that are conserved. While these enable them to adapt to the changing purine availability in the environment, only de novo purine biosynthesis is essential during infection and therefore an attractive antimycotic target.

  15. Parasite Mitogen-Activated Protein Kinases as Drug Discovery Targets to Treat Human Protozoan Pathogens

    Directory of Open Access Journals (Sweden)

    Michael J. Brumlik

    2011-01-01

    Full Text Available Protozoan pathogens are a highly diverse group of unicellular organisms, several of which are significant human pathogens. One group of protozoan pathogens includes obligate intracellular parasites such as agents of malaria, leishmaniasis, babesiosis, and toxoplasmosis. The other group includes extracellular pathogens such as agents of giardiasis and amebiasis. An unfortunate unifying theme for most human protozoan pathogens is that highly effective treatments for them are generally lacking. We will review targeting protozoan mitogen-activated protein kinases (MAPKs as a novel drug discovery approach towards developing better therapies, focusing on Plasmodia, Leishmania, and Toxoplasma, about which the most is known.

  16. Validation and characterization of a human volunteer challenge model for cholera by using frozen bacteria of the new Vibrio cholerae epidemic serotype, O139

    NARCIS (Netherlands)

    Cohen, MB; Giannella, RA; Losonsky, GA; Lang, DR; Parker, S; Hawkins, JA; Gunther, C; Schiff, GA

    1999-01-01

    Until recently, all epidemic strains of Vibrio cholerae were of the O1 serotype. Current epidemics have also been caused by a new serotype, Vibrio cholerae O139. Although the pathogenesis and clinical features of O139 cholera are similar to those of O1 cholera, immunity to serotype O1 does not

  17. The Out-of-the-Delta Hypothesis: dense human populations in low-lying river deltas served as agents for the evolution of a deadly pathogen

    Directory of Open Access Journals (Sweden)

    Yan eBoucher

    2015-10-01

    Full Text Available Cholera is a diarrheal disease that has changed the history of mankind, devastating the world with seven pandemics from 1817 to the present day. Although there is little doubt in the causative agent of these pandemics being Vibrio cholerae of the O1 serogroup, where, when, and how this pathogen emerged is not well understood. V. cholerae is a ubiquitous coastal species that likely existed for tens of thousands of years. However, the evolution of a strain capable of causing a large-scale epidemic is likely more recent historically. Here, we propose that the unique human and physical geography of low-lying river deltas made it possible for an environmental bacterium to evolve into a deadly human pathogen. Such areas are often densely populated and salt intrusion in drinking water frequent. As V. cholerae is most abundant in brackish water, its favored environment, it is likely that coastal inhabitants would regularly ingest the bacterium and release it back in the environment. This creates a continuous selection pressure for V. cholerae to adapt to life in the human gut.

  18. The mosaic accessory gene structures of the SXT/R391-like integrative and conjugative elements derived from Vibrio spp. isolated from aquatic products and environment in the Yangtze River Estuary, China.

    Science.gov (United States)

    Song, Yuze; Yu, Pan; Li, Bailin; Pan, Yingjie; Zhang, Xiaojun; Cong, Jian; Zhao, Yinying; Wang, Hua; Chen, Lanming

    2013-09-30

    The emergence, resurgence and spread of human food-borne pathogenic Vibrios are one of the major contributors to disease burden and mortality particularly in developing countries with disputable sanitary conditions. Previous research on pathogenic Vibrio cholerae and Vibrio parahaemolitycus derived from clinical samples has proposed links between acquisition of virulence and multiple drug resistance traits and intercellular transmissibility of mobile genetic elements in the environment. To date, very few information is available on environmental Vibrio isolates. In this study, we characterized eleven Vibrio strains bearing the SXT/R391-like integrative and conjugative elements (ICEs) derived from aquatic products and environment in the Yangtze River Estuary, China. The eleven Vibrio strains were isolated in 2010 to 2011, and taxonomically identified, which included six Vibrio cholerae, three Vibrio parahaemolyticus, one Vibrio alginolyticus and one Vibrio natriegens. Most of the strains displayed strong resistance phenotypes to ampicillin, mercury and chromium. The majority of their ICEs, which belong to S and R exclusion system groups, contain ICEs-chromosome junction sequences and highly conserved core-genes required for ICE transfer. However, comparative sequence analysis uncovered interesting diversity in their mosaic accessory gene structures, which carry many novel genes that have not been described in any known ICEs to date. In addition, antibiotic resistance was transmitted by ICEVchChn6 and ICEVpaChn1 from V. cholerae, V. parahaemolyticus to E. coli MG1655 via conjugation, respectively. Our data also revealed that the ICEs characterized in this study are phylogenetically distant from most of the SXT/R391 ICEs reported previously, which may represent a novel cluster likely shaped by the ecological environment in the Yangtze River Estuary, China. This study constitutes the first investigation of ICEs-positive Vibrio spp. in the Yangze River Estuary, China

  19. The mosaic accessory gene structures of the SXT/R391-like integrative and conjugative elements derived from Vibrio spp. isolated from aquatic products and environment in the Yangtze River estuary, China

    Science.gov (United States)

    2013-01-01

    Background The emergence, resurgence and spread of human food-borne pathogenic Vibrios are one of the major contributors to disease burden and mortality particularly in developing countries with disputable sanitary conditions. Previous research on pathogenic Vibrio cholerae and Vibrio parahaemolitycus derived from clinical samples has proposed links between acquisition of virulence and multiple drug resistance traits and intercellular transmissibility of mobile genetic elements in the environment. To date, very few information is available on environmental Vibrio isolates. In this study, we characterized eleven Vibrio strains bearing the SXT/R391-like integrative and conjugative elements (ICEs) derived from aquatic products and environment in the Yangtze River Estuary, China. Results The eleven Vibrio strains were isolated in 2010 to 2011, and taxonomically identified, which included six Vibrio cholerae, three Vibrio parahaemolyticus, one Vibrio alginolyticus and one Vibrio natriegens. Most of the strains displayed strong resistance phenotypes to ampicillin, mercury and chromium. The majority of their ICEs, which belong to S and R exclusion system groups, contain ICEs-chromosome junction sequences and highly conserved core-genes required for ICE transfer. However, comparative sequence analysis uncovered interesting diversity in their mosaic accessory gene structures, which carry many novel genes that have not been described in any known ICEs to date. In addition, antibiotic resistance was transmitted by ICEVchChn6 and ICEVpaChn1 from V. cholerae, V. parahaemolyticus to E. coli MG1655 via conjugation, respectively. Our data also revealed that the ICEs characterized in this study are phylogenetically distant from most of the SXT/R391 ICEs reported previously, which may represent a novel cluster likely shaped by the ecological environment in the Yangtze River Estuary, China. Conclusions This study constitutes the first investigation of ICEs-positive Vibrio spp. in the

  20. The human-bacterial pathogen protein interaction networks of Bacillus anthracis, Francisella tularensis, and Yersinia pestis.

    Directory of Open Access Journals (Sweden)

    Matthew D Dyer

    2010-08-01

    Full Text Available Bacillus anthracis, Francisella tularensis, and Yersinia pestis are bacterial pathogens that can cause anthrax, lethal acute pneumonic disease, and bubonic plague, respectively, and are listed as NIAID Category A priority pathogens for possible use as biological weapons. However, the interactions between human proteins and proteins in these bacteria remain poorly characterized leading to an incomplete understanding of their pathogenesis and mechanisms of immune evasion.In this study, we used a high-throughput yeast two-hybrid assay to identify physical interactions between human proteins and proteins from each of these three pathogens. From more than 250,000 screens performed, we identified 3,073 human-B. anthracis, 1,383 human-F. tularensis, and 4,059 human-Y. pestis protein-protein interactions including interactions involving 304 B. anthracis, 52 F. tularensis, and 330 Y. pestis proteins that are uncharacterized. Computational analysis revealed that pathogen proteins preferentially interact with human proteins that are hubs and bottlenecks in the human PPI network. In addition, we computed modules of human-pathogen PPIs that are conserved amongst the three networks. Functionally, such conserved modules reveal commonalities between how the different pathogens interact with crucial host pathways involved in inflammation and immunity.These data constitute the first extensive protein interaction networks constructed for bacterial pathogens and their human hosts. This study provides novel insights into host-pathogen interactions.

  1. Salmonella, a cross-kingdom pathogen infecting humans and plants.

    Science.gov (United States)

    Hernández-Reyes, Casandra; Schikora, Adam

    2013-06-01

    Infections with non-typhoidal Salmonella strains are constant and are a non-negligible threat to the human population. In the last two decades, salmonellosis outbreaks have increasingly been associated with infected fruits and vegetables. For a long time, Salmonellae were assumed to survive on plants after a more or less accidental infection. However, this notion has recently been challenged. Studies on the infection mechanism in vegetal hosts, as well as on plant immune systems, revealed an active infection process resembling in certain features the infection in animals. On one hand, Salmonella requires the type III secretion systems to effectively infect plants and to suppress their resistance mechanisms. On the other hand, plants recognize these bacteria and react to the infection with an induced defense mechanism similar to the reaction to other plant pathogens. In this review, we present the newest reports on the interaction between Salmonellae and plants. We discuss the possible ways used by these bacteria to infect plants as well as the plant responses to the infection. The recent findings indicate that plants play a central role in the dissemination of Salmonella within the ecosystem. © 2013 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  2. Structural genomics studies of human caries pathogen Streptococcus mutans.

    Science.gov (United States)

    Li, Lanfen; Nan, Jie; Li, Dan; Brostromer, Erik; Wang, Zixi; Liu, Cong; Hou, Qiaoming; Fan, Xuexin; Ye, Zhaoyang; Su, Xiao-Dong

    2014-09-01

    Gram-positive bacterium Streptococcus mutans is the primary causative agent of human dental caries. To better understand this pathogen at the atomic structure level and to establish potential drug and vaccine targets, we have carried out structural genomics research since 2005. To achieve the goal, we have developed various in-house automation systems including novel high-throughput crystallization equipment and methods, based on which a large-scale, high-efficiency and low-cost platform has been establish in our laboratory. From a total of 1,963 annotated open reading frames, 1,391 non-membrane targets were selected prioritized by protein sequence similarities to unknown structures, and clustered by restriction sites to allow for cost-effective high-throughput conventional cloning. Selected proteins were over-expressed in different strains of Escherichia coli. Clones expressed soluble proteins were selected, expanded, and expressed proteins were purified and subjected to crystallization trials. Finally, protein crystals were subjected to X-ray analysis and structures were determined by crystallographic methods. Using the previously established procedures, we have so far obtained more than 200 kinds of protein crystals and 100 kinds of crystal structures involved in different biological pathways. In this paper we demonstrate and review a possibility of performing structural genomics studies at moderate laboratory scale. Furthermore, the techniques and methods developed in our study can be widely applied to conventional structural biology research practice.

  3. MFS transportome of the human pathogenic yeast Candida albicans.

    Science.gov (United States)

    Gaur, Manisha; Puri, Nidhi; Manoharlal, Raman; Rai, Versha; Mukhopadhayay, Gauranga; Choudhury, Devapriya; Prasad, Rajendra

    2008-12-03

    The major facilitator superfamily (MFS) is one of the two largest superfamilies of membrane transporters present ubiquitously in bacteria, archaea, and eukarya and includes members that function as uniporters, symporters or antiporters. We report here the complete transportome of MFS proteins of a human pathogenic yeast Candida albicans. Computational analysis of C. albicans genome enabled us to identify 95 potential MFS proteins which clustered into 17 families using Saier's Transport Commission (TC) system. Among these SP, DHA1, DHA2 and ACS represented major families consisting of 22, 22, 9 and 16 members, respectively. Family designations in C. albicans were validated by subjecting Saccharomyces cerevisiae genome to TC system. Based on the published available genomics/proteomics data, 87 of the putative MFS genes of C. albicans were found to express either at mRNA or protein levels. We checked the expression of the remaining 8 genes by using RT-PCR and observed that they are not expressed under basal growth conditions implying that either these 8 genes are expressed under specific growth conditions or they may be candidates for pseudogenes. The in silico characterisation of MFS transporters in Candida albicans genome revealed a large complement of MFS transporters with most of them showing expression. Considering the clinical relevance of C. albicans and role of MFS members in antifungal resistance and nutrient transport, this analysis would pave way for identifying their physiological relevance.

  4. The Global Acetylome of the Human Pathogen Vibrio cholerae V52 Reveals Lysine Acetylation of Major Transcriptional Regulators

    DEFF Research Database (Denmark)

    Jers, Carsten; Ravikumar, Vaishnavi; Lezyk, Mateusz Jakub

    2018-01-01

    involved in metabolic and cellular processes and there was an over-representation of acetylated proteins involved in protein synthesis. Of interest, we demonstrated that many global transcription factors such as CRP, H-NS, IHF, Lrp and RpoN as well as transcription factors AphB, TcpP, and PhoB involved......Protein lysine acetylation is recognized as an important reversible post translational modification in all domains of life. While its primary roles appear to reside in metabolic processes, lysine acetylation has also been implicated in regulating pathogenesis in bacteria. Several global lysine...... of immuno-enrichment of acetylated peptides and high resolution mass spectrometry, we identified 3,402 acetylation sites on 1,240 proteins. Of the acetylated proteins, more than half were acetylated on two or more sites. As reported for other bacteria, we observed that many of the acetylated proteins were...

  5. Insights into Vibrio parahaemolyticus CHN25 Response to Artificial Gastric Fluid Stress by Transcriptomic Analysis

    Directory of Open Access Journals (Sweden)

    Xuejiao Sun

    2014-12-01

    Full Text Available Vibrio parahaemolyticus is the causative agent of food-borne gastroenteritis disease. Once consumed, human acid gastric fluid is perhaps one of the most important environmental stresses imposed on the bacterium. Herein, for the first time, we investigated Vibrio parahaemolyticus CHN25 response to artificial gastric fluid (AGF stress by transcriptomic analysis. The bacterium at logarithmic growth phase (LGP displayed lower survival rates than that at stationary growth phase (SGP under a sub-lethal acid condition (pH 4.9. Transcriptome data revealed that 11.6% of the expressed genes in Vibrio parahaemolyticus CHN25 was up-regulated in LGP cells after exposed to AGF (pH 4.9 for 30 min, including those involved in sugar transport, nitrogen metabolism, energy production and protein biosynthesis, whereas 14.0% of the genes was down-regulated, such as ATP-binding cassette (ABC transporter and flagellar biosynthesis genes. In contrast, the AGF stress only elicited 3.4% of the genes from SGP cells, the majority of which were attenuated in expression. Moreover, the number of expressed regulator genes was also substantially reduced in SGP cells. Comparison of transcriptome profiles further revealed forty-one growth-phase independent genes in the AGF stress, however, half of which displayed distinct expression features between the two growth phases. Vibrio parahaemolyticus seemed to have evolved a number of molecular strategies for coping with the acid stress. The data here will facilitate future studies for environmental stresses and pathogenicity of the leading seafood-borne pathogen worldwide.

  6. The rhizosphere microbiome: significance of plant beneficial, plant pathogenic and human pathogenic microorganisms

    NARCIS (Netherlands)

    Mendes, R.; Garbeva, P.; Raaijmakers, J.M.

    2013-01-01

    Microbial communities play a pivotal role in the functioning of plants by influencing their physiology and development. While many members of the rhizosphere microbiome are beneficial to plant growth, also plant pathogenic microorganisms colonize the rhizosphere striving to break through the

  7. The rhizosphere microbiome: significance of plant beneficial, plant pathogenic, and human pathogenic microorganisms

    NARCIS (Netherlands)

    Mendes, R.; Garbeva, P.V.; Raaijmakers, J.M.

    2013-01-01

    Microbial communities play a pivotal role in the functioning of plants by influencing their physiology and development. While many members of the rhizosphere microbiome are beneficial to plant growth, also plant pathogenic microorganisms colonize the rhizosphere striving to break through the

  8. Characterization of the interaction between the human pathogen Listeria monocytogenes and the model host C. elegans

    DEFF Research Database (Denmark)

    Simonsen, Karina Trankjær; Nielsen, Jesper Sejrup; Thomsen, Line E.

    . In addition, C. elegans is a promising model for the identification of novel virulence factors in various pathogens. A large number of human, animal, plant and insect pathogens have been shown to kill the worm, when C. elegans was allowed to feed on pathogens in stead of its normal laboratory diet [1......, which has been shown to kill C. elegans through the production of a toxic secondary metabolite [3] and Staphylococcus aureus, which establishes a persistent infection in the gut of the worm, leading to its death [4].   Recently, the facultative intracellular human pathogen Listeria monocytogenes has...

  9. Pathogen Transmission from Humans to Great Apes is a Growing Threat to Primate Conservation.

    Science.gov (United States)

    Dunay, Emily; Apakupakul, Kathleen; Leard, Stephen; Palmer, Jamie L; Deem, Sharon L

    2018-01-23

    All six great ape species are listed as endangered or critically endangered by the IUCN and experiencing decreasing population trends. One of the threats to these non-human primates is the transmission of pathogens from humans. We conducted a literature review on occurrences of pathogen transmission from humans to great apes to highlight this often underappreciated issue. In total, we found 33 individual occurrences of probable or confirmed pathogen transmission from humans to great apes: 23 involved both pathogen and disease transmission, 7 pathogen transmission only, 2 positive antibody titers to zoonotic pathogens, and 1 pathogen transmission with probable disease. Great ape populations were categorized into captive, semi-free-living, and free-living conditions. The majority of occurrences involved chimpanzees (Pan troglodytes) (n = 23) or mountain gorillas (Gorilla beringei beringei) (n = 8). These findings have implications for conservation efforts and management of endangered great ape populations. Future efforts should focus on monitoring and addressing zoonotic pathogen and disease transmission between humans, great ape species, and other taxa to ensure the health of humans, wild and domestic animals, and the ecosystems we share.

  10. Antagonistic activity of antibiotic producing Streptomyces sp. against fish and human pathogenic bacteria

    Directory of Open Access Journals (Sweden)

    Nazmul Hossain

    2014-04-01

    Full Text Available In this study, attempts were made to isolate Streptomyces sp. from soil samples of two different regions of Bangladesh and evaluate their antagonistic activity against fish and human pathogenic bacteria. A total of 10 isolates were identified as Streptomyces sp. based on several morphological, physiological and biochemical tests. Cross streak method was used to observe the antagonistic activity of the Streptomyces sp. isolates against different fish pathogens belonging to the genus Aeromonas, Pseudomonas and Edwardsiella and human clinical isolates belonging to the genus Klebsiella, Salmonella and Streptococcus. Seven Streptomyces sp. isolates showed antagonism against both fish and human pathogenic bacteria. Four isolates viz., N24, N26, N28 and N47 showed broad spectrum of antagonistic activity (80-100% against all genera of fish and human pathogenic bacteria. The isolate N49 exhibited highest spectrum of antagonism against all fish pathogens (90-100% but comparatively lower degree of antagonism against human pathogens (50-60%. Rest of the two isolates (N21 and N23 showed variability in their antagonism. Results showed that broad spectrum antibiotic(s could be developed from the isolates N24, N26, N28 and N47against several human and fish pathogens. The isolate N49 could be a potential source of antibiotic, especially for fish pathogenic bacteria.

  11. Human mobility networks and persistence of rapidly mutating pathogens

    CERN Document Server

    Aleta, Alberto; Meloni, Sandro; Poletto, Chiara; Colizza, Vittoria; Moreno, Yamir

    2016-01-01

    Rapidly mutating pathogens may be able to persist in the population and reach an endemic equilibrium by escaping hosts' acquired immunity. For such diseases, multiple biological, environmental and population-level mechanisms determine the dynamics of the outbreak, including pathogen's epidemiological traits (e.g. transmissibility, infectious period and duration of immunity), seasonality, interaction with other circulating strains and hosts' mixing and spatial fragmentation. Here, we study a susceptible-infected-recovered-susceptible model on a metapopulation where individuals are distributed in subpopulations connected via a network of mobility flows. Through extensive numerical simulations, we explore the phase space of pathogen's persistence and map the dynamical regimes of the pathogen following emergence. Our results show that spatial fragmentation and mobility play a key role in the persistence of the disease whose maximum is reached at intermediate mobility values. We describe the occurrence of differen...

  12. The pathogenesis, detection and prevention of Vibrio parahaemolyticus

    Directory of Open Access Journals (Sweden)

    Rongzhi eWang

    2015-03-01

    Full Text Available Vibrio parahaemolyticus, a Gram-negative motile bacterium that inhabits marine and estuarine environments throughout the world, is a major food-borne pathogen that causes life-threatening diseases in humans after the consumption of raw or undercooked seafood. The global occurrence of V. parahaemaolyticus accentuates the importance of investigating its virulence factors and their effects on the human host. This review describes the virulence factors of V. parahaemolyticus reported to date, including hemolysin, urease, two type III secretion systems (T3SS and two type VI secretion systems (T6SS, which both cause both cytotoxicity in cultured cells and enterotoxicity in animal models. We describe various types of detection methods, based on virulence factors, that are used for quantitative detection of V. parahaemolyticus in seafood. We also discuss some useful preventive measures and therapeutic strategies for the diseases mediated by V. parahaemolyticus, which can reduce, to some extent, the damage to humans and aquatic animals attributable to V. parahaemolyticus. This review extends our understanding of the pathogenic mechanisms of V. parahaemolyticus mediated by virulence factors and the diseases it causes in its human host. It should provide new insights for the diagnosis, treatment, and prevention of V. parahaemolyticus infection.

  13. Genome sequence of vibrio cholerae G4222, a South African clinical isolate

    CSIR Research Space (South Africa)

    Le Rouw, Wouter J

    2013-03-01

    Full Text Available Vibrio cholerae, a Gram-negative pathogen autochthonous to the aquatic environment, is the causative agent of cholera. Here, we report the complete genome sequence of V. cholerae G4222, a clinical isolate from South Africa....

  14. Comparative assessment of Vibrio virulence in marine fish larvae

    DEFF Research Database (Denmark)

    Rønneseth, A.; Castillo, D.; D'Alvise, Paul

    2017-01-01

    Vibrionaceae infections are a major obstacle for marine larviculture; however, little is known about virulence differences of Vibrio strains. The virulence of Vibrio strains, mostly isolated from vibriosis outbreaks in farmed fish, was tested in larval challenge trials with cod (Gadus morhua...... effects on survival. Some Vibrio strains were pathogenic in all of the larva species, while some caused disease only in one of the species. Twenty-nine of the Vibrio anguillarum strains increased the mortality of larvae from at least one fish species; however, pathogenicity of the strains differed...... markedly. Other Vibrio species had no or less pronounced effects on larval mortalities. Iron uptake has been related to V. anguillarum virulence; however, the presence or absence of the plasmid pJM1 encoding anguibactin did not correlate with virulence. The genomes of V. anguillarum were compared (D...

  15. Image-based Analysis to Study Plant Infection with Human Pathogens

    OpenAIRE

    Schikora, Marek; Schikora, Adam

    2014-01-01

    Our growing awareness that contaminated plants, fresh fruits and vegetables are responsible for a significant proportion of food poisoning with pathogenic microorganisms indorses the demand to understand the interactions between plants and human pathogens. Today we understand that those pathogens do not merely survive on or within plants, they actively infect plant organisms by suppressing their immune system. Studies on the infection process and disease development used mainly physiological,...

  16. The Food Production Environment and the Development of Antimicrobial Resistance in Human Pathogens of Animal Origin

    OpenAIRE

    Lekshmi, Manjusha; Ammini, Parvathi; Kumar, Sanath; Varela, Manuel F.

    2017-01-01

    Food-borne pathogens are a serious human health concern worldwide, and the emergence of antibiotic-resistant food pathogens has further confounded this problem. Once-highly-efficacious antibiotics are gradually becoming ineffective against many important pathogens, resulting in severe treatment crises. Among several reasons for the development and spread of antimicrobial resistance, their overuse in animal food production systems for purposes other than treatment of infections is prominent. M...

  17. The arable plant ecosystem as battleground for emergence of human pathogens

    Directory of Open Access Journals (Sweden)

    Leo eVan Overbeek

    2014-03-01

    Full Text Available Disease incidences related to Escherichia coli and Salmonella enterica infections by consumption of (fresh vegetables, sprouts and occasionally fruits made clear that these pathogens are not only transmitted to humans via the ‘classical’ routes of meat, eggs and dairy products, but also can be transmitted to humans via plants or products derived from plants. Nowadays, it is of major concern that these human pathogens, especially the ones belonging to the taxonomical family of Enterobacteriaceae, become adapted to environmental habitats without losing their virulence to humans. Adaptation to the plant environment would lead to longer persistence in plants, increasing their chances on transmission to humans via consumption of plant-derived food. One of the mechanisms of adaptation to the plant environment in human pathogens, proposed in this paper, is horizontal transfer of genes from different microbial communities present in the arable ecosystem, like the ones originating from soil, animal digestive track systems (manure, water and plants themselves. Genes that would confer better adaptation to the phytosphere might be genes involved in plant colonization, stress resistance and nutrient acquisition and utilization. Because human pathogenic enterics often were prone to genetic exchanges via phages and conjugative plasmids, it was postulated that these genetic elements may be hold key responsible for horizontal gene transfers between human pathogens and indigenous microbes in agroproduction systems. In analogy to zoonosis, we coin the term phytonosis for a human pathogen that is transmitted via plants and not exclusively via animals.

  18. Human mobility networks and persistence of rapidly mutating pathogens.

    Science.gov (United States)

    Aleta, Alberto; Hisi, Andreia N S; Meloni, Sandro; Poletto, Chiara; Colizza, Vittoria; Moreno, Yamir

    2017-03-01

    Rapidly mutating pathogens may be able to persist in the population and reach an endemic equilibrium by escaping hosts' acquired immunity. For such diseases, multiple biological, environmental and population-level mechanisms determine the dynamics of the outbreak, including pathogen's epidemiological traits (e.g. transmissibility, infectious period and duration of immunity), seasonality, interaction with other circulating strains and hosts' mixing and spatial fragmentation. Here, we study a susceptible-infected-recovered-susceptible model on a metapopulation where individuals are distributed in sub-populations connected via a network of mobility flows. Through extensive numerical simulations, we explore the phase space of pathogen's persistence and map the dynamical regimes of the pathogen following emergence. Our results show that spatial fragmentation and mobility play a key role in the persistence of the disease whose maximum is reached at intermediate mobility values. We describe the occurrence of different phenomena including local extinction and emergence of epidemic waves, and assess the conditions for large-scale spreading. Findings are highlighted in reference to previous studies and to real scenarios. Our work uncovers the crucial role of hosts' mobility on the ecological dynamics of rapidly mutating pathogens, opening the path for further studies on disease ecology in the presence of a complex and heterogeneous environment.

  19. [Genomic variability of vibrio cholerae El Tor biovariant strains].

    Science.gov (United States)

    Smirnova, N I; Kostromitina, E A; Osin, A V; Kutyrev, V V

    2005-01-01

    The authors performed comparative analysis of the genomes of 145 clinical and environmental isolates of Vibrio cholerae El Tor biovariants using single locus and multiplex PCR. The study found that clinical strains isolated from patients with cholera formed a genetically homogenous group, where bacterial chromosome contained all the tested virulence genes, situated on mobile genetic elements that had been acquired by the pathogen at various stages of its evolution. Strains isolated from water ecosystems during interepidemic period were heterogeneous and formed three groups: a small number of virulent strains; non-toxigenic vibrio strains that, in the process of reductional variation in their new econiche, had only managed to maintain individual virulence genes; non-pathogenic "water" vibrios, whose chromosome contained only the genes from its core part, mobile genetic elements being optionally represented only by the persistence island. Molecular typing established genetic relations among V. cholerae strains under study.

  20. Genomic taxonomy of vibrios

    DEFF Research Database (Denmark)

    Thompson, Cristiane C.; Vicente, Ana Carolina P.; Souza, Rangel C.

    2009-01-01

    BACKGROUND: Vibrio taxonomy has been based on a polyphasic approach. In this study, we retrieve useful taxonomic information (i.e. data that can be used to distinguish different taxonomic levels, such as species and genera) from 32 genome sequences of different vibrio species. We use a variety...... analytical and bioinformatics tools will enable the most accurate species identification through genomic computational analysis. This endeavour will culminate in the birth of the online genomic taxonomy whereby researchers and end-users of taxonomy will be able to identify their isolates through a web...

  1. Genomic taxonomy of vibrios

    Directory of Open Access Journals (Sweden)

    Iida Tetsuya

    2009-10-01

    Full Text Available Abstract Background Vibrio taxonomy has been based on a polyphasic approach. In this study, we retrieve useful taxonomic information (i.e. data that can be used to distinguish different taxonomic levels, such as species and genera from 32 genome sequences of different vibrio species. We use a variety of tools to explore the taxonomic relationship between the sequenced genomes, including Multilocus Sequence Analysis (MLSA, supertrees, Average Amino Acid Identity (AAI, genomic signatures, and Genome BLAST atlases. Our aim is to analyse the usefulness of these tools for species identification in vibrios. Results We have generated four new genome sequences of three Vibrio species, i.e., V. alginolyticus 40B, V. harveyi-like 1DA3, and V. mimicus strains VM573 and VM603, and present a broad analyses of these genomes along with other sequenced Vibrio species. The genome atlas and pangenome plots provide a tantalizing image of the genomic differences that occur between closely related sister species, e.g. V. cholerae and V. mimicus. The vibrio pangenome contains around 26504 genes. The V. cholerae core genome and pangenome consist of 1520 and 6923 genes, respectively. Pangenomes might allow different strains of V. cholerae to occupy different niches. MLSA and supertree analyses resulted in a similar phylogenetic picture, with a clear distinction of four groups (Vibrio core group, V. cholerae-V. mimicus, Aliivibrio spp., and Photobacterium spp.. A Vibrio species is defined as a group of strains that share > 95% DNA identity in MLSA and supertree analysis, > 96% AAI, ≤ 10 genome signature dissimilarity, and > 61% proteome identity. Strains of the same species and species of the same genus will form monophyletic groups on the basis of MLSA and supertree. Conclusion The combination of different analytical and bioinformatics tools will enable the most accurate species identification through genomic computational analysis. This endeavour will culminate in

  2. Serotypes of Vibrio cholerae Non-O1 Isolated from Water Supplies for Human Consumption in Campeche, México and their Antibiotic Susceptibility Pattern

    Directory of Open Access Journals (Sweden)

    Isaac-Márquez Angélica P

    1998-01-01

    Full Text Available The presence of Vibrio cholerae non-O1 in water supplies for human consumption in the city of Campeche and rural locality of Bécal was investigated. V. cholerae non-O1 was detected in 5.9% of the samples obtained in deep pools of Campeche. Studies conducted in Bécal and neighbourhood of Morelos in Campeche indicated that collected samples harbored V. cholerae non-O1 in 31.5% and 8.7% respectively. There was a particular pattern of distribution of V. cholerae non-O1 serotypes among different studied regions. Accordingly, V. cholerae non-O1 serotype O14 predominated in the deep pools of Campeche and together with V. cholerae non-O1, O155 were preferentially founds in samples taken from intradomiciliary faucets in the neighbourhood of Morelos. Samples from Bécal predominantly presented the serotype O112. 60% and 53.8% of all studied strains of V. cholerae non-O1 proved to be resistant to ampicillin and carbenicillin. 3.1%, 7.7% and 6.2% presented resistant to doxycycline, trimethoprim-sulfamethoxazole and erythromycin respectively. The study showed the necessity of performing a strong epidemiologic surveillance for emergence and distribution of V. cholerae non-O1

  3. Cold plasma inactivation of human pathogens on foods and regulatory status update

    Science.gov (United States)

    Contamination of foods with human pathogens such as Salmonella, Listeria monocytogenes, Escherichia coli O157:H7, norovirus, and other pathogens is an ongoing challenge for growers and processors. In recent years, cold plasma has emerged as a promising antimicrobial treatment for fresh and fresh-cut...

  4. Effects of ambient exposure, refrigeration, and icing on Vibrio vulnificus and Vibrio parahaemolyticus abundances in oysters.

    Science.gov (United States)

    Jones, J L; Lydon, K A; Kinsey, T P; Friedman, B; Curtis, M; Schuster, R; Bowers, J C

    2017-07-17

    Vibrio vulnificus (Vv) and V. parahaemolyticus (Vp) illnesses are typically acquired through the consumption of raw molluscan shellfish, particularly oysters. As Vibrio spp. are naturally-occurring bacteria, one means of mitigation of illness is achieved by limiting post-harvest growth. In this study, effects of ambient air storage, refrigeration, and icing of oysters on Vibrio spp. abundances were examined at two sites in Alabama (AL) [Dog River (DR) and Cedar Point (CP)] and one site in Delaware Bay, New Jersey (NJ). As the United States shellfish program recommendations include testing for total these organisms and gene targets, Vv and total (tlh) and pathogenic (tdh+ and trh+) Vp were enumerated from samples using MPN-real-time-PCR approaches. Mean Vv and Vp abundances in oysters from AL-DR were lowest in immediately iced samples (2.3 and -0.1 log MPN/g, respectively) and highest in the 5h ambient then refrigerated samples (3.4 and 0.5 log MPN/g, respectively). Similarly, in AL-CP Vv and Vp mean levels in oysters were lowest in immediately iced samples (3.6 and 1.2 log MPN/g, respectively) and highest in 5h ambient then refrigerated samples (5.1 and 3.2 log MPN/g, respectively). Mean levels of pathogenic Vp from AL sites were frequently below the limit of detection (ice resulted in lower Vibrio spp. levels in oysters, compared to those that were refrigerated post-harvest. These results suggest vibriosis risk can be mitigated by shorter storage times and more rapid cooling of oysters, providing data regulatory authorities can use to evaluate Vibrio spp. control plans. Published by Elsevier B.V.

  5. Abundance and antibiotic susceptibility of Vibrio spp. isolated from microplastics

    Science.gov (United States)

    Laverty, A. L.; Darr, K.; Dobbs, F. C.

    2016-02-01

    In recent years, there has been a growing concern for `microplastics' (particles resistance profiles of Vibrio spp. found on them. We collected 22 microplastic pieces, paired seawater samples, and from them cultured 44 putative Vibrio spp. isolates, 18 of which were PCR-confirmed as V. parahaemolyticus and 3 as V. vulnificus. There were no PCR-confirmed V. cholerae isolates. We used the Kirby-Bauer disk diffusion susceptibility test to examine the isolates' response to six antibiotics: chloramphenicol (30μg), gentamicin (10μg), ampicillin (10μg), streptomycin (10μg), tetracycline (30μg), and rifampin (5μg). Vibrio isolates were susceptible to three or more of the six antibiotics tested and all were susceptible to tetracycline and chloramphenicol. There were no apparent differences between the antibiotic susceptibilities of vibrios isolated from microplastics compared to those from the water column. In every instance tested, vibrios on microplastics were enriched by at least two orders of magnitude compared to those from paired seawater samples. This study demonstrates that microplastic particles serve as a habitat for Vibrio species, in particular V. vulnificus and V. parahaemolyticus, confirming the conjecture of Zettler et al. (2013) that plastics may serve as a vector for these and other potentially pathogenic bacteria.

  6. Emerging Seafood Preservation Techniques to Extend Freshness and Minimize Vibrio Contamination

    Directory of Open Access Journals (Sweden)

    Jennifer eRonholm

    2016-03-01

    Full Text Available Globally, the popularity of seafood consumption is increasing exponentially. To meet the demands of a growing market, the seafood industry has increasingly been innovating ways keep their products fresh and safe while increasing production. Marine environments harbour several species of indigenous microorganisms, some of which, including Vibrio spp., may be harmful to humans, and all of which are part of the natural microbiota of the seafood. After harvest, seafood products are then often shipped over large geographic distances, sometimes for prolonged periods, during which the food must stay fresh and pathogen proliferation must be minimized. Upon arrival there is often a strong desire, arising from both culinary and nutritional considerations, to consume seafood products raw, or minimally cooked. This supply chain and the popular preferences have increased challenges for the seafood industry. This has resulted in a desire to develop methodologies that reduce pathogenic and spoilage organisms in seafood items to comply with regulations and result in minimal changes to the taste, texture, and nutritional content of the final product. This mini-review discusses and compares several emerging technologies, such as treatment with plant derived natural compounds, phage lysis, high-pressure processing, and irradiation for their ability to control pathogenic vibrios, limit the growth of spoilage organisms, and keep the desired organoleptic properties of the seafood product intact.

  7. Antimicrobial resistance in human and animal pathogens in Zambia, Democratic Republic of Congo, Mozambique and Tanzania: an urgent need of a sustainable surveillance system

    Science.gov (United States)

    2013-01-01

    A review of the published and unpublished literature on bacterial resistance in human and animals was performed. Sixty-eight articles/reports from the Democratic Republic of Congo (DRC), Mozambique, Tanzania and Zambia were reviewed. The majority of these articles were from Tanzania. There is an increasing trend in the incidence of antibiotic resistance; of major concern is the increase in multidrug- resistant Escherichia coli, Klebsiella pneumoniae, Staphylococcus aureus, Vibrio cholera, non-typhoid Salmonella and other pathogens responsible for nosocomial infections. The increase in methicillin- resistant Staphylococcus aureus and extended-spectrum beta-lactamase (ESBL) producers in the countries under review confirms the spread of these clones worldwide. Clinical microbiology services in these countries need to be strengthened in order to allow a coordinated surveillance for antimicrobial resistance and provide data for local treatment guidelines and for national policies to control antimicrobial resistance. While the present study does not provide conclusive evidence to associate the increasing trend in antibiotic resistance in humans with the use of antibiotics in animals, either as feed additives or veterinary prescription, we strongly recommend a one-health approach of systematic surveillance across the public and animal health sectors, as well as the adherence to the FAO (Food and Agriculture Organization)-OIE (World Organization of animal Health) –WHO(World Health Organization) recommendations for non-human antimicrobial usage. PMID:24119299

  8. Identification of some human pathogenic fungi using four DNA ...

    African Journals Online (AJOL)

    Stocks from pathogenic fungi isolated from infected areas on different patients, around Lagos-Nigeria were analysed using molecular methods (DNA extraction, PCR-RFLP and DNA sequencing). Four DNA extraction protocols were employed in the identification of the fungal isolates. Sixteen different fungal isolates were ...

