WorldWideScience

Sample records for human immortalized keratinocytes

  1. Immortalization of human foreskin keratinocytes by various human papillomavirus DNAs corresponds to their association with cervical carcinoma

    Energy Technology Data Exchange (ETDEWEB)

    Woodworth, C.D.; Doniger, J.; DiPaolo, J.A.

    1989-01-01

    Normal human foreskin keratinocytes cotransfected with the neomycin resistance gene and recombinant human papillomavirus (HPV) DNAs (types 16, 18, 31, and 33) that have a high or moderate association with cervical malignancy acquired immortality and contained integrated and transcriptionally active viral genomes. Only transcripts from the intact E6 and E7 genes were detected in at least one cell line, suggesting that one or both of these genes are responsible for immortalization. Recombinant HPV DNAs with low or no oncogenic potential for cervical cancer (HPV1a, -5, -6b, and -11) induced small G418-resistant colonies that senesced as did the nontransfected cells. These colonies contained only episomal virus DNA; therefore, integration of HPV sequences is important for immortalization of keratinocytes. This study suggests that the virus-encoded immortalization function contributes to the pathogenesis of cervical carcinoma.

  2. Postirradiation expression of lethal mutations in an immortalized human keratinocyte cell line

    International Nuclear Information System (INIS)

    O'Reilly, S.; Mothersill, C.; Seymour, C.B.

    1994-01-01

    The quantification of the extent of delayed cell death and the rate and pattern of its occurrence in relation to the cell division cycle is important in radiotherapy and also in radiation transformation studies related to protection and dose limits. Here the numbers of lethal mutations occurring over 45 population doublings (clonal expansion to about 10 13 cells per cell originally surviving irradiation) was measured in an HPV 16 immortalized human keratinocyte cell lines used for transformation studies. The results showed that when postirradiation (dose range 1-6 Gy) growth curves were constructed, the difference in slopes could be accounted for entirely by correcting for the non-clonogenic fraction in the cell count, excluding a longer cell generation time as an explanation. When the cell loss was examined over the entire growth period of 6 weeks (about 45 doublings of the cell population), it was found to be dose dependent for the first two passages, but then to become more independent of dose. The results allow a time/cell generation dependent factor to be derived for the cell line and used in survival curve equations where effects of radiation are being measured at times distant from the original exposure. (author)

  3. Human papillomavirus type 59 immortalized keratinocytes express late viral proteins and infectious virus after calcium stimulation

    International Nuclear Information System (INIS)

    Lehr, Elizabeth E.; Qadadri, Brahim; Brown, Calla R.; Brown, Darron R.

    2003-01-01

    Human papillomavirus type 59 (HPV 59) is an oncogenic type related to HPV 18. HPV 59 was recently propagated in the athymic mouse xenograft system. A continuous keratinocyte cell line infected with HPV 59 was created from a foreskin xenograft grown in an athymic mouse. Cells were cultured beyond passage 50. The cells were highly pleomorphic, containing numerous abnormally shaped nuclei and mitotic figures. HPV 59 sequences were detected in the cells by DNA in situ hybridization in a diffuse nuclear distribution. Southern blots were consistent with an episomal state of HPV 59 DNA at approximately 50 copies per cell. Analysis of the cells using a PCR/reverse blot strip assay, which amplifies a portion of the L1 open reading frame, was strongly positive. Differentiation of cells in monolayers was induced by growth in F medium containing 2 mM calcium chloride for 10 days. Cells were harvested as a single tissue-like sheet, and histologic analysis revealed a four-to-six cell-thick layer. Transcripts encoding involucrin, a cornified envelope protein, and the E1-circumflexE4 and E1-circumflexE4-circumflexL1 viral transcripts were detected after several days of growth in F medium containing 2 mM calcium chloride. The E1-circumflexE4 and L1 proteins were detected by immunohistochemical analysis, and virus particles were seen in electron micrographs in a subset of differentiated cells. An extract of differentiated cells was prepared by vigorous sonication and was used to infect foreskin fragments. These fragments were implanted into athymic mice. HPV 59 was detected in the foreskin xenografts removed 4 months later by DNA in situ hybridization and PCR/reverse blot assay. Thus, the complete viral growth cycle, including production on infectious virus, was demonstrated in the HPV 59 immortalized cells grown in a simple culture system

  4. PCB153 reduces telomerase activity and telomere length in immortalized human skin keratinocytes (HaCaT) but not in human foreskin keratinocytes (NFK)

    International Nuclear Information System (INIS)

    Senthilkumar, P.K.; Robertson, L.W.; Ludewig, G.

    2012-01-01

    Polychlorinated biphenyls (PCBs), ubiquitous environmental pollutants, are characterized by long term-persistence in the environment, bioaccumulation, and biomagnification in the food chain. Exposure to PCBs may cause various diseases, affecting many cellular processes. Deregulation of the telomerase and the telomere complex leads to several biological disorders. We investigated the hypothesis that PCB153 modulates telomerase activity, telomeres and reactive oxygen species resulting in the deregulation of cell growth. Exponentially growing immortal human skin keratinocytes (HaCaT) and normal human foreskin keratinocytes (NFK) were incubated with PCB153 for 48 and 24 days, respectively, and telomerase activity, telomere length, superoxide level, cell growth, and cell cycle distribution were determined. In HaCaT cells exposure to PCB153 significantly reduced telomerase activity, telomere length, cell growth and increased intracellular superoxide levels from day 6 to day 48, suggesting that superoxide may be one of the factors regulating telomerase activity, telomere length and cell growth compared to untreated control cells. Results with NFK cells showed no shortening of telomere length but reduced cell growth and increased superoxide levels in PCB153-treated cells compared to untreated controls. As expected, basal levels of telomerase activity were almost undetectable, which made a quantitative comparison of treated and control groups impossible. The significant down regulation of telomerase activity and reduction of telomere length by PCB153 in HaCaT cells suggest that any cell type with significant telomerase activity, like stem cells, may be at risk of premature telomere shortening with potential adverse health effects for the affected organism. -- Highlights: ► Human immortal (HaCaT) and primary (NFK) keratinocytes were exposed to PCB153. ► PCB153 significantly reduced telomerase activity and telomere length in HaCaT. ► No effect on telomere length and

  5. Ski protein levels increase during in vitro progression of HPV16-immortalized human keratinocytes and in cervical cancer

    International Nuclear Information System (INIS)

    Chen, Yi; Pirisi, Lucia; Creek, Kim E.

    2013-01-01

    We compared the levels of the Ski oncoprotein, an inhibitor of transforming growth factor-beta (TGF-β) signaling, in normal human keratinocytes (HKc), HPV16 immortalized HKc (HKc/HPV16), and differentiation resistant HKc/HPV16 (HKc/DR) in the absence and presence of TGF-β. Steady-state Ski protein levels increased in HKc/HPV16 and even further in HKc/DR, compared to HKc. TGF-β treatment of HKc, HKc/HPV16, and HKc/DR dramatically decreased Ski. TGF-β-induced Ski degradation was delayed in HKc/DR. Ski and phospho-Ski protein levels are cell cycle dependent with maximal Ski expression and localization to centrosomes and mitotic spindles during G2/M. ShRNA knock down of Ski in HKc/DR inhibited cell proliferation. More intense nuclear and cytoplasmic Ski staining and altered Ski localization were found in cervical cancer samples compared to adjacent normal tissue in a cervical cancer tissue array. Overall, these studies demonstrate altered Ski protein levels, degradation and localization in HPV16-transformed human keratinocytes and in cervical cancer. - Highlights: • Ski oncoprotein levels increase during progression of HPV16-transformed cells. • Ski and phospho-Ski protein levels are cell cycle dependent. • Ski knock-down in HPV16-transformed keratinocytes inhibited cell proliferation. • Cervical cancer samples overexpress Ski

  6. Large-scale analysis of protein expression changes in human keratinocytes immortalized by human papilloma virus type 16 E6 and E7 oncogenes

    Directory of Open Access Journals (Sweden)

    Arnouk Hilal

    2009-08-01

    Full Text Available Abstract Background Infection with high-risk type human papilloma viruses (HPVs is associated with cervical carcinomas and with a subset of head and neck squamous cell carcinomas. Viral E6 and E7 oncogenes cooperate to achieve cell immortalization by a mechanism that is not yet fully understood. Here, human keratinocytes were immortalized by long-term expression of HPV type 16 E6 or E7 oncoproteins, or both. Proteomic profiling was used to compare expression levels for 741 discrete protein features. Results Six replicate measurements were performed for each group using two-dimensional difference gel electrophoresis (2D-DIGE. The median within-group coefficient of variation was 19–21%. Significance of between-group differences was tested based on Significance Analysis of Microarray and fold change. Expression of 170 (23% of the protein features changed significantly in immortalized cells compared to primary keratinocytes. Most of these changes were qualitatively similar in cells immortalized by E6, E7, or E6/7 expression, indicating convergence on a common phenotype, but fifteen proteins (~2% were outliers in this regulatory pattern. Ten demonstrated opposite regulation in E6- and E7-expressing cells, including the cell cycle regulator p16INK4a; the carbohydrate binding protein Galectin-7; two differentially migrating forms of the intermediate filament protein Cytokeratin-7; HSPA1A (Hsp70-1; and five unidentified proteins. Five others had a pattern of expression that suggested cooperativity between the co-expressed oncoproteins. Two of these were identified as forms of the small heat shock protein HSPB1 (Hsp27. Conclusion This large-scale analysis provides a framework for understanding the cooperation between E6 and E7 oncoproteins in HPV-driven carcinogenesis.

  7. Progression from productive infection to integration and oncogenic transformation in human papillomavirus type 59-immortalized foreskin keratinocytes.

    Science.gov (United States)

    Spartz, Helena; Lehr, Elizabeth; Zhang, Benyue; Roman, Ann; Brown, Darron R

    2005-05-25

    Studies of changes in the virus and host cell upon progression from human papillomavirus (HPV) episomal infection to integration are critical to understanding HPV-related malignant transformation. However, there exist only a few in vitro models of both productive HPV infection and neoplastic progression on the same host background. We recently described a unique foreskin keratinocyte cell line (ERIN 59) that contains HPV 59 (a close relative of HPV 18). Early passages of ERIN 59 cells (passages 9-13) contained approximately 50 copies of episomes/cell, were feeder cell-dependent, and could be induced to differentiate and produce infectious virus in a simple culture system. We now report that late passage cells (passages greater than 50) were morphologically different from early passage cells, were feeder cell independent, and did not differentiate or produce virus. These late passage cells contained HPV in an integrated form. An integration-derived oncogene transcript was expressed in late passage cells. The E2 open reading frame was interrupted in this transcript at nucleotide 3351. Despite a lower viral genome copy number in late passage ERIN 59 cells, expression of E6/E7 oncogene transcripts was similar to early passage cells. We conclude that ERIN 59 cells are a valuable cell line representing a model of progression from HPV 59 episomal infection and virus production to HPV 59 integration and associated oncogenic transformation on the same host background.

  8. HPV16-E2 protein modifies self-renewal and differentiation rate in progenitor cells of human immortalized keratinocytes.

    Science.gov (United States)

    Domínguez-Catzín, Victoria; Reveles-Espinoza, Alicia-María; Sánchez-Ramos, Janet; Cruz-Cadena, Raúl; Lemus-Hernández, Diana; Garrido, Efraín

    2017-04-03

    Cervical cancer is the fourth cause of death worldwide by cancer in women and is a disease associated to persistent infection with human papillomavirus (HPV), particularly from two high-risk types HPV16 and 18. The virus initiates its replicative cycle infecting cells located in the basal layer of the epithelium, where a small population of epithelial stem cells is located performing important functions of renewal and maintenance of the tissue. Viral E2 gene is one of the first expressed after infection and plays relevant roles in the replicative cycle of the virus, modifying fundamental processes in the infected cells. Thus, the aim of the present study was to demonstrate the presence of hierarchic subpopulations in HaCaT cell line and evaluate the effect of HPV16-E2 expression, on their biological processes. HaCaT-HPV16-E2 cells were generated by transduction of HaCaT cell line with a lentiviral vector. The α6-integrin-CD71 expression profile was established by immunostaining and flow cytometric analysis. After sorting, cell subpopulations were analyzed in biological assays for self-renewal, clonogenicity and expression of stemness factors (RT-qPCR). We identified in HaCaT cell line three different subpopulations that correspond to early differentiated cells (α6-integrin dim ), transitory amplifying cells (α6-integrin bri /CD71 bri ) and progenitor cells (α6-integrin bri /CD71 dim ). The last subpopulation showed stem cell characteristics, such as self-renewal ability, clonogenicity and expression of the well-known stem cell factors SOX2, OCT4 and NANOG, suggesting they are stem-like cells. Interestingly, the expression of HPV16-E2 in HaCaT cells changed its α6-integrin-CD71 immunophenotype modifying the relative abundance of the cell subpopulations, reducing significantly the percentage of α6-integrin bri /CD71 dim cells. Moreover, the expression of the stem cell markers was also modified, increasing the expression of SOX2 and NANOG, but decreasing notably

  9. Citric acid induces cell-cycle arrest and apoptosis of human immortalized keratinocyte cell line (HaCaT) via caspase- and mitochondrial-dependent signaling pathways.

    Science.gov (United States)

    Ying, Tsung-Ho; Chen, Chia-Wei; Hsiao, Yu-Ping; Hung, Sung-Jen; Chung, Jing-Gung; Yang, Jen-Hung

    2013-10-01

    Citric acid is an alpha-hydroxyacid (AHA) widely used in cosmetic dermatology and skincare products. However, there is concern regarding its safety for the skin. In this study, we investigated the cytotoxic effects of citric acid on the human keratinocyte cell line HaCaT. HaCaT cells were treated with citric acid at 2.5-12.5 mM for different time periods. Cell-cycle arrest and apoptosis were investigated by 4,6-diamidino-2-phenylindole dihydrochloride (DAPI) staining, flow cytometry, western blot and confocal microscopy. Citric acid not only inhibited proliferation of HaCaT cells in a dose-dependent manner, but also induced apoptosis and cell cycle-arrest at the G2/M phase (before 24 h) and S phase (after 24 h). Citric acid increased the level of Bcl-2-associated X protein (BAX) and reduced the levels of B-cell lymphoma-2 (BCL-2), B-cell lymphoma-extra large (BCL-XL) and activated caspase-9 and caspase-3, which subsequently induced apoptosis via caspase-dependent and caspase-independent pathways. Citric acid also activated death receptors and increased the levels of caspase-8, activated BH3 interacting-domain death agonist (BID) protein, Apoptosis-inducing factor (AIF), and Endonuclease G (EndoG). Therefore, citric acid induces apoptosis through the mitochondrial pathway in the human keratinocyte cell line HaCaT. The study results suggest that citric acid is cytotoxic to HaCaT cells via induction of apoptosis and cell-cycle arrest in vitro.

  10. The E7 protein of the cottontail rabbit papillomavirus immortalizes normal rabbit keratinocytes and reduces pRb levels, while E6 cooperates in immortalization but neither degrades p53 nor binds E6AP

    International Nuclear Information System (INIS)

    Ganzenmueller, Tina; Matthaei, Markus; Muench, Peter; Scheible, Michael; Iftner, Angelika; Hiller, Thomas; Leiprecht, Natalie; Probst, Sonja; Stubenrauch, Frank; Iftner, Thomas

    2008-01-01

    Human papillomaviruses (HPVs) cause cervical cancer and are associated with the development of non-melanoma skin cancer. A suitable animal model for papillomavirus-associated skin carcinogenesis is the infection of domestic rabbits with the cottontail rabbit papillomavirus (CRPV). As the immortalizing activity of CRPV genes in the natural target cells remains unknown, we investigated the properties of CRPV E6 and E7 in rabbit keratinocytes (RK) and their influence on the cell cycle. Interestingly, CRPV E7 immortalized RK after a cellular crisis but showed no such activity in human keratinocytes. Co-expressed CRPV E6 prevented cellular crisis. The HPV16 or CRPV E7 protein reduced rabbit pRb levels thereby causing rabbit p19 ARF induction and accumulation of p53 without affecting cellular proliferation. Both CRPV E6 proteins failed to degrade rabbit p53 in vitro or to bind E6AP; however, p53 was still inducible by mitomycin C. In summary, CRPV E7 immortalizes rabbit keratinocytes in a species-specific manner and E6 contributes to immortalization without directly affecting p53

  11. Universe, human immortality and future human evaluation

    CERN Document Server

    Bolonkin, Alexander

    2011-01-01

    This book debates the universe, the development of new technologies in the 21st century and the future of the human race. Dr Bolonkin shows that a human soul is only the information in a person's head. He offers a new unique method for re-writing the main brain information in chips without any damage to the human brain. This is the scientific prediction of the non-biological (electronic) civilization and immortality of the human being. Such a prognosis is predicated upon a new law, discovered by the author, for the development of complex systems. According to this law, every self-copying system tends to be more complex than the previous system, provided that all external conditions remain the same. The consequences are disastrous: humanity will be replaced by a new civilization created by intellectual robots (which Dr Bolonkin refers to as "E-humans" and "E-beings"). These creatures, whose intellectual and mechanical abilities will far exceed those of man, will require neither food nor oxygen to sustain their...

  12. Immortalization of human myogenic progenitor cell clone retaining multipotentiality

    International Nuclear Information System (INIS)

    Hashimoto, Naohiro; Kiyono, Tohru; Wada, Michiko R.; Shimizu, Shirabe; Yasumoto, Shigeru; Inagawa, Masayo

    2006-01-01

    Human myogenic cells have limited ability to proliferate in culture. Although forced expression of telomerase can immortalize some cell types, telomerase alone delays senescence of human primary cultured myogenic cells, but fails to immortalize them. In contrast, constitutive expression of both telomerase and the E7 gene from human papillomavirus type 16 immortalizes primary human myogenic cells. We have established an immortalized primary human myogenic cell line preserving multipotentiality by ectopic expression of telomerase and E7. The immortalized human myogenic cells exhibit the phenotypic characteristics of their primary parent, including an ability to undergo myogenic, osteogenic, and adipogenic terminal differentiation under appropriate culture conditions. The immortalized cells will be useful for both basic and applied studies aimed at human muscle disorders. Furthermore, immortalization by transduction of telomerase and E7 represents a useful method by which to expand human myogenic cells in vitro without compromising their ability to differentiate

  13. Thalidomide increases human keratinocyte migration and proliferation.

    Science.gov (United States)

    Nasca, M R; O'Toole, E A; Palicharla, P; West, D P; Woodley, D T

    1999-11-01

    Thalidomide is reported to have therapeutic utility in the treatment of pyoderma gangrenosum, Behçet's disease, aphthous ulcers, and skin wounds. We investigated the effect of thalidomide on human keratinocyte proliferation and migration, two early and critical events in the re-epithelialization of skin wounds. Thalidomide at concentrations less than 1 microM did not affect keratinocyte viability. Using a thymidine incorporation assay, we found that thalidomide, at therapeutic concentrations, induced more than a 2. 5-fold increase in the proliferative potential of the cells. Keratinocyte migration was assessed by two independent motility assays: a colloidal gold assay and an in vitro scratch assay. At optimal concentrations, thalidomide increased keratinocyte migration on a collagen matrix more than 2-fold in the colloidal gold assay and more than 3-fold in the scratch assay over control. Although pro-migratory, thalidomide did not alter the level of metalloproteinase-9 secreted into culture medium. Thalidomide did, however, induce a 2-4-fold increase in keratinocyte-derived interleukin-8, a pro-migratory cellular autocrine factor. Human keratinocyte migration and proliferation are essential for re-epithelialization of skin wounds. Interleukin-8 increases human keratinocyte migration and proliferation and is chemotactic for keratinocytes. Therefore, thalidomide may modulate keratinocyte proliferation and motility by a chemokine-dependent pathway.

  14. Human papilloma virus DNAs immortalize normal human mammary epithelial cells and reduce their growth factor requirements

    International Nuclear Information System (INIS)

    Band, V.; Zajchowski, D.; Kulesa, V.; Sager, R.

    1990-01-01

    Human papilloma virus (HPV) types 16 and 18 are most commonly associated with cervical carcinoma in patients and induce immortalization of human keratinocytes in culture. HPV has not been associated with breast cancer. This report describes the immortalization of normal human mammary epithelial cells (76N) by plasmid pHPV18 or pHPV16, each containing the linearized viral genome. Transfectants were grown continuously for more than 60 passages, whereas 76N cells senesce after 18-20 passages. The transfectants also differ from 76N cells in cloning in a completely defined medium called D2 and growing a minimally supplemented defined medium (D3) containing epidermal growth factor. All transfectant tested contain integrated HPV DNA, express HPV RNA, and produce HPV E7 protein. HPV transfectants do not form tumors in a nude mouse assay. It is concluded that products of the HPV genome induce immortalization of human breast epithelial cells and reduce their growth factor requirements. This result raises the possibility that HPV might be involved in breast cancer. Furthermore, other tissue-specific primary epithelial cells that are presently difficult to grown and investigate may also be immortalized by HPV

  15. Differential regulation of iron chelator-induced IL-8 synthesis via MAP kinase and NF-κB in immortalized and malignant oral keratinocytes

    International Nuclear Information System (INIS)

    Lee, Hwa-Jeong; Lee, Jun; Lee, Sun-Kyung; Lee, Suk-Keun; Kim, Eun-Cheol

    2007-01-01

    Interleukin-8 (IL-8) is a cytokine that plays an important role in tumor progression in a variety of cancer types; however, its regulation is not well understood in oral cancer cells. In the present study, we examined the expression and mechanism of IL-8 in which it is involved by treating immortalized (IHOK) and malignant human oral keratinocytes (HN12) cells with deferoxamine (DFO). IL-8 production was measured by an enzyme-linked immunoabsorbent assay and reverse transcriptase-polymerase chain reaction (RT-PCR) analysis. Electrophoretic mobility shift assays was used to determine NF-κB binding activity. Phosphorylation and degradation of the I-κB were analyized by Western blot. IHOK cells incubated with DFO showed increased expression of IL-8 mRNA, as well as higher release of the IL-8 protein. The up-regulation of DFO-induced IL-8 expression was higher in IHOK cells than in HN12 cells and was concentration-dependent. DFO acted additively with IL-1β to strongly up-regulate IL-8 in IHOK cells but not in HN12 cells. Accordingly, selective p38 and ERK1/2 inhibitors for both kinases abolished DFO-induced IL-8 expression in both IHOK and HN12 cells. Furthermore, DFO induced the degradation and phosphorylation of IκB, and activation of NF-κB. The IL-8 inducing effects of DFO were mediated by a nitric oxide donor (S-nitrosoglutathione), and by pyrrolidine dithiocarbamate, an inhibitor of NF-κB, as well as by wortmannin, which inhibits the phosphatidylinositol 3-kinase-dependent activation of NAD(P)H oxidase. This results demonstrate that DFO-induced IL-8 acts via multiple signaling pathways in immortalized and malignant oral keratinocytes, and that the control of IL-8 may be an important target for immunotheraphy against human oral premalignant lesions

  16. Differential Activation of Human Keratinocytes by Leishmania Species Causing Localized or Disseminated Disease.

    Science.gov (United States)

    Scorza, Breanna M; Wacker, Mark A; Messingham, Kelly; Kim, Peter; Klingelhutz, Aloysius; Fairley, Janet; Wilson, Mary E

    2017-10-01

    All Leishmania species parasites are introduced into mammalian skin through a sand fly bite, but different species cause distinct clinical outcomes. Mouse studies suggest that early responses are critical determinants of subsequent adaptive immunity in leishmaniasis, yet few studies address the role of keratinocytes, the most abundant cell in the epidermis. We hypothesized that Leishmania infection causes keratinocytes to produce immunomodulatory factors that influence the outcome of infection. Incubation of primary or immortalized human keratinocytes with Leishmania infantum or Leishmania major, which cause visceral or cutaneous leishmaniasis, respectively, elicited dramatically different responses. Keratinocytes incubated with L. infantum significantly increased expression of proinflammatory genes for IL-6, IL-8, tumor necrosis factor, and IL-1B, whereas keratinocytes exposed to several L. major isolates did not. Furthermore, keratinocyte-monocyte co-incubation studies across a 4 µM semipermeable membrane suggested that L. infantum-exposed keratinocytes release soluble factors that enhance monocyte control of intracellular L. infantum replication (P Leishmania species that may affect the course of disease. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  17. Telomere elongation in immortal human cells without detectable telomerase activity.

    Science.gov (United States)

    Bryan, T M; Englezou, A; Gupta, J; Bacchetti, S; Reddel, R R

    1995-09-01

    Immortalization of human cells is often associated with reactivation of telomerase, a ribonucleoprotein enzyme that adds TTAGGG repeats onto telomeres and compensates for their shortening. We examined whether telomerase activation is necessary for immortalization. All normal human fibroblasts tested were negative for telomerase activity. Thirteen out of 13 DNA tumor virus-transformed cell cultures were also negative in the pre-crisis (i.e. non-immortalized) stage. Of 35 immortalized cell lines, 20 had telomerase activity as expected, but 15 had no detectable telomerase. The 15 telomerase-negative immortalized cell lines all had very long and heterogeneous telomeres of up to 50 kb. Hybrids between telomerase-negative and telomerase-positive cells senesced. Two senescent hybrids demonstrated telomerase activity, indicating that activation of telomerase is not sufficient for immortalization. Some hybrid clones subsequently recommenced proliferation and became immortalized either with or without telomerase activity. Those without telomerase activity also had very long and heterogeneous telomeres. Taken together, these data suggest that the presence of lengthened or stabilized telomeres is necessary for immortalization, and that this may be achieved either by the reactivation of telomerase or by a novel and as yet unidentified mechanism.

  18. H{sup +}/peptide transporter (PEPT2) is expressed in human epidermal keratinocytes and is involved in skin oligopeptide transport

    Energy Technology Data Exchange (ETDEWEB)

    Kudo, Michiko; Katayoshi, Takeshi; Kobayashi-Nakamura, Kumiko [DHC Corporation Laboratories, Division 2, 2-42 Hamada, Mihama-ku, Chiba 261-0025 (Japan); Akagawa, Mitsugu [Department of Biological Chemistry, Division of Applied Life Science, Graduate School of Life and Environmental Sciences, Osaka Prefecture University, 1-1 Gakuen-cho, Naka-ku, Sakai 599-8531 (Japan); Tsuji-Naito, Kentaro, E-mail: knaito@dhc.co.jp [DHC Corporation Laboratories, Division 2, 2-42 Hamada, Mihama-ku, Chiba 261-0025 (Japan)

    2016-07-08

    Peptide transporter 2 (PEPT2) is a member of the proton-coupled oligopeptide transporter family, which mediates the cellular uptake of oligopeptides and peptide-like drugs. Although PEPT2 is expressed in many tissues, its expression in epidermal keratinocytes remains unclear. We investigated PEPT2 expression profile and functional activity in keratinocytes. We confirmed PEPT2 mRNA expression in three keratinocyte lines (normal human epidermal keratinocytes (NHEKs), immortalized keratinocytes, and malignant keratinocytes) by reverse transcription-polymerase chain reaction (RT-PCR) and quantitative real-time RT-PCR. In contrast to PEPT1, PEPT2 expression in the three keratinocytes was similar or higher than that in HepG2 cells, used as PEPT2-positive cells. Immunolocalization analysis using human skin showed epidermal PEPT2 localization. We studied keratinocyte transport function by measuring the oligopeptide content using liquid chromatography/tandem mass spectrometry. Glycylsarcosine uptake in NHEKs was pH-dependent, suggesting that keratinocytes could absorb small peptides in the presence of an inward H{sup +} gradient. We also performed a skin-permeability test of several oligopeptides using skin substitute, suggesting that di- and tripeptides pass actively through the epidermis. In conclusion, PEPT2 is expressed in keratinocytes and involved in skin oligopeptide uptake. -- Highlights: •PEPT2 is expressed in keratinocytes, which are more common than other skin cells. •Immunolocalization analysis using human skin revealed epidermal PEPT2 localization. •Keratinocytes could absorb small peptides in the presence of an inward H{sup +} gradient. •Di- and tripeptide pass actively through the epidermis.

  19. Generation and Characterization of an Immortalized Human Esophageal Myofibroblast Line.

    Directory of Open Access Journals (Sweden)

    Chao Niu

    Full Text Available Stromal cells with a myofibroblast phenotype present in the normal human esophagus are increased in individuals with gastro-esophageal reflux disease (GERD. We have previously demonstrated that myofibroblasts stimulated with acid and TLR4 agonists increase IL-6 and IL-8 secretion using primary cultures of myofibroblasts established from normal human esophagus. While primary cultures have the advantage of reflecting the in vivo environment, a short life span and unavoidable heterogeneity limits the usefulness of this model in larger scale in vitro cellular signaling studies. The major aim of this paper therefore was to generate a human esophageal myofibroblast line with an extended lifespan. In the work presented here we have generated and characterized an immortalized human esophageal myofibroblast line by transfection with a commercially available GFP-hTERT lentivirus. Immortalized human esophageal myofibroblasts demonstrate phenotypic, genotypic and functional similarity to primary cultures of esophageal myofibroblasts we have previously described. We found that immortalized esophageal myofibroblasts retain myofibroblast spindle-shaped morphology at low and high confluence beyond passage 80, and express α-SMA, vimentin, and CD90 myofibroblast markers. Immortalized human esophageal myofibroblasts also express the putative acid receptor TRPV1 and TLR4 and retain the functional capacity to respond to stimuli encountered in GERD with secretion of IL-6. Finally, immortalized human esophageal myofibroblasts also support the stratified growth of squamous esophageal epithelial cells in 3D organotypic cultures. This newly characterized immortalized human esophageal myofibroblast cell line can be used in future cellular signaling and co-culture studies.

  20. Differential Gene Expression in Primary Human Skin Keratinocytes and Fibroblasts in Response to Ionizing Radiation

    Science.gov (United States)

    Warters, Raymond L.; Packard, Ann T.; Kramer, Gwen F.; Gaffney, David K.; Moos, Philip J.

    2009-01-01

    Although skin is usually exposed during human exposures to ionizing radiation, there have been no thorough examinations of the transcriptional response of skin fibroblasts and keratinocytes to radiation. The transcriptional response of quiescent primary fibroblasts and keratinocytes exposed to from 10 cGy to 5 Gy and collected 4 h after treatment was examined. RNA was isolated and examined by microarray analysis for changes in the levels of gene expression. Exposure to ionizing radiation altered the expression of 279 genes across both cell types. Changes in RNA expression could be arranged into three main categories: (1) changes in keratinocytes but not in fibroblasts, (2) changes in fibroblasts but not in keratinocytes, and (3) changes in both. All of these changes were primarily of p53 target genes. Similar radiation-induced changes were induced in immortalized fibroblasts or keratinocytes. In separate experiments, protein was collected and analyzed by Western blotting for expression of proteins observed in microarray experiments to be overexpressed at the mRNA level. Both Q-PCR and Western blot analysis experiments validated these transcription changes. Our results are consistent with changes in the expression of p53 target genes as indicating the magnitude of cell responses to ionizing radiation. PMID:19580510

  1. Low calcium culture condition induces mesenchymal cell-like phenotype in normal human epidermal keratinocytes

    International Nuclear Information System (INIS)

    Takagi, Ryo; Yamato, Masayuki; Murakami, Daisuke; Sugiyama, Hiroaki; Okano, Teruo

    2011-01-01

    Highlights: → Normal human epidermal keratinocytes serially cultured under low calcium concentration were cytokeratin and vimentin double positive cells. → The human keratinocytes expressed some epithelial stem/progenitor cell makers, mesenchymal cell markers, and markers of epithelial-mesenchymal transition. → Mesenchymal cell-like phenotype in the keratinocytes was suppressed under high-calcium condition. -- Abstract: Epithelial-mesenchymal transition (EMT) is an important cellular phenomenon in organ developments, cancer invasions, and wound healing, and many types of transformed cell lines are used for investigating for molecular mechanisms of EMT. However, there are few reports for EMT in normal human epithelial cells, which are non-transformed or non-immortalized cells, in vitro. Therefore, normal human epidermal keratinocytes (NHEK) serially cultured in low-calcium concentration medium (LCM) were used for investigating relations between differentiation and proliferation and mesenchymal-like phenotype in the present study, since long-term cultivation of NHEK is achieved in LCM. Interestingly, NHEK serially cultured in LCM consisted essentially of cytokeratin-vimentin double positive cells (98%), although the NHEK exhibited differentiation under high-calcium culture condition with 3T3 feeder layer. The vimentin expression was suppressed under high-calcium condition. These results may indicate the importance of mesenchymal-like phenotype for serially cultivation of NHEK in vitro.

  2. Genes involved in immortalization of human mammary cells

    Energy Technology Data Exchange (ETDEWEB)

    Stampfer, Martha R.; Yaswen, Paul

    2001-09-27

    Breast cancer progression is characterized by inappropriate cell growth. Normal cells cease growth after a limited number of cell divisions--a process called cellular senescence-while tumor cells may acquire the ability to proliferate indefinitely (immortality). Inappropriate expression of specific oncogenes in a key cellular signaling pathway (Ras, Raf) can promote tumorigenicity in immortal cells, while causing finite lifespan cells to undergo a rapid senescence-like arrest. We have studied when in the course of transformation of cultured human mammary epithelial cells (HMEC), the response to overexpressed oncogenic Raf changes from being tumor-suppressive to tumor enhancing, and what are the molecular underpinnings of this response. Our data indicate: (1) HMEC acquire the ability to maintain growth in the presence of oncogenic Raf not simply as a consequence of overcoming senescence, but as a result of a newly discovered step in the process of immortal transformation uncovered by our lab, termed conversion. Immortal cells that have not undergone conversion (e.g., cells immortalized by exogenous introduction of the immortalizing enzyme, telomerase) remain growth inhibited. (2) Finite lifespan HMEC growth arrest in response to oncogenic Raf using mediators of growth inhibition that are very different from those used in response to oncogenic Raf by rodent cells and certain other human cell types, including the connective tissue cells from the same breast tissue. While many diverse cell types appear to have in common a tumor-suppressive response to this oncogenic signal, they also have developed multiple mechanisms to elicit this response. Understanding how cancer cells acquire the crucial capacity to be immortal and to abrogate normal tumor-suppressive mechanisms may serve both to increase our understanding of breast cancer progression, and to provide new targets for therapeutic intervention. Our results indicate that normal HMEC have novel means of enforcing a Raf

  3. SORBS2 and TLR3 induce premature senescence in primary human fibroblasts and keratinocytes

    International Nuclear Information System (INIS)

    Liesenfeld, Melanie; Mosig, Sandy; Funke, Harald; Jansen, Lars; Runnebaum, Ingo B; Dürst, Matthias; Backsch, Claudia

    2013-01-01

    Genetic aberrations are required for the progression of HPV-induced cervical precancers. A prerequisite for clonal expansion of cancer cells is unlimited proliferative capacity. In a cell culture model for cervical carcinogenesis loss of genes located on chromosome 4q35→qter and chromosome 10p14-p15 were found to be associated with escape from senescence. Moreover, by LOH and I-FISH analyses a higher frequency of allele loss of these regions was also observed in cervical carcinomas as compared to CIN3. The aim of this study was to identify candidate senescence-related genes located on chromosome 4q35→qter and chromosome 10p14-p15 which may contribute to clonal expansion at the transition of CIN3 to cancer. Microarray expression analyses were used to identify candidate genes down-regulated in cervical carcinomas as compared to CIN3. In order to relate these genes with the process of senescence their respective cDNAs were overexpressed in HPV16-immortalized keratinocytes as well as in primary human fibroblasts and keratinocytes using lentivirus mediated gene transduction. Overall fifteen genes located on chromosome 4q35→qter and chromosome 10p14-p15 were identified. Ten of these genes could be validated in biopsies by RT-PCR. Of interest is the novel finding that SORBS2 and TLR3 can induce senescence in primary human fibroblasts and keratinocytes but not in HPV-immortalized cell lines. Intriguingly, the endogenous expression of both genes increases during finite passaging of primary keratinocytes in vitro. The relevance of the genes SORBS2 and TLR3 in the process of cellular senescence warrants further investigation. In ongoing experiments we are investigating whether this increase in gene expression is also characteristic of replicative senescence

  4. Staphylococcal superantigens stimulate immortalized human adipocytes to produce chemokines.

    Directory of Open Access Journals (Sweden)

    Bao G Vu

    Full Text Available BACKGROUND: Human adipocytes may have significant functions in wound healing and the development of diabetes through production of pro-inflammatory cytokines after stimulation by gram-negative bacterial endotoxin. Diabetic foot ulcers are most often associated with staphylococcal infections. Adipocyte responses in the area of the wound may play a role in persistence and pathology. We studied the effect of staphylococcal superantigens (SAgs on immortalized human adipocytes, alone and in the presence of bacterial endotoxin or staphylococcal α-toxin. METHODOLOGY/PRINCIPAL FINDINGS: Primary non-diabetic and diabetic human preadipocytes were immortalized by the reverse transcriptase component of telomerase (TERT and the E6/E7 genes of human papillomavirus. The immortal cells were demonstrated to have properties of non-immortalized pre-adipocytes and could be differentiated into mature and functional adipocytes. Differentiated adipocytes exposed to staphylococcal SAgs produced robust levels of cytokines IL-6 and IL-8, but there were no significant differences in levels between the non-diabetic and diabetic cells. Cytokine production was increased by co-incubation of adipocytes with SAgs and endotoxin together. In contrast, α-toxin alone was cytotoxic at high concentrations, but, at sub-cytotoxic doses, did not stimulate production of IL-6 and IL-8. CONCLUSIONS/SIGNIFICANCE: Endotoxin has been proposed to contribute to diabetes through enhanced insulin resistance after chronic exposure and stimulation of adipocytes to produce cytokines. Our data indicate staphylococcal SAgs TSST-1 and SEB alone and in combination with bacterial endotoxin also stimulate adipocytes to produce cytokines and thus may contribute to the inflammatory response found in chronic diabetic ulcers and in the systemic inflammation that is associated with the development and persistence of diabetes. The immortal human pre-adipocytes reported here will be useful for studies to

  5. Six1 overexpression at early stages of HPV16-mediated transformation of human keratinocytes promotes differentiation resistance and EMT

    International Nuclear Information System (INIS)

    Xu, Hanwen; Pirisi, Lucia; Creek, Kim E.

    2015-01-01

    Previous studies in our laboratory discovered that SIX1 mRNA expression increased during in vitro progression of HPV16-immortalized human keratinocytes (HKc/HPV16) toward a differentiation-resistant (HKc/DR) phenotype. In this study, we explored the role of Six1 at early stages of HPV16-mediated transformation by overexpressing Six1 in HKc/HPV16. We found that Six1 overexpression in HKc/HPV16 increased cell proliferation and promoted cell migration and invasion by inducing epithelial–mesenchymal transition (EMT). Moreover, the overexpression of Six1 in HKc/HPV16 resulted in resistance to serum and calcium-induced differentiation, which is the hallmark of the HKc/DR phenotype. Activation of MAPK in HKc/HPV16 overexpressing Six1 is linked to resistance to calcium-induced differentiation. In conclusion, this study determined that Six1 overexpression resulted in differentiation resistance and promoted EMT at early stages of HPV16-mediated transformation of human keratinocytes. - Highlights: • Six1 expression increases during HPV16-mediated transformation. • Six1 overexpression causes differentiation resistance in HPV16-immortalized cells. • Six1 overexpression in HPV16-immortalized keratinocytes activates MAPK. • Activation of MAPK promotes EMT and differentiation resistance. • Six1 overexpression reduces Smad-dependent TGF-β signaling

  6. Decorin gene expression and its regulation in human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Velez-DelValle, Cristina; Marsch-Moreno, Meytha; Castro-Munozledo, Federico [Department of Cell Biology, Centro de Investigacion y de Estudios Avanzados del IPN, Apdo. Postal 14-740, Mexico D.F. 07000 (Mexico); Kuri-Harcuch, Walid, E-mail: walidkuri@gmail.com [Department of Cell Biology, Centro de Investigacion y de Estudios Avanzados del IPN, Apdo. Postal 14-740, Mexico D.F. 07000 (Mexico)

    2011-07-22

    Highlights: {yields} We showed that cultured human diploid epidermal keratinocytes express and synthesize decorin. {yields} Decorin is found intracytoplasmic in suprabasal cells of cultures and in human epidermis. {yields} Decorin mRNA expression in cHEK is regulated by pro-inflammatory and proliferative cytokines. {yields} Decorin immunostaining of psoriatic lesions showed a lower intensity and altered intracytoplasmic arrangements. -- Abstract: In various cell types, including cancer cells, decorin is involved in regulation of cell attachment, migration and proliferation. In skin, decorin is seen in dermis, but not in keratinocytes. We show that decorin gene (DCN) is expressed in the cultured keratinocytes, and the protein is found in the cytoplasm of differentiating keratinocytes and in suprabasal layers of human epidermis. RT-PCR experiments showed that DCN expression is regulated by pro-inflammatory and proliferative cytokines. Our data suggest that decorin should play a significant role in keratinocyte terminal differentiation, cutaneous homeostasis and dermatological diseases.

  7. In Vitro Toxicity of Aluminum Nanoparticles in Human Keratinocytes

    National Research Council Canada - National Science Library

    McCormack-Brown, Stephanie

    2008-01-01

    .... There is no published data on AL NP toxicity effects on human skin. This research used in vitro techniques to determine the cytotoxicity of AL NPs, sized 50, 80, and 120 nm, on human keratinocytes...

  8. Differentiation of human scalp hair follicle keratinocytes in culture.

    Science.gov (United States)

    Weterings, P J; Verhagen, H; Wirtz, P; Vermorken, A J

    1984-01-01

    The morphology of human scalp hair follicle keratinocytes, cultured on the bovine eye lens capsule, is studied by light and electron microscopy. The hair follicle keratinocytes in the stratified cultures are characterized by the presence of numerous tonofilaments, desmosomes and lysosomes and by the presence of glycogen accumulations. The cells in the upper layers develop a cornified envelope. Moreover, an incomplete basal lamina is found between the capsule and the basal cells. However, some features of epidermal keratinocytes in vivo, such as keratohyalin granules and stratum corneum formation, are absent. Analysis of the polypeptides by sodium dodecylsulfate polyacrylamide gel electrophoresis also reveals differences between the cultured hair follicle cells and epidermis, whilst the patterns of cultured cells and hair follicle sheaths are similar. The morphological and protein biosynthetic aspects of terminal differentiation of the keratinocytes in vitro are correlated. These results are discussed in the light of the findings with cultured epidermal keratinocytes, reported in the literature.

  9. Human Keratinocytes Radioprotection with Mentha Longifolia

    Science.gov (United States)

    Rizzo, Angela Maria; Berselli, P.; Zava, S.; Negroni, M.; Corsetto, P.; Montorfano, G.; Bertolotti, A.; Ranza, E.; Ottolenghi, A.; Berra, B.

    Antioxidants are suggested to act as radioprotectors, and dietary supplements based on antiox-idants have been proposed for astronauts involved in long-term space missions. Plant extracts with antioxidant properties may be used in dietetic supplements for astronauts; in fact recent nutritional guidelines suggest that "fruits and vegetables may become as important on space-going vessels as limes were on the sea-going vessels of old". Mint presents a large variety of biological properties, such as antiallergenic, antibacterial, anti-inflammatory, antitumor, an-tiviral, gastrointestinal protective, hepatoprotective, chemopreventive activities, most of which are attributable to its antioxidant activity. The aim of the present study is to evaluate the antioxidant properties and protective bio-efficacy of a phenol enriched Mentha longifolia ex-tract on gamma rays stressed human keratinocytes (NCTC2544). We assessed first the in vitro antioxidant activity (ABTS and DPPH), and then evaluated different stress markers in order to investigate various oxidative stress targets: cell viability (MTT); retained proliferating ca-pability (CA); DNA damage (histone H2AX) and protein damage (HSP70 induction). Results indicate that this Mint extract has a higher antioxidant activity respect to fresh extracts, that could be responsible of its really interesting radio-protective effects.

  10. Serial cultivation of human scalp hair follicle keratinocytes.

    Science.gov (United States)

    Weterings, P J; Roelofs, H M; Vermorken, A J; Bloemendal, H

    1983-01-01

    A method is described for the serial cultivation of adult human hair follicle keratinocytes. Plucked scalp hair follicles, placed on bovine eye lens capsules as a growth substrate, give rise to quickly expanding colonies within a few days. After trypsinization, the cells are replated with irradiated 3T3 cells as 'feeders'. Using this combination of techniques the keratinocytes can be subcultured up to four times. In this way about 10(7) keratinocytes can be generated from one single hair follicle. Moreover, the technique enables cryogenic storage of the cells, allowing for instance, convenient transportation. Subcultured hair follicle keratinocytes can be plated on glass coverslips. This allows immunofluorescence studies. The keratin cytoskeletons visualized using an antiserum against human keratin.

  11. Effects of 25-hydroxyvitamin D3 on cathelicidin production and antibacterial function of human oral keratinocytes.

    Science.gov (United States)

    Wang, Qi; Zhang, Wu; Li, Hao; Aprecio, Raydolf; Wu, Wan; Lin, Yiqiao; Li, Yiming

    2013-01-01

    Vitamin D and its metabolites have been recognized as key determinants in innate immune modulation. In this study, we investigated the regulation of antibacterial functions of oral keratinocyte cells by 25-hydroxyvitamin D3 (25VD3). OKF6/TERT2 cells, an immortalized human oral keratinocyte cell line, were transfected with or without 24-hydroxylase small interfering RNA (siRNA) and incubated with different amounts of 25VD3. These epithelial cells expressed high levels of inactivating 24-hydroxylase (CYP24A1) and relatively low levels of activating 1α-hydroxylase (CYP27B1) in the presence of 25VD3. 25VD3 influenced the expression of vitamin D-driven genes and cathelicidin in a dose-related manner. SiRNA specific to 24-hydroxylase augmented the cathelicidin production and subseqently influenced the antibacterial activity on multispecies of oral pathogens. These observations suggest that 25VD3 is capable of stimulating cathelicidin production and modulating antibacterial function upon CYP24A1 knochdown in oral epithelial cells, and indicate novel mechanisms that 25VD3 may enhance antibacterial ability in oral keratinocytes. Copyright © 2013 Elsevier Inc. All rights reserved.

  12. Network signatures of cellular immortalization in human lymphoblastoid cell lines

    Energy Technology Data Exchange (ETDEWEB)

    Shim, Sung-Mi; Jung, So-Young; Nam, Hye-Young; Kim, Hye-Ryun; Lee, Mee-Hee; Kim, Jun-Woo; Han, Bok-Ghee [National Biobank of Korea, Center for Genome Science, Korea National Institute of Health, Osong 363-951 (Korea, Republic of); Jeon, Jae-Pil, E-mail: jaepiljeon@hanmail.net [Division of Brain Diseases, Center for Biomedical Science, Korea National Institute of Health, Osong 363-951 (Korea, Republic of)

    2013-11-15

    Highlights: •We identified network signatures of LCL immortalization from transcriptomic profiles. •More than 41% of DEGs are possibly regulated by miRNAs in LCLs. •MicroRNA target genes in LCLs are involved in apoptosis and immune-related functions. •This approach is useful to find functional miRNA targets in specific cell conditions. -- Abstract: Human lymphoblastoid cell line (LCL) has been used as an in vitro cell model in genetic and pharmacogenomic studies, as well as a good model for studying gene expression regulatory machinery using integrated genomic analyses. In this study, we aimed to identify biological networks of LCL immortalization from transcriptomic profiles of microRNAs and their target genes in LCLs. We first selected differentially expressed genes (DEGs) and microRNAs (DEmiRs) between early passage LCLs (eLCLs) and terminally differentiated late passage LCLs (tLCLs). The in silico and correlation analysis of these DEGs and DEmiRs revealed that 1098 DEG–DEmiR pairs were found to be positively (n = 591 pairs) or negatively (n = 507 pairs) correlated with each other. More than 41% of DEGs are possibly regulated by miRNAs in LCL immortalizations. The target DEGs of DEmiRs were enriched for cellular functions associated with apoptosis, immune response, cell death, JAK–STAT cascade and lymphocyte activation while non-miRNA target DEGs were over-represented for basic cell metabolisms. The target DEGs correlated negatively with miR-548a-3p and miR-219-5p were significantly associated with protein kinase cascade, and the lymphocyte proliferation and apoptosis, respectively. In addition, the miR-106a and miR-424 clusters located in the X chromosome were enriched in DEmiR–mRNA pairs for LCL immortalization. In this study, the integrated transcriptomic analysis of LCLs could identify functional networks of biologically active microRNAs and their target genes involved in LCL immortalization.

  13. Polymeric membranes modulate human keratinocyte differentiation in specific epidermal layers.

    Science.gov (United States)

    Salerno, Simona; Morelli, Sabrina; Giordano, Francesca; Gordano, Amalia; Bartolo, Loredana De

    2016-10-01

    In vitro models of human bioengineered skin substitutes are an alternative to animal experimentation for testing the effects and toxicity of drugs, cosmetics and pollutants. For the first time specific and distinct human epidermal strata were engineered by using membranes and keratinocytes. To this purpose, biodegradable membranes of chitosan (CHT), polycaprolactone (PCL) and a polymeric blend of CHT-PCL were prepared by phase-inversion technique and characterized in order to evaluate their morphological, physico-chemical and mechanical properties. The capability of membranes to modulate keratinocyte differentiation inducing specific interactions in epidermal membrane systems was investigated. The overall results demonstrated that the membrane properties strongly influence the cell morpho-functional behaviour of human keratinocytes, modulating their terminal differentiation, with the creation of specific epidermal strata or a fully proliferative epidermal multilayer system. In particular, human keratinocytes adhered on CHT and CHT-PCL membranes, forming the structure of the epidermal top layers, such as the corneum and granulosum strata, characterized by withdrawal or reduction from the cell cycle and cell proliferation. On the PCL membrane, keratinocytes developed an epidermal basal lamina, with high proliferating cells that stratified and migrated over time to form a complete differentiating epidermal multilayer system. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. Exposure to Carbon Nanotube Material: Assessment of Nanotube Cytotoxicity Using Human Keratinocyte Cells

    Science.gov (United States)

    Shvedova, Anna A.; Castranova, Vincent; Kisin, Elena R.; Schwegler-Berry, Diane; Murray, Ashley R.; Gandelsman, Vadim Z.; Maynard, Andrew; Baron, Paul

    2003-01-01

    Carbon nanotubes are new members of carbon allotropes similar to fullerenes and graphite. Because of their unique electrical, mechanical, and thermal properties, carbon nanotubes are important for novel applications in the electronics, aerospace, and computer industries. Exposure to graphite and carbon materials has been associated with increased incidence of skin diseases, such as carbon fiber dermatitis, hyperkeratosis, and naevi. We investigated adverse effects of single-wall carbon nanotubes (SWCNT) using a cell culture of immortalized human epidermal keratinocytes (HaCaT). After 18 h of exposure of HaCaT to SWCNT, oxidative stress and cellular toxicity were indicated by formation of free radicals, accumulation of peroxidative products, antioxidant depletion, and loss of cell viability. Exposure to SWCNT also resulted in ultrastructural and morphological changes in cultured skin cells. These data indicate that dermal exposure to unrefined SWCNT may lead to dermal toxicity due to accelerated oxidative stress in the skin of exposed workers.

  15. Micronucleus formation in cultured human keratinocytes: Involvement of intercellular bioactivation.

    Science.gov (United States)

    van Pelt, F N; Haring, R M; Weterings, P J

    1991-01-01

    Micronucleus formation in cultured human keratinocytes was studied after exposure to benzo[a]pyrene, cyclophosphamide and 12-O-tetradecanoylphorbol-13-acetate without the addition of an exogenous metabolizing system. The first two agents need bioactivation by specific isoenzymes of cytochrome P-450 to form genotoxic intermediates. Benzo[a]pyrene induced the micronucleus formation in both uninduced and Aroclor 1254-pretreated cultures. Clastogenic effects of cyclophosphamide were observed only in Aroclor 1254-pretreated cells. The tumour promotor 12-O-tetradecanoylphorbol-13-acetate did not affect the frequency of micronuclei in human keratinocytes. The data indicate that cultured human keratinocytes can be used to study the tissue-specific response to genotoxic agents as well as interindividual variation in biotransformation capacity.

  16. Effects of UVB irradiation on keratinocyte growth factor (KGF) and receptor (KGFR) expression in cultured human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Y.; Lee, H.S.T.; Kooshesh, F.; Fujisawa, H.; Sauder, D.N.; Kondo, S. [Univ. of Toronto, Sunnybrook Health Science Centre, Div. of Dermatology, Toronto (Canada)

    1996-06-01

    Keratinocyte growth factor (KGF) and its receptor (KGFR) are thought to play important roles in normal keratinocyte growth and differentiation. Since UVB radiation is known to influence keratinocyte growth, we sought to determine whether UVB would alter the expression of KGF and KGFR. Using a reverse-transcription coupled polymerase chain reaction (RT-PCR), the present study examined the expression of KGF and KGFR mRNA in cultured normal human keratinocytes exposed to UVB irradiation. Total cellular RNA was extracted from cultured keratinocytes at various time points after irradiation, reverse transcribed and used for PCR amplification using primers specific for KGF and KGFR. Constitutive expression of KGFR mRNA, but not KGF mRNA, was detected in normal cultured human keratinocytes. After UVB irradiation at 300 J/m{sup 2}, the KGF mRNA remained undetectable while the KGFR mRNA level was significantly decreased. The down-regulation of KGFR mRNA expression was also confirmed by Northern blot analysis. Immunohistochemical studies demonstrated a decreased positive signal of KGFR in human keratinocytes after UVB irradiation. Our results suggest a possible role for the KGF-KGFR signalling pathway in the skin after exposure to UVB, and that UVB-induced growth inhibition of keratinocytes in hyperproliferative skin disorders may be related to downregulation of KGFR. (au) 39 refs.

  17. Variation in the loss of O6-methylguanine-DNA methyltransferase during immortalization of human fibroblasts.

    Science.gov (United States)

    Green, M H; Karran, P; Lowe, J E; Priestley, A; Arlett, C F; Mayne, L

    1990-01-01

    We have examined O6-methylguanine-DNA methyltransferase (MT) activity in four human fibroblast cell lines during immortalization. Transfection of primary fibroblasts with the plasmid pSV3gpt or pSV3neo, which encode the SV40 large T antigen, confers a transformed phenotype but not immediate immortality. After a period of growth (pre-crisis) the cells enter a quiescent phase (crisis) from which an immortal clone of cells eventually grows out. From measurements of MT activity in extracts of cells taken at different defined stages of the immortalization process, we conclude that the establishment of a Mex- (MT-deficient) cell population is not specifically associated with cellular transformation or with any particular stage of immortalization. It appears that in different cell populations the change from Mex+ to Mex- may occur at different times during the immortalization process and that the change may be very abrupt.

  18. AMPK regulation of the growth of cultured human keratinocytes

    International Nuclear Information System (INIS)

    Saha, Asish K.; Persons, Kelly; Safer, Joshua D.; Luo Zhijun; Holick, Michael F.; Ruderman, Neil B.

    2006-01-01

    AMP kinase (AMPK) is a fuel sensing enzyme that responds to cellular energy depletion by increasing processes that generate ATP and inhibiting others that require ATP but are not acutely necessary for survival. In the present study, we examined the relationship between AMPK activation and the growth (proliferation) of cultured human keratinocytes and assessed whether the inhibition of keratinocyte growth by vitamin D involves AMPK activation. In addition, we explored whether the inhibition of keratinocyte proliferation as they approach confluence could be AMPK-related. Keratinocytes were incubated for 12 h with the AMPK activator, 5-aminoimidazole-4-carboxamide-1-β-D-ribofuranoside (AICAR). At concentrations of 10 -4 and 10 -3 M, AICAR inhibited keratinocyte growth by 50% and 95%, respectively, based on measurements of thymidine incorporation into DNA. It also increased AMPK and acetyl CoA carboxylase phosphorylation (P-AMPK and P-ACC) and decreased the concentration of malonyl CoA confirming that AMPK activation had occurred. Incubation with the thiazolidinedione, troglitazone (10 -6 M) caused similar alterations in P-AMPK, P-ACC, and cell growth. In contrast, the well known inhibition of keratinocyte growth by 1,25-dihydroxyvitamin D 3 (10 -7 and 10 -6 M) was not associated with changes in P-AMPK or P-ACC. Like most cells, the growth of keratinocytes diminished as they approached confluence. Thus, it was of note that we found a progressive increase in P-AMPK (1.5- to 2-fold, p 3 is AMPK-independent

  19. Immortalization of normal human fibroblasts by treatment with 4-nitroquinoline 1-oxide.

    Science.gov (United States)

    Bai, L; Mihara, K; Kondo, Y; Honma, M; Namba, M

    1993-02-01

    Normal human fibroblasts (the OUMS-24 strain), derived from a 6-week-old human embryo, were transformed (into the OUMS-24F line) and immortalized by repeated treatments (59 times) with 4-nitroquinoline 1-oxide (4NQO). Treatment began during primary culture and ended at the 51st population doubling level (PDL). At the 57th PDL (146 days after the last treatment), morphologically altered, epithelial-type cells appeared, began to grow and became immortal (now past the 100th PDL). However, the control fibroblasts, which were not treated with 4NQO, senesced at the 62nd PDL. The finding that extensive, repeated treatments with 4NQO are required for the immortalization of normal human cells, indicates that multiple mutational events are involved in the immortalization of human cells in general. In other words, immortalization itself seems to be a multi-step process. Karyotypic analysis showed that many cells were hypodiploid before immortalization, but that afterwards chromosomes were distributed broadly in the diploid to tetraploid regions. The immortalized cells showed amplification and enhanced expression of c-myc. Two-dimensional electrophoretic analysis showed that the number of disappearing cellular proteins was greater than the number of the newly appearing ones after the cells became immortalized. Since the immortalized cells showed neither anchorage-independent growth nor tumorigenicity, they are useful for studying factors that can contribute to multi-step carcinogenesis in human cells. In addition, genetically matched normal (OUMS-24) and immortalized (OUMS-24F) cells will be useful for analyzing the genes related to cellular mortality and immortalization.

  20. Kinetics of growth and differentiation of cultured human epidermal keratinocytes

    International Nuclear Information System (INIS)

    Albers, K.M.

    1985-01-01

    A study was made of the interrelationship between replication and differentiation in cultures of human epidermal keratinocytes. Measures of both parameters were made using newly developed methods to quantify the rate at which keratinocytes replicate and the rate at which they withdraw from the cell cycle. Keratinocyte replication was measured by determining the cell doubling time, labeling index, and cell cycle duration. Cell cycle length was measured using a double label assay that determines the length of time between two successive phases of DNA synthesis. The first DNA synthesis phase was marked by labeling keratinocytes with 14 C-thymidine. At the next round of DNA synthesis, cells were labeled with bromodeoxyuridine, a heavy analog of thymidine. The cell cycle length is given by the time required for the 14 C-labeled DNA to become double labeled. To measure keratinocyte differentiation, the rate at which cells withdraw from the cell cycle was determined. To measure withdrawal, the percentage of cells labeled by a pulse of 14 C-thymidine that failed to undergo a second cycle of DNA synthesis, as measured by bromodeoxyuridine incorporation, was determined. Cells which failed to undergo a second cycle of synthesis were considered to have differentiated and withdrawn from the cell cycle

  1. Immortalized human hepatocytes as a tool for the study of hepatocytic (de-)differentiation

    NARCIS (Netherlands)

    Schippers, IJ; Moshage, H; Roelofsen, H; Muller, M; Heymans, HSA; Ruiters, M; Kuipers, F

    Primary human hepatocytes were immortalized by stable transfection with a recombinant plasmid containing the early region of simian virus (SV) 40. The cells were cultured in serum-free, hormonally defined medium during the immortalization procedure. Foci of dividing cells were seen after 3 months.

  2. Peroxisomal abnormalities in the immortalized human hepatocyte (IHH) cell line.

    Science.gov (United States)

    Klouwer, Femke C C; Koster, Janet; Ferdinandusse, Sacha; Waterham, Hans R

    2017-04-01

    The immortalized human hepatocyte (IHH) cell line is increasingly used for studies related to liver metabolism, including hepatic glucose, lipid, lipoprotein and triglyceride metabolism, and the effect of therapeutic interventions. To determine whether the IHH cell line is a good model to investigate hepatic peroxisomal metabolism, we measured several peroxisomal parameters in IHH cells and, for comparison, HepG2 cells and primary skin fibroblasts. This revealed a marked plasmalogen deficiency and a deficient fatty acid α-oxidation in the IHH cells, due to a defect of PEX7, a cytosolic receptor protein required for peroxisomal import of a subset of peroxisomal proteins. These abnormalities have consequences for the lipid homeostasis of these cells and thus should be taken into account for the interpretation of data previously generated by using this cell line and when considering using this cell line for future research.

  3. Intermittent pressure decreases human keratinocyte proliferation in vitro.

    Science.gov (United States)

    Nasca, Maria R; Shih, Alan T; West, Dennis P; Martinez, Wanda M; Micali, Giuseppe; Landsman, Adam S

    2007-01-01

    The aim of this study was to investigate the correlation between pressure changes and keratinocyte proliferation by determining whether keratinocytes exposed to altered mechanical pressures would proliferate at different rates compared to control cells not subjected to pressure changes. Tissue culture flasks of human keratinocytes plated at an approximate density of 15,000 cells/cm(2) undergoing an intermittent cyclic pressure of 362 mm Hg at a frequency of 2.28 or 5.16 cycles/min (0.038 or 0.086 Hz) for 8 h were compared to control flasks grown at ambient room pressure. An in-line pressure transducer was used to monitor and adjust pressure within the cell chambers, using a solenoid valve. A thymidine incorporation assay assessed the amount of cell proliferation in each set of experiments. Differences in proliferation between keratinocytes subjected to cyclic pressure changes and control cells were found to be statistically significant (p < 0.05) in 4 out of 5 proliferation assays. Also, a higher frequency of pressure changes consistently generated a reduced proliferation rate compared to that seen in cells exposed to a lower frequency of pressure changes. These data indicate that keratinocytes undergoing intermittent pressure changes exhibit decreased proliferation rates compared to controls. Furthermore, an increased frequency rate seems to have a greater effect on proliferation than low-frequency rate pressure changes, suggesting that the stress caused by frequently changed pressure may play a greater role in reducing keratinocyte proliferation than the actual magnitude of load applied to the cells. Our results support the current treatment protocol of reducing speed and duration of walking on the site of the wound to promote healing of foot ulcers. (c) 2007 S. Karger AG, Basel.

  4. Photodynamic toxicity of hematoporphyrin derivatives to human keratinocytes in culture.

    Science.gov (United States)

    Kappus, H; Reinhold, C; Artuc, M

    Human keratinocytes in culture were able to take up hematoporphyrin derivatives (HPDs) used during photodynamic chemotherapy of tumors. In the absence of light, HPDs showed no cytotoxic effects to keratinocytes. However, after irradiation with visible light, HPDs induced immediate cytotoxicity as measured by the neutral red uptake assay. On the other hand, cell attachment as measured by protein estimation was not affected. When the cells treated with HPDs and irradiated with light were cultured for a further 72 h, they partially lost their ability to attach to the collagen surface. Most of the cells remaining attached after 72 h were no longer viable following treatment with HPDs and light. All parameters measured depended on the intracellular concentration of HPDs used (7-50 ng/10(5) cells) and the time of irradiation (0-30 min). These results suggest that human keratinocytes are a good model to study cytotoxic effects of photodynamically active drugs. Further, keratinocytes were unable to recover after damage caused by HPDs and light.

  5. Amplification and overexpression of aurora kinase A (AURKA) in immortalized human ovarian epithelial (HOSE) cells.

    Science.gov (United States)

    Chung, C M; Man, C; Jin, Y; Jin, C; Guan, X Y; Wang, Q; Wan, T S K; Cheung, A L M; Tsao, S W

    2005-07-01

    Immortalization is an early and essential step of human carcinogenesis. Amplification of chromosome 20q has been shown to be a common event in immortalized cells and cancers. We have previously reported that gain and amplification of chromosome 20q is a non-random and common event in immortalized human ovarian surface epithelial (HOSE) cells. The chromosome 20q harbors genes including TGIF2 (20q11.2-q12), AIB1 (20q12), PTPN1 (20q13.1), ZNF217 (20q13.2), and AURKA (20q13.2-q13.3), which were previously reported to be amplified and overexpressed in ovarian cancers. Some of these genes may be involved in immortalization of HOSE cells and represent crucial premalignant changes in ovarian surface epithelium. Investigation of the involvement of these genes was examined in four pairs of pre-crisis (preimmortalized) and post-crisis (immortalized) HOSE cells. Overexpression of AURKA (Aurora kinase A), also known as BTAK and STK15, by both real time-quantitative polymerase chain reaction (RT-QPCR) and Western blotting was detected in all the four immortalized HOSE cells examined while overexpression of AIB1 and ZNF217 was observed in two of four immortalized HOSE cells examined. Overexpression of TGIF2 and PTPN1 was not significant in our immortalized HOSE cell systems. The degree of overexpression of AURKA was shown to be closely associated with the amplification of chromosome 20q in immortalized HOSE cells. Fluorescence in situ hybridization (FISH) with labeled P1 artificial clone (PAC) confirmed the amplification of the chromosomal region (20q13.2-13.3) where AURKA resides. DNA amplification of AURKA was also confirmed using semi-quantitative PCR. Our study showed that amplification and overexpression of AURKA is a common and significant event during immortalization of HOSE cells and may represent an important premalignant change in ovarian carcinogenesis. Copyright (c) 2005 Wiley-Liss, Inc.

  6. The peanut lectin-binding glycoproteins of human epidermal keratinocytes

    International Nuclear Information System (INIS)

    Morrison, A.I.; Keeble, S.; Watt, F.M.

    1988-01-01

    The peanut lectin (PNA) is known to bind more strongly to keratinocytes that are undergoing terminal differentiation than to proliferating keratinocytes. In order to investigate the significance of this change in cell-surface carbohydrate authors have identified the PNA-binding glycoproteins of cultured human keratinocytes and antibodies against them. Two heavily glycosylated bands of 110 and 250 kDa were resolved by PAGE of [ 14 C]galactose- or [ 14 C]mannose- and [ 14 C]glucosamine-labeled cell extracts eluted with galactose from PNA affinity columns. The higher molecular weight band was also detected on PNA blots of unlabeled cell extracts transferred to nitrocellulose. Both bands were sensitive to pronase digestion, but only the 250-kDa band was digested with trypsin. A rabbit antiserum that we prepared (anti-PNA-gp) immunoprecipitated both bands from cell extracts. In contrast to PNA, anti-PNA-gp bound equally to proliferating and terminally differentiating cells, indicating that some epitope(s) of the PNA-binding glycoproteins is present on the cell surface prior to terminal differentiation. When keratinocytes grown as a monolayer in low-calcium medium were switched to medium containing 2 mM calcium ions in order to induce desmosome formation and stratification, there was a dramatic redistribution of the PNA-binding glycoproteins, which became concentrated at the boundaries between cells. This may suggest a role for the glycoproteins in cell-cell interactions during stratification

  7. Loss of Robustness and Addiction to IGF1 during Early Keratinocyte Transformation by Human Papilloma Virus 16

    Science.gov (United States)

    Geiger, Tamar; Levitzki, Alexander

    2007-01-01

    Infection of keratinocytes with high risk human Papilloma virus causes immortalization, and when followed by further mutations, leads to cervical cancer and other anogenital tumors. Here we monitor the progressive loss of robustness in an in vitro model of the early stages of transformation that comprises normal keratinocytes and progressive passages of HPV16 immortalized cells. As transformation progresses, the cells acquire higher proliferation rates and gain the ability to grow in soft agar. Concurrently, the cells lose robustness, becoming more sensitive to serum starvation and DNA damage by Cisplatin. Loss of robustness in the course of transformation correlates with significant reductions in the activities of the anti-apoptotic proteins PKB/Akt, Erk, Jnk and p38 both under normal growth conditions and upon stress. In parallel, loss of robustness is manifested by the shrinkage of the number of growth factors that can rescue starving cells from apoptosis, with the emergence of dependence solely on IGF1. Treatment with IGF1 activates PKB/Akt and Jnk and through them inhibits p53, rescuing the cells from starvation. We conclude that transformation in this model induces higher susceptibility of cells to stress due to reduced anti-apoptotic signaling and hyper-activation of p53 upon stress. PMID:17622350

  8. Effects of Human Mesenchymal Stem Cells Coculture on Calcium-Induced Differentiation of Normal Human Keratinocytes.

    Science.gov (United States)

    Sah, Shyam Kishor; Kim, Hae Young; Lee, Ji Hae; Lee, Seong-Wook; Kim, Hyung-Sik; Kim, Yeon-Soo; Kang, Kyung-Sun; Kim, Tae-Yoon

    2017-06-01

    The influence of mesenchymal stem cells (MSCs) on keratinocytes in altered microenvironments is poorly understood. Here, we cocultured umbilical cord blood-derived MSCs with normal human epidermal keratinocytes to evaluate their paracrine effect in the presence of high extracellular calcium (Ca 2+ ) concentration. High Ca 2+ environment to keratinocytes can disrupt normal skin barrier function due to abnormal/premature differentiation of keratinocytes. Surprisingly, we found that MSCs suppress both proliferation and differentiation of keratinocytes under a high Ca 2+ environment in transforming growth factors β1 (TGFβ1)-dependent manner. Furthermore, we determined that MSCs can regulate the mitogen-activated protein kinases, phosphatidylinositol 3-kinase/protein kinase B, and protein kinase C pathways in Ca 2+ -induced differentiated keratinocytes. Knockdown of TGFβ1 from MSCs results in decreased suppression of differentiation with significantly increased proliferation of keratinocytes compared with control MSCs. MSCs-derived TGFβ1 further induced growth inhibition of keratinocyte in high extracellular Ca 2+ environment as analyzed by a decrease in DNA synthesis, accumulation of phosphorylated retinoblastoma protein, cdc2, and increased mRNA level of p21, and independent of TGFβ1/SMAD pathway. Taken together, we found that MSCs-derived TGFβ1 is a critical regulator of keratinocyte function, and involves multiple proximal signaling cascades. Stem Cells 2017;35:1592-1602. © 2017 AlphaMed Press.

  9. Cytogenetic characterization and H-ras associated transformation of immortalized human mammary epithelial cells

    Directory of Open Access Journals (Sweden)

    Larivee Siobhan

    2006-05-01

    Full Text Available Abstract Introduction Immortalization is a key step in malignant transformation, but immortalization alone is insufficient for transformation. Human mammary epithelial cell (HMEC transformation is a complex process that requires additional genetic changes beyond immortalization and can be accomplished in vitro by accumulation of genetic changes and expression of H-ras. Methods HMEC were immortalized by serial passaging and transduction with the catalytic subunit of the human telomerase gene (hTERT. The immortalized cells were passaged in vitro and studied by a combination of G- banding and Spectral Karyotyping (SKY. H-ras transduced, hTERT immortalized cells were cloned in soft agar and injected into nude mice. Extensive analysis was performed on the tumors that developed in nude mice, including immunohistochemistry and western blotting. Results Immortal HMEC alone were not tumorigenic in γ-irradiated nude mice and could not grow in soft agar. Late passage hTERT immortalized HMEC from a donor transduced with a retroviral vector containing the mutant, autoactive, human H-ras61L gene acquired anchorage independent growth properties and the capacity for tumorigenic growth in vivo. The tumors that developed in the nude mice were poorly differentiated epithelial carcinomas that continued to overexpress ras. These cells were resistant to doxorubicin mediated G1/S phase arrest but were sensitive to treatment with a farnesyltransferase inhibitor. Conclusion Some of the cytogenetic changes are similar to what is observed in premalignant and malignant breast lesions. Despite these changes, late passage immortal HMEC are not tumorigenic and could only be transformed with overexpression of a mutant H-ras oncogene.

  10. Successful immortalization of mesenchymal progenitor cells derived from human placenta and the differentiation abilities of immortalized cells

    International Nuclear Information System (INIS)

    Zhang Xiaohong; Soda, Yasushi; Takahashi, Kenji; Bai, Yuansong; Mitsuru, Ayako; Igura, Koichi; Satoh, Hitoshi; Yamaguchi, Satoru; Tani, Kenzaburo; Tojo, Arinobu; Takahashi, Tsuneo A.

    2006-01-01

    We reported previously that mesenchymal progenitor cells derived from chorionic villi of the human placenta could differentiate into osteoblasts, adipocytes, and chondrocytes under proper induction conditions and that these cells should be useful for allogeneic regenerative medicine, including cartilage tissue engineering. However, similar to human mesenchymal stem cells (hMSCs), though these placental cells can be isolated easily, they are difficult to study in detail because of their limited life span in vitro. To overcome this problem, we attempted to prolong the life span of human placenta-derived mesenchymal cells (hPDMCs) by modifying hTERT and Bmi-1, and investigated whether these modified hPDMCs retained their differentiation capability and multipotency. Our results indicated that the combination of hTERT and Bmi-1 was highly efficient in prolonging the life span of hPDMCs with differentiation capability to osteogenic, adipogenic, and chondrogenic cells in vitro. Clonal cell lines with directional differentiation ability were established from the immortalized parental hPDMC/hTERT + Bmi-1. Interestingly, hPDMC/Bmi-1 showed extended proliferation after long-term growth arrest and telomerase was activated in the immortal hPDMC/Bmi-1 cells. However, the differentiation potential was lost in these cells. This study reports a method to extend the life span of hPDMCs with hTERT and Bmi-1 that should become a useful tool for the study of mesenchymal stem cells

  11. Flow cytometry of human primary epidermal and follicular keratinocytes.

    Science.gov (United States)

    Gragnani, Alfredo; Ipolito, Michelle Zampieri; Sobral, Christiane S; Brunialti, Milena Karina Coló; Salomão, Reinaldo; Ferreira, Lydia Masako

    2008-02-19

    The aim of this study was to characterize using flow cytometry cultured human primary keratinocytes isolated from the epidermis and hair follicles by different methods. Human keratinocytes derived from discarded fragments of total skin and scalp hair follicles from patients who underwent plastic surgery in the Plastic Surgery Division at UNIFESP were used. The epidermal keratinocytes were isolated by using 3 different methods: the standard method, upon exposure to trypsin for 30 minutes; the second, by treatment with dispase for 18 hours and with trypsin for 10 minutes; and the third, by treatment with dispase for 18 hours and with trypsin for 30 minutes. Follicular keratinocytes were isolated using the standard method. On comparing the group treated with dispase for 18 hours and with trypsin for 10 minutes with the group treated with dispase for 18 hours and with trypsin for 30 minutes, it was observed that the first group presented the largest number of viable cells, the smallest number of cells in late apoptosis and necrosis with statistical significance, and no difference in apoptosis. When we compared the group treated with dispase for 18 hours and with trypsin for 10 minutes with the group treated with trypsin, the first group presented the largest number of viable cells, the smallest number of cells in apoptosis with statistical significance, and no difference in late apoptosis and necrosis. When we compared the results of the group treated with dispase for 18 hours and with trypsin for 10 minutes with the results for follical isolation, there was a statistical difference in apoptosis and viable cells. The isolation method of treatment with dispase for 18 hours and with trypsin for 10 minutes produced the largest number of viable cells and the smallest number of cells in apoptosis/necrosis.

