WorldWideScience

Sample records for human keratinocyte two-dimensional

  1. The human keratinocyte two-dimensional protein database (update 1994): towards an integrated approach to the study of cell proliferation, differentiation and skin diseases

    DEFF Research Database (Denmark)

    Celis, J E; Rasmussen, H H; Olsen, E

    1994-01-01

    The master two-dimensional (2-D) gel database of human keratinocytes currently lists 3087 cellular proteins (2168 isoelectric focusing, IEF; and 919 none-quilibrium pH gradient electrophoresis, NEPHGE), many of which correspond to posttranslational modifications, 890 polypeptides have been...... in the database. We also report a database of proteins recovered from the medium of noncultured, unfractionated keratinocytes. This database lists 398 polypeptides (309 IEF; 89 NEPHGE) of which 76 have been identified. The aim of the comprehensive databases is to gather, through a systematic study...

  2. The human keratinocyte two-dimensional gel protein database (update 1995): mapping components of signal transduction pathways

    DEFF Research Database (Denmark)

    Celis, J E; Rasmussen, H H; Gromov, P

    1995-01-01

    identified (protein name, organelle components, etc.) using a procedure or a combination of procedures that include (i) comigration with known human proteins, (ii) 2-D gel immunoblotting using specific antibodies, (iii) microsequencing of Coomassie Brilliant Blue stained proteins, (iv) mass spectrometry, (v......)vaccinia virus expression of full length cDNAs, and (vi) in vitro transcription/translation of full-length cDNAs. This year, special emphasis has been given to the identification of signal transduction components by using 2-D gel immunoblotting of crude keratinocyte lysates in combination with enhanced......--through a systematic study of ekeratinocytes--qualitative and quantitative information on proteins and their genes that may allow us to identify abnormal patterns of gene expression and to pinpoint signaling pathways and components affected in various skin diseases, cancer included. Udgivelsesdato: 1995-Dec...

  3. A comprehensive two-dimensional gel protein database of noncultured unfractionated normal human epidermal keratinocytes: towards an integrated approach to the study of cell proliferation, differentiation and skin diseases

    DEFF Research Database (Denmark)

    Celis, J E; Madsen, Peder; Rasmussen, H H

    1991-01-01

    A two-dimensional (2-D) gel database of cellular proteins from noncultured, unfractionated normal human epidermal keratinocytes has been established. A total of 2651 [35S]methionine-labeled cellular proteins (1868 isoelectric focusing, 783 nonequilibrium pH gradient electrophoresis) were resolved...

  4. Human muscle proteins: analysis by two-dimensional electrophoresis

    Energy Technology Data Exchange (ETDEWEB)

    Giometti, C.S.; Danon, M.J.; Anderson, N.G.

    1983-09-01

    Proteins from single frozen sections of human muscle were separated by two-dimensional gel electrophoresis and detected by fluorography or Coomassie Blue staining. The major proteins were identical in different normal muscles obtained from either sex at different ages, and in Duchenne and myotonic dystrophy samples. Congenital myopathy denervation atrophy, polymyositis, and Becker's muscular dystrophy samples, however, showed abnormal myosin light chain compositions, some with a decrease of fast-fiber myosin light chains and others with a decrease of slow-fiber light chains. These protein alterations did not correlate with any specific disease, and may be cause by generalized muscle-fiber damage.

  5. Thalidomide increases human keratinocyte migration and proliferation.

    Science.gov (United States)

    Nasca, M R; O'Toole, E A; Palicharla, P; West, D P; Woodley, D T

    1999-11-01

    Thalidomide is reported to have therapeutic utility in the treatment of pyoderma gangrenosum, Behçet's disease, aphthous ulcers, and skin wounds. We investigated the effect of thalidomide on human keratinocyte proliferation and migration, two early and critical events in the re-epithelialization of skin wounds. Thalidomide at concentrations less than 1 microM did not affect keratinocyte viability. Using a thymidine incorporation assay, we found that thalidomide, at therapeutic concentrations, induced more than a 2. 5-fold increase in the proliferative potential of the cells. Keratinocyte migration was assessed by two independent motility assays: a colloidal gold assay and an in vitro scratch assay. At optimal concentrations, thalidomide increased keratinocyte migration on a collagen matrix more than 2-fold in the colloidal gold assay and more than 3-fold in the scratch assay over control. Although pro-migratory, thalidomide did not alter the level of metalloproteinase-9 secreted into culture medium. Thalidomide did, however, induce a 2-4-fold increase in keratinocyte-derived interleukin-8, a pro-migratory cellular autocrine factor. Human keratinocyte migration and proliferation are essential for re-epithelialization of skin wounds. Interleukin-8 increases human keratinocyte migration and proliferation and is chemotactic for keratinocytes. Therefore, thalidomide may modulate keratinocyte proliferation and motility by a chemokine-dependent pathway.

  6. Human lymphocyte polymorphisms detected by quantitative two-dimensional electrophoresis

    International Nuclear Information System (INIS)

    Goldman, D.; Merril, C.R.

    1983-01-01

    A survey of 186 soluble lymphocyte proteins for genetic polymorphism was carried out utilizing two-dimensional electrophoresis of 14 C-labeled phytohemagglutinin (PHA)-stimulated human lymphocyte proteins. Nineteen of these proteins exhibited positional variation consistent with independent genetic polymorphism in a primary sample of 28 individuals. Each of these polymorphisms was characterized by quantitative gene-dosage dependence insofar as the heterozygous phenotype expressed approximately 50% of each allelic gene product as was seen in homozygotes. Patterns observed were also identical in monozygotic twins, replicate samples, and replicate gels. The three expected phenotypes (two homozygotes and a heterozygote) were observed in each of 10 of these polymorphisms while the remaining nine had one of the homozygous classes absent. The presence of the three phenotypes, the demonstration of gene-dosage dependence, and our own and previous pedigree analysis of certain of these polymorphisms supports the genetic basis of these variants. Based on this data, the frequency of polymorphic loci for man is: P . 19/186 . .102, and the average heterozygosity is .024. This estimate is approximately 1/3 to 1/2 the rate of polymorphism previously estimated for man in other studies using one-dimensional electrophoresis of isozyme loci. The newly described polymorphisms and others which should be detectable in larger protein surveys with two-dimensional electrophoresis hold promise as genetic markers of the human genome for use in gene mapping and pedigree analyses

  7. Two-dimensional PCA-based human gait identification

    Science.gov (United States)

    Chen, Jinyan; Wu, Rongteng

    2012-11-01

    It is very necessary to recognize person through visual surveillance automatically for public security reason. Human gait based identification focus on recognizing human by his walking video automatically using computer vision and image processing approaches. As a potential biometric measure, human gait identification has attracted more and more researchers. Current human gait identification methods can be divided into two categories: model-based methods and motion-based methods. In this paper a two-Dimensional Principal Component Analysis and temporal-space analysis based human gait identification method is proposed. Using background estimation and image subtraction we can get a binary images sequence from the surveillance video. By comparing the difference of two adjacent images in the gait images sequence, we can get a difference binary images sequence. Every binary difference image indicates the body moving mode during a person walking. We use the following steps to extract the temporal-space features from the difference binary images sequence: Projecting one difference image to Y axis or X axis we can get two vectors. Project every difference image in the difference binary images sequence to Y axis or X axis difference binary images sequence we can get two matrixes. These two matrixes indicate the styles of one walking. Then Two-Dimensional Principal Component Analysis(2DPCA) is used to transform these two matrixes to two vectors while at the same time keep the maximum separability. Finally the similarity of two human gait images is calculated by the Euclidean distance of the two vectors. The performance of our methods is illustrated using the CASIA Gait Database.

  8. Enhanced secretion of TIMP-1 by human hypertrophic scar keratinocytes could contribute to fibrosis.

    Science.gov (United States)

    Simon, Franck; Bergeron, Daniele; Larochelle, Sébastien; Lopez-Vallé, Carlos A; Genest, Hervé; Armour, Alexis; Moulin, Véronique J

    2012-05-01

    Hypertrophic scars are a pathological process characterized by an excessive deposition of extracellular matrix components. Using a tissue-engineered reconstructed human skin (RHS) method, we previously reported that pathological keratinocytes induce formation of a fibrotic dermal matrix. We further investigated keratinocyte action using conditioned media. Results showed that conditioned media induce a similar action on dermal thickness similar to when an epidermis is present. Using a two-dimensional electrophoresis technique, we then compared conditioned media from normal or hypertrophic scar keratinocytes and determined that TIMP-1 was increased in conditioned media from hypertrophic scar keratinocytes. This differential profile was confirmed using ELISA, assaying TIMP-1 presence on media from monolayer cultured keratinocytes and from RHS. The dermal matrix of these RHS was recreated using mesenchymal cells from three different origins (skin, wound and hypertrophic scar). The effect of increased TIMP-1 levels on dermal fibrosis was also validated independently from the mesenchymal cell origin. Immunodetection of TIMP-1 showed that this protein was increased in the epidermis of hypertrophic scar biopsies. The findings of this study represent an important advance in understanding the role of keratinocytes as a direct potent modulator for matrix degradation and scar tissue remodeling, possibly through inactivation of MMPs. Copyright © 2011 Elsevier Ltd and ISBI. All rights reserved.

  9. Decorin gene expression and its regulation in human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Velez-DelValle, Cristina; Marsch-Moreno, Meytha; Castro-Munozledo, Federico [Department of Cell Biology, Centro de Investigacion y de Estudios Avanzados del IPN, Apdo. Postal 14-740, Mexico D.F. 07000 (Mexico); Kuri-Harcuch, Walid, E-mail: walidkuri@gmail.com [Department of Cell Biology, Centro de Investigacion y de Estudios Avanzados del IPN, Apdo. Postal 14-740, Mexico D.F. 07000 (Mexico)

    2011-07-22

    Highlights: {yields} We showed that cultured human diploid epidermal keratinocytes express and synthesize decorin. {yields} Decorin is found intracytoplasmic in suprabasal cells of cultures and in human epidermis. {yields} Decorin mRNA expression in cHEK is regulated by pro-inflammatory and proliferative cytokines. {yields} Decorin immunostaining of psoriatic lesions showed a lower intensity and altered intracytoplasmic arrangements. -- Abstract: In various cell types, including cancer cells, decorin is involved in regulation of cell attachment, migration and proliferation. In skin, decorin is seen in dermis, but not in keratinocytes. We show that decorin gene (DCN) is expressed in the cultured keratinocytes, and the protein is found in the cytoplasm of differentiating keratinocytes and in suprabasal layers of human epidermis. RT-PCR experiments showed that DCN expression is regulated by pro-inflammatory and proliferative cytokines. Our data suggest that decorin should play a significant role in keratinocyte terminal differentiation, cutaneous homeostasis and dermatological diseases.

  10. In Vitro Toxicity of Aluminum Nanoparticles in Human Keratinocytes

    National Research Council Canada - National Science Library

    McCormack-Brown, Stephanie

    2008-01-01

    .... There is no published data on AL NP toxicity effects on human skin. This research used in vitro techniques to determine the cytotoxicity of AL NPs, sized 50, 80, and 120 nm, on human keratinocytes...

  11. Differentiation of human scalp hair follicle keratinocytes in culture.

    Science.gov (United States)

    Weterings, P J; Verhagen, H; Wirtz, P; Vermorken, A J

    1984-01-01

    The morphology of human scalp hair follicle keratinocytes, cultured on the bovine eye lens capsule, is studied by light and electron microscopy. The hair follicle keratinocytes in the stratified cultures are characterized by the presence of numerous tonofilaments, desmosomes and lysosomes and by the presence of glycogen accumulations. The cells in the upper layers develop a cornified envelope. Moreover, an incomplete basal lamina is found between the capsule and the basal cells. However, some features of epidermal keratinocytes in vivo, such as keratohyalin granules and stratum corneum formation, are absent. Analysis of the polypeptides by sodium dodecylsulfate polyacrylamide gel electrophoresis also reveals differences between the cultured hair follicle cells and epidermis, whilst the patterns of cultured cells and hair follicle sheaths are similar. The morphological and protein biosynthetic aspects of terminal differentiation of the keratinocytes in vitro are correlated. These results are discussed in the light of the findings with cultured epidermal keratinocytes, reported in the literature.

  12. Human Keratinocytes Radioprotection with Mentha Longifolia

    Science.gov (United States)

    Rizzo, Angela Maria; Berselli, P.; Zava, S.; Negroni, M.; Corsetto, P.; Montorfano, G.; Bertolotti, A.; Ranza, E.; Ottolenghi, A.; Berra, B.

    Antioxidants are suggested to act as radioprotectors, and dietary supplements based on antiox-idants have been proposed for astronauts involved in long-term space missions. Plant extracts with antioxidant properties may be used in dietetic supplements for astronauts; in fact recent nutritional guidelines suggest that "fruits and vegetables may become as important on space-going vessels as limes were on the sea-going vessels of old". Mint presents a large variety of biological properties, such as antiallergenic, antibacterial, anti-inflammatory, antitumor, an-tiviral, gastrointestinal protective, hepatoprotective, chemopreventive activities, most of which are attributable to its antioxidant activity. The aim of the present study is to evaluate the antioxidant properties and protective bio-efficacy of a phenol enriched Mentha longifolia ex-tract on gamma rays stressed human keratinocytes (NCTC2544). We assessed first the in vitro antioxidant activity (ABTS and DPPH), and then evaluated different stress markers in order to investigate various oxidative stress targets: cell viability (MTT); retained proliferating ca-pability (CA); DNA damage (histone H2AX) and protein damage (HSP70 induction). Results indicate that this Mint extract has a higher antioxidant activity respect to fresh extracts, that could be responsible of its really interesting radio-protective effects.

  13. Serial cultivation of human scalp hair follicle keratinocytes.

    Science.gov (United States)

    Weterings, P J; Roelofs, H M; Vermorken, A J; Bloemendal, H

    1983-01-01

    A method is described for the serial cultivation of adult human hair follicle keratinocytes. Plucked scalp hair follicles, placed on bovine eye lens capsules as a growth substrate, give rise to quickly expanding colonies within a few days. After trypsinization, the cells are replated with irradiated 3T3 cells as 'feeders'. Using this combination of techniques the keratinocytes can be subcultured up to four times. In this way about 10(7) keratinocytes can be generated from one single hair follicle. Moreover, the technique enables cryogenic storage of the cells, allowing for instance, convenient transportation. Subcultured hair follicle keratinocytes can be plated on glass coverslips. This allows immunofluorescence studies. The keratin cytoskeletons visualized using an antiserum against human keratin.

  14. Polymeric membranes modulate human keratinocyte differentiation in specific epidermal layers.

    Science.gov (United States)

    Salerno, Simona; Morelli, Sabrina; Giordano, Francesca; Gordano, Amalia; Bartolo, Loredana De

    2016-10-01

    In vitro models of human bioengineered skin substitutes are an alternative to animal experimentation for testing the effects and toxicity of drugs, cosmetics and pollutants. For the first time specific and distinct human epidermal strata were engineered by using membranes and keratinocytes. To this purpose, biodegradable membranes of chitosan (CHT), polycaprolactone (PCL) and a polymeric blend of CHT-PCL were prepared by phase-inversion technique and characterized in order to evaluate their morphological, physico-chemical and mechanical properties. The capability of membranes to modulate keratinocyte differentiation inducing specific interactions in epidermal membrane systems was investigated. The overall results demonstrated that the membrane properties strongly influence the cell morpho-functional behaviour of human keratinocytes, modulating their terminal differentiation, with the creation of specific epidermal strata or a fully proliferative epidermal multilayer system. In particular, human keratinocytes adhered on CHT and CHT-PCL membranes, forming the structure of the epidermal top layers, such as the corneum and granulosum strata, characterized by withdrawal or reduction from the cell cycle and cell proliferation. On the PCL membrane, keratinocytes developed an epidermal basal lamina, with high proliferating cells that stratified and migrated over time to form a complete differentiating epidermal multilayer system. Copyright © 2016 Elsevier B.V. All rights reserved.

  15. Micronucleus formation in cultured human keratinocytes: Involvement of intercellular bioactivation.

    Science.gov (United States)

    van Pelt, F N; Haring, R M; Weterings, P J

    1991-01-01

    Micronucleus formation in cultured human keratinocytes was studied after exposure to benzo[a]pyrene, cyclophosphamide and 12-O-tetradecanoylphorbol-13-acetate without the addition of an exogenous metabolizing system. The first two agents need bioactivation by specific isoenzymes of cytochrome P-450 to form genotoxic intermediates. Benzo[a]pyrene induced the micronucleus formation in both uninduced and Aroclor 1254-pretreated cultures. Clastogenic effects of cyclophosphamide were observed only in Aroclor 1254-pretreated cells. The tumour promotor 12-O-tetradecanoylphorbol-13-acetate did not affect the frequency of micronuclei in human keratinocytes. The data indicate that cultured human keratinocytes can be used to study the tissue-specific response to genotoxic agents as well as interindividual variation in biotransformation capacity.

  16. Effects of UVB irradiation on keratinocyte growth factor (KGF) and receptor (KGFR) expression in cultured human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Y.; Lee, H.S.T.; Kooshesh, F.; Fujisawa, H.; Sauder, D.N.; Kondo, S. [Univ. of Toronto, Sunnybrook Health Science Centre, Div. of Dermatology, Toronto (Canada)

    1996-06-01

    Keratinocyte growth factor (KGF) and its receptor (KGFR) are thought to play important roles in normal keratinocyte growth and differentiation. Since UVB radiation is known to influence keratinocyte growth, we sought to determine whether UVB would alter the expression of KGF and KGFR. Using a reverse-transcription coupled polymerase chain reaction (RT-PCR), the present study examined the expression of KGF and KGFR mRNA in cultured normal human keratinocytes exposed to UVB irradiation. Total cellular RNA was extracted from cultured keratinocytes at various time points after irradiation, reverse transcribed and used for PCR amplification using primers specific for KGF and KGFR. Constitutive expression of KGFR mRNA, but not KGF mRNA, was detected in normal cultured human keratinocytes. After UVB irradiation at 300 J/m{sup 2}, the KGF mRNA remained undetectable while the KGFR mRNA level was significantly decreased. The down-regulation of KGFR mRNA expression was also confirmed by Northern blot analysis. Immunohistochemical studies demonstrated a decreased positive signal of KGFR in human keratinocytes after UVB irradiation. Our results suggest a possible role for the KGF-KGFR signalling pathway in the skin after exposure to UVB, and that UVB-induced growth inhibition of keratinocytes in hyperproliferative skin disorders may be related to downregulation of KGFR. (au) 39 refs.

  17. Muscle protein analysis. II. Two-dimensional electrophoresis of normal and diseased human skeletal muscle

    Energy Technology Data Exchange (ETDEWEB)

    Giometti, C.S. (Argonne National Lab., IL); Barany, M.; Danon, M.J.; Anderson, N.G.

    1980-07-01

    High-resolution two-dimensional electrophoresis was used to analyze the major proteins of normal and pathological human-muscle samples. The normal human-muscle pattern contains four myosin light chains: three that co-migrate with the myosin light chains from rabbit fast muscle (extensor digitorum longus), and one that co-migrates with the light chain 2 from rabbit slow muscle (soleus). Of seven Duchenne muscular dystrophy samples, four yielded patterns with decreased amounts of actin and myosin relative to normal muscle, while three samples gave patterns comparable to that for normal muscle. Six samples from patients with myotonic dystrophy also gave normal patterns. In nemaline rod myopathy, in contrast, the pattern was deficient in two of the fast-type myosin light chains.

  18. A Two-Dimensional Human Minilung System (Model for Respiratory Syncytial Virus Infections

    Directory of Open Access Journals (Sweden)

    Esmeralda Magro-Lopez

    2017-12-01

    Full Text Available Human respiratory syncytial virus (HRSV is a major cause of serious pediatric respiratory diseases that lacks effective vaccine or specific therapeutics. Although our understanding about HRSV biology has dramatically increased during the last decades, the need for adequate models of HRSV infection is compelling. We have generated a two-dimensional minilung from human embryonic stem cells (hESCs. The differentiation protocol yielded at least six types of lung and airway cells, although it is biased toward the generation of distal cells. We show evidence of HRSV replication in lung cells, and the induction of innate and proinflammatory responses, thus supporting its use as a model for the study of HRSV–host interactions.

  19. Two-dimensional electrophoretic analysis of nuclear matrix proteins in human colon adenocarcinoma.

    Science.gov (United States)

    Toumpanaki, A; Baltatzis, G E; Gaitanarou, E; Seretis, E; Toumpanakis, C; Aroni, K; Kittas, Christos; Voloudakis-Baltatzis, I E

    2009-01-01

    The aim of the present study was to observe possible qualitative and quantitative expression differences between nuclear matrix proteins (NMPs) of human colon adenocarcinoma and their mirror biopsies, using the technique of two-dimensional gel electrophoresis, in order to identify the existence of specific NMP fingerprints for colon cancer. Colon tissues were examined ultrastructurally and NMPs were isolated biochemically, by serial extraction of lipids, soluble proteins, DNA, RNA, and intermediate filaments and were separated according to their isoelectric point (pI) and their molecular weight (MW) by high-resolution two-dimensional electrophoresis (2D). By comparing the 2D electropherograms of colon cancer tissues and mirror biopsy tissues we observed qualitative and quantitative expression differences between their NMPs but also a differentiation of NMP composition between the stages of malignancy. Moreover, despite the similarities between mirror biopsy samples, a highlight percentage of exception was observed. Electrophoretic results provided in this study demonstrated that the examined NMPs could be further investigated as potential markers for detection of colorectal cancer in an early stage, for the assessment of the disease progression, as well as useful tools for individual therapy and for preventing a possible recurrence of cancer and metastasis.

  20. Simplifying numerical ray tracing for two-dimensional non circularly symmetric models of the human eye.

    Science.gov (United States)

    Jesus, Danilo A; Iskander, D Robert

    2015-12-01

    Ray tracing is a powerful technique to understand the light behavior through an intricate optical system such as that of a human eye. The prediction of visual acuity can be achieved through characteristics of an optical system such as the geometrical point spread function. In general, its precision depends on the number of discrete rays and the accurate surface representation of each eye's components. Recently, a method that simplifies calculation of the geometrical point spread function has been proposed for circularly symmetric systems [Appl. Opt.53, 4784 (2014)]. An extension of this method to 2D noncircularly symmetric systems is proposed. In this method, a two-dimensional ray tracing procedure for an arbitrary number of surfaces and arbitrary surface shapes has been developed where surfaces, rays, and refractive indices are all represented in functional forms being approximated by Chebyshev polynomials. The Liou and Brennan anatomically accurate eye model has been adapted and used for evaluating the method. Further, real measurements of the anterior corneal surface of normal, astigmatic, and keratoconic eyes were substituted for the first surface in the model. The results have shown that performing ray tracing, utilizing the two-dimensional Chebyshev function approximation, is possible for noncircularly symmetric models, and that such calculation can be performed with a newly created Chebfun toolbox.

  1. AMPK regulation of the growth of cultured human keratinocytes

    International Nuclear Information System (INIS)

    Saha, Asish K.; Persons, Kelly; Safer, Joshua D.; Luo Zhijun; Holick, Michael F.; Ruderman, Neil B.

    2006-01-01

    AMP kinase (AMPK) is a fuel sensing enzyme that responds to cellular energy depletion by increasing processes that generate ATP and inhibiting others that require ATP but are not acutely necessary for survival. In the present study, we examined the relationship between AMPK activation and the growth (proliferation) of cultured human keratinocytes and assessed whether the inhibition of keratinocyte growth by vitamin D involves AMPK activation. In addition, we explored whether the inhibition of keratinocyte proliferation as they approach confluence could be AMPK-related. Keratinocytes were incubated for 12 h with the AMPK activator, 5-aminoimidazole-4-carboxamide-1-β-D-ribofuranoside (AICAR). At concentrations of 10 -4 and 10 -3 M, AICAR inhibited keratinocyte growth by 50% and 95%, respectively, based on measurements of thymidine incorporation into DNA. It also increased AMPK and acetyl CoA carboxylase phosphorylation (P-AMPK and P-ACC) and decreased the concentration of malonyl CoA confirming that AMPK activation had occurred. Incubation with the thiazolidinedione, troglitazone (10 -6 M) caused similar alterations in P-AMPK, P-ACC, and cell growth. In contrast, the well known inhibition of keratinocyte growth by 1,25-dihydroxyvitamin D 3 (10 -7 and 10 -6 M) was not associated with changes in P-AMPK or P-ACC. Like most cells, the growth of keratinocytes diminished as they approached confluence. Thus, it was of note that we found a progressive increase in P-AMPK (1.5- to 2-fold, p 3 is AMPK-independent

  2. Kinetics of growth and differentiation of cultured human epidermal keratinocytes

    International Nuclear Information System (INIS)

    Albers, K.M.

    1985-01-01

    A study was made of the interrelationship between replication and differentiation in cultures of human epidermal keratinocytes. Measures of both parameters were made using newly developed methods to quantify the rate at which keratinocytes replicate and the rate at which they withdraw from the cell cycle. Keratinocyte replication was measured by determining the cell doubling time, labeling index, and cell cycle duration. Cell cycle length was measured using a double label assay that determines the length of time between two successive phases of DNA synthesis. The first DNA synthesis phase was marked by labeling keratinocytes with 14 C-thymidine. At the next round of DNA synthesis, cells were labeled with bromodeoxyuridine, a heavy analog of thymidine. The cell cycle length is given by the time required for the 14 C-labeled DNA to become double labeled. To measure keratinocyte differentiation, the rate at which cells withdraw from the cell cycle was determined. To measure withdrawal, the percentage of cells labeled by a pulse of 14 C-thymidine that failed to undergo a second cycle of DNA synthesis, as measured by bromodeoxyuridine incorporation, was determined. Cells which failed to undergo a second cycle of synthesis were considered to have differentiated and withdrawn from the cell cycle

  3. Proteomic profiling of human pleural effusion using two-dimensional nano liquid chromatography tandem mass spectrometry.

    Science.gov (United States)

    Tyan, Yu-Chang; Wu, Hsin-Yi; Lai, Wu-Wei; Su, Wu-Chou; Liao, Pao-Chi

    2005-01-01

    Pleural effusion, an accumulation of pleural fluid, contains proteins originated from plasma filtrate and, especially when tissues are damaged, parenchyma interstitial spaces of lungs and/or other organs. This study details protein profiles in human pleural effusion from 43 lung adenocarcinoma patients by a two-dimensional nano-high performance liquid chromatography electrospray ionization tandem mass spectrometry (2D nano-HPLC-ESI-MS/MS) system. The experimental results revealed the identification of 1415 unique proteins from human pleural effusion. Among these 124 proteins identified with higher confidence levels, some proteins have not been reported in plasma and may represent proteins specifically present in pleural effusion. These proteins are valuable for mass identification of differentially expressed proteins involved in proteomics database and screening biomarker to further study in human lung adenocarcinoma. The significance of the use of proteomics analysis of human pleural fluid for the search of new lung cancer marker proteins, and for their simultaneous display and analysis in patients suffering from lung disorders has been examined.

  4. Quantitative two-dimensional gel electrophoresis analysis of human fibroblasts transformed by ras oncogenes.

    Science.gov (United States)

    Miller, M J; Maher, V M; McCormick, J J

    1992-11-01

    Quantitative two-dimensional gel electrophoresis was used to compare the cellular protein patterns of a normal foreskin-derived human fibroblasts cell line (LG1) and three immortal derivatives of LG1. One derivative, designated MSU-1.1 VO, was selected for its ability to grow in the absence of serum and is non-tumorigenic in athymic mice. The other two strains were selected for focus-formation following transfection with either Ha-ras or N-ras oncogenes and form high grade malignant tumors. Correspondence and cluster analysis provided a nonbiased estimate of the relative similarity of the different two-dimensional patterns. These techniques separated the gel patterns into three distinct classes: LG1, MSU-1.1 VO, and the ras transformed cell strains. The MSU-1.1 VO cells were more closely related to the parental LG1 than to the ras-transformed cells. The differences between the three classes were primarily quantitative in nature: 16% of the spots demonstrated statistically significant changes (P 2) in the rate of incorporation of radioactive amino acids. The patterns from the two ras-transformed cell strains were similar, and variations in the expression of proteins that occurred between the separate experiments obscured consistent differences between the Ha-ras and N-ras transformed cells. However, while only 9 out of 758 spots were classified as different (1%), correspondence analysis could consistently separate the two ras transformants. One of these spots was five times more intense in the Ha-ras transformed cells than the N-ras.(ABSTRACT TRUNCATED AT 250 WORDS)

  5. Intermittent pressure decreases human keratinocyte proliferation in vitro.

    Science.gov (United States)

    Nasca, Maria R; Shih, Alan T; West, Dennis P; Martinez, Wanda M; Micali, Giuseppe; Landsman, Adam S

    2007-01-01

    The aim of this study was to investigate the correlation between pressure changes and keratinocyte proliferation by determining whether keratinocytes exposed to altered mechanical pressures would proliferate at different rates compared to control cells not subjected to pressure changes. Tissue culture flasks of human keratinocytes plated at an approximate density of 15,000 cells/cm(2) undergoing an intermittent cyclic pressure of 362 mm Hg at a frequency of 2.28 or 5.16 cycles/min (0.038 or 0.086 Hz) for 8 h were compared to control flasks grown at ambient room pressure. An in-line pressure transducer was used to monitor and adjust pressure within the cell chambers, using a solenoid valve. A thymidine incorporation assay assessed the amount of cell proliferation in each set of experiments. Differences in proliferation between keratinocytes subjected to cyclic pressure changes and control cells were found to be statistically significant (p < 0.05) in 4 out of 5 proliferation assays. Also, a higher frequency of pressure changes consistently generated a reduced proliferation rate compared to that seen in cells exposed to a lower frequency of pressure changes. These data indicate that keratinocytes undergoing intermittent pressure changes exhibit decreased proliferation rates compared to controls. Furthermore, an increased frequency rate seems to have a greater effect on proliferation than low-frequency rate pressure changes, suggesting that the stress caused by frequently changed pressure may play a greater role in reducing keratinocyte proliferation than the actual magnitude of load applied to the cells. Our results support the current treatment protocol of reducing speed and duration of walking on the site of the wound to promote healing of foot ulcers. (c) 2007 S. Karger AG, Basel.

  6. Photodynamic toxicity of hematoporphyrin derivatives to human keratinocytes in culture.

    Science.gov (United States)

    Kappus, H; Reinhold, C; Artuc, M

    Human keratinocytes in culture were able to take up hematoporphyrin derivatives (HPDs) used during photodynamic chemotherapy of tumors. In the absence of light, HPDs showed no cytotoxic effects to keratinocytes. However, after irradiation with visible light, HPDs induced immediate cytotoxicity as measured by the neutral red uptake assay. On the other hand, cell attachment as measured by protein estimation was not affected. When the cells treated with HPDs and irradiated with light were cultured for a further 72 h, they partially lost their ability to attach to the collagen surface. Most of the cells remaining attached after 72 h were no longer viable following treatment with HPDs and light. All parameters measured depended on the intracellular concentration of HPDs used (7-50 ng/10(5) cells) and the time of irradiation (0-30 min). These results suggest that human keratinocytes are a good model to study cytotoxic effects of photodynamically active drugs. Further, keratinocytes were unable to recover after damage caused by HPDs and light.

  7. The peanut lectin-binding glycoproteins of human epidermal keratinocytes

    International Nuclear Information System (INIS)

    Morrison, A.I.; Keeble, S.; Watt, F.M.

    1988-01-01

    The peanut lectin (PNA) is known to bind more strongly to keratinocytes that are undergoing terminal differentiation than to proliferating keratinocytes. In order to investigate the significance of this change in cell-surface carbohydrate authors have identified the PNA-binding glycoproteins of cultured human keratinocytes and antibodies against them. Two heavily glycosylated bands of 110 and 250 kDa were resolved by PAGE of [ 14 C]galactose- or [ 14 C]mannose- and [ 14 C]glucosamine-labeled cell extracts eluted with galactose from PNA affinity columns. The higher molecular weight band was also detected on PNA blots of unlabeled cell extracts transferred to nitrocellulose. Both bands were sensitive to pronase digestion, but only the 250-kDa band was digested with trypsin. A rabbit antiserum that we prepared (anti-PNA-gp) immunoprecipitated both bands from cell extracts. In contrast to PNA, anti-PNA-gp bound equally to proliferating and terminally differentiating cells, indicating that some epitope(s) of the PNA-binding glycoproteins is present on the cell surface prior to terminal differentiation. When keratinocytes grown as a monolayer in low-calcium medium were switched to medium containing 2 mM calcium ions in order to induce desmosome formation and stratification, there was a dramatic redistribution of the PNA-binding glycoproteins, which became concentrated at the boundaries between cells. This may suggest a role for the glycoproteins in cell-cell interactions during stratification

  8. Effects of Human Mesenchymal Stem Cells Coculture on Calcium-Induced Differentiation of Normal Human Keratinocytes.

    Science.gov (United States)

    Sah, Shyam Kishor; Kim, Hae Young; Lee, Ji Hae; Lee, Seong-Wook; Kim, Hyung-Sik; Kim, Yeon-Soo; Kang, Kyung-Sun; Kim, Tae-Yoon

    2017-06-01

    The influence of mesenchymal stem cells (MSCs) on keratinocytes in altered microenvironments is poorly understood. Here, we cocultured umbilical cord blood-derived MSCs with normal human epidermal keratinocytes to evaluate their paracrine effect in the presence of high extracellular calcium (Ca 2+ ) concentration. High Ca 2+ environment to keratinocytes can disrupt normal skin barrier function due to abnormal/premature differentiation of keratinocytes. Surprisingly, we found that MSCs suppress both proliferation and differentiation of keratinocytes under a high Ca 2+ environment in transforming growth factors β1 (TGFβ1)-dependent manner. Furthermore, we determined that MSCs can regulate the mitogen-activated protein kinases, phosphatidylinositol 3-kinase/protein kinase B, and protein kinase C pathways in Ca 2+ -induced differentiated keratinocytes. Knockdown of TGFβ1 from MSCs results in decreased suppression of differentiation with significantly increased proliferation of keratinocytes compared with control MSCs. MSCs-derived TGFβ1 further induced growth inhibition of keratinocyte in high extracellular Ca 2+ environment as analyzed by a decrease in DNA synthesis, accumulation of phosphorylated retinoblastoma protein, cdc2, and increased mRNA level of p21, and independent of TGFβ1/SMAD pathway. Taken together, we found that MSCs-derived TGFβ1 is a critical regulator of keratinocyte function, and involves multiple proximal signaling cascades. Stem Cells 2017;35:1592-1602. © 2017 AlphaMed Press.

  9. Two-dimensional gel proteome reference map of human small intestine

    Directory of Open Access Journals (Sweden)

    Canzonieri Vincenzo

    2009-03-01

    Full Text Available Abstract Background The small intestine is an important human organ that plays a central role in many physiological functions including digestion, absorption, secretion and defense. Duodenal pathologies include, for instance, the ulcer associated to Helicobacter Pylori infection, adenoma and, in genetically predisposed individuals, celiac disease. Alterations in the bowel reduce its capability to absorb nutrients, minerals and fat-soluble vitamins. Anemia and osteopenia or osteoporosis may develop as a consequence of vitamins malabsorption. Adenoma is a benign tumor that has the potential to become cancerous. Adult celiac disease patients present an overall risk of cancer that is almost twice than that found in the general population. These disease processes are not completely known. To date, a two dimensional (2D reference map of proteins expressed in human duodenal tissue is not yet available: the aim of our study was to characterize the 2D protein map, and to identify proteins of duodenal mucosa of adult individuals without duodenal illness, to create a protein database. This approach, may be useful for comparing similar protein samples in different laboratories and for the molecular characterization of intestinal pathologies without recurring to the use of surgical material. Results The enrolled population comprised five selected samples (3 males and 2 females, aged 19 to 42, taken from 20 adult subjects, on their first visit at the gastroenterology unit for a suspected celiac disease, who did not turn to be affected by any duodenal pathology after gastrointestinal and histological evaluations. Proteins extracted from the five duodenal mucosal specimens were singly separated by 2D gel electrophoresis. After image analysis of each 2D gel, 179 protein spots, representing 145 unique proteins, from 218 spots tested, were successfully identified by MALDI-TOF ms analysis. Normalized volumes, for each protein, have been reported for every gel

  10. Flow cytometry of human primary epidermal and follicular keratinocytes.

    Science.gov (United States)

    Gragnani, Alfredo; Ipolito, Michelle Zampieri; Sobral, Christiane S; Brunialti, Milena Karina Coló; Salomão, Reinaldo; Ferreira, Lydia Masako

    2008-02-19

    The aim of this study was to characterize using flow cytometry cultured human primary keratinocytes isolated from the epidermis and hair follicles by different methods. Human keratinocytes derived from discarded fragments of total skin and scalp hair follicles from patients who underwent plastic surgery in the Plastic Surgery Division at UNIFESP were used. The epidermal keratinocytes were isolated by using 3 different methods: the standard method, upon exposure to trypsin for 30 minutes; the second, by treatment with dispase for 18 hours and with trypsin for 10 minutes; and the third, by treatment with dispase for 18 hours and with trypsin for 30 minutes. Follicular keratinocytes were isolated using the standard method. On comparing the group treated with dispase for 18 hours and with trypsin for 10 minutes with the group treated with dispase for 18 hours and with trypsin for 30 minutes, it was observed that the first group presented the largest number of viable cells, the smallest number of cells in late apoptosis and necrosis with statistical significance, and no difference in apoptosis. When we compared the group treated with dispase for 18 hours and with trypsin for 10 minutes with the group treated with trypsin, the first group presented the largest number of viable cells, the smallest number of cells in apoptosis with statistical significance, and no difference in late apoptosis and necrosis. When we compared the results of the group treated with dispase for 18 hours and with trypsin for 10 minutes with the results for follical isolation, there was a statistical difference in apoptosis and viable cells. The isolation method of treatment with dispase for 18 hours and with trypsin for 10 minutes produced the largest number of viable cells and the smallest number of cells in apoptosis/necrosis.

  11. Enhanced expression of IL-8 in normal human keratinocytes and human keratinocyte cell line HaCaT in vitro after stimulation with contact sensitizers, tolerogens and irritants.

    Science.gov (United States)

    Mohamadzadeh, M; Müller, M; Hultsch, T; Enk, A; Saloga, J; Knop, J

    1994-12-01

    To investigate the interleukin-8 production of keratinocytes after stimulation in vitro we have used various agents: (i) contact sensitizer (2,4-dinitrofluorobenzene, 3-n-pentadecylcatechol); (ii) tolerogen (5-methyl-3-n-pentadecylcatechol); (iii) irritant (sodium lauryl sulfate). Interleukin-8 gene expression was assessed by northern blot hybridization of the total cytoplasmic RNA extracted from subconfluent normal human keratinocyte cultures and the keratinocyte cell line HaCaT using a radiolabeled DNA probe specific for human interleukin-8. Interleukin-8 gene expression was markedly increased upon in vitro stimulation after 1-6 h with contact sensitizers, tolerogen and the irritant. In contrast, interleukin-8 production was not detectable in unstimulated normal human keratinocytes or the HaCaT keratinocyte cell line. These results suggest that the induction and production of interleukin-8 is a response to nonspecific stimuli and may play a critical role in the early response to immunogenic or inflammatory signals in man.

  12. Response of human epidermal keratinocytes to UV light

    International Nuclear Information System (INIS)

    Kartasova, A.A.

    1987-01-01

    This thesis presents a study on the response of human epidermal keratinocytes to UV light as well as to other agents like 4-NQO and TPA. The effects of ultraviolet (UV) light on the protein synthesis in cultured keratinocytes are presented in ch. III. The next chapter describes the construction of a cDNA library using mRNA isolated from UV irradiated kernatinocytes. This library was differentially screened with cDNA probes synthesized on mRNA from either UV irradiated or nonirradiated cells. Several groups of cDNA clones corresponding to transcripts whose level in the cytoplasm seem to be affected by exposure to UV light have been isolated and characterized by cross-hybridization, sequencing and Northern blot analysis. More detailed analysis of some of the cDNA clones is presented in the two chapters following ch. IV. The complete cDNA sequence of the proteinase inhibitor cystatin A and the modulation of its expression by UV light and the carcinogen 4-nitroquinoline 1-oxide (4-NQO) in keratinocytes are described in ch. V. Two other groups of cDNA clones have been isolated which do not cross-hybridize with each other on Southern blots. However, the primary structures of the proteins deduced from the nucleotide sequences of these two groups of cDNA clones are very similar. 212 refs.; 33 figs.; 2 tabs

  13. Steroid synthesis by primary human keratinocytes; implications for skin disease

    Energy Technology Data Exchange (ETDEWEB)

    Hannen, Rosalind F., E-mail: r.f.hannen@qmul.ac.uk [Centre for Cutaneous Research, Institute of Cell and Molecular Science, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, London E1 2AT (United Kingdom); Michael, Anthony E. [Centre for Developmental and Endocrine Signalling, Academic Section of Obstetrics and Gynaecology, Division of Clinical Developmental Sciences, 3rd Floor, Lanesborough Wing, St. George' s, University of London, Cranmer Terrace, Tooting, London SW17 0RE (United Kingdom); Jaulim, Adil [Centre for Cutaneous Research, Institute of Cell and Molecular Science, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, London E1 2AT (United Kingdom); Bhogal, Ranjit [Life Science, Unilever R and D Colworth House, Sharnbrook, Bedfordshire MK44 1LQ (United Kingdom); Burrin, Jacky M. [Centre for Endocrinology, William Harvey Research Institute, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, London EC1M 6BQ (United Kingdom); Philpott, Michael P. [Centre for Cutaneous Research, Institute of Cell and Molecular Science, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, London E1 2AT (United Kingdom)

    2011-01-07

    Research highlights: {yields} Primary keratinocytes express the steroid enzymes required for cortisol synthesis. {yields} Normal primary human keratinocytes can synthesise cortisol. {yields} Steroidogenic regulators, StAR and MLN64, are expressed in normal epidermis. {yields} StAR expression is down regulated in eczema and psoriatic epidermis. -- Abstract: Cortisol-based therapy is one of the most potent anti-inflammatory treatments available for skin conditions including psoriasis and atopic dermatitis. Previous studies have investigated the steroidogenic capabilities of keratinocytes, though none have demonstrated that these skin cells, which form up to 90% of the epidermis are able to synthesise cortisol. Here we demonstrate that primary human keratinocytes (PHK) express all the elements required for cortisol steroidogenesis and metabolise pregnenolone through each intermediate steroid to cortisol. We show that normal epidermis and cultured PHK express each of the enzymes (CYP11A1, CYP17A1, 3{beta}HSD1, CYP21 and CYP11B1) that are required for cortisol synthesis. These enzymes were shown to be metabolically active for cortisol synthesis since radiometric conversion assays traced the metabolism of [7-{sup 3}H]-pregnenolone through each steroid intermediate to [7-{sup 3}H]-cortisol in cultured PHK. Trilostane (a 3{beta}HSD1 inhibitor) and ketoconazole (a CYP17A1 inhibitor) blocked the metabolism of both pregnenolone and progesterone. Finally, we show that normal skin expresses two cholesterol transporters, steroidogenic acute regulatory protein (StAR), regarded as the rate-determining protein for steroid synthesis, and metastatic lymph node 64 (MLN64) whose function has been linked to cholesterol transport in steroidogenesis. The expression of StAR and MLN64 was aberrant in two skin disorders, psoriasis and atopic dermatitis, that are commonly treated with cortisol, suggesting dysregulation of epidermal steroid synthesis in these patients. Collectively these data

  14. Steroid synthesis by primary human keratinocytes; implications for skin disease

    International Nuclear Information System (INIS)

    Hannen, Rosalind F.; Michael, Anthony E.; Jaulim, Adil; Bhogal, Ranjit; Burrin, Jacky M.; Philpott, Michael P.

    2011-01-01

    Research highlights: → Primary keratinocytes express the steroid enzymes required for cortisol synthesis. → Normal primary human keratinocytes can synthesise cortisol. → Steroidogenic regulators, StAR and MLN64, are expressed in normal epidermis. → StAR expression is down regulated in eczema and psoriatic epidermis. -- Abstract: Cortisol-based therapy is one of the most potent anti-inflammatory treatments available for skin conditions including psoriasis and atopic dermatitis. Previous studies have investigated the steroidogenic capabilities of keratinocytes, though none have demonstrated that these skin cells, which form up to 90% of the epidermis are able to synthesise cortisol. Here we demonstrate that primary human keratinocytes (PHK) express all the elements required for cortisol steroidogenesis and metabolise pregnenolone through each intermediate steroid to cortisol. We show that normal epidermis and cultured PHK express each of the enzymes (CYP11A1, CYP17A1, 3βHSD1, CYP21 and CYP11B1) that are required for cortisol synthesis. These enzymes were shown to be metabolically active for cortisol synthesis since radiometric conversion assays traced the metabolism of [7- 3 H]-pregnenolone through each steroid intermediate to [7- 3 H]-cortisol in cultured PHK. Trilostane (a 3βHSD1 inhibitor) and ketoconazole (a CYP17A1 inhibitor) blocked the metabolism of both pregnenolone and progesterone. Finally, we show that normal skin expresses two cholesterol transporters, steroidogenic acute regulatory protein (StAR), regarded as the rate-determining protein for steroid synthesis, and metastatic lymph node 64 (MLN64) whose function has been linked to cholesterol transport in steroidogenesis. The expression of StAR and MLN64 was aberrant in two skin disorders, psoriasis and atopic dermatitis, that are commonly treated with cortisol, suggesting dysregulation of epidermal steroid synthesis in these patients. Collectively these data show that PHK are capable of extra

  15. Stanniocalcin-1 regulates re-epithelialization in human keratinocytes.

    Directory of Open Access Journals (Sweden)

    Bonnie H Y Yeung

    Full Text Available Stanniocalcin-1 (STC1, a glycoprotein hormone, is believed to be involved in various biological processes such as inflammation, oxidative responses and cell migration. Riding on these emerging evidences, we hypothesized that STC1 may participate in the re-epithelialization during wound healing. Re-epithelialization is a critical step that involves keratinocyte lamellipodia (e-lam formation, followed by cell migration. In this study, staurosporine (STS treatment induced human keratinocyte (HaCaT e-lam formation on fibronectin matrix and migration via the activation of focal adhesion kinase (FAK, the surge of intracellular calcium level [Ca²⁺]i and the inactivation of Akt. In accompanied with these migratory features, a time- and dose-dependent increase in STC1 expression was detected. STC1 gene expression was found not the downstream target of FAK-signaling as illustrated by FAK inhibition using PF573228. The reduction of [Ca²⁺]i by BAPTA/AM blocked the STS-mediated keratinocyte migration and STC1 gene expression. Alternatively the increase of [Ca²⁺]i by ionomycin exerted promotional effect on STS-induced STC1 gene expression. The inhibition of Akt by SH6 and GSK3β by lithium chloride (LiCl could respectively induce and inhibit the STS-mediated e-lam formation, cell migration and STC1 gene expression. The STS-mediated e-lam formation and cell migration were notably hindered or induced respectively by STC1 knockdown or overexpression. This notion was further supported by the scratched wound assay. Collectively the findings provide the first evidence that STC1 promotes re-epithelialization in wound healing.

  16. Stanniocalcin-1 regulates re-epithelialization in human keratinocytes.

    Science.gov (United States)

    Yeung, Bonnie H Y; Wong, Chris K C

    2011-01-01

    Stanniocalcin-1 (STC1), a glycoprotein hormone, is believed to be involved in various biological processes such as inflammation, oxidative responses and cell migration. Riding on these emerging evidences, we hypothesized that STC1 may participate in the re-epithelialization during wound healing. Re-epithelialization is a critical step that involves keratinocyte lamellipodia (e-lam) formation, followed by cell migration. In this study, staurosporine (STS) treatment induced human keratinocyte (HaCaT) e-lam formation on fibronectin matrix and migration via the activation of focal adhesion kinase (FAK), the surge of intracellular calcium level [Ca²⁺]i and the inactivation of Akt. In accompanied with these migratory features, a time- and dose-dependent increase in STC1 expression was detected. STC1 gene expression was found not the downstream target of FAK-signaling as illustrated by FAK inhibition using PF573228. The reduction of [Ca²⁺]i by BAPTA/AM blocked the STS-mediated keratinocyte migration and STC1 gene expression. Alternatively the increase of [Ca²⁺]i by ionomycin exerted promotional effect on STS-induced STC1 gene expression. The inhibition of Akt by SH6 and GSK3β by lithium chloride (LiCl) could respectively induce and inhibit the STS-mediated e-lam formation, cell migration and STC1 gene expression. The STS-mediated e-lam formation and cell migration were notably hindered or induced respectively by STC1 knockdown or overexpression. This notion was further supported by the scratched wound assay. Collectively the findings provide the first evidence that STC1 promotes re-epithelialization in wound healing.

  17. Human keratinocyte sensitivity towards inflammatory cytokines varies with culture time

    Directory of Open Access Journals (Sweden)

    G. Elliott

    1992-01-01

    Full Text Available Proliferating keratinocyte cultures have been reported to synthesize higher concentrations of prostaglandin (PG E than confluent ones. As interleukin-1 (IL-1 stimulates keratinocyte PGE synthesis we investigated whether the degree of confluency of the keratinocyte culture modified the response of the cells to IL-1. It was found that IL-1α (100 U/ml stimulated PGE2 synthesis by proliferating (7 days in culture but not differentiating (14 days in culture keratinocytes. Similar effects were observed using tumour necrosis factor-α. Both arachidonic acid (AA and the calcium ionophore A23187 stimulated PGE2 synthesis by 7 and 14 day cultures although the increase was greatest when 7 day cultures were used. Our data indicate that there is a specific down-regulation of the mechanism(s by which some inflammatory cytokines stimulate keratinocyte eicosanoid synthesis as cultured keratinocytes begin to differentiate.

  18. Human keratinocytes produce the complement inhibitor factor H: synthesis is regulated by interferon-gamma

    NARCIS (Netherlands)

    Timár, Krisztina K.; Pasch, Marcel C.; van den Bosch, Norbert H. A.; Jarva, Hanna; Junnikkala, Sami; Meri, Seppo; Bos, Jan D.; Asghar, Syed S.

    2006-01-01

    Locally synthesized complement is believed to play an important role in host defense and inflammation at organ level. In the epidermis, keratinocytes have so far been shown to synthesize two complement components, C3 and factor B. Here, we studied the synthesis of factor H by human keratinocytes. We

  19. Gene expression studies on human keratinocytes transduced with human growth hormone gene for a possible utilization in gene therapy

    International Nuclear Information System (INIS)

    Mathor, Monica Beatriz.

    1994-01-01

    Taking advantage of the recent progress in the DNA-recombinant techniques and of the potentiality of normal human keratinocytes primary culture to reconstitute the epidermis, it was decided to genetically transform these keratinocytes to produce human growth hormone under controllable conditions that would be used in gene therapy at this hormone deficient patients. The first step to achieve this goal was to standardize infection of keratinocytes with retrovirus producer cells containing a construct which included the gene of bacterial b-galactosidase. The best result was obtained cultivating the keratinocytes for 3 days in a 2:1 mixture of retrovirus producer cells and 3T3-J2 fibroblasts irradiated with 60 Gy, and splitting these infected keratinocytes on 3T3-J2 fibroblasts feeder layer. Another preliminary experiment was to infect normal human keratinocytes with interleukin-6 gene (hIL-6) that, in pathologic conditions, could be reproduced by keratinocytes and secreted to the blood stream. Thus, we verify that infected keratinocytes secrete an average amount of 500 ng/10 6 cell/day of cytokin during the in vitro life time, that certify the stable character of the injection. These keratinocytes, when grafted in mice, secrete hIL-6 to the blood stream reaching levels of 40 pg/ml of serum. After these preliminary experiments, we construct a retroviral vector with the human growth hormone gene (h GH) driven by human metallothionein promoter (h PMT), designated DChPMTGH. Normal human keratinocytes were infected with DChPMTGH producer cells, following previously standardized protocol, obtaining infected keratinocytes secreting to the culture media 340 ng h GH/10 6 cell/day without promoter activation. This is the highest level of h GH secreted in human keratinocytes primary culture described in literature. The h GH value increases approximately 10 times after activation with 100 μM Zn +2 for 8-12 hours. (author). 158 refs., 42 figs., 6 tabs

  20. Forkhead Box C1 Regulates Human Primary Keratinocyte Terminal Differentiation.

    Directory of Open Access Journals (Sweden)

    Lianghua Bin

    Full Text Available The epidermis serves as a critical protective barrier between the internal and external environment of the human body. Its remarkable barrier function is established through the keratinocyte (KC terminal differentiation program. The transcription factors specifically regulating terminal differentiation remain largely unknown. Using a RNA-sequencing (RNA-seq profiling approach, we found that forkhead box c 1 (FOXC1 was significantly up-regulated in human normal primary KC during the course of differentiation. This observation was validated in human normal primary KC from several different donors and human skin biopsies. Silencing FOXC1 in human normal primary KC undergoing differentiation led to significant down-regulation of late terminal differentiation genes markers including epidermal differentiation complex genes, keratinization genes, sphingolipid/ceramide metabolic process genes and epidermal specific cell-cell adhesion genes. We further demonstrated that FOXC1 works down-stream of ZNF750 and KLF4, and upstream of GRHL3. Thus, this study defines FOXC1 as a regulator specific for KC terminal differentiation and establishes its potential position in the genetic regulatory network.

  1. Human evaluation in association to the mathematical analysis of arch forms: Two-dimensional study.

    Science.gov (United States)

    Zabidin, Nurwahidah; Mohamed, Alizae Marny; Zaharim, Azami; Marizan Nor, Murshida; Rosli, Tanti Irawati

    2018-03-01

    To evaluate the relationship between human evaluation of the dental-arch form, to complete a mathematical analysis via two different methods in quantifying the arch form, and to establish agreement with the fourth-order polynomial equation. This study included 64 sets of digitised maxilla and mandible dental casts obtained from a sample of dental arch with normal occlusion. For human evaluation, a convenient sample of orthodontic practitioners ranked the photo images of dental cast from the most tapered to the less tapered (square). In the mathematical analysis, dental arches were interpolated using the fourth-order polynomial equation with millimetric acetate paper and AutoCAD software. Finally, the relations between human evaluation and mathematical objective analyses were evaluated. Human evaluations were found to be generally in agreement, but only at the extremes of tapered and square arch forms; this indicated general human error and observer bias. The two methods used to plot the arch form were comparable. The use of fourth-order polynomial equation may be facilitative in obtaining a smooth curve, which can produce a template for individual arch that represents all potential tooth positions for the dental arch. Copyright © 2018 CEO. Published by Elsevier Masson SAS. All rights reserved.

  2. Asymmetric migration of human keratinocytes under mechanical stretch and cocultured fibroblasts in a wound repair model.

    Directory of Open Access Journals (Sweden)

    Dongyuan Lü

    Full Text Available Keratinocyte migration during re-epithelization is crucial in wound healing under biochemical and biomechanical microenvironment. However, little is known about the underlying mechanisms whereby mechanical tension and cocultured fibroblasts or keratinocytes modulate the migration of keratinocytes or fibroblasts. Here we applied a tensile device together with a modified transwell assay to determine the lateral and transmembrane migration dynamics of human HaCaT keratinocytes or HF fibroblasts. A novel pattern of asymmetric migration was observed for keratinocytes when they were cocultured with non-contact fibroblasts, i.e., the accumulative distance of HaCaT cells was significantly higher when moving away from HF cells or migrating from down to up cross the membrane than that when moving close to HF cells or when migrating from up to down, whereas HF migration was symmetric. This asymmetric migration was mainly regulated by EGF derived from fibroblasts, but not transforming growth factor α or β1 production. Mechanical stretch subjected to fibroblasts fostered keratinocyte asymmetric migration by increasing EGF secretion, while no role of mechanical stretch was found for EGF secretion by keratinocytes. These results provided a new insight into understanding the regulating mechanisms of two- or three-dimensional migration of keratinocytes or fibroblasts along or across dermis and epidermis under biomechanical microenvironment.

  3. Effect of Nanodiamond and Nanoplatinum Liquid, DPV576, on Human Primary Keratinocytes.

    Science.gov (United States)

    Ghoneum, Mamdooh H; Katano, Hideki; Agrawal, Sudhanshu; Ganguly, Sreerupa; Agrawal, Anshu

    2017-01-01

    Nanofabrics are now being used in a wide range of products that come into direct contact with skin, including carpet, clothing, and medical fabrics. In the current study, we examined the effect of a dispersed aqueous mixture of nanodiamond (ND) and nanoplatinum (NP) (DPV576) on human primary keratinocytes with respect to transient receptor potential vanilloid (TRPV) channel expression, secretion of cytokines and production of nerve growth factor (NGF). Keratinocytes were treated with DPV576 at concentrations of 1:10 and 1:100 dilutions for 24 hours in vitro, and their activation of was determined by production of cytokines TNF-α, IL-1β, and prostaglandin (PGE2), and by production of NGF. Inhibitor experiments were carried out by incubating keratinocytes with the TRPV4-selective antagonist HC-067047. TRPV receptor expression (TRPV1, TRPV3 and TRPV4) on keratinocytes as well as changes in Ca2+ potential were examined by flow cytometry. DPV576 treatment of keratinocytes resulted in the following effects: (1) stimulation of keratinocytes as indicated by the significant secretion of cytokines IL-1β, TNF-α, and PGE2, an effect noted only at higher concentration (1:10); (2) significant decrease in the expression of TRPV4 on keratinocytes with a spike in the calcium flux, but no change in the expression of TRPV1 and TRPV3; (3) induction of cytokine secretion independent of TRPV4, as the addition of TRPV4 inhibitor had no significant effect on the cytokine production from keratinocytes; (4) induction of NGF secretion by keratinocytes. These results demonstrate that DPV576 activates keratinocytes via multiple signaling pathways which may reduce stress associated with inflammation, pain, and circadian rhythms. ND/NP-coated fabrics that target the modulation of local inflammation, pain, and circadian rhythms could potentially be of benefit to humans.

  4. Two Dimensional Finite Element Analysis for the Effect of a Pressure Wave in the Human Brain

    Science.gov (United States)

    Ponce L., Ernesto; Ponce S., Daniel

    2008-11-01

    Brain injuries in people of all ages is a serious, world-wide health problem, with consequences as varied as attention or memory deficits, difficulties in problem-solving, aggressive social behavior, and neuro degenerative diseases such as Alzheimer's and Parkinson's. Brain injuries can be the result of a direct impact, but also pressure waves and direct impulses. The aim of this work is to develop a predictive method to calculate the stress generated in the human brain by pressure waves such as high power sounds. The finite element method is used, combined with elastic wave theory. The predictions of the generated stress levels are compared with the resistance of the arterioles that pervade the brain. The problem was focused to the Chilean mining where there are some accidents happen by detonations and high sound level. There are not formal medical investigation, however these pressure waves could produce human brain damage.

  5. Determination of γ-hydroxybutyrate in human urine samples by ion exclusion and ion exchange two-dimensional chromatography system.

    Science.gov (United States)

    Liu, Junwei; Deng, Zhifen; Zhu, Zuoyi; Wang, Yong; Wang, Guoqing; Sun, Yu-An; Zhu, Yan

    2017-12-15

    A two-dimensional ion chromatography system was developed for the determination of γ-hydroxybutyrate (GHB) in human urine samples. Ion exclusion chromatography was used in the first dimensional separation for elimination of urine matrices and detection of GHB above 10mgL -1 , ion exchange chromatography was used in the second dimensional separation via column-switching technique for detection of GHB above 0.08mgL -1 . Under the optimized chromatographic conditions, the ion exclusion and ion exchange chromatography separation system exhibited satisfactory repeatability (RSDchromatography system was convenient and practical for the determination of GHB in human urine samples. Copyright © 2017 Elsevier B.V. All rights reserved.

  6. Generation of organotypic raft cultures from primary human keratinocytes.

    Science.gov (United States)

    Anacker, Daniel; Moody, Cary

    2012-02-22

    The development of organotypic epithelial raft cultures has provided researchers with an efficient in vitro system that faithfully recapitulates epithelial differentiation. There are many uses for this system. For instance, the ability to grow three-dimensional organotypic raft cultures of keratinocytes has been an important milestone in the study of human papillomavirus (HPV)(1). The life cycle of HPV is tightly linked to the differentiation of squamous epithelium(2). Organotypic epithelial raft cultures as demonstrated here reproduce the entire papillomavirus life cycle, including virus production(3,4,5). In addition, these raft cultures exhibit dysplastic lesions similar to those observed upon in vivo infection with HPV. Hence this system can also be used to study epithelial cell cancers, as well as the effect of drugs on epithelial cell differentiation in general. Originally developed by Asselineau and Prunieras(6) and modified by Kopan et al.(7), the organotypic epithelial raft culture system has matured into a general, relatively easy culture model, which involves the growth of cells on collagen plugs maintained at an air-liquid interface (Figure 1A). Over the course of 10-14 days, the cells stratify and differentiate, forming a full thickness epithelium that produces differentiation-specific cytokeratins. Harvested rafts can be examined histologically, as well as by standard molecular and biochemical techniques. In this article, we describe a method for the generation of raft cultures from primary human keratinocytes. The same technique can be used with established epithelial cell lines, and can easily be adapted for use with epithelial tissue from normal or diseased biopsies(8). Many viruses target either the cutaneous or mucosal epithelium as part of their replicative life cycle. Over the past several years, the feasibility of using organotypic raft cultures as a method of studying virus-host cell interactions has been shown for several herpesviruses, as

  7. Chimeric Human Skin Substitute Tissue: A Novel Treatment Option for the Delivery of Autologous Keratinocytes.

    Science.gov (United States)

    Rasmussen, Cathy A; Allen-Hoffmann, B Lynn

    2012-04-01

    For patients suffering from catastrophic burns, few treatment options are available. Chimeric coculture of patient-derived autologous cells with a "carrier" cell source of allogeneic keratinocytes has been proposed as a means to address the complex clinical problem of severe skin loss. Currently, autologous keratinocytes are harvested, cultured, and expanded to form graftable epidermal sheets. However, epidermal sheets are thin, are extremely fragile, and do not possess barrier function, which only develops as skin stratifies and matures. Grafting is typically delayed for up to 4 weeks to propagate a sufficient quantity of the patient's cells for application to wound sites. Fully stratified chimeric bioengineered skin substitutes could not only provide immediate wound coverage and restore barrier function, but would simultaneously deliver autologous keratinocytes to wounds. The ideal allogeneic cell source for this application would be an abundant supply of clinically evaluated, nontumorigenic, pathogen-free, human keratinocytes. To evaluate this potential cell-based therapy, mixed populations of a green fluorescent protein-labeled neonatal human keratinocyte cell line (NIKS) and unlabeled primary keratinocytes were used to model the allogeneic and autologous components of chimeric monolayer and organotypic cultures. Relatively few autologous keratinocytes may be required to produce fully stratified chimeric skin substitute tissue substantially composed of autologous keratinocyte-derived regions. The need for few autologous cells interspersed within an allogeneic "carrier" cell population may decrease cell expansion time, reducing the time to patient application. This study provides proof of concept for utilizing NIKS keratinocytes as the allogeneic carrier for the generation of bioengineered chimeric skin substitute tissues capable of providing immediate wound coverage while simultaneously supplying autologous human cells for tissue regeneration.

  8. Exogenous hydrogen sulfide promotes cell proliferation and differentiation by modulating autophagy in human keratinocytes

    International Nuclear Information System (INIS)

    Xie, Xin; Dai, Hui; Zhuang, Binyu; Chai, Li; Xie, Yanguang; Li, Yuzhen

    2016-01-01

    The effects and the underlying mechanisms of hydrogen sulfide (H 2 S) on keratinocyte proliferation and differentiation are still less known. In the current study, we investigated the effects and the underlying mechanisms of exogenous H 2 S on keratinocyte proliferation and differentiation. Human keratinocytes (HaCaT cells) were treated with various concentrations (0.05, 0.25, 0.5 and 1 mM) of sodium hydrosulfide (NaHS, a donor of H 2 S) for 24 h. A CCK-8 assay was used to assess cell viability. Western blot analysis was performed to determine the expression levels of proteins associated with differentiation and autophagy. Transmission electron microscopy was performed to observe autophagic vacuoles, and flow cytometry was applied to evaluate apoptosis. NaHS promoted the viability, induced the differentiation, and enhanced autophagic activity in a dose-dependent manner in HaCaT cells but had no effect on cell apoptosis. Blockage of autophagy by ATG5 siRNA inhibited NaHS-induced cell proliferation and differentiation. The current study demonstrated that autophagy in response to exogenous H 2 S treatment promoted keratinocyte proliferation and differentiation. Our results provide additional insights into the potential role of autophagy in keratinocyte proliferation and differentiation. - Highlights: • Exogenous H 2 S promotes keratinocyte proliferation and differentiation. • The effects of H 2 S on proliferation and differentiation is modulated by autophagy. • Exogenous H 2 S has no effect on keratinocyte apoptosis.

  9. Differential Activation of Human Keratinocytes by Leishmania Species Causing Localized or Disseminated Disease.

    Science.gov (United States)

    Scorza, Breanna M; Wacker, Mark A; Messingham, Kelly; Kim, Peter; Klingelhutz, Aloysius; Fairley, Janet; Wilson, Mary E

    2017-10-01

    All Leishmania species parasites are introduced into mammalian skin through a sand fly bite, but different species cause distinct clinical outcomes. Mouse studies suggest that early responses are critical determinants of subsequent adaptive immunity in leishmaniasis, yet few studies address the role of keratinocytes, the most abundant cell in the epidermis. We hypothesized that Leishmania infection causes keratinocytes to produce immunomodulatory factors that influence the outcome of infection. Incubation of primary or immortalized human keratinocytes with Leishmania infantum or Leishmania major, which cause visceral or cutaneous leishmaniasis, respectively, elicited dramatically different responses. Keratinocytes incubated with L. infantum significantly increased expression of proinflammatory genes for IL-6, IL-8, tumor necrosis factor, and IL-1B, whereas keratinocytes exposed to several L. major isolates did not. Furthermore, keratinocyte-monocyte co-incubation studies across a 4 µM semipermeable membrane suggested that L. infantum-exposed keratinocytes release soluble factors that enhance monocyte control of intracellular L. infantum replication (P Leishmania species that may affect the course of disease. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  10. Effects of titanium dioxide nanoparticles on human keratinocytes.

    Science.gov (United States)

    Wright, Clayton; Iyer, Anand Krishnan V; Wang, Liying; Wu, Nianqiang; Yakisich, Juan S; Rojanasakul, Yon; Azad, Neelam

    2017-01-01

    Titanium dioxide (TiO 2 ) is a ubiquitous whitening compound widely used in topical products such as sunscreens, lotions and facial creams. The damaging health effects of TiO 2 inhalation has been widely studied in rats, mice and humans showing oxidative stress increase, DNA damage, cell death and inflammatory gene upregulation in lung and throat cells; however, the effects on skin cells from long-term topical use of various products remain largely unknown. In this study, we assessed the effect of specific TiO 2 nanoparticles (H 2 TiO 7 ) on a human keratinocyte cell line (HaCaT). We performed a comparative analysis using three TiO 2 particles varying in size (Fine, Ultrafine and H 2 TiO 7 ) and analyzed their effects on HaCaTs. There is a clear dose-dependent increase in superoxide production, caspase 8 and 9 activity, and apoptosis in HaCaTs after treatment with all three forms of TiO 2 ; however, there is no consistent effect on cell viability and proliferation with either of these TiO 2 particles. While there is data suggesting UV exposure can enhance the carcinogenic effects of TiO 2 , we did not observe any significant effect of UV-C exposure combined with TiO 2 treatment on HaCaTs. Furthermore, TiO 2 -treated cells showed minimal effects on VEGF upregulation and Wnt signaling pathway thereby showing no potential effect on angiogenesis and malignant transformation. Overall, we report here an increase in apoptosis, which may be caspase 8/Fas-dependent, and that the H 2 TiO 7 nanoparticles, despite their smaller particle size, had no significant enhanced effect on HaCaT cells as compared to Fine and Ultrafine forms of TiO 2 .

  11. Marked stimulation of growth and motility of human keratinocytes by hepatocyte growth factor

    International Nuclear Information System (INIS)

    Matsumoto, K.; Hashimoto, K.; Yoshikawa, K.; Nakamura, T.

    1991-01-01

    Effect of hepatocyte growth factor (HGF) on normal human epidermal keratinocytes cultured under conditions of low Ca2+ (0.1 mM, growth-promoting condition) and physiological Ca2+ (1.8 mM, differentiation-promoting condition) was investigated. In low Ca2+, HGF markedly enhanced the migration of keratinocytes while it suppressed cell growth and DNA synthesis in a dose-dependent manner. In contrast, HGF enhanced the migration, cell growth, and DNA synthesis of keratinocytes cultured under conditions of physiological Ca2+. The maximal stimulation of DNA synthesis (2.4-fold stimulation) in physiological Ca2+ was seen at 2.5-5 ng/ml HGF and the stimulatory effect of HGF was suppressed by transforming growth factor-beta 1. Analysis of the HGF receptor using 125I-HGF as a ligand showed that human keratinocytes expressed a single class of specific, saturable receptor for HGF in both low and physiological Ca2+ conditions, exhibiting a Kd = 17.3 pM and approximately 690 binding sites/cell under physiological Ca2+. Thus, HGF is a potent factor which enhances growth and migration of normal human keratinocytes under conditions of physiological Ca2+. HGF may play an important role in epidermal tissue repair as it enhances both the migration and growth of keratinocytes

  12. Proteomic analysis of docetaxel resistance in human nasopharyngeal carcinoma cells using the two-dimensional gel electrophoresis method.

    Science.gov (United States)

    Peng, Xingchen; Gong, Fengming M; Ren, Min; Ai, Ping; Wu, ShaoYong; Tang, Jie; Hu, XiaoLin

    2016-09-01

    Docetaxel-based chemotherapy has been recommended for advanced nasopharyngeal carcinoma (NPC). However, treatment failure often occurs because of acquired drug resistance. In this study, a docetaxel-resistant NPC cell line CNE-2R was established with increasing doses of docetaxel for more than 6 months. Two-dimensional gel electrophoresis and ESI-Q-TOF-MS were used to compare the differential expression of docetaxel-resistance-associated proteins between human NPC CNE-2 cells and docetaxel-resistant CNE-2R cells. As a result, 24 differentially expressed proteins were identified, including 11 proteins with increased expression and 13 proteins with decreased expression. These proteins function in diverse biological processes such as metabolism, signal transduction, calcium ion binding, immune response, proteolysis, and so on. Among these, α-enolase (ENO1), significantly upregulated in CNE-2R, was selected for detailed analysis. Inhibition of ENO1 by shRNA restored CNE-2R cells' sensitivity to docetaxel. Moreover, overexpression of ENO1 could facilitate the development of acquired resistance of docetaxel in CNE-2 cells. Western blot and reverse-transcription PCR data of clinical samples confirmed that α-enolase was upregulated in docetaxel-resistant human NPC tissues. Finding such proteins might improve interpretation of the molecular mechanisms leading to the acquisition of docetaxel chemoresistance.

  13. Hyaluronan minimizes effects of UV irradiation on human keratinocytes

    Czech Academy of Sciences Publication Activity Database

    Hašová, M.; Crhák, Tomáš; Šafaříková, Barbora; Dvořáková, J.; Muthný, T.; Velebný, V.; Kubala, Lukáš

    2011-01-01

    Roč. 303, č. 4 (2011), s. 277-284 ISSN 0340-3696 R&D Projects: GA ČR(CZ) GA305/08/1704 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : hyaluronan * keratinocyte * ultraviolet light Subject RIV: BO - Biophysics Impact factor: 2.279, year: 2011

  14. Exploratory Study on the Stability Characteristics of Commercial Human Keratinocytes

    Science.gov (United States)

    1990-04-01

    Invest. Dermatol. 75:176- 182; 1980. 16. Hayflick , L. The limited in vitro lifetime of huiran diploid strains. Exp. Cell Res. 37:614-636; 1965. 17...culture keratinocytes were considered by some investigators to have limited proliferative potential, so they used third and fourth passage commercial

  15. Modeling the basin of attraction as a two-dimensional manifold from experimental data: Applications to balance in humans

    Science.gov (United States)

    Zakynthinaki, Maria S.; Stirling, James R.; Cordente Martínez, Carlos A.; Díaz de Durana, Alfonso López; Quintana, Manuel Sillero; Romo, Gabriel Rodríguez; Molinuevo, Javier Sampedro

    2010-03-01

    We present a method of modeling the basin of attraction as a three-dimensional function describing a two-dimensional manifold on which the dynamics of the system evolves from experimental time series data. Our method is based on the density of the data set and uses numerical optimization and data modeling tools. We also show how to obtain analytic curves that describe both the contours and the boundary of the basin. Our method is applied to the problem of regaining balance after perturbation from quiet vertical stance using data of an elite athlete. Our method goes beyond the statistical description of the experimental data, providing a function that describes the shape of the basin of attraction. To test its robustness, our method has also been applied to two different data sets of a second subject and no significant differences were found between the contours of the calculated basin of attraction for the different data sets. The proposed method has many uses in a wide variety of areas, not just human balance for which there are many applications in medicine, rehabilitation, and sport.

  16. Adherence of human oral keratinocytes and gingival fibroblasts to nano-structured titanium surfaces.

    Science.gov (United States)

    Dorkhan, Marjan; Yücel-Lindberg, Tülay; Hall, Jan; Svensäter, Gunnel; Davies, Julia R

    2014-06-21

    A key element for long-term success of dental implants is integration of the implant surface with the surrounding host tissues. Modification of titanium implant surfaces can enhance osteoblast activity but their effects on soft-tissue cells are unclear. Adherence of human keratinocytes and gingival fibroblasts to control commercially pure titanium (CpTi) and two surfaces prepared by anodic oxidation was therefore investigated. Since implant abutments are exposed to a bacteria-rich environment in vivo, the effect of oral bacteria on keratinocyte adhesion was also evaluated. The surfaces were characterized using scanning electron microscopy (SEM). The number of adhered cells and binding strength, as well as vitality of fibroblasts and keratinocytes were evaluated using confocal scanning laser microscopy after staining with Live/Dead Baclight. To evaluate the effect of bacteria on adherence and vitality, keratinocytes were co-cultured with a four-species streptococcal consortium. SEM analysis showed the two anodically oxidized surfaces to be nano-structured with differing degrees of pore-density. Over 24 hours, both fibroblasts and keratinocytes adhered well to the nano-structured surfaces, although to a somewhat lesser degree than to CpTi (range 42-89% of the levels on CpTi). The strength of keratinocyte adhesion was greater than that of the fibroblasts but no differences in adhesion strength could be observed between the two nano-structured surfaces and the CpTi. The consortium of commensal streptococci markedly reduced keratinocyte adherence on all the surfaces as well as compromising membrane integrity of the adhered cells. Both the vitality and level of adherence of soft-tissue cells to the nano-structured surfaces was similar to that on CpTi. Co-culture with streptococci reduced the number of keratinocytes on all the surfaces to approximately the same level and caused cell damage, suggesting that commensal bacteria could affect adherence of soft-tissue cells to

  17. Fos and jun proteins are specifically expressed during differentiation of human keratinocytes.

    Science.gov (United States)

    Mehic, Denis; Bakiri, Latifa; Ghannadan, Minoo; Wagner, Erwin F; Tschachler, Erwin

    2005-01-01

    Activator protein 1 (AP-1) proteins play key roles in the regulation of cell proliferation and differentiation. In this study we investigated the expression of Fos and Jun proteins in different models of terminal differentiation of human keratinocytes and in skin from psoriasis patients. All Jun and Fos proteins, with the exception of FosB, were efficiently expressed in keratinocytes in monolayer cultures. In contrast, in normal epidermis as well as in organotypic epidermal cultures, the expression pattern of AP-1 proteins was dependent on the differentiation stage. Fos proteins were readily detected in nuclei of keratinocytes of basal and suprabasal layers. JunB and JunD were expressed in all layers of normal epidermis. Interestingly, expression of c-Jun started suprabasally, then disappeared and became detectable again in distinct cells of the outermost granular layer directly at the transition zone to the stratum corneum. In psoriatic epidermis, c-Jun expression was prominent in both hyperproliferating basal and suprabasal keratinocytes, whereas c-Fos expression was unchanged. These data indicate that AP-1 proteins are expressed in a highly specific manner during terminal differentiation of keratinocytes and that the enhanced expression of c-Jun in basal and suprabasal keratinocytes might contribute to the pathogenesis of psoriasis.

  18. Proteomic profiling and post-translational modifications in human keratinocytes treated with Mucuna pruriens leaf extract.

    Science.gov (United States)

    Cortelazzo, Alessio; Lampariello, Raffaella L; Sticozzi, Claudia; Guerranti, Roberto; Mirasole, Cristiana; Zolla, Lello; Sacchetti, Gianni; Hajek, Joussef; Valacchi, Giuseppe

    2014-02-03

    Mucuna pruriens (Mp) is a plant belonging to the Fabaceae family, with several medicinal properties among which its potential to treat diseases where reactive oxygen species (ROS) play an important role in the pathogeneses. The aim was to investigate the effects of Mp leaf methanolic extract (MPME) on human keratinocytes protein expression and its role in preventing proteins oxidation after oxidative stress (OS) exposure. The effects of MPME on HaCaT cells protein expression were evaluated treating cells with different concentrations of MPME, with glucose oxidase (GO, source of OS) and with MPME subsequently treated with GO. The protein patterns of treated HaCaT cells are analyzed by two-dimensional gel electrophoresis (2-DE) and compared with that of untreated HaCaT. Immunoblotting was then used to evaluate the role of MPME in preventing the 4-hydroxynonenal protein adducts (4-HNE PAs) formation (marker of OS). Eighteen proteins, identified by mass spectrometry (LC-ESI-CID-MS/MS), were modulated distinctly by MPME in HaCaT. Overall, MPME counteract GO effect, reducing the GO-induced overexpression of several proteins involved in stress response (T-complex protein 1, Protein disulfide-isomerase A3, Protein DJ-1, and Stress-induced-phosphoprotein 1), in cell energy methabolism (Inorganic pyrophosphatase, Triosephosphate isomerase isoform 1, 2-phosphopyruvate-hydratase alpha-enolase, and Fructose-bisphosphate aldolase A isoform 1), in cytoskeletal organization (Cytokeratins 18, 9, 2, Cofilin-1, Annexin A2 and F-actin-capping protein subunit beta isoform 1) and in cell cycle progression (Eukaryotic translation initiation factor 5A-1 isoform B). In addition, MPME decreased the 4-HNE PAs levels, in particular on 2-phosphopyruvate-hydratase alpha-enolase and Cytokeratin 9. Our findings show that MPME might be helpful in the treatment of OS-related skin diseases by preventing protein post-translational modifications (4-HNE PAs). © 2013 Published by Elsevier Ireland Ltd.