  9. Different pathogenic stimuli induce specific metabolic rewiring in human monocytes

    NARCIS (Netherlands)

    Lachmandas, Ekta; Boutens, Lily; Ratter, Jacqueline; Hijmans, Anneke; Hooiveld, Guido; Crevel, van Reinout; Netea, Mihai; Stienstra, Rinke

    2016-01-01

    Recent studies have demonstrated that upon encountering a pathogenic stimulus, robust metabolic rewiring of immune cells occurs. A switch away from oxidative phosphorylation to glycolysis, even in the presence of sufficient amounts of oxygen (akin the Warburg effect), is typically observed in

  10. Abundance of sewage-pollution indicator and human pathogenic bacteria in a tropical estuarine complex

    Digital Repository Service at National Institute of Oceanography (India)

    Nagvenkar, G.S.; Ramaiah

    Studies on abundance and types of various pollution indicator bacterial populations from tropical estuaries are rare. This study was aimed to estimate current levels of pollution indicator as well as many groups of human pathogenic bacteria...

  11. Vibrio Cholerae 01 Infections In Jos, Nigeria | Opajobi | African ...

    African Journals Online (AJOL)

    A study to determine the prevalence of Vibrio cholerae 01 in stool sample submitted for routine examination of enteric pathogens, as well as identify the serotypes and antibiogram of the isolates to commonly used antibiotics was undertaken. The survey involved the examination of 774 (763 stool and 11 rectal swabs) ...

  12. Impacts of climate change on indirect human exposure to pathogens and chemicals from agriculture.

    Science.gov (United States)

    Boxall, Alistair; Hardy, Anthony; Beulke, Sabine; Boucard, Tatiana; Burgin, Laura; Falloon, Peter; Haygarth, Philip; Hutchinson, Thomas; Kovats, Sari; Leonardi, Giovanni; Levy, Leonard; Nichols, Gordon; Parsons, Simon; Potts, Laura; Stone, David; Topp, Edward; Turley, David; Walsh, Kerry; Wellington, Elizabeth; Williams, Richard

    2010-05-01

    Climate change is likely to affect the nature of pathogens/ chemicals in the environment and their fate and transport. We assess the implications of climate change for changes in human exposures to pathogens/chemicals in agricultural systems in the UK and discuss the effects on health impacts, using expert input and literature on climate change; health effects from exposure to pathogens/chemicals arising from agriculture; inputs of chemicals/pathogens to agricultural systems; and human exposure pathways for pathogens/chemicals in agricultural systems. We established the evidence base for health effects of chemicals/pathogens in the agricultural environment; determined the potential implications of climate change on chemical/pathogen inputs in agricultural systems; and explored the effects of climate change on environmental transport and fate of various contaminants. We merged data to assess the implications of climate change in terms of indirect human exposure to pathogens/chemicals in agricultural systems, and defined recommendations on future research and policy changes to manage adverse increases in risks.

  13. Discovery of Aspergillus frankstonensis sp nov during environmental sampling for animal and human fungal pathogens

    DEFF Research Database (Denmark)

    Talbot, Jessica J.; Houbraken, Jos; Frisvad, Jens Christian

    2017-01-01

    . nov.) and 30% were other species (30%). Seven pathogenic ASF species known to cause disease in humans and animals (A. felis-clade, A. fischeri, A. thermomutatus, A. lentulus, A. laciniosus A. fumisynne-matus, A. hiratsukae) comprised 25% of isolates overall. AVSC species were only isolated from...... to pathogenic species in ASF in Australia appears to be high, but there was no evidence of direct environmental exposure to AVSC species in areas where humans and cats cohabitate....

  14. Anti-bacterial effects of the essential oil of Teucrium polium L. on human pathogenic bacteria

    OpenAIRE

    Mohammad Mohammad; Hassan Salari; Armita Farahmand

    2013-01-01

    Background: Pathogenic bacteria are important causes of disease in humans and agricultural products contamination. Side effects of chemical preservatives necessitate research on the use of a special blend of natural oils to prevent the growth of bacteria. The aim of this study was elucidating the antibacterial effect of the essential oil of Teucrium polium on human pathogenic bacteria in the Kerman province. Materials and Methods: In order to investigate the chemical composition and antiba...

  15. Human soil-borne pathogens and risks associated with land use change

    Science.gov (United States)

    Pereg, Lily

    2017-04-01

    Soil is a source of pathogenic, neutral and beneficial microorganisms. Natural events and anthropogenic activity can affect soil biodiversity and influence the balance and distribution of soil-borne human pathogens. Important bacterial and fungal pathogens, such as Bacillus anthracis, Coxiella bernetii, Clostridium tetani, Escherichia coli 0157:H7, Listeria monocytogenes, Aspergillus fumigatus and Sporothrix schenckii will be discussed. This presentation will concentrate on soil pathogenic microorganisms and the effects of land use change on their prevalence and distribution. In particular, the potential of agricultural soil cultivation to enhance pathogen transmission to human through the release of soil microbes into the air attached to dust particles, contamination of waterways and infection of food plants and animal. Emerging solutions, such as biocontrol and probiotics, will be discussed.

  16. Detection of Escherichia coli, Salmonella species, and Vibrio cholerae in tap water and bottled drinking water in Isfahan, Iran.

    Science.gov (United States)

    Momtaz, Hassan; Dehkordi, Farhad Safarpoor; Rahimi, Ebrahim; Asgarifar, Amin

    2013-06-07

    The quality of drinking water has an important role in human infection and disease. This study was aimed at comparing polymerase chain reaction and culture in detecting Escherichia coli, Salmonella species and Vibrio cholera in tape water and bottled drinking water in various seasons in Isfahan province, Iran. A total of 448 water samples from tap water and bottled mineral water were taken over 6 months, from July 2010 to December 2010, and after filtration, samples were examined by culture and polymerase chain reaction methods for detection of Escherichia coli, Salmonella species, and Vibrio cholerae. The culture method showed that 34 (7.58%), 4 (0.89%) and 3 (0.66%) of all 448 water samples were positive for Escherichia coli, Salmonella species, and Vibrio cholera, respectively. The uidA gene from Escherichia coli, IpaB gene from Salmonella species, and epsM gene from Vibrio cholera were detected in 38 (26.38%), 5 (3.47%), and 3 (2.08%) of 144 tap-water samples, respectively. Escherichia coli was detected in 8 (2.63%) of 304 samples of bottled drinking water from 5 companies. The water of southern part of Isfahan and company 5 had the highest prevalence of bacteria. The Escherichia coli water contamination was significantly higher (P waters of southern part and tap waters of central part of Isfahan. This study showed that the polymerase chain reaction assays can be an extremely accurate, fast, safe, sensitive and specific approach to monitor drinking water quality from purification facilities and bottled water companies. Also, our study confirmed the presence of Escherichia coli, Salmonella species, and Vibrio cholerae as water-borne pathogens in tap water and bottled drinking water of Isfahan, Iran. The present study showed the important public health problem in Isfahan, Iran.

  17. Assessing the function of STAS domain protein SypA in Vibrio fischeri using a comparative analysis.

    Science.gov (United States)

    Thompson, Cecilia M; Visick, Karen L

    2015-01-01

    Colonization of the squid Euprymna scolopes by Vibrio fischeri requires biofilm formation dependent on the 18-gene symbiosis polysaccharide locus, syp. One key regulator, SypA, controls biofilm formation by an as-yet unknown mechanism; however, it is known that SypA itself is regulated by SypE. Biofilm-proficient strains form wrinkled colonies on solid media, while sypA mutants form biofilm-defective smooth colonies. To begin to understand the function of SypA, we used comparative analyses and mutagenesis approaches. sypA (and the syp locus) is conserved in other Vibrios, including two food-borne human pathogens, Vibrio vulnificus (rbdA) and Vibrio parahaemolyticus (sypA VP ). We found that both homologs could complement the biofilm defect of the V. fischeri sypA mutant, but their phenotypes varied depending on the biofilm-inducing conditions used. Furthermore, while SypAVP retained an ability to be regulated by SypE, RbdA was resistant to this control. To better understand SypA function, we examined the biofilm-promoting ability of a number of mutant SypA proteins with substitutions in conserved residues, and found many that were biofilm-defective. The most severe biofilm-defective phenotypes occurred when changes were made to a conserved stretch of amino acids within a predicted α-helix of SypA; we hypothesize that this region of SypA may interact with another protein to promote biofilm formation. Finally, we identified a residue required for negative control by SypE. Together, our data provide insights into the function of this key biofilm regulator and suggest that the SypA orthologs may play similar roles in their native Vibrio species.

  18. The Food Production Environment and the Development of Antimicrobial Resistance in Human Pathogens of Animal Origin

    Directory of Open Access Journals (Sweden)

    Manjusha Lekshmi

    2017-03-01

    Full Text Available Food-borne pathogens are a serious human health concern worldwide, and the emergence of antibiotic-resistant food pathogens has further confounded this problem. Once-highly-efficacious antibiotics are gradually becoming ineffective against many important pathogens, resulting in severe treatment crises. Among several reasons for the development and spread of antimicrobial resistance, their overuse in animal food production systems for purposes other than treatment of infections is prominent. Many pathogens of animals are zoonotic, and therefore any development of resistance in pathogens associated with food animals can spread to humans through the food chain. Human infections by antibiotic-resistant pathogens such as Campylobacter spp., Salmonella spp., Escherichia coli and Staphylococcus aureus are increasing. Considering the human health risk due to emerging antibiotic resistance in food animal–associated bacteria, many countries have banned the use of antibiotic growth promoters and the application in animals of antibiotics critically important in human medicine. Concerted global efforts are necessary to minimize the use of antimicrobials in food animals in order to control the development of antibiotic resistance in these systems and their spread to humans via food and water.

  19. The Food Production Environment and the Development of Antimicrobial Resistance in Human Pathogens of Animal Origin.

    Science.gov (United States)

    Lekshmi, Manjusha; Ammini, Parvathi; Kumar, Sanath; Varela, Manuel F

    2017-03-14

    Food-borne pathogens are a serious human health concern worldwide, and the emergence of antibiotic-resistant food pathogens has further confounded this problem. Once-highly-efficacious antibiotics are gradually becoming ineffective against many important pathogens, resulting in severe treatment crises. Among several reasons for the development and spread of antimicrobial resistance, their overuse in animal food production systems for purposes other than treatment of infections is prominent. Many pathogens of animals are zoonotic, and therefore any development of resistance in pathogens associated with food animals can spread to humans through the food chain. Human infections by antibiotic-resistant pathogens such as Campylobacter spp., Salmonella spp., Escherichia coli and Staphylococcus aureus are increasing. Considering the human health risk due to emerging antibiotic resistance in food animal-associated bacteria, many countries have banned the use of antibiotic growth promoters and the application in animals of antibiotics critically important in human medicine. Concerted global efforts are necessary to minimize the use of antimicrobials in food animals in order to control the development of antibiotic resistance in these systems and their spread to humans via food and water.

  20. Application of Reverse Transcriptase-PCR-DGGE as a rapid method for routine determination of Vibrio spp. in foods.

    Science.gov (United States)

    Chahorm, Kanchana; Prakitchaiwattana, Cheunjit

    2018-01-02

    The aim of this research was to evaluate the feasibility of PCR-DGGE and Reverse Transcriptase-PCR-DGGE techniques for rapid detection of Vibrio species in foods. Primers GC567F and 680R were initially evaluated for amplifying DNA and cDNA of ten references Vibrio species by PCR method. The GC-clamp PCR amplicons were separated according to their sequences by the DGGE using 10% (w/v) polyacrylamide gel containing 45-70% urea and formamide denaturants. Two pair of Vibrio species, which could not be differentiated on the gel, was Vibrio fluvialis - Vibrio furnissii and Vibrio parahaemolyticus - Vibrio harveyi. To determine the detection limit, in the community of 10 reference strains containing the same viable population, distinct DNA bands of 3 species; Vibrio cholerae, Vibrio mimicus and Vibrio alginolyticus were consistently observed by PCR-DGGE technique. In fact, 5 species; Vibrio cholerae, Vibrio mimicus, Vibrio alginolyticus, Vibrio parahaemolyticus and Vibrio fluvialis consistently observed by Reverse Transcriptase-PCR-DGGE. In the community containing different viable population increasing from 10 2 to 10 5 CFU/mL, PCR-DGGE analysis only detected the two most prevalent species, while RT-PCR-DGGE detected the five most prevalent species. Therefore, Reverse Transcriptase-PCR-DGGE was also selected for detection of various Vibrio cell conditions, including viable cell (VC), injured cells from frozen cultures (IVC) and injured cells from frozen cultures with pre-enrichment (PIVC). It was found that cDNA band of all cell conditions gave the same migratory patterns, except that multiple cDNA bands of Plesiomonas shigelloides under IVC and PIVC conditions were found. When Reverse Transcriptase-PCR-DGGE was used for detecting Vibrio parahaemolyticus in the pathogen-spiked food samples, Vibrio parahaemolyticus could be detected in the spiked samples containing at least 10 2 CFU/g of this pathogen. The results obtained also corresponded to standard method (USFDA, 2004

  1. Impacts of climate change on indirect human exposure to pathogens and chemicals from agriculture.

    Science.gov (United States)

    Boxall, Alistair B A; Hardy, Anthony; Beulke, Sabine; Boucard, Tatiana; Burgin, Laura; Falloon, Peter D; Haygarth, Philip M; Hutchinson, Thomas; Kovats, R Sari; Leonardi, Giovanni; Levy, Leonard S; Nichols, Gordon; Parsons, Simon A; Potts, Laura; Stone, David; Topp, Edward; Turley, David B; Walsh, Kerry; Wellington, Elizabeth M H; Williams, Richard J

    2009-04-01

    Climate change is likely to affect the nature of pathogens and chemicals in the environment and their fate and transport. Future risks of pathogens and chemicals could therefore be very different from those of today. In this review, we assess the implications of climate change for changes in human exposures to pathogens and chemicals in agricultural systems in the United Kingdom and discuss the subsequent effects on health impacts. In this review, we used expert input and considered literature on climate change; health effects resulting from exposure to pathogens and chemicals arising from agriculture; inputs of chemicals and pathogens to agricultural systems; and human exposure pathways for pathogens and chemicals in agricultural systems. We established the current evidence base for health effects of chemicals and pathogens in the agricultural environment; determined the potential implications of climate change on chemical and pathogen inputs in agricultural systems; and explored the effects of climate change on environmental transport and fate of different contaminant types. We combined these data to assess the implications of climate change in terms of indirect human exposure to pathogens and chemicals in agricultural systems. We then developed recommendations on future research and policy changes to manage any adverse increases in risks. Overall, climate change is likely to increase human exposures to agricultural contaminants. The magnitude of the increases will be highly dependent on the contaminant type. Risks from many pathogens and particulate and particle-associated contaminants could increase significantly. These increases in exposure can, however, be managed for the most part through targeted research and policy changes.

  2. The Shared Antibiotic Resistome of Soil Bacteria and Human Pathogens

    OpenAIRE

    Forsberg, K. J.; A. Reyes; Wang, B; Selleck, E. M.; Sommer, M. O. A.; Dantas, G

    2012-01-01

    Soil microbiota represent one of the ancient evolutionary origins of antibiotic resistance and have been proposed as a reservoir of resistance genes available for exchange with clinical pathogens. Using a high-throughput functional metagenomic approach in conjunction with a pipeline for the de-novo assembly of short-read sequence data from functional selections (termed PARFuMS), we provide evidence for recent exchange of antibiotic resistance genes between environmental bacteria and clinical ...

  3. Airborne pathogens from dairy manure aerial irrigation and the human health risk

    Science.gov (United States)

    Borchardt, Mark A.; Burch, Tucker R

    2016-01-01

    Dairy manure, like the fecal excrement from any domesticated or wild animal, can contain pathogens capable of infecting humans and causing illness or even death. Pathogens in dairy manure can be broadly divided into categories of taxonomy or infectiousness. Dividing by taxonomy there are three pathogen groups in dairy manure: viruses (e.g., bovine rotavirus), bacteria (e.g., Salmonella species), and protozoa (e.g., Cryptosporidium parvum). There are two categories of infectiousness for pathogens found in animals: those that are zoonotic and those that are not. A zoonotic pathogen is one that can infect both human and animal hosts. Some zoonotic pathogens found in dairy manure cause illness in both hosts (e.g., Salmonella) while other zoonotic pathogens, like Escherichia coli O157:H7, (enterohemorrhagic E. coli (EHEC)) cause illness only in humans. As a general rule, the gastrointestinal viruses found in dairy manure are not zoonotic. While there are exceptions (e.g., rare reports of bovine rotavirus infecting children), for the most part the viruses in dairy manure are not a human health concern. The primary concerns are the zoonotic bacteria and protozoa in dairy manure.

  4. Transmission and Toxigenic Potential of Vibrio cholerae in Hilsha Fish (Tenualosa ilisha) for Human Consumption in Bangladesh

    DEFF Research Database (Denmark)

    Hossain, Zenat Z.; Farhana, Israt; Tulsiani, Suhella M.

    2018-01-01

    potential of V. cholerae in Hilsha (Tenualosa ilisha), a commonly caught and consumed fish that exhibits a life cycle in both freshwater and marine environments in Bangladesh. During the period from October 2014 to October 2015, samples from the gills, recta, intestines, and scale swabs of a total of 48...... for the cholera toxin gene. Other pathogenic genes such as stn/sto, hlyA, chxA, SXT, rtxC, and HA-P were detected. The type three secretion system gene cluster (TTSS) was present in 18% (24 of 133) of non-O1/O139 isolates. The antibiotic susceptibility test revealed that the isolates conferred high resistance...

  5. Nigribactin, a Novel Siderophore from Vibrio nigripulchritudo, Modulates Staphylococcus aureus Virulence Gene Expression

    Directory of Open Access Journals (Sweden)

    Lone Gram

    2012-11-01

    Full Text Available Staphylococcus aureus is a serious human pathogen that employs a number of virulence factors as part of its pathogenesis. The purpose of the present study was to explore marine bacteria as a source of compounds that modulate virulence gene expression in S. aureus. During the global marine Galathea 3 expedition, a strain collection was established comprising bacteria that express antimicrobial activity against Vibrio anguillarum and/or Staphylococcus aureus. Within this collection we searched colony material, culture supernatants, and cell extracts for virulence modulating activity showing that 68 out of 83 marine bacteria (affiliated with the Vibrionaceae and Pseudoalteromonas sp. influenced expression of S. aureus hla encoding α-hemolysin toxin and/or spa encoding Protein A. The isolate that upon initial screening showed the highest degree of interference (crude ethyl acetate extract was a Vibrio nigripulchritudo. Extraction, purification and structural elucidation revealed a novel siderophore, designated nigribactin, which induces spa transcription. The effect of nigribactin on spa expression is likely to be independent from its siderophore activity, as another potent siderophore, enterobactin, failed to influence S. aureus virulence gene expression. This study shows that marine microorganisms produce compounds with potential use in therapeutic strategies targeting virulence rather than viability of human pathogens.

  6. Occurrence of human pathogenic Clostridium botulinum among healthy dairy animals: an emerging public health hazard.

    Science.gov (United States)

    Abdel-Moein, Khaled A; Hamza, Dalia A

    2016-01-01

    The current study was conducted to investigate the occurrence of human pathogenic Clostridium botulinum in the feces of dairy animals. Fecal samples were collected from 203 apparently healthy dairy animals (50 cattle, 50 buffaloes, 52 sheep, 51 goats). Samples were cultured to recover C. botulinum while human pathogenic C. botulinum strains were identified after screening of all C. botulinum isolates for the presence of genes that encode toxins type A, B, E, F. The overall prevalence of C. botulinum was 18.7% whereas human pathogenic C. botulinum strains (only type A) were isolated from six animals at the rates of 2, 2, 5.8, and 2% for cattle, buffaloes, sheep, and goats, respectively. High fecal carriage rates of C. botulinum among apparently healthy dairy animals especially type A alarm both veterinary and public health communities for a potential role which may be played by dairy animals in the epidemiology of such pathogen.

  7. Development of a highly sensitive lateral immunochromatographic assay for rapid detection of Vibrio parahaemolyticus.

    Science.gov (United States)

    Liu, Xinfeng; Guan, Yuyao; Cheng, Shiliang; Huang, Yidan; Yan, Qin; Zhang, Jun; Huang, Guanjun; Zheng, Jian; Liu, Tianqiang

    2016-12-01

    Vibrio parahaemolyticus is widely present in brackish water all over the world, causing infections in certain aquatic animals. It is also a foodborne pathogen that causes diarrhea in humans. The aim of this study is to develop an immunochromatographic lateral flow assay (LFA) for rapid detection of V. parahaemolyticus in both aquatic products and human feces of diarrheal patients. Two monoclonal antibody (MAb) pairs, GA1a-IC9 and IC9-KB4c, were developed and proven to be highly specific and sensitive to V. parahaemolyticus. Based on the two MAb pairs, two types of LFA strips were prepared. Their testing limits for V. parahaemolyticus culture were both 1.2×103CFU/ml. The diagnostic sensitivities and specificities were both 100% for the 32 tested microbial species, including 6 Vibrio species. Subsequently, the LFA strips were used to test Whiteleg shrimps and human feces. The type II strip showed a higher diagnostic sensitivity. Its sensitivity and specificity for hepatopancreas and fecal samples from 13 Whiteleg shrimps and fecal samples from 146 human diarrheal patients were all 100%. In conclusion, our homemade type II LFA is a very promising testing device for rapid and convenient detection of V. parahaemolyticus infection not only in aquatic animals, but also in human diarrheal patients. This sensitive immunochromtographic LFA allows rapid detection of V. parahaemolyticus without requirement of culture enrichment. Copyright © 2016. Published by Elsevier B.V.

  8. New insights into Oculina patagonica coral diseases and their associated Vibrio spp. communities.

    Science.gov (United States)

    Rubio-Portillo, Esther; Yarza, Pablo; Peñalver, Cindy; Ramos-Esplá, Alfonso A; Antón, Josefa

    2014-09-01

    Bleaching of Oculina patagonica has been extensively studied in the Eastern Mediterranean Sea, although no studies have been carried out in the Western basin. In 1996 Vibrio mediterranei was reported as the causative agent of bleaching in O. patagonica but it has not been related to bleached or healthy corals since 2003, suggesting that it was no longer involved in bleaching of O. patagonica. In an attempt to clarify the relationship between Vibrio spp., seawater temperature and coral diseases, as well as to investigate the putative differences between Eastern and Western Mediterranean basins, we have analysed the seasonal patterns of the culturable Vibrio spp. assemblages associated with healthy and diseased O. patagonica colonies. Two sampling points located in the Spanish Mediterranean coast were chosen for this study: Alicante Harbour and the Marine Reserve of Tabarca. A complex and dynamic assemblage of Vibrio spp. was present in O. patagonica along the whole year and under different environmental conditions and coral health status. While some Vibrio spp. were detected all year around in corals, the known pathogens V. mediteranei and V. coralliilyticus were only present in diseased specimens. The pathogenic potential of these bacteria was studied by experimental infection under laboratory conditions. Both vibrios caused diseased signs from 24 °C, being higher and faster at 28 °C. Unexpectedly, the co-inoculation of these two Vibrio species seemed to have a synergistic pathogenic effect over O. patagonica, as disease signs were readily observed at temperatures at which bleaching is not normally observed.

  9. Temperature effect on high salinity depuration of Vibrio vulnificus and V. parahaemolyticus from the Eastern oyster (Crassostrea virginica).

    Science.gov (United States)

    Larsen, A M; Rikard, F S; Walton, W C; Arias, C R

    2015-01-02

    Vibrio vulnificus (Vv) and Vibrio parahaemolyticus (Vp) are opportunistic human pathogens naturally associated with the Eastern oyster Crassostrea virginica. The abundances of both pathogens in oysters are positively correlated with temperature, thus ingestion of raw oysters during the warm summer months is a risk factor for contracting illness from these bacteria. Current post-harvest processing (PHP) methods for elimination of these pathogens are expensive and kill the oyster, changing their organoleptic properties and making them less appealing to some consumers. High salinity has proven effective in reducing Vv numbers in the wild and our research aims at developing an indoor recirculating system to reduce pathogenic Vibrios while maintaining the taste and texture of live oysters. The goal of this study was to determine the influence of temperature on the efficacy of high salinity depuration. Vv was enumerated as most probable number (MPN) per gram of oyster tissue using the FDA-approved modified cellobiose polymyxin colistin (mCPC) protocol and with an alternative Vibrio specific media CHROMagar™ Vibrio (CaV). CaV was also used to quantify Vp. Oysters were held at 35 psu for 10 days at three temperatures: low (20°C), mid (22.5°C) and high (25°C). There was no difference in MPN/g of Vv between media; however more Vv isolates were obtained from mCPC than CaV. There was no significant effect of temperature on reduction of Vv or Vp throughout depuration but there was a tendency for low temperatures to be less effective than the higher ones. High salinity resulted in a significant decrease in Vv by day 3 and again by day 10, and a decrease in Vp by day 3. Oyster condition indices were maintained throughout depuration and mortality was low (4% across three trials). Overall these results support the use of mCPC for Vv enumeration and demonstrate the promise of high salinity depuration for PHP of the Eastern oyster. The trend for lower temperatures to be less

  10. Single-dose Live Oral Cholera Vaccine CVD 103-HgR Protects Against Human Experimental Infection With Vibrio cholerae O1 El Tor

    Science.gov (United States)

    Chen, Wilbur H.; Cohen, Mitchell B.; Kirkpatrick, Beth D.; Brady, Rebecca C.; Galloway, David; Gurwith, Marc; Hall, Robert H.; Kessler, Robert A.; Lock, Michael; Haney, Douglas; Lyon, Caroline E.; Pasetti, Marcela F.; Simon, Jakub K.; Szabo, Flora; Tennant, Sharon; Levine, Myron M.

    2016-01-01

    Background. No licensed cholera vaccine is presently available in the United States. Cholera vaccines available in other countries require 2 spaced doses. A single-dose cholera vaccine that can rapidly protect short-notice travelers to high-risk areas and help control explosive outbreaks where logistics render 2-dose immunization regimens impractical would be a major advance. PXVX0200, based on live attenuated Vibrio cholerae O1 classical Inaba vaccine strain CVD 103-HgR, elicits seroconversion of vibriocidal antibodies (a correlate of protection) within 10 days of a single oral dose. We investigated the protection conferred by this vaccine in a human cholera challenge model. Methods. Consenting healthy adult volunteers, 18–45 years old, were randomly allocated 1:1 to receive 1 oral dose of vaccine (approximately 5 × 108 colony-forming units [CFU]) or placebo in double-blind fashion. Volunteers ingested approximately 1 × 105 CFU of wild-type V. cholerae O1 El Tor Inaba strain N16961 10 days or 3 months after vaccination and were observed on an inpatient research ward for stool output measurement and management of hydration. Results. The vaccine was well tolerated, with no difference in adverse event frequency among 95 vaccinees vs 102 placebo recipients. The primary endpoint, moderate (≥3.0 L) to severe (≥5.0 L) diarrheal purge, occurred in 39 of 66 (59.1%) placebo controls but only 2 of 35 (5.7%) vaccinees at 10 days (vaccine efficacy, 90.3%; P < .0001) and 4 of 33 (12.1%) vaccinees at 3 months (vaccine efficacy, 79.5%; P < .0001). Conclusions. The significant vaccine efficacy documented 10 days and 3 months after 1 oral dose of PXVX0200 supports further development as a single-dose cholera vaccine. Clinical Trials Registration. NCT01895855 PMID:27001804

  11. Single-dose Live Oral Cholera Vaccine CVD 103-HgR Protects Against Human Experimental Infection With Vibrio cholerae O1 El Tor.

    Science.gov (United States)

    Chen, Wilbur H; Cohen, Mitchell B; Kirkpatrick, Beth D; Brady, Rebecca C; Galloway, David; Gurwith, Marc; Hall, Robert H; Kessler, Robert A; Lock, Michael; Haney, Douglas; Lyon, Caroline E; Pasetti, Marcela F; Simon, Jakub K; Szabo, Flora; Tennant, Sharon; Levine, Myron M

    2016-06-01

    No licensed cholera vaccine is presently available in the United States. Cholera vaccines available in other countries require 2 spaced doses. A single-dose cholera vaccine that can rapidly protect short-notice travelers to high-risk areas and help control explosive outbreaks where logistics render 2-dose immunization regimens impractical would be a major advance.PXVX0200, based on live attenuated Vibrio cholerae O1 classical Inaba vaccine strain CVD 103-HgR, elicits seroconversion of vibriocidal antibodies (a correlate of protection) within 10 days of a single oral dose. We investigated the protection conferred by this vaccine in a human cholera challenge model. Consenting healthy adult volunteers, 18-45 years old, were randomly allocated 1:1 to receive 1 oral dose of vaccine (approximately 5 × 10(8) colony-forming units [CFU]) or placebo in double-blind fashion. Volunteers ingested approximately 1 × 10(5) CFU of wild-type V. cholerae O1 El Tor Inaba strain N16961 10 days or 3 months after vaccination and were observed on an inpatient research ward for stool output measurement and management of hydration. The vaccine was well tolerated, with no difference in adverse event frequency among 95 vaccinees vs 102 placebo recipients. The primary endpoint, moderate (≥3.0 L) to severe (≥5.0 L) diarrheal purge, occurred in 39 of 66 (59.1%) placebo controls but only 2 of 35 (5.7%) vaccinees at 10 days (vaccine efficacy, 90.3%; P vaccine efficacy, 79.5%; P vaccine efficacy documented 10 days and 3 months after 1 oral dose of PXVX0200 supports further development as a single-dose cholera vaccine. NCT01895855. © The Author 2016. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail journals.permissions@oup.com.

  12. Characterization of pathogenic human monoclonal autoantibodies against GM-CSF.

    Science.gov (United States)

    Wang, Yanni; Thomson, Christy A; Allan, Lenka L; Jackson, Linda M; Olson, Melanie; Hercus, Timothy R; Nero, Tracy L; Turner, Amanda; Parker, Michael W; Lopez, Angel L; Waddell, Thomas K; Anderson, Gary P; Hamilton, John A; Schrader, John W

    2013-05-07

    The origin of pathogenic autoantibodies remains unknown. Idiopathic pulmonary alveolar proteinosis is caused by autoantibodies against granulocyte-macrophage colony-stimulating factor (GM-CSF). We generated 19 monoclonal autoantibodies against GM-CSF from six patients with idiopathic pulmonary alveolar proteinosis. The autoantibodies used multiple V genes, excluding preferred V-gene use as an etiology, and targeted at least four nonoverlapping epitopes on GM-CSF, suggesting that GM-CSF is driving the autoantibodies and not a B-cell epitope on a pathogen cross-reacting with GM-CSF. The number of somatic mutations in the autoantibodies suggests that the memory B cells have been helped by T cells and re-entered germinal centers. All autoantibodies neutralized GM-CSF bioactivity, with general correlations to affinity and off-rate. The binding of certain autoantibodies was changed by point mutations in GM-CSF that reduced binding to the GM-CSF receptor. Those monoclonal autoantibodies that potently neutralize GM-CSF may be useful in treating inflammatory disease, such as rheumatoid arthritis and multiple sclerosis, cancer, and pain.

  13. Interaction of probiotics and pathogens--benefits to human health?

    Science.gov (United States)

    Salminen, Seppo; Nybom, Sonja; Meriluoto, Jussi; Collado, Maria Carmen; Vesterlund, Satu; El-Nezami, Hani

    2010-04-01

    The probiotic terminology has matured over the years and currently a unified definition has been formed. Lactic acid bacteria (LAB) and bifidobacteria have been reported to remove heavy metals, cyanotoxins and mycotoxins from aqueous solutions. The binding processes appear to be species and strain specific. The most efficient microbial species and strains in the removal of these compounds vary between components tested. However, it is of interest to note that most strains characterized until now do not bind positive components or nutrients in the diet. This has significant implications to future detoxification biotechnology development. In a similar manner, lactic acid bacteria and bifidobacteria interact directly with viruses and pathogens in food and water as well as toxin producing microbes and some toxins. This review updates information and aims to characterize these interactions in association. The target is to understand probiotic health effects and to relate the mechanisms and actions to future potential of specific probiotic bacteria on decontamination of foods and water, and diets. The same aim is targeted in characterizing the role of probiotics in inactivating pathogens and viruses of health importance to facilitate the establishment of novel means of disease risk reduction related health benefits. Copyright 2010. Published by Elsevier Ltd.

  14. Vibrio fischeri metabolism: symbiosis and beyond.

    Science.gov (United States)

    Dunn, Anne K

    2012-01-01

    Vibrio fischeri is a bioluminescent, Gram-negative marine bacterium that can be found free living and in a mutualistic association with certain squids and fishes. Over the past decades, the study of V. fischeri has led to important discoveries about bioluminescence, quorum sensing, and the mechanisms that underlie beneficial host-microbe interactions. This chapter highlights what has been learned about metabolic pathways in V. fischeri, and how this information contributes to a broader understanding of the role of bacterial metabolism in host colonization by both beneficial and pathogenic bacteria, as well as in the growth and survival of free-living bacteria. Copyright © 2012 Elsevier Ltd. All rights reserved.

  15. Detection of bacterial pathogens including potential new species in human head lice from Mali.

    Science.gov (United States)

    Amanzougaghene, Nadia; Fenollar, Florence; Sangaré, Abdoul Karim; Sissoko, Mahamadou S; Doumbo, Ogobara K; Raoult, Didier; Mediannikov, Oleg

    2017-01-01

    In poor African countries, where no medical and biological facilities are available, the identification of potential emerging pathogens of concern at an early stage is challenging. Head lice, Pediculus humanus capitis, have a short life, feed only on human blood and do not transmit pathogens to their progeny. They are, therefore, a perfect tool for the xenodiagnosis of current or recent human infection. This study assessed the occurrence of bacterial pathogens from head lice collected in two rural villages from Mali, where a high frequency of head lice infestation had previously been reported, using molecular methods. Results show that all 600 head lice, collected from 117 individuals, belonged to clade E, specific to West Africa. Bartonella quintana, the causative agent of trench fever, was identified in three of the 600 (0.5%) head lice studied. Our study also shows, for the first time, the presence of the DNA of two pathogenic bacteria, namely Coxiella burnetii (5.1%) and Rickettsia aeschlimannii (0.6%), detected in human head lice, as well as the DNA of potential new species from the Anaplasma and Ehrlichia genera of unknown pathogenicity. The finding of several Malian head lice infected with B. quintana, C. burnetii, R. aeschlimannii, Anaplasma and Ehrlichia is alarming and highlights the need for active survey programs to define the public health consequences of the detection of these emerging bacterial pathogens in human head lice.

  16. Gene cloning and prokaryotic expression of recombinant outer membrane protein from Vibrio parahaemolyticus

    Science.gov (United States)

    Yuan, Ye; Wang, Xiuli; Guo, Sheping; Qiu, Xuemei

    2011-06-01

    Gram-negative Vibrio parahaemolyticus is a common pathogen in humans and marine animals. The outer membrane protein of bacteria plays an important role in the infection and pathogenicity to the host. Thus, the outer membrane proteins are an ideal target for vaccines. We amplified a complete outer membrane protein gene (ompW) from V. parahaemolyticus ATCC 17802. We then cloned and expressed the gene into Escherichia coli BL21 (DE3) cells. The gene coded for a protein that was 42.78 kDa. We purified the protein using Ni-NTA affinity chromatography and Anti-His antibody Western blotting, respectively. Our results provide a basis for future application of the OmpW protein as a vaccine candidate against infection by V. parahaemolyticus. In addition, the purified OmpW protein can be used for further functional and structural studies.

  17. Roles of thermostable direct hemolysin (TDH and TDH-related hemolysin (TRH in Vibrio parahaemolyticus

    Directory of Open Access Journals (Sweden)

    Pendru eRaghunath

    2015-01-01

    Full Text Available Vibrio parahaemolyticus is the leading cause of seafood borne bacterial gastroenteritis in the world, often associated with the consumption of raw or undercooked seafood. However, not all strains of V. parahaemolyticus are pathogenic. The thermostable direct haemolysin (TDH or TDH-related haemolysin (TRH encoded by tdh and trh genes, respectively are considered major virulence factors in V. parahaemolyticus. However, about 10% of clinical strains do not contain tdh and/or trh. Environmental isolates of V. parahaemolyticus lacking tdh and/or trh are also highly cytotoxic to human gastrointestinal cells. Even in the absence of these hemolysins, V. parahaemolyticus remains pathogenic indicating other virulence factors exist. This mini review aims at discussing the possible roles of tdh and trh genes in clinical and environmental isolates of V. parahaemolyticus.

  18. Roles of thermostable direct hemolysin (TDH) and TDH-related hemolysin (TRH) in Vibrio parahaemolyticus.

    Science.gov (United States)

    Raghunath, Pendru

    2014-01-01

    Vibrio parahaemolyticus is the leading cause of seafood borne bacterial gastroenteritis in the world, often associated with the consumption of raw or undercooked seafood. However, not all strains of V. parahaemolyticus are pathogenic. The thermostable direct hemolysin (TDH) or TDH-related hemolysin (TRH) encoded by tdh and trh genes, respectively, are considered major virulence factors in V. parahaemolyticus. However, about 10% of clinical strains do not contain tdh and/or trh. Environmental isolates of V. parahaemolyticus lacking tdh and/or trh are also highly cytotoxic to human gastrointestinal cells. Even in the absence of these hemolysins, V. parahaemolyticus remains pathogenic indicating other virulence factors exist. This mini review aims at discussing the possible roles of tdh and trh genes in clinical and environmental isolates of V. parahaemolyticus.

  19. Genomes of foodborne and waterborne pathogens

    National Research Council Canada - National Science Library

    Fratamico, Pina M; Liu, Yanhong; Kathariou, Sophia

    2011-01-01

    ... of Pathogenic Vibrio cholerae * 85 Salvador Almagro-Moreno, Ronan A. Murphy, and E. Fidelma Boyd 8. Genomics of the Enteropathogenic Yersiniae * 101 Alan McNally, Nicholas R. Thomson, and Brendan W. ...