  12. Enhanced expression of IL-8 in normal human keratinocytes and human keratinocyte cell line HaCaT in vitro after stimulation with contact sensitizers, tolerogens and irritants.

    Science.gov (United States)

    Mohamadzadeh, M; Müller, M; Hultsch, T; Enk, A; Saloga, J; Knop, J

    1994-12-01

    To investigate the interleukin-8 production of keratinocytes after stimulation in vitro we have used various agents: (i) contact sensitizer (2,4-dinitrofluorobenzene, 3-n-pentadecylcatechol); (ii) tolerogen (5-methyl-3-n-pentadecylcatechol); (iii) irritant (sodium lauryl sulfate). Interleukin-8 gene expression was assessed by northern blot hybridization of the total cytoplasmic RNA extracted from subconfluent normal human keratinocyte cultures and the keratinocyte cell line HaCaT using a radiolabeled DNA probe specific for human interleukin-8. Interleukin-8 gene expression was markedly increased upon in vitro stimulation after 1-6 h with contact sensitizers, tolerogen and the irritant. In contrast, interleukin-8 production was not detectable in unstimulated normal human keratinocytes or the HaCaT keratinocyte cell line. These results suggest that the induction and production of interleukin-8 is a response to nonspecific stimuli and may play a critical role in the early response to immunogenic or inflammatory signals in man.

  13. Response of human epidermal keratinocytes to UV light

    International Nuclear Information System (INIS)

    Kartasova, A.A.

    1987-01-01

    This thesis presents a study on the response of human epidermal keratinocytes to UV light as well as to other agents like 4-NQO and TPA. The effects of ultraviolet (UV) light on the protein synthesis in cultured keratinocytes are presented in ch. III. The next chapter describes the construction of a cDNA library using mRNA isolated from UV irradiated kernatinocytes. This library was differentially screened with cDNA probes synthesized on mRNA from either UV irradiated or nonirradiated cells. Several groups of cDNA clones corresponding to transcripts whose level in the cytoplasm seem to be affected by exposure to UV light have been isolated and characterized by cross-hybridization, sequencing and Northern blot analysis. More detailed analysis of some of the cDNA clones is presented in the two chapters following ch. IV. The complete cDNA sequence of the proteinase inhibitor cystatin A and the modulation of its expression by UV light and the carcinogen 4-nitroquinoline 1-oxide (4-NQO) in keratinocytes are described in ch. V. Two other groups of cDNA clones have been isolated which do not cross-hybridize with each other on Southern blots. However, the primary structures of the proteins deduced from the nucleotide sequences of these two groups of cDNA clones are very similar. 212 refs.; 33 figs.; 2 tabs

  14. Possible involvement of loss of imprinting in immortalization of human fibroblasts.

    Science.gov (United States)

    Okamura, Kotaro; Ohno, Maki; Tsutsui, Takeki

    2011-04-01

    Disruption of the normal pattern of parental origin-specific gene expression is referred to as loss of imprinting (LOI), which is common in various cancers. To investigate a possible role of LOI in the early stage of human cell transformation, we studied LOI in 18 human fibroblast cell lines immortalized spontaneously, by viral oncogenes, by chemical or physical carcinogens, or by infection with a retrovirus vector encoding the human telomerase catalytic subunit, hTERT cDNA. LOI was observed in all the 18 immortal cell lines. The gene most commonly exhibiting LOI was NDN which displayed LOI in 15 of the 18 cell lines (83%). The other genes exhibiting LOI at high frequencies were PEG3 (50%), MAGE-L2 (61%) and ZNF 127 (50%). Expression of NDN that was lost in the immortal cell lines was restored by treatment with 5-aza-2'-deoxycytidine. The ratio of histone H3 lysine 9 methylation to histone H3 lysine 4 methylation of the chromatin containing the NDN promoter in the immortal WI-38VA13 cells was greater than that in the parental cells, suggesting chromatin structure-mediated regulation of NDN expression. We previously demonstrated that inactivation of the p16INK4a/pRb pathway is necessary for immortalization of human cells. Human fibroblasts in the pre-crisis phase and cells with an extended lifespan that eventually senesce, both of which have the normal p16INK4a/pRb pathway, did not show LOI at any imprinted gene examined. Although it is not clear if LOI plays a causal role in immortalization of human cells or is merely coincidental, these findings indicate a possible involvement of LOI in immortalization of human cells or a common mechanism involved in both processes.

  15. The radiosensitivity of human keratinocytes: influence of activated c-H-ras oncogene expression and tumorigenicity

    International Nuclear Information System (INIS)

    Mendonca, M.S.; Redpath, J.L.; Stanbridge, E.J.

    1991-01-01

    The authors investigated γ-ray sensitivity of several activated c-H-ras (EJ) containing clones established after transfection of the spontaneously immortalized non-tumorigenic human keratinocyte cell line HaCaT. The clones were grouped according to tumorigenic potential after subcutaneous injection into nude mice, and fell into three classes: Class I clones A-4 and I-6 are non-tumorigenic and express very low levels of c-H-ras mRNA and no mutated ras protein (p 21 ); Class II clones I-5 and I-7 grow to large (benign) epidermal cysts, express intermediate to high c-H-ras mRNA and variable levels of mutated ras p 21 protein with clone I-5 expressing little and clone I-7 expressing high levels of p 21 ; Class III clones II-3 and II-4 grow to solid squamous cell carcinomas, express high c-H-ras mRNA and high level of mutated p 21 ras protein similar to clone I-7. Comparison of single-hit multitarget or linear-quadratic survival curve parameters, and survival at 2Gy (S 2 ) indicate no general correlation with either activated c-H-ras expression level or tumorigenic potential, and increased radioresistance. (author)

  16. Steroid synthesis by primary human keratinocytes; implications for skin disease

    Energy Technology Data Exchange (ETDEWEB)

    Hannen, Rosalind F., E-mail: r.f.hannen@qmul.ac.uk [Centre for Cutaneous Research, Institute of Cell and Molecular Science, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, London E1 2AT (United Kingdom); Michael, Anthony E. [Centre for Developmental and Endocrine Signalling, Academic Section of Obstetrics and Gynaecology, Division of Clinical Developmental Sciences, 3rd Floor, Lanesborough Wing, St. George' s, University of London, Cranmer Terrace, Tooting, London SW17 0RE (United Kingdom); Jaulim, Adil [Centre for Cutaneous Research, Institute of Cell and Molecular Science, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, London E1 2AT (United Kingdom); Bhogal, Ranjit [Life Science, Unilever R and D Colworth House, Sharnbrook, Bedfordshire MK44 1LQ (United Kingdom); Burrin, Jacky M. [Centre for Endocrinology, William Harvey Research Institute, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, London EC1M 6BQ (United Kingdom); Philpott, Michael P. [Centre for Cutaneous Research, Institute of Cell and Molecular Science, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, London E1 2AT (United Kingdom)

    2011-01-07

    Research highlights: {yields} Primary keratinocytes express the steroid enzymes required for cortisol synthesis. {yields} Normal primary human keratinocytes can synthesise cortisol. {yields} Steroidogenic regulators, StAR and MLN64, are expressed in normal epidermis. {yields} StAR expression is down regulated in eczema and psoriatic epidermis. -- Abstract: Cortisol-based therapy is one of the most potent anti-inflammatory treatments available for skin conditions including psoriasis and atopic dermatitis. Previous studies have investigated the steroidogenic capabilities of keratinocytes, though none have demonstrated that these skin cells, which form up to 90% of the epidermis are able to synthesise cortisol. Here we demonstrate that primary human keratinocytes (PHK) express all the elements required for cortisol steroidogenesis and metabolise pregnenolone through each intermediate steroid to cortisol. We show that normal epidermis and cultured PHK express each of the enzymes (CYP11A1, CYP17A1, 3{beta}HSD1, CYP21 and CYP11B1) that are required for cortisol synthesis. These enzymes were shown to be metabolically active for cortisol synthesis since radiometric conversion assays traced the metabolism of [7-{sup 3}H]-pregnenolone through each steroid intermediate to [7-{sup 3}H]-cortisol in cultured PHK. Trilostane (a 3{beta}HSD1 inhibitor) and ketoconazole (a CYP17A1 inhibitor) blocked the metabolism of both pregnenolone and progesterone. Finally, we show that normal skin expresses two cholesterol transporters, steroidogenic acute regulatory protein (StAR), regarded as the rate-determining protein for steroid synthesis, and metastatic lymph node 64 (MLN64) whose function has been linked to cholesterol transport in steroidogenesis. The expression of StAR and MLN64 was aberrant in two skin disorders, psoriasis and atopic dermatitis, that are commonly treated with cortisol, suggesting dysregulation of epidermal steroid synthesis in these patients. Collectively these data

  17. Steroid synthesis by primary human keratinocytes; implications for skin disease

    International Nuclear Information System (INIS)

    Hannen, Rosalind F.; Michael, Anthony E.; Jaulim, Adil; Bhogal, Ranjit; Burrin, Jacky M.; Philpott, Michael P.

    2011-01-01

    Research highlights: → Primary keratinocytes express the steroid enzymes required for cortisol synthesis. → Normal primary human keratinocytes can synthesise cortisol. → Steroidogenic regulators, StAR and MLN64, are expressed in normal epidermis. → StAR expression is down regulated in eczema and psoriatic epidermis. -- Abstract: Cortisol-based therapy is one of the most potent anti-inflammatory treatments available for skin conditions including psoriasis and atopic dermatitis. Previous studies have investigated the steroidogenic capabilities of keratinocytes, though none have demonstrated that these skin cells, which form up to 90% of the epidermis are able to synthesise cortisol. Here we demonstrate that primary human keratinocytes (PHK) express all the elements required for cortisol steroidogenesis and metabolise pregnenolone through each intermediate steroid to cortisol. We show that normal epidermis and cultured PHK express each of the enzymes (CYP11A1, CYP17A1, 3βHSD1, CYP21 and CYP11B1) that are required for cortisol synthesis. These enzymes were shown to be metabolically active for cortisol synthesis since radiometric conversion assays traced the metabolism of [7- 3 H]-pregnenolone through each steroid intermediate to [7- 3 H]-cortisol in cultured PHK. Trilostane (a 3βHSD1 inhibitor) and ketoconazole (a CYP17A1 inhibitor) blocked the metabolism of both pregnenolone and progesterone. Finally, we show that normal skin expresses two cholesterol transporters, steroidogenic acute regulatory protein (StAR), regarded as the rate-determining protein for steroid synthesis, and metastatic lymph node 64 (MLN64) whose function has been linked to cholesterol transport in steroidogenesis. The expression of StAR and MLN64 was aberrant in two skin disorders, psoriasis and atopic dermatitis, that are commonly treated with cortisol, suggesting dysregulation of epidermal steroid synthesis in these patients. Collectively these data show that PHK are capable of extra

  18. Stanniocalcin-1 regulates re-epithelialization in human keratinocytes.

    Directory of Open Access Journals (Sweden)

    Bonnie H Y Yeung

    Full Text Available Stanniocalcin-1 (STC1, a glycoprotein hormone, is believed to be involved in various biological processes such as inflammation, oxidative responses and cell migration. Riding on these emerging evidences, we hypothesized that STC1 may participate in the re-epithelialization during wound healing. Re-epithelialization is a critical step that involves keratinocyte lamellipodia (e-lam formation, followed by cell migration. In this study, staurosporine (STS treatment induced human keratinocyte (HaCaT e-lam formation on fibronectin matrix and migration via the activation of focal adhesion kinase (FAK, the surge of intracellular calcium level [Ca²⁺]i and the inactivation of Akt. In accompanied with these migratory features, a time- and dose-dependent increase in STC1 expression was detected. STC1 gene expression was found not the downstream target of FAK-signaling as illustrated by FAK inhibition using PF573228. The reduction of [Ca²⁺]i by BAPTA/AM blocked the STS-mediated keratinocyte migration and STC1 gene expression. Alternatively the increase of [Ca²⁺]i by ionomycin exerted promotional effect on STS-induced STC1 gene expression. The inhibition of Akt by SH6 and GSK3β by lithium chloride (LiCl could respectively induce and inhibit the STS-mediated e-lam formation, cell migration and STC1 gene expression. The STS-mediated e-lam formation and cell migration were notably hindered or induced respectively by STC1 knockdown or overexpression. This notion was further supported by the scratched wound assay. Collectively the findings provide the first evidence that STC1 promotes re-epithelialization in wound healing.

  19. Stanniocalcin-1 regulates re-epithelialization in human keratinocytes.

    Science.gov (United States)

    Yeung, Bonnie H Y; Wong, Chris K C

    2011-01-01

    Stanniocalcin-1 (STC1), a glycoprotein hormone, is believed to be involved in various biological processes such as inflammation, oxidative responses and cell migration. Riding on these emerging evidences, we hypothesized that STC1 may participate in the re-epithelialization during wound healing. Re-epithelialization is a critical step that involves keratinocyte lamellipodia (e-lam) formation, followed by cell migration. In this study, staurosporine (STS) treatment induced human keratinocyte (HaCaT) e-lam formation on fibronectin matrix and migration via the activation of focal adhesion kinase (FAK), the surge of intracellular calcium level [Ca²⁺]i and the inactivation of Akt. In accompanied with these migratory features, a time- and dose-dependent increase in STC1 expression was detected. STC1 gene expression was found not the downstream target of FAK-signaling as illustrated by FAK inhibition using PF573228. The reduction of [Ca²⁺]i by BAPTA/AM blocked the STS-mediated keratinocyte migration and STC1 gene expression. Alternatively the increase of [Ca²⁺]i by ionomycin exerted promotional effect on STS-induced STC1 gene expression. The inhibition of Akt by SH6 and GSK3β by lithium chloride (LiCl) could respectively induce and inhibit the STS-mediated e-lam formation, cell migration and STC1 gene expression. The STS-mediated e-lam formation and cell migration were notably hindered or induced respectively by STC1 knockdown or overexpression. This notion was further supported by the scratched wound assay. Collectively the findings provide the first evidence that STC1 promotes re-epithelialization in wound healing.

  20. Characterization of lipid metabolism in insulin-sensitive adipocytes differentiated from immortalized human mesenchymal stem cells

    DEFF Research Database (Denmark)

    Prawitt, Janne; Niemeier, Andreas; Kassem, Moustapha

    2008-01-01

    There is a great demand for cell models to study human adipocyte function. Here we describe the adipogenic differentiation of a telomerase-immortalized human mesenchymal stem cell line (hMSC-Tert) that maintains numerous features of terminally differentiated adipocytes even after prolonged...

  1. Establishment of immortalized human erythroid progenitor cell lines able to produce enucleated red blood cells.

    Directory of Open Access Journals (Sweden)

    Ryo Kurita

    Full Text Available Transfusion of red blood cells (RBCs is a standard and indispensable therapy in current clinical practice. In vitro production of RBCs offers a potential means to overcome a shortage of transfusable RBCs in some clinical situations and also to provide a source of cells free from possible infection or contamination by microorganisms. Thus, in vitro production of RBCs may become a standard procedure in the future. We previously reported the successful establishment of immortalized mouse erythroid progenitor cell lines that were able to produce mature RBCs very efficiently. Here, we have developed a reliable protocol for establishing immortalized human erythroid progenitor cell lines that are able to produce enucleated RBCs. These immortalized cell lines produce functional hemoglobin and express erythroid-specific markers, and these markers are upregulated following induction of differentiation in vitro. Most importantly, these immortalized cell lines all produce enucleated RBCs after induction of differentiation in vitro, although the efficiency of producing enucleated RBCs remains to be improved further. To the best of our knowledge, this is the first demonstration of the feasibility of using immortalized human erythroid progenitor cell lines as an ex vivo source for production of enucleated RBCs.

  2. Immortalized human myotonic dystrophy muscle cell lines to assess therapeutic compounds

    Science.gov (United States)

    Arandel, Ludovic; Polay Espinoza, Micaela; Matloka, Magdalena; Bazinet, Audrey; De Dea Diniz, Damily; Naouar, Naïra; Rau, Frédérique; Jollet, Arnaud; Edom-Vovard, Frédérique; Mamchaoui, Kamel; Tarnopolsky, Mark; Puymirat, Jack; Battail, Christophe; Boland, Anne; Deleuze, Jean-Francois; Mouly, Vincent; Klein, Arnaud F.

    2017-01-01

    ABSTRACT Myotonic dystrophy type 1 (DM1) and type 2 (DM2) are autosomal dominant neuromuscular diseases caused by microsatellite expansions and belong to the family of RNA-dominant disorders. Availability of cellular models in which the DM mutation is expressed within its natural context is essential to facilitate efforts to identify new therapeutic compounds. Here, we generated immortalized DM1 and DM2 human muscle cell lines that display nuclear RNA aggregates of expanded repeats, a hallmark of myotonic dystrophy. Selected clones of DM1 and DM2 immortalized myoblasts behave as parental primary myoblasts with a reduced fusion capacity of immortalized DM1 myoblasts when compared with control and DM2 cells. Alternative splicing defects were observed in differentiated DM1 muscle cell lines, but not in DM2 lines. Splicing alterations did not result from differentiation delay because similar changes were found in immortalized DM1 transdifferentiated fibroblasts in which myogenic differentiation has been forced by overexpression of MYOD1. As a proof-of-concept, we show that antisense approaches alleviate disease-associated defects, and an RNA-seq analysis confirmed that the vast majority of mis-spliced events in immortalized DM1 muscle cells were affected by antisense treatment, with half of them significantly rescued in treated DM1 cells. Immortalized DM1 muscle cell lines displaying characteristic disease-associated molecular features such as nuclear RNA aggregates and splicing defects can be used as robust readouts for the screening of therapeutic compounds. Therefore, immortalized DM1 and DM2 muscle cell lines represent new models and tools to investigate molecular pathophysiological mechanisms and evaluate the in vitro effects of compounds on RNA toxicity associated with myotonic dystrophy mutations. PMID:28188264

  3. Immortalized human myotonic dystrophy muscle cell lines to assess therapeutic compounds

    Directory of Open Access Journals (Sweden)

    Ludovic Arandel

    2017-04-01

    Full Text Available Myotonic dystrophy type 1 (DM1 and type 2 (DM2 are autosomal dominant neuromuscular diseases caused by microsatellite expansions and belong to the family of RNA-dominant disorders. Availability of cellular models in which the DM mutation is expressed within its natural context is essential to facilitate efforts to identify new therapeutic compounds. Here, we generated immortalized DM1 and DM2 human muscle cell lines that display nuclear RNA aggregates of expanded repeats, a hallmark of myotonic dystrophy. Selected clones of DM1 and DM2 immortalized myoblasts behave as parental primary myoblasts with a reduced fusion capacity of immortalized DM1 myoblasts when compared with control and DM2 cells. Alternative splicing defects were observed in differentiated DM1 muscle cell lines, but not in DM2 lines. Splicing alterations did not result from differentiation delay because similar changes were found in immortalized DM1 transdifferentiated fibroblasts in which myogenic differentiation has been forced by overexpression of MYOD1. As a proof-of-concept, we show that antisense approaches alleviate disease-associated defects, and an RNA-seq analysis confirmed that the vast majority of mis-spliced events in immortalized DM1 muscle cells were affected by antisense treatment, with half of them significantly rescued in treated DM1 cells. Immortalized DM1 muscle cell lines displaying characteristic disease-associated molecular features such as nuclear RNA aggregates and splicing defects can be used as robust readouts for the screening of therapeutic compounds. Therefore, immortalized DM1 and DM2 muscle cell lines represent new models and tools to investigate molecular pathophysiological mechanisms and evaluate the in vitro effects of compounds on RNA toxicity associated with myotonic dystrophy mutations.

  4. Immortalized human myotonic dystrophy muscle cell lines to assess therapeutic compounds.

    Science.gov (United States)

    Arandel, Ludovic; Polay Espinoza, Micaela; Matloka, Magdalena; Bazinet, Audrey; De Dea Diniz, Damily; Naouar, Naïra; Rau, Frédérique; Jollet, Arnaud; Edom-Vovard, Frédérique; Mamchaoui, Kamel; Tarnopolsky, Mark; Puymirat, Jack; Battail, Christophe; Boland, Anne; Deleuze, Jean-Francois; Mouly, Vincent; Klein, Arnaud F; Furling, Denis

    2017-04-01

    Myotonic dystrophy type 1 (DM1) and type 2 (DM2) are autosomal dominant neuromuscular diseases caused by microsatellite expansions and belong to the family of RNA-dominant disorders. Availability of cellular models in which the DM mutation is expressed within its natural context is essential to facilitate efforts to identify new therapeutic compounds. Here, we generated immortalized DM1 and DM2 human muscle cell lines that display nuclear RNA aggregates of expanded repeats, a hallmark of myotonic dystrophy. Selected clones of DM1 and DM2 immortalized myoblasts behave as parental primary myoblasts with a reduced fusion capacity of immortalized DM1 myoblasts when compared with control and DM2 cells. Alternative splicing defects were observed in differentiated DM1 muscle cell lines, but not in DM2 lines. Splicing alterations did not result from differentiation delay because similar changes were found in immortalized DM1 transdifferentiated fibroblasts in which myogenic differentiation has been forced by overexpression of MYOD1. As a proof-of-concept, we show that antisense approaches alleviate disease-associated defects, and an RNA-seq analysis confirmed that the vast majority of mis-spliced events in immortalized DM1 muscle cells were affected by antisense treatment, with half of them significantly rescued in treated DM1 cells. Immortalized DM1 muscle cell lines displaying characteristic disease-associated molecular features such as nuclear RNA aggregates and splicing defects can be used as robust readouts for the screening of therapeutic compounds. Therefore, immortalized DM1 and DM2 muscle cell lines represent new models and tools to investigate molecular pathophysiological mechanisms and evaluate the in vitro effects of compounds on RNA toxicity associated with myotonic dystrophy mutations. © 2017. Published by The Company of Biologists Ltd.

  5. Human keratinocyte sensitivity towards inflammatory cytokines varies with culture time

    Directory of Open Access Journals (Sweden)

    G. Elliott

    1992-01-01

    Full Text Available Proliferating keratinocyte cultures have been reported to synthesize higher concentrations of prostaglandin (PG E than confluent ones. As interleukin-1 (IL-1 stimulates keratinocyte PGE synthesis we investigated whether the degree of confluency of the keratinocyte culture modified the response of the cells to IL-1. It was found that IL-1α (100 U/ml stimulated PGE2 synthesis by proliferating (7 days in culture but not differentiating (14 days in culture keratinocytes. Similar effects were observed using tumour necrosis factor-α. Both arachidonic acid (AA and the calcium ionophore A23187 stimulated PGE2 synthesis by 7 and 14 day cultures although the increase was greatest when 7 day cultures were used. Our data indicate that there is a specific down-regulation of the mechanism(s by which some inflammatory cytokines stimulate keratinocyte eicosanoid synthesis as cultured keratinocytes begin to differentiate.

  6. Human keratinocytes produce the complement inhibitor factor H: synthesis is regulated by interferon-gamma

    NARCIS (Netherlands)

    Timár, Krisztina K.; Pasch, Marcel C.; van den Bosch, Norbert H. A.; Jarva, Hanna; Junnikkala, Sami; Meri, Seppo; Bos, Jan D.; Asghar, Syed S.

    2006-01-01

    Locally synthesized complement is believed to play an important role in host defense and inflammation at organ level. In the epidermis, keratinocytes have so far been shown to synthesize two complement components, C3 and factor B. Here, we studied the synthesis of factor H by human keratinocytes. We

  7. Gene expression studies on human keratinocytes transduced with human growth hormone gene for a possible utilization in gene therapy

    International Nuclear Information System (INIS)

    Mathor, Monica Beatriz.

    1994-01-01

    Taking advantage of the recent progress in the DNA-recombinant techniques and of the potentiality of normal human keratinocytes primary culture to reconstitute the epidermis, it was decided to genetically transform these keratinocytes to produce human growth hormone under controllable conditions that would be used in gene therapy at this hormone deficient patients. The first step to achieve this goal was to standardize infection of keratinocytes with retrovirus producer cells containing a construct which included the gene of bacterial b-galactosidase. The best result was obtained cultivating the keratinocytes for 3 days in a 2:1 mixture of retrovirus producer cells and 3T3-J2 fibroblasts irradiated with 60 Gy, and splitting these infected keratinocytes on 3T3-J2 fibroblasts feeder layer. Another preliminary experiment was to infect normal human keratinocytes with interleukin-6 gene (hIL-6) that, in pathologic conditions, could be reproduced by keratinocytes and secreted to the blood stream. Thus, we verify that infected keratinocytes secrete an average amount of 500 ng/10 6 cell/day of cytokin during the in vitro life time, that certify the stable character of the injection. These keratinocytes, when grafted in mice, secrete hIL-6 to the blood stream reaching levels of 40 pg/ml of serum. After these preliminary experiments, we construct a retroviral vector with the human growth hormone gene (h GH) driven by human metallothionein promoter (h PMT), designated DChPMTGH. Normal human keratinocytes were infected with DChPMTGH producer cells, following previously standardized protocol, obtaining infected keratinocytes secreting to the culture media 340 ng h GH/10 6 cell/day without promoter activation. This is the highest level of h GH secreted in human keratinocytes primary culture described in literature. The h GH value increases approximately 10 times after activation with 100 μM Zn +2 for 8-12 hours. (author). 158 refs., 42 figs., 6 tabs

  8. A human beta cell line with drug inducible excision of immortalizing transgenes

    Science.gov (United States)

    Benazra, Marion; Lecomte, Marie-José; Colace, Claire; Müller, Andreas; Machado, Cécile; Pechberty, Severine; Bricout-Neveu, Emilie; Grenier-Godard, Maud; Solimena, Michele; Scharfmann, Raphaël; Czernichow, Paul; Ravassard, Philippe

    2015-01-01

    Objectives Access to immortalized human pancreatic beta cell lines that are phenotypically close to genuine adult beta cells, represent a major tool to better understand human beta cell physiology and develop new therapeutics for Diabetes. Here we derived a new conditionally immortalized human beta cell line, EndoC-βH3 in which immortalizing transgene can be efficiently removed by simple addition of tamoxifen. Methods We used lentiviral mediated gene transfer to stably integrate a tamoxifen inducible form of CRE (CRE-ERT2) into the recently developed conditionally immortalized EndoC βH2 line. The resulting EndoC-βH3 line was characterized before and after tamoxifen treatment for cell proliferation, insulin content and insulin secretion. Results We showed that EndoC-βH3 expressing CRE-ERT2 can be massively amplified in culture. We established an optimized tamoxifen treatment to efficiently excise the immortalizing transgenes resulting in proliferation arrest. In addition, insulin expression raised by 12 fold and insulin content increased by 23 fold reaching 2 μg of insulin per million cells. Such massive increase was accompanied by enhanced insulin secretion upon glucose stimulation. We further observed that tamoxifen treated cells maintained a stable function for 5 weeks in culture. Conclusions EndoC βH3 cell line represents a powerful tool that allows, using a simple and efficient procedure, the massive production of functional non-proliferative human beta cells. Such cells are close to genuine human beta cells and maintain a stable phenotype for 5 weeks in culture. PMID:26909308

  9. Forkhead Box C1 Regulates Human Primary Keratinocyte Terminal Differentiation.

    Directory of Open Access Journals (Sweden)

    Lianghua Bin

    Full Text Available The epidermis serves as a critical protective barrier between the internal and external environment of the human body. Its remarkable barrier function is established through the keratinocyte (KC terminal differentiation program. The transcription factors specifically regulating terminal differentiation remain largely unknown. Using a RNA-sequencing (RNA-seq profiling approach, we found that forkhead box c 1 (FOXC1 was significantly up-regulated in human normal primary KC during the course of differentiation. This observation was validated in human normal primary KC from several different donors and human skin biopsies. Silencing FOXC1 in human normal primary KC undergoing differentiation led to significant down-regulation of late terminal differentiation genes markers including epidermal differentiation complex genes, keratinization genes, sphingolipid/ceramide metabolic process genes and epidermal specific cell-cell adhesion genes. We further demonstrated that FOXC1 works down-stream of ZNF750 and KLF4, and upstream of GRHL3. Thus, this study defines FOXC1 as a regulator specific for KC terminal differentiation and establishes its potential position in the genetic regulatory network.

  10. Asymmetric migration of human keratinocytes under mechanical stretch and cocultured fibroblasts in a wound repair model.

    Directory of Open Access Journals (Sweden)

    Dongyuan Lü

    Full Text Available Keratinocyte migration during re-epithelization is crucial in wound healing under biochemical and biomechanical microenvironment. However, little is known about the underlying mechanisms whereby mechanical tension and cocultured fibroblasts or keratinocytes modulate the migration of keratinocytes or fibroblasts. Here we applied a tensile device together with a modified transwell assay to determine the lateral and transmembrane migration dynamics of human HaCaT keratinocytes or HF fibroblasts. A novel pattern of asymmetric migration was observed for keratinocytes when they were cocultured with non-contact fibroblasts, i.e., the accumulative distance of HaCaT cells was significantly higher when moving away from HF cells or migrating from down to up cross the membrane than that when moving close to HF cells or when migrating from up to down, whereas HF migration was symmetric. This asymmetric migration was mainly regulated by EGF derived from fibroblasts, but not transforming growth factor α or β1 production. Mechanical stretch subjected to fibroblasts fostered keratinocyte asymmetric migration by increasing EGF secretion, while no role of mechanical stretch was found for EGF secretion by keratinocytes. These results provided a new insight into understanding the regulating mechanisms of two- or three-dimensional migration of keratinocytes or fibroblasts along or across dermis and epidermis under biomechanical microenvironment.

  11. Effect of Nanodiamond and Nanoplatinum Liquid, DPV576, on Human Primary Keratinocytes.

    Science.gov (United States)

    Ghoneum, Mamdooh H; Katano, Hideki; Agrawal, Sudhanshu; Ganguly, Sreerupa; Agrawal, Anshu

    2017-01-01

    Nanofabrics are now being used in a wide range of products that come into direct contact with skin, including carpet, clothing, and medical fabrics. In the current study, we examined the effect of a dispersed aqueous mixture of nanodiamond (ND) and nanoplatinum (NP) (DPV576) on human primary keratinocytes with respect to transient receptor potential vanilloid (TRPV) channel expression, secretion of cytokines and production of nerve growth factor (NGF). Keratinocytes were treated with DPV576 at concentrations of 1:10 and 1:100 dilutions for 24 hours in vitro, and their activation of was determined by production of cytokines TNF-α, IL-1β, and prostaglandin (PGE2), and by production of NGF. Inhibitor experiments were carried out by incubating keratinocytes with the TRPV4-selective antagonist HC-067047. TRPV receptor expression (TRPV1, TRPV3 and TRPV4) on keratinocytes as well as changes in Ca2+ potential were examined by flow cytometry. DPV576 treatment of keratinocytes resulted in the following effects: (1) stimulation of keratinocytes as indicated by the significant secretion of cytokines IL-1β, TNF-α, and PGE2, an effect noted only at higher concentration (1:10); (2) significant decrease in the expression of TRPV4 on keratinocytes with a spike in the calcium flux, but no change in the expression of TRPV1 and TRPV3; (3) induction of cytokine secretion independent of TRPV4, as the addition of TRPV4 inhibitor had no significant effect on the cytokine production from keratinocytes; (4) induction of NGF secretion by keratinocytes. These results demonstrate that DPV576 activates keratinocytes via multiple signaling pathways which may reduce stress associated with inflammation, pain, and circadian rhythms. ND/NP-coated fabrics that target the modulation of local inflammation, pain, and circadian rhythms could potentially be of benefit to humans.

  12. The People Paradox: Self-Esteem Striving, Immortality Ideologies, and Human Response to Climate Change

    Directory of Open Access Journals (Sweden)

    Janis L. Dickinson

    2009-06-01

    Full Text Available In 1973, Ernest Becker, a cultural anthropologist cross-trained in philosophy, sociology, and psychiatry, invoked consciousness of self and the inevitability of death as the primary sources of human anxiety and repression. He proposed that the psychological basis of cooperation, competition, and emotional and mental health is a tendency to hold tightly to anxiety-buffering cultural world views or "immortality projects" that serve as the basis for self-esteem and meaning. Although he focused mainly on social and political outcomes like war, torture, and genocide, he was increasingly aware that materialism, denial of nature, and immortality-striving efforts to control, rather than sanctify, the natural world were problems whose severity was increasing. In this paper I review Becker's ideas and suggest ways in which they illuminate human response to global climate change. Because immortality projects range from belief in technology and materialism to reverence for nature or belief in a celestial god, they act both as barriers to and facilitators of sustainable practices. I propose that Becker's cross-disciplinary "science of man," and the predictions it generates for proximate-level determinants of social behavior, add significantly to our understanding of and potential for managing the people paradox, i.e., that the very things that bring us symbolic immortality often conflict with our prospects for survival. Analysis of immortality projects as one of the proximate barriers to addressing climate change is both cautionary and hopeful, providing insights that should be included in the cross-disciplinary quest to uncover new pathways toward rational, social change.

  13. Cell cycle pathway dysregulation in human keratinocytes during chronic exposure to low arsenite.

    Science.gov (United States)

    Al-Eryani, Laila; Waigel, Sabine; Jala, Venkatakrishna; Jenkins, Samantha F; States, J Christopher

    2017-09-15

    Arsenic is naturally prevalent in the earth's crust and widely distributed in air and water. Chronic low arsenic exposure is associated with several cancers in vivo, including skin cancer, and with transformation in vitro of cell lines including immortalized human keratinocytes (HaCaT). Arsenic also is associated with cell cycle dysregulation at different exposure levels in multiple cell lines. In this work, we analyzed gene expression in HaCaT cells to gain an understanding of gene expression changes contributing to transformation at an early time point. HaCaT cells were exposed to 0 or 100nM NaAsO 2 for 7weeks. Total RNA was purified and analyzed by microarray hybridization. Differential expression with fold change≥|1.5| and p-value≤0.05 was determined using Partek Genomic Suite™ and pathway and network analyses using MetaCore™ software (FDR≤0.05). Cell cycle analysis was performed using flow cytometry. 644 mRNAs were differentially expressed. Cell cycle/cell cycle regulation pathways predominated in the list of dysregulated pathways. Genes involved in replication origin licensing were enriched in the network. Cell cycle assay analysis showed an increase in G2/M compartment in arsenite-exposed cells. Arsenite exposure induced differential gene expression indicating dysregulation of cell cycle control, which was confirmed by cell cycle analysis. The results suggest that cell cycle dysregulation is an early event in transformation manifested in cells unable to transit G2/M efficiently. Further study at later time points will reveal additional changes in gene expression related to transformation processes. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. Generation of organotypic raft cultures from primary human keratinocytes.

    Science.gov (United States)

    Anacker, Daniel; Moody, Cary

    2012-02-22

    The development of organotypic epithelial raft cultures has provided researchers with an efficient in vitro system that faithfully recapitulates epithelial differentiation. There are many uses for this system. For instance, the ability to grow three-dimensional organotypic raft cultures of keratinocytes has been an important milestone in the study of human papillomavirus (HPV)(1). The life cycle of HPV is tightly linked to the differentiation of squamous epithelium(2). Organotypic epithelial raft cultures as demonstrated here reproduce the entire papillomavirus life cycle, including virus production(3,4,5). In addition, these raft cultures exhibit dysplastic lesions similar to those observed upon in vivo infection with HPV. Hence this system can also be used to study epithelial cell cancers, as well as the effect of drugs on epithelial cell differentiation in general. Originally developed by Asselineau and Prunieras(6) and modified by Kopan et al.(7), the organotypic epithelial raft culture system has matured into a general, relatively easy culture model, which involves the growth of cells on collagen plugs maintained at an air-liquid interface (Figure 1A). Over the course of 10-14 days, the cells stratify and differentiate, forming a full thickness epithelium that produces differentiation-specific cytokeratins. Harvested rafts can be examined histologically, as well as by standard molecular and biochemical techniques. In this article, we describe a method for the generation of raft cultures from primary human keratinocytes. The same technique can be used with established epithelial cell lines, and can easily be adapted for use with epithelial tissue from normal or diseased biopsies(8). Many viruses target either the cutaneous or mucosal epithelium as part of their replicative life cycle. Over the past several years, the feasibility of using organotypic raft cultures as a method of studying virus-host cell interactions has been shown for several herpesviruses, as

  15. Chimeric Human Skin Substitute Tissue: A Novel Treatment Option for the Delivery of Autologous Keratinocytes.

    Science.gov (United States)

    Rasmussen, Cathy A; Allen-Hoffmann, B Lynn

    2012-04-01

    For patients suffering from catastrophic burns, few treatment options are available. Chimeric coculture of patient-derived autologous cells with a "carrier" cell source of allogeneic keratinocytes has been proposed as a means to address the complex clinical problem of severe skin loss. Currently, autologous keratinocytes are harvested, cultured, and expanded to form graftable epidermal sheets. However, epidermal sheets are thin, are extremely fragile, and do not possess barrier function, which only develops as skin stratifies and matures. Grafting is typically delayed for up to 4 weeks to propagate a sufficient quantity of the patient's cells for application to wound sites. Fully stratified chimeric bioengineered skin substitutes could not only provide immediate wound coverage and restore barrier function, but would simultaneously deliver autologous keratinocytes to wounds. The ideal allogeneic cell source for this application would be an abundant supply of clinically evaluated, nontumorigenic, pathogen-free, human keratinocytes. To evaluate this potential cell-based therapy, mixed populations of a green fluorescent protein-labeled neonatal human keratinocyte cell line (NIKS) and unlabeled primary keratinocytes were used to model the allogeneic and autologous components of chimeric monolayer and organotypic cultures. Relatively few autologous keratinocytes may be required to produce fully stratified chimeric skin substitute tissue substantially composed of autologous keratinocyte-derived regions. The need for few autologous cells interspersed within an allogeneic "carrier" cell population may decrease cell expansion time, reducing the time to patient application. This study provides proof of concept for utilizing NIKS keratinocytes as the allogeneic carrier for the generation of bioengineered chimeric skin substitute tissues capable of providing immediate wound coverage while simultaneously supplying autologous human cells for tissue regeneration.

  16. Comparison of the miRNA profiles in HPV-positive and HPV-negative tonsillar tumors and a model system of human keratinocyte clones

    International Nuclear Information System (INIS)

    Vojtechova, Zuzana; Sabol, Ivan; Salakova, Martina; Smahelova, Jana; Zavadil, Jiri; Turek, Lubomir; Grega, Marek; Klozar, Jan; Prochazka, Bohumir; Tachezy, Ruth

    2016-01-01

    Better insights into the molecular changes involved in virus-associated and -independent head and neck cancer may advance our knowledge of HNC carcinogenesis and identify critical disease biomarkers. Here we aimed to characterize the expression profiles in a matched set of well-characterized HPV-dependent and HPV-independent tonsillar tumors and equivalent immortalized keratinocyte clones to define potential and clinically relevant biomarkers of HNC of different etiology. Fresh frozen tonsillar cancer tissues were analyzed together with non-malignant tonsillar tissues and compared with cervical tumors and normal cervical tissues. Furthermore, relative miRNAs abundance levels of primary and immortalized human keratinocyte clones were evaluated. The global quantitation of miRNA gene abundance was performed using a TaqMan Low Density Array system. The confirmation of differentially expressed miRNAs was performed on a set of formalin-fixed paraffin-embedded tumor samples enriched for the tumor cell fraction by macrodissection. We defined 46 upregulated and 31 downregulated miRNAs characteristic for the HPV-positive tonsillar tumors and 42 upregulated miRNAs and 42 downregulated miRNAs characteristic for HPV-independent tumors. In comparison with the expression profiles in cervical tumors, we defined miR-141-3p, miR-15b-5p, miR-200a-3p, miR-302c-3p, and miR-9-5p as specific for HPV induced malignancies. MiR-335-5p, miR-579-3p, and miR-126-5p were shared by the expression profiles of HPV-positive tonsillar tumors and of the HPV immortalized keratinocyte clones, whereas miR-328-3p, miR-34c-3p, and miR-885-5p were shared by the miRNA profiles of HPV-negative tonsillar tumors and the HPV-negative keratinocytes. We identified the miRNAs characteristic for HPV-induced tumors and tonsillar tumors of different etiology, and the results were compared with those of the model system. Our report presents the basis for further investigations leading to the identification of

  17. Immortalized human myotonic dystrophy muscle cell lines to assess therapeutic compounds

    OpenAIRE

    Arandel, Ludovic; Polay Espinoza, Micaela; Matloka, Magdalena; Bazinet, Audrey; De Dea Diniz, Damily; Naouar, Na?ra; Rau, Fr?d?rique; Jollet, Arnaud; Edom-Vovard, Fr?d?rique; Mamchaoui, Kamel; Tarnopolsky, Mark; Puymirat, Jack; Battail, Christophe; Boland, Anne; Deleuze, Jean-Francois

    2017-01-01

    International audience; Myotonic dystrophy type 1 (DM1) and type 2 (DM2) are autosomal dominant neuromuscular diseases caused by microsatellite expansions and belong to the family of RNA-dominant disorders. Availability of cellular models in which the DM mutation is expressed within its natural context is essential to facilitate efforts to identify new therapeutic compounds. Here, we generated immortalized DM1 and DM2 human muscle cell lines that display nuclear RNA aggregates of expanded rep...

  18. The People Paradox: Self-Esteem Striving, Immortality Ideologies, and Human Response to Climate Change

    OpenAIRE

    Janis L. Dickinson

    2009-01-01

    In 1973, Ernest Becker, a cultural anthropologist cross-trained in philosophy, sociology, and psychiatry, invoked consciousness of self and the inevitability of death as the primary sources of human anxiety and repression. He proposed that the psychological basis of cooperation, competition, and emotional and mental health is a tendency to hold tightly to anxiety-buffering cultural world views or "immortality projects" that serve as the basis for self-esteem and meaning. Although he focused m...

  19. Exogenous hydrogen sulfide promotes cell proliferation and differentiation by modulating autophagy in human keratinocytes

    International Nuclear Information System (INIS)

    Xie, Xin; Dai, Hui; Zhuang, Binyu; Chai, Li; Xie, Yanguang; Li, Yuzhen

    2016-01-01

    The effects and the underlying mechanisms of hydrogen sulfide (H 2 S) on keratinocyte proliferation and differentiation are still less known. In the current study, we investigated the effects and the underlying mechanisms of exogenous H 2 S on keratinocyte proliferation and differentiation. Human keratinocytes (HaCaT cells) were treated with various concentrations (0.05, 0.25, 0.5 and 1 mM) of sodium hydrosulfide (NaHS, a donor of H 2 S) for 24 h. A CCK-8 assay was used to assess cell viability. Western blot analysis was performed to determine the expression levels of proteins associated with differentiation and autophagy. Transmission electron microscopy was performed to observe autophagic vacuoles, and flow cytometry was applied to evaluate apoptosis. NaHS promoted the viability, induced the differentiation, and enhanced autophagic activity in a dose-dependent manner in HaCaT cells but had no effect on cell apoptosis. Blockage of autophagy by ATG5 siRNA inhibited NaHS-induced cell proliferation and differentiation. The current study demonstrated that autophagy in response to exogenous H 2 S treatment promoted keratinocyte proliferation and differentiation. Our results provide additional insights into the potential role of autophagy in keratinocyte proliferation and differentiation. - Highlights: • Exogenous H 2 S promotes keratinocyte proliferation and differentiation. • The effects of H 2 S on proliferation and differentiation is modulated by autophagy. • Exogenous H 2 S has no effect on keratinocyte apoptosis.

  20. Protein composition of catalytically active human telomerase from immortal cells

    DEFF Research Database (Denmark)

    Cohen, Scott B; Graham, Mark E; Lovrecz, George O

    2007-01-01

    Telomerase is a ribonucleoprotein enzyme complex that adds 5'-TTAGGG-3' repeats onto the ends of human chromosomes, providing a telomere maintenance mechanism for approximately 90% of human cancers. We have purified human telomerase approximately 10(8)-fold, with the final elution dependent on th...

  1. Immortalization of normal human embryonic fibroblasts by introduction of either the human papillomavirus type 16 E6 or E7 gene alone.

    Science.gov (United States)

    Yamamoto, Akito; Kumakura, Shin-ichi; Uchida, Minoru; Barrett, J Carl; Tsutsui, Takeki

    2003-09-01

    The ability of the human papillomavirus type 16 (HPV-16) E6 or E7 gene to induce immortalization of normal human embryonic fibroblast WHE-7 cells was examined. WHE-7 cells at 9 population doublings (PD) were infected with retrovirus vectors encoding either HPV-16 E6 or E7 alone or both E6 and E7 (E6/E7). One of 4 isolated clones carrying E6 alone became immortal and is currently at >445 PD. Four of 4 isolated clones carrying E7 alone escaped from crisis and are currently at >330 PD. Three of 5 isolated clones carrying E6/E7 were also immortalized and are currently at >268 PD. The immortal clone carrying E6 only and 2 of the 3 immortal clones carrying E6/E7 expressed a high level of E6 protein, and all the immortal clones carrying E7 alone and the other immortal clone carrying E6/E7 expressed a high level of E7 protein when compared to their mortal or precrisis clones. The immortal clones expressing a high level of E6 or E7 protein were positive for telomerase activity or an alternative mechanism of telomere maintenance, respectively, known as ALT (alternative lengthening of telomeres). All the mortal or precrisis clones were negative for both phenotypes. All the immortal clones exhibited abrogation of G1 arrest after DNA damage by X-ray irradiation. The expression of INK4a protein (p16(INK4a)) was undetectable in the E6-infected mortal and immortal clones, whereas Rb protein (pRb) was hyperphosphorylated only in the immortal clone. The p16(INK4a) protein was overexpressed in all the E7-infected immortal clones and their clones in the pre-crisis period as well as all the E6/E7-infected mortal and immortal clones, but the pRb expression was downregulated in all of these clones. These results demonstrate for the first time to our knowledge that HPV-16 E6 or E7 alone can induce immortalization of normal human embryonic fibroblasts. Inactivation of p16(INK4a)/pRb pathways in combination with activation of a telomere maintenance mechanism is suggested to be necessary for

  2. Random integration of SV40 in SV40-transformed, immortalized human fibroblasts.

    Science.gov (United States)

    Hara, H; Kaji, H

    1987-02-01

    We have studied the relationship between immortalization of SV40-transformed human embryonic fibroblasts and their SV40 integration sites. From several independently transformed cell pools, we have isolated clones which do not harbor unintegrated SV40 DNA. We have analysed whole-cell DNA from these clones, using the Southern blot method. Our results suggest that no specific integration sites in the cellular genome exist which are a prerequisite for the immortalization process. Although some integration sites were found to be predominant in pre-crisis clones, they could not be detected in the post-crisis clones. This suggests that none of these predominating sites is selected for during the crisis period.

  3. Effects of titanium dioxide nanoparticles on human keratinocytes.

    Science.gov (United States)

    Wright, Clayton; Iyer, Anand Krishnan V; Wang, Liying; Wu, Nianqiang; Yakisich, Juan S; Rojanasakul, Yon; Azad, Neelam

    2017-01-01

    Titanium dioxide (TiO 2 ) is a ubiquitous whitening compound widely used in topical products such as sunscreens, lotions and facial creams. The damaging health effects of TiO 2 inhalation has been widely studied in rats, mice and humans showing oxidative stress increase, DNA damage, cell death and inflammatory gene upregulation in lung and throat cells; however, the effects on skin cells from long-term topical use of various products remain largely unknown. In this study, we assessed the effect of specific TiO 2 nanoparticles (H 2 TiO 7 ) on a human keratinocyte cell line (HaCaT). We performed a comparative analysis using three TiO 2 particles varying in size (Fine, Ultrafine and H 2 TiO 7 ) and analyzed their effects on HaCaTs. There is a clear dose-dependent increase in superoxide production, caspase 8 and 9 activity, and apoptosis in HaCaTs after treatment with all three forms of TiO 2 ; however, there is no consistent effect on cell viability and proliferation with either of these TiO 2 particles. While there is data suggesting UV exposure can enhance the carcinogenic effects of TiO 2 , we did not observe any significant effect of UV-C exposure combined with TiO 2 treatment on HaCaTs. Furthermore, TiO 2 -treated cells showed minimal effects on VEGF upregulation and Wnt signaling pathway thereby showing no potential effect on angiogenesis and malignant transformation. Overall, we report here an increase in apoptosis, which may be caspase 8/Fas-dependent, and that the H 2 TiO 7 nanoparticles, despite their smaller particle size, had no significant enhanced effect on HaCaT cells as compared to Fine and Ultrafine forms of TiO 2 .

  4. Marked stimulation of growth and motility of human keratinocytes by hepatocyte growth factor

    International Nuclear Information System (INIS)

    Matsumoto, K.; Hashimoto, K.; Yoshikawa, K.; Nakamura, T.

    1991-01-01

    Effect of hepatocyte growth factor (HGF) on normal human epidermal keratinocytes cultured under conditions of low Ca2+ (0.1 mM, growth-promoting condition) and physiological Ca2+ (1.8 mM, differentiation-promoting condition) was investigated. In low Ca2+, HGF markedly enhanced the migration of keratinocytes while it suppressed cell growth and DNA synthesis in a dose-dependent manner. In contrast, HGF enhanced the migration, cell growth, and DNA synthesis of keratinocytes cultured under conditions of physiological Ca2+. The maximal stimulation of DNA synthesis (2.4-fold stimulation) in physiological Ca2+ was seen at 2.5-5 ng/ml HGF and the stimulatory effect of HGF was suppressed by transforming growth factor-beta 1. Analysis of the HGF receptor using 125I-HGF as a ligand showed that human keratinocytes expressed a single class of specific, saturable receptor for HGF in both low and physiological Ca2+ conditions, exhibiting a Kd = 17.3 pM and approximately 690 binding sites/cell under physiological Ca2+. Thus, HGF is a potent factor which enhances growth and migration of normal human keratinocytes under conditions of physiological Ca2+. HGF may play an important role in epidermal tissue repair as it enhances both the migration and growth of keratinocytes

  5. Telomere dynamics, end-to-end fusions and telomerase activation during the human fibroblast immortalization process.

    Science.gov (United States)

    Ducray, C; Pommier, J P; Martins, L; Boussin, F D; Sabatier, L

    1999-07-22

    Loss of telomeric repeats during cell proliferation could play a role in senescence. It has been generally assumed that activation of telomerase prevents further telomere shortening and is essential for cell immortalization. In this study, we performed a detailed cytogenetic and molecular characterization of four SV40 transformed human fibroblastic cell lines by regularly monitoring the size distribution of terminal restriction fragments, telomerase activity and the associated chromosomal instability throughout immortalization. The mean TRF lengths progressively decreased in pre-crisis cells during the lifespan of the cultures. At crisis, telomeres reached a critical size, different among the cell lines, contributing to the peak of dicentric chromosomes, which resulted mostly from telomeric associations. We observed a direct correlation between short telomere length at crisis and chromosomal instability. In two immortal cell lines, although telomerase was detected, mean telomere length still continued to decrease whereas the number of dicentric chromosomes associated was stabilized. Thus telomerase could protect specifically telomeres which have reached a critical size against end-to-end dicentrics, while long telomeres continue to decrease, although at a slower rate as before crisis. This suggests a balance between elongation by telomerase and telomere shortening, towards a stabilized 'optimal' length.

  6. Hyaluronan minimizes effects of UV irradiation on human keratinocytes

    Czech Academy of Sciences Publication Activity Database

    Hašová, M.; Crhák, Tomáš; Šafaříková, Barbora; Dvořáková, J.; Muthný, T.; Velebný, V.; Kubala, Lukáš

    2011-01-01

    Roč. 303, č. 4 (2011), s. 277-284 ISSN 0340-3696 R&D Projects: GA ČR(CZ) GA305/08/1704 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : hyaluronan * keratinocyte * ultraviolet light Subject RIV: BO - Biophysics Impact factor: 2.279, year: 2011

  7. Exploratory Study on the Stability Characteristics of Commercial Human Keratinocytes

    Science.gov (United States)

    1990-04-01

    Invest. Dermatol. 75:176- 182; 1980. 16. Hayflick , L. The limited in vitro lifetime of huiran diploid strains. Exp. Cell Res. 37:614-636; 1965. 17...culture keratinocytes were considered by some investigators to have limited proliferative potential, so they used third and fourth passage commercial

  8. In Search of Rationality in Human Longevity and Immortality

    OpenAIRE

    Bhar, Gopal C.

    2016-01-01

    The human body is machine-like, but self-moving, self-regulating, and self-adjusting, governed by willpower and intelligence. Aging of the body is basically a maintenance problem and so it could perhaps be postponed by thorough and frequent maintenance. Aging brings on a cascade of ills and health problems leading to deterioration of physical, mental, emotional, and social dimensions of life. This paper deals with solution of the problem philosophically in the light of Indian scriptures witho...

  9. Adherence of human oral keratinocytes and gingival fibroblasts to nano-structured titanium surfaces.

    Science.gov (United States)

    Dorkhan, Marjan; Yücel-Lindberg, Tülay; Hall, Jan; Svensäter, Gunnel; Davies, Julia R

    2014-06-21

    A key element for long-term success of dental implants is integration of the implant surface with the surrounding host tissues. Modification of titanium implant surfaces can enhance osteoblast activity but their effects on soft-tissue cells are unclear. Adherence of human keratinocytes and gingival fibroblasts to control commercially pure titanium (CpTi) and two surfaces prepared by anodic oxidation was therefore investigated. Since implant abutments are exposed to a bacteria-rich environment in vivo, the effect of oral bacteria on keratinocyte adhesion was also evaluated. The surfaces were characterized using scanning electron microscopy (SEM). The number of adhered cells and binding strength, as well as vitality of fibroblasts and keratinocytes were evaluated using confocal scanning laser microscopy after staining with Live/Dead Baclight. To evaluate the effect of bacteria on adherence and vitality, keratinocytes were co-cultured with a four-species streptococcal consortium. SEM analysis showed the two anodically oxidized surfaces to be nano-structured with differing degrees of pore-density. Over 24 hours, both fibroblasts and keratinocytes adhered well to the nano-structured surfaces, although to a somewhat lesser degree than to CpTi (range 42-89% of the levels on CpTi). The strength of keratinocyte adhesion was greater than that of the fibroblasts but no differences in adhesion strength could be observed between the two nano-structured surfaces and the CpTi. The consortium of commensal streptococci markedly reduced keratinocyte adherence on all the surfaces as well as compromising membrane integrity of the adhered cells. Both the vitality and level of adherence of soft-tissue cells to the nano-structured surfaces was similar to that on CpTi. Co-culture with streptococci reduced the number of keratinocytes on all the surfaces to approximately the same level and caused cell damage, suggesting that commensal bacteria could affect adherence of soft-tissue cells to

  10. Enhanced secretion of TIMP-1 by human hypertrophic scar keratinocytes could contribute to fibrosis.

    Science.gov (United States)

    Simon, Franck; Bergeron, Daniele; Larochelle, Sébastien; Lopez-Vallé, Carlos A; Genest, Hervé; Armour, Alexis; Moulin, Véronique J

    2012-05-01

    Hypertrophic scars are a pathological process characterized by an excessive deposition of extracellular matrix components. Using a tissue-engineered reconstructed human skin (RHS) method, we previously reported that pathological keratinocytes induce formation of a fibrotic dermal matrix. We further investigated keratinocyte action using conditioned media. Results showed that conditioned media induce a similar action on dermal thickness similar to when an epidermis is present. Using a two-dimensional electrophoresis technique, we then compared conditioned media from normal or hypertrophic scar keratinocytes and determined that TIMP-1 was increased in conditioned media from hypertrophic scar keratinocytes. This differential profile was confirmed using ELISA, assaying TIMP-1 presence on media from monolayer cultured keratinocytes and from RHS. The dermal matrix of these RHS was recreated using mesenchymal cells from three different origins (skin, wound and hypertrophic scar). The effect of increased TIMP-1 levels on dermal fibrosis was also validated independently from the mesenchymal cell origin. Immunodetection of TIMP-1 showed that this protein was increased in the epidermis of hypertrophic scar biopsies. The findings of this study represent an important advance in understanding the role of keratinocytes as a direct potent modulator for matrix degradation and scar tissue remodeling, possibly through inactivation of MMPs. Copyright © 2011 Elsevier Ltd and ISBI. All rights reserved.

  11. Fos and jun proteins are specifically expressed during differentiation of human keratinocytes.

    Science.gov (United States)

    Mehic, Denis; Bakiri, Latifa; Ghannadan, Minoo; Wagner, Erwin F; Tschachler, Erwin

    2005-01-01

    Activator protein 1 (AP-1) proteins play key roles in the regulation of cell proliferation and differentiation. In this study we investigated the expression of Fos and Jun proteins in different models of terminal differentiation of human keratinocytes and in skin from psoriasis patients. All Jun and Fos proteins, with the exception of FosB, were efficiently expressed in keratinocytes in monolayer cultures. In contrast, in normal epidermis as well as in organotypic epidermal cultures, the expression pattern of AP-1 proteins was dependent on the differentiation stage. Fos proteins were readily detected in nuclei of keratinocytes of basal and suprabasal layers. JunB and JunD were expressed in all layers of normal epidermis. Interestingly, expression of c-Jun started suprabasally, then disappeared and became detectable again in distinct cells of the outermost granular layer directly at the transition zone to the stratum corneum. In psoriatic epidermis, c-Jun expression was prominent in both hyperproliferating basal and suprabasal keratinocytes, whereas c-Fos expression was unchanged. These data indicate that AP-1 proteins are expressed in a highly specific manner during terminal differentiation of keratinocytes and that the enhanced expression of c-Jun in basal and suprabasal keratinocytes might contribute to the pathogenesis of psoriasis.

  12. Immortalization of human neural stem cells with the c-myc mutant T58A.

    Directory of Open Access Journals (Sweden)

    Lidia De Filippis

    Full Text Available Human neural stem cells (hNSC represent an essential source of renewable brain cells for both experimental studies and cell replacement therapies. Their relatively slow rate of proliferation and physiological senescence in culture make their use cumbersome under some experimental and pre-clinical settings. The immortalization of hNSC with the v-myc gene (v-IhNSC has been shown to generate stem cells endowed with enhanced proliferative capacity, which greatly facilitates the study of hNSCs, both in vitro and in vivo. Despite the excellent safety properties displayed by v-IhNSCs--which do not transform in vitro and are not tumorigenic in vivo--the v-myc gene contains several mutations and recombination elements, whose role(s and effects remains to be elucidated, yielding unresolved safety concerns. To address this issue, we used a c-myc T58A retroviral vector to establish an immortal cell line (T-IhNSC from the same hNSCs used to generate the original v-IhNSCs and compared their characteristics with the latter, with hNSC and with hNSC immortalized using c-myc wt (c-IhNSC. T-IhNSCs displayed an enhanced self-renewal ability, with their proliferative capacity and clonogenic potential being remarkably comparable to those of v-IhNSC and higher than wild type hNSCs and c-IhNSCs. Upon growth factors removal, T-IhNSC promptly gave rise to well-differentiated neurons, astrocytes and most importantly, to a heretofore undocumented high percentage of human oligodendrocytes (up to 23%. Persistent growth-factor dependence, steady functional properties, lack of ability to generate colonies in soft-agar colony-forming assay and to establish tumors upon orthotopic transplantation, point to the fact that immortalization by c-myc T58A does not bring about tumorigenicity in hNSCs. Hence, this work describes a novel and continuous cell line of immortalized human multipotent neural stem cells, in which the immortalizing agent is represented by a single gene which, in

  13. In Search of Rationality in Human Longevity and Immortality.

    Science.gov (United States)

    Bhar, Gopal C

    2016-01-01

    The human body is machine-like, but self-moving, self-regulating, and self-adjusting, governed by willpower and intelligence. Aging of the body is basically a maintenance problem and so it could perhaps be postponed by thorough and frequent maintenance. Aging brings on a cascade of ills and health problems leading to deterioration of physical, mental, emotional, and social dimensions of life. This paper deals with solution of the problem philosophically in the light of Indian scriptures without entering into traditional bioethical issues. With a meaningful reason for existence, life can be extended. Examining the scientific perspectives on aging, some common manipulations for its extension are discussed. These are calorie restriction, vitamin and antioxidant treatment, exercise and hormonal interventions, etc. Finally, the question of longevity is explored through pursuance of eternal value-based activity and spirituality in the tradition of Indian heritage.

  14. Human keratinocytes restrict chikungunya virus replication at a post-fusion step

    Energy Technology Data Exchange (ETDEWEB)

    Bernard, Eric [Centre d' étude d’agents Pathogènes et Biotechnologies pour la Santé, CPBS CNRS- UMR5236/UM1/UM2, Montpellier (France); Hamel, Rodolphe [Laboratoire Maladies Infectieuses et Vecteurs: Ecologie, Génétique, Evolution, Contrôle, UMR 5290 CNRS/IRD/UM1, Montpellier (France); Neyret, Aymeric [Centre d' étude d’agents Pathogènes et Biotechnologies pour la Santé, CPBS CNRS- UMR5236/UM1/UM2, Montpellier (France); Ekchariyawat, Peeraya [Laboratoire Maladies Infectieuses et Vecteurs: Ecologie, Génétique, Evolution, Contrôle, UMR 5290 CNRS/IRD/UM1, Montpellier (France); Molès, Jean-Pierre [INSERM U1058, UM1, CHU Montpellier (France); Simmons, Graham [Blood Systems Research Institute, San Francisco, CA 94118 (United States); Chazal, Nathalie [Centre d' étude d’agents Pathogènes et Biotechnologies pour la Santé, CPBS CNRS- UMR5236/UM1/UM2, Montpellier (France); Desprès, Philippe [Unité Interactions Moléculaires Flavivirus-Hôtes, Institut Pasteur, Paris (France); and others

    2015-02-15

    Transmission of chikungunya virus (CHIKV) to humans is initiated by puncture of the skin by a blood-feeding Aedes mosquito. Despite the growing knowledge accumulated on CHIKV, the interplay between skin cells and CHIKV following inoculation still remains unclear. In this study we questioned the behavior of human keratinocytes, the predominant cell population in the skin, following viral challenge. We report that CHIKV rapidly elicits an innate immune response in these cells leading to the enhanced transcription of type I/II and type III interferon genes. Concomitantly, we show that despite viral particles internalization into Rab5-positive endosomes and efficient fusion of virus and cell membranes, keratinocytes poorly replicate CHIKV as attested by absence of nonstructural proteins and genomic RNA synthesis. Accordingly, human keratinocytes behave as an antiviral defense against CHIKV infection rather than as a primary targets for initial replication. This picture significantly differs from that reported for Dengue and West Nile mosquito-borne viruses. - Highlights: • Human keratinocytes support endocytosis of CHIKV and fusion of viral membranes. • CHIKV replication is blocked at a post entry step in these cells. • Infection upregulates type-I, –II and –III IFN genes expression. • Keratinocytes behave as immune sentinels against CHIKV.

  15. Human keratinocytes restrict chikungunya virus replication at a post-fusion step

    International Nuclear Information System (INIS)

    Bernard, Eric; Hamel, Rodolphe; Neyret, Aymeric; Ekchariyawat, Peeraya; Molès, Jean-Pierre; Simmons, Graham; Chazal, Nathalie; Desprès, Philippe

    2015-01-01

    Transmission of chikungunya virus (CHIKV) to humans is initiated by puncture of the skin by a blood-feeding Aedes mosquito. Despite the growing knowledge accumulated on CHIKV, the interplay between skin cells and CHIKV following inoculation still remains unclear. In this study we questioned the behavior of human keratinocytes, the predominant cell population in the skin, following viral challenge. We report that CHIKV rapidly elicits an innate immune response in these cells leading to the enhanced transcription of type I/II and type III interferon genes. Concomitantly, we show that despite viral particles internalization into Rab5-positive endosomes and efficient fusion of virus and cell membranes, keratinocytes poorly replicate CHIKV as attested by absence of nonstructural proteins and genomic RNA synthesis. Accordingly, human keratinocytes behave as an antiviral defense against CHIKV infection rather than as a primary targets for initial replication. This picture significantly differs from that reported for Dengue and West Nile mosquito-borne viruses. - Highlights: • Human keratinocytes support endocytosis of CHIKV and fusion of viral membranes. • CHIKV replication is blocked at a post entry step in these cells. • Infection upregulates type-I, –II and –III IFN genes expression. • Keratinocytes behave as immune sentinels against CHIKV

  16. Human Papilloma Viral DNA Replicates as a Stable Episome in Cultured Epidermal Keratinocytes

    Science.gov (United States)

    Laporta, Robert F.; Taichman, Lorne B.

    1982-06-01

    Human papilloma virus (HPV) is poorly understood because systems for its growth in tissue culture have not been developed. We report here that cultured human epidermal keratinocytes could be infected with HPV from plantar warts and that the viral DNA persisted and replicated as a stable episome. There were 50-200 copies of viral DNA per cell and there was no evidence to indicate integration of viral DNA into the cellular genome. There was also no evidence to suggest that viral DNA underwent productive replication. We conclude that cultured human epidermal keratinocytes may be a model for the study of certain aspects of HPV biology.

  17. Cortactin involvement in the keratinocyte growth factor and fibroblast growth factor 10 promotion of migration and cortical actin assembly in human keratinocytes

    International Nuclear Information System (INIS)

    Ceccarelli, Simona; Cardinali, Giorgia; Aspite, Nicaela; Picardo, Mauro; Marchese, Cinzia; Torrisi, Maria Rosaria; Mancini, Patrizia

    2007-01-01

    Keratinocyte growth factor (KGF/FGF7) and fibroblast growth factor 10 (FGF10/KGF2) regulate keratinocyte proliferation and differentiation by binding to the tyrosine kinase KGF receptor (KGFR). KGF induces keratinocyte motility and cytoskeletal rearrangement, whereas a direct role of FGF10 on keratinocyte migration is not clearly established. Here we analyzed the motogenic activity of FGF10 and KGF on human keratinocytes. Migration assays and immunofluorescence of actin cytoskeleton revealed that FGF10 is less efficient than KGF in promoting migration and exerts a delayed effect in inducing lamellipodia and ruffles formation. Both growth factors promoted phosphorylation and subsequent membrane translocation of cortactin, an F-actin binding protein involved in cell migration; however, FGF10-induced cortactin phosphorylation was reduced, more transient and delayed with respect to that promoted by KGF. Cortactin phosphorylation induced by both growth factors was Src-dependent, while its membrane translocation and cell migration were blocked by either Src and PI3K inhibitors, suggesting that both pathways are involved in KGF- and FGF10-dependent motility. Furthermore, siRNA-mediated downregulation of cortactin inhibited KGF- and FGF10-induced migration. These results indicate that cortactin is involved in keratinocyte migration promoted by both KGF and FGF10

  18. Multistep carcinogenesis of normal human fibroblasts. Human fibroblasts immortalized by repeated treatment with Co-60 gamma rays were transformed into tumorigenic cells with Ha-ras oncogenes.

    Science.gov (United States)

    Namba, M; Nishitani, K; Fukushima, F; Kimoto, T

    1988-01-01

    Two normal mortal human fibroblast cell strains were transformed into immortal cell lines, SUSM-1 and KMST-6, by treatment with 4-nitroquinoline 1-oxide (4NQO) and Co-60 gamma rays, respectively. These immortalized cell lines showed morphological changes of cells and remarkable chromosome aberrations, but neither of them grew in soft agar or formed tumors in nude mice. The immortal cell line, KMST-6, was then converted into neoplastic cells by treatment with Harvey murine sarcoma virus (Ha-MSV) or the c-Ha-ras oncogene derived from a human lung carcinoma. These neoplastically transformed cells acquired anchorage-independent growth potential and developed tumors when transplanted into nude mice. All the tumors grew progressively without regression until the animals died of tumors. In addition, the tumors were transplantable into other nude mice. Normal human fibroblasts, on the other hand, were not transformed into either immortal or tumorigenic cells by treatment with Ha-MSV or c-Ha-ras alone. Our present data indicate that (1) the chemical carcinogen, 4NQO, or gamma rays worked as an initiator of carcinogenesis in normal human cells, giving rise to immortality, and (2) the ras gene played a role in the progression of the immortally transformed cells to more malignant cells showing anchorage-independent growth and tumorigenicity. In other words, the immortalization process of human cells seems to be a pivotal or rate-limiting step in the carcinogenesis of human cells.

  19. Eicosapentaenoic acid inhibits TNF-α-induced matrix metalloproteinase-9 expression in human keratinocytes, HaCaT cells

    International Nuclear Information System (INIS)

    Kim, Hyeon Ho; Lee, Youngae; Eun, Hee Chul; Chung, Jin Ho

    2008-01-01

    Eicosapentaenoic acid (EPA) is an omega-3 (ω-3) polyunsaturated fatty acid (PUFA), which has anti-inflammatory and anti-cancer properties. Some reports have demonstrated that EPA inhibits NF-κB activation induced by tumor necrosis factor (TNF)-α or lipopolysaccharide (LPS) in various cells. However, its detailed mode of action is unclear. In this report, we investigated whether EPA inhibits the expression of TNF-α-induced matrix metalloproteinases (MMP)-9 in human immortalized keratinocytes (HaCaT). TNF-α induced MMP-9 expression by NF-κB-dependent pathway. Pretreatment of EPA inhibited TNF-α-induced MMP-9 expression and p65 phosphorylation. However, EPA could not affect IκB-α phosphorylation, nuclear translocation of p65, and DNA binding activity of NF-κB. EPA inhibited TNF-α-induced p65 phosphorylation through p38 and Akt inhibition and this inhibition was IKKα-dependent event. Taken together, we demonstrate that EPA inhibits TNF-α-induced MMP-9 expression through inhibition of p38 and Akt activation

  20. Selenium-regulated hierarchy of human selenoproteome in cancerous and immortalized cells lines.

    Science.gov (United States)

    Touat-Hamici, Zahia; Bulteau, Anne-Laure; Bianga, Juliusz; Jean-Jacques, Hélène; Szpunar, Joanna; Lobinski, Ryszard; Chavatte, Laurent

    2018-04-13

    Selenoproteins (25 genes in human) co-translationally incorporate selenocysteine using a UGA codon, normally used as a stop signal. The human selenoproteome is primarily regulated by selenium bioavailability with a tissue-specific hierarchy. We investigated the hierarchy of selenoprotein expression in response to selenium concentration variation in four cell lines originating from kidney (HEK293, immortalized), prostate (LNCaP, cancer), skin (HaCaT, immortalized) and liver (HepG2, cancer), using complementary analytical methods. We performed (i) enzymatic activity, (ii) RT-qPCR, (iii) immuno-detection, (iv) selenium-specific mass spectrometric detection after non-radioactive 76 Se labeling of selenoproteins, and (v) luciferase-based reporter constructs in various cell extracts. We characterized cell-line specific alterations of the selenoproteome in response to selenium variation that, in most of the cases, resulted from a translational control of gene expression. We established that UGA-selenocysteine recoding efficiency, which depends on the nature of the SECIS element, dictates the response to selenium variation. We characterized that selenoprotein hierarchy is cell-line specific with conserved features. This analysis should be done prior to any experiments in a novel cell line. We reported a strategy based on complementary methods to evaluate selenoproteome regulation in human cells in culture. Copyright © 2018 Elsevier B.V. All rights reserved.

  1. Curcuma longa Is Able to Induce Apoptotic Cell Death of Pterygium-Derived Human Keratinocytes.

    Science.gov (United States)

    Sancilio, Silvia; Di Staso, Silvio; Sebastiani, Stefano; Centurione, Lucia; Di Girolamo, Nick; Ciancaglini, Marco; Di Pietro, Roberta

    2017-01-01

    Pterygium is a relatively common eye disease that can display an aggressive clinical behaviour. To evaluate the in vitro effects of Curcuma longa on human pterygium-derived keratinocytes, specimens of pterygium from 20 patients undergoing pterygium surgical excision were collected. Pterygium explants were put into culture and derived keratinocytes were treated with an alcoholic extract of 1.3% Curcuma longa in 0.001% Benzalkonium Chloride for 3, 6, and 24 h. Cultured cells were examined for CAM5.2 (anti-cytokeratin antibody) and CD140 (anti-fibroblast transmembrane glycoprotein antibody) expression between 3th and 16th passage to assess cell homogeneity. TUNEL technique and Annexin-V/PI staining in flow cytometry were used to detect keratinocyte apoptosis. We showed that Curcuma longa exerts a proapoptotic effect on pterygium-derived keratinocytes already after 3 h treatment. Moreover, after 24 h treatment, Curcuma longa induces a significant increase in TUNEL as well as Annexin-V/PI positive cells in comparison to untreated samples. Our study confirms previous observations highlighting the expression, in pterygium keratinocytes, of nuclear VEGF and gives evidence for the first time to the expression of nuclear and cytoplasmic VEGF-R1. All in all, these findings suggest that Curcuma longa could have some therapeutic potential in the treatment and prevention of human pterygium.

  2. Curcuma longa Is Able to Induce Apoptotic Cell Death of Pterygium-Derived Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Silvia Sancilio

    2017-01-01

    Full Text Available Pterygium is a relatively common eye disease that can display an aggressive clinical behaviour. To evaluate the in vitro effects of Curcuma longa on human pterygium-derived keratinocytes, specimens of pterygium from 20 patients undergoing pterygium surgical excision were collected. Pterygium explants were put into culture and derived keratinocytes were treated with an alcoholic extract of 1.3% Curcuma longa in 0.001% Benzalkonium Chloride for 3, 6, and 24 h. Cultured cells were examined for CAM5.2 (anti-cytokeratin antibody and CD140 (anti-fibroblast transmembrane glycoprotein antibody expression between 3th and 16th passage to assess cell homogeneity. TUNEL technique and Annexin-V/PI staining in flow cytometry were used to detect keratinocyte apoptosis. We showed that Curcuma longa exerts a proapoptotic effect on pterygium-derived keratinocytes already after 3 h treatment. Moreover, after 24 h treatment, Curcuma longa induces a significant increase in TUNEL as well as Annexin-V/PI positive cells in comparison to untreated samples. Our study confirms previous observations highlighting the expression, in pterygium keratinocytes, of nuclear VEGF and gives evidence for the first time to the expression of nuclear and cytoplasmic VEGF-R1. All in all, these findings suggest that Curcuma longa could have some therapeutic potential in the treatment and prevention of human pterygium.

  3. Insulin binding properties of normal and transformed human epidermal cultured keratinocytes

    International Nuclear Information System (INIS)

    Verrando, P.; Ortonne, J.P.