  19. Human keratinocytes restrict chikungunya virus replication at a post-fusion step

    Energy Technology Data Exchange (ETDEWEB)

    Bernard, Eric [Centre d' étude d’agents Pathogènes et Biotechnologies pour la Santé, CPBS CNRS- UMR5236/UM1/UM2, Montpellier (France); Hamel, Rodolphe [Laboratoire Maladies Infectieuses et Vecteurs: Ecologie, Génétique, Evolution, Contrôle, UMR 5290 CNRS/IRD/UM1, Montpellier (France); Neyret, Aymeric [Centre d' étude d’agents Pathogènes et Biotechnologies pour la Santé, CPBS CNRS- UMR5236/UM1/UM2, Montpellier (France); Ekchariyawat, Peeraya [Laboratoire Maladies Infectieuses et Vecteurs: Ecologie, Génétique, Evolution, Contrôle, UMR 5290 CNRS/IRD/UM1, Montpellier (France); Molès, Jean-Pierre [INSERM U1058, UM1, CHU Montpellier (France); Simmons, Graham [Blood Systems Research Institute, San Francisco, CA 94118 (United States); Chazal, Nathalie [Centre d' étude d’agents Pathogènes et Biotechnologies pour la Santé, CPBS CNRS- UMR5236/UM1/UM2, Montpellier (France); Desprès, Philippe [Unité Interactions Moléculaires Flavivirus-Hôtes, Institut Pasteur, Paris (France); and others

    2015-02-15

    Transmission of chikungunya virus (CHIKV) to humans is initiated by puncture of the skin by a blood-feeding Aedes mosquito. Despite the growing knowledge accumulated on CHIKV, the interplay between skin cells and CHIKV following inoculation still remains unclear. In this study we questioned the behavior of human keratinocytes, the predominant cell population in the skin, following viral challenge. We report that CHIKV rapidly elicits an innate immune response in these cells leading to the enhanced transcription of type I/II and type III interferon genes. Concomitantly, we show that despite viral particles internalization into Rab5-positive endosomes and efficient fusion of virus and cell membranes, keratinocytes poorly replicate CHIKV as attested by absence of nonstructural proteins and genomic RNA synthesis. Accordingly, human keratinocytes behave as an antiviral defense against CHIKV infection rather than as a primary targets for initial replication. This picture significantly differs from that reported for Dengue and West Nile mosquito-borne viruses. - Highlights: • Human keratinocytes support endocytosis of CHIKV and fusion of viral membranes. • CHIKV replication is blocked at a post entry step in these cells. • Infection upregulates type-I, –II and –III IFN genes expression. • Keratinocytes behave as immune sentinels against CHIKV.

  20. Human keratinocytes restrict chikungunya virus replication at a post-fusion step

    International Nuclear Information System (INIS)

    Bernard, Eric; Hamel, Rodolphe; Neyret, Aymeric; Ekchariyawat, Peeraya; Molès, Jean-Pierre; Simmons, Graham; Chazal, Nathalie; Desprès, Philippe

    2015-01-01

    Transmission of chikungunya virus (CHIKV) to humans is initiated by puncture of the skin by a blood-feeding Aedes mosquito. Despite the growing knowledge accumulated on CHIKV, the interplay between skin cells and CHIKV following inoculation still remains unclear. In this study we questioned the behavior of human keratinocytes, the predominant cell population in the skin, following viral challenge. We report that CHIKV rapidly elicits an innate immune response in these cells leading to the enhanced transcription of type I/II and type III interferon genes. Concomitantly, we show that despite viral particles internalization into Rab5-positive endosomes and efficient fusion of virus and cell membranes, keratinocytes poorly replicate CHIKV as attested by absence of nonstructural proteins and genomic RNA synthesis. Accordingly, human keratinocytes behave as an antiviral defense against CHIKV infection rather than as a primary targets for initial replication. This picture significantly differs from that reported for Dengue and West Nile mosquito-borne viruses. - Highlights: • Human keratinocytes support endocytosis of CHIKV and fusion of viral membranes. • CHIKV replication is blocked at a post entry step in these cells. • Infection upregulates type-I, –II and –III IFN genes expression. • Keratinocytes behave as immune sentinels against CHIKV

  1. Human Papilloma Viral DNA Replicates as a Stable Episome in Cultured Epidermal Keratinocytes

    Science.gov (United States)

    Laporta, Robert F.; Taichman, Lorne B.

    1982-06-01

    Human papilloma virus (HPV) is poorly understood because systems for its growth in tissue culture have not been developed. We report here that cultured human epidermal keratinocytes could be infected with HPV from plantar warts and that the viral DNA persisted and replicated as a stable episome. There were 50-200 copies of viral DNA per cell and there was no evidence to indicate integration of viral DNA into the cellular genome. There was also no evidence to suggest that viral DNA underwent productive replication. We conclude that cultured human epidermal keratinocytes may be a model for the study of certain aspects of HPV biology.

  2. Cortactin involvement in the keratinocyte growth factor and fibroblast growth factor 10 promotion of migration and cortical actin assembly in human keratinocytes

    International Nuclear Information System (INIS)

    Ceccarelli, Simona; Cardinali, Giorgia; Aspite, Nicaela; Picardo, Mauro; Marchese, Cinzia; Torrisi, Maria Rosaria; Mancini, Patrizia

    2007-01-01

    Keratinocyte growth factor (KGF/FGF7) and fibroblast growth factor 10 (FGF10/KGF2) regulate keratinocyte proliferation and differentiation by binding to the tyrosine kinase KGF receptor (KGFR). KGF induces keratinocyte motility and cytoskeletal rearrangement, whereas a direct role of FGF10 on keratinocyte migration is not clearly established. Here we analyzed the motogenic activity of FGF10 and KGF on human keratinocytes. Migration assays and immunofluorescence of actin cytoskeleton revealed that FGF10 is less efficient than KGF in promoting migration and exerts a delayed effect in inducing lamellipodia and ruffles formation. Both growth factors promoted phosphorylation and subsequent membrane translocation of cortactin, an F-actin binding protein involved in cell migration; however, FGF10-induced cortactin phosphorylation was reduced, more transient and delayed with respect to that promoted by KGF. Cortactin phosphorylation induced by both growth factors was Src-dependent, while its membrane translocation and cell migration were blocked by either Src and PI3K inhibitors, suggesting that both pathways are involved in KGF- and FGF10-dependent motility. Furthermore, siRNA-mediated downregulation of cortactin inhibited KGF- and FGF10-induced migration. These results indicate that cortactin is involved in keratinocyte migration promoted by both KGF and FGF10

  3. Two-dimensional errors

    International Nuclear Information System (INIS)

    Anon.

    1991-01-01

    This chapter addresses the extension of previous work in one-dimensional (linear) error theory to two-dimensional error analysis. The topics of the chapter include the definition of two-dimensional error, the probability ellipse, the probability circle, elliptical (circular) error evaluation, the application to position accuracy, and the use of control systems (points) in measurements

  4. Curcuma longa Is Able to Induce Apoptotic Cell Death of Pterygium-Derived Human Keratinocytes.

    Science.gov (United States)

    Sancilio, Silvia; Di Staso, Silvio; Sebastiani, Stefano; Centurione, Lucia; Di Girolamo, Nick; Ciancaglini, Marco; Di Pietro, Roberta

    2017-01-01

    Pterygium is a relatively common eye disease that can display an aggressive clinical behaviour. To evaluate the in vitro effects of Curcuma longa on human pterygium-derived keratinocytes, specimens of pterygium from 20 patients undergoing pterygium surgical excision were collected. Pterygium explants were put into culture and derived keratinocytes were treated with an alcoholic extract of 1.3% Curcuma longa in 0.001% Benzalkonium Chloride for 3, 6, and 24 h. Cultured cells were examined for CAM5.2 (anti-cytokeratin antibody) and CD140 (anti-fibroblast transmembrane glycoprotein antibody) expression between 3th and 16th passage to assess cell homogeneity. TUNEL technique and Annexin-V/PI staining in flow cytometry were used to detect keratinocyte apoptosis. We showed that Curcuma longa exerts a proapoptotic effect on pterygium-derived keratinocytes already after 3 h treatment. Moreover, after 24 h treatment, Curcuma longa induces a significant increase in TUNEL as well as Annexin-V/PI positive cells in comparison to untreated samples. Our study confirms previous observations highlighting the expression, in pterygium keratinocytes, of nuclear VEGF and gives evidence for the first time to the expression of nuclear and cytoplasmic VEGF-R1. All in all, these findings suggest that Curcuma longa could have some therapeutic potential in the treatment and prevention of human pterygium.

  5. Curcuma longa Is Able to Induce Apoptotic Cell Death of Pterygium-Derived Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Silvia Sancilio

    2017-01-01

    Full Text Available Pterygium is a relatively common eye disease that can display an aggressive clinical behaviour. To evaluate the in vitro effects of Curcuma longa on human pterygium-derived keratinocytes, specimens of pterygium from 20 patients undergoing pterygium surgical excision were collected. Pterygium explants were put into culture and derived keratinocytes were treated with an alcoholic extract of 1.3% Curcuma longa in 0.001% Benzalkonium Chloride for 3, 6, and 24 h. Cultured cells were examined for CAM5.2 (anti-cytokeratin antibody and CD140 (anti-fibroblast transmembrane glycoprotein antibody expression between 3th and 16th passage to assess cell homogeneity. TUNEL technique and Annexin-V/PI staining in flow cytometry were used to detect keratinocyte apoptosis. We showed that Curcuma longa exerts a proapoptotic effect on pterygium-derived keratinocytes already after 3 h treatment. Moreover, after 24 h treatment, Curcuma longa induces a significant increase in TUNEL as well as Annexin-V/PI positive cells in comparison to untreated samples. Our study confirms previous observations highlighting the expression, in pterygium keratinocytes, of nuclear VEGF and gives evidence for the first time to the expression of nuclear and cytoplasmic VEGF-R1. All in all, these findings suggest that Curcuma longa could have some therapeutic potential in the treatment and prevention of human pterygium.

  6. Insulin binding properties of normal and transformed human epidermal cultured keratinocytes

    International Nuclear Information System (INIS)

    Verrando, P.; Ortonne, J.P.

    1985-01-01

    Insulin binding to its receptors was studied in cultured normal and transformed (A431 line) human epidermal keratinocytes. The specific binding was a temperature-dependent, saturable process. Normal keratinocytes possess a mean value of about 80,000 receptors per cell. Fifteen hours exposure of the cells to insulin lowered their receptor number (about 65% loss in available sites); these reappeared when the hormone was removed from the culture medium. In the A431 epidermoid carcinoma cell line, there is a net decrease in insulin binding (84% of the initial bound/free hormone ratio in comparison with normal cells) essentially related to a loss in receptor affinity for insulin. Thus, cultured human keratinocytes which express insulin receptors may be a useful tool in understanding skin pathology related to insulin disorders

  7. Exogenous hydrogen sulfide promotes cell proliferation and differentiation by modulating autophagy in human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Xie, Xin [Department of Dermatology, The Second Affiliated Hospital of Harbin Medical University, Harbin, 150086, Heilongjiang Province (China); Dai, Hui [Department of Cardiology, The First Affiliated Hospital of Harbin Medical University, Harbin, 150001, Heilongjiang Province (China); Zhuang, Binyu [Department of Dermatology, The Second Affiliated Hospital of Harbin Medical University, Harbin, 150086, Heilongjiang Province (China); Chai, Li; Xie, Yanguang [Institute of Dermatology of Heilongjiang Province, Harbin, 150001, Heilongjiang Province (China); Li, Yuzhen, E-mail: liyuzhen@medmail.com.cn [Department of Dermatology, The Second Affiliated Hospital of Harbin Medical University, Harbin, 150086, Heilongjiang Province (China)

    2016-04-08

    The effects and the underlying mechanisms of hydrogen sulfide (H{sub 2}S) on keratinocyte proliferation and differentiation are still less known. In the current study, we investigated the effects and the underlying mechanisms of exogenous H{sub 2}S on keratinocyte proliferation and differentiation. Human keratinocytes (HaCaT cells) were treated with various concentrations (0.05, 0.25, 0.5 and 1 mM) of sodium hydrosulfide (NaHS, a donor of H{sub 2}S) for 24 h. A CCK-8 assay was used to assess cell viability. Western blot analysis was performed to determine the expression levels of proteins associated with differentiation and autophagy. Transmission electron microscopy was performed to observe autophagic vacuoles, and flow cytometry was applied to evaluate apoptosis. NaHS promoted the viability, induced the differentiation, and enhanced autophagic activity in a dose-dependent manner in HaCaT cells but had no effect on cell apoptosis. Blockage of autophagy by ATG5 siRNA inhibited NaHS-induced cell proliferation and differentiation. The current study demonstrated that autophagy in response to exogenous H{sub 2}S treatment promoted keratinocyte proliferation and differentiation. Our results provide additional insights into the potential role of autophagy in keratinocyte proliferation and differentiation. - Highlights: • Exogenous H{sub 2}S promotes keratinocyte proliferation and differentiation. • The effects of H{sub 2}S on proliferation and differentiation is modulated by autophagy. • Exogenous H{sub 2}S has no effect on keratinocyte apoptosis.

  8. H{sup +}/peptide transporter (PEPT2) is expressed in human epidermal keratinocytes and is involved in skin oligopeptide transport

    Energy Technology Data Exchange (ETDEWEB)

    Kudo, Michiko; Katayoshi, Takeshi; Kobayashi-Nakamura, Kumiko [DHC Corporation Laboratories, Division 2, 2-42 Hamada, Mihama-ku, Chiba 261-0025 (Japan); Akagawa, Mitsugu [Department of Biological Chemistry, Division of Applied Life Science, Graduate School of Life and Environmental Sciences, Osaka Prefecture University, 1-1 Gakuen-cho, Naka-ku, Sakai 599-8531 (Japan); Tsuji-Naito, Kentaro, E-mail: knaito@dhc.co.jp [DHC Corporation Laboratories, Division 2, 2-42 Hamada, Mihama-ku, Chiba 261-0025 (Japan)

    2016-07-08

    Peptide transporter 2 (PEPT2) is a member of the proton-coupled oligopeptide transporter family, which mediates the cellular uptake of oligopeptides and peptide-like drugs. Although PEPT2 is expressed in many tissues, its expression in epidermal keratinocytes remains unclear. We investigated PEPT2 expression profile and functional activity in keratinocytes. We confirmed PEPT2 mRNA expression in three keratinocyte lines (normal human epidermal keratinocytes (NHEKs), immortalized keratinocytes, and malignant keratinocytes) by reverse transcription-polymerase chain reaction (RT-PCR) and quantitative real-time RT-PCR. In contrast to PEPT1, PEPT2 expression in the three keratinocytes was similar or higher than that in HepG2 cells, used as PEPT2-positive cells. Immunolocalization analysis using human skin showed epidermal PEPT2 localization. We studied keratinocyte transport function by measuring the oligopeptide content using liquid chromatography/tandem mass spectrometry. Glycylsarcosine uptake in NHEKs was pH-dependent, suggesting that keratinocytes could absorb small peptides in the presence of an inward H{sup +} gradient. We also performed a skin-permeability test of several oligopeptides using skin substitute, suggesting that di- and tripeptides pass actively through the epidermis. In conclusion, PEPT2 is expressed in keratinocytes and involved in skin oligopeptide uptake. -- Highlights: •PEPT2 is expressed in keratinocytes, which are more common than other skin cells. •Immunolocalization analysis using human skin revealed epidermal PEPT2 localization. •Keratinocytes could absorb small peptides in the presence of an inward H{sup +} gradient. •Di- and tripeptide pass actively through the epidermis.

  9. The stress caused by nitrite with titanium dioxide nanoparticles under UVA irradiation in human keratinocyte cell

    International Nuclear Information System (INIS)

    Tu, Min; Huang, Yi; Li, Hai-Ling; Gao, Zhong-Hong

    2012-01-01

    Highlights: ► Nitrite increased photo-toxicity of nano-TiO 2 on human keratinocyte cells in a dose-dependant manner. ► Morphological study suggested the cell death may be mediated by apoptosis inducing factor. ► Protein nitration was generated in the cells, and the most abundant nitrated protein was identified as cystatin-A. ► Tyr35 was the most likely site to be nitrated in cystatin-A. -- Abstract: Our previous work found that in the presence of nitrite, titanium dioxide nanoparticles can cause protein tyrosine nitration under UVA irradiation in vivo. In this paper, the human keratinocyte cells was used as a skin cell model to further study the photo-toxicity of titanium dioxide nanoparticles when nitrite was present. The results showed that nitrite increased the photo-toxicity of titanium dioxide in a dose-dependant manner, and generated protein tyrosine nitration in keratinocyte cells. Morphological study of keratinocyte cells suggested a specific apoptosis mediated by apoptosis inducing factor. It was also found the main target nitrated in cells was cystatin-A, which expressed abundantly in cytoplasm and functioned as a cysteine protease inhibitor. The stress induced by titanium dioxide with nitrite under UVA irradiation in human keratinocyte cells appeared to trigger the apoptosis inducing factor mediated cell death and lose the inhibition of active caspase by cystatin-A. We conclude that nitrite can bring new damage and stress to human keratinocyte cells with titanium dioxide nanoparticles under UVA irradiation.

  10. Development and validation of a comprehensive two-dimensional gas chromatography-mass spectrometry method for the analysis of phytosterol oxidation products in human plasma

    NARCIS (Netherlands)

    Menéndez-Carreño, M.; Steenbergen, H.; Janssen, H.-G.

    2012-01-01

    Phytosterol oxidation products (POPs) have been suggested to exert adverse biological effects similar to, although less severe than, their cholesterol counterparts. For that reason, their analysis in human plasma is highly relevant. Comprehensive two-dimensional gas chromatography (GC×GC) coupled

  11. Differential Gene Expression in Primary Human Skin Keratinocytes and Fibroblasts in Response to Ionizing Radiation

    Science.gov (United States)

    Warters, Raymond L.; Packard, Ann T.; Kramer, Gwen F.; Gaffney, David K.; Moos, Philip J.

    2009-01-01

    Although skin is usually exposed during human exposures to ionizing radiation, there have been no thorough examinations of the transcriptional response of skin fibroblasts and keratinocytes to radiation. The transcriptional response of quiescent primary fibroblasts and keratinocytes exposed to from 10 cGy to 5 Gy and collected 4 h after treatment was examined. RNA was isolated and examined by microarray analysis for changes in the levels of gene expression. Exposure to ionizing radiation altered the expression of 279 genes across both cell types. Changes in RNA expression could be arranged into three main categories: (1) changes in keratinocytes but not in fibroblasts, (2) changes in fibroblasts but not in keratinocytes, and (3) changes in both. All of these changes were primarily of p53 target genes. Similar radiation-induced changes were induced in immortalized fibroblasts or keratinocytes. In separate experiments, protein was collected and analyzed by Western blotting for expression of proteins observed in microarray experiments to be overexpressed at the mRNA level. Both Q-PCR and Western blot analysis experiments validated these transcription changes. Our results are consistent with changes in the expression of p53 target genes as indicating the magnitude of cell responses to ionizing radiation. PMID:19580510

  12. Serially cultured keratinocytes from human scalp hair follicles: a tool for cytogenetic studies.

    Science.gov (United States)

    Weterings, P J; Roelofs, H M; Jansen, B A; Vermorken, A J

    1983-01-01

    Keratinocytes originating from adult human hair follicles, the most convenient biopsy tissue, can be serially cultured using a combination of two techniques. Primary cultures are established using plucked scalp hair follicles and the bovine eye lens capsule as a growth substrate. Subsequently, cells from these cultures are serially cultivated in the presence of irradiated 3T3 cells as feeders. By this combination of techniques many keratinocytes can be generated from one single hair follicle. These cultures, appropriately treated with colchicine, can provide an adequate number of metaphases suitable for chromosome studies.

  13. Micronucleus formation in cultured human keratinocytes following exposure to mitomycin C and cyclophosphamide.

    Science.gov (United States)

    van Pelt, F N; Haring, R M; Overkamp, M J; Weterings, P J

    1991-02-01

    A method is described to investigate the induction of micronuclei in cultured human keratinocytes after short-term exposure to known clastogenic agents. The cytokinesis-block method was applied to facilitate the scoring of micronucleated cells. Mitomycin C, a direct-acting compound, caused a 5-20-fold increase in micronuclei over the controls at the highest concentration tested (1 microgram/ml). Cyclophosphamide, an agent requiring metabolic activation, did not induce the formation of micronuclei in cultured keratinocytes. However, after pretreatment of the keratinocyte cultures with Aroclor 1254 for 72 h, exposure to cyclophosphamide resulted in a 3-fold increase in micronucleus frequency over the controls. No cytogenetic effect of Aroclor 1254 was observed in control experiments.

  14. Attachment and growth of human keratinocytes in a serum-free environment.

    Science.gov (United States)

    Gilchrest, B A; Calhoun, J K; Maciag, T

    1982-08-01

    Using a serum-free system, we have investigated the influence of human fibronectin (HFN) and selected growth factors (GF) on the attachment and growth of normal human keratinocytes in vitro. Single-cell suspensions of keratinocytes from near-confluent primary plates, plated on 5-10 microgram/cm2 HFN, showed approximately 30-40% attachment after 2-24 hours of incubation at 37 degrees C, compared with 4-6% attachment on uncoated platic plates. Percentage of attached cells was independent of seed density, tissue donor age, in vitro culture age, or medium composition, while subsequent cellular proliferation was strongly dependent on these factors. Keratinocytes grown on an adequate HFN matrix in a previously described hormone-supplemented medium (Maciag et al., 1981a) achieved four to eight population doubling over 7-12 days at densities greater than or equal to 104 cell/cm2. Removal of most GF individually from the medium had little or no effect on growth, while removal of epidermal growth factor (EGF) alone reduced growth by 30-35% and removal of bovine brain extract (BE) alone reduced growth by approximately 90%. Conversely, EGF alone in basal medium supported approximately 10% control growth, BE alone supported 30-40% control growth, and the combination of EGF and BE approximately 70%. In addition to its major effect on proliferation in this system, BE was necessary to preserve normal keratinocyte morphology and protein production. These findings expand earlier observations that HFN facilitates keratinocyte attachment in vitro and that a brain-derived extract can exert a major positive influence on cultured keratinocytes.

  15. Low calcium culture condition induces mesenchymal cell-like phenotype in normal human epidermal keratinocytes

    International Nuclear Information System (INIS)

    Takagi, Ryo; Yamato, Masayuki; Murakami, Daisuke; Sugiyama, Hiroaki; Okano, Teruo

    2011-01-01

    Highlights: → Normal human epidermal keratinocytes serially cultured under low calcium concentration were cytokeratin and vimentin double positive cells. → The human keratinocytes expressed some epithelial stem/progenitor cell makers, mesenchymal cell markers, and markers of epithelial-mesenchymal transition. → Mesenchymal cell-like phenotype in the keratinocytes was suppressed under high-calcium condition. -- Abstract: Epithelial-mesenchymal transition (EMT) is an important cellular phenomenon in organ developments, cancer invasions, and wound healing, and many types of transformed cell lines are used for investigating for molecular mechanisms of EMT. However, there are few reports for EMT in normal human epithelial cells, which are non-transformed or non-immortalized cells, in vitro. Therefore, normal human epidermal keratinocytes (NHEK) serially cultured in low-calcium concentration medium (LCM) were used for investigating relations between differentiation and proliferation and mesenchymal-like phenotype in the present study, since long-term cultivation of NHEK is achieved in LCM. Interestingly, NHEK serially cultured in LCM consisted essentially of cytokeratin-vimentin double positive cells (98%), although the NHEK exhibited differentiation under high-calcium culture condition with 3T3 feeder layer. The vimentin expression was suppressed under high-calcium condition. These results may indicate the importance of mesenchymal-like phenotype for serially cultivation of NHEK in vitro.

  16. Toxicity Assessment of Six Titanium Dioxide Nanoparticles in Human Epidermal Keratinocytes

    Science.gov (United States)

    Toxicity Assessment of Six Titanium Dioxide Nanoparticles in Human Epidermal Keratinocytes Nanoparticle uptake in cells may be an important determinant of their potential cytotoxic and inflammatory effects. Six commercial TiO2 NP (A=Alfa Aesar,10nm, A*=Alfa Aesar 32nm, B=P25 27...

  17. Comparative two-dimensional gel analysis and microsequencing identifies gelsolin as one of the most prominent downregulated markers of transformed human fibroblast and epithelial cells

    DEFF Research Database (Denmark)

    Vandekerckhove, J; Bauw, G; Vancompernolle, K

    1990-01-01

    A systematic comparison of the protein synthesis patterns of cultured normal and transformed human fibroblasts and epithelial cells, using two-dimensional gel protein analysis combined with computerized imaging and data acquisition, identified a 90-kD protein (SSP 5714) as one of the most striking...... downregulated markers typical of the transformed state. Using the information stored in the comprehensive human cellular protein database, we found this protein strongly expressed in several fetal tissues and one of them, epidermis, served as a source for preparative two-dimensional gel electrophoresis. Partial...... and by coelectrophoresis with purified human gelsolin. These results suggest that an important regulatory protein of the microfilament system may play a role in defining the phenotype of transformed human fibroblast and epithelial cells in culture. Udgivelsesdato: 1990-Jul...

  18. Comparative two-dimensional gel analysis and microsequencing identifies gelsolin as one of the most prominent downregulated markers of transformed human fibroblast and epithelial cells

    DEFF Research Database (Denmark)

    Vandekerckhove, J; Bauw, G; Vancompernolle, K

    1990-01-01

    downregulated markers typical of the transformed state. Using the information stored in the comprehensive human cellular protein database, we found this protein strongly expressed in several fetal tissues and one of them, epidermis, served as a source for preparative two-dimensional gel electrophoresis. Partial......A systematic comparison of the protein synthesis patterns of cultured normal and transformed human fibroblasts and epithelial cells, using two-dimensional gel protein analysis combined with computerized imaging and data acquisition, identified a 90-kD protein (SSP 5714) as one of the most striking...... and by coelectrophoresis with purified human gelsolin. These results suggest that an important regulatory protein of the microfilament system may play a role in defining the phenotype of transformed human fibroblast and epithelial cells in culture. Udgivelsesdato: 1990-Jul...

  19. Cox2 and β-Catenin/T-cell Factor Signaling Intestinalize Human Esophageal Keratinocytes When Cultured under Organotypic Conditions

    Directory of Open Access Journals (Sweden)

    Jianping Kong

    2011-09-01

    Full Text Available The incidence of esophageal adenocarcinoma (EAC is rising in the United States. An important risk factor for EAC is the presence of Barrett esophagus (BE. BE is the replacement of normal squamous esophageal epithelium with a specialized columnar epithelium in response to chronic acid and bile reflux. However, the emergence of BE from squamous keratinocytes has not yet been demonstrated. Our research has focused on this. Wnt and cyclooxygenase 2 (Cox2 are two pathways whose activation has been associated with BE and progression to EAC, but their role has not been tested experimentally. To explore their contribution, we engineered a human esophageal keratinocyte cell line to express either a dominant-active Wnt effector CatCLef or a Cox2 complementary DNA. In a two-dimensional culture environment, Cox2 expression increases cell proliferation and migration, but neither transgene induces known BE markers. In contrast, when these cells were placed into three-dimensional organotypic culture conditions, we observed more profound effects. CatCLef-expressing cells were more proliferative, developed a thicker epithelium, and upregulated Notch signaling and several BE markers including NHE2. Cox2 expression also increased cell proliferation and induced a thicker epithelium. More importantly, we observed cysts form within the epithelium, filled with intestinal mucins including Muc5B and Muc17. This suggests that Cox2 expression in a three-dimensional culture environment induces a lineage of mucin-secreting cells and supports an important causal role for Cox2 in BE pathogenesis. We conclude that in vitro modeling of BE pathogenesis can be improved by enhancing Wnt signaling and Cox2 activity and using three-dimensional organotypic culture conditions.

  20. Chemical allergens stimulate human epidermal keratinocytes to produce lymphangiogenic vascular endothelial growth factor.

    Science.gov (United States)

    Bae, Ok-Nam; Ahn, Seyeon; Jin, Sun Hee; Hong, Soo Hyun; Lee, Jinyoung; Kim, Eun-Sun; Jeong, Tae Cheon; Chun, Young-Jin; Lee, Ai-Young; Noh, Minsoo

    2015-03-01

    Allergic contact dermatitis (ACD) is a cell-mediated immune response that involves skin sensitization in response to contact with various allergens. Angiogenesis and lymphangiogenesis both play roles in the allergic sensitization process. Epidermal keratinocytes can produce vascular endothelial growth factor (VEGF) in response to UV irradiation and during wound healing. However, the effect of haptenic chemical allergens on the VEGF production of human keratinocytes, which is the primary contact site of toxic allergens, has not been thoroughly researched. We systematically investigated whether immune-regulatory cytokines and chemical allergens would lead to the production of VEGF in normal human keratinocytes (NHKs) in culture. VEGF production significantly increased when NHKs were treated with IFNγ, IL-1α, IL-4, IL-6, IL-17A, IL-22 or TNFα. Among the human sensitizers listed in the OECD Test Guideline (TG) 429, we found that CMI/MI, DNCB, 4-phenylenediamine, cobalt chloride, 2-mercaptobenzothiazole, citral, HCA, cinnamic alcohol, imidazolidinyl urea and nickel chloride all significantly upregulated VEGF production in NHKs. In addition, common human haptenic allergens such as avobenzone, formaldehyde and urushiol, also induced the keratinocyte-derived VEGF production. VEGF upregulation by pro-inflammatory stimuli, IFNγ, DNCB or formaldehyde is preceded by the production of IL-8, an acute inflammatory phase cytokine. Lymphangiogenic VEGF-C gene transcription was significantly increased when NHKs were treated with formaldehyde, DNCB or urushiol, while transcription of VEGF-A and VEGF-B did not change. Therefore, the chemical allergen-induced VEGF upregulation is mainly due to the increase in lymphangiogenic VEGF-C transcription in NHKs. These results suggest that keratinocyte-derived VEGF may regulate the lymphangiogenic process during the skin sensitization process of ACD. Copyright © 2015 Elsevier Inc. All rights reserved.

  1. Structural organization of the human glucocorticoid receptor determined by one- and two-dimensional gel electrophoresis of proteolytic receptor fragments

    International Nuclear Information System (INIS)

    Smith, A.C.; Harmon, J.M.

    1987-01-01

    The structural organization of the steroid-binding protein of the IM-9 cell glucocorticoid receptor was investigated by using one- and two-dimensional gel electrophoresis of proteolytic receptor fragments. One-dimensional sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) of receptor fragments isolated after trypsin digestion of immunopurified [ 3 H]dexamethasone 21-mesylate ([ 3 H]DM-) labeled receptor revealed the presence of a stable 26.5-kilodalton (kDa) steroid-containing non-DNA-binding fragment, derived from a larger, less stable, 29-kDa fragment. The 26.5-kDa tryptic fragment appeared to be completely contained within a 41-kDa, steroid-containing, DNA-binding species isolated after chymotrypsin digestion of the intact protein. Two-dimensional electrophoretic analysis of the [ 3 H]DM-labeled tryptic fragments resolved two 26.5-kDa and two 29-kDa components. This was the same number of isoforms seen in the intact protein, indicating that the charge heterogeneity of the steroid-binding protein is the result of modification within the steroid-containing, non-DNA-binding, 26.5-kDa tryptic fragment. Two-dimensional analysis of the 41-kDa [ 3 H]DM-labeled chymotryptic species revealed a pattern of isoforms more complex than that seen either in the intact protein or in the steroid-containing tryptic fragments. These results suggest that the 41-kDa [ 3 H]DM-labeled species resolved by one-dimensional SDS-PAGE after chymotrypsin digestion may be composed of several distinct proteolytic fragments

  2. Analysis of aquaporin 9 expression in human epidermis and cultured keratinocytes

    Directory of Open Access Journals (Sweden)

    Yoshinori Sugiyama

    2014-01-01

    Full Text Available Aquaporin 9 (AQP9 is a member of the aquaglyceroporin family that transports glycerol, urea and other small solutes as well as water. Compared to the expression and function in epidermal keratinocytes of AQP3, another aquaglyceroporin, our knowledge of epidermal AQP9 remains elusive. In this study, we investigated the expression of AQP9 in the human epidermis and cultured keratinocytes. Immunofluorescence studies revealed that AQP9 expression is highly restricted to the stratum granulosum of the human epidermis, where occludin is also expressed at the tight junctions. Interestingly, the AQP3 staining decreased sharply below the cell layers in which AQP9 is expressed. In cultured normal human epidermal keratinocytes (NHEK, knock-down of AQP9 expression in the differentiated cells induced by RNA interference reduced glycerol uptake, which was not as pronounced as was the case with AQP3 knock-down cells. In contrast, similar reduction of urea uptake was detected in AQP9 and AQP3 knock-down cells. These findings suggested that AQP9 expression in NHEK facilitates at least the transport of glycerol and urea. Finally, we analyzed the effect of retinoic acid (RA, a potent stimulator of keratinocyte proliferation, on AQP3 and AQP9 mRNA expression in differentiated NHEK. Stimulation with RA at 1 μM for 24 h augmented AQP3 expression and down-regulated AQP9 expression. Collectively, these results indicate that AQP9 expression in epidermal keratinocytes is regulated in a different manner from that of AQP3.

  3. 5-fluorouracil Toxicity Mechanism Determination in Human Keratinocytes: in vitro Study on HaCaT

    Directory of Open Access Journals (Sweden)

    Jan Hartinger

    2018-01-01

    Full Text Available 5-fluorouracil (5-FU and capecitabine therapy is often accompanied by palmar-plantar erythrodysesthesia (PPE which is manifestation of 5-FU toxicity in keratinocytes. The main mechanisms of 5-FU action are thymidylate synthase (TS inhibition which can be abrogated by thymidine and strengthened by calciumfolinate (CF and incorporation of fluorouridinetriphosphate into RNA which can be abrogated by uridine. For proper PPE treatment 5-FU mechanism of action in keratinocytes needs to be elucidated. We used the 5-FU toxicity modulators uridine, thymidine and CF to discover the mechanism of 5-FU action in human keratinocyte cell line HaCaT. To measure the cellular viability, we used MTT test and RTCA test. CF did not augment 5-FU toxicity and 5-FU toxicity was weakened by uridine. Therefore, the primary mechanism of 5-FU toxicity in keratinocytes is 5-FU incorporation into RNA. The uridine protective effect cannot fully develop in the presence of CF. Thymidine addition to 5-FU and uridine treated cells not only prevents the toxicity-augmenting CF effect but it also prolongs the 5-FU treated cells survival in comparison to uridine only. Therefore, it can be assumed that in the presence of uridine the 5-FU toxicity mechanism is switched from RNA incorporation to TS inhibition. Although particular 5-FU toxicity mechanisms were previously described in various cell types, this is the first time when various combinations of pyrimidine nucleosides and CF were used for 5-FU toxicity mechanism elucidation in human keratinocytes. We suggest that for PPE treatment ointment containing uridine and thymidine should be further clinically tested.

  4. Prolonged Integration Site Selection of a Lentiviral Vector in the Genome of Human Keratinocytes.

    Science.gov (United States)

    Qian, Wei; Wang, Yong; Li, Rui-Fu; Zhou, Xin; Liu, Jing; Peng, Dai-Zhi

    2017-03-03

    BACKGROUND Lentiviral vectors have been successfully used for human skin cell gene transfer studies. Defining the selection of integration sites for retroviral vectors in the host genome is crucial in risk assessment analysis of gene therapy. However, genome-wide analyses of lentiviral integration sites in human keratinocytes, especially after prolonged growth, are poorly understood. MATERIAL AND METHODS In this study, 874 unique lentiviral vector integration sites in human HaCaT keratinocytes after long-term culture were identified and analyzed with the online tool GTSG-QuickMap and SPSS software. RESULTS The data indicated that lentiviral vectors showed integration site preferences for genes and gene-rich regions. CONCLUSIONS This study will likely assist in determining the relative risks of the lentiviral vector system and in the design of a safe lentiviral vector system in the gene therapy of skin diseases.

  5. Chemical allergens stimulate human epidermal keratinocytes to produce lymphangiogenic vascular endothelial growth factor

    Energy Technology Data Exchange (ETDEWEB)

    Bae, Ok-Nam [College of Pharmacy, Institute of Pharmaceutical Science and Technology, Hanyang University, Ansan 426-791 (Korea, Republic of); Ahn, Seyeon; Jin, Sun Hee; Hong, Soo Hyun; Lee, Jinyoung [College of Pharmacy, Natural Products Research Institute, Seoul National University, Seoul 151-742 (Korea, Republic of); Kim, Eun-Sun [College of Pharmacy, Institute of Pharmaceutical Science and Technology, Hanyang University, Ansan 426-791 (Korea, Republic of); Jeong, Tae Cheon [College of Pharmacy, Yeungnam University, Gyeongsan 712-749 (Korea, Republic of); Chun, Young-Jin [College of Pharmacy, Chung-Ang University, Seoul 156-756 (Korea, Republic of); Lee, Ai-Young, E-mail: leeay@duih.org [Department of Dermatology, Dongguk University Ilsan Hospital, Goyang 410-773 (Korea, Republic of); Noh, Minsoo, E-mail: minsoo@alum.mit.edu [College of Pharmacy, Natural Products Research Institute, Seoul National University, Seoul 151-742 (Korea, Republic of)

    2015-03-01

    Allergic contact dermatitis (ACD) is a cell-mediated immune response that involves skin sensitization in response to contact with various allergens. Angiogenesis and lymphangiogenesis both play roles in the allergic sensitization process. Epidermal keratinocytes can produce vascular endothelial growth factor (VEGF) in response to UV irradiation and during wound healing. However, the effect of haptenic chemical allergens on the VEGF production of human keratinocytes, which is the primary contact site of toxic allergens, has not been thoroughly researched. We systematically investigated whether immune-regulatory cytokines and chemical allergens would lead to the production of VEGF in normal human keratinocytes (NHKs) in culture. VEGF production significantly increased when NHKs were treated with IFNγ, IL-1α, IL-4, IL-6, IL-17A, IL-22 or TNFα. Among the human sensitizers listed in the OECD Test Guideline (TG) 429, we found that CMI/MI, DNCB, 4-phenylenediamine, cobalt chloride, 2-mercaptobenzothiazole, citral, HCA, cinnamic alcohol, imidazolidinyl urea and nickel chloride all significantly upregulated VEGF production in NHKs. In addition, common human haptenic allergens such as avobenzone, formaldehyde and urushiol, also induced the keratinocyte-derived VEGF production. VEGF upregulation by pro-inflammatory stimuli, IFNγ, DNCB or formaldehyde is preceded by the production of IL-8, an acute inflammatory phase cytokine. Lymphangiogenic VEGF-C gene transcription was significantly increased when NHKs were treated with formaldehyde, DNCB or urushiol, while transcription of VEGF-A and VEGF-B did not change. Therefore, the chemical allergen-induced VEGF upregulation is mainly due to the increase in lymphangiogenic VEGF-C transcription in NHKs. These results suggest that keratinocyte-derived VEGF may regulate the lymphangiogenic process during the skin sensitization process of ACD. - Highlights: • Pro-inflammatory cytokines induced VEGF production in normal human

  6. Chemical allergens stimulate human epidermal keratinocytes to produce lymphangiogenic vascular endothelial growth factor

    International Nuclear Information System (INIS)

    Bae, Ok-Nam; Ahn, Seyeon; Jin, Sun Hee; Hong, Soo Hyun; Lee, Jinyoung; Kim, Eun-Sun; Jeong, Tae Cheon; Chun, Young-Jin; Lee, Ai-Young; Noh, Minsoo

    2015-01-01

    Allergic contact dermatitis (ACD) is a cell-mediated immune response that involves skin sensitization in response to contact with various allergens. Angiogenesis and lymphangiogenesis both play roles in the allergic sensitization process. Epidermal keratinocytes can produce vascular endothelial growth factor (VEGF) in response to UV irradiation and during wound healing. However, the effect of haptenic chemical allergens on the VEGF production of human keratinocytes, which is the primary contact site of toxic allergens, has not been thoroughly researched. We systematically investigated whether immune-regulatory cytokines and chemical allergens would lead to the production of VEGF in normal human keratinocytes (NHKs) in culture. VEGF production significantly increased when NHKs were treated with IFNγ, IL-1α, IL-4, IL-6, IL-17A, IL-22 or TNFα. Among the human sensitizers listed in the OECD Test Guideline (TG) 429, we found that CMI/MI, DNCB, 4-phenylenediamine, cobalt chloride, 2-mercaptobenzothiazole, citral, HCA, cinnamic alcohol, imidazolidinyl urea and nickel chloride all significantly upregulated VEGF production in NHKs. In addition, common human haptenic allergens such as avobenzone, formaldehyde and urushiol, also induced the keratinocyte-derived VEGF production. VEGF upregulation by pro-inflammatory stimuli, IFNγ, DNCB or formaldehyde is preceded by the production of IL-8, an acute inflammatory phase cytokine. Lymphangiogenic VEGF-C gene transcription was significantly increased when NHKs were treated with formaldehyde, DNCB or urushiol, while transcription of VEGF-A and VEGF-B did not change. Therefore, the chemical allergen-induced VEGF upregulation is mainly due to the increase in lymphangiogenic VEGF-C transcription in NHKs. These results suggest that keratinocyte-derived VEGF may regulate the lymphangiogenic process during the skin sensitization process of ACD. - Highlights: • Pro-inflammatory cytokines induced VEGF production in normal human

  7. TCDD induces dermal accumulation of keratinocyte-derived matrix metalloproteinase-10 in an organotypic model of human skin

    Energy Technology Data Exchange (ETDEWEB)

    De Abrew, K. Nadira [Molecular and Environmental Toxicology Center, University of Wisconsin—Madison, Madison, WI 53706 (United States); Thomas-Virnig, Christina L.; Rasmussen, Cathy A. [Department of Pathology, University of Wisconsin—Madison, Madison, WI 53706 (United States); Bolterstein, Elyse A. [Molecular and Environmental Toxicology Center, University of Wisconsin—Madison, Madison, WI 53706 (United States); Schlosser, Sandy J. [Department of Pathology, University of Wisconsin—Madison, Madison, WI 53706 (United States); Allen-Hoffmann, B. Lynn, E-mail: blallenh@wisc.edu [Molecular and Environmental Toxicology Center, University of Wisconsin—Madison, Madison, WI 53706 (United States); Department of Pathology, University of Wisconsin—Madison, Madison, WI 53706 (United States)

    2014-05-01

    The epidermis of skin is the first line of defense against the environment. A three dimensional model of human skin was used to investigate tissue-specific phenotypes induced by the environmental contaminant, 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Continuous treatment of organotypic cultures of human keratinocytes with TCDD resulted in intracellular spaces between keratinocytes of the basal and immediately suprabasal layers as well as thinning of the basement membrane, in addition to the previously reported hyperkeratinization. These tissue remodeling events were preceded temporally by changes in expression of the extracellular matrix degrading enzyme, matrix metalloproteinase-10 (MMP-10). In organotypic cultures MMP-10 mRNA and protein were highly induced following TCDD treatment. Q-PCR and immunoblot results from TCDD-treated monolayer cultures, as well as indirect immunofluorescence and immunoblot analysis of TCDD-treated organotypic cultures, showed that MMP-10 was specifically contributed by the epidermal keratinocytes but not the dermal fibroblasts. Keratinocyte-derived MMP-10 protein accumulated over time in the dermal compartment of organotypic cultures. TCDD-induced epidermal phenotypes in organotypic cultures were attenuated by the keratinocyte-specific expression of tissue inhibitor of metalloproteinase-1, a known inhibitor of MMP-10. These studies suggest that MMP-10 and possibly other MMP-10-activated MMPs are responsible for the phenotypes exhibited in the basement membrane, the basal keratinocyte layer, and the cornified layer of TCDD-treated organotypic cultures. Our studies reveal a novel mechanism by which the epithelial–stromal microenvironment is altered in a tissue-specific manner thereby inducing structural and functional pathology in the interfollicular epidermis of human skin. - Highlights: • TCDD causes hyperkeratosis and basement membrane changes in a model of human skin. • TCDD induces MMP-10 expression in organotypic cultures

  8. Replacement of murine fibroblasts by human fibroblasts irradiated in obtaining feeder layer for the culture of human keratinocytes

    International Nuclear Information System (INIS)

    Yoshito, Daniele; Sufi, Bianca S.; Santin, Stefany P.; Mathor, Monica B.; Altran, Silvana C.; Isaac, Cesar

    2011-01-01

    Human autologous epithelia cultivated in vitro, have been used successfully in treating damage to skin integrity. The methodology allowed the cultivation of these epithelia was described by Rheinwald and Green in 1975, this methodology consisted in seeding keratinocytes onto a feeder layer composed of lineage 3T3 murine fibroblasts, the proliferation rate is controlled through the action of ionizing radiation. However, currently there is a growing concern about the possibility of transmitting prions and murine viruses to transplanted patients. Taking into account this concern, in this present work, we replaced the feeder layer originally composed of murine fibroblasts by human fibroblasts. To obtain this new feeder layer was necessary to standardize the enough irradiation dose to inhibit the replication of human fibroblasts and the verification of effectiveness of the development of keratinocytes culture on a feeder layer thus obtained. According to the obtained results we can verify that the human fibroblasts irradiated at various tested doses (60, 70, 100, 200, 250 and 300 Gy) had their mitotic activity inactivated by irradiation, allowing the use of any of these doses to confection of the feeder layer, since these fibroblasts irradiated still showed viable until fourteen days of cultivation. In the test of colony formation efficiency was observed that keratinocytes seeded on irradiated human fibroblasts were able to develop satisfactorily, preserving their clonogenic potential. Therefore it was possible the replacement of murine fibroblasts by human fibroblasts in confection of the feeder layer, in order to eliminate this xenobiotic component of the keratinocytes culture. (author)

  9. Replacement of murine fibroblasts by human fibroblasts irradiated in obtaining feeder layer for the culture of human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Yoshito, Daniele; Sufi, Bianca S.; Santin, Stefany P.; Mathor, Monica B. [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil); Altran, Silvana C.; Isaac, Cesar [Universidade Sao Paulo (USP), Sao Paulo, SP (Brazil). Fac. de Medicina. Lab. de Microcirurgia Plastica; Esteves-Pedro, Natalia M. [Universidade Sao Paulo (USP), Sao Paulo, SP (Brazil). Fac. de Ciencias Farmaceuticas. Lab. de Controle Biologico; Herson, Marisa R. [DonorTissue Bank of Victoria (Australia)

    2011-07-01

    Human autologous epithelia cultivated in vitro, have been used successfully in treating damage to skin integrity. The methodology allowed the cultivation of these epithelia was described by Rheinwald and Green in 1975, this methodology consisted in seeding keratinocytes onto a feeder layer composed of lineage 3T3 murine fibroblasts, the proliferation rate is controlled through the action of ionizing radiation. However, currently there is a growing concern about the possibility of transmitting prions and murine viruses to transplanted patients. Taking into account this concern, in this present work, we replaced the feeder layer originally composed of murine fibroblasts by human fibroblasts. To obtain this new feeder layer was necessary to standardize the enough irradiation dose to inhibit the replication of human fibroblasts and the verification of effectiveness of the development of keratinocytes culture on a feeder layer thus obtained. According to the obtained results we can verify that the human fibroblasts irradiated at various tested doses (60, 70, 100, 200, 250 and 300 Gy) had their mitotic activity inactivated by irradiation, allowing the use of any of these doses to confection of the feeder layer, since these fibroblasts irradiated still showed viable until fourteen days of cultivation. In the test of colony formation efficiency was observed that keratinocytes seeded on irradiated human fibroblasts were able to develop satisfactorily, preserving their clonogenic potential. Therefore it was possible the replacement of murine fibroblasts by human fibroblasts in confection of the feeder layer, in order to eliminate this xenobiotic component of the keratinocytes culture. (author)

  10. Enhanced constitutive invasion activity in human nontumorigenic keratinocytes exposed to a low level of barium for a long time.

    Science.gov (United States)

    Thang, Nguyen D; Yajima, Ichiro; Ohnuma, Shoko; Ohgami, Nobutaka; Kumasaka, Mayuko Y; Ichihara, Gaku; Kato, Masashi

    2015-02-01

    We have recently demonstrated that exposure to barium for a short time (≤4 days) and at a low level (5 µM = 687 µg/L) promotes invasion of human nontumorigenic HaCaT cells, which have characteristics similar to those of normal keratinocytes, suggesting that exposure to barium for a short time enhances malignant characteristics. Here we examined the effect of exposure to low level of barium for a long time, a condition mimicking the exposure to barium through well water, on malignant characteristics of HaCaT keratinocytes. Constitutive invasion activity, focal adhesion kinase (FAK) protein expression and activity, and matrix metalloproteinase 14 (MMP14) protein expression in primary cultured normal human epidermal keratinocytes, HaCaT keratinocytes, and HSC5 and A431 human squamous cell carcinoma cells were augmented following an increase in malignancy grade of the cells. Constitutive invasion activity, FAK phosphorylation, and MMP14 expression levels of HaCaT keratinocytes after treatment with 5 µM barium for 4 months were significantly higher than those of control untreated HaCaT keratinocytes. Taken together, our results suggest that exposure to a low level of barium for a long time enhances constitutive malignant characteristics of HaCaT keratinocytes via regulatory molecules (FAK and MMP14) for invasion. © 2013 Wiley Periodicals, Inc.

  11. Two-dimensional analysis of human lymphocyte proteins. III. Preliminary report on a marker for the early detection and diagnosis of infectious mononucleosis

    International Nuclear Information System (INIS)

    Willard, K.E.

    1982-01-01

    Two-dimensional gel electrophoretic patterns of human peripheral blood leukocytes from 12 patients with infectious mononucleosis were prepared by use of the ISO-DALT system. Before the two-dimensional separation, the leukocytes were purified by Ficoll-Paque gradient centrifugation and labeled overnight with [ 35 S] methionine. Quantitative increases in two proteins were detected in the patterns of infected leukocytes from the patients as compared with controls. Fluorescence-activated cell sorting of leukocytes from normal human peripheral blood before subsequent two-dimensional gel analysis revealed that the dramatic increase in one of these proteins (Inmono:2) could be due to shifts in the population ratios of lymphocytes, monocytes, and granulocytes. In contrast, the appearance in the infected leukocytes of a second protein, Inmono:1, could not be accounted for by cell-population shifts. Increased amounts of these two proteins have been found in every patient studied who had clinically detectable infectious mononucleosis. In addition, a patient who displayed symptoms of infectious mononucleosis but who did not have a positive result in the MONOSPOT test (Ortho) until three weeks after our analysis also demonstrated increased relative amounts of these proteins in his leukocyte pattern

  12. Vanillin protects human keratinocyte stem cells against ultraviolet B irradiation.

    Science.gov (United States)

    Lee, Jienny; Cho, Jae Youl; Lee, Sang Yeol; Lee, Kyung-Woo; Lee, Jongsung; Song, Jae-Young

    2014-01-01

    Ultraviolet-B (UVB) irradiation is one of major factors which induce cellular damages in the epidermis. We investigated protective effects and mechanisms of vanillin, a main constituent of vanilla beans, against UVB-induced cellular damages in keratinocyte stem cells (KSC). Here, vanillin significantly attenuated UVB irradiation-induced cytotoxicity. The vanillin effects were also demonstrated by the results of the senescence-associated β-galactosidase and alkaline comet assays. In addition, vanillin induced production of pro-inflammatory cytokines. Attempts to elucidate a possible mechanism underlying the vanillin-mediated effects revealed that vanillin significantly reduced UVB-induced phosphorylation of ataxia telangiectasia mutated (ATM), serine threonine kinase checkpoint kinase 2 (Chk2), tumor suppressor protein 53 (p53), p38/mitogen-activated protein kinase (p38), c-Jun N-terminal kinase/stress-activated protein kinase (JNK), S6 ribosomal protein (S6RP), and histone 2A family member X (H2A.X). UVB-induced activation of p53 luciferase reporter was also significantly inhibited by vanillin. In addition, while ATM inhibitor had no effect on the vanillin effects, mouse double minute 2 homolog (MDM2) inhibitor significantly attenuated suppressive effects of vanillin on UVB-induced activation of p53 reporter in KSC. Taken together, these findings suggest that vanillin protects KSC from UVB irradiation and its effects may occur through the suppression of downstream step of MDM2 in UVB irradiation-induced p53 activation. Copyright © 2013 Elsevier Ltd. All rights reserved.

  13. Effect of 1,24R-dihydroxyvitamin D3 on the growth of human keratinocytes.

    LENUS (Irish Health Repository)

    Matsumoto, K

    1990-02-01

    The effect of 1,24R-dihydroxyvitamin D3 (1,24R(OH)2D3), a synthetic analogue of a biologically active form of vitamin D3 (1,25-dihydroxyvitamin D3, 1,25(OH)2D3), on the growth of human keratinocytes cultured in serum-free medium was investigated. The growth of cultured normal human keratinocytes was inhibited by 65% by 10(-8)M 1,24R(OH)2D3 and by 90% by 10(-7)M 1,24(OH)2D3. It inhibited cell growth almost completely at 10(-6)M. The DNA synthesis of keratinocytes was also inhibited with 1,24R(OH)2D3 by 27% at 10(-8)M, 59% at 10(-7)M, and 92% at 10(-6)M. The inhibition of cell growth and DNA synthesis were more remarkable by 1,24R(OH)2D3 than by 1,25(OH)2D3. 1,24R(OH)2D3 also inhibited the growth of keratinocytes derived from patients with psoriasis vulgaris; the growth inhibitory effect was again more remarkable with 1,24R(OH)2D3 than with 1,25(OH)2D3. The viability and protein synthesis of keratinocytes were not affected by 1,24R(OH)2D3, suggesting that the growth inhibitory effect is due to its biological activity, not to cytotoxicity. The binding of [3H]-labeled 1,25(OH)2D3 to its receptor in the cytosolic fraction of cultured keratinocytes was competitively substituted by unlabeled 1,24R(OH)2D3 as well as 1,25(OH)2D3, suggesting that 1,24R(OH)2D3 binds to the 1,25(OH)2D3 receptor. It was found that the affinity of 1,24R(OH)2D3 for the receptor was slightly higher than that of 1,25(OH)2D3. These results demonstrate that 1,24R(OH)2D3 functions as a potent growth inhibitor in vitro in human keratinocytes from both normal and psoriatic epidermis, and it possesses a higher affinity for the 1,25(OH)2D3 receptor in cultured human keratinocytes. The difference in affinity of 1,24R(OH)2D3 for the 1,25(OH)2D3 receptor correlates with its greater inhibition of keratinocyte growth than 1,25(OH)2D3. 1,24R(OH)2D3 may be useful in the treatment of psoriasis.

  14. Heavy metal-induced cytotoxicity to cultured human epidermal keratinocytes and effects of antioxidants.

    Science.gov (United States)

    Kappus, H; Reinhold, C

    1994-04-01

    Human epidermal keratinocytes which have been cultured were treated with the heavy metal ions of cadmium, mercury, copper and zinc. Cytotoxicity was measured either by protein estimation or by using the neutral red assay. Antioxidants were added in order to find out whether heavy metal-induced cytotoxicity is related to oxidative stress. All metals used showed considerable cytotoxic effects within 24 h in moderate concentrations. None of the antioxidants vitamin E (alpha-tocopherol), pyrogallol, propyl gallate, BHT or ebselen showed any protective or preventive effect. This indicates that oxidative stress may not be involved in the cytotoxicity induced by heavy metals in human epidermal keratinocytes. The cells used are, however, a valuable tool to study mechanisms of cytotoxicity.

  15. Interleukin 1 gene expression in cultured human keratinocytes is augmented by ultraviolet irradiation

    International Nuclear Information System (INIS)

    Kupper, T.S.; Chua, A.O.; Flood, P.; McGuire, J.; Gubler, U.

    1987-01-01

    Interleukin 1 (IL-1) is a family of polypeptides initially found to be produced by activated monocytes and macrophages that mediate a wide variety of cellular responses to injury and infection. Epidermal epithelial cells (keratinocytes) produce ''epidermal cell-derived thymocyte activating factor'' or ETAF, which has been recently shown to be identical to IL-1. Human epidermis is normally exposed to significant amounts of solar ultraviolet radiation. Certain ultraviolet wavelengths (UVB, 290-320 nm) are thought to be responsible for most of the immediate and long-term pathological consequences of excessive exposure to sunlight. In this study, we asked whether exposure to UVB irradiation induced IL-1 gene expression in cultured human keratinocytes. Cultured human keratinocytes contain detectable amounts of IL-1 alpha and beta mRNA and protein in the absence of apparent stimulation; these levels could be significantly enhanced 6 h after exposure to 10 ng/ml of 12-O-tetradecanoyl-phorbol-13-acetate (TPA). Exposure to UVB irradiation with an emission spectrum comparable to that of sunlight (as opposed to that of an unfiltered artificial UV light source) significantly increased the steady state levels IL-1 alpha and beta mRNA in identical populations of human keratinocytes. This was reflected in the production of increased IL-1 activity by these cultures in vitro. In the same cell population, exposures to UVB irradiation did not alter the level of actin mRNA; therefore, the effect of UV irradiation on IL-1 represents a specific enhancement of IL-1 gene expression. Local increases of IL-1 may mediate the inflammation and vasodilation characteristic of acute UVB-injured skin, and systemic release of this epidermal IL-1 may account for fever, leukocytosis, and the acute phase response seen after excessive sun exposure

  16. The master two-dimensional gel database of human AMA cell proteins: towards linking protein and genome sequence and mapping information (update 1991)

    DEFF Research Database (Denmark)

    Celis, J E; Leffers, H; Rasmussen, H H

    1991-01-01

    autoantigens" and "cDNAs". For convenience we have included an alphabetical list of all known proteins recorded in this database. In the long run, the main goal of this database is to link protein and DNA sequencing and mapping information (Human Genome Program) and to provide an integrated picture......The master two-dimensional gel database of human AMA cells currently lists 3801 cellular and secreted proteins, of which 371 cellular polypeptides (306 IEF; 65 NEPHGE) were added to the master images during the last 10 months. These include: (i) very basic and acidic proteins that do not focus...

  17. The comparison of two methods to obtain human oral keratinocytes in primary culture

    International Nuclear Information System (INIS)

    Klingbeil, Maria Fatima Guarizo

    2006-01-01

    The therapeutic procedures frequently used in oral treatments for the pathological diseases are surgical, resulting in failures of the mucosal continuity.The possibility to obtain transplantable oral epithelia from an in vitro cell culture opens new utilization perspectives not only to where it comes from, but also as a reconstructive material for other parts of the human body, such as: urethra, epithelia corneo-limbal, cornea, ocular surface. Many researchers still use controversial methods for obtaining cells. It was therefore evaluated and compared the efficiency in both methods: enzymatic and direct explant to obtain oral keratinocytes from human oral mucosa. Fragments of intra oral epithelial tissues from healthy human subjects, undergoing dental surgeries, were donated to the research project. The keratinocytes were cultivated over a feeder-layer from a previously irradiated 3T3 Swiss albino fibroblasts. In this study it was compared the time needed in the cell obtention, the best cell amount between both methods, the life-span, the cell capacity to form an in vitro epithelia and its morphologic structure. The results in the assessment of both methods have shown the possibility to obtain keratinocytes from a small oral fragment, but at the same time we may verify the advantages and peculiar restrictions for each one of both analyzed methods. (author)

  18. Anti-Inflammatory Effect of Melittin on Porphyromonas Gingivalis LPS-Stimulated Human Keratinocytes.

    Science.gov (United States)

    Kim, Woon-Hae; An, Hyun-Jin; Kim, Jung-Yeon; Gwon, Mi-Gyeong; Gu, Hyemin; Jeon, Minji; Kim, Min-Kyung; Han, Sang-Mi; Park, Kwan-Kyu

    2018-02-05

    Periodontitis is a chronic inflammatory disease that contributes to the destruction of the gingiva. Porphyromonas gingivalis ( P. gingivalis ) can cause periodontitis via its pathogenic lipopolysaccharides (LPS). Melittin, a major component of bee venom, is known to have anti-inflammatory and antibacterial effects. However, the role of melittin in the inflammatory response has not been elucidated in periodontitis-like human keratinocytes. Therefore, we investigated the anti-inflammatory effects of melittin on a P. gingivalis LPS (PgLPS)-treated HaCaT human keratinocyte cell line. The cytotoxicity of melittin was measured using a human keratinocyte cell line, HaCaT, and a Cell Counting Kit-8. The effect of melittin on PgLPS-induced inflammation was determined with Western blot, real-time quantitative PCT, and immunofluorescence. PgLPS increased the expression of toll-like receptor (TLR) 4 and proinflammatory cytokines, such as tumor necrosis factor-α (TNF-α), interleukin (IL)-6, IL-8, and interferon-γ (IFN-γ). Moreover, PgLPS induced activation of the nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB), extracellular signal-regulated kinase (ERK), and protein kinase B/Akt. Melittin also inhibited the expression of proinflammatory cytokines by suppressing the activation of the NF-κB signaling pathway, ERK, and Akt. Melittin attenuates the PgLPS-induced inflammatory response and could therefore be applied in the treatment of periodontitis for anti-inflammatory effects.

  19. Large-scale analysis of protein expression changes in human keratinocytes immortalized by human papilloma virus type 16 E6 and E7 oncogenes

    Directory of Open Access Journals (Sweden)

    Arnouk Hilal

    2009-08-01

    Full Text Available Abstract Background Infection with high-risk type human papilloma viruses (HPVs is associated with cervical carcinomas and with a subset of head and neck squamous cell carcinomas. Viral E6 and E7 oncogenes cooperate to achieve cell immortalization by a mechanism that is not yet fully understood. Here, human keratinocytes were immortalized by long-term expression of HPV type 16 E6 or E7 oncoproteins, or both. Proteomic profiling was used to compare expression levels for 741 discrete protein features. Results Six replicate measurements were performed for each group using two-dimensional difference gel electrophoresis (2D-DIGE. The median within-group coefficient of variation was 19–21%. Significance of between-group differences was tested based on Significance Analysis of Microarray and fold change. Expression of 170 (23% of the protein features changed significantly in immortalized cells compared to primary keratinocytes. Most of these changes were qualitatively similar in cells immortalized by E6, E7, or E6/7 expression, indicating convergence on a common phenotype, but fifteen proteins (~2% were outliers in this regulatory pattern. Ten demonstrated opposite regulation in E6- and E7-expressing cells, including the cell cycle regulator p16INK4a; the carbohydrate binding protein Galectin-7; two differentially migrating forms of the intermediate filament protein Cytokeratin-7; HSPA1A (Hsp70-1; and five unidentified proteins. Five others had a pattern of expression that suggested cooperativity between the co-expressed oncoproteins. Two of these were identified as forms of the small heat shock protein HSPB1 (Hsp27. Conclusion This large-scale analysis provides a framework for understanding the cooperation between E6 and E7 oncoproteins in HPV-driven carcinogenesis.

  20. A Sensitive Sensor Cell Line for the Detection of Oxidative Stress Responses in Cultured Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Ute Hofmann

    2014-06-01

    Full Text Available In the progress of allergic and irritant contact dermatitis, chemicals that cause the generation of reactive oxygen species trigger a heat shock response in keratinocytes. In this study, an optical sensor cell line based on cultured human keratinocytes (HaCaT cells expressing green fluorescent protein (GFP under the control of the stress-inducible HSP70B’ promoter were constructed. Exposure of HaCaT sensor cells to 25 µM cadmium, a model substance for oxidative stress induction, provoked a 1.7-fold increase in total glutathione and a ~300-fold induction of transcript level of the gene coding for heat shock protein HSP70B’. An extract of Arnica montana flowers resulted in a strong induction of the HSP70B’ gene and a pronounced decrease of total glutathione in keratinocytes. The HSP70B’ promoter-based sensor cells conveniently detected cadmium-induced stress using GFP fluorescence as read-out with a limit of detection of 6 µM cadmium. In addition the sensor cells responded to exposure of cells to A. montana extract with induction of GFP fluorescence. Thus, the HaCaT sensor cells provide a means for the automated detection of the compromised redox status of keratinocytes as an early indicator of the development of human skin disorders and could be applied for the prediction of skin irritation in more complex in vitro 3D human skin models and in the development of micro-total analysis systems (µTAS that may be utilized in dermatology, toxicology, pharmacology and drug screenings.

  1. Two-dimensional calculus

    CERN Document Server

    Osserman, Robert

    2011-01-01

    The basic component of several-variable calculus, two-dimensional calculus is vital to mastery of the broader field. This extensive treatment of the subject offers the advantage of a thorough integration of linear algebra and materials, which aids readers in the development of geometric intuition. An introductory chapter presents background information on vectors in the plane, plane curves, and functions of two variables. Subsequent chapters address differentiation, transformations, and integration. Each chapter concludes with problem sets, and answers to selected exercises appear at the end o

  2. Two-dimensional models

    International Nuclear Information System (INIS)

    Schroer, Bert; Freie Universitaet, Berlin

    2005-02-01

    It is not possible to compactly review the overwhelming literature on two-dimensional models in a meaningful way without a specific viewpoint; I have therefore tacitly added to the above title the words 'as theoretical laboratories for general quantum field theory'. I dedicate this contribution to the memory of J. A. Swieca with whom I have shared the passion of exploring 2-dimensional models for almost one decade. A shortened version of this article is intended as a contribution to the project 'Encyclopedia of mathematical physics' and comments, suggestions and critical remarks are welcome. (author)

  3. Ultraviolet radiation induces changes in membrane metabolism of human keratinocytes in culture

    International Nuclear Information System (INIS)

    De Leo, V.A.; Horlick, H.; Hanson, D.; Eisinger, M.; Harber, L.C.

    1984-01-01

    Human keratinocytes in culture were prelabeled with [ 3 H]arachidonic acid (AA) and then exposed to ultraviolet B radiation. Irradiated cells released labeled AA metabolites into media in a dose-dependent manner when compared to sham-irradiated cells. The response began immediately and continued for 24 h. Extracts from media were examined by high-performance liquid chromatography for identification of specific AA metabolites. Irradiated cells were stimulated to produce prostaglandin-like material (PGE2 and PGF2 alpha). These findings support the concept that the cell membrane of keratinocytes participates directly or indirectly in initiating the sunburn response. It is also felt that the metabolites formed following injury to the membrane are an integral component in the mediation of that response

  4. Leptin regulates the pro-inflammatory response in human epidermal keratinocytes.

    Science.gov (United States)

    Lee, Moonyoung; Lee, Eunyoung; Jin, Sun Hee; Ahn, Sungjin; Kim, Sae On; Kim, Jungmin; Choi, Dalwoong; Lim, Kyung-Min; Lee, Seung-Taek; Noh, Minsoo

    2018-05-01

    The role of leptin in cutaneous wound healing process has been suggested in genetically obese mouse studies. However, the molecular and cellular effects of leptin on human epidermal keratinocytes are still unclear. In this study, the whole-genome-scale microarray analysis was performed to elucidate the effect of leptin on epidermal keratinocyte functions. In the leptin-treated normal human keratinocytes (NHKs), we identified the 151 upregulated and 53 downregulated differentially expressed genes (DEGs). The gene ontology (GO) enrichment analysis with the leptin-induced DEGs suggests that leptin regulates NHKs to promote pro-inflammatory responses, extracellular matrix organization, and angiogenesis. Among the DEGs, the protein expression of IL-8, MMP-1, fibronectin, and S100A7, which play roles in which is important in the regulation of cutaneous inflammation, was confirmed in the leptin-treated NHKs. The upregulation of the leptin-induced proteins is mainly regulated by the STAT3 signaling pathway in NHKs. Among the downregulated DEGs, the protein expression of nucleosome assembly-associated centromere protein A (CENPA) and CENPM was confirmed in the leptin-treated NHKs. However, the expression of CENPA and CENPM was not coupled with those of other chromosome passenger complex like Aurora A kinase, INCENP, and survivin. In cell growth kinetics analysis, leptin had no significant effect on the cell growth curves of NHKs in the normal growth factor-enriched condition. Therefore, leptin-dependent downregulation of CENPA and CENPM in NHKs may not be directly associated with mitotic regulation during inflammation.

  5. The Herbal Bitter Drug Gentiana lutea Modulates Lipid Synthesis in Human Keratinocytes In Vitro and In Vivo.

    Science.gov (United States)

    Wölfle, Ute; Haarhaus, Birgit; Seiwerth, Jasmin; Cawelius, Anja; Schwabe, Kay; Quirin, Karl-Werner; Schempp, Christoph M

    2017-08-22

    Gentiana lutea is a herbal bitter drug that is used to enhance gastrointestinal motility and secretion. Recently we have shown that amarogentin, a characteristic bitter compound of Gentiana lutea extract (GE), binds to the bitter taste receptors TAS2R1 and TAS2R38 in human keratinocytes, and stimulates the synthesis of epidermal barrier proteins. Here, we wondered if GE also modulates lipid synthesis in human keratinocytes. To address this issue, human primary keratinocytes were incubated for 6 days with GE. Nile Red labeling revealed that GE significantly increased lipid synthesis in keratinocytes. Similarly, gas chromatography with flame ionization detector indicated that GE increases the amount of triglycerides in keratinocytes. GE induced the expression of epidermal ceramide synthase 3, but not sphingomyelinase. Lipid synthesis, as well as ceramide synthase 3 expression, could be specifically blocked by inhibitors of the p38 MAPK and PPARγ signaling pathway. To assess if GE also modulates lipid synthesis in vivo, we performed a proof of concept half side comparison on the volar forearms of 33 volunteers. In comparison to placebo, GE significantly increased the lipid content of the treated skin areas, as measured with a sebumeter. Thus, GE enhances lipid synthesis in human keratinocytes that is essential for building an intact epidermal barrier. Therefore, GE might be used to improve skin disorders with an impaired epidermal barrier, e.g., very dry skin and atopic eczema.

  6. In vitro human keratinocyte migration rates are associated with SNPs in the KRT1 interval.

    Directory of Open Access Journals (Sweden)

    Heng Tao

    Full Text Available Efforts to develop effective therapeutic treatments for promoting fast wound healing after injury to the epidermis are hindered by a lack of understanding of the factors involved. Re-epithelialization is an essential step of wound healing involving the migration of epidermal keratinocytes over the wound site. Here, we examine genetic variants in the keratin-1 (KRT1 locus for association with migration rates of human epidermal keratinocytes (HEK isolated from different individuals. Although the role of intermediate filament genes, including KRT1, in wound activated keratinocytes is well established, this is the first study to examine if genetic variants in humans contribute to differences in the migration rates of these cells. Using an in vitro scratch wound assay we observe quantifiable variation in HEK migration rates in two independent sets of samples; 24 samples in the first set and 17 samples in the second set. We analyze genetic variants in the KRT1 interval and identify SNPs significantly associated with HEK migration rates in both samples sets. Additionally, we show in the first set of samples that the average migration rate of HEK cells homozygous for one common haplotype pattern in the KRT1 interval is significantly faster than that of HEK cells homozygous for a second common haplotype pattern. Our study demonstrates that genetic variants in the KRT1 interval contribute to quantifiable differences in the migration rates of keratinocytes isolated from different individuals. Furthermore we show that in vitro cell assays can successfully be used to deconstruct complex traits into simple biological model systems for genetic association studies.

  7. SORBS2 and TLR3 induce premature senescence in primary human fibroblasts and keratinocytes

    International Nuclear Information System (INIS)

    Liesenfeld, Melanie; Mosig, Sandy; Funke, Harald; Jansen, Lars; Runnebaum, Ingo B; Dürst, Matthias; Backsch, Claudia

    2013-01-01

    Genetic aberrations are required for the progression of HPV-induced cervical precancers. A prerequisite for clonal expansion of cancer cells is unlimited proliferative capacity. In a cell culture model for cervical carcinogenesis loss of genes located on chromosome 4q35→qter and chromosome 10p14-p15 were found to be associated with escape from senescence. Moreover, by LOH and I-FISH analyses a higher frequency of allele loss of these regions was also observed in cervical carcinomas as compared to CIN3. The aim of this study was to identify candidate senescence-related genes located on chromosome 4q35→qter and chromosome 10p14-p15 which may contribute to clonal expansion at the transition of CIN3 to cancer. Microarray expression analyses were used to identify candidate genes down-regulated in cervical carcinomas as compared to CIN3. In order to relate these genes with the process of senescence their respective cDNAs were overexpressed in HPV16-immortalized keratinocytes as well as in primary human fibroblasts and keratinocytes using lentivirus mediated gene transduction. Overall fifteen genes located on chromosome 4q35→qter and chromosome 10p14-p15 were identified. Ten of these genes could be validated in biopsies by RT-PCR. Of interest is the novel finding that SORBS2 and TLR3 can induce senescence in primary human fibroblasts and keratinocytes but not in HPV-immortalized cell lines. Intriguingly, the endogenous expression of both genes increases during finite passaging of primary keratinocytes in vitro. The relevance of the genes SORBS2 and TLR3 in the process of cellular senescence warrants further investigation. In ongoing experiments we are investigating whether this increase in gene expression is also characteristic of replicative senescence

  8. Two-dimensional ferroelectrics

    Energy Technology Data Exchange (ETDEWEB)

    Blinov, L M; Fridkin, Vladimir M; Palto, Sergei P [A.V. Shubnikov Institute of Crystallography, Russian Academy of Sciences, Moscow, Russian Federaion (Russian Federation); Bune, A V; Dowben, P A; Ducharme, Stephen [Department of Physics and Astronomy, Behlen Laboratory of Physics, Center for Materials Research and Analysis, University of Nebraska-Linkoln, Linkoln, NE (United States)

    2000-03-31

    The investigation of the finite-size effect in ferroelectric crystals and films has been limited by the experimental conditions. The smallest demonstrated ferroelectric crystals had a diameter of {approx}200 A and the thinnest ferroelectric films were {approx}200 A thick, macroscopic sizes on an atomic scale. Langmuir-Blodgett deposition of films one monolayer at a time has produced high quality ferroelectric films as thin as 10 A, made from polyvinylidene fluoride and its copolymers. These ultrathin films permitted the ultimate investigation of finite-size effects on the atomic thickness scale. Langmuir-Blodgett films also revealed the fundamental two-dimensional character of ferroelectricity in these materials by demonstrating that there is no so-called critical thickness; films as thin as two monolayers (1 nm) are ferroelectric, with a transition temperature near that of the bulk material. The films exhibit all the main properties of ferroelectricity with a first-order ferroelectric-paraelectric phase transition: polarization hysteresis (switching); the jump in spontaneous polarization at the phase transition temperature; thermal hysteresis in the polarization; the increase in the transition temperature with applied field; double hysteresis above the phase transition temperature; and the existence of the ferroelectric critical point. The films also exhibit a new phase transition associated with the two-dimensional layers. (reviews of topical problems)

  9. PCB153 reduces telomerase activity and telomere length in immortalized human skin keratinocytes (HaCaT) but not in human foreskin keratinocytes (NFK)

    International Nuclear Information System (INIS)

    Senthilkumar, P.K.; Robertson, L.W.; Ludewig, G.

    2012-01-01

    Polychlorinated biphenyls (PCBs), ubiquitous environmental pollutants, are characterized by long term-persistence in the environment, bioaccumulation, and biomagnification in the food chain. Exposure to PCBs may cause various diseases, affecting many cellular processes. Deregulation of the telomerase and the telomere complex leads to several biological disorders. We investigated the hypothesis that PCB153 modulates telomerase activity, telomeres and reactive oxygen species resulting in the deregulation of cell growth. Exponentially growing immortal human skin keratinocytes (HaCaT) and normal human foreskin keratinocytes (NFK) were incubated with PCB153 for 48 and 24 days, respectively, and telomerase activity, telomere length, superoxide level, cell growth, and cell cycle distribution were determined. In HaCaT cells exposure to PCB153 significantly reduced telomerase activity, telomere length, cell growth and increased intracellular superoxide levels from day 6 to day 48, suggesting that superoxide may be one of the factors regulating telomerase activity, telomere length and cell growth compared to untreated control cells. Results with NFK cells showed no shortening of telomere length but reduced cell growth and increased superoxide levels in PCB153-treated cells compared to untreated controls. As expected, basal levels of telomerase activity were almost undetectable, which made a quantitative comparison of treated and control groups impossible. The significant down regulation of telomerase activity and reduction of telomere length by PCB153 in HaCaT cells suggest that any cell type with significant telomerase activity, like stem cells, may be at risk of premature telomere shortening with potential adverse health effects for the affected organism. -- Highlights: ► Human immortal (HaCaT) and primary (NFK) keratinocytes were exposed to PCB153. ► PCB153 significantly reduced telomerase activity and telomere length in HaCaT. ► No effect on telomere length and

  10. Effects of 25-hydroxyvitamin D3 on cathelicidin production and antibacterial function of human oral keratinocytes.

    Science.gov (United States)

    Wang, Qi; Zhang, Wu; Li, Hao; Aprecio, Raydolf; Wu, Wan; Lin, Yiqiao; Li, Yiming

    2013-01-01

    Vitamin D and its metabolites have been recognized as key determinants in innate immune modulation. In this study, we investigated the regulation of antibacterial functions of oral keratinocyte cells by 25-hydroxyvitamin D3 (25VD3). OKF6/TERT2 cells, an immortalized human oral keratinocyte cell line, were transfected with or without 24-hydroxylase small interfering RNA (siRNA) and incubated with different amounts of 25VD3. These epithelial cells expressed high levels of inactivating 24-hydroxylase (CYP24A1) and relatively low levels of activating 1α-hydroxylase (CYP27B1) in the presence of 25VD3. 25VD3 influenced the expression of vitamin D-driven genes and cathelicidin in a dose-related manner. SiRNA specific to 24-hydroxylase augmented the cathelicidin production and subseqently influenced the antibacterial activity on multispecies of oral pathogens. These observations suggest that 25VD3 is capable of stimulating cathelicidin production and modulating antibacterial function upon CYP24A1 knochdown in oral epithelial cells, and indicate novel mechanisms that 25VD3 may enhance antibacterial ability in oral keratinocytes. Copyright © 2013 Elsevier Inc. All rights reserved.

  11. Two-dimensional gel human protein databases offer a systematic approach to the study of cell proliferation and differentiation

    DEFF Research Database (Denmark)

    Celis, julio E.; Gesser, Borbala; Dejgaard, Kurt

    1989-01-01

    Human cellular protein databases have been established using computer-analyzed 2D gel electrophoresis. These databases, which include information on various properties of proteins, offer a global approach to the study of regulation of cell proliferation and differentiation. Furthermore, thanks...

  12. Two dimensional gel human protein databases offer a systematic approach to the study of cell proliferation and differentiation

    DEFF Research Database (Denmark)

    Celis, J E; Gesser, B; Dejgaard, K

    1989-01-01

    Human cellular protein databases have been established using computer-analyzed 2D gel electrophoresis. These databases, which include information on various properties of proteins, offer a global approach to the study of regulation of cell proliferation and differentiation. Furthermore, thanks to...

  13. Pseudomonas-derived ceramidase induces production of inflammatory mediators from human keratinocytes via sphingosine-1-phosphate.