  20. Bottlenecks in the transmission of antibiotic resistance from natural ecosystems to human bacterial pathogens

    Directory of Open Access Journals (Sweden)

    Jose L Martinez

    2012-01-01

    Full Text Available It is generally accepted that resistance genes acquired by human pathogens trough horizontal gene transfer have been originated in environmental, non pathogenic bacteria. As the consequence, there exists an increasing concern on the role that natural, non-clinical ecosystems, may play on the evolution of resistance. Recent studies have shown that the variability of determinants that can provide antibiotic resistance upon their expression in a heterologous host is much larger than what is actually found in human pathogens. Along the review, the role that different processes as founder effect, ecological connectivity, fitness costs or second-order selection may have on the establishment of a specific resistance determinant in the population of bacterial pathogens is analysed.

  1. The BER necessities: the repair of DNA damage in human-adapted bacterial pathogens.

    Science.gov (United States)

    van der Veen, Stijn; Tang, Christoph M

    2015-02-01

    During colonization and disease, bacterial pathogens must survive the onslaught of the host immune system. A key component of the innate immune response is the generation of reactive oxygen and nitrogen species by phagocytic cells, which target and disrupt pathogen molecules, particularly DNA, and the base excision repair (BER) pathway is the most important mechanism for the repair of such oxidative DNA damage. In this Review, we discuss how the human-specific pathogens Mycobacterium tuberculosis, Helicobacter pylori and Neisseria meningitidis have evolved specialized mechanisms of DNA repair, particularly their BER pathways, compared with model organisms such as Escherichia coli. This specialization in DNA repair is likely to reflect the distinct niches occupied by these important human pathogens in the host.

  2. Disease induction by human microbial pathogens in plant-model systems : potential, problems and prospects

    NARCIS (Netherlands)

    Baarlen, P.; Belkum, A. van; Thomma, B.P.

    2007-01-01

    Relatively simple eukaryotic model organisms such as the genetic model weed plant Arabidopsis thaliana possess an innate immune system that shares important similarities with its mammalian counterpart. In fact, some human pathogens infect Arabidopsis and cause overt disease with human symptomology.

  3. Disease induction by human microbial pathogens in plant-model systems: potential, problems and prospects

    NARCIS (Netherlands)

    Baarlen, van P.; Belkum, van A.; Thomma, B.P.H.J.

    2007-01-01

    Relatively simple eukaryotic model organisms such as the genetic model weed plant Arabidopsis thaliana possess an innate immune system that shares important similarities with its mammalian counterpart. In fact, some human pathogens infect Arabidopsis and cause overt disease with human symptomology.

  4. Identification of Potentially Human-Pathogenic Enterocytozoon bieneusi Genotypes in Various Birds▿

    Science.gov (United States)

    Lobo, Maria Luísa ; Xiao, Lihua; Cama, Vitaliano; Magalhães, Nuno; Antunes, Francisco; Matos, Olga

    2006-01-01

    Enterocytozoon bieneusi was detected in 24 of 83 samples from birds of the orders Columbiformes, Passeriformes, and Psittaciformes. It was identical to or closely related to the Peru6 genotype, which was previously found in humans in Peru. Thus, various birds can be a significant source of environmental contamination by potentially human-pathogenic E. bieneusi. PMID:16936045

  5. Update on the proteomics of major arthropod vectors of human and animal pathogens.

    Science.gov (United States)

    Patramool, Sirilaksana; Choumet, Valérie; Surasombatpattana, Pornapat; Sabatier, Laurence; Thomas, Frédéric; Thongrungkiat, Supatra; Rabilloud, Thierry; Boulanger, Nathalie; Biron, David G; Missé, Dorothée

    2012-12-01

    Vector-borne diseases (VBDs) are defined as infectious diseases of humans and animals caused by pathogenic agents such as viruses, protists, bacteria, and helminths transmitted by the bite of blood-feeding arthropod (BFA) vectors. VBDs represent a major public health threat in endemic areas, generally subtropical zones, and many are considered to be neglected diseases. Genome sequencing of some arthropod vectors as well as modern proteomic and genomic technologies are expanding our knowledge of arthropod-pathogen interactions. This review describes the proteomic approaches that have been used to investigate diverse biological questions about arthropod vectors, including the interplay between vectors and pathogens. Proteomic studies have identified proteins and biochemical pathways that may be involved in molecular crosstalk in BFA-pathogen associations. Future work can build upon this promising start and functional analyses coupled with interactome bioassays will be carried out to investigate the role of candidate peptides and proteins in BFA-human pathogen associations. Dissection of the host-pathogen interactome will be key to understanding the strategies and biochemical pathways used by BFAs to cope with pathogens. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Prevalence of plant beneficial and human pathogenic bacteria isolated from salad vegetables in India.

    Science.gov (United States)

    Nithya, Angamuthu; Babu, Subramanian

    2017-03-14

    The study aimed at enumerating, identifying and categorizing the endophytic cultivable bacterial community in selected salad vegetables (carrot, cucumber, tomato and onion). Vegetable samples were collected from markets of two vegetable hot spot growing areas, during two different crop harvest seasons. Crude and diluted vegetable extracts were plated and the population of endophytic bacteria was assessed based on morphologically distinguishable colonies. The bacterial isolates were identified by growth in selective media, biochemical tests and 16S rRNA gene sequencing. The endophytic population was found to be comparably higher in cucumber and tomato in both of the sampling locations, whereas lower in carrot and onion. Bacterial isolates belonged to 5 classes covering 46 distinct species belonging to 19 genera. Human opportunistic pathogens were predominant in carrot and onion, whereas plant beneficial bacteria dominated in cucumber and tomato. Out of the 104 isolates, 16.25% are human pathogens and 26.5% are human opportunistic pathogens. Existence of a high population of plant beneficial bacteria was found to have suppressed the population of plant and human pathogens. There is a greater potential to study the native endophytic plant beneficial bacteria for developing them as biocontrol agents against human pathogens that are harboured by plants.

  7. Targeted Disruption of Melanin Biosynthesis Genes in the Human Pathogenic Fungus Lomentospora prolificans and Its Consequences for Pathogen Survival.

    Science.gov (United States)

    Al-Laaeiby, Ayat; Kershaw, Michael J; Penn, Tina J; Thornton, Christopher R

    2016-03-24

    The dematiaceous (melanised) fungus Lomentospora (Scedosporium) prolificans is a life-threatening opportunistic pathogen of immunocompromised humans, resistant to anti-fungal drugs. Melanin has been shown to protect human pathogenic fungi against antifungal drugs, oxidative killing and environmental stresses. To determine the protective role of melanin in L. prolificans to oxidative killing (H₂O₂), UV radiation and the polyene anti-fungal drug amphotericin B, targeted gene disruption was used to generate mutants of the pathogen lacking the dihydroxynaphthalene (DHN)-melanin biosynthetic enzymes polyketide synthase (PKS1), tetrahydroxynapthalene reductase (4HNR) and scytalone dehydratase (SCD1). Infectious propagules (spores) of the wild-type strain 3.1 were black/brown, whereas spores of the PKS-deficient mutant ΔLppks1::hph were white. Complementation of the albino mutant ΔLppks1::hph restored the black-brown spore pigmentation, while the 4HNR-deficient mutant ΔLp4hnr::hph and SCD-deficient mutant ΔLpscd1::hph both produced orange-yellow spores. The mutants ΔLppks1::hph and ΔLp4hnr::hph showed significant reductions in spore survival following H₂O₂ treatment, while spores of ΔLpscd1::hph and the ΔLppks1::hph complemented strain ΔLppks1::hph:PKS showed spore survivals similar to strain 3.1. Spores of the mutants ΔLp4hnr::hph and ΔLpscd1::hph and complemented strain ΔLppks1::hph:PKS showed spore survivals similar to 3.1 following exposure to UV radiation, but survival of ΔLppks1::hph spores was significantly reduced compared to the wild-type strain. Strain 3.1 and mutants ΔLp4hnr::hph and ΔLppks1::hph:PKS were resistant to amphotericin B while, paradoxically, the PKS1- and SCD1-deficient mutants showed significant increases in growth in the presence of the antifungal drug. Taken together, these results show that while melanin plays a protective role in the survival of the pathogen to oxidative killing and UV radiation, melanin does not

  8. Targeted Disruption of Melanin Biosynthesis Genes in the Human Pathogenic Fungus Lomentospora prolificans and Its Consequences for Pathogen Survival

    Directory of Open Access Journals (Sweden)

    Ayat Al-Laaeiby

    2016-03-01

    Full Text Available The dematiaceous (melanised fungus Lomentospora (Scedosporium prolificans is a life-threatening opportunistic pathogen of immunocompromised humans, resistant to anti-fungal drugs. Melanin has been shown to protect human pathogenic fungi against antifungal drugs, oxidative killing and environmental stresses. To determine the protective role of melanin in L. prolificans to oxidative killing (H2O2, UV radiation and the polyene anti-fungal drug amphotericin B, targeted gene disruption was used to generate mutants of the pathogen lacking the dihydroxynaphthalene (DHN-melanin biosynthetic enzymes polyketide synthase (PKS1, tetrahydroxynapthalene reductase (4HNR and scytalone dehydratase (SCD1. Infectious propagules (spores of the wild-type strain 3.1 were black/brown, whereas spores of the PKS-deficient mutant ΔLppks1::hph were white. Complementation of the albino mutant ΔLppks1::hph restored the black-brown spore pigmentation, while the 4HNR-deficient mutant ΔLp4hnr::hph and SCD-deficient mutant ΔLpscd1::hph both produced orange-yellow spores. The mutants ΔLppks1::hph and ΔLp4hnr::hph showed significant reductions in spore survival following H2O2 treatment, while spores of ΔLpscd1::hph and the ΔLppks1::hph complemented strain ΔLppks1::hph:PKS showed spore survivals similar to strain 3.1. Spores of the mutants ΔLp4hnr::hph and ΔLpscd1::hph and complemented strain ΔLppks1::hph:PKS showed spore survivals similar to 3.1 following exposure to UV radiation, but survival of ΔLppks1::hph spores was significantly reduced compared to the wild-type strain. Strain 3.1 and mutants ΔLp4hnr::hph and ΔLppks1::hph:PKS were resistant to amphotericin B while, paradoxically, the PKS1- and SCD1-deficient mutants showed significant increases in growth in the presence of the antifungal drug. Taken together, these results show that while melanin plays a protective role in the survival of the pathogen to oxidative killing and UV radiation, melanin does not

  9. Pathogen prevalence predicts human cross-cultural variability in individualism/collectivism.

    Science.gov (United States)

    Fincher, Corey L; Thornhill, Randy; Murray, Damian R; Schaller, Mark

    2008-06-07

    Pathogenic diseases impose selection pressures on the social behaviour of host populations. In humans (Homo sapiens), many psychological phenomena appear to serve an antipathogen defence function. One broad implication is the existence of cross-cultural differences in human cognition and behaviour contingent upon the relative presence of pathogens in the local ecology. We focus specifically on one fundamental cultural variable: differences in individualistic versus collectivist values. We suggest that specific behavioural manifestations of collectivism (e.g. ethnocentrism, conformity) can inhibit the transmission of pathogens; and so we hypothesize that collectivism (compared with individualism) will more often characterize cultures in regions that have historically had higher prevalence of pathogens. Drawing on epidemiological data and the findings of worldwide cross-national surveys of individualism/collectivism, our results support this hypothesis: the regional prevalence of pathogens has a strong positive correlation with cultural indicators of collectivism and a strong negative correlation with individualism. The correlations remain significant even when controlling for potential confounding variables. These results help to explain the origin of a paradigmatic cross-cultural difference, and reveal previously undocumented consequences of pathogenic diseases on the variable nature of human societies.

  10. Metalloprotease vsm is the major determinant of toxicity for extracellular products of Vibrio splendidus.

    Science.gov (United States)

    Binesse, Johan; Delsert, Claude; Saulnier, Denis; Champomier-Vergès, Marie-Christine; Zagorec, Monique; Munier-Lehmann, Hélène; Mazel, Didier; Le Roux, Frédérique

    2008-12-01

    Genomic data combined with reverse genetic approaches have contributed to the characterization of major virulence factors of Vibrio species; however, these studies have targeted primarily human pathogens. Here, we investigate virulence factors in the oyster pathogen Vibrio splendidus LGP32 and show that toxicity is correlated to the presence of a metalloprotease and its corresponding vsm gene. Comparative genomics showed that an avirulent strain closely related to LGP32 lacked the metalloprotease. The toxicity of LGP32 metalloprotease was confirmed by exposing mollusk and mouse fibroblastic cell lines to extracellular products (ECPs) of the wild type (wt) and a vsm deletion mutant (Deltavsm mutant). The ECPs of the wt induced a strong cytopathic effect whose severity was cell type dependent, while those of the Deltavsm mutant were much less toxic, and exposure to purified protein demonstrated the direct toxicity of the Vsm metalloprotease. Finally, to investigate Vsm molecular targets, a proteomic analysis of the ECPs of both LGP32 and the Deltavsm mutant was performed, revealing a number of differentially expressed and/or processed proteins. One of these, the VSA1062 metalloprotease, was found to have significant identity to the immune inhibitor A precursor, a virulence factor of Bacillus thuringiensis. Deletion mutants corresponding to several of the major proteins were constructed by allelic exchange, and the ECPs of these mutants proved to be toxic to both cell cultures and animals. Taken together, these data demonstrate that Vsm is the major toxicity factor in the ECPs of V. splendidus.

  11. Photochemical inactivation of pathogenic bacteria in human platelet concentrates.

    Science.gov (United States)

    Lin, L; Londe, H; Janda, J M; Hanson, C V; Corash, L

    1994-05-01

    Platelet concentrates (PC) may be infrequently contaminated with low levels of bacteria that can cause septicemia and death in patients receiving transfusion therapy. We evaluated the efficacy of a photochemical decontamination (PCD) technique using 8-methoxypsoralen (8-MOP) and long wavelength UV light (UVA) to inactivate bacteria in standard therapeutic PC. Twelve phylogenetically distinct pathogenic bacteria, 5 gram-positive and 7 gram-negative organisms, were seeded into PC to a final challenge dose ranging from 10(5) to 10(7) colony-forming units (CFU)/mL. Contaminated PC were treated with 8-MOP (5 micrograms/mL) and 5 J/cm2 of UVA, a PCD treatment regimen found to adequately preserve in vitro platelet function. Greater than 10(5) CFU/mL of all 5 gram-positive (Staphylococcus aureus, Streptococcus epidermidis, Streptococcus pyogenes, Listeria monocytogenes, and Corynebacterium minutissimum) and 2 of the gram-negative (Escherichia coli and Yersinia enterocolitica) organisms were inactivated. The remaining 5 gram-negative organisms were more resistant, with less than 10(1) to 10(3.7) CFU/mL inactivated under these conditions. The inactivation efficiency for this resistant group of gram-negative organisms was improved when PC were resuspended in a synthetic storage medium with reduced plasma protein concentration (15%) and an increased 8-MOP concentration (23.4 micrograms/mL). Illumination with 3 J/cm2 of UVA in this system inactivated greater than 10(5) CFU/mL of 4 resistant gram-negative organisms (Salmonella choleraesuis, Enterobacter cloacae, Serratia marcescens, and Klebsiella pneumoniae) and 10(4.1) CFU/mL of the most resistant gram-negative organism (Pseudomonas aeruginosa). This level of PCD treatment did not adversely affect in vitro platelet function. These results demonstrate that PCD using 8-MOP (5 to 23.4 micrograms/mL) effectively inactivated high levels of pathogenic bacteria in PC with adequate preservation of in vitro platelet properties.

  12. Evolution of Bordetellae from Environmental Microbes to Human Respiratory Pathogens: Amoebae as a Missing Link

    Directory of Open Access Journals (Sweden)

    Dawn L. Taylor-Mulneix

    2017-12-01

    Full Text Available The genus Bordetella comprises several bacterial species that colonize the respiratory tract of mammals. It includes B. pertussis, a human-restricted pathogen that is the causative agent of Whooping Cough. In contrast, the closely related species B. bronchiseptica colonizes a broad range of animals as well as immunocompromised humans. Recent metagenomic studies have identified known and novel bordetellae isolated from different environmental sources, providing a new perspective on their natural history. Using phylogenetic analysis, we have shown that human and animal pathogenic bordetellae have most likely evolved from ancestors that originated from soil and water. Our recent study found that B. bronchiseptica can evade amoebic predation and utilize Dictyostelium discoideum as an expansion and transmission vector, which suggests that the evolutionary pressure to evade the amoebic predator enabled the rise of bordetellae as respiratory pathogens. Interactions with amoeba may represent the starting point for bacterial adaptation to eukaryotic cells. However, as bacteria evolve and adapt to a novel host, they can become specialized and restricted to a specific host. B. pertussis is known to colonize and cause infection only in humans, and this specialization to a closed human-to-human lifecycle has involved genome reduction and the loss of ability to utilize amoeba as an environmental reservoir. The discoveries from studying the interaction of Bordetella species with amoeba will elicit a better understanding of the evolutionary history of these and other important human pathogens.

  13. Human pathogen shown to cause disease in the threatened eklhorn coral Acropora palmata.

    Directory of Open Access Journals (Sweden)

    Kathryn Patterson Sutherland

    Full Text Available Coral reefs are in severe decline. Infections by the human pathogen Serratia marcescens have contributed to precipitous losses in the common Caribbean elkhorn coral, Acropora palmata, culminating in its listing under the United States Endangered Species Act. During a 2003 outbreak of this coral disease, called acroporid serratiosis (APS, a unique strain of the pathogen, Serratia marcescens strain PDR60, was identified from diseased A. palmata, human wastewater, the non-host coral Siderastrea siderea and the corallivorous snail Coralliophila abbreviata. In order to examine humans as a source and other marine invertebrates as vectors and/or reservoirs of the APS pathogen, challenge experiments were conducted with A. palmata maintained in closed aquaria to determine infectivity of strain PDR60 from reef and wastewater sources. Strain PDR60 from wastewater and diseased A. palmata caused disease signs in elkhorn coral in as little as four and five days, respectively, demonstrating that wastewater is a definitive source of APS and identifying human strain PDR60 as a coral pathogen through fulfillment of Koch's postulates. A. palmata inoculated with strain PDR60 from C. abbreviata showed limited virulence, with one of three inoculated fragments developing APS signs within 13 days. Strain PDR60 from non-host coral S. siderea showed a delayed pathogenic effect, with disease signs developing within an average of 20 days. These results suggest that C. abbreviata and non-host corals may function as reservoirs or vectors of the APS pathogen. Our results provide the first example of a marine "reverse zoonosis" involving the transmission of a human pathogen (S. marcescens to a marine invertebrate (A. palmata. These findings underscore the interaction between public health practices and environmental health indices such as coral reef survival.

  14. Effects of Ethyl Acetate Extracts from the Polycephalomyces nipponicus Isolate Cod-MK1201 (Ascomycetes) against Human Pathogenic Bacteria and a Breast Cancer Cell Line.

    Science.gov (United States)

    Sangdee, Kusavadee; Seephonkai, Prapairat; Buranrat, Benjaporn; Surapong, Nilawan; Sangdee, Aphidech

    2016-01-01

    This study aimed to identify a suitable organic solvent for extracting bioactive compounds from Polycephalomyces nipponicus and to evaluate the antibacterial and anticancer activities of the extracts obtained. Only extracts obtained with ethyl acetate exhibited antibacterial activity, so ethyl acetate was chosen for large-scale extraction. The minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) against Gram-positive and Gram-negative human pathogenic bacteria of the 3 ethyl acetate-derived extracts-ethyl acetate extract from P. nipponicus (PN-ME), ethyl acetate extract after defatting (PN-ME*), and ethyl acetate extract after refluxation (PN-ME')-were determined. PN-ME' exhibited the most potent activity, inhibiting 12 of the 18 test bacteria, especially Bacillus cereus ATCC 11778 and Vibrio cholera (O1) DMST 9700, with low MIC and MBC values. PN-ME* showed greater inhibitory activity than PN-ME. The effects of the extracts on bacterial cell morphology were also determined. After 120 minutes of treatment with PN-ME* or PN-ME', B. cereus ATCC 11778 exhibited an abnormal rod-shaped cell structure, with some cells elongated to multiple times their original size and others appearing collapsed. V cholera (O1) DMST 9700 cells showed shrinkage and the formed subsurface cavities. PN-ME* and PN-ME' also inhibited the growth of MCF-7 breast cancer cells. In conclusion, the fungal isolate P. nipponicus Cod-MK1201 represents a source of antibacterial and anti-breast cancer compounds.

  15. Shared and distinct mechanisms of iron acquisition by bacterial and fungal pathogens of humans

    Directory of Open Access Journals (Sweden)

    Mélissa eCaza

    2013-11-01

    Full Text Available Iron is the most abundant transition metal in the human body and its bioavailability is stringently controlled. In particular, iron is tightly bound to host proteins such as transferrin to maintain homeostasis, to limit potential damage caused by iron toxicity under physiological conditions and to restrict access by pathogens. Therefore, iron acquisition during infection of a human host is a challenge that must be surmounted by every successful pathogenic microorganism. Iron is essential for bacterial and fungal physiological processes such as DNA replication, transcription, metabolism and energy generation via respiration. Hence, pathogenic bacteria and fungi have developed sophisticated strategies to gain access to iron from host sources. Indeed, siderophore production and transport, iron acquisition from heme and host iron-containing proteins such as hemoglobin and transferrin, and reduction of ferric to ferrous iron with subsequent transport are all strategies found in bacterial and fungal pathogens of humans. This review focuses on a comparison of these strategies between bacterial and fungal pathogens in the context of virulence and the iron limitation that occurs in the human body as a mechanism of innate nutritional defence.

  16. Black Molds and Melanized Yeasts Pathogenic to Humans

    NARCIS (Netherlands)

    Chowdhary, Anuradha; Perfect, John; de Hoog, G Sybren

    2014-01-01

    A review is given of melanized fungi involved in human infection, including species forming budding cells and strictly filamentous representatives. Classically, they are known as "phaeoid" or "dematiaceous" fungi, and, today, agents are recognized to belong to seven orders of fungi, of which the

  17. Population genetic correlates of declining transmission in a human pathogen.

    Science.gov (United States)

    Nkhoma, Standwell C; Nair, Shalini; Al-Saai, Salma; Ashley, Elizabeth; McGready, Rose; Phyo, Aung P; Nosten, François; Anderson, Tim J C

    2013-01-01

    Pathogen control programs provide a valuable, but rarely exploited, opportunity to directly examine the relationship between population decline and population genetics. We investigated the impact of an ~12-fold decline in transmission on the population genetics of Plasmodium falciparum infections (n = 1731) sampled from four clinics on the Thai-Burma border over 10 years and genotyped using 96 genome-wide SNPs. The most striking associated genetic change was a reduction in the frequency of infections containing multiple parasite genotypes from 63% in 2001 to 14% in 2010 (P = 3 × 10(-15)). Two measures of the clonal composition of populations (genotypic richness and the β-parameter of the Pareto distribution) declined over time as more people were infected by parasites with identical multilocus genotypes, consistent with increased selfing and a reduction in the rate at which multilocus genotypes are broken apart by recombination. We predicted that the reduction in transmission, multiple clone carriage and outbreeding would be mirrored by an increased influence of genetic drift. However, geographical differentiation and expected heterozygosity remained stable across the sampling period. Furthermore, N(e) estimates derived from allele frequencies fluctuation between years remained high (582 to ∞) and showed no downward trend. These results demonstrate how genetic data can compliment epidemiological assessments of infectious disease control programs. The temporal changes in a single declining population parallel to those seen in comparisons of parasite genetics in regions of differing endemicity, strongly supporting the notion that reduced opportunity for outbreeding is the key driver of these patterns. © 2012 Blackwell Publishing Ltd.

  18. Probiotic Potential of Lactobacillus Strains with Antimicrobial Activity against Some Human Pathogenic Strains

    Science.gov (United States)

    Shokryazdan, Parisa; Sieo, Chin Chin; Kalavathy, Ramasamy; Liang, Juan Boo; Alitheen, Noorjahan Banu; Faseleh Jahromi, Mohammad; Ho, Yin Wan

    2014-01-01

    The objective of this study was to isolate, identify, and characterize some lactic acid bacterial strains from human milk, infant feces, and fermented grapes and dates, as potential probiotics with antimicrobial activity against some human pathogenic strains. One hundred and forty bacterial strains were isolated and, after initial identification and a preliminary screening for acid and bile tolerance, nine of the best isolates were selected and further identified using 16 S rRNA gene sequences. The nine selected isolates were then characterized in vitro for their probiotic characteristics and their antimicrobial activities against some human pathogens. Results showed that all nine isolates belonged to the genus Lactobacillus. They were able to tolerate pH 3 for 3 h, 0.3% bile salts for 4 h, and 1.9 mg/mL pancreatic enzymes for 3 h. They exhibited good ability to attach to intestinal epithelial cells and were not resistant to the tested antibiotics. They also showed good antimicrobial activities against the tested pathogenic strains of humans, and most of them exhibited stronger antimicrobial activity than the reference strain L. casei Shirota. Thus, the nine Lactobacillus strains could be considered as potential antimicrobial probiotic strains against human pathogens and should be further studied for their human health benefits. PMID:25105147

  19. Probiotic Potential of Lactobacillus Strains with Antimicrobial Activity against Some Human Pathogenic Strains

    Directory of Open Access Journals (Sweden)

    Parisa Shokryazdan

    2014-01-01

    Full Text Available The objective of this study was to isolate, identify, and characterize some lactic acid bacterial strains from human milk, infant feces, and fermented grapes and dates, as potential probiotics with antimicrobial activity against some human pathogenic strains. One hundred and forty bacterial strains were isolated and, after initial identification and a preliminary screening for acid and bile tolerance, nine of the best isolates were selected and further identified using 16 S rRNA gene sequences. The nine selected isolates were then characterized in vitro for their probiotic characteristics and their antimicrobial activities against some human pathogens. Results showed that all nine isolates belonged to the genus Lactobacillus. They were able to tolerate pH 3 for 3 h, 0.3% bile salts for 4 h, and 1.9 mg/mL pancreatic enzymes for 3 h. They exhibited good ability to attach to intestinal epithelial cells and were not resistant to the tested antibiotics. They also showed good antimicrobial activities against the tested pathogenic strains of humans, and most of them exhibited stronger antimicrobial activity than the reference strain L. casei Shirota. Thus, the nine Lactobacillus strains could be considered as potential antimicrobial probiotic strains against human pathogens and should be further studied for their human health benefits.

  20. Probiotic potential of Lactobacillus strains with antimicrobial activity against some human pathogenic strains.

    Science.gov (United States)

    Shokryazdan, Parisa; Sieo, Chin Chin; Kalavathy, Ramasamy; Liang, Juan Boo; Alitheen, Noorjahan Banu; Faseleh Jahromi, Mohammad; Ho, Yin Wan

    2014-01-01

    The objective of this study was to isolate, identify, and characterize some lactic acid bacterial strains from human milk, infant feces, and fermented grapes and dates, as potential probiotics with antimicrobial activity against some human pathogenic strains. One hundred and forty bacterial strains were isolated and, after initial identification and a preliminary screening for acid and bile tolerance, nine of the best isolates were selected and further identified using 16 S rRNA gene sequences. The nine selected isolates were then characterized in vitro for their probiotic characteristics and their antimicrobial activities against some human pathogens. Results showed that all nine isolates belonged to the genus Lactobacillus. They were able to tolerate pH 3 for 3 h, 0.3% bile salts for 4 h, and 1.9 mg/mL pancreatic enzymes for 3 h. They exhibited good ability to attach to intestinal epithelial cells and were not resistant to the tested antibiotics. They also showed good antimicrobial activities against the tested pathogenic strains of humans, and most of them exhibited stronger antimicrobial activity than the reference strain L. casei Shirota. Thus, the nine Lactobacillus strains could be considered as potential antimicrobial probiotic strains against human pathogens and should be further studied for their human health benefits.

  1. Potential human pathogenic bacteria in a mixed urban watershed as revealed by pyrosequencing.

    Directory of Open Access Journals (Sweden)

    A Mark Ibekwe

    Full Text Available Current microbial source tracking (MST methods for water depend on testing for fecal indicator bacterial counts or specific marker gene sequences to identify fecal contamination where potential human pathogenic bacteria could be present. In this study, we applied 454 high-throughput pyrosequencing to identify bacterial pathogen DNA sequences, including those not traditionally monitored by MST and correlated their abundances to specific sources of contamination such as urban runoff and agricultural runoff from concentrated animal feeding operations (CAFOs, recreation park area, waste-water treatment plants, and natural sites with little or no human activities. Samples for pyrosequencing were surface water, and sediment collected from 19 sites. A total of 12,959 16S rRNA gene sequences with average length of ≤400 bp were obtained, and were assigned to corresponding taxonomic ranks using ribosomal database project (RDP, Classifier and Greengenes databases. The percent of total potential pathogens were highest in urban runoff water (7.94%, agricultural runoff sediment (6.52%, and Prado Park sediment (6.00%, respectively. Although the numbers of DNA sequence tags from pyrosequencing were very high for the natural site, corresponding percent potential pathogens were very low (3.78-4.08%. Most of the potential pathogenic bacterial sequences identified were from three major phyla, namely, Proteobacteria, Bacteroidetes, and Firmicutes. The use of deep sequencing may provide improved and faster methods for the identification of pathogen sources in most watersheds so that better risk assessment methods may be developed to enhance public health.

  2. Vibrio vulnificus infection in Southern Brazil - Case report Infecção por Vibrio vulnificus no sul do Brasil - Relato de caso

    Directory of Open Access Journals (Sweden)

    João César Beenke França

    2013-06-01

    Full Text Available The genus Vibrio is a member of the family Vibrionaceae, and among their disease-causing species, Vibrio vulnificus, a lactose-positive gram-negative bacillus, is one of the most virulent pathogen of the noncholerae vibrios. We describe the case of a 39-year-old male patient, who was using immunosuppressive therapy, admitted to the hospital for liver transplantation. Twelve hours later, the patient presented high fever, myalgia, anuria and erythematous plaques on lower limbs, of rapid growth and proximal progression. The patient was treated with ceftriaxone, meropenem and oxacillin, however he expired within 30 hours. Blood cultures showed growth of a gram-negative bacillus, which was later identified as Vibrio vulnificus.O gênero Vibrio é membro da família Vibrionaceae, e entre as espécies patogênicas, Vibrio vulnificus, bacilo gram negativo lactose positivo, tem sido frequentemente citado. Descrevemos o caso de um paciente masculino de 39 anos, em uso de medicação imunossupressora, admitido no hospital para transplante hepático. Doze horas após a internação, o paciente evoluiu com febre, mialgias, anúria e placas eritematosas em membros inferiores, com rápido crescimento e evolução proximal. O paciente foi tratado com ceftriaxona, meropenem e oxacilina sem melhora, evoluindo para óbito em 30 horas. Hemocultura mostrou crescimento de bacilo gram negativo posteriormente identificado como Vibrio vulnificus.

  3. Multiple Cross Displacement Amplification Combined with Gold Nanoparticle-Based Lateral Flow Biosensor for Detection of Vibrio parahaemolyticus.

    Science.gov (United States)

    Wang, Yi; Li, Hui; Li, Dongxun; Li, Kewei; Wang, Yan; Xu, Jianguo; Ye, Changyun

    2016-01-01

    Vibrio parahaemolyticus (V. parahaemolyticus) is a marine seafood-borne pathogen causing severe illnesses in humans and aquatic animals. In the present study, multiple cross displacement amplification was combined with a lateral flow biosensor (MCDA-LFB) to detect the toxR gene of V. parahaemolyticus in DNA extracts from pure cultures and spiked oyster homogenates. Amplification was carried out at a constant temperature (62°C) for only 30 min, and amplification products were directly applied to the biosensor. The entire process, including oyster homogenate processing (30 min), isothermal amplification (30 min) and results indicating (∼2 min), could be completed within 65 min. Amplification product was detectable from as little as 10 fg of pure V. parahaemolyticus DNA and from approximately 4.2 × 10(2) CFU in 1 mL of oyster homogenate. No cross-reaction with other Vibrio species and with non-Vibrio species was observed. Therefore, the MCDA-LFB method established in the current report is suitable for the rapid screening of V. parahaemolyticus in clinical, food, and environmental samples.

  4. The Pseudomonas aeruginosa opportunistic pathogen and human infections.

    Science.gov (United States)

    de Bentzmann, Sophie; Plésiat, Patrick

    2011-07-01

    Pseudomonas aeruginosa, a Gram-negative environmental species and an opportunistic microorganism, establishes itself in vulnerable patients, such as those with cystic fibrosis or hospitalized in intensive care units. It has become a major cause of nosocomial infections worldwide (about 10% of all such infections in most European Union hospitals) and a serious threat to Public Health. The overuse and misuse of antibiotics have also led to the selection of resistant strains against which very few therapeutic options exist. How an environmental species can cause human infections remains a key question that still needs elucidation despite the incredibly high progress that has been made in the P. aeruginosa biology over the past decades. The workshop belonging to Current trends in Biomedicine series, which was held under the sponsorship of the Universidad International de Andalucia between the 8th and the 10th November 2010 brought in the most recent advances in the environmental life of P. aeruginosa, the human P. aeruginosa infections, the new animal models to study Pseudomonas infections, the new genetic aspects including metabolomics, genomics and bioinformatics and the community lifestyle named biofilm that accounts for P. aeruginosa persistence in humans. This workshop organized by Soeren Molin (Danemark), Juan-Luis Ramos (Spain) and Sophie de Bentzmann (France) gathered 46 researchers coming from 11 European and American countries in a small format and was hosted in the 'Sede Antonio Machado' in Baeza. It was organized in seven sessions covering animal models for P. aeruginosa pathogenesis, resistance to drugs, regulatory potency including small RNA, two component systems, extracytoplasmic function sigma factors and trancriptional regulators, new therapies emerging from dissection of molecular mechanisms, and evolutionary mechanisms of P. aeruginosa strains in patients. © 2011 Society for Applied Microbiology and Blackwell Publishing Ltd.

  5. Aerially transmitted human fungal pathogens: what can we learn from metagenomics and comparative genomics?

    Science.gov (United States)

    Aliouat-Denis, Cécile-Marie; Chabé, Magali; Delhaes, Laurence; Dei-Cas, Eduardo

    2014-01-01

    In the last few decades, aerially transmitted human fungal pathogens have been increasingly recognized to impact the clinical course of chronic pulmonary diseases, such as asthma, cystic fibrosis or chronic obstructive pulmonary disease. Thanks to recent development of culture-free high-throughput sequencing methods, the metagenomic approaches are now appropriate to detect, identify and even quantify prokaryotic or eukaryotic microorganism communities inhabiting human respiratory tract and to access the complexity of even low-burden microbe communities that are likely to play a role in chronic pulmonary diseases. In this review, we explore how metagenomics and comparative genomics studies can alleviate fungal culture bottlenecks, improve our knowledge about fungal biology, lift the veil on cross-talks between host lung and fungal microbiota, and gain insights into the pathogenic impact of these aerially transmitted fungi that affect human beings. We reviewed metagenomic studies and comparative genomic analyses of carefully chosen microorganisms, and confirmed the usefulness of such approaches to better delineate biology and pathogenesis of aerially transmitted human fungal pathogens. Efforts to generate and efficiently analyze the enormous amount of data produced by such novel approaches have to be pursued, and will potentially provide the patients suffering from chronic pulmonary diseases with a better management. This manuscript is part of the series of works presented at the "V International Workshop: Molecular genetic approaches to the study of human pathogenic fungi" (Oaxaca, Mexico, 2012). Copyright © 2013 Revista Iberoamericana de Micología. Published by Elsevier Espana. All rights reserved.

  6. Black Molds and Melanized Yeasts Pathogenic to Humans.

    Science.gov (United States)

    Chowdhary, Anuradha; Perfect, John; de Hoog, G Sybren

    2014-11-10

    A review is given of melanized fungi involved in human infection, including species forming budding cells and strictly filamentous representatives. Classically, they are known as "phaeoid" or "dematiaceous" fungi, and, today, agents are recognized to belong to seven orders of fungi, of which the Chaetothyriales and Pleosporales are the most important. Infections range from cutaneous or pulmonary colonization to systemic or disseminated invasion. Subcutaneous involvement, either primary or after dissemination, may lead to host tissue proliferation of dermis or epidermis. Particularly in the Chaetothyriales, subcutaneous and systemic infections may occur in otherwise apparently healthy individuals. Infections are mostly chronic and require extended antifungal therapy and/or surgery. Copyright © 2015 Cold Spring Harbor Laboratory Press; all rights reserved.

  7. Human pathogens associated with the blacklegged tick Ixodes scapularis: a systematic review.

    Science.gov (United States)

    Nelder, Mark P; Russell, Curtis B; Sheehan, Nina Jain; Sander, Beate; Moore, Stephen; Li, Ye; Johnson, Steven; Patel, Samir N; Sider, Doug

    2016-05-05

    The blacklegged tick Ixodes scapularis transmits Borrelia burgdorferi (sensu stricto) in eastern North America; however, the agent of Lyme disease is not the sole pathogen harbored by the blacklegged tick. The blacklegged tick is expanding its range into areas of southern Canada such as Ontario, an area where exposure to blacklegged tick bites and tick-borne pathogens is increasing. We performed a systematic review to evaluate the public health risks posed by expanding blacklegged tick populations and their associated pathogens. We followed PRISMA (Preferred Reporting Items for Systematic Reviews and Meta-Analyses) guidelines for conducting our systematic review. We searched Ovid MEDLINE, Embase, BIOSIS, Scopus and Environment Complete databases for studies published from 2000 through 2015, using subject headings and keywords that included "Ixodes scapularis", "Rickettsia", "Borrelia", "Anaplasma", "Babesia" and "pathogen." Two reviewers screened titles and abstracts against eligibility criteria (i.e. studies that included field-collected blacklegged ticks and studies that did not focus solely on B. burgdorferi) and performed quality assessments on eligible studies. Seventy-eight studies were included in the final review, 72 were from the US and eight were from Canada (two studies included blacklegged ticks from both countries). Sixty-four (82%) studies met ≥ 75% of the quality assessment criteria. Blacklegged ticks harbored 91 distinct taxa, 16 of these are tick-transmitted human pathogens, including species of Anaplasma, Babesia, Bartonella, Borrelia, Ehrlichia, Rickettsia, Theileria and Flavivirus. Organism richness was highest in the Northeast (Connecticut, New York) and Upper Midwest US (Wisconsin); however, organism richness was dependent on sampling effort. The primary tick-borne pathogens of public health concern in Ontario, due to the geographic proximity or historical detection in Ontario, are Anaplasma phagocytophilum, Babesia microti, B. burgdorferi

  8. Prevalence and Molecular Typing of Vibrio parahaemolyticus (tdh+) isolated from seafood using PCR-based methods

    Science.gov (United States)

    Vibrio parahaemolyticus is a pathogen most frequently implicated in foodborne outbreaks linked to the consumption of seafood in the coastal cities of China. The pathogenicity of environmental V. parahaemolyticus is mostly correlated with the production of thermostable direct hemolysin (TDH). In orde...