    1985-01-01

    Insulin binding to its receptors was studied in cultured normal and transformed (A431 line) human epidermal keratinocytes. The specific binding was a temperature-dependent, saturable process. Normal keratinocytes possess a mean value of about 80,000 receptors per cell. Fifteen hours exposure of the cells to insulin lowered their receptor number (about 65% loss in available sites); these reappeared when the hormone was removed from the culture medium. In the A431 epidermoid carcinoma cell line, there is a net decrease in insulin binding (84% of the initial bound/free hormone ratio in comparison with normal cells) essentially related to a loss in receptor affinity for insulin. Thus, cultured human keratinocytes which express insulin receptors may be a useful tool in understanding skin pathology related to insulin disorders

  4. Exogenous hydrogen sulfide promotes cell proliferation and differentiation by modulating autophagy in human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Xie, Xin [Department of Dermatology, The Second Affiliated Hospital of Harbin Medical University, Harbin, 150086, Heilongjiang Province (China); Dai, Hui [Department of Cardiology, The First Affiliated Hospital of Harbin Medical University, Harbin, 150001, Heilongjiang Province (China); Zhuang, Binyu [Department of Dermatology, The Second Affiliated Hospital of Harbin Medical University, Harbin, 150086, Heilongjiang Province (China); Chai, Li; Xie, Yanguang [Institute of Dermatology of Heilongjiang Province, Harbin, 150001, Heilongjiang Province (China); Li, Yuzhen, E-mail: liyuzhen@medmail.com.cn [Department of Dermatology, The Second Affiliated Hospital of Harbin Medical University, Harbin, 150086, Heilongjiang Province (China)

    2016-04-08

    The effects and the underlying mechanisms of hydrogen sulfide (H{sub 2}S) on keratinocyte proliferation and differentiation are still less known. In the current study, we investigated the effects and the underlying mechanisms of exogenous H{sub 2}S on keratinocyte proliferation and differentiation. Human keratinocytes (HaCaT cells) were treated with various concentrations (0.05, 0.25, 0.5 and 1 mM) of sodium hydrosulfide (NaHS, a donor of H{sub 2}S) for 24 h. A CCK-8 assay was used to assess cell viability. Western blot analysis was performed to determine the expression levels of proteins associated with differentiation and autophagy. Transmission electron microscopy was performed to observe autophagic vacuoles, and flow cytometry was applied to evaluate apoptosis. NaHS promoted the viability, induced the differentiation, and enhanced autophagic activity in a dose-dependent manner in HaCaT cells but had no effect on cell apoptosis. Blockage of autophagy by ATG5 siRNA inhibited NaHS-induced cell proliferation and differentiation. The current study demonstrated that autophagy in response to exogenous H{sub 2}S treatment promoted keratinocyte proliferation and differentiation. Our results provide additional insights into the potential role of autophagy in keratinocyte proliferation and differentiation. - Highlights: • Exogenous H{sub 2}S promotes keratinocyte proliferation and differentiation. • The effects of H{sub 2}S on proliferation and differentiation is modulated by autophagy. • Exogenous H{sub 2}S has no effect on keratinocyte apoptosis.

  5. The stress caused by nitrite with titanium dioxide nanoparticles under UVA irradiation in human keratinocyte cell

    International Nuclear Information System (INIS)

    Tu, Min; Huang, Yi; Li, Hai-Ling; Gao, Zhong-Hong

    2012-01-01

    Highlights: ► Nitrite increased photo-toxicity of nano-TiO 2 on human keratinocyte cells in a dose-dependant manner. ► Morphological study suggested the cell death may be mediated by apoptosis inducing factor. ► Protein nitration was generated in the cells, and the most abundant nitrated protein was identified as cystatin-A. ► Tyr35 was the most likely site to be nitrated in cystatin-A. -- Abstract: Our previous work found that in the presence of nitrite, titanium dioxide nanoparticles can cause protein tyrosine nitration under UVA irradiation in vivo. In this paper, the human keratinocyte cells was used as a skin cell model to further study the photo-toxicity of titanium dioxide nanoparticles when nitrite was present. The results showed that nitrite increased the photo-toxicity of titanium dioxide in a dose-dependant manner, and generated protein tyrosine nitration in keratinocyte cells. Morphological study of keratinocyte cells suggested a specific apoptosis mediated by apoptosis inducing factor. It was also found the main target nitrated in cells was cystatin-A, which expressed abundantly in cytoplasm and functioned as a cysteine protease inhibitor. The stress induced by titanium dioxide with nitrite under UVA irradiation in human keratinocyte cells appeared to trigger the apoptosis inducing factor mediated cell death and lose the inhibition of active caspase by cystatin-A. We conclude that nitrite can bring new damage and stress to human keratinocyte cells with titanium dioxide nanoparticles under UVA irradiation.

  6. Serially cultured keratinocytes from human scalp hair follicles: a tool for cytogenetic studies.

    Science.gov (United States)

    Weterings, P J; Roelofs, H M; Jansen, B A; Vermorken, A J

    1983-01-01

    Keratinocytes originating from adult human hair follicles, the most convenient biopsy tissue, can be serially cultured using a combination of two techniques. Primary cultures are established using plucked scalp hair follicles and the bovine eye lens capsule as a growth substrate. Subsequently, cells from these cultures are serially cultivated in the presence of irradiated 3T3 cells as feeders. By this combination of techniques many keratinocytes can be generated from one single hair follicle. These cultures, appropriately treated with colchicine, can provide an adequate number of metaphases suitable for chromosome studies.

  7. Micronucleus formation in cultured human keratinocytes following exposure to mitomycin C and cyclophosphamide.

    Science.gov (United States)

    van Pelt, F N; Haring, R M; Overkamp, M J; Weterings, P J

    1991-02-01

    A method is described to investigate the induction of micronuclei in cultured human keratinocytes after short-term exposure to known clastogenic agents. The cytokinesis-block method was applied to facilitate the scoring of micronucleated cells. Mitomycin C, a direct-acting compound, caused a 5-20-fold increase in micronuclei over the controls at the highest concentration tested (1 microgram/ml). Cyclophosphamide, an agent requiring metabolic activation, did not induce the formation of micronuclei in cultured keratinocytes. However, after pretreatment of the keratinocyte cultures with Aroclor 1254 for 72 h, exposure to cyclophosphamide resulted in a 3-fold increase in micronucleus frequency over the controls. No cytogenetic effect of Aroclor 1254 was observed in control experiments.

  8. Attachment and growth of human keratinocytes in a serum-free environment.

    Science.gov (United States)

    Gilchrest, B A; Calhoun, J K; Maciag, T

    1982-08-01

    Using a serum-free system, we have investigated the influence of human fibronectin (HFN) and selected growth factors (GF) on the attachment and growth of normal human keratinocytes in vitro. Single-cell suspensions of keratinocytes from near-confluent primary plates, plated on 5-10 microgram/cm2 HFN, showed approximately 30-40% attachment after 2-24 hours of incubation at 37 degrees C, compared with 4-6% attachment on uncoated platic plates. Percentage of attached cells was independent of seed density, tissue donor age, in vitro culture age, or medium composition, while subsequent cellular proliferation was strongly dependent on these factors. Keratinocytes grown on an adequate HFN matrix in a previously described hormone-supplemented medium (Maciag et al., 1981a) achieved four to eight population doubling over 7-12 days at densities greater than or equal to 104 cell/cm2. Removal of most GF individually from the medium had little or no effect on growth, while removal of epidermal growth factor (EGF) alone reduced growth by 30-35% and removal of bovine brain extract (BE) alone reduced growth by approximately 90%. Conversely, EGF alone in basal medium supported approximately 10% control growth, BE alone supported 30-40% control growth, and the combination of EGF and BE approximately 70%. In addition to its major effect on proliferation in this system, BE was necessary to preserve normal keratinocyte morphology and protein production. These findings expand earlier observations that HFN facilitates keratinocyte attachment in vitro and that a brain-derived extract can exert a major positive influence on cultured keratinocytes.

  9. Toxicity Assessment of Six Titanium Dioxide Nanoparticles in Human Epidermal Keratinocytes

    Science.gov (United States)

    Toxicity Assessment of Six Titanium Dioxide Nanoparticles in Human Epidermal Keratinocytes Nanoparticle uptake in cells may be an important determinant of their potential cytotoxic and inflammatory effects. Six commercial TiO2 NP (A=Alfa Aesar,10nm, A*=Alfa Aesar 32nm, B=P25 27...

  10. Barium promotes anchorage-independent growth and invasion of human HaCaT keratinocytes via activation of c-SRC kinase.

    Science.gov (United States)

    Thang, Nguyen Dinh; Yajima, Ichiro; Kumasaka, Mayuko Y; Ohnuma, Shoko; Yanagishita, Takeshi; Hayashi, Rumiko; Shekhar, Hossain U; Watanabe, Daisuke; Kato, Masashi

    2011-01-01

    Explosive increases in skin cancers have been reported in more than 36 million patients with arsenicosis caused by drinking arsenic-polluted well water. This study and previous studies showed high levels of barium as well as arsenic in the well water. However, there have been no reports showing a correlation between barium and cancer. In this study, we examined whether barium (BaCl(2)) may independently have cancer-related effects on human precancerous keratinocytes (HaCaT). Barium (5-50 µM) biologically promoted anchorage-independent growth and invasion of HaCaT cells in vitro. Barium (5 µM) biochemically enhanced activities of c-SRC, FAK, ERK and MT1-MMP molecules, which regulate anchorage-independent growth and/or invasion. A SRC kinase specific inhibitor, protein phosphatase 2 (PP2), blocked barium-mediated promotion of anchorage-independent growth and invasion with decreased c-SRC kinase activity. Barium (2.5-5 µM) also promoted anchorage-independent growth and invasion of fibroblasts (NIH3T3) and immortalized nontumorigenic melanocytes (melan-a), but not transformed cutaneous squamous cell carcinoma (HSC5 and A431) and malignant melanoma (Mel-ret) cells, with activation of c-SRC kinase. Taken together, our biological and biochemical findings newly suggest that the levels of barium shown in drinking well water independently has the cancer-promoting effects on precancerous keratinocytes, fibroblast and melanocytes in vitro.

  11. Comparison of the biological features between human fetal hepatocyte and immortalized L-02 hepatocyte in vitro

    International Nuclear Information System (INIS)

    Kong Weiwei; Teng Gaojun

    2004-01-01

    Objective: To evaluate the feasibilities of the potential donors in liver cell transplantation using the human fetal hepatocytes and immortalized L-02 hepatocytes by comparing their biological features. Methods: Human fetal hepatocytes were isolated from aborted fetal livers (gestational ages from 14 w to 24 w) by an improved two-stage perfusion method and cultured in a conditioned medium without any growth factors. α-fetal protein (AFP) and albumin (ALB) were detected by radioimmunoassay (RIA) and cytokeratin-19 (CK-19 ) was identified by cellular immunochemistry study. Immortalized L-02 hepatocytes were cultured in the same condition and the characteristic proteins were detected by the same methods. Results: The viability of human fetal hepatocytes was approximately 95% using the perfusion method, and the maximum survival time of the cultured hepatocytes was 3 weeks. The expression of AFP, ALB, and CK19 was detected at the same time, especially during Day 3 to Day 7 in the culture. By comparison, the proliferation ability of L-02 hepatocyte was greater, although with a lower level of ALB secretion. The expression of AFP and CK19 was not detected. Furthermore, during the long culture, L-02 hepatocytes may undergo a morphologic change and fail to express ALB. Conclusion: Human fetal hepatocyte may be a practical donor for hepatocyte transplantation with its high-level protein expression and potential bi-differentiation ability. In view of the absent expression of ALB and the morphologic change in culture, although with better proliferation, L-02 hepatocyte seems not useful for hepatocyte transplantation

  12. Generation of human cortical neurons from a new immortal fetal neural stem cell line

    International Nuclear Information System (INIS)

    Cacci, E.; Villa, A.; Parmar, M.; Cavallaro, M.; Mandahl, N.; Lindvall, O.; Martinez-Serrano, A.; Kokaia, Z.

    2007-01-01

    Isolation and expansion of neural stem cells (NSCs) of human origin are crucial for successful development of cell therapy approaches in neurodegenerative diseases. Different epigenetic and genetic immortalization strategies have been established for long-term maintenance and expansion of these cells in vitro. Here we report the generation of a new, clonal NSC (hc-NSC) line, derived from human fetal cortical tissue, based on v-myc immortalization. Using immunocytochemistry, we show that these cells retain the characteristics of NSCs after more than 50 passages. Under proliferation conditions, when supplemented with epidermal and basic fibroblast growth factors, the hc-NSCs expressed neural stem/progenitor cell markers like nestin, vimentin and Sox2. When growth factors were withdrawn, proliferation and expression of v-myc and telomerase were dramatically reduced, and the hc-NSCs differentiated into glia and neurons (mostly glutamatergic and GABAergic, as well as tyrosine hydroxylase-positive, presumably dopaminergic neurons). RT-PCR analysis showed that the hc-NSCs retained expression of Pax6, Emx2 and Neurogenin2, which are genes associated with regionalization and cell commitment in cortical precursors during brain development. Our data indicate that this hc-NSC line could be useful for exploring the potential of human NSCs to replace dead or damaged cortical cells in animal models of acute and chronic neurodegenerative diseases. Taking advantage of its clonality and homogeneity, this cell line will also be a valuable experimental tool to study the regulatory role of intrinsic and extrinsic factors in human NSC biology

  13. Chemical allergens stimulate human epidermal keratinocytes to produce lymphangiogenic vascular endothelial growth factor.

    Science.gov (United States)

    Bae, Ok-Nam; Ahn, Seyeon; Jin, Sun Hee; Hong, Soo Hyun; Lee, Jinyoung; Kim, Eun-Sun; Jeong, Tae Cheon; Chun, Young-Jin; Lee, Ai-Young; Noh, Minsoo

    2015-03-01

    Allergic contact dermatitis (ACD) is a cell-mediated immune response that involves skin sensitization in response to contact with various allergens. Angiogenesis and lymphangiogenesis both play roles in the allergic sensitization process. Epidermal keratinocytes can produce vascular endothelial growth factor (VEGF) in response to UV irradiation and during wound healing. However, the effect of haptenic chemical allergens on the VEGF production of human keratinocytes, which is the primary contact site of toxic allergens, has not been thoroughly researched. We systematically investigated whether immune-regulatory cytokines and chemical allergens would lead to the production of VEGF in normal human keratinocytes (NHKs) in culture. VEGF production significantly increased when NHKs were treated with IFNγ, IL-1α, IL-4, IL-6, IL-17A, IL-22 or TNFα. Among the human sensitizers listed in the OECD Test Guideline (TG) 429, we found that CMI/MI, DNCB, 4-phenylenediamine, cobalt chloride, 2-mercaptobenzothiazole, citral, HCA, cinnamic alcohol, imidazolidinyl urea and nickel chloride all significantly upregulated VEGF production in NHKs. In addition, common human haptenic allergens such as avobenzone, formaldehyde and urushiol, also induced the keratinocyte-derived VEGF production. VEGF upregulation by pro-inflammatory stimuli, IFNγ, DNCB or formaldehyde is preceded by the production of IL-8, an acute inflammatory phase cytokine. Lymphangiogenic VEGF-C gene transcription was significantly increased when NHKs were treated with formaldehyde, DNCB or urushiol, while transcription of VEGF-A and VEGF-B did not change. Therefore, the chemical allergen-induced VEGF upregulation is mainly due to the increase in lymphangiogenic VEGF-C transcription in NHKs. These results suggest that keratinocyte-derived VEGF may regulate the lymphangiogenic process during the skin sensitization process of ACD. Copyright © 2015 Elsevier Inc. All rights reserved.

  14. Regulation of hTERT Expression and Function in Newly Immortalized p53(+) Human Mammary Epithelial Cell Lines

    Science.gov (United States)

    2007-06-01

    human mammary epithelial cell types by human papilloma virus 16 e6 or e7. Proc Nat Acad Sci USA 1995; 92:3687-91. 54. Shay JW, Pereira-Smith OM, Wright...Liu X-L, Chu Q, Gao Q, Band V. Immortalization of distinct human mammary epithelial cell types by human papilloma virus 16 e6 or e7. Proc Nat Acad

  15. Artichoke compound cynarin differentially affects the survival, growth and stress response of normal, immortalized and cancerous human cells

    DEFF Research Database (Denmark)

    Gezer, Ceren; Yücecan, Sevinç; Rattan, Suresh Inder Singh

    2015-01-01

    of CYN on the proliferative potential, survival, morphology, and stress response (SR) markers haemoxygenase-1 (HO-1) and heat shock protein-70 (HSP70) in normal human skin fibroblasts (FSF-1), telomerase-immortalized mesenchymal stem cells (hTERT-MSC) and cervical cancer cells, HeLa. Effects of CYN...

  16. Analysis of aquaporin 9 expression in human epidermis and cultured keratinocytes

    Directory of Open Access Journals (Sweden)

    Yoshinori Sugiyama

    2014-01-01

    Full Text Available Aquaporin 9 (AQP9 is a member of the aquaglyceroporin family that transports glycerol, urea and other small solutes as well as water. Compared to the expression and function in epidermal keratinocytes of AQP3, another aquaglyceroporin, our knowledge of epidermal AQP9 remains elusive. In this study, we investigated the expression of AQP9 in the human epidermis and cultured keratinocytes. Immunofluorescence studies revealed that AQP9 expression is highly restricted to the stratum granulosum of the human epidermis, where occludin is also expressed at the tight junctions. Interestingly, the AQP3 staining decreased sharply below the cell layers in which AQP9 is expressed. In cultured normal human epidermal keratinocytes (NHEK, knock-down of AQP9 expression in the differentiated cells induced by RNA interference reduced glycerol uptake, which was not as pronounced as was the case with AQP3 knock-down cells. In contrast, similar reduction of urea uptake was detected in AQP9 and AQP3 knock-down cells. These findings suggested that AQP9 expression in NHEK facilitates at least the transport of glycerol and urea. Finally, we analyzed the effect of retinoic acid (RA, a potent stimulator of keratinocyte proliferation, on AQP3 and AQP9 mRNA expression in differentiated NHEK. Stimulation with RA at 1 μM for 24 h augmented AQP3 expression and down-regulated AQP9 expression. Collectively, these results indicate that AQP9 expression in epidermal keratinocytes is regulated in a different manner from that of AQP3.

  17. 3D cultured immortalized human hepatocytes useful to develop drugs for blood-borne HCV

    International Nuclear Information System (INIS)

    Aly, Hussein Hassan; Shimotohno, Kunitada; Hijikata, Makoto

    2009-01-01

    Due to the high polymorphism of natural hepatitis C virus (HCV) variants, existing recombinant HCV replication models have failed to be effective in developing effective anti-HCV agents. In the current study, we describe an in vitro system that supports the infection and replication of natural HCV from patient blood using an immortalized primary human hepatocyte cell line cultured in a three-dimensional (3D) culture system. Comparison of the gene expression profile of cells cultured in the 3D system to those cultured in the existing 2D system demonstrated an up-regulation of several genes activated by peroxisome proliferator-activated receptor alpha (PPARα) signaling. Furthermore, using PPARα agonists and antagonists, we also analyzed the effect of PPARα signaling on the modulation of HCV replication using this system. The 3D in vitro system described in this study provides significant insight into the search for novel anti-HCV strategies that are specific to various strains of HCV.

  18. Phenotypic characterization of telomerase-immortalized primary non-malignant and malignant tumor-derived human prostate epithelial cell lines

    International Nuclear Information System (INIS)

    Gu Yongpeng; Li Hongzhen; Miki, Jun; Kim, Kee-Hong; Furusato, Bungo; Sesterhenn, Isabell A.; Chu, Wei-Sing; McLeod, David G.; Srivastava, Shiv; Ewing, Charles M.; Isaacs, William B.; Rhim, Johng S.

    2006-01-01

    In vitro human prostate cell culture models are critical for clarifying the mechanism of prostate cancer progression and for testing preventive and therapeutic agents. Cell lines ideal for the study of human primary prostate tumors would be those derived from spontaneously immortalized tumor cells; unfortunately, explanted primary prostate cells survive only short-term in culture, and rarely immortalize spontaneously. Therefore, we recently have generated five immortal human prostate epithelial cell cultures derived from both the benign and malignant tissues of prostate cancer patients with telomerase, a gene that prevents cellular senescence. Examination of these cell lines for their morphologies and proliferative capacities, their abilities to grow in low serum, to respond to androgen stimulation, to grow above the agar layer, to form tumors in SCID mice, suggests that they may serve as valid, useful tools for the elucidation of early events in prostate tumorigenesis. Furthermore, the chromosome alterations observed in these immortalized cell lines expressing aspects of the malignant phenotypes imply that these cell lines accurately recapitulate the genetic composition of primary tumors. These novel in vitro models may offer unique models for the study of prostate carcinogenesis and also provide the means for testing both chemopreventive and chemotherapeutic agents

  19. 5-fluorouracil Toxicity Mechanism Determination in Human Keratinocytes: in vitro Study on HaCaT

    Directory of Open Access Journals (Sweden)

    Jan Hartinger

    2018-01-01

    Full Text Available 5-fluorouracil (5-FU and capecitabine therapy is often accompanied by palmar-plantar erythrodysesthesia (PPE which is manifestation of 5-FU toxicity in keratinocytes. The main mechanisms of 5-FU action are thymidylate synthase (TS inhibition which can be abrogated by thymidine and strengthened by calciumfolinate (CF and incorporation of fluorouridinetriphosphate into RNA which can be abrogated by uridine. For proper PPE treatment 5-FU mechanism of action in keratinocytes needs to be elucidated. We used the 5-FU toxicity modulators uridine, thymidine and CF to discover the mechanism of 5-FU action in human keratinocyte cell line HaCaT. To measure the cellular viability, we used MTT test and RTCA test. CF did not augment 5-FU toxicity and 5-FU toxicity was weakened by uridine. Therefore, the primary mechanism of 5-FU toxicity in keratinocytes is 5-FU incorporation into RNA. The uridine protective effect cannot fully develop in the presence of CF. Thymidine addition to 5-FU and uridine treated cells not only prevents the toxicity-augmenting CF effect but it also prolongs the 5-FU treated cells survival in comparison to uridine only. Therefore, it can be assumed that in the presence of uridine the 5-FU toxicity mechanism is switched from RNA incorporation to TS inhibition. Although particular 5-FU toxicity mechanisms were previously described in various cell types, this is the first time when various combinations of pyrimidine nucleosides and CF were used for 5-FU toxicity mechanism elucidation in human keratinocytes. We suggest that for PPE treatment ointment containing uridine and thymidine should be further clinically tested.

  20. Immortalization protocols used in cell culture models of human breast morphogenesis

    DEFF Research Database (Denmark)

    Gudjonsson, T; Villadsen, R; Rønnov-Jessen, L

    2004-01-01

    of the tissue of origin. In recent years, we have sought to establish immortalized primary breast cells, which retain crucial characteristics of their original in situ tissue pattern. This review discusses various approaches to immortalization of breast-derived epithelial and stromal cells and the application...

  1. Prolonged Integration Site Selection of a Lentiviral Vector in the Genome of Human Keratinocytes.

    Science.gov (United States)

    Qian, Wei; Wang, Yong; Li, Rui-Fu; Zhou, Xin; Liu, Jing; Peng, Dai-Zhi

    2017-03-03

    BACKGROUND Lentiviral vectors have been successfully used for human skin cell gene transfer studies. Defining the selection of integration sites for retroviral vectors in the host genome is crucial in risk assessment analysis of gene therapy. However, genome-wide analyses of lentiviral integration sites in human keratinocytes, especially after prolonged growth, are poorly understood. MATERIAL AND METHODS In this study, 874 unique lentiviral vector integration sites in human HaCaT keratinocytes after long-term culture were identified and analyzed with the online tool GTSG-QuickMap and SPSS software. RESULTS The data indicated that lentiviral vectors showed integration site preferences for genes and gene-rich regions. CONCLUSIONS This study will likely assist in determining the relative risks of the lentiviral vector system and in the design of a safe lentiviral vector system in the gene therapy of skin diseases.

  2. Chemical allergens stimulate human epidermal keratinocytes to produce lymphangiogenic vascular endothelial growth factor

    Energy Technology Data Exchange (ETDEWEB)

    Bae, Ok-Nam [College of Pharmacy, Institute of Pharmaceutical Science and Technology, Hanyang University, Ansan 426-791 (Korea, Republic of); Ahn, Seyeon; Jin, Sun Hee; Hong, Soo Hyun; Lee, Jinyoung [College of Pharmacy, Natural Products Research Institute, Seoul National University, Seoul 151-742 (Korea, Republic of); Kim, Eun-Sun [College of Pharmacy, Institute of Pharmaceutical Science and Technology, Hanyang University, Ansan 426-791 (Korea, Republic of); Jeong, Tae Cheon [College of Pharmacy, Yeungnam University, Gyeongsan 712-749 (Korea, Republic of); Chun, Young-Jin [College of Pharmacy, Chung-Ang University, Seoul 156-756 (Korea, Republic of); Lee, Ai-Young, E-mail: leeay@duih.org [Department of Dermatology, Dongguk University Ilsan Hospital, Goyang 410-773 (Korea, Republic of); Noh, Minsoo, E-mail: minsoo@alum.mit.edu [College of Pharmacy, Natural Products Research Institute, Seoul National University, Seoul 151-742 (Korea, Republic of)

    2015-03-01

    Allergic contact dermatitis (ACD) is a cell-mediated immune response that involves skin sensitization in response to contact with various allergens. Angiogenesis and lymphangiogenesis both play roles in the allergic sensitization process. Epidermal keratinocytes can produce vascular endothelial growth factor (VEGF) in response to UV irradiation and during wound healing. However, the effect of haptenic chemical allergens on the VEGF production of human keratinocytes, which is the primary contact site of toxic allergens, has not been thoroughly researched. We systematically investigated whether immune-regulatory cytokines and chemical allergens would lead to the production of VEGF in normal human keratinocytes (NHKs) in culture. VEGF production significantly increased when NHKs were treated with IFNγ, IL-1α, IL-4, IL-6, IL-17A, IL-22 or TNFα. Among the human sensitizers listed in the OECD Test Guideline (TG) 429, we found that CMI/MI, DNCB, 4-phenylenediamine, cobalt chloride, 2-mercaptobenzothiazole, citral, HCA, cinnamic alcohol, imidazolidinyl urea and nickel chloride all significantly upregulated VEGF production in NHKs. In addition, common human haptenic allergens such as avobenzone, formaldehyde and urushiol, also induced the keratinocyte-derived VEGF production. VEGF upregulation by pro-inflammatory stimuli, IFNγ, DNCB or formaldehyde is preceded by the production of IL-8, an acute inflammatory phase cytokine. Lymphangiogenic VEGF-C gene transcription was significantly increased when NHKs were treated with formaldehyde, DNCB or urushiol, while transcription of VEGF-A and VEGF-B did not change. Therefore, the chemical allergen-induced VEGF upregulation is mainly due to the increase in lymphangiogenic VEGF-C transcription in NHKs. These results suggest that keratinocyte-derived VEGF may regulate the lymphangiogenic process during the skin sensitization process of ACD. - Highlights: • Pro-inflammatory cytokines induced VEGF production in normal human

  3. Chemical allergens stimulate human epidermal keratinocytes to produce lymphangiogenic vascular endothelial growth factor

    International Nuclear Information System (INIS)

    Bae, Ok-Nam; Ahn, Seyeon; Jin, Sun Hee; Hong, Soo Hyun; Lee, Jinyoung; Kim, Eun-Sun; Jeong, Tae Cheon; Chun, Young-Jin; Lee, Ai-Young; Noh, Minsoo

    2015-01-01

    Allergic contact dermatitis (ACD) is a cell-mediated immune response that involves skin sensitization in response to contact with various allergens. Angiogenesis and lymphangiogenesis both play roles in the allergic sensitization process. Epidermal keratinocytes can produce vascular endothelial growth factor (VEGF) in response to UV irradiation and during wound healing. However, the effect of haptenic chemical allergens on the VEGF production of human keratinocytes, which is the primary contact site of toxic allergens, has not been thoroughly researched. We systematically investigated whether immune-regulatory cytokines and chemical allergens would lead to the production of VEGF in normal human keratinocytes (NHKs) in culture. VEGF production significantly increased when NHKs were treated with IFNγ, IL-1α, IL-4, IL-6, IL-17A, IL-22 or TNFα. Among the human sensitizers listed in the OECD Test Guideline (TG) 429, we found that CMI/MI, DNCB, 4-phenylenediamine, cobalt chloride, 2-mercaptobenzothiazole, citral, HCA, cinnamic alcohol, imidazolidinyl urea and nickel chloride all significantly upregulated VEGF production in NHKs. In addition, common human haptenic allergens such as avobenzone, formaldehyde and urushiol, also induced the keratinocyte-derived VEGF production. VEGF upregulation by pro-inflammatory stimuli, IFNγ, DNCB or formaldehyde is preceded by the production of IL-8, an acute inflammatory phase cytokine. Lymphangiogenic VEGF-C gene transcription was significantly increased when NHKs were treated with formaldehyde, DNCB or urushiol, while transcription of VEGF-A and VEGF-B did not change. Therefore, the chemical allergen-induced VEGF upregulation is mainly due to the increase in lymphangiogenic VEGF-C transcription in NHKs. These results suggest that keratinocyte-derived VEGF may regulate the lymphangiogenic process during the skin sensitization process of ACD. - Highlights: • Pro-inflammatory cytokines induced VEGF production in normal human

  4. TCDD induces dermal accumulation of keratinocyte-derived matrix metalloproteinase-10 in an organotypic model of human skin

    Energy Technology Data Exchange (ETDEWEB)

    De Abrew, K. Nadira [Molecular and Environmental Toxicology Center, University of Wisconsin—Madison, Madison, WI 53706 (United States); Thomas-Virnig, Christina L.; Rasmussen, Cathy A. [Department of Pathology, University of Wisconsin—Madison, Madison, WI 53706 (United States); Bolterstein, Elyse A. [Molecular and Environmental Toxicology Center, University of Wisconsin—Madison, Madison, WI 53706 (United States); Schlosser, Sandy J. [Department of Pathology, University of Wisconsin—Madison, Madison, WI 53706 (United States); Allen-Hoffmann, B. Lynn, E-mail: blallenh@wisc.edu [Molecular and Environmental Toxicology Center, University of Wisconsin—Madison, Madison, WI 53706 (United States); Department of Pathology, University of Wisconsin—Madison, Madison, WI 53706 (United States)

    2014-05-01

    The epidermis of skin is the first line of defense against the environment. A three dimensional model of human skin was used to investigate tissue-specific phenotypes induced by the environmental contaminant, 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Continuous treatment of organotypic cultures of human keratinocytes with TCDD resulted in intracellular spaces between keratinocytes of the basal and immediately suprabasal layers as well as thinning of the basement membrane, in addition to the previously reported hyperkeratinization. These tissue remodeling events were preceded temporally by changes in expression of the extracellular matrix degrading enzyme, matrix metalloproteinase-10 (MMP-10). In organotypic cultures MMP-10 mRNA and protein were highly induced following TCDD treatment. Q-PCR and immunoblot results from TCDD-treated monolayer cultures, as well as indirect immunofluorescence and immunoblot analysis of TCDD-treated organotypic cultures, showed that MMP-10 was specifically contributed by the epidermal keratinocytes but not the dermal fibroblasts. Keratinocyte-derived MMP-10 protein accumulated over time in the dermal compartment of organotypic cultures. TCDD-induced epidermal phenotypes in organotypic cultures were attenuated by the keratinocyte-specific expression of tissue inhibitor of metalloproteinase-1, a known inhibitor of MMP-10. These studies suggest that MMP-10 and possibly other MMP-10-activated MMPs are responsible for the phenotypes exhibited in the basement membrane, the basal keratinocyte layer, and the cornified layer of TCDD-treated organotypic cultures. Our studies reveal a novel mechanism by which the epithelial–stromal microenvironment is altered in a tissue-specific manner thereby inducing structural and functional pathology in the interfollicular epidermis of human skin. - Highlights: • TCDD causes hyperkeratosis and basement membrane changes in a model of human skin. • TCDD induces MMP-10 expression in organotypic cultures

  5. Replacement of murine fibroblasts by human fibroblasts irradiated in obtaining feeder layer for the culture of human keratinocytes

    International Nuclear Information System (INIS)

    Yoshito, Daniele; Sufi, Bianca S.; Santin, Stefany P.; Mathor, Monica B.; Altran, Silvana C.; Isaac, Cesar

    2011-01-01

    Human autologous epithelia cultivated in vitro, have been used successfully in treating damage to skin integrity. The methodology allowed the cultivation of these epithelia was described by Rheinwald and Green in 1975, this methodology consisted in seeding keratinocytes onto a feeder layer composed of lineage 3T3 murine fibroblasts, the proliferation rate is controlled through the action of ionizing radiation. However, currently there is a growing concern about the possibility of transmitting prions and murine viruses to transplanted patients. Taking into account this concern, in this present work, we replaced the feeder layer originally composed of murine fibroblasts by human fibroblasts. To obtain this new feeder layer was necessary to standardize the enough irradiation dose to inhibit the replication of human fibroblasts and the verification of effectiveness of the development of keratinocytes culture on a feeder layer thus obtained. According to the obtained results we can verify that the human fibroblasts irradiated at various tested doses (60, 70, 100, 200, 250 and 300 Gy) had their mitotic activity inactivated by irradiation, allowing the use of any of these doses to confection of the feeder layer, since these fibroblasts irradiated still showed viable until fourteen days of cultivation. In the test of colony formation efficiency was observed that keratinocytes seeded on irradiated human fibroblasts were able to develop satisfactorily, preserving their clonogenic potential. Therefore it was possible the replacement of murine fibroblasts by human fibroblasts in confection of the feeder layer, in order to eliminate this xenobiotic component of the keratinocytes culture. (author)

  6. Replacement of murine fibroblasts by human fibroblasts irradiated in obtaining feeder layer for the culture of human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Yoshito, Daniele; Sufi, Bianca S.; Santin, Stefany P.; Mathor, Monica B. [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil); Altran, Silvana C.; Isaac, Cesar [Universidade Sao Paulo (USP), Sao Paulo, SP (Brazil). Fac. de Medicina. Lab. de Microcirurgia Plastica; Esteves-Pedro, Natalia M. [Universidade Sao Paulo (USP), Sao Paulo, SP (Brazil). Fac. de Ciencias Farmaceuticas. Lab. de Controle Biologico; Herson, Marisa R. [DonorTissue Bank of Victoria (Australia)

    2011-07-01

    Human autologous epithelia cultivated in vitro, have been used successfully in treating damage to skin integrity. The methodology allowed the cultivation of these epithelia was described by Rheinwald and Green in 1975, this methodology consisted in seeding keratinocytes onto a feeder layer composed of lineage 3T3 murine fibroblasts, the proliferation rate is controlled through the action of ionizing radiation. However, currently there is a growing concern about the possibility of transmitting prions and murine viruses to transplanted patients. Taking into account this concern, in this present work, we replaced the feeder layer originally composed of murine fibroblasts by human fibroblasts. To obtain this new feeder layer was necessary to standardize the enough irradiation dose to inhibit the replication of human fibroblasts and the verification of effectiveness of the development of keratinocytes culture on a feeder layer thus obtained. According to the obtained results we can verify that the human fibroblasts irradiated at various tested doses (60, 70, 100, 200, 250 and 300 Gy) had their mitotic activity inactivated by irradiation, allowing the use of any of these doses to confection of the feeder layer, since these fibroblasts irradiated still showed viable until fourteen days of cultivation. In the test of colony formation efficiency was observed that keratinocytes seeded on irradiated human fibroblasts were able to develop satisfactorily, preserving their clonogenic potential. Therefore it was possible the replacement of murine fibroblasts by human fibroblasts in confection of the feeder layer, in order to eliminate this xenobiotic component of the keratinocytes culture. (author)

  7. Enhanced constitutive invasion activity in human nontumorigenic keratinocytes exposed to a low level of barium for a long time.

    Science.gov (United States)

    Thang, Nguyen D; Yajima, Ichiro; Ohnuma, Shoko; Ohgami, Nobutaka; Kumasaka, Mayuko Y; Ichihara, Gaku; Kato, Masashi

    2015-02-01

    We have recently demonstrated that exposure to barium for a short time (≤4 days) and at a low level (5 µM = 687 µg/L) promotes invasion of human nontumorigenic HaCaT cells, which have characteristics similar to those of normal keratinocytes, suggesting that exposure to barium for a short time enhances malignant characteristics. Here we examined the effect of exposure to low level of barium for a long time, a condition mimicking the exposure to barium through well water, on malignant characteristics of HaCaT keratinocytes. Constitutive invasion activity, focal adhesion kinase (FAK) protein expression and activity, and matrix metalloproteinase 14 (MMP14) protein expression in primary cultured normal human epidermal keratinocytes, HaCaT keratinocytes, and HSC5 and A431 human squamous cell carcinoma cells were augmented following an increase in malignancy grade of the cells. Constitutive invasion activity, FAK phosphorylation, and MMP14 expression levels of HaCaT keratinocytes after treatment with 5 µM barium for 4 months were significantly higher than those of control untreated HaCaT keratinocytes. Taken together, our results suggest that exposure to a low level of barium for a long time enhances constitutive malignant characteristics of HaCaT keratinocytes via regulatory molecules (FAK and MMP14) for invasion. © 2013 Wiley Periodicals, Inc.

  8. Vanillin protects human keratinocyte stem cells against ultraviolet B irradiation.

    Science.gov (United States)

    Lee, Jienny; Cho, Jae Youl; Lee, Sang Yeol; Lee, Kyung-Woo; Lee, Jongsung; Song, Jae-Young

    2014-01-01

    Ultraviolet-B (UVB) irradiation is one of major factors which induce cellular damages in the epidermis. We investigated protective effects and mechanisms of vanillin, a main constituent of vanilla beans, against UVB-induced cellular damages in keratinocyte stem cells (KSC). Here, vanillin significantly attenuated UVB irradiation-induced cytotoxicity. The vanillin effects were also demonstrated by the results of the senescence-associated β-galactosidase and alkaline comet assays. In addition, vanillin induced production of pro-inflammatory cytokines. Attempts to elucidate a possible mechanism underlying the vanillin-mediated effects revealed that vanillin significantly reduced UVB-induced phosphorylation of ataxia telangiectasia mutated (ATM), serine threonine kinase checkpoint kinase 2 (Chk2), tumor suppressor protein 53 (p53), p38/mitogen-activated protein kinase (p38), c-Jun N-terminal kinase/stress-activated protein kinase (JNK), S6 ribosomal protein (S6RP), and histone 2A family member X (H2A.X). UVB-induced activation of p53 luciferase reporter was also significantly inhibited by vanillin. In addition, while ATM inhibitor had no effect on the vanillin effects, mouse double minute 2 homolog (MDM2) inhibitor significantly attenuated suppressive effects of vanillin on UVB-induced activation of p53 reporter in KSC. Taken together, these findings suggest that vanillin protects KSC from UVB irradiation and its effects may occur through the suppression of downstream step of MDM2 in UVB irradiation-induced p53 activation. Copyright © 2013 Elsevier Ltd. All rights reserved.

  9. Effect of 1,24R-dihydroxyvitamin D3 on the growth of human keratinocytes.

    LENUS (Irish Health Repository)

    Matsumoto, K

    1990-02-01

    The effect of 1,24R-dihydroxyvitamin D3 (1,24R(OH)2D3), a synthetic analogue of a biologically active form of vitamin D3 (1,25-dihydroxyvitamin D3, 1,25(OH)2D3), on the growth of human keratinocytes cultured in serum-free medium was investigated. The growth of cultured normal human keratinocytes was inhibited by 65% by 10(-8)M 1,24R(OH)2D3 and by 90% by 10(-7)M 1,24(OH)2D3. It inhibited cell growth almost completely at 10(-6)M. The DNA synthesis of keratinocytes was also inhibited with 1,24R(OH)2D3 by 27% at 10(-8)M, 59% at 10(-7)M, and 92% at 10(-6)M. The inhibition of cell growth and DNA synthesis were more remarkable by 1,24R(OH)2D3 than by 1,25(OH)2D3. 1,24R(OH)2D3 also inhibited the growth of keratinocytes derived from patients with psoriasis vulgaris; the growth inhibitory effect was again more remarkable with 1,24R(OH)2D3 than with 1,25(OH)2D3. The viability and protein synthesis of keratinocytes were not affected by 1,24R(OH)2D3, suggesting that the growth inhibitory effect is due to its biological activity, not to cytotoxicity. The binding of [3H]-labeled 1,25(OH)2D3 to its receptor in the cytosolic fraction of cultured keratinocytes was competitively substituted by unlabeled 1,24R(OH)2D3 as well as 1,25(OH)2D3, suggesting that 1,24R(OH)2D3 binds to the 1,25(OH)2D3 receptor. It was found that the affinity of 1,24R(OH)2D3 for the receptor was slightly higher than that of 1,25(OH)2D3. These results demonstrate that 1,24R(OH)2D3 functions as a potent growth inhibitor in vitro in human keratinocytes from both normal and psoriatic epidermis, and it possesses a higher affinity for the 1,25(OH)2D3 receptor in cultured human keratinocytes. The difference in affinity of 1,24R(OH)2D3 for the 1,25(OH)2D3 receptor correlates with its greater inhibition of keratinocyte growth than 1,25(OH)2D3. 1,24R(OH)2D3 may be useful in the treatment of psoriasis.

  10. Heavy metal-induced cytotoxicity to cultured human epidermal keratinocytes and effects of antioxidants.

    Science.gov (United States)

    Kappus, H; Reinhold, C

    1994-04-01

    Human epidermal keratinocytes which have been cultured were treated with the heavy metal ions of cadmium, mercury, copper and zinc. Cytotoxicity was measured either by protein estimation or by using the neutral red assay. Antioxidants were added in order to find out whether heavy metal-induced cytotoxicity is related to oxidative stress. All metals used showed considerable cytotoxic effects within 24 h in moderate concentrations. None of the antioxidants vitamin E (alpha-tocopherol), pyrogallol, propyl gallate, BHT or ebselen showed any protective or preventive effect. This indicates that oxidative stress may not be involved in the cytotoxicity induced by heavy metals in human epidermal keratinocytes. The cells used are, however, a valuable tool to study mechanisms of cytotoxicity.

  11. The Frog Skin-Derived Antimicrobial Peptide Esculentin-1a(1-21)NH2 Promotes the Migration of Human HaCaT Keratinocytes in an EGF Receptor-Dependent Manner: A Novel Promoter of Human Skin Wound Healing?

    Science.gov (United States)

    Di Grazia, Antonio; Cappiello, Floriana; Imanishi, Akiko; Mastrofrancesco, Arianna; Picardo, Mauro; Paus, Ralf; Mangoni, Maria Luisa

    2015-01-01

    One of the many functions of skin is to protect the organism against a wide range of pathogens. Antimicrobial peptides (AMPs) produced by the skin epithelium provide an effective chemical shield against microbial pathogens. However, whereas antibacterial/antifungal activities of AMPs have been extensively characterized, much less is known regarding their wound healing-modulatory properties. By using an in vitro re-epithelialisation assay employing special cell-culture inserts, we detected that a derivative of the frog-skin AMP esculentin-1a, named esculentin-1a(1-21)NH2, significantly stimulates migration of immortalized human keratinocytes (HaCaT cells) over a wide range of peptide concentrations (0.025-4 μM), and this notably more efficiently than human cathelicidin (LL-37). This activity is preserved in primary human epidermal keratinocytes. By using appropriate inhibitors and an enzyme-linked immunosorbent assay we found that the peptide-induced cell migration involves activation of the epidermal growth factor receptor and STAT3 protein. These results suggest that esculentin-1a(1-21)NH2 now deserves to be tested in standard wound healing assays as a novel candidate promoter of skin re-epithelialisation. The established ability of esculentin-1a(1-21)NH2 to kill microbes without harming mammalian cells, namely its high anti-Pseudomonal activity, makes this AMP a particularly attractive candidate wound healing promoter, especially in the management of chronic, often Pseudomonas-infected, skin ulcers.

  12. The Frog Skin-Derived Antimicrobial Peptide Esculentin-1a(1-21NH2 Promotes the Migration of Human HaCaT Keratinocytes in an EGF Receptor-Dependent Manner: A Novel Promoter of Human Skin Wound Healing?

    Directory of Open Access Journals (Sweden)

    Antonio Di Grazia

    Full Text Available One of the many functions of skin is to protect the organism against a wide range of pathogens. Antimicrobial peptides (AMPs produced by the skin epithelium provide an effective chemical shield against microbial pathogens. However, whereas antibacterial/antifungal activities of AMPs have been extensively characterized, much less is known regarding their wound healing-modulatory properties. By using an in vitro re-epithelialisation assay employing special cell-culture inserts, we detected that a derivative of the frog-skin AMP esculentin-1a, named esculentin-1a(1-21NH2, significantly stimulates migration of immortalized human keratinocytes (HaCaT cells over a wide range of peptide concentrations (0.025-4 μM, and this notably more efficiently than human cathelicidin (LL-37. This activity is preserved in primary human epidermal keratinocytes. By using appropriate inhibitors and an enzyme-linked immunosorbent assay we found that the peptide-induced cell migration involves activation of the epidermal growth factor receptor and STAT3 protein. These results suggest that esculentin-1a(1-21NH2 now deserves to be tested in standard wound healing assays as a novel candidate promoter of skin re-epithelialisation. The established ability of esculentin-1a(1-21NH2 to kill microbes without harming mammalian cells, namely its high anti-Pseudomonal activity, makes this AMP a particularly attractive candidate wound healing promoter, especially in the management of chronic, often Pseudomonas-infected, skin ulcers.

  13. Interleukin 1 gene expression in cultured human keratinocytes is augmented by ultraviolet irradiation

    International Nuclear Information System (INIS)

    Kupper, T.S.; Chua, A.O.; Flood, P.; McGuire, J.; Gubler, U.

    1987-01-01

    Interleukin 1 (IL-1) is a family of polypeptides initially found to be produced by activated monocytes and macrophages that mediate a wide variety of cellular responses to injury and infection. Epidermal epithelial cells (keratinocytes) produce ''epidermal cell-derived thymocyte activating factor'' or ETAF, which has been recently shown to be identical to IL-1. Human epidermis is normally exposed to significant amounts of solar ultraviolet radiation. Certain ultraviolet wavelengths (UVB, 290-320 nm) are thought to be responsible for most of the immediate and long-term pathological consequences of excessive exposure to sunlight. In this study, we asked whether exposure to UVB irradiation induced IL-1 gene expression in cultured human keratinocytes. Cultured human keratinocytes contain detectable amounts of IL-1 alpha and beta mRNA and protein in the absence of apparent stimulation; these levels could be significantly enhanced 6 h after exposure to 10 ng/ml of 12-O-tetradecanoyl-phorbol-13-acetate (TPA). Exposure to UVB irradiation with an emission spectrum comparable to that of sunlight (as opposed to that of an unfiltered artificial UV light source) significantly increased the steady state levels IL-1 alpha and beta mRNA in identical populations of human keratinocytes. This was reflected in the production of increased IL-1 activity by these cultures in vitro. In the same cell population, exposures to UVB irradiation did not alter the level of actin mRNA; therefore, the effect of UV irradiation on IL-1 represents a specific enhancement of IL-1 gene expression. Local increases of IL-1 may mediate the inflammation and vasodilation characteristic of acute UVB-injured skin, and systemic release of this epidermal IL-1 may account for fever, leukocytosis, and the acute phase response seen after excessive sun exposure

  14. The comparison of two methods to obtain human oral keratinocytes in primary culture

    International Nuclear Information System (INIS)

    Klingbeil, Maria Fatima Guarizo

    2006-01-01

    The therapeutic procedures frequently used in oral treatments for the pathological diseases are surgical, resulting in failures of the mucosal continuity.The possibility to obtain transplantable oral epithelia from an in vitro cell culture opens new utilization perspectives not only to where it comes from, but also as a reconstructive material for other parts of the human body, such as: urethra, epithelia corneo-limbal, cornea, ocular surface. Many researchers still use controversial methods for obtaining cells. It was therefore evaluated and compared the efficiency in both methods: enzymatic and direct explant to obtain oral keratinocytes from human oral mucosa. Fragments of intra oral epithelial tissues from healthy human subjects, undergoing dental surgeries, were donated to the research project. The keratinocytes were cultivated over a feeder-layer from a previously irradiated 3T3 Swiss albino fibroblasts. In this study it was compared the time needed in the cell obtention, the best cell amount between both methods, the life-span, the cell capacity to form an in vitro epithelia and its morphologic structure. The results in the assessment of both methods have shown the possibility to obtain keratinocytes from a small oral fragment, but at the same time we may verify the advantages and peculiar restrictions for each one of both analyzed methods. (author)

  15. Anti-Inflammatory Effect of Melittin on Porphyromonas Gingivalis LPS-Stimulated Human Keratinocytes.

    Science.gov (United States)

    Kim, Woon-Hae; An, Hyun-Jin; Kim, Jung-Yeon; Gwon, Mi-Gyeong; Gu, Hyemin; Jeon, Minji; Kim, Min-Kyung; Han, Sang-Mi; Park, Kwan-Kyu

    2018-02-05

    Periodontitis is a chronic inflammatory disease that contributes to the destruction of the gingiva. Porphyromonas gingivalis ( P. gingivalis ) can cause periodontitis via its pathogenic lipopolysaccharides (LPS). Melittin, a major component of bee venom, is known to have anti-inflammatory and antibacterial effects. However, the role of melittin in the inflammatory response has not been elucidated in periodontitis-like human keratinocytes. Therefore, we investigated the anti-inflammatory effects of melittin on a P. gingivalis LPS (PgLPS)-treated HaCaT human keratinocyte cell line. The cytotoxicity of melittin was measured using a human keratinocyte cell line, HaCaT, and a Cell Counting Kit-8. The effect of melittin on PgLPS-induced inflammation was determined with Western blot, real-time quantitative PCT, and immunofluorescence. PgLPS increased the expression of toll-like receptor (TLR) 4 and proinflammatory cytokines, such as tumor necrosis factor-α (TNF-α), interleukin (IL)-6, IL-8, and interferon-γ (IFN-γ). Moreover, PgLPS induced activation of the nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB), extracellular signal-regulated kinase (ERK), and protein kinase B/Akt. Melittin also inhibited the expression of proinflammatory cytokines by suppressing the activation of the NF-κB signaling pathway, ERK, and Akt. Melittin attenuates the PgLPS-induced inflammatory response and could therefore be applied in the treatment of periodontitis for anti-inflammatory effects.

  16. A Sensitive Sensor Cell Line for the Detection of Oxidative Stress Responses in Cultured Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Ute Hofmann

    2014-06-01

    Full Text Available In the progress of allergic and irritant contact dermatitis, chemicals that cause the generation of reactive oxygen species trigger a heat shock response in keratinocytes. In this study, an optical sensor cell line based on cultured human keratinocytes (HaCaT cells expressing green fluorescent protein (GFP under the control of the stress-inducible HSP70B’ promoter were constructed. Exposure of HaCaT sensor cells to 25 µM cadmium, a model substance for oxidative stress induction, provoked a 1.7-fold increase in total glutathione and a ~300-fold induction of transcript level of the gene coding for heat shock protein HSP70B’. An extract of Arnica montana flowers resulted in a strong induction of the HSP70B’ gene and a pronounced decrease of total glutathione in keratinocytes. The HSP70B’ promoter-based sensor cells conveniently detected cadmium-induced stress using GFP fluorescence as read-out with a limit of detection of 6 µM cadmium. In addition the sensor cells responded to exposure of cells to A. montana extract with induction of GFP fluorescence. Thus, the HaCaT sensor cells provide a means for the automated detection of the compromised redox status of keratinocytes as an early indicator of the development of human skin disorders and could be applied for the prediction of skin irritation in more complex in vitro 3D human skin models and in the development of micro-total analysis systems (µTAS that may be utilized in dermatology, toxicology, pharmacology and drug screenings.

  17. Immortal ethics.

    Science.gov (United States)

    Harris, John

    2004-06-01

    This article draws on ideas published in my "Intimations of Immortality" essay in Science (Vol. 288, No. 5463, p. 59, April 7, 2000) and my "Intimations of Immortality-The Ethics and Justice of Life Extending Therapies" in editor Michael Freeman's Current Legal Problems (Oxford University Press 2002: 65-97). This article outlines the ethical issues involved in life-extending therapies. The arguments against life extension are examined and found wanting. The consequences of life extension are explored and found challenging but not sufficiently daunting to warrant regulation or control. In short, there is no doubt that immortality would be a mixed blessing, but we should be slow to reject cures for terrible diseases that may be an inextricable part of life-extending procedures even if the price we have to pay for those cures is increasing life expectancy and even creating immortals. Better surely to accompany the scientific race to achieve immortality with commensurate work in ethics and social policy to ensure that we know how to cope with the transition to parallel populations of mortals and immortals as envisaged in mythology.

  18. Ultraviolet radiation induces changes in membrane metabolism of human keratinocytes in culture

    International Nuclear Information System (INIS)

    De Leo, V.A.; Horlick, H.; Hanson, D.; Eisinger, M.; Harber, L.C.

    1984-01-01

    Human keratinocytes in culture were prelabeled with [ 3 H]arachidonic acid (AA) and then exposed to ultraviolet B radiation. Irradiated cells released labeled AA metabolites into media in a dose-dependent manner when compared to sham-irradiated cells. The response began immediately and continued for 24 h. Extracts from media were examined by high-performance liquid chromatography for identification of specific AA metabolites. Irradiated cells were stimulated to produce prostaglandin-like material (PGE2 and PGF2 alpha). These findings support the concept that the cell membrane of keratinocytes participates directly or indirectly in initiating the sunburn response. It is also felt that the metabolites formed following injury to the membrane are an integral component in the mediation of that response

  19. Telomerase reverse transcriptase mediated immortalization of human bone marrow stromal cells

    Directory of Open Access Journals (Sweden)

    Yong Teng

    2014-02-01

    Full Text Available Primary human bone marrow stromal cells (hMSCs were transfected with human telomerase reverse transcriptase (hTERT gene with lipofection method. The hTERT transfected hMSCs of passage 100 underwent chondrogenesis induction with dexamethasone, transforming the growth factor β and vitamin C, osteogenesis induction with dexamethasone, β glycerophosphoric acid and vitamin C, and cardiomyocyte induction with 5-azacytidine. After 7, 14, 21 and 28 days of induction, immunocytochemistry was performed to detect the expressions of type I and II collagen and osteocalcin, and alizarin red staining was performed to detect the bone nodule formation in osteogenesis induction. Immunocytochemistry was carried out to detect the striated muscle actin expression in cardiomyocytes. The hMSCs undergoing successful transfection were positive for the hTERT. The hTERT transfected cells were grown in vitro successfully and passaged for 136 generations. Results showed that these cells could be induced to differentiate into chondrocytes, bone and myocardial cells. Introduction of exogenous hTERT into hMSCs could achieve immortalized hMSCs with the potential of multi-directional differentiation. Thus, these cells could be applied as seed cells in tissue engineering.

  20. Validation of an immortalized human (hBMEC) in vitro blood-brain barrier model.

    Science.gov (United States)

    Eigenmann, Daniela Elisabeth; Jähne, Evelyn Andrea; Smieško, Martin; Hamburger, Matthias; Oufir, Mouhssin

    2016-03-01

    We recently established and optimized an immortalized human in vitro blood-brain barrier (BBB) model based on the hBMEC cell line. In the present work, we validated this mono-culture 24-well model with a representative series of drug substances which are known to cross or not to cross the BBB. For each individual compound, a quantitative UHPLC-MS/MS method in Ringer HEPES buffer was developed and validated according to current regulatory guidelines, with respect to selectivity, precision, and reliability. Various biological and analytical challenges were met during method validation, highlighting the importance of careful method development. The positive controls antipyrine, caffeine, diazepam, and propranolol showed mean endothelial permeability coefficients (P e) in the range of 17-70 × 10(-6) cm/s, indicating moderate to high BBB permeability when compared to the barrier integrity marker sodium fluorescein (mean P e 3-5 × 10(-6) cm/s). The negative controls atenolol, cimetidine, and vinblastine showed mean P e values < 10 × 10(-6) cm/s, suggesting low permeability. In silico calculations were in agreement with in vitro data. With the exception of quinidine (P-glycoprotein inhibitor and substrate), BBB permeability of all control compounds was correctly predicted by this new, easy, and fast to set up human in vitro BBB model. Addition of retinoic acid and puromycin did not increase transendothelial electrical resistance (TEER) values of the BBB model.

  1. Characterization of lipid metabolism in insulin-sensitive adipocytes differentiated from immortalized human mesenchymal stem cells

    International Nuclear Information System (INIS)

    Prawitt, Janne; Niemeier, Andreas; Kassem, Moustapha; Beisiegel, Ulrike; Heeren, Joerg

    2008-01-01

    There is a great demand for cell models to study human adipocyte function. Here we describe the adipogenic differentiation of a telomerase-immortalized human mesenchymal stem cell line (hMSC-Tert) that maintains numerous features of terminally differentiated adipocytes even after prolonged withdrawal of the peroxisome proliferator activated receptor γ (PPARγ) agonist rosiglitazone. Differentiated hMSC-Tert developed the characteristic monolocular phenotype of mature adipocytes. The expression of adipocyte specific markers was highly increased during differentiation. Most importantly, the presence of the PPARγ agonist rosiglitazone was not required for the stable expression of lipoprotein lipase, adipocyte fatty acid binding protein and perilipin on mRNA and protein levels. Adiponectin expression was post-transcriptionally down-regulated in the absence of rosiglitazone. Insulin sensitivity as measured by insulin-induced phosphorylation of Akt and S6 ribosomal protein was also independent of rosiglitazone. In addition to commonly used adipogenic markers, we investigated further PPARγ-stimulated proteins with a role in lipid metabolism. We observed an increase of lipoprotein receptor (VLDLR, LRP1) and apolipoprotein E expression during differentiation. Despite this increased expression, the receptor-mediated endocytosis of lipoproteins was decreased in differentiated adipocytes, suggesting that these proteins may have an additional function in adipose tissue beyond lipoprotein uptake

  2. Leptin regulates the pro-inflammatory response in human epidermal keratinocytes.

    Science.gov (United States)

    Lee, Moonyoung; Lee, Eunyoung; Jin, Sun Hee; Ahn, Sungjin; Kim, Sae On; Kim, Jungmin; Choi, Dalwoong; Lim, Kyung-Min; Lee, Seung-Taek; Noh, Minsoo

    2018-05-01

    The role of leptin in cutaneous wound healing process has been suggested in genetically obese mouse studies. However, the molecular and cellular effects of leptin on human epidermal keratinocytes are still unclear. In this study, the whole-genome-scale microarray analysis was performed to elucidate the effect of leptin on epidermal keratinocyte functions. In the leptin-treated normal human keratinocytes (NHKs), we identified the 151 upregulated and 53 downregulated differentially expressed genes (DEGs). The gene ontology (GO) enrichment analysis with the leptin-induced DEGs suggests that leptin regulates NHKs to promote pro-inflammatory responses, extracellular matrix organization, and angiogenesis. Among the DEGs, the protein expression of IL-8, MMP-1, fibronectin, and S100A7, which play roles in which is important in the regulation of cutaneous inflammation, was confirmed in the leptin-treated NHKs. The upregulation of the leptin-induced proteins is mainly regulated by the STAT3 signaling pathway in NHKs. Among the downregulated DEGs, the protein expression of nucleosome assembly-associated centromere protein A (CENPA) and CENPM was confirmed in the leptin-treated NHKs. However, the expression of CENPA and CENPM was not coupled with those of other chromosome passenger complex like Aurora A kinase, INCENP, and survivin. In cell growth kinetics analysis, leptin had no significant effect on the cell growth curves of NHKs in the normal growth factor-enriched condition. Therefore, leptin-dependent downregulation of CENPA and CENPM in NHKs may not be directly associated with mitotic regulation during inflammation.

  3. Genome-wide transcriptional reorganization associated with senescence-to-immortality switch during human hepatocellular carcinogenesis.

    Directory of Open Access Journals (Sweden)

    Gokhan Yildiz

    Full Text Available Senescence is a permanent proliferation arrest in response to cell stress such as DNA damage. It contributes strongly to tissue aging and serves as a major barrier against tumor development. Most tumor cells are believed to bypass the senescence barrier (become "immortal" by inactivating growth control genes such as TP53 and CDKN2A. They also reactivate telomerase reverse transcriptase. Senescence-to-immortality transition is accompanied by major phenotypic and biochemical changes mediated by genome-wide transcriptional modifications. This appears to happen during hepatocellular carcinoma (HCC development in patients with liver cirrhosis, however, the accompanying transcriptional changes are virtually unknown. We investigated genome-wide transcriptional changes related to the senescence-to-immortality switch during hepatocellular carcinogenesis. Initially, we performed transcriptome analysis of senescent and immortal clones of Huh7 HCC cell line, and identified genes with significant differential expression to establish a senescence-related gene list. Through the analysis of senescence-related gene expression in different liver tissues we showed that cirrhosis and HCC display expression patterns compatible with senescent and immortal phenotypes, respectively; dysplasia being a transitional state. Gene set enrichment analysis revealed that cirrhosis/senescence-associated genes were preferentially expressed in non-tumor tissues, less malignant tumors, and differentiated or senescent cells. In contrast, HCC/immortality genes were up-regulated in tumor tissues, or more malignant tumors and progenitor cells. In HCC tumors and immortal cells genes involved in DNA repair, cell cycle, telomere extension and branched chain amino acid metabolism were up-regulated, whereas genes involved in cell signaling, as well as in drug, lipid, retinoid and glycolytic metabolism were down-regulated. Based on these distinctive gene expression features we developed a 15

  4. The Herbal Bitter Drug Gentiana lutea Modulates Lipid Synthesis in Human Keratinocytes In Vitro and In Vivo.

    Science.gov (United States)

    Wölfle, Ute; Haarhaus, Birgit; Seiwerth, Jasmin; Cawelius, Anja; Schwabe, Kay; Quirin, Karl-Werner; Schempp, Christoph M

    2017-08-22

    Gentiana lutea is a herbal bitter drug that is used to enhance gastrointestinal motility and secretion. Recently we have shown that amarogentin, a characteristic bitter compound of Gentiana lutea extract (GE), binds to the bitter taste receptors TAS2R1 and TAS2R38 in human keratinocytes, and stimulates the synthesis of epidermal barrier proteins. Here, we wondered if GE also modulates lipid synthesis in human keratinocytes. To address this issue, human primary keratinocytes were incubated for 6 days with GE. Nile Red labeling revealed that GE significantly increased lipid synthesis in keratinocytes. Similarly, gas chromatography with flame ionization detector indicated that GE increases the amount of triglycerides in keratinocytes. GE induced the expression of epidermal ceramide synthase 3, but not sphingomyelinase. Lipid synthesis, as well as ceramide synthase 3 expression, could be specifically blocked by inhibitors of the p38 MAPK and PPARγ signaling pathway. To assess if GE also modulates lipid synthesis in vivo, we performed a proof of concept half side comparison on the volar forearms of 33 volunteers. In comparison to placebo, GE significantly increased the lipid content of the treated skin areas, as measured with a sebumeter. Thus, GE enhances lipid synthesis in human keratinocytes that is essential for building an intact epidermal barrier. Therefore, GE might be used to improve skin disorders with an impaired epidermal barrier, e.g., very dry skin and atopic eczema.

  5. In vitro human keratinocyte migration rates are associated with SNPs in the KRT1 interval.

    Directory of Open Access Journals (Sweden)

    Heng Tao

    Full Text Available Efforts to develop effective therapeutic treatments for promoting fast wound healing after injury to the epidermis are hindered by a lack of understanding of the factors involved. Re-epithelialization is an essential step of wound healing involving the migration of epidermal keratinocytes over the wound site. Here, we examine genetic variants in the keratin-1 (KRT1 locus for association with migration rates of human epidermal keratinocytes (HEK isolated from different individuals. Although the role of intermediate filament genes, including KRT1, in wound activated keratinocytes is well established, this is the first study to examine if genetic variants in humans contribute to differences in the migration rates of these cells. Using an in vitro scratch wound assay we observe quantifiable variation in HEK migration rates in two independent sets of samples; 24 samples in the first set and 17 samples in the second set. We analyze genetic variants in the KRT1 interval and identify SNPs significantly associated with HEK migration rates in both samples sets. Additionally, we show in the first set of samples that the average migration rate of HEK cells homozygous for one common haplotype pattern in the KRT1 interval is significantly faster than that of HEK cells homozygous for a second common haplotype pattern. Our study demonstrates that genetic variants in the KRT1 interval contribute to quantifiable differences in the migration rates of keratinocytes isolated from different individuals. Furthermore we show that in vitro cell assays can successfully be used to deconstruct complex traits into simple biological model systems for genetic association studies.

  6. Xenobiotic metabolism capacities of human skin in comparison with a 3D-epidermis model and keratinocyte-based cell culture as in vitro alternatives for chemical testing: phase II enzymes.

    Science.gov (United States)

    Götz, Christine; Pfeiffer, Roland; Tigges, Julia; Ruwiedel, Karsten; Hübenthal, Ulrike; Merk, Hans F; Krutmann, Jean; Edwards, Robert J; Abel, Josef; Pease, Camilla; Goebel, Carsten; Hewitt, Nicola; Fritsche, Ellen

    2012-05-01

    The 7th Amendment to the EU Cosmetics Directive prohibits the use of animals in cosmetic testing for certain endpoints, such as genotoxicity. Therefore, skin in vitro models have to replace chemical testing in vivo. However, the metabolic competence neither of human skin nor of alternative in vitro models has so far been fully characterized, although skin is the first-pass organ for accidentally or purposely (cosmetics and pharmaceuticals) applied chemicals. Thus, there is an urgent need to understand the xenobiotic-metabolizing capacities of human skin and to compare these activities to models developed to replace animal testing. We have measured the activity of the phase II enzymes glutathione S-transferase, UDP-glucuronosyltransferase and N-acetyltransferase in ex vivo human skin, the 3D epidermal model EpiDerm 200 (EPI-200), immortalized keratinocyte-based cell lines (HaCaT and NCTC 2544) and primary normal human epidermal keratinocytes. We show that all three phase II enzymes are present and highly active in skin as compared to phase I. Human skin, therefore, represents a more detoxifying than activating organ. This work systematically compares the activities of three important phase II enzymes in four different in vitro models directly to human skin. We conclude from our studies that 3D epidermal models, like the EPI-200 employed here, are superior over monolayer cultures in mimicking human skin xenobiotic metabolism and thus better suited for dermatotoxicity testing. © 2012 John Wiley & Sons A/S.

  7. Analysis of proviral integration in human mammary epithelial cell lines immortalized by retroviral infection with a temperature-sensitive SV40 T-antigen construct.

    Science.gov (United States)

    Stamps, A C; Davies, S C; Burman, J; O'Hare, M J

    1994-06-15

    A panel of eight conditionally immortal lines derived by infection of human breast epithelial cells with an amphotropic retrovirus transducing a ts mutant of SV40 large T-antigen was analyzed with respect to individual retroviral integration patterns. Each line contained multiple integration sites which were clonal and stable over extended passage. Similar integration patterns were observed between individual lines arising separately from the same stock of pre-immortal cells, suggesting a common progenitor. Retroviral integration analysis of pre-immortal cells at different stages of pre-crisis growth showed changes indicative of a progressive transition from polyclonality to clonality as the cells approached crisis. Each of the immortal lines contained a sub-set of the integration sites of their pre-immortal progenitors, with individual combinations and copy numbers of sites. Since all the cell lines appeared to originate from single foci in separate flasks, it is likely that each set arose from a common clone of pre-immortal cells as the result of separate genetic events. There was no evidence from this analysis to suggest that specific integration sites played any part either in the selection of pre-crisis clones or in the subsequent establishment of immortal lines.

  8. Pseudomonas-derived ceramidase induces production of inflammatory mediators from human keratinocytes via sphingosine-1-phosphate.

    Directory of Open Access Journals (Sweden)

    Ami Oizumi

    Full Text Available Ceramide is important for water retention and permeability barrier functions in the stratum corneum, and plays a key role in the pathogenesis of atopic dermatitis (AD. A Pseudomonas aeruginosa-derived neutral ceramidase (PaCDase isolated from a patient with AD was shown to effectively degrade ceramide in the presence of Staphylococcus aureus-derived lipids or neutral detergents. However, the effect of ceramide metabolites on the functions of differentiating keratinocytes is poorly understood. We found that the ceramide metabolite sphingosine-1-phosphate (S1P stimulated the production of inflammatory mediators such as TNF-α and IL-8 from three-dimensionally cultured human primary keratinocytes (termed "3D keratinocytes", which form a stratum corneum. PaCDase alone did not affect TNF-α gene expression in 3D keratinocytes. In the presence of the detergent Triton X-100, which damages stratum corneum structure, PaCDase, but not heat-inactivated PaCDase or PaCDase-inactive mutant, induced the production of TNF-α, endothelin-1, and IL-8, indicating that this production was dependent on ceramidase activity. Among various ceramide metabolites, sphingosine and S1P enhanced the gene expression of TNF-α, endothelin-1, and IL-8. The PaCDase-enhanced expression of these genes was inhibited by a sphingosine kinase inhibitor and by an S1P receptor antagonist VPC 23019. The TNF-α-binding antibody infliximab suppressed the PaCDase-induced upregulation of IL-8, but not TNF-α, mRNA. PaCDase induced NF-κB p65 phosphorylation. The NF-κB inhibitor curcumin significantly inhibited PaCDase-induced expression of IL-8 and endothelin-1. VPC 23019 and infliximab inhibited PaCDase-induced NF-κB p65 phosphorylation and reduction in the protein level of the NF-κB inhibitor IκBα. Collectively, these findings suggest that (i 3D keratinocytes produce S1P from sphingosine, which is produced through the hydrolysis of ceramide by PaCDase, (ii S1P induces the production

  9. Inefficiency in macromolecular transport of SCS-based microcapsules affects viability of primary human mesenchymal stem cells but not of immortalized cells

    DEFF Research Database (Denmark)

    Sanz-Nogués, Clara; Horan, Jason; Thompson, Kerry

    2015-01-01

    mesenchymal stem cells (hMSCs). Human MSCs are of interest in regenerative medicine applications due to pro-angiogenic, anti-inflammatory and immunomodulatory properties, which result from paracrine effects of this cell type. In the present work we have encapsulated primary hMSCs and hMSC-TERT immortalized...... nutrients and had a more detrimental effect on the viability of primary cell cultures compared to cell lines and immortalized cells. This article is protected by copyright. All rights reserved....

  10. Rat embryonic fibroblasts improve reprogramming of human keratinocytes into induced pluripotent stem cells.

    Science.gov (United States)

    Linta, Leonhard; Stockmann, Marianne; Kleinhans, Karin N; Böckers, Anja; Storch, Alexander; Zaehres, Holm; Lin, Qiong; Barbi, Gotthold; Böckers, Tobias M; Kleger, Alexander; Liebau, Stefan

    2012-04-10

    Patient-specific human induced pluripotent stem (hiPS) cells not only provide a promising tool for cellular disease models in general, but also open up the opportunity to establish cell-type-specific systems for personalized medicine. One of the crucial prerequisites for these strategies, however, is a fast and efficient reprogramming strategy from easy accessible somatic cell populations. Keratinocytes from plucked human hair had been introduced as a superior cell source for reprogramming purposes compared with the widely used skin fibroblasts. The starting cell population is, however, limited and thereby further optimization in terms of time, efficiency, and quality is inevitable. Here we show that rat embryonic fibroblasts (REFs) should replace mouse embryonic fibroblasts as feeder cells in the reprogramming process. REFs enable a significantly more efficient reprogramming procedure as shown by colony number and total amount of SSEA4-positive cells. We successfully produced keratinocyte-derived hiPS (k-hiPS) cells from various donors. The arising k-hiPS cells display the hallmarks of pluripotency such as expression of stem cell markers and differentiation into all 3 germ layers. The increased reprogramming efficiency using REFs as a feeder layer occurred independent of the proliferation rate in the parental keratinocytes and acts, at least in part, in a non-cell autonomous way by secreting factors known to facilitate pluripotency such as Tgfb1, Inhba and Grem1. Hence, we provide an easy to use and highly efficient reprogramming system that could be very useful for a broad application to generate human iPS cells. © Mary Ann Liebert, Inc.

  11. UVA and UVB irradiation differentially regulate microRNA expression in human primary keratinocytes.

    Directory of Open Access Journals (Sweden)

    Anne Kraemer

    Full Text Available MicroRNA (miRNA-mediated regulation of the cellular transcriptome is an important epigenetic mechanism for fine-tuning regulatory pathways. These include processes related to skin cancer development, progression and metastasis. However, little is known about the role of microRNA as an intermediary in the carcinogenic processes following exposure to UV-radiation. We now show that UV irradiation of human primary keratinocytes modulates the expression of several cellular miRNAs. A common set of miRNAs was influenced by exposure to both UVA and UVB. However, each wavelength band also activated a distinct subset of miRNAs. Common sets of UVA- and UVB-regulated miRNAs harbor the regulatory elements GLYCA-nTRE, GATA-1-undefined-site-13 or Hox-2.3-undefined-site-2 in their promoters. In silico analysis indicates that the differentially expressed miRNAs responding to UV have potential functions in the cellular pathways of cell growth and proliferation. Interestingly, the expression of miR-23b, which is a differentiation marker of human keratinocytes, is remarkably up-regulated after UVA irradiation. Studying the interaction between miR-23b and its putative skin-relevant targets using a Luciferase reporter assay revealed that RRAS2 (related RAS viral oncogene homolog 2, which is strongly expressed in highly aggressive malignant skin cancer, to be a direct target of miR-23b. This study demonstrates for the first time a differential miRNA response to UVA and UVB in human primary keratinocytes. This suggests that selective regulation of signaling pathways occurs in response to different UV energies. This may shed new light on miRNA-regulated carcinogenic processes involved in UV-induced skin carcinogenesis.

  12. UVA and UVB Irradiation Differentially Regulate microRNA Expression in Human Primary Keratinocytes

    Science.gov (United States)

    Kraemer, Anne; Chen, I-Peng; Henning, Stefan; Faust, Alexandra; Volkmer, Beate; Atkinson, Michael J.; Moertl, Simone; Greinert, Ruediger

    2013-01-01

    MicroRNA (miRNA)-mediated regulation of the cellular transcriptome is an important epigenetic mechanism for fine-tuning regulatory pathways. These include processes related to skin cancer development, progression and metastasis. However, little is known about the role of microRNA as an intermediary in the carcinogenic processes following exposure to UV-radiation. We now show that UV irradiation of human primary keratinocytes modulates the expression of several cellular miRNAs. A common set of miRNAs was influenced by exposure to both UVA and UVB. However, each wavelength band also activated a distinct subset of miRNAs. Common sets of UVA- and UVB-regulated miRNAs harbor the regulatory elements GLYCA-nTRE, GATA-1-undefined-site-13 or Hox-2.3-undefined-site-2 in their promoters. In silico analysis indicates that the differentially expressed miRNAs responding to UV have potential functions in the cellular pathways of cell growth and proliferation. Interestingly, the expression of miR-23b, which is a differentiation marker of human keratinocytes, is remarkably up-regulated after UVA irradiation. Studying the interaction between miR-23b and its putative skin-relevant targets using a Luciferase reporter assay revealed that RRAS2 (related RAS viral oncogene homolog 2), which is strongly expressed in highly aggressive malignant skin cancer, to be a direct target of miR-23b. This study demonstrates for the first time a differential miRNA response to UVA and UVB in human primary keratinocytes. This suggests that selective regulation of signaling pathways occurs in response to different UV energies. This may shed new light on miRNA-regulated carcinogenic processes involved in UV-induced skin carcinogenesis. PMID:24391759

  13. Efficient generation of integration-free human induced pluripotent stem cells from keratinocytes by simple transfection of episomal vectors.