    Directory of Open Access Journals (Sweden)

    Ami Oizumi

    Full Text Available Ceramide is important for water retention and permeability barrier functions in the stratum corneum, and plays a key role in the pathogenesis of atopic dermatitis (AD. A Pseudomonas aeruginosa-derived neutral ceramidase (PaCDase isolated from a patient with AD was shown to effectively degrade ceramide in the presence of Staphylococcus aureus-derived lipids or neutral detergents. However, the effect of ceramide metabolites on the functions of differentiating keratinocytes is poorly understood. We found that the ceramide metabolite sphingosine-1-phosphate (S1P stimulated the production of inflammatory mediators such as TNF-α and IL-8 from three-dimensionally cultured human primary keratinocytes (termed "3D keratinocytes", which form a stratum corneum. PaCDase alone did not affect TNF-α gene expression in 3D keratinocytes. In the presence of the detergent Triton X-100, which damages stratum corneum structure, PaCDase, but not heat-inactivated PaCDase or PaCDase-inactive mutant, induced the production of TNF-α, endothelin-1, and IL-8, indicating that this production was dependent on ceramidase activity. Among various ceramide metabolites, sphingosine and S1P enhanced the gene expression of TNF-α, endothelin-1, and IL-8. The PaCDase-enhanced expression of these genes was inhibited by a sphingosine kinase inhibitor and by an S1P receptor antagonist VPC 23019. The TNF-α-binding antibody infliximab suppressed the PaCDase-induced upregulation of IL-8, but not TNF-α, mRNA. PaCDase induced NF-κB p65 phosphorylation. The NF-κB inhibitor curcumin significantly inhibited PaCDase-induced expression of IL-8 and endothelin-1. VPC 23019 and infliximab inhibited PaCDase-induced NF-κB p65 phosphorylation and reduction in the protein level of the NF-κB inhibitor IκBα. Collectively, these findings suggest that (i 3D keratinocytes produce S1P from sphingosine, which is produced through the hydrolysis of ceramide by PaCDase, (ii S1P induces the production

  14. Rat embryonic fibroblasts improve reprogramming of human keratinocytes into induced pluripotent stem cells.

    Science.gov (United States)

    Linta, Leonhard; Stockmann, Marianne; Kleinhans, Karin N; Böckers, Anja; Storch, Alexander; Zaehres, Holm; Lin, Qiong; Barbi, Gotthold; Böckers, Tobias M; Kleger, Alexander; Liebau, Stefan

    2012-04-10

    Patient-specific human induced pluripotent stem (hiPS) cells not only provide a promising tool for cellular disease models in general, but also open up the opportunity to establish cell-type-specific systems for personalized medicine. One of the crucial prerequisites for these strategies, however, is a fast and efficient reprogramming strategy from easy accessible somatic cell populations. Keratinocytes from plucked human hair had been introduced as a superior cell source for reprogramming purposes compared with the widely used skin fibroblasts. The starting cell population is, however, limited and thereby further optimization in terms of time, efficiency, and quality is inevitable. Here we show that rat embryonic fibroblasts (REFs) should replace mouse embryonic fibroblasts as feeder cells in the reprogramming process. REFs enable a significantly more efficient reprogramming procedure as shown by colony number and total amount of SSEA4-positive cells. We successfully produced keratinocyte-derived hiPS (k-hiPS) cells from various donors. The arising k-hiPS cells display the hallmarks of pluripotency such as expression of stem cell markers and differentiation into all 3 germ layers. The increased reprogramming efficiency using REFs as a feeder layer occurred independent of the proliferation rate in the parental keratinocytes and acts, at least in part, in a non-cell autonomous way by secreting factors known to facilitate pluripotency such as Tgfb1, Inhba and Grem1. Hence, we provide an easy to use and highly efficient reprogramming system that could be very useful for a broad application to generate human iPS cells. © Mary Ann Liebert, Inc.

  15. UVA and UVB irradiation differentially regulate microRNA expression in human primary keratinocytes.

    Directory of Open Access Journals (Sweden)

    Anne Kraemer

    Full Text Available MicroRNA (miRNA-mediated regulation of the cellular transcriptome is an important epigenetic mechanism for fine-tuning regulatory pathways. These include processes related to skin cancer development, progression and metastasis. However, little is known about the role of microRNA as an intermediary in the carcinogenic processes following exposure to UV-radiation. We now show that UV irradiation of human primary keratinocytes modulates the expression of several cellular miRNAs. A common set of miRNAs was influenced by exposure to both UVA and UVB. However, each wavelength band also activated a distinct subset of miRNAs. Common sets of UVA- and UVB-regulated miRNAs harbor the regulatory elements GLYCA-nTRE, GATA-1-undefined-site-13 or Hox-2.3-undefined-site-2 in their promoters. In silico analysis indicates that the differentially expressed miRNAs responding to UV have potential functions in the cellular pathways of cell growth and proliferation. Interestingly, the expression of miR-23b, which is a differentiation marker of human keratinocytes, is remarkably up-regulated after UVA irradiation. Studying the interaction between miR-23b and its putative skin-relevant targets using a Luciferase reporter assay revealed that RRAS2 (related RAS viral oncogene homolog 2, which is strongly expressed in highly aggressive malignant skin cancer, to be a direct target of miR-23b. This study demonstrates for the first time a differential miRNA response to UVA and UVB in human primary keratinocytes. This suggests that selective regulation of signaling pathways occurs in response to different UV energies. This may shed new light on miRNA-regulated carcinogenic processes involved in UV-induced skin carcinogenesis.

  16. UVA and UVB Irradiation Differentially Regulate microRNA Expression in Human Primary Keratinocytes

    Science.gov (United States)

    Kraemer, Anne; Chen, I-Peng; Henning, Stefan; Faust, Alexandra; Volkmer, Beate; Atkinson, Michael J.; Moertl, Simone; Greinert, Ruediger

    2013-01-01

    MicroRNA (miRNA)-mediated regulation of the cellular transcriptome is an important epigenetic mechanism for fine-tuning regulatory pathways. These include processes related to skin cancer development, progression and metastasis. However, little is known about the role of microRNA as an intermediary in the carcinogenic processes following exposure to UV-radiation. We now show that UV irradiation of human primary keratinocytes modulates the expression of several cellular miRNAs. A common set of miRNAs was influenced by exposure to both UVA and UVB. However, each wavelength band also activated a distinct subset of miRNAs. Common sets of UVA- and UVB-regulated miRNAs harbor the regulatory elements GLYCA-nTRE, GATA-1-undefined-site-13 or Hox-2.3-undefined-site-2 in their promoters. In silico analysis indicates that the differentially expressed miRNAs responding to UV have potential functions in the cellular pathways of cell growth and proliferation. Interestingly, the expression of miR-23b, which is a differentiation marker of human keratinocytes, is remarkably up-regulated after UVA irradiation. Studying the interaction between miR-23b and its putative skin-relevant targets using a Luciferase reporter assay revealed that RRAS2 (related RAS viral oncogene homolog 2), which is strongly expressed in highly aggressive malignant skin cancer, to be a direct target of miR-23b. This study demonstrates for the first time a differential miRNA response to UVA and UVB in human primary keratinocytes. This suggests that selective regulation of signaling pathways occurs in response to different UV energies. This may shed new light on miRNA-regulated carcinogenic processes involved in UV-induced skin carcinogenesis. PMID:24391759

  17. Efficient generation of integration-free human induced pluripotent stem cells from keratinocytes by simple transfection of episomal vectors.

    Science.gov (United States)

    Piao, Yulan; Hung, Sandy Shen-Chi; Lim, Shiang Y; Wong, Raymond Ching-Bong; Ko, Minoru S H

    2014-07-01

    Keratinocytes represent an easily accessible cell source for derivation of human induced pluripotent stem (hiPS) cells, reportedly achieving higher reprogramming efficiency than fibroblasts. However, most studies utilized a retroviral or lentiviral method for reprogramming of keratinocytes, which introduces undesirable transgene integrations into the host genome. Moreover, current protocols of generating integration-free hiPS cells from keratinocytes are mostly inefficient. In this paper, we describe a more efficient, simple-to-use, and cost-effective method for generating integration-free hiPS cells from keratinocytes. Our improved method using lipid-mediated transfection achieved a reprogramming efficiency of ∼0.14% on average. Keratinocyte-derived hiPS cells showed no integration of episomal vectors, expressed stem cell-specific markers and possessed potentials to differentiate into all three germ layers by in vitro embryoid body formation as well as in vivo teratoma formation. To our knowledge, this represents the most efficient method to generate integration-free hiPS cells from keratinocytes. ©AlphaMed Press.

  18. Ultraviolet Radiation Increases the Toxicity of Pyrene, 1-Aminopyrene and 1-Hydroxypyrene to Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Huey-Min Hwang

    2005-04-01

    Full Text Available Over the past several years, a great deal of interest has been focused on the harmful effects of ultraviolet (UV radiation to human skin. UV light has been implicated in aging, sunburn and skin cancer. Few studies, however, have been done to determine the effects that UV light, in conjunction with other environmental contaminants, may have on human skin. Polycyclic Aromatic Hydrocarbons (PAHs are a class of compounds that have been reported to be toxic, mutagenic and carcinogenic to many eukaryotic organisms. UV light is also known to increase the toxicity of PAHs through photo-activation and photo-modification. The purpose of this study was to assess the effects of UV-A irradiated pyrene (Pyr, 1-aminopyrene (1-AP and 1-hydroxypyrene (1-HP on human keratinocytes, the skin primary site of UV irradiated PAH exposure. Our findings indicate that simultaneous treatment of human keratinocyte cell line, HaCaT, with 1.0μg/ml pyrene, 1-AP or 1-HP and 3.9 J/cm2/min UV-A light resulted in significant inhibition of cell proliferation. Approximately 100% of the cells died in the case of UV-A irradiated 1-AP and 1-HP. In the case of UV-A irradiated pyrene, more than 70% of the cells died, indicating that UV-A is able to transform these PAHs into more harmful intermediates.

  19. Portulaca oleracea extracts protect human keratinocytes and fibroblasts from UV-induced apoptosis.

    Science.gov (United States)

    Lee, Suyeon; Kim, Ki Ho; Park, Changhoon; Lee, Jong-Suk; Kim, Young Heui

    2014-10-01

    Portulaca oleracea extracts, known as Ma Chi Hyun in the traditional Korean medicine, show a variety of biomedical efficacies including those in anti-inflammation and anti-allergy. In this study, we investigate the protective activity of the P. oleracea extracts against UVB-induced damage in human epithelial keratinocytes and fibroblasts by several apoptosis-related tests. The results suggest that P. oleracea extracts have protective effects from UVB-induced apoptosis. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  20. Immortalization of human foreskin keratinocytes by various human papillomavirus DNAs corresponds to their association with cervical carcinoma

    Energy Technology Data Exchange (ETDEWEB)

    Woodworth, C.D.; Doniger, J.; DiPaolo, J.A.

    1989-01-01

    Normal human foreskin keratinocytes cotransfected with the neomycin resistance gene and recombinant human papillomavirus (HPV) DNAs (types 16, 18, 31, and 33) that have a high or moderate association with cervical malignancy acquired immortality and contained integrated and transcriptionally active viral genomes. Only transcripts from the intact E6 and E7 genes were detected in at least one cell line, suggesting that one or both of these genes are responsible for immortalization. Recombinant HPV DNAs with low or no oncogenic potential for cervical cancer (HPV1a, -5, -6b, and -11) induced small G418-resistant colonies that senesced as did the nontransfected cells. These colonies contained only episomal virus DNA; therefore, integration of HPV sequences is important for immortalization of keratinocytes. This study suggests that the virus-encoded immortalization function contributes to the pathogenesis of cervical carcinoma.

  1. Are there intracellular Ca2+ oscillations correlated with flagellar beating in human sperm? A three vs. two-dimensional analysis.

    Science.gov (United States)

    Corkidi, G; Montoya, F; Hernández-Herrera, P; Ríos-Herrera, W A; Müller, M F; Treviño, C L; Darszon, A

    2017-09-01

    Are there intracellular Ca2+ ([Ca2+]i) oscillations correlated with flagellar beating in human sperm? The results reveal statistically significant [Ca2+]i oscillations that are correlated with the human sperm flagellar beating frequency, when measured in three-dimensions (3D). Fast [Ca2+]i oscillations that are correlated to the beating flagellar frequency of cells swimming in a restricted volume have been detected in hamster sperm. To date, such findings have not been confirmed in any other mammalian sperm species. An important question that has remained regarding these observations is whether the fast [Ca2+]i oscillations are real or might they be due to remaining defocusing effects of the Z component arising from the 3D beating of the flagella. Healthy donors whose semen samples fulfill the WHO criteria between the age of 18-28 were selected. Cells from at least six different donors were utilized for analysis. Approximately the same number of experimental and control cells were analyzed. Motile cells were obtained by the swim-up technique and were loaded with Fluo-4 (Ca2+ sensitive dye) or with Calcein (Ca2+ insensitive dye). Ni2+ was used as a non-specific plasma membrane Ca2+ channel blocker. Fluorescence data and flagella position were acquired in 3D. Each cell was recorded for up to 5.6 s within a depth of 16 microns with a high speed camera (coupled to an image intensifier) acquiring at a rate of 3000 frames per second, while an oscillating objective vibrated at 90 Hz via a piezoelectric device. From these samples, eight experimental and nine control sperm cells were analyzed in both 2D and 3D. We have implemented a new system that allows [Ca2+]i measurements of the human sperm flagellum beating in 3D. These measurements reveal statistically significant [Ca2+]i oscillations that correlate with the flagellar beating frequency. These oscillations may arise from intracellular sources and/or Ca2+ transporters, as they were insensitive to external Ni2+, a non

  2. Hyperthermia-induced micronucleus formation in a human keratinocyte cell line

    International Nuclear Information System (INIS)

    Hintzsche, Henning; Riese, Thorsten; Stopper, Helga

    2012-01-01

    Elevated temperature can cause biological effects in vitro and in vivo. Many studies on effects of hypo- and hyperthermia have been conducted, but only few studies systematically investigated the formation of genomic damage in the micronucleus test in human cells in vitro as a consequence of different temperatures. In the present study, HaCaT human keratinocytes were exposed to different temperatures from 37 °C to 42 °C for 24 h in a regular cell culture incubator. Micronucleus frequency as a marker of genomic damage was elevated in a temperature-dependent and statistically significant manner. Apoptosis occurred at temperatures of 39 °C or higher. Cell proliferation was unaffected up to 40 °C and decreased at 41 °C and 42 °C. Expression of the heat shock protein Hsp70 was elevated, particularly at temperatures of 40 °C and higher. These findings are in agreement with several in vivo studies and some in vitro studies looking at single, specific temperatures, but a systematically investigated temperature-dependent increase of genomic damage in human keratinocytes in vitro is demonstrated for the first time here.

  3. Combinatorial modification of human histone H4 quantitated by two-dimensional liquid chromatography coupled with top down mass spectrometry.

    Science.gov (United States)

    Pesavento, James J; Bullock, Courtney R; LeDuc, Richard D; Mizzen, Craig A; Kelleher, Neil L

    2008-05-30

    Quantitative proteomics has focused heavily on correlating protein abundances, ratios, and dynamics by developing methods that are protein expression-centric (e.g. isotope coded affinity tag, isobaric tag for relative and absolute quantification, etc.). These methods effectively detect changes in protein abundance but fail to provide a comprehensive perspective of the diversity of proteins such as histones, which are regulated by post-translational modifications. Here, we report the characterization of modified forms of HeLa cell histone H4 with a dynamic range >10(4) using a strictly Top Down mass spectrometric approach coupled with two dimensions of liquid chromatography. This enhanced dynamic range enabled the precise characterization and quantitation of 42 forms uniquely modified by combinations of methylation and acetylation, including those with trimethylated Lys-20, monomethylated Arg-3, and the novel dimethylated Arg-3 (each <1% of all H4 forms). Quantitative analyses revealed distinct trends in acetylation site occupancy depending on Lys-20 methylation state. Because both modifications are dynamically regulated through the cell cycle, we simultaneously investigated acetylation and methylation kinetics through three cell cycle phases and used these data to statistically assess the robustness of our quantitative analysis. This work represents the most comprehensive analysis of histone H4 forms present in human cells reported to date.

  4. Interaction of urokinase A chain with the receptor of human keratinocytes stimulates release of urokinase-like plasminogen activator

    Energy Technology Data Exchange (ETDEWEB)

    Fibbi, G.; Magnelli, L.; Pucci, M.; Del Rosso, M. (Florence Univ. (Italy))

    1990-03-01

    On the basis of a fibrinolytic assay with {sup 125}I-fibrin, zymography, and immunoprobing with anti-human urokinase antibody, the authors have observed that the in vitro established NCTC human keratinocyte cell line releases into the culture medium a 54,000-Da plasminogen activator which is indistinguishable from human urokinase. Only the early release following the washing of keratinocyte monolayers is accounted for by secretion of preformed enzyme, while late secretory events require the de novo synthesis of urokinase. The released enzyme can interact by autocriny with its own receptor present on keratinocytes. The addition to the keratinocyte culture medium of the urokinase A chain can stimulate a concentration-dependent urokinase oversecretion, which is not paralleled by oversecretion of plasminogen activator inhibitor-1. Since stimulation of urokinase production can be obtained by an A chain concentration which was previously shown to be efficient in inducing keratinocyte mobilization in an in vitro migration model system, they hypothesize that this mechanism may be important in vivo during the process of wound repair.

  5. Additive Effects of Millimeter Waves and 2-Deoxyglucose Co-Exposure on the Human Keratinocyte Transcriptome.

    Science.gov (United States)

    Soubere Mahamoud, Yonis; Aite, Meziane; Martin, Catherine; Zhadobov, Maxim; Sauleau, Ronan; Le Dréan, Yves; Habauzit, Denis

    2016-01-01

    Millimeter Waves (MMW) will be used in the next-generation of high-speed wireless technologies, especially in future Ultra-Broadband small cells in 5G cellular networks. Therefore, their biocompatibilities must be evaluated prior to their massive deployment. Using a microarray-based approach, we analyzed modifications to the whole genome of a human keratinocyte model that was exposed at 60.4 GHz-MMW at an incident power density (IPD) of 20 mW/cm2 for 3 hours in athermic conditions. No keratinocyte transcriptome modifications were observed. We tested the effects of MMWs on cell metabolism by co-treating MMW-exposed cells with a glycolysis inhibitor, 2-deoxyglucose (2dG, 20 mM for 3 hours), and whole genome expression was evaluated along with the ATP content. We found that the 2dG treatment decreased the cellular ATP content and induced a high modification in the transcriptome (632 coding genes). The affected genes were associated with transcriptional repression, cellular communication and endoplasmic reticulum homeostasis. The MMW/2dG co-treatment did not alter the keratinocyte ATP content, but it did slightly alter the transcriptome, which reflected the capacity of MMW to interfere with the bioenergetic stress response. The RT-PCR-based validation confirmed 6 MMW-sensitive genes (SOCS3, SPRY2, TRIB1, FAM46A, CSRNP1 and PPP1R15A) during the 2dG treatment. These 6 genes encoded transcription factors or inhibitors of cytokine pathways, which raised questions regarding the potential impact of long-term or chronic MMW exposure on metabolically stressed cells.

  6. Additive Effects of Millimeter Waves and 2-Deoxyglucose Co-Exposure on the Human Keratinocyte Transcriptome.

    Directory of Open Access Journals (Sweden)

    Yonis Soubere Mahamoud

    Full Text Available Millimeter Waves (MMW will be used in the next-generation of high-speed wireless technologies, especially in future Ultra-Broadband small cells in 5G cellular networks. Therefore, their biocompatibilities must be evaluated prior to their massive deployment. Using a microarray-based approach, we analyzed modifications to the whole genome of a human keratinocyte model that was exposed at 60.4 GHz-MMW at an incident power density (IPD of 20 mW/cm2 for 3 hours in athermic conditions. No keratinocyte transcriptome modifications were observed. We tested the effects of MMWs on cell metabolism by co-treating MMW-exposed cells with a glycolysis inhibitor, 2-deoxyglucose (2dG, 20 mM for 3 hours, and whole genome expression was evaluated along with the ATP content. We found that the 2dG treatment decreased the cellular ATP content and induced a high modification in the transcriptome (632 coding genes. The affected genes were associated with transcriptional repression, cellular communication and endoplasmic reticulum homeostasis. The MMW/2dG co-treatment did not alter the keratinocyte ATP content, but it did slightly alter the transcriptome, which reflected the capacity of MMW to interfere with the bioenergetic stress response. The RT-PCR-based validation confirmed 6 MMW-sensitive genes (SOCS3, SPRY2, TRIB1, FAM46A, CSRNP1 and PPP1R15A during the 2dG treatment. These 6 genes encoded transcription factors or inhibitors of cytokine pathways, which raised questions regarding the potential impact of long-term or chronic MMW exposure on metabolically stressed cells.

  7. Human lactoferrin stimulates skin keratinocyte function and wound re-epithelialization.

    Science.gov (United States)

    Tang, L; Wu, J J; Ma, Q; Cui, T; Andreopoulos, F M; Gil, J; Valdes, J; Davis, S C; Li, J

    2010-07-01

    Human lactoferrin (hLF), a member of the transferrin family, is known for its antimicrobial and anti-inflammatory effects. Recent studies on various nonskin cell lines indicate that hLF may have a stimulatory effect on cell proliferation. To study the potential role of hLF in wound re-epithelialization. The effects of hLF on cell growth, migration, attachment and survival were assessed, with a rice-derived recombinant hLF (holo-rhLF), using proliferation analysis, scratch migration assay, calcein-AM/propidium iodide staining and terminal deoxynucleotidyl transferase-mediated dUTP nick-end labelling (TUNEL) method, respectively. The mechanisms of hLF on cell proliferation and migration were explored using specific pathway inhibitors. The involvement of lactoferrin receptor low-density lipoprotein receptor-related protein 1 (LRP1) was examined with RNA interference technique. An in vivo swine second-degree burn wound model was also used to assess wound re-epithelialization. Studies revealed that holo-rhLF significantly stimulated keratinocyte proliferation which could be blocked by mitogen-activated protein kinase (MAPK) kinase 1 inhibitor. Holo-rhLF also showed strong promoting effects on keratinocyte migration, which could be blocked by either inhibition of the MAPK, Src and Rho/ROCK pathways, or downregulation of the LRP1 receptor. With cells under starving or 12-O-tetradecanoylphorbol-13-acetate exposure, the addition of holo-rhLF was found greatly to increase cell viability and inhibit cell apoptosis. Additionally, holo-rhLF significantly increased the rate of wound re-epithelialization in swine second-degree burn wounds. Our studies demonstrate the direct effects of holo-rhLF on wound re-epithelialization including the enhancement of keratinocyte proliferation and migration as well as the protection of cells from apoptosis. The data strongly indicate its potential therapeutic applications in wound healing.

  8. Long-wave ultraviolet light induces phospholipase activation in cultured human epidermal keratinocytes

    International Nuclear Information System (INIS)

    Hanson, D.; DeLeo, V.

    1990-01-01

    Long wave ultraviolet radiation (UVA) has been shown to play an important role in the overall response of skin to solar radiation, including sunburn, tanning, premature aging, and non-melanoma skin cancer. UVA induction of inflammation in human skin is thought to be mediated by membrane lipid derived products. In order to investigate the mechanism of this response we examined the effect of UVA on phospholipid metabolism of human epidermal keratinocytes in culture. Keratinocytes were grown in serum free low calcium medium. The cells were prelabeled with [3H] arachidonic acid or [3H] choline and irradiated with UVA (Honle 2002-Hg vapor lamp). Identification and quantitation of specific membrane phospholipid-derived components was achieved using high-performance liquid chromatography, paper chromatography, and radioimmunoassay. UVA resulted in a linear dose dependent release of [3H] arachidonic acid into medium between 1 and 20 joule/cm2. This response was inhibited in an oxygen-reduced environment. The radiolabel released was predominantly free arachidonate and cyclooxygenase metabolites. Cyclooxygenase metabolites prostaglandin E2 and prostacyclin derivative, 6-keto-prostaglandin F1a, were stimulated following UVA irradiation, but the lipoxygenase metabolite, leukotriene B was not detected. Maximal release was measured immediately after irradiation and changed little over 24 h post-irradiation. UVA stimulated an increase of [3H] choline metabolites glycerophosphorylcholine and phosphorylcholine in media extracts suggesting UVA activation of phospholipase C and phospholipase A2 or diacylglyceride lipase

  9. Transcription factors and stress response gene alterations in human keratinocytes following Solar Simulated Ultra Violet Radiation.

    Science.gov (United States)

    Marais, Thomas L Des; Kluz, Thomas; Xu, Dazhong; Zhang, Xiaoru; Gesumaria, Lisa; Matsui, Mary S; Costa, Max; Sun, Hong

    2017-10-19

    Ultraviolet radiation (UVR) from sunlight is the major effector for skin aging and carcinogenesis. However, genes and pathways altered by solar-simulated UVR (ssUVR), a mixture of UVA and UVB, are not well characterized. Here we report global changes in gene expression as well as associated pathways and upstream transcription factors in human keratinocytes exposed to ssUVR. Human HaCaT keratinocytes were exposed to either a single dose or 5 repetitive doses of ssUVR. Comprehensive analyses of gene expression profiles as well as functional annotation were performed at 24 hours post irradiation. Our results revealed that ssUVR modulated genes with diverse cellular functions changed in a dose-dependent manner. Gene expression in cells exposed to a single dose of ssUVR differed significantly from those that underwent repetitive exposures. While single ssUVR caused a significant inhibition in genes involved in cell cycle progression, especially G2/M checkpoint and mitotic regulation, repetitive ssUVR led to extensive changes in genes related to cell signaling and metabolism. We have also identified a panel of ssUVR target genes that exhibited persistent changes in gene expression even at 1 week after irradiation. These results revealed a complex network of transcriptional regulators and pathways that orchestrate the cellular response to ssUVR.

  10. Upregulation of FOXM1 induces genomic instability in human epidermal keratinocytes

    Directory of Open Access Journals (Sweden)

    Philpott Michael P

    2010-02-01

    Full Text Available Abstract Background The human cell cycle transcription factor FOXM1 is known to play a key role in regulating timely mitotic progression and accurate chromosomal segregation during cell division. Deregulation of FOXM1 has been linked to a majority of human cancers. We previously showed that FOXM1 was upregulated in basal cell carcinoma and recently reported that upregulation of FOXM1 precedes malignancy in a number of solid human cancer types including oral, oesophagus, lung, breast, kidney, bladder and uterus. This indicates that upregulation of FOXM1 may be an early molecular signal required for aberrant cell cycle and cancer initiation. Results The present study investigated the putative early mechanism of UVB and FOXM1 in skin cancer initiation. We have demonstrated that UVB dose-dependently increased FOXM1 protein levels through protein stabilisation and accumulation rather than de novo mRNA expression in human epidermal keratinocytes. FOXM1 upregulation in primary human keratinocytes triggered pro-apoptotic/DNA-damage checkpoint response genes such as p21, p38 MAPK, p53 and PARP, however, without causing significant cell cycle arrest or cell death. Using a high-resolution Affymetrix genome-wide single nucleotide polymorphism (SNP mapping technique, we provided the evidence that FOXM1 upregulation in epidermal keratinocytes is sufficient to induce genomic instability, in the form of loss of heterozygosity (LOH and copy number variations (CNV. FOXM1-induced genomic instability was significantly enhanced and accumulated with increasing cell passage and this instability was increased even further upon exposure to UVB resulting in whole chromosomal gain (7p21.3-7q36.3 and segmental LOH (6q25.1-6q25.3. Conclusion We hypothesise that prolonged and repeated UVB exposure selects for skin cells bearing stable FOXM1 protein causes aberrant cell cycle checkpoint thereby allowing ectopic cell cycle entry and subsequent genomic instability. The aberrant

  11. High Levels of Chemokine C-C Motif Ligand 20 in Human Milk and Its Production by Oral Keratinocytes.

    Science.gov (United States)

    Lourenço, Alan G; Komesu, Marilena C; Duarte, Geraldo; Del Ciampo, Luiz A; Mussi-Pinhata, Marisa M; Yamamoto, Aparecida Y

    2017-03-01

    Chemokine C-C motif ligand 20 (CCL20) is implicated in the formation and function of mucosal lymphoid tissues. Although CCL20 is secreted by many normal human tissues, no studies have evaluated the presence of CCL20 in human milk or its production by oral keratinocytes stimulated by human milk. To evaluate the presence of CCL20 in breast milk and verify CCL20 secretion in vitro by oral keratinocytes stimulated with human and bovine milk, as well as its possible association with breast milk lactoferrin levels. The levels of CCL20 and lactoferrin were measured by enzyme-linked immunosorbent assay in human milk at three different stages of maturation from 74 healthy breastfeeding mothers. In vitro, oral keratinocytes were stimulated with human and bovine milk, and CCL20 was measured in their supernatant. High concentrations of CCL20 were detected in the human breast milk samples obtained during the first week (1,777.07 pg/mL) and second week postpartum (1,523.44 pg/mL), with a significantly low concentration in samples at 3-6 weeks postpartum (238.42 pg/mL; p stimulated higher CCL20 secretion by oral keratinocytes compared with bovine milk (p stimulation had no association with breast milk lactoferrin concentration. CCl20 is present at high levels in human milk, predominantly in the first and second week postpartum, but at significantly lower levels at 3-6 weeks postpartum. Human milk is capable of stimulating CCL20 secretion by oral keratinocytes, and this induction had no association with breast milk lactoferrin concentration.

  12. Solar Simulated Ultraviolet Radiation Induces Global Histone Hypoacetylation in Human Keratinocytes.

    Science.gov (United States)

    Zhang, Xiaoru; Kluz, Thomas; Gesumaria, Lisa; Matsui, Mary S; Costa, Max; Sun, Hong

    2016-01-01

    Ultraviolet radiation (UVR) from sunlight is the primary effector of skin DNA damage. Chromatin remodeling and histone post-translational modification (PTM) are critical factors in repairing DNA damage and maintaining genomic integrity, however, the dynamic changes of histone marks in response to solar UVR are not well characterized. Here we report global changes in histone PTMs induced by solar simulated UVR (ssUVR). A decrease in lysine acetylation of histones H3 and H4, particularly at positions of H3 lysine 9, lysine 56, H4 lysine 5, and lysine 16, was found in human keratinocytes exposed to ssUVR. These acetylation changes were highly associated with ssUVR in a dose-dependent and time-specific manner. Interestingly, H4K16ac, a mark that is crucial for higher order chromatin structure, exhibited a persistent reduction by ssUVR that was transmitted through multiple cell divisions. In addition, the enzymatic activities of histone acetyltransferases were significantly reduced in irradiated cells, which may account for decreased global acetylation. Moreover, depletion of histone deacetylase SIRT1 in keratinocytes rescued ssUVR-induced H4K16 hypoacetylation. These results indicate that ssUVR affects both HDAC and HAT activities, leading to reduced histone acetylation.

  13. Dermal-epidermal membrane systems by using human keratinocytes and mesenchymal stem cells isolated from dermis

    Energy Technology Data Exchange (ETDEWEB)

    Salerno, Simona, E-mail: s.salerno@itm.cnr.it [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy); Messina, Antonietta [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy); Giordano, Francesca [Department of Pharmacy, Health and Nutritional Sciences, University of Calabria, I-87036 Rende, (CS) (Italy); Bader, Augustinus [Biomedical-Biotechnological Center, BBZ, University of Leipzig, D-04103 Leipzig (Germany); Drioli, Enrico [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy); WCU Energy Engineering Department, Hanyang University, Seoul (Korea, Republic of); De Bartolo, Loredana, E-mail: l.debartolo@itm.cnr.it [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy)

    2017-02-01

    Dermal-epidermal membrane systems were developed by co-culturing human keratinocytes with Skin derived Stem Cells (SSCs), which are Mesenchymal Stem Cells (MSCs) isolated from dermis, on biodegradable membranes of chitosan (CHT), polycaprolactone (PCL) and a polymeric blend of CHT and PCL. The membranes display physico-chemical, morphological, mechanical and biodegradation properties that could satisfy and fulfil specific requirements in skin tissue engineering. CHT membrane exhibits an optimal biodegradation rate for acute wounds; CHT-PCL for the chronic ones. On the other hand, PCL membrane in spite of its very slow biodegradation rate exhibits mechanical properties similar to in vivo dermis, a lower hydrophilic character, and a surface roughness, all properties that make it able to sustain cell adhesion and proliferation for in vitro skin models. Both CHT–PCL and PCL membranes guided epidermal and dermal differentiation of SSCs as pointed out by the expression of cytokeratins and the deposition of the ECM protein fibronectin, respectively. In the dermal-epidermal membrane systems, a more suitable microenvironment for the SSCs differentiation was promoted by the interactions and the mutual interplay with keratinocytes. Being skin tissue-biased stem cells committed to their specific final dermal and/or epidermal cell differentiation, SSCs are more suitable for skin tissue engineering than other adult MSCs with different origin. For this reason, they represent a useful autologous cell source for engineering skin substitutes for both in vivo and in vitro applications.

  14. IKKα regulates human keratinocyte migration through surveillance of the redox environment.

    Science.gov (United States)

    Lisse, Thomas S; Rieger, Sandra

    2017-03-01

    Although the functions of H 2 O 2 in epidermal wound repair are conserved throughout evolution, the underlying signaling mechanisms are largely unknown. In this study we used human keratinocytes (HEK001) to investigate H 2 O 2 -dependent wound repair mechanisms. Scratch wounding led to H 2 O 2 production in two or three cell layers at the wound margin within ∼30 min and subsequent cysteine modification of proteins via sulfenylation. Intriguingly, exogenous H 2 O 2 treatment resulted in preferential sulfenylation of keratinocytes that adopted a migratory phenotype and detached from neighboring cells, suggesting that one of the primary functions of H 2 O 2 is to stimulate signaling factors involved in cell migration. Based on previous findings that revealed epidermal growth factor receptor (EGFR) involvement in H 2 O 2 -dependent cell migration, we analyzed oxidation of a candidate upstream target, the inhibitor of κB kinase α (IKKα; encoded by CHUK ), as a mechanism of action. We show that IKKα is sulfenylated at a conserved cysteine residue in the kinase domain, which correlates with de-repression of EGF promoter activity and increased EGF expression. Thus, this indicates that IKKα promotes migration through dynamic interactions with the EGF promoter depending on the redox state within cells. © 2017. Published by The Company of Biologists Ltd.

  15. Analyses of the Secondary Particle Radiation and the DNA Damage it Causes to Human Keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Lebel E. A.; Tafrov S.; Rusek, A.; Sivertz, M. B.; Yip, K.; Thompson, K. H.

    2011-11-01

    High-energy protons, and high mass and energy ions, along with the secondary particles they produce, are the main contributors to the radiation hazard during space explorations. Skin, particularly the epidermis, consisting mainly of keratinocytes with potential for proliferation and malignant transformation, absorbs the majority of the radiation dose. Therefore, we used normal human keratinocytes to investigate and quantify the DNA damage caused by secondary radiation. Its manifestation depends on the presence of retinol in the serum-free media, and is regulated by phosphatidylinositol 3-kinases. We simulated the generation of secondary radiation after the impact of protons and iron ions on an aluminum shield. We also measured the intensity and the type of the resulting secondary particles at two sample locations; our findings agreed well with our predictions. We showed that secondary particles inflict DNA damage to different extents, depending on the type of primary radiation. Low-energy protons produce fewer secondary particles and cause less DNA damage than do high-energy protons. However, both generate fewer secondary particles and inflict less DNA damage than do high mass and energy ions. The majority of cells repaired the initial damage, as denoted by the presence of 53BPI foci, within the first 24 hours after exposure, but some cells maintained the 53BP1 foci longer.

  16. Saponins from Tribulus terrestris L. protect human keratinocytes from UVB-induced damage.

    Science.gov (United States)

    Sisto, Margherita; Lisi, Sabrina; D'Amore, Massimo; De Lucro, Raffaella; Carati, Davide; Castellana, Donatello; La Pesa, Velia; Zuccarello, Vincenzo; Lofrumento, Dario D

    2012-12-05

    Chronic exposure to solar UVB radiation damages skin, increasing the risk to develop cancer. Hence the identification of compounds with a photoprotective efficacy is essential. This study examined the role of saponins derived from Tribulus terrestris L. (TT) on the modulation of apoptosis in normal human keratinocytes (NHEK) exposed to physiological doses of UVB and to evaluate their antitumoral properties. In NHEK, TT saponins attenuate UVB-induced programmed cell death through inhibition of intrinsic apoptotic pathway. In squamous cell carcinomas (SCC) TT saponins do not make the malignant keratinocytes more resistant to UVB and determine an enhanced apoptotic response. The photoprotective effect of TT saponins is tightly correlated to the enhancement of NER genes expression and the block of UVB-mediated NF-κB activation. Collectively, our study shows experimental evidence that TT has a preventive efficacy against UVB-induced carcinogenesis and the molecular knowledge on the mechanisms through which TT saponins regulate cell death suggests great potential for TT to be developed into a new medicine for cancer patients. Copyright © 2012 Elsevier B.V. All rights reserved.

  17. Resveratrol-Sensitized UVA Induced Apoptosis in Human Keratinocytes through Mitochondrial Oxidative Stress and Pore Opening

    Science.gov (United States)

    Boyer, Jean Z; Jandova, Jana; Janda, Jaroslav; Vleugels, Frank R; Elliott, David; Sligh, James E

    2012-01-01

    Resveratrol (3, 5, 4′-trihydroxy- trans- stilbene), a polyphenol compound, is derived from natural products such as the skin of red grapes, blueberries and cranberries. Resveratrol not only exhibits antioxidant, cardioprotection, and anti-aging properties, but can also inhibit cancer cell growth and induce apoptosis. It has been shown that resveratrol inhibits the activation of Nf-kB and subsequently down regulates the expression of Nf-kB regulated genes such as interleukin-2 and Bcl-2, leading to cell cycle arrest and increased apoptosis in multiple myeloma cells. In the skin, resveratrol has been reported to sensitize keratinocytes to UVA induced apoptosis. However, the effect of resveratrol on opening of the mitochondrial permeability transition pore has not been previously examined. Our data show that UVA (14J/cm2) along with resveratrol causes massive oxidative stress in mitochondria. As a consequence of oxidative stress, the mitochondrial membrane potential decreases which results in opening of the mitochondrial pores ultimately leading to apoptosis in human keratinocytes. These results may have clinical implications for development of future chemotherapeutic treatment for tumors of the skin. PMID:22673012

  18. Proteomic profiling of human keratinocytes undergoing UVB-induced alternative differentiation reveals TRIpartite Motif Protein 29 as a survival factor.

    Directory of Open Access Journals (Sweden)

    Véronique Bertrand-Vallery

    Full Text Available BACKGROUND: Repeated exposures to UVB of human keratinocytes lacking functional p16(INK-4a and able to differentiate induce an alternative state of differentiation rather than stress-induced premature senescence. METHODOLOGY/PRINCIPAL FINDINGS: A 2D-DIGE proteomic profiling of this alternative state of differentiation was performed herein at various times after the exposures to UVB. Sixty-nine differentially abundant protein species were identified by mass spectrometry, many of which are involved in keratinocyte differentiation and survival. Among these protein species was TRIpartite Motif Protein 29 (TRIM29. Increased abundance of TRIM29 following UVB exposures was validated by Western blot using specific antibody and was also further analysed by immunochemistry and by RT-PCR. TRIM29 was found very abundant in keratinocytes and reconstructed epidermis. Knocking down the expression of TRIM29 by short-hairpin RNA interference decreased the viability of keratinocytes after UVB exposure. The abundance of involucrin mRNA, a marker of late differentiation, increased concomitantly. In TRIM29-knocked down reconstructed epidermis, the presence of picnotic cells revealed cell injury. Increased abundance of TRIM29 was also observed upon exposure to DNA damaging agents and PKC activation. The UVB-induced increase of TRIM29 abundance was dependent on a PKC signaling pathway, likely PKCdelta. CONCLUSIONS/SIGNIFICANCE: These findings suggest that TRIM29 allows keratinocytes to enter a protective alternative differentiation process rather than die massively after stress.

  19. UVB induces IL-12 transcription in human keratinocytes in vivo and in vitro

    International Nuclear Information System (INIS)

    Enk, C.D.; Blauvet, A.; Katz, S.I.; Mahanty, S.

    1996-01-01

    Human epidermal cells produce a wide range of cytokines, including those characteristic of Th2-like responses such as interleukin (IL)-4 and IL-10. As well, keratinocytes have recently been shown to produce Th1-like cytokines such as IL-12. Exposure to UVB has profound effects on the skin and systemic immune system, which is in part mediated by secretion of tumor necrosis factor (TNF)-α by epidermal cells. Because IL-12 induces production of TNF-α by certain cells of the immune system, we sought to determine whether UVB is an inducer of IL-12 gene expression in epidermal cells. Human epidermal cells were exposed to UVB radiation in vivo, isolated by suction blister technique and trypsinization and transcription of the IL-12 p35 and p40 chains was examined by RT-PCR. (Author)

  20. Nuclear DNA damage-triggered NLRP3 inflammasome activation promotes UVB-induced inflammatory responses in human keratinocytes

    International Nuclear Information System (INIS)

    Hasegawa, Tatsuya; Nakashima, Masaya; Suzuki, Yoshiharu

    2016-01-01

    Ultraviolet (UV) radiation in sunlight can result in DNA damage and an inflammatory reaction of the skin commonly known as sunburn, which in turn can lead to cutaneous tissue disorders. However, little has been known about how UV-induced DNA damage mediates the release of inflammatory mediators from keratinocytes. Here, we show that UVB radiation intensity-dependently increases NLRP3 gene expression and IL-1β production in human keratinocytes. Knockdown of NLRP3 with siRNA suppresses UVB-induced production of not only IL-1β, but also other inflammatory mediators, including IL-1α, IL-6, TNF-α, and PGE_2. In addition, inhibition of DNA damage repair by knockdown of XPA, which is a major component of the nucleotide excision repair system, causes accumulation of cyclobutane pyrimidine dimer (CPD) and activation of NLRP3 inflammasome. In vivo immunofluorescence analysis confirmed that NLRP3 expression is also elevated in UV-irradiated human epidermis. Overall, our findings indicate that UVB-induced DNA damage initiates NLRP3 inflammasome activation, leading to release of various inflammatory mediators from human keratinocytes. - Highlights: • UVB radiation induces NLRP3 inflammasome activation in human keratinocytes. • NLRP3 knockdown suppresses production of UVB-induced inflammatory mediators. • UVB-induced DNA damage triggers NLRP3 inflammasome activation. • NLRP3 expression in human epidermis is elevated in response to UV radiation.

  1. Nuclear DNA damage-triggered NLRP3 inflammasome activation promotes UVB-induced inflammatory responses in human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Hasegawa, Tatsuya, E-mail: tatsuya.hasegawa@to.shiseido.co.jp; Nakashima, Masaya; Suzuki, Yoshiharu

    2016-08-26

    Ultraviolet (UV) radiation in sunlight can result in DNA damage and an inflammatory reaction of the skin commonly known as sunburn, which in turn can lead to cutaneous tissue disorders. However, little has been known about how UV-induced DNA damage mediates the release of inflammatory mediators from keratinocytes. Here, we show that UVB radiation intensity-dependently increases NLRP3 gene expression and IL-1β production in human keratinocytes. Knockdown of NLRP3 with siRNA suppresses UVB-induced production of not only IL-1β, but also other inflammatory mediators, including IL-1α, IL-6, TNF-α, and PGE{sub 2}. In addition, inhibition of DNA damage repair by knockdown of XPA, which is a major component of the nucleotide excision repair system, causes accumulation of cyclobutane pyrimidine dimer (CPD) and activation of NLRP3 inflammasome. In vivo immunofluorescence analysis confirmed that NLRP3 expression is also elevated in UV-irradiated human epidermis. Overall, our findings indicate that UVB-induced DNA damage initiates NLRP3 inflammasome activation, leading to release of various inflammatory mediators from human keratinocytes. - Highlights: • UVB radiation induces NLRP3 inflammasome activation in human keratinocytes. • NLRP3 knockdown suppresses production of UVB-induced inflammatory mediators. • UVB-induced DNA damage triggers NLRP3 inflammasome activation. • NLRP3 expression in human epidermis is elevated in response to UV radiation.

  2. Human atopic dermatitis skin-derived T cells can induce a reaction in mouse keratinocytes in vivo

    DEFF Research Database (Denmark)

    Martel, Britta C; Blom, Lars; Dyring-Andersen, Beatrice

    2015-01-01

    . In comparison, blood -derived in vitro differentiated Th2 cells only induced a weak response in a few of the mice. Thus, we conclude that human AD skin-derived T cells can induce a reaction in mouse skin through induction of a proliferative response in the mouse keratinocytes. This article is protected......In atopic dermatitis (AD), the inflammatory response between skin infiltrating T cells and keratinocytes is fundamental to the development of chronic lesional eczema. The aim of this study was to investigate whether skin-derived T cells from AD patients could induce an inflammatory response in mice...... through keratinocyte activation and consequently cause development of eczematous lesions. Punch biopsies of lesional skin from AD patients were used to establish skin-derived T cell cultures and which were transferred into NOD.Cg-Prkd(scid) Il2rg(tm1Sug) /JicTac (NOG) mice. We found that subcutaneous...

  3. Chromium III histidinate exposure modulates antioxidant gene expression in HaCaT human keratinocytes exposed to oxidative stress

    Science.gov (United States)

    While the toxicity of hexavalent chromium is well established, trivalent Cr (Cr(III)) is an essential nutrient involved in insulin and glucose homeostasis. Recently, antioxidant effects of chromium (III) histidinate (Cr(III)His) were reported in HaCaT human keratinocytes exposed to oxidative stress...

  4. Tumor necrosis factor related apoptosis inducing ligand triggers apoptosis in dividing but not in differentiating human epidermal keratinocytes

    NARCIS (Netherlands)

    Jansen, Bastiaan J. H.; van Ruissen, Fred; Cerneus, Stefanie; Cloin, Wendy; Bergers, Mieke; van Erp, Piet E. J.; Schalkwijk, Joost

    2003-01-01

    Using serial analysis of gene expression we have previously identified the expression of several pro-apoptotic and anti-apoptotic genes in cultured human primary epidermal keratinocytes, including tumor necrosis factor related apoptosis inducing ligand (TRAIL). TRAIL is a potent inducer of apoptosis

  5. Triterpenoid α-amyrin stimulates proliferation of human keratinocytes but does not protect them against UVB damage

    DEFF Research Database (Denmark)

    Biskup, Edyta; Gołębiowski, Marek; Gniadecki, Robert

    2012-01-01

    Rhaponticum carthamoides plants ("maral root") are widely used in Siberian folk medicine. The present study reports for the first time the presence of pentacyclic terpenoid, α-amyrin, in methanol extract from leaves of this plant. α-Amyrin induced proliferation of human keratinocytes (HaCaT) by a...

  6. Two-dimensional and three-dimensional models used for teaching Human Evolution in Secondary Schools. Learning proficiency assessment. A Case Study

    Directory of Open Access Journals (Sweden)

    Ulisses Dardon

    2016-06-01

    Full Text Available The evolution of the human species is a topic of extreme importance reported in the “Parâmetros Curriculares Nacionais do Ensino Médio – PCNEM” (National Curriculum Standards of Secondary Education, although it is not often taught as part of basic education. This work presents the results of an experimental work performed with 31 students of a religious high school of State of Rio de Janeiro. Learning proficiency was assessed by using two-dimensional (2D and three-dimensional (3D illustration techniques of hominids skulls and a Pongidae for teaching Human Evolution. The teaching-learning process using these methodologies was more effective with the application of three-dimensional (3D illustration techniques. The group of students that used 3D illustrations were able to observe similarities and differences between the presented taxonomic models, and formulate hypotheses about their palaeobiology more consistently than the students that used 2D models. Results of this work indicate that the use of three-dimensional techniques (3D provides an excellent support to teaching-learning process in basic education, captivating and stimulating new interests of students during the educational process.

  7. Two-dimensional finite difference model to study temperature distribution in SST regions of human limbs immediately after physical exercise in cold climate

    Science.gov (United States)

    Kumari, Babita; Adlakha, Neeru

    2015-02-01

    Thermoregulation is a complex mechanism regulating heat production within the body (chemical thermoregulation) and heat exchange between the body and the environment (physical thermoregulation) in such a way that the heat exchange is balanced and deep body temperatures are relatively stable. The external heat transfer mechanisms are radiation, conduction, convection and evaporation. The physical activity causes thermal stress and poses challenges for this thermoregulation. In this paper, a model has been developed to study temperature distribution in SST regions of human limbs immediately after physical exercise under cold climate. It is assumed that the subject is doing exercise initially and comes to rest at time t = 0. The human limb is assumed to be of cylindrical shape. The peripheral region of limb is divided into three natural components namely epidermis, dermis and subdermal tissues (SST). Appropriate boundary conditions have been framed based on the physical conditions of the problem. Finite difference has been employed for time, radial and angular variables. The numerical results have been used to obtain temperature profiles in the SST region immediately after continuous exercise for a two-dimensional unsteady state case. The results have been used to analyze the thermal stress in relation to light, moderate and vigorous intensity exercise.

  8. Identification of differentially expressed proteins between human esophageal immortalized and carcinomatous cell lines by two-dimensional electrophoresis and MALDI-TOF-mass spectrometry

    Institute of Scientific and Technical Information of China (English)

    Xing-Dong Xiong; Li-Yan Xu; Zhong-Ying Shen; Wei-Jia Cai; Jian-Min Luo; Ya-Li Han; En-Min Li

    2002-01-01

    AIM: To identify the differentially expressed proteins between the human immortalized esophageal epithelial cell line (SHEE) and the malignant transformed esophageal carcinoma cell line (SHEEC), and to explore new ways for studying esophageal carcinoma associated genes. METHODS: SHEE and SHEEC cell lines were used to separate differentially expressed proteins by two-dimensional electrophoresis/The silver-stained 2-D gels was scanned with EDAS290 digital camera system and analyzed with the PDQuest 6.2 Software. Six spots in which the differentially expressed protein was more obvious were selected and analyzed with matrix-assisted laser desorption/ionization time of flying mass spectrometry (MALDI-TOF-MS).RESULTS: There were 107±4.58 and 115±9.91 protein spots observed in SHEE and SHEEC respectively, and the majority of these spots between the two cell lines matched each other (r=-0.772), only a few were expressed differentially. After analyzed by MALDI-TOF-MS and database search for the six differentially expressed proteins, One new protein as well as other five sequence-known proteins including RNPEP-like protein, human rRNA gene upstream sequence binding transcription factor, uracil DNA glycosylase,Annexin A2 and p300/CBP-associated factor were preliminarily identified.CONCLUSION: These differentially expressed proteins might play an importance role during malignant transformation of SHEEC from SHEE. The identification of these proteins may serve as a new way for studying esophageal carcinoma associated genes.

  9. Identification of proteins of human colorectal carcinoma cell line SW480 by two-dimensional electrophoresis and MALDI-TOF mass spectrometry

    Institute of Scientific and Technical Information of China (English)

    Ying-Tao Zhang; Yi-Ping Geng; Le Zhou; Bao-Chang Lai; Lv-Sheng Si; Yi-Li Wang

    2005-01-01

    AIM: To conduct the proteomic analysis of human colorectal carcinoma cell line, SW480 by using two-dimensional electrophoresis (2-DE) and matrix-assisted laser desorption /ionization-time of flight mass spectrometry (MALDITOFMS).METHODS: The total proteins of human colorectal carcinoma cell line, SW480 were separated with 2-DE by using immobilized pH gradient strips and visualized by staining with silver nitrate. The gel images were acquired by scanner and 2-DE analysis software, Image Master 2D Elite. Nineteen distinct protein spots were excised from gel randomly and digested in gel by TPCK-trypsin. Mass analysis ofthe tryptic digest peptides mixture was performed by using MALDI-TOF MS. Peptide mass fingerprints (PMFs) obtained by the MALDI-TOF analysis were used to search NCBI,SWISS-PROT and MSDB databases by using Mascot software.RESULTS: PMF maps of all spots were obtained by MALDI-TOF MS and thirteen proteins were preliminarily identified.CONCLUSION: The methods of analysis and identification of protein spots of tumor cells in 2-DE gel with silver staining by MALDI-TOF MS derived PMF have been established.Protein expression profile of SW480 has been obtained.It is demonstrated that a combination of proteomics and cell culture is a useful approach to comprehend the process of colon carcinogenesis.

  10. Cytoskeletal proteins from human skin fibroblasts, peripheral blood leukocytes, and a lymphoblastoid cell line compared by two-dimensional gel electrophoresis

    International Nuclear Information System (INIS)

    Giometti, C.S.; Willard, K.E.; Anderson, N.L.

    1982-01-01

    Differences in proteins between cells grown as suspension cultures and those grown as attached cultures were studied by comparing the proteins of detergent-resistant cytoskeletons prepared from peripheral blood leukocytes and a lymphoblastoid cell line (GM607) (both grown as suspension cultures) and those of human skin fibroblasts (grown as attached cultures) by two-dimensional gel electrophoresis. The major cytoskeletal proteins of the leukocytes were also present in the protein pattern of GM607 cytoskeletons. In contrast, the fibroblast cytoskeletal protein pattern contained four groups of proteins that differed from the patterns of the leukocytes and GM607. In addition, surface labeling of GM607 and human fibroblasts with 125 I demonstrated that substantial amounts of vimentin and actin are exposed at the surface of the attached fibroblasts, but there is little evidence of similar exposure at the surface of the suspension-grown GM607. These results demonstrate some differences in cytoskeletal protein composition between different types of cells could be related to their ability or lack of ability to grow as attached cells in tissue culture

  11. Hepatocyte and keratinocyte growth factors and their receptors in human lung emphysema

    Directory of Open Access Journals (Sweden)

    Marchal Joëlle

    2005-10-01

    Full Text Available Abstract Background Hepatocyte and keratinocyte growth factors are key growth factors in the process of alveolar repair. We hypothesized that excessive alveolar destruction observed in lung emphysema involves impaired expression of hepatocyte and keratinocyte growth factors or their respective receptors, c-met and keratinocyte growth factor receptor. The aim of our study was to compare the expression of hepatocyte and keratinocyte growth factors and their receptors in lung samples from 3 groups of patients: emphysema; smokers without emphysema and non-smokers without emphysema. Methods Hepatocyte and keratinocyte growth factor proteins were analysed by immunoassay and western blot; mRNA expression was measured by real time quantitative polymerase chain reaction. Results Hepatocyte and keratinocyte growth factors, c-met and keratinocyte growth factor receptor mRNA levels were similar in emphysema and non-emphysema patients. Hepatocyte growth factor mRNA correlated negatively with FEV1 and the FEV1/FVC ratio both in emphysema patients and in smokers with or without emphysema. Hepatocyte and keratinocyte growth factor protein concentrations were similar in all patients' groups. Conclusion The expression of hepatocyte and keratinocyte growth factors and their receptors is preserved in patients with lung emphysema as compared to patients without emphysema. Hepatocyte growth factor mRNA correlates with the severity of airflow obstruction in smokers.

  12. Arsenic exposure disrupts epigenetic regulation of SIRT1 in human keratinocytes

    International Nuclear Information System (INIS)

    Herbert, Katharine J.; Holloway, Adele; Cook, Anthony L.; Chin, Suyin P.; Snow, Elizabeth T.

    2014-01-01

    Arsenic is an environmental toxin which increases skin cancer risk for exposed populations worldwide; however the underlying biomolecular mechanism for arsenic-induced carcinogenesis is complex and poorly defined. Recent investigations show that histone deacetylase and DNA methyltransferase activity is impaired, and epigenetic patterns of gene regulation are consistently altered in cancers associated with arsenic exposure. Expression of the histone deacetylase SIRT1 is altered in solid tumours and haematological malignancies; however its role in arsenic-induced pathology is unknown. In this study we investigated the effect of arsenic on epigenetic regulation of SIRT1 and its targeting microRNA, miR-34a in primary human keratinocytes. Acetylation of histone H4 at lysine 16 (H4K16) increased in keratinocytes exposed to 0.5 μM arsenite [As(III)]; and this was associated with chromatin remodelling at the miR-34a promoter. Moreover, although SIRT1 protein initially increased in these As(III)-exposed cells, after 24 days expression was not significantly different from untreated controls. Extended exposure to low-dose As(III) (0.5 μM; > 5 weeks) compromised the pattern of CpG methylation at SIRT1 and miR-34a gene promoters, and this was associated with altered expression for both genes. We have found that arsenic alters epigenetic regulation of SIRT1 expression via structural reorganisation of chromatin at the miR-34a gene promoter in the initial 24 h of exposure; and over time, through shifts in miR-34a and SIRT1 gene methylation. Taken together, this investigation demonstrates that arsenic produces cumulative disruptions to epigenetic regulation of miR-34a expression, and this is associated with impaired coordination of SIRT1 functional activity. - Highlights: • Submicromolar arsenic concentrations disrupt SIRT1 activity and expression in human keratinocytes. • Arsenic-induced chromatin remodelling at the miR-34a gene promoter is associated with hyperacetylation

  13. Cobalt Oxide Nanoparticles: Behavior towards Intact and Impaired Human Skin and Keratinocytes Toxicity

    Directory of Open Access Journals (Sweden)

    Marcella Mauro

    2015-07-01

    Full Text Available Skin absorption and toxicity on keratinocytes of cobalt oxide nanoparticles (Co3O4NPs have been investigated. Co3O4NPs are commonly used in industrial products and biomedicine. There is evidence that these nanoparticles can cause membrane damage and genotoxicity in vitro, but no data are available on their skin absorption and cytotoxicity on keratinocytes. Two independent 24 h in vitro experiments were performed using Franz diffusion cells, using intact (experiment 1 and needle-abraded human skin (experiment 2. Co3O4NPs at a concentration of 1000 mg/L in physiological solution were used as donor phase. Cobalt content was evaluated by Inductively Coupled–Mass Spectroscopy. Co permeation through the skin was demonstrated after 24 h only when damaged skin protocol was used (57 ± 38 ng·cm−2, while no significant differences were shown between blank cells (0.92 ± 0.03 ng cm−2 and those with intact skin (1.08 ± 0.20 ng·cm−2. To further investigate Co3O4NPs toxicity, human-derived HaCaT keratinocytes were exposed to Co3O4NPs and cytotoxicity evaluated by MTT, Alamarblue® and propidium iodide (PI uptake assays. The results indicate that a long exposure time (i.e., seven days was necessary to induce a concentration-dependent cell viability reduction (EC50 values: 1.3 × 10−4 M, 95% CL = 0.8–1.9 × 10−4 M, MTT essay; 3.7 × 10−5 M, 95% CI = 2.2–6.1 × 10−5 M, AlamarBlue® assay that seems to be associated to necrotic events (EC50 value: 1.3 × 10−4 M, 95% CL = 0.9–1.9 × 10−4 M, PI assay. This study demonstrated that Co3O4NPs can penetrate only damaged skin and is cytotoxic for HaCat cells after long term exposure.

  14. Arsenic exposure disrupts epigenetic regulation of SIRT1 in human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Herbert, Katharine J. [School of Health Sciences, University of Tasmania, Launceston, TAS 7250 (Australia); Holloway, Adele [Menzies Research Institute Tasmania, University of Tasmania, Hobart, TAS 7000 (Australia); Cook, Anthony L. [School of Health Sciences, University of Tasmania, Launceston, TAS 7250 (Australia); Chin, Suyin P. [Menzies Research Institute Tasmania, University of Tasmania, Hobart, TAS 7000 (Australia); Snow, Elizabeth T., E-mail: elizabeth.snow@utas.edu.au [School of Health Sciences, University of Tasmania, Launceston, TAS 7250 (Australia)

    2014-11-15

    Arsenic is an environmental toxin which increases skin cancer risk for exposed populations worldwide; however the underlying biomolecular mechanism for arsenic-induced carcinogenesis is complex and poorly defined. Recent investigations show that histone deacetylase and DNA methyltransferase activity is impaired, and epigenetic patterns of gene regulation are consistently altered in cancers associated with arsenic exposure. Expression of the histone deacetylase SIRT1 is altered in solid tumours and haematological malignancies; however its role in arsenic-induced pathology is unknown. In this study we investigated the effect of arsenic on epigenetic regulation of SIRT1 and its targeting microRNA, miR-34a in primary human keratinocytes. Acetylation of histone H4 at lysine 16 (H4K16) increased in keratinocytes exposed to 0.5 μM arsenite [As(III)]; and this was associated with chromatin remodelling at the miR-34a promoter. Moreover, although SIRT1 protein initially increased in these As(III)-exposed cells, after 24 days expression was not significantly different from untreated controls. Extended exposure to low-dose As(III) (0.5 μM; > 5 weeks) compromised the pattern of CpG methylation at SIRT1 and miR-34a gene promoters, and this was associated with altered expression for both genes. We have found that arsenic alters epigenetic regulation of SIRT1 expression via structural reorganisation of chromatin at the miR-34a gene promoter in the initial 24 h of exposure; and over time, through shifts in miR-34a and SIRT1 gene methylation. Taken together, this investigation demonstrates that arsenic produces cumulative disruptions to epigenetic regulation of miR-34a expression, and this is associated with impaired coordination of SIRT1 functional activity. - Highlights: • Submicromolar arsenic concentrations disrupt SIRT1 activity and expression in human keratinocytes. • Arsenic-induced chromatin remodelling at the miR-34a gene promoter is associated with hyperacetylation

  15. Exposure to Carbon Nanotube Material: Assessment of Nanotube Cytotoxicity Using Human Keratinocyte Cells

    Science.gov (United States)

    Shvedova, Anna A.; Castranova, Vincent; Kisin, Elena R.; Schwegler-Berry, Diane; Murray, Ashley R.; Gandelsman, Vadim Z.; Maynard, Andrew; Baron, Paul

    2003-01-01

    Carbon nanotubes are new members of carbon allotropes similar to fullerenes and graphite. Because of their unique electrical, mechanical, and thermal properties, carbon nanotubes are important for novel applications in the electronics, aerospace, and computer industries. Exposure to graphite and carbon materials has been associated with increased incidence of skin diseases, such as carbon fiber dermatitis, hyperkeratosis, and naevi. We investigated adverse effects of single-wall carbon nanotubes (SWCNT) using a cell culture of immortalized human epidermal keratinocytes (HaCaT). After 18 h of exposure of HaCaT to SWCNT, oxidative stress and cellular toxicity were indicated by formation of free radicals, accumulation of peroxidative products, antioxidant depletion, and loss of cell viability. Exposure to SWCNT also resulted in ultrastructural and morphological changes in cultured skin cells. These data indicate that dermal exposure to unrefined SWCNT may lead to dermal toxicity due to accelerated oxidative stress in the skin of exposed workers.

  16. Two-Dimensional Capillary Electrophoresis with On-Line Sample Preparation and Cyclodextrin Separation Environment for Direct Determination of Serotonin in Human Urine.

    Science.gov (United States)

    Piešťanský, Juraj; Maráková, Katarína; Mikuš, Peter

    2017-10-07

    An advanced two-dimensional capillary electrophoresis method, based on on-line combination of capillary isotachophoresis and capillary zone electrophoresis with cyclodextrin additive in background electrolyte, was developed for effective determination of serotonin in human urine. Hydrodynamically closed separation system and large bore capillaries (300-800 µm) were chosen for the possibility to enhance the sample load capacity, and, by that, to decrease limit of detection. Isotachophoresis served for the sample preseparation, defined elimination of sample matrix constituents (sample clean up), and preconcentration of the analyte. Cyclodextrin separation environment enhanced separation selectivity of capillary zone electrophoresis. In this way, serotonin could be successfully separated from the rest of the sample matrix constituents migrating in capillary zone electrophoresis step so that human urine could be directly (i.e., without any external sample preparation) injected into the analyzer. The proposed method was successfully validated, showing favorable parameters of sensitivity (limit of detection for serotonin was 2.32 ng·mL -1 ), linearity (regression coefficient higher than 0.99), precision (repeatability of the migration time and peak area were in the range of 0.02-1.17% and 5.25-7.88%, respectively), and recovery (ranging in the interval of 90.0-93.6%). The developed method was applied for the assay of the human urine samples obtained from healthy volunteers. The determined concentrations of serotonin in such samples were in the range of 12.4-491.2 ng·mL -1 that was in good agreement with literature data. This advanced method represents a highly effective, reliable, and low-cost alternative for the routine determination of serotonin as a biomarker in human urine.

  17. Human eccrine sweat gland cells turn into melanin-uptaking keratinocytes in dermo-epidermal skin substitutes.

    Science.gov (United States)

    Böttcher-Haberzeth, Sophie; Biedermann, Thomas; Pontiggia, Luca; Braziulis, Erik; Schiestl, Clemens; Hendriks, Bart; Eichhoff, Ossia M; Widmer, Daniel S; Meuli-Simmen, Claudia; Meuli, Martin; Reichmann, Ernst

    2013-02-01

    Recently, Biedermann et al. (2010) have demonstrated that human eccrine sweat gland cells can develop a multilayered epidermis. The question still remains whether these cells can fulfill exclusive and very specific functional properties of epidermal keratinocytes, such as the incorporation of melanin, a feature absent in sweat gland cells. We added human melanocytes to eccrine sweat gland cells to let them develop into an epidermal analog in vivo. The interaction between melanocytes and sweat gland-derived keratinocytes was investigated. The following results were gained: (1) macroscopically, a pigmentation of the substitutes was seen 2-3 weeks after transplantation; (2) we confirmed the development of a multilayered, stratified epidermis with melanocytes distributed evenly throughout the basal layer; (3) melanocytic dendrites projected to suprabasal layers; and (4) melanin was observed to be integrated into former eccrine sweat gland cells. These skin substitutes were similar or equal to skin substitutes cultured from human epidermal keratinocytes. The only differences observed were a delay in pigmentation and less melanin uptake. These data suggest that eccrine sweat gland cells can form a functional epidermal melanin unit, thereby providing striking evidence that they can assume one of the most characteristic keratinocyte properties.

  18. A comparative in vitro study of the viability of human keratinocytes grown on irradiated human amnion membrane and fibrin glue scaffolds

    International Nuclear Information System (INIS)

    Dorai, A.A.; Lim, C.K.; Azman, W.S.; Halim, A.S.

    2008-01-01

    Full text: The dried irradiated human amnion membrane has been used as a biological dressing for various clinical conditions. Being another biological membrane its potential as a scaffold to grow human keratinocytes is not known yet. To compare the growth patterns and cell viability of keratinocytes using fibrin glue and air dried amnion membrane as a scaffold. Keratinocytes were obtained from skin samples of six patients undergoing elective surgery. Fibrin glue (Tisseel, Baxter ) was diluted and used to coat the wells. Human dried amnion membrane was obtained and placed into the 24 well plates. Keratinocytes were seeded into the fibrin and amnion scaffold. Cell viability assay (MTT) was performed after 24, 48 and 72 hours. Finally the measurements were done by the Enzyme-Linked Immunosorbent Assay (ELISA) reader at 570 nm. Six patients consented for the study. The cells growing on the amnion scaffold showed a decreasing trend (20.67%, 17.94% and 16.78% respectively for 24, 48 and 72 hours). The cells growing on the fibrin scaffold showed a steady increase in number at 24, 48 and 72 hours (73.03%, 74.12% and 79.66%). The percentage of growth of normal human keratinocytes were significantly greater in the fibrin scaffold group (Mann - Whitney p = 0.002) for 24, 48 and 72 hours. The air dried irradiated human amnion membrane can be used as a scaffold to grow keratinocytes but however the growth pattern does not sustain with time. Fibrin glue supports the growth of human keratinocytes and shows an increasing pattern of growth with time. (Author)

  19. Assessment of radiation induced cytogenetic damage in human keratinocytes by comet assay

    International Nuclear Information System (INIS)

    Joseph, Praveen; Sanjeev Ganesh; Narayana, Y.; Puthali, Abhay; Bhat, N.N.

    2010-01-01

    In the present study the effect of gamma radiation on normal human keratinocytes (HaCaT) cells has been analyzed using alkaline comet assay and a comparative study over the sensitivity of different comet parameters such as tail length (TL), olive tail moment (OTM) and percentage tail DNA (TDNA) has also been made. Human keratinocytes (HaCaT) cells were grown in Dulbecco's modified essential medium (DMEM) (10% FCS) at 37 °C in a humidified atmosphere containing 5% CO 2 . Cultured cells were harvested with 0.025 % trypsin EDTA. The sample (2 X 10 cells/ml) was exposed to gamma radiation of different dose using a 60 Co gamma source at dose rate of 2 Gy min -1 and the dosimetry has been carried out using Fricke and FBX dosimeters. After irradiation, to quantify the DNA damage the comet assay (single cell gel electrophoresis) was carried out under alkaline conditions, by the methods outlined by Singh et al. The quantification of the DNA strand breaks in each cells were performed using CASP software. The DNA damage quantification can be accomplished by measuring those comet parameters which exhibit a linear dependence on the amount of DNA damage. In the present study, comet parameters such as OTM, TL and TDNA were recorded and the variation of these parameters and their correlation coefficients for different doses of gamma radiation is plotted. The OTM value is normalized with control value and control for TL and TDNA is adjusted to zero to avoid initial variations in different experiments

  20. Cultivation of human dermal fibroblasts and epidermal keratinocytes on keratin-coated silica bead substrates.

    Science.gov (United States)

    Tan, Bee Yi; Nguyen, Luong T H; Kim, Hyo-Sop; Kim, Jae-Ho; Ng, Kee Woei

    2017-10-01

    Human hair keratin is promising as a bioactive material platform for various biomedical applications. To explore its versatility further, human hair keratin was coated onto monolayers of silica beads to produce film-like substrates. This combination was hypothesized to provide a synergistic effect in improving the biochemical properties of the resultant composite. Atomic force microscopy analysis showed uniform coatings of keratin on the silica beads with a slight increase in the resulting surface roughness. Keratin-coated silica beads had higher surface energy and relatively lower negative charge than those of bare silica beads. To investigate cell response, human dermal fibroblasts (HDFs), and human epidermal keratinocytes (HEKs) were cultured on the substrates over 4 days. Results showed that keratin coatings significantly enhanced the metabolic activity of HDFs and encouraged cell spreading but did not exert any significant effects on HEKs. HDF expression of collagen I was significantly more intense on the keratin-coated compared to the bare silica substrates. Furthermore, HDF secretion of various cytokines suggested that keratin coatings triggered active cell responses related to wound healing. Collectively, our study demonstrated that human hair keratin-coated silica bead monolayers have the potential to modulate HDF behavior in culture and may be exploited further. © 2017 Wiley Periodicals, Inc. J Biomed Mater Res Part A: 105A: 2789-2798, 2017. © 2017 Wiley Periodicals, Inc.

  1. Biological interactions of quantum dot nanoparticles in skin and in human epidermal keratinocytes

    International Nuclear Information System (INIS)

    Zhang, Leshuai W.; Yu, William W.; Colvin, Vicki L.; Monteiro-Riviere, Nancy A.

    2008-01-01

    Quantum dots nanoparticles have novel optical properties for biomedical applications and electronics, but little is known about their skin permeability and interaction with cells. QD621 are nail-shaped nanoparticles that contain a cadmium/selenide core with a cadmium sulfide shell coated with polyethylene glycol (PEG) and are soluble in water. QD were topically applied to porcine skin flow-through diffusion cells to assess penetration at 1 μM, 2 μM and 10 μM for 24 h. QD were also studied in human epidermal keratinocytes (HEK) to determine cellular uptake, cytotoxicity and inflammatory potential. Confocal microscopy depicted the penetration of QD621 through the uppermost stratum corneum (SC) layers of the epidermis and fluorescence was found primarily in the SC and near hair follicles. QD were found in the intercellular lipid bilayers of the SC by transmission electron microscopy (TEM). Inductively coupled plasma-optical emission spectroscopy (ICP-OES) analysis for cadmium (Cd) and fluorescence for QD both did not detect Cd nor fluorescence signal in the perfusate at any time point or concentration. In HEK, viability decreased significantly (p < 0.05) from 1.25 nM to 10nM after 24 h and 48 h. There was a significant increase in IL-6 at 1.25 nM to 10 nM, while IL-8 increased from 2.5nM to 10nM after 24 h and 48 h. TEM of HEK treated with 10 nM of QD621 at 24 h depicted QD in cytoplasmic vacuoles and at the periphery of the cell membranes. These results indicate that porcine skin penetration of QD621 is minimal and limited primarily to the outer SC layers, yet if the skin were damaged allowing direct QD exposure to skin or keratinocytes, an inflammatory response could be initiated

  2. Inhibition of inflammatory and proliferative responses of human keratinocytes exposed to the sesquiterpene lactones dehydrocostuslactone and costunolide.

    Directory of Open Access Journals (Sweden)

    Claudia Scarponi

    Full Text Available The imbalance of the intracellular redox state and, in particular, of the glutathione (GSH/GSH disulfide couple homeostasis, is involved in the pathogenesis of a number of diseases. In many skin diseases, including psoriasis, oxidative stress plays an important role, as demonstrated by the observation that treatments leading to increase of the local levels of oxidant species ameliorate the disease. Recently, dehydrocostuslactone (DCE and costunolide (CS, two terpenes naturally occurring in many plants, have been found to exert various anti-inflammatory and pro-apoptotic effects on different human cell types. These compounds decrease the level of the intracellular GSH by direct interaction with it, and, therefore, can alter cellular redox state. DCE and CS can trigger S-glutathionylation of various substrates, including the transcription factor STAT3 and JAK1/2 proteins. In the present study, we investigated on the potential role of DCE and CS in regulating inflammatory and proliferative responses of human keratinocytes to cytokines. We demonstrated that DCE and CS decreased intracellular GSH levels in human keratinocytes, as well as inhibited STAT3 and STAT1 phosphorylation and activation triggered by IL-22 or IFN-γ, respectively. Consequently, DCE and CS decreased the IL-22- and IFN-γ-induced expression of inflammatory and regulatory genes in keratinocytes, including CCL2, CXCL10, ICAM-1 and SOCS3. DCE and CS also inhibited proliferation and cell-cycle progression-related gene expression, as well as they promoted cell cycle arrest and apoptosis. In parallel, DCE and CS activated the anti-inflammatory EGFR and ERK1/2 molecules in keratinocytes, and, thus, wound healing in an in vitro injury model. In light of our findings, we can hypothesize that the employment of DCE and CS in psoriasis could efficiently counteract the pro-inflammatory effects of IFN-γ and IL-22 on keratinocytes, revert the apoptosis-resistant phenotype, as well as inhibit

  3. Comparative study of human-induced pluripotent stem cells derived from bone marrow cells, hair keratinocytes, and skin fibroblasts.

    Science.gov (United States)

    Streckfuss-Bömeke, Katrin; Wolf, Frieder; Azizian, Azadeh; Stauske, Michael; Tiburcy, Malte; Wagner, Stefan; Hübscher, Daniela; Dressel, Ralf; Chen, Simin; Jende, Jörg; Wulf, Gerald; Lorenz, Verena; Schön, Michael P; Maier, Lars S; Zimmermann, Wolfram H; Hasenfuss, Gerd; Guan, Kaomei

    2013-09-01

    Induced pluripotent stem cells (iPSCs) provide a unique opportunity for the generation of patient-specific cells for use in disease modelling, drug screening, and regenerative medicine. The aim of this study was to compare human-induced pluripotent stem cells (hiPSCs) derived from different somatic cell sources regarding their generation efficiency and cardiac differentiation potential, and functionalities of cardiomyocytes. We generated hiPSCs from hair keratinocytes, bone marrow mesenchymal stem cells (MSCs), and skin fibroblasts by using two different virus systems. We show that MSCs and fibroblasts are more easily reprogrammed than keratinocytes. This corresponds to higher methylation levels of minimal promoter regions of the OCT4 and NANOG genes in keratinocytes than in MSCs and fibroblasts. The success rate and reprogramming efficiency was significantly higher by using the STEMCCA system than the OSNL system. All analysed hiPSCs are pluripotent and show phenotypical characteristics similar to human embryonic stem cells. We studied the cardiac differentiation efficiency of generated hiPSC lines (n = 24) and found that MSC-derived hiPSCs exhibited a significantly higher efficiency to spontaneously differentiate into beating cardiomyocytes when compared with keratinocyte-, and fibroblast-derived hiPSCs. There was no significant difference in the functionalities of the cardiomyocytes derived from hiPSCs with different origins, showing the presence of pacemaker-, atrial-, ventricular- and Purkinje-like cardiomyocytes, and exhibiting rhythmic Ca2+ transients and Ca2+ sparks in hiPSC-derived cardiomyocytes. Furthermore, spontaneously and synchronously beating and force-developing engineered heart tissues were generated. Human-induced pluripotent stem cells can be reprogrammed from all three somatic cell types, but with different efficiency. All analysed iPSCs can differentiate into cardiomyocytes, and the functionalities of cardiomyocytes derived from different cell

  4. High-throughput determination of vancomycin in human plasma by a cost-effective system of two-dimensional liquid chromatography.

    Science.gov (United States)

    Sheng, Yanghao; Zhou, Boting

    2017-05-26

    Therapeutic drug monitoring (TDM) is one of the most important services of clinical laboratories. Two main techniques are commonly used: the immunoassay and chromatography method. We have developed a cost-effective system of two-dimensional liquid chromatography with ultraviolet detection (2D-LC-UV) for high-throughput determination of vancomycin in human plasma that combines the automation and low start-up costs of the immunoassay with the high selectivity and sensitivity of the liquid chromatography coupled with mass spectrometric detection without incurring their disadvantages, achieving high cost-effectiveness. This 2D-LC system offers a large volume injection to provide sufficient sensitivity and uses simulated gradient peak compression technology to control peak broadening and to improve peak shape. A middle column was added to reduce the analysis cycle time and make it suitable for high-throughput routine clinical assays. The analysis cycle time was 4min and the peak width was 0.8min. Compared with other chromatographic methods that have been developed, the analysis cycle time and peak width for vancomycin was reduced significantly. The lower limit of quantification was 0.20μg/mL for vancomycin, which is the same as certain LC-MS/MS methods that have been recently developed and validated. The method is rapid, automated, and low-cost and has high selectivity and sensitivity for the quantification of vancomycin in human plasma, thus making it well-suited for use in hospital clinical laboratories. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. The Effect of Calcipotriol on the Expression of Human β Defensin-2 and LL-37 in Cultured Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Beom Joon Kim

    2009-01-01

    Full Text Available Background. Vitamin D has been reported to regulate innate immunity by controlling the expression of antimicrobial peptides (AMPs. Objective. We investigated the effect of calcipotriol on the expression of AMPs in human cultured keratinocytes. Methods. Keratinocytes were treated with lipopolysaccharide (LPS, TNF-α, Calcipotriol and irradiated with UVB, cultured, and harvested. To assess the expression of human beta defensin-2 and LL-37 in the control group, not exposed to any stimulants, the experimental group was treated with LPS, TNF-α, or UVB, and another group was treated again with calcipotriol; reverse transcriptase-polymerase chain reaction, Western blotting, and immunohistochemical staining were performed. Results. In the experimental group treated with LPS, UVB irradiation, and TNF-α, the expression of β-defensin and LL-37 was increased more than in the control group and then decreased in the experimental group treated with calcipotriol. Conclusions. Calcipotriol suppressed HBD-2 and LL-37, which were stimulated by UVB, LPS, and TNF-α.

  6. cDNA microarray analysis of human keratinocytes cells of patients submitted to chemoradiotherapy and oral photobiomodulation therapy: pilot study.

    Science.gov (United States)

    Antunes, Heliton S; Wajnberg, Gabriel; Pinho, Marcos B; Jorge, Natasha Andressa Nogueira; de Moraes, Joyce Luana Melo; Stefanoff, Claudio Gustavo; Herchenhorn, Daniel; Araújo, Carlos M M; Viégas, Celia Maria Pais; Rampini, Mariana P; Dias, Fernando L; de Araujo-Souza, Patricia Savio; Passetti, Fabio; Ferreira, Carlos G

    2018-01-01

    Oral mucositis is an acute toxicity that occurs in patients submitted to chemoradiotherapy to treat head and neck squamous cell carcinoma. In this study, we evaluated differences in gene expression in the keratinocytes of the oral mucosa of patients treated with photobiomodulation therapy and tried to associate the molecular mechanisms with clinical findings. From June 2009 to December 2010, 27 patients were included in a randomized double-blind pilot study. Buccal smears from 13 patients were obtained at days 1 and 10 of chemoradiotherapy, and overall gene expression of samples from both dates were analyzed by complementary DNA (cDNA) microarray. In addition, samples from other 14 patients were also collected at D1 and D10 of chemoradiotherapy for subsequent validation of cDNA microarray findings by qPCR. The expression array analysis identified 105 upregulated and 60 downregulated genes in our post-treatment samples when compared with controls. Among the upregulated genes with the highest fold change, it was interesting to observe the presence of genes related to keratinocyte differentiation. Among downregulated genes were observed genes related to cytotoxicity and immune response. The results indicate that genes known to be induced during differentiation of human epidermal keratinocytes were upregulated while genes associated with cytotoxicity and immune response were downregulated in the laser group. These results support previous clinical findings indicating that the lower incidence of oral mucositis associated with photobiomodulation therapy might be correlated to the activation of genes involved in keratinocyte differentiation.