  9. The role of human movement in the transmission of vector-borne pathogens.

    Directory of Open Access Journals (Sweden)

    Steven T Stoddard

    2009-07-01

    Full Text Available Human movement is a key behavioral factor in many vector-borne disease systems because it influences exposure to vectors and thus the transmission of pathogens. Human movement transcends spatial and temporal scales with different influences on disease dynamics. Here we develop a conceptual model to evaluate the importance of variation in exposure due to individual human movements for pathogen transmission, focusing on mosquito-borne dengue virus.We develop a model showing that the relevance of human movement at a particular scale depends on vector behavior. Focusing on the day-biting Aedes aegypti, we illustrate how vector biting behavior combined with fine-scale movements of individual humans engaged in their regular daily routine can influence transmission. Using a simple example, we estimate a transmission rate (R(0 of 1.3 when exposure is assumed to occur only in the home versus 3.75 when exposure at multiple locations--e.g., market, friend's--due to movement is considered. Movement also influences for which sites and individuals risk is greatest. For the example considered, intriguingly, our model predicts little correspondence between vector abundance in a site and estimated R(0 for that site when movement is considered. This illustrates the importance of human movement for understanding and predicting the dynamics of a disease like dengue. To encourage investigation of human movement and disease, we review methods currently available to study human movement and, based on our experience studying dengue in Peru, discuss several important questions to address when designing a study.Human movement is a critical, understudied behavioral component underlying the transmission dynamics of many vector-borne pathogens. Understanding movement will facilitate identification of key individuals and sites in the transmission of pathogens such as dengue, which then may provide targets for surveillance, intervention, and improved disease prevention.

  10. The Inhibitor Pathogen Bacteria’s of Sea Grape Caulerpa lentillifera Applies on Fresh Fish

    Directory of Open Access Journals (Sweden)

    Alfonsina M. Tapotubun

    2017-02-01

    Full Text Available AbstractContamination of pathogen bacteries at the fresh fish may occur during the post harvesting to the consuming period, and endanger human health. One of simple and safe way to protect secureness of fresh fish food is the use of Caulerpa lentillifera to push down pathogen bacteries activity. The aims of this research to investigate lability of sea grape (Caulerpa lentillifera against the activity of pathogen bacteries Escherichia coli, Vibrio cholerae and Salmonella sp., in fresh fish, during storage phase, at ambient and ice temperatures. Method used in this research is experimental laboratories method, that is, 10%, 20% and 30% blended sea grapes applied on fresh fishes, Selar crumenopthalmus during storage of 1, 2 and 3 days at ambient and ice temperatures. All the applied of blended of Caulerpa lentillifera, shows the ability to obstruct the activity of bactery group coliform and Escherichia coli on fresh fish Selar crumenopthalmus up to 2x 24 hours, at ambient temperature, and 3x24 hours at ice temperature. During storage period, the occurance and grows of Salmonella sp. and Vibrio cholerae bacteries is undetected. Fresh sea grapes concentration of 10% is sufficient to be applied on fresh fish to obstruct the activity of pathogen bacteries Escherichia coli during storage time of 2 x 24 hours at room temperature, and 3 x 24 hours at ice temperature, and to block the occurance of Vibrio cholerae and Salmonella sp. during storage period.

  11. The Inhibitor Pathogen Bacteria’s of Sea Grape Caulerpa lentillifera Applies on Fresh Fish

    Directory of Open Access Journals (Sweden)

    Alfonsina M.Tapotubun

    2016-12-01

    Full Text Available Contamination of pathogen bacteries at the fresh fish may occur during the post harvesting to the consuming period, and endanger human health. One of simple and safe way to protect secureness of fresh fish food is the use of Caulerpa lentillifera to push down pathogen bacteries activity. The aims of this research to investigate lability of sea grape (Caulerpa lentillifera against the activity of pathogen bacteries Escherichia coli, Vibrio cholerae and Salmonella sp., in fresh fish, during storage phase, at ambient and ice temperatures. Method used in this research is experimental laboratories method, that is, 10%, 20% and 30% blended sea grapes applied on fresh fishes, Selar crumenopthalmus during storage of 1, 2 and 3 days at ambient and ice temperatures. All the applied of blended of Caulerpa lentillifera, shows the ability to obstruct the activity of bactery group coliform and Escherichia coli on fresh fish Selar crumenopthalmus up to 2x 24 hours, at ambient temperature, and 3x24 hours at ice temperature. During storage period, the occurance and grows of Salmonella sp. and Vibrio cholerae bacteries is undetected. Fresh sea grapes concentration of 10% is sufficient to be applied on fresh fish to obstruct the activity of pathogen bacteries Escherichia coli during storage time of 2 x 24 hours at room temperature, and 3 x 24 hours at ice temperature, and to block the occurance of Vibrio cholerae and Salmonella sp. during storage period. .

  12. Nanoparticle-based lateral flow biosensor combined with multiple cross displacement amplification for rapid, visual and sensitive detection of Vibrio cholerae.

    Science.gov (United States)

    Wang, Yi; Li, Hui; Wang, Yan; Zhang, Lu; Zhang, Jingyun; Xu, Jianguo; Ye, Changyun

    2017-12-15

    Vibrio cholerae is an important human pathogen that is responsible for cholera, a severe acute watery diarrhea. In the current study, a multiple cross displacement amplification (MCDA) coupled with amplicon detection by chromatographic lateral flow biosensor (LFB) method (MCDA-LFB) was successfully established and evaluated for the identification of V. cholerae. A set of 10 primers was designed specifically to recognize 10 different regions of the V. cholerae-specific gene ompW. The optimized time and temperature conditions for the MCDA were 30 min and 63°C, respectively. The MCDA-LFB assay correctly identified 31 strains of V. cholerae but did not detect 13 non-cholerae Vibrio strains and 30 non-Vibrio strains. The sensitivity of MCDA-LFB for target pathogen detection in pure culture was 10 fg per reaction. In the case of spiked shrimp samples without enrichment, the limit of detection was 4.1 CFUs per reaction or equivalent to 4.1 × 102 CFU g-1. The whole process, including shrimp homogenates processing (30 min), MCDA reaction (30 min) and results reporting (2 min), could be finished within 65 min. These results show that this assay is suitable for the rapid, sensitive and specific detection of V. cholerae in food, environmental and clinical samples. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  13. The genome of the basidiomycetous yeast and human pathogen Cryptococcus neoformans

    NARCIS (Netherlands)

    Loftus, BJ; Fung, E; Roncaglia, P; Rowley, D; Amedeo, P; Bruno, D; Vamathevan, J; Miranda, M; Anderson, IJ; Fraser, JA; Allen, JE; Bosdet, IE; Brent, MR; Chiu, R; Doering, TL; Dontin, MJ; D'Souza, CA; Fox, DS; Grinberg, [No Value; Fu, JM; Fukushima, M; Haas, BJ; Huang, JC; Janbon, G; Jones, SJM; Koo, HL; Krzywinski, MI; Kwon-Chung, JK; Lengeler, KB; Maiti, R; Marra, MA; Marra, RE; Mathewson, CA; Mitchell, TG; Pertea, M; Riggs, FR; Salzberg, SL; Schein, JE; Shvartsbeyn, A; Shin, H; Shumway, M; Specht, CA; Suh, BB; Tenney, A; Utterback, TR; Wickes, BL; Wortman, [No Value; Wye, NH; Kronstad, JW; Lodge, JK; Heitman, J; Davis, RW; Fraser, CM; Hyman, RW

    2005-01-01

    Cryptococcus neoformans is a basidionnycetous yeast ubiquitous in the environment, a model for fungal pathogenesis, and an opportunistic human pathogen of global importance. We have sequenced its similar to20-megabase genome, which contains similar to6500 intron-rich gene structures and encodes a

  14. Potential human pathogenic bacteria in a mixed urban watershed as revealed by pyrosequencing

    Science.gov (United States)

    Current microbial source tracking (MST) methods for water depend on testing for fecal indicator bacterial counts or specific marker gene sequences to identify fecal contamination where potential human pathogenic bacteria could be present. In this study, we applied 454 high-throughput pyrosequencing ...

  15. Avian reservoirs and zoonotic potential of the emerging human pathogen Helicobacter canadensis

    DEFF Research Database (Denmark)

    Waldenström, J.; On, Stephen L.W.; Ottvall, R.

    2003-01-01

    testing; four strains were characterized by 16S rRNA gene sequence analysis. The results clearly identified the bird isolates as Helicobacter canadensis, recently described as an emerging human pathogen. This is the first report of an animal reservoir for this organism and of its presence in Europe...... and confirms the zoonotic potential of H. canadensis....

  16. Developing a Salivary Antibody Multiplex Immunoassay to Measure Human Exposure to Environmental Pathogens

    Science.gov (United States)

    The etiology and impacts of human exposure to environmental pathogens are of major concern worldwide and, thus, the ability to assess exposure and infections using cost effective, high-throughput approaches would be indispensable. The principal objective of this work is to devel...

  17. The arable ecosystem as battleground for emergence of new human pathogens

    NARCIS (Netherlands)

    Overbeek, van L.S.; Doorn, van J.; Wichers, J.H.; Amerongen, van A.; Roermund, van H.J.W.; Willemsen, P.T.J.

    2014-01-01

    Disease incidences related to Escherichia coli and Salmonella enterica infections by consumption of (fresh) vegetables, sprouts, and occasionally fruits made clear that these pathogens are not only transmitted to humans via the “classical” routes of meat, eggs, and dairy products, but also can be

  18. Genome sequence of the human- and animal-pathogenic strain Nocardia cyriacigeorgica GUH-2.

    Science.gov (United States)

    Zoropogui, Anthony; Pujic, Petar; Normand, Philippe; Barbe, Valérie; Beaman, Blaine; Beaman, LoVelle; Boiron, Patrick; Colinon, Céline; Deredjian, Amélie; Graindorge, Arnault; Mangenot, Sophie; Nazaret, Sylvie; Neto, Manuelle; Petit, Stéphanie; Roche, David; Vallenet, David; Rodríguez-Nava, Veronica; Richard, Yves; Cournoyer, Benoit; Blaha, Didier

    2012-04-01

    The pathogenic strain Nocardia cyriacigeorgica GUH-2 was isolated from a fatal human nocardiosis case, and its genome was sequenced. The complete genomic sequence of this strain contains 6,194,645 bp, an average G+C content of 68.37%, and no plasmids. We also identified several protein-coding genes to which N. cyriacigeorgica's virulence can potentially be attributed.

  19. Potent innate immune response to pathogenic Leptospira in human whole blood

    NARCIS (Netherlands)

    M.G.A. Goris (Marga); J.F.P. Wagenaar (Jiri); R.A. Hartskeerl (Rudy); E.C.M. van Gorp (Eric); S. Schuller (Simone); A.M. Monahan (Avril); J.E. Nally (Jarlath); T. van der Poll (Tom); C. van 't Veer (Cornelis)

    2011-01-01

    textabstractBackground: Leptospirosis is caused by pathogenic spirochetes of the genus Leptospira. The bacteria enter the human body via abraded skin or mucous membranes and may disseminate throughout. In general the clinical picture is mild but some patients develop rapidly progressive, severe

  20. Potent Innate Immune Response to Pathogenic Leptospira in Human Whole Blood

    NARCIS (Netherlands)

    Goris, M.G.A.; Wagenaar, J.F.P.; Hartskeerl, R.A.; van Gorp, E.C.M.; Schuller, S.; Monahan, A.M.; Nally, J.E.; van der Poll, T.; van 't Veer, C.

    2011-01-01

    Background: Leptospirosis is caused by pathogenic spirochetes of the genus Leptospira. The bacteria enter the human body via abraded skin or mucous membranes and may disseminate throughout. In general the clinical picture is mild but some patients develop rapidly progressive, severe disease with a

  1. Bioinformatic Tools for Metagenomic Analysis of Pathogen Backgrounds and Human Microbial Communities

    Science.gov (United States)

    2010-05-01

    RNA viral community in human feces: prevalence of plant pathogenic viruses. PLoS Biol. 4(1):e3. 6. NCBI Nucleotide Database - http...AACAAGGT >gi|265679010|ref|NR_029318.1| Listeria innocua strain 58/1971 16S ribosomal RNA, partial sequence...NR_026349.1| Listeria grayi strain ATCC19120 16S ribosomal RNA, partial sequence GTGCCTAATACATGCAAGTCGAACGAATGACCTTAGGAGCTTGCTCCTTTGGTCGTTAGTGGCGGACGGG

  2. Vibrio parahaemolyticus: A Review on the Pathogenesis, Prevalence and Advance Molecular Identification Techniques

    Directory of Open Access Journals (Sweden)

    Vengadesh eLetchumanan

    2014-12-01

    Full Text Available Vibrio parahaemolyticus is a Gram-negative halophilic bacterium that is found in estuarine, marine and coastal environments. Vibrio parahaemolyticus is the leading causal agent of human acute gastroenteritis following the consumption of raw, undercooked or mishandled marine products. In rare cases, Vibrio parahaemolyticus causes wound infection, ear infection or septicaemia in individuals with pre-existing medical conditions. Vibrio parahaemolyticus has two hemolysins virulence factors that are thermostable direct hemolysin (tdh-a pore-forming protein that contributes to the invasiveness of the bacterium in humans, and TDH-related hemolysin (trh, which plays a similar role as thermostable direct hemolysin (tdh in the disease pathogenesis. In addition, the bacterium is also encodes for adhesions and type III secretion systems (T3SS1 and T3SS2 to ensure its survival in the environment. This review aims at discussing the Vibrio parahemolyticus growth and characteristics, pathogenesis, prevalence and advances in molecular identification techniques.

  3. Vibrio spp. isolados a partir de mexilhões (Perna perna in natura e pré-cozidos de Estação Experimental de Cultivo, Rio de Janeiro, RJ, Brasil Vibrio spp. isolated from in natura and precooked mussels (Perna perna of an Experimental Station Culture, Rio de Janeiro, RJ, Brazil

    Directory of Open Access Journals (Sweden)

    Christiane Soares Pereira

    2007-06-01

    Full Text Available A análise microbiológica dos mexilhões reflete a qualidade do habitat aquático, pois estes animais podem reter em seus organismos diversos patógenos, dentre os quais aqueles pertencentes à família Vibrionaceae. No presente estudo foi avaliada a presença de Vibrio spp. em mexilhões (in natura e pré-cozidos, comercializados na Estação Experimental de Cultivo de Mexilhões, situada em Jurujuba, Niterói, Rio de Janeiro. Foram avaliadas 86 amostras, tomando como procedimento, o enriquecimento em Água Peptonada Alcalina (APA adicionada de 1 e 3% de NaCl, isolamento em Agar Tiossulfato Citrato Bile Sacarose (TCBS e confirmação das colônias típicas por análise bioquímica. Dentre as 12 espécies de Vibrio identificadas destacaram-se como de maior prevalência as espécies Vibrio alginolyticus, V. cholerae não-O1, V. parahaemolyticus, V. carchariae e Vibrio vulnificus. A relevância epidemiológica destes patógenos associada a casos de gastrenterite humana após consumo de mexilhões crus ou parcialmente cozidos, reforça a importância de alertar as autoridades de Vigilância Sanitária sobre sua presença na cadeia alimentar e seus riscos para a Saúde Pública.The microbiology analysis of mussels reflects the aquatic environment quality because these animals retain various pathogens such as Vibrionaceae family microorganisms in their organism. In the present investigation, we evaluated the presence of Vibrio spp. in mussels (in natura and precooked commercialized at an Experimental Station Mussel Culture in Jurujuba, Niterói, Rio de Janeiro. A total of 86 samples were analyzed using the enrichment in Alkaline Peptone Water (APW added to 1 and 3% of NaCl, isolated in Thiossulfate Citrate Bile Sucrose Agar (TCBS and confirmed that there were suspect colonies by biochemical tests. The results showed the identification of 12 different Vibrio species whereby Vibrio alginolyticus, V. cholerae non-O1, V. parahaemolyticus, V. carchariae

  4. Nocardia amikacinitolerans sp. nov., an amikacin-resistant human pathogen.

    Science.gov (United States)

    Ezeoke, Ifeoma; Klenk, Hans-Peter; Pötter, Gabriele; Schumann, Peter; Moser, Ben D; Lasker, Brent A; Nicholson, Ainsley; Brown, June M

    2013-03-01

    Five nocardioform isolates from human clinical sources were evaluated. Analysis of the nearly full-length 16S rRNA gene showed 99.9-100 % similarity among the strains. The results of a comparative phylogenetic analysis of the 16S rRNA gene sequences indicated that the isolates belonged to the genus Nocardia. Phenotypic and molecular analyses were performed on the clinical isolates. Traditional phenotypic analyses included morphological, biochemical/physiological, chemotaxonomic and antimicrobial susceptibility profiling. Molecular studies included 1441-bp 16S rRNA and 1246-bp gyrB gene sequence analyses, as well as DNA-DNA hybridizations. Biochemical analysis failed to differentiate the putative novel species from its phylogenetic neighbours; however, molecular studies were able to distinguish the patient strains and confirm them as members of a single species. Based on 16S rRNA gene sequence analysis, similarity between the isolates and their closest relatives (type strains of Nocardia araoensis, N. arthritidis, N. beijingensis and N. niwae) was ≤99.3 %. Analysis of partial gyrB gene sequences showed 98-99.7 % relatedness among the isolates. Nocardia lijiangensis and N. xishanensis were the closest related species to the isolates based on gyrB gene sequence analysis, and their type strains showed 95.7 and 95.3 % similarity, respectively, to strain W9988(T). Resistance to amikacin and molecular analyses, including DNA-DNA hybridization, distinguished the five patient strains from their phylogenetic neighbours, and the results of this polyphasic study indicated the existence of a novel species of Nocardia, for which we propose the name Nocardia amikacinitolerans sp. nov., with strain W9988(T) ( = DSM 45539(T)  = CCUG 59655(T)) as the type strain.

  5. Antigenic Relationships among Human Pathogenic Orientia tsutsugamushi Isolates from Thailand.

    Directory of Open Access Journals (Sweden)

    Sarah L James

    2016-06-01

    Full Text Available Scrub typhus is a common cause of undiagnosed febrile illness in certain tropical regions, but can be easily treated with antibiotics. The causative agent, Orientia tsutsugamushi, is antigenically variable which complicates diagnosis and efforts towards vaccine development.This study aimed to dissect the antigenic and genetic relatedness of O. tsutsugamushi strains and investigate sero-diagnostic reactivities by titrating individual patient sera against their O. tsutsugamushi isolates (whole-cell antigen preparation, in homologous and heterologous serum-isolate pairs from the same endemic region in NE Thailand. The indirect immunofluorescence assay was used to titrate Orientia tsutsugamushi isolates and human sera, and a mathematical technique, antigenic cartography, was applied to these data to visualise the antigenic differences and cross-reactivity between strains and sera. No functional or antigen-specific analyses were performed. The antigenic variation found in clinical isolates was much less pronounced than the genetic differences found in the 56kDa type-specific antigen genes. The Karp-like sera were more broadly reactive than the Gilliam-like sera.Antigenic cartography worked well with scrub typhus indirect immunofluorescence titres. The data from humoral responses suggest that a Karp-like strain would provide broader antibody cross-reactivity than a Gilliam-like strain. Although previous exposure to O. tsutsugamushi could not be ruled out, scrub typhus patient serum antibody responses were characterised by strong homologous, but weak heterologous antibody titres, with little evidence for cross-reactivity by Gilliam-like sera, but a broader response from some Karp-like sera. This work highlights the importance of antigenic variation in O. tsutsugamushi diagnosis and determination of new serotypes.

  6. Genome-wide characterization of vibrio phage ϕpp2 with unique arrangements of the mob-like genes

    Directory of Open Access Journals (Sweden)

    Lin Ying-Rong

    2012-06-01

    Full Text Available Abstract Background Vibrio parahaemolyticus is associated with gastroenteritis, wound infections, and septicemia in human and animals. Phages can control the population of the pathogen. So far, the only one reported genome among giant vibriophages is KVP40: 244,835 bp with 26% coding regions that have T4 homologs. Putative homing endonucleases (HE were found in Vibrio phage KVP40 bearing one segD and Vibrio cholerae phage ICP1 carrying one mobC/E and one segG. Results A newly isolated Vibrio phage ϕpp2, which was specific to the hosts of V. parahaemolyticus and V. alginolyticus, featured a long nonenveloped head of ~90 × 150 nm and tail of ~110 nm. The phage can survive at 50°C for more than one hour. The genome of the phage ϕpp2 was sequenced to be 246,421 bp, which is 1587 bp larger than KVP40. 383 protein-encoding genes (PEGs and 30 tRNAs were found in the phage ϕpp2. Between the genomes of ϕpp2 and KVP40, 254 genes including 29 PEGs for viral structure were of high similarity, whereas 17 PEGs of KVP40 and 21 PEGs of ϕpp2 were unmatched. In both genomes, the capsid and tail genes have been identified, as well as the extensive representation of the DNA replication, recombination, and repair enzymes. In addition to the three giant indels of 1098, 1143 and 3330 nt, ϕpp2 possessed unique proteins involved in potassium channel, gp2 (DNA end protector, tRNA nucleotidyltransferase, and mob-type HEs, which were not reported in KVP40. The ϕpp2 PEG274, with strong promoters and translational initiation, was identified to be a mobE type, flanked by NrdA and NrdB/C homologs. Coincidently, several pairs of HE-flanking homologs with empty center were found in the phages of Vibrio phages ϕpp2 and KVP40, as well as in Aeromonas phages (Aeh1 and Ae65, and cyanophage P-SSM2. Conclusions Vibrio phage ϕpp2 was characterized by morphology, growth, and genomics with three giant indels and different types of HEs. The gene analysis on the required

  7. wKinMut-2: Identification and Interpretation of Pathogenic Variants in Human Protein Kinases

    DEFF Research Database (Denmark)

    Vazquez, Miguel; Pons, Tirso; Brunak, Søren

    2016-01-01

    forest approach. To understand the biological mechanisms causative of human diseases and cancer, information from pertinent reference knowledgebases and the literature is automatically mined, digested and homogenized. Variants are visualized in their structural contexts and residues affecting catalytic...... is often scattered across different sources, which makes the integrative analysis complex and laborious. wKinMut-2 constitutes a solution to facilitate the interpretation of the consequences of human protein kinase variation. Nine methods predict their pathogenicity, including a kinase-specific random...

  8. Exserohilum rostratum: characterization of a cross-kingdom pathogen of plants and humans.

    Directory of Open Access Journals (Sweden)

    Kalpana Sharma

    Full Text Available Pathogen host shifts represent a major source of new infectious diseases. There are several examples of cross-genus host jumps that have caused catastrophic epidemics in animal and plant species worldwide. Cross-kingdom jumps are rare, and are often associated with nosocomial infections. Here we provide an example of human-mediated cross-kingdom jumping of Exserohilum rostratum isolated from a patient who had received a corticosteroid injection and died of fungal meningitis in a Florida hospital in 2012. The clinical isolate of E. rostratum was compared with two plant pathogenic isolates of E. rostratum and an isolate of the closely related genus Bipolaris in terms of morphology, phylogeny, and pathogenicity on one C3 grass, Gulf annual rye grass (Lolium multiflorum, and two C4 grasses, Japanese stilt grass (Microstegium vimineum and bahia grass (Paspalum notatum. Colony growth and color, as well as conidia shape and size were the same for the clinical and plant isolates of E. rostratum, while these characteristics differed slightly for the Bipolaris sp. isolate. The plant pathogenic and clinical isolates of E. rostratum were indistinguishable based on morphology and ITS and 28S rDNA sequence analysis. The clinical isolate was as pathogenic to all grass species tested as the plant pathogenic strains that were originally isolated from plant hosts. The clinical isolate induced more severe symptoms on stilt grass than on rye grass, while this was the reverse for the plant isolates of E. rostratum. The phylogenetic similarity between the clinical and plant-associated E. rostratum isolates and the ability of the clinical isolate to infect plants suggests that a plant pathogenic strain of E. rostratum contaminated the corticosteroid injection fluid and was able to cause systemic disease in the affected patient. This is the first proof that a clinical isolate of E. rostratum is also an effective plant pathogen.

  9. Streptococcus suis: an important zoonotic pathogen for human – prevention aspects

    Directory of Open Access Journals (Sweden)

    VG Papatsiros

    2011-10-01

    Full Text Available Streptococcus suis is a major porcine pathogen, causing economical health worldwide problems in the global swine industry. It is also emerging as a zoonotic agent capable of causing severe invasive disease in humans exposed to pigs or pork products. The most important clinical sign in swine and human is meningitis, but other pathological conditions have also been described. Serotype 2 is the most commonly associated with diseases in pigs and humans, and also the most frequently reported serotype isolated from diseased animals worldwide. The majority of human infection occurs in pork handlers, particularly in slaughterhouse workers and by minor wounds or skin abrasions contaminated by raw pork or viscera of pigs. Veterinarians should also be aware that a low but real risk may be present when manipulating S. suis-diseased animals that are probably shedding high numbers of this pathogen. Up today, in Greece there is no published epidemiological data for S. suis serotypes in swine herds and the zoonotic risk of S. suis infection in human with daily contact with pigs and pork meat. However, in our experience clinical forms of S. suis infection are common in most greek swine farms. The aim of this review study is to perform recent information about S. suis infection in swine and human, focus on zoonotic risk of this emerging pathogen and prevention strategies. [Vet. World 2011; 4(5.000: 216-221

  10. Development of a loop-mediated Isothermal amplification assay for sensitive and rapid detection of Vibrio parahaemolyticus

    Directory of Open Access Journals (Sweden)

    Kawahara Ryuji

    2008-09-01

    Full Text Available Abstract Background Vibrio parahaemolyticus is a marine seafood-borne pathogen causing gastrointestinal disorders in humans. Thermostable direct hemolysin (TDH and TDH-related hemolysin (TRH are known as major virulence determinants of V. parahaemolyticus. Most V. parahaemolyticus isolates from the environment do not produce TDH or TRH. Total V. parahaemolyticus has been used as an indicator for control of seafood contamination toward prevention of infection. Detection of total V. parahaemolyticus using conventional culture- and biochemical-based assays is time-consuming and laborious, requiring more than three days. Thus, we developed a novel and highly specific loop-mediated isothermal amplification (LAMP assay for the sensitive and rapid detection of Vibrio parahaemolyticus. Results The assay provided markedly more sensitive and rapid detection of V. parahaemolyticus strains than conventional biochemical and PCR assays. The assay correctly identified 143 V. parahaemolyticus strains, but did not detect 33 non-parahaemolyticus Vibrio and 56 non-Vibrio strains. Sensitivity of the LAMP assay for direct detection of V. parahaemolyticus in pure cultures and in spiked shrimp samples was 5.3 × 102 CFU per ml/g (2.0 CFU per reaction. The sensitivity of the LAMP assay was 10-fold more sensitive than that of the conventional PCR assay. The LAMP assay was markedly faster, requiring for amplification 13–22 min in a single colony on TCBS agar from each of 143 V. parahaemolyticus strains and less than 35 min in spiked shrimp samples. The LAMP assay for detection of V. parahaemolyticus required less than 40 min in a single colony on thiosulfate citrate bile salt sucrose (TCBS agar and 60 min in spiked shrimp samples from the beginning of DNA extraction to final determination. Conclusion The LAMP assay is a sensitive, rapid and simple tool for the detection of V. parahaemolyticus and will facilitate the surveillance for control of contamination of V

  11. Molecular Mechanisms of Bacterial Pathogenicity

    Science.gov (United States)

    Fuchs, Thilo Martin

    Cautious optimism has arisen over recent decades with respect to the long struggle against bacteria, viruses, and parasites. This has been offset, however, by a fatal complacency stemming from previous successes such as the development of antimicrobial drugs, the eradication of smallpox, and global immunization programs. Infectious diseases nevertheless remain the world's leading cause of death, killing at least 17 million persons annually [61]. Diarrheal diseases caused by Vibrio cholerae or Shigella dysenteriae kill about 3 million persons every year, most of them young children: Another 4 million die of tuberculosis or tetanus. Outbreaks of diphtheria in Eastern Europe threatens the population with a disease that had previously seemed to be overcome. Efforts to control infectious diseases more comprehensively are undermined not only by socioeconomic conditions but also by the nature of the pathogenic organisms itself; some isolates of Staphylococcus aureus and Enterobacter have become so resistant to drugs by horizontal gene transfer that they are almost untreatable. In addition, the mechanism of genetic variability helps pathogens to evade the human immune system, thus compromising the development of powerful vaccines. Therefore detailed knowledge of the molecular mechanisms of microbial pathogenicity is absolutely necessary to develop new strategies against infectious diseases and thus to lower their impact on human health and social development.

  12. New human pathogenic dengue like virus infections (Zika, Alkhumraand Mayaro viruses: a short review

    Directory of Open Access Journals (Sweden)

    Sora Yasri

    2015-06-01

    Full Text Available Dengue is an important pathogenic arbovirus that causes acute febrile illness with hemorrhagic complication. This disease is an important tropical disease that is the present public health threat. To diagnose dengue, it is usually based on clinical diagnosis. However, there are many dengues like infections that can be easily missed diagnosed. In the past decades, there are many new emerging dengues like infections that should be mentioned. Here, the authors briefly review on 2 important new human pathogenic dengue like virus infections (Zika, Alkhumra and Mayaro viruses.

  13. Galleria mellonella as a model host for human pathogens: recent studies and new perspectives.

    Science.gov (United States)

    Junqueira, Juliana Campos

    2012-10-01

    The number of studies using G. mellonella as a model host for human pathogens has increased significantly in the last few years. Important studies were published from different countries for evaluating the pathogenesis of bacterial and fungal infections and for exploring the host defenses against pathogens. Therefore, standardized conditions for the use of G. melonella larvae need to be established. Recent research showed that the deprivation of G. mellonella larvae of food during the experiment caused a reduction in immune responses and an increased susceptibility to infection, suggesting that incubating of larvae in the presence or absence of nutrition may affect the results and comparisons among different laboratories.

  14. New insight into bacterial zoonotic pathogens posing health hazards to humans

    Directory of Open Access Journals (Sweden)

    Marcin Ciszewski

    2014-12-01

    Full Text Available This article presents the problem of evolutionary changes of zoonotic pathogens responsible for human diseases. Everyone is exposed to the risk of zoonotic infection, particularly employees having direct contact with animals, i.e. veterinarians, breeders, butchers and workers of animal products’ processing industry. The article focuses on pathogens monitored by the European Centre for Disease Prevention and Control (ECDC, which has been collecting statistical data on zoonoses from all European Union countries for 19 years and publishing collected data in annual epidemiological reports. Currently, the most important 11 pathogens responsible for causing human zoonotic diseases are being monitored, of which seven are bacteria: Salmonella spp., Campylobacter spp., Listeria monocytogenes, Mycobacterium bovis, Brucella spp., Coxiella burnetti and Verotoxin- producing E. coli (VTEC / Shiga-like toxin producing E. coli (STEC. As particularly important are considered foodborne pathogens. The article also includes new emerging zoonotic bacteria, which are not currently monitored by ECDC but might pose a serious epidemiological problem in a foreseeable future: Streptococcus iniae, S. suis, S. dysgalactiae and staphylococci: Staphylococcus intermedius, S. pseudintermedius. Those species have just crossed the animal-human interspecies barrier. The exact mechanism of this phenomenon remains unknown, it is connected, however, with genetic variability, capability to survive in changing environment. These abilities derive from DNA rearrangement and horizontal gene transfer between bacterial cells. Substantial increase in the number of scientific publications on this subject, observed over the last few years, illustrates the importance of the problem. Med Pr 2014;65(6:819–829

  15. 76 FR 30705 - Problem Formulation for Human Health Risk Assessments of Pathogens in Land-Applied Biosolids

    Science.gov (United States)

    2011-05-26

    ... AGENCY Problem Formulation for Human Health Risk Assessments of Pathogens in Land-Applied Biosolids... the availability of a final report titled, ``Problem Formulation for Human Health Risk Assessments of... health risk assessments on potential pathogens in land-applied biosolids. The document does not represent...

  16. IN VITRO ANTAGONISTIC ACTIVITIES OF INDONESIAN MARINE SPONGE AAPTOS AAPTOS AND CALLYSPONGIA PSEUDORETICULATA EXTRACTS AND THEIR TOXICITY AGAINST Vibrio spp.

    Directory of Open Access Journals (Sweden)

    Rosmiati Rosmiati

    2011-12-01

    Full Text Available Vibriosis is one of diseases which often results in mass mortality of Penaeus monodon larval rearing systems. It attacks shrimp of all stages in zoea, mysis and shrimp postlarva stage. This disease is caused by Vibrio spp, particularly Vibrio harveyi (a luminescent bacterium. Several kinds of antibiotics and chemical material have been used to overcome the disease but they have side effects to environment and human. The searching of bioactive compounds as an alternative treatment has been done for multi purposes. In this study diethyl eter, butanol and aqueous extract of Indonesian sponges Aaptos aaptos and Callyspongia pseudoreticulata were tested for in vitro activity against Vibrio spp. and Vibrio harveyi by using disc diffusion method. The result showed that all extracts of Aaptos aaptos gave a positive antibacterial activity towards those pathogenic bacteria. Meanwhile, only butanol extract of Callyspongia pseudoreticulata obtained to exhibit an antibacterial activity on those pathogenic bacteria. The strong anti-vibrio activity were shown by butanol and aqueous extract of Aaptos aaptos with the minimum inhibitory concentration (MIC value of 0.313 and 0.625 mg/mL, respectively. Whilst, the butanol extract of Callyspongia pseudoreticulata indicated a low antibacterial activity with the MIC value of 10 mg/mL. Toxicity of those active extracts was evaluated by Brine Shrimp Lethality Test (BST. Interestingly, butanol and aqueous extracts of Aaptos aaptos did not show any toxic effect in Artemia salina larvae up to 8 x MIC (2.504 mg/mL and 5.000 mg/mL. It is the first report for the anti-vibr io activity of both Aaptos aaptos and Callyspongia pseudoreticulata. This results suggest that Aaptos aaptos has a potential to be used as a source of alternative compound to vibriosis prevention for mariculture.

  17. Human milk blocks DC-SIGN - pathogen interaction via MUC1

    Directory of Open Access Journals (Sweden)

    Nathalie eKoning

    2015-03-01

    Full Text Available Beneficial effects of breastfeeding are well-recognized and include both immediate neonatal protection against pathogens, as well as long term protection against allergies and autoimmune diseases. Although several proteins have been identified to have anti-viral or anti-bacterial effects like secretory IgA or lactoferrin, the mechanisms of immune modulation are not fully understood. Recent studies identified important beneficial effects of glycans in human milk, such as those expressed in oligosaccharides or on glycoproteins. Glycans are recognized by the carbohydrate receptors C-type lectins on DC and specific tissue macrophages, which exert important functions in immune modulation and immune homeostasis. A well-characterized C-type lectin is DC-SIGN, which binds terminal fucose. The present study shows that in human milk, MUC1 is the major milk glycoprotein that binds to the lectin domain of DC-SIGN and prevents pathogen interaction through the presence of Lewis x-type oligosaccharides. Surprisingly, this was specific for human milk, as formula, bovine or camel milk did not show any presence of proteins that interacted with DC-SIGN. The expression of DC-SIGN is found in young infants along the entire gastro-intestinal tract. Our data thus suggest the importance of human milk glycoproteins for blocking pathogen interaction to DC in young children. Moreover, a potential benefit of human milk later in life in shaping the infants immune system through DC-SIGN cannot be ruled out.

  18. Image-based Analysis to Study Plant Infection with Human Pathogens.

    Science.gov (United States)

    Schikora, Marek; Schikora, Adam

    2014-11-01

    Our growing awareness that contaminated plants, fresh fruits and vegetables are responsible for a significant proportion of food poisoning with pathogenic microorganisms indorses the demand to understand the interactions between plants and human pathogens. Today we understand that those pathogens do not merely survive on or within plants, they actively infect plant organisms by suppressing their immune system. Studies on the infection process and disease development used mainly physiological, genetic, and molecular approaches, and image-based analysis provides yet another method for this toolbox. Employed as an observational tool, it bears the potential for objective and high throughput approaches, and together with other methods it will be very likely a part of data fusion approaches in the near future.

  19. Image-based Analysis to Study Plant Infection with Human Pathogens

    Directory of Open Access Journals (Sweden)

    Marek Schikora

    2014-11-01

    Full Text Available Our growing awareness that contaminated plants, fresh fruits and vegetables are responsible for a significant proportion of food poisoning with pathogenic microorganisms indorses the demand to understand the interactions between plants and human pathogens. Today we understand that those pathogens do not merely survive on or within plants, they actively infect plant organisms by suppressing their immune system. Studies on the infection process and disease development used mainly physiological, genetic, and molecular approaches, and image-based analysis provides yet another method for this toolbox. Employed as an observational tool, it bears the potential for objective and high throughput approaches, and together with other methods it will be very likely a part of data fusion approaches in the near future.