    Science.gov (United States)

    Piao, Yulan; Hung, Sandy Shen-Chi; Lim, Shiang Y; Wong, Raymond Ching-Bong; Ko, Minoru S H

    2014-07-01

    Keratinocytes represent an easily accessible cell source for derivation of human induced pluripotent stem (hiPS) cells, reportedly achieving higher reprogramming efficiency than fibroblasts. However, most studies utilized a retroviral or lentiviral method for reprogramming of keratinocytes, which introduces undesirable transgene integrations into the host genome. Moreover, current protocols of generating integration-free hiPS cells from keratinocytes are mostly inefficient. In this paper, we describe a more efficient, simple-to-use, and cost-effective method for generating integration-free hiPS cells from keratinocytes. Our improved method using lipid-mediated transfection achieved a reprogramming efficiency of ∼0.14% on average. Keratinocyte-derived hiPS cells showed no integration of episomal vectors, expressed stem cell-specific markers and possessed potentials to differentiate into all three germ layers by in vitro embryoid body formation as well as in vivo teratoma formation. To our knowledge, this represents the most efficient method to generate integration-free hiPS cells from keratinocytes. ©AlphaMed Press.

  14. Ultraviolet Radiation Increases the Toxicity of Pyrene, 1-Aminopyrene and 1-Hydroxypyrene to Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Huey-Min Hwang

    2005-04-01

    Full Text Available Over the past several years, a great deal of interest has been focused on the harmful effects of ultraviolet (UV radiation to human skin. UV light has been implicated in aging, sunburn and skin cancer. Few studies, however, have been done to determine the effects that UV light, in conjunction with other environmental contaminants, may have on human skin. Polycyclic Aromatic Hydrocarbons (PAHs are a class of compounds that have been reported to be toxic, mutagenic and carcinogenic to many eukaryotic organisms. UV light is also known to increase the toxicity of PAHs through photo-activation and photo-modification. The purpose of this study was to assess the effects of UV-A irradiated pyrene (Pyr, 1-aminopyrene (1-AP and 1-hydroxypyrene (1-HP on human keratinocytes, the skin primary site of UV irradiated PAH exposure. Our findings indicate that simultaneous treatment of human keratinocyte cell line, HaCaT, with 1.0μg/ml pyrene, 1-AP or 1-HP and 3.9 J/cm2/min UV-A light resulted in significant inhibition of cell proliferation. Approximately 100% of the cells died in the case of UV-A irradiated 1-AP and 1-HP. In the case of UV-A irradiated pyrene, more than 70% of the cells died, indicating that UV-A is able to transform these PAHs into more harmful intermediates.

  15. Transformation of SV40-immortalized human uroepithelial cells by 3-methylcholanthrene increases IFN- and Large T Antigen-induced transcripts

    Directory of Open Access Journals (Sweden)

    Easton Marilyn J

    2010-02-01

    Full Text Available Abstract Background Simian Virus 40 (SV40 immortalization followed by treatment of cells with 3-methylcholanthrene (3-MC has been used to elicit tumors in athymic mice. 3-MC carcinogenesis has been thoroughly studied, however gene-level interactions between 3-MC and SV40 that could have produced the observed tumors have not been explored. The commercially-available human uroepithelial cell lines were either SV40-immortalized (HUC or SV40-immortalized and then 3-MC-transformed (HUC-TC. Results To characterize the SV40 - 3MC interaction, we compared human gene expression in these cell lines using a human cancer array and confirmed selected changes by RT-PCR. Many viral Large T Antigen (Tag expression-related changes occurred in HUC-TC, and it is concluded that SV40 and 3-MC may act synergistically to transform cells. Changes noted in IFP 9-27, 2'-5' OAS, IF 56, MxA and MxAB were typical of those that occur in response to viral exposure and are part of the innate immune response. Because interferon is crucial to innate immune host defenses and many gene changes were interferon-related, we explored cellular growth responses to exogenous IFN-γ and found that treatment impeded growth in tumor, but not immortalized HUC on days 4 - 7. Cellular metabolism however, was inhibited in both cell types. We conclude that IFN-γ metabolic responses were functional in both cell lines, but IFN-γ anti-proliferative responses functioned only in tumor cells. Conclusions Synergism of SV40 with 3-MC or other environmental carcinogens may be of concern as SV40 is now endemic in 2-5.9% of the U.S. population. In addition, SV40-immortalization is a generally-accepted method used in many research materials, but the possibility of off-target effects in studies carried out using these cells has not been considered. We hope that our work will stimulate further study of this important phenomenon.

  16. Portulaca oleracea extracts protect human keratinocytes and fibroblasts from UV-induced apoptosis.

    Science.gov (United States)

    Lee, Suyeon; Kim, Ki Ho; Park, Changhoon; Lee, Jong-Suk; Kim, Young Heui

    2014-10-01

    Portulaca oleracea extracts, known as Ma Chi Hyun in the traditional Korean medicine, show a variety of biomedical efficacies including those in anti-inflammation and anti-allergy. In this study, we investigate the protective activity of the P. oleracea extracts against UVB-induced damage in human epithelial keratinocytes and fibroblasts by several apoptosis-related tests. The results suggest that P. oleracea extracts have protective effects from UVB-induced apoptosis. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  17. Arsenic compromises conducting airway epithelial barrier properties in primary mouse and immortalized human cell cultures.

    Directory of Open Access Journals (Sweden)

    Cara L Sherwood

    Full Text Available Arsenic is a lung toxicant that can lead to respiratory illness through inhalation and ingestion, although the most common exposure is through contaminated drinking water. Lung effects reported from arsenic exposure include lung cancer and obstructive lung disease, as well as reductions in lung function and immune response. As part of their role in innate immune function, airway epithelial cells provide a barrier that protects underlying tissue from inhaled particulates, pathogens, and toxicants frequently found in inspired air. We evaluated the effects of a five-day exposure to environmentally relevant levels of arsenic {<4μM [~300 μg/L (ppb] as NaAsO2} on airway epithelial barrier function and structure. In a primary mouse tracheal epithelial (MTE cell model we found that both micromolar (3.9 μM and submicromolar (0.8 μM arsenic concentrations reduced transepithelial resistance, a measure of barrier function. Immunofluorescent staining of arsenic-treated MTE cells showed altered patterns of localization of the transmembrane tight junction proteins claudin (Cl Cl-1, Cl-4, Cl-7 and occludin at cell-cell contacts when compared with untreated controls. To better quantify arsenic-induced changes in tight junction transmembrane proteins we conducted arsenic exposure experiments with an immortalized human bronchial epithelial cell line (16HBE14o-. We found that arsenic exposure significantly increased the protein expression of Cl-4 and occludin as well as the mRNA levels of Cl-4 and Cl-7 in these cells. Additionally, arsenic exposure resulted in altered phosphorylation of occludin. In summary, exposure to environmentally relevant levels of arsenic can alter both the function and structure of airway epithelial barrier constituents. These changes likely contribute to the observed arsenic-induced loss in basic innate immune defense and increased infection in the airway.

  18. Hyperthermia-induced micronucleus formation in a human keratinocyte cell line

    International Nuclear Information System (INIS)

    Hintzsche, Henning; Riese, Thorsten; Stopper, Helga

    2012-01-01

    Elevated temperature can cause biological effects in vitro and in vivo. Many studies on effects of hypo- and hyperthermia have been conducted, but only few studies systematically investigated the formation of genomic damage in the micronucleus test in human cells in vitro as a consequence of different temperatures. In the present study, HaCaT human keratinocytes were exposed to different temperatures from 37 °C to 42 °C for 24 h in a regular cell culture incubator. Micronucleus frequency as a marker of genomic damage was elevated in a temperature-dependent and statistically significant manner. Apoptosis occurred at temperatures of 39 °C or higher. Cell proliferation was unaffected up to 40 °C and decreased at 41 °C and 42 °C. Expression of the heat shock protein Hsp70 was elevated, particularly at temperatures of 40 °C and higher. These findings are in agreement with several in vivo studies and some in vitro studies looking at single, specific temperatures, but a systematically investigated temperature-dependent increase of genomic damage in human keratinocytes in vitro is demonstrated for the first time here.

  19. Functional analysis of a novel human serotonin transporter gene promoter in immortalized raphe cells

    DEFF Research Database (Denmark)

    Mortensen, O V; Thomassen, M; Larsen, M B

    1999-01-01

    were found to possess the additional 379 bp fragment. The integrity of the promoter was furthermore confirmed by genomic Southern blotting. The promoter activity was analyzed by reporter gene assays in neuronal and non-neuronal serotonergic cell lines. In immortalized serotonergic raphe neurons, RN46A...

  20. Interaction of urokinase A chain with the receptor of human keratinocytes stimulates release of urokinase-like plasminogen activator

    Energy Technology Data Exchange (ETDEWEB)

    Fibbi, G.; Magnelli, L.; Pucci, M.; Del Rosso, M. (Florence Univ. (Italy))

    1990-03-01

    On the basis of a fibrinolytic assay with {sup 125}I-fibrin, zymography, and immunoprobing with anti-human urokinase antibody, the authors have observed that the in vitro established NCTC human keratinocyte cell line releases into the culture medium a 54,000-Da plasminogen activator which is indistinguishable from human urokinase. Only the early release following the washing of keratinocyte monolayers is accounted for by secretion of preformed enzyme, while late secretory events require the de novo synthesis of urokinase. The released enzyme can interact by autocriny with its own receptor present on keratinocytes. The addition to the keratinocyte culture medium of the urokinase A chain can stimulate a concentration-dependent urokinase oversecretion, which is not paralleled by oversecretion of plasminogen activator inhibitor-1. Since stimulation of urokinase production can be obtained by an A chain concentration which was previously shown to be efficient in inducing keratinocyte mobilization in an in vitro migration model system, they hypothesize that this mechanism may be important in vivo during the process of wound repair.

  1. Additive Effects of Millimeter Waves and 2-Deoxyglucose Co-Exposure on the Human Keratinocyte Transcriptome.

    Science.gov (United States)

    Soubere Mahamoud, Yonis; Aite, Meziane; Martin, Catherine; Zhadobov, Maxim; Sauleau, Ronan; Le Dréan, Yves; Habauzit, Denis

    2016-01-01

    Millimeter Waves (MMW) will be used in the next-generation of high-speed wireless technologies, especially in future Ultra-Broadband small cells in 5G cellular networks. Therefore, their biocompatibilities must be evaluated prior to their massive deployment. Using a microarray-based approach, we analyzed modifications to the whole genome of a human keratinocyte model that was exposed at 60.4 GHz-MMW at an incident power density (IPD) of 20 mW/cm2 for 3 hours in athermic conditions. No keratinocyte transcriptome modifications were observed. We tested the effects of MMWs on cell metabolism by co-treating MMW-exposed cells with a glycolysis inhibitor, 2-deoxyglucose (2dG, 20 mM for 3 hours), and whole genome expression was evaluated along with the ATP content. We found that the 2dG treatment decreased the cellular ATP content and induced a high modification in the transcriptome (632 coding genes). The affected genes were associated with transcriptional repression, cellular communication and endoplasmic reticulum homeostasis. The MMW/2dG co-treatment did not alter the keratinocyte ATP content, but it did slightly alter the transcriptome, which reflected the capacity of MMW to interfere with the bioenergetic stress response. The RT-PCR-based validation confirmed 6 MMW-sensitive genes (SOCS3, SPRY2, TRIB1, FAM46A, CSRNP1 and PPP1R15A) during the 2dG treatment. These 6 genes encoded transcription factors or inhibitors of cytokine pathways, which raised questions regarding the potential impact of long-term or chronic MMW exposure on metabolically stressed cells.

  2. Additive Effects of Millimeter Waves and 2-Deoxyglucose Co-Exposure on the Human Keratinocyte Transcriptome.

    Directory of Open Access Journals (Sweden)

    Yonis Soubere Mahamoud

    Full Text Available Millimeter Waves (MMW will be used in the next-generation of high-speed wireless technologies, especially in future Ultra-Broadband small cells in 5G cellular networks. Therefore, their biocompatibilities must be evaluated prior to their massive deployment. Using a microarray-based approach, we analyzed modifications to the whole genome of a human keratinocyte model that was exposed at 60.4 GHz-MMW at an incident power density (IPD of 20 mW/cm2 for 3 hours in athermic conditions. No keratinocyte transcriptome modifications were observed. We tested the effects of MMWs on cell metabolism by co-treating MMW-exposed cells with a glycolysis inhibitor, 2-deoxyglucose (2dG, 20 mM for 3 hours, and whole genome expression was evaluated along with the ATP content. We found that the 2dG treatment decreased the cellular ATP content and induced a high modification in the transcriptome (632 coding genes. The affected genes were associated with transcriptional repression, cellular communication and endoplasmic reticulum homeostasis. The MMW/2dG co-treatment did not alter the keratinocyte ATP content, but it did slightly alter the transcriptome, which reflected the capacity of MMW to interfere with the bioenergetic stress response. The RT-PCR-based validation confirmed 6 MMW-sensitive genes (SOCS3, SPRY2, TRIB1, FAM46A, CSRNP1 and PPP1R15A during the 2dG treatment. These 6 genes encoded transcription factors or inhibitors of cytokine pathways, which raised questions regarding the potential impact of long-term or chronic MMW exposure on metabolically stressed cells.

  3. Human lactoferrin stimulates skin keratinocyte function and wound re-epithelialization.

    Science.gov (United States)

    Tang, L; Wu, J J; Ma, Q; Cui, T; Andreopoulos, F M; Gil, J; Valdes, J; Davis, S C; Li, J

    2010-07-01

    Human lactoferrin (hLF), a member of the transferrin family, is known for its antimicrobial and anti-inflammatory effects. Recent studies on various nonskin cell lines indicate that hLF may have a stimulatory effect on cell proliferation. To study the potential role of hLF in wound re-epithelialization. The effects of hLF on cell growth, migration, attachment and survival were assessed, with a rice-derived recombinant hLF (holo-rhLF), using proliferation analysis, scratch migration assay, calcein-AM/propidium iodide staining and terminal deoxynucleotidyl transferase-mediated dUTP nick-end labelling (TUNEL) method, respectively. The mechanisms of hLF on cell proliferation and migration were explored using specific pathway inhibitors. The involvement of lactoferrin receptor low-density lipoprotein receptor-related protein 1 (LRP1) was examined with RNA interference technique. An in vivo swine second-degree burn wound model was also used to assess wound re-epithelialization. Studies revealed that holo-rhLF significantly stimulated keratinocyte proliferation which could be blocked by mitogen-activated protein kinase (MAPK) kinase 1 inhibitor. Holo-rhLF also showed strong promoting effects on keratinocyte migration, which could be blocked by either inhibition of the MAPK, Src and Rho/ROCK pathways, or downregulation of the LRP1 receptor. With cells under starving or 12-O-tetradecanoylphorbol-13-acetate exposure, the addition of holo-rhLF was found greatly to increase cell viability and inhibit cell apoptosis. Additionally, holo-rhLF significantly increased the rate of wound re-epithelialization in swine second-degree burn wounds. Our studies demonstrate the direct effects of holo-rhLF on wound re-epithelialization including the enhancement of keratinocyte proliferation and migration as well as the protection of cells from apoptosis. The data strongly indicate its potential therapeutic applications in wound healing.

  4. Long-wave ultraviolet light induces phospholipase activation in cultured human epidermal keratinocytes

    International Nuclear Information System (INIS)

    Hanson, D.; DeLeo, V.

    1990-01-01

    Long wave ultraviolet radiation (UVA) has been shown to play an important role in the overall response of skin to solar radiation, including sunburn, tanning, premature aging, and non-melanoma skin cancer. UVA induction of inflammation in human skin is thought to be mediated by membrane lipid derived products. In order to investigate the mechanism of this response we examined the effect of UVA on phospholipid metabolism of human epidermal keratinocytes in culture. Keratinocytes were grown in serum free low calcium medium. The cells were prelabeled with [3H] arachidonic acid or [3H] choline and irradiated with UVA (Honle 2002-Hg vapor lamp). Identification and quantitation of specific membrane phospholipid-derived components was achieved using high-performance liquid chromatography, paper chromatography, and radioimmunoassay. UVA resulted in a linear dose dependent release of [3H] arachidonic acid into medium between 1 and 20 joule/cm2. This response was inhibited in an oxygen-reduced environment. The radiolabel released was predominantly free arachidonate and cyclooxygenase metabolites. Cyclooxygenase metabolites prostaglandin E2 and prostacyclin derivative, 6-keto-prostaglandin F1a, were stimulated following UVA irradiation, but the lipoxygenase metabolite, leukotriene B was not detected. Maximal release was measured immediately after irradiation and changed little over 24 h post-irradiation. UVA stimulated an increase of [3H] choline metabolites glycerophosphorylcholine and phosphorylcholine in media extracts suggesting UVA activation of phospholipase C and phospholipase A2 or diacylglyceride lipase

  5. Transcription factors and stress response gene alterations in human keratinocytes following Solar Simulated Ultra Violet Radiation.

    Science.gov (United States)

    Marais, Thomas L Des; Kluz, Thomas; Xu, Dazhong; Zhang, Xiaoru; Gesumaria, Lisa; Matsui, Mary S; Costa, Max; Sun, Hong

    2017-10-19

    Ultraviolet radiation (UVR) from sunlight is the major effector for skin aging and carcinogenesis. However, genes and pathways altered by solar-simulated UVR (ssUVR), a mixture of UVA and UVB, are not well characterized. Here we report global changes in gene expression as well as associated pathways and upstream transcription factors in human keratinocytes exposed to ssUVR. Human HaCaT keratinocytes were exposed to either a single dose or 5 repetitive doses of ssUVR. Comprehensive analyses of gene expression profiles as well as functional annotation were performed at 24 hours post irradiation. Our results revealed that ssUVR modulated genes with diverse cellular functions changed in a dose-dependent manner. Gene expression in cells exposed to a single dose of ssUVR differed significantly from those that underwent repetitive exposures. While single ssUVR caused a significant inhibition in genes involved in cell cycle progression, especially G2/M checkpoint and mitotic regulation, repetitive ssUVR led to extensive changes in genes related to cell signaling and metabolism. We have also identified a panel of ssUVR target genes that exhibited persistent changes in gene expression even at 1 week after irradiation. These results revealed a complex network of transcriptional regulators and pathways that orchestrate the cellular response to ssUVR.

  6. Upregulation of FOXM1 induces genomic instability in human epidermal keratinocytes

    Directory of Open Access Journals (Sweden)

    Philpott Michael P

    2010-02-01

    Full Text Available Abstract Background The human cell cycle transcription factor FOXM1 is known to play a key role in regulating timely mitotic progression and accurate chromosomal segregation during cell division. Deregulation of FOXM1 has been linked to a majority of human cancers. We previously showed that FOXM1 was upregulated in basal cell carcinoma and recently reported that upregulation of FOXM1 precedes malignancy in a number of solid human cancer types including oral, oesophagus, lung, breast, kidney, bladder and uterus. This indicates that upregulation of FOXM1 may be an early molecular signal required for aberrant cell cycle and cancer initiation. Results The present study investigated the putative early mechanism of UVB and FOXM1 in skin cancer initiation. We have demonstrated that UVB dose-dependently increased FOXM1 protein levels through protein stabilisation and accumulation rather than de novo mRNA expression in human epidermal keratinocytes. FOXM1 upregulation in primary human keratinocytes triggered pro-apoptotic/DNA-damage checkpoint response genes such as p21, p38 MAPK, p53 and PARP, however, without causing significant cell cycle arrest or cell death. Using a high-resolution Affymetrix genome-wide single nucleotide polymorphism (SNP mapping technique, we provided the evidence that FOXM1 upregulation in epidermal keratinocytes is sufficient to induce genomic instability, in the form of loss of heterozygosity (LOH and copy number variations (CNV. FOXM1-induced genomic instability was significantly enhanced and accumulated with increasing cell passage and this instability was increased even further upon exposure to UVB resulting in whole chromosomal gain (7p21.3-7q36.3 and segmental LOH (6q25.1-6q25.3. Conclusion We hypothesise that prolonged and repeated UVB exposure selects for skin cells bearing stable FOXM1 protein causes aberrant cell cycle checkpoint thereby allowing ectopic cell cycle entry and subsequent genomic instability. The aberrant

  7. High Levels of Chemokine C-C Motif Ligand 20 in Human Milk and Its Production by Oral Keratinocytes.

    Science.gov (United States)

    Lourenço, Alan G; Komesu, Marilena C; Duarte, Geraldo; Del Ciampo, Luiz A; Mussi-Pinhata, Marisa M; Yamamoto, Aparecida Y

    2017-03-01

    Chemokine C-C motif ligand 20 (CCL20) is implicated in the formation and function of mucosal lymphoid tissues. Although CCL20 is secreted by many normal human tissues, no studies have evaluated the presence of CCL20 in human milk or its production by oral keratinocytes stimulated by human milk. To evaluate the presence of CCL20 in breast milk and verify CCL20 secretion in vitro by oral keratinocytes stimulated with human and bovine milk, as well as its possible association with breast milk lactoferrin levels. The levels of CCL20 and lactoferrin were measured by enzyme-linked immunosorbent assay in human milk at three different stages of maturation from 74 healthy breastfeeding mothers. In vitro, oral keratinocytes were stimulated with human and bovine milk, and CCL20 was measured in their supernatant. High concentrations of CCL20 were detected in the human breast milk samples obtained during the first week (1,777.07 pg/mL) and second week postpartum (1,523.44 pg/mL), with a significantly low concentration in samples at 3-6 weeks postpartum (238.42 pg/mL; p stimulated higher CCL20 secretion by oral keratinocytes compared with bovine milk (p stimulation had no association with breast milk lactoferrin concentration. CCl20 is present at high levels in human milk, predominantly in the first and second week postpartum, but at significantly lower levels at 3-6 weeks postpartum. Human milk is capable of stimulating CCL20 secretion by oral keratinocytes, and this induction had no association with breast milk lactoferrin concentration.

  8. Solar Simulated Ultraviolet Radiation Induces Global Histone Hypoacetylation in Human Keratinocytes.

    Science.gov (United States)

    Zhang, Xiaoru; Kluz, Thomas; Gesumaria, Lisa; Matsui, Mary S; Costa, Max; Sun, Hong

    2016-01-01

    Ultraviolet radiation (UVR) from sunlight is the primary effector of skin DNA damage. Chromatin remodeling and histone post-translational modification (PTM) are critical factors in repairing DNA damage and maintaining genomic integrity, however, the dynamic changes of histone marks in response to solar UVR are not well characterized. Here we report global changes in histone PTMs induced by solar simulated UVR (ssUVR). A decrease in lysine acetylation of histones H3 and H4, particularly at positions of H3 lysine 9, lysine 56, H4 lysine 5, and lysine 16, was found in human keratinocytes exposed to ssUVR. These acetylation changes were highly associated with ssUVR in a dose-dependent and time-specific manner. Interestingly, H4K16ac, a mark that is crucial for higher order chromatin structure, exhibited a persistent reduction by ssUVR that was transmitted through multiple cell divisions. In addition, the enzymatic activities of histone acetyltransferases were significantly reduced in irradiated cells, which may account for decreased global acetylation. Moreover, depletion of histone deacetylase SIRT1 in keratinocytes rescued ssUVR-induced H4K16 hypoacetylation. These results indicate that ssUVR affects both HDAC and HAT activities, leading to reduced histone acetylation.

  9. Dermal-epidermal membrane systems by using human keratinocytes and mesenchymal stem cells isolated from dermis

    Energy Technology Data Exchange (ETDEWEB)

    Salerno, Simona, E-mail: s.salerno@itm.cnr.it [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy); Messina, Antonietta [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy); Giordano, Francesca [Department of Pharmacy, Health and Nutritional Sciences, University of Calabria, I-87036 Rende, (CS) (Italy); Bader, Augustinus [Biomedical-Biotechnological Center, BBZ, University of Leipzig, D-04103 Leipzig (Germany); Drioli, Enrico [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy); WCU Energy Engineering Department, Hanyang University, Seoul (Korea, Republic of); De Bartolo, Loredana, E-mail: l.debartolo@itm.cnr.it [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy)

    2017-02-01

    Dermal-epidermal membrane systems were developed by co-culturing human keratinocytes with Skin derived Stem Cells (SSCs), which are Mesenchymal Stem Cells (MSCs) isolated from dermis, on biodegradable membranes of chitosan (CHT), polycaprolactone (PCL) and a polymeric blend of CHT and PCL. The membranes display physico-chemical, morphological, mechanical and biodegradation properties that could satisfy and fulfil specific requirements in skin tissue engineering. CHT membrane exhibits an optimal biodegradation rate for acute wounds; CHT-PCL for the chronic ones. On the other hand, PCL membrane in spite of its very slow biodegradation rate exhibits mechanical properties similar to in vivo dermis, a lower hydrophilic character, and a surface roughness, all properties that make it able to sustain cell adhesion and proliferation for in vitro skin models. Both CHT–PCL and PCL membranes guided epidermal and dermal differentiation of SSCs as pointed out by the expression of cytokeratins and the deposition of the ECM protein fibronectin, respectively. In the dermal-epidermal membrane systems, a more suitable microenvironment for the SSCs differentiation was promoted by the interactions and the mutual interplay with keratinocytes. Being skin tissue-biased stem cells committed to their specific final dermal and/or epidermal cell differentiation, SSCs are more suitable for skin tissue engineering than other adult MSCs with different origin. For this reason, they represent a useful autologous cell source for engineering skin substitutes for both in vivo and in vitro applications.

  10. IKKα regulates human keratinocyte migration through surveillance of the redox environment.

    Science.gov (United States)

    Lisse, Thomas S; Rieger, Sandra

    2017-03-01

    Although the functions of H 2 O 2 in epidermal wound repair are conserved throughout evolution, the underlying signaling mechanisms are largely unknown. In this study we used human keratinocytes (HEK001) to investigate H 2 O 2 -dependent wound repair mechanisms. Scratch wounding led to H 2 O 2 production in two or three cell layers at the wound margin within ∼30 min and subsequent cysteine modification of proteins via sulfenylation. Intriguingly, exogenous H 2 O 2 treatment resulted in preferential sulfenylation of keratinocytes that adopted a migratory phenotype and detached from neighboring cells, suggesting that one of the primary functions of H 2 O 2 is to stimulate signaling factors involved in cell migration. Based on previous findings that revealed epidermal growth factor receptor (EGFR) involvement in H 2 O 2 -dependent cell migration, we analyzed oxidation of a candidate upstream target, the inhibitor of κB kinase α (IKKα; encoded by CHUK ), as a mechanism of action. We show that IKKα is sulfenylated at a conserved cysteine residue in the kinase domain, which correlates with de-repression of EGF promoter activity and increased EGF expression. Thus, this indicates that IKKα promotes migration through dynamic interactions with the EGF promoter depending on the redox state within cells. © 2017. Published by The Company of Biologists Ltd.

  11. Analyses of the Secondary Particle Radiation and the DNA Damage it Causes to Human Keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Lebel E. A.; Tafrov S.; Rusek, A.; Sivertz, M. B.; Yip, K.; Thompson, K. H.

    2011-11-01

    High-energy protons, and high mass and energy ions, along with the secondary particles they produce, are the main contributors to the radiation hazard during space explorations. Skin, particularly the epidermis, consisting mainly of keratinocytes with potential for proliferation and malignant transformation, absorbs the majority of the radiation dose. Therefore, we used normal human keratinocytes to investigate and quantify the DNA damage caused by secondary radiation. Its manifestation depends on the presence of retinol in the serum-free media, and is regulated by phosphatidylinositol 3-kinases. We simulated the generation of secondary radiation after the impact of protons and iron ions on an aluminum shield. We also measured the intensity and the type of the resulting secondary particles at two sample locations; our findings agreed well with our predictions. We showed that secondary particles inflict DNA damage to different extents, depending on the type of primary radiation. Low-energy protons produce fewer secondary particles and cause less DNA damage than do high-energy protons. However, both generate fewer secondary particles and inflict less DNA damage than do high mass and energy ions. The majority of cells repaired the initial damage, as denoted by the presence of 53BPI foci, within the first 24 hours after exposure, but some cells maintained the 53BP1 foci longer.

  12. Saponins from Tribulus terrestris L. protect human keratinocytes from UVB-induced damage.

    Science.gov (United States)

    Sisto, Margherita; Lisi, Sabrina; D'Amore, Massimo; De Lucro, Raffaella; Carati, Davide; Castellana, Donatello; La Pesa, Velia; Zuccarello, Vincenzo; Lofrumento, Dario D

    2012-12-05

    Chronic exposure to solar UVB radiation damages skin, increasing the risk to develop cancer. Hence the identification of compounds with a photoprotective efficacy is essential. This study examined the role of saponins derived from Tribulus terrestris L. (TT) on the modulation of apoptosis in normal human keratinocytes (NHEK) exposed to physiological doses of UVB and to evaluate their antitumoral properties. In NHEK, TT saponins attenuate UVB-induced programmed cell death through inhibition of intrinsic apoptotic pathway. In squamous cell carcinomas (SCC) TT saponins do not make the malignant keratinocytes more resistant to UVB and determine an enhanced apoptotic response. The photoprotective effect of TT saponins is tightly correlated to the enhancement of NER genes expression and the block of UVB-mediated NF-κB activation. Collectively, our study shows experimental evidence that TT has a preventive efficacy against UVB-induced carcinogenesis and the molecular knowledge on the mechanisms through which TT saponins regulate cell death suggests great potential for TT to be developed into a new medicine for cancer patients. Copyright © 2012 Elsevier B.V. All rights reserved.

  13. Resveratrol-Sensitized UVA Induced Apoptosis in Human Keratinocytes through Mitochondrial Oxidative Stress and Pore Opening

    Science.gov (United States)

    Boyer, Jean Z; Jandova, Jana; Janda, Jaroslav; Vleugels, Frank R; Elliott, David; Sligh, James E

    2012-01-01

    Resveratrol (3, 5, 4′-trihydroxy- trans- stilbene), a polyphenol compound, is derived from natural products such as the skin of red grapes, blueberries and cranberries. Resveratrol not only exhibits antioxidant, cardioprotection, and anti-aging properties, but can also inhibit cancer cell growth and induce apoptosis. It has been shown that resveratrol inhibits the activation of Nf-kB and subsequently down regulates the expression of Nf-kB regulated genes such as interleukin-2 and Bcl-2, leading to cell cycle arrest and increased apoptosis in multiple myeloma cells. In the skin, resveratrol has been reported to sensitize keratinocytes to UVA induced apoptosis. However, the effect of resveratrol on opening of the mitochondrial permeability transition pore has not been previously examined. Our data show that UVA (14J/cm2) along with resveratrol causes massive oxidative stress in mitochondria. As a consequence of oxidative stress, the mitochondrial membrane potential decreases which results in opening of the mitochondrial pores ultimately leading to apoptosis in human keratinocytes. These results may have clinical implications for development of future chemotherapeutic treatment for tumors of the skin. PMID:22673012

  14. Proteomic profiling of human keratinocytes undergoing UVB-induced alternative differentiation reveals TRIpartite Motif Protein 29 as a survival factor.

    Directory of Open Access Journals (Sweden)

    Véronique Bertrand-Vallery

    Full Text Available BACKGROUND: Repeated exposures to UVB of human keratinocytes lacking functional p16(INK-4a and able to differentiate induce an alternative state of differentiation rather than stress-induced premature senescence. METHODOLOGY/PRINCIPAL FINDINGS: A 2D-DIGE proteomic profiling of this alternative state of differentiation was performed herein at various times after the exposures to UVB. Sixty-nine differentially abundant protein species were identified by mass spectrometry, many of which are involved in keratinocyte differentiation and survival. Among these protein species was TRIpartite Motif Protein 29 (TRIM29. Increased abundance of TRIM29 following UVB exposures was validated by Western blot using specific antibody and was also further analysed by immunochemistry and by RT-PCR. TRIM29 was found very abundant in keratinocytes and reconstructed epidermis. Knocking down the expression of TRIM29 by short-hairpin RNA interference decreased the viability of keratinocytes after UVB exposure. The abundance of involucrin mRNA, a marker of late differentiation, increased concomitantly. In TRIM29-knocked down reconstructed epidermis, the presence of picnotic cells revealed cell injury. Increased abundance of TRIM29 was also observed upon exposure to DNA damaging agents and PKC activation. The UVB-induced increase of TRIM29 abundance was dependent on a PKC signaling pathway, likely PKCdelta. CONCLUSIONS/SIGNIFICANCE: These findings suggest that TRIM29 allows keratinocytes to enter a protective alternative differentiation process rather than die massively after stress.

  15. UVB induces IL-12 transcription in human keratinocytes in vivo and in vitro

    International Nuclear Information System (INIS)

    Enk, C.D.; Blauvet, A.; Katz, S.I.; Mahanty, S.

    1996-01-01

    Human epidermal cells produce a wide range of cytokines, including those characteristic of Th2-like responses such as interleukin (IL)-4 and IL-10. As well, keratinocytes have recently been shown to produce Th1-like cytokines such as IL-12. Exposure to UVB has profound effects on the skin and systemic immune system, which is in part mediated by secretion of tumor necrosis factor (TNF)-α by epidermal cells. Because IL-12 induces production of TNF-α by certain cells of the immune system, we sought to determine whether UVB is an inducer of IL-12 gene expression in epidermal cells. Human epidermal cells were exposed to UVB radiation in vivo, isolated by suction blister technique and trypsinization and transcription of the IL-12 p35 and p40 chains was examined by RT-PCR. (Author)

  16. Nuclear DNA damage-triggered NLRP3 inflammasome activation promotes UVB-induced inflammatory responses in human keratinocytes

    International Nuclear Information System (INIS)

    Hasegawa, Tatsuya; Nakashima, Masaya; Suzuki, Yoshiharu

    2016-01-01

    Ultraviolet (UV) radiation in sunlight can result in DNA damage and an inflammatory reaction of the skin commonly known as sunburn, which in turn can lead to cutaneous tissue disorders. However, little has been known about how UV-induced DNA damage mediates the release of inflammatory mediators from keratinocytes. Here, we show that UVB radiation intensity-dependently increases NLRP3 gene expression and IL-1β production in human keratinocytes. Knockdown of NLRP3 with siRNA suppresses UVB-induced production of not only IL-1β, but also other inflammatory mediators, including IL-1α, IL-6, TNF-α, and PGE_2. In addition, inhibition of DNA damage repair by knockdown of XPA, which is a major component of the nucleotide excision repair system, causes accumulation of cyclobutane pyrimidine dimer (CPD) and activation of NLRP3 inflammasome. In vivo immunofluorescence analysis confirmed that NLRP3 expression is also elevated in UV-irradiated human epidermis. Overall, our findings indicate that UVB-induced DNA damage initiates NLRP3 inflammasome activation, leading to release of various inflammatory mediators from human keratinocytes. - Highlights: • UVB radiation induces NLRP3 inflammasome activation in human keratinocytes. • NLRP3 knockdown suppresses production of UVB-induced inflammatory mediators. • UVB-induced DNA damage triggers NLRP3 inflammasome activation. • NLRP3 expression in human epidermis is elevated in response to UV radiation.

  17. Nuclear DNA damage-triggered NLRP3 inflammasome activation promotes UVB-induced inflammatory responses in human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Hasegawa, Tatsuya, E-mail: tatsuya.hasegawa@to.shiseido.co.jp; Nakashima, Masaya; Suzuki, Yoshiharu

    2016-08-26

    Ultraviolet (UV) radiation in sunlight can result in DNA damage and an inflammatory reaction of the skin commonly known as sunburn, which in turn can lead to cutaneous tissue disorders. However, little has been known about how UV-induced DNA damage mediates the release of inflammatory mediators from keratinocytes. Here, we show that UVB radiation intensity-dependently increases NLRP3 gene expression and IL-1β production in human keratinocytes. Knockdown of NLRP3 with siRNA suppresses UVB-induced production of not only IL-1β, but also other inflammatory mediators, including IL-1α, IL-6, TNF-α, and PGE{sub 2}. In addition, inhibition of DNA damage repair by knockdown of XPA, which is a major component of the nucleotide excision repair system, causes accumulation of cyclobutane pyrimidine dimer (CPD) and activation of NLRP3 inflammasome. In vivo immunofluorescence analysis confirmed that NLRP3 expression is also elevated in UV-irradiated human epidermis. Overall, our findings indicate that UVB-induced DNA damage initiates NLRP3 inflammasome activation, leading to release of various inflammatory mediators from human keratinocytes. - Highlights: • UVB radiation induces NLRP3 inflammasome activation in human keratinocytes. • NLRP3 knockdown suppresses production of UVB-induced inflammatory mediators. • UVB-induced DNA damage triggers NLRP3 inflammasome activation. • NLRP3 expression in human epidermis is elevated in response to UV radiation.

  18. Human atopic dermatitis skin-derived T cells can induce a reaction in mouse keratinocytes in vivo

    DEFF Research Database (Denmark)

    Martel, Britta C; Blom, Lars; Dyring-Andersen, Beatrice

    2015-01-01

    . In comparison, blood -derived in vitro differentiated Th2 cells only induced a weak response in a few of the mice. Thus, we conclude that human AD skin-derived T cells can induce a reaction in mouse skin through induction of a proliferative response in the mouse keratinocytes. This article is protected......In atopic dermatitis (AD), the inflammatory response between skin infiltrating T cells and keratinocytes is fundamental to the development of chronic lesional eczema. The aim of this study was to investigate whether skin-derived T cells from AD patients could induce an inflammatory response in mice...... through keratinocyte activation and consequently cause development of eczematous lesions. Punch biopsies of lesional skin from AD patients were used to establish skin-derived T cell cultures and which were transferred into NOD.Cg-Prkd(scid) Il2rg(tm1Sug) /JicTac (NOG) mice. We found that subcutaneous...

  19. Chromium III histidinate exposure modulates antioxidant gene expression in HaCaT human keratinocytes exposed to oxidative stress

    Science.gov (United States)

    While the toxicity of hexavalent chromium is well established, trivalent Cr (Cr(III)) is an essential nutrient involved in insulin and glucose homeostasis. Recently, antioxidant effects of chromium (III) histidinate (Cr(III)His) were reported in HaCaT human keratinocytes exposed to oxidative stress...

  20. Tumor necrosis factor related apoptosis inducing ligand triggers apoptosis in dividing but not in differentiating human epidermal keratinocytes

    NARCIS (Netherlands)

    Jansen, Bastiaan J. H.; van Ruissen, Fred; Cerneus, Stefanie; Cloin, Wendy; Bergers, Mieke; van Erp, Piet E. J.; Schalkwijk, Joost

    2003-01-01

    Using serial analysis of gene expression we have previously identified the expression of several pro-apoptotic and anti-apoptotic genes in cultured human primary epidermal keratinocytes, including tumor necrosis factor related apoptosis inducing ligand (TRAIL). TRAIL is a potent inducer of apoptosis

  1. Triterpenoid α-amyrin stimulates proliferation of human keratinocytes but does not protect them against UVB damage

    DEFF Research Database (Denmark)

    Biskup, Edyta; Gołębiowski, Marek; Gniadecki, Robert

    2012-01-01

    Rhaponticum carthamoides plants ("maral root") are widely used in Siberian folk medicine. The present study reports for the first time the presence of pentacyclic terpenoid, α-amyrin, in methanol extract from leaves of this plant. α-Amyrin induced proliferation of human keratinocytes (HaCaT) by a...

  2. Hepatocyte and keratinocyte growth factors and their receptors in human lung emphysema

    Directory of Open Access Journals (Sweden)

    Marchal Joëlle

    2005-10-01

    Full Text Available Abstract Background Hepatocyte and keratinocyte growth factors are key growth factors in the process of alveolar repair. We hypothesized that excessive alveolar destruction observed in lung emphysema involves impaired expression of hepatocyte and keratinocyte growth factors or their respective receptors, c-met and keratinocyte growth factor receptor. The aim of our study was to compare the expression of hepatocyte and keratinocyte growth factors and their receptors in lung samples from 3 groups of patients: emphysema; smokers without emphysema and non-smokers without emphysema. Methods Hepatocyte and keratinocyte growth factor proteins were analysed by immunoassay and western blot; mRNA expression was measured by real time quantitative polymerase chain reaction. Results Hepatocyte and keratinocyte growth factors, c-met and keratinocyte growth factor receptor mRNA levels were similar in emphysema and non-emphysema patients. Hepatocyte growth factor mRNA correlated negatively with FEV1 and the FEV1/FVC ratio both in emphysema patients and in smokers with or without emphysema. Hepatocyte and keratinocyte growth factor protein concentrations were similar in all patients' groups. Conclusion The expression of hepatocyte and keratinocyte growth factors and their receptors is preserved in patients with lung emphysema as compared to patients without emphysema. Hepatocyte growth factor mRNA correlates with the severity of airflow obstruction in smokers.

  3. Arsenic exposure disrupts epigenetic regulation of SIRT1 in human keratinocytes

    International Nuclear Information System (INIS)

    Herbert, Katharine J.; Holloway, Adele; Cook, Anthony L.; Chin, Suyin P.; Snow, Elizabeth T.

    2014-01-01

    Arsenic is an environmental toxin which increases skin cancer risk for exposed populations worldwide; however the underlying biomolecular mechanism for arsenic-induced carcinogenesis is complex and poorly defined. Recent investigations show that histone deacetylase and DNA methyltransferase activity is impaired, and epigenetic patterns of gene regulation are consistently altered in cancers associated with arsenic exposure. Expression of the histone deacetylase SIRT1 is altered in solid tumours and haematological malignancies; however its role in arsenic-induced pathology is unknown. In this study we investigated the effect of arsenic on epigenetic regulation of SIRT1 and its targeting microRNA, miR-34a in primary human keratinocytes. Acetylation of histone H4 at lysine 16 (H4K16) increased in keratinocytes exposed to 0.5 μM arsenite [As(III)]; and this was associated with chromatin remodelling at the miR-34a promoter. Moreover, although SIRT1 protein initially increased in these As(III)-exposed cells, after 24 days expression was not significantly different from untreated controls. Extended exposure to low-dose As(III) (0.5 μM; > 5 weeks) compromised the pattern of CpG methylation at SIRT1 and miR-34a gene promoters, and this was associated with altered expression for both genes. We have found that arsenic alters epigenetic regulation of SIRT1 expression via structural reorganisation of chromatin at the miR-34a gene promoter in the initial 24 h of exposure; and over time, through shifts in miR-34a and SIRT1 gene methylation. Taken together, this investigation demonstrates that arsenic produces cumulative disruptions to epigenetic regulation of miR-34a expression, and this is associated with impaired coordination of SIRT1 functional activity. - Highlights: • Submicromolar arsenic concentrations disrupt SIRT1 activity and expression in human keratinocytes. • Arsenic-induced chromatin remodelling at the miR-34a gene promoter is associated with hyperacetylation

  4. Cobalt Oxide Nanoparticles: Behavior towards Intact and Impaired Human Skin and Keratinocytes Toxicity

    Directory of Open Access Journals (Sweden)

    Marcella Mauro

    2015-07-01

    Full Text Available Skin absorption and toxicity on keratinocytes of cobalt oxide nanoparticles (Co3O4NPs have been investigated. Co3O4NPs are commonly used in industrial products and biomedicine. There is evidence that these nanoparticles can cause membrane damage and genotoxicity in vitro, but no data are available on their skin absorption and cytotoxicity on keratinocytes. Two independent 24 h in vitro experiments were performed using Franz diffusion cells, using intact (experiment 1 and needle-abraded human skin (experiment 2. Co3O4NPs at a concentration of 1000 mg/L in physiological solution were used as donor phase. Cobalt content was evaluated by Inductively Coupled–Mass Spectroscopy. Co permeation through the skin was demonstrated after 24 h only when damaged skin protocol was used (57 ± 38 ng·cm−2, while no significant differences were shown between blank cells (0.92 ± 0.03 ng cm−2 and those with intact skin (1.08 ± 0.20 ng·cm−2. To further investigate Co3O4NPs toxicity, human-derived HaCaT keratinocytes were exposed to Co3O4NPs and cytotoxicity evaluated by MTT, Alamarblue® and propidium iodide (PI uptake assays. The results indicate that a long exposure time (i.e., seven days was necessary to induce a concentration-dependent cell viability reduction (EC50 values: 1.3 × 10−4 M, 95% CL = 0.8–1.9 × 10−4 M, MTT essay; 3.7 × 10−5 M, 95% CI = 2.2–6.1 × 10−5 M, AlamarBlue® assay that seems to be associated to necrotic events (EC50 value: 1.3 × 10−4 M, 95% CL = 0.9–1.9 × 10−4 M, PI assay. This study demonstrated that Co3O4NPs can penetrate only damaged skin and is cytotoxic for HaCat cells after long term exposure.

  5. Arsenic exposure disrupts epigenetic regulation of SIRT1 in human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Herbert, Katharine J. [School of Health Sciences, University of Tasmania, Launceston, TAS 7250 (Australia); Holloway, Adele [Menzies Research Institute Tasmania, University of Tasmania, Hobart, TAS 7000 (Australia); Cook, Anthony L. [School of Health Sciences, University of Tasmania, Launceston, TAS 7250 (Australia); Chin, Suyin P. [Menzies Research Institute Tasmania, University of Tasmania, Hobart, TAS 7000 (Australia); Snow, Elizabeth T., E-mail: elizabeth.snow@utas.edu.au [School of Health Sciences, University of Tasmania, Launceston, TAS 7250 (Australia)

    2014-11-15

    Arsenic is an environmental toxin which increases skin cancer risk for exposed populations worldwide; however the underlying biomolecular mechanism for arsenic-induced carcinogenesis is complex and poorly defined. Recent investigations show that histone deacetylase and DNA methyltransferase activity is impaired, and epigenetic patterns of gene regulation are consistently altered in cancers associated with arsenic exposure. Expression of the histone deacetylase SIRT1 is altered in solid tumours and haematological malignancies; however its role in arsenic-induced pathology is unknown. In this study we investigated the effect of arsenic on epigenetic regulation of SIRT1 and its targeting microRNA, miR-34a in primary human keratinocytes. Acetylation of histone H4 at lysine 16 (H4K16) increased in keratinocytes exposed to 0.5 μM arsenite [As(III)]; and this was associated with chromatin remodelling at the miR-34a promoter. Moreover, although SIRT1 protein initially increased in these As(III)-exposed cells, after 24 days expression was not significantly different from untreated controls. Extended exposure to low-dose As(III) (0.5 μM; > 5 weeks) compromised the pattern of CpG methylation at SIRT1 and miR-34a gene promoters, and this was associated with altered expression for both genes. We have found that arsenic alters epigenetic regulation of SIRT1 expression via structural reorganisation of chromatin at the miR-34a gene promoter in the initial 24 h of exposure; and over time, through shifts in miR-34a and SIRT1 gene methylation. Taken together, this investigation demonstrates that arsenic produces cumulative disruptions to epigenetic regulation of miR-34a expression, and this is associated with impaired coordination of SIRT1 functional activity. - Highlights: • Submicromolar arsenic concentrations disrupt SIRT1 activity and expression in human keratinocytes. • Arsenic-induced chromatin remodelling at the miR-34a gene promoter is associated with hyperacetylation

  6. Maintenance of vascular endothelial cell-specific properties after immortalization with an amphotrophic replication-deficient retrovirus containing human papilloma virus 16 E6/E7 DNA

    NARCIS (Netherlands)

    Fontijn, R.; Hop, C.; Brinkman, H. J.; Slater, R.; Westerveld, A.; van Mourik, J. A.; Pannekoek, H.

    1995-01-01

    Primary human vascular endothelial cells were immortalized by the integration of a single DNA copy of an amphotrophic, replication-deficient retrovirus containing the E6/E7 genes of human papilloma virus. To date, the resulting cell lines, designated EC-RF7 and EC-RF24, have been cultured for more

  7. Human eccrine sweat gland cells turn into melanin-uptaking keratinocytes in dermo-epidermal skin substitutes.

    Science.gov (United States)

    Böttcher-Haberzeth, Sophie; Biedermann, Thomas; Pontiggia, Luca; Braziulis, Erik; Schiestl, Clemens; Hendriks, Bart; Eichhoff, Ossia M; Widmer, Daniel S; Meuli-Simmen, Claudia; Meuli, Martin; Reichmann, Ernst

    2013-02-01

    Recently, Biedermann et al. (2010) have demonstrated that human eccrine sweat gland cells can develop a multilayered epidermis. The question still remains whether these cells can fulfill exclusive and very specific functional properties of epidermal keratinocytes, such as the incorporation of melanin, a feature absent in sweat gland cells. We added human melanocytes to eccrine sweat gland cells to let them develop into an epidermal analog in vivo. The interaction between melanocytes and sweat gland-derived keratinocytes was investigated. The following results were gained: (1) macroscopically, a pigmentation of the substitutes was seen 2-3 weeks after transplantation; (2) we confirmed the development of a multilayered, stratified epidermis with melanocytes distributed evenly throughout the basal layer; (3) melanocytic dendrites projected to suprabasal layers; and (4) melanin was observed to be integrated into former eccrine sweat gland cells. These skin substitutes were similar or equal to skin substitutes cultured from human epidermal keratinocytes. The only differences observed were a delay in pigmentation and less melanin uptake. These data suggest that eccrine sweat gland cells can form a functional epidermal melanin unit, thereby providing striking evidence that they can assume one of the most characteristic keratinocyte properties.

  8. A comparative in vitro study of the viability of human keratinocytes grown on irradiated human amnion membrane and fibrin glue scaffolds

    International Nuclear Information System (INIS)

    Dorai, A.A.; Lim, C.K.; Azman, W.S.; Halim, A.S.

    2008-01-01

    Full text: The dried irradiated human amnion membrane has been used as a biological dressing for various clinical conditions. Being another biological membrane its potential as a scaffold to grow human keratinocytes is not known yet. To compare the growth patterns and cell viability of keratinocytes using fibrin glue and air dried amnion membrane as a scaffold. Keratinocytes were obtained from skin samples of six patients undergoing elective surgery. Fibrin glue (Tisseel, Baxter ) was diluted and used to coat the wells. Human dried amnion membrane was obtained and placed into the 24 well plates. Keratinocytes were seeded into the fibrin and amnion scaffold. Cell viability assay (MTT) was performed after 24, 48 and 72 hours. Finally the measurements were done by the Enzyme-Linked Immunosorbent Assay (ELISA) reader at 570 nm. Six patients consented for the study. The cells growing on the amnion scaffold showed a decreasing trend (20.67%, 17.94% and 16.78% respectively for 24, 48 and 72 hours). The cells growing on the fibrin scaffold showed a steady increase in number at 24, 48 and 72 hours (73.03%, 74.12% and 79.66%). The percentage of growth of normal human keratinocytes were significantly greater in the fibrin scaffold group (Mann - Whitney p = 0.002) for 24, 48 and 72 hours. The air dried irradiated human amnion membrane can be used as a scaffold to grow keratinocytes but however the growth pattern does not sustain with time. Fibrin glue supports the growth of human keratinocytes and shows an increasing pattern of growth with time. (Author)

  9. Assessment of radiation induced cytogenetic damage in human keratinocytes by comet assay

    International Nuclear Information System (INIS)

    Joseph, Praveen; Sanjeev Ganesh; Narayana, Y.; Puthali, Abhay; Bhat, N.N.

    2010-01-01

    In the present study the effect of gamma radiation on normal human keratinocytes (HaCaT) cells has been analyzed using alkaline comet assay and a comparative study over the sensitivity of different comet parameters such as tail length (TL), olive tail moment (OTM) and percentage tail DNA (TDNA) has also been made. Human keratinocytes (HaCaT) cells were grown in Dulbecco's modified essential medium (DMEM) (10% FCS) at 37 °C in a humidified atmosphere containing 5% CO 2 . Cultured cells were harvested with 0.025 % trypsin EDTA. The sample (2 X 10 cells/ml) was exposed to gamma radiation of different dose using a 60 Co gamma source at dose rate of 2 Gy min -1 and the dosimetry has been carried out using Fricke and FBX dosimeters. After irradiation, to quantify the DNA damage the comet assay (single cell gel electrophoresis) was carried out under alkaline conditions, by the methods outlined by Singh et al. The quantification of the DNA strand breaks in each cells were performed using CASP software. The DNA damage quantification can be accomplished by measuring those comet parameters which exhibit a linear dependence on the amount of DNA damage. In the present study, comet parameters such as OTM, TL and TDNA were recorded and the variation of these parameters and their correlation coefficients for different doses of gamma radiation is plotted. The OTM value is normalized with control value and control for TL and TDNA is adjusted to zero to avoid initial variations in different experiments

  10. Genetic effect of low dose rate radiation on human cells immortalized with the hTERT gene

    International Nuclear Information System (INIS)

    Nakamura, Hideaki; Fukami, Hiroko; Hayashi, Yuko; Kiyono, Tohru; Ishizaki, Kanji; Tachibana, Akira; Nakatsugawa, Shigekazu; Hamaguchi, Michinari

    2003-01-01

    We established immortal human cells by introducing the hTERT gene into skin fibroblast cells obtained from normal (SuSa) and ataxia telangiectasia (AT: AT1OS) individuals of Japanese origin. These immortalized cells showed the same characteristics as the original cells except expanded life span. We irradiated SuSa/T-n and AT1OS/T-n cells with low-dose-rate (LDR; 0.3 mGy/min) irradiation at confluent state in low-serum medium. Then, survival rate and micronucleus frequency of each cell line were analyzed. In SuSa/T-n cells, frequency of HPRT mutation induction was also determined by 6TG selection. In SuSa/T-n cells, survival rate and micronucleus frequency showed higher resistance after irradiation with LDR than high-dose-rate (HDR; 2 Gy/min) irradiation. In contrast, no significant difference was observed in survival and micronucleus induction in AT1OS/T-n cells between HDR and LDR irradiation, suggesting that AT1OS/T-n cells may have some defect in DNA repair activity. In SuSa/T-n cells, the frequency of HPRT mutation after LDR irradiation decreased to approximately one eighth that after HDR irradiation. (author)

  11. Conditionally immortalized human pancreatic stellate cell lines demonstrate enhanced proliferation and migration in response to IGF-I

    Energy Technology Data Exchange (ETDEWEB)

    Rosendahl, Ann H., E-mail: ann.rosendahl@med.lu.se [Lund University, Department of Clinical Sciences Lund, Division of Surgery, Lund (Sweden); Lund University and Skåne University Hospital, Department of Clinical Sciences Lund, Division of Oncology and Pathology, Lund (Sweden); Gundewar, Chinmay; Said Hilmersson, Katarzyna [Lund University, Department of Clinical Sciences Lund, Division of Surgery, Lund (Sweden); Ni, Lan; Saleem, Moin A. [University of Bristol, School of Clinical Sciences, Children' s Renal Unit and Academic Renal Unit, Bristol (United Kingdom); Andersson, Roland [Lund University, Department of Clinical Sciences Lund, Division of Surgery, Lund (Sweden)

    2015-01-15

    Pancreatic stellate cells (PSCs) play a key role in the dense desmoplastic stroma associated with pancreatic ductal adenocarcinoma. Studies on human PSCs have been minimal due to difficulty in maintaining primary PSC in culture. We have generated the first conditionally immortalized human non-tumor (NPSC) and tumor-derived (TPSC) pancreatic stellate cells via transformation with the temperature-sensitive SV40 large T antigen and human telomerase (hTERT). These cells proliferate at 33°C. After transfer to 37°C, the SV40LT is switched off and the cells regain their primary PSC phenotype and growth characteristics. NPSC contained cytoplasmic vitamin A-storing lipid droplets, while both NPSC and TPSC expressed the characteristic markers αSMA, vimentin, desmin and GFAP. Proteome array analysis revealed that of the 55 evaluated proteins, 27 (49%) were upregulated ≥3-fold in TPSC compared to NPSC, including uPA, pentraxin-3, endoglin and endothelin-1. Two insulin-like growth factor binding proteins (IGFBPs) were inversely expressed. Although discordant IGFBP-2 and IGFBP-3 levels, IGF-I was found to stimulate proliferation of both NPSC and TPSC. Both basal and IGF-I stimulated motility was significantly enhanced in TPSC compared to NPSC. In conclusion, these cells provide a unique resource that will facilitate further study of the active stroma compartment associated with pancreatic cancer. - Highlights: • Generation of human conditionally immortalized human pancreatic stellate cell lines. • Temperature-sensitive SV40LT allows switch to primary PSC phenotype characteristics. • Proteome profiling revealed distinct expression patterns between TPSC and NPSC. • Enhanced IGF-I-stimulated proliferation and motility by TPSC compared to NPSC.

  12. Efficient immortalization of primary human cells by p16INK4a-specific short hairpin RNA or Bmi-1, combined with introduction of hTERT.

    Science.gov (United States)

    Haga, Kei; Ohno, Shin-ichi; Yugawa, Takashi; Narisawa-Saito, Mako; Fujita, Masatoshi; Sakamoto, Michiie; Galloway, Denise A; Kiyono, Tohru

    2007-02-01

    Activation of telomerase is sufficient for immortalization of some types of human cells but additional factors may also be essential. It has been proposed that stress imposed by inadequate culture conditions induces senescence due to accumulation of p16(INK4a). Here, we present evidence that many human cell types undergo senescence by activation of the p16(INK4a)/Rb pathway, and that introduction of Bmi-1 can inhibit p16(INK4a) expression and extend the life span of human epithelial cells derived from skin, mammary gland and lung. Introduction of p16(INK4a)-specific short hairpin RNA, as well as Bmi-1, suppressed p16(INK4a) expression in human mammary epithelial cells without promoter methylation, and extended their life span. Subsequent introduction of hTERT, the telomerase catalytic subunit, into cells with low p16(INK4a) levels resulted in efficient immortalization of three cell types without crisis or growth arrest. The majority of the human mammary epithelial cells thus immortalized showed almost normal ploidy as judged by G-banding and spectral karyotyping analysis. Our data suggest that inhibition of p16(INK4a) and introduction of hTERT can immortalize many human cell types with little chromosomal instability.

  13. Cultivation of human dermal fibroblasts and epidermal keratinocytes on keratin-coated silica bead substrates.

    Science.gov (United States)

    Tan, Bee Yi; Nguyen, Luong T H; Kim, Hyo-Sop; Kim, Jae-Ho; Ng, Kee Woei

    2017-10-01

    Human hair keratin is promising as a bioactive material platform for various biomedical applications. To explore its versatility further, human hair keratin was coated onto monolayers of silica beads to produce film-like substrates. This combination was hypothesized to provide a synergistic effect in improving the biochemical properties of the resultant composite. Atomic force microscopy analysis showed uniform coatings of keratin on the silica beads with a slight increase in the resulting surface roughness. Keratin-coated silica beads had higher surface energy and relatively lower negative charge than those of bare silica beads. To investigate cell response, human dermal fibroblasts (HDFs), and human epidermal keratinocytes (HEKs) were cultured on the substrates over 4 days. Results showed that keratin coatings significantly enhanced the metabolic activity of HDFs and encouraged cell spreading but did not exert any significant effects on HEKs. HDF expression of collagen I was significantly more intense on the keratin-coated compared to the bare silica substrates. Furthermore, HDF secretion of various cytokines suggested that keratin coatings triggered active cell responses related to wound healing. Collectively, our study demonstrated that human hair keratin-coated silica bead monolayers have the potential to modulate HDF behavior in culture and may be exploited further. © 2017 Wiley Periodicals, Inc. J Biomed Mater Res Part A: 105A: 2789-2798, 2017. © 2017 Wiley Periodicals, Inc.

  14. Accumulation and altered localization of telomere-associated protein TRF2 in immortally transformed and tumor-derived human breast cells

    Energy Technology Data Exchange (ETDEWEB)

    Nijjar, Tarlochan; Bassett, Ekaterina; Garbe, James; Takenaka, Yasuhiro; Stampfer, Martha R.; Gilley, David; Yaswen, Paul

    2004-12-23

    We have used cultured human mammary epithelial cells (HMEC) and breast tumor-derived lines to gain information on defects that occur during breast cancer progression. HMEC immortalized by a variety of agents (the chemical carcinogen benzo(a)pyrene, oncogenes c-myc and ZNF217, and/or dominant negative p53 genetic suppressor element GSE22) displayed marked up regulation (10-15 fold) of the telomere binding protein, TRF2. Up-regulation of TRF2 protein was apparently due to differences in post-transcriptional regulation, as mRNA levels remained comparable in finite life span and immortal HMEC. TRF2 protein was not up-regulated by the oncogenic agents alone in the absence of immortalization, nor by expression of exogenously introduced hTERT genes. We found TRF2 levels to be at least 2-fold higher than in control cells in 11/15 breast tumor cell lines, suggesting that elevated TRF2 levels are a frequent occurrence during the transformation of breast tumor cells in vivo. The dispersed distribution of TRF2 throughout the nuclei in some immortalized and tumor-derived cells indicated that not all the TRF2 was associated with telomeres in these cells. The process responsible for accumulation of TRF2 in immortalized HMEC and breast tumor-derived cell lines may promote tumorigenesis by contributing to the cells ability to maintain an indefinite life span.

  15. Biological interactions of quantum dot nanoparticles in skin and in human epidermal keratinocytes

    International Nuclear Information System (INIS)

    Zhang, Leshuai W.; Yu, William W.; Colvin, Vicki L.; Monteiro-Riviere, Nancy A.

    2008-01-01

    Quantum dots nanoparticles have novel optical properties for biomedical applications and electronics, but little is known about their skin permeability and interaction with cells. QD621 are nail-shaped nanoparticles that contain a cadmium/selenide core with a cadmium sulfide shell coated with polyethylene glycol (PEG) and are soluble in water. QD were topically applied to porcine skin flow-through diffusion cells to assess penetration at 1 μM, 2 μM and 10 μM for 24 h. QD were also studied in human epidermal keratinocytes (HEK) to determine cellular uptake, cytotoxicity and inflammatory potential. Confocal microscopy depicted the penetration of QD621 through the uppermost stratum corneum (SC) layers of the epidermis and fluorescence was found primarily in the SC and near hair follicles. QD were found in the intercellular lipid bilayers of the SC by transmission electron microscopy (TEM). Inductively coupled plasma-optical emission spectroscopy (ICP-OES) analysis for cadmium (Cd) and fluorescence for QD both did not detect Cd nor fluorescence signal in the perfusate at any time point or concentration. In HEK, viability decreased significantly (p < 0.05) from 1.25 nM to 10nM after 24 h and 48 h. There was a significant increase in IL-6 at 1.25 nM to 10 nM, while IL-8 increased from 2.5nM to 10nM after 24 h and 48 h. TEM of HEK treated with 10 nM of QD621 at 24 h depicted QD in cytoplasmic vacuoles and at the periphery of the cell membranes. These results indicate that porcine skin penetration of QD621 is minimal and limited primarily to the outer SC layers, yet if the skin were damaged allowing direct QD exposure to skin or keratinocytes, an inflammatory response could be initiated

  16. Inhibition of inflammatory and proliferative responses of human keratinocytes exposed to the sesquiterpene lactones dehydrocostuslactone and costunolide.

    Directory of Open Access Journals (Sweden)

    Claudia Scarponi

    Full Text Available The imbalance of the intracellular redox state and, in particular, of the glutathione (GSH/GSH disulfide couple homeostasis, is involved in the pathogenesis of a number of diseases. In many skin diseases, including psoriasis, oxidative stress plays an important role, as demonstrated by the observation that treatments leading to increase of the local levels of oxidant species ameliorate the disease. Recently, dehydrocostuslactone (DCE and costunolide (CS, two terpenes naturally occurring in many plants, have been found to exert various anti-inflammatory and pro-apoptotic effects on different human cell types. These compounds decrease the level of the intracellular GSH by direct interaction with it, and, therefore, can alter cellular redox state. DCE and CS can trigger S-glutathionylation of various substrates, including the transcription factor STAT3 and JAK1/2 proteins. In the present study, we investigated on the potential role of DCE and CS in regulating inflammatory and proliferative responses of human keratinocytes to cytokines. We demonstrated that DCE and CS decreased intracellular GSH levels in human keratinocytes, as well as inhibited STAT3 and STAT1 phosphorylation and activation triggered by IL-22 or IFN-γ, respectively. Consequently, DCE and CS decreased the IL-22- and IFN-γ-induced expression of inflammatory and regulatory genes in keratinocytes, including CCL2, CXCL10, ICAM-1 and SOCS3. DCE and CS also inhibited proliferation and cell-cycle progression-related gene expression, as well as they promoted cell cycle arrest and apoptosis. In parallel, DCE and CS activated the anti-inflammatory EGFR and ERK1/2 molecules in keratinocytes, and, thus, wound healing in an in vitro injury model. In light of our findings, we can hypothesize that the employment of DCE and CS in psoriasis could efficiently counteract the pro-inflammatory effects of IFN-γ and IL-22 on keratinocytes, revert the apoptosis-resistant phenotype, as well as inhibit

  17. Comparative study of human-induced pluripotent stem cells derived from bone marrow cells, hair keratinocytes, and skin fibroblasts.

    Science.gov (United States)

    Streckfuss-Bömeke, Katrin; Wolf, Frieder; Azizian, Azadeh; Stauske, Michael; Tiburcy, Malte; Wagner, Stefan; Hübscher, Daniela; Dressel, Ralf; Chen, Simin; Jende, Jörg; Wulf, Gerald; Lorenz, Verena; Schön, Michael P; Maier, Lars S; Zimmermann, Wolfram H; Hasenfuss, Gerd; Guan, Kaomei

    2013-09-01

    Induced pluripotent stem cells (iPSCs) provide a unique opportunity for the generation of patient-specific cells for use in disease modelling, drug screening, and regenerative medicine. The aim of this study was to compare human-induced pluripotent stem cells (hiPSCs) derived from different somatic cell sources regarding their generation efficiency and cardiac differentiation potential, and functionalities of cardiomyocytes. We generated hiPSCs from hair keratinocytes, bone marrow mesenchymal stem cells (MSCs), and skin fibroblasts by using two different virus systems. We show that MSCs and fibroblasts are more easily reprogrammed than keratinocytes. This corresponds to higher methylation levels of minimal promoter regions of the OCT4 and NANOG genes in keratinocytes than in MSCs and fibroblasts. The success rate and reprogramming efficiency was significantly higher by using the STEMCCA system than the OSNL system. All analysed hiPSCs are pluripotent and show phenotypical characteristics similar to human embryonic stem cells. We studied the cardiac differentiation efficiency of generated hiPSC lines (n = 24) and found that MSC-derived hiPSCs exhibited a significantly higher efficiency to spontaneously differentiate into beating cardiomyocytes when compared with keratinocyte-, and fibroblast-derived hiPSCs. There was no significant difference in the functionalities of the cardiomyocytes derived from hiPSCs with different origins, showing the presence of pacemaker-, atrial-, ventricular- and Purkinje-like cardiomyocytes, and exhibiting rhythmic Ca2+ transients and Ca2+ sparks in hiPSC-derived cardiomyocytes. Furthermore, spontaneously and synchronously beating and force-developing engineered heart tissues were generated. Human-induced pluripotent stem cells can be reprogrammed from all three somatic cell types, but with different efficiency. All analysed iPSCs can differentiate into cardiomyocytes, and the functionalities of cardiomyocytes derived from different cell

  18. The Effect of Calcipotriol on the Expression of Human β Defensin-2 and LL-37 in Cultured Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Beom Joon Kim

    2009-01-01

    Full Text Available Background. Vitamin D has been reported to regulate innate immunity by controlling the expression of antimicrobial peptides (AMPs. Objective. We investigated the effect of calcipotriol on the expression of AMPs in human cultured keratinocytes. Methods. Keratinocytes were treated with lipopolysaccharide (LPS, TNF-α, Calcipotriol and irradiated with UVB, cultured, and harvested. To assess the expression of human beta defensin-2 and LL-37 in the control group, not exposed to any stimulants, the experimental group was treated with LPS, TNF-α, or UVB, and another group was treated again with calcipotriol; reverse transcriptase-polymerase chain reaction, Western blotting, and immunohistochemical staining were performed. Results. In the experimental group treated with LPS, UVB irradiation, and TNF-α, the expression of β-defensin and LL-37 was increased more than in the control group and then decreased in the experimental group treated with calcipotriol. Conclusions. Calcipotriol suppressed HBD-2 and LL-37, which were stimulated by UVB, LPS, and TNF-α.

  19. Sensitive Tumorigenic Potential Evaluation of Adult Human Multipotent Neural Cells Immortalized by hTERT Gene Transduction.

    Directory of Open Access Journals (Sweden)

    Kee Hang Lee

    Full Text Available Stem cells and therapeutic genes are emerging as a new therapeutic approach to treat various neurodegenerative diseases with few effective treatment options. However, potential formation of tumors by stem cells has hampered their clinical application. Moreover, adequate preclinical platforms to precisely test tumorigenic potential of stem cells are controversial. In this study, we compared the sensitivity of various animal models for in vivo stem cell tumorigenicity testing to identify the most sensitive platform. Then, tumorigenic potential of adult human multipotent neural cells (ahMNCs immortalized by the human telomerase reverse transcriptase (hTERT gene was examined as a stem cell model with therapeutic genes. When human glioblastoma (GBM cells were injected into adult (4-6-week-old Balb/c-nu, adult NOD/SCID, adult NOG, or neonate (1-2-week-old NOG mice, the neonate NOG mice showed significantly faster tumorigenesis than that of the other groups regardless of intracranial or subcutaneous injection route. Two kinds of ahMNCs (682TL and 779TL were primary cultured from surgical samples of patients with temporal lobe epilepsy. Although the ahMNCs were immortalized by lentiviral hTERT gene delivery (hTERT-682TL and hTERT-779TL, they did not form any detectable masses, even in the most sensitive neonate NOG mouse platform. Moreover, the hTERT-ahMNCs had no gross chromosomal abnormalities on a karyotype analysis. Taken together, our data suggest that neonate NOG mice could be a sensitive animal platform to test tumorigenic potential of stem cell therapeutics and that ahMNCs could be a genetically stable stem cell source with little tumorigenic activity to develop regenerative treatments for neurodegenerative diseases.

  20. cDNA microarray analysis of human keratinocytes cells of patients submitted to chemoradiotherapy and oral photobiomodulation therapy: pilot study.

    Science.gov (United States)

    Antunes, Heliton S; Wajnberg, Gabriel; Pinho, Marcos B; Jorge, Natasha Andressa Nogueira; de Moraes, Joyce Luana Melo; Stefanoff, Claudio Gustavo; Herchenhorn, Daniel; Araújo, Carlos M M; Viégas, Celia Maria Pais; Rampini, Mariana P; Dias, Fernando L; de Araujo-Souza, Patricia Savio; Passetti, Fabio; Ferreira, Carlos G

    2018-01-01

    Oral mucositis is an acute toxicity that occurs in patients submitted to chemoradiotherapy to treat head and neck squamous cell carcinoma. In this study, we evaluated differences in gene expression in the keratinocytes of the oral mucosa of patients treated with photobiomodulation therapy and tried to associate the molecular mechanisms with clinical findings. From June 2009 to December 2010, 27 patients were included in a randomized double-blind pilot study. Buccal smears from 13 patients were obtained at days 1 and 10 of chemoradiotherapy, and overall gene expression of samples from both dates were analyzed by complementary DNA (cDNA) microarray. In addition, samples from other 14 patients were also collected at D1 and D10 of chemoradiotherapy for subsequent validation of cDNA microarray findings by qPCR. The expression array analysis identified 105 upregulated and 60 downregulated genes in our post-treatment samples when compared with controls. Among the upregulated genes with the highest fold change, it was interesting to observe the presence of genes related to keratinocyte differentiation. Among downregulated genes were observed genes related to cytotoxicity and immune response. The results indicate that genes known to be induced during differentiation of human epidermal keratinocytes were upregulated while genes associated with cytotoxicity and immune response were downregulated in the laser group. These results support previous clinical findings indicating that the lower incidence of oral mucositis associated with photobiomodulation therapy might be correlated to the activation of genes involved in keratinocyte differentiation.

  1. Effect of in vitro and in vivo UV irradiation on the production of ETAF activity by human and murine keratinocytes

    International Nuclear Information System (INIS)

    Ansel, J.C.; Luger, T.A.; Green, I.

    1983-01-01

    Cultured epidermal cells and keratinocytes produce a potent hormone-like factor called epidermal cell-derived thymocyte-activating factor (ETAF). ETAF appears to be similar if not identical to a monocyte-derived lymphokine, known as interleukin 1 (IL-1). These two cytokines are able to amplify a diverse number of proliferative and inflammatory processes. Several recent investigations have suggested that UV-induced immunosuppression may be due in part to the inhibition of IL-1/ETAF production by monocytes and keratinocytes, respectively. We therefore decided to directly study the effects of various doses of in vitro and in vivo UV radiation (UVR) on the production of ETAF by normal murine epidermal cells and a murine (Pam 212) and a human (SCC) keratinocyte cell line. Our results surprisingly demonstrated an increase in both the extracellular and the intracellular ETAF activity of the murine epidermal, Pam 212, and SCC after sublethal amounts of in vitro UVR. Likewise, increased ETAF activity of murine epidermal cells was detected after sublethal doses of in vivo UVR. The UV-induced ETAF activity was cycloheximide-sensitive, suggesting that de novo synthesis of ETAF rather than cell membrane leakage was responsible for the increased ETAF activity. The fact that UV irradiation can increase ETAF activity by keratinocytes could have important local and systemic consequences for the host and may provide an efficient, contaminant-free method for generating ETAF activity for further biochemical and immunologic studies

  2. Expression profile of senescence-associated beta-galactosidase and activation of telomerase in human ovarian surface epithelial cells undergoing immortalization.

    Science.gov (United States)

    Litaker, J R; Pan, J; Cheung, Y; Zhang, D K; Liu, Y; Wong, S C; Wan, T S; Tsao, S W

    1998-11-01

    Senescence is a specific physiological stage of cells characterized by long population doubling time. It accounts for the inability of normal somatic cells to undergo indefinite cell division. As the number of population doublings increase, cell cycle regulatory mechanisms come into play and signal cells to exit the cell cycle and become senescent. Senescence has been implicated in the aging process and may function as a tumor suppressor mechanism in human cells. The ability to measure the degree of cellular senescence is important in understanding the biological processes regulating cell aging and immortalization. Senescent cells exhibit an enzyme termed senescence-associated histochemical staining. Cells immortalized by viral oncogenes often enter a stage of crisis at the early phase of immortalization. The cells at crisis have a long population doubling time. Cells at the crisis stage resemble senescent cells and the expression of SA- beta-Gal may be used to monitor the process of immortalization. In this study the expression profile of SA-beta-Gal was examined in human ovarian surface epithelial cells (HOSE 6-3) undergoing immortalization by the human papilloma viral oncogene E6 and E7 (HPV E6 and E7). Our results showed a low percentage (12.0%) of HOSE 6-3 cells expressing SA-beta-Gal activity at the pre-crisis stage. The percentage of HOSE 6-3 cells expressing SA-beta-Gal activity was highest (39.2%) at the crisis stage. When HOSE 6-3 cells achieved immortalized status there was a sharp decrease in cells (1. 3%) expressing SA-beta-Gal activity. In addition, an inverse relationship between the expression of SA-beta-Gal activity and telomerase activity was noted in cells undergoing immortalization. The results confirm that the SA-beta-Gal enzyme is a good marker for monitoring the population of cells undergoing senescence at different stages of immortalization and that telomerase activation is a characteristic feature of post-crisis cells.