  7. Effect of in vitro and in vivo UV irradiation on the production of ETAF activity by human and murine keratinocytes

    International Nuclear Information System (INIS)

    Ansel, J.C.; Luger, T.A.; Green, I.

    1983-01-01

    Cultured epidermal cells and keratinocytes produce a potent hormone-like factor called epidermal cell-derived thymocyte-activating factor (ETAF). ETAF appears to be similar if not identical to a monocyte-derived lymphokine, known as interleukin 1 (IL-1). These two cytokines are able to amplify a diverse number of proliferative and inflammatory processes. Several recent investigations have suggested that UV-induced immunosuppression may be due in part to the inhibition of IL-1/ETAF production by monocytes and keratinocytes, respectively. We therefore decided to directly study the effects of various doses of in vitro and in vivo UV radiation (UVR) on the production of ETAF by normal murine epidermal cells and a murine (Pam 212) and a human (SCC) keratinocyte cell line. Our results surprisingly demonstrated an increase in both the extracellular and the intracellular ETAF activity of the murine epidermal, Pam 212, and SCC after sublethal amounts of in vitro UVR. Likewise, increased ETAF activity of murine epidermal cells was detected after sublethal doses of in vivo UVR. The UV-induced ETAF activity was cycloheximide-sensitive, suggesting that de novo synthesis of ETAF rather than cell membrane leakage was responsible for the increased ETAF activity. The fact that UV irradiation can increase ETAF activity by keratinocytes could have important local and systemic consequences for the host and may provide an efficient, contaminant-free method for generating ETAF activity for further biochemical and immunologic studies

  8. Gene expression signatures affected by ethanol and/or nicotine in normal human normal oral keratinocytes (NHOKs

    Directory of Open Access Journals (Sweden)

    Jeffrey J. Kim

    2014-12-01

    Full Text Available It has been reported that nicotine/alcohol alters epigenetic control and leads to abrogated DNA methylation and histone modifications, which could subsequently perturb transcriptional regulation critically important in cellular transformation. The aim of this study is to determine the molecular mechanisms of nicotine/alcohol-induced epigenetic alterations and their mechanistic roles in transcriptional regulation in human adult stem cells. We hypothesized that nicotine/alcohol induces deregulation of epigenetic machinery and leads to epigenetic alterations, which subsequently affect transcriptional regulation in oral epithelial stem cells. As an initiating step we have profiled transcriptomic alterations induced by the combinatory administration of EtOH and nicotine in primary normal human oral keratinocytes. Here we provide detailed experimental methods, analysis and information associated with our data deposited into Gene Expression Omnibus (GEO under GSE57634. Our data provide comprehensive transcriptomic map describing molecular changes induced by EtOH and nicotine on normal human oral keratinocytes.

  9. Sacha Inchi Oil (Plukenetia volubilis L.), effect on adherence of Staphylococus aureus to human skin explant and keratinocytes in vitro.

    Science.gov (United States)

    Gonzalez-Aspajo, German; Belkhelfa, Haouaria; Haddioui-Hbabi, Laïla; Bourdy, Geneviève; Deharo, Eric

    2015-08-02

    Plukenetia volubilis L. (Euphorbiaceae) is a domesticated vine distributed from the high-altitude Andean rain forest to the lowlands of the Peruvian Amazon. Oil from the cold-pressed seeds, sold under the commercial name of Sacha Inchi Oil (SIO) is actually much in favour because it contains a high percentage of omega 3 and omega 6, and is hence used as a dietary supplement. SIO is also used traditionally for skin care, in order to maintain skin softness, and for the treatment of wounds, insect bites and skin infections, in a tropical context where the skin is frequently damaged. This study was designed in order to verify whether the traditional use of SIO for skin care would have any impact on Staphylococcus aureus growth and skin adherence, as S. aureus is involved in many skin pathologies (impetigo, folliculitis, furuncles and subcutaneous abscesses) being one if the main pathogens that can be found on the skin. Therefore, our objective was to assess SIO bactericidal activity and interference with adherence to human skin explants and the keratinocyte cell line. Cytotoxicity on that cells was also determined. The activity of SIO was compared to coconut oil (CocO), which is widely used for skin care but has different unsaturated fatty acids contents. Laboratory testing with certified oil, determined antibacterial activity against radio labelled S. aureus. Cytotoxic effects were measured with XTT on keratinocyte cells and with neutral red on human skin explants; phenol was used as cytotoxic control. Adherence assays were carried out by mixing H3-labelled S. aureus bacteria with keratinocyte cells and human skin explants, incubated with oils 2h before (to determine the inhibition of adherence, assimilated to a preventive effect) or 2h after the contact of the biological material with S. aureus (to assess the detachment of the bacteria, assimilated to a curative effect). Residual radioactivity measured after washings made it possible to determine the adherence

  10. The Antimicrobial Peptide Human Beta-Defensin-3 Is Induced by Platelet-Released Growth Factors in Primary Keratinocytes

    Directory of Open Access Journals (Sweden)

    Andreas Bayer

    2017-01-01

    Full Text Available Platelet-released growth factors (PRGF and its related clinically used formulations (e.g., Vivostat Platelet-Rich Fibrin (PRF® contain a variety of chemokines, cytokines, and growth factors and are therefore used to support healing of chronic, hard-to-heal, or infected wounds. Human beta-defensin-3 (hBD-3 is an antimicrobial peptide inducibly expressed in human keratinocytes especially upon wounding. The potent antimicrobial activity of hBD-3 together with its wound closure-promoting activities suggests that hBD-3 may play a crucial role in wound healing. Therefore, we analyzed the influence of PRGF on hBD-3 expression in human primary keratinocytes in vitro. In addition, we investigated the influence of Vivostat PRF on hBD-3 expression in artificially generated human skin wounds in vivo. PRGF treatment of primary keratinocytes induced a significant, concentration- and time-dependent increase in hBD-3 gene expression which was partially mediated by the epidermal growth factor receptor (EGFR. In line with these cell culture data, in vivo experiments revealed an enhanced hBD-3 expression in experimentally produced human wounds after the treatment with Vivostat PRF. Thus, the induction of hBD-3 may contribute to the beneficial effects of thrombocyte concentrate lysates in the treatment of chronic or infected wounds.

  11. The Antimicrobial Peptide Human Beta-Defensin-3 Is Induced by Platelet-Released Growth Factors in Primary Keratinocytes

    Science.gov (United States)

    Lammel, Justus; Tohidnezhad, Mersedeh; Lippross, Sebastian; Behrendt, Peter; Klüter, Tim; Pufe, Thomas; Cremer, Jochen; Jahr, Holger; Rademacher, Franziska; Gläser, Regine; Harder, Jürgen

    2017-01-01

    Platelet-released growth factors (PRGF) and its related clinically used formulations (e.g., Vivostat Platelet-Rich Fibrin (PRF®)) contain a variety of chemokines, cytokines, and growth factors and are therefore used to support healing of chronic, hard-to-heal, or infected wounds. Human beta-defensin-3 (hBD-3) is an antimicrobial peptide inducibly expressed in human keratinocytes especially upon wounding. The potent antimicrobial activity of hBD-3 together with its wound closure-promoting activities suggests that hBD-3 may play a crucial role in wound healing. Therefore, we analyzed the influence of PRGF on hBD-3 expression in human primary keratinocytes in vitro. In addition, we investigated the influence of Vivostat PRF on hBD-3 expression in artificially generated human skin wounds in vivo. PRGF treatment of primary keratinocytes induced a significant, concentration- and time-dependent increase in hBD-3 gene expression which was partially mediated by the epidermal growth factor receptor (EGFR). In line with these cell culture data, in vivo experiments revealed an enhanced hBD-3 expression in experimentally produced human wounds after the treatment with Vivostat PRF. Thus, the induction of hBD-3 may contribute to the beneficial effects of thrombocyte concentrate lysates in the treatment of chronic or infected wounds. PMID:28811680

  12. Insights into the impact of silver nanoparticles on human keratinocytes metabolism through NMR metabolomics.

    Science.gov (United States)

    Carrola, Joana; Bastos, Verónica; Ferreira de Oliveira, José Miguel P; Oliveira, Helena; Santos, Conceição; Gil, Ana M; Duarte, Iola F

    2016-01-01

    Due to their antimicrobial properties, silver nanoparticles (AgNPs) are increasingly incorporated into consumer goods and medical products. Their potential toxicity to human cells is however a major concern, and there is a need for improved understanding of their effects on cell metabolism and function. Here, Nuclear Magnetic Resonance (NMR) metabolomics was used to investigate the metabolic profile of human epidermis keratinocytes (HaCaT cell line) exposed for 48 h to 30 nm citrate-stabilized spherical AgNPs (10 and 40 μg/mL). Intracellular aqueous extracts, organic extracts and extracellular culture medium were analysed to provide an integrated view of the cellular metabolic response. The specific metabolite variations, highlighted through multivariate analysis and confirmed by spectral integration, suggested that HaCaT cells exposed to AgNPs displayed upregulated glutathione-based antioxidant protection, increased glutaminolysis, downregulated tricarboxylic acid (TCA) cycle activity, energy depletion and cell membrane modification. Importantly, most metabolic changes were apparent in cells exposed to a concentration of AgNPs which did not affect cell viability at significant levels, thus underlying the sensitivity of NMR metabolomics to detect early biochemical events, even in the absence of a clear cytotoxic response. It can be concluded that NMR metabolomics is an important new tool in the field of in vitro nanotoxicology. Copyright © 2015 Elsevier Inc. All rights reserved.

  13. Cellular interactions of a lipid-based nanocarrier model with human keratinocytes: Unravelling transport mechanisms.

    Science.gov (United States)

    Silva, Elisabete; Barreiros, Luísa; Segundo, Marcela A; Costa Lima, Sofia A; Reis, Salette

    2017-04-15

    Knowledge of delivery system transport through epidermal cell monolayer is vital to improve skin permeation and bioavailability. Recently, nanostructured lipid carriers (NLCs) have gained great attention for transdermal delivery due to their biocompatibility, high drug payload, occlusive properties and skin hydration effect. However, the nanocarriers transport related mechanisms in epidermal epithelial cells are not yet understood. In this research, the internalization and transport pathways of the NLCs across the epidermal epithelial cell monolayer (HaCaT cells) were investigated. The 250nm sized witepsol/miglyol NLCs, prepared by hot homogenization had reduced cytotoxicity and no effect on the integrity of cell membrane in human HaCaT keratinocytes. The internalization was time-, concentration- and energy-dependent, and the uptake of NLCs was a vesicle-mediated process by macropinocytosis and clathrin-mediated pathways. 3% of NLCs were found at the apical membrane side of the HaCaT monolayer through exocytosis mechanism. Additionally, the endoplasmic reticulum, Golgi apparatus and microtubules played crucial roles in the transport of NLCs out of HaCaT cells. NLCs were transported intact across the human keratinocytes monolayer, without disturbing the tight junction's structure. From the transcytosis data only approximately 12% of the internalized NLCs were passed from the apical to the basolateral side. The transcytosis of NLCs throughout the HaCaT cell monolayer towards the basolateral membrane side requires the involvement of the endoplasmic reticulum, Golgi apparatus and microtubules. Our findings may contribute to a systematic understanding of NLCs transport across epidermal epithelial cell monolayers and their optimization for clinical transdermal application. Transdermal drug delivery is a challenging and growing area of clinical application. Lipid nanoparticles such as nanostructured lipid carriers (NLCs) have gained wide interest for transdermal drug

  14. Two-dimensional NMR spectrometry

    International Nuclear Information System (INIS)

    Farrar, T.C.

    1987-01-01

    This article is the second in a two-part series. In part one (ANALYTICAL CHEMISTRY, May 15) the authors discussed one-dimensional nuclear magnetic resonance (NMR) spectra and some relatively advanced nuclear spin gymnastics experiments that provide a capability for selective sensitivity enhancements. In this article and overview and some applications of two-dimensional NMR experiments are presented. These powerful experiments are important complements to the one-dimensional experiments. As in the more sophisticated one-dimensional experiments, the two-dimensional experiments involve three distinct time periods: a preparation period, t 0 ; an evolution period, t 1 ; and a detection period, t 2

  15. Quasi-two-dimensional holography

    International Nuclear Information System (INIS)

    Kutzner, J.; Erhard, A.; Wuestenberg, H.; Zimpfer, J.

    1980-01-01

    The acoustical holography with numerical reconstruction by area scanning is memory- and time-intensive. With the experiences by the linear holography we tried to derive a scanning for the evaluating of the two-dimensional flaw-sizes. In most practical cases it is sufficient to determine the exact depth extension of a flaw, whereas the accuracy of the length extension is less critical. For this reason the applicability of the so-called quasi-two-dimensional holography is appropriate. The used sound field given by special probes is divergent in the inclined plane and light focussed in the perpendicular plane using cylindrical lenses. (orig.) [de

  16. Isolation, identification, and pathological effects of beach sand bacterial extract on human skin keratinocytes in vitro

    Directory of Open Access Journals (Sweden)

    Fazli Subhan

    2018-01-01

    Full Text Available Background Beaches are recreational spots for people. However, beach sand contains harmful microbes that affect human health, and there are no established methods for either sampling and identifying beach-borne pathogens or managing the quality of beach sand. Method This study was conducted with the aim of improving human safety at beaches and augmenting the quality of the beach experience. Beach sand was used as a resource to isolate bacteria due to its distinctive features and the biodiversity of the beach sand biota. A selected bacterial isolate termed FSRS was identified as Pseudomonas stutzeri using 16S rRNA sequencing and phylogenetic analysis, and the sequence was deposited in the NCBI GenBank database under the accession number MF599548. The isolated P. stutzeri bacterium was cultured in Luria–Bertani growth medium, and a crude extract was prepared using ethyl acetate to examine the potential pathogenic effect of P. stutzeri on human skin. A human skin keratinocyte cell line (HaCaT was used to assess cell adhesion, cell viability, and cell proliferation using a morphological analysis and a WST-1 assay. Result The crude P. stutzeri extract inhibited cell adhesion and decreased cell viability in HaCaT cells. We concluded that the crude extract of P. stutzeri FSRS had a strong pathological effect on human skin cells. Discussion Beach visitors frequently get skin infections, but the exact cause of the infections is yet to be determined. The beach sand bacterium P. stutzeri may, therefore, be responsible for some of the dermatological problems experienced by people visiting the beach.

  17. Influence of ion implantation on the adhesion and grow of human keratinocytes

    International Nuclear Information System (INIS)

    Walachova, K.; Svorcik, V.; Dvorakova, B.; Vogtova, D.

    1999-01-01

    Interaction of keratinocytes with polymer modified by ion implantation was studied with the possibility of cultivate these cells for regeneration of dermal cover, for example, heavy burned persons. The modification on polyethylene (PE) with 100 μm thickness was processed by implantation the Ar + ions with the energy 63 keV and Xe + ions with the energy 156 keV. Some characteristics of superficial modified layers and influence of ion implantation on the adhesion and proliferation of keratinocytes were studied

  18. Tumor necrosis factor beta and ultraviolet radiation are potent regulators of human keratinocyte ICAM-1 expression

    International Nuclear Information System (INIS)

    Krutmann, J.; Koeck, A.S.; Schauer, E.; Parlow, F.; Moeller, A.K.; Kapp, A.; Foerster, E.S.; Schoepf, E.L.; Luger, T.A.

    1990-01-01

    Intercellular adhesion molecule-1 (ICAM-1) functions as a ligand of leukocyte function-associated antigen-1 (LFA-1), as well as a receptor for human picorna virus, and its regulation thus affects various immunologic and inflammatory reactions. The weak, constitutive ICAM-1 expression on human keratinocytes (KC) can be up-regulated by cytokines such as interferon-gamma (IFN gamma) and tumor necrosis factor alpha (TNF alpha). In order to further examine the regulation of KC ICAM-1 expression, normal human KC or epidermoid carcinoma cells (KB) were incubated with different cytokines and/or exposed to ultraviolet (UV) radiation. Subsequently, ICAM-1 expression was monitored cytofluorometrically using a monoclonal anti-ICAM-1 antibody. Stimulation of cells with recombinant human (rh) interleukin (IL) 1 alpha, rhIL-4, rhIL-5, rhIL-6, rh granulocyte/macrophage colony-stimulating factor (GM-CSF), rh interferon alpha (rhIFN alpha), and rh transforming growth factor beta (TGF beta) did not increase ICAM-1 surface expression. In contrast, rhTNF beta significantly up-regulated ICAM-1 expression in a time- and dose-dependent manner. Moreover, the combination of rhTNF beta with rhIFN gamma increased the percentage of ICAM-1-positive KC synergistically. This stimulatory effect of rhTNF beta was further confirmed by the demonstration that rhTNF beta was capable of markedly enhancing ICAM-1 mRNA expression in KC. Finally, exposure of KC in vitro to sublethal doses of UV radiation (0-100 J/m2) prior to cytokine (rhIFN tau, rhTNF alpha, rhTNF beta) stimulation inhibited ICAM-1 up-regulation in a dose-dependent fashion. These studies identify TNF beta and UV light as potent regulators of KC ICAM-1 expression, which may influence both attachment and detachment of leukocytes and possibly viruses to KC

  19. Two-dimensional metamaterial optics

    International Nuclear Information System (INIS)

    Smolyaninov, I I

    2010-01-01

    While three-dimensional photonic metamaterials are difficult to fabricate, many new concepts and ideas in the metamaterial optics can be realized in two spatial dimensions using planar optics of surface plasmon polaritons. In this paper we review recent progress in this direction. Two-dimensional photonic crystals, hyperbolic metamaterials, and plasmonic focusing devices are demonstrated and used in novel microscopy and waveguiding schemes

  20. Protection against 2-chloroethyl ethyl sulfide (CEES) - induced cytotoxicity in human keratinocytes by an inducer of the glutathione detoxification pathway

    International Nuclear Information System (INIS)

    Abel, Erika L.; Bubel, Jennifer D.; Simper, Melissa S.; Powell, Leslie; McClellan, S. Alex; Andreeff, Michael; MacLeod, Michael C.; DiGiovanni, John

    2011-01-01

    Sulfur mustard (SM or mustard gas) was first used as a chemical warfare agent almost 100 years ago. Due to its toxic effects on the eyes, lungs, and skin, and the relative ease with which it may be synthesized, mustard gas remains a potential chemical threat to the present day. SM exposed skin develops fluid filled bullae resulting from potent cytotoxicity of cells lining the basement membrane of the epidermis. Currently, there are no antidotes for SM exposure; therefore, chemopreventive measures for first responders following an SM attack are needed. Glutathione (GSH) is known to have a protective effect against SM toxicity, and detoxification of SM is believed to occur, in part, via GSH conjugation. Therefore, we screened 6 potential chemopreventive agents for ability to induce GSH synthesis and protect cultured human keratinocytes against the SM analog, 2-chloroethyl ethyl sulfide (CEES). Using NCTC2544 human keratinocytes, we found that both sulforaphane and methyl-2-cyano-3,12-dioxooleana-1,9-dien-28-oate (CDDO-Me) stimulated nuclear localization of Nrf2 and induced expression of the GSH synthesis gene, GCLM. Additionally, we found that treatment with CDDO-Me elevated reduced GSH content of NCTC2544 cells and preserved their viability by ∼ 3-fold following exposure to CEES. Our data also suggested that CDDO-Me may act additively with 2,6-dithiopurine (DTP), a nucleophilic scavenging agent, to increase the viability of keratinocytes exposed to CEES. These results suggest that CDDO-Me is a promising chemopreventive agent for SM toxicity in the skin. - Highlights: → CDDO-Me treatment increased intracellular GSH in human keratinocytes. → CDDO-Me increased cell viability following exposure to the half-mustard, CEES. → The cytoprotective effect of CDDO-Me was likely due to scavenging with endogenous GSH.

  1. Radiation-induced genomic instability is associated with DNA methylation changes in cultured human keratinocytes

    International Nuclear Information System (INIS)

    Kaup, Sahana; Grandjean, Valerie; Mukherjee, Rajarshi; Kapoor, Aparna; Keyes, Edward; Seymour, Colin B.; Mothersill, Carmel E.; Schofield, Paul N.

    2006-01-01

    The mechanism by which radiation-induced genomic instability is initiated, propagated and effected is currently under intense scrutiny. We have investigated the potential role of altered genomic methylation patterns in the cellular response to irradiation and have found evidence for widespread dysregulation of CpG methylation persisting up to 20 population doublings post-irradiation. Similar effects are seen with cells treated with medium from irradiated cells (the 'bystander effect') rather than subjected to direct irradiation. Using an arbitrarily primed methylation sensitive PCR screening method we have demonstrated that irradiation causes reproducible alterations in the methylation profile of a human keratinocyte cell line, HPV-G, and have further characterised one of these sequences as being a member of a retrotransposon element derived sequence family on chromosome 7; MLT1A. Multiple changes were also detected in the screen, which indicate that although the response of cells is predominantly hypermethylation, specific hypomethylation occurs as well. Sequence specific changes are also reported in the methylation of the pericentromeric SAT2 satellite sequence. This is the first demonstration that irradiation results in the induction of heritable methylation changes in mammalian cells, and provides a link between the various non-radiological instigators of genomic instability, the perpetuation of the unstable state and several of its manifestations

  2. The radiosensitivity of human keratinocytes: influence of activated c-H-ras oncogene expression and tumorigenicity

    International Nuclear Information System (INIS)

    Mendonca, M.S.; Redpath, J.L.; Stanbridge, E.J.

    1991-01-01

    The authors investigated γ-ray sensitivity of several activated c-H-ras (EJ) containing clones established after transfection of the spontaneously immortalized non-tumorigenic human keratinocyte cell line HaCaT. The clones were grouped according to tumorigenic potential after subcutaneous injection into nude mice, and fell into three classes: Class I clones A-4 and I-6 are non-tumorigenic and express very low levels of c-H-ras mRNA and no mutated ras protein (p 21 ); Class II clones I-5 and I-7 grow to large (benign) epidermal cysts, express intermediate to high c-H-ras mRNA and variable levels of mutated ras p 21 protein with clone I-5 expressing little and clone I-7 expressing high levels of p 21 ; Class III clones II-3 and II-4 grow to solid squamous cell carcinomas, express high c-H-ras mRNA and high level of mutated p 21 ras protein similar to clone I-7. Comparison of single-hit multitarget or linear-quadratic survival curve parameters, and survival at 2Gy (S 2 ) indicate no general correlation with either activated c-H-ras expression level or tumorigenic potential, and increased radioresistance. (author)

  3. Postirradiation expression of lethal mutations in an immortalized human keratinocyte cell line

    International Nuclear Information System (INIS)

    O'Reilly, S.; Mothersill, C.; Seymour, C.B.

    1994-01-01

    The quantification of the extent of delayed cell death and the rate and pattern of its occurrence in relation to the cell division cycle is important in radiotherapy and also in radiation transformation studies related to protection and dose limits. Here the numbers of lethal mutations occurring over 45 population doublings (clonal expansion to about 10 13 cells per cell originally surviving irradiation) was measured in an HPV 16 immortalized human keratinocyte cell lines used for transformation studies. The results showed that when postirradiation (dose range 1-6 Gy) growth curves were constructed, the difference in slopes could be accounted for entirely by correcting for the non-clonogenic fraction in the cell count, excluding a longer cell generation time as an explanation. When the cell loss was examined over the entire growth period of 6 weeks (about 45 doublings of the cell population), it was found to be dose dependent for the first two passages, but then to become more independent of dose. The results allow a time/cell generation dependent factor to be derived for the cell line and used in survival curve equations where effects of radiation are being measured at times distant from the original exposure. (author)

  4. The effect of melanin on the bystander effect in human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Mosse, I. [Institute of Genetics and Cytology of the National Academy of Sciences, Academicheskaya Str. 27, Minsk (Belarus)]. E-mail: i.mosse@igc.bas-net.by; Marozik, P. [Institute of Genetics and Cytology of the National Academy of Sciences, Academicheskaya Str. 27, Minsk (Belarus); Radiation and Environmental Science Centre, DIT, Dublin 8 (Ireland); Seymour, C. [Department of Medical Physics and Applied Radiation Sciences, McMaster University, Hamilton, Ont. (Canada); Mothersill, C. [Department of Medical Physics and Applied Radiation Sciences, McMaster University, Hamilton, Ont. (Canada)

    2006-05-11

    The influence of melanin on radiation-induced bystander effects has been studied. Melanin is known to be a natural substance with proved radioprotective properties in different organisms and cell lines. It is non-toxic and is effective against acute and chronic irradiation. The lower the radiation dose, the higher the relative impact of melanin protection. In this study influence of melanin on human keratinocytes (HPV-G cells) has been studied using the colony-forming assay. We have shown that bystander donor medium from 0.5 Gy irradiated cells when transferred to unirradiated cells, caused almost the same effect as direct irradiation. Melanin increased the colony-forming ability of bystander recipient cells when it was added into culture medium before irradiation. The effect of melanin added after irradiation was to produce less protection in both the directly irradiated and bystander medium treated groups. The absorption spectrum of the filtered medium is identical to one of the intact culture medium showing that melanin was not present in filtered medium. Thus, it cannot protect recipient cells but reduces the amount of the bystander effect. It is concluded that melanin added before irradiation effectively decreased the radiation dose. The reduction of the impact of the bystander signal on recipient cells when melanin was added to the donor medium after harvest but before filtration, may mean that the bystander signal has a physical component as melanin can absorb all types of physical energy.

  5. Toll like receptors gene expression of human keratinocytes cultured of severe burn injury.

    Science.gov (United States)

    Cornick, Sarita Mac; Noronha, Silvana Aparecida Alves Corrêa de; Noronha, Samuel Marcos Ribeiro de; Cezillo, Marcus V B; Ferreira, Lydia Masako; Gragnani, Alfredo

    2014-01-01

    To evaluate the expression profile of genes related to Toll Like Receptors (TLR) pathways of human Primary Epidermal keratinocytes of patients with severe burns. After obtaining viable fragments of skin with and without burning, culture hKEP was initiated by the enzymatic method using Dispase (Sigma-Aldrich). These cells were treated with Trizol(r) (Life Technologies) for extraction of total RNA. This was quantified and analyzed for purity for obtaining cDNA for the analysis of gene expression using specific TLR pathways PCR Arrays plates (SA Biosciences). After the analysis of gene expression we found that 21% of these genes were differentially expressed, of which 100% were repressed or hyporegulated. Among these, the following genes (fold decrease): HSPA1A (-58), HRAS (-36), MAP2K3 (-23), TOLLIP (-23), RELA (-18), FOS (-16), and TLR1 (-6.0). This study contributes to the understanding of the molecular mechanisms related to TLR pathways and underlying wound infection caused by the burn. Furthermore, it may provide new strategies to restore normal expression of these genes and thereby change the healing process and improve clinical outcome.

  6. Innate and adaptive immunity gene expression of human keratinocytes cultured of severe burn injury.

    Science.gov (United States)

    Noronha, Silvana Aparecida Alves Corrêa de; Noronha, Samuel Marcos Ribeiro de; Lanziani, Larissa Elias; Ferreira, Lydia Masako; Gragnani, Alfredo

    2014-01-01

    Evaluate the expression profile of genes related to Innate and Adaptive Immune System (IAIS) of human Primary Epidermal keratinocytes (hPEKP) of patients with severe burns. After obtaining viable fragments of skin with and without burning, culture hKEP was initiated by the enzymatic method using Dispase (Sigma-Aldrich). These cells were treated with Trizol(r) (Life Technologies) for extraction of total RNA. This was quantified and analyzed for purity for obtaining cDNA for the analysis of gene expression using specific IAIS PCR Arrays plates (SA Biosciences). After the analysis of gene expression we found that 63% of these genes were differentially expressed, of which 77% were repressed and 23% were hyper-regulated. Among these, the following genes (fold increase or decrease): IL8 (41), IL6 (32), TNF (-92), HLA-E (-86), LYS (-74), CCR6 (- 73), CD86 (-41) and HLA-A (-35). This study contributes to the understanding of the molecular mechanisms underlying wound infection caused by the burn. Furthermore, it may provide new strategies to restore normal expression of these genes and thereby change the healing process and improve clinical outcome.

  7. The effect of melanin on the bystander effect in human keratinocytes

    International Nuclear Information System (INIS)

    Mosse, I.; Marozik, P.; Seymour, C.; Mothersill, C.

    2006-01-01

    The influence of melanin on radiation-induced bystander effects has been studied. Melanin is known to be a natural substance with proved radioprotective properties in different organisms and cell lines. It is non-toxic and is effective against acute and chronic irradiation. The lower the radiation dose, the higher the relative impact of melanin protection. In this study influence of melanin on human keratinocytes (HPV-G cells) has been studied using the colony-forming assay. We have shown that bystander donor medium from 0.5 Gy irradiated cells when transferred to unirradiated cells, caused almost the same effect as direct irradiation. Melanin increased the colony-forming ability of bystander recipient cells when it was added into culture medium before irradiation. The effect of melanin added after irradiation was to produce less protection in both the directly irradiated and bystander medium treated groups. The absorption spectrum of the filtered medium is identical to one of the intact culture medium showing that melanin was not present in filtered medium. Thus, it cannot protect recipient cells but reduces the amount of the bystander effect. It is concluded that melanin added before irradiation effectively decreased the radiation dose. The reduction of the impact of the bystander signal on recipient cells when melanin was added to the donor medium after harvest but before filtration, may mean that the bystander signal has a physical component as melanin can absorb all types of physical energy

  8. Blockage of JNK pathway enhances arsenic trioxide-induced apoptosis in human keratinocytes

    International Nuclear Information System (INIS)

    Huang, H.-S.; Liu, Z.-M.; Hong, D.-Y.

    2010-01-01

    Arsenic is well known as a carcinogen predisposing humans to some severe diseases and also as an effective medicine for treating acute promyelocytic leukemia, syphilis, and psoriasis. Multiple active mechanisms, including cell cycle arrest and apoptosis, have been proposed in therapy; however, the opposing effects of arsenic remain controversial. Our previous study found that arsenic trioxide (ATO)-induced activation of p21 WAF1/CIP1 (p21) led to A431 cell death through the antagonistic effects of the signaling of ERK1/2 and JNK1. In the current study, the inhibitory effects of JNK1 on ATO-induced p21 expression were explored. Over-expression of JNK1 in A431 cells could inhibit p21 expression, which was associated with HDAC1 and TGIF. Using the GST pull-down assay and fluorescence resonance energy transfer analysis, N-terminal domain (amino acids 1-108) of TGIF, critical to its binding with c-Jun, was found. Using reporter assays, requirement of the C-terminal domain (amino acids 138-272) of TGIF to suppress ATO-induced p21 expression was observed. Thus, the domains of TGIF that carried out its inhibitory effects on p21 were identified. Finally, treatment with JNK inhibitor SP600125 could enhance ATO-induced apoptosis of HaCaT keratinocytes by using flow cytometry.

  9. How Does Chronic Cigarette Smoke Exposure Affect Human Skin? A Global Proteomics Study in Primary Human Keratinocytes.

    Science.gov (United States)

    Rajagopalan, Pavithra; Nanjappa, Vishalakshi; Raja, Remya; Jain, Ankit P; Mangalaparthi, Kiran K; Sathe, Gajanan J; Babu, Niraj; Patel, Krishna; Cavusoglu, Nükhet; Soeur, Jeremie; Pandey, Akhilesh; Roy, Nita; Breton, Lionel; Chatterjee, Aditi; Misra, Namita; Gowda, Harsha

    2016-11-01

    Cigarette smoking has been associated with multiple negative effects on human skin. Long-term physiological effects of cigarette smoke are through chronic and not acute exposure. Molecular alterations due to chronic exposure to cigarette smoke remain unclear. Primary human skin keratinocytes chronically exposed to cigarette smoke condensate (CSC) showed a decreased wound-healing capacity with an increased expression of NRF2 and MMP9. Using quantitative proteomics, we identified 4728 proteins, of which 105 proteins were overexpressed (≥2-fold) and 41 proteins were downregulated (≤2-fold) in primary skin keratinocytes chronically exposed to CSC. We observed an alteration in the expression of several proteins involved in maintenance of epithelial barrier integrity, including keratin 80 (5.3 fold, p value 2.5 × 10 -7 ), cystatin A (3.6-fold, p value 3.2 × 10 -3 ), and periplakin (2.4-fold, p value 1.2 × 10 -8 ). Increased expression of proteins associated with skin hydration, including caspase 14 (2.2-fold, p value 4.7 × 10 -2 ) and filaggrin (3.6-fold, p value 5.4 × 10 -7 ), was also observed. In addition, we report differential expression of several proteins, including adipogenesis regulatory factor (2.5-fold, p value 1.3 × 10 -3 ) and histone H1.0 (2.5-fold, p value 6.3 × 10 -3 ) that have not been reported earlier. Bioinformatics analyses demonstrated that proteins differentially expressed in response to CSC are largely related to oxidative stress, maintenance of skin integrity, and anti-inflammatory responses. Importantly, treatment with vitamin E, a widely used antioxidant, could partially rescue adverse effects of CSC exposure in primary skin keratinocytes. The utility of antioxidant-based new dermatological formulations in delaying or preventing skin aging and oxidative damages caused by chronic cigarette smoke exposure warrants further clinical investigations and multi-omics research.

  10. Dynamic changes in nicotinamide pyridine dinucleotide content in normal human epidermal keratinocytes and their effect on retinoic acid biosynthesis

    International Nuclear Information System (INIS)

    Pinkas-Sarafova, Adriana; Markova, N.G.; Simon, M.

    2005-01-01

    The function of many enzymes that regulate metabolism and transcription depends critically on the nicotinamide pyridine dinucleotides. To understand the role of NAD(P)(H) in physiology and pathophysiology, it is imperative to estimate both their amount and ratios in a given cell type. In human epidermis and in cultured epidermal keratinocytes, we found that the total dinucleotide content is in the low millimolar range. The dinucleotide pattern changes during proliferation and maturation of keratinocytes in culture. Differences in the concentrations of NAD(P)(H) of 1.5- to 12-fold were observed. This resulted in alteration of the NAD(P)H/NAD(P) ratio, which could impact the differential regulation of both transcriptional and metabolic processes. In support of this notion, we provide evidence that the two-step oxidation of retinol to retinoic acid, a nuclear hormone critical for epidermal homeostasis, can be regulated by the relative physiological amounts of the pyridine dinucleotides

  11. Six1 overexpression at early stages of HPV16-mediated transformation of human keratinocytes promotes differentiation resistance and EMT

    International Nuclear Information System (INIS)

    Xu, Hanwen; Pirisi, Lucia; Creek, Kim E.

    2015-01-01

    Previous studies in our laboratory discovered that SIX1 mRNA expression increased during in vitro progression of HPV16-immortalized human keratinocytes (HKc/HPV16) toward a differentiation-resistant (HKc/DR) phenotype. In this study, we explored the role of Six1 at early stages of HPV16-mediated transformation by overexpressing Six1 in HKc/HPV16. We found that Six1 overexpression in HKc/HPV16 increased cell proliferation and promoted cell migration and invasion by inducing epithelial–mesenchymal transition (EMT). Moreover, the overexpression of Six1 in HKc/HPV16 resulted in resistance to serum and calcium-induced differentiation, which is the hallmark of the HKc/DR phenotype. Activation of MAPK in HKc/HPV16 overexpressing Six1 is linked to resistance to calcium-induced differentiation. In conclusion, this study determined that Six1 overexpression resulted in differentiation resistance and promoted EMT at early stages of HPV16-mediated transformation of human keratinocytes. - Highlights: • Six1 expression increases during HPV16-mediated transformation. • Six1 overexpression causes differentiation resistance in HPV16-immortalized cells. • Six1 overexpression in HPV16-immortalized keratinocytes activates MAPK. • Activation of MAPK promotes EMT and differentiation resistance. • Six1 overexpression reduces Smad-dependent TGF-β signaling

  12. Influence of acidic pH on keratinocyte function and re-epithelialisation of human in vitro wounds.

    Science.gov (United States)

    Lönnqvist, Susanna; Emanuelsson, Peter; Kratz, Gunnar

    2015-01-01

    Chronic wounds are one of the greatest challenges for the healthcare system. Today, a plethora of dressings are used in the treatment of these wounds, each with specific influence on the wound environment. Due to differences in the permeability of the dressings the use will result in differences in the pH balance in the wound bed. However, little is known about how changes in the pH in the wound environment affect the different phases of the healing process. The aim of the present study was to investigate the effects of acidic pH on the regeneration phase by studying keratinocyte function in vitro and re-epithelialisation in an in vitro model of human skin. In vitro assays showed reduced viability and migration rates in human keratinocytes when pH was lowered. Real time PCR revealed differential expression of genes related to wound healing and environmental impairment. Tissue culture showed no re-epithelialisation of wounds subjected to pH 5.0 and moderate re-epithelialisation at pH 6.0, compared to controls at pH 7.4. The results indicate that lowering pH down to pH 5.0 in wounds is counterproductive in aspect of keratinocyte function which is crucial for successful wound healing.

  13. Ski protein levels increase during in vitro progression of HPV16-immortalized human keratinocytes and in cervical cancer

    International Nuclear Information System (INIS)

    Chen, Yi; Pirisi, Lucia; Creek, Kim E.

    2013-01-01

    We compared the levels of the Ski oncoprotein, an inhibitor of transforming growth factor-beta (TGF-β) signaling, in normal human keratinocytes (HKc), HPV16 immortalized HKc (HKc/HPV16), and differentiation resistant HKc/HPV16 (HKc/DR) in the absence and presence of TGF-β. Steady-state Ski protein levels increased in HKc/HPV16 and even further in HKc/DR, compared to HKc. TGF-β treatment of HKc, HKc/HPV16, and HKc/DR dramatically decreased Ski. TGF-β-induced Ski degradation was delayed in HKc/DR. Ski and phospho-Ski protein levels are cell cycle dependent with maximal Ski expression and localization to centrosomes and mitotic spindles during G2/M. ShRNA knock down of Ski in HKc/DR inhibited cell proliferation. More intense nuclear and cytoplasmic Ski staining and altered Ski localization were found in cervical cancer samples compared to adjacent normal tissue in a cervical cancer tissue array. Overall, these studies demonstrate altered Ski protein levels, degradation and localization in HPV16-transformed human keratinocytes and in cervical cancer. - Highlights: • Ski oncoprotein levels increase during progression of HPV16-transformed cells. • Ski and phospho-Ski protein levels are cell cycle dependent. • Ski knock-down in HPV16-transformed keratinocytes inhibited cell proliferation. • Cervical cancer samples overexpress Ski

  14. Incorporation and distribution of dihomo-gamma-linolenic acid, arachidonic acid, and eicosapentaenoic acid in cultured human keratinocytes

    International Nuclear Information System (INIS)

    Punnonen, K.; Puustinen, T.; Jansen, C.T.

    1986-01-01

    Human keratinocytes in culture were labelled with 14 C-dihomo-gamma-linolenic acid, 14 C-arachidonic acid or 14 C-eicosapentaenoic acid. All three eicosanoid precursor fatty acids were effectively incorporated into the cells. In phospholipids most of the radioactivity was recovered, in neutral lipids a substantial amount, and as free unesterified fatty acids only a minor amount. Most of the radioactivity was found in phosphatidylethanolamine which was also the major phospholipid as measured by phosphorous assay. The incorporation of dihomo-gamma-linolenic acid and arachidonic acid into lipid subfractions was essentially similar. Eicosapentaenoic acid was, however, much less effectively incorporated into phosphatidylinositol + phosphatidylserine and, correspondingly, more effectively into triacylglycerols as compared to the two other precursor fatty acids. Once incorporated, the distribution of all three precursor fatty acids was relatively stable, and only minor amounts of fatty acids were released into the culture medium during short term culture (two days). Our study demonstrates that eicosanoid precursor fatty acids are avidly taken up by human keratinocytes and esterified into membrane lipids. The clinical implication of this finding is that dietary manipulations might be employed to cause changes in the fatty acid composition of keratinocytes

  15. Activation of endogenous opioid gene expression in human keratinocytes and fibroblasts by pulsed radiofrequency energy fields

    Directory of Open Access Journals (Sweden)

    Moffett J

    2012-09-01

    Full Text Available John Moffett,1 Linley M Fray,1 Nicole J Kubat21Life Science Department, 2Independent Consultant, Regenesis Biomedical Inc, Scottsdale, AZ, USABackground: Pulsed radiofrequency energy (PRFE fields are being used increasingly for the treatment of pain arising from dermal trauma. However, despite their increased use, little is known about the biological and molecular mechanism(s responsible for PRFE-mediated analgesia. In general, current therapeutics used for analgesia target either endogenous factors involved in inflammation, or act on endogenous opioid pathways.Methods and Results: Using cultured human dermal fibroblasts (HDF and human epidermal keratinocytes (HEK, we investigated the effect of PRFE treatment on factors, which are involved in modulating peripheral analgesia in vivo. We found that PRFE treatment did not inhibit cyclooxygenase enzyme activity, but instead had a positive effect on levels of endogenous opioid precursor mRNA (proenkephalin, pro-opiomelanocortin, prodynorphin and corresponding opioid peptide. In HEK cells, increases in opioid mRNA were dependent, at least in part, on endothelin-1. In HDF cells, additional pathways also appear to be involved. PRFE treatment was also followed by changes in endogenous expression of several cytokines, including increased levels of interleukin-10 mRNA and decreased levels of interleukin-1β mRNA in both cell types.Conclusion: These findings provide a new insight into the molecular mechanism underlying PRFE-mediated analgesia reported in the clinical setting.Keywords: peripheral analgesia, endogenous opioids, endothelin-1, endothelin receptor A, endothelin receptor B, pulsed radiofrequency energy field, cyclooxygenase

  16. Lysophosphatidic acid induces expression of genes in human oral keratinocytes involved in wound healing.

    Science.gov (United States)

    Thorlakson, Hong Huynh; Engen, Stian Andre; Schreurs, Olav; Schenck, Karl; Blix, Inger Johanne Schytte

    2017-08-01

    Epithelial cells participate in wound healing by covering wounds, but also as important mediators of wound healing processes. Topical application of the phospholipid growth factor lysophosphatidic acid (LPA) accelerates dermal wound healing and we hypothesized that LPA can play a role in human oral wound healing through its effects on human oral keratinocytes (HOK). HOK were isolated from gingival biopsies and exposed to LPA. The LPA receptor profile, signal transduction pathways, gene expression and secretion of selected cytokines were analyzed. HOK expressed the receptors LPA 1 , LPA 5 and LPA 6 and LPA activated the ERK1/2, JNK and p38 intracellular pathways, substantiated by secretion of IL-6 and IL-8. The early (2h) and intermediate (6h) gene expression profiles of HOK after LPA treatment showed a wide array of regulated genes. The majority of the strongest upregulated genes were related to chemotaxis and inflammation, and became downregulated after 6h. At 6h, genes coding for factors involved in extracellular matrix remodeling and re-epithelialization became highly expressed. IL-36γ, not earlier known to be regulated by LPA, was strongly transcribed and translated but not secreted. After stimulation with LPA, HOK responded by regulating factors and genes that are essential in wound healing processes. As LPA is found in saliva and is released by activated cells after wounding, our results indicate that LPA has a favorable physiological role in oral wound healing. This may further point towards a beneficial role for application of LPA on oral surgical or chronic wounds. Copyright © 2017 Elsevier Ltd. All rights reserved.

  17. Early Gene Expression in Wounded Human Keratinocytes Revealed by DNA Microarray Analysis

    Directory of Open Access Journals (Sweden)

    Pascal Barbry

    2006-04-01

    Full Text Available Wound healing involves several steps: spreading of the cells, migration and proliferation. We have profiled gene expression during the early events of wound healing in normal human keratinocytes with a home-made DNA microarray containing about 1000 relevant human probes. An original wounding machine was used, that allows the wounding of up to 40% of the surface of a confluent monolayer of cultured cells grown on a Petri dish (compared with 5% with a classical ‘scratch’ method. The two aims of the present study were: (a to validate a limited number of genes by comparing the expression levels obtained with this technique with those found in the literature; (b to combine the use of the wounding machine with DNA microarray analysis for large-scale detection of the molecular events triggered during the early stages of the wound-healing process. The time-courses of RNA expression observed at 0.5, 1.5, 3, 6 and 15 h after wounding for genes such as c-Fos, c-Jun, Egr1, the plasminogen activator PLAU (uPA and the signal transducer and transcription activator STAT3, were consistent with previously published data. This suggests that our methodologies are able to perform quantitative measurement of gene expression. Transcripts encoding two zinc finger proteins, ZFP36 and ZNF161, and the tumour necrosis factor α-induced protein TNFAIP3, were also overexpressed after wounding. The role of the p38 mitogen-activated protein kinase (p38MAPK in wound healing was shown after the inhibition of p38 by SB203580, but our results also suggest the existence of surrogate activating pathways.

  18. Expression and purification of recombinant truncated human keratinocyte growth factor-1

    International Nuclear Information System (INIS)

    Deng Lin; Ma Jisheng; Liu Xiaoju; Wang Xiaojie; Li Xiaokun; Gong Shouliang; Wang Huiyan; Tian Haishan

    2010-01-01

    Objective: To construct the genetic engineering bacteria highly expressing 23 amino acids human keratinocyte growth factor-1 (rhKGF1 dest23 ) missing N terminal, and provide experimental data for development of new drug for treatment of oral mucositis after radiotherapy and chemotherapy. Methods: PCR was used to synthese 23 amino acids rhKGF1 dest23 missing N terminal and sumo gene fragments, and construct four kinds of recombinant prokaryotic expression vectors: pET22b-rhKGF1 dest23 , pET22b-sumo-rhKGF1 dest23 , pET3c-rhKGF1 dest23 and pET3c-sumo-rhKGF1 dest23 , then they were transformed into prokaryotic expression host bacteria: Rosetta (DE3) plysS, BL21 (DE3), BL21 (DE3) Star plysS, origima(DE3) and BL21AI, the best expression combination of plasmid and host strain of rhKGF1 dest23 protein was screened and purified by CM ion-exchange and heparin affinity chromatography and identified with Western blotting. Results: pET22b-rhKGF1 dest23 plasmid and the BL21AI host bacteria was the best combination of expression, after induced by IPTG and arabinose, the majority of recombinant protein was expressed in soluble form, accounting for about 12% of the total bacterial proteins. Its purity reached to more than 95% of the protein after two steps chromatography, then conformed with Western blotting. Conclusion: Human genetic engineering bacteria of KGF1 dest23 is successfully constructed and induced by IPTG and arabinose, then after CM weak cation exchange and heparin affinity chromatography, the purified rhKGF1 dest23 protein is obtained. (authors)

  19. Two-dimensional flexible nanoelectronics

    Science.gov (United States)

    Akinwande, Deji; Petrone, Nicholas; Hone, James

    2014-12-01

    2014/2015 represents the tenth anniversary of modern graphene research. Over this decade, graphene has proven to be attractive for thin-film transistors owing to its remarkable electronic, optical, mechanical and thermal properties. Even its major drawback--zero bandgap--has resulted in something positive: a resurgence of interest in two-dimensional semiconductors, such as dichalcogenides and buckled nanomaterials with sizeable bandgaps. With the discovery of hexagonal boron nitride as an ideal dielectric, the materials are now in place to advance integrated flexible nanoelectronics, which uniquely take advantage of the unmatched portfolio of properties of two-dimensional crystals, beyond the capability of conventional thin films for ubiquitous flexible systems.

  20. Two-dimensional topological photonics

    Science.gov (United States)

    Khanikaev, Alexander B.; Shvets, Gennady

    2017-12-01

    Originating from the studies of two-dimensional condensed-matter states, the concept of topological order has recently been expanded to other fields of physics and engineering, particularly optics and photonics. Topological photonic structures have already overturned some of the traditional views on wave propagation and manipulation. The application of topological concepts to guided wave propagation has enabled novel photonic devices, such as reflection-free sharply bent waveguides, robust delay lines, spin-polarized switches and non-reciprocal devices. Discrete degrees of freedom, widely used in condensed-matter physics, such as spin and valley, are now entering the realm of photonics. In this Review, we summarize the latest advances in this highly dynamic field, with special emphasis on the experimental work on two-dimensional photonic topological structures.

  1. Two-dimensional thermofield bosonization

    International Nuclear Information System (INIS)

    Amaral, R.L.P.G.; Belvedere, L.V.; Rothe, K.D.

    2005-01-01

    The main objective of this paper was to obtain an operator realization for the bosonization of fermions in 1 + 1 dimensions, at finite, non-zero temperature T. This is achieved in the framework of the real-time formalism of Thermofield Dynamics. Formally, the results parallel those of the T = 0 case. The well-known two-dimensional Fermion-Boson correspondences at zero temperature are shown to hold also at finite temperature. To emphasize the usefulness of the operator realization for handling a large class of two-dimensional quantum field-theoretic problems, we contrast this global approach with the cumbersome calculation of the fermion-current two-point function in the imaginary-time formalism and real-time formalisms. The calculations also illustrate the very different ways in which the transmutation from Fermi-Dirac to Bose-Einstein statistics is realized

  2. Two-dimensional critical phenomena

    International Nuclear Information System (INIS)

    Saleur, H.

    1987-09-01

    Two dimensional critical systems are studied using transformation to free fields and conformal invariance methods. The relations between the two approaches are also studied. The analytical results obtained generally depend on universality hypotheses or on renormalization group trajectories which are not established rigorously, so numerical verifications, mainly using the transfer matrix approach, are presented. The exact determination of critical exponents; the partition functions of critical models on toruses; and results as the critical point is approached are discussed [fr

  3. Two dimensional unstable scar statistics.

    Energy Technology Data Exchange (ETDEWEB)

    Warne, Larry Kevin; Jorgenson, Roy Eberhardt; Kotulski, Joseph Daniel; Lee, Kelvin S. H. (ITT Industries/AES Los Angeles, CA)

    2006-12-01

    This report examines the localization of time harmonic high frequency modal fields in two dimensional cavities along periodic paths between opposing sides of the cavity. The cases where these orbits lead to unstable localized modes are known as scars. This paper examines the enhancements for these unstable orbits when the opposing mirrors are both convex and concave. In the latter case the construction includes the treatment of interior foci.

  4. Finding two-dimensional peaks

    International Nuclear Information System (INIS)

    Silagadze, Z.K.

    2007-01-01

    Two-dimensional generalization of the original peak finding algorithm suggested earlier is given. The ideology of the algorithm emerged from the well-known quantum mechanical tunneling property which enables small bodies to penetrate through narrow potential barriers. We merge this 'quantum' ideology with the philosophy of Particle Swarm Optimization to get the global optimization algorithm which can be called Quantum Swarm Optimization. The functionality of the newborn algorithm is tested on some benchmark optimization problems

  5. The Effects of Antifungal Azoles on Inflammatory Cytokine Production in Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    K Zomorodian

    2008-04-01

    Full Text Available ABSTRACT: Introduction & Objective: Azoles drugs are being used successfully in treatment of fungal infections. Recently, immunosuppressive effects of some of these agents have been reported. Keratinocytes, as the major cells of the skin, have an important role in innate immunity against pathogenic agents. Considering the scanty of information about the effects of azoles on immune responces, this study was conducted to assess the expression and secretion of inflammatory cytokines in keratinocytes following treatment with azole drugs. Materials & Methods: This is an exprimental study conducted in in molecular biology division in Tehran University of Medical Sciences and Immunodermatology Department in Vienna Medical University. Primery keratinocytes were cultured and treated with different concentrations of fluconazole, itraconazole, ketoconazole and griseofulvin. Secreted IL1, IL6 and TNF-α by keratinocytes in culture supernatant were measured by quantitative enzyme immunoassay technique. Moreover, expression of the genes encoding IL1 and IL8 was evaluated by Real Time-PCR. Results: Treatment of keratinocytes with different concentrations of fluconazole and low concentration of ketoconazole resulted in decrease in IL1 secretion, but Itraconazole and griseofulvin did not show such an effect at the same concentrations. In addition, none of the examined drugs had an effect on secretion level of IL6 and TNF-α. Quantitative analysis of IL1 and IL8 encoding genes revealed that transcription on these genes might be suppressed following treatment with fluconazole or ketoconazole. Conclusion: Fluconazole and ketoconazole might modulate the expression and secretion of IL1 and IL8 and affect the direction of immune responses induced by keratinocytes

  6. The Antimicrobial Peptide Human Beta-Defensin-3 Is Induced by Platelet-Released Growth Factors in Primary Keratinocytes

    OpenAIRE

    Andreas Bayer; Justus Lammel; Mersedeh Tohidnezhad; Sebastian Lippross; Peter Behrendt; Tim Klüter; Thomas Pufe; Jochen Cremer; Holger Jahr; Franziska Rademacher; Regine Gläser; Jürgen Harder

    2017-01-01

    Platelet-released growth factors (PRGF) and its related clinically used formulations (e.g., Vivostat Platelet-Rich Fibrin (PRF?)) contain a variety of chemokines, cytokines, and growth factors and are therefore used to support healing of chronic, hard-to-heal, or infected wounds. Human beta-defensin-3 (hBD-3) is an antimicrobial peptide inducibly expressed in human keratinocytes especially upon wounding. The potent antimicrobial activity of hBD-3 together with its wound closure-promoting acti...

  7. Human papillomavirus type 59 immortalized keratinocytes express late viral proteins and infectious virus after calcium stimulation

    International Nuclear Information System (INIS)

    Lehr, Elizabeth E.; Qadadri, Brahim; Brown, Calla R.; Brown, Darron R.

    2003-01-01

    Human papillomavirus type 59 (HPV 59) is an oncogenic type related to HPV 18. HPV 59 was recently propagated in the athymic mouse xenograft system. A continuous keratinocyte cell line infected with HPV 59 was created from a foreskin xenograft grown in an athymic mouse. Cells were cultured beyond passage 50. The cells were highly pleomorphic, containing numerous abnormally shaped nuclei and mitotic figures. HPV 59 sequences were detected in the cells by DNA in situ hybridization in a diffuse nuclear distribution. Southern blots were consistent with an episomal state of HPV 59 DNA at approximately 50 copies per cell. Analysis of the cells using a PCR/reverse blot strip assay, which amplifies a portion of the L1 open reading frame, was strongly positive. Differentiation of cells in monolayers was induced by growth in F medium containing 2 mM calcium chloride for 10 days. Cells were harvested as a single tissue-like sheet, and histologic analysis revealed a four-to-six cell-thick layer. Transcripts encoding involucrin, a cornified envelope protein, and the E1-circumflexE4 and E1-circumflexE4-circumflexL1 viral transcripts were detected after several days of growth in F medium containing 2 mM calcium chloride. The E1-circumflexE4 and L1 proteins were detected by immunohistochemical analysis, and virus particles were seen in electron micrographs in a subset of differentiated cells. An extract of differentiated cells was prepared by vigorous sonication and was used to infect foreskin fragments. These fragments were implanted into athymic mice. HPV 59 was detected in the foreskin xenografts removed 4 months later by DNA in situ hybridization and PCR/reverse blot assay. Thus, the complete viral growth cycle, including production on infectious virus, was demonstrated in the HPV 59 immortalized cells grown in a simple culture system

  8. Factors affecting ultraviolet-A photon emission from β-irradiated human keratinocyte cells.

    Science.gov (United States)

    Le, M; Mothersill, C E; Seymour, C B; Ahmad, S B; Armstrong, A; Rainbow, A J; McNeill, F E

    2015-08-21

    The luminescence intensity of 340±5 nm photons emitted from HaCaT (human keratinocyte) cells was investigated using a single-photon-counting system during cellular exposure to (90)Y β-particles. Multiple factors were assessed to determine their influence upon the quantity and pattern of photon emission from β-irradiated cells. Exposure of 1 x 10(4) cells/5 mL to 703 μCi resulted in maximum UVA photoemission at 44.8 x 10(3)±2.5 x 10(3) counts per second (cps) from live HaCaT cells (background: 1-5 cps); a 16-fold increase above cell-free controls. Significant biophoton emission was achieved only upon stimulation and was also dependent upon presence of cells. UVA luminescence was measured for (90)Y activities 14 to 703 μCi where a positive relationship between photoemission and (90)Y activity was observed. Irradiation of live HaCaT cells plated at various densities produced a distinct pattern of emission whereby luminescence increased up to a maximum at 1 x 10(4) cells/5 mL and thereafter decreased. However, this result was not observed in the dead cell population. Both live and dead HaCaT cells were irradiated and were found to demonstrate different rates of photon emission at low β activities (⩽400 μCi). Dead cells exhibited greater photon emission rates than live cells which may be attributable to metabolic processes taking place to modulate the photoemissive effect. The results indicate that photon emission from HaCaT cells is perturbed by external stimulation, is dependent upon the activity of radiation delivered, the density of irradiated cells, and cell viability. It is postulated that biophoton emission may be modulated by a biological or metabolic process.

  9. Biocompatibility of polymer-infiltrated-ceramic-network (PICN) materials with Human Gingival Keratinocytes (HGKs).

    Science.gov (United States)

    Grenade, Charlotte; De Pauw-Gillet, Marie-Claire; Pirard, Catherine; Bertrand, Virginie; Charlier, Corinne; Vanheusden, Alain; Mainjot, Amélie

    2017-03-01

    Biocompatibility of polymer-infiltrated-ceramic-network (PICN) materials, a new class of CAD-CAM composites, is poorly explored in the literature, in particular, no data are available regarding Human Gingival Keratinocytes (HGK). The first objective of this study was to evaluate the in vitro biocompatibility of PICNs with HGKs in comparison with other materials typically used for implant prostheses. The second objective was to correlate results with PICN monomer release and indirect cytotoxicity. HGK attachment, proliferation and spreading on PICN, grade V titanium (Ti), yttrium zirconia (Zi), lithium disilicate glass-ceramic (eM) and polytetrafluoroethylene (negative control) discs were evaluated using a specific insert-based culture system. For PICN and eM samples, monomer release in the culture medium was quantified by high performance liquid chromatography and indirect cytotoxicity tests were performed. Ti and Zi exhibited the best results regarding HGK viability, number and coverage. eM showed inferior results while PICN showed statistically similar results to eM but also to Ti regarding cell number and to Ti and Zi regarding cell viability. No monomer release from PICN discs was found, nor indirect cytotoxicity, as for eM. The results confirmed the excellent behavior of Ti and Zi with gingival cells. Even if polymer based, PICN materials exhibited intermediate results between Ti-Zi and eM. These promising results could notably be explained by PICN high temperature-high pressure (HT-HP) innovative polymerization mode, as confirmed by the absence of monomer release and indirect cytotoxicity. Copyright © 2017 The Academy of Dental Materials. Published by Elsevier Ltd. All rights reserved.

  10. Cell cycle pathway dysregulation in human keratinocytes during chronic exposure to low arsenite.

    Science.gov (United States)

    Al-Eryani, Laila; Waigel, Sabine; Jala, Venkatakrishna; Jenkins, Samantha F; States, J Christopher

    2017-09-15

    Arsenic is naturally prevalent in the earth's crust and widely distributed in air and water. Chronic low arsenic exposure is associated with several cancers in vivo, including skin cancer, and with transformation in vitro of cell lines including immortalized human keratinocytes (HaCaT). Arsenic also is associated with cell cycle dysregulation at different exposure levels in multiple cell lines. In this work, we analyzed gene expression in HaCaT cells to gain an understanding of gene expression changes contributing to transformation at an early time point. HaCaT cells were exposed to 0 or 100nM NaAsO 2 for 7weeks. Total RNA was purified and analyzed by microarray hybridization. Differential expression with fold change≥|1.5| and p-value≤0.05 was determined using Partek Genomic Suite™ and pathway and network analyses using MetaCore™ software (FDR≤0.05). Cell cycle analysis was performed using flow cytometry. 644 mRNAs were differentially expressed. Cell cycle/cell cycle regulation pathways predominated in the list of dysregulated pathways. Genes involved in replication origin licensing were enriched in the network. Cell cycle assay analysis showed an increase in G2/M compartment in arsenite-exposed cells. Arsenite exposure induced differential gene expression indicating dysregulation of cell cycle control, which was confirmed by cell cycle analysis. The results suggest that cell cycle dysregulation is an early event in transformation manifested in cells unable to transit G2/M efficiently. Further study at later time points will reveal additional changes in gene expression related to transformation processes. Copyright © 2017 Elsevier Inc. All rights reserved.

  11. Effect of retinoic acid on the radiosensitivity of normal human oral keratinocyte

    International Nuclear Information System (INIS)

    Lee, Jean; Heo, Min Suk; Lee, Sam Sun; Oh, Sung Ook; Choi, Soon Chul; Park, Tae Won; Lee, Sul Mi; Choi, Hang Moon

    2003-01-01

    To evaluate the effect of all-trans-retinotic acid (ATRA) on the radiosensitivity of normal human oral keratinocyte (NHOK). Relative cell survival fraction including SF2 (survival fraction at 2 Gy) was calculated on the basis of colony formation assay. Data were fitted to the linear-quadratic model to establish the survival curve and calculate α and β values. Using flow cytometry at 1, 2, 3, 4, and 5 days after exposure to 2 and 10 Gy irradiation, cell cycle arrest and apoptosis were analysed. To understand the molecular mechanism of the radiosensitization of ATRA on NHOK, proteins related with apoptosis and cell cycle arrest were investigated by Western blot analysis. Treatment with ATRA resulted in a significant decrease of SF2 value for NHOK from 0.63 to 0.27, and increased α and β value, indicating that ATRA increased radiosensitivity of NHOK. ATRA increased LDH significantly, but increasing irradiation dose decreased LDH, suggesting that the radiosensitizing effect of ATRA is not directly related with increasing cell necrosis by ATRA. ATRA did not induce appotosis but increased G2 arrest after 10 Gy irradiation, implying that the increased radiosensitivity of NHOK may be due to a decrease in mitosis caused by increasing G2 arrest. ATRA inhibited the reduction of p53 at 3 days after 10 Gy irradiation and increased p21 at 1 day after 10 Gy irradiation. Further study is required to determine the precise relationship between this effect and the radiosensitizing effect of ATRA. These results suggested that ATRA increase radiosensitivity by inhibiting mitosis caused by increasing G2 arrest.

  12. Two-dimensional analysis of metabolically and cell surface radiolabeled proteins of some human lymphoid and myeloid leukemia cell lines. II. Glycosylated and phosphorylated proteins

    Energy Technology Data Exchange (ETDEWEB)

    Chorvath, B; Duraj, J; Sedlak, J; Pleskova, I

    1986-01-01

    Cell surface glycoproteins, radiolabelled by the sodium metaperiodate/tritiated borohydride technique, and cell phosphoproteins, metabolically radiolabelled with /sup 32/P-orthophosphate were analyzed by two-dimensional electrophoretic analysis in some myeloid and lymphoid leukemia cell lines. Some markedly expressed major glycoproteins were predominant in some of the cell lines (such as 95k and 100k glycoproteins with marked charge heterogeneity in non-T, non-B acute lymphoblastic leukemia cell lines NALM 6 and NALM 16), but markedly quantitatively reduced in other examined cell lines, such as lymphoblastoid cell line UHKT 34/2. /sup 32/P-orthophosphate radiolabelled phosphoprotein two-dimensional patterns of the examined lymphoid leukemia cell lines were essentially similar, with some minor differences, in examined lymphoid and myeloid leukemia cell lines, such as marked expression of a series of large phosphoproteins in the molecular weight range 80-100k in lymphoid cell lines and almost complete absence of these phosphoproteins on the examined myeloid leukemia cell lines. Another configuration of acidic phosphoproteins (30-35k) exhibited individual cell line variability and differences between both individual myeloid leukemia cell lines and between the lymphoid and myeloid cell lines examined. (author) 2 figs., 15 refs.

  13. Two dimensional infinite conformal symmetry

    International Nuclear Information System (INIS)

    Mohanta, N.N.; Tripathy, K.C.

    1993-01-01

    The invariant discontinuous (discrete) conformal transformation groups, namely the Kleinian and Fuchsian groups Gamma (with an arbitrary signature) of H (the Poincare upper half-plane l) and the unit disc Delta are explicitly constructed from the fundamental domain D. The Riemann surface with signatures of Gamma and conformally invariant automorphic forms (functions) with Peterson scalar product are discussed. The functor, where the category of complex Hilbert spaces spanned by the space of cusp forms constitutes the two dimensional conformal field theory. (Author) 7 refs

  14. Two-dimensional liquid chromatography

    DEFF Research Database (Denmark)

    Græsbøll, Rune

    -dimensional separation space. Optimization of gradients in online RP×RP is more difficult than in normal HPLC as a result of the increased number of parameters and their influence on each other. Modeling the coverage of the compounds across the two-dimensional chromatogram as a result of a change in gradients could...... be used for optimization purposes, and reduce the time spend on optimization. In this thesis (chapter 6), and manuscript B, a measure of the coverage of the compounds in the twodimensional separation space is defined. It is then shown that this measure can be modeled for changes in the gradient in both...

  15. Differential effects of the extracellular microenvironment on human embryonic stem cell differentiation into keratinocytes and their subsequent replicative life span.

    Science.gov (United States)

    Movahednia, Mohammad Mehdi; Kidwai, Fahad Karim; Zou, Yu; Tong, Huei Jinn; Liu, Xiaochen; Islam, Intekhab; Toh, Wei Seong; Raghunath, Michael; Cao, Tong

    2015-04-01

    Culture microenvironment plays a critical role in the propagation and differentiation of human embryonic stem cells (hESCs) and their differentiated progenies. Although high efficiency of hESC differentiation to keratinocytes (hESC-Kert) has been achieved, little is known regarding the effects of early culture microenvironment and pertinent extracellular matrix (ECM) interactions during epidermal commitment on subsequent proliferative capacity of hESC-Kert. The aim of this study is to evaluate the effects of the different ECM microenvironments during hESC differentiation on subsequent replicative life span of hESC-Kert. In doing so, H1-hESCs were differentiated to keratinocytes (H1-Kert) in two differentiation systems. The first system employed autologous fibroblast feeder support, in which keratinocytes (H1-Kert(ACC)) were derived by coculture of hESCs with hESC-derived fibroblasts (H1-ebFs). The second system employed a novel decellularized matrix from H1-ebFs to create a dermoepidermal junction-like (DEJ) matrix. H1-Kert(AFF) were derived by differentiation of hESCs on the feeder-free system employing the DEJ matrix. Our study indicated that the feeder-free system with the use of DEJ matrix was more efficient in differentiation of hESCs toward epidermal progenitors. However, the feeder-free system was not sufficient to support the subsequent replicative capacity of differentiated keratinocytes. Of note, H1-Kert(AFF) showed limited replicative capacity with reduced telomere length and early cellular senescence. We further showed that the lack of cell-cell interactions during epidermal commitment led to heightened production of TGF-β1 by hESC-Kert during extended culture, which in turn was responsible for resulting in the limited replicative life span with cellular senescence of hESC-Kert derived under the feeder-free culture system. This study highlights for the first time the importance of the culture microenvironment and cell-ECM interactions during

  16. Two-dimensional capillary origami

    Energy Technology Data Exchange (ETDEWEB)

    Brubaker, N.D., E-mail: nbrubaker@math.arizona.edu; Lega, J., E-mail: lega@math.arizona.edu

    2016-01-08

    We describe a global approach to the problem of capillary origami that captures all unfolded equilibrium configurations in the two-dimensional setting where the drop is not required to fully wet the flexible plate. We provide bifurcation diagrams showing the level of encapsulation of each equilibrium configuration as a function of the volume of liquid that it contains, as well as plots representing the energy of each equilibrium branch. These diagrams indicate at what volume level the liquid drop ceases to be attached to the endpoints of the plate, which depends on the value of the contact angle. As in the case of pinned contact points, three different parameter regimes are identified, one of which predicts instantaneous encapsulation for small initial volumes of liquid. - Highlights: • Full solution set of the two-dimensional capillary origami problem. • Fluid does not necessarily wet the entire plate. • Global energy approach provides exact differential equations satisfied by minimizers. • Bifurcation diagrams highlight three different regimes. • Conditions for spontaneous encapsulation are identified.

  17. Two-dimensional capillary origami

    International Nuclear Information System (INIS)

    Brubaker, N.D.; Lega, J.

    2016-01-01

    We describe a global approach to the problem of capillary origami that captures all unfolded equilibrium configurations in the two-dimensional setting where the drop is not required to fully wet the flexible plate. We provide bifurcation diagrams showing the level of encapsulation of each equilibrium configuration as a function of the volume of liquid that it contains, as well as plots representing the energy of each equilibrium branch. These diagrams indicate at what volume level the liquid drop ceases to be attached to the endpoints of the plate, which depends on the value of the contact angle. As in the case of pinned contact points, three different parameter regimes are identified, one of which predicts instantaneous encapsulation for small initial volumes of liquid. - Highlights: • Full solution set of the two-dimensional capillary origami problem. • Fluid does not necessarily wet the entire plate. • Global energy approach provides exact differential equations satisfied by minimizers. • Bifurcation diagrams highlight three different regimes. • Conditions for spontaneous encapsulation are identified.

  18. Two dimensional solid state NMR

    International Nuclear Information System (INIS)

    Kentgens, A.P.M.

    1987-01-01

    This thesis illustrates, by discussing some existing and newly developed 2D solid state experiments, that two-dimensional NMR of solids is a useful and important extension of NMR techniques. Chapter 1 gives an overview of spin interactions and averaging techniques important in solid state NMR. As 2D NMR is already an established technique in solutions, only the basics of two dimensional NMR are presented in chapter 2, with an emphasis on the aspects important for solid spectra. The following chapters discuss the theoretical background and applications of specific 2D solid state experiments. An application of 2D-J resolved NMR, analogous to J-resolved spectroscopy in solutions, to natural rubber is given in chapter 3. In chapter 4 the anisotropic chemical shift is mapped out against the heteronuclear dipolar interaction to obtain information about the orientation of the shielding tensor in poly-(oxymethylene). Chapter 5 concentrates on the study of super-slow molecular motions in polymers using a variant of the 2D exchange experiment developed by us. Finally chapter 6 discusses a new experiment, 2D nutation NMR, which makes it possible to study the quadrupole interaction of half-integer spins. 230 refs.; 48 figs.; 8 tabs

  19. Two-dimensional turbulent convection

    Science.gov (United States)

    Mazzino, Andrea

    2017-11-01

    We present an overview of the most relevant, and sometimes contrasting, theoretical approaches to Rayleigh-Taylor and mean-gradient-forced Rayleigh-Bénard two-dimensional turbulence together with numerical and experimental evidences for their support. The main aim of this overview is to emphasize that, despite the different character of these two systems, especially in relation to their steadiness/unsteadiness, turbulent fluctuations are well described by the same scaling relationships originated from the Bolgiano balance. The latter states that inertial terms and buoyancy terms balance at small scales giving rise to an inverse kinetic energy cascade. The main difference with respect to the inverse energy cascade in hydrodynamic turbulence [R. H. Kraichnan, "Inertial ranges in two-dimensional turbulence," Phys. Fluids 10, 1417 (1967)] is that the rate of cascade of kinetic energy here is not constant along the inertial range of scales. Thanks to the absence of physical boundaries, the two systems here investigated turned out to be a natural physical realization of the Kraichnan scaling regime hitherto associated with the elusive "ultimate state of thermal convection" [R. H. Kraichnan, "Turbulent thermal convection at arbitrary Prandtl number," Phys. Fluids 5, 1374-1389 (1962)].

  20. Cultivation and grafting of human keratinocytes on a poly(hydroxyethyl methacrylate) support to the wound bed: a clinical study.

    Science.gov (United States)

    Dvoránková, B; Smetana, K; Königová, R; Singerová, H; Vacík, J; Jelínková, M; Kapounková, Z; Zahradník, M

    1998-01-01

    Cultured epithelial sheets on a textile support are used for the treatment of seriously burned patients. In this study we demonstrate a new procedure for the grafting of keratinocytes directly on a polymer cultivation support. This procedure is much easier in comparison with classical techniques, and encouraging results of clinical trials demonstrate the improved healing of the wound bed after the use of this procedure. There is no difference in the cytokeratine pattern (LP-34, cytokeratin-10) of the reconstructed epidermis and normal human skin.

  1. Interaction of Mycobacterium leprae with the HaCaT human keratinocyte cell line: new frontiers in the cellular immunology of leprosy.

    Science.gov (United States)

    Lyrio, Eloah C D; Campos-Souza, Ivy C; Corrêa, Luiz C D; Lechuga, Guilherme C; Verícimo, Maurício; Castro, Helena C; Bourguignon, Saulo C; Côrte-Real, Suzana; Ratcliffe, Norman; Declercq, Wim; Santos, Dilvani O

    2015-07-01

    Leprosy is a chronic granulomatous disease caused by Mycobacterium leprae affecting the skin and peripheral nerves. Despite M. leprae invasion of the skin and keratinocytes importance in innate immunity, the interaction of these cells in vitro during M. leprae infection is poorly understood. Conventional and fluorescence optical microscopy, transmission electronic microscopy, flow cytometry and ELISA were used to study the in vitro interaction of M. leprae with the HaCaT human keratinocyte cell line. Keratinocytes uptake of M. leprae is described, and modulation of the surface expression of CD80 and CD209, cathelicidin expression and TNF-α and IL-1β production of human keratinocytes are compared with dendritic cells and macrophages during M. leprae interaction. This study demonstrated that M. leprae interaction with human keratinocytes enhanced expression of cathelicidin and greatly increased TNF-α production. The highest spontaneous expression of cathelicidin was by dendritic cells which are less susceptible to M. leprae infection. In contrast, keratinocytes displayed low spontaneous cathelicidin expression and were more susceptible to M. leprae infection than dendritic cells. The results show, for the first time, an active role for keratinocytes during infection by irradiated whole cells of M. leprae and the effect of vitamin D on this process. They also suggest that therapies which target cathelicidin modulation may provide novel approaches for treatment of leprosy. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  2. Resveratrol prevents oxidative stress-induced senescence and proliferative dysfunction by activating the AMPK-FOXO3 cascade in cultured primary human keratinocytes.

    Directory of Open Access Journals (Sweden)

    Yasuo Ido

    Full Text Available The aging process is perceived as resulting from a combination of intrinsic factors such as changes in intracellular signaling and extrinsic factors, most notably environmental stressors. In skin, the relationship between intrinsic changes and keratinocyte function is not clearly understood. Previously, we found that increasing the activity of AMP-activated protein kinase (AMPK suppressed senescence in hydrogen peroxide (H2O2-treated human primary keratinocytes, a model of oxidative stress-induced cellular aging. Using this model in the present study, we observed that resveratrol, an agent that increases the activities of both AMPK and sirtuins, ameliorated two age-associated phenotypes: cellular senescence and proliferative dysfunction. In addition, we found that treatment of keratinocytes with Ex527, a specific inhibitor of sirtuin 1 (SIRT1, attenuated the ability of resveratrol to suppress senescence. In keeping with the latter observation, we noted that compared to non-senescent keratinocytes, senescent cells lacked SIRT1. In addition to these effects on H2O2-induced senescence, resveratrol also prevented the H2O2-induced decrease in proliferation (as indicated by 3H-thymidine incorporation in the presence of insulin. This effect was abrogated by inhibition of AMPK but not SIRT1. Compared to endothelium, we found that human keratinocytes expressed relatively high levels of Forkhead box O3 (FOXO3, a downstream target of both AMPK and SIRT1. Treatment of keratinocytes with resveratrol transactivated FOXO3 and increased the expression of its target genes including catalase. Resveratrol's effects on both senescence and proliferation disappeared when FOXO3 was knocked down. Finally, we performed an exploratory study which showed that skin from humans over 50 years old had lower AMPK activity than skin from individuals under age 20. Collectively, these findings suggest that the effects of resveratrol on keratinocyte senescence and proliferation

  3. The effect of 648 nm diode laser irradiation on second messengers in senescent human keratinocytes

    Science.gov (United States)

    Hawkins Evans, D.; Abrahamse, H.

    2009-02-01

    Background/purpose: Stress induced premature senescence (SIPS) is defined as the long-term effect of subcytotoxic stress on proliferative cell types. Cells in SIPS display differences at the level of protein expression which affect energy metabolism, defense systems, redox potential, cell morphology and transduction pathways. This study aimed to determine the effect of laser irradiation on second messengers in senescent cells and to establish if that effect can be directly linked to changes in cellular function such as cell viability or proliferation. Materials and Methods: Human keratinocyte cell cultures were modified to induce premature senescence using repeated sub-lethal stresses of 200 uM H2O2 or 5% OH every day for four days with two days recovery. SIPS was confirmed by senescence-associated β-galactosidase staining. Control conditions included normal, repeated stress of 500 uM H2O2 to induce apoptosis and 200 uM PBN as an anti-oxidant or free radical scavenger. Cells were irradiated with 1.5 J/cm2 on day 1 and 4 using a 648 nm diode laser (3.3 mW/cm2) and cellular responses were measured 1 h post irradiation. The affect on second messengers was assessed by measuring cAMP, cGMP, nitric oxide and intracellular calcium (Ca2+) while functional changes were assessed using cell morphology, ATP cell viability, LDH membrane integrity and WST-1 cell proliferation. Results: Results indicate an increase in NO and a decrease in cGMP and Ca2+ in 200 uM H2O2 irradiated cells while PBN irradiated cells showed a decrease in cAMP and an increase in ATP viability and cell proliferation. Conclusion: Laser irradiation influences cell signaling which ultimately changes the biological function of senescent cells. If laser therapy can stimulate the biological function of senescent cells it may be beneficial to conditions such as immune senescence, skin ageing, muscle atrophy, premature ageing of arteries in patients with advanced heart disease, neurodegenerative disorders and

  4. Two-dimensional quantum repeaters

    Science.gov (United States)

    Wallnöfer, J.; Zwerger, M.; Muschik, C.; Sangouard, N.; Dür, W.

    2016-11-01

    The endeavor to develop quantum networks gave rise to a rapidly developing field with far-reaching applications such as secure communication and the realization of distributed computing tasks. This ultimately calls for the creation of flexible multiuser structures that allow for quantum communication between arbitrary pairs of parties in the network and facilitate also multiuser applications. To address this challenge, we propose a two-dimensional quantum repeater architecture to establish long-distance entanglement shared between multiple communication partners in the presence of channel noise and imperfect local control operations. The scheme is based on the creation of self-similar multiqubit entanglement structures at growing scale, where variants of entanglement swapping and multiparty entanglement purification are combined to create high-fidelity entangled states. We show how such networks can be implemented using trapped ions in cavities.

  5. Repair of ultraviolet light damage to the DNA of cultured human epidermal keratinocytes and fibroblasts

    International Nuclear Information System (INIS)

    Taichman, L.B.; Setlow, R.B.

    1979-01-01

    Pure cultures of dermal fibroblasts and epidermal keroatinocytes have been obtained from a single biopsy of newborn foreskin. The cells were labeled, exposed to several doses of uv light, and allowed to repair in the dark for 16 h. The number of pyrimidine dimers before and after repair was assessed by measuring the numbers of sites in the DNA sensitive to a specific uv endonuclease. At all doses used, the extent of repair was similar in the cultured keratinocytes and cultured fibroblasts

  6. Mannosides as crucial part of bioactive supports for cultivation of human epidermal keratinocytes without feeder cells

    Czech Academy of Sciences Publication Activity Database

    Labský, Jiří; Dvořánková, B.; Smetana, Karel; Holíková, Z.; Brož, L.; Gabius, H.J.