  20. Arbovirus infection in humans in NSW: seroprevalence and pathogenicity of certain Australian bunyaviruses.

    Science.gov (United States)

    Boughton, C R; Hawkes, R A; Naim, H M

    1990-02-01

    A sero epidemiological study was carried out on human sera from all regions of New South Wales for the presence of antibodies to nine bunyaviruses viz Aino, Akabane, Belmont, Gan Gan, Kowanyama, mapputta, Peaton, Tinaroo, Trubanaman and the orbivirus Corriparta. Neutralising antibodies were found in titres up to 1280 to Gan Gan and to 640 to Trubanaman viruses, prevalences 4.7% and 1.4% respectively. Neutralisation titres up to 40 were found to Belmont, Aino, Peaton and Corriparta viruses but the significance of these is uncertain since they may represent either non-specific inhibitors or cross reacting antibodies to related but currently unknown viruses. No antibodies were found to Akabane, Kowanyama, Mapputta or Tinaroo viruses in New South Wales sera. Gan Gan virus appeared to be pathogenic for man being associated with an acute epidemic polyarthritic like illness. Trubanaman virus is suspected of being pathogenic. This is the first report of the pathogenicity of these Australian bunyaviruses.

  1. Detection of Pathogenic Organisms in Food, Water and Body (Postprint)

    Science.gov (United States)

    2002-06-27

    originally cloned from the marine bacterium Vibrio fischeri . The bioluminescent (lux) genes from bacteria have been genetically and biochemically...bacteriophage specific for pathogenic bacteria. The bioreporter design will incorporate a lux gene from Vibrio fischeri into the genome of the

  2. Transcriptome Remodeling Contributes to Epidemic Disease Caused by the Human Pathogen Streptococcus pyogenes.

    Science.gov (United States)

    Beres, Stephen B; Kachroo, Priyanka; Nasser, Waleed; Olsen, Randall J; Zhu, Luchang; Flores, Anthony R; de la Riva, Ivan; Paez-Mayorga, Jesus; Jimenez, Francisco E; Cantu, Concepcion; Vuopio, Jaana; Jalava, Jari; Kristinsson, Karl G; Gottfredsson, Magnus; Corander, Jukka; Fittipaldi, Nahuel; Di Luca, Maria Chiara; Petrelli, Dezemona; Vitali, Luca A; Raiford, Annessa; Jenkins, Leslie; Musser, James M

    2016-05-31

    For over a century, a fundamental objective in infection biology research has been to understand the molecular processes contributing to the origin and perpetuation of epidemics. Divergent hypotheses have emerged concerning the extent to which environmental events or pathogen evolution dominates in these processes. Remarkably few studies bear on this important issue. Based on population pathogenomic analysis of 1,200 Streptococcus pyogenes type emm89 infection isolates, we report that a series of horizontal gene transfer events produced a new pathogenic genotype with increased ability to cause infection, leading to an epidemic wave of disease on at least two continents. In the aggregate, these and other genetic changes substantially remodeled the transcriptomes of the evolved progeny, causing extensive differential expression of virulence genes and altered pathogen-host interaction, including enhanced immune evasion. Our findings delineate the precise molecular genetic changes that occurred and enhance our understanding of the evolutionary processes that contribute to the emergence and persistence of epidemically successful pathogen clones. The data have significant implications for understanding bacterial epidemics and for translational research efforts to blunt their detrimental effects. The confluence of studies of molecular events underlying pathogen strain emergence, evolutionary genetic processes mediating altered virulence, and epidemics is in its infancy. Although understanding these events is necessary to develop new or improved strategies to protect health, surprisingly few studies have addressed this issue, in particular, at the comprehensive population genomic level. Herein we establish that substantial remodeling of the transcriptome of the human-specific pathogen Streptococcus pyogenes by horizontal gene flow and other evolutionary genetic changes is a central factor in precipitating and perpetuating epidemic disease. The data unambiguously show that

  3. UV light inactivation of human and plant pathogens in unfiltered surface irrigation water.

    Science.gov (United States)

    Jones, Lisa A; Worobo, Randy W; Smart, Christine D

    2014-02-01

    Fruit and vegetable growers continually battle plant diseases and food safety concerns. Surface water is commonly used in the production of fruits and vegetables and can harbor both human- and plant-pathogenic microorganisms that can contaminate crops when used for irrigation or other agricultural purposes. Treatment methods for surface water are currently limited, and there is a need for suitable treatment options. A liquid-processing unit that uses UV light for the decontamination of turbid juices was analyzed for its efficacy in the treatment of surface waters contaminated with bacterial or oomycete pathogens, i.e., Escherichia coli, Salmonella enterica, Listeria monocytogenes, Clavibacter michiganensis subsp. michiganensis, Pseudomonas syringae pv. tomato, and Phytophthora capsici. Five-strain cocktails of each pathogen, containing approximately 10(8) or 10(9) CFU/liter for bacteria or 10(4) or 10(5) zoospores/liter for Ph. capsici, were inoculated into aliquots of two turbid surface water irrigation sources and processed with the UV unit. Pathogens were enumerated before and after treatment. In general, as the turbidity of the water source increased, the effectiveness of the UV treatment decreased, but in all cases, 99.9% or higher inactivation was achieved. Log reductions ranged from 10.0 to 6.1 and from 5.0 to 4.2 for bacterial pathogens and Ph. capsici, respectively.

  4. A novel system of cytoskeletal elements in the human pathogen Helicobacter pylori.

    Directory of Open Access Journals (Sweden)

    Barbara Waidner

    2009-11-01

    Full Text Available Pathogenicity of the human pathogen Helicobacter pylori relies upon its capacity to adapt to a hostile environment and to escape from the host response. Therefore, cell shape, motility, and pH homeostasis of these bacteria are specifically adapted to the gastric mucus. We have found that the helical shape of H. pylori depends on coiled coil rich proteins (Ccrp, which form extended filamentous structures in vitro and in vivo, and are differentially required for the maintenance of cell morphology. We have developed an in vivo localization system for this pathogen. Consistent with a cytoskeleton-like structure, Ccrp proteins localized in a regular punctuate and static pattern within H. pylori cells. Ccrp genes show a high degree of sequence variation, which could be the reason for the morphological diversity between H. pylori strains. In contrast to other bacteria, the actin-like MreB protein is dispensable for viability in H. pylori, and does not affect cell shape, but cell length and chromosome segregation. In addition, mreB mutant cells displayed significantly reduced urease activity, and thus compromise a major pathogenicity factor of H. pylori. Our findings reveal that Ccrp proteins, but not MreB, affect cell morphology, while both cytoskeletal components affect the development of pathogenicity factors and/or cell cycle progression.

  5. Misidentification of Vibrio cholerae O155 isolated from imported shrimp as O serogroup O139 due to cross-agglutination with commercial O139 antisera

    DEFF Research Database (Denmark)

    Dalsgaard, A.; Mazur, J.; Dalsgaard, Inger

    2002-01-01

    Fish and shellfish products imported into Denmark are routinely analyzed for pathogenic Vibrio spp., particularly Vibrio cholerae, if products originate from subtropical or tropical areas. A V. cholerae strain that agglutinated commercial O139 antiserum but not the O1, Inaba, or Ogawa antisera...

  6. Identification of tick-borne pathogens in ticks feeding on humans in Turkey.

    Science.gov (United States)

    Orkun, Ömer; Karaer, Zafer; Çakmak, Ayşe; Nalbantoğlu, Serpil

    2014-08-01

    The importance of tick-borne diseases is increasing all over the world, including Turkey. The tick-borne disease outbreaks reported in recent years and the abundance of tick species and the existence of suitable habitats increase the importance of studies related to the epidemiology of ticks and tick-borne pathogens in Turkey. The aim of this study was to investigate the presence of and to determine the infection rates of some tick-borne pathogens, including Babesia spp., Borrelia burgdorferi sensu lato and spotted fever group rickettsiae in the ticks removed from humans in different parts of Ankara. A total of 169 ticks belonging to the genus Haemaphysalis, Hyalomma, Ixodes and Rhipicephalus were collected by removing from humans in different parts of Ankara. Ticks were molecularly screened for Babesia spp., Borrelia burgdorferi sensu lato and spotted fever group rickettsiae by PCR and sequencing analysis. We detected 4 Babesia spp.; B. crassa, B. major, B. occultans and B. rossi, one Borrelia spp.; B. burgdorferi sensu stricto and 3 spotted fever group rickettsiae; R. aeschlimannii, R. slovaca and R. hoogstraalii in the tick specimens analyzed. This is the report showing the presence of B. rossi in a region that is out of Africa and in the host species Ha. parva. In addition, B. crassa, for which limited information is available on its distribution and vector species, and B. occultans, for which no conclusive information is available on its presence in Turkey, were identified in Ha. parva and H. marginatum, respectively. Two human pathogenic rickettsia species (R. aeschlimannii and R. slovaca) were detected with a high prevalence in ticks. Additionally, B. burgdorferi sensu stricto was detected in unusual tick species (H. marginatum, H. excavatum, Hyalomma spp. (nymph) and Ha. parva). This study investigates both the distribution of several tick-borne pathogens affecting humans and animals, and the presence of new tick-borne pathogens in Turkey. More

  7. Identification of tick-borne pathogens in ticks feeding on humans in Turkey.

    Directory of Open Access Journals (Sweden)

    Ömer Orkun

    2014-08-01

    Full Text Available The importance of tick-borne diseases is increasing all over the world, including Turkey. The tick-borne disease outbreaks reported in recent years and the abundance of tick species and the existence of suitable habitats increase the importance of studies related to the epidemiology of ticks and tick-borne pathogens in Turkey. The aim of this study was to investigate the presence of and to determine the infection rates of some tick-borne pathogens, including Babesia spp., Borrelia burgdorferi sensu lato and spotted fever group rickettsiae in the ticks removed from humans in different parts of Ankara.A total of 169 ticks belonging to the genus Haemaphysalis, Hyalomma, Ixodes and Rhipicephalus were collected by removing from humans in different parts of Ankara. Ticks were molecularly screened for Babesia spp., Borrelia burgdorferi sensu lato and spotted fever group rickettsiae by PCR and sequencing analysis. We detected 4 Babesia spp.; B. crassa, B. major, B. occultans and B. rossi, one Borrelia spp.; B. burgdorferi sensu stricto and 3 spotted fever group rickettsiae; R. aeschlimannii, R. slovaca and R. hoogstraalii in the tick specimens analyzed. This is the report showing the presence of B. rossi in a region that is out of Africa and in the host species Ha. parva. In addition, B. crassa, for which limited information is available on its distribution and vector species, and B. occultans, for which no conclusive information is available on its presence in Turkey, were identified in Ha. parva and H. marginatum, respectively. Two human pathogenic rickettsia species (R. aeschlimannii and R. slovaca were detected with a high prevalence in ticks. Additionally, B. burgdorferi sensu stricto was detected in unusual tick species (H. marginatum, H. excavatum, Hyalomma spp. (nymph and Ha. parva.This study investigates both the distribution of several tick-borne pathogens affecting humans and animals, and the presence of new tick-borne pathogens in Turkey

  8. Signatures of environmental genetic adaptation pinpoint pathogens as the main selective pressure through human evolution.

    Directory of Open Access Journals (Sweden)

    Matteo Fumagalli

    2011-11-01

    Full Text Available Previous genome-wide scans of positive natural selection in humans have identified a number of non-neutrally evolving genes that play important roles in skin pigmentation, metabolism, or immune function. Recent studies have also shown that a genome-wide pattern of local adaptation can be detected by identifying correlations between patterns of allele frequencies and environmental variables. Despite these observations, the degree to which natural selection is primarily driven by adaptation to local environments, and the role of pathogens or other ecological factors as selective agents, is still under debate. To address this issue, we correlated the spatial allele frequency distribution of a large sample of SNPs from 55 distinct human populations to a set of environmental factors that describe local geographical features such as climate, diet regimes, and pathogen loads. In concordance with previous studies, we detected a significant enrichment of genic SNPs, and particularly non-synonymous SNPs associated with local adaptation. Furthermore, we show that the diversity of the local pathogenic environment is the predominant driver of local adaptation, and that climate, at least as measured here, only plays a relatively minor role. While background demography by far makes the strongest contribution in explaining the genetic variance among populations, we detected about 100 genes which show an unexpectedly strong correlation between allele frequencies and pathogenic environment, after correcting for demography. Conversely, for diet regimes and climatic conditions, no genes show a similar correlation between the environmental factor and allele frequencies. This result is validated using low-coverage sequencing data for multiple populations. Among the loci targeted by pathogen-driven selection, we found an enrichment of genes associated to autoimmune diseases, such as celiac disease, type 1 diabetes, and multiples sclerosis, which lends credence to the

  9. Signatures of environmental genetic adaptation pinpoint pathogens as the main selective pressure through human evolution.

    Science.gov (United States)

    Fumagalli, Matteo; Sironi, Manuela; Pozzoli, Uberto; Ferrer-Admetlla, Anna; Ferrer-Admettla, Anna; Pattini, Linda; Nielsen, Rasmus

    2011-11-01

    Previous genome-wide scans of positive natural selection in humans have identified a number of non-neutrally evolving genes that play important roles in skin pigmentation, metabolism, or immune function. Recent studies have also shown that a genome-wide pattern of local adaptation can be detected by identifying correlations between patterns of allele frequencies and environmental variables. Despite these observations, the degree to which natural selection is primarily driven by adaptation to local environments, and the role of pathogens or other ecological factors as selective agents, is still under debate. To address this issue, we correlated the spatial allele frequency distribution of a large sample of SNPs from 55 distinct human populations to a set of environmental factors that describe local geographical features such as climate, diet regimes, and pathogen loads. In concordance with previous studies, we detected a significant enrichment of genic SNPs, and particularly non-synonymous SNPs associated with local adaptation. Furthermore, we show that the diversity of the local pathogenic environment is the predominant driver of local adaptation, and that climate, at least as measured here, only plays a relatively minor role. While background demography by far makes the strongest contribution in explaining the genetic variance among populations, we detected about 100 genes which show an unexpectedly strong correlation between allele frequencies and pathogenic environment, after correcting for demography. Conversely, for diet regimes and climatic conditions, no genes show a similar correlation between the environmental factor and allele frequencies. This result is validated using low-coverage sequencing data for multiple populations. Among the loci targeted by pathogen-driven selection, we found an enrichment of genes associated to autoimmune diseases, such as celiac disease, type 1 diabetes, and multiples sclerosis, which lends credence to the hypothesis that some

  10. Human and Pathogen Factors Associated with Chlamydia trachomatis-Related Infertility in Women

    Science.gov (United States)

    Menon, S.; Timms, P.; Allan, J. A.; Alexander, K.; Rombauts, L.; Horner, P.; Keltz, M.; Hocking, J.

    2015-01-01

    SUMMARY Chlamydia trachomatis is the most common bacterial sexually transmitted pathogen worldwide. Infection can result in serious reproductive pathologies, including pelvic inflammatory disease, ectopic pregnancy, and infertility, in women. However, the processes that result in these reproductive pathologies have not been well defined. Here we review the evidence for the human disease burden of these chlamydial reproductive pathologies. We then review human-based evidence that links Chlamydia with reproductive pathologies in women. We present data supporting the idea that host, immunological, epidemiological, and pathogen factors may all contribute to the development of infertility. Specifically, we review the existing evidence that host and pathogen genotypes, host hormone status, age of sexual debut, sexual behavior, coinfections, and repeat infections are all likely to be contributory factors in development of infertility. Pathogen factors such as infectious burden, treatment failure, and tissue tropisms or ascension capacity are also potential contributory factors. We present four possible processes of pathology development and how these processes are supported by the published data. We highlight the limitations of the evidence and propose future studies that could improve our understanding of how chlamydial infertility in women occurs and possible future interventions to reduce this disease burden. PMID:26310245

  11. Human and Pathogen Factors Associated with Chlamydia trachomatis-Related Infertility in Women.

    Science.gov (United States)

    Menon, S; Timms, P; Allan, J A; Alexander, K; Rombauts, L; Horner, P; Keltz, M; Hocking, J; Huston, W M

    2015-10-01

    Chlamydia trachomatis is the most common bacterial sexually transmitted pathogen worldwide. Infection can result in serious reproductive pathologies, including pelvic inflammatory disease, ectopic pregnancy, and infertility, in women. However, the processes that result in these reproductive pathologies have not been well defined. Here we review the evidence for the human disease burden of these chlamydial reproductive pathologies. We then review human-based evidence that links Chlamydia with reproductive pathologies in women. We present data supporting the idea that host, immunological, epidemiological, and pathogen factors may all contribute to the development of infertility. Specifically, we review the existing evidence that host and pathogen genotypes, host hormone status, age of sexual debut, sexual behavior, coinfections, and repeat infections are all likely to be contributory factors in development of infertility. Pathogen factors such as infectious burden, treatment failure, and tissue tropisms or ascension capacity are also potential contributory factors. We present four possible processes of pathology development and how these processes are supported by the published data. We highlight the limitations of the evidence and propose future studies that could improve our understanding of how chlamydial infertility in women occurs and possible future interventions to reduce this disease burden. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  12. [Human plague and pneumonic plague : pathogenicity, epidemiology, clinical presentations and therapy].

    Science.gov (United States)

    Riehm, Julia M; Löscher, Thomas

    2015-07-01

    Yersinia pestis is a highly pathogenic gram-negative bacterium and the causative agent of human plague. In the last 1500 years and during three dreaded pandemics, millions of people became victims of Justinian's plague, the Black Death, or modern plague. Today, Y. pestis is endemic in natural foci of Asian, African and American countries. Due to its broad dissemination in mammal species and fleas, eradication of the pathogen will not be possible in the near future. In fact, plague is currently classified as a "re-emerging disease". Infection may occur after the bite of an infected flea, but also after oral ingestion or inhalation of the pathogen. The clinical presentations comprise the bubonic and pneumonic form, septicemia, rarely pharyngitis, and meningitis. Most human cases can successfully be treated with antibiotics. However, the high transmission rate and lethality of pneumonic plague require international and mandatory case notification and quarantine of patients. Rapid diagnosis, therapy and barrier nursing are not only crucial for the individual patient but also for the prevention of further spread of the pathogen or of epidemics. Therefore, WHO emergency schedules demand the isolation of cases, identification and surveillance of contacts as well as control of zoonotic reservoir animals and vectors. These sanctions and effective antibiotic treatment usually allow a rapid containment of outbreaks. However, multiple antibiotic resistant strains of Y. pestis have been isolated from patients in the past. So far, no outbreaks with such strains have been reported.

  13. BIOFILM FORMATION OF Vibrio cholerae ON STAINLESS STEEL USED IN FOOD PROCESSING

    Directory of Open Access Journals (Sweden)

    Milagro FERNÁNDEZ-DELGADO

    2016-01-01

    Full Text Available Vibrio cholerae represents a significant threat to human health in developing countries. This pathogen forms biofilms which favors its attachment to surfaces and its survival and transmission by water or food. This work evaluated the in vitro biofilm formation of V. cholerae isolated from clinical and environmental sources on stainless steel of the type used in food processing by using the environmental scanning electron microscopy (ESEM. Results showed no cell adhesion at 4 h and scarce surface colonization at 24 h. Biofilms from the environmental strain were observed at 48 h with high cellular aggregations embedded in Vibrio exopolysaccharide (VPS, while less confluence and VPS production with microcolonies of elongated cells were observed in biofilms produced by the clinical strain. At 96 h the biofilms of the environmental strain were released from the surface leaving coccoid cells and residual structures, whereas biofilms of the clinical strain formed highly organized structures such as channels, mushroom-like and pillars. This is the first study that has shown the in vitro ability of V. cholerae to colonize and form biofilms on stainless steel used in food processing.

  14. BIOFILM FORMATION OF Vibrio cholerae ON STAINLESS STEEL USED IN FOOD PROCESSING.

    Science.gov (United States)

    Fernández-Delgado, Milagro; Rojas, Héctor; Duque, Zoilabet; Suárez, Paula; Contreras, Monica; García-Amado, M Alexandra; Alciaturi, Carlos

    2016-01-01

    Vibrio cholerae represents a significant threat to human health in developing countries. This pathogen forms biofilms which favors its attachment to surfaces and its survival and transmission by water or food. This work evaluated the in vitro biofilm formation of V. cholerae isolated from clinical and environmental sources on stainless steel of the type used in food processing by using the environmental scanning electron microscopy (ESEM). Results showed no cell adhesion at 4 h and scarce surface colonization at 24 h. Biofilms from the environmental strain were observed at 48 h with high cellular aggregations embedded in Vibrio exopolysaccharide (VPS), while less confluence and VPS production with microcolonies of elongated cells were observed in biofilms produced by the clinical strain. At 96 h the biofilms of the environmental strain were released from the surface leaving coccoid cells and residual structures, whereas biofilms of the clinical strain formed highly organized structures such as channels, mushroom-like and pillars. This is the first study that has shown the in vitro ability of V. cholerae to colonize and form biofilms on stainless steel used in food processing.

  15. Antibacterial effects of Lactobacillus isolates of curd and human milk origin against food-borne and human pathogens.

    Science.gov (United States)

    Sharma, Chetan; Singh, Brij Pal; Thakur, Nishchal; Gulati, Sachin; Gupta, Sanjolly; Mishra, Santosh Kumar; Panwar, Harsh

    2017-05-01

    This study was undertaken to assess the antibacterial efficacy of lactobacilli isolated from curd and human milk samples. Identities of thirty-one different lactobacilli (20 from curd and 11 from human milk) were confirmed by genus-specific PCR and 16S rRNA-based sequencing. These strains belonged to five species, Lactobacillus casei, L. delbrueckii, L. fermentum, L. plantarum, and L. pentosus. Antibacterial activities of cell-free supernatants (CFSs) of all the Lactobacillus isolates were estimated through standard agar-well diffusion assay, against commonly occurring food-borne and clinically important human pathogens. None of the lactobacilli cell-free supernatant (CFS) exhibited inhibitory activity against four pathogens, namely Staphylococcus aureus, Listeria monocytogenes, Escherichia coli, and Klebsiella pneumoniae. Bacillus cereus, Salmonella enterica serovar Typhi, and Shigella flexneri were moderately inhibited by majority of CFSs, whereas, weak activity was observed against Pseudomonas aeruginosa and Proteus mirabilis. CFS of some of the curd isolates displayed antagonistic activity against Streptococcus mutans; however, human milk lactobacilli did not displayed any inhibitory activity against them. As expected, Nisin (Nisaplin ® ) showed inhibitory activity against Gram-positive, S. aureus, B. cereus, and L. monocytogenes. Interestingly, few of the examined CFSs exhibited inhibitory activities against both Gram-positive and Gram-negative pathogens. Findings from this study support the possibility to explore the tested lactobacilli and their CFSs as natural bio-preservatives, alone or in combination with approved bacteriocins in food and pharma formulations after validating their safety.

  16. Classification of human pathogen bacteria for early screening using electronic nose

    Science.gov (United States)

    Zulkifli, Syahida Amani; Mohamad, Che Wan Syarifah Robiah; Abdullah, Abu Hassan

    2017-10-01

    This paper present human pathogen bacteria for early screening using electronic nose. Electronic nose (E-nose) known as gas sensor array is a device that analyze the odor measurement give the fast response and less time consuming for clinical diagnosis. Many bacterial pathogens could lead to life threatening infections. Accurate and rapid diagnosis is crucial for the successful management of these infections disease. The conventional method need more time to detect the growth of bacterial. Alternatively, the bacteria are Pseudomonas aeruginosa and Shigella cultured on different media agar can be detected and classifies according to the volatile compound in shorter time using electronic nose (E-nose). Then, the data from electronic nose (E-nose) is processed using statistical method which is principal component analysis (PCA). The study shows the capability of electronic nose (E-nose) for early screening for bacterial infection in human stomach.

  17. Differential metabolic responses of clam Ruditapes philippinarum to Vibrio anguillarum and Vibrio splendidus challenges.

    Science.gov (United States)

    Liu, Xiaoli; Ji, Chenglong; Zhao, Jianmin; Wu, Huifeng

    2013-12-01

    Clam Ruditapes philippinarum is one of the important marine aquaculture species in North China. However, pathogens can often cause diseases and lead to massive mortalities and economic losses of clam. In this work, we compared the metabolic responses induced by Vibrio anguillarum and Vibrio splendidus challenges towards hepatopancreas of clam using NMR-based metabolomics. Metabolic responses suggested that both V. anguillarum and V. splendidus induced disturbances in energy metabolism and osmotic regulation, oxidative and immune stresses with different mechanisms, as indicated by correspondingly differential metabolic biomarkers (e.g., amino acids, ATP, glucose, glycogen, taurine, betaine, choline and hypotaurine) and altered mRNA expression levels of related genes including ATP synthase, ATPase, glutathione peroxidase, heat shock protein 90, defensin and lysozyme. However, V. anguillarum caused more severe oxidative and immune stresses in clam hepatopancreas than V. splendidus. Our results indicated that metabolomics could be used to elucidate the biological effects of pathogens to the marine clam R. philippinarum. Copyright © 2013 Elsevier Ltd. All rights reserved.

  18. Vibrio vulnificus produces quorum sensing signals of the AHL-class

    DEFF Research Database (Denmark)

    Valiente, E.; Bruhn, Jesper Bartholin; Nielsen, Kristian Fog

    2009-01-01

    Vibrio vulnificus is an aquatic pathogenic bacterium that can cause vibriosis in humans and fish. The species is subdivided into three biotypes with the fish-virulent strains belonging to biotype 2. The quorum sensing (QS) phenomenon mediated by furanosyl borate diester or autoinducer 2 (AI-2) ha...... biotype 2 strains. No known AHL-related gene was detected by PCR or Southern blot suggesting that AHL-related genes in V. vulnificus are different from those found in other Gram-negative bacteria....... was detected when AHL-positive strains were grown in low-nutrient medium [modified sea water yeast extract (MSWYE)] but not in rich media (tryptic soy broth or brain–heart infusion) and its production was enhanced when blood factors were added to MSWYE. C4-HL was detected in vivo, in eels infected with AHL-positive...

  19. Strategies of Vibrio parahaemolyticus to acquire nutritional iron during host colonization

    Science.gov (United States)

    León-Sicairos, Nidia; Angulo-Zamudio, Uriel A.; de la Garza, Mireya; Velázquez-Román, Jorge; Flores-Villaseñor, Héctor M.; Canizalez-Román, Adrian

    2015-01-01

    Iron is an essential element for the growth and development of virtually all living organisms. As iron acquisition is critical for the pathogenesis, a host defense strategy during infection is to sequester iron to restrict the growth of invading pathogens. To counteract this strategy, bacteria such as Vibrio parahaemolyticus have adapted to such an environment by developing mechanisms to obtain iron from human hosts. This review focuses on the multiple strategies employed by V. parahaemolyticus to obtain nutritional iron from host sources. In these strategies are included the use of siderophores and xenosiderophores, proteases and iron-protein receptor. The host sources used by V. parahaemolyticus are the iron-containing proteins transferrin, hemoglobin, and hemin. The implications of iron acquisition systems in the virulence of V. parahaemolyticus are also discussed. PMID:26217331

  20. Nigribactin, a Novel Siderophore from Vibrio nigripulchritudo, Modulates Staphylococcus aureus Virulence Gene Expression

    DEFF Research Database (Denmark)

    Nielsen, Anita; Månsson, Maria; Wietz, Matthias

    2012-01-01

    Staphylococcus aureus is a serious human pathogen that employs a number of virulence factors as part of its pathogenesis. The purpose of the present study was to explore marine bacteria as a source of compounds that modulate virulence gene expression in S. aureus. During the global marine Galathea...... 3 expedition, a strain collection was established comprising bacteria that express antimicrobial activity against Vibrio anguillarum and/or Staphylococcus aureus. Within this collection we searched colony material, culture supernatants, and cell extracts for virulence modulating activity showing...... that 68 out of 83 marine bacteria (affiliated with the Vibrionaceae and Pseudoalteromonas sp.) influenced expression of S. aureus hla encoding α-hemolysin toxin and/or spa encoding Protein A. The isolate that upon initial screening showed the highest degree of interference (crude ethyl acetate extract...

  1. UV Light Inactivation of Human and Plant Pathogens in Unfiltered Surface Irrigation Water

    OpenAIRE

    Jones, Lisa A.; Worobo, Randy W.; Smart, Christine D.

    2014-01-01

    Fruit and vegetable growers continually battle plant diseases and food safety concerns. Surface water is commonly used in the production of fruits and vegetables and can harbor both human- and plant-pathogenic microorganisms that can contaminate crops when used for irrigation or other agricultural purposes. Treatment methods for surface water are currently limited, and there is a need for suitable treatment options. A liquid-processing unit that uses UV light for the decontamination of turbid...

  2. VectorBase: a home for invertebrate vectors of human pathogens

    Science.gov (United States)

    Lawson, Daniel; Arensburger, Peter; Atkinson, Peter; Besansky, Nora J.; Bruggner, Robert V.; Butler, Ryan; Campbell, Kathryn S.; Christophides, George K.; Christley, Scott; Dialynas, Emmanuel; Emmert, David; Hammond, Martin; Hill, Catherine A.; Kennedy, Ryan C.; Lobo, Neil F.; MacCallum, M. Robert; Madey, Greg; Megy, Karine; Redmond, Seth; Russo, Susan; Severson, David W.; Stinson, Eric O.; Topalis, Pantelis; Zdobnov, Evgeny M.; Birney, Ewan; Gelbart, William M.; Kafatos, Fotis C.; Louis, Christos; Collins, Frank H.

    2007-01-01

    VectorBase () is a web-accessible data repository for information about invertebrate vectors of human pathogens. VectorBase annotates and maintains vector genomes providing an integrated resource for the research community. Currently, VectorBase contains genome information for two organisms: Anopheles gambiae, a vector for the Plasmodium protozoan agent causing malaria, and Aedes aegypti, a vector for the flaviviral agents causing Yellow fever and Dengue fever. PMID:17145709

  3. Prevalence of human pathogens and indicators in stormwater runoff in Brisbane, Australia.

    Science.gov (United States)

    Sidhu, J P S; Hodgers, L; Ahmed, W; Chong, M N; Toze, S

    2012-12-15

    Elevated numbers of enteric pathogens in the receiving waters following a storm event can be a serious public health concern. The purpose of this study was to conduct a preliminary investigation into the presence of human pathogens of concern in urban stormwater runoff. The involvement of a human sewage as a potential source of contamination was also investigated by using microbial source tracking methods. Water samples (20 L) were collected after storm events and during the dry weather from six sites in Brisbane, Australia. Collected samples were analyzed for fecal indicator bacteria (FIB), and then concentrated using hollow fiber ultrafiltration followed by molecular detection of selected enteric pathogens. The levels of FIB were found to frequently exceed the upper limit of Australian guidelines for managing risks in recreational water, during the dry periods and by further several orders of magnitude in the stormwater runoff. Enterococcus spp. numbers as high as 3×10(4) 100 mL(-1) were detected in the stormwater runoff at the Fitzgibbon site. Human adenovirus and polyomavirus were frequently detected from all six sampling sites during wet and dry weather conditions suggesting their wide spread presence in the urban aquatic environments. Campylobacter jejuni, Campylobacter coli and Salmonella enterica were also detected during both dry and wet weather conditions. Presence of human-specific HF183 Bacteroides marker in most of the samples tested suggests ubiquitous sewage contamination in the urban environment. Since stormwater runoff routinely contains high numbers of FIB and other enteric pathogens, some degree of treatment of captured stormwater would be required if it were to be used for non-potable purposes. Crown Copyright © 2012. Published by Elsevier Ltd. All rights reserved.

  4. Rhizobium pusense is the main human pathogen in the genus Agrobacterium/Rhizobium.

    Science.gov (United States)

    Aujoulat, F; Marchandin, H; Zorgniotti, I; Masnou, A; Jumas-Bilak, E

    2015-05-01

    Rhizobium pusense was recently described after isolation from the rhizosphere of chickpea. Multilocus sequence-based analysis of clinical isolates identified as Agrobacterium (Rhizobium) radiobacter demonstrated that R. pusense is the main human pathogen within Agrobacterium (Rhizobium) spp. Clinical microbiology of Agrobacterium (Rhizobium) should be considered in the light of recent taxonomic changes. Copyright © 2014 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  5. Colonization of plants by human pathogenic bacteria in the course of organic vegetable production

    Directory of Open Access Journals (Sweden)

    Andreas eHofmann

    2014-05-01

    Full Text Available In recent years, increasing numbers of outbreaks caused by the consumption of vegetables contaminated with human pathogenic bacteria were reported. The application of organic fertilizers during vegetable production is one of the possible reasons for contamination with those pathogens. In this study laboratory experiments in axenic and soil systems following common practices in organic farming were conducted to identify the minimal dose needed for bacterial colonization of plants and to identify possible factors like bacterial species or serovariation, plant species or organic fertilizer types used, influencing the success of plant colonization by human pathogenic bacteria. Spinach and corn salad were chosen as model plants and were inoculated with different concentrations of Salmonella enterica sv. Weltevreden, Listeria monocytogenes sv. 4b and EGD-E sv. 1/2a either directly (axenic system or via agricultural soil amended with spiked organic fertilizers (soil system. In addition to PCR- and culture-based detection methods, fluorescence in situ hybridization (FISH was applied in order to localize bacteria on or in plant tissues. Our results demonstrate that shoots were colonized by the pathogenic bacteria at inoculation doses as low as 4x10CFU/ml in the axenic system or 4x105CFU/g in the soil system. In addition, plant species dependent effects were observed. Spinach was colonized more often and at lower inoculation doses compared to corn salad. Differential colonization sites on roots, depending on the plant species could be detected using FISH-CLSM analysis. Furthermore, the transfer of pathogenic bacteria to plants via organic fertilizers was observed more often and at lower initial inoculation doses when fertilization was performed with inoculated slurry compared to inoculated manure. Finally, it could be shown that by introducing a simple washing step, the bacterial contamination was reduced in most cases or even was removed completely in

  6. Colonization of plants by human pathogenic bacteria in the course of organic vegetable production

    Science.gov (United States)

    Hofmann, Andreas; Fischer, Doreen; Hartmann, Anton; Schmid, Michael

    2014-01-01

    In recent years, increasing numbers of outbreaks caused by the consumption of vegetables contaminated with human pathogenic bacteria were reported. The application of organic fertilizers during vegetable production is one of the possible reasons for contamination with those pathogens. In this study laboratory experiments in axenic and soil systems following common practices in organic farming were conducted to identify the minimal dose needed for bacterial colonization of plants and to identify possible factors like bacterial species or serovariation, plant species or organic fertilizer types used, influencing the success of plant colonization by human pathogenic bacteria. Spinach and corn salad were chosen as model plants and were inoculated with different concentrations of Salmonella enterica sv. Weltevreden, Listeria monocytogenes sv. 4b and EGD-E sv. 1/2a either directly (axenic system) or via agricultural soil amended with spiked organic fertilizers (soil system). In addition to PCR- and culture-based detection methods, fluorescence in situ hybridization (FISH) was applied in order to localize bacteria on or in plant tissues. Our results demonstrate that shoots were colonized by the pathogenic bacteria at inoculation doses as low as 4 × 10 CFU/ml in the axenic system or 4 × 105 CFU/g in the soil system. In addition, plant species dependent effects were observed. Spinach was colonized more often and at lower inoculation doses compared to corn salad. Differential colonization sites on roots, depending on the plant species could be detected using FISH-CLSM analysis. Furthermore, the transfer of pathogenic bacteria to plants via organic fertilizers was observed more often and at lower initial inoculation doses when fertilization was performed with inoculated slurry compared to inoculated manure. Finally, it could be shown that by introducing a simple washing step, the bacterial contamination was reduced in most cases or even was removed completely in some cases

  7. Ebolaviruses Associated with Differential Pathogenicity Induce Distinct Host Responses in Human Macrophages.

    Science.gov (United States)

    Olejnik, Judith; Forero, Adriana; Deflubé, Laure R; Hume, Adam J; Manhart, Whitney A; Nishida, Andrew; Marzi, Andrea; Katze, Michael G; Ebihara, Hideki; Rasmussen, Angela L; Mühlberger, Elke

    2017-06-01

    Ebola virus (EBOV) and Reston virus (RESTV) are members of the Ebolavirus genus which greatly differ in their pathogenicity. While EBOV causes a severe disease in humans characterized by a dysregulated inflammatory response and elevated cytokine and chemokine production, there are no reported disease-associated human cases of RESTV infection, suggesting that RESTV is nonpathogenic for humans. The underlying mechanisms determining the pathogenicity of different ebolavirus species are not yet known. In this study, we dissected the host response to EBOV and RESTV infection in primary human monocyte-derived macrophages (MDMs). As expected, EBOV infection led to a profound proinflammatory response, including strong induction of type I and type III interferons (IFNs). In contrast, RESTV-infected macrophages remained surprisingly silent. Early activation of IFN regulatory factor 3 (IRF3) and NF-κB was observed in EBOV-infected, but not in RESTV-infected, MDMs. In concordance with previous results, MDMs treated with inactivated EBOV and Ebola virus-like particles (VLPs) induced NF-κB activation mediated by Toll-like receptor 4 (TLR4) in a glycoprotein (GP)-dependent manner. This was not the case in cells exposed to live RESTV, inactivated RESTV, or VLPs containing RESTV GP, indicating that RESTV GP does not trigger TLR4 signaling. Our results suggest that the lack of immune activation in RESTV-infected MDMs contributes to lower pathogenicity by preventing the cytokine storm observed in EBOV infection. We further demonstrate that inhibition of TLR4 signaling abolishes EBOV GP-mediated NF-κB activation. This finding indicates that limiting the excessive TLR4-mediated proinflammatory response in EBOV infection should be considered as a potential supportive treatment option for EBOV disease.IMPORTANCE Emerging infectious diseases are a major public health concern, as exemplified by the recent devastating Ebola virus (EBOV) outbreak. Different ebolavirus species are

  8. Vibrio cholerae Biofilms and Cholera Pathogenesis.

    Directory of Open Access Journals (Sweden)

    Anisia J Silva

    2016-02-01

    Full Text Available Vibrio cholerae can switch between motile and biofilm lifestyles. The last decades have been marked by a remarkable increase in our knowledge of the structure, regulation, and function of biofilms formed under laboratory conditions. Evidence has grown suggesting that V. cholerae can form biofilm-like aggregates during infection that could play a critical role in pathogenesis and disease transmission. However, the structure and regulation of biofilms formed during infection, as well as their role in intestinal colonization and virulence, remains poorly understood. Here, we review (i the evidence for biofilm formation during infection, (ii the coordinate regulation of biofilm and virulence gene expression, and (iii the host signals that favor V. cholerae transitions between alternative lifestyles during intestinal colonization, and (iv we discuss a model for the role of V. cholerae biofilms in pathogenicity.