  3. Gene expression signatures affected by ethanol and/or nicotine in normal human normal oral keratinocytes (NHOKs

    Directory of Open Access Journals (Sweden)

    Jeffrey J. Kim

    2014-12-01

    Full Text Available It has been reported that nicotine/alcohol alters epigenetic control and leads to abrogated DNA methylation and histone modifications, which could subsequently perturb transcriptional regulation critically important in cellular transformation. The aim of this study is to determine the molecular mechanisms of nicotine/alcohol-induced epigenetic alterations and their mechanistic roles in transcriptional regulation in human adult stem cells. We hypothesized that nicotine/alcohol induces deregulation of epigenetic machinery and leads to epigenetic alterations, which subsequently affect transcriptional regulation in oral epithelial stem cells. As an initiating step we have profiled transcriptomic alterations induced by the combinatory administration of EtOH and nicotine in primary normal human oral keratinocytes. Here we provide detailed experimental methods, analysis and information associated with our data deposited into Gene Expression Omnibus (GEO under GSE57634. Our data provide comprehensive transcriptomic map describing molecular changes induced by EtOH and nicotine on normal human oral keratinocytes.

  4. Sacha Inchi Oil (Plukenetia volubilis L.), effect on adherence of Staphylococus aureus to human skin explant and keratinocytes in vitro.

    Science.gov (United States)

    Gonzalez-Aspajo, German; Belkhelfa, Haouaria; Haddioui-Hbabi, Laïla; Bourdy, Geneviève; Deharo, Eric

    2015-08-02

    Plukenetia volubilis L. (Euphorbiaceae) is a domesticated vine distributed from the high-altitude Andean rain forest to the lowlands of the Peruvian Amazon. Oil from the cold-pressed seeds, sold under the commercial name of Sacha Inchi Oil (SIO) is actually much in favour because it contains a high percentage of omega 3 and omega 6, and is hence used as a dietary supplement. SIO is also used traditionally for skin care, in order to maintain skin softness, and for the treatment of wounds, insect bites and skin infections, in a tropical context where the skin is frequently damaged. This study was designed in order to verify whether the traditional use of SIO for skin care would have any impact on Staphylococcus aureus growth and skin adherence, as S. aureus is involved in many skin pathologies (impetigo, folliculitis, furuncles and subcutaneous abscesses) being one if the main pathogens that can be found on the skin. Therefore, our objective was to assess SIO bactericidal activity and interference with adherence to human skin explants and the keratinocyte cell line. Cytotoxicity on that cells was also determined. The activity of SIO was compared to coconut oil (CocO), which is widely used for skin care but has different unsaturated fatty acids contents. Laboratory testing with certified oil, determined antibacterial activity against radio labelled S. aureus. Cytotoxic effects were measured with XTT on keratinocyte cells and with neutral red on human skin explants; phenol was used as cytotoxic control. Adherence assays were carried out by mixing H3-labelled S. aureus bacteria with keratinocyte cells and human skin explants, incubated with oils 2h before (to determine the inhibition of adherence, assimilated to a preventive effect) or 2h after the contact of the biological material with S. aureus (to assess the detachment of the bacteria, assimilated to a curative effect). Residual radioactivity measured after washings made it possible to determine the adherence

  5. The Antimicrobial Peptide Human Beta-Defensin-3 Is Induced by Platelet-Released Growth Factors in Primary Keratinocytes

    Directory of Open Access Journals (Sweden)

    Andreas Bayer

    2017-01-01

    Full Text Available Platelet-released growth factors (PRGF and its related clinically used formulations (e.g., Vivostat Platelet-Rich Fibrin (PRF® contain a variety of chemokines, cytokines, and growth factors and are therefore used to support healing of chronic, hard-to-heal, or infected wounds. Human beta-defensin-3 (hBD-3 is an antimicrobial peptide inducibly expressed in human keratinocytes especially upon wounding. The potent antimicrobial activity of hBD-3 together with its wound closure-promoting activities suggests that hBD-3 may play a crucial role in wound healing. Therefore, we analyzed the influence of PRGF on hBD-3 expression in human primary keratinocytes in vitro. In addition, we investigated the influence of Vivostat PRF on hBD-3 expression in artificially generated human skin wounds in vivo. PRGF treatment of primary keratinocytes induced a significant, concentration- and time-dependent increase in hBD-3 gene expression which was partially mediated by the epidermal growth factor receptor (EGFR. In line with these cell culture data, in vivo experiments revealed an enhanced hBD-3 expression in experimentally produced human wounds after the treatment with Vivostat PRF. Thus, the induction of hBD-3 may contribute to the beneficial effects of thrombocyte concentrate lysates in the treatment of chronic or infected wounds.

  6. The Antimicrobial Peptide Human Beta-Defensin-3 Is Induced by Platelet-Released Growth Factors in Primary Keratinocytes

    Science.gov (United States)

    Lammel, Justus; Tohidnezhad, Mersedeh; Lippross, Sebastian; Behrendt, Peter; Klüter, Tim; Pufe, Thomas; Cremer, Jochen; Jahr, Holger; Rademacher, Franziska; Gläser, Regine; Harder, Jürgen

    2017-01-01

    Platelet-released growth factors (PRGF) and its related clinically used formulations (e.g., Vivostat Platelet-Rich Fibrin (PRF®)) contain a variety of chemokines, cytokines, and growth factors and are therefore used to support healing of chronic, hard-to-heal, or infected wounds. Human beta-defensin-3 (hBD-3) is an antimicrobial peptide inducibly expressed in human keratinocytes especially upon wounding. The potent antimicrobial activity of hBD-3 together with its wound closure-promoting activities suggests that hBD-3 may play a crucial role in wound healing. Therefore, we analyzed the influence of PRGF on hBD-3 expression in human primary keratinocytes in vitro. In addition, we investigated the influence of Vivostat PRF on hBD-3 expression in artificially generated human skin wounds in vivo. PRGF treatment of primary keratinocytes induced a significant, concentration- and time-dependent increase in hBD-3 gene expression which was partially mediated by the epidermal growth factor receptor (EGFR). In line with these cell culture data, in vivo experiments revealed an enhanced hBD-3 expression in experimentally produced human wounds after the treatment with Vivostat PRF. Thus, the induction of hBD-3 may contribute to the beneficial effects of thrombocyte concentrate lysates in the treatment of chronic or infected wounds. PMID:28811680

  7. Insights into the impact of silver nanoparticles on human keratinocytes metabolism through NMR metabolomics.

    Science.gov (United States)

    Carrola, Joana; Bastos, Verónica; Ferreira de Oliveira, José Miguel P; Oliveira, Helena; Santos, Conceição; Gil, Ana M; Duarte, Iola F

    2016-01-01

    Due to their antimicrobial properties, silver nanoparticles (AgNPs) are increasingly incorporated into consumer goods and medical products. Their potential toxicity to human cells is however a major concern, and there is a need for improved understanding of their effects on cell metabolism and function. Here, Nuclear Magnetic Resonance (NMR) metabolomics was used to investigate the metabolic profile of human epidermis keratinocytes (HaCaT cell line) exposed for 48 h to 30 nm citrate-stabilized spherical AgNPs (10 and 40 μg/mL). Intracellular aqueous extracts, organic extracts and extracellular culture medium were analysed to provide an integrated view of the cellular metabolic response. The specific metabolite variations, highlighted through multivariate analysis and confirmed by spectral integration, suggested that HaCaT cells exposed to AgNPs displayed upregulated glutathione-based antioxidant protection, increased glutaminolysis, downregulated tricarboxylic acid (TCA) cycle activity, energy depletion and cell membrane modification. Importantly, most metabolic changes were apparent in cells exposed to a concentration of AgNPs which did not affect cell viability at significant levels, thus underlying the sensitivity of NMR metabolomics to detect early biochemical events, even in the absence of a clear cytotoxic response. It can be concluded that NMR metabolomics is an important new tool in the field of in vitro nanotoxicology. Copyright © 2015 Elsevier Inc. All rights reserved.

  8. Cellular interactions of a lipid-based nanocarrier model with human keratinocytes: Unravelling transport mechanisms.

    Science.gov (United States)

    Silva, Elisabete; Barreiros, Luísa; Segundo, Marcela A; Costa Lima, Sofia A; Reis, Salette

    2017-04-15

    Knowledge of delivery system transport through epidermal cell monolayer is vital to improve skin permeation and bioavailability. Recently, nanostructured lipid carriers (NLCs) have gained great attention for transdermal delivery due to their biocompatibility, high drug payload, occlusive properties and skin hydration effect. However, the nanocarriers transport related mechanisms in epidermal epithelial cells are not yet understood. In this research, the internalization and transport pathways of the NLCs across the epidermal epithelial cell monolayer (HaCaT cells) were investigated. The 250nm sized witepsol/miglyol NLCs, prepared by hot homogenization had reduced cytotoxicity and no effect on the integrity of cell membrane in human HaCaT keratinocytes. The internalization was time-, concentration- and energy-dependent, and the uptake of NLCs was a vesicle-mediated process by macropinocytosis and clathrin-mediated pathways. 3% of NLCs were found at the apical membrane side of the HaCaT monolayer through exocytosis mechanism. Additionally, the endoplasmic reticulum, Golgi apparatus and microtubules played crucial roles in the transport of NLCs out of HaCaT cells. NLCs were transported intact across the human keratinocytes monolayer, without disturbing the tight junction's structure. From the transcytosis data only approximately 12% of the internalized NLCs were passed from the apical to the basolateral side. The transcytosis of NLCs throughout the HaCaT cell monolayer towards the basolateral membrane side requires the involvement of the endoplasmic reticulum, Golgi apparatus and microtubules. Our findings may contribute to a systematic understanding of NLCs transport across epidermal epithelial cell monolayers and their optimization for clinical transdermal application. Transdermal drug delivery is a challenging and growing area of clinical application. Lipid nanoparticles such as nanostructured lipid carriers (NLCs) have gained wide interest for transdermal drug

  9. Isolation, identification, and pathological effects of beach sand bacterial extract on human skin keratinocytes in vitro

    Directory of Open Access Journals (Sweden)

    Fazli Subhan

    2018-01-01

    Full Text Available Background Beaches are recreational spots for people. However, beach sand contains harmful microbes that affect human health, and there are no established methods for either sampling and identifying beach-borne pathogens or managing the quality of beach sand. Method This study was conducted with the aim of improving human safety at beaches and augmenting the quality of the beach experience. Beach sand was used as a resource to isolate bacteria due to its distinctive features and the biodiversity of the beach sand biota. A selected bacterial isolate termed FSRS was identified as Pseudomonas stutzeri using 16S rRNA sequencing and phylogenetic analysis, and the sequence was deposited in the NCBI GenBank database under the accession number MF599548. The isolated P. stutzeri bacterium was cultured in Luria–Bertani growth medium, and a crude extract was prepared using ethyl acetate to examine the potential pathogenic effect of P. stutzeri on human skin. A human skin keratinocyte cell line (HaCaT was used to assess cell adhesion, cell viability, and cell proliferation using a morphological analysis and a WST-1 assay. Result The crude P. stutzeri extract inhibited cell adhesion and decreased cell viability in HaCaT cells. We concluded that the crude extract of P. stutzeri FSRS had a strong pathological effect on human skin cells. Discussion Beach visitors frequently get skin infections, but the exact cause of the infections is yet to be determined. The beach sand bacterium P. stutzeri may, therefore, be responsible for some of the dermatological problems experienced by people visiting the beach.

  10. Influence of ion implantation on the adhesion and grow of human keratinocytes

    International Nuclear Information System (INIS)

    Walachova, K.; Svorcik, V.; Dvorakova, B.; Vogtova, D.

    1999-01-01

    Interaction of keratinocytes with polymer modified by ion implantation was studied with the possibility of cultivate these cells for regeneration of dermal cover, for example, heavy burned persons. The modification on polyethylene (PE) with 100 μm thickness was processed by implantation the Ar + ions with the energy 63 keV and Xe + ions with the energy 156 keV. Some characteristics of superficial modified layers and influence of ion implantation on the adhesion and proliferation of keratinocytes were studied

  11. No evidence for induction of key components of the Notch signaling pathway (Notch-1, Jagged-1) by treatment with UV-B, 1,25(OH)(2)D(3), and/or epigenetic drugs (TSA, 5-Aza) in human keratinocytes in vitro.

    Science.gov (United States)

    Reichrath, Sandra; Reichrath, Jörg

    2012-01-01

    Notch signaling is of high importance for growth and survival of various cell types. We now analyzed the protein expression of two key components of the Notch signaling pathway (Notch-1, Jagged-1) in spontaneously immortalized (HaCaT) and in malignant (SCL-1) human keratinocytes, using western analysis. We found that Notch-1 and its corresponding ligand Jagged-1 are expressed in both cell lines, with no marked change following UV-B treatment. Moreover, treatment of both cell lines before or after UV-B irradiation with 1,25-dihydroxyvitamin D(3), the biologically active form of vitamin D, and/or epigenetic modulating drugs (TSA; 5-Aza) did not result in a marked modulation of the protein expression of Notch-1 or Jagged-1. Under the experimental conditions of this study, treatment with 1,25(OH)(2)D(3) protected human keratinocytes in part against the antiproliferative effects of UV-B-radiation. In conclusion, our findings do not point at a differential expression of these two key components of Notch signaling in non-malignant as compared to malignant human keratinocytes, indicating that alterations in their expression are not of importance for the photocarcinogenesis of human squamous cell carcinomas. Moreover, our findings do not support the hypothesis that modulation of Notch signaling may be involved in the photoprotective effect of 1,25-dihydroxyvitamin D(3), that we and others reported previously. Additionally, we demonstrate that epigenetic modulating drugs (TSA, 5-Aza) do not markedly modulate the expression Notch-1 or Jagged-1 in UV-B-treated human keratinocytes in vitro.

  12. 20-Hydroxycholecalciferol, product of vitamin D3 hydroxylation by P450scc, decreases NF-kappaB activity by increasing IkappaB alpha levels in human keratinocytes.

    Directory of Open Access Journals (Sweden)

    Zorica Janjetovic

    Full Text Available The side chain of vitamin D3 is hydroxylated in a sequential manner by cytochrome P450scc (CYP11A1 to form 20-hydroxycholecalciferol, which can induce growth arrest and differentiation of both primary and immortalized epidermal keratinocytes. Since nuclear factor-kappaB (NF-kappaB plays a pivotal role in the regulation of cell proliferation, differentiation and apoptosis, we examined the capability of 20-hydroxycholecalciferol to modulate the activity of NF-kappaB, using 1,25-dihydroxycholecalciferol (calcitriol as a positive control. 20-hydroxycholecalciferol inhibits the activation of NFkappaB DNA binding activity as well as NF-kappaB-driven reporter gene activity in keratinocytes. Also, 20-hydroxycholecalciferol induced significant increases in the mRNA and protein levels of the NF-kappaB inhibitor protein, IkappaB alpha, in a time dependent manner, while no changes in total NF-kappaB-p65 mRNA or protein levels were observed. Another measure of NF-kappaB activity, p65 translocation from the cytoplasm into the nucleus was also inhibited in extracts of 20-hydroxycholecalciferol treated keratinocytes. Increased IkappaB alpha was concomitantly observed in cytosolic extracts of 20-hydroxycholecalciferol treated keratinocytes, as determined by immunoblotting and immunofluorescent staining. In keratinocytes lacking vitamin D receptor (VDR, 20-hydroxycholecalciferol did not affect IkappaB alpha mRNA levels, indicating that it requires VDR for its action on NF-kappaB activity. Comparison of the effects of calcitrol, hormonally active form of vitamin D3, with 20-hydrocholecalciferol show that both agents have a similar potency in inhibiting NF-kappaB. Since NF-kappaB is a major transcription factor for the induction of inflammatory mediators, our findings indicate that 20-hydroxycholecalciferol may be an effective therapeutic agent for inflammatory and hyperproliferative skin diseases.

  13. Tumor necrosis factor beta and ultraviolet radiation are potent regulators of human keratinocyte ICAM-1 expression

    International Nuclear Information System (INIS)

    Krutmann, J.; Koeck, A.S.; Schauer, E.; Parlow, F.; Moeller, A.K.; Kapp, A.; Foerster, E.S.; Schoepf, E.L.; Luger, T.A.

    1990-01-01

    Intercellular adhesion molecule-1 (ICAM-1) functions as a ligand of leukocyte function-associated antigen-1 (LFA-1), as well as a receptor for human picorna virus, and its regulation thus affects various immunologic and inflammatory reactions. The weak, constitutive ICAM-1 expression on human keratinocytes (KC) can be up-regulated by cytokines such as interferon-gamma (IFN gamma) and tumor necrosis factor alpha (TNF alpha). In order to further examine the regulation of KC ICAM-1 expression, normal human KC or epidermoid carcinoma cells (KB) were incubated with different cytokines and/or exposed to ultraviolet (UV) radiation. Subsequently, ICAM-1 expression was monitored cytofluorometrically using a monoclonal anti-ICAM-1 antibody. Stimulation of cells with recombinant human (rh) interleukin (IL) 1 alpha, rhIL-4, rhIL-5, rhIL-6, rh granulocyte/macrophage colony-stimulating factor (GM-CSF), rh interferon alpha (rhIFN alpha), and rh transforming growth factor beta (TGF beta) did not increase ICAM-1 surface expression. In contrast, rhTNF beta significantly up-regulated ICAM-1 expression in a time- and dose-dependent manner. Moreover, the combination of rhTNF beta with rhIFN gamma increased the percentage of ICAM-1-positive KC synergistically. This stimulatory effect of rhTNF beta was further confirmed by the demonstration that rhTNF beta was capable of markedly enhancing ICAM-1 mRNA expression in KC. Finally, exposure of KC in vitro to sublethal doses of UV radiation (0-100 J/m2) prior to cytokine (rhIFN tau, rhTNF alpha, rhTNF beta) stimulation inhibited ICAM-1 up-regulation in a dose-dependent fashion. These studies identify TNF beta and UV light as potent regulators of KC ICAM-1 expression, which may influence both attachment and detachment of leukocytes and possibly viruses to KC

  14. Immortalization of Human Fetal Hepatocyte by Ectopic Expression of Human Telomerase Reverse Transcriptase, Human Papilloma Virus (E7) and Simian Virus 40 Large T (SV40 T) Antigen Towards Bioartificial Liver Support.

    Science.gov (United States)

    Giri, Shibashish; Bader, Augustinus

    2014-09-01

    Generation of genetically stable and non-tumoric immortalization cell line from primary cells would be enormously useful for research and therapeutic purposes, but progress towards this goal has so far been limited. It is now universal acceptance that immortalization of human fetal hepatocytes based on recent advances of telomerase biology and oncogene, lead to unlimited population doubling could be the possible source for bioartificial liver device. Immortalization of human fetal hepatocytes cell line by ectopic expression of human telomerase reverse transcriptase (hTERT), human papilloma virus gene (E7) and simian virus 40 large T (SV40 T) antigens is main goal of present study. We used an inducible system containing human telomerase and E7, both of which are cloned into responder constructs controlled by doxycycline transactivator. We characterized the immortalized human fetal hepatocyte cells by analysis of green fluorescent cells (GFP) positive cells using flow cytometry (FACs) cell sorting and morphology, proliferative rate and antigen expression by immunohistochemical analysis. In addition to we analysized lactate formation, glucose consumption, albumin secretion and urea production of immortalized human fetal hepatocyte cells. After 25 attempts for transfection of adult primary hepatocytes by human telomerase and E7 to immortalize them, none of the transfection systems resulted in the production of a stable, proliferating cell line. Although the transfection efficiency was more than 70% on the first day, the vast majority of the transfected hepatocytes lost their signal within the first 5-7 days. The remaining transfected hepatocytes persisted for 2-4 weeks and divided one or two times without forming a clone. After 10 attempts of transfection human fetal hepatocytes using the same transfection system, we obtained one stable human fetal hepatocytes cell line which was able albumin secretion urea production and glucose consumption. We established a

  15. Protection against 2-chloroethyl ethyl sulfide (CEES) - induced cytotoxicity in human keratinocytes by an inducer of the glutathione detoxification pathway

    International Nuclear Information System (INIS)

    Abel, Erika L.; Bubel, Jennifer D.; Simper, Melissa S.; Powell, Leslie; McClellan, S. Alex; Andreeff, Michael; MacLeod, Michael C.; DiGiovanni, John

    2011-01-01

    Sulfur mustard (SM or mustard gas) was first used as a chemical warfare agent almost 100 years ago. Due to its toxic effects on the eyes, lungs, and skin, and the relative ease with which it may be synthesized, mustard gas remains a potential chemical threat to the present day. SM exposed skin develops fluid filled bullae resulting from potent cytotoxicity of cells lining the basement membrane of the epidermis. Currently, there are no antidotes for SM exposure; therefore, chemopreventive measures for first responders following an SM attack are needed. Glutathione (GSH) is known to have a protective effect against SM toxicity, and detoxification of SM is believed to occur, in part, via GSH conjugation. Therefore, we screened 6 potential chemopreventive agents for ability to induce GSH synthesis and protect cultured human keratinocytes against the SM analog, 2-chloroethyl ethyl sulfide (CEES). Using NCTC2544 human keratinocytes, we found that both sulforaphane and methyl-2-cyano-3,12-dioxooleana-1,9-dien-28-oate (CDDO-Me) stimulated nuclear localization of Nrf2 and induced expression of the GSH synthesis gene, GCLM. Additionally, we found that treatment with CDDO-Me elevated reduced GSH content of NCTC2544 cells and preserved their viability by ∼ 3-fold following exposure to CEES. Our data also suggested that CDDO-Me may act additively with 2,6-dithiopurine (DTP), a nucleophilic scavenging agent, to increase the viability of keratinocytes exposed to CEES. These results suggest that CDDO-Me is a promising chemopreventive agent for SM toxicity in the skin. - Highlights: → CDDO-Me treatment increased intracellular GSH in human keratinocytes. → CDDO-Me increased cell viability following exposure to the half-mustard, CEES. → The cytoprotective effect of CDDO-Me was likely due to scavenging with endogenous GSH.

  16. Radiation-induced genomic instability is associated with DNA methylation changes in cultured human keratinocytes

    International Nuclear Information System (INIS)

    Kaup, Sahana; Grandjean, Valerie; Mukherjee, Rajarshi; Kapoor, Aparna; Keyes, Edward; Seymour, Colin B.; Mothersill, Carmel E.; Schofield, Paul N.

    2006-01-01

    The mechanism by which radiation-induced genomic instability is initiated, propagated and effected is currently under intense scrutiny. We have investigated the potential role of altered genomic methylation patterns in the cellular response to irradiation and have found evidence for widespread dysregulation of CpG methylation persisting up to 20 population doublings post-irradiation. Similar effects are seen with cells treated with medium from irradiated cells (the 'bystander effect') rather than subjected to direct irradiation. Using an arbitrarily primed methylation sensitive PCR screening method we have demonstrated that irradiation causes reproducible alterations in the methylation profile of a human keratinocyte cell line, HPV-G, and have further characterised one of these sequences as being a member of a retrotransposon element derived sequence family on chromosome 7; MLT1A. Multiple changes were also detected in the screen, which indicate that although the response of cells is predominantly hypermethylation, specific hypomethylation occurs as well. Sequence specific changes are also reported in the methylation of the pericentromeric SAT2 satellite sequence. This is the first demonstration that irradiation results in the induction of heritable methylation changes in mammalian cells, and provides a link between the various non-radiological instigators of genomic instability, the perpetuation of the unstable state and several of its manifestations

  17. The effect of melanin on the bystander effect in human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Mosse, I. [Institute of Genetics and Cytology of the National Academy of Sciences, Academicheskaya Str. 27, Minsk (Belarus)]. E-mail: i.mosse@igc.bas-net.by; Marozik, P. [Institute of Genetics and Cytology of the National Academy of Sciences, Academicheskaya Str. 27, Minsk (Belarus); Radiation and Environmental Science Centre, DIT, Dublin 8 (Ireland); Seymour, C. [Department of Medical Physics and Applied Radiation Sciences, McMaster University, Hamilton, Ont. (Canada); Mothersill, C. [Department of Medical Physics and Applied Radiation Sciences, McMaster University, Hamilton, Ont. (Canada)

    2006-05-11

    The influence of melanin on radiation-induced bystander effects has been studied. Melanin is known to be a natural substance with proved radioprotective properties in different organisms and cell lines. It is non-toxic and is effective against acute and chronic irradiation. The lower the radiation dose, the higher the relative impact of melanin protection. In this study influence of melanin on human keratinocytes (HPV-G cells) has been studied using the colony-forming assay. We have shown that bystander donor medium from 0.5 Gy irradiated cells when transferred to unirradiated cells, caused almost the same effect as direct irradiation. Melanin increased the colony-forming ability of bystander recipient cells when it was added into culture medium before irradiation. The effect of melanin added after irradiation was to produce less protection in both the directly irradiated and bystander medium treated groups. The absorption spectrum of the filtered medium is identical to one of the intact culture medium showing that melanin was not present in filtered medium. Thus, it cannot protect recipient cells but reduces the amount of the bystander effect. It is concluded that melanin added before irradiation effectively decreased the radiation dose. The reduction of the impact of the bystander signal on recipient cells when melanin was added to the donor medium after harvest but before filtration, may mean that the bystander signal has a physical component as melanin can absorb all types of physical energy.

  18. Toll like receptors gene expression of human keratinocytes cultured of severe burn injury.

    Science.gov (United States)

    Cornick, Sarita Mac; Noronha, Silvana Aparecida Alves Corrêa de; Noronha, Samuel Marcos Ribeiro de; Cezillo, Marcus V B; Ferreira, Lydia Masako; Gragnani, Alfredo

    2014-01-01

    To evaluate the expression profile of genes related to Toll Like Receptors (TLR) pathways of human Primary Epidermal keratinocytes of patients with severe burns. After obtaining viable fragments of skin with and without burning, culture hKEP was initiated by the enzymatic method using Dispase (Sigma-Aldrich). These cells were treated with Trizol(r) (Life Technologies) for extraction of total RNA. This was quantified and analyzed for purity for obtaining cDNA for the analysis of gene expression using specific TLR pathways PCR Arrays plates (SA Biosciences). After the analysis of gene expression we found that 21% of these genes were differentially expressed, of which 100% were repressed or hyporegulated. Among these, the following genes (fold decrease): HSPA1A (-58), HRAS (-36), MAP2K3 (-23), TOLLIP (-23), RELA (-18), FOS (-16), and TLR1 (-6.0). This study contributes to the understanding of the molecular mechanisms related to TLR pathways and underlying wound infection caused by the burn. Furthermore, it may provide new strategies to restore normal expression of these genes and thereby change the healing process and improve clinical outcome.

  19. Innate and adaptive immunity gene expression of human keratinocytes cultured of severe burn injury.

    Science.gov (United States)

    Noronha, Silvana Aparecida Alves Corrêa de; Noronha, Samuel Marcos Ribeiro de; Lanziani, Larissa Elias; Ferreira, Lydia Masako; Gragnani, Alfredo

    2014-01-01

    Evaluate the expression profile of genes related to Innate and Adaptive Immune System (IAIS) of human Primary Epidermal keratinocytes (hPEKP) of patients with severe burns. After obtaining viable fragments of skin with and without burning, culture hKEP was initiated by the enzymatic method using Dispase (Sigma-Aldrich). These cells were treated with Trizol(r) (Life Technologies) for extraction of total RNA. This was quantified and analyzed for purity for obtaining cDNA for the analysis of gene expression using specific IAIS PCR Arrays plates (SA Biosciences). After the analysis of gene expression we found that 63% of these genes were differentially expressed, of which 77% were repressed and 23% were hyper-regulated. Among these, the following genes (fold increase or decrease): IL8 (41), IL6 (32), TNF (-92), HLA-E (-86), LYS (-74), CCR6 (- 73), CD86 (-41) and HLA-A (-35). This study contributes to the understanding of the molecular mechanisms underlying wound infection caused by the burn. Furthermore, it may provide new strategies to restore normal expression of these genes and thereby change the healing process and improve clinical outcome.

  20. The effect of melanin on the bystander effect in human keratinocytes

    International Nuclear Information System (INIS)

    Mosse, I.; Marozik, P.; Seymour, C.; Mothersill, C.

    2006-01-01

    The influence of melanin on radiation-induced bystander effects has been studied. Melanin is known to be a natural substance with proved radioprotective properties in different organisms and cell lines. It is non-toxic and is effective against acute and chronic irradiation. The lower the radiation dose, the higher the relative impact of melanin protection. In this study influence of melanin on human keratinocytes (HPV-G cells) has been studied using the colony-forming assay. We have shown that bystander donor medium from 0.5 Gy irradiated cells when transferred to unirradiated cells, caused almost the same effect as direct irradiation. Melanin increased the colony-forming ability of bystander recipient cells when it was added into culture medium before irradiation. The effect of melanin added after irradiation was to produce less protection in both the directly irradiated and bystander medium treated groups. The absorption spectrum of the filtered medium is identical to one of the intact culture medium showing that melanin was not present in filtered medium. Thus, it cannot protect recipient cells but reduces the amount of the bystander effect. It is concluded that melanin added before irradiation effectively decreased the radiation dose. The reduction of the impact of the bystander signal on recipient cells when melanin was added to the donor medium after harvest but before filtration, may mean that the bystander signal has a physical component as melanin can absorb all types of physical energy

  1. Blockage of JNK pathway enhances arsenic trioxide-induced apoptosis in human keratinocytes

    International Nuclear Information System (INIS)

    Huang, H.-S.; Liu, Z.-M.; Hong, D.-Y.

    2010-01-01

    Arsenic is well known as a carcinogen predisposing humans to some severe diseases and also as an effective medicine for treating acute promyelocytic leukemia, syphilis, and psoriasis. Multiple active mechanisms, including cell cycle arrest and apoptosis, have been proposed in therapy; however, the opposing effects of arsenic remain controversial. Our previous study found that arsenic trioxide (ATO)-induced activation of p21 WAF1/CIP1 (p21) led to A431 cell death through the antagonistic effects of the signaling of ERK1/2 and JNK1. In the current study, the inhibitory effects of JNK1 on ATO-induced p21 expression were explored. Over-expression of JNK1 in A431 cells could inhibit p21 expression, which was associated with HDAC1 and TGIF. Using the GST pull-down assay and fluorescence resonance energy transfer analysis, N-terminal domain (amino acids 1-108) of TGIF, critical to its binding with c-Jun, was found. Using reporter assays, requirement of the C-terminal domain (amino acids 138-272) of TGIF to suppress ATO-induced p21 expression was observed. Thus, the domains of TGIF that carried out its inhibitory effects on p21 were identified. Finally, treatment with JNK inhibitor SP600125 could enhance ATO-induced apoptosis of HaCaT keratinocytes by using flow cytometry.

  2. How Does Chronic Cigarette Smoke Exposure Affect Human Skin? A Global Proteomics Study in Primary Human Keratinocytes.

    Science.gov (United States)

    Rajagopalan, Pavithra; Nanjappa, Vishalakshi; Raja, Remya; Jain, Ankit P; Mangalaparthi, Kiran K; Sathe, Gajanan J; Babu, Niraj; Patel, Krishna; Cavusoglu, Nükhet; Soeur, Jeremie; Pandey, Akhilesh; Roy, Nita; Breton, Lionel; Chatterjee, Aditi; Misra, Namita; Gowda, Harsha

    2016-11-01

    Cigarette smoking has been associated with multiple negative effects on human skin. Long-term physiological effects of cigarette smoke are through chronic and not acute exposure. Molecular alterations due to chronic exposure to cigarette smoke remain unclear. Primary human skin keratinocytes chronically exposed to cigarette smoke condensate (CSC) showed a decreased wound-healing capacity with an increased expression of NRF2 and MMP9. Using quantitative proteomics, we identified 4728 proteins, of which 105 proteins were overexpressed (≥2-fold) and 41 proteins were downregulated (≤2-fold) in primary skin keratinocytes chronically exposed to CSC. We observed an alteration in the expression of several proteins involved in maintenance of epithelial barrier integrity, including keratin 80 (5.3 fold, p value 2.5 × 10 -7 ), cystatin A (3.6-fold, p value 3.2 × 10 -3 ), and periplakin (2.4-fold, p value 1.2 × 10 -8 ). Increased expression of proteins associated with skin hydration, including caspase 14 (2.2-fold, p value 4.7 × 10 -2 ) and filaggrin (3.6-fold, p value 5.4 × 10 -7 ), was also observed. In addition, we report differential expression of several proteins, including adipogenesis regulatory factor (2.5-fold, p value 1.3 × 10 -3 ) and histone H1.0 (2.5-fold, p value 6.3 × 10 -3 ) that have not been reported earlier. Bioinformatics analyses demonstrated that proteins differentially expressed in response to CSC are largely related to oxidative stress, maintenance of skin integrity, and anti-inflammatory responses. Importantly, treatment with vitamin E, a widely used antioxidant, could partially rescue adverse effects of CSC exposure in primary skin keratinocytes. The utility of antioxidant-based new dermatological formulations in delaying or preventing skin aging and oxidative damages caused by chronic cigarette smoke exposure warrants further clinical investigations and multi-omics research.

  3. Dynamic changes in nicotinamide pyridine dinucleotide content in normal human epidermal keratinocytes and their effect on retinoic acid biosynthesis

    International Nuclear Information System (INIS)

    Pinkas-Sarafova, Adriana; Markova, N.G.; Simon, M.

    2005-01-01

    The function of many enzymes that regulate metabolism and transcription depends critically on the nicotinamide pyridine dinucleotides. To understand the role of NAD(P)(H) in physiology and pathophysiology, it is imperative to estimate both their amount and ratios in a given cell type. In human epidermis and in cultured epidermal keratinocytes, we found that the total dinucleotide content is in the low millimolar range. The dinucleotide pattern changes during proliferation and maturation of keratinocytes in culture. Differences in the concentrations of NAD(P)(H) of 1.5- to 12-fold were observed. This resulted in alteration of the NAD(P)H/NAD(P) ratio, which could impact the differential regulation of both transcriptional and metabolic processes. In support of this notion, we provide evidence that the two-step oxidation of retinol to retinoic acid, a nuclear hormone critical for epidermal homeostasis, can be regulated by the relative physiological amounts of the pyridine dinucleotides

  4. Influence of acidic pH on keratinocyte function and re-epithelialisation of human in vitro wounds.

    Science.gov (United States)

    Lönnqvist, Susanna; Emanuelsson, Peter; Kratz, Gunnar

    2015-01-01

    Chronic wounds are one of the greatest challenges for the healthcare system. Today, a plethora of dressings are used in the treatment of these wounds, each with specific influence on the wound environment. Due to differences in the permeability of the dressings the use will result in differences in the pH balance in the wound bed. However, little is known about how changes in the pH in the wound environment affect the different phases of the healing process. The aim of the present study was to investigate the effects of acidic pH on the regeneration phase by studying keratinocyte function in vitro and re-epithelialisation in an in vitro model of human skin. In vitro assays showed reduced viability and migration rates in human keratinocytes when pH was lowered. Real time PCR revealed differential expression of genes related to wound healing and environmental impairment. Tissue culture showed no re-epithelialisation of wounds subjected to pH 5.0 and moderate re-epithelialisation at pH 6.0, compared to controls at pH 7.4. The results indicate that lowering pH down to pH 5.0 in wounds is counterproductive in aspect of keratinocyte function which is crucial for successful wound healing.

  5. Incorporation and distribution of dihomo-gamma-linolenic acid, arachidonic acid, and eicosapentaenoic acid in cultured human keratinocytes

    International Nuclear Information System (INIS)

    Punnonen, K.; Puustinen, T.; Jansen, C.T.

    1986-01-01

    Human keratinocytes in culture were labelled with 14 C-dihomo-gamma-linolenic acid, 14 C-arachidonic acid or 14 C-eicosapentaenoic acid. All three eicosanoid precursor fatty acids were effectively incorporated into the cells. In phospholipids most of the radioactivity was recovered, in neutral lipids a substantial amount, and as free unesterified fatty acids only a minor amount. Most of the radioactivity was found in phosphatidylethanolamine which was also the major phospholipid as measured by phosphorous assay. The incorporation of dihomo-gamma-linolenic acid and arachidonic acid into lipid subfractions was essentially similar. Eicosapentaenoic acid was, however, much less effectively incorporated into phosphatidylinositol + phosphatidylserine and, correspondingly, more effectively into triacylglycerols as compared to the two other precursor fatty acids. Once incorporated, the distribution of all three precursor fatty acids was relatively stable, and only minor amounts of fatty acids were released into the culture medium during short term culture (two days). Our study demonstrates that eicosanoid precursor fatty acids are avidly taken up by human keratinocytes and esterified into membrane lipids. The clinical implication of this finding is that dietary manipulations might be employed to cause changes in the fatty acid composition of keratinocytes

  6. Cytogenetic and molecular genetic characterization of immortalized human ovarian surface epithelial cell lines: consistent loss of chromosome 13 and amplification of chromosome 20.

    Science.gov (United States)

    Jin, Yuesheng; Zhang, Hao; Tsao, Sai Wah; Jin, Charlotte; Lv, Mei; Strömbeck, Bodil; Wiegant, Joop; Wan, Thomas Shek Kong; Yuen, Po Wing; Kwong, Yok-Lam

    2004-01-01

    This study aimed at identifying the genetic events involved in immortalization of ovarian epithelial cells, which might be important steps in ovarian carcinogenesis. The genetic profiles of five human ovarian surface epithelial (HOSE) cell lines immortalized by retroviral transfection of the human papillomavirus (HPV) E6/E7 genes were thoroughly characterized by chromosome banding and fluorescence in situ hybridization (FISH), at various passages pre- and post-crisis. In pre-crisis, most cells had simple, non-clonal karyotypic changes. Telomere association was the commonest aberration, suggesting that tolermase dysfunction might be an important genetic event leading to cellular crisis. After immortalization post-crisis, however, the karyotypic patterns were non-random. Loss of genetic materials was a characteristic feature. The commonest numerical aberrations were -13, -14, -16, -17, -18, and +5. Among them, loss of chromosome 13 was common change observed in all lines. The only recurrent structural aberration was homogeneously staining regions (hsr) observed in three lines. FISH and combined binary ratio labeling (COBRA)-FISH showed in two cases that the hsrs were derived from chromosome 20. Clonal evolution was observed in four of the lines. In one line, hsr was the only change shared by all subclones, suggesting that it might be a primary event in cell immortalization. The results of the present study suggested that loss of chromosome 13 and the amplification of chromosome 20 might be early genetic events involved in ovarian cell immortalization, and might be useful targets for the study of genomic aberrations in ovarian carcinogenesis.

  7. hTERT gene immortalized human adipose-derived stem cells and its multiple differentiations: a preliminary investigation.

    Science.gov (United States)

    Wang, L; Song, K; Qu, X; Wang, H; Zhu, H; Xu, X; Zhang, M; Tang, Y; Yang, X

    2013-03-01

    Human adipose-derived adult stem cells (hADSCs) can express human telomerase reverse transcriptase phenotypes under an appropriate culture condition. Because adipose tissue is abundant and easily accessible, hADSCs offer a promising source of stem cells for tissue engineering application and other cell-based therapies. However, the shortage of cells number and the difficulty to proliferate, known as the "Hayflick limit" in vitro, limit their further clinical application. Here, hADSCs were transfected with human telomerase reverse transcriptase (hTERT) gene by the lentiviral vector to prolong the lifespan of stem cells and even immortalize them. Following to this, the cellular properties and functionalities of the transfected cell lines were assayed. The results demonstrated that hADSCs had been successfully transfected with hTERT gene (hTERT-ADSCs). Then, hTERT-ADSCs were initially selected by G418 and subsequently expanded over 20 passages in vitro. Moreover, the qualitative and quantitative differentiation criteria for 20 passages of hTERT-ADSCs also demonstrated that hTERT-ADSCs could differentiate into osteogenesis, chondrogenesis, and adipogenesis phenotypes in lineage-specific differentiation media. These findings confirmed that this transfection could prolong the lifespan of hADSCs.

  8. Determination of Drug Toxicity Using 3D Spheroids Constructed From an Immortal Human Hepatocyte Cell Line

    Science.gov (United States)

    Fey, Stephen J.; Wrzesinski, Krzysztof

    2012-01-01

    Numerous publications have documented that the immortal cells grown in three-dimensional (3D) cultures possess physiological behavior, which is more reminiscent of their parental organ than when the same cells are cultivated using classical two-dimensional (2D) culture techniques. The goal of this study was to investigate whether this observation could be extended to the determination of LD50 values and whether 3D data could be correlated to in vivo observations. We developed a noninvasive means to estimate the amount of protein present in a 3D spheroid from it is planar area (± 21%) so that a precise dose can be provided in a manner similar to in vivo studies. This avoided correction of the actual dose given based on a protein determination after treatment (when some cells may have lysed). Conversion of published in vitro LC50 data (mM) for six common drugs (acetaminophen, amiodarone, diclofenac, metformin, phenformin, and valproic acid) to LD50 data (mg compound/mg cellular protein) showed that the variation in LD50 values was generally less than that suggested by the original LC50 data. Toxicological analysis of these six compounds in 3D spheroid culture (either published or presented here) demonstrated similar LD50 values. Although in vitro 2D HepG2 data showed a poor correlation, the primary hepatocyte and 3D spheroid data resulted in a much higher degree of correlation with in vivo lethal blood plasma levels. These results corroborate that 3D hepatocyte cultures are significantly different from 2D cultures and are more representative of the liver in vivo. PMID:22454432

  9. Activation of endogenous opioid gene expression in human keratinocytes and fibroblasts by pulsed radiofrequency energy fields

    Directory of Open Access Journals (Sweden)

    Moffett J

    2012-09-01

    Full Text Available John Moffett,1 Linley M Fray,1 Nicole J Kubat21Life Science Department, 2Independent Consultant, Regenesis Biomedical Inc, Scottsdale, AZ, USABackground: Pulsed radiofrequency energy (PRFE fields are being used increasingly for the treatment of pain arising from dermal trauma. However, despite their increased use, little is known about the biological and molecular mechanism(s responsible for PRFE-mediated analgesia. In general, current therapeutics used for analgesia target either endogenous factors involved in inflammation, or act on endogenous opioid pathways.Methods and Results: Using cultured human dermal fibroblasts (HDF and human epidermal keratinocytes (HEK, we investigated the effect of PRFE treatment on factors, which are involved in modulating peripheral analgesia in vivo. We found that PRFE treatment did not inhibit cyclooxygenase enzyme activity, but instead had a positive effect on levels of endogenous opioid precursor mRNA (proenkephalin, pro-opiomelanocortin, prodynorphin and corresponding opioid peptide. In HEK cells, increases in opioid mRNA were dependent, at least in part, on endothelin-1. In HDF cells, additional pathways also appear to be involved. PRFE treatment was also followed by changes in endogenous expression of several cytokines, including increased levels of interleukin-10 mRNA and decreased levels of interleukin-1β mRNA in both cell types.Conclusion: These findings provide a new insight into the molecular mechanism underlying PRFE-mediated analgesia reported in the clinical setting.Keywords: peripheral analgesia, endogenous opioids, endothelin-1, endothelin receptor A, endothelin receptor B, pulsed radiofrequency energy field, cyclooxygenase

  10. Lysophosphatidic acid induces expression of genes in human oral keratinocytes involved in wound healing.

    Science.gov (United States)

    Thorlakson, Hong Huynh; Engen, Stian Andre; Schreurs, Olav; Schenck, Karl; Blix, Inger Johanne Schytte

    2017-08-01

    Epithelial cells participate in wound healing by covering wounds, but also as important mediators of wound healing processes. Topical application of the phospholipid growth factor lysophosphatidic acid (LPA) accelerates dermal wound healing and we hypothesized that LPA can play a role in human oral wound healing through its effects on human oral keratinocytes (HOK). HOK were isolated from gingival biopsies and exposed to LPA. The LPA receptor profile, signal transduction pathways, gene expression and secretion of selected cytokines were analyzed. HOK expressed the receptors LPA 1 , LPA 5 and LPA 6 and LPA activated the ERK1/2, JNK and p38 intracellular pathways, substantiated by secretion of IL-6 and IL-8. The early (2h) and intermediate (6h) gene expression profiles of HOK after LPA treatment showed a wide array of regulated genes. The majority of the strongest upregulated genes were related to chemotaxis and inflammation, and became downregulated after 6h. At 6h, genes coding for factors involved in extracellular matrix remodeling and re-epithelialization became highly expressed. IL-36γ, not earlier known to be regulated by LPA, was strongly transcribed and translated but not secreted. After stimulation with LPA, HOK responded by regulating factors and genes that are essential in wound healing processes. As LPA is found in saliva and is released by activated cells after wounding, our results indicate that LPA has a favorable physiological role in oral wound healing. This may further point towards a beneficial role for application of LPA on oral surgical or chronic wounds. Copyright © 2017 Elsevier Ltd. All rights reserved.

  11. Early Gene Expression in Wounded Human Keratinocytes Revealed by DNA Microarray Analysis

    Directory of Open Access Journals (Sweden)

    Pascal Barbry

    2006-04-01

    Full Text Available Wound healing involves several steps: spreading of the cells, migration and proliferation. We have profiled gene expression during the early events of wound healing in normal human keratinocytes with a home-made DNA microarray containing about 1000 relevant human probes. An original wounding machine was used, that allows the wounding of up to 40% of the surface of a confluent monolayer of cultured cells grown on a Petri dish (compared with 5% with a classical ‘scratch’ method. The two aims of the present study were: (a to validate a limited number of genes by comparing the expression levels obtained with this technique with those found in the literature; (b to combine the use of the wounding machine with DNA microarray analysis for large-scale detection of the molecular events triggered during the early stages of the wound-healing process. The time-courses of RNA expression observed at 0.5, 1.5, 3, 6 and 15 h after wounding for genes such as c-Fos, c-Jun, Egr1, the plasminogen activator PLAU (uPA and the signal transducer and transcription activator STAT3, were consistent with previously published data. This suggests that our methodologies are able to perform quantitative measurement of gene expression. Transcripts encoding two zinc finger proteins, ZFP36 and ZNF161, and the tumour necrosis factor α-induced protein TNFAIP3, were also overexpressed after wounding. The role of the p38 mitogen-activated protein kinase (p38MAPK in wound healing was shown after the inhibition of p38 by SB203580, but our results also suggest the existence of surrogate activating pathways.

  12. Expression and purification of recombinant truncated human keratinocyte growth factor-1

    International Nuclear Information System (INIS)

    Deng Lin; Ma Jisheng; Liu Xiaoju; Wang Xiaojie; Li Xiaokun; Gong Shouliang; Wang Huiyan; Tian Haishan

    2010-01-01

    Objective: To construct the genetic engineering bacteria highly expressing 23 amino acids human keratinocyte growth factor-1 (rhKGF1 dest23 ) missing N terminal, and provide experimental data for development of new drug for treatment of oral mucositis after radiotherapy and chemotherapy. Methods: PCR was used to synthese 23 amino acids rhKGF1 dest23 missing N terminal and sumo gene fragments, and construct four kinds of recombinant prokaryotic expression vectors: pET22b-rhKGF1 dest23 , pET22b-sumo-rhKGF1 dest23 , pET3c-rhKGF1 dest23 and pET3c-sumo-rhKGF1 dest23 , then they were transformed into prokaryotic expression host bacteria: Rosetta (DE3) plysS, BL21 (DE3), BL21 (DE3) Star plysS, origima(DE3) and BL21AI, the best expression combination of plasmid and host strain of rhKGF1 dest23 protein was screened and purified by CM ion-exchange and heparin affinity chromatography and identified with Western blotting. Results: pET22b-rhKGF1 dest23 plasmid and the BL21AI host bacteria was the best combination of expression, after induced by IPTG and arabinose, the majority of recombinant protein was expressed in soluble form, accounting for about 12% of the total bacterial proteins. Its purity reached to more than 95% of the protein after two steps chromatography, then conformed with Western blotting. Conclusion: Human genetic engineering bacteria of KGF1 dest23 is successfully constructed and induced by IPTG and arabinose, then after CM weak cation exchange and heparin affinity chromatography, the purified rhKGF1 dest23 protein is obtained. (authors)

  13. Induction of chromosomal aberrations in human primary fibroblasts and immortalized cancer cells exposed to extremely-low-frequency electromagnetic fields

    International Nuclear Information System (INIS)

    Seyyedi, S. S.; Mozdarani, H.; Rezaei Tavirani, M.; Heydari, S.

    2010-01-01

    Rapidly increasing possibilities of exposure to environmental extremely low-frequency electromagnetic fields have become a topic of worldwide investigation. Epidemiological and laboratory studies suggest that exposure to extremely low-frequency electromagnetic fields may increase cancer risk therefore assessment of chromosomal damage in various cell lines might be of predictive value for future risk estimation. Materials and Methods: Primary cultures of fibroblasts from human skin biopsy were exposed to continuous extremely low-frequency electromagnetic fields (3, 50 and 60 Hz, sinusoidal, 3h, and 4 m T). Also immortalized cell lines, SW480, MCF-7 and 1321N1 were exposed to continuous extremely low-frequency electromagnetic fields (50 Hz, sinusoidal, 3 h, 4 m T). Metaphase plates Were prepared according to standard methods and stained in 5% Giemsa solution. Chromosomal aberrations of both chromosome and chromatid types were scored to evaluate the effects of extremely low-frequency electromagnetic fields on primary or established cell lines. Results: Results indicate that by increasing the frequency of extremely low-frequency electromagnetic fields, chromosomal aberrations were increased up to 7-fold above background levels in primary human fibroblast cells. In addition, continuous exposure to a 50 Hz electromagnetic field led to a significant increase in chromosomal aberrations in SW480, MCF-7 and 1321N1 cell lines compared to sham control. Conclusion: Results obtained indicate that extremely low-frequency electromagnetic fields has the potential for induction of chromosomal aberrations in all cell types.

  14. Aneuploidy in immortalized human mesenchymal stem cells with non-random loss of chromosome 13 in culture.

    Science.gov (United States)

    Takeuchi, Masao; Takeuchi, Kikuko; Ozawa, Yutaka; Kohara, Akihiro; Mizusawa, Hiroshi

    2009-01-01

    Aneuploidy (an abnormal number of chromosomes) is commonly observed in most human cancer cells, highlighting the need to examine chromosomal instability in tumorigenesis. Previously, the immortalized human mesenchymal stem cell line UE6E7T-3 was shown to undergo a preferential loss of one copy of chromosome 13 after prolonged culture. Here, the loss of chromosome 13 was found to be caused by chromosome missegregation during mitosis, which involved unequal segregation, exclusion of the misaligned chromosome 13 on the metaphase plate, and trapping of chromosome 13 in the midbody region, as observed by fluorescence in situ hybridization. Near-diploid aneuploidy, not tetraploidy, was the direct result. The loss of chromosome 13 was non-random, and was detected by analysis of microsatellites and single nucleotide polymorphism-based loss of heterozygosity (LOH). Of the five microsatellite loci on chromosome 13, four loci showed microsatellite instability at an early stage in culture, and LOH was apparent at a late stage in culture. These results suggest that the microsatellite mutations cause changes in centromere integrity provoking loss of this chromosome in the UE6E7T-3 cell line. Thus, these results support the use of this cell line as a useful model for understanding the mechanism of aneuploid formation in cell cultures.

  15. The Effects of Antifungal Azoles on Inflammatory Cytokine Production in Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    K Zomorodian

    2008-04-01

    Full Text Available ABSTRACT: Introduction & Objective: Azoles drugs are being used successfully in treatment of fungal infections. Recently, immunosuppressive effects of some of these agents have been reported. Keratinocytes, as the major cells of the skin, have an important role in innate immunity against pathogenic agents. Considering the scanty of information about the effects of azoles on immune responces, this study was conducted to assess the expression and secretion of inflammatory cytokines in keratinocytes following treatment with azole drugs. Materials & Methods: This is an exprimental study conducted in in molecular biology division in Tehran University of Medical Sciences and Immunodermatology Department in Vienna Medical University. Primery keratinocytes were cultured and treated with different concentrations of fluconazole, itraconazole, ketoconazole and griseofulvin. Secreted IL1, IL6 and TNF-α by keratinocytes in culture supernatant were measured by quantitative enzyme immunoassay technique. Moreover, expression of the genes encoding IL1 and IL8 was evaluated by Real Time-PCR. Results: Treatment of keratinocytes with different concentrations of fluconazole and low concentration of ketoconazole resulted in decrease in IL1 secretion, but Itraconazole and griseofulvin did not show such an effect at the same concentrations. In addition, none of the examined drugs had an effect on secretion level of IL6 and TNF-α. Quantitative analysis of IL1 and IL8 encoding genes revealed that transcription on these genes might be suppressed following treatment with fluconazole or ketoconazole. Conclusion: Fluconazole and ketoconazole might modulate the expression and secretion of IL1 and IL8 and affect the direction of immune responses induced by keratinocytes

  16. The Antimicrobial Peptide Human Beta-Defensin-3 Is Induced by Platelet-Released Growth Factors in Primary Keratinocytes

    OpenAIRE

    Andreas Bayer; Justus Lammel; Mersedeh Tohidnezhad; Sebastian Lippross; Peter Behrendt; Tim Klüter; Thomas Pufe; Jochen Cremer; Holger Jahr; Franziska Rademacher; Regine Gläser; Jürgen Harder

    2017-01-01

    Platelet-released growth factors (PRGF) and its related clinically used formulations (e.g., Vivostat Platelet-Rich Fibrin (PRF?)) contain a variety of chemokines, cytokines, and growth factors and are therefore used to support healing of chronic, hard-to-heal, or infected wounds. Human beta-defensin-3 (hBD-3) is an antimicrobial peptide inducibly expressed in human keratinocytes especially upon wounding. The potent antimicrobial activity of hBD-3 together with its wound closure-promoting acti...

  17. Factors affecting ultraviolet-A photon emission from β-irradiated human keratinocyte cells.

    Science.gov (United States)

    Le, M; Mothersill, C E; Seymour, C B; Ahmad, S B; Armstrong, A; Rainbow, A J; McNeill, F E

    2015-08-21

    The luminescence intensity of 340±5 nm photons emitted from HaCaT (human keratinocyte) cells was investigated using a single-photon-counting system during cellular exposure to (90)Y β-particles. Multiple factors were assessed to determine their influence upon the quantity and pattern of photon emission from β-irradiated cells. Exposure of 1 x 10(4) cells/5 mL to 703 μCi resulted in maximum UVA photoemission at 44.8 x 10(3)±2.5 x 10(3) counts per second (cps) from live HaCaT cells (background: 1-5 cps); a 16-fold increase above cell-free controls. Significant biophoton emission was achieved only upon stimulation and was also dependent upon presence of cells. UVA luminescence was measured for (90)Y activities 14 to 703 μCi where a positive relationship between photoemission and (90)Y activity was observed. Irradiation of live HaCaT cells plated at various densities produced a distinct pattern of emission whereby luminescence increased up to a maximum at 1 x 10(4) cells/5 mL and thereafter decreased. However, this result was not observed in the dead cell population. Both live and dead HaCaT cells were irradiated and were found to demonstrate different rates of photon emission at low β activities (⩽400 μCi). Dead cells exhibited greater photon emission rates than live cells which may be attributable to metabolic processes taking place to modulate the photoemissive effect. The results indicate that photon emission from HaCaT cells is perturbed by external stimulation, is dependent upon the activity of radiation delivered, the density of irradiated cells, and cell viability. It is postulated that biophoton emission may be modulated by a biological or metabolic process.

  18. Proteomic profiling and post-translational modifications in human keratinocytes treated with Mucuna pruriens leaf extract.

    Science.gov (United States)

    Cortelazzo, Alessio; Lampariello, Raffaella L; Sticozzi, Claudia; Guerranti, Roberto; Mirasole, Cristiana; Zolla, Lello; Sacchetti, Gianni; Hajek, Joussef; Valacchi, Giuseppe

    2014-02-03

    Mucuna pruriens (Mp) is a plant belonging to the Fabaceae family, with several medicinal properties among which its potential to treat diseases where reactive oxygen species (ROS) play an important role in the pathogeneses. The aim was to investigate the effects of Mp leaf methanolic extract (MPME) on human keratinocytes protein expression and its role in preventing proteins oxidation after oxidative stress (OS) exposure. The effects of MPME on HaCaT cells protein expression were evaluated treating cells with different concentrations of MPME, with glucose oxidase (GO, source of OS) and with MPME subsequently treated with GO. The protein patterns of treated HaCaT cells are analyzed by two-dimensional gel electrophoresis (2-DE) and compared with that of untreated HaCaT. Immunoblotting was then used to evaluate the role of MPME in preventing the 4-hydroxynonenal protein adducts (4-HNE PAs) formation (marker of OS). Eighteen proteins, identified by mass spectrometry (LC-ESI-CID-MS/MS), were modulated distinctly by MPME in HaCaT. Overall, MPME counteract GO effect, reducing the GO-induced overexpression of several proteins involved in stress response (T-complex protein 1, Protein disulfide-isomerase A3, Protein DJ-1, and Stress-induced-phosphoprotein 1), in cell energy methabolism (Inorganic pyrophosphatase, Triosephosphate isomerase isoform 1, 2-phosphopyruvate-hydratase alpha-enolase, and Fructose-bisphosphate aldolase A isoform 1), in cytoskeletal organization (Cytokeratins 18, 9, 2, Cofilin-1, Annexin A2 and F-actin-capping protein subunit beta isoform 1) and in cell cycle progression (Eukaryotic translation initiation factor 5A-1 isoform B). In addition, MPME decreased the 4-HNE PAs levels, in particular on 2-phosphopyruvate-hydratase alpha-enolase and Cytokeratin 9. Our findings show that MPME might be helpful in the treatment of OS-related skin diseases by preventing protein post-translational modifications (4-HNE PAs). © 2013 Published by Elsevier Ireland Ltd.

  19. Biocompatibility of polymer-infiltrated-ceramic-network (PICN) materials with Human Gingival Keratinocytes (HGKs).

    Science.gov (United States)

    Grenade, Charlotte; De Pauw-Gillet, Marie-Claire; Pirard, Catherine; Bertrand, Virginie; Charlier, Corinne; Vanheusden, Alain; Mainjot, Amélie

    2017-03-01

    Biocompatibility of polymer-infiltrated-ceramic-network (PICN) materials, a new class of CAD-CAM composites, is poorly explored in the literature, in particular, no data are available regarding Human Gingival Keratinocytes (HGK). The first objective of this study was to evaluate the in vitro biocompatibility of PICNs with HGKs in comparison with other materials typically used for implant prostheses. The second objective was to correlate results with PICN monomer release and indirect cytotoxicity. HGK attachment, proliferation and spreading on PICN, grade V titanium (Ti), yttrium zirconia (Zi), lithium disilicate glass-ceramic (eM) and polytetrafluoroethylene (negative control) discs were evaluated using a specific insert-based culture system. For PICN and eM samples, monomer release in the culture medium was quantified by high performance liquid chromatography and indirect cytotoxicity tests were performed. Ti and Zi exhibited the best results regarding HGK viability, number and coverage. eM showed inferior results while PICN showed statistically similar results to eM but also to Ti regarding cell number and to Ti and Zi regarding cell viability. No monomer release from PICN discs was found, nor indirect cytotoxicity, as for eM. The results confirmed the excellent behavior of Ti and Zi with gingival cells. Even if polymer based, PICN materials exhibited intermediate results between Ti-Zi and eM. These promising results could notably be explained by PICN high temperature-high pressure (HT-HP) innovative polymerization mode, as confirmed by the absence of monomer release and indirect cytotoxicity. Copyright © 2017 The Academy of Dental Materials. Published by Elsevier Ltd. All rights reserved.

  20. Effect of retinoic acid on the radiosensitivity of normal human oral keratinocyte

    International Nuclear Information System (INIS)

    Lee, Jean; Heo, Min Suk; Lee, Sam Sun; Oh, Sung Ook; Choi, Soon Chul; Park, Tae Won; Lee, Sul Mi; Choi, Hang Moon

    2003-01-01

    To evaluate the effect of all-trans-retinotic acid (ATRA) on the radiosensitivity of normal human oral keratinocyte (NHOK). Relative cell survival fraction including SF2 (survival fraction at 2 Gy) was calculated on the basis of colony formation assay. Data were fitted to the linear-quadratic model to establish the survival curve and calculate α and β values. Using flow cytometry at 1, 2, 3, 4, and 5 days after exposure to 2 and 10 Gy irradiation, cell cycle arrest and apoptosis were analysed. To understand the molecular mechanism of the radiosensitization of ATRA on NHOK, proteins related with apoptosis and cell cycle arrest were investigated by Western blot analysis. Treatment with ATRA resulted in a significant decrease of SF2 value for NHOK from 0.63 to 0.27, and increased α and β value, indicating that ATRA increased radiosensitivity of NHOK. ATRA increased LDH significantly, but increasing irradiation dose decreased LDH, suggesting that the radiosensitizing effect of ATRA is not directly related with increasing cell necrosis by ATRA. ATRA did not induce appotosis but increased G2 arrest after 10 Gy irradiation, implying that the increased radiosensitivity of NHOK may be due to a decrease in mitosis caused by increasing G2 arrest. ATRA inhibited the reduction of p53 at 3 days after 10 Gy irradiation and increased p21 at 1 day after 10 Gy irradiation. Further study is required to determine the precise relationship between this effect and the radiosensitizing effect of ATRA. These results suggested that ATRA increase radiosensitivity by inhibiting mitosis caused by increasing G2 arrest.

  1. Characterization of a novel telomerase-immortalized human endometrial stromal cell line, St-T1b

    Directory of Open Access Journals (Sweden)

    Brosens Jan J

    2009-07-01

    Full Text Available Abstract Background Coordinated differentiation of the endometrial compartments in the second half of the menstrual cycle is a prerequisite for the establishment of pregnancy. Endometrial stromal cells (ESC decidualize under the influence of ovarian progesterone to accommodate implantation of the blastocyst and support establishment of the placenta. Studies into the mechanisms of decidualization are often hampered by the lack of primary ESC. Here we describe a novel immortalized human ESC line. Methods Primary ESC were immortalized by the transduction of telomerase. The resultant cell line, termed St-T1b, was characterized for its morphological and biochemical properties by immunocytochemistry, RT-PCR and immunoblotting. Its progestational response was tested using progesterone and medroxyprogesterone acetate with and without 8-Br-cAMP, an established inducer of decidualization in vitro. Results St-T1b were positive for the fibroblast markers vimentin and CD90 and negative for the epithelial marker cytokeratin-7. They acquired a decidual phenotype indistinguishable from primary ESC in response to cAMP stimulation. The decidual response was characterized by transcriptional activation of marker genes, such as PRL, IGFBP1, and FOXO1, and enhanced protein levels of the tumor suppressor p53 and the metastasis suppressor KAI1 (CD82. Progestins alone had no effect on St-T1b cells, but medroxyprogesterone acetate greatly enhanced the cAMP-stimulated expression of IGFBP-1 after 3 and 7 days. Progesterone, albeit more weakly, also augmented the cAMP-induced IGFBP-1 production but only after 7 days of treatment. The cell line remained stable in continuous culture for more than 150 passages. Conclusion St-T1b express the appropriate phenotypic ESC markers and their decidual response closely mimics that of primary cultures. Decidualization is efficiently induced by cAMP analog and enhanced by medroxyprogesterone acetate, and, to a lesser extent, by natural

  2. Telomerase-immortalized non-malignant human prostate epithelial cells retain the properties of multipotent stem cells

    International Nuclear Information System (INIS)

    Li Hongzhen; Zhou Jianjun; Miki, Jun; Furusato, Bungo; Gu Yongpeng; Srivastava, Shiv; McLeod, David G.; Vogel, Jonathan C.; Rhim, Johng S.

    2008-01-01

    Understanding prostate stem cells may provide insight into the origin of prostate cancer. Primary cells have been cultured from human prostate tissue but they usually survive only 15-20 population doublings before undergoing senescence. We report here that RC-170N/h/clone 7 cells, a clonal cell line from hTERT-immortalized primary non-malignant tissue-derived human prostate epithelial cell line (RC170N/h), retain multipotent stem cell properties. The RC-170N/h/clone 7 cells expressed a human embryonic stem cell marker, Oct-4, and potential prostate epithelial stem cell markers, CD133, integrin α2β1 hi and CD44. The RC-170N/h/clone 7 cells proliferated in KGM and Dulbecco's Modified Eagle Medium with 10% fetal bovine serum and 5 μg/ml insulin (DMEM + 10% FBS + Ins.) medium, and differentiated into epithelial stem cells that expressed epithelial cell markers, including CK5/14, CD44, p63 and cytokeratin 18 (CK18); as well as the mesenchymal cell markers, vimentin, desmin; the neuron and neuroendocrine cell marker, chromogranin A. Furthermore the RC170 N/h/clone 7 cells differentiated into multi tissues when transplanted into the sub-renal capsule and subcutaneously of NOD-SCID mice. The results indicate that RC170N/h/clone 7 cells retain the properties of multipotent stem cells and will be useful as a novel cell model for studying the mechanisms of human prostate stem cell differentiation and transformation

  3. Differential effects of the extracellular microenvironment on human embryonic stem cell differentiation into keratinocytes and their subsequent replicative life span.

    Science.gov (United States)

    Movahednia, Mohammad Mehdi; Kidwai, Fahad Karim; Zou, Yu; Tong, Huei Jinn; Liu, Xiaochen; Islam, Intekhab; Toh, Wei Seong; Raghunath, Michael; Cao, Tong

    2015-04-01

    Culture microenvironment plays a critical role in the propagation and differentiation of human embryonic stem cells (hESCs) and their differentiated progenies. Although high efficiency of hESC differentiation to keratinocytes (hESC-Kert) has been achieved, little is known regarding the effects of early culture microenvironment and pertinent extracellular matrix (ECM) interactions during epidermal commitment on subsequent proliferative capacity of hESC-Kert. The aim of this study is to evaluate the effects of the different ECM microenvironments during hESC differentiation on subsequent replicative life span of hESC-Kert. In doing so, H1-hESCs were differentiated to keratinocytes (H1-Kert) in two differentiation systems. The first system employed autologous fibroblast feeder support, in which keratinocytes (H1-Kert(ACC)) were derived by coculture of hESCs with hESC-derived fibroblasts (H1-ebFs). The second system employed a novel decellularized matrix from H1-ebFs to create a dermoepidermal junction-like (DEJ) matrix. H1-Kert(AFF) were derived by differentiation of hESCs on the feeder-free system employing the DEJ matrix. Our study indicated that the feeder-free system with the use of DEJ matrix was more efficient in differentiation of hESCs toward epidermal progenitors. However, the feeder-free system was not sufficient to support the subsequent replicative capacity of differentiated keratinocytes. Of note, H1-Kert(AFF) showed limited replicative capacity with reduced telomere length and early cellular senescence. We further showed that the lack of cell-cell interactions during epidermal commitment led to heightened production of TGF-β1 by hESC-Kert during extended culture, which in turn was responsible for resulting in the limited replicative life span with cellular senescence of hESC-Kert derived under the feeder-free culture system. This study highlights for the first time the importance of the culture microenvironment and cell-ECM interactions during

  4. Hepatocyte nuclear factor 4A improves hepatic differentiation of immortalized adult human hepatocytes and improves liver function and survival.

    Science.gov (United States)

    Hang, Hua-Lian; Liu, Xin-Yu; Wang, Hai-Tian; Xu, Ning; Bian, Jian-Min; Zhang, Jian-Jun; Xia, Lei; Xia, Qiang

    2017-11-15

    Immortalized human hepatocytes (IHH) could provide an unlimited supply of hepatocytes, but insufficient differentiation and phenotypic instability restrict their clinical application. This study aimed to determine the role of hepatocyte nuclear factor 4A (HNF4A) in hepatic differentiation of IHH, and whether encapsulation of IHH overexpressing HNF4A could improve liver function and survival in rats with acute liver failure (ALF). Primary human hepatocytes were transduced with lentivirus-mediated catalytic subunit of human telomerase reverse transcriptase (hTERT) to establish IHH. Cells were analyzed for telomerase activity, proliferative capacity, hepatocyte markers, and tumorigenicity (c-myc) expression. Hepatocyte markers, hepatocellular functions, and morphology were studied in the HNF4A-overexpressing IHH. Hepatocyte markers and karyotype analysis were completed in the primary hepatocytes using shRNA knockdown of HNF4A. Nuclear translocation of β-catenin was assessed. Rat models of ALF were treated with encapsulated IHH or HNF4A-overexpressing IHH. A HNF4A-positive IHH line was established, which was non-tumorigenic and conserved properties of primary hepatocytes. HNF4A overexpression significantly enhanced mRNA levels of genes related to hepatic differentiation in IHH. Urea levels were increased by the overexpression of HNF4A, as measured 24h after ammonium chloride addition, similar to that of primary hepatocytes. Chromosomal abnormalities were observed in primary hepatocytes transfected with HNF4A shRNA. HNF4α overexpression could significantly promote β-catenin activation. Transplantation of HNF4A overexpressing IHH resulted in better liver function and survival of rats with ALF compared with IHH. HNF4A improved hepatic differentiation of IHH. Transplantation of HNF4A-overexpressing IHH could improve the liver function and survival in a rat model of ALF. Copyright © 2017 Elsevier Inc. All rights reserved.

  5. Cultivation and grafting of human keratinocytes on a poly(hydroxyethyl methacrylate) support to the wound bed: a clinical study.

    Science.gov (United States)

    Dvoránková, B; Smetana, K; Königová, R; Singerová, H; Vacík, J; Jelínková, M; Kapounková, Z; Zahradník, M

    1998-01-01

    Cultured epithelial sheets on a textile support are used for the treatment of seriously burned patients. In this study we demonstrate a new procedure for the grafting of keratinocytes directly on a polymer cultivation support. This procedure is much easier in comparison with classical techniques, and encouraging results of clinical trials demonstrate the improved healing of the wound bed after the use of this procedure. There is no difference in the cytokeratine pattern (LP-34, cytokeratin-10) of the reconstructed epidermis and normal human skin.

  6. Interaction of Mycobacterium leprae with the HaCaT human keratinocyte cell line: new frontiers in the cellular immunology of leprosy.

    Science.gov (United States)

    Lyrio, Eloah C D; Campos-Souza, Ivy C; Corrêa, Luiz C D; Lechuga, Guilherme C; Verícimo, Maurício; Castro, Helena C; Bourguignon, Saulo C; Côrte-Real, Suzana; Ratcliffe, Norman; Declercq, Wim; Santos, Dilvani O

    2015-07-01

    Leprosy is a chronic granulomatous disease caused by Mycobacterium leprae affecting the skin and peripheral nerves. Despite M. leprae invasion of the skin and keratinocytes importance in innate immunity, the interaction of these cells in vitro during M. leprae infection is poorly understood. Conventional and fluorescence optical microscopy, transmission electronic microscopy, flow cytometry and ELISA were used to study the in vitro interaction of M. leprae with the HaCaT human keratinocyte cell line. Keratinocytes uptake of M. leprae is described, and modulation of the surface expression of CD80 and CD209, cathelicidin expression and TNF-α and IL-1β production of human keratinocytes are compared with dendritic cells and macrophages during M. leprae interaction. This study demonstrated that M. leprae interaction with human keratinocytes enhanced expression of cathelicidin and greatly increased TNF-α production. The highest spontaneous expression of cathelicidin was by dendritic cells which are less susceptible to M. leprae infection. In contrast, keratinocytes displayed low spontaneous cathelicidin expression and were more susceptible to M. leprae infection than dendritic cells. The results show, for the first time, an active role for keratinocytes during infection by irradiated whole cells of M. leprae and the effect of vitamin D on this process. They also suggest that therapies which target cathelicidin modulation may provide novel approaches for treatment of leprosy. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  7. Resveratrol prevents oxidative stress-induced senescence and proliferative dysfunction by activating the AMPK-FOXO3 cascade in cultured primary human keratinocytes.

    Directory of Open Access Journals (Sweden)

    Yasuo Ido

    Full Text Available The aging process is perceived as resulting from a combination of intrinsic factors such as changes in intracellular signaling and extrinsic factors, most notably environmental stressors. In skin, the relationship between intrinsic changes and keratinocyte function is not clearly understood. Previously, we found that increasing the activity of AMP-activated protein kinase (AMPK suppressed senescence in hydrogen peroxide (H2O2-treated human primary keratinocytes, a model of oxidative stress-induced cellular aging. Using this model in the present study, we observed that resveratrol, an agent that increases the activities of both AMPK and sirtuins, ameliorated two age-associated phenotypes: cellular senescence and proliferative dysfunction. In addition, we found that treatment of keratinocytes with Ex527, a specific inhibitor of sirtuin 1 (SIRT1, attenuated the ability of resveratrol to suppress senescence. In keeping with the latter observation, we noted that compared to non-senescent keratinocytes, senescent cells lacked SIRT1. In addition to these effects on H2O2-induced senescence, resveratrol also prevented the H2O2-induced decrease in proliferation (as indicated by 3H-thymidine incorporation in the presence of insulin. This effect was abrogated by inhibition of AMPK but not SIRT1. Compared to endothelium, we found that human keratinocytes expressed relatively high levels of Forkhead box O3 (FOXO3, a downstream target of both AMPK and SIRT1. Treatment of keratinocytes with resveratrol transactivated FOXO3 and increased the expression of its target genes including catalase. Resveratrol's effects on both senescence and proliferation disappeared when FOXO3 was knocked down. Finally, we performed an exploratory study which showed that skin from humans over 50 years old had lower AMPK activity than skin from individuals under age 20. Collectively, these findings suggest that the effects of resveratrol on keratinocyte senescence and proliferation

  8. The effect of 648 nm diode laser irradiation on second messengers in senescent human keratinocytes

    Science.gov (United States)

    Hawkins Evans, D.; Abrahamse, H.

    2009-02-01

    Background/purpose: Stress induced premature senescence (SIPS) is defined as the long-term effect of subcytotoxic stress on proliferative cell types. Cells in SIPS display differences at the level of protein expression which affect energy metabolism, defense systems, redox potential, cell morphology and transduction pathways. This study aimed to determine the effect of laser irradiation on second messengers in senescent cells and to establish if that effect can be directly linked to changes in cellular function such as cell viability or proliferation. Materials and Methods: Human keratinocyte cell cultures were modified to induce premature senescence using repeated sub-lethal stresses of 200 uM H2O2 or 5% OH every day for four days with two days recovery. SIPS was confirmed by senescence-associated β-galactosidase staining. Control conditions included normal, repeated stress of 500 uM H2O2 to induce apoptosis and 200 uM PBN as an anti-oxidant or free radical scavenger. Cells were irradiated with 1.5 J/cm2 on day 1 and 4 using a 648 nm diode laser (3.3 mW/cm2) and cellular responses were measured 1 h post irradiation. The affect on second messengers was assessed by measuring cAMP, cGMP, nitric oxide and intracellular calcium (Ca2+) while functional changes were assessed using cell morphology, ATP cell viability, LDH membrane integrity and WST-1 cell proliferation. Results: Results indicate an increase in NO and a decrease in cGMP and Ca2+ in 200 uM H2O2 irradiated cells while PBN irradiated cells showed a decrease in cAMP and an increase in ATP viability and cell proliferation. Conclusion: Laser irradiation influences cell signaling which ultimately changes the biological function of senescent cells. If laser therapy can stimulate the biological function of senescent cells it may be beneficial to conditions such as immune senescence, skin ageing, muscle atrophy, premature ageing of arteries in patients with advanced heart disease, neurodegenerative disorders and

  9. Repair of ultraviolet light damage to the DNA of cultured human epidermal keratinocytes and fibroblasts

    International Nuclear Information System (INIS)

    Taichman, L.B.; Setlow, R.B.