    2003-01-01

    Roč. 24, č. 5 (2003), s. 863-872 ISSN 0142-9612 R&D Projects: GA ČR GA203/00/1310; GA MŠk LN00A065; GA MZd ND6340 Institutional research plan: CEZ:AV0Z4050913 Keywords : cell therapy * keratinocyte * mannose Subject RIV: CD - Macromolecular Chemistry Impact factor: 2.903, year: 2003

  7. Multiple biological effects of inhibitors of arachidonic acid metabolism on human keratinocytes

    Czech Academy of Sciences Publication Activity Database

    Pacherník, Jiří; Hampl, Aleš; Souček, Karel; Kovaříková, Martina; Andrysík, Zdeněk; Hofmanová, Jiřina; Kozubík, Alois

    2002-01-01

    Roč. 293, č. 12 (2002), s. 626-633 ISSN 0340-3696 R&D Projects: GA ČR GA524/99/0694; GA AV ČR IBS5004009; GA ČR GA524/98/0190 Institutional research plan: CEZ:AV0Z5004920 Keywords : lipoxygenase * keratinocytes * cell cycle Subject RIV: BO - Biophysics Impact factor: 1.452, year: 2002

  8. The influence of ions implantation on adhesion and growth of human keratinocytes

    International Nuclear Information System (INIS)

    Walachova, K.; Dvorankova, B.; Vogtova, D.; Svorcik, V.

    1999-01-01

    This work deals with the study of modification of surface of the polyethylene after ion implantation. For experiments were used the Ar + ions with energy 63 keV and Xe + ions with energy 156 keV. Some surface properties of modified layers (100 nm) and their influence on adhesion and proliferation of keratinocytes were studied. For the study of structural changes of polymer were used methods UV-VIS and FTIR spectrometry, atomic force spectroscopy

  9. Comparative transcriptomic profiling of hydrogen peroxide signaling networks in zebrafish and human keratinocytes: Implications toward conservation, migration and wound healing.

    Science.gov (United States)

    Lisse, Thomas S; King, Benjamin L; Rieger, Sandra

    2016-02-05

    Skin wounds need to be repaired rapidly after injury to restore proper skin barrier function. Hydrogen peroxide (H2O2) is a conserved signaling factor that has been shown to promote a variety of skin wound repair processes, including immune cell migration, angiogenesis and sensory axon repair. Despite growing research on H2O2 functions in wound repair, the downstream signaling pathways activated by this reactive oxygen species in the context of injury remain largely unknown. The goal of this study was to provide a comprehensive analysis of gene expression changes in the epidermis upon exposure to H2O2 concentrations known to promote wound repair. Comparative transcriptome analysis using RNA-seq data from larval zebrafish and previously reported microarray data from a human epidermal keratinocyte line shows that H2O2 activates conserved cell migration, adhesion, cytoprotective and anti-apoptotic programs in both zebrafish and human keratinocytes. Further assessment of expression characteristics and signaling pathways revealed the activation of three major H2O2-dependent pathways, EGF, FOXO1, and IKKα. This study expands on our current understanding of the clinical potential of low-level H2O2 for the promotion of epidermal wound repair and provides potential candidates in the treatment of wound healing deficits.

  10. Protective Effect of the Ethyl Acetate Fraction of Sargassum muticum against Ultraviolet B–Irradiated Damage in Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Jin Won Hyun

    2011-11-01

    Full Text Available The aim of this study was to investigate the cytoprotective properties of the ethyl acetate fraction of Sargassum muticum (SME against ultraviolet B (UVB-induced cell damage in human keratinocytes (HaCaT cells. SME exhibited scavenging activity toward the 1,1-diphenyl-2-picrylhydrazyl radicals and hydrogen peroxide (H2O2 and UVB-induced intracellular reactive oxygen species (ROS. SME also scavenged the hydroxyl radicals generated by the Fenton reaction (FeSO4 + H2O2, which was detected using electron spin resonance spectrometry. In addition, SME decreased the level of lipid peroxidation that was increased by UVB radiation, and restored the level of protein expression and the activities of antioxidant enzymes that were decreased by UVB radiation. Furthermore, SME reduced UVB-induced apoptosis as shown by decreased DNA fragmentation and numbers of apoptotic bodies. These results suggest that SME protects human keratinocytes against UVB-induced oxidative stress by enhancing antioxidant activity in cells, thereby inhibiting apoptosis.

  11. Response of Primary Human Bone Marrow Mesenchymal Stromal Cells and Dermal Keratinocytes to Thermal Printer Materials In Vitro.

    Science.gov (United States)

    Schmelzer, Eva; Over, Patrick; Gridelli, Bruno; Gerlach, Jörg C

    Advancement in thermal three-dimensional printing techniques has greatly increased the possible applications of various materials in medical applications and tissue engineering. Yet, potential toxic effects on primary human cells have been rarely investigated. Therefore, we compared four materials commonly used in thermal printing for bioengineering, namely thermally printed acrylonitrile butadiene styrene, MED610, polycarbonate, and polylactic acid, and investigated their effects on primary human adult skin epidermal keratinocytes and bone marrow mesenchymal stromal cells (BM-MSCs) in vitro. We investigated indirect effects on both cell types caused by potential liberation of soluble substances from the materials, and also analyzed BM-MSCs in direct contact with the materials. We found that even in culture without direct contact with the materials, the culture with MED610 (and to a lesser extent acrylonitrile butadiene styrene) significantly affected keratinocytes, reducing cell numbers and proliferation marker Ki67 expression, and increasing glucose consumption, lactate secretion, and expression of differentiation-associated genes. BM-MSCs had decreased metabolic activity, and exhibited increased cell death in direct culture on the materials. MED610 and acrylonitrile butadiene styrene induced the strongest expression of genes associated to differentiation and estrogen receptor activation. In conclusion, we found strong cell-type-specific effects of the materials, suggesting that materials for applications in regenerative medicine should be carefully selected not only based on their mechanical properties but also based on their cell-type-specific biological effects.

  12. Metabolic activation of pyrrolizidine alkaloids leading to phototoxicity and photogenotoxicity in human HaCaT keratinocytes.

    Science.gov (United States)

    Wang, Chia-Chi; Xia, Qingsu; Li, Meng; Wang, Shuguang; Zhao, Yuewei; Tolleson, William H; Yin, Jun-Jie; Fu, Peter P

    2014-01-01

    Pyrrolizidine alkaloids, produced by a large number of poisonous plants with wide global distribution, are associated with genotoxicity, tumorigenicity, and hepatotoxicity in animals and humans. Mammalian metabolism converts pyrrolizidine alkaloids to reactive pyrrolic metabolites (dehydropyrrolizidine alkaloids) that form covalent protein and DNA adducts. Although a mechanistic understanding is currently unclear, pyrrolizidine alkaloids can cause secondary (hepatogenous) photosensitization and induce skin cancer. In this study, the phototoxicity of monocrotaline, riddelliine, dehydromonocrotaline, dehydroriddelliine, and dehydroretronecine (DHR) in human HaCaT keratinocytes under ultraviolet A (UVA) irradiation was determined. UVA irradiation of HaCaT cells treated with dehydromonocrotaline, dehydroriddelline, and DHR resulted in increased release of lactate dehydrogenase and enhanced photocytotoxicity proportional to the UVA doses. UVA-induced photochemical DNA damage also increased proportionally with dehydromonocrotaline and dehydroriddelline. UVA treatment potentiated the formation of 8-hydroxy-2'-deoxyguanosine DNA adducts induced by dehydromonocrotaline in HaCaT skin keratinocytes. Using electron spin resistance trapping, we found that UVA irradiation of dehydromonocrotaline and dehydroriddelliine generates reactive oxygen species (ROS), including hydroxyl radical, singlet oxygen, and superoxide, and electron transfer reactions, indicating that cytotoxicity and genotoxicity of these compounds could be mediated by ROS. Our results suggest that dehydropyrrolizidine alkaloids formed or delivered to the skin cause pyrrolizidine alkaloid-induced secondary photosensitization and possible skin cancer.

  13. Human papillomavirus types detected in skin warts and cancer differ in their transforming properties but commonly counteract UVB induced protective responses in human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Shterzer, Naama; Heyman, Dariya; Shapiro, Beny; Yaniv, Abraham; Jackman, Anna [Department of Clinical Microbiology and Immunology, Sackler School of Medicine, Tel-Aviv University, Tel-Aviv (Israel); Serour, Francis [Department of Pediatric Surgery, The E. Wolfson Medical Center, Holon (Israel); Chaouat, Malka [Laboratory of Experimental Surgery, Hadassah University Hospital, Ein Karem, Jerusalem (Israel); Gonen, Pinhas [Department of Clinical Microbiology and Immunology, Sackler School of Medicine, Tel-Aviv University, Tel-Aviv (Israel); Tommasino, Massimo [International Agency for Research on Cancer, World Health Organization, Lyon (France); Sherman, Levana [Department of Clinical Microbiology and Immunology, Sackler School of Medicine, Tel-Aviv University, Tel-Aviv (Israel)

    2014-11-15

    In the present study, E6E7 and E6 proteins of human papillomaviruses (HPVs) associated with skin warts and cancer were compared for their transforming and carcinogenic abilities in primary human keratinocytes (PHKs). We show that E6E7 of cancer associated beta HPV types, notably 49 and 24, were able to extend the life span and enhance the clonogenic efficiency of PHKs when maintained in serum free/low calcium medium. Activities of the beta HPV E6E7 were lower than those of HPV16 E6E7. In contrast, E6 proteins from HPV types detected in skin warts or cancer, notably 10, 49 and 38, attenuated UVB induced protective responses in PHKs including cell death, proliferation arrest and accumulation of the proapoptotic proteins, p53, bax or bak. Together, this investigation revealed functional differences and commonalities between HPVs associated with skin warts and cancer, and allowed the identification of specific properties of beta HPVs supporting their involvement in skin carcinogenesis. - Highlights: • Primary keratinocytes were used to evaluate transforming and carcinogenic abilities of cutaneous HPVs. • E6E7 of cancer associated β HPV types transform primary human keratinocytes. • E6 proteins of cancer and wart associated HPVs inhibit UVB induced cell death. • E6s of cancer and wart associated HPVs attenuate UVB induced proliferation arrest. • E6s of cancer and wart associated HPVs attenuate UVB induced apoptosis signaling.

  14. Human papillomavirus types detected in skin warts and cancer differ in their transforming properties but commonly counteract UVB induced protective responses in human keratinocytes

    International Nuclear Information System (INIS)

    Shterzer, Naama; Heyman, Dariya; Shapiro, Beny; Yaniv, Abraham; Jackman, Anna; Serour, Francis; Chaouat, Malka; Gonen, Pinhas; Tommasino, Massimo; Sherman, Levana

    2014-01-01

    In the present study, E6E7 and E6 proteins of human papillomaviruses (HPVs) associated with skin warts and cancer were compared for their transforming and carcinogenic abilities in primary human keratinocytes (PHKs). We show that E6E7 of cancer associated beta HPV types, notably 49 and 24, were able to extend the life span and enhance the clonogenic efficiency of PHKs when maintained in serum free/low calcium medium. Activities of the beta HPV E6E7 were lower than those of HPV16 E6E7. In contrast, E6 proteins from HPV types detected in skin warts or cancer, notably 10, 49 and 38, attenuated UVB induced protective responses in PHKs including cell death, proliferation arrest and accumulation of the proapoptotic proteins, p53, bax or bak. Together, this investigation revealed functional differences and commonalities between HPVs associated with skin warts and cancer, and allowed the identification of specific properties of beta HPVs supporting their involvement in skin carcinogenesis. - Highlights: • Primary keratinocytes were used to evaluate transforming and carcinogenic abilities of cutaneous HPVs. • E6E7 of cancer associated β HPV types transform primary human keratinocytes. • E6 proteins of cancer and wart associated HPVs inhibit UVB induced cell death. • E6s of cancer and wart associated HPVs attenuate UVB induced proliferation arrest. • E6s of cancer and wart associated HPVs attenuate UVB induced apoptosis signaling

  15. Modulation of interferon-gamma-induced HLA-DR expression on the human keratinocyte cell line SCC-13 by ultraviolet radiation

    International Nuclear Information System (INIS)

    Khan, I.U.; Boehm, K.D.; Elmets, C.A.

    1993-01-01

    Cell surface expression of major histocompatibility determinants on epidermal keratinocytes is a characteristic feature of a number of inflammatory dermatoses and in all likelihood is caused by diffusion of human leukocyte antigen (HLA)-DR-inducing cytokines from cells present in the dermal mononuclear cell infiltrate. Many of these same disorders respond to ultraviolet (UV) radiation phototherapy. Using the human SCC-13 keratinocyte cell line as a model, UV radiation was found to inhibit interferon-gamma-induced HLA-DR expression. Inhibition correlated closely with decreased steady-state levels of HLA-DR mRNA. These findings provide evidence that the therapeutic effect of UV radiation phototherapy may be mediated by its capacity to down-regulate cytokine-induced keratinocyte HLA-DR expression. (Author)

  16. Release by ultraviolet B (u.v.B) radiation of nitric oxide (NO) from human keratinocytes: a potential role for nitric oxide in erythema production

    International Nuclear Information System (INIS)

    Deliconstantinos, G.; Villiotou, V.; Stravrides, J.C.

    1995-01-01

    The mechanism of human sunburn is poorly understood but its characteristic features include the development of erythema. In this study we attempted to determine whether human keratinocytes possess a nitric oxide (NO) synthase (NOS), if this enzyme could be activated to release NO following exposure to ultraviolet B (u.v.B) and to define whether this photo-induced response could be involved in the pathogenesis of sunburn erythema. The present results indicate that u.v.B radiation acts as a potent stimulator of NOS in keratinocytes. NO is lipophilic and may diffuse out of the keratinocytes, activating sGC in endothelial cells and neighbouring smooth muscle cells. This may be a major part of the integrated response of the skin leading to vasodilatation and erythema. (author)

  17. Rho kinase inhibitor Y-27632 promotes the differentiation of human bone marrow mesenchymal stem cells into keratinocyte-like cells in xeno-free conditioned medium.

    Science.gov (United States)

    Li, Zhenzhen; Han, Shichao; Wang, Xingqin; Han, Fu; Zhu, Xiongxiang; Zheng, Zhao; Wang, Hongtao; Zhou, Qin; Wang, Yunchuan; Su, Linlin; Shi, Jihong; Tang, Chaowu; Hu, Dahai

    2015-03-11

    Bone marrow mesenchymal stem cells (BMSCs), which have the ability to self-renew and to differentiate into multiple cell types, have recently become a novel strategy for cell-based therapies. The differentiation of BMSCs into keratinocytes may be beneficial for patients with burns, disease, or trauma. However, the currently available cells are exposed to animal materials during their cultivation and induction. These xeno-contaminations severely limit their clinical outcomes. Previous studies have shown that the Rho kinase (ROCK) inhibitor Y-27632 can promote induction efficiency and regulate the self-renewal and differentiation of stem cells. In the present study, we attempted to establish a xeno-free system for the differentiation of BMSCs into keratinocytes and to investigate whether Y-27632 can facilitate this differentiation. BMSCs isolated from patients were cultured by using a xeno-free system and characterised by using flow cytometric analysis and adipogenic and osteogenic differentiation assays. Human primary keratinocytes were also isolated from patients. Then, the morphology, population doubling time, and β-galactosidase staining level of these cells were evaluated in the presence or absence of Y-27632 to determine the effects of Y-27632 on the state of the keratinocytes. Keratinocyte-like cells (KLCs) were detected at different time points by immunocytofluorescence analysis. Moreover, the efficiency of BMSC differentiation under different conditions was measured by quantitative real-time-polymerase chain reaction (RT-PCR) and Western blot analyses. The ROCK inhibitor Y-27632 promoted the proliferation and lifespan of human primary keratinocytes. In addition, we showed that keratinocyte-specific markers could be detected in BMSCs cultured in a xeno-free system using keratinocyte-conditioned medium (KCM) independent of the presence of Y-27632. However, the efficiency of the differentiation of BMSCs into KLCs was significantly higher in the presence of Y

  18. Identification of proteins in a human pleural exudate using two-dimensional preparative liquid-phase electrophoresis and matrix-assisted laser desorption/ionization mass spectrometry.

    Science.gov (United States)

    Nilsson, C L; Puchades, M; Westman, A; Blennow, K; Davidsson, P

    1999-01-01

    Pleural effusion may occur in patients suffering from physical trauma or systemic disorders such as infection, inflammation, or cancer. In order to investigate proteins in a pleural exudate from a patient with severe pneumonia, we used a strategy that combined preparative two-dimensional liquid-phase electrophoresis (2-D LPE), matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF-MS) and Western blotting. Preparative 2-D LPE is based on the same principles as analytical 2-D gel electrophoresis, except that the proteins remain in liquid phase during the entire procedure. In the first dimension, liquid-phase isoelectric focusing allows for the enrichment of proteins in liquid fractions. In the Rotofor cell, large volumes (up to 55 mL) and protein amounts (up to 1-2 g) can be loaded. Several low abundance proteins, cystatin C, haptoglobin, transthyretin, beta2-microglobulin, and transferrin, were detected after liquid-phase isoelectric focusing, through Western blotting analysis, in a pleural exudate (by definition, >25 g/L total protein). Direct MALDI-TOF-MS analysis of proteins in a Rotofor fraction is demonstrated as well. MALDI-TOF-MS analysis of a tryptic digest of a continuous elution sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) fraction confirmed the presence of cystatin C. By applying 2-D LPE, MALDI-TOF-MS, and Western blotting to the analysis of this pleural exudate, we were able to confirm the identity of proteins of potential diagnostic value. Our findings serve to illustrate the usefulness of this combination of methods in the analysis of pathological fluids.

  19. Alterations of nitric-oxide synthase and xanthine-oxidase activities of human keratinocytes by ultraviolet-B radiation -potential role for peroxynitrite in skin inflammation

    Energy Technology Data Exchange (ETDEWEB)

    Deliconstantinos, G.; Villiotou, V.; Stavrides, J.C. [Athens Univ. (Greece). School of Medicine

    1996-06-28

    In the present study, we demonstrated that NO synthase (cNOS) and xanthine oxidase (XO) of human keratinocytes can be activated to release NO, superoxide (O-2(-)) and peroxynitrite (ONOO-) following exposure to ultraviolet B (UVB) radiation. We defined that this photo induced response may be involved in the pathogenesis of sunburn erythema and inflammation. Treatment of human keratinocytes with UVB (290-320 nm) radiation (up to 200 mJ/cm(2)) resulted in a dose-dependent increase in NO and ONOO-release that was inhibited by N-monomethyl-L-arginine (L-NMMA). NO and ONOO- release from keratinocytes was accompanied by an increase in intracellular cGMP levels. Treatment of human keratinocyte cytosol with various doses of UVB (up to 100 mJ/cm(2)) resulted in an increase in XO activity that was inhibited by oxypurinol. In in vivo experiments, when experimental animals were subjected to UVB radiation, a protection factor (PF) of 6.5 {+-} 1.8 was calculated when an emulsified cream formulation containing nitro-L-arginine (L-NA) (2%) and L-NMMA (2%) was applied to their skin. The present study indicates that UVB radiation acts as a potent stimulator of cNOS and XO activities in human keratinocytes. NO and ONOO- may exert cytotoxic effects in keratinocytes themselves, as well as in their neighbouring endothelial and smooth muscle cells. This may be a major part of the integrated response leading to erythema production and the inflammation process. (UK).

  20. Alterations of nitric-oxide synthase and xanthine-oxidase activities of human keratinocytes by ultraviolet-B radiation -potential role for peroxynitrite in skin inflammation

    International Nuclear Information System (INIS)

    Deliconstantinos, G.; Villiotou, V.; Stavrides, J.C.

    1996-01-01

    In the present study, we demonstrated that NO synthase (cNOS) and xanthine oxidase (XO) of human keratinocytes can be activated to release NO, superoxide (O-2(-)) and peroxynitrite (ONOO-) following exposure to ultraviolet B (UVB) radiation. We defined that this photo induced response may be involved in the pathogenesis of sunburn erythema and inflammation. Treatment of human keratinocytes with UVB (290-320 nm) radiation (up to 200 mJ/cm(2)) resulted in a dose-dependent increase in NO and ONOO-release that was inhibited by N-monomethyl-L-arginine (L-NMMA). NO and ONOO- release from keratinocytes was accompanied by an increase in intracellular cGMP levels. Treatment of human keratinocyte cytosol with various doses of UVB (up to 100 mJ/cm(2)) resulted in an increase in XO activity that was inhibited by oxypurinol. In in vivo experiments, when experimental animals were subjected to UVB radiation, a protection factor (PF) of 6.5 ± 1.8 was calculated when an emulsified cream formulation containing nitro-L-arginine (L-NA) (2%) and L-NMMA (2%) was applied to their skin. The present study indicates that UVB radiation acts as a potent stimulator of cNOS and XO activities in human keratinocytes. NO and ONOO- may exert cytotoxic effects in keratinocytes themselves, as well as in their neighbouring endothelial and smooth muscle cells. This may be a major part of the integrated response leading to erythema production and the inflammation process. (UK)

  1. Equilibrium: two-dimensional configurations

    International Nuclear Information System (INIS)

    Anon.

    1987-01-01

    In Chapter 6, the problem of toroidal force balance is addressed in the simplest, nontrivial two-dimensional geometry, that of an axisymmetric torus. A derivation is presented of the Grad-Shafranov equation, the basic equation describing axisymmetric toroidal equilibrium. The solutions to equations provide a complete description of ideal MHD equilibria: radial pressure balance, toroidal force balance, equilibrium Beta limits, rotational transform, shear, magnetic wall, etc. A wide number of configurations are accurately modeled by the Grad-Shafranov equation. Among them are all types of tokamaks, the spheromak, the reversed field pinch, and toroidal multipoles. An important aspect of the analysis is the use of asymptotic expansions, with an inverse aspect ratio serving as the expansion parameter. In addition, an equation similar to the Grad-Shafranov equation, but for helically symmetric equilibria, is presented. This equation represents the leading-order description low-Beta and high-Beta stellarators, heliacs, and the Elmo bumpy torus. The solutions all correspond to infinitely long straight helices. Bending such a configuration into a torus requires a full three-dimensional calculation and is discussed in Chapter 7

  2. The E5 protein of human papillomavirus type 16 perturbs MHC class II antigen maturation in human foreskin keratinocytes treated with interferon-γ

    International Nuclear Information System (INIS)

    Zhang Benyue; Li Ping; Wang Exing; Brahmi, Zacharie; Dunn, Kenneth W.; Blum, Janice S.; Roman, Ann

    2003-01-01

    Major histocompatibility complex (MHC) class II antigens are expressed on human foreskin keratinocytes (HFKs) following exposure to interferon gamma. The expression of MHC class II proteins on the cell surface may allow keratinocytes to function as antigen-presenting cells and induce a subsequent immune response to virus infection. Invariant chain (Ii) is a chaperone protein which plays an important role in the maturation of MHC class II molecules. The sequential degradation of Ii within acidic endocytic compartments is a key process required for the successful loading of antigenic peptide onto MHC class II molecules. Since human papillomavirus (HPV) 16 E5 can inhibit the acidification of late endosomes in HFKs, the E5 protein may be able to affect proper peptide loading onto the MHC class II molecule. To test this hypothesis, HFKs were infected with either control virus or a recombinant virus expressing HPV16 E5 and the infected cells were subsequently treated with interferon-γ. ELISAs revealed a decrease of MHC class II expression on the surface of E5-expressing cells compared with control virus-infected cells after interferon treatment. Western blot analysis showed that, in cells treated with interferon gamma, E5 could prevent the breakdown of Ii and block the formation of peptide-loaded, SDS-stable mature MHC class II dimers, correlating with diminished surface MHC class II expression. These data suggest that HPV16 E5 may be able to decrease immune recognition of infected keratinocytes via disruption of MHC class II protein function

  3. Loss of Robustness and Addiction to IGF1 during Early Keratinocyte Transformation by Human Papilloma Virus 16

    Science.gov (United States)

    Geiger, Tamar; Levitzki, Alexander

    2007-01-01

    Infection of keratinocytes with high risk human Papilloma virus causes immortalization, and when followed by further mutations, leads to cervical cancer and other anogenital tumors. Here we monitor the progressive loss of robustness in an in vitro model of the early stages of transformation that comprises normal keratinocytes and progressive passages of HPV16 immortalized cells. As transformation progresses, the cells acquire higher proliferation rates and gain the ability to grow in soft agar. Concurrently, the cells lose robustness, becoming more sensitive to serum starvation and DNA damage by Cisplatin. Loss of robustness in the course of transformation correlates with significant reductions in the activities of the anti-apoptotic proteins PKB/Akt, Erk, Jnk and p38 both under normal growth conditions and upon stress. In parallel, loss of robustness is manifested by the shrinkage of the number of growth factors that can rescue starving cells from apoptosis, with the emergence of dependence solely on IGF1. Treatment with IGF1 activates PKB/Akt and Jnk and through them inhibits p53, rescuing the cells from starvation. We conclude that transformation in this model induces higher susceptibility of cells to stress due to reduced anti-apoptotic signaling and hyper-activation of p53 upon stress. PMID:17622350

  4. Strain-dependent augmentation of tight-junction barrier function in human primary epidermal keratinocytes by Lactobacillus and Bifidobacterium lysates.

    Science.gov (United States)

    Sultana, Reshma; McBain, Andrew J; O'Neill, Catherine A

    2013-08-01

    In this study, we investigated whether probiotic lysates can modify the tight-junction function of human primary keratinocytes. The keratinocytes were grown on cell culture inserts and treated with lysates from Bifidobacterium longum, Lactobacillus plantarum, Lactobacillus reuteri, Lactobacillus fermentum, or Lactobacillus rhamnosus GG. With the exception of L. fermentum (which decreased cell viability), all strains markedly enhanced tight-junction barrier function within 24 h, as assessed by measurements of transepithelial electrical resistance (TEER). However, B. longum and L. rhamnosus GG were the most efficacious, producing dose-dependent increases in resistance that were maintained for 4 days. These increases in TEER correlated with elevated expression of tight-junction protein components. Neutralization of Toll-like receptor 2 abolished both the increase in TEER and expression of tight-junction proteins induced by B. longum, but not L. rhamnosus GG. These data suggest that some bacterial strains increase tight-junction function via modulation of protein components but the different pathways involved may vary depending on the bacterial strain.

  5. Basement membrane reconstruction in human skin equivalents is regulated by fibroblasts and/or exogenously activated keratinocytes.

    Science.gov (United States)

    El Ghalbzouri, Abdoelwaheb; Jonkman, Marcel F; Dijkman, Remco; Ponec, Maria

    2005-01-01

    This study was undertaken to examine the role fibroblasts play in the formation of the basement membrane (BM) in human skin equivalents. For this purpose, keratinocytes were seeded on top of fibroblast-free or fibroblast-populated collagen matrix or de-epidermized dermis and cultured in the absence of serum and exogenous growth factors. The expression of various BM components was analyzed on the protein and mRNA level. Irrespective of the presence or absence of fibroblasts, keratin 14, hemidesmosomal proteins plectin, BP230 and BP180, and integrins alpha1beta1, alpha2beta1, alpha3beta1, and alpha6beta4 were expressed but laminin 1 was absent. Only in the presence of fibroblasts or of various growth factors, laminin 5 and laminin 10/11, nidogen, uncein, type IV and type VII collagen were decorating the dermal/epidermal junction. These findings indicate that the attachment of basal keratinocytes to the dermal matrix is most likely mediated by integrins alpha1beta1 and alpha2beta1, and not by laminins that bind to integrin alpha6beta4 and that the epithelial-mesenchymal cross-talk plays an important role in synthesis and deposition of various BM components.

  6. Cytoskeleton and pericellular matrix organization of pure adult human keratinocytes cultured from suction-blister roof epidermis.

    Science.gov (United States)

    Kariniemi, A L; Lehto, V P; Vartio, T; Virtanen, I

    1982-12-01

    Pure adult human keratinocyte cultures were raised from suction-blister roof epidermis and cultured in MCDB-151 medium. In primary culture the epidermal cells rapidly adhered, spread and began to proliferate on collagen-coated growth substrata but not on uncoated plastic or glass substrata. A fibrillar keratin-specific fluorescence, showing a typical cell-cell arrangement, was seen in all cells in indirect immunofluorescence microscopy, whereas only some cells also showed vimentin-specific staining. A fine fibrillar fibronectin-specific surface staining was seen at the margin of attaching cells and in marginal cells of spreading cell islands, whereas no fluorescence could be seen in epidermal cells, with antibodies against type IV collagen or laminin. Interestingly, the marginal cells also showed intracellular fibronectin. The synthesis of fibronectin in epidermal cell cultures could also be revealed by metabolic labelling experiments with [35S]methionine. In contrast to primary cultures, subcultivated keratinocytes also adhered to uncoated plastic and glass substrata. After subcultivation, keratin and surface fibronectin distribution remained unaltered but after some subcultivations, most of the cells also showed fibrillar vimentin and expressed fibronectin intracellularly. The results show that the suction-blister method provides an easy way to obtain pure epidermal cell cultures without contaminating mesenchymal cells. Our results also suggest a direct role for fibronectin but not for collagen type IV or laminin in adhesion and spreading of epidermal cells in vitro.

  7. Interleukin 22 early affects keratinocyte differentiation, but not proliferation, in a three-dimensional model of normal human skin

    Energy Technology Data Exchange (ETDEWEB)

    Donetti, Elena, E-mail: elena.donetti@unimi.it [Department of Biomedical Sciences for Health, Università degli Studi di Milano, 20133 Milan (Italy); Cornaghi, Laura; Arnaboldi, Francesca; Landoni, Federica [Department of Biomedical Sciences for Health, Università degli Studi di Milano, 20133 Milan (Italy); Romagnoli, Paolo [Department of Experimental and Clinical Medicine, Università degli Studi di Firenze, 50125 Florence (Italy); Mastroianni, Nicolino [Department of Biomedical Sciences for Health, Università degli Studi di Milano, 20133 Milan (Italy); Pescitelli, Leonardo [Department of Surgery and Translational Medicine, Università degli Studi di Firenze, 50125 Florence (Italy); Baruffaldi Preis, Franz W. [I.R.C.C.S. Istituto Ortopedico Galeazzi, 20161 Milan (Italy); Prignano, Francesca [Department of Surgery and Translational Medicine, Università degli Studi di Firenze, 50125 Florence (Italy)

    2016-07-15

    Interleukin (IL)-22 is a pro-inflammatory cytokine driving the progression of the psoriatic lesion with other cytokines, as Tumor Necrosis Factor (TNF)-alpha and IL-17. Our study was aimed at evaluating the early effect of IL-22 alone or in combination with TNF-alpha and IL-17 by immunofluorescence on i) keratinocyte (KC) proliferation, ii) terminal differentiation biomarkers as keratin (K) 10 and 17 expression, iii) intercellular junctions. Transmission electron microscopy (TEM) analysis was performed. A model of human skin culture reproducing a psoriatic microenvironment was used. Plastic surgery explants were obtained from healthy young women (n=7) after informed consent. Fragments were divided before adding IL-22 or a combination of the three cytokines, and harvested 24 (T24), 48 (T48), and 72 (T72) h later. From T24, in IL-22 samples we detected a progressive decrease in K10 immunostaining in the spinous layer paralleled by K17 induction. By TEM, after IL-22 incubation, keratin aggregates were evident in the perinuclear area. Occludin immunostaining was not homogeneously distributed. Conversely, KC proliferation was not inhibited by IL-22 alone, but only by the combination of cytokines. Our results suggest that IL-22 affects keratinocyte terminal differentiation, whereas, in order to induce a proliferation impairment, a more complex psoriatic-like microenvironment is needed.

  8. Interleukin 22 early affects keratinocyte differentiation, but not proliferation, in a three-dimensional model of normal human skin

    International Nuclear Information System (INIS)

    Donetti, Elena; Cornaghi, Laura; Arnaboldi, Francesca; Landoni, Federica; Romagnoli, Paolo; Mastroianni, Nicolino; Pescitelli, Leonardo; Baruffaldi Preis, Franz W.; Prignano, Francesca

    2016-01-01

    Interleukin (IL)-22 is a pro-inflammatory cytokine driving the progression of the psoriatic lesion with other cytokines, as Tumor Necrosis Factor (TNF)-alpha and IL-17. Our study was aimed at evaluating the early effect of IL-22 alone or in combination with TNF-alpha and IL-17 by immunofluorescence on i) keratinocyte (KC) proliferation, ii) terminal differentiation biomarkers as keratin (K) 10 and 17 expression, iii) intercellular junctions. Transmission electron microscopy (TEM) analysis was performed. A model of human skin culture reproducing a psoriatic microenvironment was used. Plastic surgery explants were obtained from healthy young women (n=7) after informed consent. Fragments were divided before adding IL-22 or a combination of the three cytokines, and harvested 24 (T24), 48 (T48), and 72 (T72) h later. From T24, in IL-22 samples we detected a progressive decrease in K10 immunostaining in the spinous layer paralleled by K17 induction. By TEM, after IL-22 incubation, keratin aggregates were evident in the perinuclear area. Occludin immunostaining was not homogeneously distributed. Conversely, KC proliferation was not inhibited by IL-22 alone, but only by the combination of cytokines. Our results suggest that IL-22 affects keratinocyte terminal differentiation, whereas, in order to induce a proliferation impairment, a more complex psoriatic-like microenvironment is needed.

  9. Evaluation of the effect of radiation levels and dose rates in irradiation of murine fibroblasts used as a feeder layer in the culture of human keratinocytes

    International Nuclear Information System (INIS)

    Yoshito, Daniele; Almeida, Tiago L.; Santin, Stefany Plumeri; Somessari, Elizabeth S.R.; Silveira, Carlos G. da; Mathor, Monica B.; Altran, Silvana C.; Isaac, Cesar

    2009-01-01

    In 1975, Rheinwald and Green published an effective methodology for obtaining and cultivating human keratinocytes. This methodology consisted of seeding keratinocytes onto a feeder layer composed of lineage 3T3 murine fibroblasts, the proliferation rate of which is then controlled through the action of ionizing radiation. The presence of the feeder layer encourages the development of keratinocyte colonies and their propagation in similar cultures, becoming possible several clinical applications as skin substitutes or wound dressings in situations such as post burn extensive skin loss and other skin disorders. However, good development of these keratinocytes depends on a high quality feeder layer among other factors. In the present work, we evaluated the relationship between radiation levels and dose rates applied to fibroblasts used in construction of feeder layers and the radiation effect on keratinocytes colonies forming efficiency. Results indicate 3T3 lineage murine fibroblasts irradiated with doses varying between 60 and 100 Gy can be used as a feeder layer immediately after irradiation or storage of the irradiated cells in suspension at 4 g C for 24 hours with similar results. The exception is when the irradiation dose rate is 2.75 Gyh -1 ; in this case, results suggested that the fibroblasts should be used immediately after irradiation. (author)

  10. IFI16 and cGAS cooperate in the activation of STING during DNA sensing in human keratinocytes.

    Science.gov (United States)

    Almine, Jessica F; O'Hare, Craig A J; Dunphy, Gillian; Haga, Ismar R; Naik, Rangeetha J; Atrih, Abdelmadjid; Connolly, Dympna J; Taylor, Jordan; Kelsall, Ian R; Bowie, Andrew G; Beard, Philippa M; Unterholzner, Leonie

    2017-02-13

    Many human cells can sense the presence of exogenous DNA during infection though the cytosolic DNA receptor cyclic GMP-AMP synthase (cGAS), which produces the second messenger cyclic GMP-AMP (cGAMP). Other putative DNA receptors have been described, but whether their functions are redundant, tissue-specific or integrated in the cGAS-cGAMP pathway is unclear. Here we show that interferon-γ inducible protein 16 (IFI16) cooperates with cGAS during DNA sensing in human keratinocytes, as both cGAS and IFI16 are required for the full activation of an innate immune response to exogenous DNA and DNA viruses. IFI16 is also required for the cGAMP-induced activation of STING, and interacts with STING to promote STING phosphorylation and translocation. We propose that the two DNA sensors IFI16 and cGAS cooperate to prevent the spurious activation of the type I interferon response.

  11. Non-thermal Plasma Activates Human Keratinocytes by Stimulation of Antioxidant and Phase II Pathways

    Science.gov (United States)

    Schmidt, Anke; Dietrich, Stephan; Steuer, Anna; Weltmann, Klaus-Dieter; von Woedtke, Thomas; Masur, Kai; Wende, Kristian

    2015-01-01

    Non-thermal atmospheric pressure plasma provides a novel therapeutic opportunity to control redox-based processes, e.g. wound healing, cancer, and inflammatory diseases. By spatial and time-resolved delivery of reactive oxygen and nitrogen species, it allows stimulation or inhibition of cellular processes in biological systems. Our data show that both gene and protein expression is highly affected by non-thermal plasma. Nuclear factor erythroid-related factor 2 (NRF2) and phase II enzyme pathway components were found to act as key controllers orchestrating the cellular response in keratinocytes. Additionally, glutathione metabolism, which is a marker for NRF2-related signaling events, was affected. Among the most robustly increased genes and proteins, heme oxygenase 1, NADPH-quinone oxidoreductase 1, and growth factors were found. The roles of NRF2 targets, investigated by siRNA silencing, revealed that NRF2 acts as an important switch for sensing oxidative stress events. Moreover, the influence of non-thermal plasma on the NRF2 pathway prepares cells against exogenic noxae and increases their resilience against oxidative species. Via paracrine mechanisms, distant cells benefit from cell-cell communication. The finding that non-thermal plasma triggers hormesis-like processes in keratinocytes facilitates the understanding of plasma-tissue interaction and its clinical application. PMID:25589789

  12. Expression of the helix-loop-helix protein inhibitor of DNA binding-1 (ID-1) is activated by all-trans retinoic acid in normal human keratinocytes

    International Nuclear Information System (INIS)

    Villano, C.M.; White, L.A.

    2006-01-01

    The ID (inhibitor of differentiation or DNA binding) helix-loop-helix proteins are important mediators of cellular differentiation and proliferation in a variety of cell types through regulation of gene expression. Overexpression of the ID proteins in normal human keratinocytes results in extension of culture lifespan, indicating that these proteins are important for epidermal differentiation. Our hypothesis is that the ID proteins are targets of the retinoic acid signaling pathway in keratinocytes. Retinoids, vitamin A analogues, are powerful regulators of cell growth and differentiation and are widely used in the prevention and treatment of a variety of cancers in humans. Furthermore, retinoic acid is necessary for the maintenance of epithelial differentiation and demonstrates an inhibitory action on skin carcinogenesis. We examined the effect of all-trans retinoic acid on expression of ID-1, -2, -3, and -4 in normal human keratinocytes and found that exposure of these cells to all-trans retinoic acid causes an increase in both ID-1 and ID-3 gene expression. Furthermore, our data show that this increase is mediated by increased transcription involving several cis-acting elements in the distal portion of the promoter, including a CREB-binding site, an Egr1 element, and an YY1 site. These data demonstrate that the ID proteins are direct targets of the retinoic acid signaling pathway. Given the importance of the ID proteins to epidermal differentiation, these results suggest that IDs may be mediating some of the effects of all-trans retinoic acid in normal human keratinocytes

  13. Induction of interleukin-6 production by ultraviolet radiation in normal human epidermal keratinocytes and in a human keratinocyte cell line is mediated by DNA damage

    NARCIS (Netherlands)

    Petit-Frère, C.; Clingen, P.H.; Grewe, M.; Krutmann, J.; Roza, L.; Arlett, C.F.; Green, M.H.L.

    1998-01-01

    The sunburn reaction is the most common consequence of human exposure to ultraviolet radiation (UVR), and is mediated at least in part by interleukin- 6 (IL-6). The aim of this study was to determine if DNA is a major chromophore involved in the induction of IL-6 following UV irradiation of a human

  14. Analysis of human plasma lipids by using comprehensive two-dimensional gas chromatography with dual detection and with the support of high-resolution time-of-flight mass spectrometry for structural elucidation.

    Science.gov (United States)

    Salivo, Simona; Beccaria, Marco; Sullini, Giuseppe; Tranchida, Peter Q; Dugo, Paola; Mondello, Luigi

    2015-01-01

    The main focus of the present research is the analysis of the unsaponifiable lipid fraction of human plasma by using data derived from comprehensive two-dimensional gas chromatography with dual quadrupole mass spectrometry and flame ionization detection. This approach enabled us to attain both mass spectral information and analyte percentage data. Furthermore, gas chromatography coupled with high-resolution time-of-flight mass spectrometry was used to increase the reliability of identification of several unsaponifiable lipid constituents. The synergism between both the high-resolution gas chromatography and mass spectrometry processes enabled us to attain a more in-depth knowledge of the unsaponifiable fraction of human plasma. Additionally, information was attained on the fatty acid and triacylglycerol composition of the plasma samples, subjected to investigation by using comprehensive two-dimensional gas chromatography with dual quadrupole mass spectrometry and flame ionization detection and high-performance liquid chromatography with atmospheric pressure chemical ionization quadrupole mass spectrometry, respectively. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Triggering Apoptotic Death of Human Epidermal Keratinocytes by Malic Acid: Involvement of Endoplasmic Reticulum Stress- and Mitochondria-Dependent Signaling Pathways

    Directory of Open Access Journals (Sweden)

    Yu-Ping Hsiao

    2015-01-01

    Full Text Available Malic acid (MA has been commonly used in cosmetic products, but the safety reports in skin are sparse. To investigate the biological effects of MA in human skin keratinocytes, we investigated the potential cytotoxicity and apoptotic effects of MA in human keratinocyte cell lines (HaCaT. The data showed that MA induced apoptosis based on the observations of DAPI staining, DNA fragmentation, and sub-G1 phase in HaCaT cells and normal human epidermal keratinocytes (NHEKs. Flow cytometric assays also showed that MA increased the production of mitochondrial superoxide (mito-SOX but decreased the mitochondrial membrane potential. Analysis of bioenergetics function with the XF 24 analyzer Seahorse extracellular flux analyzer demonstrated that oxygen consumption rate (OCR was significantly decreased whereas extracellular acidification rate (ECAR was increased in MA-treated keratinocytes. The occurrence of apoptosis was proved by the increased expressions of FasL, Fas, Bax, Bid, caspases-3, -8, -9, cytochrome c, and the declined expressions of Bcl-2, PARP. MA also induced endoplasmic reticulum stress associated protein expression such as GRP78, GADD153, and ATF6α. We demonstrated that MA had anti-proliferative effect in HaCaT cell through the inhibition of cell cycle progression at G0/G1, and the induction of programmed cell death through endoplasmic reticulum stress- and mitochondria-dependent pathways.

  16. Changes in localization of human discs large (hDlg) during keratinocyte differentiation is associated with expression of alternatively spliced hDlg variants

    International Nuclear Information System (INIS)

    Roberts, S.; Calautti, E.; Vanderweil, S.; Nguyen, H.O.; Foley, A.; Baden, H.P.; Viel, A.

    2007-01-01

    Alternative spliced variants of the human discs large (hDlg) tumour suppressor are characterized by combinations of insertions. Here, using insertions I2- and I3-specific antibodies, we show that I2 and I3 variants have distinct distributions in epidermal and cervical epithelia. In skin and cervix, I3 variants are found in the cytoplasm. Cytoplasmic localization of I3 variants decreases as cervical keratinocytes differentiate, concomitant with relocalization to the cell periphery. I2 variants are found at the cell periphery of differentiated epidermal and cervical keratinocytes. Nuclear localization of I2 variants was evident in both tissues, with concentration of nuclear I2 variants in basal and parabasal cervical keratinocytes. A prominent nuclear localization of hDlg in cells of hyperproliferative layers of psoriatic lesions, but not in mature differentiated keratinocytes, together with I2 redistribution in differentiating keratinocytes, suggests that nuclear hDlg functions may be pertinent to growth of undifferentiated cells. Supporting our findings in squamous tissues, a decrease of nuclear hDlg and an increase of membrane-bound and cytoplasmic hDlg upon calcium-induced keratinocyte differentiation were not concomitant processes. Furthermore, we confirm that the exit of I2 variants from the nucleus is linked to stimulation of epithelial differentiation. The dynamic redistribution of hDlg also correlated with a marked increase in the expression of I3 variants while the level of I2 variants showed only a moderate decrease. Because changes in the intracellular distribution of hDlg splice variants, and in their expression levels, correlate with changes in differentiation state we hypothesize that the different hDlg isoforms play distinct roles at various stages of epithelial differentiation

  17. [14C]mechlorethamine binding to proteins of the human keratinocyte

    International Nuclear Information System (INIS)

    Deaton, M.A.; Jones, G.P.; Bowman, P.D.

    1990-01-01

    Much mustard agent research has focused on mustard/DNA interactions. Mustard also interacts with proteins, however, and to reach the DNA any agent must first pass through the cytoplasm. We hypothesized that the cell's proteins would covalently bind mustard, and thereby limit its access to the DNA. Keratinocyte proteins were radiolabeled with [ 14 C]mechlorethamine and separated by electrophoresis. The banding patterns that resulted were made visible on x-ray films, then compared with control patterns. A correspondence of almost one-to-one was observed, which supports the hypothesis that many cellular proteins are susceptible to mustard alkylation. It follows that some mustard symptoms probably result from effects on existing proteins

  18. Human T-Lymphotropic virus (HTLV type I in vivo integration in oral keratinocytes

    Directory of Open Access Journals (Sweden)

    Martha C Domínguez

    2011-03-01

    Full Text Available Although the infection of HTLV-1 to cell components of the mouth have been previously reported, there was not until this report, a detailed study to show the characteristics of such infection. From 14 Tropical Spastic Paraparesis/ HTLV-1-Associated Myelopathy (HAM/TSP patients and 11 asymptomatic carrier individuals (AC coming from HTLV-1 endemic areas of southwest Pacific of Colombia, infected oral mucosa cells were primary cultured during five days. These cell cultures were immunophenotyped by dual color fluorescence cell assortment using different lymphocyte CD markers and also were immunohistochemically processed using a polyclonal anti-keratin antibody. Five days old primary cultures were characterized as oral keratinocytes, whose phenotype was CD3- /CD4-/CD8-/CD19-/CD14-/CD45-/A575-keratin+. From DNA extracted of primary cultures LTR, pol, env and tax HTLV-1 proviral DNA regions were differentially amplified by PCR showing proviral integration. Using poly A+ RNA obtained of these primary cultures, we amplify by RT-PCR cDNA of tax and pol in 57.14% (8/14 HAM/TSP patients and 27.28% (3/11 AC. Tax and pol poly A+ RNA were expressed only in those sIgA positive subjects. Our results showed that proviral integration and viral gene expression in oral keratinocytes are associated with a HTLV-1 specific local mucosal immune response only in those HTLV-1 infected individuals with detectable levels of sIgA in their oral fluids. Altogether the results gave strong evidence that oral mucosa infection would be parte of the systemic spreading of HTLV-1 infection.

  19. Effects of bee venom against Propionibacterium acnes-induced inflammation in human keratinocytes and monocytes.

    Science.gov (United States)

    Kim, Jung-Yeon; Lee, Woo-Ram; Kim, Kyung-Hyun; An, Hyun-Jin; Chang, Young-Chae; Han, Sang-Mi; Park, Yoon-Yub; Pak, Sok Cheon; Park, Kwan-Kyu

    2015-06-01

    Propionibacterium acnes (P. acnes) cause inflammatory acne and play an important role in the pathogenesis of acne by inducing inflammatory mediators. P. acnes contributes to the inflammatory responses of acne by activating inflammatory cells, keratinocytes and sebocytes to secrete pro-inflammatory cytokines such as tumor necrosis factor-α (TNF-α), interleukin (IL)-1β and IL-8. Bee venom has traditionally been used in the treatment of certain immune-related diseases. However, there has not yet been a robust trial to prove the therapeutic effect of bee venom in skin inflammation. The aim of the present study was to investigate anti-inflammatory properties of bee venom in skin inflammation induced by P. acnes using keratinocytes (HaCaT) and monocytes (THP-1). P. acnes is known to stimulate the production of pro-inflammatory cytokines such as IL-1, IL-8, IL-12 and TNF-α. In the present study, the production of interferon-γ (IFN-γ), IL-1β, IL-8 and TNF-α was increased by P. acnes treatment in HaCaT and THP-1 cells. By contrast, bee venom effectively inhibited the secretion of IFN-γ, IL-1β, IL-8 and TNF-α. Furthermore, P. acnes treatment activated the expression of IL-8 and toll-like receptor 2 (TLR2) in HaCaT cells. However, bee venom inhibited the expression of IL-8 and TLR2 in heat-killed P. acnes. Based on these results, it is concluded that bee venom has an effective anti-inflammatory activity against P. acnes in HaCaT and THP-1 cells. Therefore, we suggest that bee venom is an alternative treatment to antibiotic therapy of acne.

  20. Incoming human papillomavirus 16 genome is lost in PML protein-deficient HaCaT keratinocytes.

    Science.gov (United States)

    Bienkowska-Haba, Malgorzata; Luszczek, Wioleta; Keiffer, Timothy R; Guion, Lucile G M; DiGiuseppe, Stephen; Scott, Rona S; Sapp, Martin

    2017-05-01

    Human papillomaviruses (HPVs) target promyelocytic leukemia (PML) nuclear bodies (NBs) during infectious entry and PML protein is important for efficient transcription of incoming viral genome. However, the transcriptional down regulation was shown to be promoter-independent in that heterologous promoters delivered by papillomavirus particles were also affected. To further investigate the role of PML protein in HPV entry, we used small hairpin RNA to knockdown PML protein in HaCaT keratinocytes. Confirming previous findings, PML knockdown in HaCaT cells reduced HPV16 transcript levels significantly following infectious entry without impairing binding and trafficking. However, when we quantified steady-state levels of pseudogenomes in interphase cells, we found strongly reduced genome levels compared with parental HaCaT cells. Because nuclear delivery was comparable in both cell lines, we conclude that viral pseudogenome must be removed after successful nuclear delivery. Transcriptome analysis by gene array revealed that PML knockdown in clonal HaCaT cells was associated with a constitutive interferon response. Abrogation of JAK1/2 signaling prevented genome loss, however, did not restore viral transcription. In contrast, knockdown of PML protein in HeLa cells did not affect HPV genome delivery and transcription. HeLa cells are transformed by HPV18 oncogenes E6 and E7, which have been shown to interfere with the JAK/Stat signaling pathway. Our data imply that PML NBs protect incoming HPV genomes. Furthermore, they provide evidence that PML NBs are key regulators of the innate immune response in keratinocytes. Promyelocytic leukemia nuclear bodies (PML NBs) are important for antiviral defense. Many DNA viruses target these subnuclear structures and reorganize them. Reorganization of PML NBs by viral proteins is important for establishment of infection. In contrast, HPVs require the presence of PML protein for efficient transcription of incoming viral genome. Our

  1. Comprehensive lipidomic analysis of human plasma using multidimensional liquid- and gas-phase separations: Two-dimensional liquid chromatography-mass spectrometry vs. liquid chromatography-trapped-ion-mobility-mass spectrometry.

    Science.gov (United States)

    Baglai, Anna; Gargano, Andrea F G; Jordens, Jan; Mengerink, Ynze; Honing, Maarten; van der Wal, Sjoerd; Schoenmakers, Peter J

    2017-12-29

    Recent advancements in separation science have resulted in the commercialization of multidimensional separation systems that provide higher peak capacities and, hence, enable a more-detailed characterization of complex mixtures. In particular, two powerful analytical tools are increasingly used by analytical scientists, namely online comprehensive two-dimensional liquid chromatography (LC×LC, having a second-dimension separation in the liquid phase) and liquid chromatography-ion mobility-spectrometry (LC-IMS, second dimension separation in the gas phase). The goal of the current study was a general assessment of the liquid-chromatography-trapped-ion-mobility-mass spectrometry (LC-TIMS-MS) and comprehensive two-dimensional liquid chromatography-mass spectrometry (LC×LC-MS) platforms for untargeted lipid mapping in human plasma. For the first time trapped-ion-mobility spectrometry (TIMS) was employed for the separation of the major lipid classes and ion-mobility-derived collision-cross-section values were determined for a number of lipid standards. The general effects of a number of influencing parameters have been inspected and possible directions for improvements are discussed. We aimed to provide a general indication and practical guidelines for the analyst to choose an efficient multidimensional separation platform according to the particular requirements of the application. Analysis time, orthogonality, peak capacity, and an indicative measure for the resolving power are discussed as main characteristics for multidimensional separation systems. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. Major proteins in normal human lymphocyte subpopulations separated by fluorescence-activated cell sorting and analyzed by two-dimensional gel electrophoresis

    DEFF Research Database (Denmark)

    Madsen, P S; Hokland, M; Ellegaard, J

    1988-01-01

    markers were observed in all cell types. All the putative protein markers have been identified in the protein database of human peripheral blood mononuclear cells (PBMCs) (see accompanying article by Celis et al.). Comparison of the overall patterns of protein synthesis of the unsorted PBMCs with those...... of the four subpopulations showed that the synthesis of some major PBMC proteins decreased substantially in the sorted subsets. These proteins are most likely not of monocyte origin, as these cells constituted only about 15% of the total PBMCs. Also, the inhibition does not seem to be due to the addition...

  3. GATA3 is a master regulator of the transcriptional response to low-dose ionizing radiation in human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Bonin, F.; Molina, M.; Berthier-Vergnes, O.; Lamartine, J. [Universite de Lyon, Lyon, F-69003 (France); Universite Lyon 1, Lyon, F-69003 (France); CNRS, UMR5534, Centre de Genetique Moleculaire et Cellulaire, Villeurbanne, F-69622 (France); Malet, C.; Ginestet, C. [Centre Leon Berard, Service de Radiotherapie, Lyon F-69008 (France); Martin, M.T. [Laboratoire de Genomique et Radiobiologie de la Keratinopoiese, CEA, IRCM, Evry F-91000 (France)

    2009-07-01

    Background: The general population is constantly exposed to low levels of radiation through natural, occupational or medical irradiation. Even if the biological effects of low-level radiation have been intensely debated and investigated, the molecular mechanisms underlying the cellular response to low doses remain largely unknown. Results: The present study investigated the role of GATA3 protein in the control of the cellular and molecular response of human keratinocytes exposed to a 1 cGy dose of X-rays. Chromatin immunoprecipitation showed GATA3 to be able to bind the promoter of 4 genes responding to a 1 cGy exposure. To go further into the role of GATA3 after ionizing radiation exposure, we studied the cellular and molecular consequences of radiation in GATA3 knock-down cells. Knockdown was obtained by lentiviral-mediated expression of an shRNA targeting the GATA3 transcript in differentiated keratinocytes. First, radiosensitivity was assessed: the toxicity, in terms of immediate survival (with XTT test), associated with 1 cGy radiation was found to be increased in GATA3 knock-down cells. The impact of GATA3 knock-down on the transcriptome of X-ray irradiated cells was also investigated, using oligonucleotide micro-arrays to assess changes between 3 h and 72 h post-irradiation in normal vs GATA3 knock-down backgrounds; transcriptome response was found to be completely altered in GATA3 knock-down cells, with a strong induction/repression peak 48 h after irradiation. Functional annotation revealed enrichment in genes known to be involved in chaperone activity, TGF{beta} signalling and stress response. Conclusion: Taken together, these data indicate that GATA3 is an important regulator of the cellular and molecular response of epidermal cells to very low doses of radiation. (authors)

  4. Osteo-/odontogenic differentiation of induced mesenchymal stem cells generated through epithelial-mesenchyme transition of cultured human keratinocytes.

    Science.gov (United States)

    Yi, Jin-Kyu; Mehrazarin, Shebli; Oh, Ju-Eun; Bhalla, Anu; Oo, Jenessa; Chen, Wei; Lee, Min; Kim, Reuben H; Shin, Ki-Hyuk; Park, No-Hee; Kang, Mo K

    2014-11-01

    Revascularization of necrotic pulp has been successful in the resolution of periradicular inflammation; yet, several case studies suggest the need for cell-based therapies using mesenchymal stem cells (MSCs) as an alternative for de novo pulp regeneration. Because the availability of MSCs may be limited, especially in an aged population, the current study reports an alternative approach in generating MSCs from epidermal keratinocytes through a process called epithelial-mesenchymal transition (EMT). We induced EMT in primary normal human epidermal keratinocytes (NHEKs) by transient transfection of small interfering RNA targeting the p63 gene. The resulting cells were assayed for their mesenchymal marker expression, proliferation capacities as a monolayer and in a 3-dimensional collagen scaffold, and differentiation capacities. Transient transfection of p63 small-interfering RNA successfully abolished the expression of endogenous p63 in NHEKs and induced the expression of mesenchymal markers (eg, vimentin and fibronectin), whereas epithelial markers (eg, E-cadherin and involucrin) were lost. The NHEKs exhibiting the EMT phenotype acquired extended replicative potential and an increased telomere length compared with the control cells. Similar to the established MSCs, the NHEKs with p63 knockdown showed attachment onto the 3-dimensional collagen scaffold and underwent progressive proliferation and differentiation. Upon differentiation, these EMT cells expressed alkaline phosphatase activity, osteocalcin, and osteonectin and readily formed mineralized nodules detected by alizarin S red staining, showing osteo-/odontogenic differentiation. The induction of EMT in primary NHEKs by means of transient p63 knockdown allows the generation of induced MSCs from autologous sources. These cells may be used for tissues engineering purposes, including that of dental pulp. Copyright © 2014 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

  5. Broad-spectrum sunscreens prevent the secretion of proinflammatory cytokines in human keratinocytes exposed to ultraviolet A and phototoxic lomefloxacin

    International Nuclear Information System (INIS)

    Reinhardt, P.; Cybulski, M.; Miller, S.M.; Ferrarotto, C.; Wilkins, R.; Deslauriers, Y.

    2006-01-01

    The combination of phototoxic drugs and ultraviolet (UV) radiation can trigger the release of proinflammatory cytokines. The present study measured the ability of sunscreens to prevent cytokine secretion in human keratinocytes following cotreatment of these cells with a known photoreactive drug and UVA. Keratinocytes were treated for 1 h with increasing concentrations of lomefloxacin (LOM) or norfloxacin (NOR), exposed to 15 J/cm 2 UVA, and incubated for 24 h. NOR, owing to the absence of a fluorine atom in position 8, was non-phototoxic and used as a negative control. Cell viability and the release of 3 cytokines were assessed, namely interleukin-1α (IL-1α), interleukin-6 (IL-6), and tumour necrosis factor-α (TNF-α). The measurement of these cytokines may be a useful tool for detecting photoreactive compounds. To measure their ability to prevent cytokine secretion, various sunscreens were inserted between the UVA source and the cells. Treatment with NOR, NOR plus UVA, or LOM had no effect on the cells. LOM plus UVA, however, had an effect on cell viability and on cytokine secretion. IL-1α levels increased with LOM concentration. The release of TNF-α and IL-6 followed the same pattern at lower concentrations of LOM but peaked at 15 μmol/L and decreased at higher concentrations. Sunscreens protected the cells from the effects of LOM plus UVA, as cell viability and levels of cytokines remained the same as in the control cells. In conclusion, the application of broad-spectrum sunscreen by individuals exposed to UVA radiation may prevent phototoxic reactions initiated by drugs such as LOM. (author)

  6. GATA3 is a master regulator of the transcriptional response to low-dose ionizing radiation in human keratinocytes

    International Nuclear Information System (INIS)

    Bonin, F.; Molina, M.; Berthier-Vergnes, O.; Lamartine, J.; Malet, C.; Ginestet, C.; Martin, M.T.

    2009-01-01

    Background: The general population is constantly exposed to low levels of radiation through natural, occupational or medical irradiation. Even if the biological effects of low-level radiation have been intensely debated and investigated, the molecular mechanisms underlying the cellular response to low doses remain largely unknown. Results: The present study investigated the role of GATA3 protein in the control of the cellular and molecular response of human keratinocytes exposed to a 1 cGy dose of X-rays. Chromatin immunoprecipitation showed GATA3 to be able to bind the promoter of 4 genes responding to a 1 cGy exposure. To go further into the role of GATA3 after ionizing radiation exposure, we studied the cellular and molecular consequences of radiation in GATA3 knock-down cells. Knockdown was obtained by lentiviral-mediated expression of an shRNA targeting the GATA3 transcript in differentiated keratinocytes. First, radiosensitivity was assessed: the toxicity, in terms of immediate survival (with XTT test), associated with 1 cGy radiation was found to be increased in GATA3 knock-down cells. The impact of GATA3 knock-down on the transcriptome of X-ray irradiated cells was also investigated, using oligonucleotide micro-arrays to assess changes between 3 h and 72 h post-irradiation in normal vs GATA3 knock-down backgrounds; transcriptome response was found to be completely altered in GATA3 knock-down cells, with a strong induction/repression peak 48 h after irradiation. Functional annotation revealed enrichment in genes known to be involved in chaperone activity, TGFβ signalling and stress response. Conclusion: Taken together, these data indicate that GATA3 is an important regulator of the cellular and molecular response of epidermal cells to very low doses of radiation. (authors)

  7. Repeatability of two-dimensional chemical shift imaging multivoxel proton magnetic resonance spectroscopy for measuring human cerebral choline-containing compounds.

    Science.gov (United States)

    Puri, Basant K; Egan, Mary; Wallis, Fintan; Jakeman, Philip

    2018-03-22

    To investigate the repeatability of proton magnetic resonance spectroscopy in the in vivo measurement of human cerebral levels of choline-containing compounds (Cho). Two consecutive scans were carried out in six healthy resting subjects at a magnetic field strength of 1.5 T. On each occasion, neurospectroscopy data were collected from 64 voxels using the same 2D chemical shift imaging (CSI) sequence. The data were analyzed in the same way, using the same software, to obtain the values for each voxel of the ratio of Cho to creatine. The Wilcoxon related-samples signed-rank test, coefficient of variation (CV), repeatability coefficient (RC), and intraclass correlation coefficient (ICC) were used to assess the repeatability. The CV ranged from 2.75% to 33.99%, while the minimum RC was 5.68%. There was excellent reproducibility, as judged by significant ICC values, in 26 voxels. Just three voxels showed significant differences according to the Wilcoxon related-samples signed-rank test. It is therefore concluded that when CSI multivoxel proton neurospectroscopy is used to measure cerebral choline-containing compounds at 1.5 T, the reproducibility is highly acceptable.

  8. Evidence for Alteration of EZH2, BMI1, and KDM6A and Epigenetic Reprogramming in Human Papillomavirus Type 16 E6/E7-Expressing Keratinocytes

    OpenAIRE

    Hyland, Paula L.; McDade, Simon S.; McCloskey, Rachel; Dickson, Glenda J.; Arthur, Ken; McCance, Dennis J.; Patel, Daksha

    2011-01-01

    A number of epigenetic alterations occur in both the virus and host cellular genomes during human papillomavirus (HPV)-associated carcinogenesis, and investigations of such alterations, including changes in chromatin proteins and histone modifications, have the potential to lead to therapeutic epigenetic reversion. We report here that transformed HPV16 E6/E7-expressing primary human foreskin keratinocytes (HFKs) (E6/E7 cells) demonstrate increased expression of the PRC2 methyltransferase EZH2...

  9. Topology optimization of two-dimensional waveguides

    DEFF Research Database (Denmark)

    Jensen, Jakob Søndergaard; Sigmund, Ole

    2003-01-01

    In this work we use the method of topology optimization to design two-dimensional waveguides with low transmission loss.......In this work we use the method of topology optimization to design two-dimensional waveguides with low transmission loss....

  10. Clinicopathological correlation of keratinocyte growth factor and matrix metalloproteinase-9 expression in human gastric cancer.

    Science.gov (United States)

    Zhang, Qing; Wang, Ping; Shao, Ming; Chen, Shi-Wen; Xu, Zhi-Feng; Xu, Feng; Yang, Zhong-Yin; Liu, Bing-Ya; Gu, Qin-Long; Zhang, Wen-Jian; Li, Yong

    2015-01-01

    Keratinocyte growth factor (KGF) is reported to be implicated in the growth of some cancer cells. Matrix metalloproteinase 9 (MMP-9) is thought to enhance the tumor invasion and metastasis ability. This study was aimed at analyzing the relationship between KGF and MMP-9 expression and patients' clinicopathological characteristics to clarify the clinical significance of the expression of KGF and MMP-9 in gastric cancer. Tissue samples from 161 patients with primary gastric cancer were investigated using immunohistochemistry. The relationship between KGF and/or MMP-9 expression and clinicopathological characteristics was analyzed. KGF expression and MMP-9 expression in gastric cancer tissue were observed in 62 cases (38.5%) and 97 cases (60.2%), respectively. MMP-9 was significantly associated with depth of invasion, lymph node metastasis and TNM stage. The prognosis of MMP-9-positive patients was significantly poorer than that of MMP-9-negative patients (p = 0.009). KGF expression was positively correlated with MMP-9 expression in gastric cancer, and the prognosis of patients with both KGF- and MMP-9-positive tumors was significantly worse than that of patients with negative tumors for either factor (p = 0.045). Expression of MMP-9 was revealed to be an independent prognostic factor (p = 0.026). Coexpression of KGF and MMP-9 in gastric cancer could be a useful prognostic factor, and MMP-9 might also serve as a novel target for both prognostic prediction and therapeutics.

  11. Human keratinocytes are a source for tumor necrosis factor alpha: Evidence for synthesis and release upon stimulation with endotoxin or ultraviolet light

    International Nuclear Information System (INIS)

    Koeck, A.S.; Schwarz, T.; Kirnbauer, R.; Urbanski, A.; Perry, P.; Ansel, J.C.; Luger, T.A.

    1990-01-01

    Tumor necrosis factor alpha (TNF-alpha), in addition to being cytotoxic for certain tumor cells, has turned out as a multifunctional cytokine that is involved in the regulation of immunity and inflammation. Since human keratinocytes have been demonstrated to be a potent source of various cytokines, it was investigated whether epidermal cells synthesize and release TNF-alpha. Supernatants derived from normal human keratinocytes (HNK) and human epidermoid carcinoma cell lines (KB, A431) were tested both in a TNF-alpha-specific ELISA and a bioassay. In supernatants of untreated epidermal cells, no or minimal TNF-alpha activity was found, while after stimulation with lipopolysaccharide (LPS) or ultraviolet (UV) light, significant amounts were detected. Western blot analysis using an antibody directed against human TNF-alpha revealed a molecular mass of 17 kD for keratinocyte-derived TNF-alpha. These biological and biochemical data were also confirmed by Northern blot analysis revealing mRNA specific for TNF-alpha in LPS- or ultraviolet B (UVB)-treated HNK and KB cells. In addition, increased TNF-alpha levels were detected in the serum obtained from human volunteers 12 and 24 h after a single total body UVB exposure, which caused a severe sunburn reaction. These findings indicate that keratinocytes upon stimulation are able to synthesize and release TNF-alpha, which may gain access to the circulation. Thus, TNF-alpha in concert with other epidermal cell-derived cytokines may mediate local and systemic inflammatory reactions during host defense against injurious events caused by microbial agents or UV irradiation

  12. Protective effect of Opuntia ficus-indica L. cladodes against UVA-induced oxidative stress in normal human keratinocytes.

    Science.gov (United States)

    Petruk, Ganna; Di Lorenzo, Flaviana; Imbimbo, Paola; Silipo, Alba; Bonina, Andrea; Rizza, Luisa; Piccoli, Renata; Monti, Daria Maria; Lanzetta, Rosa

    2017-12-15

    Opuntia ficus-indica L. is known for its beneficial effects on human health, but still little is known on cladodes as a potent source of antioxidants. Here, a direct, economic and safe method was set up to obtain water extracts from Opuntia ficus-indica cladodes rich in antioxidant compounds. When human keratinocytes were pre-treated with the extract before being exposed to UVA radiations, a clear protective effect against UVA-induced stress was evidenced, as indicated by the inhibition of stress-induced processes, such as free radicals production, lipid peroxidation and GSH depletion. Moreover, a clear protective effect against apoptosis in pre-treated irradiated cells was evidenced. We found that eucomic and piscidic acids were responsible for the anti-oxidative stress action of cladode extract. In conclusion, a bioactive, safe, low-cost and high value-added extract from Opuntia cladodes was obtained to be used for skin health/protection. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. Cytotoxic effects of denture adhesives on primary human oral keratinocytes, fibroblasts and permanent L929 cell lines.

    Science.gov (United States)

    Chen, Fengying; Wu, Tianfu; Cheng, Xiangrong

    2014-03-01

    To date, there have been very little data on the cytotoxic responses of different cell lines to denture adhesives. To determine the cytotoxicity of three denture adhesives on primary human oral keratinocytes (HOKs), fibroblasts (HOFs) and permanent mouse fibroblasts cell lines (L929). Three commercial denture adhesives (two creams and one powder) were prepared for indirect contact using the agar diffusion test, as well as extracts in MTT assay. The results of the MTT assay were statistically analysed by one-way anova and Tukey's test (p adhesives showed mild to moderate cytotoxicity to primary HOKs (p  0.05) in both assays. For primary HOFs cultures, slight cytotoxicity was observed for one of the products from the agar diffusion test and undiluted eluates of all tested adhesives with MTT assay (p adhesives are toxic to the primary HOKs and HOFs cultures, whereas non-toxic to L929 cells. The results suggest that primary human oral mucosal cells may provide more valuable information in toxicity screening of denture adhesives. © 2012 John Wiley & Sons A/S and The Gerodontology Association. Published by John Wiley & Sons Ltd.

  14. Trichloroethylene-mediated cytotoxicity in human epidermal keratinocytes is mediated by the rapid accumulation of intracellular calcium: Interception by naringenin.

    Science.gov (United States)

    Ali, F; Khan, A Q; Khan, R; Sultana, S

    2016-02-01

    Industrial solvents pose a significant threat to the humankind. The mechanisms of their toxicity still remain in debate. Trichloroethylene (TCE) is a widespread industrial solvent responsible for severe liver dysfunction, cutaneous toxicity in occupationally exposed humans. We utilized an in vitro system of human epidermal keratinocyte (HaCaT) cells in this study to avoid complex cell and extracellular interactions. We report the cytotoxicity of organic solvent TCE in HaCaT and its reversal by a natural flavanone, naringenin (Nar). The cytotoxicity was attributed to the rapid intracellular free calcium (Ca(2+)) release, which might lead to the elevation of protein kinase C along with robust free radical generation, instability due to energy depletion, and sensitization of intracellular stress signal transducer nuclear factor κB. These effects were actually seen to induce significant amount of genomic DNA fragmentation. Furthermore, all these effects of TCE were effectively reversed by the treatment of Nar, a natural flavanone. Our studies identify intracellular Ca as a unique target used by organic solvents in the cytotoxicity and highlight the Ca(2+) ion stabilizer properties of Nar. © The Author(s) 2015.

  15. Discrimination of skin sensitizers from non-sensitizers by interleukin-1α and interleukin-6 production on cultured human keratinocytes.

    Science.gov (United States)

    Jung, Daun; Che, Jeong-Hwan; Lim, Kyung-Min; Chun, Young-Jin; Heo, Yong; Seok, Seung Hyeok

    2016-09-01

    In vitro testing methods for classifying sensitizers could be valuable alternatives to in vivo sensitization testing using animal models, such as the murine local lymph node assay (LLNA) and the guinea pig maximization test (GMT), but there remains a need for in vitro methods that are more accurate and simpler to distinguish skin sensitizers from non-sensitizers. Thus, the aim of our study was to establish an in vitro assay as a screening tool for detecting skin sensitizers using the human keratinocyte cell line, HaCaT. HaCaT cells were exposed to 16 relevant skin sensitizers and 6 skin non-sensitizers. The highest dose used was the dose causing 75% cell viability (CV75) that we determined by an MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] assay. The levels of extracellular production of interleukin-1α (IL-1α) and IL-6 were measured. The sensitivity of IL-1α was 63%, specificity was 83% and accuracy was 68%. In the case of IL-6, sensitivity: 69%, specificity: 83% and accuracy: 73%. Thus, this study suggests that measuring extracellular production of pro-inflammatory cytokines IL-1α and IL-6 by human HaCaT cells may potentially classify skin sensitizers from non-sensitizers. Copyright © 2015 John Wiley & Sons, Ltd. Copyright © 2015 John Wiley & Sons, Ltd.

  16. Gene expression studies on human keratinocytes transduced with human growth hormone gene for a possible utilization in gene therapy; Estudos da expressao genica mediante utilizacao de queratinocitos humanos normais transduzidos com o gene do hormonio de crscimento humano. Possivel utilizacao em terapia genica

    Energy Technology Data Exchange (ETDEWEB)

    Mathor, Monica Beatriz

    1994-12-31

    Taking advantage of the recent progress in the DNA-recombinant techniques and of the potentiality of normal human keratinocytes primary culture to reconstitute the epidermis, it was decided to genetically transform these keratinocytes to produce human growth hormone under controllable conditions that would be used in gene therapy at this hormone deficient patients. The first step to achieve this goal was to standardize infection of keratinocytes with retrovirus producer cells containing a construct which included the gene of bacterial b-galactosidase. The best result was obtained cultivating the keratinocytes for 3 days in a 2:1 mixture of retrovirus producer cells and 3T3-J2 fibroblasts irradiated with 60 Gy, and splitting these infected keratinocytes on 3T3-J2 fibroblasts feeder layer. Another preliminary experiment was to infect normal human keratinocytes with interleukin-6 gene (hIL-6) that, in pathologic conditions, could be reproduced by keratinocytes and secreted to the blood stream. Thus, we verify that infected keratinocytes secrete an average amount of 500 ng/10{sup 6} cell/day of cytokin during the in vitro life time, that certify the stable character of the injection. These keratinocytes, when grafted in mice, secrete hIL-6 to the blood stream reaching levels of 40 pg/ml of serum. After these preliminary experiments, we construct a retroviral vector with the human growth hormone gene (h GH) driven by human metallothionein promoter (h PMT), designated DChPMTGH. Normal human keratinocytes were infected with DChPMTGH producer cells, following previously standardized protocol, obtaining infected keratinocytes secreting to the culture media 340 ng h GH/10{sup 6} cell/day without promoter activation. This is the highest level of h GH secreted in human keratinocytes primary culture described in literature. The h GH value increases approximately 10 times after activation with 100 {mu}M Zn{sup +2} for 8-12 hours. (author). 158 refs., 42 figs., 6 tabs.

  17. Assessment of the potential skin irritation of lysine-derivative anionic surfactants using mouse fibroblast and human keratinocytes as an alternative to animal testing

    OpenAIRE

    Sánchez Molina, Lourdes; Mitjans Arnal, Montserrat; Infante Martínez-Pardo, Ma. Rosa; Vinardell Martínez-Hidalgo, Ma. Pilar

    2004-01-01

    Purpose. The aim of this study was to identify new surfactants with low skin irritant properties for use in pharmaceutical and cosmetic formulations, employing cell culture as an alternative method to in vivo testing. In addition, we sought to establish whether potential cytotoxic properties were related to the size of the counterions bound to the surfactants. Methods. Cytotoxicity was assessed in the mouse fibroblast cell line 3T6, and the human keratinocyte cell line NCTC 2544, using the MT...

  18. Epidermal cell-shape regulation and subpopulation kinetics during butyrate-induced terminal maturation of normal and SV40-transformed human keratinocytes: epithelial models of differentiation therapy.

    Science.gov (United States)

    Staiano-Coico, L; Steinberg, M; Higgins, P J

    1990-10-15

    Recent data indicate that malignant human epidermal cells may be appropriate targets for sodium butyrate (NaB)-mediated differentiation therapy. The response of pre- and post-crisis populations of SV40-transformed human keratinocytes (SVKs) to this differentiation-inducing agent was assessed, therefore, within the framework of NaB-directed normal human keratinocyte (NHK) maturation. NaB augmented cornified envelope (CE) production in NHK and pre-crisis SVK cultures; the time-course and efficiency of induced maturation were similar in the 2 cell systems. In NHKs, the percentage of amplifying ("B" substate) cells decreased with time in NaB correlating with increases in both "C" stage keratinocytes and CEs. The latter formed over one or 2 layers of nucleated basal-like cells. Inductions were accompanied by immediate cell cycle blocks (in both the G1 and G2/M phases), reorganization within the actin cytoskeleton, and transient early increases in cellular actin content. Increased NHK and pre-crisis SVK cytoskeletal-associated actin reached a maximum approximately 48 hr after NaB addition and preceded development of CEs. The CE precursors, thus, probably reside in the "B" substate. Post-crisis SVKs, in contrast, were refractive to NaB-induced terminal maturation or cell-cycle perturbation, failed to initiate actin filament rearrangements, and retained a basal cell-like phenotype. Stable transformation of human SVKs in post-crisis phase, therefore, appears to be associated with loss of maturation "competence" within the "B" keratinocyte subpopulation.

  19. Piezoelectricity in Two-Dimensional Materials

    KAUST Repository

    Wu, Tao; Zhang, Hua

    2015-01-01

    Powering up 2D materials: Recent experimental studies confirmed the existence of piezoelectricity - the conversion of mechanical stress into electricity - in two-dimensional single-layer MoS2 nanosheets. The results represent a milestone towards

  20. Construction of two-dimensional quantum chromodynamics

    Energy Technology Data Exchange (ETDEWEB)

    Klimek, S.; Kondracki, W.

    1987-12-01

    We present a sketch of the construction of the functional measure for the SU(2) quantum chromodynamics with one generation of fermions in two-dimensional space-time. The method is based on a detailed analysis of Wilson loops.

  1. Development of Two-Dimensional NMR

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 20; Issue 11. Development of Two-Dimensional NMR: Strucure Determination of Biomolecules in Solution. Anil Kumar. General Article Volume 20 Issue 11 November 2015 pp 995-1002 ...

  2. Autophagy participates in isoliquiritigenin-induced melanin degradation in human epidermal keratinocytes through PI3K/AKT/mTOR signaling.

    Science.gov (United States)

    Yang, Zhibo; Zeng, Biyun; Pan, Yi; Huang, Pan; Wang, Chang

    2018-01-01

    Melanin is the pigment responsible for the color of human skin and hair. Melanin serves as a double-edge sword which can exert both protective and spot-causing effects on skin. Although melanin has an important role in protecting the skin against UV damage, an excessive or uneven melanin production can lead to the formation of freckles and age spots. Isoliquiritigenin (ISL) has been reported to inhibit melanin synthesis; however, its role in melanin degradation remains unclear. In the present study, we evaluated the detailed function of ISL in melanin degradation in human epidermal keratinocytes. Since autophagy has been reported to be related to melanin degradation, we also examined the activation of autophagy by ISL treatment in keratinocytes by measurement of autophagy-related proteins, ATG7, LC3 and p62. Moreover, si-ATG7-induced ATG7 knockdown and autophagy inhibitor 3-MA decreased LC3 II protein levels and increased PMEL17, p62 and melanin levels in HaCaT cells, which could be partially reversed by ISL treatment, indicating that autophagy participated in melanin degradation. The decreased p-AKT and p-mTOR proteins upon ISL treatment indicated the involvement of PI3K/AKT/mTOR signaling in ISL-induced melanin degradation. Taken together, we demonstrated that autophagy participates in ISL-induced melanin degradation in human epidermal keratinocytes through PI3K/AKT/mTOR signaling. Copyright © 2017. Published by Elsevier Masson SAS.