  9. Bile acid-induced virulence gene expression of Vibrio parahaemolyticus reveals a novel therapeutic potential for bile acid sequestrants.

    Directory of Open Access Journals (Sweden)

    Kazuyoshi Gotoh

    Full Text Available Vibrio parahaemolyticus, a bacterial pathogen, causes human gastroenteritis. A type III secretion system (T3SS2 encoded in pathogenicity island (Vp-PAI is the main contributor to enterotoxicity and expression of Vp-PAI encoded genes is regulated by two transcriptional regulators, VtrA and VtrB. However, a host-derived inducer for the Vp-PAI genes has not been identified. Here, we demonstrate that bile induces production of T3SS2-related proteins under osmotic conditions equivalent to those in the intestinal lumen. We also show that bile induces vtrA-mediated vtrB transcription. Transcriptome analysis of bile-responsive genes revealed that bile strongly induces expression of Vp-PAI genes in a vtrA-dependent manner. The inducing activity of bile was diminished by treatment with bile acid sequestrant cholestyramine. Finally, we demonstrate an in vivo protective effect of cholestyramine on enterotoxicity and show that similar protection is observed in infection with a different type of V. parahaemolyticus or with non-O1/non-O139 V. cholerae strains of vibrios carrying the same kind of T3SS. In summary, these results provide an insight into how bacteria, through the ingenious action of Vp-PAI genes, can take advantage of an otherwise hostile host environment. The results also reveal a new therapeutic potential for widely used bile acid sequestrants in enteric bacterial infections.

  10. A framework for examining climate-driven changes to the seasonality and geographical range of coastal pathogens and harmful algae

    Directory of Open Access Journals (Sweden)

    John Jacobs

    2015-01-01

    Full Text Available Climate change is expected to alter coastal ecosystems in ways which may have predictable consequences for the seasonality and geographical distribution of human pathogens and harmful algae. Here we demonstrate relatively simple approaches for evaluating the risk of occurrence of pathogenic bacteria in the genus Vibrio and outbreaks of toxin-producing harmful algae in the genus Alexandrium, with estimates of uncertainty, in U.S. coastal waters under future climate change scenarios through the end of the 21st century. One approach forces empirical models of growth, abundance and the probability of occurrence of the pathogens and algae at specific locations in the Chesapeake Bay and Puget Sound with ensembles of statistically downscaled climate model projections to produce first order assessments of changes in seasonality. In all of the case studies examined, the seasonal window of occurrence for Vibrio and Alexandrium broadened, indicating longer annual periods of time when there is increased risk for outbreaks. A second approach uses climate model projections coupled with GIS to identify the potential for geographic range shifts for Vibrio spp. in the coastal waters of Alaska. These two approaches could be applied to other coastal pathogens that have climate sensitive drivers to investigate potential changes to the risk of outbreaks in both time (seasonality and space (geographical distribution under future climate change scenarios.

  11. The complete genome sequence and analysis of the human pathogen Campylobacter lari

    DEFF Research Database (Denmark)

    Miller, WG; Wang, G; Binnewies, Tim Terence

    2008-01-01

    Campylobacter lari is a member of the epsilon subdivision of the Proteobacteria and is part of the thermotolerant Campylobacter group, a clade that includes the human pathogen C. jejuni. Here we present the complete genome sequence of the human clinical isolate, C. lari RM2100. The genome of strain...... biosynthetic pathways in this organism could be potentially compensated by the large number of encoded peptidases. Nevertheless, the apparent absence of certain key enzymatic functions in strain RM2100 would be expected to have an impact on C. lari biology. It is also possible that the reduction in the C. lari...

  12. Metabolic adaptation of a human pathogen during chronic infections - a systems biology approach

    DEFF Research Database (Denmark)

    Thøgersen, Juliane Charlotte

    modeling to uncover how human pathogens adapt to the human host. Pseudomonas aeruginosa infections in cystic fibrosis patients are used as a model system for under-­‐ standing these adaptation processes. The exploratory systems biology approach facilitates identification of important phenotypes...... by classical molecular biology approaches where genes and reactions typically are investigated in a one to one relationship. This thesis is an example of how mathematical approaches and modeling can facilitate new biologi-­‐ cal understanding and provide new surprising ideas to important biological processes....

  13. Pan-Genome Analysis of Human Gastric Pathogen H. pylori: Comparative Genomics and Pathogenomics Approaches to Identify Regions Associated with Pathogenicity and Prediction of Potential Core Therapeutic Targets

    DEFF Research Database (Denmark)

    Ali, Amjad; Naz, Anam; Soares, Siomar C.

    2015-01-01

    Helicobacter pylori is a human gastric pathogen implicated as the major cause of peptic ulcer and second leading cause of gastric cancer (similar to 70%) around the world. Conversely, an increased resistance to antibiotics and hindrances in the development of vaccines against H. pylori are observed...

  14. Vibrio cholerae Colonization of Soft-Shelled Turtles.

    Science.gov (United States)

    Wang, Jiazheng; Yan, Meiying; Gao, He; Lu, Xin; Kan, Biao

    2017-07-15

    Vibrio cholerae is an important human pathogen and environmental microflora species that can both propagate in the human intestine and proliferate in zooplankton and aquatic organisms. Cholera is transmitted through food and water. In recent years, outbreaks caused by V. cholerae-contaminated soft-shelled turtles, contaminated mainly with toxigenic serogroup O139, have been frequently reported, posing a new foodborne disease public health problem. In this study, the colonization by toxigenic V. cholerae on the body surfaces and intestines of soft-shelled turtles was explored. Preferred colonization sites on the turtle body surfaces, mainly the carapace and calipash of the dorsal side, were observed for the O139 and O1 strains. Intestinal colonization was also found. The colonization factors of V. cholerae played different roles in the colonization of the soft-shelled turtle's body surface and intestine. Mannose-sensitive hemagglutinin (MSHA) of V. cholerae was necessary for body surface colonization, but no roles were found for toxin-coregulated pili (TCP) or N-acetylglucosamine-binding protein A (GBPA). Both TCP and GBPA play important roles for colonization in the intestine, whereas the deletion of MSHA revealed only a minor colonization-promoting role for this factor. Our study demonstrated that V. cholerae can colonize the surfaces and the intestines of soft-shelled turtles and indicated that the soft-shelled turtles played a role in the transmission of cholera. In addition, this study showed that the soft-shelled turtle has potential value as an animal model in studies of the colonization and environmental adaption mechanisms of V. cholerae in aquatic organisms.IMPORTANCE Cholera is transmitted through water and food. Soft-shelled turtles contaminated with Vibrio cholerae (commonly the serogroup O139 strains) have caused many foodborne infections and outbreaks in recent years, and they have become a foodborne disease problem. Except for epidemiological

  15. Antifungal activity of different neem leaf extracts and the nimonol against some important human pathogens

    Directory of Open Access Journals (Sweden)

    D.A Mahmoud

    2011-09-01

    Full Text Available This study was conducted to evaluate the effect of aqueous, ethanolic and ethyl acetate extracts from neem leaves on growth of some human pathogens (Aspergillus flavus, Aspergillus fumigatus, Aspergillus niger, Aspergillus terreus, Candida albicans and Microsporum gypseum in vitro. Different concentrations (5, 10, 15 and 20% prepared from these extracts inhibited the growth of the test pathogens and the effect gradually increased with concentration. The 20% ethyl acetate extract gave the strongest inhibition compared with the activity obtained by the same concentration of the other extracts. High Performance Liquid Chromatography (HPLC analysis of ethyl acetate extract showed the presence of a main component (nimonol which was purified and chemically confirmed by Nuclear Magnetic Resonance (NMR spectroscopic analysis. The 20% ethyl acetate extract lost a part of its antifungal effect after pooling out the nimonol and this loss in activity was variable on test pathogens. The purified nimonol as a separate compound did not show any antifungal activity when assayed against all the six fungal pathogens.

  16. Control of human and plant fungal pathogens using pentaene macrolide 32, 33-didehydroroflamycoin.

    Science.gov (United States)

    Milisavljevic, M; Zivkovic, S; Pekmezovic, M; Stankovic, N; Vojnovic, S; Vasiljevic, B; Senerovic, L

    2015-06-01

    The aim of this study was to address the toxicity of recently described polyene macrolide 32, 33-didehydroroflamycoin (DDHR) on a wide range of fungal pathogens and its potential to control plant fungal diseases. The antifungal activity of DDHR in vitro was examined against common human and plant pathogenic fungi using a broth microdilution assay and a disk diffusion assay. Minimum inhibitory concentrations ranged from 12·5 to 35 μg ml(-1) . A radial growth inhibition assay showed that DDHR inhibited mycelia growth, inducing mycelial necrosis and affecting sporulation. During the in vivo assay on apple fruits administration of DDHR 1 h before fungal inoculation inhibited spreading of the infection. Importantly, DDHR exhibited no phytotoxic effects on the model plant, Capsicum annum, verified by the plant growth rate and chlorophyll content. DDHR inhibits growth of various plant pathogens in vitro with the strongest activity against Alternaria alternata, Colletotrichum acutatum and Penicillium expansum, and protects apple fruits from decay. This is the first report of the inhibitory effect of DDHR on important pathogenic fungal isolates. DDHR could be a good scaffold for developing new antifungal agents for fruit and vegetable protection. © 2015 The Society for Applied Microbiology.

  17. Zoonotic pathogens isolated from wild animals and environmental samples at two California wildlife hospitals.

    Science.gov (United States)

    Siembieda, Jennifer L; Miller, Woutrina A; Byrne, Barbara A; Ziccardi, Michael H; Anderson, Nancy; Chouicha, Nadira; Sandrock, Christian E; Johnson, Christine K

    2011-03-15

    To determine types and estimate prevalence of potentially zoonotic enteric pathogens shed by wild animals admitted to either of 2 wildlife hospitals and to characterize distribution of these pathogens and of aerobic bacteria in a hospital environment. Cross-sectional study. Fecal samples from 338 animals in 2 wildlife hospitals and environmental samples from 1 wildlife hospital. Fecal samples were collected within 24 hours of hospital admission. Environmental samples were collected from air and surfaces. Samples were tested for zoonotic pathogens via culture techniques and biochemical analyses. Prevalence of pathogen shedding was compared among species groups, ages, sexes, and seasons. Bacterial counts were determined for environmental samples. Campylobacter spp, Vibrio spp, Salmonella spp, Giardia spp, and Cryptosporidium spp (alone or in combination) were detected in 105 of 338 (31%) fecal samples. Campylobacter spp were isolated only from birds. Juvenile passerines were more likely to shed Campylobacter spp than were adults; prevalence increased among juvenile passerines during summer. Non-O1 serotypes of Vibrio cholerae were isolated from birds; during an oil-spill response, 9 of 10 seabirds screened were shedding this pathogen, which was also detected in environmental samples. Salmonella spp and Giardia spp were isolated from birds and mammals; Cryptosporidium spp were isolated from mammals only. Floors of animal rooms had higher bacterial counts than did floors with only human traffic. Potentially zoonotic enteric pathogens were identified in samples from several species admitted to wildlife hospitals, indicating potential for transmission if prevention is not practiced.

  18. Saharan dust nutrients promote Vibrio bloom formation in marine surface waters

    Science.gov (United States)

    Westrich, Jason R.; Ebling, Alina M.; Landing, William M.; Joyner, Jessica L.; Kemp, Keri M.; Griffin, Dale W.; Lipp, Erin K.

    2016-01-01

    Vibrio is a ubiquitous genus of marine bacteria, typically comprising a small fraction of the total microbial community in surface waters, but capable of becoming a dominant taxon in response to poorly characterized factors. Iron (Fe), often restricted by limited bioavailability and low external supply, is an essential micronutrient that can limit Vibrio growth. Vibrio species have robust metabolic capabilities and an array of Fe-acquisition mechanisms, and are able to respond rapidly to nutrient influx, yet Vibrio response to environmental pulses of Fe remains uncharacterized. Here we examined the population growth of Vibrioafter natural and simulated pulses of atmospherically transported Saharan dust, an important and episodic source of Fe to tropical marine waters. As a model for opportunistic bacterial heterotrophs, we demonstrated that Vibrio proliferate in response to a broad range of dust-Fe additions at rapid timescales. Within 24 h of exposure, strains of Vibrio cholerae and Vibrio alginolyticus were able to directly use Saharan dust–Fe to support rapid growth. These findings were also confirmed with in situ field studies; arrival of Saharan dust in the Caribbean and subtropical Atlantic coincided with high levels of dissolved Fe, followed by up to a 30-fold increase of culturable Vibrio over background levels within 24 h. The relative abundance of Vibrio increased from ∼1 to ∼20% of the total microbial community. This study, to our knowledge, is the first to describe Vibrio response to Saharan dust nutrients, having implications at the intersection of marine ecology, Fe biogeochemistry, and both human and environmental health.

  19. Human Milk Blocks DC-SIGN-Pathogen Interaction via MUC1.

    Science.gov (United States)

    Koning, Nathalie; Kessen, Sabine F M; Van Der Voorn, J Patrick; Appelmelk, Ben J; Jeurink, Prescilla V; Knippels, Leon M J; Garssen, Johan; Van Kooyk, Yvette

    2015-01-01

    Beneficial effects of breastfeeding are well-recognized and include both immediate neonatal protection against pathogens and long-term protection against allergies and autoimmune diseases. Although several proteins have been identified to have anti-viral or anti-bacterial effects like secretory IgA or lactoferrin, the mechanisms of immune modulation are not fully understood. Recent studies identified important beneficial effects of glycans in human milk, such as those expressed in oligosaccharides or on glycoproteins. Glycans are recognized by the carbohydrate receptors C-type lectins on dendritic cell (DC) and specific tissue macrophages, which exert important functions in immune modulation and immune homeostasis. A well-characterized C-type lectin is dendritic cell-specific intercellular adhesion molecule-3-grabbing non-integrin (DC-SIGN), which binds terminal fucose. The present study shows that in human milk, MUC1 is the major milk glycoprotein that binds to the lectin domain of DC-SIGN and prevents pathogen interaction through the presence of Lewis x-type oligosaccharides. Surprisingly, this was specific for human milk, as formula, bovine or camel milk did not show any presence of proteins that interacted with DC-SIGN. The expression of DC-SIGN is found in young infants along the entire gastrointestinal tract. Our data thus suggest the importance of human milk glycoproteins for blocking pathogen interaction to DC in young children. Moreover, a potential benefit of human milk later in life in shaping the infants immune system through DC-SIGN cannot be ruled out.

  20. Human Milk Blocks DC-SIGN–Pathogen Interaction via MUC1

    Science.gov (United States)

    Koning, Nathalie; Kessen, Sabine F. M.; Van Der Voorn, J. Patrick; Appelmelk, Ben J.; Jeurink, Prescilla V.; Knippels, Leon M. J.; Garssen, Johan; Van Kooyk, Yvette

    2015-01-01

    Beneficial effects of breastfeeding are well-recognized and include both immediate neonatal protection against pathogens and long-term protection against allergies and autoimmune diseases. Although several proteins have been identified to have anti-viral or anti-bacterial effects like secretory IgA or lactoferrin, the mechanisms of immune modulation are not fully understood. Recent studies identified important beneficial effects of glycans in human milk, such as those expressed in oligosaccharides or on glycoproteins. Glycans are recognized by the carbohydrate receptors C-type lectins on dendritic cell (DC) and specific tissue macrophages, which exert important functions in immune modulation and immune homeostasis. A well-characterized C-type lectin is dendritic cell-specific intercellular adhesion molecule-3-grabbing non-integrin (DC-SIGN), which binds terminal fucose. The present study shows that in human milk, MUC1 is the major milk glycoprotein that binds to the lectin domain of DC-SIGN and prevents pathogen interaction through the presence of Lewis x-type oligosaccharides. Surprisingly, this was specific for human milk, as formula, bovine or camel milk did not show any presence of proteins that interacted with DC-SIGN. The expression of DC-SIGN is found in young infants along the entire gastrointestinal tract. Our data thus suggest the importance of human milk glycoproteins for blocking pathogen interaction to DC in young children. Moreover, a potential benefit of human milk later in life in shaping the infants immune system through DC-SIGN cannot be ruled out. PMID:25821450

  1. A molecular biological protocol to distinguish potentially human pathogenic Stenotrophomonas maltophilia from plant-associated Stenotrophomonas rhizophila

    NARCIS (Netherlands)

    Ribbeck-Busch, K.; Roder, A.; Hasse, D.; De Boer, W.; Martinez, J.L.; Hagemann, M.; Berg, G.

    2005-01-01

    In recent years, the importance of the Gram-negative bacterium Stenotrophomonas as an opportunistic pathogen as well as in biotechnology has increased. The aim of the present study was to develop new methods for distinguishing between strains closely related to the potentially human pathogenic

  2. The cell wall of the human pathogen Candida glabrata: differential incorporation of novel adhesin-like wall proteins

    NARCIS (Netherlands)

    de Groot, P.W.J.; Kraneveld, E.A.; Yin, Q.Y.; Dekker, H.L.; Groß, U.; Crielaard, W.; de Koster, C.G.; Bader, O.; Klis, F.M.; Weig, M.

    2008-01-01

    The cell wall of the human pathogen Candida glabrata governs initial host-pathogen interactions that underlie the establishment of fungal infections. With the aim of identifying species-specific features that may directly relate to its virulence, we have investigated the cell wall of C. glabrata

  3. Designation of pathogenic resistant bacteria in the Sparusaurata sea collected in Tunisia coastlines: Correlation with high performance liquid chromatography-tandem mass spectrometry analysis of antibiotics.

    Science.gov (United States)

    Zouiten, Amina; Mehri, Ines; Beltifa, Asma; Ghorbel, Asma; Sire, Olivier; Van Loco, Joris; Abdenaceur, Hassen; Reyns, Tim; Ben Mansour, Hedi

    2017-05-01

    Vibrio is characterized by a large number of species and some of them are human pathogens causing gastro intestinal and wound infections through the ingestion or manipulation of contaminated fishes including Vibrio parahaemolyticus and Vibrio alginolyticus. In this study, we reported the phenotypic and molecular characterization of Vibrio parahaemolyticus and Vibrio alginolyticus strains isolated from wild and farm sea bream (Sparus aurata L.) along the Tunisian coast from December 2015 to April 2016. Therefore, the antibiograms indicate a difference between farmed and wild fish. Resistance against amoxicillin antibiotic appears for the bacteria isolated from wild fish, while those from aquaculture farming presented sensitivity to amoxicillin and resistance to antibiotics colistin and fusidic acid. The chloramphenicol antibiotic exhibited a high sensitivity in all isolated bacteria. In fact, traces of amoxicillin in the organs of the fish from Hergla farm were detected by UPLC-MS/MS analysis during December 2016 to April 2016. In addition, antibiotics were detected in January 2014 with high concentration of norfloxacin 2262 ng/g in fish from Hergla coast. The results obtained in this work indicated that the use and presence of antibiotics in water impacts on the occurrence of resistant bacteria and the detection of antibiotic in fish. Copyright © 2017. Published by Elsevier Ltd.

  4. Abundance and distribution of Vibrio cholerae, V. parahaemolyticus, and V. vulnificus following a major freshwater intrusion into the Mississippi Sound.

    Science.gov (United States)

    Griffitt, Kimberly J; Grimes, D Jay

    2013-04-01

    In response to a major influx of freshwater to the Mississippi Sound following the opening of the Bonnet Carre Spillway, water samples were collected from three sites along the Mississippi shoreline to assess the impact of altered salinity on three pathogenic Vibrio species. Salinity readings across the affected area during the 2011 sample period ranged from 1.4 to 12.9 ppt (mean = 7.0) and for the 2012 sample period from 14.1 to 23.6 ppt (mean = 19.8). Analyses of the data collected in 2011 showed a reduction in densities of Vibrio parahaemolyticus and Vibrio vulnificus with a concurrent increase of Vibrio cholerae numbers, with V. cholerae becoming the only Vibrio detected once salinity readings dropped to 6 ppt. Follow-up samples taken in 2012 after recovery of the salinity in the sound showed that the relative densities of the three pathogenic vibrios had reverted back to normal levels. This study shows that although the spillway was open but a few weeks and the effects were therefore time limited, the Mississippi River water had a profound, if temporary, effect on Vibrio ecology in the Mississippi Sound.

  5. Pathogens of Food Animals: Sources, Characteristics, Human Risk, and Methods of Detection.

    Science.gov (United States)

    Logue, Catherine M; Barbieri, Nicolle L; Nielsen, Daniel W

    Pathogens associated with food production (livestock) animals come in many forms causing a multitude of disease for humans. For the purpose of this review, these infectious agents can be divided into three broad categories: those that are associated with bacterial disease, those that are associated with viruses, and those that are parasitic in nature. The goal of this chapter is to provide the reader with an overview of the most common pathogens that cause disease in humans through exposure via the food chain and the consequence of this exposure as well as risk and detection methods. We have also included a collection of unusual pathogens that although rare have still caused disease, and their recognition is warranted in light of emerging and reemerging diseases. These provide the reader an understanding of where the next big outbreak could occur. The influence of the global economy, the movement of people, and food makes understanding production animal-associated disease paramount to being able to address new diseases as they arise. © 2017 Elsevier Inc. All rights reserved.

  6. Survival of pathogenic and lactobacilli species of fermented olives during simulated human digestion.

    Science.gov (United States)

    Arroyo-López, Francisco N; Blanquet-Diot, Stéphanie; Denis, Sylvain; Thévenot, Jonathan; Chalancon, Sandrine; Alric, Monique; Rodríguez-Gómez, Francisco; Romero-Gil, Verónica; Jiménez-Díaz, Rufino; Garrido-Fernández, Antonio

    2014-01-01

    The present survey uses a dynamic gastric and small intestinal model to assess the survival of one pathogenic (Escherichia coli O157:H7 EDL 933) and three lactobacilli bacteria with probiotic potential (Lactobacillus rhamnosus GG, L. pentosus TOMC-LAB2, and L. pentosus TOMC-LAB4) during their passage through the human gastrointestinal tract using fermented olives as the food matrix. The data showed that the survival of the E. coli strain in the stomach and duodenum was very low, while its transit through the distal parts (jejunum and ileum) resulted in an increase in the pathogen population. The production of Shiga toxins by this enterohemorrhagic microorganism in the ileal effluents of the in vitro system was too low to be detected by ELISA assays. On the contrary, the three lactobacilli species assayed showed a considerable resistance to the gastric digestion, but not to the intestinal one, which affected their survival, and was especially evident in the case of both L. pentosus strains. In spite of this, high population levels for all assayed microorganisms were recovered at the end of the gastrointestinal passage. The results obtained in the present study show the potential use of table olives as a vehicle of beneficial microorganisms to the human body, as well as the need for good hygienic practices on the part of olive manufacturers in order to avoid the possibility of contamination by food-borne pathogens.

  7. Survival of pathogenic and lactobacilli species of fermented olives during simulated human digestion

    Directory of Open Access Journals (Sweden)

    Francisco Noé eArroyo López

    2014-10-01

    Full Text Available The present survey uses a dynamic gastric and small intestinal model to assess the survival of one pathogenic (Escherichia coli O157:H7 EDL 933 and three lactobacilli bacteria with probiotic potential (Lactobacillus rhamnosus GG, Lactobacillus pentosus TOMC-LAB2 and Lactobacillus pentosus TOMC-LAB4 during their passage through the human gastrointestinal tract using fermented olives as the food matrix. The data showed that the survival of the E. coli strain in the stomach and duodenum was very low, while its transit through the distal parts (jejunum and ileum resulted in an increase in the pathogen population. The production of Shiga toxins by this enterohemorrhagic microorganism in the ileal effluents of the in vitro system was too low to be detected by ELISA assays. On the contrary, the three lactobacilli species assayed showed a considerable resistance to the gastric digestion, but not to the intestinal one, which affected their survival, and was especially evident in the case of both L. pentosus strains. In spite of this, high population levels for all assayed microorganisms were recovered at the end of the gastrointestinal passage. The results obtained in the present study show the potential use of table olives as a vehicle of beneficial microorganisms to the human body, as well as the need for good hygienic practices on the part of olive manufacturers in order to avoid the possibility of contamination by food-borne pathogens.

  8. FungalRV: adhesin prediction and immunoinformatics portal for human fungal pathogens

    Directory of Open Access Journals (Sweden)

    Ramachandran Srinivasan

    2011-04-01

    Full Text Available Abstract Background The availability of sequence data of human pathogenic fungi generates opportunities to develop Bioinformatics tools and resources for vaccine development towards benefitting at-risk patients. Description We have developed a fungal adhesin predictor and an immunoinformatics database with predicted adhesins. Based on literature search and domain analysis, we prepared a positive dataset comprising adhesin protein sequences from human fungal pathogens Candida albicans, Candida glabrata, Aspergillus fumigatus, Coccidioides immitis, Coccidioides posadasii, Histoplasma capsulatum, Blastomyces dermatitidis, Pneumocystis carinii, Pneumocystis jirovecii and Paracoccidioides brasiliensis. The negative dataset consisted of proteins with high probability to function intracellularly. We have used 3945 compositional properties including frequencies of mono, doublet, triplet, and multiplets of amino acids and hydrophobic properties as input features of protein sequences to Support Vector Machine. Best classifiers were identified through an exhaustive search of 588 parameters and meeting the criteria of best Mathews Correlation Coefficient and lowest coefficient of variation among the 3 fold cross validation datasets. The "FungalRV adhesin predictor" was built on three models whose average Mathews Correlation Coefficient was in the range 0.89-0.90 and its coefficient of variation across three fold cross validation datasets in the range 1.2% - 2.74% at threshold score of 0. We obtained an overall MCC value of 0.8702 considering all 8 pathogens, namely, C. albicans, C. glabrata, A. fumigatus, B. dermatitidis, C. immitis, C. posadasii, H. capsulatum and P. brasiliensis thus showing high sensitivity and specificity at a threshold of 0.511. In case of P. brasiliensis the algorithm achieved a sensitivity of 66.67%. A total of 307 fungal adhesins and adhesin like proteins were predicted from the entire proteomes of eight human pathogenic fungal

  9. Rapid Synthesis of Gold Nanoparticles from Quercus incana and Their Antimicrobial Potential against Human Pathogens

    Directory of Open Access Journals (Sweden)

    Rizwana Sarwar

    2017-01-01

    Full Text Available In current study, bioreduction of tetrachloroauric acid (HAuCl4·3H2O was carried out using leaves extract of Quercus incana for nanoparticle synthesis. The nanoparticles were characterized by ultraviolet visible spectrum (UV, Fourier-transform infrared (FT-IR, and transmission electron microscopy (TEM analysis. The gold nanoparticles (GNPs were generally clumpy agglomerates of polydispersed particles, with an average size in the range 5.5–10 nm. The Gas chromatography–mass spectrometry (GC–MS qualitative analysis and FT-IR data supported the presence of bioactive compounds, which are responsible for the metal reduction and nanoparticles stabilization. The biocompatibility of synthesized GNPs was evaluated via antibacterial activity by using human bacterial pathogens. The results showed that synthesized GNPs showed enhanced antibacterial activity against all bacterial pathogens.

  10. Antibacterial screening of traditional herbal plants and standard antibiotics against some human bacterial pathogens.

    Science.gov (United States)

    Awan, Uzma Azeem; Andleeb, Saiqa; Kiyani, Ayesha; Zafar, Atiya; Shafique, Irsa; Riaz, Nazia; Azhar, Muhammad Tehseen; Uddin, Hafeez

    2013-11-01

    Chloroformic and isoamyl alcohol extracts of Cinnnamomum zylanicum, Cuminum cyminum, Curcuma long Linn, Trachyspermum ammi and selected standard antibiotics were investigated for their in vitro antibacterial activity against six human bacterial pathogens. The antibacterial activity was evaluated and based on the zone of inhibition using agar disc diffusion method. The tested bacterial strains were Streptococcus pyogenes, Staphylococcus epidermidis, Klebsiella pneumonia, Staphylococcus aurues, Serratia marcesnces, and Pseudomonas aeruginosa. Ciprofloxacin showed highly significant action against K. pneumonia and S. epidermidis while Ampicillin and Amoxicillin indicated lowest antibacterial activity against tested pathogens. Among the plants chloroform and isoamyl alcohol extracts of C. cyminum, S. aromaticum and C. long Linn had significant effect against P. aeruginosa, S. marcesnces and S. pyogenes. Comparison of antibacterial activity of medicinal herbs and standard antibiotics was also recorded via activity index. Used medicinal plants have various phytochemicals which reasonably justify their use as antibacterial agent.

  11. Blastocystis: how do specific diets and human gut microbiota affect its development and pathogenicity?

    Science.gov (United States)

    Lepczyńska, M; Białkowska, J; Dzika, E; Piskorz-Ogórek, K; Korycińska, J

    2017-09-01

    Blastocystis is an enteric parasite that inhabits the gastrointestinal tract of humans and many animals. This emerging parasite has a worldwide distribution. It is often identified as the most common eukaryotic organism reported in human fecal samples. This parasite is recognized and diagnosed more often than ever before. Furthermore, some strains develop resistance against currently recommended drugs, such as metronidazole; therefore, the use of natural remedies or special diets has many positive aspects that may address this problem. The goal of this review is to compare natural treatments and various diets against the efficacy of drugs, and describe their influence on the composition of the gut microbiota, which affects Blastocystis growth and the occurrence of symptoms. This article reviews important work in the literature, including the classification, life cycle, epidemiology, pathogenesis, pathogenicity, genetics, biology, and treatment of Blastocystis. It also includes a review of the current knowledge about human gut microbiota and various diets proposed for Blastocystis eradication. The literature has revealed that garlic, ginger, some medical plants, and many spices contain the most effective organic compounds for parasite eradication. They work by inhibiting parasitic enzymes and nucleic acids, as well as by inhibiting protein synthesis. The efficacy of any specific organic compound depends on the Blastocystis subtype, and, consequently, on its immunity to treatment. In conclusion, the article discusses the findings that human gut microbiota composition triggers important mechanisms at the molecular level, and, thus, has a crucial influence on the parasitic pathogenicity.

  12. Evaluating the use of fatty acid profiles to differentiate human pathogenic and nonpathogenic Listeria species.

    Science.gov (United States)

    Whittaker, Paul

    2012-01-01

    Listeria monocytogenes is a Gram-positive human pathogen that is responsible for serious infections in immunocompromised individuals and pregnant women. Because of recent epidemics caused by food contaminated with L. monocytogenes, rapid methods for the detection of this pathogen in food are of interest. Capillary gas chromatography with flame ionization detection (GC-FID) was used to determine the cellular fatty acid profiles of six species of Listeria. The six different species are L. monocytogenes, L. ivanovii, L. innocua, L. welshimeri, L. seeligeri, and L. grayi. For GC-FID analysis, whole cell fatty acid methyl esters (FAMEs) from cells cultured on brain heart infusion (BHI) agar at 35 degrees C for 24 h were obtained by saponification, methylation, and extraction into hexane/methyl tert-butyl ether. A preliminary data set for 15 strains of Listeria species was prepared using fatty acid profiles from two or three replicates prepared on different days. Major fatty acids of the Listeria strains evaluated in this study were C15:0 iso, C15:0 ante iso, C16:0 iso, C16:0, C17:0 iso, and C17:0 ante iso. All of the major fatty acids differ significantly among these six species. The two fatty acids C17:0 ante iso and C15:0 ante iso showed the highest percentages, and the ratio of the two clearly showed significant differences between the human pathogen L. monocytogenes and the five nonpathogenic species. Analysis of FAMEs from Listeria strains grown on BHI agar by a GC-FID method is a sensitive procedure for identification of these organisms and differentiation between pathogenic and nonpathogenic species.

  13. Genetic heterogeneity among Vibrio alginolyticus strains, and design of a PCR-based identification method using gyrB gene sequence.

    Science.gov (United States)

    Bunpa, Supansa; Nishibuchi, Mitsuaki; Thawonsuwan, Jumroensri; Sermwittayawong, Natthawan

    2017-10-10

    Vibrio alginolyticus, a pathogen among humans and marine animals, is ubiquitous in marine environments. The aims of this study were to analyze the relationships between genetic diversity and origins, and to develop new primers based on the gyrB sequence to identify V. alginolyticus isolated from various sources. To determine the genetic diversity of this bacterium, an arbitrarily primed polymerase chain reaction (AP-PCR) technique was performed on 36 strains of V. alginolyticus isolated from diarrhea patients and from diseased marine animals and environments in southern Thailand. The results showed distinct DNA fingerprints of all strains, indicating that they are genetically heterogeneous. For species-specific identification of V. alginolyticus, primers targeting the gyrB gene of V. alginolyticus were developed. Thirty reference Vibrio spp., 13 non-Vibrio spp., and 160 strains of V. alginolyticus isolated from various sources in southern Thailand were used to evaluate the specificity of these primers. Our results showed that the gyrB primers could specifically identify V. alginolyticus from all sample types. In addition, the detection limit of the PCR was at least 95 pg of DNA template. Therefore, we concluded that the newly designed gyrB primers are rapid, highly sensitive, and specific to identify V. alginolyticus isolated from various sources.

  14. Identification of Staphylococcus aureus Factors Required for Pathogenicity and Growth in Human Blood.

    Science.gov (United States)

    Connolly, John; Boldock, Emma; Prince, Lynne R; Renshaw, Stephen A; Whyte, Moira K; Foster, Simon J

    2017-11-01

    Staphylococcus aureus is a human commensal but also has devastating potential as an opportunistic pathogen. S. aureus bacteremia is often associated with an adverse outcome. To identify potential targets for novel control approaches, we have identified S. aureus components that are required for growth in human blood. An ordered transposon mutant library was screened, and 9 genes involved specifically in hemolysis or growth on human blood agar were identified by comparing the mutants to the parental strain. Three genes ( purA , purB , and pabA ) were subsequently found to be required for pathogenesis in the zebrafish embryo infection model. The pabA growth defect was specific to the red blood cell component of human blood, showing no difference from the parental strain in growth in human serum, human plasma, or sheep or horse blood. PabA is required in the tetrahydrofolate (THF) biosynthesis pathway. The pabA growth defect was found to be due to a combination of loss of THF-dependent dTMP production by the ThyA enzyme and increased demand for pyrimidines in human blood. Our work highlights pabA and the pyrimidine salvage pathway as potential targets for novel therapeutics and suggests a previously undefined role for a human blood factor in the activity of sulfonamide antibiotics. Copyright © 2017 Connolly et al.

  15. Pathogenic clones versus environmentally driven population increase: analysis of an epidemic of the human fungal pathogen Coccidioides immitis.

    Science.gov (United States)

    Fisher, M C; Koenig, G L; White, T J; Taylor, J W

    2000-02-01

    For many pathogenic microbes that utilize mainly asexual modes of reproduction, it is unknown whether epidemics are due to either the emergence of pathogenic clones or environmentally determined increases in the population size of the organism. Descriptions of the genetic structures of epidemic populations, in conjunction with analyses of key environmental variables, are able to distinguish between these competing hypotheses. A major epidemic of coccidioidomycosis (etiologic agent, Coccidioides immitis) occurred between 1991 and 1994 in central California, representing an 11-fold increase above the mean number of cases reported from 1955 to 1990. Molecular analyses showed extensive genetic diversity, a lack of linkage disequilibria, and little phylogenetic structure, demonstrating that a newly pathogenic strain was not responsible for the observed epidemic. Epidemiological analyses showed that morbidity caused by C. immitis was best explained by the interaction between two variables, the lengths of droughts preceding epidemics and the amounts of rainfall. This shows that the principal factors governing this epidemic of C. immitis are environmental and not genetic. An important implication of this result is that the periodicity of cyclical environmental factors regulates the population size of C. immitis and is instrumental in determining the size of epidemics. This knowledge provides an important tool for predicting outbreaks of this pathogen, as well as a general framework that may be applied to determine the causes of epidemics of other fungal diseases.

  16. Norepinephrine and dopamine increase motility, biofilm formation and virulence of Vibrio harveyi

    Directory of Open Access Journals (Sweden)

    Qian eYang

    2014-11-01

    Full Text Available Vibrio harveyi is one of the major pathogens of aquatic organisms, affecting both vertebrates and invertebrates, and causes important losses in the aquaculture industry. In order to develop novel methods to control disease caused by this pathogen, we need to obtain a better understanding of pathogenicity mechanisms. Sensing of catecholamines increases both growth and production of virulence-related factors in pathogens of terrestrial animals and humans. However, at this moment, knowledge on the impact of catecholamines on the virulence of pathogens of aquatic organisms is lacking. In the present study, we report that in V. harveyi, norepinephrine and dopamine increased growth in serum-supplemented medium, siderophore production, swimming motility and expression of genes involved in flagellar motility, biofilm formation, and exopolysaccharide production. Consistent with this, pretreatment of V. harveyi with catecholamines prior to inoculation into the rearing water resulted in significantly decreased survival of gnotobiotic brine shrimp larvae, when compared to larvae challenged with untreated V. harveyi. Further, norepinephrine-induced effects could be neutralized by α-adrenergic antagonists or by the bacterial catecholamine receptor antagonist LED209, but not by β-adrenergic or dopaminergic antagonists. Dopamine-induced effects could be neutralized by dopaminergic antagonists or LED209, but not by adrenergic antagonists. Together, our results indicate that catecholamine sensing increases the success of transmission of V. harveyi and that interfering with catecholamine sensing might be an interesting strategy to control vibriosis in aquaculture. We hypothesise that upon tissue and/or hemocyte damage during infection, pathogens come into contact with elevated catecholamine levels, and that this stimulates the expression of virulence factors that are required to colonize a new host.