    1979-01-01

    Pure cultures of dermal fibroblasts and epidermal keroatinocytes have been obtained from a single biopsy of newborn foreskin. The cells were labeled, exposed to several doses of uv light, and allowed to repair in the dark for 16 h. The number of pyrimidine dimers before and after repair was assessed by measuring the numbers of sites in the DNA sensitive to a specific uv endonuclease. At all doses used, the extent of repair was similar in the cultured keratinocytes and cultured fibroblasts

  10. Mannosides as crucial part of bioactive supports for cultivation of human epidermal keratinocytes without feeder cells

    Czech Academy of Sciences Publication Activity Database

    Labský, Jiří; Dvořánková, B.; Smetana, Karel; Holíková, Z.; Brož, L.; Gabius, H.J.

    2003-01-01

    Roč. 24, č. 5 (2003), s. 863-872 ISSN 0142-9612 R&D Projects: GA ČR GA203/00/1310; GA MŠk LN00A065; GA MZd ND6340 Institutional research plan: CEZ:AV0Z4050913 Keywords : cell therapy * keratinocyte * mannose Subject RIV: CD - Macromolecular Chemistry Impact factor: 2.903, year: 2003

  11. Multiple biological effects of inhibitors of arachidonic acid metabolism on human keratinocytes

    Czech Academy of Sciences Publication Activity Database

    Pacherník, Jiří; Hampl, Aleš; Souček, Karel; Kovaříková, Martina; Andrysík, Zdeněk; Hofmanová, Jiřina; Kozubík, Alois

    2002-01-01

    Roč. 293, č. 12 (2002), s. 626-633 ISSN 0340-3696 R&D Projects: GA ČR GA524/99/0694; GA AV ČR IBS5004009; GA ČR GA524/98/0190 Institutional research plan: CEZ:AV0Z5004920 Keywords : lipoxygenase * keratinocytes * cell cycle Subject RIV: BO - Biophysics Impact factor: 1.452, year: 2002

  12. The influence of ions implantation on adhesion and growth of human keratinocytes

    International Nuclear Information System (INIS)

    Walachova, K.; Dvorankova, B.; Vogtova, D.; Svorcik, V.

    1999-01-01

    This work deals with the study of modification of surface of the polyethylene after ion implantation. For experiments were used the Ar + ions with energy 63 keV and Xe + ions with energy 156 keV. Some surface properties of modified layers (100 nm) and their influence on adhesion and proliferation of keratinocytes were studied. For the study of structural changes of polymer were used methods UV-VIS and FTIR spectrometry, atomic force spectroscopy

  13. Enabling a robust scalable manufacturing process for therapeutic exosomes through oncogenic immortalization of human ESC-derived MSCs

    Directory of Open Access Journals (Sweden)

    Choo Andre

    2011-04-01

    Full Text Available Abstract Background Exosomes or secreted bi-lipid vesicles from human ESC-derived mesenchymal stem cells (hESC-MSCs have been shown to reduce myocardial ischemia/reperfusion injury in animal models. However, as hESC-MSCs are not infinitely expansible, large scale production of these exosomes would require replenishment of hESC-MSC through derivation from hESCs and incur recurring costs for testing and validation of each new batch. Our aim was therefore to investigate if MYC immortalization of hESC-MSC would circumvent this constraint without compromising the production of therapeutically efficacious exosomes. Methods The hESC-MSCs were transfected by lentivirus carrying a MYC gene. The transformed cells were analyzed for MYC transgene integration, transcript and protein levels, and surface markers, rate of cell cycling, telomerase activity, karyotype, genome-wide gene expression and differentiation potential. The exosomes were isolated by HPLC fractionation and tested in a mouse model of myocardial ischemia/reperfusion injury, and infarct sizes were further assessed by using Evans' blue dye injection and TTC staining. Results MYC-transformed MSCs largely resembled the parental hESC-MSCs with major differences being reduced plastic adherence, faster growth, failure to senesce, increased MYC protein expression, and loss of in vitro adipogenic potential that technically rendered the transformed cells as non-MSCs. Unexpectedly, exosomes from MYC-transformed MSCs were able to reduce relative infarct size in a mouse model of myocardial ischemia/reperfusion injury indicating that the capacity for producing therapeutic exosomes was preserved. Conclusion Our results demonstrated that MYC transformation is a practical strategy in ensuring an infinite supply of cells for the production of exosomes in the milligram range as either therapeutic agents or delivery vehicles. In addition, the increased proliferative rate by MYC transformation reduces the time

  14. MicroRNA-4739 regulates osteogenic and adipocytic differentiation of immortalized human bone marrow stromal cells via targeting LRP3

    Directory of Open Access Journals (Sweden)

    Mona Elsafadi

    2017-04-01

    Full Text Available Understanding the regulatory networks underlying lineage differentiation and fate determination of human bone marrow stromal cells (hBMSC is a prerequisite for their therapeutic use. The goal of the current study was to unravel the novel role of the low-density lipoprotein receptor-related protein 3 (LRP3 in regulating the osteogenic and adipogenic differentiation of immortalized hBMSCs. Gene expression profiling revealed significantly higher LRP3 levels in the highly osteogenic hBMSC clone imCL1 than in the less osteogenic clone imCL2, as well as a significant upregulation of LRP3 during the osteogenic induction of the imCL1 clone. Data from functional and gene expression assays demonstrated the role of LRP3 as a molecular switch promoting hBMSC lineage differentiation into osteoblasts and inhibiting differentiation into adipocytes. Interestingly, microRNA (miRNA expression profiling identified miR-4739 as the most under-represented miRNA (−36.11 fold in imCL1 compared to imCL2. The TargetScan prediction algorithm, combined with functional and biochemical assays, identified LRP3 mRNA as a novel target of miR-4739, with a single potential binding site for miR-4739 located in the LRP3 3′ UTR. Regulation of LRP3 expression by miR-4739 was subsequently confirmed by qRT-PCR, western blotting, and luciferase assays. Over-expression of miR-4739 mimicked the effects of LRP3 knockdown on promoting adipogenic and suppressing osteogenic differentiation of hBMSCs. Hence, we report for the first time a novel biological role for the LRP3/hsa-miR-4739 axis in balancing osteogenic and adipocytic differentiation of hBMSCs. Our data support the potential utilization of miRNA-based therapies in regenerative medicine.

  15. Comparative transcriptomic profiling of hydrogen peroxide signaling networks in zebrafish and human keratinocytes: Implications toward conservation, migration and wound healing.

    Science.gov (United States)

    Lisse, Thomas S; King, Benjamin L; Rieger, Sandra

    2016-02-05

    Skin wounds need to be repaired rapidly after injury to restore proper skin barrier function. Hydrogen peroxide (H2O2) is a conserved signaling factor that has been shown to promote a variety of skin wound repair processes, including immune cell migration, angiogenesis and sensory axon repair. Despite growing research on H2O2 functions in wound repair, the downstream signaling pathways activated by this reactive oxygen species in the context of injury remain largely unknown. The goal of this study was to provide a comprehensive analysis of gene expression changes in the epidermis upon exposure to H2O2 concentrations known to promote wound repair. Comparative transcriptome analysis using RNA-seq data from larval zebrafish and previously reported microarray data from a human epidermal keratinocyte line shows that H2O2 activates conserved cell migration, adhesion, cytoprotective and anti-apoptotic programs in both zebrafish and human keratinocytes. Further assessment of expression characteristics and signaling pathways revealed the activation of three major H2O2-dependent pathways, EGF, FOXO1, and IKKα. This study expands on our current understanding of the clinical potential of low-level H2O2 for the promotion of epidermal wound repair and provides potential candidates in the treatment of wound healing deficits.

  16. Protective Effect of the Ethyl Acetate Fraction of Sargassum muticum against Ultraviolet B–Irradiated Damage in Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Jin Won Hyun

    2011-11-01

    Full Text Available The aim of this study was to investigate the cytoprotective properties of the ethyl acetate fraction of Sargassum muticum (SME against ultraviolet B (UVB-induced cell damage in human keratinocytes (HaCaT cells. SME exhibited scavenging activity toward the 1,1-diphenyl-2-picrylhydrazyl radicals and hydrogen peroxide (H2O2 and UVB-induced intracellular reactive oxygen species (ROS. SME also scavenged the hydroxyl radicals generated by the Fenton reaction (FeSO4 + H2O2, which was detected using electron spin resonance spectrometry. In addition, SME decreased the level of lipid peroxidation that was increased by UVB radiation, and restored the level of protein expression and the activities of antioxidant enzymes that were decreased by UVB radiation. Furthermore, SME reduced UVB-induced apoptosis as shown by decreased DNA fragmentation and numbers of apoptotic bodies. These results suggest that SME protects human keratinocytes against UVB-induced oxidative stress by enhancing antioxidant activity in cells, thereby inhibiting apoptosis.

  17. Response of Primary Human Bone Marrow Mesenchymal Stromal Cells and Dermal Keratinocytes to Thermal Printer Materials In Vitro.

    Science.gov (United States)

    Schmelzer, Eva; Over, Patrick; Gridelli, Bruno; Gerlach, Jörg C

    Advancement in thermal three-dimensional printing techniques has greatly increased the possible applications of various materials in medical applications and tissue engineering. Yet, potential toxic effects on primary human cells have been rarely investigated. Therefore, we compared four materials commonly used in thermal printing for bioengineering, namely thermally printed acrylonitrile butadiene styrene, MED610, polycarbonate, and polylactic acid, and investigated their effects on primary human adult skin epidermal keratinocytes and bone marrow mesenchymal stromal cells (BM-MSCs) in vitro. We investigated indirect effects on both cell types caused by potential liberation of soluble substances from the materials, and also analyzed BM-MSCs in direct contact with the materials. We found that even in culture without direct contact with the materials, the culture with MED610 (and to a lesser extent acrylonitrile butadiene styrene) significantly affected keratinocytes, reducing cell numbers and proliferation marker Ki67 expression, and increasing glucose consumption, lactate secretion, and expression of differentiation-associated genes. BM-MSCs had decreased metabolic activity, and exhibited increased cell death in direct culture on the materials. MED610 and acrylonitrile butadiene styrene induced the strongest expression of genes associated to differentiation and estrogen receptor activation. In conclusion, we found strong cell-type-specific effects of the materials, suggesting that materials for applications in regenerative medicine should be carefully selected not only based on their mechanical properties but also based on their cell-type-specific biological effects.

  18. Metabolic activation of pyrrolizidine alkaloids leading to phototoxicity and photogenotoxicity in human HaCaT keratinocytes.

    Science.gov (United States)

    Wang, Chia-Chi; Xia, Qingsu; Li, Meng; Wang, Shuguang; Zhao, Yuewei; Tolleson, William H; Yin, Jun-Jie; Fu, Peter P

    2014-01-01

    Pyrrolizidine alkaloids, produced by a large number of poisonous plants with wide global distribution, are associated with genotoxicity, tumorigenicity, and hepatotoxicity in animals and humans. Mammalian metabolism converts pyrrolizidine alkaloids to reactive pyrrolic metabolites (dehydropyrrolizidine alkaloids) that form covalent protein and DNA adducts. Although a mechanistic understanding is currently unclear, pyrrolizidine alkaloids can cause secondary (hepatogenous) photosensitization and induce skin cancer. In this study, the phototoxicity of monocrotaline, riddelliine, dehydromonocrotaline, dehydroriddelliine, and dehydroretronecine (DHR) in human HaCaT keratinocytes under ultraviolet A (UVA) irradiation was determined. UVA irradiation of HaCaT cells treated with dehydromonocrotaline, dehydroriddelline, and DHR resulted in increased release of lactate dehydrogenase and enhanced photocytotoxicity proportional to the UVA doses. UVA-induced photochemical DNA damage also increased proportionally with dehydromonocrotaline and dehydroriddelline. UVA treatment potentiated the formation of 8-hydroxy-2'-deoxyguanosine DNA adducts induced by dehydromonocrotaline in HaCaT skin keratinocytes. Using electron spin resistance trapping, we found that UVA irradiation of dehydromonocrotaline and dehydroriddelliine generates reactive oxygen species (ROS), including hydroxyl radical, singlet oxygen, and superoxide, and electron transfer reactions, indicating that cytotoxicity and genotoxicity of these compounds could be mediated by ROS. Our results suggest that dehydropyrrolizidine alkaloids formed or delivered to the skin cause pyrrolizidine alkaloid-induced secondary photosensitization and possible skin cancer.

  19. Human papillomavirus types detected in skin warts and cancer differ in their transforming properties but commonly counteract UVB induced protective responses in human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Shterzer, Naama; Heyman, Dariya; Shapiro, Beny; Yaniv, Abraham; Jackman, Anna [Department of Clinical Microbiology and Immunology, Sackler School of Medicine, Tel-Aviv University, Tel-Aviv (Israel); Serour, Francis [Department of Pediatric Surgery, The E. Wolfson Medical Center, Holon (Israel); Chaouat, Malka [Laboratory of Experimental Surgery, Hadassah University Hospital, Ein Karem, Jerusalem (Israel); Gonen, Pinhas [Department of Clinical Microbiology and Immunology, Sackler School of Medicine, Tel-Aviv University, Tel-Aviv (Israel); Tommasino, Massimo [International Agency for Research on Cancer, World Health Organization, Lyon (France); Sherman, Levana [Department of Clinical Microbiology and Immunology, Sackler School of Medicine, Tel-Aviv University, Tel-Aviv (Israel)

    2014-11-15

    In the present study, E6E7 and E6 proteins of human papillomaviruses (HPVs) associated with skin warts and cancer were compared for their transforming and carcinogenic abilities in primary human keratinocytes (PHKs). We show that E6E7 of cancer associated beta HPV types, notably 49 and 24, were able to extend the life span and enhance the clonogenic efficiency of PHKs when maintained in serum free/low calcium medium. Activities of the beta HPV E6E7 were lower than those of HPV16 E6E7. In contrast, E6 proteins from HPV types detected in skin warts or cancer, notably 10, 49 and 38, attenuated UVB induced protective responses in PHKs including cell death, proliferation arrest and accumulation of the proapoptotic proteins, p53, bax or bak. Together, this investigation revealed functional differences and commonalities between HPVs associated with skin warts and cancer, and allowed the identification of specific properties of beta HPVs supporting their involvement in skin carcinogenesis. - Highlights: • Primary keratinocytes were used to evaluate transforming and carcinogenic abilities of cutaneous HPVs. • E6E7 of cancer associated β HPV types transform primary human keratinocytes. • E6 proteins of cancer and wart associated HPVs inhibit UVB induced cell death. • E6s of cancer and wart associated HPVs attenuate UVB induced proliferation arrest. • E6s of cancer and wart associated HPVs attenuate UVB induced apoptosis signaling.

  20. Human papillomavirus types detected in skin warts and cancer differ in their transforming properties but commonly counteract UVB induced protective responses in human keratinocytes

    International Nuclear Information System (INIS)

    Shterzer, Naama; Heyman, Dariya; Shapiro, Beny; Yaniv, Abraham; Jackman, Anna; Serour, Francis; Chaouat, Malka; Gonen, Pinhas; Tommasino, Massimo; Sherman, Levana

    2014-01-01

    In the present study, E6E7 and E6 proteins of human papillomaviruses (HPVs) associated with skin warts and cancer were compared for their transforming and carcinogenic abilities in primary human keratinocytes (PHKs). We show that E6E7 of cancer associated beta HPV types, notably 49 and 24, were able to extend the life span and enhance the clonogenic efficiency of PHKs when maintained in serum free/low calcium medium. Activities of the beta HPV E6E7 were lower than those of HPV16 E6E7. In contrast, E6 proteins from HPV types detected in skin warts or cancer, notably 10, 49 and 38, attenuated UVB induced protective responses in PHKs including cell death, proliferation arrest and accumulation of the proapoptotic proteins, p53, bax or bak. Together, this investigation revealed functional differences and commonalities between HPVs associated with skin warts and cancer, and allowed the identification of specific properties of beta HPVs supporting their involvement in skin carcinogenesis. - Highlights: • Primary keratinocytes were used to evaluate transforming and carcinogenic abilities of cutaneous HPVs. • E6E7 of cancer associated β HPV types transform primary human keratinocytes. • E6 proteins of cancer and wart associated HPVs inhibit UVB induced cell death. • E6s of cancer and wart associated HPVs attenuate UVB induced proliferation arrest. • E6s of cancer and wart associated HPVs attenuate UVB induced apoptosis signaling

  1. Modulation of interferon-gamma-induced HLA-DR expression on the human keratinocyte cell line SCC-13 by ultraviolet radiation

    International Nuclear Information System (INIS)

    Khan, I.U.; Boehm, K.D.; Elmets, C.A.

    1993-01-01

    Cell surface expression of major histocompatibility determinants on epidermal keratinocytes is a characteristic feature of a number of inflammatory dermatoses and in all likelihood is caused by diffusion of human leukocyte antigen (HLA)-DR-inducing cytokines from cells present in the dermal mononuclear cell infiltrate. Many of these same disorders respond to ultraviolet (UV) radiation phototherapy. Using the human SCC-13 keratinocyte cell line as a model, UV radiation was found to inhibit interferon-gamma-induced HLA-DR expression. Inhibition correlated closely with decreased steady-state levels of HLA-DR mRNA. These findings provide evidence that the therapeutic effect of UV radiation phototherapy may be mediated by its capacity to down-regulate cytokine-induced keratinocyte HLA-DR expression. (Author)

  2. Release by ultraviolet B (u.v.B) radiation of nitric oxide (NO) from human keratinocytes: a potential role for nitric oxide in erythema production

    International Nuclear Information System (INIS)

    Deliconstantinos, G.; Villiotou, V.; Stravrides, J.C.

    1995-01-01

    The mechanism of human sunburn is poorly understood but its characteristic features include the development of erythema. In this study we attempted to determine whether human keratinocytes possess a nitric oxide (NO) synthase (NOS), if this enzyme could be activated to release NO following exposure to ultraviolet B (u.v.B) and to define whether this photo-induced response could be involved in the pathogenesis of sunburn erythema. The present results indicate that u.v.B radiation acts as a potent stimulator of NOS in keratinocytes. NO is lipophilic and may diffuse out of the keratinocytes, activating sGC in endothelial cells and neighbouring smooth muscle cells. This may be a major part of the integrated response of the skin leading to vasodilatation and erythema. (author)

  3. Immortalization of Werner syndrome and progeria fibroblasts

    International Nuclear Information System (INIS)

    Saito, H.; Moses, R.E.

    1991-01-01

    Human fibroblast cells from two different progeroid syndromes, Werner syndrome (WS) and progeria, were established as immortalized cell lines by transfection with plasmid DNA containing the SV40 early region. The lineage of each immortalized cell line was confirmed by VNTR analysis. Each of the immortalized cell lines maintained its original phenotype of slow growth. DNA repair ability of these cells was also studied by measuring sensitivity to killing by uv or the DNA-damaging drugs methyl methansulfonate, bleomycin, and cis-dichlorodiamine platinum. The results showed that both WS and progeria cells have normal sensitivity to these agents

  4. Rho kinase inhibitor Y-27632 promotes the differentiation of human bone marrow mesenchymal stem cells into keratinocyte-like cells in xeno-free conditioned medium.

    Science.gov (United States)

    Li, Zhenzhen; Han, Shichao; Wang, Xingqin; Han, Fu; Zhu, Xiongxiang; Zheng, Zhao; Wang, Hongtao; Zhou, Qin; Wang, Yunchuan; Su, Linlin; Shi, Jihong; Tang, Chaowu; Hu, Dahai

    2015-03-11

    Bone marrow mesenchymal stem cells (BMSCs), which have the ability to self-renew and to differentiate into multiple cell types, have recently become a novel strategy for cell-based therapies. The differentiation of BMSCs into keratinocytes may be beneficial for patients with burns, disease, or trauma. However, the currently available cells are exposed to animal materials during their cultivation and induction. These xeno-contaminations severely limit their clinical outcomes. Previous studies have shown that the Rho kinase (ROCK) inhibitor Y-27632 can promote induction efficiency and regulate the self-renewal and differentiation of stem cells. In the present study, we attempted to establish a xeno-free system for the differentiation of BMSCs into keratinocytes and to investigate whether Y-27632 can facilitate this differentiation. BMSCs isolated from patients were cultured by using a xeno-free system and characterised by using flow cytometric analysis and adipogenic and osteogenic differentiation assays. Human primary keratinocytes were also isolated from patients. Then, the morphology, population doubling time, and β-galactosidase staining level of these cells were evaluated in the presence or absence of Y-27632 to determine the effects of Y-27632 on the state of the keratinocytes. Keratinocyte-like cells (KLCs) were detected at different time points by immunocytofluorescence analysis. Moreover, the efficiency of BMSC differentiation under different conditions was measured by quantitative real-time-polymerase chain reaction (RT-PCR) and Western blot analyses. The ROCK inhibitor Y-27632 promoted the proliferation and lifespan of human primary keratinocytes. In addition, we showed that keratinocyte-specific markers could be detected in BMSCs cultured in a xeno-free system using keratinocyte-conditioned medium (KCM) independent of the presence of Y-27632. However, the efficiency of the differentiation of BMSCs into KLCs was significantly higher in the presence of Y

  5. MicroRNA-4739 regulates osteogenic and adipocytic differentiation of immortalized human bone marrow stromal cells via targeting LRP3

    DEFF Research Database (Denmark)

    Elsafadi, Mona; Manikandan, Muthurangan; Alajez, Nehad M

    2017-01-01

    3 (LRP3) in regulating the osteogenic and adipogenic differentiation of immortalized hBMSCs. Gene expression profiling revealed significantly higher LRP3 levels in the highly osteogenic hBMSC clone imCL1 than in the less osteogenic clone imCL2, as well as a significant upregulation of LRP3 during...

  6. Glucose metabolite glyoxal induces senescence in telomerase-immortalized human mesenchymal stem cells

    DEFF Research Database (Denmark)

    Larsen, Simon Asbjørn; Kassem, Moustapha; Rattan, Suresh

    2012-01-01

    ). Furthermore, the in vitro differentiation potential of hMSC-TERT to become functional osteoblasts was highly reduced in GO-treated stem cells, as determined by alkaline phosphatase (ALP) activity and mineralized matrix (MM) formation. Conclusions The results of our study imply that an imbalanced glucose...... physiological metabolite produced by the auto-oxidation of glucose, and can form covalent adducts known as advanced glycation endproducts (AGE). We have previously reported that GO accelerates ageing and causes premature senescence in normal human skin fibroblasts. Results Using a bone marrow-derived telomerase...

  7. Human conditionally immortalized neural stem cells improve locomotor function after spinal cord injury in the rat

    Czech Academy of Sciences Publication Activity Database

    Amemori, Takashi; Romanyuk, Nataliya; Jendelová, Pavla; Herynek, V.; Turnovcová, Karolína; Procházka, Pavel; Kapcalová, Miroslava; Cocks, G.; Price, J.; Syková, Eva

    2013-01-01

    Roč. 4, č. 3 (2013), s. 68 ISSN 1757-6512 R&D Projects: GA ČR(CZ) GAP304/12/1370; GA ČR GA13-00939S; GA MŠk LH12024; GA ČR(CZ) GBP304/12/G069 Grant - others:GA MZd(CZ) 00023001IKEM Institutional support: RVO:68378041 Keywords : human fetal neural stem cells * spinal cord injury * motor neuron differentiation Subject RIV: FH - Neurology Impact factor: 4.634, year: 2013

  8. Alterations of nitric-oxide synthase and xanthine-oxidase activities of human keratinocytes by ultraviolet-B radiation -potential role for peroxynitrite in skin inflammation

    Energy Technology Data Exchange (ETDEWEB)

    Deliconstantinos, G.; Villiotou, V.; Stavrides, J.C. [Athens Univ. (Greece). School of Medicine

    1996-06-28

    In the present study, we demonstrated that NO synthase (cNOS) and xanthine oxidase (XO) of human keratinocytes can be activated to release NO, superoxide (O-2(-)) and peroxynitrite (ONOO-) following exposure to ultraviolet B (UVB) radiation. We defined that this photo induced response may be involved in the pathogenesis of sunburn erythema and inflammation. Treatment of human keratinocytes with UVB (290-320 nm) radiation (up to 200 mJ/cm(2)) resulted in a dose-dependent increase in NO and ONOO-release that was inhibited by N-monomethyl-L-arginine (L-NMMA). NO and ONOO- release from keratinocytes was accompanied by an increase in intracellular cGMP levels. Treatment of human keratinocyte cytosol with various doses of UVB (up to 100 mJ/cm(2)) resulted in an increase in XO activity that was inhibited by oxypurinol. In in vivo experiments, when experimental animals were subjected to UVB radiation, a protection factor (PF) of 6.5 {+-} 1.8 was calculated when an emulsified cream formulation containing nitro-L-arginine (L-NA) (2%) and L-NMMA (2%) was applied to their skin. The present study indicates that UVB radiation acts as a potent stimulator of cNOS and XO activities in human keratinocytes. NO and ONOO- may exert cytotoxic effects in keratinocytes themselves, as well as in their neighbouring endothelial and smooth muscle cells. This may be a major part of the integrated response leading to erythema production and the inflammation process. (UK).

  9. Alterations of nitric-oxide synthase and xanthine-oxidase activities of human keratinocytes by ultraviolet-B radiation -potential role for peroxynitrite in skin inflammation

    International Nuclear Information System (INIS)

    Deliconstantinos, G.; Villiotou, V.; Stavrides, J.C.

    1996-01-01

    In the present study, we demonstrated that NO synthase (cNOS) and xanthine oxidase (XO) of human keratinocytes can be activated to release NO, superoxide (O-2(-)) and peroxynitrite (ONOO-) following exposure to ultraviolet B (UVB) radiation. We defined that this photo induced response may be involved in the pathogenesis of sunburn erythema and inflammation. Treatment of human keratinocytes with UVB (290-320 nm) radiation (up to 200 mJ/cm(2)) resulted in a dose-dependent increase in NO and ONOO-release that was inhibited by N-monomethyl-L-arginine (L-NMMA). NO and ONOO- release from keratinocytes was accompanied by an increase in intracellular cGMP levels. Treatment of human keratinocyte cytosol with various doses of UVB (up to 100 mJ/cm(2)) resulted in an increase in XO activity that was inhibited by oxypurinol. In in vivo experiments, when experimental animals were subjected to UVB radiation, a protection factor (PF) of 6.5 ± 1.8 was calculated when an emulsified cream formulation containing nitro-L-arginine (L-NA) (2%) and L-NMMA (2%) was applied to their skin. The present study indicates that UVB radiation acts as a potent stimulator of cNOS and XO activities in human keratinocytes. NO and ONOO- may exert cytotoxic effects in keratinocytes themselves, as well as in their neighbouring endothelial and smooth muscle cells. This may be a major part of the integrated response leading to erythema production and the inflammation process. (UK)

  10. The E5 protein of human papillomavirus type 16 perturbs MHC class II antigen maturation in human foreskin keratinocytes treated with interferon-γ

    International Nuclear Information System (INIS)

    Zhang Benyue; Li Ping; Wang Exing; Brahmi, Zacharie; Dunn, Kenneth W.; Blum, Janice S.; Roman, Ann

    2003-01-01

    Major histocompatibility complex (MHC) class II antigens are expressed on human foreskin keratinocytes (HFKs) following exposure to interferon gamma. The expression of MHC class II proteins on the cell surface may allow keratinocytes to function as antigen-presenting cells and induce a subsequent immune response to virus infection. Invariant chain (Ii) is a chaperone protein which plays an important role in the maturation of MHC class II molecules. The sequential degradation of Ii within acidic endocytic compartments is a key process required for the successful loading of antigenic peptide onto MHC class II molecules. Since human papillomavirus (HPV) 16 E5 can inhibit the acidification of late endosomes in HFKs, the E5 protein may be able to affect proper peptide loading onto the MHC class II molecule. To test this hypothesis, HFKs were infected with either control virus or a recombinant virus expressing HPV16 E5 and the infected cells were subsequently treated with interferon-γ. ELISAs revealed a decrease of MHC class II expression on the surface of E5-expressing cells compared with control virus-infected cells after interferon treatment. Western blot analysis showed that, in cells treated with interferon gamma, E5 could prevent the breakdown of Ii and block the formation of peptide-loaded, SDS-stable mature MHC class II dimers, correlating with diminished surface MHC class II expression. These data suggest that HPV16 E5 may be able to decrease immune recognition of infected keratinocytes via disruption of MHC class II protein function

  11. Strain-dependent augmentation of tight-junction barrier function in human primary epidermal keratinocytes by Lactobacillus and Bifidobacterium lysates.

    Science.gov (United States)

    Sultana, Reshma; McBain, Andrew J; O'Neill, Catherine A

    2013-08-01

    In this study, we investigated whether probiotic lysates can modify the tight-junction function of human primary keratinocytes. The keratinocytes were grown on cell culture inserts and treated with lysates from Bifidobacterium longum, Lactobacillus plantarum, Lactobacillus reuteri, Lactobacillus fermentum, or Lactobacillus rhamnosus GG. With the exception of L. fermentum (which decreased cell viability), all strains markedly enhanced tight-junction barrier function within 24 h, as assessed by measurements of transepithelial electrical resistance (TEER). However, B. longum and L. rhamnosus GG were the most efficacious, producing dose-dependent increases in resistance that were maintained for 4 days. These increases in TEER correlated with elevated expression of tight-junction protein components. Neutralization of Toll-like receptor 2 abolished both the increase in TEER and expression of tight-junction proteins induced by B. longum, but not L. rhamnosus GG. These data suggest that some bacterial strains increase tight-junction function via modulation of protein components but the different pathways involved may vary depending on the bacterial strain.

  12. Basement membrane reconstruction in human skin equivalents is regulated by fibroblasts and/or exogenously activated keratinocytes.

    Science.gov (United States)

    El Ghalbzouri, Abdoelwaheb; Jonkman, Marcel F; Dijkman, Remco; Ponec, Maria

    2005-01-01

    This study was undertaken to examine the role fibroblasts play in the formation of the basement membrane (BM) in human skin equivalents. For this purpose, keratinocytes were seeded on top of fibroblast-free or fibroblast-populated collagen matrix or de-epidermized dermis and cultured in the absence of serum and exogenous growth factors. The expression of various BM components was analyzed on the protein and mRNA level. Irrespective of the presence or absence of fibroblasts, keratin 14, hemidesmosomal proteins plectin, BP230 and BP180, and integrins alpha1beta1, alpha2beta1, alpha3beta1, and alpha6beta4 were expressed but laminin 1 was absent. Only in the presence of fibroblasts or of various growth factors, laminin 5 and laminin 10/11, nidogen, uncein, type IV and type VII collagen were decorating the dermal/epidermal junction. These findings indicate that the attachment of basal keratinocytes to the dermal matrix is most likely mediated by integrins alpha1beta1 and alpha2beta1, and not by laminins that bind to integrin alpha6beta4 and that the epithelial-mesenchymal cross-talk plays an important role in synthesis and deposition of various BM components.

  13. Cytoskeleton and pericellular matrix organization of pure adult human keratinocytes cultured from suction-blister roof epidermis.

    Science.gov (United States)

    Kariniemi, A L; Lehto, V P; Vartio, T; Virtanen, I

    1982-12-01

    Pure adult human keratinocyte cultures were raised from suction-blister roof epidermis and cultured in MCDB-151 medium. In primary culture the epidermal cells rapidly adhered, spread and began to proliferate on collagen-coated growth substrata but not on uncoated plastic or glass substrata. A fibrillar keratin-specific fluorescence, showing a typical cell-cell arrangement, was seen in all cells in indirect immunofluorescence microscopy, whereas only some cells also showed vimentin-specific staining. A fine fibrillar fibronectin-specific surface staining was seen at the margin of attaching cells and in marginal cells of spreading cell islands, whereas no fluorescence could be seen in epidermal cells, with antibodies against type IV collagen or laminin. Interestingly, the marginal cells also showed intracellular fibronectin. The synthesis of fibronectin in epidermal cell cultures could also be revealed by metabolic labelling experiments with [35S]methionine. In contrast to primary cultures, subcultivated keratinocytes also adhered to uncoated plastic and glass substrata. After subcultivation, keratin and surface fibronectin distribution remained unaltered but after some subcultivations, most of the cells also showed fibrillar vimentin and expressed fibronectin intracellularly. The results show that the suction-blister method provides an easy way to obtain pure epidermal cell cultures without contaminating mesenchymal cells. Our results also suggest a direct role for fibronectin but not for collagen type IV or laminin in adhesion and spreading of epidermal cells in vitro.

  14. Interleukin 22 early affects keratinocyte differentiation, but not proliferation, in a three-dimensional model of normal human skin

    Energy Technology Data Exchange (ETDEWEB)

    Donetti, Elena, E-mail: elena.donetti@unimi.it [Department of Biomedical Sciences for Health, Università degli Studi di Milano, 20133 Milan (Italy); Cornaghi, Laura; Arnaboldi, Francesca; Landoni, Federica [Department of Biomedical Sciences for Health, Università degli Studi di Milano, 20133 Milan (Italy); Romagnoli, Paolo [Department of Experimental and Clinical Medicine, Università degli Studi di Firenze, 50125 Florence (Italy); Mastroianni, Nicolino [Department of Biomedical Sciences for Health, Università degli Studi di Milano, 20133 Milan (Italy); Pescitelli, Leonardo [Department of Surgery and Translational Medicine, Università degli Studi di Firenze, 50125 Florence (Italy); Baruffaldi Preis, Franz W. [I.R.C.C.S. Istituto Ortopedico Galeazzi, 20161 Milan (Italy); Prignano, Francesca [Department of Surgery and Translational Medicine, Università degli Studi di Firenze, 50125 Florence (Italy)

    2016-07-15

    Interleukin (IL)-22 is a pro-inflammatory cytokine driving the progression of the psoriatic lesion with other cytokines, as Tumor Necrosis Factor (TNF)-alpha and IL-17. Our study was aimed at evaluating the early effect of IL-22 alone or in combination with TNF-alpha and IL-17 by immunofluorescence on i) keratinocyte (KC) proliferation, ii) terminal differentiation biomarkers as keratin (K) 10 and 17 expression, iii) intercellular junctions. Transmission electron microscopy (TEM) analysis was performed. A model of human skin culture reproducing a psoriatic microenvironment was used. Plastic surgery explants were obtained from healthy young women (n=7) after informed consent. Fragments were divided before adding IL-22 or a combination of the three cytokines, and harvested 24 (T24), 48 (T48), and 72 (T72) h later. From T24, in IL-22 samples we detected a progressive decrease in K10 immunostaining in the spinous layer paralleled by K17 induction. By TEM, after IL-22 incubation, keratin aggregates were evident in the perinuclear area. Occludin immunostaining was not homogeneously distributed. Conversely, KC proliferation was not inhibited by IL-22 alone, but only by the combination of cytokines. Our results suggest that IL-22 affects keratinocyte terminal differentiation, whereas, in order to induce a proliferation impairment, a more complex psoriatic-like microenvironment is needed.

  15. Interleukin 22 early affects keratinocyte differentiation, but not proliferation, in a three-dimensional model of normal human skin

    International Nuclear Information System (INIS)

    Donetti, Elena; Cornaghi, Laura; Arnaboldi, Francesca; Landoni, Federica; Romagnoli, Paolo; Mastroianni, Nicolino; Pescitelli, Leonardo; Baruffaldi Preis, Franz W.; Prignano, Francesca

    2016-01-01

    Interleukin (IL)-22 is a pro-inflammatory cytokine driving the progression of the psoriatic lesion with other cytokines, as Tumor Necrosis Factor (TNF)-alpha and IL-17. Our study was aimed at evaluating the early effect of IL-22 alone or in combination with TNF-alpha and IL-17 by immunofluorescence on i) keratinocyte (KC) proliferation, ii) terminal differentiation biomarkers as keratin (K) 10 and 17 expression, iii) intercellular junctions. Transmission electron microscopy (TEM) analysis was performed. A model of human skin culture reproducing a psoriatic microenvironment was used. Plastic surgery explants were obtained from healthy young women (n=7) after informed consent. Fragments were divided before adding IL-22 or a combination of the three cytokines, and harvested 24 (T24), 48 (T48), and 72 (T72) h later. From T24, in IL-22 samples we detected a progressive decrease in K10 immunostaining in the spinous layer paralleled by K17 induction. By TEM, after IL-22 incubation, keratin aggregates were evident in the perinuclear area. Occludin immunostaining was not homogeneously distributed. Conversely, KC proliferation was not inhibited by IL-22 alone, but only by the combination of cytokines. Our results suggest that IL-22 affects keratinocyte terminal differentiation, whereas, in order to induce a proliferation impairment, a more complex psoriatic-like microenvironment is needed.

  16. Evaluation of the effect of radiation levels and dose rates in irradiation of murine fibroblasts used as a feeder layer in the culture of human keratinocytes

    International Nuclear Information System (INIS)

    Yoshito, Daniele; Almeida, Tiago L.; Santin, Stefany Plumeri; Somessari, Elizabeth S.R.; Silveira, Carlos G. da; Mathor, Monica B.; Altran, Silvana C.; Isaac, Cesar

    2009-01-01

    In 1975, Rheinwald and Green published an effective methodology for obtaining and cultivating human keratinocytes. This methodology consisted of seeding keratinocytes onto a feeder layer composed of lineage 3T3 murine fibroblasts, the proliferation rate of which is then controlled through the action of ionizing radiation. The presence of the feeder layer encourages the development of keratinocyte colonies and their propagation in similar cultures, becoming possible several clinical applications as skin substitutes or wound dressings in situations such as post burn extensive skin loss and other skin disorders. However, good development of these keratinocytes depends on a high quality feeder layer among other factors. In the present work, we evaluated the relationship between radiation levels and dose rates applied to fibroblasts used in construction of feeder layers and the radiation effect on keratinocytes colonies forming efficiency. Results indicate 3T3 lineage murine fibroblasts irradiated with doses varying between 60 and 100 Gy can be used as a feeder layer immediately after irradiation or storage of the irradiated cells in suspension at 4 g C for 24 hours with similar results. The exception is when the irradiation dose rate is 2.75 Gyh -1 ; in this case, results suggested that the fibroblasts should be used immediately after irradiation. (author)

  17. IFI16 and cGAS cooperate in the activation of STING during DNA sensing in human keratinocytes.

    Science.gov (United States)

    Almine, Jessica F; O'Hare, Craig A J; Dunphy, Gillian; Haga, Ismar R; Naik, Rangeetha J; Atrih, Abdelmadjid; Connolly, Dympna J; Taylor, Jordan; Kelsall, Ian R; Bowie, Andrew G; Beard, Philippa M; Unterholzner, Leonie

    2017-02-13

    Many human cells can sense the presence of exogenous DNA during infection though the cytosolic DNA receptor cyclic GMP-AMP synthase (cGAS), which produces the second messenger cyclic GMP-AMP (cGAMP). Other putative DNA receptors have been described, but whether their functions are redundant, tissue-specific or integrated in the cGAS-cGAMP pathway is unclear. Here we show that interferon-γ inducible protein 16 (IFI16) cooperates with cGAS during DNA sensing in human keratinocytes, as both cGAS and IFI16 are required for the full activation of an innate immune response to exogenous DNA and DNA viruses. IFI16 is also required for the cGAMP-induced activation of STING, and interacts with STING to promote STING phosphorylation and translocation. We propose that the two DNA sensors IFI16 and cGAS cooperate to prevent the spurious activation of the type I interferon response.

  18. The human keratinocyte two-dimensional protein database (update 1994): towards an integrated approach to the study of cell proliferation, differentiation and skin diseases

    DEFF Research Database (Denmark)

    Celis, J E; Rasmussen, H H; Olsen, E

    1994-01-01

    The master two-dimensional (2-D) gel database of human keratinocytes currently lists 3087 cellular proteins (2168 isoelectric focusing, IEF; and 919 none-quilibrium pH gradient electrophoresis, NEPHGE), many of which correspond to posttranslational modifications, 890 polypeptides have been...... in the database. We also report a database of proteins recovered from the medium of noncultured, unfractionated keratinocytes. This database lists 398 polypeptides (309 IEF; 89 NEPHGE) of which 76 have been identified. The aim of the comprehensive databases is to gather, through a systematic study...

  19. Non-thermal Plasma Activates Human Keratinocytes by Stimulation of Antioxidant and Phase II Pathways

    Science.gov (United States)

    Schmidt, Anke; Dietrich, Stephan; Steuer, Anna; Weltmann, Klaus-Dieter; von Woedtke, Thomas; Masur, Kai; Wende, Kristian

    2015-01-01

    Non-thermal atmospheric pressure plasma provides a novel therapeutic opportunity to control redox-based processes, e.g. wound healing, cancer, and inflammatory diseases. By spatial and time-resolved delivery of reactive oxygen and nitrogen species, it allows stimulation or inhibition of cellular processes in biological systems. Our data show that both gene and protein expression is highly affected by non-thermal plasma. Nuclear factor erythroid-related factor 2 (NRF2) and phase II enzyme pathway components were found to act as key controllers orchestrating the cellular response in keratinocytes. Additionally, glutathione metabolism, which is a marker for NRF2-related signaling events, was affected. Among the most robustly increased genes and proteins, heme oxygenase 1, NADPH-quinone oxidoreductase 1, and growth factors were found. The roles of NRF2 targets, investigated by siRNA silencing, revealed that NRF2 acts as an important switch for sensing oxidative stress events. Moreover, the influence of non-thermal plasma on the NRF2 pathway prepares cells against exogenic noxae and increases their resilience against oxidative species. Via paracrine mechanisms, distant cells benefit from cell-cell communication. The finding that non-thermal plasma triggers hormesis-like processes in keratinocytes facilitates the understanding of plasma-tissue interaction and its clinical application. PMID:25589789

  20. Expression of the helix-loop-helix protein inhibitor of DNA binding-1 (ID-1) is activated by all-trans retinoic acid in normal human keratinocytes

    International Nuclear Information System (INIS)

    Villano, C.M.; White, L.A.

    2006-01-01

    The ID (inhibitor of differentiation or DNA binding) helix-loop-helix proteins are important mediators of cellular differentiation and proliferation in a variety of cell types through regulation of gene expression. Overexpression of the ID proteins in normal human keratinocytes results in extension of culture lifespan, indicating that these proteins are important for epidermal differentiation. Our hypothesis is that the ID proteins are targets of the retinoic acid signaling pathway in keratinocytes. Retinoids, vitamin A analogues, are powerful regulators of cell growth and differentiation and are widely used in the prevention and treatment of a variety of cancers in humans. Furthermore, retinoic acid is necessary for the maintenance of epithelial differentiation and demonstrates an inhibitory action on skin carcinogenesis. We examined the effect of all-trans retinoic acid on expression of ID-1, -2, -3, and -4 in normal human keratinocytes and found that exposure of these cells to all-trans retinoic acid causes an increase in both ID-1 and ID-3 gene expression. Furthermore, our data show that this increase is mediated by increased transcription involving several cis-acting elements in the distal portion of the promoter, including a CREB-binding site, an Egr1 element, and an YY1 site. These data demonstrate that the ID proteins are direct targets of the retinoic acid signaling pathway. Given the importance of the ID proteins to epidermal differentiation, these results suggest that IDs may be mediating some of the effects of all-trans retinoic acid in normal human keratinocytes

  1. Induction of interleukin-6 production by ultraviolet radiation in normal human epidermal keratinocytes and in a human keratinocyte cell line is mediated by DNA damage

    NARCIS (Netherlands)

    Petit-Frère, C.; Clingen, P.H.; Grewe, M.; Krutmann, J.; Roza, L.; Arlett, C.F.; Green, M.H.L.

    1998-01-01

    The sunburn reaction is the most common consequence of human exposure to ultraviolet radiation (UVR), and is mediated at least in part by interleukin- 6 (IL-6). The aim of this study was to determine if DNA is a major chromophore involved in the induction of IL-6 following UV irradiation of a human

  2. Isolation and Characterization of Exosome from Human Embryonic Stem Cell-Derived C-Myc-Immortalized Mesenchymal Stem Cells.

    Science.gov (United States)

    Lai, Ruenn Chai; Yeo, Ronne Wee Yeh; Padmanabhan, Jayanthi; Choo, Andre; de Kleijn, Dominique P V; Lim, Sai Kiang

    2016-01-01

    Mesenchymal stem cells (MSC) are currently the cell type of choice in many cell therapy trials. The number of therapeutic applications for MSCs registered as product IND submissions with the FDA and initiation of registered clinical trials has increased substantially in recent years, in particular between 2006 and 2012. However, defined mechanisms of action underpinning the therapeutic efficacy of MSCs are lacking, but they are increasingly attributed to MSC trophic secretion rather than their differentiation potential. A promising secreted therapeutic candidate is an extracellular vesicle (EV) known as the exosome. The use of exosomes instead of cells as a therapeutic agent provides several advantages. A critical advantage is the prospect of a conventional pharmaceutical manufacturing process that is highly scalable and amenable to the stringent manufacturing process. For example, MSCs used as producers of therapeutics, and not as therapeutics per se, could be immortalized to generate infinitely expansible clonal lines to enhance the reproducible production of therapeutic exosomes. In this chapter, we will describe the immortalization of MSCs, and the production, isolation, and characterization of exosomes from immortalized MSC.

  3. The human keratinocyte two-dimensional gel protein database (update 1995): mapping components of signal transduction pathways

    DEFF Research Database (Denmark)

    Celis, J E; Rasmussen, H H; Gromov, P

    1995-01-01

    identified (protein name, organelle components, etc.) using a procedure or a combination of procedures that include (i) comigration with known human proteins, (ii) 2-D gel immunoblotting using specific antibodies, (iii) microsequencing of Coomassie Brilliant Blue stained proteins, (iv) mass spectrometry, (v......)vaccinia virus expression of full length cDNAs, and (vi) in vitro transcription/translation of full-length cDNAs. This year, special emphasis has been given to the identification of signal transduction components by using 2-D gel immunoblotting of crude keratinocyte lysates in combination with enhanced......--through a systematic study of ekeratinocytes--qualitative and quantitative information on proteins and their genes that may allow us to identify abnormal patterns of gene expression and to pinpoint signaling pathways and components affected in various skin diseases, cancer included. Udgivelsesdato: 1995-Dec...

  4. Triggering Apoptotic Death of Human Epidermal Keratinocytes by Malic Acid: Involvement of Endoplasmic Reticulum Stress- and Mitochondria-Dependent Signaling Pathways

    Directory of Open Access Journals (Sweden)

    Yu-Ping Hsiao

    2015-01-01

    Full Text Available Malic acid (MA has been commonly used in cosmetic products, but the safety reports in skin are sparse. To investigate the biological effects of MA in human skin keratinocytes, we investigated the potential cytotoxicity and apoptotic effects of MA in human keratinocyte cell lines (HaCaT. The data showed that MA induced apoptosis based on the observations of DAPI staining, DNA fragmentation, and sub-G1 phase in HaCaT cells and normal human epidermal keratinocytes (NHEKs. Flow cytometric assays also showed that MA increased the production of mitochondrial superoxide (mito-SOX but decreased the mitochondrial membrane potential. Analysis of bioenergetics function with the XF 24 analyzer Seahorse extracellular flux analyzer demonstrated that oxygen consumption rate (OCR was significantly decreased whereas extracellular acidification rate (ECAR was increased in MA-treated keratinocytes. The occurrence of apoptosis was proved by the increased expressions of FasL, Fas, Bax, Bid, caspases-3, -8, -9, cytochrome c, and the declined expressions of Bcl-2, PARP. MA also induced endoplasmic reticulum stress associated protein expression such as GRP78, GADD153, and ATF6α. We demonstrated that MA had anti-proliferative effect in HaCaT cell through the inhibition of cell cycle progression at G0/G1, and the induction of programmed cell death through endoplasmic reticulum stress- and mitochondria-dependent pathways.

  5. Changes in localization of human discs large (hDlg) during keratinocyte differentiation is associated with expression of alternatively spliced hDlg variants

    International Nuclear Information System (INIS)

    Roberts, S.; Calautti, E.; Vanderweil, S.; Nguyen, H.O.; Foley, A.; Baden, H.P.; Viel, A.

    2007-01-01

    Alternative spliced variants of the human discs large (hDlg) tumour suppressor are characterized by combinations of insertions. Here, using insertions I2- and I3-specific antibodies, we show that I2 and I3 variants have distinct distributions in epidermal and cervical epithelia. In skin and cervix, I3 variants are found in the cytoplasm. Cytoplasmic localization of I3 variants decreases as cervical keratinocytes differentiate, concomitant with relocalization to the cell periphery. I2 variants are found at the cell periphery of differentiated epidermal and cervical keratinocytes. Nuclear localization of I2 variants was evident in both tissues, with concentration of nuclear I2 variants in basal and parabasal cervical keratinocytes. A prominent nuclear localization of hDlg in cells of hyperproliferative layers of psoriatic lesions, but not in mature differentiated keratinocytes, together with I2 redistribution in differentiating keratinocytes, suggests that nuclear hDlg functions may be pertinent to growth of undifferentiated cells. Supporting our findings in squamous tissues, a decrease of nuclear hDlg and an increase of membrane-bound and cytoplasmic hDlg upon calcium-induced keratinocyte differentiation were not concomitant processes. Furthermore, we confirm that the exit of I2 variants from the nucleus is linked to stimulation of epithelial differentiation. The dynamic redistribution of hDlg also correlated with a marked increase in the expression of I3 variants while the level of I2 variants showed only a moderate decrease. Because changes in the intracellular distribution of hDlg splice variants, and in their expression levels, correlate with changes in differentiation state we hypothesize that the different hDlg isoforms play distinct roles at various stages of epithelial differentiation

  6. [14C]mechlorethamine binding to proteins of the human keratinocyte

    International Nuclear Information System (INIS)

    Deaton, M.A.; Jones, G.P.; Bowman, P.D.

    1990-01-01

    Much mustard agent research has focused on mustard/DNA interactions. Mustard also interacts with proteins, however, and to reach the DNA any agent must first pass through the cytoplasm. We hypothesized that the cell's proteins would covalently bind mustard, and thereby limit its access to the DNA. Keratinocyte proteins were radiolabeled with [ 14 C]mechlorethamine and separated by electrophoresis. The banding patterns that resulted were made visible on x-ray films, then compared with control patterns. A correspondence of almost one-to-one was observed, which supports the hypothesis that many cellular proteins are susceptible to mustard alkylation. It follows that some mustard symptoms probably result from effects on existing proteins

  7. Human T-Lymphotropic virus (HTLV type I in vivo integration in oral keratinocytes

    Directory of Open Access Journals (Sweden)

    Martha C Domínguez

    2011-03-01

    Full Text Available Although the infection of HTLV-1 to cell components of the mouth have been previously reported, there was not until this report, a detailed study to show the characteristics of such infection. From 14 Tropical Spastic Paraparesis/ HTLV-1-Associated Myelopathy (HAM/TSP patients and 11 asymptomatic carrier individuals (AC coming from HTLV-1 endemic areas of southwest Pacific of Colombia, infected oral mucosa cells were primary cultured during five days. These cell cultures were immunophenotyped by dual color fluorescence cell assortment using different lymphocyte CD markers and also were immunohistochemically processed using a polyclonal anti-keratin antibody. Five days old primary cultures were characterized as oral keratinocytes, whose phenotype was CD3- /CD4-/CD8-/CD19-/CD14-/CD45-/A575-keratin+. From DNA extracted of primary cultures LTR, pol, env and tax HTLV-1 proviral DNA regions were differentially amplified by PCR showing proviral integration. Using poly A+ RNA obtained of these primary cultures, we amplify by RT-PCR cDNA of tax and pol in 57.14% (8/14 HAM/TSP patients and 27.28% (3/11 AC. Tax and pol poly A+ RNA were expressed only in those sIgA positive subjects. Our results showed that proviral integration and viral gene expression in oral keratinocytes are associated with a HTLV-1 specific local mucosal immune response only in those HTLV-1 infected individuals with detectable levels of sIgA in their oral fluids. Altogether the results gave strong evidence that oral mucosa infection would be parte of the systemic spreading of HTLV-1 infection.

  8. Effects of bee venom against Propionibacterium acnes-induced inflammation in human keratinocytes and monocytes.

    Science.gov (United States)

    Kim, Jung-Yeon; Lee, Woo-Ram; Kim, Kyung-Hyun; An, Hyun-Jin; Chang, Young-Chae; Han, Sang-Mi; Park, Yoon-Yub; Pak, Sok Cheon; Park, Kwan-Kyu

    2015-06-01

    Propionibacterium acnes (P. acnes) cause inflammatory acne and play an important role in the pathogenesis of acne by inducing inflammatory mediators. P. acnes contributes to the inflammatory responses of acne by activating inflammatory cells, keratinocytes and sebocytes to secrete pro-inflammatory cytokines such as tumor necrosis factor-α (TNF-α), interleukin (IL)-1β and IL-8. Bee venom has traditionally been used in the treatment of certain immune-related diseases. However, there has not yet been a robust trial to prove the therapeutic effect of bee venom in skin inflammation. The aim of the present study was to investigate anti-inflammatory properties of bee venom in skin inflammation induced by P. acnes using keratinocytes (HaCaT) and monocytes (THP-1). P. acnes is known to stimulate the production of pro-inflammatory cytokines such as IL-1, IL-8, IL-12 and TNF-α. In the present study, the production of interferon-γ (IFN-γ), IL-1β, IL-8 and TNF-α was increased by P. acnes treatment in HaCaT and THP-1 cells. By contrast, bee venom effectively inhibited the secretion of IFN-γ, IL-1β, IL-8 and TNF-α. Furthermore, P. acnes treatment activated the expression of IL-8 and toll-like receptor 2 (TLR2) in HaCaT cells. However, bee venom inhibited the expression of IL-8 and TLR2 in heat-killed P. acnes. Based on these results, it is concluded that bee venom has an effective anti-inflammatory activity against P. acnes in HaCaT and THP-1 cells. Therefore, we suggest that bee venom is an alternative treatment to antibiotic therapy of acne.

  9. Incoming human papillomavirus 16 genome is lost in PML protein-deficient HaCaT keratinocytes.

    Science.gov (United States)

    Bienkowska-Haba, Malgorzata; Luszczek, Wioleta; Keiffer, Timothy R; Guion, Lucile G M; DiGiuseppe, Stephen; Scott, Rona S; Sapp, Martin

    2017-05-01

    Human papillomaviruses (HPVs) target promyelocytic leukemia (PML) nuclear bodies (NBs) during infectious entry and PML protein is important for efficient transcription of incoming viral genome. However, the transcriptional down regulation was shown to be promoter-independent in that heterologous promoters delivered by papillomavirus particles were also affected. To further investigate the role of PML protein in HPV entry, we used small hairpin RNA to knockdown PML protein in HaCaT keratinocytes. Confirming previous findings, PML knockdown in HaCaT cells reduced HPV16 transcript levels significantly following infectious entry without impairing binding and trafficking. However, when we quantified steady-state levels of pseudogenomes in interphase cells, we found strongly reduced genome levels compared with parental HaCaT cells. Because nuclear delivery was comparable in both cell lines, we conclude that viral pseudogenome must be removed after successful nuclear delivery. Transcriptome analysis by gene array revealed that PML knockdown in clonal HaCaT cells was associated with a constitutive interferon response. Abrogation of JAK1/2 signaling prevented genome loss, however, did not restore viral transcription. In contrast, knockdown of PML protein in HeLa cells did not affect HPV genome delivery and transcription. HeLa cells are transformed by HPV18 oncogenes E6 and E7, which have been shown to interfere with the JAK/Stat signaling pathway. Our data imply that PML NBs protect incoming HPV genomes. Furthermore, they provide evidence that PML NBs are key regulators of the innate immune response in keratinocytes. Promyelocytic leukemia nuclear bodies (PML NBs) are important for antiviral defense. Many DNA viruses target these subnuclear structures and reorganize them. Reorganization of PML NBs by viral proteins is important for establishment of infection. In contrast, HPVs require the presence of PML protein for efficient transcription of incoming viral genome. Our

  10. Establishment of a new immortalized human corneal epithelial cell line (iHCE-NY1) for use in evaluating eye irritancy by in vitro test methods.

    Science.gov (United States)

    Yamamoto, Naoki; Kato, Yoshinao; Sato, Atsushi; Hiramatsu, Noriko; Yamashita, Hiromi; Ohkuma, Mahito; Miyachi, Ei-Ichi; Horiguchi, Masayuki; Hirano, Koji; Kojima, Hajime

    2016-08-01

    In vitro test methods that use human corneal epithelial cells to evaluate the eye irritation potency of chemical substances do not use human corneal epithelium because it has been difficult to maintain more than four passages. In this study, we make a new cell line comprising immortalized human corneal epithelial cells (iHCE-NY1). The IC50 of iHCE-NY1 cells is slightly higher than that of Statens Seruminstitut Rabbit Cornea (SIRC) cells, which are currently used in some in vitro test methods. CDKN1A in iHCE-NY1 cells was used as a marker of gene expression to indicate cell cycle activity. This enabled us to evaluate cell recovery characteristics at concentrations lower than the IC50 of cytotoxic tests.

  11. GATA3 is a master regulator of the transcriptional response to low-dose ionizing radiation in human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Bonin, F.; Molina, M.; Berthier-Vergnes, O.; Lamartine, J. [Universite de Lyon, Lyon, F-69003 (France); Universite Lyon 1, Lyon, F-69003 (France); CNRS, UMR5534, Centre de Genetique Moleculaire et Cellulaire, Villeurbanne, F-69622 (France); Malet, C.; Ginestet, C. [Centre Leon Berard, Service de Radiotherapie, Lyon F-69008 (France); Martin, M.T. [Laboratoire de Genomique et Radiobiologie de la Keratinopoiese, CEA, IRCM, Evry F-91000 (France)

    2009-07-01

    Background: The general population is constantly exposed to low levels of radiation through natural, occupational or medical irradiation. Even if the biological effects of low-level radiation have been intensely debated and investigated, the molecular mechanisms underlying the cellular response to low doses remain largely unknown. Results: The present study investigated the role of GATA3 protein in the control of the cellular and molecular response of human keratinocytes exposed to a 1 cGy dose of X-rays. Chromatin immunoprecipitation showed GATA3 to be able to bind the promoter of 4 genes responding to a 1 cGy exposure. To go further into the role of GATA3 after ionizing radiation exposure, we studied the cellular and molecular consequences of radiation in GATA3 knock-down cells. Knockdown was obtained by lentiviral-mediated expression of an shRNA targeting the GATA3 transcript in differentiated keratinocytes. First, radiosensitivity was assessed: the toxicity, in terms of immediate survival (with XTT test), associated with 1 cGy radiation was found to be increased in GATA3 knock-down cells. The impact of GATA3 knock-down on the transcriptome of X-ray irradiated cells was also investigated, using oligonucleotide micro-arrays to assess changes between 3 h and 72 h post-irradiation in normal vs GATA3 knock-down backgrounds; transcriptome response was found to be completely altered in GATA3 knock-down cells, with a strong induction/repression peak 48 h after irradiation. Functional annotation revealed enrichment in genes known to be involved in chaperone activity, TGF{beta} signalling and stress response. Conclusion: Taken together, these data indicate that GATA3 is an important regulator of the cellular and molecular response of epidermal cells to very low doses of radiation. (authors)

  12. Osteo-/odontogenic differentiation of induced mesenchymal stem cells generated through epithelial-mesenchyme transition of cultured human keratinocytes.

    Science.gov (United States)

    Yi, Jin-Kyu; Mehrazarin, Shebli; Oh, Ju-Eun; Bhalla, Anu; Oo, Jenessa; Chen, Wei; Lee, Min; Kim, Reuben H; Shin, Ki-Hyuk; Park, No-Hee; Kang, Mo K

    2014-11-01

    Revascularization of necrotic pulp has been successful in the resolution of periradicular inflammation; yet, several case studies suggest the need for cell-based therapies using mesenchymal stem cells (MSCs) as an alternative for de novo pulp regeneration. Because the availability of MSCs may be limited, especially in an aged population, the current study reports an alternative approach in generating MSCs from epidermal keratinocytes through a process called epithelial-mesenchymal transition (EMT). We induced EMT in primary normal human epidermal keratinocytes (NHEKs) by transient transfection of small interfering RNA targeting the p63 gene. The resulting cells were assayed for their mesenchymal marker expression, proliferation capacities as a monolayer and in a 3-dimensional collagen scaffold, and differentiation capacities. Transient transfection of p63 small-interfering RNA successfully abolished the expression of endogenous p63 in NHEKs and induced the expression of mesenchymal markers (eg, vimentin and fibronectin), whereas epithelial markers (eg, E-cadherin and involucrin) were lost. The NHEKs exhibiting the EMT phenotype acquired extended replicative potential and an increased telomere length compared with the control cells. Similar to the established MSCs, the NHEKs with p63 knockdown showed attachment onto the 3-dimensional collagen scaffold and underwent progressive proliferation and differentiation. Upon differentiation, these EMT cells expressed alkaline phosphatase activity, osteocalcin, and osteonectin and readily formed mineralized nodules detected by alizarin S red staining, showing osteo-/odontogenic differentiation. The induction of EMT in primary NHEKs by means of transient p63 knockdown allows the generation of induced MSCs from autologous sources. These cells may be used for tissues engineering purposes, including that of dental pulp. Copyright © 2014 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

  13. Cox2 and β-Catenin/T-cell Factor Signaling Intestinalize Human Esophageal Keratinocytes When Cultured under Organotypic Conditions

    Directory of Open Access Journals (Sweden)

    Jianping Kong

    2011-09-01

    Full Text Available The incidence of esophageal adenocarcinoma (EAC is rising in the United States. An important risk factor for EAC is the presence of Barrett esophagus (BE. BE is the replacement of normal squamous esophageal epithelium with a specialized columnar epithelium in response to chronic acid and bile reflux. However, the emergence of BE from squamous keratinocytes has not yet been demonstrated. Our research has focused on this. Wnt and cyclooxygenase 2 (Cox2 are two pathways whose activation has been associated with BE and progression to EAC, but their role has not been tested experimentally. To explore their contribution, we engineered a human esophageal keratinocyte cell line to express either a dominant-active Wnt effector CatCLef or a Cox2 complementary DNA. In a two-dimensional culture environment, Cox2 expression increases cell proliferation and migration, but neither transgene induces known BE markers. In contrast, when these cells were placed into three-dimensional organotypic culture conditions, we observed more profound effects. CatCLef-expressing cells were more proliferative, developed a thicker epithelium, and upregulated Notch signaling and several BE markers including NHE2. Cox2 expression also increased cell proliferation and induced a thicker epithelium. More importantly, we observed cysts form within the epithelium, filled with intestinal mucins including Muc5B and Muc17. This suggests that Cox2 expression in a three-dimensional culture environment induces a lineage of mucin-secreting cells and supports an important causal role for Cox2 in BE pathogenesis. We conclude that in vitro modeling of BE pathogenesis can be improved by enhancing Wnt signaling and Cox2 activity and using three-dimensional organotypic culture conditions.

  14. Broad-spectrum sunscreens prevent the secretion of proinflammatory cytokines in human keratinocytes exposed to ultraviolet A and phototoxic lomefloxacin

    International Nuclear Information System (INIS)

    Reinhardt, P.; Cybulski, M.; Miller, S.M.; Ferrarotto, C.; Wilkins, R.; Deslauriers, Y.

    2006-01-01

    The combination of phototoxic drugs and ultraviolet (UV) radiation can trigger the release of proinflammatory cytokines. The present study measured the ability of sunscreens to prevent cytokine secretion in human keratinocytes following cotreatment of these cells with a known photoreactive drug and UVA. Keratinocytes were treated for 1 h with increasing concentrations of lomefloxacin (LOM) or norfloxacin (NOR), exposed to 15 J/cm 2 UVA, and incubated for 24 h. NOR, owing to the absence of a fluorine atom in position 8, was non-phototoxic and used as a negative control. Cell viability and the release of 3 cytokines were assessed, namely interleukin-1α (IL-1α), interleukin-6 (IL-6), and tumour necrosis factor-α (TNF-α). The measurement of these cytokines may be a useful tool for detecting photoreactive compounds. To measure their ability to prevent cytokine secretion, various sunscreens were inserted between the UVA source and the cells. Treatment with NOR, NOR plus UVA, or LOM had no effect on the cells. LOM plus UVA, however, had an effect on cell viability and on cytokine secretion. IL-1α levels increased with LOM concentration. The release of TNF-α and IL-6 followed the same pattern at lower concentrations of LOM but peaked at 15 μmol/L and decreased at higher concentrations. Sunscreens protected the cells from the effects of LOM plus UVA, as cell viability and levels of cytokines remained the same as in the control cells. In conclusion, the application of broad-spectrum sunscreen by individuals exposed to UVA radiation may prevent phototoxic reactions initiated by drugs such as LOM. (author)

  15. GATA3 is a master regulator of the transcriptional response to low-dose ionizing radiation in human keratinocytes

    International Nuclear Information System (INIS)

    Bonin, F.; Molina, M.; Berthier-Vergnes, O.; Lamartine, J.; Malet, C.; Ginestet, C.; Martin, M.T.

    2009-01-01

    Background: The general population is constantly exposed to low levels of radiation through natural, occupational or medical irradiation. Even if the biological effects of low-level radiation have been intensely debated and investigated, the molecular mechanisms underlying the cellular response to low doses remain largely unknown. Results: The present study investigated the role of GATA3 protein in the control of the cellular and molecular response of human keratinocytes exposed to a 1 cGy dose of X-rays. Chromatin immunoprecipitation showed GATA3 to be able to bind the promoter of 4 genes responding to a 1 cGy exposure. To go further into the role of GATA3 after ionizing radiation exposure, we studied the cellular and molecular consequences of radiation in GATA3 knock-down cells. Knockdown was obtained by lentiviral-mediated expression of an shRNA targeting the GATA3 transcript in differentiated keratinocytes. First, radiosensitivity was assessed: the toxicity, in terms of immediate survival (with XTT test), associated with 1 cGy radiation was found to be increased in GATA3 knock-down cells. The impact of GATA3 knock-down on the transcriptome of X-ray irradiated cells was also investigated, using oligonucleotide micro-arrays to assess changes between 3 h and 72 h post-irradiation in normal vs GATA3 knock-down backgrounds; transcriptome response was found to be completely altered in GATA3 knock-down cells, with a strong induction/repression peak 48 h after irradiation. Functional annotation revealed enrichment in genes known to be involved in chaperone activity, TGFβ signalling and stress response. Conclusion: Taken together, these data indicate that GATA3 is an important regulator of the cellular and molecular response of epidermal cells to very low doses of radiation. (authors)

  16. Evidence for Alteration of EZH2, BMI1, and KDM6A and Epigenetic Reprogramming in Human Papillomavirus Type 16 E6/E7-Expressing Keratinocytes

    OpenAIRE

    Hyland, Paula L.; McDade, Simon S.; McCloskey, Rachel; Dickson, Glenda J.; Arthur, Ken; McCance, Dennis J.; Patel, Daksha

    2011-01-01

    A number of epigenetic alterations occur in both the virus and host cellular genomes during human papillomavirus (HPV)-associated carcinogenesis, and investigations of such alterations, including changes in chromatin proteins and histone modifications, have the potential to lead to therapeutic epigenetic reversion. We report here that transformed HPV16 E6/E7-expressing primary human foreskin keratinocytes (HFKs) (E6/E7 cells) demonstrate increased expression of the PRC2 methyltransferase EZH2...

  17. Clinicopathological correlation of keratinocyte growth factor and matrix metalloproteinase-9 expression in human gastric cancer.

    Science.gov (United States)

    Zhang, Qing; Wang, Ping; Shao, Ming; Chen, Shi-Wen; Xu, Zhi-Feng; Xu, Feng; Yang, Zhong-Yin; Liu, Bing-Ya; Gu, Qin-Long; Zhang, Wen-Jian; Li, Yong

    2015-01-01

    Keratinocyte growth factor (KGF) is reported to be implicated in the growth of some cancer cells. Matrix metalloproteinase 9 (MMP-9) is thought to enhance the tumor invasion and metastasis ability. This study was aimed at analyzing the relationship between KGF and MMP-9 expression and patients' clinicopathological characteristics to clarify the clinical significance of the expression of KGF and MMP-9 in gastric cancer. Tissue samples from 161 patients with primary gastric cancer were investigated using immunohistochemistry. The relationship between KGF and/or MMP-9 expression and clinicopathological characteristics was analyzed. KGF expression and MMP-9 expression in gastric cancer tissue were observed in 62 cases (38.5%) and 97 cases (60.2%), respectively. MMP-9 was significantly associated with depth of invasion, lymph node metastasis and TNM stage. The prognosis of MMP-9-positive patients was significantly poorer than that of MMP-9-negative patients (p = 0.009). KGF expression was positively correlated with MMP-9 expression in gastric cancer, and the prognosis of patients with both KGF- and MMP-9-positive tumors was significantly worse than that of patients with negative tumors for either factor (p = 0.045). Expression of MMP-9 was revealed to be an independent prognostic factor (p = 0.026). Coexpression of KGF and MMP-9 in gastric cancer could be a useful prognostic factor, and MMP-9 might also serve as a novel target for both prognostic prediction and therapeutics.

  18. Combined introduction of Bmi-1 and hTERT immortalizes human adipose tissue-derived stromal cells with low risk of transformation

    Energy Technology Data Exchange (ETDEWEB)

    Tatrai, Peter, E-mail: peter.tatrai@biomembrane.hu [Institute of Enzymology, Research Center for Natural Sciences, Hungarian Academy of Sciences, Karolina ut 29, H-1113 Budapest (Hungary); Department of Biochemistry and Molecular Biology, Medical and Health Science Center, University of Debrecen, Egyetem ter 1, H-4032 Debrecen (Hungary); Szepesi, Aron, E-mail: aron.szepesi@biomembrane.hu [Creative Cell Ltd., Puskas Tivadar utca 13, H-1119 Budapest (Hungary); Matula, Zsolt, E-mail: matula.zsolt@gmail.com [Creative Cell Ltd., Puskas Tivadar utca 13, H-1119 Budapest (Hungary); Szigeti, Anna, E-mail: anna.szigeti@biomembrane.hu [Creative Cell Ltd., Puskas Tivadar utca 13, H-1119 Budapest (Hungary); Buchan, Gyoengyi, E-mail: buchan@med.unideb.hu [Department of Biochemistry and Molecular Biology, Medical and Health Science Center, University of Debrecen, Egyetem ter 1, H-4032 Debrecen (Hungary); Madi, Andras, E-mail: madi@med.unideb.hu [Department of Biochemistry and Molecular Biology, Medical and Health Science Center, University of Debrecen, Egyetem ter 1, H-4032 Debrecen (Hungary); Stem Cell, Apoptosis and Genomics Research Group of the Hungarian Academy of Sciences, University of Debrecen, Egyetem ter 1, H-4032 Debrecen (Hungary); Uher, Ferenc, E-mail: uher@biomembrane.hu [Stem Cell Laboratory, Hungarian National Blood Transfusion Service, Dioszegi ut 64, H-1113 Budapest (Hungary); and others

    2012-05-25

    Highlights: Black-Right-Pointing-Pointer We immortalized human adipose stromal cells (ASCs) with hTERT, Bmi-1, and SV40T. Black-Right-Pointing-Pointer hTERT-only ASCs are prone to transformation, while Bmi-only ASCs become senescent. Black-Right-Pointing-Pointer SV40T introduced along with hTERT abrogates proliferation control and multipotency. Black-Right-Pointing-Pointer hTERT combined with Bmi-1 yields stable phenotype up to 140 population doublings. -- Abstract: Adipose tissue-derived stromal cells (ASCs) are increasingly being studied for their usefulness in regenerative medicine. However, limited life span and donor-dependent variation of primary cells such as ASCs present major hurdles to controlled and reproducible experiments. We therefore aimed to establish immortalized ASC cell lines that provide steady supply of homogeneous cells for in vitro work while retain essential features of primary cells. To this end, combinations of human telomerase reverse transcriptase (hTERT), murine Bmi-1, and SV40 large T antigen (SV40T) were introduced by lentiviral transduction into ASCs. The resulting cell lines ASC{sup hTERT}, ASC{sup Bmi-1}, ASC{sup Bmi-1+hTERT} and ASC{sup SV40T+hTERT} were tested for transgene expression, telomerase activity, surface immunomarkers, proliferation, osteogenic and adipogenic differentiation, karyotype, tumorigenicity, and cellular senescence. All cell lines have maintained expression of characteristic surface immunomarkers, and none was tumorigenic. However, ASC{sup Bmi-1} had limited replicative potential, while the rapidly proliferating ASC{sup SV40T+hTERT} acquired chromosomal aberrations, departed from MSC phenotype, and lost differentiation capacity. ASC{sup hTERT} and ASC{sup hTERT+Bmi-1}, on the other hand, preserved all essential MSC features and did not senesce after 100 population doublings. Notably, a subpopulation of ASC{sup hTERT} also acquired aberrant karyotype and showed signs of transformation after long-term culture

  19. Combined introduction of Bmi-1 and hTERT immortalizes human adipose tissue-derived stromal cells with low risk of transformation

    International Nuclear Information System (INIS)

    Tátrai, Péter; Szepesi, Áron; Matula, Zsolt; Szigeti, Anna; Buchan, Gyöngyi; Mádi, András; Uher, Ferenc

    2012-01-01

    Highlights: ► We immortalized human adipose stromal cells (ASCs) with hTERT, Bmi-1, and SV40T. ► hTERT-only ASCs are prone to transformation, while Bmi-only ASCs become senescent. ► SV40T introduced along with hTERT abrogates proliferation control and multipotency. ► hTERT combined with Bmi-1 yields stable phenotype up to 140 population doublings. -- Abstract: Adipose tissue-derived stromal cells (ASCs) are increasingly being studied for their usefulness in regenerative medicine. However, limited life span and donor-dependent variation of primary cells such as ASCs present major hurdles to controlled and reproducible experiments. We therefore aimed to establish immortalized ASC cell lines that provide steady supply of homogeneous cells for in vitro work while retain essential features of primary cells. To this end, combinations of human telomerase reverse transcriptase (hTERT), murine Bmi-1, and SV40 large T antigen (SV40T) were introduced by lentiviral transduction into ASCs. The resulting cell lines ASC hTERT , ASC Bmi-1 , ASC Bmi-1+hTERT and ASC SV40T+hTERT were tested for transgene expression, telomerase activity, surface immunomarkers, proliferation, osteogenic and adipogenic differentiation, karyotype, tumorigenicity, and cellular senescence. All cell lines have maintained expression of characteristic surface immunomarkers, and none was tumorigenic. However, ASC Bmi-1 had limited replicative potential, while the rapidly proliferating ASC SV40T+hTERT acquired chromosomal aberrations, departed from MSC phenotype, and lost differentiation capacity. ASC hTERT and ASC hTERT+Bmi-1 , on the other hand, preserved all essential MSC features and did not senesce after 100 population doublings. Notably, a subpopulation of ASC hTERT also acquired aberrant karyotype and showed signs of transformation after long-term culture. In conclusion, hTERT alone was sufficient to extend the life span of human ASC, but ASC hTERT are prone to transformation during extensive

  20. Introduction of a normal human chromosome 8 corrects abnormal phenotypes of Werner syndrome cells immortalized by expressing an hTERT gene

    International Nuclear Information System (INIS)

    Ariyoshi, Kentaro; Kodama, Seiji; Suzuki, Keiji; Goto, Makoto; Oshimura, Mitsuo; Ishizaki, Kanji; Watanabe, Masami

    2009-01-01

    Werner syndrome (WS) is an autosomal recessive disease characterized by premature aging and caused by mutations of the WRN gene mapped at 8p12. To examine functional complementation of WS phenotypes, we introduced a normal human chromosome 8 into a strain of WS fibroblasts (WS3RGB) immortalized by expressing a human telomerase reverse transcriptase subunit (hTERT) gene. Here, we demonstrate that the abnormal WS phenotypes including cellular sensitivities to 4-nitroquinoline-1-oxide (4NQO) and hydroxy urea (HU), and chromosomal radiosensitivity at G 2 phase are corrected by expression of the WRN gene mediated by introducing a chromosome 8. This indicates that those multiple abnormal WS phenotypes are derived from a primary, but not secondary, defect in the WRN gene. (author)

  1. Progressive loss of sensitivity to growth control by retinoic acid and transforming growth factor-beta at late stages of human papillomavirus type 16-initiated transformation of human keratinocytes.