  3. The comparison of two methods to obtain human oral keratinocytes in primary culture; Comparacao de dois metodos de obtencao celular para cultura primaria de queratinocitos bucais humanos

    Energy Technology Data Exchange (ETDEWEB)

    Klingbeil, Maria Fatima Guarizo

    2006-07-01

    The therapeutic procedures frequently used in oral treatments for the pathological diseases are surgical, resulting in failures of the mucosal continuity.The possibility to obtain transplantable oral epithelia from an in vitro cell culture opens new utilization perspectives not only to where it comes from, but also as a reconstructive material for other parts of the human body, such as: urethra, epithelia corneo-limbal, cornea, ocular surface. Many researchers still use controversial methods for obtaining cells. It was therefore evaluated and compared the efficiency in both methods: enzymatic and direct explant to obtain oral keratinocytes from human oral mucosa. Fragments of intra oral epithelial tissues from healthy human subjects, undergoing dental surgeries, were donated to the research project. The keratinocytes were cultivated over a feeder-layer from a previously irradiated 3T3 Swiss albino fibroblasts. In this study it was compared the time needed in the cell obtention, the best cell amount between both methods, the life-span, the cell capacity to form an in vitro epithelia and its morphologic structure. The results in the assessment of both methods have shown the possibility to obtain keratinocytes from a small oral fragment, but at the same time we may verify the advantages and peculiar restrictions for each one of both analyzed methods. (author)

  4. Phase transitions in two-dimensional systems

    International Nuclear Information System (INIS)

    Salinas, S.R.A.

    1983-01-01

    Some experiences are related using synchrotron radiation beams, to characterize solid-liquid (fusion) and commensurate solid-uncommensurate solid transitions in two-dimensional systems. Some ideas involved in the modern theories of two-dimensional fusion are shortly exposed. The systems treated consist of noble gases (Kr,Ar,Xe) adsorbed in the basal plane of graphite and thin films formed by some liquid crystal shells. (L.C.) [pt

  5. Whole-body biodistribution and radiation dosimetry in monkeys and humans of the phosphodiesterase 4 radioligand [11C](R)-rolipram: comparison of two-dimensional planar, bisected and quadrisected image analyses

    International Nuclear Information System (INIS)

    Sprague, David R.; Fujita, Masahiro; Ryu, Yong Hoon; Liow, Jeih-San; Pike, Victor W.; Innis, Robert B.

    2008-01-01

    Introduction: [ 11 C](R)-Rolipram is a selective radioligand for positron emission tomography (PET) imaging of phosphodiesterase 4, an enzyme that metabolizes 3',5'-cyclic adenosine monophosphate. The aim of this study was to estimate the human radiation absorbed dose of the radioligand based on its biodistribution in both monkeys and humans. Methods: Whole-body PET images were acquired for 2 h after injecting [ 11 C](R)-rolipram in eight healthy humans and three monkeys. The simple method of using a single two-dimensional (2D) planar image was compared to more time-consuming methods that used two (bisected) or four (quadrisected) tomographic images in the anteroposterior direction. Results: Effective dose was 4.8 μGy/MBq based on 2D planar images. The effective dose was only slightly lower by 1% and 5% using the bisected and quadrisected images, respectively. Nevertheless, the two tomographic methods may have more accurately estimated the exposure of some organs (e.g., kidneys) that are asymmetrically located in the body or have radioactivity that appears to overlap on 2D planar images. Monkeys had a different biodistribution pattern compared to humans (e.g., greater urinary excretion) such that their data overestimated the effective dose in humans by 40%. Conclusions: The effective dose of [ 11 C](R)-rolipram was modest and comparable to that of other 11 C-labeled radioligands. The simple and far less time-consuming 2D planar method provided accurate and somewhat more conservative estimates of effective dose than the two tomographic methods. Although monkeys are commonly used to estimate human radiation exposures, their data gave a considerable overestimation for this radioligand

  6. Chitosan-shelled oxygen-loaded nanodroplets abrogate hypoxia dysregulation of human keratinocyte gelatinases and inhibitors: New insights for chronic wound healing

    International Nuclear Information System (INIS)

    Khadjavi, Amina; Magnetto, Chiara; Panariti, Alice; Argenziano, Monica; Gulino, Giulia Rossana; Rivolta, Ilaria; Cavalli, Roberta; Giribaldi, Giuliana; Guiot, Caterina; Prato, Mauro

    2015-01-01

    Background: : In chronic wounds, efficient epithelial tissue repair is hampered by hypoxia, and balances between the molecules involved in matrix turn-over such as matrix metalloproteinases (MMPs) and tissue inhibitors of metalloproteinases (TIMPs) are seriously impaired. Intriguingly, new oxygenating nanocarriers such as 2H,3H-decafluoropentane-based oxygen-loaded nanodroplets (OLNs) might effectively target chronic wounds. Objective: : To investigate hypoxia and chitosan-shelled OLN effects on MMP/TIMP production by human keratinocytes. Methods: : HaCaT cells were treated for 24 h with 10% v/v OLNs both in normoxia or hypoxia. Cytotoxicity and cell viability were measured through biochemical assays; cellular uptake by confocal microscopy; and MMP and TIMP production by enzyme-linked immunosorbent assay or gelatin zymography. Results: : Normoxic HaCaT cells constitutively released MMP-2, MMP-9, TIMP-1 and TIMP-2. Hypoxia strongly impaired MMP/TIMP balances by reducing MMP-2, MMP-9, and TIMP-2, without affecting TIMP-1 release. After cellular uptake by keratinocytes, nontoxic OLNs abrogated all hypoxia effects on MMP/TIMP secretion, restoring physiological balances. OLN abilities were specifically dependent on time-sustained oxygen diffusion from OLN core. Conclusion: : Chitosan-shelled OLNs effectively counteract hypoxia-dependent dysregulation of MMP/TIMP balances in human keratinocytes. Therefore, topical administration of exogenous oxygen, properly encapsulated in nanodroplet formulations, might be a promising adjuvant approach to promote healing processes in hypoxic wounds. - Highlights: • Hypoxia impairs MMP9/TIMP1 and MMP2/TIMP2 balances in HaCaT human keratinocytes. • Chitosan-shelled oxygen-loaded nanodroplets (OLNs) are internalised by HaCaT cells. • OLNs are not toxic to HaCaT cells. • OLNs effectively counteract hypoxia effects on MMP/TIMP balances in HaCaT cells. • OLNs appear as promising and cost-effective therapeutic tools for hypoxic

  7. Chitosan-shelled oxygen-loaded nanodroplets abrogate hypoxia dysregulation of human keratinocyte gelatinases and inhibitors: New insights for chronic wound healing

    Energy Technology Data Exchange (ETDEWEB)

    Khadjavi, Amina [Dipartimento di Neuroscienze, Università di Torino, Torino (Italy); Magnetto, Chiara [Istituto Nazionale di Ricerca Metrologica (INRIM), Torino (Italy); Panariti, Alice [Dipartimento di Scienze della Salute, Università di Milano Bicocca, Monza (Italy); Argenziano, Monica [Dipartimento di Scienza e Tecnologia del Farmaco, Università di Torino, Torino (Italy); Gulino, Giulia Rossana [Dipartimento di Oncologia, Università di Torino, Torino (Italy); Rivolta, Ilaria [Dipartimento di Scienze della Salute, Università di Milano Bicocca, Monza (Italy); Cavalli, Roberta [Dipartimento di Scienza e Tecnologia del Farmaco, Università di Torino, Torino (Italy); Giribaldi, Giuliana [Dipartimento di Oncologia, Università di Torino, Torino (Italy); Guiot, Caterina [Dipartimento di Neuroscienze, Università di Torino, Torino (Italy); Prato, Mauro, E-mail: mauro.prato@unito.it [Dipartimento di Neuroscienze, Università di Torino, Torino (Italy); Dipartimento di Scienze della Sanità Pubblica e Pediatriche, Università di Torino, Torino (Italy)

    2015-08-01

    Background: : In chronic wounds, efficient epithelial tissue repair is hampered by hypoxia, and balances between the molecules involved in matrix turn-over such as matrix metalloproteinases (MMPs) and tissue inhibitors of metalloproteinases (TIMPs) are seriously impaired. Intriguingly, new oxygenating nanocarriers such as 2H,3H-decafluoropentane-based oxygen-loaded nanodroplets (OLNs) might effectively target chronic wounds. Objective: : To investigate hypoxia and chitosan-shelled OLN effects on MMP/TIMP production by human keratinocytes. Methods: : HaCaT cells were treated for 24 h with 10% v/v OLNs both in normoxia or hypoxia. Cytotoxicity and cell viability were measured through biochemical assays; cellular uptake by confocal microscopy; and MMP and TIMP production by enzyme-linked immunosorbent assay or gelatin zymography. Results: : Normoxic HaCaT cells constitutively released MMP-2, MMP-9, TIMP-1 and TIMP-2. Hypoxia strongly impaired MMP/TIMP balances by reducing MMP-2, MMP-9, and TIMP-2, without affecting TIMP-1 release. After cellular uptake by keratinocytes, nontoxic OLNs abrogated all hypoxia effects on MMP/TIMP secretion, restoring physiological balances. OLN abilities were specifically dependent on time-sustained oxygen diffusion from OLN core. Conclusion: : Chitosan-shelled OLNs effectively counteract hypoxia-dependent dysregulation of MMP/TIMP balances in human keratinocytes. Therefore, topical administration of exogenous oxygen, properly encapsulated in nanodroplet formulations, might be a promising adjuvant approach to promote healing processes in hypoxic wounds. - Highlights: • Hypoxia impairs MMP9/TIMP1 and MMP2/TIMP2 balances in HaCaT human keratinocytes. • Chitosan-shelled oxygen-loaded nanodroplets (OLNs) are internalised by HaCaT cells. • OLNs are not toxic to HaCaT cells. • OLNs effectively counteract hypoxia effects on MMP/TIMP balances in HaCaT cells. • OLNs appear as promising and cost-effective therapeutic tools for hypoxic

  8. Eicosapentaenoic acid inhibits TNF-α-induced matrix metalloproteinase-9 expression in human keratinocytes, HaCaT cells

    International Nuclear Information System (INIS)

    Kim, Hyeon Ho; Lee, Youngae; Eun, Hee Chul; Chung, Jin Ho

    2008-01-01

    Eicosapentaenoic acid (EPA) is an omega-3 (ω-3) polyunsaturated fatty acid (PUFA), which has anti-inflammatory and anti-cancer properties. Some reports have demonstrated that EPA inhibits NF-κB activation induced by tumor necrosis factor (TNF)-α or lipopolysaccharide (LPS) in various cells. However, its detailed mode of action is unclear. In this report, we investigated whether EPA inhibits the expression of TNF-α-induced matrix metalloproteinases (MMP)-9 in human immortalized keratinocytes (HaCaT). TNF-α induced MMP-9 expression by NF-κB-dependent pathway. Pretreatment of EPA inhibited TNF-α-induced MMP-9 expression and p65 phosphorylation. However, EPA could not affect IκB-α phosphorylation, nuclear translocation of p65, and DNA binding activity of NF-κB. EPA inhibited TNF-α-induced p65 phosphorylation through p38 and Akt inhibition and this inhibition was IKKα-dependent event. Taken together, we demonstrate that EPA inhibits TNF-α-induced MMP-9 expression through inhibition of p38 and Akt activation

  9. Assessment of dermal toxicity of nanosilica using cultured keratinocytes, a human skin equivalent model and an invivo model

    International Nuclear Information System (INIS)

    Park, Yoon-Hee; Kim, Ji Na; Jeong, Sang Hoon; Choi, Jae Eun; Lee, Seung-Ho; Choi, Byeong Hyeok; Lee, Jung Pyo; Sohn, Kyung Hee; Park, Kui Lea; Kim, Meyoung-Kon; Son, Sang Wook

    2010-01-01

    Assessments of skin irritation potentials are important aspects of the development of nanotechnology. Nanosilica is currently being widely used for commercial purposes, but little literature is available on its skin toxicity and irritation potential. This study was designed to determine whether nanosilica has the potential to cause acute cutaneous toxicity, using cultured HaCaT keratinocytes (CHK), a human skin equivalent model (HSEM), and invivo model. Nanosilica was characterized by scanning electron microscopy. We evaluated the cytotoxic effects of nanosilica on CHKs and the HSEM. In addition, we also investigated whether two commercially available nanosilicas with different sizes (7 and 10-20 nm) have different effects. To confirm invitro results, we evaluated the irritation potentials of nanosilicas on rabbit skin. Nanosilicas reduced the cell viabilities of CHKs in a dose-dependent manner. However, the HSEM revealed no irritation at 500 μg/ml of nanosilica. Furthermore, this result concurred with Draize skin irritation test findings. The present study data indicate that nanosilica does not cause acute cutaneous irritation. Furthermore, this study shows that the HSEM used provides more useful screening data than the conventional cell culture model on the relative toxicities of NPs.

  10. Progression from productive infection to integration and oncogenic transformation in human papillomavirus type 59-immortalized foreskin keratinocytes.

    Science.gov (United States)

    Spartz, Helena; Lehr, Elizabeth; Zhang, Benyue; Roman, Ann; Brown, Darron R

    2005-05-25

    Studies of changes in the virus and host cell upon progression from human papillomavirus (HPV) episomal infection to integration are critical to understanding HPV-related malignant transformation. However, there exist only a few in vitro models of both productive HPV infection and neoplastic progression on the same host background. We recently described a unique foreskin keratinocyte cell line (ERIN 59) that contains HPV 59 (a close relative of HPV 18). Early passages of ERIN 59 cells (passages 9-13) contained approximately 50 copies of episomes/cell, were feeder cell-dependent, and could be induced to differentiate and produce infectious virus in a simple culture system. We now report that late passage cells (passages greater than 50) were morphologically different from early passage cells, were feeder cell independent, and did not differentiate or produce virus. These late passage cells contained HPV in an integrated form. An integration-derived oncogene transcript was expressed in late passage cells. The E2 open reading frame was interrupted in this transcript at nucleotide 3351. Despite a lower viral genome copy number in late passage ERIN 59 cells, expression of E6/E7 oncogene transcripts was similar to early passage cells. We conclude that ERIN 59 cells are a valuable cell line representing a model of progression from HPV 59 episomal infection and virus production to HPV 59 integration and associated oncogenic transformation on the same host background.

  11. In Vitro Growth of Human Keratinocytes and Oral Cancer Cells into Microtissues: An Aerosol-Based Microencapsulation Technique

    Directory of Open Access Journals (Sweden)

    Wai Yean Leong

    2017-05-01

    Full Text Available Cells encapsulation is a micro-technology widely applied in cell and tissue research, tissue transplantation, and regenerative medicine. In this paper, we proposed a growth of microtissue model for the human keratinocytes (HaCaT cell line and an oral squamous cell carcinoma (OSCC cell line (ORL-48 based on a simple aerosol microencapsulation technique. At an extrusion rate of 20 μL/min and air flow rate of 0.3 L/min programmed in the aerosol system, HaCaT and ORL-48 cells in alginate microcapsules were encapsulated in microcapsules with a diameter ranging from 200 to 300 μm. Both cell lines were successfully grown into microtissues in the microcapsules of alginate within 16 days of culture. The microtissues were characterized by using a live/dead cell viability assay, field emission-scanning electron microscopy (FE-SEM, fluorescence staining, and cell re-plating experiments. The microtissues of both cell types were viable after being extracted from the alginate membrane using alginate lyase. However, the microtissues of HaCaT and ORL-48 demonstrated differences in both nucleus size and morphology. The microtissues with re-associated cells in spheroids are potentially useful as a cell model for pharmacological studies.

  12. Sonoporation delivery of monoclonal antibodies against human papillomavirus 16 E6 restores p53 expression in transformed cervical keratinocytes.

    Directory of Open Access Journals (Sweden)

    Melissa Togtema

    Full Text Available High-risk types of human papillomavirus (HPV, such as HPV16, have been found in nearly all cases of cervical cancer. Therapies targeted at blocking the HPV16 E6 protein and its deleterious effects on the tumour suppressor pathways of the cell can reverse the malignant phenotype of affected keratinocytes while sparing uninfected cells. Through a strong interdisciplinary collaboration between engineering and biology, a novel, non-invasive intracellular delivery method for the HPV16 E6 antibody, F127-6G6, was developed. The method employs high intensity focused ultrasound (HIFU in combination with microbubbles, in a process known as sonoporation. In this proof of principle study, it was first demonstrated that sonoporation antibody delivery into the HPV16 positive cervical carcinoma derived cell lines CaSki and SiHa was possible, using chemical transfection as a baseline for comparison. Delivery of the E6 antibody using sonoporation significantly restored p53 expression in these cells, indicating the antibody is able to enter the cells and remains active. This delivery method is targeted, non-cytotoxic, and non-invasive, making it more easily translatable for in vivo experiments than other transfection methods.

  13. Molecular photoprotection of human keratinocytes in vitro by the naturally occurring mycosporine-like amino acid palythine.

    Science.gov (United States)

    Lawrence, K P; Gacesa, R; Long, P F; Young, A R

    2017-11-13

    Solar ultraviolet radiation (UVR) induces molecular and genetic changes in the skin, which result in skin cancer, photoageing and photosensitivity disorders. The use of sunscreens is advocated to prevent such photodamage; however, most formulations contain organic and inorganic UVR filters that are nonbiodegradable and can damage fragile marine ecosystems. Mycosporine-like amino acids (MAAs) are natural UVR-absorbing compounds that have evolved in marine species for protection against chronic UVR exposure in shallow-water habitats. To determine if palythine, a photostable model MAA, could offer protection against a range of UVR-induced damage biomarkers that are important in skin cancer and photoageing. HaCaT human keratinocytes were used to assess the photoprotective potential of palythine using a number of end points including cell viability, DNA damage (nonspecific, cyclobutane pyrimidine dimers and oxidatively generated damage), gene expression changes (linked to inflammation, photoageing and oxidative stress) and oxidative stress. The antioxidant mechanism was investigated using chemical quenching and Nrf2 pathway activation assays. Palythine offered statistically significant protection (P photoprotective molecule in vitro that has potential to be developed as a natural and biocompatible alternative to currently approved UVR filters. © 2017 The Authors. British Journal of Dermatology published by John Wiley & Sons Ltd on behalf of British Association of Dermatologists.

  14. Dissecting the calcium-induced differentiation of human primary keratinocytes stem cells by integrative and structural network analyses.

    Directory of Open Access Journals (Sweden)

    Kiana Toufighi

    2015-05-01

    Full Text Available The molecular details underlying the time-dependent assembly of protein complexes in cellular networks, such as those that occur during differentiation, are largely unexplored. Focusing on the calcium-induced differentiation of primary human keratinocytes as a model system for a major cellular reorganization process, we look at the expression of genes whose products are involved in manually-annotated protein complexes. Clustering analyses revealed only moderate co-expression of functionally related proteins during differentiation. However, when we looked at protein complexes, we found that the majority (55% are composed of non-dynamic and dynamic gene products ('di-chromatic', 19% are non-dynamic, and 26% only dynamic. Considering three-dimensional protein structures to predict steric interactions, we found that proteins encoded by dynamic genes frequently interact with a common non-dynamic protein in a mutually exclusive fashion. This suggests that during differentiation, complex assemblies may also change through variation in the abundance of proteins that compete for binding to common proteins as found in some cases for paralogous proteins. Considering the example of the TNF-α/NFκB signaling complex, we suggest that the same core complex can guide signals into diverse context-specific outputs by addition of time specific expressed subunits, while keeping other cellular functions constant. Thus, our analysis provides evidence that complex assembly with stable core components and competition could contribute to cell differentiation.

  15. Evaluation of dermal-epidermal skin equivalents ('composite-skin') of human keratinocytes in a collagen-glycosaminoglycan matrix(Integra artificial skin).

    Science.gov (United States)

    Kremer, M; Lang, E; Berger, A C

    2000-09-01

    Integra artificial skin (Integra LifeSciences Corp., Plainsboro, NJ, USA) is a dermal template consisting of bovine collagen, chondroitin-6-sulphate and a silastic membrane manufactured as Integra. This product has gained widespread use in the clinical treatment of third degree burn wounds and full thickness skin defects of different aetiologies. The product was designed to significantly reduce the time needed to achieve final wound closure in the treatment of major burn wounds, to optimise the sparse autologous donor skin resources and to improve the durable mechanical quality of the skin substitute. The clinical procedure requires two stages. The first step creates a self neodermis, the second creates a self epidermis on the neodermis. However, it is desirable to cover major burn wounds early in a single step by a skin substitute consisting of a dermal equivalent seeded in vitro with autologous keratinocytes ('composite-skin') out of which a full thickness skin develops in vivo.The goal of this experimental study was to develop a method to integrate human keratinocytes in homogeneous distribution and depth into Integra Artificial Skin. The seeded cell-matrix composites were grafted onto athymic mice in order to evaluate their potential to reconstitute a human epidermis in vivo. We were able to demonstrate that the inoculated human keratinocytes reproducibly displayed a homogeneous pattern of distribution, adherence, proliferation and confluence. The cell-matrix composites grafted in this model exhibited good wound adherence, complete healing, minor wound contraction and had the potential to reconstitute an elastic, functional and durable human skin. Histologically we were able to show that the inoculated human keratinocytes in vivo colonised the matrix in a histomorphologically characteristic epidermal pattern (keratomorula, keratinocyte bubbling) and developed a persisting, stratified, keratinising epidermis which immunohistologically proved to be of human

  16. Comparative proteomic analysis of the ribosomes in 5-fluorouracil resistance of a human colon cancer cell line using the radical-free and highly reducing method of two-dimensional polyacrylamide gel electrophoresis.

    Science.gov (United States)

    Kimura, Kosei; Wada, Akira; Ueta, Masami; Ogata, Akihiko; Tanaka, Satoru; Sakai, Akiko; Yoshida, Hideji; Fushitani, Hideo; Miyamoto, Akiko; Fukushima, Masakazu; Uchiumi, Toshio; Tanigawa, Nobuhiko

    2010-11-01

    Many auxiliary functions of ribosomal proteins (r-proteins) have received considerable attention in recent years. However, human r-proteins have hardly been examined by proteomic analysis. In this study, we isolated ribosomal particles and subsequently compared the proteome of r-proteins between the DLD-1 human colon cancer cell line and its 5-fluorouracil (5-FU)-resistant sub-line, DLD-1/5-FU, using the radical-free and highly reducing method of two-dimensional polyacrylamide gel electrophoresis, which has a superior ability to separate basic proteins, and we discuss the role of r-proteins in 5-FU resistance. Densitometric analysis was performed to quantify modulated proteins, and protein spots showing significant changes were identified by employing matrix-assisted laser desorption/ionization time-of-flight/time-of-flight mass spectrometry. Three basic proteins (L15, L37 and prohibitin) which were significantly modulated between DLD-1 and DLD-1/5-FU were identified. Two proteins, L15 and L37, showed down-regulated expression in DLD-1/5-FU in comparison to DLD-1. Prohibitin, which is not an r-protein and is known to be localized in the mitochondria, showed up-regulated expression in DLD-1/5-FU. These 3 proteins may be related to 5-FU resistance.

  17. Identification of DNA-binding proteins that interact with the 5'-flanking region of the human D-amino acid oxidase gene by pull-down assay coupled with two-dimensional gel electrophoresis and mass spectrometry.

    Science.gov (United States)

    Tran, Diem Hong; Shishido, Yuji; Chung, Seong Pil; Trinh, Huong Thi Thanh; Yorita, Kazuko; Sakai, Takashi; Fukui, Kiyoshi

    2015-12-10

    D-Amino acid oxidase (DAO) is a flavoenzyme that metabolizes D-amino acids and is expected to be a promising therapeutic target of schizophrenia and glioblastoma. The study of DNA-binding proteins has yielded much information in the regulation of transcription and other biological processes. However, proteins interacting with DAO gene have not been elucidated. Our assessment of human DAO promoter activity using luciferase reporter system indicated the 5'-flanking region of this gene (-4289 bp from transcription initiation site) has a regulatory sequence for gene expression, which is regulated by multi-protein complexes interacting with this region. By using pull-down assay coupled with two-dimensional gel electrophoresis and mass spectrometry, we identified six proteins binding to the 5'-flanking region of the human DAO gene (zinc finger C2HC domain-containing protein 1A; histidine-tRNA ligase, cytoplasmic; molybdenum cofactor biosynthesis protein; 60S ribosomal protein L37; calponin-1; calmodulin binding protein and heterogeneous nuclear ribonucleoprotein A2/B1). These preliminary results will contribute to the advance in the understanding of the potential factors associated with the regulatory mechanism of DAO expression. Copyright © 2015 Elsevier B.V. All rights reserved.

  18. Differential responses of cells from human skin keratinocyte and bovine mammary epithelium to attack by pore-forming Staphylococcus aureus alpha-toxin.

    Science.gov (United States)

    Suriyaphol, Gunnaporn; Sarikaputi, Meena; Suriyaphol, Prapat

    2009-11-01

    Human skin keratinocytes HaCat attacked by Staphylococcus aureus alpha-toxin showed a transient drop of cellular ATP levels whereas in toxin-perforated bovine mammary epithelial cells (BMEC), the ATP levels dropped more slowly. Morphologically, during the ATP level depletion, HaCat cell developed a spacious intracellular vacuole together with the transient influx of trypan blue. WST-1 signal, which tested the function of mitochondrial enzyme in viable cells, also decreased concomitantly. On the other hand, BMEC excluded trypan blue and vacuolation was not observed throughout the experiment. We conclude that mammary epithelial cells resist the toxin better than keratinocytes. This is the first report showing that alpha-toxin enhances transient membrane permeability to large molecules, temporary vacuole formation and the transient defect of mitochondrial enzyme in viable cells without cell lysis.

  19. Influence of extracellular matrix proteins on human keratinocyte attachment, proliferation and transfer to a dermal wound model.

    Science.gov (United States)

    Dawson, R A; Goberdhan, N J; Freedlander, E; MacNeil, S

    1996-03-01

    The aim of this study was to investigate whether prior culture of cells on ECM proteins might positively influence the performance of keratinocytes when cells are transferred to a dermal in vitro wound bed model. Keratinocytes were cultured using a method for producing cultured epithelial autografts for severely burned patients (essentially using Green's medium, a mitogen-rich medium containing fetal calf serum, cholera toxin, EGF, insulin, transferrin and triiodothyronine). Cells were cultured either on irradiated 3T3 fibroblasts (as in the standard Rheinwald and Green technique) or, alternatively, on collagen I, collagen IV, matrigel, RGD, vitronectin or fibronectin. Under these conditions matrigel, collagen I and IV enhanced initial attachment, RGD, vitronectin, fibronectin and irradiated 3T3 fibroblasts did not. Proliferation of cells was positively influenced by matrigel, collagen I and IV and irradiated 3T3 fibroblasts; of these, however, only matrigel and 3T3 fibroblasts had sustained significant effects on keratinocyte proliferation over 4 days. Cells on fibronectin showed significantly reduced proliferation. An acellular non-viable dermis was then used to mimic the homograft allodermis onto which cultured epithelial autograft sheets are grafted clinically and cells cultured on the various ECM proteins for 96 h were transferred to this in vitro wound model. None of the substrates enhanced keratinocyte performance on this model. It was concluded that under these conditions some ECM proteins can significantly affect keratinocyte attachment and, to a lesser extent, proliferation but that the culture of keratinocytes on these ECM proteins does not appear to confer any lasting benefit to the attachment of these keratinocytes to an in vitro wound-bed model.

  20. Upregulation of adhesion complex proteins and fibronectin by human keratinocytes treated with an aqueous extract from the leaves of Chromolaena odorata (Eupolin).

    Science.gov (United States)

    Phan, T T; Allen, J; Hughes, M A; Cherry, G; Wojnarowska, F

    2000-01-01

    The fresh leaves and extract of the plant Chromolaena odorata are a traditional herbal treatment in developing countries for burns, soft tissue wounds and skin infections. We have previously shown that the extract had an effect on the growth and proliferation of keratinocytes and fibroblasts in culture. This study has demonstrated that Eupolin extract increased expression of several components of the adhesion complex and fibronectin by human keratinocytes. Using indirect immunofluorescence we found increased expression (dose-dependent) of laminin 5, laminin 1, collagen IV, and fibronectin. The expression of the b1 and b4 integrins was upregulated by the extract at low concentrations (0.1 and 1 microg/ml), but the expression was decreased at higher doses of Eupolin (10 microg-150 microg/ml). A number of clinical studies carried out by Vietnamese and international medical investigators have demonstrated the efficacy of this extract on the wound healing process. In this study we have shown that Eupolin stimulated the expression of many proteins of the adhesion complex and fibronectin by human keratinocytes. The adhesion complex proteins are essential to stabilise epithelium and this effect could contribute to the clinical efficacy of Eupolin in healing.

  1. Protective effect of 3,4-dihydroxybenzoic acid isolated from Cladophora wrightiana Harvey against ultraviolet B radiation-induced cell damage in human HaCaT keratinocytes.

    Science.gov (United States)

    Cha, Ji Won; Piao, Mei Jing; Kim, Ki Cheon; Zheng, Jian; Yao, Cheng Wen; Hyun, Chang Lim; Kang, Hee Kyoung; Yoo, Eun Sook; Koh, Young Sang; Lee, Nam Ho; Ko, Mi Hee; Hyun, Jin Won

    2014-03-01

    The aim of the present study was to elucidate the protective properties of 3,4-dihydroxybenzoic acid (DBA) isolated from Cladophora wrightiana Harvey (a green alga) against ultraviolet B (UVB)-induced damage to human HaCaT keratinocytes. DBA exhibited scavenging actions against the 1,1-diphenyl-2-picrylhydrazyl radical, the superoxide anion, and the hydroxyl radical. Furthermore, DBA decreased the levels of intracellular reactive oxygen species generated by hydrogen peroxide or UVB treatment of the cells. DBA also decreased the UVB-augmented levels of phospho-histone H2A.X and the extent of comet tail formation, which are both indications of DNA damage. In addition, the compound safeguarded keratinocytes from UVB-induced injury by reversing the production of apoptotic bodies, overturning the disruption of mitochondrial membrane potential, increasing the expression of the anti-apoptotic protein, B-cell lymphoma 2, and decreasing the expression of the pro-apoptotic proteins, Bcl-2-associated X and cleaved caspase-3. Taken together, these results demonstrate that DBA isolated from a green alga protects human keratinocytes against UVB-induced oxidative stress and apoptosis.

  2. Interferon-gamma up-regulates a unique set of proteins in human keratinocytes. Molecular cloning and expression of the cDNA encoding the RGD-sequence-containing protein IGUP I-5111

    DEFF Research Database (Denmark)

    Honoré, B; Leffers, H; Madsen, Peder

    1993-01-01

    AMP (Bt2cAMP), dibutyryl cGMP (Bt2cGMP)] and compounds known to affect keratinocytes [4 beta-phorbol 12-myristate 13-acetate (PMA), retinoic acid, Ca2+, dexamethasone, lipopolysaccharides, foetal calf serum]. Protein IGUP I-5111 was selected for further studies as its level is affected by simian-virus-40......, which migrated with the AMA variant of keratinocyte protein IEF SSP 5111, is novel although it exhibits weak similarity to cytoskeletal proteins. IGUP I-5111 contains the RGD sequence found in many extracellular glycoprotein ligands of the integrin receptor family and it is found at least partially...... in the culture supernatant. Considering the presence of IFN-gamma in psoriatic plaques as well as its putative involvement in the pathophysiology of the disease it was of interest to determine whether the set of proteins was upregulated in these cells. Two-dimensional gel analysis of the protein phenotype of non-cultured...

  3. Inflammatory responses of a human keratinocyte cell line to 10 nm citrate- and PEG-coated silver nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Bastos, V. [University of Aveiro, CESAM & Laboratory of Biotechnology and Cytomics (Portugal); Brown, D.; Johnston, H. [Heriot-Watt University, School of Life Sciences (United Kingdom); Daniel-da-Silva, A. L.; Duarte, I. F. [University of Aveiro, Department of Chemistry, CICECO – Aveiro Institute of Materials (Portugal); Santos, C., E-mail: csantos@fc.up.pt; Oliveira, H. [University of Aveiro, CESAM & Laboratory of Biotechnology and Cytomics (Portugal)

    2016-07-15

    Silver nanoparticles (AgNPs) are among the most commonly used engineered NPs and various commercially available products are designed to come in direct contact with the skin (wound dressings, textiles, creams, among others). Currently, there is limited understanding of the influence of coatings on the toxicity of AgNPs and in particular their ability to impact on AgNP’s mediated inflammatory responses. As AgNPs are often stabilized by different coatings, including citrate and polyethyleneglycol (PEG), in this study we investigate the influence of citrate (Cit10) or PEG (PEG10) coatings to 10 nm AgNP on skin, using human HaCaT keratinocytes. AgNPs cytotoxicity and inflammatory response (nuclear factor (NF)-κB induction and cytokine production) of HaCaT were assessed after in vitro exposure to 10 and 40 µg/mL after 4, 24, and 48 h. Results showed that although both types of coated AgNPs decreased cell proliferation and viability, Cit10 AgNPs were more toxic. NF-κB inhibition was observed for the highest concentration (40 µg/mL) of PEG10 AgNPs, and the putative link to early apoptotic pathways observed in these cells is discussed. No production of IL-1β, IL-6, IL-10, and TNFα was stimulated by AgNPs. Furthermore, Cit10 and PEG10 AgNPs decreased the release of MCP-1 by HaCaT cells after 48 h of exposure. As cytokines are vital for the immunologic regulation in the human body, and it is demonstrated that they may interfere with NPs, more research is needed to understand how different AgNPs affect the immune system.

  4. Comparison of rat epidermal keratinocyte organotypic culture (ROC) with intact human skin

    DEFF Research Database (Denmark)

    Pappinen, Sari; Hermansson, Martin; Kuntsche, Judith

    2008-01-01

    study was to compare the stratum corneum lipid content of ROC with the corresponding material from human skin. The lipid composition was determined by thin-layer chromatography (TLC) and mass-spectrometry, and the thermal phase transitions of stratum corneum were studied by differential scanning...... calorimetry (DSC). All major lipid classes of the stratum corneum were present in ROC in a similar ratio as found in human stratum corneum. Compared to human skin, the level of non-hydroxyacid-sphingosine ceramide (NS) was increased in ROC, while alpha-hydroxyacid-phytosphingosine ceramide (AP) and non...... compared to human skin, in agreement with the results from DSC. ROC underwent a lipid lamellar order to disorder transition (T2) at a slightly lower temperature (68 degrees C) than human skin (74 degrees C). These differences in stratum corneum lipid composition and the thermal phase transitions may...

  5. Two-dimensional nuclear magnetic resonance spectroscopy

    International Nuclear Information System (INIS)

    Bax, A.; Lerner, L.

    1986-01-01

    Great spectral simplification can be obtained by spreading the conventional one-dimensional nuclear magnetic resonance (NMR) spectrum in two independent frequency dimensions. This so-called two-dimensional NMR spectroscopy removes spectral overlap, facilitates spectral assignment, and provides a wealth of additional information. For example, conformational information related to interproton distances is available from resonance intensities in certain types of two-dimensional experiments. Another method generates 1 H NMR spectra of a preselected fragment of the molecule, suppressing resonances from other regions and greatly simplifying spectral appearance. Two-dimensional NMR spectroscopy can also be applied to the study of 13 C and 15 N, not only providing valuable connectivity information but also improving sensitivity of 13 C and 15 N detection by up to two orders of magnitude. 45 references, 10 figures

  6. Punicalagin and (-)-Epigallocatechin-3-Gallate Rescue Cell Viability and Attenuate Inflammatory Responses of Human Epidermal Keratinocytes Exposed to Airborne Particulate Matter PM10.

    Science.gov (United States)

    Seok, Jin Kyung; Lee, Jeong-Won; Kim, Young Mi; Boo, Yong Chool

    2018-01-01

    Airborne particulate matter with a diameter of < 10 µm (PM10) causes oxidative damage, inflammation, and premature skin aging. In this study, we evaluated whether polyphenolic antioxidants attenuate the inflammatory responses of PM10-exposed keratinocytes. Primary human epidermal keratinocytes were exposed in vitro to PM10 in the absence or presence of punicalagin and (-)-epigallocatechin-3-gallate (EGCG), which are the major polyphenolic antioxidants found in pomegranate and green tea, respectively. Assays were performed to determine cell viability, production of reactive oxygen species (ROS), and expression of NADPH oxidases (NOX), proinflammatory cytokines, and matrix metalloproteinase (MMP)-1. PM10 decreased cell viability and increased ROS production in a dose-dependent manner. It also increased the expression levels of NOX-1, NOX-2, tumor necrosis factor-α (TNF-α), interleukin (IL)-1β, IL-6, IL-8, and MMP-1. Punicalagin was not cytotoxic up to 300 μM, and (-)-EGCG was cytotoxic above 30 μM, respectively. Further, punicalagin (3-30 μM) and EGCG (3-10 μM) rescued the viability of PM10-exposed cells. They also attenuated ROS production and the expression of NOX-1, NOX-2, TNF-α, IL-1β, IL-6, IL-8, and MMP-1 stimulated by PM10. This study demonstrates that polyphenolic antioxidants, such as punicalagin and (-)-EGCG, rescue keratinocyte viability and attenuate the inflammatory responses of these cells due to airborne particles. © 2018 S. Karger AG, Basel.

  7. Inhibitors of cysteine cathepsin and calpain do not prevent ultraviolet-B-induced apoptosis in human keratinocytes and HeLa cells

    DEFF Research Database (Denmark)

    Bang, Bo; Baadsgaard, Ole; Skov, Lone

    2004-01-01

    been demonstrated to play a role in the execution of programmed cell death induced by other stimuli, e.g. TNF-alpha. The purpose of the present study was therefore to investigate whether inhibitors of cysteine cathepsins and calpains could prevent UVB-induced apoptosis in HeLa cells and keratinocytes....... This was done by investigating the effect of the irreversible cysteine protease inhibitor zFA-fmk, the cathepsin B inhibitor CA-074-Me and the calpain inhibitor ALLN on the viability of UVB-irradiated human keratinocytes and HeLa cells. At concentrations of 10 microM and above zVAD-fmk conferred partial dose......-dependent protection against UVB-induced apoptosis in HeLa cells and keratinocytes. Moreover, caspase-3 activity was completely blocked at zVAD-fmk concentrations of 1 microM in HeLa cells. This indicates that caspase-independent mechanisms could be involved in UVB-induced apoptosis. However, the protease inhibitors z...

  8. Cultivating technique for human keratinocyte under laboratory condition%实验室条件下人角质形成细胞的培养技术

    Institute of Scientific and Technical Information of China (English)

    卢宁; 朱平; 刘玉峰; 王刚; 张海龙; 赵小东

    2006-01-01

    %,9 d左右细胞融合达90%,11d左右细胞完全融合形成细胞膜片.角质形成细胞可在体外稳定培养2~3个月,细胞形态和生长速度无明显改变. ②不同代的角质形成细胞冻存和复苏情况:将不同代的角质形成细胞分别冻存于液氮罐中,3个月后进行复苏,发现角质形成细胞的形态和生长速度无明显改变.③角质形成细胞形态学观察结果:显微镜下细胞呈典型上皮样特征,高核浆比例,细胞紧密排列,轮廓清楚折光性好.透射电镜下培养的表皮角质形成细胞胞浆内有大量束状张力丝和张力原纤维,可见线粒体和粗面内质网,胞质周边有短的突起,细胞间有桥粒相连等角化细胞所具有的特点.结论:培养的角质形成细胞在多次传代后仍能够保持正常的形态特征,提示改良的培养角质形成细胞的技术可为实验和临床提供可靠丰富的角质形成细胞来源.%BACKGROUND: Along with the establishment and development of in vitro culture technique for human keratinocyte, skin would no longer be considered only as the physiological barrier, it's of important significance in immunity and endocrinology and so on.OBJECTIVE: To explore the experimental cultivating technique for human keratinocytes to provide reliable cell resource forthe appliance of keratinocytes in many ways.DESIGN: An opening study with keratinocytes as the subjects of the experiment.SETTING: Department of Immunology and Department of Dermatology,Xijing Hospital, Fourth Military Medical University of Chinese PLA MATERIALS: This experiment was carried out in the clinical laboratory of Department of Immunology of Xijing Hospital of the Fourth Military Medical University of Chinese PLA between March 2003 and March 2005.Prepuce sample was postoperatively obtained from a 6-year-old boy who was admitted to the department of urology surgery of Xijing hospital in April 2003, prepuce was used as the source for keratinocytes.METHODS:

  9. Two-dimensional x-ray diffraction

    CERN Document Server

    He, Bob B

    2009-01-01

    Written by one of the pioneers of 2D X-Ray Diffraction, this useful guide covers the fundamentals, experimental methods and applications of two-dimensional x-ray diffraction, including geometry convention, x-ray source and optics, two-dimensional detectors, diffraction data interpretation, and configurations for various applications, such as phase identification, texture, stress, microstructure analysis, crystallinity, thin film analysis and combinatorial screening. Experimental examples in materials research, pharmaceuticals, and forensics are also given. This presents a key resource to resea

  10. Equivalence of two-dimensional gravities

    International Nuclear Information System (INIS)

    Mohammedi, N.

    1990-01-01

    The authors find the relationship between the Jackiw-Teitelboim model of two-dimensional gravity and the SL(2,R) induced gravity. These are shown to be related to a two-dimensional gauge theory obtained by dimensionally reducing the Chern-Simons action of the 2 + 1 dimensional gravity. The authors present an explicit solution to the equations of motion of the auxiliary field of the Jackiw-Teitelboim model in the light-cone gauge. A renormalization of the cosmological constant is also given

  11. Investigation of double strand breaks induced by alpha particle irradiation using C.N.B.G. microbeam in human keratinocytes

    International Nuclear Information System (INIS)

    Pouthier, Th.

    2006-12-01

    To understand the mechanisms of interaction of ionizing radiation with living tissues exposed to low and protracted doses remains a major issue for risk evaluation. The response cannot be found in epidemiological studies because the only available data concern accidental exposures to high doses of radiation. The natural exposure represents the main source of exposure in the daily life, just before the medical sources (radiology, radiotherapy). In addition, this kind of exposure is very difficult to reproduce in vitro by irradiating cell lines. The method per preference is based on random irradiation of cell populations. The mean number of particles having traversed cells is then calculated on the basis of Poisson statistics. In addition to inevitable multiple impacts, the numerous potential intracellular targets (nuclei, cytoplasm), the indirect effects induced by the impact of particles on neighbouring cells or simply the extracellular targets, constitute phenomena that make more complex the interpretation of experimental data. A charged particle microbeam was developed at C.E.N.B.G. to perform the targeted irradiation of individual cells with a targeting precision of a few microns. It is possible to deliver a counted number of alpha particles down to the ultimate dose of one alpha per cell, to target predetermined cells and then to observe the response of the neighbouring cells. This facility has been validated during this work on human keratinocyte cells expressing a recombinant nuclear fluorescent protein (histone H2B-GFP). The combination of ion micro-beams with confocal microscopy and numeric quantitative analysis allowed the measurement of DNA double strand breaks via the phosphorylation of the histone H2A.X in individual cells. The mechanisms of DNA reparation and apoptosis induction were also in the scope of those studies. The experimental results obtained during this thesis validate the methodology we have developed by demonstrating the targeting

  12. Effect of irradiation on cell cycle, cell death and expression of its related proteins in normal human oral keratinocytes

    International Nuclear Information System (INIS)

    Kang, Mi Ae; Heo, Min Suk; Lee, Sam Sun; Oh, Sung Ook; Choi, Soon Chul; Park, Tae Won; Lee, Sul Mi; Jeon, In Seong

    2003-01-01

    To investigate the radiosensitivity of the normal human oral keratinocytes (NHOK), and the effect of irradiation on cell cycle and protein expression. To evaluate the radiosensitivity of NHOK, the number of colonies and cells were counted after irradiation and the SF2 (survival fraction as 2 Gy) value, and the cell survival curve fitted on a linear-quadratic model were obtained. LDH analysis was carried out to evaluate the necrosis of NHOK at 1, 2,3, and 4 days after 2, 10, and 20 Gy irradiation. Cell cycle arrest and the induction of apoptosis were analyzed using flow cytometry at 1, 2, 3, and 4 days after 2, 10, and 20 Gy irradiation. Finally, proteins related cell cycle arrest and apoptosis were analysed by Western blot. The number of survival cell was significantly decreased in a dose-dependent manner. The cell survival curve showed SF2, α, and β values to be 0.568, 0.209, and 0.020 respectively. At 20 Gy irradiated cells showed higher optical density than the control group. After irradiation, apoptosis was not observed but G2 arrest was observed in the NHOK cells. 1 day after 10 Gy irradiation, the expression of p53 remained unchanged, the p21 WAF1/Cip1 increased and the mdm2 decreased. The expression of bax, bcl-2, cyclin B1, and cyclin D remained unchanged. These results indicate that NHOK responds to irradiation by G2 arrest, which is possibly mediated by the expression of p21 WAF1/Cip1 , and that cell necrosis occurs by high dose irradiation.

  13. Modulation of TLR2 protein expression by a miR-105 in human oral keratinocytes

    Science.gov (United States)

    Mammalian biological processes such as inflammation, involve regulation of hundreds of genes controlling onset and termination. MicroRNAs (miRNAs) can translationally repress target mRNAs and can regulate innate immune responses. Our model system comprised primary human keratinoc...

  14. Analytical simulation of two dimensional advection dispersion ...

    African Journals Online (AJOL)

    The study was designed to investigate the analytical simulation of two dimensional advection dispersion equation of contaminant transport. The steady state flow condition of the contaminant transport where inorganic contaminants in aqueous waste solutions are disposed of at the land surface where it would migrate ...

  15. Analytical Simulation of Two Dimensional Advection Dispersion ...

    African Journals Online (AJOL)

    ADOWIE PERE

    ABSTRACT: The study was designed to investigate the analytical simulation of two dimensional advection dispersion equation of contaminant transport. The steady state flow condition of the contaminant transport where inorganic contaminants in aqueous waste solutions are disposed of at the land surface where it would ...

  16. Sums of two-dimensional spectral triples

    DEFF Research Database (Denmark)

    Christensen, Erik; Ivan, Cristina

    2007-01-01

    construct a sum of two dimensional modules which reflects some aspects of the topological dimensions of the compact metric space, but this will only give the metric back approximately. At the end we make an explicit computation of the last module for the unit interval in. The metric is recovered exactly...

  17. Stability of two-dimensional vorticity filaments

    International Nuclear Information System (INIS)

    Elhmaidi, D.; Provenzale, A.; Lili, T.; Babiano, A.

    2004-01-01

    We discuss the results of a numerical study on the stability of two-dimensional vorticity filaments around a circular vortex. We illustrate how the stability of the filaments depends on the balance between the strain associated with the far field of the vortex and the local vorticity of the filament, and we discuss an empirical criterion for filament stability

  18. Two-Dimensional Motions of Rockets

    Science.gov (United States)

    Kang, Yoonhwan; Bae, Saebyok

    2007-01-01

    We analyse the two-dimensional motions of the rockets for various types of rocket thrusts, the air friction and the gravitation by using a suitable representation of the rocket equation and the numerical calculation. The slope shapes of the rocket trajectories are discussed for the three types of rocket engines. Unlike the projectile motions, the…

  19. Two-dimensional microstrip detector for neutrons

    Energy Technology Data Exchange (ETDEWEB)

    Oed, A [Institut Max von Laue - Paul Langevin (ILL), 38 - Grenoble (France)

    1997-04-01

    Because of their robust design, gas microstrip detectors, which were developed at ILL, can be assembled relatively quickly, provided the prefabricated components are available. At the beginning of 1996, orders were received for the construction of three two-dimensional neutron detectors. These detectors have been completed. The detectors are outlined below. (author). 2 refs.

  20. Conformal invariance and two-dimensional physics

    International Nuclear Information System (INIS)

    Zuber, J.B.

    1993-01-01

    Actually, physicists and mathematicians are very interested in conformal invariance: geometric transformations which keep angles. This symmetry is very important for two-dimensional systems as phase transitions, string theory or node mathematics. In this article, the author presents the conformal invariance and explains its usefulness

  1. Matching Two-dimensional Gel Electrophoresis' Spots

    DEFF Research Database (Denmark)

    Dos Anjos, António; AL-Tam, Faroq; Shahbazkia, Hamid Reza

    2012-01-01

    This paper describes an approach for matching Two-Dimensional Electrophoresis (2-DE) gels' spots, involving the use of image registration. The number of false positive matches produced by the proposed approach is small, when compared to academic and commercial state-of-the-art approaches. This ar...

  2. Two-dimensional membranes in motion

    NARCIS (Netherlands)

    Davidovikj, D.

    2018-01-01

    This thesis revolves around nanomechanical membranes made of suspended two - dimensional materials. Chapters 1-3 give an introduction to the field of 2D-based nanomechanical devices together with an overview of the underlying physics and the measurementtools used in subsequent chapters. The research

  3. Extended Polymorphism of Two-Dimensional Material

    NARCIS (Netherlands)

    Yoshida, Masaro; Ye, Jianting; Zhang, Yijin; Imai, Yasuhiko; Kimura, Shigeru; Fujiwara, Akihiko; Nishizaki, Terukazu; Kobayashi, Norio; Nakano, Masaki; Iwasa, Yoshihiro

    When controlling electronic properties of bulk materials, we usually assume that the basic crystal structure is fixed. However, in two-dimensional (2D) materials, atomic structure or to functionalize their properties. Various polymorphs can exist in transition metal dichalcogenides (TMDCs) from

  4. Piezoelectricity in Two-Dimensional Materials

    KAUST Repository

    Wu, Tao

    2015-02-25

    Powering up 2D materials: Recent experimental studies confirmed the existence of piezoelectricity - the conversion of mechanical stress into electricity - in two-dimensional single-layer MoS2 nanosheets. The results represent a milestone towards embedding low-dimensional materials into future disruptive technologies. © 2015 Wiley-VCH Verlag GmbH & Co. KGaA.

  5. In vivo production of novel vitamin D2 hydroxy-derivatives by human placentas, epidermal keratinocytes, Caco-2 colon cells and the adrenal gland

    Science.gov (United States)

    Slominski, Andrzej T.; Kim, Tae-Kang; Shehabi, Haleem Z.; Tang, Edith; Benson, Heather A. E.; Semak, Igor; Lin, Zongtao; Yates, Charles R.; Wang, Jin; Li, Wei; Tuckey, Robert C.

    2014-01-01

    We investigated the metabolism of vitamin D2 to hydroxyvitamin D2 metabolites ((OH)D2) by human placentas ex-utero, adrenal glands ex-vivo and cultured human epidermal keratinocytes and colonic Caco-2 cells, and identified 20(OH)D2, 17,20(OH)2D2, 1,20(OH)2D2, 25(OH)D2 and 1,25(OH)2D2 as products. Inhibition of product formation by 22R-hydroxycholesterol indicated involvement of CYP11A1 in 20- and 17-hydroxylation of vitamin D2, while use of ketoconazole indicated involvement of CYP27B1 in 1α-hydroxylation of products. Studies with purified human CYP11A1 confirmed the ability of this enzyme to convert vitamin D2 to 20(OH)D2 and 17,20(OH)2D2. In placentas and Caco-2 cells, production of 20(OH)D2 was higher than 25(OH)D2 while in human keratinocytes the production of 20(OH)D2 and 25(OH)D2 were comparable. HaCaT keratinocytes showed high accumulation of 1,20(OH)2D2 relative to 20(OH)D2 indicating substantial CYP27B1 activity. This is the first in vivo evidence for a novel pathway of vitamin D2 metabolism initiated by CYP11A1 and modified by CYP27B1, with the product profile showing tissue- and cell-type specificity. PMID:24382416

  6. Protective effect of Juglans regia L. against ultraviolet B radiation induced inflammatory responses in human epidermal keratinocytes.

    Science.gov (United States)

    Muzaffer, Umar; Paul, V I; Prasad, Nagarajan Rajendra; Karthikeyan, Ramasamy; Agilan, Balupillai

    2018-03-15

    Juglans regia L. has a history of traditional medicinal use for the treatment of various maladies and have been documented with significant antioxidant and antiinflammatory properties. Although all parts of the plant are medicinally important, but male the flower of the plant has not been yet investigated against the photo-damage. The present study, we sought to determine the photoprotective effect of the male flower of J. regia L. against ultraviolet-B radiation-induced inflammatory responses in human skin cells. The profile of pharmacological active compounds present in the male flower of J. regia was analyzed by GC-MS. Then, the antioxidant property of methanolic extract of J. regia (MEJR) was analyzed by in vitro free radical scavenging assays. Further, we analyzed the sun protection factor of this extract by spectrophotometry. Moreover, we investigated the photoprotective effect of MEJR against UVB induced inflammatory signaling in human epidermal cells. Human skin epidermal keratinocytes (HaCaT) were pretreated with the MEJR (80 µg/ml), 30 min prior to UVB-irradiation at a dose of 20 mJ/cm 2 and were investigated for lipid peroxidation, enzymatic antioxidants activity, apoptosis and inflammatory markers expression level. The GC-MS results showed the presence of good amount of pharmacologically active compounds in the MEJR. We observed that the MEJR possess significant free radical scavenging activity and it was comparable with standard antioxidants. Further, the MEJR exhibits 8.8 sun-protection-factor (SPF) value. Pretreatment with MEJR, 30 min prior to UVB-irradiation, prevented ROS generation, lipid peroxidation and restored the activity of antioxidant status in HaCaT cells. Moreover, MEJR pretreatment significantly prevented UVB activated inflammatory markers like TNF-α, IL-1, IL-6, NF-κB, COX-2 in HaCaT. The present findings suggest that MEJR exhibit photoprotective effects and hence it may be useful for the treatment of inflammation related

  7. Heat stress-induced loss of eukaryotic initiation factor 5A (eIF-5A) in a human pancreatic cancer cell line, MIA PaCa-2, analyzed by two-dimensional gel electrophoresis.

    Science.gov (United States)

    Takeuchi, Kana; Nakamura, Kazuyuki; Fujimoto, Masanori; Kaino, Seiji; Kondoh, Satoshi; Okita, Kiwamu

    2002-02-01

    Alterations of intracellular proteins during the process of heat stress-induced cell death of a human pancreatic cancer cell line, MIA PaCa-2, were investigated using two-dimensional gel electrophoresis (2-DE), agarose gel electrophoresis, and cell biology techniques. Incubation of MIA PaCa-2 at 45 degrees C for 30 min decreased the cell growth rate and cell viability without causing chromosomal DNA fragmentation. Incubation at 51 degrees C for 30 min suppressed cell growth and again led to death without DNA fragmentation. The cell death was associated with the loss of an intracellular protein of M(r) 17,500 and pI 5.2 on 2-DE gel. This protein was determined to be eukaryotic initiation factor SA (eIF-5A) by microsequencing of the N-terminal region of peptide fragments obtained by cyanogen bromide treatment of the protein blotted onto a polyvinylidene difluoride (PVDF) membrane. The sequences detected were QXSALRKNGFVVLKGRP and STSKTGXHGHAKVHLVGID, which were homologous with the sequence of eIF-5A from Gln 20 to Pro 36 and from Ser 43 to Asp 61, respectively. Furthermore, the result of sequencing suggested that the protein was an active form of hypusinated eIF-5A, because Lys 46 could be detected but not Lys 49, which is the site for hypusination. These results suggest that loss of the active form of eIF-5A is an important factor in the irreversible process of heat stress-induced death of MIA PaCa-2 cells.

  8. Expression of Raf kinase inhibitor protein in human hepatoma tissues by two-dimensional gel electrophoresis and matrix-assisted laser desorption/ionization time-of-flight methods.

    Science.gov (United States)

    Tsao, D A; Shiau, Y F; Tseng, C S; Chang, H R

    2016-01-01

    Hepatocellular carcinoma (HCC) is the most common malignant liver tumor. To reduce the mortality and improve the effectiveness of therapy, it is important to search for changes in tumor-specific biomarkers whose function may involve in disease progression and which may be useful as potential therapeutic targets. Materials and Mehtods: In this study, we use two-dimensional polyacrylamide gel electrophoresis (2-DE) and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry to observe proteome alterations of 12 tissue pairs isolated from HCC patients: Normal and tumorous tissue. Comparing the tissue types with each other, 40 protein spots corresponding to fifteen differentially expressed between normal and cancer part of HCC patients. Raf kinase inhibitor protein (RKIP), an inhibitor of Raf-mediated activation of mitogen-activated protein kinase/extracellular signal-regulated kinase, may play an important role in cancer metastasis and cell proliferation and migration of human hepatoma cells. RKIP may be considered as a marker for HCC, because its expression level changes considerably in HCC compared with normal tissue. In addition, we used the methods of Western blotting and real time-polymerase chain reaction to analysis the protein expression and gene expression of RKIP. The result showed RKIP protein and gene expression in tumor part liver tissues of HCC patient is lower than peritumorous non-neoplastic liver tissue of the corresponding HCC samples. These results strongly suggest that RKIP may be considered to be a marker for HCC and RKIP are down-regulated in liver cancer cell.

  9. Ultraviolet B, melanin and mitochondrial DNA: Photo-damage in human epidermal keratinocytes and melanocytes modulated by alpha-melanocyte-stimulating hormone [version 1; referees: 2 approved

    Directory of Open Access Journals (Sweden)

    Markus Böhm

    2016-05-01

    Full Text Available Alpha-melanocyte-stimulating hormone (alpha-MSH increases melanogenesis and protects from UV-induced DNA damage. However, its effect on mitochondrial DNA (mtDNA damage is unknown. We have addressed this issue in a pilot study using human epidermal keratinocytes and melanocytes incubated with alpha-MSH and irradiated with UVB. Real-time touchdown PCR was used to quantify total and deleted mtDNA. The deletion detected encompassed the common deletion but was more sensitive to detection. There were 4.4 times more mtDNA copies in keratinocytes than in melanocytes. Irradiation alone did not affect copy numbers. Alpha-MSH slightly increased copy numbers in both cell types in the absence of UVB and caused a similar small decrease in copy number with dose in both cell types. Deleted copies were nearly twice as frequent in keratinocytes as in melanocytes. Alpha-MSH reduced the frequency of deleted copies by half in keratinocytes but not in melanocytes. UVB dose dependently led to an increase in the deleted copy number in alpha-MSH-treated melanocytes. UVB irradiation had little effect on deleted copy number in alpha-MSH-treated keratinocytes. In summary, alpha-MSH enhances mtDNA damage in melanocytes presumably by increased melanogenesis, while α-MSH is protective in keratinocytes, the more so in the absence of irradiation.

  10. Oxidative stress induced by palytoxin in human keratinocytes is mediated by a H+-dependent mitochondrial pathway

    International Nuclear Information System (INIS)

    Pelin, Marco; Ponti, Cristina; Sosa, Silvio; Gibellini, Davide; Florio, Chiara; Tubaro, Aurelia

    2013-01-01

    In the last decades, massive blooms of palytoxin (PLTX)-producing Ostreopsis cf. ovata have been observed along Mediterranean coasts, usually associated to human respiratory and cutaneous problems. At the molecular level, PLTX induces a massive intracellular Na + influx due to the transformation of Na + /K + ATPase in a cationic channel. Recently, we have demonstrated that Na + overload is the crucial step in mediating overproduction of reactive oxygen species (ROS) and cell death in human HaCaT keratinocytes, tentatively explaining PLTX-induced skin irritant effects. In the present study the molecular mechanisms of ROS production induced by PLTX-mediated Na + intracellular overload have been investigated. In HaCaT cells, PLTX exposure caused accumulation of superoxide anion, but not of nitric oxide or peroxynitrite/hydroxyl radicals. Even if RT-PCR and western blot analysis revealed an early NOX-2 and iNOS gene and protein over-expressions, their active involvement seemed to be only partial since selective inhibitors did not completely reduce O 2 − production. A significant role of other enzymes (COX-1, COX-2, XO) was not evidenced. Nigericin, that counteracts Na + -mediated H + -imbalance, dissipating ΔpH across mitochondrial inner membrane, and the uncouplers DNP significantly reduced O 2 − production. These inhibitions were synergistic when co-exposed with complex-I inhibitor rotenone. These results suggest a novel mechanism of O 2 − production induced by PLTX-mediated ionic imbalance. Indeed, the H + intracellular overload that follows PLTX-induced intracellular Na + accumulation, could enhance ΔpH across mitochondrial inner membrane, that seems to be the driving force for O 2 − production by reversing mitochondrial electron transport. Highlights: ► PLTX induces superoxide (O 2 − ) production by reversing mitochondrial transport chain. ► The mechanism of O 2 − production is dependent on PLTX-induced ionic imbalance. ► The results led to the

  11. Oxidative stress induced by palytoxin in human keratinocytes is mediated by a H{sup +}-dependent mitochondrial pathway

    Energy Technology Data Exchange (ETDEWEB)

    Pelin, Marco, E-mail: marco.pelin@phd.units.it [Department of Life Science, University of Trieste, Via L. Giorgieri 7/9, 34127 Trieste (Italy); Ponti, Cristina, E-mail: cponti@units.it [Department of Life Science, University of Trieste, Via L. Giorgieri 7/9, 34127 Trieste (Italy); Sosa, Silvio, E-mail: silvio.sosa@econ.units.it [Department of Life Science, University of Trieste, Via L. Giorgieri 7/9, 34127 Trieste (Italy); Gibellini, Davide, E-mail: davide.gibellini@unibo.it [Department of Haematology and Oncological Sciences, University of Bologna, Via Massarenti 9, 40138 Bologna (Italy); Florio, Chiara, E-mail: florioc@units.it [Department of Life Science, University of Trieste, Via L. Giorgieri 7/9, 34127 Trieste (Italy); Tubaro, Aurelia, E-mail: tubaro@units.it [Department of Life Science, University of Trieste, Via L. Giorgieri 7/9, 34127 Trieste (Italy)

    2013-01-01

    In the last decades, massive blooms of palytoxin (PLTX)-producing Ostreopsis cf. ovata have been observed along Mediterranean coasts, usually associated to human respiratory and cutaneous problems. At the molecular level, PLTX induces a massive intracellular Na{sup +} influx due to the transformation of Na{sup +}/K{sup +} ATPase in a cationic channel. Recently, we have demonstrated that Na{sup +} overload is the crucial step in mediating overproduction of reactive oxygen species (ROS) and cell death in human HaCaT keratinocytes, tentatively explaining PLTX-induced skin irritant effects. In the present study the molecular mechanisms of ROS production induced by PLTX-mediated Na{sup +} intracellular overload have been investigated. In HaCaT cells, PLTX exposure caused accumulation of superoxide anion, but not of nitric oxide or peroxynitrite/hydroxyl radicals. Even if RT-PCR and western blot analysis revealed an early NOX-2 and iNOS gene and protein over-expressions, their active involvement seemed to be only partial since selective inhibitors did not completely reduce O{sub 2}{sup −} production. A significant role of other enzymes (COX-1, COX-2, XO) was not evidenced. Nigericin, that counteracts Na{sup +}-mediated H{sup +}-imbalance, dissipating ΔpH across mitochondrial inner membrane, and the uncouplers DNP significantly reduced O{sub 2}{sup −} production. These inhibitions were synergistic when co-exposed with complex-I inhibitor rotenone. These results suggest a novel mechanism of O{sub 2}{sup −} production induced by PLTX-mediated ionic imbalance. Indeed, the H{sup +} intracellular overload that follows PLTX-induced intracellular Na{sup +} accumulation, could enhance ΔpH across mitochondrial inner membrane, that seems to be the driving force for O{sub 2}{sup −} production by reversing mitochondrial electron transport. Highlights: ► PLTX induces superoxide (O{sub 2}{sup −}) production by reversing mitochondrial transport chain. ► The mechanism of

  12. Two-dimensional confinement of heavy fermions

    International Nuclear Information System (INIS)

    Shishido, Hiroaki; Shibauchi, Takasada; Matsuda, Yuji; Terashima, Takahito

    2010-01-01

    Metallic systems with the strongest electron correlations are realized in certain rare-earth and actinide compounds whose physics are dominated by f-electrons. These materials are known as heavy fermions, so called because the effective mass of the conduction electrons is enhanced via correlation effects up to as much as several hundreds times the free electron mass. To date the electronic structure of all heavy-fermion compounds is essentially three-dimensional. Here we report on the first realization of a two-dimensional heavy-fermion system, where the dimensionality is adjusted in a controllable fashion by fabricating heterostructures using molecular beam epitaxy. The two-dimensional heavy fermion system displays striking deviations from the standard Fermi liquid low-temperature electronic properties. (author)

  13. Two-dimensional sensitivity calculation code: SENSETWO

    International Nuclear Information System (INIS)

    Yamauchi, Michinori; Nakayama, Mitsuo; Minami, Kazuyoshi; Seki, Yasushi; Iida, Hiromasa.

    1979-05-01

    A SENSETWO code for the calculation of cross section sensitivities with a two-dimensional model has been developed, on the basis of first order perturbation theory. It uses forward neutron and/or gamma-ray fluxes and adjoint fluxes obtained by two-dimensional discrete ordinates code TWOTRAN-II. The data and informations of cross sections, geometry, nuclide density, response functions, etc. are transmitted to SENSETWO by the dump magnetic tape made in TWOTRAN calculations. The required input for SENSETWO calculations is thus very simple. The SENSETWO yields as printed output the cross section sensitivities for each coarse mesh zone and for each energy group, as well as the plotted output of sensitivity profiles specified by the input. A special feature of the code is that it also calculates the reaction rate with the response function used as the adjoint source in TWOTRAN adjoint calculation and the calculated forward flux from the TWOTRAN forward calculation. (author)

  14. Two-dimensional ranking of Wikipedia articles

    Science.gov (United States)

    Zhirov, A. O.; Zhirov, O. V.; Shepelyansky, D. L.

    2010-10-01

    The Library of Babel, described by Jorge Luis Borges, stores an enormous amount of information. The Library exists ab aeterno. Wikipedia, a free online encyclopaedia, becomes a modern analogue of such a Library. Information retrieval and ranking of Wikipedia articles become the challenge of modern society. While PageRank highlights very well known nodes with many ingoing links, CheiRank highlights very communicative nodes with many outgoing links. In this way the ranking becomes two-dimensional. Using CheiRank and PageRank we analyze the properties of two-dimensional ranking of all Wikipedia English articles and show that it gives their reliable classification with rich and nontrivial features. Detailed studies are done for countries, universities, personalities, physicists, chess players, Dow-Jones companies and other categories.

  15. Toward two-dimensional search engines

    International Nuclear Information System (INIS)

    Ermann, L; Shepelyansky, D L; Chepelianskii, A D

    2012-01-01

    We study the statistical properties of various directed networks using ranking of their nodes based on the dominant vectors of the Google matrix known as PageRank and CheiRank. On average PageRank orders nodes proportionally to a number of ingoing links, while CheiRank orders nodes proportionally to a number of outgoing links. In this way, the ranking of nodes becomes two dimensional which paves the way for the development of two-dimensional search engines of a new type. Statistical properties of information flow on the PageRank–CheiRank plane are analyzed for networks of British, French and Italian universities, Wikipedia, Linux Kernel, gene regulation and other networks. A special emphasis is done for British universities networks using the large database publicly available in the UK. Methods of spam links control are also analyzed. (paper)

  16. Acoustic phonon emission by two dimensional plasmons

    International Nuclear Information System (INIS)

    Mishonov, T.M.

    1990-06-01

    Acoustic wave emission of the two dimensional plasmons in a semiconductor or superconductor microstructure is investigated by using the phenomenological deformation potential within the jellium model. The plasmons are excited by the external electromagnetic (e.m.) field. The power conversion coefficient of e.m. energy into acoustic wave energy is also estimated. It is shown, the coherent transformation has a sharp resonance at the plasmon frequency of the two dimensional electron gas (2DEG). The incoherent transformation of the e.m. energy is generated by ohmic dissipation of 2DEG. The method proposed for coherent phonon beam generation can be very effective for high mobility 2DEG and for thin superconducting layers if the plasmon frequency ω is smaller than the superconducting gap 2Δ. (author). 21 refs, 1 fig

  17. Confined catalysis under two-dimensional materials

    OpenAIRE

    Li, Haobo; Xiao, Jianping; Fu, Qiang; Bao, Xinhe

    2017-01-01

    Small spaces in nanoreactors may have big implications in chemistry, because the chemical nature of molecules and reactions within the nanospaces can be changed significantly due to the nanoconfinement effect. Two-dimensional (2D) nanoreactor formed under 2D materials can provide a well-defined model system to explore the confined catalysis. We demonstrate a general tendency for weakened surface adsorption under the confinement of graphene overlayer, illustrating the feasible modulation of su...

  18. Two-Dimensional Extreme Learning Machine

    Directory of Open Access Journals (Sweden)

    Bo Jia

    2015-01-01

    (BP networks. However, like many other methods, ELM is originally proposed to handle vector pattern while nonvector patterns in real applications need to be explored, such as image data. We propose the two-dimensional extreme learning machine (2DELM based on the very natural idea to deal with matrix data directly. Unlike original ELM which handles vectors, 2DELM take the matrices as input features without vectorization. Empirical studies on several real image datasets show the efficiency and effectiveness of the algorithm.

  19. Superintegrability on the two dimensional hyperboloid

    International Nuclear Information System (INIS)

    Akopyan, E.; Pogosyan, G.S.; Kalnins, E.G.; Miller, W. Jr

    1998-01-01

    This work is devoted to the investigation of the quantum mechanical systems on the two dimensional hyperboloid which admit separation of variables in at least two coordinate systems. Here we consider two potentials introduced in a paper of C.P.Boyer, E.G.Kalnins and P.Winternitz, which haven't been studied yet. An example of an interbasis expansion is given and the structure of the quadratic algebra generated by the integrals of motion is carried out

  20. Two-dimensional Kagome photonic bandgap waveguide

    DEFF Research Database (Denmark)

    Nielsen, Jens Bo; Søndergaard, Thomas; Libori, Stig E. Barkou

    2000-01-01

    The transverse-magnetic photonic-bandgap-guidance properties are investigated for a planar two-dimensional (2-D) Kagome waveguide configuration using a full-vectorial plane-wave-expansion method. Single-moded well-localized low-index guided modes are found. The localization of the optical modes...... is investigated with respect to the width of the 2-D Kagome waveguide, and the number of modes existing for specific frequencies and waveguide widths is mapped out....

  1. UV Radiation Activates Toll-Like Receptor 9 Expression in Primary Human Keratinocytes, an Event Inhibited by Human Papillomavirus 38 E6 and E7 Oncoproteins.

    Science.gov (United States)

    Pacini, Laura; Ceraolo, Maria Grazia; Venuti, Assunta; Melita, Giusi; Hasan, Uzma A; Accardi, Rosita; Tommasino, Massimo

    2017-10-01

    Several lines of evidence indicate that cutaneous human papillomavirus (HPV) types belonging to the beta genus of the HPV phylogenetic tree synergize with UV radiation in the development of skin cancer. Accordingly, the E6 and E7 oncoproteins from some beta HPV types are able to deregulate pathways related to immune response and cellular transformation. Toll-like receptor 9 (TLR9), in addition to playing a role in innate immunity, has been shown to be involved in the cellular stress response. Using primary human keratinocytes as experimental models, we have shown that UV irradiation (and other cellular stresses) activates TLR9 expression. This event is closely linked to p53 activation. Silencing the expression of p53 or deleting its encoding gene affected the activation of TLR9 expression after UV irradiation. Using various strategies, we have also shown that the transcription factors p53 and c-Jun are recruited onto a specific region of the TLR9 promoter after UV irradiation. Importantly, the E6 and E7 oncoproteins from beta HPV38, by inducing the accumulation of the p53 antagonist ΔNp73α, prevent the UV-mediated recruitment of these transcription factors onto the TLR9 promoter, with subsequent impairment of TLR9 gene expression. This study provides new insight into the mechanism that mediates TLR9 upregulation in response to cellular stresses. In addition, we show that HPV38 E6 and E7 are able to interfere with this mechanism, providing another explanation for the possible cooperation of beta HPV types with UV radiation in skin carcinogenesis. IMPORTANCE Beta HPV types have been suggested to act as cofactors in UV-induced skin carcinogenesis by altering several cellular mechanisms activated by UV radiation. We show that the expression of TLR9, a sensor of damage-associated molecular patterns produced during cellular stress, is activated by UV radiation in primary human keratinocytes (PHKs). Two transcription factors known to be activated by UV radiation, p53

  2. Mechanical exfoliation of two-dimensional materials

    Science.gov (United States)

    Gao, Enlai; Lin, Shao-Zhen; Qin, Zhao; Buehler, Markus J.; Feng, Xi-Qiao; Xu, Zhiping

    2018-06-01

    Two-dimensional materials such as graphene and transition metal dichalcogenides have been identified and drawn much attention over the last few years for their unique structural and electronic properties. However, their rise begins only after these materials are successfully isolated from their layered assemblies or adhesive substrates into individual monolayers. Mechanical exfoliation and transfer are the most successful techniques to obtain high-quality single- or few-layer nanocrystals from their native multi-layer structures or their substrate for growth, which involves interfacial peeling and intralayer tearing processes that are controlled by material properties, geometry and the kinetics of exfoliation. This procedure is rationalized in this work through theoretical analysis and atomistic simulations. We propose a criterion to assess the feasibility for the exfoliation of two-dimensional sheets from an adhesive substrate without fracturing itself, and explore the effects of material and interface properties, as well as the geometrical, kinetic factors on the peeling behaviors and the torn morphology. This multi-scale approach elucidates the microscopic mechanism of the mechanical processes, offering predictive models and tools for the design of experimental procedures to obtain single- or few-layer two-dimensional materials and structures.

  3. Acrolein, an I-κBα-independent downregulator of NF-κB activity, causes the decrease in nitric oxide production in human malignant keratinocytes.

    Science.gov (United States)

    Moon, Ki-Young

    2011-05-01

    Acrolein, a reactive electrophilic α, β-unsaturated aldehyde, is known to be an alkylating chemical carcinogen. The effect of acrolein on the activation of NF-κB in human malignant epidermal keratinocytes was examined to elucidate the molecular mechanism associated with this NF-κB-acrolein regulation and its consecutive sequence, nitric oxide (NO) production. Acrolein significantly downregulated the cellular NF-κB activity up to 60% compared with control as well as the lipopolysaccharide (LPS)-induced NO production in a dose response manner at concentrations of 10~30 μM. To investigate the regulatory mechanism associated with this NF-κB-acrolein downregulation, the relative level of phosphorylation of I-κBα (serines-32 and -36), a principle regulator of NF-κB activation, represented by acrolein, was quantified. Acrolein inhibited NF-κB activity without altering cellular levels of the phosphorylated and nonphosphorylated forms of I-κBα, implying that the downregulatory effect of acrolein on cellular NF-κB activity in human skin cells is an I-κBα-independent activation pathway. The results suggests that acrolein causes the decrease in nitric oxide production as an I-κBα-independent downregulator of NF-κB activity in human malignant keratinocytes, and acrolein-induced carcinogenesis may be associated with the modulation of cellular NF-κB activity.

  4. CARMA2sh and ULK2 control pathogen-associated molecular patterns recognition in human keratinocytes: psoriasis-linked CARMA2sh mutants escape ULK2 censorship.

    Science.gov (United States)

    Scudiero, Ivan; Mazzone, Pellegrino; D'Andrea, Luca E; Ferravante, Angela; Zotti, Tiziana; Telesio, Gianluca; De Rubis, Gabriele; Reale, Carla; Pizzulo, Maddalena; Muralitharan, Shanmugakonar; Vito, Pasquale; Stilo, Romania

    2017-02-23

    The molecular complexes formed by specific members of the family of CARMA proteins, the CARD domain-containing adapter molecule BCL10 and MALT1 (CBM complex) represent a central hub in regulating activation of the pleiotropic transcription factor NF-κB. Recently, missense mutations in CARMA2sh have been shown to cause psoriasis in a dominant manner and with high penetrancy. Here, we demonstrate that in human keratinocytes CARMA2sh plays an essential role in the signal transduction pathway that connects pathogen-associated molecular patterns recognition to NF-κB activation. We also find that the serine/threonine kinase ULK2 binds to and phosphorylates CARMA2sh, thereby inhibiting its capacity to activate NF-κB by promoting lysosomal degradation of BCL10, which is essential for CARMA2sh-mediated NF-κB signaling. Remarkably, CARMA2sh mutants associated with psoriasis escape ULK2 inhibition. Finally, we show that a peptide blocking CARD-mediated BCL10 interactions reduces the capacity of psoriasis-linked CARMA2sh mutants to activate NF-κB. Our work elucidates a fundamental signaling mechanism operating in human keratinocytes and opens to novel potential tools for the therapeutical treatment of human skin disorders.

  5. Effects of UVB-induced oxidative stress on protein expression and specific protein oxidation in normal human epithelial keratinocytes: a proteomic approach

    Directory of Open Access Journals (Sweden)

    De Marco Federico

    2010-03-01

    Full Text Available Abstract Background The UVB component of solar ultraviolet irradiation is one of the major risk factors for the development of skin cancer in humans. UVB exposure elicits an increased generation of reactive oxygen species (ROS, which are responsible for oxidative damage to proteins, DNA, RNA and lipids. In order to examine the biological impact of UVB irradiation on skin cells, we used a parallel proteomics approach to analyze the protein expression profile and to identify oxidatively modified proteins in normal human epithelial keratinocytes. Results The expression levels of fifteen proteins - involved in maintaining the cytoskeleton integrity, removal of damaged proteins and heat shock response - were differentially regulated in UVB-exposed cells, indicating that an appropriate response is developed in order to counteract/neutralize the toxic effects of UVB-raised ROS. On the other side, the redox proteomics approach revealed that seven proteins - involved in cellular adhesion, cell-cell interaction and protein folding - were selectively oxidized. Conclusions Despite a wide and well orchestrated cellular response, a relevant oxidation of specific proteins concomitantly occurs in UVB-irradiated human epithelial Keratinocytes. These modified (i.e. likely dysfunctional proteins might result in cell homeostasis impairment and therefore eventually promote cellular degeneration, senescence or carcinogenesis.

  6. Low-dose dose-response for reduced cell viability after exposure of human keratinocyte (HEK001 cells to arsenite

    Directory of Open Access Journals (Sweden)

    Kenneth T. Bogen

    Full Text Available The in vitro arsenite (AsIII cytotoxicity dose-response (DR of human keratinocytes (HEK001 was examined at greater statistical resolution than ever previously reported using the MTT assay to determine cell viability. Fifty-four 96-well plates were treated with AsIII concentrations of 0.25, 0.5, 1, 2, 3, 4, 5, 7, 10, 15, 20, 25, or 30 μM. Because of unexpected variation in viability response patterns, a two-stage DR analysis was used in which data on plate-specific viability (%, estimated as 100% times the ratio of measured viability in exposed to unexposed cells, were fit initially to a generalized lognormal response function positing that HEK001 cells studied consisted of: a proportion P of relatively highly sensitive (HS cells, a proportion Po of relatively resistant cells, and a remaining (1–P–Po fraction of typical-sensitivity (TS cells exhibiting the intermediate level of AsIII sensitivity characteristic of most cells in each assay. The estimated fractions P and Po were used to adjust data from all 54 plates (and from the 28 plates yielding the best fits to reflect the condition that P = Po = 0 to provide detailed DR analysis specifically for TS cells. Four DR models fit to the combined adjusted data were each very predictive (R2 > 0.97 overall but were inconsistent with at least one of the data set examined (p  0.30 and exceeded 100% significance (p ≤ 10−6. A low-dose hormetic model provided the best fit to the combined adjusted data for TS cells (R2 = 0.995. Marked variability in estimates of P (the proportion of apparent HS cells was unexpected, not readily explained, and warrants further study using additional cell lines and assay methods, and in vivo. Keywords: Arsenic, Arsenate, Cell culture, Cell death, Cytotoxicity, HEK001 cells

  7. Interleukin-1α Induction in Human Keratinocytes (HaCaT: An In Vitro Model for Chemoprevention in Skin

    Directory of Open Access Journals (Sweden)

    T. Magcwebeba

    2012-01-01

    Full Text Available Long-term exposure to UV irradiation and toxic chemicals is associated with chronic inflammation that contributes to skin cancer development with interleukin-1 alpha (IL-1α, constitutively produced by keratinocytes, playing a pivotal role in skin inflammation. The aim of this study was to investigate the modulation of IL-1α production in the HaCaT keratinocyte cell line. Phorbol 12-myristate 13-acetate failed to induce IL-1α in HaCaT cells, and this might be associated with the specific deficiency known to affect downstream signalling of the MEK/ERK pathway in these cells. The calcium ionophore, ionomycin, slightly enhanced the production of intracellular (icIL-1α, but this resulted in a necrotic release at higher concentrations. UV-B exposure significantly increased the production of icIL-1α in a dose-dependent manner with a maximal induction exhibited at 24 h with minimal necrotic and apoptotic effects. Validation of the HaCaT cell model indicated that the nonsteroidal anti-inflammatory drug (NSAID, ibuprofen, and the glucocorticoid, dexamethasone, inhibited icIL-1α production, and this was associated with a slight inhibition of cell viability. The UV-B-induced keratinocyte cell model provides an in vitro system that could, apart from phorbol ester-like compounds, be utilised as a screening assay in identifying skin irritants and/or therapeutic topical agents via the modulation of IL-1α production.