  17. A new class of synthetic peptide inhibitors blocks attachment and entry of human pathogenic viruses.

    Science.gov (United States)

    Krepstakies, Marcel; Lucifora, Julie; Nagel, Claus-Henning; Zeisel, Mirjam B; Holstermann, Barbara; Hohenberg, Heinrich; Kowalski, Ina; Gutsmann, Thomas; Baumert, Thomas F; Brandenburg, Klaus; Hauber, Joachim; Protzer, Ulrike

    2012-06-01

    Many enveloped viruses, including herpes viruses, hepatitis B virus (HBV), and hepatitis C virus (HCV), and human immunodeficiency virus (HIV), are among the most important human pathogens and are often responsible for coinfections involving ≥2 types of viruses. However, therapies that are effective against multiple virus classes are rare. Here we present a new class of synthetic anti-lipopolysaccharide peptides (SALPs) that bind to heparan sulfate moieties on the cell surface and inhibit infection with a variety of enveloped viruses. We demonstrate that SALPs inhibit entry of human immunodeficiency virus type 1 (HIV-1), herpes simplex virus (HSV) 1 and 2, HBV, and HCV to their respective host cells. Despite their high antiviral efficiency, SALPs were well tolerated, and neither toxicity nor measurable inhibitor-induced adverse effects were observed. Since these broad-spectrum antiviral peptides target a host cell rather than a viral component, they may also be useful for suppression of viruses that are resistant to antiviral drugs.

  18. Metalloprotease Vsm Is the Major Determinant of Toxicity for Extracellular Products of Vibrio splendidus▿ †

    Science.gov (United States)

    Binesse, Johan; Delsert, Claude; Saulnier, Denis; Champomier-Vergès, Marie-Christine; Zagorec, Monique; Munier-Lehmann, Hélène; Mazel, Didier; Le Roux, Frédérique

    2008-01-01

    Genomic data combined with reverse genetic approaches have contributed to the characterization of major virulence factors of Vibrio species; however, these studies have targeted primarily human pathogens. Here, we investigate virulence factors in the oyster pathogen Vibrio splendidus LGP32 and show that toxicity is correlated to the presence of a metalloprotease and its corresponding vsm gene. Comparative genomics showed that an avirulent strain closely related to LGP32 lacked the metalloprotease. The toxicity of LGP32 metalloprotease was confirmed by exposing mollusk and mouse fibroblastic cell lines to extracellular products (ECPs) of the wild type (wt) and a vsm deletion mutant (Δvsm mutant). The ECPs of the wt induced a strong cytopathic effect whose severity was cell type dependent, while those of the Δvsm mutant were much less toxic, and exposure to purified protein demonstrated the direct toxicity of the Vsm metalloprotease. Finally, to investigate Vsm molecular targets, a proteomic analysis of the ECPs of both LGP32 and the Δvsm mutant was performed, revealing a number of differentially expressed and/or processed proteins. One of these, the VSA1062 metalloprotease, was found to have significant identity to the immune inhibitor A precursor, a virulence factor of Bacillus thuringiensis. Deletion mutants corresponding to several of the major proteins were constructed by allelic exchange, and the ECPs of these mutants proved to be toxic to both cell cultures and animals. Taken together, these data demonstrate that Vsm is the major toxicity factor in the ECPs of V. splendidus. PMID:18836018

  19. Occurrence of Vibrio Pathotypes in the Final Effluents of Five Wastewater Treatment Plants in Amathole and Chris Hani District Municipalities in South Africa

    Directory of Open Access Journals (Sweden)

    Vuyokazi Nongogo

    2014-08-01

    Full Text Available We assessed the occurrence of Vibrio pathogens in the final effluents of five wastewater treatment plants (WWTPs located in Amathole and Chris Hani District Municipalities in South Africa over a 12 months period between September 2012 and August 2013 using standard membrane filtration technique followed by cultivation on thiosulphate citrate-bile salts-sucrose (TCBS agar. The identities of the presumptive Vibrio isolates were confirmed using polymerase chain reaction (PCR including delineation into V. parahaemolyticus, V. vulnificus and V. fluvialis pathotypes. The counts of Vibrio spp. varied with months in all the study sites and ranged in the order of 101 and 104 CFU/100mL. Vibrio distribution also showed seasonality with high counts being obtained in autumn and spring (p < 0.05. Prevalence of Vibrio spp. among the five WWTPs also differed significantly (p < 0.05. Of the 300 isolates that were confirmed as belonging to the Vibrio genus, 29% (86 were V. fluvialis, 28% (84 were V. vulnificus and 12% (35 were V. parahaemolyticus. The isolation of Vibrio pathogens from the final effluent suggests that this pathogen is in circulation in some pockets of the population and that the WWTPs under study do not efficiently remove bacterial pathogens from the wastewater and consequently are threats to public health.

  20. Diversity and dynamics of the Vibrio community in well water used for drinking in Guinea-Bissau (West Africa).

    Science.gov (United States)

    Machado, A; Bordalo, A A

    2014-09-01

    Bacteria of the genus Vibrio are ubiquitous in aquatic environments and can be found either in culturable or in a viable but nonculturable (VBNC) state. The genus comprises many pathogenic species accountable for water and food-borne diseases that prove to be fatal, especially in developing countries, as in Guinea-Bissau (West Africa), where cholera is endemic. In order to ascertain the abundance and structure of Vibrio spp. community in well waters that serve as the sole source of water for the population, quantitative polymerase chain reaction (qPCR), PCR-denaturant gradient gel electrophoresis (DGGE), and cloning approaches were used. Results suggest that Vibrio spp. were present throughout the year in acidic, freshwater wells with a seasonal community composition shift. Vibrio spp. abundance was in accordance with the abundance found in coastal environments. Sequences closely related to pathogenic Vibrio species were retrieved from well water revealing exposure of the population to such pathogens. pH, ammonium, and turbidity, regulated by the rain pattern, seem to be the variables that contributed mostly to the shaping and selection of the Vibrio spp. community. These results reinforce the evidence for water monitoring with culture-independent methods and the clear need to create/recover water infrastructures and a proper water resources management in West African countries with similar environmental conditions.

  1. In vitro antibacterial potential of Eugenia jambolana seed extracts against multidrug-resistant human bacterial pathogens.

    Science.gov (United States)

    Bag, Anwesa; Bhattacharyya, Subir Kumar; Pal, Nishith Kumar; Chattopadhyay, Rabi Ranjan

    2012-06-20

    The present study was carried out to evaluate the possible in vitro antibacterial potential of extracts of Eugenia jambolana seeds against multidrug-resistant human bacterial pathogens. Agar well diffusion and microbroth dilution assay methods were used for antibacterial susceptibility testing. Kill-kinetics study was done to know the rate and extent of bacterial killing. Phytochemical analysis and TLC-bioautography were performed by colour tests to characterize the putative compounds responsible for this antibacterial activity. Cytotoxic potential was evaluated on human erythrocytes by haemolytic assay method and acute oral toxicity study was done in mice. The plant extracts demonstrated varying degrees of strain specific antibacterial activity against all the test isolates. Further, ethyl acetate fraction obtained from fractionation of most active ethanol extract showed maximum antibacterial effect against all the test isolates. Phytochemical analysis and TLC-bioautography of ethyl acetate fraction revealed that phenolics were the major active phytoconstituents. Ethyl acetate fraction also demonstrated no haemolytic activity on human erythrocytes and no gross behavioural changes as well as toxic symptoms were observed in mice at recommended dosage level. The results provide justification for the use of E. jambolana in folk medicine to treat various infectious diseases and may contribute to the development of novel antimicrobial agents for the treatment of infections caused by these drug-resistant bacterial pathogens. Copyright © 2012 Elsevier GmbH. All rights reserved.

  2. Multilocus Sequence Typing of Borrelia burgdorferi Suggests Existence of Lineages with Differential Pathogenic Properties in Humans

    Science.gov (United States)

    Hanincova, Klara; Mukherjee, Priyanka; Ogden, Nicholas H.; Margos, Gabriele; Wormser, Gary P.; Reed, Kurt D.; Meece, Jennifer K.; Vandermause, Mary F.; Schwartz, Ira

    2013-01-01

    The clinical manifestations of Lyme disease, caused by Borrelia burgdorferi, vary considerably in different patients, possibly due to infection by strains with varying pathogenicity. Both rRNA intergenic spacer and ospC typing methods have proven to be useful tools for categorizing B. burgdorferi strains that vary in their tendency to disseminate in humans. Neither method, however, is suitable for inferring intraspecific relationships among strains that are important for understanding the evolution of pathogenicity and the geographic spread of disease. In this study, multilocus sequence typing (MLST) was employed to investigate the population structure of B. burgdorferi recovered from human Lyme disease patients. A total of 146 clinical isolates from patients in New York and Wisconsin were divided into 53 sequence types (STs). A goeBURST analysis, that also included previously published STs from the northeastern and upper Midwestern US and adjoining areas of Canada, identified 11 major and 3 minor clonal complexes, as well as 14 singletons. The data revealed that patients from New York and Wisconsin were infected with two distinct, but genetically and phylogenetically closely related, populations of B. burgdorferi. Importantly, the data suggest the existence of B. burgdorferi lineages with differential capabilities for dissemination in humans. Interestingly, the data also indicate that MLST is better able to predict the outcome of localized or disseminated infection than is ospC typing. PMID:24069170

  3. Virulence Profiles of Vibrio vulnificus in German Coastal Waters, a Comparison of North Sea and Baltic Sea Isolates

    Directory of Open Access Journals (Sweden)

    Nadja Bier

    2015-12-01

    Full Text Available Vibrio vulnificus is a halophilic bacterium of coastal environments known for sporadically causing severe foodborne or wound infections. Global warming is expected to lead to a rising occurrence of V. vulnificus and an increasing incidence of human infections in Northern Europe. So far, infections in Germany were exclusively documented for the Baltic Sea coast, while no cases from the North Sea region have been reported. Regional variations in the prevalence of infections may be influenced by differences in the pathogenicity of V. vulnificus populations in both areas. This study aimed to compare the distribution of virulence-associated traits and genotypes among 101 V. vulnificus isolates from the Baltic Sea and North Sea in order to assess their pathogenicity potential. Furthermore, genetic relationships were examined by multilocus sequence typing (MLST. A high diversity of MLST sequences (74 sequence types and differences regarding the presence of six potential pathogenicity markers were observed in the V. vulnificus populations of both areas. Strains with genotypes and markers associated with pathogenicity are not restricted to a particular geographic region. This indicates that lack of reported cases in the North Sea region is not caused by the absence of potentially pathogenic strains.

  4. Transmission of Bacterial Zoonotic Pathogens between Pets and Humans: The Role of Pet Food.

    Science.gov (United States)

    Lambertini, Elisabetta; Buchanan, Robert L; Narrod, Clare; Pradhan, Abani K

    2016-01-01

    Recent Salmonella outbreaks associated with dry pet food and treats raised the level of concern for these products as vehicle of pathogen exposure for both pets and their owners. The need to characterize the microbiological and risk profiles of this class of products is currently not supported by sufficient specific data. This systematic review summarizes existing data on the main variables needed to support an ingredients-to-consumer quantitative risk model to (1) describe the microbial ecology of bacterial pathogens in the dry pet food production chain, (2) estimate pet exposure to pathogens through dry food consumption, and (3) assess human exposure and illness incidence due to contact with pet food and pets in the household. Risk models populated with the data here summarized will provide a tool to quantitatively address the emerging public health concerns associated with pet food and the effectiveness of mitigation measures. Results of such models can provide a basis for improvements in production processes, risk communication to consumers, and regulatory action.

  5. Mycosynthesis and characterization of silver nanoparticles and their activity against some human pathogenic bacteria.

    Science.gov (United States)

    Muhsin, Tawfik M; Hachim, Ahmad K

    2014-07-01

    The aim of this study was to biosynthesis silver nanoparticles from the fungus Nigrospora sphaerica isolated from soil samples and to examine their activity against five human pathogenic strains of bacteria viz. Escherichia coli, Proteus mirabilis, Pseudomonas aeruginosa, Salmonella typhi and Staphylococcus aureus using disc diffusion method. The synergistic effect of silver nanoparticles in combination with commonly used antibiotic Gentamycin against the selected bacteria was also examined. The synthesized silver nanoparticles from free-cell filtrate were characterized by using UV-Vis spectrophotometer analysis, Fourier transform infrared spectroscopy (FTIR) and scanning electron microscope (SEM). UV-Vis spectrophotometer analysis showed a peak at 420 nm indicating the synthesis of silver nanoparticles, FTIR analysis verified the detection of protein capping of silver nanoparticles while SEM micrographs revealed that the silver nanoparticles are dispersed and aggregated and mostly having spherical shape within the size range between 20 and 70 nm. The synthesized silver nanoparticles exhibited a varied growth inhibition activity (15-26 mm diam inhibition zones) against the tested pathogenic bacteria. A remarkable increase of bacterial growth inhibition (26-34 mm diam) was detected when a combination of silver nanoparticles and Gentamycin was used. A significant increase in fold area of antibacterial activity was observed when AgNPs in combination with Gentamycin was applied. The synthesized silver nanoparticles produced by the fungus N. sphaerica is a promising to be used as safe drug in medical therapy due to their broad spectrum against pathogenic bacteria.

  6. Antimicrobial activity of home disinfectants and natural products against potential human pathogens.

    Science.gov (United States)

    Rutala, W A; Barbee, S L; Aguiar, N C; Sobsey, M D; Weber, D J

    2000-01-01

    To assess the efficacy of both natural products (vinegar, baking soda) and common commercial disinfectants (Vesphene IIse, TBQ, Clorox, Lysol Disinfectant Spray, Lysol Antibacterial Kitchen Cleaner, Mr. Clean Ultra, ethanol) designed for home or institutional use against potential human pathogens, including selected antibiotic-resistant bacteria. A quantitative suspension test was used to assess the efficacy of selected disinfectants following exposure times of 30 seconds and 5 minutes. Activity was assessed against Staphylococcus aureus, Salmonella choleraesuis, Escherichia coli O157:H7, and Pseudomonas aeruginosa. Selected disinfectants were also tested against poliovirus, vancomycin-susceptible and -resistant Enterococcus species, and methicillin-susceptible and -resistant S. aureus. The following compounds demonstrated excellent antimicrobial activity (>5.6-8.2 log10 reduction) at both exposure times: TBQ, Vesphene, Clorox, ethanol, and Lysol Antibacterial Kitchen Cleaner. Mr. Clean eliminated 4 to >6 logs10 and Lysol Disinfectant approximately 4 logs10 of pathogenic microorganisms at both exposure times. Vinegar eliminated baking soda 3 log10 reduction) against poliovirus. A variety of commercial household disinfectants were highly effective against potential bacterial pathogens. The natural products were less effective than commercial household disinfectants. Only Clorox and Lysol disinfectant were effective against poliovirus.

  7. Comparative Analysis of Protein Glycosylation Pathways in Humans and the Fungal Pathogen Candida albicans

    Directory of Open Access Journals (Sweden)

    Iván Martínez-Duncker

    2014-01-01

    Full Text Available Protein glycosylation pathways are present in all kingdoms of life and are metabolic pathways found in all the life kingdoms. Despite sharing commonalities in their synthesis, glycans attached to glycoproteins have species-specific structures generated by the presence of different sets of enzymes and acceptor substrates in each organism. In this review, we present a comparative analysis of the main glycosylation pathways shared by humans and the fungal pathogen Candida albicans: N-linked glycosylation, O-linked mannosylation and glycosylphosphatidylinositol-anchorage. The knowledge of similarities and divergences between these metabolic pathways could help find new pharmacological targets for C. albicans infection.

  8. Vibrio fischeri flavohaemoglobin protects against nitric oxide during initiation of the squid-Vibrio symbiosis.

    Science.gov (United States)

    Wang, Yanling; Dunn, Anne K; Wilneff, Jacqueline; McFall-Ngai, Margaret J; Spiro, Stephen; Ruby, Edward G

    2010-11-01

    Nitric oxide (NO) is implicated in a wide range of biological processes, including innate immunity against pathogens, signal transduction and protection against oxidative stress. However, its possible roles in beneficial host-microbe associations are less well recognized. During the early stages of the squid-vibrio symbiosis, the bacterial symbiont Vibrio fischeri encounters host-derived NO, which has been hypothesized to serve as a specificity determinant. We demonstrate here that the flavohaemoglobin, Hmp, of V. fischeri protects against NO, both in culture and during colonization of the squid host. Transcriptional analyses indicate that hmp expression is highly responsive to NO, principally through the repressor, NsrR. Hmp protects V. fischeri from NO inhibition of aerobic respiration, and removes NO under both oxic and anoxic conditions. A Δhmp mutant of V. fischeri initiates squid colonization less effectively than wild type, but is rescued by the presence of an NO synthase inhibitor. The hmp promoter is activated during the initial stage of colonization, during which the Δhmp strain fails to form normal-sized aggregates of colonizing cells. Taken together, these results suggest that the sensing of host-derived NO by NsrR, and the subsequent removal of NO by Hmp, influence aggregate size and, thereby, V. fischeri colonization efficiency. © 2010 Blackwell Publishing Ltd.

  9. Host-pathogen interactions: A cholera surveillance system

    Energy Technology Data Exchange (ETDEWEB)

    Wright, Aaron T.

    2016-02-22

    Bacterial pathogen-secreted proteases may play a key role in inhibiting a potentially widespread host-pathogen interaction. Activity-based protein profiling enabled the identification of a major Vibrio cholerae serine protease that limits the ability of a host-derived intestinal lectin to bind to the bacterial pathogen in vivo.

  10. Occurrence of Vibrio species, beta-lactam resistant Vibrio species, and indicator bacteria in ballast and port waters of a tropical harbor.

    Science.gov (United States)

    Ng, Charmaine; Goh, Shin Giek; Saeidi, Nazanin; Gerhard, William A; Gunsch, Claudia K; Gin, Karina Yew Hoong

    2018-01-01

    Ballast water discharges are potential sources for the spread of invasive and pathogenic aquatic organisms. Ballast waters from six ships docked in the Port of Singapore were tested to determine if indictor organisms fell within proposed standards for ballast water discharge according to regulation D-2 of the Ballast Water Management Convention (BWMC) guidelines. Vibrio species were cultured on media supplemented with beta-lactam antibiotics to determine the presence of antibiotic resistant Vibrio species in the ballast waters of these vessels. Indicator organisms were quantified using culture media Colilert-18 and Enterolert in ballast waters of six ships docked in a tropical harbor, with uptake from different geographical locations. Of the six ships, one had ballast water originating from the Persian Gulf, another from the East China Sea, and four from the South China Sea. Two of the six ships which carried ballast waters from the East China Sea and the South China Sea did not meet the D-2 stipulated requirements of the Ballast Water Management Convention for indicator organisms with Enterococci values more than three times higher than the acceptable limit of 110 MPN/100mL), and Vibrio parahaemolyticus (2 to >110 MPN/100mL) were detected in at least one of six ballast water samples. Using thiosulfate-citrate-bile salts-sucrose agar (TCBS) supplemented with beta-lactam antibiotics (meropenem, ceftazidime), 11 different Vibrio species, exhibiting resistance to beta-lactam antibiotics were isolated; with Vibrio campbellii (44%) and Vibrio alginolyticus (15%) the most detected antibiotic resistant Vibrio species. A practical approach of prioritized screening of high-risk vessels should be conducted to ensure that the water quality meets D-2 standards prior to discharge. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. Zoonose Vibrio vulnificus: meldingsplicht raadzaam

    NARCIS (Netherlands)

    Dijkstra, A.; Haenen, O.L.M.; Moller, L.

    2010-01-01

    Op de lijst van meldingsplichtige infectieziekten komen een aantal zoönosen voor, zoals pest, rabiës en leptospirose. De relatief onbekende zoönotische Vibrio vulnificus valt opmerkelijk genoeg niet onder de meldingsplichtige infectieziekten. Juist vanwege het zeer agressieve beloop van een

  12. From SARS to MERS: 10 years of research on highly pathogenic human coronaviruses.

    Science.gov (United States)

    Hilgenfeld, Rolf; Peiris, Malik

    2013-10-01

    This article introduces a series of invited papers in Antiviral Research marking the 10th anniversary of the outbreak of severe acute respiratory syndrome (SARS), caused by a novel coronavirus that emerged in southern China in late 2002. Until that time, coronaviruses had not been recognized as agents causing severe disease in humans, hence, the emergence of the SARS-CoV came as a complete surprise. Research during the past ten years has revealed the existence of a diverse pool of coronaviruses circulating among various bat species and other animals, suggesting that further introductions of highly pathogenic coronaviruses into the human population are not merely probable, but inevitable. The recent emergence of another coronavirus causing severe disease, Middle East respiratory syndrome (MERS), in humans, has made it clear that coronaviruses pose a major threat to human health, and that more research is urgently needed to elucidate their replication mechanisms, identify potential drug targets, and develop effective countermeasures. In this series, experts in many different aspects of coronavirus replication and disease will provide authoritative, up-to-date reviews of the following topics: - clinical management and infection control of SARS; - reservoir hosts of coronaviruses; - receptor recognition and cross-species transmission of SARS-CoV; - SARS-CoV evasion of innate immune responses; - structures and functions of individual coronaviral proteins; - anti-coronavirus drug discovery and development; and - the public health legacy of the SARS outbreak. Each article will be identified in the last line of its abstract as belonging to the series "From SARS to MERS: 10years of research on highly pathogenic human coronaviruses." Copyright © 2013 Elsevier B.V. All rights reserved.

  13. From Insect to Man: Photorhabdus Sheds Light on the Emergence of Human Pathogenicity.

    Directory of Open Access Journals (Sweden)

    Geraldine Mulley

    Full Text Available Photorhabdus are highly effective insect pathogenic bacteria that exist in a mutualistic relationship with Heterorhabditid nematodes. Unlike other members of the genus, Photorhabdus asymbiotica can also infect humans. Most Photorhabdus cannot replicate above 34°C, limiting their host-range to poikilothermic invertebrates. In contrast, P. asymbiotica must necessarily be able to replicate at 37°C or above. Many well-studied mammalian pathogens use the elevated temperature of their host as a signal to regulate the necessary changes in gene expression required for infection. Here we use RNA-seq, proteomics and phenotype microarrays to examine temperature dependent differences in transcription, translation and phenotype of P. asymbiotica at 28°C versus 37°C, relevant to the insect or human hosts respectively. Our findings reveal relatively few temperature dependant differences in gene expression. There is however a striking difference in metabolism at 37°C, with a significant reduction in the range of carbon and nitrogen sources that otherwise support respiration at 28°C. We propose that the key adaptation that enables P. asymbiotica to infect humans is to aggressively acquire amino acids, peptides and other nutrients from the human host, employing a so called "nutritional virulence" strategy. This would simultaneously cripple the host immune response while providing nutrients sufficient for reproduction. This might explain the severity of ulcerated lesions observed in clinical cases of Photorhabdosis. Furthermore, while P. asymbiotica can invade mammalian cells they must also resist immediate killing by humoral immunity components in serum. We observed an increase in the production of the insect Phenol-oxidase inhibitor Rhabduscin normally deployed to inhibit the melanisation immune cascade. Crucially we demonstrated this molecule also facilitates protection against killing by the alternative human complement pathway.

  14. Prevalence and heterogeneity of Hemolysin gene vhh among hatchery isolates of Vibrio harveyi in India

    Digital Repository Service at National Institute of Oceanography (India)

    Parvathi, A.; George, J.; Kumar, S.

    , Baticados MCL, Cruz-Lacierda ER, de la Pena EL (1990) Occurrence of luminous bacterial disease of Penaeus monodon larvae in the Philippines. Aquaculture 91:1-13 19. Liu PC, Lee KK, Chen SN (1996) Pathogenicity of different isolates of Vibrio harveyi...

  15. Human mini-guts: new insights into intestinal physiology and host–pathogen interactions

    Science.gov (United States)

    In, Julie G.; Foulke-Abel, Jennifer; Estes, Mary K.; Zachos, Nicholas C.; Kovbasnjuk, Olga; Donowitz, Mark

    2016-01-01

    The development of indefinitely propagating human ‘mini-guts’ has led to a rapid advance in gastrointestinal research related to transport physiology, developmental biology, pharmacology, and pathophysiology. These mini-guts, also called enteroids or colonoids, are derived from LGR5+ intestinal stem cells isolated from the small intestine or colon. Addition of WNT3A and other growth factors promotes stemness and results in viable, physiologically functional human intestinal or colonic cultures that develop a crypt–villus axis and can be differentiated into all intestinal epithelial cell types. The success of research using human enteroids has highlighted the limitations of using animals or in vitro, cancer-derived cell lines to model transport physiology and pathophysiology. For example, curative or preventive therapies for acute enteric infections have been limited, mostly due to the lack of a physiological human intestinal model. However, the human enteroid model enables specific functional studies of secretion and absorption in each intestinal segment as well as observations of the earliest molecular events that occur during enteric infections. This Review describes studies characterizing these human mini-guts as a physiological model to investigate intestinal transport and host pathogen interactions. PMID:27677718

  16. Human mini-guts: new insights into intestinal physiology and host-pathogen interactions.

    Science.gov (United States)

    In, Julie G; Foulke-Abel, Jennifer; Estes, Mary K; Zachos, Nicholas C; Kovbasnjuk, Olga; Donowitz, Mark

    2016-11-01

    The development of indefinitely propagating human 'mini-guts' has led to a rapid advance in gastrointestinal research related to transport physiology, developmental biology, pharmacology, and pathophysiology. These mini-guts, also called enteroids or colonoids, are derived from LGR5 + intestinal stem cells isolated from the small intestine or colon. Addition of WNT3A and other growth factors promotes stemness and results in viable, physiologically functional human intestinal or colonic cultures that develop a crypt-villus axis and can be differentiated into all intestinal epithelial cell types. The success of research using human enteroids has highlighted the limitations of using animals or in vitro, cancer-derived cell lines to model transport physiology and pathophysiology. For example, curative or preventive therapies for acute enteric infections have been limited, mostly due to the lack of a physiological human intestinal model. However, the human enteroid model enables specific functional studies of secretion and absorption in each intestinal segment as well as observations of the earliest molecular events that occur during enteric infections. This Review describes studies characterizing these human mini-guts as a physiological model to investigate intestinal transport and host-pathogen interactions.

  17. Ecological fitness and virulence features of Vibrio parahaemolyticus in estuarine environments.

    Science.gov (United States)

    Lovell, Charles R

    2017-03-01

    Vibrio parahaemolyticus is a commonly encountered and highly successful organism in marine ecosystems. It is a fast-growing, extremely versatile copiotroph that is active over a very broad range of conditions. It frequently occurs suspended in the water column (often attached to particles or zooplankton), and is a proficient colonist of submerged surfaces. This organism is an important pathogen of animals ranging from microcrustaceans to humans and is a causative agent of seafood-associated food poisoning. This review examines specific ecological adaptations of V. parahaemolyticus, including its broad tolerances to temperature and salinity, its utilization of a wide variety of organic carbon and energy sources, and its pervasive colonization of suspended and stationary materials that contribute to its success and ubiquity in temperate and tropical estuarine ecosystems. Several virulence-related features are examined, in particular the thermostable direct hemolysin (TDH), the TDH-related hemolysin (TRH), and the type 3 secretion system, and the possible importance of these features in V. parahaemolyticus pathogenicity is explored. The impact of new and much more effective PCR primers on V. parahaemolyticus detection and our views of virulent strain abundance are also described. It is clear that strains carrying the canonical virulence genes are far more common than previously thought, which opens questions regarding the role of these genes in pathogenesis. It is also clear that virulence is an evolving feature of V. parahaemolyticus and that novel combinations of virulence factors can lead to emergent virulence in which a strain that is markedly more pathogenic evolves and propagates to produce an outbreak. The effects of global climate change on the frequency of epidemic disease, the geographic distribution of outbreaks, and the human impacts of V. parahaemolyticus are increasing and this review provides information on why this ubiquitous human pathogen has

  18. Isolation and molecular identification of Vibrio spp. by sequencing of 16S rDNA from seafood, meat and meat products in Libya.

    Science.gov (United States)

    Azwai, S M; Alfallani, E A; Abolghait, S K; Garbaj, A M; Naas, H T; Moawad, A A; Gammoudi, F T; Rayes, H M; Barbieri, I; Eldaghayes, I M

    2016-01-01

    The genus Vibrio includes several food-borne pathogens that cause a spectrum of clinical conditions including septicemia, cholera and milder forms of gastroenteritis. Several Vibrio spp. are commonly associated with food-borne transmission including Vibrio cholerae, Vibrio parahemolyticus, and Vibrio vulnificus. Microbiological analysis for enumeration and isolation of Vibrio spp. were carried out for a total of 93 samples of seafood, meat and meat products from different geographic localities in Libya (Tripoli, Regdalin, Janzour and Tobruk). Vibrio spp. were detected by conventional cultural and molecular method using PCR and sequencing of 16S rDNA. Out of the 93 cultured samples only 48 (51.6%) yielded colonies on Thiosulfate Citrate Bile Salt agar (TCBS) with culture characteristics of Vibrio spp. More than half (n=27) of processed seafood samples (n=46) yielded colonies on TCBS, while only 44.6 % of samples of meat and meat products showed colonies on TCBS. Among cultured seafood samples, the highest bacterial count was recorded in clam with a count of 3.8 ×10(4) CFU\\g. Chicken burger samples showed the highest bacterial count with 6.5 ×10(4) CFU\\g. Molecular analysis of the isolates obtained in this study, showed that 11 samples out of 48 (22.9%) were Vibrio spp. Vibrio parahemolyticus was isolated from camel meat for the first time. This study is an initial step to provide a baseline for future molecular research targeting Vibrio spp. foodborne illnesses. This data will be used to provide information on the magnitude of such pathogens in Libyan seafood, meat and meat products.

  19. Isolation and molecular identification of Vibrio spp. by sequencing of 16S rDNA from seafood, meat and meat products in Libya

    Directory of Open Access Journals (Sweden)

    S.M. Azwai

    2016-03-01

    Full Text Available The genus Vibrio includes several food-borne pathogens that cause a spectrum of clinical conditions including septicemia, cholera and milder forms of gastroenteritis. Several Vibrio spp. are commonly associated with food-borne transmission including Vibrio cholerae, Vibrio parahemolyticus, and Vibrio vulnificus. Microbiological analysis for enumeration and isolation of Vibrio spp. were carried out for a total of 93 samples of seafood, meat and meat products from different geographic localities in Libya (Tripoli, Regdalin, Janzour and Tobruk. Vibrio spp. were detected by conventional cultural and molecular method using PCR and sequencing of 16S rDNA. Out of the 93 cultured samples only 48 (51.6% yielded colonies on Thiosulfate Citrate Bile Salt agar (TCBS with culture characteristics of Vibrio spp. More than half (n=27 of processed seafood samples (n=46 yielded colonies on TCBS, while only 44.6% of samples of meat and meat products showed colonies on TCBS. Among cultured seafood samples, the highest bacterial count was recorded in clam with a count of 3.8 х104 CFU\\g. Chicken burger samples showed the highest bacterial count with 6.5 х104 CFU\\g. Molecular analysis of the isolates obtained in this study, showed that 11 samples out of 48 (22.9% were Vibrio spp. Vibrio parahemolyticus was isolated from camel meat for the first time. This study is an initial step to provide a baseline for future molecular research targeting Vibrio spp. foodborne illnesses. This data will be used to provide information on the magnitude of such pathogens in Libyan seafood, meat and meat products.

  20. Pathogen Loading From Canada Geese Faeces in Freshwater: Potential Risks to Human Health Through Recreational Water Exposure.

    Science.gov (United States)

    Gorham, T J; Lee, J

    2016-05-01

    Canada geese (Branta canadensis) faeces have been shown to contain pathogenic protozoa and bacteria in numerous studies over the past 15 years. Further, increases in both the Canada geese populations and their ideal habitat requirements in the United States (US) translate to a greater presence of these human pathogens in public areas, such as recreational freshwater beaches. Combining these factors, the potential health risk posed by Canada geese faeces at freshwater beaches presents an emerging public health issue that warrants further study. Here, literature concerning human pathogens in Canada geese faeces is reviewed and the potential impacts these pathogens may have on human health are discussed. Pathogens of potential concern include Campylobacter jejuni, Salmonella Typhimurium, Listeria monocytogenes, Helicobacter canadensis, Arcobacter spp., Enterohemorragic Escherichia coli pathogenic strains, Chlamydia psitacci, Cryptosporidium parvum and Giardia lamblia. Scenarios presenting potential exposure to pathogens eluted from faeces include bathers swimming in lakes, children playing with wet and dry sand impacted by geese droppings and other common recreational activities associated with public beaches. Recent recreational water-associated disease outbreaks in the US support the plausibility for some of these pathogens, including Cryptosporidium spp. and C. jejuni, to cause human illness in this setting. In view of these findings and the uncertainties associated with the real health risk posed by Canada geese faecal pathogens to users of freshwater lakes, it is recommended that beach managers use microbial source tracking and conduct a quantitative microbial risk assessment to analyse the local impact of Canada geese on microbial water quality during their decision-making process in beach and watershed management. © 2015 Blackwell Verlag GmbH.

  1. Conidial Dihydroxynaphthalene Melanin of the Human Pathogenic Fungus Aspergillus fumigatus Interferes with the Host Endocytosis Pathway

    Science.gov (United States)

    Thywißen, Andreas; Heinekamp, Thorsten; Dahse, Hans-Martin; Schmaler-Ripcke, Jeannette; Nietzsche, Sandor; Zipfel, Peter F.; Brakhage, Axel A.

    2011-01-01

    Aspergillus fumigatus is the most important air-borne fungal pathogen of humans. The interaction of the pathogen with the host's immune system represents a key process to understand pathogenicity. For elimination of invading microorganisms, they need to be efficiently phagocytosed and located in acidified phagolysosomes. However, as shown previously, A. fumigatus is able to manipulate the formation of functional phagolysosomes. Here, we demonstrate that in contrast to pigmentless pksP mutant conidia of A. fumigatus, the gray-green wild-type conidia inhibit the acidification of phagolysosomes of alveolar macrophages, monocyte-derived macrophages, and human neutrophil granulocytes. Therefore, this inhibition is independent of the cell type and applies to the major immune effector cells required for defense against A. fumigatus. Studies with melanin ghosts indicate that the inhibitory effect of wild-type conidia is due to their dihydroxynaphthalene (DHN)-melanin covering the conidia, whereas the hydrophobin RodA rodlet layer plays no role in this process. This is also supported by the observation that pksP conidia still exhibit the RodA hydrophobin layer, as shown by scanning electron microscopy. Mutants defective in different steps of the DHN-melanin biosynthesis showed stronger inhibition than pksP mutant conidia but lower inhibition than wild-type conidia. Moreover, A. fumigatus and A. flavus led to a stronger inhibition of phagolysosomal acidification than A. nidulans and A. terreus. These data indicate that a certain type of DHN-melanin that is different in the various Aspergillus species, is required for maximal inhibition of phagolysosomal acidification. Finally, we identified the vacuolar ATPase (vATPase) as potential target for A. fumigatus based on the finding that addition of bafilomycin which inhibits vATPase, led to complete inhibition of the acidification whereas the fusion of phagosomes containing wild-type conidia and lysosomes was not affected. PMID

  2. Antimicrobial Activity of Croton macrostachyus Stem Bark Extracts against Several Human Pathogenic Bacteria

    Directory of Open Access Journals (Sweden)

    Jackie K. Obey

    2016-01-01

    Full Text Available In Kenya, leaves and roots from Croton macrostachyus are used as a traditional medicine for infectious diseases such as typhoid and measles, but reports on possible antimicrobial activity of stem bark do not exist. In this study, the antibacterial and antifungal effects of methanol, ethyl acetate and butanol extracts, and purified lupeol of C. macrostachyus stem bark were determined against important human gram-negative pathogens Escherichia coli, Salmonella typhi, Klebsiella pneumoniae, and Enterobacter aerogenes, gram-positive Listeria monocytogenes, and a fungus Candida albicans. The most promising broad scale antimicrobial activity against all the studied pathogens was shown by the ethyl acetate extract. The ethyl acetate extract induced the zone of inhibition between 10.1±0.6 mm and 16.0±1.2 mm against S. typhi, E. coli, K. pneumoniae, E. aerogenes, and L. monocytogenes with weaker antimicrobial activity against C. albicans (zone of inhibition: 5.6±1.0 mm. The antibiotic controls (amoxicillin, ciprofloxacin, ampicillin, benzylpenicillin, clotrimazole, and cefotaxime showed antimicrobial activity with zones of inhibition within 13.4±0.7–22.1±0.9 mm. The ethyl acetate extract had MIC in the range of 125–250 mg/mL against all the studied bacteria and against C. albicans MIC was 500 mg/mL. The present results give scientific evidence and support the traditional use of C. macrostachyus stem bark as a source for antimicrobials. We show that C. macrostachyus stem bark lupeol is a promising antimicrobial agent against several important human pathogens.

  3. Sanitation in constructed wetlands: A review on the removal of human pathogens and fecal indicators.

    Science.gov (United States)

    Wu, Shubiao; Carvalho, Pedro N; Müller, Jochen A; Manoj, Valsa Remony; Dong, Renjie

    2016-01-15

    Removal of human pathogens from wastewater is a critical factor with linkage to human health. Constructed Wetlands (CWs) are environmental friendly ecosystems that are applicable not only for chemical pollution control, but also for the reduction of pathogens from wastewater. Yet the knowledge on the fate and removal of such indicator bacteria in CWs is still not sufficient due to the complexity of removal mechanisms and influencing factors. This review serves to provide a better understanding of this state-of-the-art technology, which is necessary for further investigations and design development. The fecal indicator bacteria in CWs mainly come from three sources, namely, influent wastewaters, regrowth within the CWs, and animal activities. The properties of microbial contamination vary depending on the different sources. The removal of pathogens is a complex process that is influenced by operational parameters such as hydraulic regime and retention time, vegetation, seasonal fluctuation, and water composition. The most frequent and well-validated removal mechanisms include natural die-off due to starvation or predation, sedimentation and filtration, and adsorption. The concentration of the main fecal indicator bacteria in the effluent was found to be exponentially related to the loading rate. Generally, horizontal subsurface flow CWs have better reduction capacity than free water surface flow CWs, and hybrid wetland systems were found to be the most efficient due to a longer retention time. Further improvement of fecal indicator bacteria removal in CWs is needed, however, levels in CW effluents are still higher than most of the regulation standards for reuse. Copyright © 2015 Elsevier B.V. All rights reserved.