    Science.gov (United States)

    Creek, K E; Geslani, G; Batova, A; Pirisi, L

    1995-01-01

    Retinoids (vitamin A and its natural and synthetic derivatives) have shown potential as chemopreventive agents, and diets poor in vitamin A and/or its precursor beta-carotene have been linked to an increased risk of cancer at several sites including the cervix. Human papillomavirus (HPV) plays an important role in the etiology of cervical cancer. We have developed an in vitro model of cancer progression using human keratinocytes (HKc) immortalized by HPV16 DNA (HKc/HPV16). Although immortal, early passage HKc/HPV16, like normal HKc, require epidermal growth factor (EGF) and bovine pituitary extract (BPE) for proliferation and undergo terminal differentiation in response to serum and calcium. However, following prolonged culture, growth factor independent HKc/HPV16 lines that no longer require EGF and BPE can be selected (HKc/GFI). Further selection of HKc/GFI produces lines that are resistant to serum- and calcium- induced terminal differentiation (HKc/DR). HKc/DR, but not early passage HKc/HPV16, are susceptible to malignant conversion following transfection with viral Harvey ras or Herpes simplex virus type II DNA. We have investigated the sensitivity of low to high passage HKc/HPV16 and HKc/GFI to growth control by all-trans-retinoic acid (RA, an active metabolite of vitamin A). Early passage HKc/HPV16 are very sensitive to growth inhibition by RA, and in these cells RA decreases the expression of the HPV16 oncogenes E6 and E7. However, as the cells progress in culture they lose their sensitivity to RA. Growth inhibition by RA may be mediated through the cytokine transforming growth factor-beta (TGF-beta), a potent inhibitor of epithelial cell proliferation. RA treatment of HKc/HPV16 and HKc/GFI results in a dose-and time-dependent induction (maximal of 3-fold) in secreted levels of TGF-beta. Also, Northern blot analysis of mRNA isolated from HKc/HPV16 demonstrated that RA treatment induced TGF-beta 1 and TGF-beta 2 expression about 3- and 50-fold, respectively

  2. Human keratinocytes are a source for tumor necrosis factor alpha: Evidence for synthesis and release upon stimulation with endotoxin or ultraviolet light

    International Nuclear Information System (INIS)

    Koeck, A.S.; Schwarz, T.; Kirnbauer, R.; Urbanski, A.; Perry, P.; Ansel, J.C.; Luger, T.A.

    1990-01-01

    Tumor necrosis factor alpha (TNF-alpha), in addition to being cytotoxic for certain tumor cells, has turned out as a multifunctional cytokine that is involved in the regulation of immunity and inflammation. Since human keratinocytes have been demonstrated to be a potent source of various cytokines, it was investigated whether epidermal cells synthesize and release TNF-alpha. Supernatants derived from normal human keratinocytes (HNK) and human epidermoid carcinoma cell lines (KB, A431) were tested both in a TNF-alpha-specific ELISA and a bioassay. In supernatants of untreated epidermal cells, no or minimal TNF-alpha activity was found, while after stimulation with lipopolysaccharide (LPS) or ultraviolet (UV) light, significant amounts were detected. Western blot analysis using an antibody directed against human TNF-alpha revealed a molecular mass of 17 kD for keratinocyte-derived TNF-alpha. These biological and biochemical data were also confirmed by Northern blot analysis revealing mRNA specific for TNF-alpha in LPS- or ultraviolet B (UVB)-treated HNK and KB cells. In addition, increased TNF-alpha levels were detected in the serum obtained from human volunteers 12 and 24 h after a single total body UVB exposure, which caused a severe sunburn reaction. These findings indicate that keratinocytes upon stimulation are able to synthesize and release TNF-alpha, which may gain access to the circulation. Thus, TNF-alpha in concert with other epidermal cell-derived cytokines may mediate local and systemic inflammatory reactions during host defense against injurious events caused by microbial agents or UV irradiation

  3. Direct induction of hepatocyte-like cells from immortalized human bone marrow mesenchymal stem cells by overexpression of HNF4α

    International Nuclear Information System (INIS)

    Hu, Xiaojun; Xie, Peiyi; Li, Weiqiang; Li, Zhengran; Shan, Hong

    2016-01-01

    Hepatocytes from human bone marrow-derived mesenchymal stem cells (hBM-MSCs) are expected to be a useful source for cell transplantation. However, relatively low efficiency and repeatability of hepatic differentiation of human BM-MSCs remains an obstacle for clinical translation. Hepatocyte nuclear factor 4 alpha (HNF4α), a critical transcription factor, plays an essential role in the entire process of liver development. In this study, immortalized hBM-MSCs, UE7T-13 cells were transduced with a lentiviral vector containing HNF4α. The typical fibroblast-like morphology of the MSCs changed, and polygonal, epithelioid cells grew out after HNF4α transduction. In hepatocyte culture medium, HNF4α-transduced MSCs (E7-hHNF4α cells) strongly expressed the albumin (ALB), CYP2B6, alpha-1 antitrypsin (AAT), and FOXA2 mRNA and exhibited morphology markedly similar to that of mature hepatocytes. The E7-hHNF4α cells showed hepatic functions such as Indocyanine green (ICG) uptake and release, glycogen storage, urea production and ALB secretion. Approximately 28% of E7-hHNF4α cells expressed both ALB and AAT. Furthermore, these E7-hHNF4α cells via superior mesenteric vein (SMV) injection expressed human ALB in mouse chronic injured liver. In conclusion, this study represents a novel strategy by directly inducing hepatocyte-like cells from MSCs. - Highlights: • We overexpressed HNF4α in immortalized BM-MSCs by lentiviral transduction. • HNF4α-transduced MSCs transdifferentiated into hepatocytes with mature hepatic metabolic functions. • Our study represents a novel strategy by direct induction of hepatocyte-like cells from MSCs.

  4. Protective effect of Opuntia ficus-indica L. cladodes against UVA-induced oxidative stress in normal human keratinocytes.

    Science.gov (United States)

    Petruk, Ganna; Di Lorenzo, Flaviana; Imbimbo, Paola; Silipo, Alba; Bonina, Andrea; Rizza, Luisa; Piccoli, Renata; Monti, Daria Maria; Lanzetta, Rosa

    2017-12-15

    Opuntia ficus-indica L. is known for its beneficial effects on human health, but still little is known on cladodes as a potent source of antioxidants. Here, a direct, economic and safe method was set up to obtain water extracts from Opuntia ficus-indica cladodes rich in antioxidant compounds. When human keratinocytes were pre-treated with the extract before being exposed to UVA radiations, a clear protective effect against UVA-induced stress was evidenced, as indicated by the inhibition of stress-induced processes, such as free radicals production, lipid peroxidation and GSH depletion. Moreover, a clear protective effect against apoptosis in pre-treated irradiated cells was evidenced. We found that eucomic and piscidic acids were responsible for the anti-oxidative stress action of cladode extract. In conclusion, a bioactive, safe, low-cost and high value-added extract from Opuntia cladodes was obtained to be used for skin health/protection. Copyright © 2017 Elsevier Ltd. All rights reserved.

  5. Cytotoxic effects of denture adhesives on primary human oral keratinocytes, fibroblasts and permanent L929 cell lines.

    Science.gov (United States)

    Chen, Fengying; Wu, Tianfu; Cheng, Xiangrong

    2014-03-01

    To date, there have been very little data on the cytotoxic responses of different cell lines to denture adhesives. To determine the cytotoxicity of three denture adhesives on primary human oral keratinocytes (HOKs), fibroblasts (HOFs) and permanent mouse fibroblasts cell lines (L929). Three commercial denture adhesives (two creams and one powder) were prepared for indirect contact using the agar diffusion test, as well as extracts in MTT assay. The results of the MTT assay were statistically analysed by one-way anova and Tukey's test (p adhesives showed mild to moderate cytotoxicity to primary HOKs (p  0.05) in both assays. For primary HOFs cultures, slight cytotoxicity was observed for one of the products from the agar diffusion test and undiluted eluates of all tested adhesives with MTT assay (p adhesives are toxic to the primary HOKs and HOFs cultures, whereas non-toxic to L929 cells. The results suggest that primary human oral mucosal cells may provide more valuable information in toxicity screening of denture adhesives. © 2012 John Wiley & Sons A/S and The Gerodontology Association. Published by John Wiley & Sons Ltd.

  6. Trichloroethylene-mediated cytotoxicity in human epidermal keratinocytes is mediated by the rapid accumulation of intracellular calcium: Interception by naringenin.

    Science.gov (United States)

    Ali, F; Khan, A Q; Khan, R; Sultana, S

    2016-02-01

    Industrial solvents pose a significant threat to the humankind. The mechanisms of their toxicity still remain in debate. Trichloroethylene (TCE) is a widespread industrial solvent responsible for severe liver dysfunction, cutaneous toxicity in occupationally exposed humans. We utilized an in vitro system of human epidermal keratinocyte (HaCaT) cells in this study to avoid complex cell and extracellular interactions. We report the cytotoxicity of organic solvent TCE in HaCaT and its reversal by a natural flavanone, naringenin (Nar). The cytotoxicity was attributed to the rapid intracellular free calcium (Ca(2+)) release, which might lead to the elevation of protein kinase C along with robust free radical generation, instability due to energy depletion, and sensitization of intracellular stress signal transducer nuclear factor κB. These effects were actually seen to induce significant amount of genomic DNA fragmentation. Furthermore, all these effects of TCE were effectively reversed by the treatment of Nar, a natural flavanone. Our studies identify intracellular Ca as a unique target used by organic solvents in the cytotoxicity and highlight the Ca(2+) ion stabilizer properties of Nar. © The Author(s) 2015.

  7. Discrimination of skin sensitizers from non-sensitizers by interleukin-1α and interleukin-6 production on cultured human keratinocytes.

    Science.gov (United States)

    Jung, Daun; Che, Jeong-Hwan; Lim, Kyung-Min; Chun, Young-Jin; Heo, Yong; Seok, Seung Hyeok

    2016-09-01

    In vitro testing methods for classifying sensitizers could be valuable alternatives to in vivo sensitization testing using animal models, such as the murine local lymph node assay (LLNA) and the guinea pig maximization test (GMT), but there remains a need for in vitro methods that are more accurate and simpler to distinguish skin sensitizers from non-sensitizers. Thus, the aim of our study was to establish an in vitro assay as a screening tool for detecting skin sensitizers using the human keratinocyte cell line, HaCaT. HaCaT cells were exposed to 16 relevant skin sensitizers and 6 skin non-sensitizers. The highest dose used was the dose causing 75% cell viability (CV75) that we determined by an MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] assay. The levels of extracellular production of interleukin-1α (IL-1α) and IL-6 were measured. The sensitivity of IL-1α was 63%, specificity was 83% and accuracy was 68%. In the case of IL-6, sensitivity: 69%, specificity: 83% and accuracy: 73%. Thus, this study suggests that measuring extracellular production of pro-inflammatory cytokines IL-1α and IL-6 by human HaCaT cells may potentially classify skin sensitizers from non-sensitizers. Copyright © 2015 John Wiley & Sons, Ltd. Copyright © 2015 John Wiley & Sons, Ltd.

  8. A telomerase immortalized human proximal tubule cell line with a truncation mutation (Q4004X in polycystin-1.

    Directory of Open Access Journals (Sweden)

    Brittney-Shea Herbert

    Full Text Available Autosomal dominant polycystic kidney disease (ADPKD is associated with a variety of cellular phenotypes in renal epithelial cells. Cystic epithelia are secretory as opposed to absorptive, have higher proliferation rates in cell culture and have some characteristics of epithelial to mesenchymal transitions. In this communication we describe a telomerase immortalized cell line that expresses proximal tubule markers and is derived from renal cysts of an ADPKD kidney. These cells have a single detectable truncating mutation (Q4004X in polycystin-1. These cells make normal appearing but shorter cilia and fail to assemble polycystin-1 in the cilia, and less uncleaved polycystin-1 in membrane fractions. This cell line has been maintained in continuous passage for over 35 passages without going into senescence. Nephron segment specific markers suggest a proximal tubule origin for these cells and the cell line will be useful to study mechanistic details of cyst formation in proximal tubule cells.

  9. Gene expression studies on human keratinocytes transduced with human growth hormone gene for a possible utilization in gene therapy; Estudos da expressao genica mediante utilizacao de queratinocitos humanos normais transduzidos com o gene do hormonio de crscimento humano. Possivel utilizacao em terapia genica

    Energy Technology Data Exchange (ETDEWEB)

    Mathor, Monica Beatriz

    1994-12-31

    Taking advantage of the recent progress in the DNA-recombinant techniques and of the potentiality of normal human keratinocytes primary culture to reconstitute the epidermis, it was decided to genetically transform these keratinocytes to produce human growth hormone under controllable conditions that would be used in gene therapy at this hormone deficient patients. The first step to achieve this goal was to standardize infection of keratinocytes with retrovirus producer cells containing a construct which included the gene of bacterial b-galactosidase. The best result was obtained cultivating the keratinocytes for 3 days in a 2:1 mixture of retrovirus producer cells and 3T3-J2 fibroblasts irradiated with 60 Gy, and splitting these infected keratinocytes on 3T3-J2 fibroblasts feeder layer. Another preliminary experiment was to infect normal human keratinocytes with interleukin-6 gene (hIL-6) that, in pathologic conditions, could be reproduced by keratinocytes and secreted to the blood stream. Thus, we verify that infected keratinocytes secrete an average amount of 500 ng/10{sup 6} cell/day of cytokin during the in vitro life time, that certify the stable character of the injection. These keratinocytes, when grafted in mice, secrete hIL-6 to the blood stream reaching levels of 40 pg/ml of serum. After these preliminary experiments, we construct a retroviral vector with the human growth hormone gene (h GH) driven by human metallothionein promoter (h PMT), designated DChPMTGH. Normal human keratinocytes were infected with DChPMTGH producer cells, following previously standardized protocol, obtaining infected keratinocytes secreting to the culture media 340 ng h GH/10{sup 6} cell/day without promoter activation. This is the highest level of h GH secreted in human keratinocytes primary culture described in literature. The h GH value increases approximately 10 times after activation with 100 {mu}M Zn{sup +2} for 8-12 hours. (author). 158 refs., 42 figs., 6 tabs.

  10. Assessment of the potential skin irritation of lysine-derivative anionic surfactants using mouse fibroblast and human keratinocytes as an alternative to animal testing

    OpenAIRE

    Sánchez Molina, Lourdes; Mitjans Arnal, Montserrat; Infante Martínez-Pardo, Ma. Rosa; Vinardell Martínez-Hidalgo, Ma. Pilar

    2004-01-01

    Purpose. The aim of this study was to identify new surfactants with low skin irritant properties for use in pharmaceutical and cosmetic formulations, employing cell culture as an alternative method to in vivo testing. In addition, we sought to establish whether potential cytotoxic properties were related to the size of the counterions bound to the surfactants. Methods. Cytotoxicity was assessed in the mouse fibroblast cell line 3T6, and the human keratinocyte cell line NCTC 2544, using the MT...

  11. Epidermal cell-shape regulation and subpopulation kinetics during butyrate-induced terminal maturation of normal and SV40-transformed human keratinocytes: epithelial models of differentiation therapy.

    Science.gov (United States)

    Staiano-Coico, L; Steinberg, M; Higgins, P J

    1990-10-15

    Recent data indicate that malignant human epidermal cells may be appropriate targets for sodium butyrate (NaB)-mediated differentiation therapy. The response of pre- and post-crisis populations of SV40-transformed human keratinocytes (SVKs) to this differentiation-inducing agent was assessed, therefore, within the framework of NaB-directed normal human keratinocyte (NHK) maturation. NaB augmented cornified envelope (CE) production in NHK and pre-crisis SVK cultures; the time-course and efficiency of induced maturation were similar in the 2 cell systems. In NHKs, the percentage of amplifying ("B" substate) cells decreased with time in NaB correlating with increases in both "C" stage keratinocytes and CEs. The latter formed over one or 2 layers of nucleated basal-like cells. Inductions were accompanied by immediate cell cycle blocks (in both the G1 and G2/M phases), reorganization within the actin cytoskeleton, and transient early increases in cellular actin content. Increased NHK and pre-crisis SVK cytoskeletal-associated actin reached a maximum approximately 48 hr after NaB addition and preceded development of CEs. The CE precursors, thus, probably reside in the "B" substate. Post-crisis SVKs, in contrast, were refractive to NaB-induced terminal maturation or cell-cycle perturbation, failed to initiate actin filament rearrangements, and retained a basal cell-like phenotype. Stable transformation of human SVKs in post-crisis phase, therefore, appears to be associated with loss of maturation "competence" within the "B" keratinocyte subpopulation.

  12. Autophagy participates in isoliquiritigenin-induced melanin degradation in human epidermal keratinocytes through PI3K/AKT/mTOR signaling.

    Science.gov (United States)

    Yang, Zhibo; Zeng, Biyun; Pan, Yi; Huang, Pan; Wang, Chang

    2018-01-01

    Melanin is the pigment responsible for the color of human skin and hair. Melanin serves as a double-edge sword which can exert both protective and spot-causing effects on skin. Although melanin has an important role in protecting the skin against UV damage, an excessive or uneven melanin production can lead to the formation of freckles and age spots. Isoliquiritigenin (ISL) has been reported to inhibit melanin synthesis; however, its role in melanin degradation remains unclear. In the present study, we evaluated the detailed function of ISL in melanin degradation in human epidermal keratinocytes. Since autophagy has been reported to be related to melanin degradation, we also examined the activation of autophagy by ISL treatment in keratinocytes by measurement of autophagy-related proteins, ATG7, LC3 and p62. Moreover, si-ATG7-induced ATG7 knockdown and autophagy inhibitor 3-MA decreased LC3 II protein levels and increased PMEL17, p62 and melanin levels in HaCaT cells, which could be partially reversed by ISL treatment, indicating that autophagy participated in melanin degradation. The decreased p-AKT and p-mTOR proteins upon ISL treatment indicated the involvement of PI3K/AKT/mTOR signaling in ISL-induced melanin degradation. Taken together, we demonstrated that autophagy participates in ISL-induced melanin degradation in human epidermal keratinocytes through PI3K/AKT/mTOR signaling. Copyright © 2017. Published by Elsevier Masson SAS.

  13. The comparison of two methods to obtain human oral keratinocytes in primary culture; Comparacao de dois metodos de obtencao celular para cultura primaria de queratinocitos bucais humanos

    Energy Technology Data Exchange (ETDEWEB)

    Klingbeil, Maria Fatima Guarizo

    2006-07-01

    The therapeutic procedures frequently used in oral treatments for the pathological diseases are surgical, resulting in failures of the mucosal continuity.The possibility to obtain transplantable oral epithelia from an in vitro cell culture opens new utilization perspectives not only to where it comes from, but also as a reconstructive material for other parts of the human body, such as: urethra, epithelia corneo-limbal, cornea, ocular surface. Many researchers still use controversial methods for obtaining cells. It was therefore evaluated and compared the efficiency in both methods: enzymatic and direct explant to obtain oral keratinocytes from human oral mucosa. Fragments of intra oral epithelial tissues from healthy human subjects, undergoing dental surgeries, were donated to the research project. The keratinocytes were cultivated over a feeder-layer from a previously irradiated 3T3 Swiss albino fibroblasts. In this study it was compared the time needed in the cell obtention, the best cell amount between both methods, the life-span, the cell capacity to form an in vitro epithelia and its morphologic structure. The results in the assessment of both methods have shown the possibility to obtain keratinocytes from a small oral fragment, but at the same time we may verify the advantages and peculiar restrictions for each one of both analyzed methods. (author)

  14. Chitosan-shelled oxygen-loaded nanodroplets abrogate hypoxia dysregulation of human keratinocyte gelatinases and inhibitors: New insights for chronic wound healing

    International Nuclear Information System (INIS)

    Khadjavi, Amina; Magnetto, Chiara; Panariti, Alice; Argenziano, Monica; Gulino, Giulia Rossana; Rivolta, Ilaria; Cavalli, Roberta; Giribaldi, Giuliana; Guiot, Caterina; Prato, Mauro

    2015-01-01

    Background: : In chronic wounds, efficient epithelial tissue repair is hampered by hypoxia, and balances between the molecules involved in matrix turn-over such as matrix metalloproteinases (MMPs) and tissue inhibitors of metalloproteinases (TIMPs) are seriously impaired. Intriguingly, new oxygenating nanocarriers such as 2H,3H-decafluoropentane-based oxygen-loaded nanodroplets (OLNs) might effectively target chronic wounds. Objective: : To investigate hypoxia and chitosan-shelled OLN effects on MMP/TIMP production by human keratinocytes. Methods: : HaCaT cells were treated for 24 h with 10% v/v OLNs both in normoxia or hypoxia. Cytotoxicity and cell viability were measured through biochemical assays; cellular uptake by confocal microscopy; and MMP and TIMP production by enzyme-linked immunosorbent assay or gelatin zymography. Results: : Normoxic HaCaT cells constitutively released MMP-2, MMP-9, TIMP-1 and TIMP-2. Hypoxia strongly impaired MMP/TIMP balances by reducing MMP-2, MMP-9, and TIMP-2, without affecting TIMP-1 release. After cellular uptake by keratinocytes, nontoxic OLNs abrogated all hypoxia effects on MMP/TIMP secretion, restoring physiological balances. OLN abilities were specifically dependent on time-sustained oxygen diffusion from OLN core. Conclusion: : Chitosan-shelled OLNs effectively counteract hypoxia-dependent dysregulation of MMP/TIMP balances in human keratinocytes. Therefore, topical administration of exogenous oxygen, properly encapsulated in nanodroplet formulations, might be a promising adjuvant approach to promote healing processes in hypoxic wounds. - Highlights: • Hypoxia impairs MMP9/TIMP1 and MMP2/TIMP2 balances in HaCaT human keratinocytes. • Chitosan-shelled oxygen-loaded nanodroplets (OLNs) are internalised by HaCaT cells. • OLNs are not toxic to HaCaT cells. • OLNs effectively counteract hypoxia effects on MMP/TIMP balances in HaCaT cells. • OLNs appear as promising and cost-effective therapeutic tools for hypoxic

  15. Chitosan-shelled oxygen-loaded nanodroplets abrogate hypoxia dysregulation of human keratinocyte gelatinases and inhibitors: New insights for chronic wound healing

    Energy Technology Data Exchange (ETDEWEB)

    Khadjavi, Amina [Dipartimento di Neuroscienze, Università di Torino, Torino (Italy); Magnetto, Chiara [Istituto Nazionale di Ricerca Metrologica (INRIM), Torino (Italy); Panariti, Alice [Dipartimento di Scienze della Salute, Università di Milano Bicocca, Monza (Italy); Argenziano, Monica [Dipartimento di Scienza e Tecnologia del Farmaco, Università di Torino, Torino (Italy); Gulino, Giulia Rossana [Dipartimento di Oncologia, Università di Torino, Torino (Italy); Rivolta, Ilaria [Dipartimento di Scienze della Salute, Università di Milano Bicocca, Monza (Italy); Cavalli, Roberta [Dipartimento di Scienza e Tecnologia del Farmaco, Università di Torino, Torino (Italy); Giribaldi, Giuliana [Dipartimento di Oncologia, Università di Torino, Torino (Italy); Guiot, Caterina [Dipartimento di Neuroscienze, Università di Torino, Torino (Italy); Prato, Mauro, E-mail: mauro.prato@unito.it [Dipartimento di Neuroscienze, Università di Torino, Torino (Italy); Dipartimento di Scienze della Sanità Pubblica e Pediatriche, Università di Torino, Torino (Italy)

    2015-08-01

    Background: : In chronic wounds, efficient epithelial tissue repair is hampered by hypoxia, and balances between the molecules involved in matrix turn-over such as matrix metalloproteinases (MMPs) and tissue inhibitors of metalloproteinases (TIMPs) are seriously impaired. Intriguingly, new oxygenating nanocarriers such as 2H,3H-decafluoropentane-based oxygen-loaded nanodroplets (OLNs) might effectively target chronic wounds. Objective: : To investigate hypoxia and chitosan-shelled OLN effects on MMP/TIMP production by human keratinocytes. Methods: : HaCaT cells were treated for 24 h with 10% v/v OLNs both in normoxia or hypoxia. Cytotoxicity and cell viability were measured through biochemical assays; cellular uptake by confocal microscopy; and MMP and TIMP production by enzyme-linked immunosorbent assay or gelatin zymography. Results: : Normoxic HaCaT cells constitutively released MMP-2, MMP-9, TIMP-1 and TIMP-2. Hypoxia strongly impaired MMP/TIMP balances by reducing MMP-2, MMP-9, and TIMP-2, without affecting TIMP-1 release. After cellular uptake by keratinocytes, nontoxic OLNs abrogated all hypoxia effects on MMP/TIMP secretion, restoring physiological balances. OLN abilities were specifically dependent on time-sustained oxygen diffusion from OLN core. Conclusion: : Chitosan-shelled OLNs effectively counteract hypoxia-dependent dysregulation of MMP/TIMP balances in human keratinocytes. Therefore, topical administration of exogenous oxygen, properly encapsulated in nanodroplet formulations, might be a promising adjuvant approach to promote healing processes in hypoxic wounds. - Highlights: • Hypoxia impairs MMP9/TIMP1 and MMP2/TIMP2 balances in HaCaT human keratinocytes. • Chitosan-shelled oxygen-loaded nanodroplets (OLNs) are internalised by HaCaT cells. • OLNs are not toxic to HaCaT cells. • OLNs effectively counteract hypoxia effects on MMP/TIMP balances in HaCaT cells. • OLNs appear as promising and cost-effective therapeutic tools for hypoxic

  16. Assessment of dermal toxicity of nanosilica using cultured keratinocytes, a human skin equivalent model and an invivo model

    International Nuclear Information System (INIS)

    Park, Yoon-Hee; Kim, Ji Na; Jeong, Sang Hoon; Choi, Jae Eun; Lee, Seung-Ho; Choi, Byeong Hyeok; Lee, Jung Pyo; Sohn, Kyung Hee; Park, Kui Lea; Kim, Meyoung-Kon; Son, Sang Wook

    2010-01-01

    Assessments of skin irritation potentials are important aspects of the development of nanotechnology. Nanosilica is currently being widely used for commercial purposes, but little literature is available on its skin toxicity and irritation potential. This study was designed to determine whether nanosilica has the potential to cause acute cutaneous toxicity, using cultured HaCaT keratinocytes (CHK), a human skin equivalent model (HSEM), and invivo model. Nanosilica was characterized by scanning electron microscopy. We evaluated the cytotoxic effects of nanosilica on CHKs and the HSEM. In addition, we also investigated whether two commercially available nanosilicas with different sizes (7 and 10-20 nm) have different effects. To confirm invitro results, we evaluated the irritation potentials of nanosilicas on rabbit skin. Nanosilicas reduced the cell viabilities of CHKs in a dose-dependent manner. However, the HSEM revealed no irritation at 500 μg/ml of nanosilica. Furthermore, this result concurred with Draize skin irritation test findings. The present study data indicate that nanosilica does not cause acute cutaneous irritation. Furthermore, this study shows that the HSEM used provides more useful screening data than the conventional cell culture model on the relative toxicities of NPs.

  17. In Vitro Growth of Human Keratinocytes and Oral Cancer Cells into Microtissues: An Aerosol-Based Microencapsulation Technique

    Directory of Open Access Journals (Sweden)

    Wai Yean Leong

    2017-05-01

    Full Text Available Cells encapsulation is a micro-technology widely applied in cell and tissue research, tissue transplantation, and regenerative medicine. In this paper, we proposed a growth of microtissue model for the human keratinocytes (HaCaT cell line and an oral squamous cell carcinoma (OSCC cell line (ORL-48 based on a simple aerosol microencapsulation technique. At an extrusion rate of 20 μL/min and air flow rate of 0.3 L/min programmed in the aerosol system, HaCaT and ORL-48 cells in alginate microcapsules were encapsulated in microcapsules with a diameter ranging from 200 to 300 μm. Both cell lines were successfully grown into microtissues in the microcapsules of alginate within 16 days of culture. The microtissues were characterized by using a live/dead cell viability assay, field emission-scanning electron microscopy (FE-SEM, fluorescence staining, and cell re-plating experiments. The microtissues of both cell types were viable after being extracted from the alginate membrane using alginate lyase. However, the microtissues of HaCaT and ORL-48 demonstrated differences in both nucleus size and morphology. The microtissues with re-associated cells in spheroids are potentially useful as a cell model for pharmacological studies.

  18. Sonoporation delivery of monoclonal antibodies against human papillomavirus 16 E6 restores p53 expression in transformed cervical keratinocytes.

    Directory of Open Access Journals (Sweden)

    Melissa Togtema

    Full Text Available High-risk types of human papillomavirus (HPV, such as HPV16, have been found in nearly all cases of cervical cancer. Therapies targeted at blocking the HPV16 E6 protein and its deleterious effects on the tumour suppressor pathways of the cell can reverse the malignant phenotype of affected keratinocytes while sparing uninfected cells. Through a strong interdisciplinary collaboration between engineering and biology, a novel, non-invasive intracellular delivery method for the HPV16 E6 antibody, F127-6G6, was developed. The method employs high intensity focused ultrasound (HIFU in combination with microbubbles, in a process known as sonoporation. In this proof of principle study, it was first demonstrated that sonoporation antibody delivery into the HPV16 positive cervical carcinoma derived cell lines CaSki and SiHa was possible, using chemical transfection as a baseline for comparison. Delivery of the E6 antibody using sonoporation significantly restored p53 expression in these cells, indicating the antibody is able to enter the cells and remains active. This delivery method is targeted, non-cytotoxic, and non-invasive, making it more easily translatable for in vivo experiments than other transfection methods.

  19. Molecular photoprotection of human keratinocytes in vitro by the naturally occurring mycosporine-like amino acid palythine.

    Science.gov (United States)

    Lawrence, K P; Gacesa, R; Long, P F; Young, A R

    2017-11-13

    Solar ultraviolet radiation (UVR) induces molecular and genetic changes in the skin, which result in skin cancer, photoageing and photosensitivity disorders. The use of sunscreens is advocated to prevent such photodamage; however, most formulations contain organic and inorganic UVR filters that are nonbiodegradable and can damage fragile marine ecosystems. Mycosporine-like amino acids (MAAs) are natural UVR-absorbing compounds that have evolved in marine species for protection against chronic UVR exposure in shallow-water habitats. To determine if palythine, a photostable model MAA, could offer protection against a range of UVR-induced damage biomarkers that are important in skin cancer and photoageing. HaCaT human keratinocytes were used to assess the photoprotective potential of palythine using a number of end points including cell viability, DNA damage (nonspecific, cyclobutane pyrimidine dimers and oxidatively generated damage), gene expression changes (linked to inflammation, photoageing and oxidative stress) and oxidative stress. The antioxidant mechanism was investigated using chemical quenching and Nrf2 pathway activation assays. Palythine offered statistically significant protection (P photoprotective molecule in vitro that has potential to be developed as a natural and biocompatible alternative to currently approved UVR filters. © 2017 The Authors. British Journal of Dermatology published by John Wiley & Sons Ltd on behalf of British Association of Dermatologists.

  20. Dissecting the calcium-induced differentiation of human primary keratinocytes stem cells by integrative and structural network analyses.

    Directory of Open Access Journals (Sweden)

    Kiana Toufighi

    2015-05-01

    Full Text Available The molecular details underlying the time-dependent assembly of protein complexes in cellular networks, such as those that occur during differentiation, are largely unexplored. Focusing on the calcium-induced differentiation of primary human keratinocytes as a model system for a major cellular reorganization process, we look at the expression of genes whose products are involved in manually-annotated protein complexes. Clustering analyses revealed only moderate co-expression of functionally related proteins during differentiation. However, when we looked at protein complexes, we found that the majority (55% are composed of non-dynamic and dynamic gene products ('di-chromatic', 19% are non-dynamic, and 26% only dynamic. Considering three-dimensional protein structures to predict steric interactions, we found that proteins encoded by dynamic genes frequently interact with a common non-dynamic protein in a mutually exclusive fashion. This suggests that during differentiation, complex assemblies may also change through variation in the abundance of proteins that compete for binding to common proteins as found in some cases for paralogous proteins. Considering the example of the TNF-α/NFκB signaling complex, we suggest that the same core complex can guide signals into diverse context-specific outputs by addition of time specific expressed subunits, while keeping other cellular functions constant. Thus, our analysis provides evidence that complex assembly with stable core components and competition could contribute to cell differentiation.

  1. Evaluation of dermal-epidermal skin equivalents ('composite-skin') of human keratinocytes in a collagen-glycosaminoglycan matrix(Integra artificial skin).

    Science.gov (United States)

    Kremer, M; Lang, E; Berger, A C

    2000-09-01

    Integra artificial skin (Integra LifeSciences Corp., Plainsboro, NJ, USA) is a dermal template consisting of bovine collagen, chondroitin-6-sulphate and a silastic membrane manufactured as Integra. This product has gained widespread use in the clinical treatment of third degree burn wounds and full thickness skin defects of different aetiologies. The product was designed to significantly reduce the time needed to achieve final wound closure in the treatment of major burn wounds, to optimise the sparse autologous donor skin resources and to improve the durable mechanical quality of the skin substitute. The clinical procedure requires two stages. The first step creates a self neodermis, the second creates a self epidermis on the neodermis. However, it is desirable to cover major burn wounds early in a single step by a skin substitute consisting of a dermal equivalent seeded in vitro with autologous keratinocytes ('composite-skin') out of which a full thickness skin develops in vivo.The goal of this experimental study was to develop a method to integrate human keratinocytes in homogeneous distribution and depth into Integra Artificial Skin. The seeded cell-matrix composites were grafted onto athymic mice in order to evaluate their potential to reconstitute a human epidermis in vivo. We were able to demonstrate that the inoculated human keratinocytes reproducibly displayed a homogeneous pattern of distribution, adherence, proliferation and confluence. The cell-matrix composites grafted in this model exhibited good wound adherence, complete healing, minor wound contraction and had the potential to reconstitute an elastic, functional and durable human skin. Histologically we were able to show that the inoculated human keratinocytes in vivo colonised the matrix in a histomorphologically characteristic epidermal pattern (keratomorula, keratinocyte bubbling) and developed a persisting, stratified, keratinising epidermis which immunohistologically proved to be of human

  2. Differential responses of cells from human skin keratinocyte and bovine mammary epithelium to attack by pore-forming Staphylococcus aureus alpha-toxin.

    Science.gov (United States)

    Suriyaphol, Gunnaporn; Sarikaputi, Meena; Suriyaphol, Prapat

    2009-11-01

    Human skin keratinocytes HaCat attacked by Staphylococcus aureus alpha-toxin showed a transient drop of cellular ATP levels whereas in toxin-perforated bovine mammary epithelial cells (BMEC), the ATP levels dropped more slowly. Morphologically, during the ATP level depletion, HaCat cell developed a spacious intracellular vacuole together with the transient influx of trypan blue. WST-1 signal, which tested the function of mitochondrial enzyme in viable cells, also decreased concomitantly. On the other hand, BMEC excluded trypan blue and vacuolation was not observed throughout the experiment. We conclude that mammary epithelial cells resist the toxin better than keratinocytes. This is the first report showing that alpha-toxin enhances transient membrane permeability to large molecules, temporary vacuole formation and the transient defect of mitochondrial enzyme in viable cells without cell lysis.

  3. Influence of extracellular matrix proteins on human keratinocyte attachment, proliferation and transfer to a dermal wound model.

    Science.gov (United States)

    Dawson, R A; Goberdhan, N J; Freedlander, E; MacNeil, S

    1996-03-01

    The aim of this study was to investigate whether prior culture of cells on ECM proteins might positively influence the performance of keratinocytes when cells are transferred to a dermal in vitro wound bed model. Keratinocytes were cultured using a method for producing cultured epithelial autografts for severely burned patients (essentially using Green's medium, a mitogen-rich medium containing fetal calf serum, cholera toxin, EGF, insulin, transferrin and triiodothyronine). Cells were cultured either on irradiated 3T3 fibroblasts (as in the standard Rheinwald and Green technique) or, alternatively, on collagen I, collagen IV, matrigel, RGD, vitronectin or fibronectin. Under these conditions matrigel, collagen I and IV enhanced initial attachment, RGD, vitronectin, fibronectin and irradiated 3T3 fibroblasts did not. Proliferation of cells was positively influenced by matrigel, collagen I and IV and irradiated 3T3 fibroblasts; of these, however, only matrigel and 3T3 fibroblasts had sustained significant effects on keratinocyte proliferation over 4 days. Cells on fibronectin showed significantly reduced proliferation. An acellular non-viable dermis was then used to mimic the homograft allodermis onto which cultured epithelial autograft sheets are grafted clinically and cells cultured on the various ECM proteins for 96 h were transferred to this in vitro wound model. None of the substrates enhanced keratinocyte performance on this model. It was concluded that under these conditions some ECM proteins can significantly affect keratinocyte attachment and, to a lesser extent, proliferation but that the culture of keratinocytes on these ECM proteins does not appear to confer any lasting benefit to the attachment of these keratinocytes to an in vitro wound-bed model.

  4. Upregulation of adhesion complex proteins and fibronectin by human keratinocytes treated with an aqueous extract from the leaves of Chromolaena odorata (Eupolin).

    Science.gov (United States)

    Phan, T T; Allen, J; Hughes, M A; Cherry, G; Wojnarowska, F

    2000-01-01

    The fresh leaves and extract of the plant Chromolaena odorata are a traditional herbal treatment in developing countries for burns, soft tissue wounds and skin infections. We have previously shown that the extract had an effect on the growth and proliferation of keratinocytes and fibroblasts in culture. This study has demonstrated that Eupolin extract increased expression of several components of the adhesion complex and fibronectin by human keratinocytes. Using indirect immunofluorescence we found increased expression (dose-dependent) of laminin 5, laminin 1, collagen IV, and fibronectin. The expression of the b1 and b4 integrins was upregulated by the extract at low concentrations (0.1 and 1 microg/ml), but the expression was decreased at higher doses of Eupolin (10 microg-150 microg/ml). A number of clinical studies carried out by Vietnamese and international medical investigators have demonstrated the efficacy of this extract on the wound healing process. In this study we have shown that Eupolin stimulated the expression of many proteins of the adhesion complex and fibronectin by human keratinocytes. The adhesion complex proteins are essential to stabilise epithelium and this effect could contribute to the clinical efficacy of Eupolin in healing.

  5. Protective effect of 3,4-dihydroxybenzoic acid isolated from Cladophora wrightiana Harvey against ultraviolet B radiation-induced cell damage in human HaCaT keratinocytes.

    Science.gov (United States)

    Cha, Ji Won; Piao, Mei Jing; Kim, Ki Cheon; Zheng, Jian; Yao, Cheng Wen; Hyun, Chang Lim; Kang, Hee Kyoung; Yoo, Eun Sook; Koh, Young Sang; Lee, Nam Ho; Ko, Mi Hee; Hyun, Jin Won

    2014-03-01

    The aim of the present study was to elucidate the protective properties of 3,4-dihydroxybenzoic acid (DBA) isolated from Cladophora wrightiana Harvey (a green alga) against ultraviolet B (UVB)-induced damage to human HaCaT keratinocytes. DBA exhibited scavenging actions against the 1,1-diphenyl-2-picrylhydrazyl radical, the superoxide anion, and the hydroxyl radical. Furthermore, DBA decreased the levels of intracellular reactive oxygen species generated by hydrogen peroxide or UVB treatment of the cells. DBA also decreased the UVB-augmented levels of phospho-histone H2A.X and the extent of comet tail formation, which are both indications of DNA damage. In addition, the compound safeguarded keratinocytes from UVB-induced injury by reversing the production of apoptotic bodies, overturning the disruption of mitochondrial membrane potential, increasing the expression of the anti-apoptotic protein, B-cell lymphoma 2, and decreasing the expression of the pro-apoptotic proteins, Bcl-2-associated X and cleaved caspase-3. Taken together, these results demonstrate that DBA isolated from a green alga protects human keratinocytes against UVB-induced oxidative stress and apoptosis.

  6. Human Papillomavirus type 16 E6 and E 7 proteins alter NF-kB in cultured cervical epithelial cells and inhibition of NF-kB promotes cell growth and immortalization

    Science.gov (United States)

    Vandermark, Erik R.; Deluca, Krysta A.; Gardner, Courtney R.; Marker, Daniel F.; Schreiner, Cynthia N.; Strickland, David A.; Wilton, Katelynn M.; Mondal, Sumona; Woodworth, Craig D.

    2012-01-01

    The NF-kB family of transcription factors regulates important biological functions including cell growth, survival and the immune response. We found that Human Papillomavirus type 16 (HPV-16) E7 and E6/E7 proteins inhibited basal and TNF-alpha-inducible NF-kB activity in human epithelial cells cultured from the cervical transformation zone, the anatomic region where most cervical cancers develop. In contrast, HPV-16 E6 regulated NF-kB in a cell type- and cell growth-dependent manner. NF-kB influenced immortalization of cervical cells by HPV16. Inhibition of NF-kB by an IkB alpha repressor mutant increased colony formation and immortalization by HPV-16. In contrast, activation of NF-kB by constitutive expression of p65 inhibited proliferation and immortalization. Our results suggest that inhibition of NF-kB by HPV-16 E6/E7 contributes to immortalization of cells from the cervical transformation zone. PMID:22284893

  7. Inflammatory responses of a human keratinocyte cell line to 10 nm citrate- and PEG-coated silver nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Bastos, V. [University of Aveiro, CESAM & Laboratory of Biotechnology and Cytomics (Portugal); Brown, D.; Johnston, H. [Heriot-Watt University, School of Life Sciences (United Kingdom); Daniel-da-Silva, A. L.; Duarte, I. F. [University of Aveiro, Department of Chemistry, CICECO – Aveiro Institute of Materials (Portugal); Santos, C., E-mail: csantos@fc.up.pt; Oliveira, H. [University of Aveiro, CESAM & Laboratory of Biotechnology and Cytomics (Portugal)

    2016-07-15

    Silver nanoparticles (AgNPs) are among the most commonly used engineered NPs and various commercially available products are designed to come in direct contact with the skin (wound dressings, textiles, creams, among others). Currently, there is limited understanding of the influence of coatings on the toxicity of AgNPs and in particular their ability to impact on AgNP’s mediated inflammatory responses. As AgNPs are often stabilized by different coatings, including citrate and polyethyleneglycol (PEG), in this study we investigate the influence of citrate (Cit10) or PEG (PEG10) coatings to 10 nm AgNP on skin, using human HaCaT keratinocytes. AgNPs cytotoxicity and inflammatory response (nuclear factor (NF)-κB induction and cytokine production) of HaCaT were assessed after in vitro exposure to 10 and 40 µg/mL after 4, 24, and 48 h. Results showed that although both types of coated AgNPs decreased cell proliferation and viability, Cit10 AgNPs were more toxic. NF-κB inhibition was observed for the highest concentration (40 µg/mL) of PEG10 AgNPs, and the putative link to early apoptotic pathways observed in these cells is discussed. No production of IL-1β, IL-6, IL-10, and TNFα was stimulated by AgNPs. Furthermore, Cit10 and PEG10 AgNPs decreased the release of MCP-1 by HaCaT cells after 48 h of exposure. As cytokines are vital for the immunologic regulation in the human body, and it is demonstrated that they may interfere with NPs, more research is needed to understand how different AgNPs affect the immune system.

  8. Comparison of rat epidermal keratinocyte organotypic culture (ROC) with intact human skin

    DEFF Research Database (Denmark)

    Pappinen, Sari; Hermansson, Martin; Kuntsche, Judith

    2008-01-01

    study was to compare the stratum corneum lipid content of ROC with the corresponding material from human skin. The lipid composition was determined by thin-layer chromatography (TLC) and mass-spectrometry, and the thermal phase transitions of stratum corneum were studied by differential scanning...... calorimetry (DSC). All major lipid classes of the stratum corneum were present in ROC in a similar ratio as found in human stratum corneum. Compared to human skin, the level of non-hydroxyacid-sphingosine ceramide (NS) was increased in ROC, while alpha-hydroxyacid-phytosphingosine ceramide (AP) and non...... compared to human skin, in agreement with the results from DSC. ROC underwent a lipid lamellar order to disorder transition (T2) at a slightly lower temperature (68 degrees C) than human skin (74 degrees C). These differences in stratum corneum lipid composition and the thermal phase transitions may...

  9. Punicalagin and (-)-Epigallocatechin-3-Gallate Rescue Cell Viability and Attenuate Inflammatory Responses of Human Epidermal Keratinocytes Exposed to Airborne Particulate Matter PM10.

    Science.gov (United States)

    Seok, Jin Kyung; Lee, Jeong-Won; Kim, Young Mi; Boo, Yong Chool

    2018-01-01

    Airborne particulate matter with a diameter of < 10 µm (PM10) causes oxidative damage, inflammation, and premature skin aging. In this study, we evaluated whether polyphenolic antioxidants attenuate the inflammatory responses of PM10-exposed keratinocytes. Primary human epidermal keratinocytes were exposed in vitro to PM10 in the absence or presence of punicalagin and (-)-epigallocatechin-3-gallate (EGCG), which are the major polyphenolic antioxidants found in pomegranate and green tea, respectively. Assays were performed to determine cell viability, production of reactive oxygen species (ROS), and expression of NADPH oxidases (NOX), proinflammatory cytokines, and matrix metalloproteinase (MMP)-1. PM10 decreased cell viability and increased ROS production in a dose-dependent manner. It also increased the expression levels of NOX-1, NOX-2, tumor necrosis factor-α (TNF-α), interleukin (IL)-1β, IL-6, IL-8, and MMP-1. Punicalagin was not cytotoxic up to 300 μM, and (-)-EGCG was cytotoxic above 30 μM, respectively. Further, punicalagin (3-30 μM) and EGCG (3-10 μM) rescued the viability of PM10-exposed cells. They also attenuated ROS production and the expression of NOX-1, NOX-2, TNF-α, IL-1β, IL-6, IL-8, and MMP-1 stimulated by PM10. This study demonstrates that polyphenolic antioxidants, such as punicalagin and (-)-EGCG, rescue keratinocyte viability and attenuate the inflammatory responses of these cells due to airborne particles. © 2018 S. Karger AG, Basel.

  10. Inhibitors of cysteine cathepsin and calpain do not prevent ultraviolet-B-induced apoptosis in human keratinocytes and HeLa cells

    DEFF Research Database (Denmark)

    Bang, Bo; Baadsgaard, Ole; Skov, Lone

    2004-01-01

    been demonstrated to play a role in the execution of programmed cell death induced by other stimuli, e.g. TNF-alpha. The purpose of the present study was therefore to investigate whether inhibitors of cysteine cathepsins and calpains could prevent UVB-induced apoptosis in HeLa cells and keratinocytes....... This was done by investigating the effect of the irreversible cysteine protease inhibitor zFA-fmk, the cathepsin B inhibitor CA-074-Me and the calpain inhibitor ALLN on the viability of UVB-irradiated human keratinocytes and HeLa cells. At concentrations of 10 microM and above zVAD-fmk conferred partial dose......-dependent protection against UVB-induced apoptosis in HeLa cells and keratinocytes. Moreover, caspase-3 activity was completely blocked at zVAD-fmk concentrations of 1 microM in HeLa cells. This indicates that caspase-independent mechanisms could be involved in UVB-induced apoptosis. However, the protease inhibitors z...

  11. Cultivating technique for human keratinocyte under laboratory condition%实验室条件下人角质形成细胞的培养技术

    Institute of Scientific and Technical Information of China (English)

    卢宁; 朱平; 刘玉峰; 王刚; 张海龙; 赵小东

    2006-01-01

    %,9 d左右细胞融合达90%,11d左右细胞完全融合形成细胞膜片.角质形成细胞可在体外稳定培养2~3个月,细胞形态和生长速度无明显改变. ②不同代的角质形成细胞冻存和复苏情况:将不同代的角质形成细胞分别冻存于液氮罐中,3个月后进行复苏,发现角质形成细胞的形态和生长速度无明显改变.③角质形成细胞形态学观察结果:显微镜下细胞呈典型上皮样特征,高核浆比例,细胞紧密排列,轮廓清楚折光性好.透射电镜下培养的表皮角质形成细胞胞浆内有大量束状张力丝和张力原纤维,可见线粒体和粗面内质网,胞质周边有短的突起,细胞间有桥粒相连等角化细胞所具有的特点.结论:培养的角质形成细胞在多次传代后仍能够保持正常的形态特征,提示改良的培养角质形成细胞的技术可为实验和临床提供可靠丰富的角质形成细胞来源.%BACKGROUND: Along with the establishment and development of in vitro culture technique for human keratinocyte, skin would no longer be considered only as the physiological barrier, it's of important significance in immunity and endocrinology and so on.OBJECTIVE: To explore the experimental cultivating technique for human keratinocytes to provide reliable cell resource forthe appliance of keratinocytes in many ways.DESIGN: An opening study with keratinocytes as the subjects of the experiment.SETTING: Department of Immunology and Department of Dermatology,Xijing Hospital, Fourth Military Medical University of Chinese PLA MATERIALS: This experiment was carried out in the clinical laboratory of Department of Immunology of Xijing Hospital of the Fourth Military Medical University of Chinese PLA between March 2003 and March 2005.Prepuce sample was postoperatively obtained from a 6-year-old boy who was admitted to the department of urology surgery of Xijing hospital in April 2003, prepuce was used as the source for keratinocytes.METHODS:

  12. Universal mortality law and immortality

    Science.gov (United States)

    Azbel', Mark Ya.

    2004-10-01

    Well-protected human and laboratory animal populations with abundant resources are evolutionarily unprecedented. Physical approach, which takes advantage of their extensively quantified mortality, establishes that its dominant fraction yields the exact law, which is universal for all animals from yeast to humans. Singularities of the law demonstrate new kinds of stepwise adaptation. The law proves that universal mortality is an evolutionary by-product, which at any given age is reversible, independent of previous life history, and disposable. Life expectancy may be extended, arguably to immortality, by minor biological amendments in the animals. Indeed, in nematodes with a small number of perturbed genes and tissues it increased 6-fold (to 430 years in human terms), with no apparent loss in health and vitality. The law relates universal mortality to specific processes in cells and their genetic regulation.

  13. Symbiotic Plant Peptides Eliminate Candida albicans Both In Vitro and in an Epithelial Infection Model and Inhibit the Proliferation of Immortalized Human Cells

    Directory of Open Access Journals (Sweden)

    Lilla Ördögh

    2014-01-01

    Full Text Available The increasing number of multidrug-resistant microbes now emerging necessitates the identification of novel antimicrobial agents. Plants produce a great variety of antimicrobial peptides including hundreds of small, nodule-specific cysteine-rich NCR peptides that, in the legume Medicago truncatula, govern the differentiation of endosymbiotic nitrogen fixing bacteria and, in vitro, can display potent antibacterial activities. In this study, the potential candidacidal activity of 19 NCR peptides was investigated. Cationic NCR peptides having an isoelectric point above 9 were efficient in killing Candida albicans, one of the most common fungal pathogens of humans. None of the tested NCR peptides were toxic for immortalized human epithelial cells at concentrations that effectively killed the fungus; however, at higher concentrations, some of them inhibited the division of the cells. Furthermore, the cationic peptides successfully inhibited C. albicans induced human epithelial cell death in an in vitro coculture model. These results highlight the therapeutic potential of cationic NCR peptides in the treatment of candidiasis.

  14. Investigation of double strand breaks induced by alpha particle irradiation using C.N.B.G. microbeam in human keratinocytes

    International Nuclear Information System (INIS)

    Pouthier, Th.

    2006-12-01

    To understand the mechanisms of interaction of ionizing radiation with living tissues exposed to low and protracted doses remains a major issue for risk evaluation. The response cannot be found in epidemiological studies because the only available data concern accidental exposures to high doses of radiation. The natural exposure represents the main source of exposure in the daily life, just before the medical sources (radiology, radiotherapy). In addition, this kind of exposure is very difficult to reproduce in vitro by irradiating cell lines. The method per preference is based on random irradiation of cell populations. The mean number of particles having traversed cells is then calculated on the basis of Poisson statistics. In addition to inevitable multiple impacts, the numerous potential intracellular targets (nuclei, cytoplasm), the indirect effects induced by the impact of particles on neighbouring cells or simply the extracellular targets, constitute phenomena that make more complex the interpretation of experimental data. A charged particle microbeam was developed at C.E.N.B.G. to perform the targeted irradiation of individual cells with a targeting precision of a few microns. It is possible to deliver a counted number of alpha particles down to the ultimate dose of one alpha per cell, to target predetermined cells and then to observe the response of the neighbouring cells. This facility has been validated during this work on human keratinocyte cells expressing a recombinant nuclear fluorescent protein (histone H2B-GFP). The combination of ion micro-beams with confocal microscopy and numeric quantitative analysis allowed the measurement of DNA double strand breaks via the phosphorylation of the histone H2A.X in individual cells. The mechanisms of DNA reparation and apoptosis induction were also in the scope of those studies. The experimental results obtained during this thesis validate the methodology we have developed by demonstrating the targeting

  15. Effect of irradiation on cell cycle, cell death and expression of its related proteins in normal human oral keratinocytes

    International Nuclear Information System (INIS)

    Kang, Mi Ae; Heo, Min Suk; Lee, Sam Sun; Oh, Sung Ook; Choi, Soon Chul; Park, Tae Won; Lee, Sul Mi; Jeon, In Seong

    2003-01-01

    To investigate the radiosensitivity of the normal human oral keratinocytes (NHOK), and the effect of irradiation on cell cycle and protein expression. To evaluate the radiosensitivity of NHOK, the number of colonies and cells were counted after irradiation and the SF2 (survival fraction as 2 Gy) value, and the cell survival curve fitted on a linear-quadratic model were obtained. LDH analysis was carried out to evaluate the necrosis of NHOK at 1, 2,3, and 4 days after 2, 10, and 20 Gy irradiation. Cell cycle arrest and the induction of apoptosis were analyzed using flow cytometry at 1, 2, 3, and 4 days after 2, 10, and 20 Gy irradiation. Finally, proteins related cell cycle arrest and apoptosis were analysed by Western blot. The number of survival cell was significantly decreased in a dose-dependent manner. The cell survival curve showed SF2, α, and β values to be 0.568, 0.209, and 0.020 respectively. At 20 Gy irradiated cells showed higher optical density than the control group. After irradiation, apoptosis was not observed but G2 arrest was observed in the NHOK cells. 1 day after 10 Gy irradiation, the expression of p53 remained unchanged, the p21 WAF1/Cip1 increased and the mdm2 decreased. The expression of bax, bcl-2, cyclin B1, and cyclin D remained unchanged. These results indicate that NHOK responds to irradiation by G2 arrest, which is possibly mediated by the expression of p21 WAF1/Cip1 , and that cell necrosis occurs by high dose irradiation.

  16. Modulation of TLR2 protein expression by a miR-105 in human oral keratinocytes

    Science.gov (United States)

    Mammalian biological processes such as inflammation, involve regulation of hundreds of genes controlling onset and termination. MicroRNAs (miRNAs) can translationally repress target mRNAs and can regulate innate immune responses. Our model system comprised primary human keratinoc...

  17. In vivo production of novel vitamin D2 hydroxy-derivatives by human placentas, epidermal keratinocytes, Caco-2 colon cells and the adrenal gland

    Science.gov (United States)

    Slominski, Andrzej T.; Kim, Tae-Kang; Shehabi, Haleem Z.; Tang, Edith; Benson, Heather A. E.; Semak, Igor; Lin, Zongtao; Yates, Charles R.; Wang, Jin; Li, Wei; Tuckey, Robert C.

    2014-01-01

    We investigated the metabolism of vitamin D2 to hydroxyvitamin D2 metabolites ((OH)D2) by human placentas ex-utero, adrenal glands ex-vivo and cultured human epidermal keratinocytes and colonic Caco-2 cells, and identified 20(OH)D2, 17,20(OH)2D2, 1,20(OH)2D2, 25(OH)D2 and 1,25(OH)2D2 as products. Inhibition of product formation by 22R-hydroxycholesterol indicated involvement of CYP11A1 in 20- and 17-hydroxylation of vitamin D2, while use of ketoconazole indicated involvement of CYP27B1 in 1α-hydroxylation of products. Studies with purified human CYP11A1 confirmed the ability of this enzyme to convert vitamin D2 to 20(OH)D2 and 17,20(OH)2D2. In placentas and Caco-2 cells, production of 20(OH)D2 was higher than 25(OH)D2 while in human keratinocytes the production of 20(OH)D2 and 25(OH)D2 were comparable. HaCaT keratinocytes showed high accumulation of 1,20(OH)2D2 relative to 20(OH)D2 indicating substantial CYP27B1 activity. This is the first in vivo evidence for a novel pathway of vitamin D2 metabolism initiated by CYP11A1 and modified by CYP27B1, with the product profile showing tissue- and cell-type specificity. PMID:24382416

  18. Identification of differentially expressed proteins between human esophageal immortalized and carcinomatous cell lines by two-dimensional electrophoresis and MALDI-TOF-mass spectrometry

    Institute of Scientific and Technical Information of China (English)

    Xing-Dong Xiong; Li-Yan Xu; Zhong-Ying Shen; Wei-Jia Cai; Jian-Min Luo; Ya-Li Han; En-Min Li

    2002-01-01

    AIM: To identify the differentially expressed proteins between the human immortalized esophageal epithelial cell line (SHEE) and the malignant transformed esophageal carcinoma cell line (SHEEC), and to explore new ways for studying esophageal carcinoma associated genes. METHODS: SHEE and SHEEC cell lines were used to separate differentially expressed proteins by two-dimensional electrophoresis/The silver-stained 2-D gels was scanned with EDAS290 digital camera system and analyzed with the PDQuest 6.2 Software. Six spots in which the differentially expressed protein was more obvious were selected and analyzed with matrix-assisted laser desorption/ionization time of flying mass spectrometry (MALDI-TOF-MS).RESULTS: There were 107±4.58 and 115±9.91 protein spots observed in SHEE and SHEEC respectively, and the majority of these spots between the two cell lines matched each other (r=-0.772), only a few were expressed differentially. After analyzed by MALDI-TOF-MS and database search for the six differentially expressed proteins, One new protein as well as other five sequence-known proteins including RNPEP-like protein, human rRNA gene upstream sequence binding transcription factor, uracil DNA glycosylase,Annexin A2 and p300/CBP-associated factor were preliminarily identified.CONCLUSION: These differentially expressed proteins might play an importance role during malignant transformation of SHEEC from SHEE. The identification of these proteins may serve as a new way for studying esophageal carcinoma associated genes.

  19. Protective effect of Juglans regia L. against ultraviolet B radiation induced inflammatory responses in human epidermal keratinocytes.

    Science.gov (United States)

    Muzaffer, Umar; Paul, V I; Prasad, Nagarajan Rajendra; Karthikeyan, Ramasamy; Agilan, Balupillai

    2018-03-15

    Juglans regia L. has a history of traditional medicinal use for the treatment of various maladies and have been documented with significant antioxidant and antiinflammatory properties. Although all parts of the plant are medicinally important, but male the flower of the plant has not been yet investigated against the photo-damage. The present study, we sought to determine the photoprotective effect of the male flower of J. regia L. against ultraviolet-B radiation-induced inflammatory responses in human skin cells. The profile of pharmacological active compounds present in the male flower of J. regia was analyzed by GC-MS. Then, the antioxidant property of methanolic extract of J. regia (MEJR) was analyzed by in vitro free radical scavenging assays. Further, we analyzed the sun protection factor of this extract by spectrophotometry. Moreover, we investigated the photoprotective effect of MEJR against UVB induced inflammatory signaling in human epidermal cells. Human skin epidermal keratinocytes (HaCaT) were pretreated with the MEJR (80 µg/ml), 30 min prior to UVB-irradiation at a dose of 20 mJ/cm 2 and were investigated for lipid peroxidation, enzymatic antioxidants activity, apoptosis and inflammatory markers expression level. The GC-MS results showed the presence of good amount of pharmacologically active compounds in the MEJR. We observed that the MEJR possess significant free radical scavenging activity and it was comparable with standard antioxidants. Further, the MEJR exhibits 8.8 sun-protection-factor (SPF) value. Pretreatment with MEJR, 30 min prior to UVB-irradiation, prevented ROS generation, lipid peroxidation and restored the activity of antioxidant status in HaCaT cells. Moreover, MEJR pretreatment significantly prevented UVB activated inflammatory markers like TNF-α, IL-1, IL-6, NF-κB, COX-2 in HaCaT. The present findings suggest that MEJR exhibit photoprotective effects and hence it may be useful for the treatment of inflammation related

  20. Ultraviolet B, melanin and mitochondrial DNA: Photo-damage in human epidermal keratinocytes and melanocytes modulated by alpha-melanocyte-stimulating hormone [version 1; referees: 2 approved

    Directory of Open Access Journals (Sweden)

    Markus Böhm

    2016-05-01

    Full Text Available Alpha-melanocyte-stimulating hormone (alpha-MSH increases melanogenesis and protects from UV-induced DNA damage. However, its effect on mitochondrial DNA (mtDNA damage is unknown. We have addressed this issue in a pilot study using human epidermal keratinocytes and melanocytes incubated with alpha-MSH and irradiated with UVB. Real-time touchdown PCR was used to quantify total and deleted mtDNA. The deletion detected encompassed the common deletion but was more sensitive to detection. There were 4.4 times more mtDNA copies in keratinocytes than in melanocytes. Irradiation alone did not affect copy numbers. Alpha-MSH slightly increased copy numbers in both cell types in the absence of UVB and caused a similar small decrease in copy number with dose in both cell types. Deleted copies were nearly twice as frequent in keratinocytes as in melanocytes. Alpha-MSH reduced the frequency of deleted copies by half in keratinocytes but not in melanocytes. UVB dose dependently led to an increase in the deleted copy number in alpha-MSH-treated melanocytes. UVB irradiation had little effect on deleted copy number in alpha-MSH-treated keratinocytes. In summary, alpha-MSH enhances mtDNA damage in melanocytes presumably by increased melanogenesis, while α-MSH is protective in keratinocytes, the more so in the absence of irradiation.

  1. Oxidative stress induced by palytoxin in human keratinocytes is mediated by a H+-dependent mitochondrial pathway

    International Nuclear Information System (INIS)

    Pelin, Marco; Ponti, Cristina; Sosa, Silvio; Gibellini, Davide; Florio, Chiara; Tubaro, Aurelia

    2013-01-01

    In the last decades, massive blooms of palytoxin (PLTX)-producing Ostreopsis cf. ovata have been observed along Mediterranean coasts, usually associated to human respiratory and cutaneous problems. At the molecular level, PLTX induces a massive intracellular Na + influx due to the transformation of Na + /K + ATPase in a cationic channel. Recently, we have demonstrated that Na + overload is the crucial step in mediating overproduction of reactive oxygen species (ROS) and cell death in human HaCaT keratinocytes, tentatively explaining PLTX-induced skin irritant effects. In the present study the molecular mechanisms of ROS production induced by PLTX-mediated Na + intracellular overload have been investigated. In HaCaT cells, PLTX exposure caused accumulation of superoxide anion, but not of nitric oxide or peroxynitrite/hydroxyl radicals. Even if RT-PCR and western blot analysis revealed an early NOX-2 and iNOS gene and protein over-expressions, their active involvement seemed to be only partial since selective inhibitors did not completely reduce O 2 − production. A significant role of other enzymes (COX-1, COX-2, XO) was not evidenced. Nigericin, that counteracts Na + -mediated H + -imbalance, dissipating ΔpH across mitochondrial inner membrane, and the uncouplers DNP significantly reduced O 2 − production. These inhibitions were synergistic when co-exposed with complex-I inhibitor rotenone. These results suggest a novel mechanism of O 2 − production induced by PLTX-mediated ionic imbalance. Indeed, the H + intracellular overload that follows PLTX-induced intracellular Na + accumulation, could enhance ΔpH across mitochondrial inner membrane, that seems to be the driving force for O 2 − production by reversing mitochondrial electron transport. Highlights: ► PLTX induces superoxide (O 2 − ) production by reversing mitochondrial transport chain. ► The mechanism of O 2 − production is dependent on PLTX-induced ionic imbalance. ► The results led to the

  2. Oxidative stress induced by palytoxin in human keratinocytes is mediated by a H{sup +}-dependent mitochondrial pathway

    Energy Technology Data Exchange (ETDEWEB)

    Pelin, Marco, E-mail: marco.pelin@phd.units.it [Department of Life Science, University of Trieste, Via L. Giorgieri 7/9, 34127 Trieste (Italy); Ponti, Cristina, E-mail: cponti@units.it [Department of Life Science, University of Trieste, Via L. Giorgieri 7/9, 34127 Trieste (Italy); Sosa, Silvio, E-mail: silvio.sosa@econ.units.it [Department of Life Science, University of Trieste, Via L. Giorgieri 7/9, 34127 Trieste (Italy); Gibellini, Davide, E-mail: davide.gibellini@unibo.it [Department of Haematology and Oncological Sciences, University of Bologna, Via Massarenti 9, 40138 Bologna (Italy); Florio, Chiara, E-mail: florioc@units.it [Department of Life Science, University of Trieste, Via L. Giorgieri 7/9, 34127 Trieste (Italy); Tubaro, Aurelia, E-mail: tubaro@units.it [Department of Life Science, University of Trieste, Via L. Giorgieri 7/9, 34127 Trieste (Italy)

    2013-01-01

    In the last decades, massive blooms of palytoxin (PLTX)-producing Ostreopsis cf. ovata have been observed along Mediterranean coasts, usually associated to human respiratory and cutaneous problems. At the molecular level, PLTX induces a massive intracellular Na{sup +} influx due to the transformation of Na{sup +}/K{sup +} ATPase in a cationic channel. Recently, we have demonstrated that Na{sup +} overload is the crucial step in mediating overproduction of reactive oxygen species (ROS) and cell death in human HaCaT keratinocytes, tentatively explaining PLTX-induced skin irritant effects. In the present study the molecular mechanisms of ROS production induced by PLTX-mediated Na{sup +} intracellular overload have been investigated. In HaCaT cells, PLTX exposure caused accumulation of superoxide anion, but not of nitric oxide or peroxynitrite/hydroxyl radicals. Even if RT-PCR and western blot analysis revealed an early NOX-2 and iNOS gene and protein over-expressions, their active involvement seemed to be only partial since selective inhibitors did not completely reduce O{sub 2}{sup −} production. A significant role of other enzymes (COX-1, COX-2, XO) was not evidenced. Nigericin, that counteracts Na{sup +}-mediated H{sup +}-imbalance, dissipating ΔpH across mitochondrial inner membrane, and the uncouplers DNP significantly reduced O{sub 2}{sup −} production. These inhibitions were synergistic when co-exposed with complex-I inhibitor rotenone. These results suggest a novel mechanism of O{sub 2}{sup −} production induced by PLTX-mediated ionic imbalance. Indeed, the H{sup +} intracellular overload that follows PLTX-induced intracellular Na{sup +} accumulation, could enhance ΔpH across mitochondrial inner membrane, that seems to be the driving force for O{sub 2}{sup −} production by reversing mitochondrial electron transport. Highlights: ► PLTX induces superoxide (O{sub 2}{sup −}) production by reversing mitochondrial transport chain. ► The mechanism of

  3. UV Radiation Activates Toll-Like Receptor 9 Expression in Primary Human Keratinocytes, an Event Inhibited by Human Papillomavirus 38 E6 and E7 Oncoproteins.

    Science.gov (United States)

    Pacini, Laura; Ceraolo, Maria Grazia; Venuti, Assunta; Melita, Giusi; Hasan, Uzma A; Accardi, Rosita; Tommasino, Massimo

    2017-10-01

    Several lines of evidence indicate that cutaneous human papillomavirus (HPV) types belonging to the beta genus of the HPV phylogenetic tree synergize with UV radiation in the development of skin cancer. Accordingly, the E6 and E7 oncoproteins from some beta HPV types are able to deregulate pathways related to immune response and cellular transformation. Toll-like receptor 9 (TLR9), in addition to playing a role in innate immunity, has been shown to be involved in the cellular stress response. Using primary human keratinocytes as experimental models, we have shown that UV irradiation (and other cellular stresses) activates TLR9 expression. This event is closely linked to p53 activation. Silencing the expression of p53 or deleting its encoding gene affected the activation of TLR9 expression after UV irradiation. Using various strategies, we have also shown that the transcription factors p53 and c-Jun are recruited onto a specific region of the TLR9 promoter after UV irradiation. Importantly, the E6 and E7 oncoproteins from beta HPV38, by inducing the accumulation of the p53 antagonist ΔNp73α, prevent the UV-mediated recruitment of these transcription factors onto the TLR9 promoter, with subsequent impairment of TLR9 gene expression. This study provides new insight into the mechanism that mediates TLR9 upregulation in response to cellular stresses. In addition, we show that HPV38 E6 and E7 are able to interfere with this mechanism, providing another explanation for the possible cooperation of beta HPV types with UV radiation in skin carcinogenesis. IMPORTANCE Beta HPV types have been suggested to act as cofactors in UV-induced skin carcinogenesis by altering several cellular mechanisms activated by UV radiation. We show that the expression of TLR9, a sensor of damage-associated molecular patterns produced during cellular stress, is activated by UV radiation in primary human keratinocytes (PHKs). Two transcription factors known to be activated by UV radiation, p53

  4. Acrolein, an I-κBα-independent downregulator of NF-κB activity, causes the decrease in nitric oxide production in human malignant keratinocytes.

    Science.gov (United States)

    Moon, Ki-Young

    2011-05-01

    Acrolein, a reactive electrophilic α, β-unsaturated aldehyde, is known to be an alkylating chemical carcinogen. The effect of acrolein on the activation of NF-κB in human malignant epidermal keratinocytes was examined to elucidate the molecular mechanism associated with this NF-κB-acrolein regulation and its consecutive sequence, nitric oxide (NO) production. Acrolein significantly downregulated the cellular NF-κB activity up to 60% compared with control as well as the lipopolysaccharide (LPS)-induced NO production in a dose response manner at concentrations of 10~30 μM. To investigate the regulatory mechanism associated with this NF-κB-acrolein downregulation, the relative level of phosphorylation of I-κBα (serines-32 and -36), a principle regulator of NF-κB activation, represented by acrolein, was quantified. Acrolein inhibited NF-κB activity without altering cellular levels of the phosphorylated and nonphosphorylated forms of I-κBα, implying that the downregulatory effect of acrolein on cellular NF-κB activity in human skin cells is an I-κBα-independent activation pathway. The results suggests that acrolein causes the decrease in nitric oxide production as an I-κBα-independent downregulator of NF-κB activity in human malignant keratinocytes, and acrolein-induced carcinogenesis may be associated with the modulation of cellular NF-κB activity.

  5. CARMA2sh and ULK2 control pathogen-associated molecular patterns recognition in human keratinocytes: psoriasis-linked CARMA2sh mutants escape ULK2 censorship.

    Science.gov (United States)

    Scudiero, Ivan; Mazzone, Pellegrino; D'Andrea, Luca E; Ferravante, Angela; Zotti, Tiziana; Telesio, Gianluca; De Rubis, Gabriele; Reale, Carla; Pizzulo, Maddalena; Muralitharan, Shanmugakonar; Vito, Pasquale; Stilo, Romania

    2017-02-23

    The molecular complexes formed by specific members of the family of CARMA proteins, the CARD domain-containing adapter molecule BCL10 and MALT1 (CBM complex) represent a central hub in regulating activation of the pleiotropic transcription factor NF-κB. Recently, missense mutations in CARMA2sh have been shown to cause psoriasis in a dominant manner and with high penetrancy. Here, we demonstrate that in human keratinocytes CARMA2sh plays an essential role in the signal transduction pathway that connects pathogen-associated molecular patterns recognition to NF-κB activation. We also find that the serine/threonine kinase ULK2 binds to and phosphorylates CARMA2sh, thereby inhibiting its capacity to activate NF-κB by promoting lysosomal degradation of BCL10, which is essential for CARMA2sh-mediated NF-κB signaling. Remarkably, CARMA2sh mutants associated with psoriasis escape ULK2 inhibition. Finally, we show that a peptide blocking CARD-mediated BCL10 interactions reduces the capacity of psoriasis-linked CARMA2sh mutants to activate NF-κB. Our work elucidates a fundamental signaling mechanism operating in human keratinocytes and opens to novel potential tools for the therapeutical treatment of human skin disorders.

  6. Effects of UVB-induced oxidative stress on protein expression and specific protein oxidation in normal human epithelial keratinocytes: a proteomic approach

    Directory of Open Access Journals (Sweden)

    De Marco Federico

    2010-03-01

    Full Text Available Abstract Background The UVB component of solar ultraviolet irradiation is one of the major risk factors for the development of skin cancer in humans. UVB exposure elicits an increased generation of reactive oxygen species (ROS, which are responsible for oxidative damage to proteins, DNA, RNA and lipids. In order to examine the biological impact of UVB irradiation on skin cells, we used a parallel proteomics approach to analyze the protein expression profile and to identify oxidatively modified proteins in normal human epithelial keratinocytes. Results The expression levels of fifteen proteins - involved in maintaining the cytoskeleton integrity, removal of damaged proteins and heat shock response - were differentially regulated in UVB-exposed cells, indicating that an appropriate response is developed in order to counteract/neutralize the toxic effects of UVB-raised ROS. On the other side, the redox proteomics approach revealed that seven proteins - involved in cellular adhesion, cell-cell interaction and protein folding - were selectively oxidized. Conclusions Despite a wide and well orchestrated cellular response, a relevant oxidation of specific proteins concomitantly occurs in UVB-irradiated human epithelial Keratinocytes. These modified (i.e. likely dysfunctional proteins might result in cell homeostasis impairment and therefore eventually promote cellular degeneration, senescence or carcinogenesis.