  8. Binding of antibodies to the extractable nuclear antigens SS-A/Ro and SS-B/La is induced on the surface of human keratinocytes by ultraviolet light (UVL): Implications for the pathogenesis of photosensitive cutaneous lupus

    International Nuclear Information System (INIS)

    Furukawa, F.; Kashihara-Sawami, M.; Lyons, M.B.; Norris, D.A.

    1990-01-01

    Autoantibodies to the non-histone nucleoprotein antigens SS-A/Ro, SS-B/La, and RNP are highly associated with photosensitive cutaneous lupus erythematosus (LE). In order to better understand the potential mechanisms of ultraviolet (UV) light on photosensitivity in patients with cutaneous LE, we designed immunopathologic in vitro and in vivo experiments to evaluate the effects of UV on the binding of such autoantibodies to the surface of human keratinocytes, one major target of immunologic damage in photosensitive LE. Short-term 2% paraformaldehyde fixation of suspensions of cultured human keratinocytes previously incubated with monospecific antiserum probes enabled the detection of ENA expression on the cell surface by flow-cytometry analysis. UVB light (280-320 nm) induced the binding of monospecific antibody probes for SS-A/Ro and SS-B/La on keratinocytes in a dose-dependent pattern with maximal induction observed at the dose of 200 mJ/cm2 UVB. Binding of SS-A/Ro, SS-B/La, and RNP antibody was augmented strongly, but binding of anti-Sm was very weak. In contrast, UVA (320-400 nm) light had no effect on the induction of binding of these antibody probes. Identical results were seen by standard immunofluorescence techniques. Hydroxyurea-treated keratinocytes showed similar induction of those antigens by UVB irradiation, which suggested that ENA expression on cultured keratinocytes by UVB were cell-cycle independent. Tunicamycin, an inhibitor of glycosylation of proteins, reduced UVB light effect on the SS-A/Ro and SS-B/La antigen's expression. These in vitro FACS analyses revealed that ENA augmentation on the keratinocyte cell surface was dose dependent, UVB dependent, glycosylation dependent, and cell-cycle independent. In vivo ENA augmentation on the keratinocyte surface was examined in suction blister epidermal roofs

  9. A distal region of the human TGM1 promoter is required for expression in transgenic mice and cultured keratinocytes

    Directory of Open Access Journals (Sweden)

    Lu Ying

    2004-04-01

    Full Text Available Abstract Background TGM1(transglutaminase 1 is an enzyme that crosslinks the cornified envelope of mature keratinocytes. Appropriate expression of the TGM1 gene is crucial for proper keratinocyte function as inactivating mutations lead to the debilitating skin disease, lamellar ichthyosis. TGM1 is also expressed in squamous metaplasia, a consequence in some epithelia of vitamin A deficiency or toxic insult that can lead to neoplasia. An understanding of the regulation of this gene in normal and abnormal differentiation states may contribute to better disease diagnosis and treatment. Methods In vivo requirements for expression of the TGM1 gene were studied by fusing various lengths of promoter DNA to a reporter and injecting the DNA into mouse embryos to generate transgenic animals. Expression of the reporter was ascertained by Western blotting and immunohistochemistry. Further delineation of a transcriptionally important distal region was determined by transfections of progressively shortened or mutated promoter DNA into cultured keratinocytes. Results In vivo analysis of a reporter transgene driven by the TGM1 promoter revealed that 1.6 kilobases, but not 1.1 kilobases, of DNA was sufficient to confer tissue-specific and cell layer-specific expression. This same region was responsible for reporter expression in tissues undergoing squamous metaplasia as a response to vitamin A deprivation. Mutation of a distal promoter AP1 site or proximal promoter CRE site, both identified as important transcriptional elements in transfection assays, did not prevent appropriate expression. Further searching for transcriptional elements using electrophoretic mobility shift (EMSA and transfection assays in cultured keratinocytes identified two Sp1 elements in a transcriptionally active region between -1.6 and -1.4 kilobases. While mutation of either Sp1 site or the AP1 site singly had only a small effect, mutation of all three sites eliminated nearly all the

  10. Nicotinamide enhances repair of arsenic and ultraviolet radiation-induced DNA damage in HaCaT keratinocytes and ex vivo human skin.

    Directory of Open Access Journals (Sweden)

    Benjamin C Thompson

    Full Text Available Arsenic-induced skin cancer is a significant global health burden. In areas with arsenic contamination of water sources, such as China, Pakistan, Myanmar, Cambodia and especially Bangladesh and West Bengal, large populations are at risk of arsenic-induced skin cancer. Arsenic acts as a co-carcinogen with ultraviolet (UV radiation and affects DNA damage and repair. Nicotinamide (vitamin B3 reduces premalignant keratoses in sun-damaged skin, likely by prevention of UV-induced cellular energy depletion and enhancement of DNA repair. We investigated whether nicotinamide modifies DNA repair following exposure to UV radiation and sodium arsenite. HaCaT keratinocytes and ex vivo human skin were exposed to 2μM sodium arsenite and low dose (2J/cm2 solar-simulated UV, with and without nicotinamide supplementation. DNA photolesions in the form of 8-oxo-7,8-dihydro-2'-deoxyguanosine and cyclobutane pyrimidine dimers were detected by immunofluorescence. Arsenic exposure significantly increased levels of 8-oxo-7,8-dihydro-2'-deoxyguanosine in irradiated cells. Nicotinamide reduced both types of photolesions in HaCaT keratinocytes and in ex vivo human skin, likely by enhancing DNA repair. These results demonstrate a reduction of two different photolesions over time in two different models in UV and arsenic exposed cells. Nicotinamide is a nontoxic, inexpensive agent with potential for chemoprevention of arsenic induced skin cancer.

  11. UVB irradiation does not directly induce detectable changes of DNA methylation in human keratinocytes [v1; ref status: indexed, http://f1000r.es/np

    Directory of Open Access Journals (Sweden)

    Christoph Lahtz

    2013-02-01

    Full Text Available Unprotected exposure to UVB radiation from the sun and the resulting DNA damage are thought to be responsible for physiological changes in the skin and for a variety of skin cancers, including basal cell and squamous cell carcinoma and malignant melanoma. Although the mutagenic effects of UVB have been well documented and studied mechanistically, there is only limited information as to whether UV light may also be responsible for inducing epigenetic changes in the genome of exposed cells. DNA methylation is a stable epigenetic modification involved in gene control. To study the effects of UVB radiation on DNA methylation, we repeatedly exposed normal human keratinocytes to a UVB light source. After a recovery period, we analyzed global DNA methylation patterns in the irradiated and control cells using the methylated-CpG island recovery assay (MIRA method in combination with high-resolution microarrays. Bioinformatics analysis revealed only a limited number of possible differences between UVB-exposed and control cells. However, these minor apparent changes could not be independently confirmed by bisulfite sequencing-based approaches. This study reveals that UVB irradiation of keratinocytes has no recognizable global effect on DNA methylation patterns and suggests that changes in DNA methylation, as observed in skin cancers, are not immediate consequences of human exposure to solar UVB irradiation.

  12. Vector (two-dimensional) magnetic phenomena

    International Nuclear Information System (INIS)

    Enokizono, Masato

    2002-01-01

    In this paper, some interesting phenomena were described from the viewpoint of two-dimensional magnetic property, which is reworded with the vector magnetic property. It shows imperfection of conventional magnetic property and some interested phenomena were discovered, too. We found magnetic materials had the strong nonlinearity both magnitude and spatial phase due to the relationship between the magnetic field strength H-vector and the magnetic flux density B-vector. Therefore, magnetic properties should be defined as the vector relationship. Furthermore, the new Barukhausen signal was observed under rotating flux. (Author)

  13. Two-dimensional Semiconductor-Superconductor Hybrids

    DEFF Research Database (Denmark)

    Suominen, Henri Juhani

    This thesis investigates hybrid two-dimensional semiconductor-superconductor (Sm-S) devices and presents a new material platform exhibiting intimate Sm-S coupling straight out of the box. Starting with the conventional approach, we investigate coupling superconductors to buried quantum well....... To overcome these issues we integrate the superconductor directly into the semiconducting material growth stack, depositing it in-situ in a molecular beam epitaxy system under high vacuum. We present a number of experiments on these hybrid heterostructures, demonstrating near unity interface transparency...

  14. Optimized two-dimensional Sn transport (BISTRO)

    International Nuclear Information System (INIS)

    Palmiotti, G.; Salvatores, M.; Gho, C.

    1990-01-01

    This paper reports on an S n two-dimensional transport module developed for the French fast reactor code system CCRR to optimize algorithms in order to obtain the best performance in terms of computational time. A form of diffusion synthetic acceleration was adopted, and a special effort was made to solve the associated diffusion equation efficiently. The improvements in the algorithms, along with the use of an efficient programming language, led to a significant gain in computational time with respect to the DOT code

  15. Binding energy of two-dimensional biexcitons

    DEFF Research Database (Denmark)

    Singh, Jai; Birkedal, Dan; Vadim, Lyssenko

    1996-01-01

    Using a model structure for a two-dimensional (2D) biexciton confined in a quantum well, it is shown that the form of the Hamiltonian of the 2D biexciton reduces into that of an exciton. The binding energies and Bohr radii of a 2D biexciton in its various internal energy states are derived...... analytically using the fractional dimension approach. The ratio of the binding energy of a 2D biexciton to that of a 2D exciton is found to be 0.228, which agrees very well with the recent experimental value. The results of our approach are compared with those of earlier theories....

  16. Airy beams on two dimensional materials

    Science.gov (United States)

    Imran, Muhammad; Li, Rujiang; Jiang, Yuyu; Lin, Xiao; Zheng, Bin; Dehdashti, Shahram; Xu, Zhiwei; Wang, Huaping

    2018-05-01

    We propose that quasi-transverse-magnetic (quasi-TM) Airy beams can be supported on two dimensional (2D) materials. By taking graphene as a typical example, the solution of quasi-TM Airy beams is studied under the paraxial approximation. The analytical field intensity in a bilayer graphene-based planar plasmonic waveguide is confirmed by the simulation results. Due to the tunability of the chemical potential of graphene, the self-accelerating behavior of the quasi-TM Airy beam can be steered effectively. 2D materials thus provide a good platform to investigate the propagation of Airy beams.

  17. Two-dimensional heat flow apparatus

    Science.gov (United States)

    McDougall, Patrick; Ayars, Eric

    2014-06-01

    We have created an apparatus to quantitatively measure two-dimensional heat flow in a metal plate using a grid of temperature sensors read by a microcontroller. Real-time temperature data are collected from the microcontroller by a computer for comparison with a computational model of the heat equation. The microcontroller-based sensor array allows previously unavailable levels of precision at very low cost, and the combination of measurement and modeling makes for an excellent apparatus for the advanced undergraduate laboratory course.

  18. Development of a two-dimensional high-performance liquid chromatography system coupled with on-line reduction as a new efficient analytical method of 3-nitrobenzanthrone, a potential human carcinogen.

    Science.gov (United States)

    Hasei, Tomohiro; Nakanishi, Haruka; Toda, Yumiko; Watanabe, Tetsushi

    2012-08-31

    3-Nitrobenzanthrone (3-NBA) is an extremely strong mutagen and carcinogen in rats inducing squamous cell carcinoma and adenocarcinoma. We developed a new sensitive analytical method, a two-dimensional HPLC system coupled with on-line reduction, to quantify non-fluorescent 3-NBA as fluorescent 3-aminobenzanthrone (3-ABA). The two-dimensional HPLC system consisted of reversed-phase HPLC and normal-phase HPLC, which were connected with a switch valve. 3-NBA was purified by reversed-phase HPLC and reduced to 3-ABA with a catalyst column, packed with alumina coated with platinum, in ethanol. An alcoholic solvent is necessary for reduction of 3-NBA, but 3-ABA is not fluorescent in the alcoholic solvent. Therefore, 3-ABA was separated from alcohol and impurities by normal-phase HPLC and detected with a fluorescence detector. Extracts from surface soil, airborne particles, classified airborne particles, and incinerator dust were applied to the two-dimensional HPLC system after clean-up with a silica gel column. 3-NBA, detected as 3-ABA, in the extracts was found as a single peak on the chromatograms without any interfering peaks. 3-NBA was detected in 4 incinerator dust samples (n=5). When classified airborne particles, that is, those 7.0 μm in size, were applied to the two-dimensional HPLC system after purified using a silica gel column, 3-NBA was detected in those particles with particle sizes NBA in airborne particles and the detection of 3-NBA in incinerator dust. Copyright © 2012 Elsevier B.V. All rights reserved.

  19. Comparison of the miRNA profiles in HPV-positive and HPV-negative tonsillar tumors and a model system of human keratinocyte clones

    International Nuclear Information System (INIS)

    Vojtechova, Zuzana; Sabol, Ivan; Salakova, Martina; Smahelova, Jana; Zavadil, Jiri; Turek, Lubomir; Grega, Marek; Klozar, Jan; Prochazka, Bohumir; Tachezy, Ruth

    2016-01-01

    Better insights into the molecular changes involved in virus-associated and -independent head and neck cancer may advance our knowledge of HNC carcinogenesis and identify critical disease biomarkers. Here we aimed to characterize the expression profiles in a matched set of well-characterized HPV-dependent and HPV-independent tonsillar tumors and equivalent immortalized keratinocyte clones to define potential and clinically relevant biomarkers of HNC of different etiology. Fresh frozen tonsillar cancer tissues were analyzed together with non-malignant tonsillar tissues and compared with cervical tumors and normal cervical tissues. Furthermore, relative miRNAs abundance levels of primary and immortalized human keratinocyte clones were evaluated. The global quantitation of miRNA gene abundance was performed using a TaqMan Low Density Array system. The confirmation of differentially expressed miRNAs was performed on a set of formalin-fixed paraffin-embedded tumor samples enriched for the tumor cell fraction by macrodissection. We defined 46 upregulated and 31 downregulated miRNAs characteristic for the HPV-positive tonsillar tumors and 42 upregulated miRNAs and 42 downregulated miRNAs characteristic for HPV-independent tumors. In comparison with the expression profiles in cervical tumors, we defined miR-141-3p, miR-15b-5p, miR-200a-3p, miR-302c-3p, and miR-9-5p as specific for HPV induced malignancies. MiR-335-5p, miR-579-3p, and miR-126-5p were shared by the expression profiles of HPV-positive tonsillar tumors and of the HPV immortalized keratinocyte clones, whereas miR-328-3p, miR-34c-3p, and miR-885-5p were shared by the miRNA profiles of HPV-negative tonsillar tumors and the HPV-negative keratinocytes. We identified the miRNAs characteristic for HPV-induced tumors and tonsillar tumors of different etiology, and the results were compared with those of the model system. Our report presents the basis for further investigations leading to the identification of

  20. Ultraviolet radiation can either suppress or induce expression of intercellular adhesion molecule 1 (ICAM-1) on the surface of cultured human keratinocytes

    International Nuclear Information System (INIS)

    Norris, D.A.; Lyons, M.B.; Middleton, M.H.; Yohn, J.J.; Kashihara-Sawami, M.

    1990-01-01

    Interactions of the ligand/receptor pair LFA-1(CD11a/CD18) and ICAM-1(CD54) initiate and control the cell-cell interactions of leukocytes and interactions of leukocytes with parenchymal cells in all phases of the immune response. Induction of the intercellular adhesion molecule 1 (ICAM-1) on the surface of epidermal keratinocytes has been proposed as an important regulator of contact-dependent aspects of cutaneous inflammation. Ultraviolet radiation (UVR) also modifies cutaneous inflammation, producing both up- and down-regulation of contact hypersensitivity. We have found that UVR has a biphasic effect on the induction of keratinocyte CD54. Using immunofluorescence and FACS techniques to quantitate cell-surface CD54 staining, we have shown that UVR significantly (p less than 0.01) inhibits keratinocyte CD54 induction by gamma interferon 24 h after irradiation. However, at 48, 72, and 96 h after UVR, CD54 expression is significantly induced to levels even greater than are induced by gamma interferon (20 U/ml). In addition, at 48, 72, or 96 h following UVR (30-100 mJ/cm2), the gamma-interferon-induced CD54 expression on human keratinocytes is also strongly (p less than 0.05 to p less than 0.001) enhanced. In this cell-culture system, gamma interferon and TNF-alpha are both strong CD54 inducers and are synergistic, but GM-CSF, TFG-beta, and IL-1 have no direct CD54-inducing effects. Thus the effects of UVR on CD54 induction are biphasic, producing inhibition at 24 h and induction at 48, 72, and 96 h. This effect on CD54 may contribute to the biphasic effects of UVR on delayed hypersensitivity in vivo. The early inhibition of ICAM-1 by UVR may also contribute to the therapeutic effects of UVR. We also speculate that the late induction of ICAM-1 by UVR might be an important step in the induction of photosensitive diseases such as lupus erythematosus

  1. Interferon-β induces cellular senescence in cutaneous human papilloma virus-transformed human keratinocytes by affecting p53 transactivating activity.

    Directory of Open Access Journals (Sweden)

    Maria V Chiantore

    Full Text Available Interferon (IFN-β inhibits cell proliferation and affects cell cycle in keratinocytes transformed by both mucosal high risk Human Papilloma Virus (HPV and cutaneous HPV E6 and E7 proteins. In particular, upon longer IFN-β treatments, cutaneous HPV38 expressing cells undergo senescence. IFN-β appears to induce senescence by upregulating the expression of the tumor suppressor PML, a well known IFN-induced gene. Indeed, experiments in gene silencing via specific siRNAs have shown that PML is essential in the execution of the senescence programme and that both p53 and p21 pathways are involved. IFN-β treatment leads to a modulation of p53 phosphorylation and acetylation status and a reduction in the expression of the p53 dominant negative ΔNp73. These effects allow the recovery of p53 transactivating activity of target genes involved in the control of cell proliferation. Taken together, these studies suggest that signaling through the IFN pathway might play an important role in cellular senescence. This additional understanding of IFN antitumor action and mechanisms influencing tumor responsiveness or resistance appears useful in aiding further promising development of biomolecular strategies in the IFN therapy of cancer.

  2. Upregulation of cathepsin S in psoriatic keratinocytes.

    Science.gov (United States)

    Schönefuss, Alexander; Wendt, Wiebke; Schattling, Benjamin; Schulten, Roxane; Hoffmann, Klaus; Stuecker, Markus; Tigges, Christian; Lübbert, Hermann; Stichel, Christine

    2010-08-01

    Cathepsin S (CATS) is a cysteine protease, well known for its role in MHC class II-mediated antigen presentation and extracellular matrix degradation. Disturbance of the expression or metabolism of this protease is a concomitant feature of several diseases. Given this importance we studied the localization and regulation of CATS expression in normal and pathological human/mouse skin. In normal human skin CATS-immunostaining is mainly present in the dermis and is localized in macrophages, Langerhans, T- and endothelial cells, but absent in keratinocytes. In all analyzed pathological skin biopsies, i.e. atopic dermatitis, actinic keratosis and psoriasis, CATS staining is strongly increased in the dermis. But only in psoriasis, CATS-immunostaining is also detectable in keratinocytes. We show that cocultivation with T-cells as well as treatment with cytokines can trigger expression and secretion of CATS, which is involved in MHC II processing in keratinocytes. Our data provide first evidence that CATS expression (i) is selectively induced in psoriatic keratinocytes, (ii) is triggered by T-cells and (iii) might be involved in keratinocytic MHC class II expression, the processing of the MHC class II-associated invariant chain and remodeling of the extracellular matrix. This paper expands our knowledge on the important role of keratinocytes in dermatological disease.

  3. Decoherence in two-dimensional quantum walks

    International Nuclear Information System (INIS)

    Oliveira, A. C.; Portugal, R.; Donangelo, R.

    2006-01-01

    We analyze the decoherence in quantum walks in two-dimensional lattices generated by broken-link-type noise. In this type of decoherence, the links of the lattice are randomly broken with some given constant probability. We obtain the evolution equation for a quantum walker moving on two-dimensional (2D) lattices subject to this noise, and we point out how to generalize for lattices in more dimensions. In the nonsymmetric case, when the probability of breaking links in one direction is different from the probability in the perpendicular direction, we have obtained a nontrivial result. If one fixes the link-breaking probability in one direction, and gradually increases the probability in the other direction from 0 to 1, the decoherence initially increases until it reaches a maximum value, and then it decreases. This means that, in some cases, one can increase the noise level and still obtain more coherence. Physically, this can be explained as a transition from a decoherent 2D walk to a coherent 1D walk

  4. Study of two-dimensional interchange turbulence

    International Nuclear Information System (INIS)

    Sugama, Hideo; Wakatani, Masahiro.

    1990-04-01

    An eddy viscosity model describing enstrophy transfer in two-dimensional turbulence is presented. This model is similar to that of Canuto et al. and provides an equation for the energy spectral function F(k) as a function of the energy input rate to the system per unit wavenumber, γ s (k). In the enstrophy-transfer inertial range, F(k)∝ k -3 is predicted by the model. The eddy viscosity model is applied to the interchange turbulence of a plasma in shearless magnetic field. Numerical simulation of the two-dimensional interchange turbulence demonstrates that the energy spectrum in the high wavenumber region is well described by this model. The turbulent transport driven by the interchange turbulence is expressed in terms of the Nusselt number Nu, the Rayleigh number Ra and Prantl number Pr in the same manner as that of thermal convection problem. When we use the linear growth rate for γ s (k), our theoretical model predicts that Nu ∝ (Ra·Pr) 1/2 for a constant background pressure gradient and Nu ∝ (Ra·Pr) 1/3 for a self-consistent background pressure profile with the stress-free slip boundary conditions. The latter agrees with our numerical result showing Nu ∝ Ra 1/3 . (author)

  5. Two-Dimensional Theory of Scientific Representation

    Directory of Open Access Journals (Sweden)

    A Yaghmaie

    2013-03-01

    Full Text Available Scientific representation is an interesting topic for philosophers of science, many of whom have recently explored it from different points of view. There are currently two competing approaches to the issue: cognitive and non-cognitive, and each of them claims its own merits over the other. This article tries to provide a hybrid theory of scientific representation, called Two-Dimensional Theory of Scientific Representation, which has the merits of the two accounts and is free of their shortcomings. To do this, we will argue that although scientific representation needs to use the notion of intentionality, such a notion is defined and realized in a simply structural form contrary to what cognitive approach says about intentionality. After a short introduction, the second part of the paper is devoted to introducing theories of scientific representation briefly. In the third part, the structural accounts of representation will be criticized. The next step is to introduce the two-dimensional theory which involves two key components: fixing and structural fitness. It will be argued that fitness is an objective and non-intentional relation, while fixing is intentional.

  6. ER signaling is activated to protect human HaCaT keratinocytes from ER stress induced by environmental doses of UVB

    International Nuclear Information System (INIS)

    Mera, Kentaro; Kawahara, Ko-ichi; Tada, Ko-ichi; Kawai, Kazuhiro; Hashiguchi, Teruto; Maruyama, Ikuro; Kanekura, Takuro

    2010-01-01

    Proteins are folded properly in the endoplasmic reticulum (ER). Various stress such as hypoxia, ischemia and starvation interfere with the ER function, causing ER stress, which is defined by the accumulation of unfolded protein (UP) in the ER. ER stress is prevented by the UP response (UPR) and ER-associated degradation (ERAD). These signaling pathways are activated by three major ER molecules, ATF6, IRE-1 and PERK. Using HaCaT cells, we investigated ER signaling in human keratinocytes irradiated by environmental doses of ultraviolet B (UVB). The expression of Ero1-Lα, an upstream signaling molecule of ER stress, decreased at 1-4 h after 10 mJ/cm 2 irradiation, indicating that the environmental dose of UVB-induced ER stress in HaCaT cells, without growth retardation. Furthermore, expression of intact ATF6 was decreased and it was translocated to the nuclei. The expression of XBP-1, a downstream molecule of IRE-1, which is an ER chaperone whose expression is regulated by XBP-1, and UP ubiquitination were induced by 10 mJ/cm 2 UVB at 4 h. PERK, which regulates apoptosis, was not phosphorylated. Our results demonstrate that UVB irradiation generates UP in HaCaT cells and that the UPR and ERAD systems are activated to protect cells from UVB-induced ER stress. This is the first report to show ER signaling in UVB-irradiated keratinocytes.

  7. The effect of the antipsoriatic drug metabolite etretin (Ro 10-1670) on UVB irradiation induced changes in the metabolism of arachidonic acid in human keratinocytes in culture

    International Nuclear Information System (INIS)

    Punnonen, Kari; Jansen, C.T.; Puustinen, Tapio

    1986-01-01

    [ 14 C]Arachidonic acid was avidly incorporated into human keratinocytes in culture and following exposure to UVB irradiation of 9 mJ/cm 2 (erythemally effective, EE) substantial amounts of 14 C-radiolabel were released from the cells. The release of radiolabel was accompanied by a decrease in the labelling of phosphatidylethanolamine whereas the labelling of triacylglycerols and cholesteryl esters was increased. Keratinocytes produced significant amounts of prostaglandin E 2 (PGE 2 ) and following UVB irradiation of 9 mJ/cm 2 (EE) the formation of prostaglandin E 2 was increased. Etretin (Ro 10-1670), the active metabolite of the antipsoriatic drug etretinate (Ro 10-9359), affected significantly neither the total release of radiolabel induced by UVB nor the formation of prostaglandin E 2 . However, in the presence of etretin the UVB irradiation induced transfer of [ 14 C]arachidonic acid into triacylglycerols and cholesteryl esters was not increased as much as in the corresponding experiments without etretin. On the basis of the present study it appears that etretin dose not interfere with the release of arachidonic acid in amounts which could be related to the therapeutic effects of the combination of retinoids with UVB irradiation (Re-UVB) in the treatment of psoriasis. (author)

  8. Barium promotes anchorage-independent growth and invasion of human HaCaT keratinocytes via activation of c-SRC kinase.

    Science.gov (United States)

    Thang, Nguyen Dinh; Yajima, Ichiro; Kumasaka, Mayuko Y; Ohnuma, Shoko; Yanagishita, Takeshi; Hayashi, Rumiko; Shekhar, Hossain U; Watanabe, Daisuke; Kato, Masashi

    2011-01-01

    Explosive increases in skin cancers have been reported in more than 36 million patients with arsenicosis caused by drinking arsenic-polluted well water. This study and previous studies showed high levels of barium as well as arsenic in the well water. However, there have been no reports showing a correlation between barium and cancer. In this study, we examined whether barium (BaCl(2)) may independently have cancer-related effects on human precancerous keratinocytes (HaCaT). Barium (5-50 µM) biologically promoted anchorage-independent growth and invasion of HaCaT cells in vitro. Barium (5 µM) biochemically enhanced activities of c-SRC, FAK, ERK and MT1-MMP molecules, which regulate anchorage-independent growth and/or invasion. A SRC kinase specific inhibitor, protein phosphatase 2 (PP2), blocked barium-mediated promotion of anchorage-independent growth and invasion with decreased c-SRC kinase activity. Barium (2.5-5 µM) also promoted anchorage-independent growth and invasion of fibroblasts (NIH3T3) and immortalized nontumorigenic melanocytes (melan-a), but not transformed cutaneous squamous cell carcinoma (HSC5 and A431) and malignant melanoma (Mel-ret) cells, with activation of c-SRC kinase. Taken together, our biological and biochemical findings newly suggest that the levels of barium shown in drinking well water independently has the cancer-promoting effects on precancerous keratinocytes, fibroblast and melanocytes in vitro.

  9. AP-2α Inhibits c-MYC Induced Oxidative Stress and Apoptosis in HaCaT Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Lei Yu

    2009-01-01

    AP-2 may have a direct effect on the c-myc gene. Chromatin immunoprecipitation assays demonstrated that AP-2 proteins bound to a cluster of AP-2 binding sites located within a 2 kb upstream regulatory region of c-myc These results suggest that the negative regulation of AP-2 on c-MYC activity was achieved through binding of AP-2 protein to the c-myc gene. The effects of AP-2 on c-MYC induced ROS accumulation and apoptosis in epidermal keratinocytes are likely to play an important role in cell growth, differentiation and carcinogenesis of the skin.

  10. Two-dimensional simulation of sintering process

    International Nuclear Information System (INIS)

    Vasconcelos, Vanderley de; Pinto, Lucio Carlos Martins; Vasconcelos, Wander L.

    1996-01-01

    The results of two-dimensional simulations are directly applied to systems in which one of the dimensions is much smaller than the others, and to sections of three dimensional models. Moreover, these simulations are the first step of the analysis of more complex three-dimensional systems. In this work, two basic features of the sintering process are studied: the types of particle size distributions related to the powder production processes and the evolution of geometric parameters of the resultant microstructures during the solid-state sintering. Random packing of equal spheres is considered in the sintering simulation. The packing algorithm does not take into account the interactive forces between the particles. The used sintering algorithm causes the densification of the particle set. (author)

  11. Two dimensional generalizations of the Newcomb equation

    International Nuclear Information System (INIS)

    Dewar, R.L.; Pletzer, A.

    1989-11-01

    The Bineau reduction to scalar form of the equation governing ideal, zero frequency linearized displacements from a hydromagnetic equilibrium possessing a continuous symmetry is performed in 'universal coordinates', applicable to both the toroidal and helical cases. The resulting generalized Newcomb equation (GNE) has in general a more complicated form than the corresponding one dimensional equation obtained by Newcomb in the case of circular cylindrical symmetry, but in this cylindrical case , the equation can be transformed to that of Newcomb. In the two dimensional case there is a transformation which leaves the form of the GNE invariant and simplifies the Frobenius expansion about a rational surface, especially in the limit of zero pressure gradient. The Frobenius expansions about a mode rational surface is developed and the connection with Hamiltonian transformation theory is shown. 17 refs

  12. Pressure of two-dimensional Yukawa liquids

    International Nuclear Information System (INIS)

    Feng, Yan; Wang, Lei; Tian, Wen-de; Goree, J; Liu, Bin

    2016-01-01

    A simple analytic expression for the pressure of a two-dimensional Yukawa liquid is found by fitting results from a molecular dynamics simulation. The results verify that the pressure can be written as the sum of a potential term which is a simple multiple of the Coulomb potential energy at a distance of the Wigner–Seitz radius, and a kinetic term which is a multiple of the one for an ideal gas. Dimensionless coefficients for each of these terms are found empirically, by fitting. The resulting analytic expression, with its empirically determined coefficients, is plotted as isochores, or curves of constant area. These results should be applicable to monolayer dusty plasmas. (paper)

  13. Two dimensional nanomaterials for flexible supercapacitors.

    Science.gov (United States)

    Peng, Xu; Peng, Lele; Wu, Changzheng; Xie, Yi

    2014-05-21

    Flexible supercapacitors, as one of most promising emerging energy storage devices, are of great interest owing to their high power density with great mechanical compliance, making them very suitable as power back-ups for future stretchable electronics. Two-dimensional (2D) nanomaterials, including the quasi-2D graphene and inorganic graphene-like materials (IGMs), have been greatly explored to providing huge potential for the development of flexible supercapacitors with higher electrochemical performance. This review article is devoted to recent progresses in engineering 2D nanomaterials for flexible supercapacitors, which survey the evolution of electrode materials, recent developments in 2D nanomaterials and their hybrid nanostructures with regulated electrical properties, and the new planar configurations of flexible supercapacitors. Furthermore, a brief discussion on future directions, challenges and opportunities in this fascinating area is also provided.

  14. Geometrical aspects of solvable two dimensional models

    International Nuclear Information System (INIS)

    Tanaka, K.

    1989-01-01

    It was noted that there is a connection between the non-linear two-dimensional (2D) models and the scalar curvature r, i.e., when r = -2 the equations of motion of the Liouville and sine-Gordon models were obtained. Further, solutions of various classical nonlinear 2D models can be obtained from the condition that the appropriate curvature two form Ω = 0, which suggests that these models are closely related. This relation is explored further in the classical version by obtaining the equations of motion from the evolution equations, the infinite number of conserved quantities, and the common central charge. The Poisson brackets of the solvable 2D models are specified by the Virasoro algebra. 21 refs

  15. Two-dimensional materials for ultrafast lasers

    International Nuclear Information System (INIS)

    Wang Fengqiu

    2017-01-01

    As the fundamental optical properties and novel photophysics of graphene and related two-dimensional (2D) crystals are being extensively investigated and revealed, a range of potential applications in optical and optoelectronic devices have been proposed and demonstrated. Of the many possibilities, the use of 2D materials as broadband, cost-effective and versatile ultrafast optical switches (or saturable absorbers) for short-pulsed lasers constitutes a rapidly developing field with not only a good number of publications, but also a promising prospect for commercial exploitation. This review primarily focuses on the recent development of pulsed lasers based on several representative 2D materials. The comparative advantages of these materials are discussed, and challenges to practical exploitation, which represent good future directions of research, are laid out. (paper)

  16. Two-dimensional phase fraction charts

    International Nuclear Information System (INIS)

    Morral, J.E.

    1984-01-01

    A phase fraction chart is a graphical representation of the amount of each phase present in a system as a function of temperature, composition or other variable. Examples are phase fraction versus temperature charts used to characterize specific alloys and as a teaching tool in elementary texts, and Schaeffler diagrams used to predict the amount of ferrite in stainless steel welds. Isothermal-transformation diagrams (TTT diagrams) are examples that give phase (or microconstituent) amount versus temperature and time. The purpose of this communication is to discuss the properties of two-dimensional phase fraction charts in more general terms than have been reported before. It is shown that they can represent multi-component, multiphase equilibria in a way which is easier to read and which contains more information than the isotherms and isopleths of multi-component phase diagrams

  17. Two-dimensional motions of rockets

    International Nuclear Information System (INIS)

    Kang, Yoonhwan; Bae, Saebyok

    2007-01-01

    We analyse the two-dimensional motions of the rockets for various types of rocket thrusts, the air friction and the gravitation by using a suitable representation of the rocket equation and the numerical calculation. The slope shapes of the rocket trajectories are discussed for the three types of rocket engines. Unlike the projectile motions, the descending parts of the trajectories tend to be gentler and straighter slopes than the ascending parts for relatively large launching angles due to the non-vanishing thrusts. We discuss the ranges, the maximum altitudes and the engine performances of the rockets. It seems that the exponential fuel exhaustion can be the most potent engine for the longest and highest flights

  18. Two dimensional NMR studies of polysaccharides

    International Nuclear Information System (INIS)

    Byrd, R.A.; Egan, W.; Summers, M.F.

    1987-01-01

    Polysaccharides are very important components in the immune response system. Capsular polysaccharides and lipopolysaccharides occupy cell surface sites of bacteria, play key roles in recognition and some have been used to develop vaccines. Consequently, the ability to determine chemical structures of these systems is vital to an understanding of their immunogenic action. The authors have been utilizing recently developed two-dimensional homonuclear and heteronuclear correlation spectroscopy for unambiguous assignment and structure determination of a number of polysaccharides. In particular, the 1 H-detected heteronuclear correlation experiments are essential to the rapid and sensitive determination of these structures. Linkage sites are determined by independent polarization transfer experiments and multiple quantum correlation experiments. These methods permit the complete structure determination on very small amounts of the polysaccharides. They present the results of a number of structural determinations and discuss the limits of these experiments in terms of their applications to polysaccharides

  19. Two-Dimensional Homogeneous Fermi Gases

    Science.gov (United States)

    Hueck, Klaus; Luick, Niclas; Sobirey, Lennart; Siegl, Jonas; Lompe, Thomas; Moritz, Henning

    2018-02-01

    We report on the experimental realization of homogeneous two-dimensional (2D) Fermi gases trapped in a box potential. In contrast to harmonically trapped gases, these homogeneous 2D systems are ideally suited to probe local as well as nonlocal properties of strongly interacting many-body systems. As a first benchmark experiment, we use a local probe to measure the density of a noninteracting 2D Fermi gas as a function of the chemical potential and find excellent agreement with the corresponding equation of state. We then perform matter wave focusing to extract the momentum distribution of the system and directly observe Pauli blocking in a near unity occupation of momentum states. Finally, we measure the momentum distribution of an interacting homogeneous 2D gas in the crossover between attractively interacting fermions and bosonic dimers.

  20. Two-dimensional electroacoustic waves in silicene

    Science.gov (United States)

    Zhukov, Alexander V.; Bouffanais, Roland; Konobeeva, Natalia N.; Belonenko, Mikhail B.

    2018-01-01

    In this letter, we investigate the propagation of two-dimensional electromagnetic waves in a piezoelectric medium built upon silicene. Ultrashort optical pulses of Gaussian form are considered to probe this medium. On the basis of Maxwell's equations supplemented with the wave equation for the medium's displacement vector, we obtain the effective governing equation for the vector potential associated with the electromagnetic field, as well as the component of the displacement vector. The dependence of the pulse shape on the bandgap in silicene and the piezoelectric coefficient of the medium was analyzed, thereby revealing a nontrivial triadic interplay between the characteristics of the pulse dynamics, the electronic properties of silicene, and the electrically induced mechanical vibrations of the medium. In particular, we uncovered the possibility for an amplification of the pulse amplitude through the tuning of the piezoelectric coefficient. This property could potentially offer promising prospects for the development of amplification devices for the optoelectronics industry.

  1. Versatile two-dimensional transition metal dichalcogenides

    DEFF Research Database (Denmark)

    Canulescu, Stela; Affannoukoué, Kévin; Döbeli, Max

    ), a strategy for the fabrication of 2D heterostructures must be developed. Here we demonstrate a novel approach for the bottom-up synthesis of TMDC monolayers, namely Pulsed Laser Deposition (PLD) combined with a sulfur evaporation beam. PLD relies on the use of a pulsed laser (ns pulse duration) to induce...... material transfer from a solid source (such as a sintered target of MoS2) to a substrate (such as Si or sapphire). The deposition rate in PLD is typically much less than a monolayer per pulse, meaning that the number of MLs can be controlled by a careful selection of the number of laser pulses......Two-dimensional transition metal dichalcogenides (2D-TMDCs), such as MoS2, have emerged as a new class of semiconducting materials with distinct optical and electrical properties. The availability of 2D-TMDCs with distinct band gaps allows for unlimited combinations of TMDC monolayers (MLs...

  2. Two-dimensional heterostructures for energy storage

    Energy Technology Data Exchange (ETDEWEB)

    Gogotsi, Yury G. [Drexel Univ., Philadelphia, PA (United States); Pomerantseva, Ekaterina [Drexel Univ., Philadelphia, PA (United States)

    2017-06-12

    Two-dimensional (2D) materials provide slit-shaped ion diffusion channels that enable fast movement of lithium and other ions. However, electronic conductivity, the number of intercalation sites, and stability during extended cycling are also crucial for building high-performance energy storage devices. While individual 2D materials, such as graphene, show some of the required properties, none of them can offer all properties needed to maximize energy density, power density, and cycle life. Here we argue that stacking different 2D materials into heterostructured architectures opens an opportunity to construct electrodes that would combine the advantages of the individual building blocks while eliminating the associated shortcomings. We discuss characteristics of common 2D materials and provide examples of 2D heterostructured electrodes that showed new phenomena leading to superior electrochemical performance. As a result, we also consider electrode fabrication approaches and finally outline future steps to create 2D heterostructured electrodes that could greatly expand current energy storage technologies.

  3. Two-dimensional fourier transform spectrometer

    Science.gov (United States)

    DeFlores, Lauren; Tokmakoff, Andrei

    2013-09-03

    The present invention relates to a system and methods for acquiring two-dimensional Fourier transform (2D FT) spectra. Overlap of a collinear pulse pair and probe induce a molecular response which is collected by spectral dispersion of the signal modulated probe beam. Simultaneous collection of the molecular response, pulse timing and characteristics permit real time phasing and rapid acquisition of spectra. Full spectra are acquired as a function of pulse pair timings and numerically transformed to achieve the full frequency-frequency spectrum. This method demonstrates the ability to acquire information on molecular dynamics, couplings and structure in a simple apparatus. Multi-dimensional methods can be used for diagnostic and analytical measurements in the biological, biomedical, and chemical fields.

  4. Equivalency of two-dimensional algebras

    International Nuclear Information System (INIS)

    Santos, Gildemar Carneiro dos; Pomponet Filho, Balbino Jose S.

    2011-01-01

    Full text: Let us consider a vector z = xi + yj over the field of real numbers, whose basis (i,j) satisfy a given algebra. Any property of this algebra will be reflected in any function of z, so we can state that the knowledge of the properties of an algebra leads to more general conclusions than the knowledge of the properties of a function. However structural properties of an algebra do not change when this algebra suffers a linear transformation, though the structural constants defining this algebra do change. We say that two algebras are equivalent to each other whenever they are related by a linear transformation. In this case, we have found that some relations between the structural constants are sufficient to recognize whether or not an algebra is equivalent to another. In spite that the basis transform linearly, the structural constants change like a third order tensor, but some combinations of these tensors result in a linear transformation, allowing to write the entries of the transformation matrix as function of the structural constants. Eventually, a systematic way to find the transformation matrix between these equivalent algebras is obtained. In this sense, we have performed the thorough classification of associative commutative two-dimensional algebras, and find that even non-division algebra may be helpful in solving non-linear dynamic systems. The Mandelbrot set was used to have a pictorial view of each algebra, since equivalent algebras result in the same pattern. Presently we have succeeded in classifying some non-associative two-dimensional algebras, a task more difficult than for associative one. (author)

  5. Germacrane sesquiterpenes isolated from the rhizome of Curcuma xanthorrhiza Roxb. inhibit UVB-induced upregulation of MMP-1, -2, and -3 expression in human keratinocytes.

    Science.gov (United States)

    Park, Ji-Hae; Mohamed, Mohamed Antar Aziz; Jung, Ye-Jin; Shrestha, Sabina; Lee, Tae Hoon; Lee, Chang-Ho; Han, Daeseok; Kim, Jiyoung; Baek, Nam-In

    2015-10-01

    Four sesquiterpenes were isolated from the rhizome of Curcuma xanthorrhiza Roxb.: furanodiene (1), germacrone (2), furanodienone (3), and 13-hydroxygermacrone (4). Importantly, this was the first time compounds 1 and 4 were isolated from this plant. The chemical structures of these compounds were determined using 1D- and 2D-nuclear magnetic resonance, infrared spectroscopy, and electron ionization mass spectrometry analyses. Among the isolated compounds, compounds 2 and 4 inhibited UVB-induced upregulation of the mRNA and protein expression levels of MMP-1, MMP-2, and MMP-3 in human keratinocytes (HaCaT). Moreover, this upregulation occurred in a dose-dependent manner over the range of 1-10 μM for each compound.

  6. Effect of Gloriosa superba and Catharanthus roseus Extracts on IFN-γ-Induced Keratin 17 Expression in HaCaT Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Nattaporn Pattarachotanant

    2014-01-01

    Full Text Available Gloriosa superba and Catharanthus roseus are useful in traditional medicine for treatment of various skin diseases and cancer. However, their molecular effect on psoriasis has not been investigated. In this study, the effect of ethanol extracts derived from G. superba leaves and C. roseus stems on the expression of psoriatic marker, keratin 17 (K17, was investigated in human keratinocytes using biochemical and molecular experimental approaches. Both extracts could reduce the expression of K17 in a dose-dependent manner through JAK/STAT pathway as demonstrated by an observation of reduced phosphorylation of STAT3 (p-STAT3. The inhibitory activity of G. superba extract was more potent than that of C. roseus. The Pearson's correlation between K17 and cell viability was shown positive. Taken together, the extracts of G. superba and C. roseus may be developed as alternative therapies for psoriasis.

  7. Citric acid induces cell-cycle arrest and apoptosis of human immortalized keratinocyte cell line (HaCaT) via caspase- and mitochondrial-dependent signaling pathways.

    Science.gov (United States)

    Ying, Tsung-Ho; Chen, Chia-Wei; Hsiao, Yu-Ping; Hung, Sung-Jen; Chung, Jing-Gung; Yang, Jen-Hung

    2013-10-01

    Citric acid is an alpha-hydroxyacid (AHA) widely used in cosmetic dermatology and skincare products. However, there is concern regarding its safety for the skin. In this study, we investigated the cytotoxic effects of citric acid on the human keratinocyte cell line HaCaT. HaCaT cells were treated with citric acid at 2.5-12.5 mM for different time periods. Cell-cycle arrest and apoptosis were investigated by 4,6-diamidino-2-phenylindole dihydrochloride (DAPI) staining, flow cytometry, western blot and confocal microscopy. Citric acid not only inhibited proliferation of HaCaT cells in a dose-dependent manner, but also induced apoptosis and cell cycle-arrest at the G2/M phase (before 24 h) and S phase (after 24 h). Citric acid increased the level of Bcl-2-associated X protein (BAX) and reduced the levels of B-cell lymphoma-2 (BCL-2), B-cell lymphoma-extra large (BCL-XL) and activated caspase-9 and caspase-3, which subsequently induced apoptosis via caspase-dependent and caspase-independent pathways. Citric acid also activated death receptors and increased the levels of caspase-8, activated BH3 interacting-domain death agonist (BID) protein, Apoptosis-inducing factor (AIF), and Endonuclease G (EndoG). Therefore, citric acid induces apoptosis through the mitochondrial pathway in the human keratinocyte cell line HaCaT. The study results suggest that citric acid is cytotoxic to HaCaT cells via induction of apoptosis and cell-cycle arrest in vitro.

  8. γ-Tocotrienol prevents 5-FU-induced reactive oxygen species production in human oral keratinocytes through the stabilization of 5-FU-induced activation of Nrf2.

    Science.gov (United States)

    Takano, Hideyuki; Momota, Yukihiro; Kani, Kouichi; Aota, Keiko; Yamamura, Yoshiko; Yamanoi, Tomoko; Azuma, Masayuki

    2015-04-01

    Chemotherapy-induced oral mucositis is a common adverse event in patients with oral squamous cell carcinoma, and is initiated through a variety of mechanisms, including the generation of reactive oxygen species (ROS). In this study, we examined the preventive effect of γ-tocotrienol on the 5-FU-induced ROS production in human oral keratinocytes (RT7). We treated RT7 cells with 5-FU and γ-tocotrienol at concentrations of 10 µg/ml and 10 nM, respectively. When cells were treated with 5-FU alone, significant growth inhibition was observed as compared to untreated cells. This inhibition was, in part, due to the ROS gene-rated by 5-FU treatment, because N-acetyl cysteine (NAC), a ROS scavenger, significantly ameliorated the growth of RT7 cells. γ-tocotrienol showed no cytotoxic effect on the growth of RT7 cells. Simultaneous treatment of cells with these agents resulted in the significant recovery of cell growth, owing to the suppression of ROS generation by γ-tocotrienol. Whereas 5-FU stimulated the expression of NF-E2-related factor 2 (Nrf2) protein in the nucleus up to 12 h after treatment of RT7 cells, γ-tocotrienol had no obvious effect on the expression of nuclear Nrf2 protein. Of note, the combined treatment with both agents stabilized the 5-FU-induced nuclear Nrf2 protein expression until 24 h after treatment. In addition, expression of Nrf2-dependent antioxidant genes, such as heme oxygenase-1 (HO-1) and quinone oxidoreductase-1 (NQO-1), was significantly augmented by treatment of cells with both agents. These findings suggest that γ-tocotrienol could prevent 5-FU-induced ROS generation by stabilizing Nrf2 activation, thereby leading to ROS detoxification and cell survival in human oral keratinocytes.

  9. Piperine attenuates UV-R induced cell damage in human keratinocytes via NF-kB, Bax/Bcl-2 pathway: An application for photoprotection.

    Science.gov (United States)

    Verma, Ankit; Kushwaha, Hari N; Srivastava, Ajeet K; Srivastava, Saumya; Jamal, Naseem; Srivastava, Kriti; Ray, Ratan Singh

    2017-07-01

    Chronic ultraviolet radiation (UV-R) exposure causes skin disorders like erythema, edema, hyperpigmentation, photoaging and photocarcinogenesis. Recent research trends of researchers have focused more attention on the identification and use of photo stable natural agents with photoprotective properties. Piperine (PIP), as a plant alkaloid, is an important constituent present in black pepper (Piper nigrum), used widely in ayurvedic and other traditional medicines and has broad pharmacological properties. The study was planned to photoprotective efficacy of PIP in human keratinocyte (HaCaT) cell line. We have assessed the UV-R induced activation of transcription factor NF-κB in coordination with cell death modulators (Bax/Bcl-2 and p21). The LC-MS/MS analysis revealed that PIP was photostable under UV-A/UV-B exposure. PIP (10μg/ml) attenuates the UV-R (A and B) induced phototoxicity of keratinocyte cell line through the restoration of cell viability, inhibition of ROS, and malondialdehyde generation. Further, PIP inhibited UV-R mediated DNA damage, prevented micronuclei formation, and reduced sub-G1 phase in cell cycle, which supported against photogenotoxicity. This study revealed that PIP pretreatment strongly suppressed UV-R induced photodamages. Molecular docking studies suggest that PIP binds at the active site of NF-κB, and thus, preventing its translocation to nucleus. In addition, transcriptional and translational analysis advocate the increased expression of NF-κB and concomitant decrease in IkB-α expression under UV-R exposed cells, favouring the apoptosis via Bax/Bcl-2 and p21 pathways. However, PIP induced expression of IkB-α suppress the NF-κB activity which resulted in suppression of apoptotic marker genes and proteins that involved in photoprotection. Therefore, we suggest the applicability of photostable PIP as photoprotective agent for human use. Copyright © 2017. Published by Elsevier B.V.

  10. Chafuroside B, an Oolong tea polyphenol, ameliorates UVB-induced DNA damage and generation of photo-immunosuppression related mediators in human keratinocytes.

    Directory of Open Access Journals (Sweden)

    Tatsuya Hasegawa

    Full Text Available Chafuroside B was recently isolated as a new polyphenolic constituent of oolong tea leaves. However, the effects of chafuroside B on skin function have not been examined. In this study, we investigated the protective effects of chafuroside B against UVB-induced DNA damage, apoptosis and generation of photo-immunosuppression related mediators in cultured normal human epidermal keratinocytes (NHEK. Chafuroside B at 1 µM attenuated both UVB-induced apoptosis, evaluated in terms of caspase-3/7 activity, and UVB-induced DNA damage, evaluated in terms of formation of cyclobutane pyrimidine dimers (CPD, in NHEK exposed to UVB (20 mJ/cm2. In addition, chafuroside B at 0.3 or 1 µM suppressed the UVB-induced production of interleukin (IL-10, tumor necrosis factor (TNF-α, and prostaglandin E2 (PGE2, as determined by ELISA, and conversely enhanced IL-12 mRNA expression and production, as measured by RT-PCR and ELISA. Further, chafuroside B at 1 µM also suppressed UVB-induced expression of receptor activator of nuclear factor κB ligand (RANKL mRNA. These results indicate that chafuroside B promotes repair of UVB-induced DNA damage and ameliorates the generation of IL-10, TNF-α, PGE2, and RANKL, all of which are UVB-induced immunosuppression related mediators. These effects of chafuroside B may be mediated at least in part through induction of IL-12 synthesis in human keratinocytes. Because chafuroside B might have practical value as a photoprotective agent, a further study of the in vivo effects of chafuroside B seems warranted.

  11. Electronic Transport in Two-Dimensional Materials

    Science.gov (United States)

    Sangwan, Vinod K.; Hersam, Mark C.

    2018-04-01

    Two-dimensional (2D) materials have captured the attention of the scientific community due to the wide range of unique properties at nanometer-scale thicknesses. While significant exploratory research in 2D materials has been achieved, the understanding of 2D electronic transport and carrier dynamics remains in a nascent stage. Furthermore, because prior review articles have provided general overviews of 2D materials or specifically focused on charge transport in graphene, here we instead highlight charge transport mechanisms in post-graphene 2D materials, with particular emphasis on transition metal dichalcogenides and black phosphorus. For these systems, we delineate the intricacies of electronic transport, including band structure control with thickness and external fields, valley polarization, scattering mechanisms, electrical contacts, and doping. In addition, electronic interactions between 2D materials are considered in the form of van der Waals heterojunctions and composite films. This review concludes with a perspective on the most promising future directions in this fast-evolving field.

  12. Stress distribution in two-dimensional silos

    Science.gov (United States)

    Blanco-Rodríguez, Rodolfo; Pérez-Ángel, Gabriel

    2018-01-01

    Simulations of a polydispersed two-dimensional silo were performed using molecular dynamics, with different numbers of grains reaching up to 64 000, verifying numerically the model derived by Janssen and also the main assumption that the walls carry part of the weight due to the static friction between grains with themselves and those with the silo's walls. We vary the friction coefficient, the radii dispersity, the silo width, and the size of grains. We find that the Janssen's model becomes less relevant as the the silo width increases since the behavior of the stresses becomes more hydrostatic. Likewise, we get the normal and tangential stress distribution on the walls evidencing the existence of points of maximum stress. We also obtained the stress matrix with which we observe zones of concentration of load, located always at a height around two thirds of the granular columns. Finally, we observe that the size of the grains affects the distribution of stresses, increasing the weight on the bottom and reducing the normal stress on the walls, as the grains are made smaller (for the same total mass of the granulate), giving again a more hydrostatic and therefore less Janssen-type behavior for the weight of the column.

  13. Asymptotics for Two-dimensional Atoms

    DEFF Research Database (Denmark)

    Nam, Phan Thanh; Portmann, Fabian; Solovej, Jan Philip

    2012-01-01

    We prove that the ground state energy of an atom confined to two dimensions with an infinitely heavy nucleus of charge $Z>0$ and $N$ quantum electrons of charge -1 is $E(N,Z)=-{1/2}Z^2\\ln Z+(E^{\\TF}(\\lambda)+{1/2}c^{\\rm H})Z^2+o(Z^2)$ when $Z\\to \\infty$ and $N/Z\\to \\lambda$, where $E^{\\TF}(\\lambd......We prove that the ground state energy of an atom confined to two dimensions with an infinitely heavy nucleus of charge $Z>0$ and $N$ quantum electrons of charge -1 is $E(N,Z)=-{1/2}Z^2\\ln Z+(E^{\\TF}(\\lambda)+{1/2}c^{\\rm H})Z^2+o(Z^2)$ when $Z\\to \\infty$ and $N/Z\\to \\lambda$, where $E......^{\\TF}(\\lambda)$ is given by a Thomas-Fermi type variational problem and $c^{\\rm H}\\approx -2.2339$ is an explicit constant. We also show that the radius of a two-dimensional neutral atom is unbounded when $Z\\to \\infty$, which is contrary to the expected behavior of three-dimensional atoms....

  14. Seismic isolation of two dimensional periodic foundations

    International Nuclear Information System (INIS)

    Yan, Y.; Mo, Y. L.; Laskar, A.; Cheng, Z.; Shi, Z.; Menq, F.; Tang, Y.

    2014-01-01

    Phononic crystal is now used to control acoustic waves. When the crystal goes to a larger scale, it is called periodic structure. The band gaps of the periodic structure can be reduced to range from 0.5 Hz to 50 Hz. Therefore, the periodic structure has potential applications in seismic wave reflection. In civil engineering, the periodic structure can be served as the foundation of upper structure. This type of foundation consisting of periodic structure is called periodic foundation. When the frequency of seismic waves falls into the band gaps of the periodic foundation, the seismic wave can be blocked. Field experiments of a scaled two dimensional (2D) periodic foundation with an upper structure were conducted to verify the band gap effects. Test results showed the 2D periodic foundation can effectively reduce the response of the upper structure for excitations with frequencies within the frequency band gaps. When the experimental and the finite element analysis results are compared, they agree well with each other, indicating that 2D periodic foundation is a feasible way of reducing seismic vibrations.

  15. Two-dimensional transport of tokamak plasmas

    International Nuclear Information System (INIS)

    Hirshman, S.P.; Jardin, S.C.

    1979-01-01

    A reduced set of two-fluid transport equations is obtained from the conservation equations describing the time evolution of the differential particle number, entropy, and magnetic fluxes in an axisymmetric toroidal plasma with nested magnetic surfaces. Expanding in the small ratio of perpendicular to parallel mobilities and thermal conductivities yields as solubility constraints one-dimensional equations for the surface-averaged thermodynamic variables and magnetic fluxes. Since Ohm's law E +u x B =R', where R' accounts for any nonideal effects, only determines the particle flow relative to the diffusing magnetic surfaces, it is necessary to solve a single two-dimensional generalized differential equation, (partial/partialt) delpsi. (delp - J x B) =0, to find the absolute velocity of a magnetic surface enclosing a fixed toroidal flux. This equation is linear but nonstandard in that it involves flux surface averages of the unknown velocity. Specification of R' and the cross-field ion and electron heat fluxes provides a closed system of equations. A time-dependent coordinate transformation is used to describe the diffusion of plasma quantities through magnetic surfaces of changing shape

  16. Two-dimensional topological photonic systems

    Science.gov (United States)

    Sun, Xiao-Chen; He, Cheng; Liu, Xiao-Ping; Lu, Ming-Hui; Zhu, Shi-Ning; Chen, Yan-Feng

    2017-09-01

    The topological phase of matter, originally proposed and first demonstrated in fermionic electronic systems, has drawn considerable research attention in the past decades due to its robust transport of edge states and its potential with respect to future quantum information, communication, and computation. Recently, searching for such a unique material phase in bosonic systems has become a hot research topic worldwide. So far, many bosonic topological models and methods for realizing them have been discovered in photonic systems, acoustic systems, mechanical systems, etc. These discoveries have certainly yielded vast opportunities in designing material phases and related properties in the topological domain. In this review, we first focus on some of the representative photonic topological models and employ the underlying Dirac model to analyze the edge states and geometric phase. On the basis of these models, three common types of two-dimensional topological photonic systems are discussed: 1) photonic quantum Hall effect with broken time-reversal symmetry; 2) photonic topological insulator and the associated pseudo-time-reversal symmetry-protected mechanism; 3) time/space periodically modulated photonic Floquet topological insulator. Finally, we provide a summary and extension of this emerging field, including a brief introduction to the Weyl point in three-dimensional systems.

  17. Turbulent equipartitions in two dimensional drift convection

    International Nuclear Information System (INIS)

    Isichenko, M.B.; Yankov, V.V.

    1995-01-01

    Unlike the thermodynamic equipartition of energy in conservative systems, turbulent equipartitions (TEP) describe strongly non-equilibrium systems such as turbulent plasmas. In turbulent systems, energy is no longer a good invariant, but one can utilize the conservation of other quantities, such as adiabatic invariants, frozen-in magnetic flux, entropy, or combination thereof, in order to derive new, turbulent quasi-equilibria. These TEP equilibria assume various forms, but in general they sustain spatially inhomogeneous distributions of the usual thermodynamic quantities such as density or temperature. This mechanism explains the effects of particle and energy pinch in tokamaks. The analysis of the relaxed states caused by turbulent mixing is based on the existence of Lagrangian invariants (quantities constant along fluid-particle or other orbits). A turbulent equipartition corresponds to the spatially uniform distribution of relevant Lagrangian invariants. The existence of such turbulent equilibria is demonstrated in the simple model of two dimensional electrostatically turbulent plasma in an inhomogeneous magnetic field. The turbulence is prescribed, and the turbulent transport is assumed to be much stronger than the classical collisional transport. The simplicity of the model makes it possible to derive the equations describing the relaxation to the TEP state in several limits

  18. Radiation effects on two-dimensional materials

    Energy Technology Data Exchange (ETDEWEB)

    Walker, R.C. II; Robinson, J.A. [Department of Materials Science, Penn State, University Park, PA (United States); Center for Two-Dimensional Layered Materials, Penn State, University Park, PA (United States); Shi, T. [Department of Mechanical and Nuclear Engineering, Penn State, University Park, PA (United States); Department of Nuclear Engineering and Radiological Sciences, University of Michigan, Ann Arbor, MI (United States); Silva, E.C. [GlobalFoundries, Malta, NY (United States); Jovanovic, I. [Department of Nuclear Engineering and Radiological Sciences, University of Michigan, Ann Arbor, MI (United States)

    2016-12-15

    The effects of electromagnetic and particle irradiation on two-dimensional materials (2DMs) are discussed in this review. Radiation creates defects that impact the structure and electronic performance of materials. Determining the impact of these defects is important for developing 2DM-based devices for use in high-radiation environments, such as space or nuclear reactors. As such, most experimental studies have been focused on determining total ionizing dose damage to 2DMs and devices. Total dose experiments using X-rays, gamma rays, electrons, protons, and heavy ions are summarized in this review. We briefly discuss the possibility of investigating single event effects in 2DMs based on initial ion beam irradiation experiments and the development of 2DM-based integrated circuits. Additionally, beneficial uses of irradiation such as ion implantation to dope materials or electron-beam and helium-beam etching to shape materials have begun to be used on 2DMs and are reviewed as well. For non-ionizing radiation, such as low-energy photons, we review the literature on 2DM-based photo-detection from terahertz to UV. The majority of photo-detecting devices operate in the visible and UV range, and for this reason they are the focus of this review. However, we review the progress in developing 2DMs for detecting infrared and terahertz radiation. (copyright 2016 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  19. Buckled two-dimensional Xene sheets.

    Science.gov (United States)

    Molle, Alessandro; Goldberger, Joshua; Houssa, Michel; Xu, Yong; Zhang, Shou-Cheng; Akinwande, Deji

    2017-02-01

    Silicene, germanene and stanene are part of a monoelemental class of two-dimensional (2D) crystals termed 2D-Xenes (X = Si, Ge, Sn and so on) which, together with their ligand-functionalized derivatives referred to as Xanes, are comprised of group IVA atoms arranged in a honeycomb lattice - similar to graphene but with varying degrees of buckling. Their electronic structure ranges from trivial insulators, to semiconductors with tunable gaps, to semi-metallic, depending on the substrate, chemical functionalization and strain. More than a dozen different topological insulator states are predicted to emerge, including the quantum spin Hall state at room temperature, which, if realized, would enable new classes of nanoelectronic and spintronic devices, such as the topological field-effect transistor. The electronic structure can be tuned, for example, by changing the group IVA element, the degree of spin-orbit coupling, the functionalization chemistry or the substrate, making the 2D-Xene systems promising multifunctional 2D materials for nanotechnology. This Perspective highlights the current state of the art and future opportunities in the manipulation and stability of these materials, their functions and applications, and novel device concepts.

  20. The key role of miR-21-regulated SOD2 in the medium-mediated bystander responses in human fibroblasts induced by α-irradiated keratinocytes

    International Nuclear Information System (INIS)

    Tian, Wenqian; Yin, Xiaoming; Wang, Longxiao; Wang, Jingdong; Zhu, Wei; Cao, Jianping; Yang, Hongying

    2015-01-01

    Highlights: • After co-culture with α-irradiated HaCaT cells, WS1 cells displayed oxidative stress and DNA damage. • Increased miR-21 expression in bystander cells was critical to the occurrence of RIBEs. • SOD2 of bystander cells played an important role in bystander responses. • miR-21 mediated bystander effects through its regulation on SOD2. - Abstract: Radiation-induced bystander effect (RIBE) is well accepted in the radiation research field by now, but the underlying molecular mechanisms for better understanding this phenomenon caused by intercellular communication and intracellular signal transduction are still incomplete. Although our previous study has demonstrated an important role of miR-21 of unirradiated bystander cells in RIBEs, the direct evidence for the hypothesis that RIBE is epigenetically regulated is still limited and how miR-21 mediates RIBEs is unknown. Reactive oxygen species (ROS) have been demonstrated to be involved in RIBEs, however, the roles of anti-oxidative stress system of cells in RIBEs are unclear. Using transwell insert co-culture system, we investigated medium-mediated bystander responses in WS1 human fibroblasts after co-culture with HaCaT keratinocytes traversed by α-particles. Results showed that the ROS levels in unirradiated bystander WS1 cells were significantly elevated after 30 min of co-culture, and 53BP1 foci, a surrogate marker of DNA damage, were obviously induced after 3 h of co-culture. This indicates the occurrence of oxidative stress and DNA damage in bystander WS1 cells after co-culture with irradiated keratinocytes. Furthermore, the expression of miR-21 was increased in bystander WS1 cells, downregulation of miR-21 eliminated the bystander responses, overexpression of miR-21 alone could induce bystander-like oxidative stress and DNA damage in WS1 cells. These data indicate an important mediating role of miR-21 in RIBEs. In addition, MnSOD or SOD2 in WS1 cells was involved in the bystander effects

  1. The key role of miR-21-regulated SOD2 in the medium-mediated bystander responses in human fibroblasts induced by α-irradiated keratinocytes.

    Science.gov (United States)

    Tian, Wenqian; Yin, Xiaoming; Wang, Longxiao; Wang, Jingdong; Zhu, Wei; Cao, Jianping; Yang, Hongying

    2015-10-01

    Radiation-induced bystander effect (RIBE) is well accepted in the radiation research field by now, but the underlying molecular mechanisms for better understanding this phenomenon caused by intercellular communication and intracellular signal transduction are still incomplete. Although our previous study has demonstrated an important role of miR-21 of unirradiated bystander cells in RIBEs, the direct evidence for the hypothesis that RIBE is epigenetically regulated is still limited and how miR-21 mediates RIBEs is unknown. Reactive oxygen species (ROS) have been demonstrated to be involved in RIBEs, however, the roles of anti-oxidative stress system of cells in RIBEs are unclear. Using transwell insert co-culture system, we investigated medium-mediated bystander responses in WS1 human fibroblasts after co-culture with HaCaT keratinocytes traversed by α-particles. Results showed that the ROS levels in unirradiated bystander WS1 cells were significantly elevated after 30min of co-culture, and 53BP1 foci, a surrogate marker of DNA damage, were obviously induced after 3h of co-culture. This indicates the occurrence of oxidative stress and DNA damage in bystander WS1 cells after co-culture with irradiated keratinocytes. Furthermore, the expression of miR-21 was increased in bystander WS1 cells, downregulation of miR-21 eliminated the bystander responses, overexpression of miR-21 alone could induce bystander-like oxidative stress and DNA damage in WS1 cells. These data indicate an important mediating role of miR-21 in RIBEs. In addition, MnSOD or SOD2 in WS1 cells was involved in the bystander effects, overexpression of SOD2 abolished the bystander oxidative stress and DNA damage, indicating that SOD2 was critical to the induction of RIBEs. Moreover, we found that miR-21 regulated SOD2, suggesting that miR-21 might mediate bystander responses through its regulation on SOD2. In conclusion, this study revealed a profound role of miR-21-regulated SOD2 of unirradiated WS1

  2. The key role of miR-21-regulated SOD2 in the medium-mediated bystander responses in human fibroblasts induced by α-irradiated keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Tian, Wenqian; Yin, Xiaoming; Wang, Longxiao; Wang, Jingdong; Zhu, Wei; Cao, Jianping [School of Radiation Medicine and Protection, Medical College of Soochow University/Collaborative Innovation Center of Radiation Medicine of Jiangsu Higher Education Institutions, 199 Renai Road, Suzhou Industrial Park, Suzhou, Jiangsu Province 215123 (China); Yang, Hongying, E-mail: yanghongying@suda.edu.cn [School of Radiation Medicine and Protection, Medical College of Soochow University/Collaborative Innovation Center of Radiation Medicine of Jiangsu Higher Education Institutions, 199 Renai Road, Suzhou Industrial Park, Suzhou, Jiangsu Province 215123 (China); Institute of Radiotherapy & Oncology, Soochow University (China)

    2015-10-15

    Highlights: • After co-culture with α-irradiated HaCaT cells, WS1 cells displayed oxidative stress and DNA damage. • Increased miR-21 expression in bystander cells was critical to the occurrence of RIBEs. • SOD2 of bystander cells played an important role in bystander responses. • miR-21 mediated bystander effects through its regulation on SOD2. - Abstract: Radiation-induced bystander effect (RIBE) is well accepted in the radiation research field by now, but the underlying molecular mechanisms for better understanding this phenomenon caused by intercellular communication and intracellular signal transduction are still incomplete. Although our previous study has demonstrated an important role of miR-21 of unirradiated bystander cells in RIBEs, the direct evidence for the hypothesis that RIBE is epigenetically regulated is still limited and how miR-21 mediates RIBEs is unknown. Reactive oxygen species (ROS) have been demonstrated to be involved in RIBEs, however, the roles of anti-oxidative stress system of cells in RIBEs are unclear. Using transwell insert co-culture system, we investigated medium-mediated bystander responses in WS1 human fibroblasts after co-culture with HaCaT keratinocytes traversed by α-particles. Results showed that the ROS levels in unirradiated bystander WS1 cells were significantly elevated after 30 min of co-culture, and 53BP1 foci, a surrogate marker of DNA damage, were obviously induced after 3 h of co-culture. This indicates the occurrence of oxidative stress and DNA damage in bystander WS1 cells after co-culture with irradiated keratinocytes. Furthermore, the expression of miR-21 was increased in bystander WS1 cells, downregulation of miR-21 eliminated the bystander responses, overexpression of miR-21 alone could induce bystander-like oxidative stress and DNA damage in WS1 cells. These data indicate an important mediating role of miR-21 in RIBEs. In addition, MnSOD or SOD2 in WS1 cells was involved in the bystander effects

  3. Two-dimensional vibrational-electronic spectroscopy

    Science.gov (United States)

    Courtney, Trevor L.; Fox, Zachary W.; Slenkamp, Karla M.; Khalil, Munira

    2015-10-01

    Two-dimensional vibrational-electronic (2D VE) spectroscopy is a femtosecond Fourier transform (FT) third-order nonlinear technique that creates a link between existing 2D FT spectroscopies in the vibrational and electronic regions of the spectrum. 2D VE spectroscopy enables a direct measurement of infrared (IR) and electronic dipole moment cross terms by utilizing mid-IR pump and optical probe fields that are resonant with vibrational and electronic transitions, respectively, in a sample of interest. We detail this newly developed 2D VE spectroscopy experiment and outline the information contained in a 2D VE spectrum. We then use this technique and its single-pump counterpart (1D VE) to probe the vibrational-electronic couplings between high frequency cyanide stretching vibrations (νCN) and either a ligand-to-metal charge transfer transition ([FeIII(CN)6]3- dissolved in formamide) or a metal-to-metal charge transfer (MMCT) transition ([(CN)5FeIICNRuIII(NH3)5]- dissolved in formamide). The 2D VE spectra of both molecules reveal peaks resulting from coupled high- and low-frequency vibrational modes to the charge transfer transition. The time-evolving amplitudes and positions of the peaks in the 2D VE spectra report on coherent and incoherent vibrational energy transfer dynamics among the coupled vibrational modes and the charge transfer transition. The selectivity of 2D VE spectroscopy to vibronic processes is evidenced from the selective coupling of specific νCN modes to the MMCT transition in the mixed valence complex. The lineshapes in 2D VE spectra report on the correlation of the frequency fluctuations between the coupled vibrational and electronic frequencies in the mixed valence complex which has a time scale of 1 ps. The details and results of this study confirm the versatility of 2D VE spectroscopy and its applicability to probe how vibrations modulate charge and energy transfer in a wide range of complex molecular, material, and biological systems.

  4. Two-dimensional silica opens new perspectives

    Science.gov (United States)

    Büchner, Christin; Heyde, Markus

    2017-12-01

    In recent years, silica films have emerged as a novel class of two-dimensional (2D) materials. Several groups succeeded in epitaxial growth of ultrathin SiO2 layers using different growth methods and various substrates. The structures consist of tetrahedral [SiO4] building blocks in two mirror symmetrical planes, connected via oxygen bridges. This arrangement is called a silica bilayer as it is the thinnest 2D arrangement with the stoichiometry SiO2 known today. With all bonds saturated within the nano-sheet, the interaction with the substrate is based on van der Waals forces. Complex ring networks are observed, including hexagonal honeycomb lattices, point defects and domain boundaries, as well as amorphous domains. The network structures are highly tuneable through variation of the substrate, deposition parameters, cooling procedure, introducing dopants or intercalating small species. The amorphous networks and structural defects were resolved with atomic resolution microscopy and modeled with density functional theory and molecular dynamics. Such data contribute to our understanding of the formation and characteristic motifs of glassy systems. Growth studies and doping with other chemical elements reveal ways to tune ring sizes and defects as well as chemical reactivities. The pristine films have been utilized as molecular sieves and for confining molecules in nanocatalysis. Post growth hydroxylation can be used to tweak the reactivity as well. The electronic properties of silica bilayers are favourable for using silica as insulators in 2D material stacks. Due to the fully saturated atomic structure, the bilayer interacts weakly with the substrate and can be described as quasi-freestanding. Recently, a mm-scale film transfer under structure retention has been demonstrated. The chemical and mechanical stability of silica bilayers is very promising for technological applications in 2D heterostacks. Due to the impact of this bilayer system for glass science

  5. Two-dimensional vibrational-electronic spectroscopy

    Energy Technology Data Exchange (ETDEWEB)

    Courtney, Trevor L.; Fox, Zachary W.; Slenkamp, Karla M.; Khalil, Munira, E-mail: mkhalil@uw.edu [Department of Chemistry, University of Washington, Box 351700, Seattle, Washington 98195 (United States)

    2015-10-21

    Two-dimensional vibrational-electronic (2D VE) spectroscopy is a femtosecond Fourier transform (FT) third-order nonlinear technique that creates a link between existing 2D FT spectroscopies in the vibrational and electronic regions of the spectrum. 2D VE spectroscopy enables a direct measurement of infrared (IR) and electronic dipole moment cross terms by utilizing mid-IR pump and optical probe fields that are resonant with vibrational and electronic transitions, respectively, in a sample of interest. We detail this newly developed 2D VE spectroscopy experiment and outline the information contained in a 2D VE spectrum. We then use this technique and its single-pump counterpart (1D VE) to probe the vibrational-electronic couplings between high frequency cyanide stretching vibrations (ν{sub CN}) and either a ligand-to-metal charge transfer transition ([Fe{sup III}(CN){sub 6}]{sup 3−} dissolved in formamide) or a metal-to-metal charge transfer (MMCT) transition ([(CN){sub 5}Fe{sup II}CNRu{sup III}(NH{sub 3}){sub 5}]{sup −} dissolved in formamide). The 2D VE spectra of both molecules reveal peaks resulting from coupled high- and low-frequency vibrational modes to the charge transfer transition. The time-evolving amplitudes and positions of the peaks in the 2D VE spectra report on coherent and incoherent vibrational energy transfer dynamics among the coupled vibrational modes and the charge transfer transition. The selectivity of 2D VE spectroscopy to vibronic processes is evidenced from the selective coupling of specific ν{sub CN} modes to the MMCT transition in the mixed valence complex. The lineshapes in 2D VE spectra report on the correlation of the frequency fluctuations between the coupled vibrational and electronic frequencies in the mixed valence complex which has a time scale of 1 ps. The details and results of this study confirm the versatility of 2D VE spectroscopy and its applicability to probe how vibrations modulate charge and energy transfer in a

  6. The transcriptional regulator gene E2 of the Human Papillomavirus (HPV) 16 influences the radiosensitivity of cervical keratinocytes

    International Nuclear Information System (INIS)

    Lindel, Katja; Rieken, Stefan; Daffinger, Sigrid; Weber, Klaus J; Villiers, Ethel-Michele de; Debus, Jürgen

    2012-01-01

    Clinical studies have demonstrated that HPV induced tumors constitute a specific subclass of cancer with a better response to radiation treatment. The purpose of this study was to investigate meaning of viral E2-gene for radiosensitivity. W12 cells contain episomal HPV 16 genomes, whereas S12 cells, which derive from the W12 line, contain HPV DNA as integrated copies. Clonogenic survival was analyzed using 96-well in vitro test. Using flow cytometry cell cycle analyses were performed. Expression of pRb and p53 were analyzed using intracellular staining. W12 cells (intact E2 gene) showed a lower survival fraction than S12 cells. W12 cells developed a G2/M block 24 h after irradiation with 2 Gy whereas S12 showed no G2/M bloc. After irradiation S12 cells developed polyploidy and pRb-positive cells decreased. W12 cells showed no change of pRb-positive cells. Depending on E2 gene status differences in cell cycle regulation might cause radioresistance. The E2/E7/pRb pathway seems to influence HPV-induced radiosensitivity. Our experiments demonstrated an effect of HPV on radiosensitivity of cervical keratinocytes via viral transcription regulator E2 pathway

  7. Effects of Wannachawee Recipe with Antipsoriatic Activity on Suppressing Inflammatory Cytokine Production in HaCaT Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Mingkwan Na Takuathung

    2017-01-01

    Full Text Available Psoriasis is a chronic inflammatory and immune-mediated skin disease. The pathogenesis involves T cells activation via the IL-23/Th17 axis. Conventional treatments of psoriasis have adverse events influencing patients’ adherence. Wannachawee Recipe (WCR has been effectively used as Thai folk remedy for psoriasis patients; however, preclinical evidence defining how WCR works is still lacking. This study defined mechanisms for its antiproliferation and anti-inflammatory effects in HaCaT cells. The cytotoxicity and antiproliferation results from SRB and CCK-8 assays showed that WCR inhibited the growth and viability of HaCaT cells in a concentration-dependent manner. The distribution of cell cycle phases determined by flow cytometry showed that WCR did not interrupt cell cycle progression. Interestingly, RT-qPCR revealed that WCR significantly decreased the mRNA expression of IL-1β, IL-6, IL-8, IL-17A, IL-22, IL-23, and TNF-α but induced IL-10 expression in TNF-α- and IFN-γ-induced HaCaT cells. At the protein level determined by ELISA, WCR significantly reduced the secretion of IL-17A, IL-22, and IL-23. The WCR at low concentrations was proved to possess anti-inflammatory effect without cytotoxicity and it did not interfere with cell cycle of keratinocytes. This is the first study to provide convincing evidence that WCR is a potential candidate for development of effective psoriasis therapies.

  8. Analysis of volatile organic compounds released from the decay of surrogate human models simulating victims of collapsed buildings by thermal desorption-comprehensive two-dimensional gas chromatography-time of flight mass spectrometry.

    Science.gov (United States)

    Agapiou, A; Zorba, E; Mikedi, K; McGregor, L; Spiliopoulou, C; Statheropoulos, M

    2015-07-09

    Field experiments were devised to mimic the entrapment conditions under the rubble of collapsed buildings aiming to investigate the evolution of volatile organic compounds (VOCs) during the early dead body decomposition stage. Three pig carcasses were placed inside concrete tunnels of a search and rescue (SAR) operational field terrain for simulating the entrapment environment after a building collapse. The experimental campaign employed both laboratory and on-site analytical methods running in parallel. The current work focuses only on the results of the laboratory method using thermal desorption coupled to comprehensive two-dimensional gas chromatography with time-of-flight mass spectrometry (TD-GC×GC-TOF MS). The flow-modulated TD-GC×GC-TOF MS provided enhanced separation of the VOC profile and served as a reference method for the evaluation of the on-site analytical methods in the current experimental campaign. Bespoke software was used to deconvolve the VOC profile to extract as much information as possible into peak lists. In total, 288 unique VOCs were identified (i.e., not found in blank samples). The majority were aliphatics (172), aromatics (25) and nitrogen compounds (19), followed by ketones (17), esters (13), alcohols (12), aldehydes (11), sulfur (9), miscellaneous (8) and acid compounds (2). The TD-GC×GC-TOF MS proved to be a sensitive and powerful system for resolving the chemical puzzle of above-ground "scent of death". Copyright © 2015 Elsevier B.V. All rights reserved.