  4. Exoproteome and secretome derived broad spectrum novel drug and vaccine candidates in Vibrio cholerae targeted by Piper betel derived compounds.

    Directory of Open Access Journals (Sweden)

    Debmalya Barh

    Full Text Available Vibrio cholerae is the causal organism of the cholera epidemic, which is mostly prevalent in developing and underdeveloped countries. However, incidences of cholera in developed countries are also alarming. Because of the emergence of new drug-resistant strains, even though several generic drugs and vaccines have been developed over time, Vibrio infections remain a global health problem that appeals for the development of novel drugs and vaccines against the pathogen. Here, applying comparative proteomic and reverse vaccinology approaches to the exoproteome and secretome of the pathogen, we have identified three candidate targets (ompU, uppP and yajC for most of the pathogenic Vibrio strains. Two targets (uppP and yajC are novel to Vibrio, and two targets (uppP and ompU can be used to develop both drugs and vaccines (dual targets against broad spectrum Vibrio serotypes. Using our novel computational approach, we have identified three peptide vaccine candidates that have high potential to induce both B- and T-cell-mediated immune responses from our identified two dual targets. These two targets were modeled and subjected to virtual screening against natural compounds derived from Piper betel. Seven compounds were identified first time from Piper betel to be highly effective to render the function of these targets to identify them as emerging potential drugs against Vibrio. Our preliminary validation suggests that these identified peptide vaccines and betel compounds are highly effective against Vibrio cholerae. Currently we are exhaustively validating these targets, candidate peptide vaccines, and betel derived lead compounds against a number of Vibrio species.

  5. RECOGNITION OF PATHOGENIC GENES IN V.PARAHAEMOLYTICUS, ISOLATED IN SOUTHERN REGIONS OF UKRAINE

    Directory of Open Access Journals (Sweden)

    Petrenko OV

    2013-06-01

    Full Text Available Study of genetic determinants of V.parahaemolyticus showed a correlation between geno- and phenotypic attributes of parahaemolytic vibrios. Presence of pathogenic genes tdh or trh in parahaemolytic vibrios genome, which are responsible for TDH and TRH hemolysins production, indicates their virulent properties, which in turn are exhibited by vibrios in haemolytic activity.Application of molecular-genetic studies along with other methods of differentiation of V.parahaemolyticus allows for accelerating and improving its laboratory diagnostics.

  6. N-acyl-homoserine lactones-producing bacteria protect plants against plant and human pathogens.

    Science.gov (United States)

    Hernández-Reyes, Casandra; Schenk, Sebastian T; Neumann, Christina; Kogel, Karl-Heinz; Schikora, Adam

    2014-11-01

    The implementation of beneficial microorganisms for plant protection has a long history. Many rhizobia bacteria are able to influence the immune system of host plants by inducing resistance towards pathogenic microorganisms. In this report, we present a translational approach in which we demonstrate the resistance-inducing effect of Ensifer meliloti (Sinorhizobium meliloti) on crop plants that have a significant impact on the worldwide economy and on human nutrition. Ensifer meliloti is usually associated with root nodulation in legumes and nitrogen fixation. Here, we suggest that the ability of S. meliloti to induce resistance depends on the production of the quorum-sensing molecule, oxo-C14-HSL. The capacity to enhanced resistance provides a possibility to the use these beneficial bacteria in agriculture. Using the Arabidopsis-Salmonella model, we also demonstrate that the application of N-acyl-homoserine lactones-producing bacteria could be a successful strategy to prevent plant-originated infections with human pathogens. © 2014 The Authors. Microbial Biotechnology published by John Wiley & Sons Ltd and Society for Applied Microbiology.

  7. TLR-dependent human mucosal epithelial cell responses to microbial pathogens.

    Directory of Open Access Journals (Sweden)

    Paola eMassari

    2014-08-01

    Full Text Available AbstractToll-Like Receptor (TLR signaling represents one of the best studied pathways to implement defense mechanisms against invading microbes in humans as well as in animals. TLRs respond to specific microbial ligands and to danger signals produced by the host during infection, and initiate downstream cascades that activate both innate and adaptive immunity. TLRs are expressed by professional immune cells and by the large majority of non-hematopoietic cells, including epithelial cells. In epithelial tissues, TLR functions are particularly important because these sites are constantly exposed to microorganisms, due to their location at the host interface with the environment. While at these sites, specific defense mechanisms and inflammatory responses are initiated via TLR signaling against pathogens, suppression or lack of TLR activation is also observed in response to the commensal microbiota. The mechanisms by which TLR signaling is regulated in mucosal epithelial cells include differential expression and levels of TLRs (and their signaling partners, their cellular localization and positioning within the tissue in a fashion that favors responses to pathogens while dampening responses to commensals and maintaining tissue homeostasis in physiologic conditions. In this review, the expression and activation of TLRs in mucosal epithelial cells of several sites of the human body are examined. Specifically, the oral cavity, the ear canal and eye, the airways, the gut and the reproductive tract are discussed, along with how site-specific host defense mechanisms are implemented via TLR signaling.

  8. Promiscuous nickel import in human pathogens: structure, thermodynamics, and evolution of extracytoplasmic nickel-binding proteins.

    Science.gov (United States)

    Lebrette, Hugo; Brochier-Armanet, Céline; Zambelli, Barbara; de Reuse, Hilde; Borezée-Durant, Elise; Ciurli, Stefano; Cavazza, Christine

    2014-10-07

    In human pathogenic bacteria, nickel is required for the activation of two enzymes, urease and [NiFe]-hydrogenase, necessary for host infection. Acquisition of Ni(II) is mediated by either permeases or ABC-importers, the latter including a subclass that involves an extracytoplasmic nickel-binding protein, Ni-BP. This study reports on the structure of three Ni-BPs from a diversity of human pathogens and on the existence of three new nickel-binding motifs. These are different from that previously described for Escherichia coli Ni-BP NikA, known to bind nickel via a nickelophore, and indicate a variegated ligand selectivity for Ni-BPs. The structures are consistent with ligand affinities measured in solution by calorimetry and challenge the hypothesis of a general requirement of nickelophores for nickel uptake by canonical ABC importers. Phylogenetic analyses showed that Ni-BPs have different evolutionary origins and emerged independently from peptide-binding proteins, possibly explaining the promiscuous behavior of this class of Ni(II) carriers. Copyright © 2014 Elsevier Ltd. All rights reserved.

  9. In vitro antibacterial activity of Hibiscus rosa-sinensis flower extract against human pathogens.

    Science.gov (United States)

    Ruban, P; Gajalakshmi, K

    2012-05-01

    To access the in vitro antibacterial activity of Hibiscus rosa-sinensis (H. rosa- sinensis) flower extract against human pathogens. Antibacterial activity was evaluated by using disc and agar diffusion methods. The protein was run through poly acrylmide gel electrophoresis to view their protein profile. The results showed that the cold extraction illustrates a maximum zone of inhibition against Bacillus subtillis (B. subtillis), Escherichia coli (E. coli) viz., (17.00 ± 2.91), (14.50 ± 1.71) mm, followed by hot extraction against, E. coli, Salmonella sp. as (11.66 ± 3.14), (10.60 ± 3.09) mm. In methanol extraction showed a highest zone of inhibition recorded against B. subtillis, E. coli as (18.86 ± 0.18), (18.00 ± 1.63) mm pursued by ethanol extraction showed utmost zone of inhibition recorded against Salmonella sp. at (20.40 ± 1.54) mm. The crude protein from flower showed a maximum inhibitory zone observed against Salmonella sp., E. coli viz., (16.55 ± 1.16), (14.30 ± 2.86) mm. The flower material can be taken as an alternative source of antibacterial agent against the human pathogens. The extracts of the H. rosa-sinensis are proved to have potential antibacterial activity, further studies are highly need for the drug development.

  10. Cysteamine-mediated clearance of antibiotic-resistant pathogens in human cystic fibrosis macrophages.

    Directory of Open Access Journals (Sweden)

    Chandra L Shrestha

    Full Text Available Members of the Burkholderia cepacia complex are virulent, multi-drug resistant pathogens that survive and replicate intracellularly in patients with cystic fibrosis (CF. We have discovered that B. cenocepacia cannot be cleared from CF macrophages due to defective autophagy, causing continued systemic inflammation and infection. Defective autophagy in CF is mediated through constitutive reactive oxygen species (ROS activation of transglutaminase-2 (TG2, which causes the sequestration (accumulation of essential autophagy initiating proteins. Cysteamine is a TG2 inhibitor and proteostasis regulator with the potential to restore autophagy. Therefore, we sought to examine the impact of cysteamine on CF macrophage autophagy and bacterial killing. Human peripheral blood monocyte-derived macrophages (MDMs and alveolar macrophages were isolated from CF and non-CF donors. Macrophages were infected with clinical isolates of relevant CF pathogens. Cysteamine caused direct bacterial growth killing of live B. cenocepacia, B. multivorans, P. aeruginosa and MRSA in the absence of cells. Additionally, B. cenocepacia, B. multivorans, and P. aeruginosa invasion were significantly decreased in CF MDMs treated with cysteamine. Finally, cysteamine decreased TG2, p62, and beclin-1 accumulation in CF, leading to increased Burkholderia uptake into autophagosomes, increased macrophage CFTR expression, and decreased ROS and IL-1β production. Cysteamine has direct anti-bacterial growth killing and improves human CF macrophage autophagy resulting in increased macrophage-mediated bacterial clearance, decreased inflammation, and reduced constitutive ROS production. Thus, cysteamine may be an effective adjunct to antibiotic regimens in CF.

  11. In vitro antibacterial activity of Hibiscus rosa-sinensis flower extract against human pathogens

    Science.gov (United States)

    Ruban, P; Gajalakshmi, K

    2012-01-01

    Objective To access the in vitro antibacterial activity of Hibiscus rosa-sinensis (H. rosa- sinensis) flower extract against human pathogens. Methods Antibacterial activity was evaluated by using disc and agar diffusion methods. The protein was run through poly acrylmide gel electrophoresis to view their protein profile. Results The results showed that the cold extraction illustrates a maximum zone of inhibition against Bacillus subtillis (B. subtillis), Escherichia coli (E. coli) viz., (17.00 ± 2.91), (14.50 ± 1.71) mm, followed by hot extraction against, E. coli, Salmonella sp. as (11.66 ± 3.14), (10.60 ± 3.09) mm. In methanol extraction showed a highest zone of inhibition recorded against B. subtillis, E. coli as (18.86 ± 0.18), (18.00 ± 1.63) mm pursued by ethanol extraction showed utmost zone of inhibition recorded against Salmonella sp. at (20.40 ± 1.54) mm. The crude protein from flower showed a maximum inhibitory zone observed against Salmonella sp., E. coli viz., (16.55 ± 1.16), (14.30 ± 2.86) mm. The flower material can be taken as an alternative source of antibacterial agent against the human pathogens. Conclusions The extracts of the H. rosa-sinensis are proved to have potential antibacterial activity, further studies are highly need for the drug development. PMID:23569938

  12. Gold Nanoparticles: An Efficient Antimicrobial Agent against Enteric Bacterial Human Pathogen

    Science.gov (United States)

    Shamaila, Shahzadi; Zafar, Noshin; Riaz, Saira; Sharif, Rehana; Nazir, Jawad; Naseem, Shahzad

    2016-01-01

    Enteric bacterial human pathogens, i.e., Escherichia coli, Staphylococcus aureus, Bacillus subtilis and Klebsiella pneumoniae, are the major cause of diarrheal infections in children and adults. Their structure badly affects the human immune system. It is important to explore new antibacterial agents instead of antibiotics for treatment. This project is an attempt to explain how gold nanoparticles affect these bacteria. We investigated the important role of the mean particle size, and the inhibition of a bacterium is dose-dependent. Ultra Violet (UV)-visible spectroscopy revealed the size of chemically synthesized gold nanoparticle as 6–40 nm. Atomic force microscopy (AFM) analysis confirmed the size and X-ray diffractometry (XRD) analysis determined the polycrystalline nature of gold nanoparticles. The present findings explained how gold nanoparticles lyse Gram-negative and Gram-positive bacteria. PMID:28335198

  13. Immune Recognition of Latency-insitigating Pathogens by Human Dendritic Cells

    DEFF Research Database (Denmark)

    Søndergaard, Jonas Nørskov

    Latent infections with the human pathogenic microorganisms Mycobacterium tuberculosis (Mtb) and the human immunodeficiency virus (HIV) are creating some of the most devastating pandemics to date, with great impact on the infected people’s lives, their expected lifetime, as well as general costs...... for society. Consequently there is a pressing need to search for new treatment strategies. Nowadays it is known that HIV-1 and Mtb have acquired the ability to escape the removal from the body by exploiting the immune system for their own benefits. Dendritic cells (DCs) determine the way the immune response...... unfolds by signaling other immune cells how to respond. An early deregulation of the DCs may therefore propagate into detrimental effects in later stages of the immune response, and may permit HIV-1 and Mtb to become latent. Hence, understanding the way HIV-1 and Mtb interacts with DCs could lead to novel...

  14. Prevalence and pathogenic potential of campylobacter isolates from free-living, human-commensal american crows.

    Science.gov (United States)

    Weis, Allison M; Miller, Woutrina A; Byrne, Barbara A; Chouicha, Nadira; Boyce, Walter M; Townsend, Andrea K

    2014-03-01

    Recent studies have suggested a potential role for wild birds in zoonotic transmission of Campylobacter jejuni, the leading cause of gastroenteritis in humans worldwide. In this study, we detected Campylobacter spp. in 66.9% (85/127) of free-ranging American crows (Corvus brachyrhyncos) sampled in the Sacramento Valley of California in 2012 and 2013. Biochemical testing and sequence analysis of 16S rRNA revealed that 93% of isolates (n = 70) were C. jejuni, with cytolethal distending toxin (CDT) and flagellin A genes detected by PCR in 20% and 46% of the C. jejuni isolates (n = 59), respectively. The high prevalence of C. jejuni, coupled with the occurrence of known virulence markers CDT and flagellin A, demonstrates that crows shed Campylobacter spp. in their feces that are potentially pathogenic to humans. Crows are abundant in urban, suburban, and agricultural settings, and thus further study to determine their role in zoonotic transmission of Campylobacter will inform public health.

  15. Xylosyltransferase-I regulates glycosaminoglycan synthesis during the pathogenic process of human osteoarthritis.

    Directory of Open Access Journals (Sweden)

    Narayanan Venkatesan

    Full Text Available Loss of glycosaminoglycan (GAG chains of proteoglycans (PGs is an early event of osteoarthritis (OA resulting in cartilage degradation that has been previously demonstrated in both huma and experimental OA models. However, the mechanism of GAG loss and the role of xylosyltransferase-I (XT-I that initiates GAG biosynthesis onto PG molecules in the pathogenic process of human OA are unknown. In this study, we have characterized XT-I expression and activity together with GAG synthesis in human OA cartilage obtained from different regions of the same joint, defined as "normal", "late-stage" or adjacent to "late-stage". The results showed that GAG synthesis and content increased in cartilage from areas flanking OA lesions compared to cartilage from macroscopically "normal" unaffected regions, while decreased in "late-stage" OA cartilage lesions. This increase in anabolic state was associated with a marked upregulation of XT-I expression and activity in cartilage "next to lesion" while a decrease in the "late-stage" OA cartilage. Importantly, XT-I inhibition by shRNA or forced-expression with a pCMV-XT-I construct correlated with the modulation of GAG anabolism in human cartilage explants. The observation that XT-I gene expression was down-regulated by IL-1β and up-regulated by TGF-β1 indicates that these cytokines may play a role in regulating GAG content in human OA. Noteworthy, expression of IL-1β receptor (IL-1R1 was down-regulated whereas that of TGF-β1 was up-regulated in early OA cartilage. Theses observations may account for upregulation of XT-I and sustained GAG synthesis prior to the development of cartilage lesions during the pathogenic process of OA.

  16. Xylosyltransferase-I regulates glycosaminoglycan synthesis during the pathogenic process of human osteoarthritis.

    Science.gov (United States)

    Venkatesan, Narayanan; Barré, Lydia; Bourhim, Mustapha; Magdalou, Jacques; Mainard, Didier; Netter, Patrick; Fournel-Gigleux, Sylvie; Ouzzine, Mohamed

    2012-01-01

    Loss of glycosaminoglycan (GAG) chains of proteoglycans (PGs) is an early event of osteoarthritis (OA) resulting in cartilage degradation that has been previously demonstrated in both huma and experimental OA models. However, the mechanism of GAG loss and the role of xylosyltransferase-I (XT-I) that initiates GAG biosynthesis onto PG molecules in the pathogenic process of human OA are unknown. In this study, we have characterized XT-I expression and activity together with GAG synthesis in human OA cartilage obtained from different regions of the same joint, defined as "normal", "late-stage" or adjacent to "late-stage". The results showed that GAG synthesis and content increased in cartilage from areas flanking OA lesions compared to cartilage from macroscopically "normal" unaffected regions, while decreased in "late-stage" OA cartilage lesions. This increase in anabolic state was associated with a marked upregulation of XT-I expression and activity in cartilage "next to lesion" while a decrease in the "late-stage" OA cartilage. Importantly, XT-I inhibition by shRNA or forced-expression with a pCMV-XT-I construct correlated with the modulation of GAG anabolism in human cartilage explants. The observation that XT-I gene expression was down-regulated by IL-1β and up-regulated by TGF-β1 indicates that these cytokines may play a role in regulating GAG content in human OA. Noteworthy, expression of IL-1β receptor (IL-1R1) was down-regulated whereas that of TGF-β1 was up-regulated in early OA cartilage. Theses observations may account for upregulation of XT-I and sustained GAG synthesis prior to the development of cartilage lesions during the pathogenic process of OA.

  17. Xylosyltransferase-I Regulates Glycosaminoglycan Synthesis during the Pathogenic Process of Human Osteoarthritis

    Science.gov (United States)

    Venkatesan, Narayanan; Barré, Lydia; Bourhim, Mustapha; Magdalou, Jacques; Mainard, Didier; Netter, Patrick; Fournel-Gigleux, Sylvie; Ouzzine, Mohamed

    2012-01-01

    Loss of glycosaminoglycan (GAG) chains of proteoglycans (PGs) is an early event of osteoarthritis (OA) resulting in cartilage degradation that has been previously demonstrated in both huma and experimental OA models. However, the mechanism of GAG loss and the role of xylosyltransferase-I (XT-I) that initiates GAG biosynthesis onto PG molecules in the pathogenic process of human OA are unknown. In this study, we have characterized XT-I expression and activity together with GAG synthesis in human OA cartilage obtained from different regions of the same joint, defined as “normal”, “late-stage” or adjacent to “late-stage”. The results showed that GAG synthesis and content increased in cartilage from areas flanking OA lesions compared to cartilage from macroscopically “normal” unaffected regions, while decreased in “late-stage” OA cartilage lesions. This increase in anabolic state was associated with a marked upregulation of XT-I expression and activity in cartilage “next to lesion” while a decrease in the “late-stage” OA cartilage. Importantly, XT-I inhibition by shRNA or forced-expression with a pCMV-XT-I construct correlated with the modulation of GAG anabolism in human cartilage explants. The observation that XT-I gene expression was down-regulated by IL-1β and up-regulated by TGF-β1 indicates that these cytokines may play a role in regulating GAG content in human OA. Noteworthy, expression of IL-1β receptor (IL-1R1) was down-regulated whereas that of TGF-β1 was up-regulated in early OA cartilage. Theses observations may account for upregulation of XT-I and sustained GAG synthesis prior to the development of cartilage lesions during the pathogenic process of OA. PMID:22479506

  18. Control of human pathogenic Yersinia enterocolitica in minced meat: Comparative analysis of different interventions using a risk assessment approach

    DEFF Research Database (Denmark)

    Van Damme, I.; De Zutter, L.; Jacxsens, L.

    2017-01-01

    This study aimed to evaluate the effect of different processing scenarios along the farm-to-fork chain on the contamination of minced pork with human pathogenic Y. enterocolitica. A modular process risk model (MPRM) was used to perform the assessment of the concentrations of pathogenic Y. enterocolitica...... in minced meat produced in industrial meat processing plants. The model described the production of minced pork starting from the contamination of pig carcasses with pathogenic Y. enterocolitica just before chilling. The endpoints of the assessment were (i) the proportion of 0.5 kg minced meat packages...... that contained pathogenic Y. enterocolitica and (ii) the proportion of 0.5 kg minced meat packages that contained more than 10³ pathogenic Y. enterocolitica at the end of storage, just before consumption of raw pork or preparation. Comparing alternative scenarios to the baseline model showed that the initial...

  19. Cladophora (Chlorophyta) spp. harbor human bacterial pathogens in nearshore water of Lake Michigan

    Science.gov (United States)

    Ishii, S.; Yan, T.; Shively, D.A.; Byappanahalli, M.N.; Whitman, R.L.; Sadowsky, M.J.

    2006-01-01

    Cladophora glomerata, a macrophytic green alga, is commonly found in the Great Lakes, and significant accumulations occur along shorelines during the summer months. Recently, Cladophora has been shown to harbor high densities of the fecal indicator bacteria Escherichia coli and enterococci. Cladophora may also harbor human pathogens; however, until now, no studies to address this question have been performed. In the present study, we determined whether attachedCladophora, obtained from the Lake Michigan and Burns Ditch (Little Calumet River, Indiana) sides of a breakwater during the summers of 2004 and 2005, harbored the bacterial pathogens Shiga toxin-producing Escherichia coli (STEC),Salmonella, Shigella, and Campylobacter. The presence of potential pathogens and numbers of organisms were determined by using cultural methods and by using conventional PCR, most-probable-number PCR (MPN-PCR), and quantitative PCR (QPCR) performed with genus- and toxin-specific primers and probes. WhileShigella and STEC were detected in 100% and 25%, respectively, of the algal samples obtained near Burns Ditch in 2004, the same pathogens were not detected in samples collected in 2005. MPN-PCR and QPCR allowed enumeration of Salmonella in 40 to 80% of the ditch- and lakeside samples, respectively, and the densities were up to 1.6 × 103 cells per g Cladophora. Similarly, these PCR methods allowed enumeration of up to 5.4 × 102 Campylobacter cells/gCladophora in 60 to 100% of lake- and ditchside samples. The Campylobacterdensities were significantly higher (P < 0.05) in the lakeside Cladophora samples than in the ditchside Cladophora samples. DNA fingerprint analyses indicated that genotypically identical Salmonella isolates were associated with geographically and temporally distinct Cladophora samples. However, Campylobacter isolates were genetically diverse. Since animal hosts are thought to be the primary habitat for

  20. Differentiation of the emerging human pathogens Trichosporon asahii and Trichosporon asteroides from other pathogenic yeasts and moulds by using species-specific monoclonal antibodies.

    Science.gov (United States)

    Davies, Genna E; Thornton, Christopher R

    2014-01-01

    The fungal genus Trichosporon contains emerging opportunistic pathogens of humans, and is the third most commonly isolated non-candidal yeast from humans. Trichosporon asahii and T. asteroides are the most important species causing disseminated disease in immunocompromised patients, while inhalation of T. asahii spores is the most important cause of summer-type hypersensitivity pneumonitis in healthy individuals. Trichosporonosis is misdiagnosed as candidiasis or cryptococcosis due to a lack of awareness and the ambiguity of diagnostic tests for these pathogens. In this study, hybridoma technology was used to produce two murine monoclonal antibodies (MAbs), CA7 and TH1, for detection and differentiation of Trichosporon from other human pathogenic yeasts and moulds. The MAbs react with extracellular antigens from T. asahii and T. asteroides, but do not recognise other related Trichosporon spp., or unrelated pathogenic yeasts and moulds including Candida, Cryptococcus, Aspergillus, Fusarium, and Scedosporium spp., or the etiologic agents of mucormycosis. Immunofluorescence and Western blotting studies show that MAb CA7, an immunoglobulin G1 (IgG1), binds to a major 60 kDa glycoprotein antigen produced on the surface of hyphae, while TH1, an immunoglobulin M (IgM), binds to an antigen produced on the surface of conidia. The MAbs were used in combination with a standard mycological growth medium (Sabouraud Dextrose Agar) to develop an enzyme-linked immunosorbent assay (ELISA) for differentiation of T. asahii from Candida albicans and Cryptococcus neoformans in single and mixed species cultures. The MAbs represent a major advance in the identification of T. asahii and T. asteroides using standard mycological identification methods.

  1. Transmission to Eels, Portals of Entry, and Putative Reservoirs of Vibrio vulnificus Serovar E (Biotype 2)

    OpenAIRE

    Marco-Noales, Ester; Milán, Miguel; Fouz, Belén; Sanjuán, Eva; Amaro, Carmen

    2001-01-01

    Vibrio vulnificus serovar E (formerly biotype 2) is the etiologic agent that is responsible for the main infectious disease affecting farmed eels. Although the pathogen can theoretically use water as a vehicle for disease transmission, it has not been isolated from tank water during epizootics to date. In this work, the mode of transmission of the disease to healthy eels, the portals of entry of the pathogen into fish, and their putative reservoirs have been investigated by means of laborator...

  2. Light Modulates Metabolic Pathways and Other Novel Physiological Traits in the Human Pathogen Acinetobacter baumannii.

    Science.gov (United States)

    Müller, Gabriela L; Tuttobene, Marisel; Altilio, Matías; Martínez Amezaga, Maitena; Nguyen, Meaghan; Cribb, Pamela; Cybulski, Larisa E; Ramírez, María Soledad; Altabe, Silvia; Mussi, María Alejandra

    2017-05-15

    Light sensing in chemotrophic bacteria has been relatively recently ascertained. In the human pathogen Acinetobacter baumannii, light modulates motility, biofilm formation, and virulence through the blue-light-sensing-using flavin (BLUF) photoreceptor BlsA. In addition, light can induce a reduction in susceptibility to certain antibiotics, such as minocycline and tigecycline, in a photoreceptor-independent manner. In this work, we identified new traits whose expression levels are modulated by light in this pathogen, which comprise not only important determinants related to pathogenicity and antibiotic resistance but also metabolic pathways, which represents a novel concept for chemotrophic bacteria. Indeed, the phenylacetic acid catabolic pathway and trehalose biosynthesis were modulated by light, responses that completely depend on BlsA. We further show that tolerance to some antibiotics and modulation of antioxidant enzyme levels are also influenced by light, likely contributing to bacterial persistence in adverse environments. Also, we present evidence indicating that surfactant production is modulated by light. Finally, the expression of whole pathways and gene clusters, such as genes involved in lipid metabolism and genes encoding components of the type VI secretion system, as well as efflux pumps related to antibiotic resistance, was differentially induced by light. Overall, our results indicate that light modulates global features of the A. baumannii lifestyle.IMPORTANCE The discovery that nonphototrophic bacteria respond to light constituted a novel concept in microbiology. In this context, we demonstrated that light could modulate aspects related to bacterial virulence, persistence, and resistance to antibiotics in the human pathogen Acinetobacter baumannii In this work, we present the novel finding that light directly regulates metabolism in this chemotrophic bacterium. Insights into the mechanism show the involvement of the photoreceptor BlsA. In

  3. Comparative genomics allowed the identification of drug targets against human fungal pathogens

    Directory of Open Access Journals (Sweden)

    Martins Natalia F

    2011-01-01

    Full Text Available Abstract Background The prevalence of invasive fungal infections (IFIs has increased steadily worldwide in the last few decades. Particularly, there has been a global rise in the number of infections among immunosuppressed people. These patients present severe clinical forms of the infections, which are commonly fatal, and they are more susceptible to opportunistic fungal infections than non-immunocompromised people. IFIs have historically been associated with high morbidity and mortality, partly because of the limitations of available antifungal therapies, including side effects, toxicities, drug interactions and antifungal resistance. Thus, the search for alternative therapies and/or the development of more specific drugs is a challenge that needs to be met. Genomics has created new ways of examining genes, which open new strategies for drug development and control of human diseases. Results In silico analyses and manual mining selected initially 57 potential drug targets, based on 55 genes experimentally confirmed as essential for Candida albicans or Aspergillus fumigatus and other 2 genes (kre2 and erg6 relevant for fungal survival within the host. Orthologs for those 57 potential targets were also identified in eight human fungal pathogens (C. albicans, A. fumigatus, Blastomyces dermatitidis, Paracoccidioides brasiliensis, Paracoccidioides lutzii, Coccidioides immitis, Cryptococcus neoformans and Histoplasma capsulatum. Of those, 10 genes were present in all pathogenic fungi analyzed and absent in the human genome. We focused on four candidates: trr1 that encodes for thioredoxin reductase, rim8 that encodes for a protein involved in the proteolytic activation of a transcriptional factor in response to alkaline pH, kre2 that encodes for α-1,2-mannosyltransferase and erg6 that encodes for Δ(24-sterol C-methyltransferase. Conclusions Our data show that the comparative genomics analysis of eight fungal pathogens enabled the identification of

  4. Detection of Vibrio splendidus and related species in Chamelea gallina sampled in the Adriatic along the Abruzzi coastline

    Directory of Open Access Journals (Sweden)

    Marina Torresi

    2011-09-01

    Full Text Available Vibrio species are an important and widespread component of marine microbial communities. Some Vibrio strains are potentially pathogenic to marine vertebrates and invertebrates. The aim of this study was to identify vibrios, in particular Vibrio splendidus and related species, isolated from clams (Chamelea gallina collected along the coasts of the Abruzzi region from May to October 2007. The isolates obtained were phenotyped and classified as belonging to the genus Vibrio. The strains underwent biochemical testing in accordance with Alsina’s scheme for V. splendidus identification. Molecular analysis of the 16S-23S intergenic space region and recA gene was used to identify V. splendidus and related species. All the samples examined were found to contain halophylic Vibrio species, with V. alginolyticus, V. splendidus-related species and V. mediterranei most commonly found. A polymerase chain reaction of the 16S-23S intergenic space region and sequencing of the recA gene from isolates confirmed that phenotyping of Vibrio species is not sufficient to distinguish between different species. Differentiation of the highly related species among V. splendidus-related clusters remains an important issue. In this regard, our data suggests sequencing the recA genes was far more discriminatory than sequencing 16S rDNA for this purpose.

  5. Assessing the function of STAS domain protein SypA in Vibrio fischeri using a comparative analysis

    Directory of Open Access Journals (Sweden)

    Cecilia M Thompson

    2015-07-01

    Full Text Available Colonization of the squid Euprymna scolopes by Vibrio fischeri requires biofilm formation dependent on the 18-gene symbiosis polysaccharide locus, syp. One key regulator, SypA, controls biofilm formation by an as-yet unknown mechanism; however, it is known that SypA itself is regulated by SypE. Biofilm-proficient strains form wrinkled colonies on solid media, while sypA mutants form biofilm-defective smooth colonies. To begin to understand the function of SypA, we used comparative analyses and mutagenesis approaches. sypA (and the syp locus is conserved in other Vibrios, including two food-borne human pathogens, V. vulnificus (rbdA and V. parahaemolyticus (sypAVP. We found that both homologs could complement the biofilm defect of the V. fischeri sypA mutant, but their phenotypes varied depending on the biofilm-inducing conditions used. Furthermore, while SypAVP retained an ability to be regulated by SypE, RbdA was resistant to this control. To better understand SypA function, we examined the biofilm-promoting ability of a number of mutant SypA proteins with substitutions in conserved residues, and found many that were biofilm-defective. The most severe biofilm-defective phenotypes occurred when changes were made to a conserved stretch of amino acids within a predicted a-helix of SypA; we hypothesize that this region of SypA may interact with another protein to promote biofilm formation. Finally, we identified a residue required for negative control by SypE. Together, our data provide insights into the function of this key biofilm regulator and suggest that the SypA orthologs may play similar roles in their native Vibrio species.

  6. Environmental controls, oceanography and population dynamics of pathogens and harmful algal blooms: connecting sources to human exposure

    Directory of Open Access Journals (Sweden)

    Minnett Peter

    2008-11-01

    Full Text Available Abstract Coupled physical-biological models are capable of linking the complex interactions between environmental factors and physical hydrodynamics to simulate the growth, toxicity and transport of infectious pathogens and harmful algal blooms (HABs. Such simulations can be used to assess and predict the impact of pathogens and HABs on human health. Given the widespread and increasing reliance of coastal communities on aquatic systems for drinking water, seafood and recreation, such predictions are critical for making informed resource management decisions. Here we identify three challenges to making this connection between pathogens/HABs and human health: predicting concentrations and toxicity; identifying the spatial and temporal scales of population and ecosystem interactions; and applying the understanding of population dynamics of pathogens/HABs to management strategies. We elaborate on the need to meet each of these challenges, describe how modeling approaches can be used and discuss strategies for moving forward in addressing these challenges.

  7. Environmental controls, oceanography and population dynamics of pathogens and harmful algal blooms: connecting sources to human exposure.

    Science.gov (United States)

    Dyble, Julianne; Bienfang, Paul; Dusek, Eva; Hitchcock, Gary; Holland, Fred; Laws, Ed; Lerczak, James; McGillicuddy, Dennis J; Minnett, Peter; Moore, Stephanie K; O'Kelly, Charles; Solo-Gabriele, Helena; Wang, John D

    2008-11-07

    Coupled physical-biological models are capable of linking the complex interactions between environmental factors and physical hydrodynamics to simulate the growth, toxicity and transport of infectious pathogens and harmful algal blooms (HABs). Such simulations can be used to assess and predict the impact of pathogens and HABs on human health. Given the widespread and increasing reliance of coastal communities on aquatic systems for drinking water, seafood and recreation, such predictions are critical for making informed resource management decisions. Here we identify three challenges to making this connection between pathogens/HABs and human health: predicting concentrations and toxicity; identifying the spatial and temporal scales of population and ecosystem interactions; and applying the understanding of population dynamics of pathogens/HABs to management strategies. We elaborate on the need to meet each of these challenges, describe how modeling approaches can be used and discuss strategies for moving forward in addressing these challenges.

  8. Human-livestock contacts and their relationship to transmission of zoonotic pathogens, a systematic review of literature

    NARCIS (Netherlands)

    Klous, Gijs|info:eu-repo/dai/nl/413752631; Huss, Anke; Heederik, Dick J J; Coutinho, Roel A.|info:eu-repo/dai/nl/069832862

    2016-01-01

    Background: Micro-organisms transmitted from vertebrate animals - including livestock - to humans account for an estimated 60% of human pathogens. Micro-organisms can be transmitted through inhalation, ingestion, via conjunctiva or physical contact. Close contact with animals is crucial for

  9. Control of human pathogenic Yersinia enterocolitica in minced meat: Comparative analysis of different interventions using a risk assessment approach

    DEFF Research Database (Denmark)

    Van Damme, I.; De Zutter, L.; Jacxsens, L.

    2017-01-01

    This study aimed to evaluate the effect of different processing scenarios along the farm-to-fork chain on the contamination of minced pork with human pathogenic Y. enterocolitica. A modular process risk model (MPRM) was used to perform the assessment of the concentrations of pathogenic Y....... enterocolitica in minced meat produced in industrial meat processing plants. The model described the production of minced pork starting from the contamination of pig carcasses with pathogenic Y. enterocolitica just before chilling. The endpoints of the assessment were (i) the proportion of 0.5 kg minced meat packages...

  10. Transcriptional regulation of carbohydrate metabolism in the human pathogen Candida albicans.

    Directory of Open Access Journals (Sweden)

    Christopher Askew

    2009-10-01

    Full Text Available Glycolysis is a metabolic pathway that is central to the assimilation of carbon for either respiration or fermentation and therefore is critical for the growth of all organisms. Consequently, glycolytic transcriptional regulation is important for the metabolic flexibility of pathogens in their attempts to colonize diverse niches. We investigated the transcriptional control of carbohydrate metabolism in the human fungal pathogen Candida albicans and identified two factors, Tye7p and Gal4p, as key regulators of glycolysis. When respiration was inhibited or oxygen was limited, a gal4tye7 C. albicans strain showed a severe growth defect when cultured on glucose, fructose or mannose as carbon sources. The gal4tye7 strain displayed attenuated virulence in both Galleria and mouse models as well, supporting the connection between pathogenicity and metabolism. Chromatin immunoprecipitation coupled with microarray analysis (ChIP-CHIP and transcription profiling revealed that Tye7p bound the promoter sequences of the glycolytic genes and activated their expression during growth on either fermentable or non-fermentable carbon sources. Gal4p also bound the glycolytic promoter sequences and activated the genes although to a lesser extent than Tye7p. Intriguingly, binding and activation by Gal4p was carbon source-dependent and much stronger during growth on media containing fermentable sugars than on glycerol. Furthermore, Tye7p and Gal4p were responsible for the complete induction of the glycolytic genes under hypoxic growth conditions. Tye7p and Gal4p also regulated unique sets of carbohydrate metabolic genes; Tye7p bound and activated genes involved in trehalose, glycogen, and glycerol metabolism, while Gal4p regulated the pyruvate dehydrogenase complex. This suggests that Tye7p represents the key transcriptional regulator of carbohydrate metabolism in C. albicans and Gal4p provides a carbon source-dependent fine-tuning of gene expression while regulating

  11. Comparative genomics of pathogenic Leptospira interrogans serovar Canicola isolated from swine and human in Brazil

    Directory of Open Access Journals (Sweden)

    Luisa Z Moreno

    Full Text Available Leptospira interrogans serovar Canicola is one of the most important pathogenic serovars for the maintenance of urban leptospirosis. Even though it is considered highly adapted to dogs, serovar Canicola infection has already been described in other animals and even a few human cases. Here, we present the genomic characterisation of two Brazilian L. interrogans serovar Canicola strains isolated from slaughtered sows (L0-3 and L0-4 and their comparison with human strain Fiocruz LV133. It was observed that the porcine serovar Canicola strains present the genetic machinery to cause human infection and, therefore, represent a higher risk to public health. Both human and porcine serovar Canicola isolates also presented sequences with high identity to the Chinese serovar Canicola published plasmids pGui1 and pGui2. The plasmids identification in the Brazilian and Chinese serovar Canicola strains suggest that extra-chromosomal elements are one more feature of this serovar that was previously unnoticed.