  9. Ultraviolet B irradiation induces changes in the distribution and release of arachidonic acid, dihomo-gamma-linolenic acid, and eicosapentaenoic acid in human keratinocytes in culture

    International Nuclear Information System (INIS)

    Punnonen, K.; Puustinen, T.; Jansen, C.T.

    1987-01-01

    There is increasing evidence that derivatives of 20-carbon polyunsaturated fatty acids, the eicosanoids, play an important role in the inflammatory responses of the human skin. To better understand the metabolic fate of fatty acids in the skin, the effect of ultraviolet B (UVB) irradiation (280-320 nm) on the distribution and release of 14 C-labeled arachidonic acid, dihomo-gamma-linolenic acid, and eicosapentaenoic acid in human keratinocytes in culture was investigated. Ultraviolet B irradiation induced the release of all three 14 C-labeled fatty acids from the phospholipids, especially from phosphatidylethanolamine, and this was accompanied by increased labeling of the nonphosphorus lipids. This finding suggests that UVB induces a significant liberation of eicosanoid precursor fatty acids from cellular phospholipids, but the liberated fatty acids are largely reincorporated into the nonphosphorus lipids. In conclusion, the present study suggests that not only arachidonic acid but also dihomo-gamma-linolenic acid, and eicosapentaenoic acid might be involved in the UVB irradiation-induced inflammatory reactions of human skin

  10. Humanized Mouse Model of Skin Inflammation Is Characterized by Disturbed Keratinocyte Differentiation and Influx of IL-17A Producing T Cells

    Science.gov (United States)

    de Oliveira, Vivian L.; Keijsers, Romy R. M. C.; van de Kerkhof, Peter C. M.; Seyger, Marieke M. B.; Fasse, Esther; Svensson, Lars; Latta, Markus; Norsgaard, Hanne; Labuda, Tord; Hupkens, Pieter; van Erp, Piet E. J.; Joosten, Irma; Koenen, Hans J. P. M.

    2012-01-01

    Humanized mouse models offer a challenging possibility to study human cell function in vivo. In the huPBL-SCID-huSkin allograft model human skin is transplanted onto immunodeficient mice and allowed to heal. Thereafter allogeneic human peripheral blood mononuclear cells are infused intra peritoneally to induce T cell mediated inflammation and microvessel destruction of the human skin. This model has great potential for in vivo study of human immune cells in (skin) inflammatory processes and for preclinical screening of systemically administered immunomodulating agents. Here we studied the inflammatory skin response of human keratinocytes and human T cells and the concomitant systemic human T cell response. As new findings in the inflamed human skin of the huPBL-SCID-huSkin model we here identified: 1. Parameters of dermal pathology that enable precise quantification of the local skin inflammatory response exemplified by acanthosis, increased expression of human β-defensin-2, Elafin, K16, Ki67 and reduced expression of K10 by microscopy and immunohistochemistry. 2. Induction of human cytokines and chemokines using quantitative real-time PCR. 3. Influx of inflammation associated IL-17A-producing human CD4+ and CD8+ T cells as well as immunoregulatory CD4+Foxp3+ cells using immunohistochemistry and -fluorescence, suggesting that active immune regulation is taking place locally in the inflamed skin. 4. Systemic responses that revealed activated and proliferating human CD4+ and CD8+ T cells that acquired homing marker expression of CD62L and CLA. Finally, we demonstrated the value of the newly identified parameters by showing significant changes upon systemic treatment with the T cell inhibitory agents cyclosporine-A and rapamycin. In summary, here we equipped the huPBL-SCID-huSkin humanized mouse model with relevant tools not only to quantify the inflammatory dermal response, but also to monitor the peripheral immune status. This combined approach will gain our

  11. Areca nut extract up-regulates prostaglandin production, cyclooxygenase-2 mRNA and protein expression of human oral keratinocytes.

    Science.gov (United States)

    Jeng, J H; Ho, Y S; Chan, C P; Wang, Y J; Hahn, L J; Lei, D; Hsu, C C; Chang, M C

    2000-07-01

    There are about 600 million betel quid (BQ) chewers in the world. BQ chewing is associated with increased incidence of oral cancer and submucous fibrosis. In this study, areca nut (AN) extract (200-800 microg/ml) induced the prostaglandin E(2) (PGE(2)) production by 1. 4-3.4-fold and 6-keto-PGF(1 alpha) production by 1.1-1.7-fold of gingival keratinocytes (GK), respectively, following 24 h of exposure. Exposure of GK to AN extract (>400 microg/ml) led to cell retraction and intracellular vacuoles formation. At concentrations of 800 and 1200 microg/ml, AN extract induced cell death at 21-24 and 32-52% as detected by MTT assay and cellular lactate dehydrogenase release, respectively. Interestingly, AN-induced morphological changes of GK are reversible. GK can still proliferate following exposure to AN extract. Cytotoxicity of AN extract cannot be inhibited by indomethacin (1 microM) and aspirin (50 microM), indicating that prostaglandin (PG) production is not the major factor responsible for AN cytotoxicity. PGE(2) exhibited little effect on the growth of GK at concentrations ranging from 100-1000 pg/ml. Stimulating GK production of PGs by AN extract could be due to induction of cyclooxygenase-2 (COX-2) mRNA expression and protein production. These results suggest that AN ingredients are critical in the pathogenesis of oral submucous fibrosis and oral cancer via their stimulatory effects on the PGs, COX-2 production and associated tissue inflammatory responses. AN cytotoxicity to GK is not directly mediated by COX-2 stimulation and PG production.

  12. The Frog Skin-Derived Antimicrobial Peptide Esculentin-1a(1-21)NH2 Promotes the Migration of Human HaCaT Keratinocytes in an EGF Receptor-Dependent Manner: A Novel Promoter of Human Skin Wound Healing?

    Science.gov (United States)

    Di Grazia, Antonio; Cappiello, Floriana; Imanishi, Akiko; Mastrofrancesco, Arianna; Picardo, Mauro; Paus, Ralf; Mangoni, Maria Luisa

    2015-01-01

    One of the many functions of skin is to protect the organism against a wide range of pathogens. Antimicrobial peptides (AMPs) produced by the skin epithelium provide an effective chemical shield against microbial pathogens. However, whereas antibacterial/antifungal activities of AMPs have been extensively characterized, much less is known regarding their wound healing-modulatory properties. By using an in vitro re-epithelialisation assay employing special cell-culture inserts, we detected that a derivative of the frog-skin AMP esculentin-1a, named esculentin-1a(1-21)NH2, significantly stimulates migration of immortalized human keratinocytes (HaCaT cells) over a wide range of peptide concentrations (0.025-4 μM), and this notably more efficiently than human cathelicidin (LL-37). This activity is preserved in primary human epidermal keratinocytes. By using appropriate inhibitors and an enzyme-linked immunosorbent assay we found that the peptide-induced cell migration involves activation of the epidermal growth factor receptor and STAT3 protein. These results suggest that esculentin-1a(1-21)NH2 now deserves to be tested in standard wound healing assays as a novel candidate promoter of skin re-epithelialisation. The established ability of esculentin-1a(1-21)NH2 to kill microbes without harming mammalian cells, namely its high anti-Pseudomonal activity, makes this AMP a particularly attractive candidate wound healing promoter, especially in the management of chronic, often Pseudomonas-infected, skin ulcers.

  13. The Frog Skin-Derived Antimicrobial Peptide Esculentin-1a(1-21NH2 Promotes the Migration of Human HaCaT Keratinocytes in an EGF Receptor-Dependent Manner: A Novel Promoter of Human Skin Wound Healing?

    Directory of Open Access Journals (Sweden)

    Antonio Di Grazia

    Full Text Available One of the many functions of skin is to protect the organism against a wide range of pathogens. Antimicrobial peptides (AMPs produced by the skin epithelium provide an effective chemical shield against microbial pathogens. However, whereas antibacterial/antifungal activities of AMPs have been extensively characterized, much less is known regarding their wound healing-modulatory properties. By using an in vitro re-epithelialisation assay employing special cell-culture inserts, we detected that a derivative of the frog-skin AMP esculentin-1a, named esculentin-1a(1-21NH2, significantly stimulates migration of immortalized human keratinocytes (HaCaT cells over a wide range of peptide concentrations (0.025-4 μM, and this notably more efficiently than human cathelicidin (LL-37. This activity is preserved in primary human epidermal keratinocytes. By using appropriate inhibitors and an enzyme-linked immunosorbent assay we found that the peptide-induced cell migration involves activation of the epidermal growth factor receptor and STAT3 protein. These results suggest that esculentin-1a(1-21NH2 now deserves to be tested in standard wound healing assays as a novel candidate promoter of skin re-epithelialisation. The established ability of esculentin-1a(1-21NH2 to kill microbes without harming mammalian cells, namely its high anti-Pseudomonal activity, makes this AMP a particularly attractive candidate wound healing promoter, especially in the management of chronic, often Pseudomonas-infected, skin ulcers.

  14. Evidence for Alteration of EZH2, BMI1, and KDM6A and Epigenetic Reprogramming in Human Papillomavirus Type 16 E6/E7-Expressing Keratinocytes

    Science.gov (United States)

    Hyland, Paula L.; McDade, Simon S.; McCloskey, Rachel; Dickson, Glenda J.; Arthur, Ken; McCance, Dennis J.; Patel, Daksha

    2011-01-01

    A number of epigenetic alterations occur in both the virus and host cellular genomes during human papillomavirus (HPV)-associated carcinogenesis, and investigations of such alterations, including changes in chromatin proteins and histone modifications, have the potential to lead to therapeutic epigenetic reversion. We report here that transformed HPV16 E6/E7-expressing primary human foreskin keratinocytes (HFKs) (E6/E7 cells) demonstrate increased expression of the PRC2 methyltransferase EZH2 at both the mRNA and protein levels but do not exhibit the expected increase in trimethylated H3K27 (H3K27me3) compared to normal keratinocytes. In contrast, these cells show a reduction in global H3K27me3 levels in vitro, as well as upregulation of the KDM6A demethylase. We further show for the first time that transformation with the HPV16 E6 and E7 oncogenes also results in an increase in phosphorylated EZH2 serine 21 (P-EZH2-Ser21), mediated by active Akt, and in a downregulation of the PRC1 protein BMI1 in these cells. High-grade squamous cervical intraepithelial lesions also showed a loss of H3K27me3 in the presence of increased expression of EZH2. Correlating with the loss of H3K27me3, E6/E7 cells exhibited derepression of specific EZH2-, KMD6A-, and BMI1-targeted HOX genes. These results suggest that the observed reduction in H3K27me3 may be due to a combination of reduced activities/levels of specific polycomb proteins and increases in demethylases. The dysregulation of multiple chromatin proteins resulting in the loss of global H3K27me3 and the transcriptional reprogramming in HPV16 E6/E7-infected cells could provide an epigenetic signature associated with risk and/or progression of HPV16-associated cancers, as well as the potential for epigenetic reversion in the future. PMID:21865393

  15. Evidence for alteration of EZH2, BMI1, and KDM6A and epigenetic reprogramming in human papillomavirus type 16 E6/E7-expressing keratinocytes.

    Science.gov (United States)

    Hyland, Paula L; McDade, Simon S; McCloskey, Rachel; Dickson, Glenda J; Arthur, Ken; McCance, Dennis J; Patel, Daksha

    2011-11-01

    A number of epigenetic alterations occur in both the virus and host cellular genomes during human papillomavirus (HPV)-associated carcinogenesis, and investigations of such alterations, including changes in chromatin proteins and histone modifications, have the potential to lead to therapeutic epigenetic reversion. We report here that transformed HPV16 E6/E7-expressing primary human foreskin keratinocytes (HFKs) (E6/E7 cells) demonstrate increased expression of the PRC2 methyltransferase EZH2 at both the mRNA and protein levels but do not exhibit the expected increase in trimethylated H3K27 (H3K27me3) compared to normal keratinocytes. In contrast, these cells show a reduction in global H3K27me3 levels in vitro, as well as upregulation of the KDM6A demethylase. We further show for the first time that transformation with the HPV16 E6 and E7 oncogenes also results in an increase in phosphorylated EZH2 serine 21 (P-EZH2-Ser21), mediated by active Akt, and in a downregulation of the PRC1 protein BMI1 in these cells. High-grade squamous cervical intraepithelial lesions also showed a loss of H3K27me3 in the presence of increased expression of EZH2. Correlating with the loss of H3K27me3, E6/E7 cells exhibited derepression of specific EZH2-, KMD6A-, and BMI1-targeted HOX genes. These results suggest that the observed reduction in H3K27me3 may be due to a combination of reduced activities/levels of specific polycomb proteins and increases in demethylases. The dysregulation of multiple chromatin proteins resulting in the loss of global H3K27me3 and the transcriptional reprogramming in HPV16 E6/E7-infected cells could provide an epigenetic signature associated with risk and/or progression of HPV16-associated cancers, as well as the potential for epigenetic reversion in the future.

  16. Comprehensive two-dimensional gel protein databases offer a global approach to the analysis of human cells: the transformed amnion cells (AMA) master database and its link to genome DNA sequence data

    DEFF Research Database (Denmark)

    Celis, J E; Gesser, B; Rasmussen, H H

    1990-01-01

    , mitochondria, Golgi, ribosomes, intermediate filaments, microfilaments and microtubules), levels in fetal human tissues, partial protein sequences (containing information on 48 human proteins microsequenced so far), cell cycle-regulated proteins, proteins sensitive to interferons alpha, beta, and gamma, heat...

  17. Lie algebra contractions on two-dimensional hyperboloid

    International Nuclear Information System (INIS)

    Pogosyan, G. S.; Yakhno, A.

    2010-01-01

    The Inoenue-Wigner contraction from the SO(2, 1) group to the Euclidean E(2) and E(1, 1) group is used to relate the separation of variables in Laplace-Beltrami (Helmholtz) equations for the four corresponding two-dimensional homogeneous spaces: two-dimensional hyperboloids and two-dimensional Euclidean and pseudo-Euclidean spaces. We show how the nine systems of coordinates on the two-dimensional hyperboloids contracted to the four systems of coordinates on E 2 and eight on E 1,1 . The text was submitted by the authors in English.

  18. Wavelet analysis in two-dimensional tomography

    Science.gov (United States)

    Burkovets, Dimitry N.

    2002-02-01

    The diagnostic possibilities of wavelet-analysis of coherent images of connective tissue in its pathological changes diagnostics. The effectiveness of polarization selection in obtaining wavelet-coefficients' images is also shown. The wavelet structures, characterizing the process of skin psoriasis, bone-tissue osteoporosis have been analyzed. The histological sections of physiological normal and pathologically changed samples of connective tissue of human skin and spongy bone tissue have been analyzed.

  19. IFN-β antiproliferative effect and miRNA regulation in Human Papilloma Virus E6- and E7-transformed keratinocytes.

    Science.gov (United States)

    Chiantore, Maria Vincenza; Mangino, Giorgio; Iuliano, Marco; Zangrillo, Maria Simona; De Lillis, Ilaria; Vaccari, Gabriele; Accardi, Rosita; Tommasino, Massimo; Fiorucci, Gianna; Romeo, Giovanna

    2017-01-01

    Human Papilloma Viruses (HPVs) are the causative agents of cervical cancer although other types of cancers are associated with HPV infection. Type I Interferons can interfere with HPV E6- and/or E7-dependent transformation and can affect microRNA (miRNA) expression. Cancer cells show a specific pattern of miRNA expression and HPVs are able to modulate miRNAs expressed in infected cells. Keratinocytes transduced with E6 and E7 from mucosal HPV-16 or cutaneous HPV-38 (K16 and K38) were studied to analyze the involvement of HPV oncoproteins in the anti-proliferative activity of IFN-β. In view of our previous data showing senescence induction by the cytokine in K38 cells, we observe that IFN-β treatment leads to p53-indipendent apoptosis in K16 cells whereas induces senescence in K16 cells if E6 is silenced and p53 expression is restored. The levels of selected miRNAs, deregulated in K16 and K38 cells, can be modulated by IFN-β when E6 and E7 proteins of HPV-16, but not HPV-38, are expressed. Copyright © 2015 Elsevier Ltd. All rights reserved.

  20. Protective Effect of Mangifera indica Linn., Cocos nucifera Linn., and Averrhoa carambola Linn. Extracts against Ultraviolet B-Induced Damage in Human Keratinocytes

    Science.gov (United States)

    Ronpirin, Chalinee; Pattarachotanant, Nattaporn

    2016-01-01

    This study was aimed at investigating the antioxidant activity of Mangifera indica Linn., Cocos nucifera Linn., and Averrhoa carambola Linn. and their biological effect on human keratinocytes affected by the ultraviolet B (UVB), a major cause of cell damage and skin cancer through induction of DNA damage, production of reactive oxygen species (ROS), and apoptosis. The richest antioxidant activity was found in ethanol fraction of M. indica (21.32 ± 0.66 mg QE/g dry weight), while the lowest one was found in aqueous fractions of M. indica and C. nucifera (1.76 ± 2.10 and 1.65 ± 0.38 mg QE/g dry weight, respectively). Ethanol and aqueous fractions of A. carambola (250 µg/mL) significantly reduced the number of apoptotic cells. The expression of cleaved caspase 3 in UVB-treated group was significantly greater than that in untreated group. Both fractions of A. carambola (50, 100, and 250 µg/mL) significantly decreased the expression of cleaved caspase 3. Regarding the induction of DNA repair, ethanol (100 and 250 µg/mL) and aqueous (50, 100 and 250 µg/mL) fractions of A. carambola significantly decreased the percentage of cyclobutane pyrimidine dimers (CPD). Taken together, our results suggest that both fractions of A. carambola may be potentially developed for dermal applications. PMID:27057195

  1. Reinforcing the inner phase of the filled hydrogels with CNTs alters drug release properties and human keratinocyte morphology: A study on the gelatin- tamarind gum filled hydrogels.

    Science.gov (United States)

    Maharana, Vivek; Gaur, Deepanjali; Nayak, Suraj K; Singh, Vinay K; Chakraborty, Subhabrata; Banerjee, Indranil; Ray, Sirsendu S; Anis, Arfat; Pal, Kunal

    2017-11-01

    The study reports the synthesis and characterization of gelatin-tamarind gum (TG) based filled hydrogels for drug delivery applications. In this study, three different types of carbon nanotubes (CNTs) were incorporated within the dispersed TG phase of the filled hydrogels. The prepared hydrogels were thoroughly characterised using bright field microscope, FESEM, FTIR spectroscopy, differential scanning calorimeter, and mechanical tester. The swelling and the drug (salicylic acid) release properties of the filled hydrogels were also evaluated. The micrographs revealed the formation of biphasic systems. The internal phase appeared as agglomerates, and the CNTs were confined within the dispersed TG phase. FTIR and XRD studies revealed that CNTs promoted associative interactions among the components of the hydrogel, which promoted the formation of large crystallite size. The mechanical study indicated better resistance to the breakdown of the architecture of the CNT-containing filled hydrogels. Drug release studies, both passive and iontophoretic, suggested that the non-Fickian diffusion of the drug was prevalent during its release from hydrogel matrices. The prepared hydrogels were cytocompatible with human keratinocytes. The results suggested the probable use of such hydrogels in wound healing, tissue engineering and drug delivery applications. Copyright © 2017 Elsevier Ltd. All rights reserved.

  2. Protective Effect of Mangifera indica Linn., Cocos nucifera Linn., and Averrhoa carambola Linn. Extracts against Ultraviolet B-Induced Damage in Human Keratinocytes.

    Science.gov (United States)

    Ronpirin, Chalinee; Pattarachotanant, Nattaporn; Tencomnao, Tewin

    2016-01-01

    This study was aimed at investigating the antioxidant activity of Mangifera indica Linn., Cocos nucifera Linn., and Averrhoa carambola Linn. and their biological effect on human keratinocytes affected by the ultraviolet B (UVB), a major cause of cell damage and skin cancer through induction of DNA damage, production of reactive oxygen species (ROS), and apoptosis. The richest antioxidant activity was found in ethanol fraction of M. indica (21.32 ± 0.66 mg QE/g dry weight), while the lowest one was found in aqueous fractions of M. indica and C. nucifera (1.76 ± 2.10 and 1.65 ± 0.38 mg QE/g dry weight, respectively). Ethanol and aqueous fractions of A. carambola (250 µg/mL) significantly reduced the number of apoptotic cells. The expression of cleaved caspase 3 in UVB-treated group was significantly greater than that in untreated group. Both fractions of A. carambola (50, 100, and 250 µg/mL) significantly decreased the expression of cleaved caspase 3. Regarding the induction of DNA repair, ethanol (100 and 250 µg/mL) and aqueous (50, 100 and 250 µg/mL) fractions of A. carambola significantly decreased the percentage of cyclobutane pyrimidine dimers (CPD). Taken together, our results suggest that both fractions of A. carambola may be potentially developed for dermal applications.

  3. Protective Effect of Mangifera indica Linn., Cocos nucifera Linn., and Averrhoa carambola Linn. Extracts against Ultraviolet B-Induced Damage in Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Chalinee Ronpirin

    2016-01-01

    Full Text Available This study was aimed at investigating the antioxidant activity of Mangifera indica Linn., Cocos nucifera Linn., and Averrhoa carambola Linn. and their biological effect on human keratinocytes affected by the ultraviolet B (UVB, a major cause of cell damage and skin cancer through induction of DNA damage, production of reactive oxygen species (ROS, and apoptosis. The richest antioxidant activity was found in ethanol fraction of M. indica (21.32 ± 0.66 mg QE/g dry weight, while the lowest one was found in aqueous fractions of M. indica and C. nucifera (1.76 ± 2.10 and 1.65 ± 0.38 mg QE/g dry weight, respectively. Ethanol and aqueous fractions of A. carambola (250 µg/mL significantly reduced the number of apoptotic cells. The expression of cleaved caspase 3 in UVB-treated group was significantly greater than that in untreated group. Both fractions of A. carambola (50, 100, and 250 µg/mL significantly decreased the expression of cleaved caspase 3. Regarding the induction of DNA repair, ethanol (100 and 250 µg/mL and aqueous (50, 100 and 250 µg/mL fractions of A. carambola significantly decreased the percentage of cyclobutane pyrimidine dimers (CPD. Taken together, our results suggest that both fractions of A. carambola may be potentially developed for dermal applications.

  4. Effect of Standardized Boesenbergia pandurata Extract and Its Active Compound Panduratin A on Skin Hydration and Barrier Function in Human Epidermal Keratinocytes.

    Science.gov (United States)

    Woo, Seon Wook; Rhim, Dong-Bin; Kim, Changhee; Hwang, Jae-Kwan

    2015-03-01

    The skin plays a key role in protecting the body from the environment and from water loss. Cornified envelope (CE) and natural moisturizing factor (NMF) are considered as the primary regulators of skin hydration and barrier function. The CE prevents loss of water from the body and is formed by cross-linking of several proteins. Among these proteins, filaggrin is an important protein because NMF is produced by the degradation of filaggrin. Proteases, including matriptase and prostasin, stimulate the generation of filaggrin from profilaggrin and caspase-14 plays a role in the degradation of filaggrin. This study elucidated the effects of an ethanol extract of Boesenbergia pandurata (Roxb.) Schltr., known as fingerroot, and its active compound panduratin A on CE formation and filaggrin processing in HaCaT, human epidermal keratinocytes. B. pandurata extract (BPE) and panduratin A significantly stimulated not only CE formation but also the expression of CE proteins, such as loricrin, involucrin, and transglutaminase, which were associated with PPARα expression. The mRNA and protein levels of filaggrin and filaggrin-related enzymes, such as matriptase, prostasin, and caspase-14 were also up-regulated by BPE and panduratin A treatment. These results suggest that BPE and panduratin A are potential nutraceuticals which can enhance skin hydration and barrier function based on their CE formation and filaggrin processing.

  5. Influence of CAD/CAM all-ceramic materials on cell viability, migration ability and adenylate kinase release of human gingival fibroblasts and oral keratinocytes.

    Science.gov (United States)

    Pabst, A M; Walter, C; Grassmann, L; Weyhrauch, M; Brüllmann, D D; Ziebart, T; Scheller, H; Lehmann, K M

    2014-05-01

    The aim of this study was to analyze the influence of four CAD/CAM all-ceramic materials on cell viability, migration ability and adenylate kinase (ADK) release of human gingival fibroblasts (HGF) and oral keratinocytes (HOK). HGF and HOK were cultured on disc-shaped CAD/CAM all-ceramic materials (e.max CAD LT, e.max CAD HT, Empress CAD and Mark II) and on discs made of tissue culture polystyrene surface (TCPS) serving as control. Cell viability was analyzed by using an MTT assay, and migration ability was investigated by a scratch assay. A ToxiLight assay has been performed to analyze the effect of all-ceramic materials on ADK release and cell apoptosis. At MTT assay for HGF, no significant decrease of cell viability could be detected at all points of measurement (p each > 0.05), while HOK demonstrated a significant decrease in cell viability especially on Empress CAD and Mark II at each point of measurement (p each materials at all points of measurement (between -36 % and -71 %; p each ceramic materials could be investigated. This study disclosed significant differences in cell viability and migration ability of HGF and HOK on CAD/CAM all-ceramic materials. CAD/CAM all-ceramic materials can influence oral cell lines responsible for soft tissue creation which may affect the esthetic outcome.

  6. Characterisation of Human Keratinocytes by Measuring Cellular Repair Capacity of UVB-Induced DNA Damage and Monitoring of Cytogenetic Changes in Melanoma Cell Lines

    Energy Technology Data Exchange (ETDEWEB)

    Greinert, R.; Breibart, E.W.; Mitchell, D.; Smida, J.; Volkmer, B

    2000-07-01

    The molecular mechanisms for UV-induced photocarcinogenesis are far from being understood in detail, especially in the case of malignant melanoma of the skin. Nevertheless, it is known that deficiencies in cellular repair processes of UV-induced DNA damage (e.g. in the case of Xeroderma pigmentosum) represent important aetiological factors in the multistep development of skin cancer. The repair kinetics have therefore been studied of an established skin cell line (HaCaT), primary human keratinocytes, melanocytes and melanoma cell lines, using fluorescence microscopy and flow cytometry. Our data show a high degree of interindividual variability in cellular repair capacity for UV-induced DNA lesions, which might be due to individual differences in the degree of tolerable damage and/or the onsets of saturation of the enzymatic repair system. The cytogenetic analysis of melanoma cell lines, using spectral karyotyping (SKY) furthermore proves that malignant melanoma of the skin are characterised by high numbers of chromosomal aberrations. (author)

  7. Protective Effect of Diphlorethohydroxycarmalol against Ultraviolet B Radiation-Induced DNA Damage by Inducing the Nucleotide Excision Repair System in HaCaT Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Mei Jing Piao

    2015-09-01

    Full Text Available We investigated the protective properties of diphlorethohydroxycarmalol (DPHC, a phlorotannin, against ultraviolet B (UVB radiation-induced cyclobutane pyrimidine dimers (CPDs in HaCaT human keratinocytes. The nucleotide excision repair (NER system is the pathway by which cells identify and repair bulky, helix-distorting DNA lesions such as ultraviolet (UV radiation-induced CPDs and 6-4 photoproducts. CPDs levels were elevated in UVB-exposed cells; however, this increase was reduced by DPHC. Expression levels of xeroderma pigmentosum complementation group C (XPC and excision repair cross-complementing 1 (ERCC1, which are essential components of the NER pathway, were induced in DPHC-treated cells. Expression of XPC and ERCC1 were reduced following UVB exposure, whereas DPHC treatment partially restored the levels of both proteins. DPHC also increased expression of transcription factor specificity protein 1 (SP1 and sirtuin 1, an up-regulator of XPC, in UVB-exposed cells. DPHC restored binding of the SP1 to the XPC promoter, which is reduced in UVB-exposed cells. These results indicate that DPHC can protect cells against UVB-induced DNA damage by inducing the NER system.

  8. Beginning Introductory Physics with Two-Dimensional Motion

    Science.gov (United States)

    Huggins, Elisha

    2009-01-01

    During the session on "Introductory College Physics Textbooks" at the 2007 Summer Meeting of the AAPT, there was a brief discussion about whether introductory physics should begin with one-dimensional motion or two-dimensional motion. Here we present the case that by starting with two-dimensional motion, we are able to introduce a considerable…

  9. Two-dimensional black holes and non-commutative spaces

    International Nuclear Information System (INIS)

    Sadeghi, J.

    2008-01-01

    We study the effects of non-commutative spaces on two-dimensional black hole. The event horizon of two-dimensional black hole is obtained in non-commutative space up to second order of perturbative calculations. A lower limit for the non-commutativity parameter is also obtained. The observer in that limit in contrast to commutative case see two horizon

  10. Solution of the two-dimensional spectral factorization problem

    Science.gov (United States)

    Lawton, W. M.

    1985-01-01

    An approximation theorem is proven which solves a classic problem in two-dimensional (2-D) filter theory. The theorem shows that any continuous two-dimensional spectrum can be uniformly approximated by the squared modulus of a recursively stable finite trigonometric polynomial supported on a nonsymmetric half-plane.

  11. Two-dimensional Navier-Stokes turbulence in bounded domains

    NARCIS (Netherlands)

    Clercx, H.J.H.; van Heijst, G.J.F.

    In this review we will discuss recent experimental and numerical results of quasi-two-dimensional decaying and forced Navier–Stokes turbulence in bounded domains. We will give a concise overview of developments in two-dimensional turbulence research, with emphasis on the progress made during the

  12. Two-dimensional Navier-Stokes turbulence in bounded domains

    NARCIS (Netherlands)

    Clercx, H.J.H.; Heijst, van G.J.F.

    2009-01-01

    In this review we will discuss recent experimental and numerical results of quasi-two-dimensional decaying and forced Navier–Stokes turbulence in bounded domains. We will give a concise overview of developments in two-dimensional turbulence research, with emphasis on the progress made during the

  13. Skin metabolism of aminophenols: Human keratinocytes as a suitable in vitro model to qualitatively predict the dermal transformation of 4-amino-2-hydroxytoluene in vivo

    International Nuclear Information System (INIS)

    Goebel, C.; Hewitt, N.J.; Kunze, G.; Wenker, M.; Hein, D.W.; Beck, H.; Skare, J.

    2009-01-01

    4-Amino-2-hydroxytolune (AHT) is an aromatic amine ingredient in oxidative hair colouring products. As skin contact occurs during hair dyeing, characterisation of dermal metabolism is important for the safety assessment of this chemical class. We have compared the metabolism of AHT in the human keratinocyte cell line HaCaT with that observed ex-vivo in human skin and in vivo (topical application versus oral (p.o.) and intravenous (i.v.) route). Three major metabolites of AHT were excreted, i.e. N-acetyl-AHT, AHT-sulfate and AHT-glucuronide. When 12.5 mg/kg AHT was applied topically, the relative amounts of each metabolite were altered such that N-acetyl-AHT product was the major metabolite (66% of the dose in comparison with 37% and 32% of the same applied dose after i.v. and p.o. administration, respectively). N-acetylated products were the only metabolites detected in HaCaT cells and ex-vivo whole human skin discs for AHT and p-aminophenol (PAP), an aromatic amine known to undergo N-acetylation in vivo. Since N-acetyltransferase 1 (NAT1) is the responsible enzyme, kinetics of AHT was further compared to the standard NAT1 substrate p-aminobenzoic acid (PABA) in the HaCaT model revealing similar values for K m and V max . In conclusion NAT1 dependent dermal N-acetylation of AHT represents a 'first-pass' metabolism effect in the skin prior to entering the systemic circulation. Since the HaCaT cell model represents a suitable in vitro assay for addressing the qualitative contribution of the skin to the metabolism of topically-applied aromatic amines it may contribute to a reduction in animal testing

  14. Interactive effects of 2,3,7,8-tetrachlorodibenzo-p-dioxin and retinoids on proliferation and differentiation in cultured human keratinocytes: quantification of cross-linked envelope formation

    International Nuclear Information System (INIS)

    Berkers, J.A.M.; Hassing, I.; Spenkelink, B.; Brouwer, A.; Blaauboer, B.J.

    1995-01-01

    Dioxins are potent inducers of chloracne in humans. This skin aberration can be interpreted as an altered differentiation pattern of acinar sebaceous base cells and a change in the rate of terminal differentiation of the keratinocytes. We measured this rate induced by 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) in primary cultures of human keratinocytes. As parameters for differentiation, we quantified the 35 S-methionine incorporation into cross-linked envelopes (revealing the total CLE biomass), as well as the number of microscopically visible CLEs. It was shown that TCDD is a very potent inducer of both CLE biomass and number with a half-maximal effect concentration (EC 50 ) of 1.4 nM. CLE biomass was maximally increased 10-fold and the number of cells in culture producing a CLE was increased from 15% in control cultures to maximally 75% of the cells in TCDD-treated cultures. Both effects were Ca 2+ -dependent and increased with elevated cell density, being optimal in post-confluent cultures. Retinoic acid dose-dependently decreased the effect of 10 -8 M TCDD, 10 -6 M having a nearly complete antagonistic action. This interaction of retinoic acid with TCDD-induced differentiation was non-competitive. Retinol was equally potent as an antagonist of the TCDD-induced elevation of CLE formation as compared with retinoic acid. Retinyl palmitate and etretinate were not very effective as TCDD antagonists. Supplementation of hydrocortisone suppressed the TCDD-induced keratinocyte differentiation. It was concluded that CLE biomass quantification provides a reliable and sensitive parameter for keratinocyte differentiation. In this in vitro system it is shown that TCDD strongly induces a switch from proliferation to terminal differentiation and that this effect can be antagonized effectively by retinoic acid and retinol. (orig.)

  15. Coordination of different ligands to copper(II) and cobalt(III) metal centers enhances Zika virus and dengue virus loads in both arthropod cells and human keratinocytes.

    Science.gov (United States)

    Dutta, Shovan; Celestine, Michael J; Khanal, Supreet; Huddleston, Alexis; Simms, Colin; Arca, Jessa Faye; Mitra, Amlan; Heller, Loree; Kraj, Piotr J; Ledizet, Michel; Anderson, John F; Neelakanta, Girish; Holder, Alvin A; Sultana, Hameeda

    2018-01-01

    Trace elements such as copper and cobalt have been associated with virus-host interactions. However, studies to show the effect of conjugation of copper(II) or cobalt(III) metal centers to thiosemicarbazone ligand(s) derived from either food additives or mosquito repellent such as 2-acetylethiazole or citral, respectively, on Zika virus (ZIKV) or dengue virus (serotype 2; DENV2) infections have not been explored. In this study, we show that four compounds comprising of thiosemicarbazone ligand derived from 2-acetylethiazole viz., (E)-N-ethyl-2-[1-(thiazol-2-yl)ethylidene]hydrazinecarbothioamide (acetylethTSC) (compound 1), a copper(II) complex with acetylethTSC as a ligand (compound 2), a thiosemicarbazone ligand-derived from citral (compound 3) and a cobalt(III) complex with a citral-thiosemicarbazone ligand (compound 4) increased DENV2 and ZIKV replication in both mosquito C6/36 cells and human keratinocytes (HaCaT cells). Treatment of both cell lines with compounds 2 or 4 showed increased dengue viral titers at all three tested doses. Enhanced dengue viral plaque formation was also noted at the tested dose of 100μM, suggesting higher production of infectious viral particles. Treatment with the compounds 2 or 4 enhanced ZIKV and DENV2 RNA levels in HeLa cell line and primary cultures of mouse bone marrow derived dendritic cells. Also, pre- or post treatments with conjugated compounds 2 or 4 showed higher loads of ZIKV or DENV2 envelope (E) protein in HaCaT cells. No changes in loads of E-protein were found in ZIKV-infected C6/36 cells, when compounds were treated after infection. In addition, we tested bis(1,10-phenanthroline)copper(II) chloride ([Cu(phen) 2 ]Cl 2 , (compound 5) and tris(1,10-phenanthroline)cobalt(III) chloride ([Co(phen) 3 ]Cl 3 , (compound 6) that also showed enhanced DENV2 loads. Also, we found that copper(II) chloride dehydrate (CuCl 2 ·2H 2 O) or cobalt(II) chloride hexahydrate (CoCl 2 ·6H 2 O) alone had no effects as "free" cations

  16. Optimizing separations in online comprehensive two-dimensional liquid chromatography.

    Science.gov (United States)

    Pirok, Bob W J; Gargano, Andrea F G; Schoenmakers, Peter J

    2018-01-01

    Online comprehensive two-dimensional liquid chromatography has become an attractive option for the analysis of complex nonvolatile samples found in various fields (e.g. environmental studies, food, life, and polymer sciences). Two-dimensional liquid chromatography complements the highly popular hyphenated systems that combine liquid chromatography with mass spectrometry. Two-dimensional liquid chromatography is also applied to the analysis of samples that are not compatible with mass spectrometry (e.g. high-molecular-weight polymers), providing important information on the distribution of the sample components along chemical dimensions (molecular weight, charge, lipophilicity, stereochemistry, etc.). Also, in comparison with conventional one-dimensional liquid chromatography, two-dimensional liquid chromatography provides a greater separation power (peak capacity). Because of the additional selectivity and higher peak capacity, the combination of two-dimensional liquid chromatography with mass spectrometry allows for simpler mixtures of compounds to be introduced in the ion source at any given time, improving quantitative analysis by reducing matrix effects. In this review, we summarize the rationale and principles of two-dimensional liquid chromatography experiments, describe advantages and disadvantages of combining different selectivities and discuss strategies to improve the quality of two-dimensional liquid chromatography separations. © 2017 The Authors. Journal of Separation Science published by WILEY-VCH Verlag GmbH & Co. KGaA.

  17. Inhibition of Genotoxic Effects of UVC Radiation on Human Keratinocyte HaCaT Cells by Echinacea Purpurea (L.) Moench Herbal Extract

    International Nuclear Information System (INIS)

    Kosalec, I.; Segvic Klaric, M.; Kopjar, N.; Milic, M.

    2013-01-01

    Exposure of skin to ultraviolet (UV) radiation might provoke acute and chronic inflammation and oxidative stress which might cause DNA damage leading to skin photoaging and photocarcinogenesis. Previously we showed that Echinacea purpurea (L.) Moench (EH) extract, rich in phenolic acids, has protective effect on human blood lymphocytes exposed to UVC radiation. In this study we checked whether the pre-treatment of human keratinocyte HaCaT cells with lyophilisate of EH (1 and 10 mg/mL) could reduce or prevent primary DNA damage induced by UVC radiation (253.7 nm) in laboratory conditions. Prior to that experiment we examined cell viability using MTT test upon exposure to EH and UVC (30 and 60 min) alone and in combination. Primary DNA damage in HaCaT cells was studied using the alkaline comet assay. Exposure of cells to EH and UVC alone or EH in combination with UV radiation did not reduce cell viability. Opposite to that UV radiation (30 and 60 min) caused a significant increase in the level of primary DNA damage (P < 0.001). Pre-treatment of cells with both concentrations of EH was not genotoxic to HaCaT cells. Only concentration of 1 mg/mL EH successfully protected the cells against the effects of 30 min exposure to UVC radiation. Positive results obtained in this study speak in favour of continuing the research on effectiveness of Echinacea purpurea preparations and their potential application in developing cosmetic products for skin protection.(author)

  18. Arsenic transformation predisposes human skin keratinocytes to UV-induced DNA damage yet enhances their survival apparently by diminishing oxidant response

    International Nuclear Information System (INIS)

    Sun Yang; Kojima, Chikara; Chignell, Colin; Mason, Ronald; Waalkes, Michael P.

    2011-01-01

    Inorganic arsenic and UV, both human skin carcinogens, may act together as skin co-carcinogens. We find human skin keratinocytes (HaCaT cells) are malignantly transformed by low-level arsenite (100 nM, 30 weeks; termed As-TM cells) and with transformation concurrently undergo full adaptation to arsenic toxicity involving reduced apoptosis and oxidative stress response to high arsenite concentrations. Oxidative DNA damage (ODD) is a possible mechanism in arsenic carcinogenesis and a hallmark of UV-induced skin cancer. In the current work, inorganic arsenite exposure (100 nM) did not induce ODD during the 30 weeks required for malignant transformation. Although acute UV-treatment (UVA, 25 J/cm 2 ) increased ODD in passage-matched control cells, once transformed by arsenic to As-TM cells, acute UV actually further increased ODD (> 50%). Despite enhanced ODD, As-TM cells were resistant to UV-induced apoptosis. The response of apoptotic factors and oxidative stress genes was strongly mitigated in As-TM cells after UV exposure including increased Bcl2/Bax ratio and reduced Caspase-3, Nrf2, and Keap1 expression. Several Nrf2-related genes (HO-1, GCLs, SOD) showed diminished responses in As-TM cells after UV exposure consistent with reduced oxidant stress response. UV-exposed As-TM cells showed increased expression of cyclin D1 (proliferation gene) and decreased p16 (tumor suppressor). UV exposure enhanced the malignant phenotype of As-TM cells. Thus, the co-carcinogenicity between UV and arsenic in skin cancer might involve adaptation to chronic arsenic exposure generally mitigating the oxidative stress response, allowing apoptotic by-pass after UV and enhanced cell survival even in the face of increased UV-induced oxidative stress and increased ODD. - Highlights: → Arsenic transformation adapted to UV-induced apoptosis. → Arsenic transformation diminished oxidant response. → Arsenic transformation enhanced UV-induced DNA damage.

  19. N-Acetylglutaminoyl-S-farnesyl-L-cysteine (SIG-1191): an anti-inflammatory molecule that increases the expression of the aquaglyceroporin, aquaporin-3, in human keratinocytes.

    Science.gov (United States)

    Fernández, José R; Webb, Corey; Rouzard, Karl; Voronkov, Michael; Huber, Kristen L; Stock, Jeffry B; Stock, Maxwell; Gordon, Joel S; Perez, Eduardo

    2017-03-01

    Isoprenylcysteine (IPC) small molecules were discovered as signal transduction modulating compounds ~25 years ago. More recently, IPC molecules have demonstrated antioxidant and anti-inflammatory properties in a variety of dermal cells as well as antimicrobial activity, representing a novel class of compounds to ameliorate skin conditions and disease. Here, we demonstrate a new IPC compound, N-acetylglutaminoyl-S-farnesyl-L-cysteine (SIG-1191), which inhibits UVB-induced inflammation blocking pro-inflammatory cytokine interleukin-6 (IL-6) and tumor necrosis factor alpha (TNF-α) production. To investigate further the previously reported hydrating potential of IPC compounds, SIG-1191 was tested for its ability to modulate aquaporin expression. Specifically, aquaporin 3 (AQP3) the most abundant aquaporin found in skin has been reported to play a key role in skin hydration, elasticity and barrier repair. Results show here for the first time that SIG-1191 increases AQP3 expression in both cultured normal human epidermal keratinocytes as well as when applied topically in a three-dimensional (3D) reconstructed human skin equivalent. Additionally, SIG-1191 dose dependently increased AQP3 protein levels, as determined by specific antibody staining, in the epidermis of the 3D skin equivalents. To begin to elucidate which signaling pathways SIG-1191 may be modulating to increase AQP3 levels, we used several pharmacological pathway inhibitors and determined that AQP3 expression is mediated by the Mitogen-activated protein kinase/Extracellular signal-regulated kinase kinase (MEK) pathway. Altogether, these data suggest SIG-1191 represents a new IPC derivative with anti-inflammatory activity that may also promote increased skin hydration based on its ability to increase AQP3 levels.

  20. Exploring two-dimensional electron gases with two-dimensional Fourier transform spectroscopy

    Energy Technology Data Exchange (ETDEWEB)

    Paul, J.; Dey, P.; Karaiskaj, D., E-mail: karaiskaj@usf.edu [Department of Physics, University of South Florida, 4202 East Fowler Ave., Tampa, Florida 33620 (United States); Tokumoto, T.; Hilton, D. J. [Department of Physics, University of Alabama at Birmingham, Birmingham, Alabama 35294 (United States); Reno, J. L. [CINT, Sandia National Laboratories, Albuquerque, New Mexico 87185 (United States)

    2014-10-07

    The dephasing of the Fermi edge singularity excitations in two modulation doped single quantum wells of 12 nm and 18 nm thickness and in-well carrier concentration of ∼4 × 10{sup 11} cm{sup −2} was carefully measured using spectrally resolved four-wave mixing (FWM) and two-dimensional Fourier transform (2DFT) spectroscopy. Although the absorption at the Fermi edge is broad at this doping level, the spectrally resolved FWM shows narrow resonances. Two peaks are observed separated by the heavy hole/light hole energy splitting. Temperature dependent “rephasing” (S{sub 1}) 2DFT spectra show a rapid linear increase of the homogeneous linewidth with temperature. The dephasing rate increases faster with temperature in the narrower 12 nm quantum well, likely due to an increased carrier-phonon scattering rate. The S{sub 1} 2DFT spectra were measured using co-linear, cross-linear, and co-circular polarizations. Distinct 2DFT lineshapes were observed for co-linear and cross-linear polarizations, suggesting the existence of polarization dependent contributions. The “two-quantum coherence” (S{sub 3}) 2DFT spectra for the 12 nm quantum well show a single peak for both co-linear and co-circular polarizations.

  1. Functional inks and printing of two-dimensional materials.

    Science.gov (United States)

    Hu, Guohua; Kang, Joohoon; Ng, Leonard W T; Zhu, Xiaoxi; Howe, Richard C T; Jones, Christopher G; Hersam, Mark C; Hasan, Tawfique

    2018-05-08

    Graphene and related two-dimensional materials provide an ideal platform for next generation disruptive technologies and applications. Exploiting these solution-processed two-dimensional materials in printing can accelerate this development by allowing additive patterning on both rigid and conformable substrates for flexible device design and large-scale, high-speed, cost-effective manufacturing. In this review, we summarise the current progress on ink formulation of two-dimensional materials and the printable applications enabled by them. We also present our perspectives on their research and technological future prospects.

  2. Third sound in one and two dimensional modulated structures

    International Nuclear Information System (INIS)

    Komuro, T.; Kawashima, H., Shirahama, K.; Kono, K.

    1996-01-01

    An experimental technique is developed to study acoustic transmission in one and two dimensional modulated structures by employing third sound of a superfluid helium film. In particular, the Penrose lattice, which is a two dimensional quasiperiodic structure, is studied. In two dimensions, the scattering of third sound is weaker than in one dimension. Nevertheless, the authors find that the transmission spectrum in the Penrose lattice, which is a two dimensional prototype of the quasicrystal, is observable if the helium film thickness is chosen around 5 atomic layers. The transmission spectra in the Penrose lattice are explained in terms of dynamical theory of diffraction

  3. ONE-DIMENSIONAL AND TWO-DIMENSIONAL LEADERSHIP STYLES

    Directory of Open Access Journals (Sweden)

    Nikola Stefanović

    2007-06-01

    Full Text Available In order to motivate their group members to perform certain tasks, leaders use different leadership styles. These styles are based on leaders' backgrounds, knowledge, values, experiences, and expectations. The one-dimensional styles, used by many world leaders, are autocratic and democratic styles. These styles lie on the two opposite sides of the leadership spectrum. In order to precisely define the leadership styles on the spectrum between the autocratic leadership style and the democratic leadership style, leadership theory researchers use two dimensional matrices. The two-dimensional matrices define leadership styles on the basis of different parameters. By using these parameters, one can identify two-dimensional styles.

  4. Suppression of Innate Immune Response by Primary Human Keratinocytes Expressing HPV-16 E6 and E7

    National Research Council Canada - National Science Library

    Guess, Jennifer L

    2005-01-01

    Human papillomavims (HPV) types infect the skin and mucosal epithelium. Lesions resulting from HPV infection can linger for months or years suggesting that HPV - presence goes unnoticed by the host immune system...

  5. The MRC-5 human embryonal lung fibroblast two-dimensional gel cellular protein database: quantitative identification of polypeptides whose relative abundance differs between quiescent, proliferating and SV40 transformed cells

    DEFF Research Database (Denmark)

    Celis, J E; Dejgaard, K; Madsen, Peder

    1990-01-01

    interferon-induced proteins, were not detected in the master MRC-5 images. The identity of 36 of the transformation-sensitive proteins whose levels are up or down regulated by two times or more was determined and additional information can be transferred from the master transformed human epithelial amnion......, this comprehensive database will outline an integrated picture of the expression levels and properties of the thousands of protein components of organelles, pathways and cytoskeletal systems that may be directly or indirectly involved in properties associated with the transformed state. Udgivelsesdato: 1990-Dec...

  6. Xenobiotic metabolism capacities of human skin in comparison with a 3D-epidermis model and keratinocyte-based cell culture as in vitro alternatives for chemical testing: phase II enzymes.

    Science.gov (United States)

    Götz, Christine; Pfeiffer, Roland; Tigges, Julia; Ruwiedel, Karsten; Hübenthal, Ulrike; Merk, Hans F; Krutmann, Jean; Edwards, Robert J; Abel, Josef; Pease, Camilla; Goebel, Carsten; Hewitt, Nicola; Fritsche, Ellen

    2012-05-01

    The 7th Amendment to the EU Cosmetics Directive prohibits the use of animals in cosmetic testing for certain endpoints, such as genotoxicity. Therefore, skin in vitro models have to replace chemical testing in vivo. However, the metabolic competence neither of human skin nor of alternative in vitro models has so far been fully characterized, although skin is the first-pass organ for accidentally or purposely (cosmetics and pharmaceuticals) applied chemicals. Thus, there is an urgent need to understand the xenobiotic-metabolizing capacities of human skin and to compare these activities to models developed to replace animal testing. We have measured the activity of the phase II enzymes glutathione S-transferase, UDP-glucuronosyltransferase and N-acetyltransferase in ex vivo human skin, the 3D epidermal model EpiDerm 200 (EPI-200), immortalized keratinocyte-based cell lines (HaCaT and NCTC 2544) and primary normal human epidermal keratinocytes. We show that all three phase II enzymes are present and highly active in skin as compared to phase I. Human skin, therefore, represents a more detoxifying than activating organ. This work systematically compares the activities of three important phase II enzymes in four different in vitro models directly to human skin. We conclude from our studies that 3D epidermal models, like the EPI-200 employed here, are superior over monolayer cultures in mimicking human skin xenobiotic metabolism and thus better suited for dermatotoxicity testing. © 2012 John Wiley & Sons A/S.

  7. Ultraviolet radiation (UVR) induces cell-surface Ro/SSA antigen expression by human keratinocytes in vitro: a possible mechanism for the UVR induction of cutaneous lupus lesions

    International Nuclear Information System (INIS)

    Jones, S.K.

    1992-01-01

    Antinuclear antibodies are useful markers of connective tissue disease. In this study, UVB but not UVA induced the expression of Ro/SSA antigen on keratinocyte surfaces in vitro. This expression was also found with the extractable nuclear antigens RnP and Sm, but not with single or double-stranded DNA. The expression was prevented by blocking protein synthesis, suggesting that it was an active process. The results suggest that UVB exposure may result in the expression of Ro/SSA antigen on the surfaces of basal keratinocytes in vivo. This antigen could then bind circulating antibody leading to the cutaneous lesions in neonatal and subacute cutaneous lupus erythematosus. (Author)

  8. Shining a Light on Black Holes in Keratinocytes.

    Science.gov (United States)

    Bowman, Shanna L; Marks, Michael S

    2018-03-01

    The mechanisms by which melanins are transferred from melanocytes and stored within keratinocytes to generate skin pigmentation are hotly debated. Correia et al. and Hurbain et al. provide evidence that melanin cores of melanosomes are secreted from melanocytes and taken up and stored within non-degradative membranous organelles in keratinocytes in the basal epidermis of human skin. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  9. Multisoliton formula for completely integrable two-dimensional systems

    International Nuclear Information System (INIS)

    Chudnovsky, D.V.; Chudnovsky, G.V.

    1979-01-01

    For general two-dimensional completely integrable systems, the exact formulae for multisoliton type solutions are given. The formulae are obtained algebrically from solutions of two linear partial differential equations

  10. Two-dimensional electronic femtosecond stimulated Raman spectroscopy

    Directory of Open Access Journals (Sweden)

    Ogilvie J.P.

    2013-03-01

    Full Text Available We report two-dimensional electronic spectroscopy with a femtosecond stimulated Raman scattering probe. The method reveals correlations between excitation energy and excited state vibrational structure following photoexcitation. We demonstrate the method in rhodamine 6G.

  11. Micromachined two dimensional resistor arrays for determination of gas parameters

    NARCIS (Netherlands)

    van Baar, J.J.J.; Verwey, Willem B.; Dijkstra, Mindert; Dijkstra, Marcel; Wiegerink, Remco J.; Lammerink, Theodorus S.J.; Krijnen, Gijsbertus J.M.; Elwenspoek, Michael Curt

    A resistive sensor array is presented for two dimensional temperature distribution measurements in a micromachined flow channel. This allows simultaneous measurement of flow velocity and fluid parameters, like thermal conductivity, diffusion coefficient and viscosity. More general advantages of

  12. Generalized similarity method in unsteady two-dimensional MHD ...

    African Journals Online (AJOL)

    user

    International Journal of Engineering, Science and Technology. Vol. 1, No. 1, 2009 ... temperature two-dimensional MHD laminar boundary layer of incompressible fluid. ...... Φ η is Blasius solution for stationary boundary layer on the plate,. ( ). 0.

  13. Topological aspect of disclinations in two-dimensional crystals

    International Nuclear Information System (INIS)

    Wei-Kai, Qi; Tao, Zhu; Yong, Chen; Ji-Rong, Ren

    2009-01-01

    By using topological current theory, this paper studies the inner topological structure of disclinations during the melting of two-dimensional systems. From two-dimensional elasticity theory, it finds that there are topological currents for topological defects in homogeneous equation. The evolution of disclinations is studied, and the branch conditions for generating, annihilating, crossing, splitting and merging of disclinations are given. (the physics of elementary particles and fields)

  14. Structures of two-dimensional three-body systems

    International Nuclear Information System (INIS)

    Ruan, W.Y.; Liu, Y.Y.; Bao, C.G.

    1996-01-01

    Features of the structure of L = 0 states of a two-dimensional three-body model system have been investigated. Three types of permutation symmetry of the spatial part, namely symmetric, antisymmetric, and mixed, have been considered. A comparison has been made between the two-dimensional system and the corresponding three-dimensional one. The effect of symmetry on microscopic structures is emphasized. (author)

  15. Study on two-dimensional induced signal readout of MRPC

    International Nuclear Information System (INIS)

    Wu Yucheng; Yue Qian; Li Yuanjing; Ye Jin; Cheng Jianping; Wang Yi; Li Jin

    2012-01-01

    A kind of two-dimensional readout electrode structure for the induced signal readout of MRPC has been studied in both simulation and experiments. Several MRPC prototypes are produced and a series of test experiments have been done to compare with the result of simulation, in order to verify the simulation model. The experiment results are in good agreement with those of simulation. This method will be used to design the two-dimensional signal readout mode of MRPC in the future work.

  16. Controlled Interactions between Two Dimensional Layered Inorganic Nanosheets and Polymers

    Science.gov (United States)

    2016-06-15

    AFRL-AFOSR-JP-TR-2016-0071 Controlled Interactions between Two Dimensional Layered Inorganic Nanosheets and Polymers Cheolmin Park YONSEI UNIVERSITY...Interactions between Two Dimensional Layered Inorganic Nanosheets and Polymers 5a.  CONTRACT NUMBER 5b.  GRANT NUMBER FA2386-14-1-4054 5c.  PROGRAM ELEMENT...prospects for a variety of emerging applications in a broad range of fields, such as electronics, energy conversion and storage, catalysis and polymer

  17. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  18. Toxicity of jet fuel aliphatic and aromatic hydrocarbon mixtures on human epidermal Keratinocytes: evaluation based on in vitro cytotoxicity and interleukin-8 release

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Jen-Hung (Chung-Shan Medical University Hospital, Department of Dermatology, Taichung, Taiwan, R.O.C); Lee, Chia-Hue; Tsang, Chau-Loong [National Chung-Hsing University, College of Veterinary Medicine, Taichung (Taiwan); Monteiro-Riviere, Nancy A.; Riviere, Jim E. [North Carolina State University, Center for Chemical Toxicology Research and Pharmacokinetics (CCTRP), Raleigh, NC (United States); Chou, Chi-Chung [National Chung-Hsing University, College of Veterinary Medicine, Taichung (Taiwan); National Chung-Hsing University, College of Veterinary Medicine, Taichung (Taiwan)

    2006-08-15

    Jet fuels are complex mixtures of aliphatic (ALI) and aromatic (ARO) hydrocarbons that vary significantly in individual cytotoxicity and proinflammatory activity in human epidermal keratinocytes (HEK). In order to delineate the toxicological interactions among individual hydrocarbons in a mixture and their contributions to cutaneous toxicity, nine ALI and five ARO hydrocarbons were each divided into five (high/medium/low cytotoxic and strong/weak IL-8 induction) groups and intra/inter-mixed to assess for their mixture effects on HEK mortality and IL-8 release. Addition of single hydrocarbon to JP-8 fuel was also evaluated for their changes in fuel dermatotoxicity. The results indicated that when hydrocarbons were mixed, HEK mortality and IL-8 release were not all predictable by their individual ability affecting these two parameters. The lowest HEK mortality (7%) and the highest IL-8 production were induced with mixtures including high cytotoxic and weak IL-8 inductive ARO hydrocarbons. Antagonistic reactions not consistently correlated with ALI carbon chain length and ARO structure were evident and carried different weight in the overall mixture toxicities. Single addition of benzene, toluene, xylene or ethylbenzene for up to tenfold in JP-8 did not increase HEK mortality while single addition of ALI hydrocarbons exhibited dose-related differential response in IL-8. In an all ALI environment, no single hydrocarbon is the dominating factor in the determination of HEK cytotoxicity while deletion of hexadecane resulted in a 2.5-fold increase in IL-8 production. Overall, decane, undecane and dodecane were the major hydrocarbons associated with high cytotoxicity while tetradecane, pentadecane and hexadecane were those which had the greatest buffering effect attenuating dermatotoxicity. The mixture effects must be considered when evaluating jet fuel toxicity to HEK. (orig.)

  19. Direct biological effects of fractional ultrapulsed CO2 laser irradiation on keratinocytes and fibroblasts in human organotypic full-thickness 3D skin models.

    Science.gov (United States)

    Schmitt, L; Huth, S; Amann, P M; Marquardt, Y; Heise, R; Fietkau, K; Huth, L; Steiner, T; Hölzle, F; Baron, J M

    2018-05-01

    Molecular effects of various ablative and non-ablative laser treatments on human skin cells-especially primary effects on epidermal keratinocytes and dermal fibroblasts-are not yet fully understood. We present the first study addressing molecular effects of fractional non-sequential ultrapulsed CO 2 laser treatment using a 3D skin model that allows standardized investigations of time-dependent molecular changes ex vivo. While histological examination was performed to assess morphological changes, we utilized gene expression profiling using microarray and qRT-PCR analyses to identify molecular effects of laser treatment. Irradiated models exhibited dose-dependent morphological changes resulting in an almost complete recovery of the epidermis 5 days after irradiation. On day 5 after laser injury with a laser fluence of 100 mJ/cm 2 , gene array analysis identified an upregulation of genes associated with tissue remodeling and wound healing (e.g., COL12A1 and FGF7), genes that are involved in the immune response (e.g., CXCL12 and CCL8) as well as members of the heat shock protein family (e.g., HSPB3). On the other hand, we detected a downregulation of matrix metalloproteinases (e.g., MMP3), differentiation markers (e.g., LOR and S100A7), and the pro-inflammatory cytokine IL1α.Overall, our findings substantiate the understanding of time-dependent molecular changes after CO 2 laser treatment. The utilized 3D skin model system proved to be a reliable, accurate, and reproducible tool to explore the effects of various laser settings both on skin morphology and gene expression during wound healing.

  20. The theory of critical phenomena in two-dimensional systems

    International Nuclear Information System (INIS)

    Olvera de la C, M.

    1981-01-01

    An exposition of the theory of critical phenomena in two-dimensional physical systems is presented. The first six chapters deal with the mean field theory of critical phenomena, scale invariance of the thermodynamic functions, Kadanoff's spin block construction, Wilson's renormalization group treatment of critical phenomena in configuration space, and the two-dimensional Ising model on a triangular lattice. The second part of this work is made of four chapters devoted to the application of the ideas expounded in the first part to the discussion of critical phenomena in superfluid films, two-dimensional crystals and the two-dimensional XY model of magnetic systems. Chapters seven to ten are devoted to the following subjects: analysis of long range order in one, two, and three-dimensional physical systems. Topological defects in the XY model, in superfluid films and in two-dimensional crystals. The Thouless-Kosterlitz iterated mean field theory of the dipole gas. The renormalization group treatment of the XY model, superfluid films and two-dimensional crystal. (author)

  1. Two-dimensional multifractal cross-correlation analysis

    International Nuclear Information System (INIS)

    Xi, Caiping; Zhang, Shuning; Xiong, Gang; Zhao, Huichang; Yang, Yonghong

    2017-01-01

    Highlights: • We study the mathematical models of 2D-MFXPF, 2D-MFXDFA and 2D-MFXDMA. • Present the definition of the two-dimensional N 2 -partitioned multiplicative cascading process. • Do the comparative analysis of 2D-MC by 2D-MFXPF, 2D-MFXDFA and 2D-MFXDMA. • Provide a reference on the choice and parameter settings of these methods in practice. - Abstract: There are a number of situations in which several signals are simultaneously recorded in complex systems, which exhibit long-term power-law cross-correlations. This paper presents two-dimensional multifractal cross-correlation analysis based on the partition function (2D-MFXPF), two-dimensional multifractal cross-correlation analysis based on the detrended fluctuation analysis (2D-MFXDFA) and two-dimensional multifractal cross-correlation analysis based on the detrended moving average analysis (2D-MFXDMA). We apply these methods to pairs of two-dimensional multiplicative cascades (2D-MC) to do a comparative study. Then, we apply the two-dimensional multifractal cross-correlation analysis based on the detrended fluctuation analysis (2D-MFXDFA) to real images and unveil intriguing multifractality in the cross correlations of the material structures. At last, we give the main conclusions and provide a valuable reference on how to choose the multifractal algorithms in the potential applications in the field of SAR image classification and detection.

  2. Two-Dimensional Materials for Sensing: Graphene and Beyond

    Directory of Open Access Journals (Sweden)

    Seba Sara Varghese

    2015-09-01

    Full Text Available Two-dimensional materials have attracted great scientific attention due to their unusual and fascinating properties for use in electronics, spintronics, photovoltaics, medicine, composites, etc. Graphene, transition metal dichalcogenides such as MoS2, phosphorene, etc., which belong to the family of two-dimensional materials, have shown great promise for gas sensing applications due to their high surface-to-volume ratio, low noise and sensitivity of electronic properties to the changes in the surroundings. Two-dimensional nanostructured semiconducting metal oxide based gas sensors have also been recognized as successful gas detection devices. This review aims to provide the latest advancements in the field of gas sensors based on various two-dimensional materials with the main focus on sensor performance metrics such as sensitivity, specificity, detection limit, response time, and reversibility. Both experimental and theoretical studies on the gas sensing properties of graphene and other two-dimensional materials beyond graphene are also discussed. The article concludes with the current challenges and future prospects for two-dimensional materials in gas sensor applications.

  3. Non-parametric comparison of histogrammed two-dimensional data distributions using the Energy Test

    International Nuclear Information System (INIS)

    Reid, Ivan D; Lopes, Raul H C; Hobson, Peter R

    2012-01-01

    When monitoring complex experiments, comparison is often made between regularly acquired histograms of data and reference histograms which represent the ideal state of the equipment. With the larger HEP experiments now ramping up, there is a need for automation of this task since the volume of comparisons could overwhelm human operators. However, the two-dimensional histogram comparison tools available in ROOT have been noted in the past to exhibit shortcomings. We discuss a newer comparison test for two-dimensional histograms, based on the Energy Test of Aslan and Zech, which provides more conclusive discrimination between histograms of data coming from different distributions than methods provided in a recent ROOT release.

  4. Y chromosome and vimentin used to trace the fate of allogeneic keratinocytes delivered to the wound by the recombined human/pig skin

    Czech Academy of Sciences Publication Activity Database

    Pokorná, Eva; Brož, L.; Veselý, Pavel; Matoušková, Eva

    2001-01-01

    Roč. 47, č. 4 (2001), s. 128-134 ISSN 0015-5500 R&D Projects: GA MZd IZ4368; GA MZd NK6126 Keywords : allogeneic keratinocytes * xenodermis * Y-chromosome FISH Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 0.519, year: 2001

  5. Establishment of primary keratinocyte culture from horse tissue biopsates

    Directory of Open Access Journals (Sweden)

    Jernej OGOREVC

    2015-12-01

    Full Text Available Primary cell lines established from skin tissue can be used in immunological, proteomic and genomic studies as in vitro skin models. The goal of our study was to establish a primary keratinocyte cell culture from tissue biopsates of two horses. The primary keratinocyte cell culture was obtained by mechanical and enzymatic dissociation and with explant culture method. The result was a heterogeneous primary culture comprised of keratinocytes and fibroblasts. To distinguish epithelial and mesenchymal cells immunofluorescent characterisation was performed, using antibodies against cytokeratin 14 and vimentin. We successfully at attained a primary cell line of keratinocytes, which could potentially be used to study equine skin diseases, as an animal model for human diseases, and for cosmetic and therapeutic product testing.

  6. Keratinocytes at the uppermost layer of epidermis might act as sensors of atmospheric pressure change.

    Science.gov (United States)

    Denda, Mitsuhiro

    2016-01-01

    It has long been suggested that climate, especially atmospheric pressure change, can cause health problems ranging from migraine to myocardial infarction. Here, I hypothesize that the sensory system of epidermal keratinocytes mediates the influence of atmospheric pressure change on the human physiological condition. We previously demonstrated that even subtle changes of atmospheric pressure (5-20 hPa) induce elevation of intracellular calcium level in cultured human keratinocytes (excitation of keratinocytes). It is also established that communication occurs between epidermal keratinocytes and peripheral nerve systems. Moreover, various neurotransmitters and hormones that influence multiple systems (nervous, cardiovascular, endocrine, and immune systems) are generated and released from epidermal keratinocytes in response to various external stimuli. Thus, I suggest that pathophysiological phenomena induced by atmospheric pressure changes might be triggered by epidermal keratinocytes.

  7. 20-Hydroxycholecalciferol, product of vitamin D3 hydroxylation by P450scc, decreases NF-kappaB activity by increasing IkappaB alpha levels in human keratinocytes.

    Directory of Open Access Journals (Sweden)

    Zorica Janjetovic

    Full Text Available The side chain of vitamin D3 is hydroxylated in a sequential manner by cytochrome P450scc (CYP11A1 to form 20-hydroxycholecalciferol, which can induce growth arrest and differentiation of both primary and immortalized epidermal keratinocytes. Since nuclear factor-kappaB (NF-kappaB plays a pivotal role in the regulation of cell proliferation, differentiation and apoptosis, we examined the capability of 20-hydroxycholecalciferol to modulate the activity of NF-kappaB, using 1,25-dihydroxycholecalciferol (calcitriol as a positive control. 20-hydroxycholecalciferol inhibits the activation of NFkappaB DNA binding activity as well as NF-kappaB-driven reporter gene activity in keratinocytes. Also, 20-hydroxycholecalciferol induced significant increases in the mRNA and protein levels of the NF-kappaB inhibitor protein, IkappaB alpha, in a time dependent manner, while no changes in total NF-kappaB-p65 mRNA or protein levels were observed. Another measure of NF-kappaB activity, p65 translocation from the cytoplasm into the nucleus was also inhibited in extracts of 20-hydroxycholecalciferol treated keratinocytes. Increased IkappaB alpha was concomitantly observed in cytosolic extracts of 20-hydroxycholecalciferol treated keratinocytes, as determined by immunoblotting and immunofluorescent staining. In keratinocytes lacking vitamin D receptor (VDR, 20-hydroxycholecalciferol did not affect IkappaB alpha mRNA levels, indicating that it requires VDR for its action on NF-kappaB activity. Comparison of the effects of calcitrol, hormonally active form of vitamin D3, with 20-hydrocholecalciferol show that both agents have a similar potency in inhibiting NF-kappaB. Since NF-kappaB is a major transcription factor for the induction of inflammatory mediators, our findings indicate that 20-hydroxycholecalciferol may be an effective therapeutic agent for inflammatory and hyperproliferative skin diseases.

  8. Traditional Semiconductors in the Two-Dimensional Limit.

    Science.gov (United States)

    Lucking, Michael C; Xie, Weiyu; Choe, Duk-Hyun; West, Damien; Lu, Toh-Ming; Zhang, S B

    2018-02-23

    Interest in two-dimensional materials has exploded in recent years. Not only are they studied due to their novel electronic properties, such as the emergent Dirac fermion in graphene, but also as a new paradigm in which stacking layers of distinct two-dimensional materials may enable different functionality or devices. Here, through first-principles theory, we reveal a large new class of two-dimensional materials which are derived from traditional III-V, II-VI, and I-VII semiconductors. It is found that in the ultrathin limit the great majority of traditional binary semiconductors studied (a series of 28 semiconductors) are not only kinetically stable in a two-dimensional double layer honeycomb structure, but more energetically stable than the truncated wurtzite or zinc-blende structures associated with three dimensional bulk. These findings both greatly increase the landscape of two-dimensional materials and also demonstrate that in the double layer honeycomb form, even ordinary semiconductors, such as GaAs, can exhibit exotic topological properties.

  9. Two-dimensional analytic weighting functions for limb scattering

    Science.gov (United States)

    Zawada, D. J.; Bourassa, A. E.; Degenstein, D. A.

    2017-10-01

    Through the inversion of limb scatter measurements it is possible to obtain vertical profiles of trace species in the atmosphere. Many of these inversion methods require what is often referred to as weighting functions, or derivatives of the radiance with respect to concentrations of trace species in the atmosphere. Several radiative transfer models have implemented analytic methods to calculate weighting functions, alleviating the computational burden of traditional numerical perturbation methods. Here we describe the implementation of analytic two-dimensional weighting functions, where derivatives are calculated relative to atmospheric constituents in a two-dimensional grid of altitude and angle along the line of sight direction, in the SASKTRAN-HR radiative transfer model. Two-dimensional weighting functions are required for two-dimensional inversions of limb scatter measurements. Examples are presented where the analytic two-dimensional weighting functions are calculated with an underlying one-dimensional atmosphere. It is shown that the analytic weighting functions are more accurate than ones calculated with a single scatter approximation, and are orders of magnitude faster than a typical perturbation method. Evidence is presented that weighting functions for stratospheric aerosols calculated under a single scatter approximation may not be suitable for use in retrieval algorithms under solar backscatter conditions.

  10. Dynamical class of a two-dimensional plasmonic Dirac system.

    Science.gov (United States)

    Silva, Érica de Mello

    2015-10-01

    A current goal in plasmonic science and technology is to figure out how to manage the relaxational dynamics of surface plasmons in graphene since its damping constitutes a hinder for the realization of graphene-based plasmonic devices. In this sense we believe it might be of interest to enlarge the knowledge on the dynamical class of two-dimensional plasmonic Dirac systems. According to the recurrence relations method, different systems are said to be dynamically equivalent if they have identical relaxation functions at all times, and such commonality may lead to deep connections between seemingly unrelated physical systems. We employ the recurrence relations approach to obtain relaxation and memory functions of density fluctuations and show that a two-dimensional plasmonic Dirac system at long wavelength and zero temperature belongs to the same dynamical class of standard two-dimensional electron gas and classical harmonic oscillator chain with an impurity mass.

  11. Hamiltonian formalism of two-dimensional Vlasov kinetic equation.

    Science.gov (United States)

    Pavlov, Maxim V

    2014-12-08

    In this paper, the two-dimensional Benney system describing long wave propagation of a finite depth fluid motion and the multi-dimensional Russo-Smereka kinetic equation describing a bubbly flow are considered. The Hamiltonian approach established by J. Gibbons for the one-dimensional Vlasov kinetic equation is extended to a multi-dimensional case. A local Hamiltonian structure associated with the hydrodynamic lattice of moments derived by D. J. Benney is constructed. A relationship between this hydrodynamic lattice of moments and the two-dimensional Vlasov kinetic equation is found. In the two-dimensional case, a Hamiltonian hydrodynamic lattice for the Russo-Smereka kinetic model is constructed. Simple hydrodynamic reductions are presented.

  12. Control Operator for the Two-Dimensional Energized Wave Equation

    Directory of Open Access Journals (Sweden)

    Sunday Augustus REJU

    2006-07-01

    Full Text Available This paper studies the analytical model for the construction of the two-dimensional Energized wave equation. The control operator is given in term of space and time t independent variables. The integral quadratic objective cost functional is subject to the constraint of two-dimensional Energized diffusion, Heat and a source. The operator that shall be obtained extends the Conjugate Gradient method (ECGM as developed by Hestenes et al (1952, [1]. The new operator enables the computation of the penalty cost, optimal controls and state trajectories of the two-dimensional energized wave equation when apply to the Conjugate Gradient methods in (Waziri & Reju, LEJPT & LJS, Issues 9, 2006, [2-4] to appear in this series.

  13. Velocity and Dispersion for a Two-Dimensional Random Walk

    International Nuclear Information System (INIS)

    Li Jinghui

    2009-01-01

    In the paper, we consider the transport of a two-dimensional random walk. The velocity and the dispersion of this two-dimensional random walk are derived. It mainly show that: (i) by controlling the values of the transition rates, the direction of the random walk can be reversed; (ii) for some suitably selected transition rates, our two-dimensional random walk can be efficient in comparison with the one-dimensional random walk. Our work is motivated in part by the challenge to explain the unidirectional transport of motor proteins. When the motor proteins move at the turn points of their tracks (i.e., the cytoskeleton filaments and the DNA molecular tubes), some of our results in this paper can be used to deal with the problem. (general)

  14. Platelet-Released Growth Factors Induce Differentiation of Primary Keratinocytes

    Science.gov (United States)

    Tohidnezhad, Mersedeh; Lammel, Justus; Lippross, Sebastian; Behrendt, Peter; Klüter, Tim; Pufe, Thomas; Jahr, Holger; Cremer, Jochen; Rademacher, Franziska; Gläser, Regine; Harder, Jürgen

    2017-01-01

    Autologous thrombocyte concentrate lysates, for example, platelet-released growth factors, (PRGFs) or their clinically related formulations (e.g., Vivostat PRF®) came recently into the physicians' focus as they revealed promising effects in regenerative and reparative medicine such as the support of healing of chronic wounds. To elucidate the underlying mechanisms, we analyzed the influence of PRGF and Vivostat PRF on human keratinocyte differentiation in vitro and on epidermal differentiation status of skin wounds in vivo. Therefore, we investigated the expression of early (keratin 1 and keratin 10) and late (transglutaminase-1 and involucrin) differentiation markers. PRGF treatment of primary human keratinocytes decreased keratin 1 and keratin 10 gene expression but induced involucrin and transglutaminase-1 gene expression in an epidermal growth factor receptor- (EGFR-) dependent manner. In concordance with these results, microscopic analyses revealed that PRGF-treated human keratinocytes displayed morphological features typical of keratinocytes undergoing terminal differentiation. In vivo treatment of artificial human wounds with Vivostat PRF revealed a significant induction of involucrin and transglutaminase-1 gene expression. Together, our results indicate that PRGF and Vivostat PRF induce terminal differentiation of primary human keratinocytes. This potential mechanism may contribute to the observed beneficial effects in the treatment of hard-to-heal wounds with autologous thrombocyte concentrate lysates in vivo. PMID:28808357

  15. Platelet-Released Growth Factors Induce Differentiation of Primary Keratinocytes

    Directory of Open Access Journals (Sweden)

    Andreas Bayer

    2017-01-01

    Full Text Available Autologous thrombocyte concentrate lysates, for example, platelet-released growth factors, (PRGFs or their clinically related formulations (e.g., Vivostat PRF® came recently into the physicians’ focus as they revealed promising effects in regenerative and reparative medicine such as the support of healing of chronic wounds. To elucidate the underlying mechanisms, we analyzed the influence of PRGF and Vivostat PRF on human keratinocyte differentiation in vitro and on epidermal differentiation status of skin wounds in vivo. Therefore, we investigated the expression of early (keratin 1 and keratin 10 and late (transglutaminase-1 and involucrin differentiation markers. PRGF treatment of primary human keratinocytes decreased keratin 1 and keratin 10 gene expression but induced involucrin and transglutaminase-1 gene expression in an epidermal growth factor receptor- (EGFR- dependent manner. In concordance with these results, microscopic analyses revealed that PRGF-treated human keratinocytes displayed morphological features typical of keratinocytes undergoing terminal differentiation. In vivo treatment of artificial human wounds with Vivostat PRF revealed a significant induction of involucrin and transglutaminase-1 gene expression. Together, our results indicate that PRGF and Vivostat PRF induce terminal differentiation of primary human keratinocytes. This potential mechanism may contribute to the observed beneficial effects in the treatment of hard-to-heal wounds with autologous thrombocyte concentrate lysates in vivo.

  16. HPV16-E2 protein modifies self-renewal and differentiation rate in progenitor cells of human immortalized keratinocytes.

    Science.gov (United States)

    Domínguez-Catzín, Victoria; Reveles-Espinoza, Alicia-María; Sánchez-Ramos, Janet; Cruz-Cadena, Raúl; Lemus-Hernández, Diana; Garrido, Efraín

    2017-04-03

    Cervical cancer is the fourth cause of death worldwide by cancer in women and is a disease associated to persistent infection with human papillomavirus (HPV), particularly from two high-risk types HPV16 and 18. The virus initiates its replicative cycle infecting cells located in the basal layer of the epithelium, where a small population of epithelial stem cells is located performing important functions of renewal and maintenance of the tissue. Viral E2 gene is one of the first expressed after infection and plays relevant roles in the replicative cycle of the virus, modifying fundamental processes in the infected cells. Thus, the aim of the present study was to demonstrate the presence of hierarchic subpopulations in HaCaT cell line and evaluate the effect of HPV16-E2 expression, on their biological processes. HaCaT-HPV16-E2 cells were generated by transduction of HaCaT cell line with a lentiviral vector. The α6-integrin-CD71 expression profile was established by immunostaining and flow cytometric analysis. After sorting, cell subpopulations were analyzed in biological assays for self-renewal, clonogenicity and expression of stemness factors (RT-qPCR). We identified in HaCaT cell line three different subpopulations that correspond to early differentiated cells (α6-integrin dim ), transitory amplifying cells (α6-integrin bri /CD71 bri ) and progenitor cells (α6-integrin bri /CD71 dim ). The last subpopulation showed stem cell characteristics, such as self-renewal ability, clonogenicity and expression of the well-known stem cell factors SOX2, OCT4 and NANOG, suggesting they are stem-like cells. Interestingly, the expression of HPV16-E2 in HaCaT cells changed its α6-integrin-CD71 immunophenotype modifying the relative abundance of the cell subpopulations, reducing significantly the percentage of α6-integrin bri /CD71 dim cells. Moreover, the expression of the stem cell markers was also modified, increasing the expression of SOX2 and NANOG, but decreasing notably

  17. Two-dimensional nonlinear equations of supersymmetric gauge theories

    International Nuclear Information System (INIS)

    Savel'ev, M.V.

    1985-01-01

    Supersymmetric generalization of two-dimensional nonlinear dynamical equations of gauge theories is presented. The nontrivial dynamics