  7. Low-dose dose-response for reduced cell viability after exposure of human keratinocyte (HEK001 cells to arsenite

    Directory of Open Access Journals (Sweden)

    Kenneth T. Bogen

    Full Text Available The in vitro arsenite (AsIII cytotoxicity dose-response (DR of human keratinocytes (HEK001 was examined at greater statistical resolution than ever previously reported using the MTT assay to determine cell viability. Fifty-four 96-well plates were treated with AsIII concentrations of 0.25, 0.5, 1, 2, 3, 4, 5, 7, 10, 15, 20, 25, or 30 μM. Because of unexpected variation in viability response patterns, a two-stage DR analysis was used in which data on plate-specific viability (%, estimated as 100% times the ratio of measured viability in exposed to unexposed cells, were fit initially to a generalized lognormal response function positing that HEK001 cells studied consisted of: a proportion P of relatively highly sensitive (HS cells, a proportion Po of relatively resistant cells, and a remaining (1–P–Po fraction of typical-sensitivity (TS cells exhibiting the intermediate level of AsIII sensitivity characteristic of most cells in each assay. The estimated fractions P and Po were used to adjust data from all 54 plates (and from the 28 plates yielding the best fits to reflect the condition that P = Po = 0 to provide detailed DR analysis specifically for TS cells. Four DR models fit to the combined adjusted data were each very predictive (R2 > 0.97 overall but were inconsistent with at least one of the data set examined (p  0.30 and exceeded 100% significance (p ≤ 10−6. A low-dose hormetic model provided the best fit to the combined adjusted data for TS cells (R2 = 0.995. Marked variability in estimates of P (the proportion of apparent HS cells was unexpected, not readily explained, and warrants further study using additional cell lines and assay methods, and in vivo. Keywords: Arsenic, Arsenate, Cell culture, Cell death, Cytotoxicity, HEK001 cells

  8. Interleukin-1α Induction in Human Keratinocytes (HaCaT: An In Vitro Model for Chemoprevention in Skin

    Directory of Open Access Journals (Sweden)

    T. Magcwebeba

    2012-01-01

    Full Text Available Long-term exposure to UV irradiation and toxic chemicals is associated with chronic inflammation that contributes to skin cancer development with interleukin-1 alpha (IL-1α, constitutively produced by keratinocytes, playing a pivotal role in skin inflammation. The aim of this study was to investigate the modulation of IL-1α production in the HaCaT keratinocyte cell line. Phorbol 12-myristate 13-acetate failed to induce IL-1α in HaCaT cells, and this might be associated with the specific deficiency known to affect downstream signalling of the MEK/ERK pathway in these cells. The calcium ionophore, ionomycin, slightly enhanced the production of intracellular (icIL-1α, but this resulted in a necrotic release at higher concentrations. UV-B exposure significantly increased the production of icIL-1α in a dose-dependent manner with a maximal induction exhibited at 24 h with minimal necrotic and apoptotic effects. Validation of the HaCaT cell model indicated that the nonsteroidal anti-inflammatory drug (NSAID, ibuprofen, and the glucocorticoid, dexamethasone, inhibited icIL-1α production, and this was associated with a slight inhibition of cell viability. The UV-B-induced keratinocyte cell model provides an in vitro system that could, apart from phorbol ester-like compounds, be utilised as a screening assay in identifying skin irritants and/or therapeutic topical agents via the modulation of IL-1α production.

  9. Binding of antibodies to the extractable nuclear antigens SS-A/Ro and SS-B/La is induced on the surface of human keratinocytes by ultraviolet light (UVL): Implications for the pathogenesis of photosensitive cutaneous lupus

    International Nuclear Information System (INIS)

    Furukawa, F.; Kashihara-Sawami, M.; Lyons, M.B.; Norris, D.A.

    1990-01-01

    Autoantibodies to the non-histone nucleoprotein antigens SS-A/Ro, SS-B/La, and RNP are highly associated with photosensitive cutaneous lupus erythematosus (LE). In order to better understand the potential mechanisms of ultraviolet (UV) light on photosensitivity in patients with cutaneous LE, we designed immunopathologic in vitro and in vivo experiments to evaluate the effects of UV on the binding of such autoantibodies to the surface of human keratinocytes, one major target of immunologic damage in photosensitive LE. Short-term 2% paraformaldehyde fixation of suspensions of cultured human keratinocytes previously incubated with monospecific antiserum probes enabled the detection of ENA expression on the cell surface by flow-cytometry analysis. UVB light (280-320 nm) induced the binding of monospecific antibody probes for SS-A/Ro and SS-B/La on keratinocytes in a dose-dependent pattern with maximal induction observed at the dose of 200 mJ/cm2 UVB. Binding of SS-A/Ro, SS-B/La, and RNP antibody was augmented strongly, but binding of anti-Sm was very weak. In contrast, UVA (320-400 nm) light had no effect on the induction of binding of these antibody probes. Identical results were seen by standard immunofluorescence techniques. Hydroxyurea-treated keratinocytes showed similar induction of those antigens by UVB irradiation, which suggested that ENA expression on cultured keratinocytes by UVB were cell-cycle independent. Tunicamycin, an inhibitor of glycosylation of proteins, reduced UVB light effect on the SS-A/Ro and SS-B/La antigen's expression. These in vitro FACS analyses revealed that ENA augmentation on the keratinocyte cell surface was dose dependent, UVB dependent, glycosylation dependent, and cell-cycle independent. In vivo ENA augmentation on the keratinocyte surface was examined in suction blister epidermal roofs

  10. A distal region of the human TGM1 promoter is required for expression in transgenic mice and cultured keratinocytes

    Directory of Open Access Journals (Sweden)

    Lu Ying

    2004-04-01

    Full Text Available Abstract Background TGM1(transglutaminase 1 is an enzyme that crosslinks the cornified envelope of mature keratinocytes. Appropriate expression of the TGM1 gene is crucial for proper keratinocyte function as inactivating mutations lead to the debilitating skin disease, lamellar ichthyosis. TGM1 is also expressed in squamous metaplasia, a consequence in some epithelia of vitamin A deficiency or toxic insult that can lead to neoplasia. An understanding of the regulation of this gene in normal and abnormal differentiation states may contribute to better disease diagnosis and treatment. Methods In vivo requirements for expression of the TGM1 gene were studied by fusing various lengths of promoter DNA to a reporter and injecting the DNA into mouse embryos to generate transgenic animals. Expression of the reporter was ascertained by Western blotting and immunohistochemistry. Further delineation of a transcriptionally important distal region was determined by transfections of progressively shortened or mutated promoter DNA into cultured keratinocytes. Results In vivo analysis of a reporter transgene driven by the TGM1 promoter revealed that 1.6 kilobases, but not 1.1 kilobases, of DNA was sufficient to confer tissue-specific and cell layer-specific expression. This same region was responsible for reporter expression in tissues undergoing squamous metaplasia as a response to vitamin A deprivation. Mutation of a distal promoter AP1 site or proximal promoter CRE site, both identified as important transcriptional elements in transfection assays, did not prevent appropriate expression. Further searching for transcriptional elements using electrophoretic mobility shift (EMSA and transfection assays in cultured keratinocytes identified two Sp1 elements in a transcriptionally active region between -1.6 and -1.4 kilobases. While mutation of either Sp1 site or the AP1 site singly had only a small effect, mutation of all three sites eliminated nearly all the

  11. Nicotinamide enhances repair of arsenic and ultraviolet radiation-induced DNA damage in HaCaT keratinocytes and ex vivo human skin.

    Directory of Open Access Journals (Sweden)

    Benjamin C Thompson

    Full Text Available Arsenic-induced skin cancer is a significant global health burden. In areas with arsenic contamination of water sources, such as China, Pakistan, Myanmar, Cambodia and especially Bangladesh and West Bengal, large populations are at risk of arsenic-induced skin cancer. Arsenic acts as a co-carcinogen with ultraviolet (UV radiation and affects DNA damage and repair. Nicotinamide (vitamin B3 reduces premalignant keratoses in sun-damaged skin, likely by prevention of UV-induced cellular energy depletion and enhancement of DNA repair. We investigated whether nicotinamide modifies DNA repair following exposure to UV radiation and sodium arsenite. HaCaT keratinocytes and ex vivo human skin were exposed to 2μM sodium arsenite and low dose (2J/cm2 solar-simulated UV, with and without nicotinamide supplementation. DNA photolesions in the form of 8-oxo-7,8-dihydro-2'-deoxyguanosine and cyclobutane pyrimidine dimers were detected by immunofluorescence. Arsenic exposure significantly increased levels of 8-oxo-7,8-dihydro-2'-deoxyguanosine in irradiated cells. Nicotinamide reduced both types of photolesions in HaCaT keratinocytes and in ex vivo human skin, likely by enhancing DNA repair. These results demonstrate a reduction of two different photolesions over time in two different models in UV and arsenic exposed cells. Nicotinamide is a nontoxic, inexpensive agent with potential for chemoprevention of arsenic induced skin cancer.

  12. UVB irradiation does not directly induce detectable changes of DNA methylation in human keratinocytes [v1; ref status: indexed, http://f1000r.es/np

    Directory of Open Access Journals (Sweden)

    Christoph Lahtz

    2013-02-01

    Full Text Available Unprotected exposure to UVB radiation from the sun and the resulting DNA damage are thought to be responsible for physiological changes in the skin and for a variety of skin cancers, including basal cell and squamous cell carcinoma and malignant melanoma. Although the mutagenic effects of UVB have been well documented and studied mechanistically, there is only limited information as to whether UV light may also be responsible for inducing epigenetic changes in the genome of exposed cells. DNA methylation is a stable epigenetic modification involved in gene control. To study the effects of UVB radiation on DNA methylation, we repeatedly exposed normal human keratinocytes to a UVB light source. After a recovery period, we analyzed global DNA methylation patterns in the irradiated and control cells using the methylated-CpG island recovery assay (MIRA method in combination with high-resolution microarrays. Bioinformatics analysis revealed only a limited number of possible differences between UVB-exposed and control cells. However, these minor apparent changes could not be independently confirmed by bisulfite sequencing-based approaches. This study reveals that UVB irradiation of keratinocytes has no recognizable global effect on DNA methylation patterns and suggests that changes in DNA methylation, as observed in skin cancers, are not immediate consequences of human exposure to solar UVB irradiation.

  13. Ultraviolet radiation can either suppress or induce expression of intercellular adhesion molecule 1 (ICAM-1) on the surface of cultured human keratinocytes

    International Nuclear Information System (INIS)

    Norris, D.A.; Lyons, M.B.; Middleton, M.H.; Yohn, J.J.; Kashihara-Sawami, M.

    1990-01-01

    Interactions of the ligand/receptor pair LFA-1(CD11a/CD18) and ICAM-1(CD54) initiate and control the cell-cell interactions of leukocytes and interactions of leukocytes with parenchymal cells in all phases of the immune response. Induction of the intercellular adhesion molecule 1 (ICAM-1) on the surface of epidermal keratinocytes has been proposed as an important regulator of contact-dependent aspects of cutaneous inflammation. Ultraviolet radiation (UVR) also modifies cutaneous inflammation, producing both up- and down-regulation of contact hypersensitivity. We have found that UVR has a biphasic effect on the induction of keratinocyte CD54. Using immunofluorescence and FACS techniques to quantitate cell-surface CD54 staining, we have shown that UVR significantly (p less than 0.01) inhibits keratinocyte CD54 induction by gamma interferon 24 h after irradiation. However, at 48, 72, and 96 h after UVR, CD54 expression is significantly induced to levels even greater than are induced by gamma interferon (20 U/ml). In addition, at 48, 72, or 96 h following UVR (30-100 mJ/cm2), the gamma-interferon-induced CD54 expression on human keratinocytes is also strongly (p less than 0.05 to p less than 0.001) enhanced. In this cell-culture system, gamma interferon and TNF-alpha are both strong CD54 inducers and are synergistic, but GM-CSF, TFG-beta, and IL-1 have no direct CD54-inducing effects. Thus the effects of UVR on CD54 induction are biphasic, producing inhibition at 24 h and induction at 48, 72, and 96 h. This effect on CD54 may contribute to the biphasic effects of UVR on delayed hypersensitivity in vivo. The early inhibition of ICAM-1 by UVR may also contribute to the therapeutic effects of UVR. We also speculate that the late induction of ICAM-1 by UVR might be an important step in the induction of photosensitive diseases such as lupus erythematosus

  14. Interferon-β induces cellular senescence in cutaneous human papilloma virus-transformed human keratinocytes by affecting p53 transactivating activity.

    Directory of Open Access Journals (Sweden)

    Maria V Chiantore

    Full Text Available Interferon (IFN-β inhibits cell proliferation and affects cell cycle in keratinocytes transformed by both mucosal high risk Human Papilloma Virus (HPV and cutaneous HPV E6 and E7 proteins. In particular, upon longer IFN-β treatments, cutaneous HPV38 expressing cells undergo senescence. IFN-β appears to induce senescence by upregulating the expression of the tumor suppressor PML, a well known IFN-induced gene. Indeed, experiments in gene silencing via specific siRNAs have shown that PML is essential in the execution of the senescence programme and that both p53 and p21 pathways are involved. IFN-β treatment leads to a modulation of p53 phosphorylation and acetylation status and a reduction in the expression of the p53 dominant negative ΔNp73. These effects allow the recovery of p53 transactivating activity of target genes involved in the control of cell proliferation. Taken together, these studies suggest that signaling through the IFN pathway might play an important role in cellular senescence. This additional understanding of IFN antitumor action and mechanisms influencing tumor responsiveness or resistance appears useful in aiding further promising development of biomolecular strategies in the IFN therapy of cancer.

  15. Upregulation of cathepsin S in psoriatic keratinocytes.

    Science.gov (United States)

    Schönefuss, Alexander; Wendt, Wiebke; Schattling, Benjamin; Schulten, Roxane; Hoffmann, Klaus; Stuecker, Markus; Tigges, Christian; Lübbert, Hermann; Stichel, Christine

    2010-08-01

    Cathepsin S (CATS) is a cysteine protease, well known for its role in MHC class II-mediated antigen presentation and extracellular matrix degradation. Disturbance of the expression or metabolism of this protease is a concomitant feature of several diseases. Given this importance we studied the localization and regulation of CATS expression in normal and pathological human/mouse skin. In normal human skin CATS-immunostaining is mainly present in the dermis and is localized in macrophages, Langerhans, T- and endothelial cells, but absent in keratinocytes. In all analyzed pathological skin biopsies, i.e. atopic dermatitis, actinic keratosis and psoriasis, CATS staining is strongly increased in the dermis. But only in psoriasis, CATS-immunostaining is also detectable in keratinocytes. We show that cocultivation with T-cells as well as treatment with cytokines can trigger expression and secretion of CATS, which is involved in MHC II processing in keratinocytes. Our data provide first evidence that CATS expression (i) is selectively induced in psoriatic keratinocytes, (ii) is triggered by T-cells and (iii) might be involved in keratinocytic MHC class II expression, the processing of the MHC class II-associated invariant chain and remodeling of the extracellular matrix. This paper expands our knowledge on the important role of keratinocytes in dermatological disease.

  16. ER signaling is activated to protect human HaCaT keratinocytes from ER stress induced by environmental doses of UVB

    International Nuclear Information System (INIS)

    Mera, Kentaro; Kawahara, Ko-ichi; Tada, Ko-ichi; Kawai, Kazuhiro; Hashiguchi, Teruto; Maruyama, Ikuro; Kanekura, Takuro

    2010-01-01

    Proteins are folded properly in the endoplasmic reticulum (ER). Various stress such as hypoxia, ischemia and starvation interfere with the ER function, causing ER stress, which is defined by the accumulation of unfolded protein (UP) in the ER. ER stress is prevented by the UP response (UPR) and ER-associated degradation (ERAD). These signaling pathways are activated by three major ER molecules, ATF6, IRE-1 and PERK. Using HaCaT cells, we investigated ER signaling in human keratinocytes irradiated by environmental doses of ultraviolet B (UVB). The expression of Ero1-Lα, an upstream signaling molecule of ER stress, decreased at 1-4 h after 10 mJ/cm 2 irradiation, indicating that the environmental dose of UVB-induced ER stress in HaCaT cells, without growth retardation. Furthermore, expression of intact ATF6 was decreased and it was translocated to the nuclei. The expression of XBP-1, a downstream molecule of IRE-1, which is an ER chaperone whose expression is regulated by XBP-1, and UP ubiquitination were induced by 10 mJ/cm 2 UVB at 4 h. PERK, which regulates apoptosis, was not phosphorylated. Our results demonstrate that UVB irradiation generates UP in HaCaT cells and that the UPR and ERAD systems are activated to protect cells from UVB-induced ER stress. This is the first report to show ER signaling in UVB-irradiated keratinocytes.

  17. The effect of the antipsoriatic drug metabolite etretin (Ro 10-1670) on UVB irradiation induced changes in the metabolism of arachidonic acid in human keratinocytes in culture

    International Nuclear Information System (INIS)

    Punnonen, Kari; Jansen, C.T.; Puustinen, Tapio

    1986-01-01

    [ 14 C]Arachidonic acid was avidly incorporated into human keratinocytes in culture and following exposure to UVB irradiation of 9 mJ/cm 2 (erythemally effective, EE) substantial amounts of 14 C-radiolabel were released from the cells. The release of radiolabel was accompanied by a decrease in the labelling of phosphatidylethanolamine whereas the labelling of triacylglycerols and cholesteryl esters was increased. Keratinocytes produced significant amounts of prostaglandin E 2 (PGE 2 ) and following UVB irradiation of 9 mJ/cm 2 (EE) the formation of prostaglandin E 2 was increased. Etretin (Ro 10-1670), the active metabolite of the antipsoriatic drug etretinate (Ro 10-9359), affected significantly neither the total release of radiolabel induced by UVB nor the formation of prostaglandin E 2 . However, in the presence of etretin the UVB irradiation induced transfer of [ 14 C]arachidonic acid into triacylglycerols and cholesteryl esters was not increased as much as in the corresponding experiments without etretin. On the basis of the present study it appears that etretin dose not interfere with the release of arachidonic acid in amounts which could be related to the therapeutic effects of the combination of retinoids with UVB irradiation (Re-UVB) in the treatment of psoriasis. (author)

  18. Critical role of free cytosolic calcium, but not uncoupling, in mitochondrial permeability transition and cell death induced by diclofenac oxidative metabolites in immortalized human hepatocytes

    International Nuclear Information System (INIS)

    Lim, M.S.; Lim, Priscilla L.K.; Gupta, Rashi; Boelsterli, Urs A.

    2006-01-01

    Diclofenac is a widely used nonsteroidal anti-inflammatory drug that has been associated with rare but serious hepatotoxicity. Experimental evidence indicates that diclofenac targets mitochondria and induces the permeability transition (mPT) which leads to apoptotic cell death in hepatocytes. While the downstream effector mechanisms have been well characterized, the more proximal pathways leading to the mPT are not known. The purpose of this study was to explore the role of free cytosolic calcium (Ca 2+ c ) in diclofenac-induced cell injury in immortalized human hepatocytes. We show that exposure to diclofenac caused time- and concentration-dependent cell injury, which was prevented by the specific mPT inhibitor cyclosporin A (CsA, 5 μM). At 8 h, diclofenac caused increases in [Ca 2+ ] c (Fluo-4 fluorescence), which was unaffected by CsA. Combined exposure to diclofenac/BAPTA (Ca 2+ chelator) inhibited cell injury, indicating that Ca 2+ plays a critical role in precipitating mPT. Diclofenac decreased the mitochondrial membrane potential, ΔΨ m (JC-1 fluorescence), even in the presence of CsA or BAPTA, indicating that mitochondrial depolarization was not a consequence of the mPT or elevated [Ca 2+ ] c . The CYP2C9 inhibitor sulphaphenazole (10 μM) protected from diclofenac-induced cell injury and prevented increases in [Ca 2+ ] c , while it had no effect on the dissipation of the ΔΨ m . Finally, diclofenac exposure greatly increased the mitochondria-selective superoxide levels secondary to the increases in [Ca 2+ ] c . In conclusion, these data demonstrate that diclofenac has direct depolarizing effects on mitochondria which does not lead to cell injury, while CYP2C9-mediated bioactivation causes increases in [Ca 2+ ] c , triggering the mPT and precipitating cell death

  19. Leflunomide or A77 1726 protect from acetaminophen-induced cell injury through inhibition of JNK-mediated mitochondrial permeability transition in immortalized human hepatocytes

    International Nuclear Information System (INIS)

    Latchoumycandane, Calivarathan; Seah, Quee Ming; Tan, Rachel C.H.; Sattabongkot, Jetsumon; Beerheide, Walter; Boelsterli, Urs A.

    2006-01-01

    Leflunomide, a disease-modifying anti-rheumatic drug, protects against T-cell-mediated liver injury by poorly understood mechanisms. The active metabolite of leflunomide, A77 1726 (teriflunomide) has been shown to inhibit stress-activated protein kinases (JNK pathway), which are key regulators of mitochondria-mediated cell death. Therefore, we hypothesized that leflunomide may protect from drugs that induce the mitochondrial permeability transition (mPT) by blocking the JNK signaling pathway. To this end, we exposed cultured immortalized human hepatocytes (HC-04) to the standard protoxicant drug acetaminophen (APAP), which induces CsA-sensitive mPT-mediated cell death. We determined the effects of leflunomide on the extent of APAP-induced hepatocyte injury and the upstream JNK-mediated mitochondrial signaling pathways. We found that leflunomide or A77 1726 concentration-dependently protected hepatocytes from APAP (1 mM)-induced mitochondrial permeabilization and lethal cell injury. This was not due to proximal inhibition of CYP-catalyzed APAP bioactivation to its thiol-reactive metabolite. Instead, we demonstrate that leflunomide (20 μM) inhibited the APAP-induced early (3 h) activation (phosphorylation) of JNK1/2, thus inhibiting phosphorylation of the anti-apoptotic protein Bcl-2 and preventing P-Bcl-2-mediated induction of the mPT. This greatly attenuated mitochondrial cytochrome c release, which we used as a marker for mitochondrial permeabilization. The specific JNK2 inhibitor SP600125 similarly protected from APAP-induced cell death. In conclusion, these findings are consistent with our hypothesis that leflunomide protects from protoxicant-induced hepatocyte injury by inhibiting JNK signaling and preventing mPT induction

  20. AP-2α Inhibits c-MYC Induced Oxidative Stress and Apoptosis in HaCaT Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Lei Yu

    2009-01-01

    AP-2 may have a direct effect on the c-myc gene. Chromatin immunoprecipitation assays demonstrated that AP-2 proteins bound to a cluster of AP-2 binding sites located within a 2 kb upstream regulatory region of c-myc These results suggest that the negative regulation of AP-2 on c-MYC activity was achieved through binding of AP-2 protein to the c-myc gene. The effects of AP-2 on c-MYC induced ROS accumulation and apoptosis in epidermal keratinocytes are likely to play an important role in cell growth, differentiation and carcinogenesis of the skin.

  1. On the Immortality of Television Sets: ?Function? in the Human Genome According to the Evolution-Free Gospel of ENCODE

    OpenAIRE

    Graur, Dan; Zheng, Yichen; Price, Nicholas; Azevedo, Ricardo B.R.; Zufall, Rebecca A.; Elhaik, Eran

    2013-01-01

    A recent slew of ENCyclopedia Of DNA Elements (ENCODE) Consortium publications, specifically the article signed by all Consortium members, put forward the idea that more than 80% of the human genome is functional. This claim flies in the face of current estimates according to which the fraction of the genome that is evolutionarily conserved through purifying selection is less than 10%. Thus, according to the ENCODE Consortium, a biological function can be maintained indefinitely without selec...

  2. Effects of hTERT immortalization on osteogenic and adipogenic differentiation of dental pulp stem cells

    Directory of Open Access Journals (Sweden)

    El-Ayachi Ikbale

    2016-03-01

    Full Text Available These data relate to the differentiation of human dental pulp stem cells (DPSC and DPSC immortalized by constitutively expressing human telomerase reverse transcriptase (hTERT through both osteogenic and adipogenic lineages (i.e. to make bone producing and fat producing cells from these dental pulp stem cells. The data augment another study to characterize immortalized DPSC for the study of neurogenetic “Characterization of neurons from immortalized dental pulp stem cells for the study of neurogenetic disorders” [1]. Two copies of one typical control cell line (technical replicates were used in this study. The data represent the differentiation of primary DPSC into osteoblast cells approximately 60% more effectively than hTERT immortalized DPSC. Conversely, both primary and immortalized DPSC are poorly differentiated into adipocytes. The mRNA expression levels for both early and late adipogenic and osteogenic gene markers are shown. Keywords: Stem cells, Osteogenic, Adipogenic, Immortalized, hTERT, DPSC

  3. On the immortality of television sets: "function" in the human genome according to the evolution-free gospel of ENCODE.

    Science.gov (United States)

    Graur, Dan; Zheng, Yichen; Price, Nicholas; Azevedo, Ricardo B R; Zufall, Rebecca A; Elhaik, Eran

    2013-01-01

    A recent slew of ENCyclopedia Of DNA Elements (ENCODE) Consortium publications, specifically the article signed by all Consortium members, put forward the idea that more than 80% of the human genome is functional. This claim flies in the face of current estimates according to which the fraction of the genome that is evolutionarily conserved through purifying selection is less than 10%. Thus, according to the ENCODE Consortium, a biological function can be maintained indefinitely without selection, which implies that at least 80 - 10 = 70% of the genome is perfectly invulnerable to deleterious mutations, either because no mutation can ever occur in these "functional" regions or because no mutation in these regions can ever be deleterious. This absurd conclusion was reached through various means, chiefly by employing the seldom used "causal role" definition of biological function and then applying it inconsistently to different biochemical properties, by committing a logical fallacy known as "affirming the consequent," by failing to appreciate the crucial difference between "junk DNA" and "garbage DNA," by using analytical methods that yield biased errors and inflate estimates of functionality, by favoring statistical sensitivity over specificity, and by emphasizing statistical significance rather than the magnitude of the effect. Here, we detail the many logical and methodological transgressions involved in assigning functionality to almost every nucleotide in the human genome. The ENCODE results were predicted by one of its authors to necessitate the rewriting of textbooks. We agree, many textbooks dealing with marketing, mass-media hype, and public relations may well have to be rewritten.

  4. Immortality versus resurrection in the Christian tradition.

    Science.gov (United States)

    Murphy, Nancey

    2011-10-01

    For those in contemporary society who believe in an afterlife, there are a number of views available. The most common may be based on belief in an immortal soul. However, the early Christian account was, instead, bodily resurrection. As Christianity moved throughout the Mediterranean world, apologists and theologians adapted their teaching on human nature and the afterlife to Greek and Roman philosophies. By the time of Augustine (d. 430), the doctrines of body-soul dualism and immortality of the soul were firmly entrenched in Christian teaching. The incorporation of the concept of an immortal soul into Christian accounts of life after death produced a hybrid account. The body dies, the soul (at least of those who were to be saved) travels to heaven. At the end of history, there would be a general resurrection, and the souls would be reunited with their bodies, although the bodies would be in a transformed, indestructible state. This hybrid account of life after death went largely uncontested until the twentieth century. In this essay, I describe this history and argue for a return to the early Christian view of humans as a unity, not a duality, and for belief in resurrection of the body as the appropriate expectation for eternal life. This would not only be truer to Christian sources, but, valuable, I believe, in focusing Christian attention on the need to care for the environment. © 2011 New York Academy of Sciences.

  5. A comprehensive two-dimensional gel protein database of noncultured unfractionated normal human epidermal keratinocytes: towards an integrated approach to the study of cell proliferation, differentiation and skin diseases

    DEFF Research Database (Denmark)

    Celis, J E; Madsen, Peder; Rasmussen, H H

    1991-01-01

    A two-dimensional (2-D) gel database of cellular proteins from noncultured, unfractionated normal human epidermal keratinocytes has been established. A total of 2651 [35S]methionine-labeled cellular proteins (1868 isoelectric focusing, 783 nonequilibrium pH gradient electrophoresis) were resolved...

  6. Germacrane sesquiterpenes isolated from the rhizome of Curcuma xanthorrhiza Roxb. inhibit UVB-induced upregulation of MMP-1, -2, and -3 expression in human keratinocytes.

    Science.gov (United States)

    Park, Ji-Hae; Mohamed, Mohamed Antar Aziz; Jung, Ye-Jin; Shrestha, Sabina; Lee, Tae Hoon; Lee, Chang-Ho; Han, Daeseok; Kim, Jiyoung; Baek, Nam-In

    2015-10-01

    Four sesquiterpenes were isolated from the rhizome of Curcuma xanthorrhiza Roxb.: furanodiene (1), germacrone (2), furanodienone (3), and 13-hydroxygermacrone (4). Importantly, this was the first time compounds 1 and 4 were isolated from this plant. The chemical structures of these compounds were determined using 1D- and 2D-nuclear magnetic resonance, infrared spectroscopy, and electron ionization mass spectrometry analyses. Among the isolated compounds, compounds 2 and 4 inhibited UVB-induced upregulation of the mRNA and protein expression levels of MMP-1, MMP-2, and MMP-3 in human keratinocytes (HaCaT). Moreover, this upregulation occurred in a dose-dependent manner over the range of 1-10 μM for each compound.

  7. Effect of Gloriosa superba and Catharanthus roseus Extracts on IFN-γ-Induced Keratin 17 Expression in HaCaT Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Nattaporn Pattarachotanant

    2014-01-01

    Full Text Available Gloriosa superba and Catharanthus roseus are useful in traditional medicine for treatment of various skin diseases and cancer. However, their molecular effect on psoriasis has not been investigated. In this study, the effect of ethanol extracts derived from G. superba leaves and C. roseus stems on the expression of psoriatic marker, keratin 17 (K17, was investigated in human keratinocytes using biochemical and molecular experimental approaches. Both extracts could reduce the expression of K17 in a dose-dependent manner through JAK/STAT pathway as demonstrated by an observation of reduced phosphorylation of STAT3 (p-STAT3. The inhibitory activity of G. superba extract was more potent than that of C. roseus. The Pearson's correlation between K17 and cell viability was shown positive. Taken together, the extracts of G. superba and C. roseus may be developed as alternative therapies for psoriasis.

  8. γ-Tocotrienol prevents 5-FU-induced reactive oxygen species production in human oral keratinocytes through the stabilization of 5-FU-induced activation of Nrf2.

    Science.gov (United States)

    Takano, Hideyuki; Momota, Yukihiro; Kani, Kouichi; Aota, Keiko; Yamamura, Yoshiko; Yamanoi, Tomoko; Azuma, Masayuki

    2015-04-01

    Chemotherapy-induced oral mucositis is a common adverse event in patients with oral squamous cell carcinoma, and is initiated through a variety of mechanisms, including the generation of reactive oxygen species (ROS). In this study, we examined the preventive effect of γ-tocotrienol on the 5-FU-induced ROS production in human oral keratinocytes (RT7). We treated RT7 cells with 5-FU and γ-tocotrienol at concentrations of 10 µg/ml and 10 nM, respectively. When cells were treated with 5-FU alone, significant growth inhibition was observed as compared to untreated cells. This inhibition was, in part, due to the ROS gene-rated by 5-FU treatment, because N-acetyl cysteine (NAC), a ROS scavenger, significantly ameliorated the growth of RT7 cells. γ-tocotrienol showed no cytotoxic effect on the growth of RT7 cells. Simultaneous treatment of cells with these agents resulted in the significant recovery of cell growth, owing to the suppression of ROS generation by γ-tocotrienol. Whereas 5-FU stimulated the expression of NF-E2-related factor 2 (Nrf2) protein in the nucleus up to 12 h after treatment of RT7 cells, γ-tocotrienol had no obvious effect on the expression of nuclear Nrf2 protein. Of note, the combined treatment with both agents stabilized the 5-FU-induced nuclear Nrf2 protein expression until 24 h after treatment. In addition, expression of Nrf2-dependent antioxidant genes, such as heme oxygenase-1 (HO-1) and quinone oxidoreductase-1 (NQO-1), was significantly augmented by treatment of cells with both agents. These findings suggest that γ-tocotrienol could prevent 5-FU-induced ROS generation by stabilizing Nrf2 activation, thereby leading to ROS detoxification and cell survival in human oral keratinocytes.

  9. Piperine attenuates UV-R induced cell damage in human keratinocytes via NF-kB, Bax/Bcl-2 pathway: An application for photoprotection.

    Science.gov (United States)

    Verma, Ankit; Kushwaha, Hari N; Srivastava, Ajeet K; Srivastava, Saumya; Jamal, Naseem; Srivastava, Kriti; Ray, Ratan Singh

    2017-07-01

    Chronic ultraviolet radiation (UV-R) exposure causes skin disorders like erythema, edema, hyperpigmentation, photoaging and photocarcinogenesis. Recent research trends of researchers have focused more attention on the identification and use of photo stable natural agents with photoprotective properties. Piperine (PIP), as a plant alkaloid, is an important constituent present in black pepper (Piper nigrum), used widely in ayurvedic and other traditional medicines and has broad pharmacological properties. The study was planned to photoprotective efficacy of PIP in human keratinocyte (HaCaT) cell line. We have assessed the UV-R induced activation of transcription factor NF-κB in coordination with cell death modulators (Bax/Bcl-2 and p21). The LC-MS/MS analysis revealed that PIP was photostable under UV-A/UV-B exposure. PIP (10μg/ml) attenuates the UV-R (A and B) induced phototoxicity of keratinocyte cell line through the restoration of cell viability, inhibition of ROS, and malondialdehyde generation. Further, PIP inhibited UV-R mediated DNA damage, prevented micronuclei formation, and reduced sub-G1 phase in cell cycle, which supported against photogenotoxicity. This study revealed that PIP pretreatment strongly suppressed UV-R induced photodamages. Molecular docking studies suggest that PIP binds at the active site of NF-κB, and thus, preventing its translocation to nucleus. In addition, transcriptional and translational analysis advocate the increased expression of NF-κB and concomitant decrease in IkB-α expression under UV-R exposed cells, favouring the apoptosis via Bax/Bcl-2 and p21 pathways. However, PIP induced expression of IkB-α suppress the NF-κB activity which resulted in suppression of apoptotic marker genes and proteins that involved in photoprotection. Therefore, we suggest the applicability of photostable PIP as photoprotective agent for human use. Copyright © 2017. Published by Elsevier B.V.

  10. Chafuroside B, an Oolong tea polyphenol, ameliorates UVB-induced DNA damage and generation of photo-immunosuppression related mediators in human keratinocytes.

    Directory of Open Access Journals (Sweden)

    Tatsuya Hasegawa

    Full Text Available Chafuroside B was recently isolated as a new polyphenolic constituent of oolong tea leaves. However, the effects of chafuroside B on skin function have not been examined. In this study, we investigated the protective effects of chafuroside B against UVB-induced DNA damage, apoptosis and generation of photo-immunosuppression related mediators in cultured normal human epidermal keratinocytes (NHEK. Chafuroside B at 1 µM attenuated both UVB-induced apoptosis, evaluated in terms of caspase-3/7 activity, and UVB-induced DNA damage, evaluated in terms of formation of cyclobutane pyrimidine dimers (CPD, in NHEK exposed to UVB (20 mJ/cm2. In addition, chafuroside B at 0.3 or 1 µM suppressed the UVB-induced production of interleukin (IL-10, tumor necrosis factor (TNF-α, and prostaglandin E2 (PGE2, as determined by ELISA, and conversely enhanced IL-12 mRNA expression and production, as measured by RT-PCR and ELISA. Further, chafuroside B at 1 µM also suppressed UVB-induced expression of receptor activator of nuclear factor κB ligand (RANKL mRNA. These results indicate that chafuroside B promotes repair of UVB-induced DNA damage and ameliorates the generation of IL-10, TNF-α, PGE2, and RANKL, all of which are UVB-induced immunosuppression related mediators. These effects of chafuroside B may be mediated at least in part through induction of IL-12 synthesis in human keratinocytes. Because chafuroside B might have practical value as a photoprotective agent, a further study of the in vivo effects of chafuroside B seems warranted.

  11. HaCaT Keratinocytes and Primary Epidermal Keratinocytes Have Different Transcriptional Profiles of Cornified Envelope-Associated Genes to T Helper Cell Cytokines

    Science.gov (United States)

    Seo, Min-Duk; Kang, Tae Jin; Lee, Chang Hoon; Lee, Ai-Young; Noh, Minsoo

    2012-01-01

    HaCaT cells are the immortalized human keratinocytes and have been extensively used to study the epidermal homeostasis and its pathophysiology. T helper cells play a role in various chronic dermatological conditions and they can affect skin barrier homeostasis. To evaluate whether HaCaT cells can be used as a model cell system to study abnormal skin barrier development in various dermatologic diseases, we analyzed the gene expression profile of epidermal differentiation markers of HaCaT cells in response to major T helper (Th) cell cytokines, such as IFNγ, IL-4, IL-17A and IL-22. The gene transcriptional profile of cornified envelope-associated proteins, such as filaggrin, loricrin, involucrin and keratin 10 (KRT10), in HaCaT cells was generally different from that in normal human keratinocytes (NHKs). This suggests that HaCaT cells have a limitation as a model system to study the pathophysiological mechanism associated with the Th cell cytokine-dependent changes in cornified envelope-associated proteins which are essential for normal skin barrier development. In contrast, the gene transcription profile change of human β2-defensin (HBD2) in response to IFNγ, IL-4 or IL-17A in HaCaT cells was consistent with the expression pattern of NHKs. IFNγ also up-regulated transglutaminase 2 (TGM2) gene transcription in both HaCaT cells and NHKs. As an alternative cell culture system for NHKs, HaCaT cells can be used to study molecular mechanisms associated with abnormal HBD2 and TGM2 expression in response to IFNγ, IL-4 or IL-17A. PMID:24116291

  12. Immortality in the Christian Physicalistic Theology: A Critical Survey

    Directory of Open Access Journals (Sweden)

    Hasan Ahmadizade

    2017-07-01

    Full Text Available Physicalistic Theology is a term that has no exact definition in theologian views. In the 20th century some of Christian thinkers on theology, like Nancy Murphy and Peter van Inwagen, by accepting a Physicalistic approach on human being, tried to analyze the Christian beliefs about human identity and his immortality. This approach today is called Physicalistic Theology. According to this approach, human is not but this physical body itself and so we can simply analyze the immortality problem. In this article we try to by an analytic and descriptive method, analyze the immortality of human according to the view of Physicalistic Theology. We will analyze the most important reasoning of Physicalistic Theology that is: no-interaction between the material and the immaterial, interaction between the person and the body, and the physicalism in Christian beliefs. One of the conclusions of this article is that according to Physicalistic view, the person that at some time has not been in the world, must exists any time to destroyed forever because the Christians believe to things that cannot justify rationally. The problem of immortality is one of these matters. Physicalistic Theology try to prove the immortality based on the miracles and the absolute power of God.

  13. The key role of miR-21-regulated SOD2 in the medium-mediated bystander responses in human fibroblasts induced by α-irradiated keratinocytes

    International Nuclear Information System (INIS)

    Tian, Wenqian; Yin, Xiaoming; Wang, Longxiao; Wang, Jingdong; Zhu, Wei; Cao, Jianping; Yang, Hongying

    2015-01-01

    Highlights: • After co-culture with α-irradiated HaCaT cells, WS1 cells displayed oxidative stress and DNA damage. • Increased miR-21 expression in bystander cells was critical to the occurrence of RIBEs. • SOD2 of bystander cells played an important role in bystander responses. • miR-21 mediated bystander effects through its regulation on SOD2. - Abstract: Radiation-induced bystander effect (RIBE) is well accepted in the radiation research field by now, but the underlying molecular mechanisms for better understanding this phenomenon caused by intercellular communication and intracellular signal transduction are still incomplete. Although our previous study has demonstrated an important role of miR-21 of unirradiated bystander cells in RIBEs, the direct evidence for the hypothesis that RIBE is epigenetically regulated is still limited and how miR-21 mediates RIBEs is unknown. Reactive oxygen species (ROS) have been demonstrated to be involved in RIBEs, however, the roles of anti-oxidative stress system of cells in RIBEs are unclear. Using transwell insert co-culture system, we investigated medium-mediated bystander responses in WS1 human fibroblasts after co-culture with HaCaT keratinocytes traversed by α-particles. Results showed that the ROS levels in unirradiated bystander WS1 cells were significantly elevated after 30 min of co-culture, and 53BP1 foci, a surrogate marker of DNA damage, were obviously induced after 3 h of co-culture. This indicates the occurrence of oxidative stress and DNA damage in bystander WS1 cells after co-culture with irradiated keratinocytes. Furthermore, the expression of miR-21 was increased in bystander WS1 cells, downregulation of miR-21 eliminated the bystander responses, overexpression of miR-21 alone could induce bystander-like oxidative stress and DNA damage in WS1 cells. These data indicate an important mediating role of miR-21 in RIBEs. In addition, MnSOD or SOD2 in WS1 cells was involved in the bystander effects

  14. The key role of miR-21-regulated SOD2 in the medium-mediated bystander responses in human fibroblasts induced by α-irradiated keratinocytes.

    Science.gov (United States)

    Tian, Wenqian; Yin, Xiaoming; Wang, Longxiao; Wang, Jingdong; Zhu, Wei; Cao, Jianping; Yang, Hongying

    2015-10-01

    Radiation-induced bystander effect (RIBE) is well accepted in the radiation research field by now, but the underlying molecular mechanisms for better understanding this phenomenon caused by intercellular communication and intracellular signal transduction are still incomplete. Although our previous study has demonstrated an important role of miR-21 of unirradiated bystander cells in RIBEs, the direct evidence for the hypothesis that RIBE is epigenetically regulated is still limited and how miR-21 mediates RIBEs is unknown. Reactive oxygen species (ROS) have been demonstrated to be involved in RIBEs, however, the roles of anti-oxidative stress system of cells in RIBEs are unclear. Using transwell insert co-culture system, we investigated medium-mediated bystander responses in WS1 human fibroblasts after co-culture with HaCaT keratinocytes traversed by α-particles. Results showed that the ROS levels in unirradiated bystander WS1 cells were significantly elevated after 30min of co-culture, and 53BP1 foci, a surrogate marker of DNA damage, were obviously induced after 3h of co-culture. This indicates the occurrence of oxidative stress and DNA damage in bystander WS1 cells after co-culture with irradiated keratinocytes. Furthermore, the expression of miR-21 was increased in bystander WS1 cells, downregulation of miR-21 eliminated the bystander responses, overexpression of miR-21 alone could induce bystander-like oxidative stress and DNA damage in WS1 cells. These data indicate an important mediating role of miR-21 in RIBEs. In addition, MnSOD or SOD2 in WS1 cells was involved in the bystander effects, overexpression of SOD2 abolished the bystander oxidative stress and DNA damage, indicating that SOD2 was critical to the induction of RIBEs. Moreover, we found that miR-21 regulated SOD2, suggesting that miR-21 might mediate bystander responses through its regulation on SOD2. In conclusion, this study revealed a profound role of miR-21-regulated SOD2 of unirradiated WS1

  15. The key role of miR-21-regulated SOD2 in the medium-mediated bystander responses in human fibroblasts induced by α-irradiated keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Tian, Wenqian; Yin, Xiaoming; Wang, Longxiao; Wang, Jingdong; Zhu, Wei; Cao, Jianping [School of Radiation Medicine and Protection, Medical College of Soochow University/Collaborative Innovation Center of Radiation Medicine of Jiangsu Higher Education Institutions, 199 Renai Road, Suzhou Industrial Park, Suzhou, Jiangsu Province 215123 (China); Yang, Hongying, E-mail: yanghongying@suda.edu.cn [School of Radiation Medicine and Protection, Medical College of Soochow University/Collaborative Innovation Center of Radiation Medicine of Jiangsu Higher Education Institutions, 199 Renai Road, Suzhou Industrial Park, Suzhou, Jiangsu Province 215123 (China); Institute of Radiotherapy & Oncology, Soochow University (China)

    2015-10-15

    Highlights: • After co-culture with α-irradiated HaCaT cells, WS1 cells displayed oxidative stress and DNA damage. • Increased miR-21 expression in bystander cells was critical to the occurrence of RIBEs. • SOD2 of bystander cells played an important role in bystander responses. • miR-21 mediated bystander effects through its regulation on SOD2. - Abstract: Radiation-induced bystander effect (RIBE) is well accepted in the radiation research field by now, but the underlying molecular mechanisms for better understanding this phenomenon caused by intercellular communication and intracellular signal transduction are still incomplete. Although our previous study has demonstrated an important role of miR-21 of unirradiated bystander cells in RIBEs, the direct evidence for the hypothesis that RIBE is epigenetically regulated is still limited and how miR-21 mediates RIBEs is unknown. Reactive oxygen species (ROS) have been demonstrated to be involved in RIBEs, however, the roles of anti-oxidative stress system of cells in RIBEs are unclear. Using transwell insert co-culture system, we investigated medium-mediated bystander responses in WS1 human fibroblasts after co-culture with HaCaT keratinocytes traversed by α-particles. Results showed that the ROS levels in unirradiated bystander WS1 cells were significantly elevated after 30 min of co-culture, and 53BP1 foci, a surrogate marker of DNA damage, were obviously induced after 3 h of co-culture. This indicates the occurrence of oxidative stress and DNA damage in bystander WS1 cells after co-culture with irradiated keratinocytes. Furthermore, the expression of miR-21 was increased in bystander WS1 cells, downregulation of miR-21 eliminated the bystander responses, overexpression of miR-21 alone could induce bystander-like oxidative stress and DNA damage in WS1 cells. These data indicate an important mediating role of miR-21 in RIBEs. In addition, MnSOD or SOD2 in WS1 cells was involved in the bystander effects

  16. Telomerase activation by the E6 gene product of human papillomavirus type 16.

    Science.gov (United States)

    Klingelhutz, A J; Foster, S A; McDougall, J K

    1996-03-07

    Activation of telomerase, a ribonucleoprotein complex that synthesizes telomere repeat sequences, is linked to cell immortalization and is characteristic of most cell lines and tumours. Here we show that expression of the human papillomavirus type 16 (HPV-16) E6 protein activates telomerase in early-passage human keratinocytes and mammary epithelial cells. This activation was observed in cells pre-crisis, that is, before they became immortal, and occurred within one passage of retroviral infection with vectors expressing HPV-16 E6. Studies using HPV-16 E6 mutants showed that there was no correlation between the ability of the mutants to activate telomerase and their ability to target p53 for degradation, suggesting that telomerase activation by HPV-16 E6 is p53 independent. Keratinocytes expressing wild-type HPV-16 E6 have an extended lifespan, but do not become immortal, indicating that telomerase activation and E6-mediate degradation of p53 are insufficient for their immortalization. These results show that telomerase activation is an intrinsic, but insufficient, component of transformation by HPV.

  17. The transcriptional regulator gene E2 of the Human Papillomavirus (HPV) 16 influences the radiosensitivity of cervical keratinocytes

    International Nuclear Information System (INIS)

    Lindel, Katja; Rieken, Stefan; Daffinger, Sigrid; Weber, Klaus J; Villiers, Ethel-Michele de; Debus, Jürgen

    2012-01-01

    Clinical studies have demonstrated that HPV induced tumors constitute a specific subclass of cancer with a better response to radiation treatment. The purpose of this study was to investigate meaning of viral E2-gene for radiosensitivity. W12 cells contain episomal HPV 16 genomes, whereas S12 cells, which derive from the W12 line, contain HPV DNA as integrated copies. Clonogenic survival was analyzed using 96-well in vitro test. Using flow cytometry cell cycle analyses were performed. Expression of pRb and p53 were analyzed using intracellular staining. W12 cells (intact E2 gene) showed a lower survival fraction than S12 cells. W12 cells developed a G2/M block 24 h after irradiation with 2 Gy whereas S12 showed no G2/M bloc. After irradiation S12 cells developed polyploidy and pRb-positive cells decreased. W12 cells showed no change of pRb-positive cells. Depending on E2 gene status differences in cell cycle regulation might cause radioresistance. The E2/E7/pRb pathway seems to influence HPV-induced radiosensitivity. Our experiments demonstrated an effect of HPV on radiosensitivity of cervical keratinocytes via viral transcription regulator E2 pathway

  18. Effects of Wannachawee Recipe with Antipsoriatic Activity on Suppressing Inflammatory Cytokine Production in HaCaT Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Mingkwan Na Takuathung

    2017-01-01

    Full Text Available Psoriasis is a chronic inflammatory and immune-mediated skin disease. The pathogenesis involves T cells activation via the IL-23/Th17 axis. Conventional treatments of psoriasis have adverse events influencing patients’ adherence. Wannachawee Recipe (WCR has been effectively used as Thai folk remedy for psoriasis patients; however, preclinical evidence defining how WCR works is still lacking. This study defined mechanisms for its antiproliferation and anti-inflammatory effects in HaCaT cells. The cytotoxicity and antiproliferation results from SRB and CCK-8 assays showed that WCR inhibited the growth and viability of HaCaT cells in a concentration-dependent manner. The distribution of cell cycle phases determined by flow cytometry showed that WCR did not interrupt cell cycle progression. Interestingly, RT-qPCR revealed that WCR significantly decreased the mRNA expression of IL-1β, IL-6, IL-8, IL-17A, IL-22, IL-23, and TNF-α but induced IL-10 expression in TNF-α- and IFN-γ-induced HaCaT cells. At the protein level determined by ELISA, WCR significantly reduced the secretion of IL-17A, IL-22, and IL-23. The WCR at low concentrations was proved to possess anti-inflammatory effect without cytotoxicity and it did not interfere with cell cycle of keratinocytes. This is the first study to provide convincing evidence that WCR is a potential candidate for development of effective psoriasis therapies.

  19. Ultraviolet B irradiation induces changes in the distribution and release of arachidonic acid, dihomo-gamma-linolenic acid, and eicosapentaenoic acid in human keratinocytes in culture

    International Nuclear Information System (INIS)

    Punnonen, K.; Puustinen, T.; Jansen, C.T.

    1987-01-01

    There is increasing evidence that derivatives of 20-carbon polyunsaturated fatty acids, the eicosanoids, play an important role in the inflammatory responses of the human skin. To better understand the metabolic fate of fatty acids in the skin, the effect of ultraviolet B (UVB) irradiation (280-320 nm) on the distribution and release of 14 C-labeled arachidonic acid, dihomo-gamma-linolenic acid, and eicosapentaenoic acid in human keratinocytes in culture was investigated. Ultraviolet B irradiation induced the release of all three 14 C-labeled fatty acids from the phospholipids, especially from phosphatidylethanolamine, and this was accompanied by increased labeling of the nonphosphorus lipids. This finding suggests that UVB induces a significant liberation of eicosanoid precursor fatty acids from cellular phospholipids, but the liberated fatty acids are largely reincorporated into the nonphosphorus lipids. In conclusion, the present study suggests that not only arachidonic acid but also dihomo-gamma-linolenic acid, and eicosapentaenoic acid might be involved in the UVB irradiation-induced inflammatory reactions of human skin

  20. Humanized Mouse Model of Skin Inflammation Is Characterized by Disturbed Keratinocyte Differentiation and Influx of IL-17A Producing T Cells

    Science.gov (United States)

    de Oliveira, Vivian L.; Keijsers, Romy R. M. C.; van de Kerkhof, Peter C. M.; Seyger, Marieke M. B.; Fasse, Esther; Svensson, Lars; Latta, Markus; Norsgaard, Hanne; Labuda, Tord; Hupkens, Pieter; van Erp, Piet E. J.; Joosten, Irma; Koenen, Hans J. P. M.

    2012-01-01

    Humanized mouse models offer a challenging possibility to study human cell function in vivo. In the huPBL-SCID-huSkin allograft model human skin is transplanted onto immunodeficient mice and allowed to heal. Thereafter allogeneic human peripheral blood mononuclear cells are infused intra peritoneally to induce T cell mediated inflammation and microvessel destruction of the human skin. This model has great potential for in vivo study of human immune cells in (skin) inflammatory processes and for preclinical screening of systemically administered immunomodulating agents. Here we studied the inflammatory skin response of human keratinocytes and human T cells and the concomitant systemic human T cell response. As new findings in the inflamed human skin of the huPBL-SCID-huSkin model we here identified: 1. Parameters of dermal pathology that enable precise quantification of the local skin inflammatory response exemplified by acanthosis, increased expression of human β-defensin-2, Elafin, K16, Ki67 and reduced expression of K10 by microscopy and immunohistochemistry. 2. Induction of human cytokines and chemokines using quantitative real-time PCR. 3. Influx of inflammation associated IL-17A-producing human CD4+ and CD8+ T cells as well as immunoregulatory CD4+Foxp3+ cells using immunohistochemistry and -fluorescence, suggesting that active immune regulation is taking place locally in the inflamed skin. 4. Systemic responses that revealed activated and proliferating human CD4+ and CD8+ T cells that acquired homing marker expression of CD62L and CLA. Finally, we demonstrated the value of the newly identified parameters by showing significant changes upon systemic treatment with the T cell inhibitory agents cyclosporine-A and rapamycin. In summary, here we equipped the huPBL-SCID-huSkin humanized mouse model with relevant tools not only to quantify the inflammatory dermal response, but also to monitor the peripheral immune status. This combined approach will gain our

  1. Areca nut extract up-regulates prostaglandin production, cyclooxygenase-2 mRNA and protein expression of human oral keratinocytes.

    Science.gov (United States)

    Jeng, J H; Ho, Y S; Chan, C P; Wang, Y J; Hahn, L J; Lei, D; Hsu, C C; Chang, M C

    2000-07-01

    There are about 600 million betel quid (BQ) chewers in the world. BQ chewing is associated with increased incidence of oral cancer and submucous fibrosis. In this study, areca nut (AN) extract (200-800 microg/ml) induced the prostaglandin E(2) (PGE(2)) production by 1. 4-3.4-fold and 6-keto-PGF(1 alpha) production by 1.1-1.7-fold of gingival keratinocytes (GK), respectively, following 24 h of exposure. Exposure of GK to AN extract (>400 microg/ml) led to cell retraction and intracellular vacuoles formation. At concentrations of 800 and 1200 microg/ml, AN extract induced cell death at 21-24 and 32-52% as detected by MTT assay and cellular lactate dehydrogenase release, respectively. Interestingly, AN-induced morphological changes of GK are reversible. GK can still proliferate following exposure to AN extract. Cytotoxicity of AN extract cannot be inhibited by indomethacin (1 microM) and aspirin (50 microM), indicating that prostaglandin (PG) production is not the major factor responsible for AN cytotoxicity. PGE(2) exhibited little effect on the growth of GK at concentrations ranging from 100-1000 pg/ml. Stimulating GK production of PGs by AN extract could be due to induction of cyclooxygenase-2 (COX-2) mRNA expression and protein production. These results suggest that AN ingredients are critical in the pathogenesis of oral submucous fibrosis and oral cancer via their stimulatory effects on the PGs, COX-2 production and associated tissue inflammatory responses. AN cytotoxicity to GK is not directly mediated by COX-2 stimulation and PG production.

  2. Evidence for Alteration of EZH2, BMI1, and KDM6A and Epigenetic Reprogramming in Human Papillomavirus Type 16 E6/E7-Expressing Keratinocytes

    Science.gov (United States)

    Hyland, Paula L.; McDade, Simon S.; McCloskey, Rachel; Dickson, Glenda J.; Arthur, Ken; McCance, Dennis J.; Patel, Daksha

    2011-01-01

    A number of epigenetic alterations occur in both the virus and host cellular genomes during human papillomavirus (HPV)-associated carcinogenesis, and investigations of such alterations, including changes in chromatin proteins and histone modifications, have the potential to lead to therapeutic epigenetic reversion. We report here that transformed HPV16 E6/E7-expressing primary human foreskin keratinocytes (HFKs) (E6/E7 cells) demonstrate increased expression of the PRC2 methyltransferase EZH2 at both the mRNA and protein levels but do not exhibit the expected increase in trimethylated H3K27 (H3K27me3) compared to normal keratinocytes. In contrast, these cells show a reduction in global H3K27me3 levels in vitro, as well as upregulation of the KDM6A demethylase. We further show for the first time that transformation with the HPV16 E6 and E7 oncogenes also results in an increase in phosphorylated EZH2 serine 21 (P-EZH2-Ser21), mediated by active Akt, and in a downregulation of the PRC1 protein BMI1 in these cells. High-grade squamous cervical intraepithelial lesions also showed a loss of H3K27me3 in the presence of increased expression of EZH2. Correlating with the loss of H3K27me3, E6/E7 cells exhibited derepression of specific EZH2-, KMD6A-, and BMI1-targeted HOX genes. These results suggest that the observed reduction in H3K27me3 may be due to a combination of reduced activities/levels of specific polycomb proteins and increases in demethylases. The dysregulation of multiple chromatin proteins resulting in the loss of global H3K27me3 and the transcriptional reprogramming in HPV16 E6/E7-infected cells could provide an epigenetic signature associated with risk and/or progression of HPV16-associated cancers, as well as the potential for epigenetic reversion in the future. PMID:21865393

  3. Evidence for alteration of EZH2, BMI1, and KDM6A and epigenetic reprogramming in human papillomavirus type 16 E6/E7-expressing keratinocytes.

    Science.gov (United States)

    Hyland, Paula L; McDade, Simon S; McCloskey, Rachel; Dickson, Glenda J; Arthur, Ken; McCance, Dennis J; Patel, Daksha

    2011-11-01

    A number of epigenetic alterations occur in both the virus and host cellular genomes during human papillomavirus (HPV)-associated carcinogenesis, and investigations of such alterations, including changes in chromatin proteins and histone modifications, have the potential to lead to therapeutic epigenetic reversion. We report here that transformed HPV16 E6/E7-expressing primary human foreskin keratinocytes (HFKs) (E6/E7 cells) demonstrate increased expression of the PRC2 methyltransferase EZH2 at both the mRNA and protein levels but do not exhibit the expected increase in trimethylated H3K27 (H3K27me3) compared to normal keratinocytes. In contrast, these cells show a reduction in global H3K27me3 levels in vitro, as well as upregulation of the KDM6A demethylase. We further show for the first time that transformation with the HPV16 E6 and E7 oncogenes also results in an increase in phosphorylated EZH2 serine 21 (P-EZH2-Ser21), mediated by active Akt, and in a downregulation of the PRC1 protein BMI1 in these cells. High-grade squamous cervical intraepithelial lesions also showed a loss of H3K27me3 in the presence of increased expression of EZH2. Correlating with the loss of H3K27me3, E6/E7 cells exhibited derepression of specific EZH2-, KMD6A-, and BMI1-targeted HOX genes. These results suggest that the observed reduction in H3K27me3 may be due to a combination of reduced activities/levels of specific polycomb proteins and increases in demethylases. The dysregulation of multiple chromatin proteins resulting in the loss of global H3K27me3 and the transcriptional reprogramming in HPV16 E6/E7-infected cells could provide an epigenetic signature associated with risk and/or progression of HPV16-associated cancers, as well as the potential for epigenetic reversion in the future.

  4. Exploring the motifs of death and immortality | Maina | Journal of ...

    African Journals Online (AJOL)

    felt threatened by the eventuality of death, inculcating in them a fear so great that all possible strategies are engaged in the search for an avenue that would prepare them for this eventuality. A careful exploration of human activities surrounding the issues of death and immortality reveals an obsession with the expression of ...

  5. The Golden Bough: Literature and the Idea of Immortality.

    Science.gov (United States)

    Klotz, Kenneth

    1979-01-01

    All works of literature reflect man's obsession with death and his creative attempts to evade or postpone it. Art cannot solve the problem, but within the limits of human capabilities, we come to art, whether as artists or audience, for our own small share in the "intimations of immortality." (Author/SJL)

  6. IFN-β antiproliferative effect and miRNA regulation in Human Papilloma Virus E6- and E7-transformed keratinocytes.

    Science.gov (United States)

    Chiantore, Maria Vincenza; Mangino, Giorgio; Iuliano, Marco; Zangrillo, Maria Simona; De Lillis, Ilaria; Vaccari, Gabriele; Accardi, Rosita; Tommasino, Massimo; Fiorucci, Gianna; Romeo, Giovanna

    2017-01-01

    Human Papilloma Viruses (HPVs) are the causative agents of cervical cancer although other types of cancers are associated with HPV infection. Type I Interferons can interfere with HPV E6- and/or E7-dependent transformation and can affect microRNA (miRNA) expression. Cancer cells show a specific pattern of miRNA expression and HPVs are able to modulate miRNAs expressed in infected cells. Keratinocytes transduced with E6 and E7 from mucosal HPV-16 or cutaneous HPV-38 (K16 and K38) were studied to analyze the involvement of HPV oncoproteins in the anti-proliferative activity of IFN-β. In view of our previous data showing senescence induction by the cytokine in K38 cells, we observe that IFN-β treatment leads to p53-indipendent apoptosis in K16 cells whereas induces senescence in K16 cells if E6 is silenced and p53 expression is restored. The levels of selected miRNAs, deregulated in K16 and K38 cells, can be modulated by IFN-β when E6 and E7 proteins of HPV-16, but not HPV-38, are expressed. Copyright © 2015 Elsevier Ltd. All rights reserved.

  7. Protective Effect of Mangifera indica Linn., Cocos nucifera Linn., and Averrhoa carambola Linn. Extracts against Ultraviolet B-Induced Damage in Human Keratinocytes

    Science.gov (United States)

    Ronpirin, Chalinee; Pattarachotanant, Nattaporn

    2016-01-01

    This study was aimed at investigating the antioxidant activity of Mangifera indica Linn., Cocos nucifera Linn., and Averrhoa carambola Linn. and their biological effect on human keratinocytes affected by the ultraviolet B (UVB), a major cause of cell damage and skin cancer through induction of DNA damage, production of reactive oxygen species (ROS), and apoptosis. The richest antioxidant activity was found in ethanol fraction of M. indica (21.32 ± 0.66 mg QE/g dry weight), while the lowest one was found in aqueous fractions of M. indica and C. nucifera (1.76 ± 2.10 and 1.65 ± 0.38 mg QE/g dry weight, respectively). Ethanol and aqueous fractions of A. carambola (250 µg/mL) significantly reduced the number of apoptotic cells. The expression of cleaved caspase 3 in UVB-treated group was significantly greater than that in untreated group. Both fractions of A. carambola (50, 100, and 250 µg/mL) significantly decreased the expression of cleaved caspase 3. Regarding the induction of DNA repair, ethanol (100 and 250 µg/mL) and aqueous (50, 100 and 250 µg/mL) fractions of A. carambola significantly decreased the percentage of cyclobutane pyrimidine dimers (CPD). Taken together, our results suggest that both fractions of A. carambola may be potentially developed for dermal applications. PMID:27057195

  8. Reinforcing the inner phase of the filled hydrogels with CNTs alters drug release properties and human keratinocyte morphology: A study on the gelatin- tamarind gum filled hydrogels.

    Science.gov (United States)

    Maharana, Vivek; Gaur, Deepanjali; Nayak, Suraj K; Singh, Vinay K; Chakraborty, Subhabrata; Banerjee, Indranil; Ray, Sirsendu S; Anis, Arfat; Pal, Kunal

    2017-11-01

    The study reports the synthesis and characterization of gelatin-tamarind gum (TG) based filled hydrogels for drug delivery applications. In this study, three different types of carbon nanotubes (CNTs) were incorporated within the dispersed TG phase of the filled hydrogels. The prepared hydrogels were thoroughly characterised using bright field microscope, FESEM, FTIR spectroscopy, differential scanning calorimeter, and mechanical tester. The swelling and the drug (salicylic acid) release properties of the filled hydrogels were also evaluated. The micrographs revealed the formation of biphasic systems. The internal phase appeared as agglomerates, and the CNTs were confined within the dispersed TG phase. FTIR and XRD studies revealed that CNTs promoted associative interactions among the components of the hydrogel, which promoted the formation of large crystallite size. The mechanical study indicated better resistance to the breakdown of the architecture of the CNT-containing filled hydrogels. Drug release studies, both passive and iontophoretic, suggested that the non-Fickian diffusion of the drug was prevalent during its release from hydrogel matrices. The prepared hydrogels were cytocompatible with human keratinocytes. The results suggested the probable use of such hydrogels in wound healing, tissue engineering and drug delivery applications. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. Protective Effect of Mangifera indica Linn., Cocos nucifera Linn., and Averrhoa carambola Linn. Extracts against Ultraviolet B-Induced Damage in Human Keratinocytes.

    Science.gov (United States)

    Ronpirin, Chalinee; Pattarachotanant, Nattaporn; Tencomnao, Tewin

    2016-01-01

    This study was aimed at investigating the antioxidant activity of Mangifera indica Linn., Cocos nucifera Linn., and Averrhoa carambola Linn. and their biological effect on human keratinocytes affected by the ultraviolet B (UVB), a major cause of cell damage and skin cancer through induction of DNA damage, production of reactive oxygen species (ROS), and apoptosis. The richest antioxidant activity was found in ethanol fraction of M. indica (21.32 ± 0.66 mg QE/g dry weight), while the lowest one was found in aqueous fractions of M. indica and C. nucifera (1.76 ± 2.10 and 1.65 ± 0.38 mg QE/g dry weight, respectively). Ethanol and aqueous fractions of A. carambola (250 µg/mL) significantly reduced the number of apoptotic cells. The expression of cleaved caspase 3 in UVB-treated group was significantly greater than that in untreated group. Both fractions of A. carambola (50, 100, and 250 µg/mL) significantly decreased the expression of cleaved caspase 3. Regarding the induction of DNA repair, ethanol (100 and 250 µg/mL) and aqueous (50, 100 and 250 µg/mL) fractions of A. carambola significantly decreased the percentage of cyclobutane pyrimidine dimers (CPD). Taken together, our results suggest that both fractions of A. carambola may be potentially developed for dermal applications.

  10. Protective Effect of Mangifera indica Linn., Cocos nucifera Linn., and Averrhoa carambola Linn. Extracts against Ultraviolet B-Induced Damage in Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Chalinee Ronpirin

    2016-01-01

    Full Text Available This study was aimed at investigating the antioxidant activity of Mangifera indica Linn., Cocos nucifera Linn., and Averrhoa carambola Linn. and their biological effect on human keratinocytes affected by the ultraviolet B (UVB, a major cause of cell damage and skin cancer through induction of DNA damage, production of reactive oxygen species (ROS, and apoptosis. The richest antioxidant activity was found in ethanol fraction of M. indica (21.32 ± 0.66 mg QE/g dry weight, while the lowest one was found in aqueous fractions of M. indica and C. nucifera (1.76 ± 2.10 and 1.65 ± 0.38 mg QE/g dry weight, respectively. Ethanol and aqueous fractions of A. carambola (250 µg/mL significantly reduced the number of apoptotic cells. The expression of cleaved caspase 3 in UVB-treated group was significantly greater than that in untreated group. Both fractions of A. carambola (50, 100, and 250 µg/mL significantly decreased the expression of cleaved caspase 3. Regarding the induction of DNA repair, ethanol (100 and 250 µg/mL and aqueous (50, 100 and 250 µg/mL fractions of A. carambola significantly decreased the percentage of cyclobutane pyrimidine dimers (CPD. Taken together, our results suggest that both fractions of A. carambola may be potentially developed for dermal applications.

  11. Effect of Standardized Boesenbergia pandurata Extract and Its Active Compound Panduratin A on Skin Hydration and Barrier Function in Human Epidermal Keratinocytes.

    Science.gov (United States)

    Woo, Seon Wook; Rhim, Dong-Bin; Kim, Changhee; Hwang, Jae-Kwan

    2015-03-01

    The skin plays a key role in protecting the body from the environment and from water loss. Cornified envelope (CE) and natural moisturizing factor (NMF) are considered as the primary regulators of skin hydration and barrier function. The CE prevents loss of water from the body and is formed by cross-linking of several proteins. Among these proteins, filaggrin is an important protein because NMF is produced by the degradation of filaggrin. Proteases, including matriptase and prostasin, stimulate the generation of filaggrin from profilaggrin and caspase-14 plays a role in the degradation of filaggrin. This study elucidated the effects of an ethanol extract of Boesenbergia pandurata (Roxb.) Schltr., known as fingerroot, and its active compound panduratin A on CE formation and filaggrin processing in HaCaT, human epidermal keratinocytes. B. pandurata extract (BPE) and panduratin A significantly stimulated not only CE formation but also the expression of CE proteins, such as loricrin, involucrin, and transglutaminase, which were associated with PPARα expression. The mRNA and protein levels of filaggrin and filaggrin-related enzymes, such as matriptase, prostasin, and caspase-14 were also up-regulated by BPE and panduratin A treatment. These results suggest that BPE and panduratin A are potential nutraceuticals which can enhance skin hydration and barrier function based on their CE formation and filaggrin processing.

  12. Influence of CAD/CAM all-ceramic materials on cell viability, migration ability and adenylate kinase release of human gingival fibroblasts and oral keratinocytes.

    Science.gov (United States)

    Pabst, A M; Walter, C; Grassmann, L; Weyhrauch, M; Brüllmann, D D; Ziebart, T; Scheller, H; Lehmann, K M

    2014-05-01

    The aim of this study was to analyze the influence of four CAD/CAM all-ceramic materials on cell viability, migration ability and adenylate kinase (ADK) release of human gingival fibroblasts (HGF) and oral keratinocytes (HOK). HGF and HOK were cultured on disc-shaped CAD/CAM all-ceramic materials (e.max CAD LT, e.max CAD HT, Empress CAD and Mark II) and on discs made of tissue culture polystyrene surface (TCPS) serving as control. Cell viability was analyzed by using an MTT assay, and migration ability was investigated by a scratch assay. A ToxiLight assay has been performed to analyze the effect of all-ceramic materials on ADK release and cell apoptosis. At MTT assay for HGF, no significant decrease of cell viability could be detected at all points of measurement (p each > 0.05), while HOK demonstrated a significant decrease in cell viability especially on Empress CAD and Mark II at each point of measurement (p each materials at all points of measurement (between -36 % and -71 %; p each ceramic materials could be investigated. This study disclosed significant differences in cell viability and migration ability of HGF and HOK on CAD/CAM all-ceramic materials. CAD/CAM all-ceramic materials can influence oral cell lines responsible for soft tissue creation which may affect the esthetic outcome.

  13. Characterisation of Human Keratinocytes by Measuring Cellular Repair Capacity of UVB-Induced DNA Damage and Monitoring of Cytogenetic Changes in Melanoma Cell Lines

    Energy Technology Data Exchange (ETDEWEB)

    Greinert, R.; Breibart, E.W.; Mitchell, D.; Smida, J.; Volkmer, B

    2000-07-01

    The molecular mechanisms for UV-induced photocarcinogenesis are far from being understood in detail, especially in the case of malignant melanoma of the skin. Nevertheless, it is known that deficiencies in cellular repair processes of UV-induced DNA damage (e.g. in the case of Xeroderma pigmentosum) represent important aetiological factors in the multistep development of skin cancer. The repair kinetics have therefore been studied of an established skin cell line (HaCaT), primary human keratinocytes, melanocytes and melanoma cell lines, using fluorescence microscopy and flow cytometry. Our data show a high degree of interindividual variability in cellular repair capacity for UV-induced DNA lesions, which might be due to individual differences in the degree of tolerable damage and/or the onsets of saturation of the enzymatic repair system. The cytogenetic analysis of melanoma cell lines, using spectral karyotyping (SKY) furthermore proves that malignant melanoma of the skin are characterised by high numbers of chromosomal aberrations. (author)

  14. Protective Effect of Diphlorethohydroxycarmalol against Ultraviolet B Radiation-Induced DNA Damage by Inducing the Nucleotide Excision Repair System in HaCaT Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Mei Jing Piao

    2015-09-01

    Full Text Available We investigated the protective properties of diphlorethohydroxycarmalol (DPHC, a phlorotannin, against ultraviolet B (UVB radiation-induced cyclobutane pyrimidine dimers (CPDs in HaCaT human keratinocytes. The nucleotide excision repair (NER system is the pathway by which cells identify and repair bulky, helix-distorting DNA lesions such as ultraviolet (UV radiation-induced CPDs and 6-4 photoproducts. CPDs levels were elevated in UVB-exposed cells; however, this increase was reduced by DPHC. Expression levels of xeroderma pigmentosum complementation group C (XPC and excision repair cross-complementing 1 (ERCC1, which are essential components of the NER pathway, were induced in DPHC-treated cells. Expression of XPC and ERCC1 were reduced following UVB exposure, whereas DPHC treatment partially restored the levels of both proteins. DPHC also increased expression of transcription factor specificity protein 1 (SP1 and sirtuin 1, an up-regulator of XPC, in UVB-exposed cells. DPHC restored binding of the SP1 to the XPC promoter, which is reduced in UVB-exposed cells. These results indicate that DPHC can protect cells against UVB-induced DNA damage by inducing the NER system.

  15. Skin metabolism of aminophenols: Human keratinocytes as a suitable in vitro model to qualitatively predict the dermal transformation of 4-amino-2-hydroxytoluene in vivo

    International Nuclear Information System (INIS)

    Goebel, C.; Hewitt, N.J.; Kunze, G.; Wenker, M.; Hein, D.W.; Beck, H.; Skare, J.

    2009-01-01

    4-Amino-2-hydroxytolune (AHT) is an aromatic amine ingredient in oxidative hair colouring products. As skin contact occurs during hair dyeing, characterisation of dermal metabolism is important for the safety assessment of this chemical class. We have compared the metabolism of AHT in the human keratinocyte cell line HaCaT with that observed ex-vivo in human skin and in vivo (topical application versus oral (p.o.) and intravenous (i.v.) route). Three major metabolites of AHT were excreted, i.e. N-acetyl-AHT, AHT-sulfate and AHT-glucuronide. When 12.5 mg/kg AHT was applied topically, the relative amounts of each metabolite were altered such that N-acetyl-AHT product was the major metabolite (66% of the dose in comparison with 37% and 32% of the same applied dose after i.v. and p.o. administration, respectively). N-acetylated products were the only metabolites detected in HaCaT cells and ex-vivo whole human skin discs for AHT and p-aminophenol (PAP), an aromatic amine known to undergo N-acetylation in vivo. Since N-acetyltransferase 1 (NAT1) is the responsible enzyme, kinetics of AHT was further compared to the standard NAT1 substrate p-aminobenzoic acid (PABA) in the HaCaT model revealing similar values for K m and V max . In conclusion NAT1 dependent dermal N-acetylation of AHT represents a 'first-pass' metabolism effect in the skin prior to entering the systemic circulation. Since the HaCaT cell model represents a suitable in vitro assay for addressing the qualitative contribution of the skin to the metabolism of topically-applied aromatic amines it may contribute to a reduction in animal testing

  16. Interactive effects of 2,3,7,8-tetrachlorodibenzo-p-dioxin and retinoids on proliferation and differentiation in cultured human keratinocytes: quantification of cross-linked envelope formation

    International Nuclear Information System (INIS)

    Berkers, J.A.M.; Hassing, I.; Spenkelink, B.; Brouwer, A.; Blaauboer, B.J.

    1995-01-01

    Dioxins are potent inducers of chloracne in humans. This skin aberration can be interpreted as an altered differentiation pattern of acinar sebaceous base cells and a change in the rate of terminal differentiation of the keratinocytes. We measured this rate induced by 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) in primary cultures of human keratinocytes. As parameters for differentiation, we quantified the 35 S-methionine incorporation into cross-linked envelopes (revealing the total CLE biomass), as well as the number of microscopically visible CLEs. It was shown that TCDD is a very potent inducer of both CLE biomass and number with a half-maximal effect concentration (EC 50 ) of 1.4 nM. CLE biomass was maximally increased 10-fold and the number of cells in culture producing a CLE was increased from 15% in control cultures to maximally 75% of the cells in TCDD-treated cultures. Both effects were Ca 2+ -dependent and increased with elevated cell density, being optimal in post-confluent cultures. Retinoic acid dose-dependently decreased the effect of 10 -8 M TCDD, 10 -6 M having a nearly complete antagonistic action. This interaction of retinoic acid with TCDD-induced differentiation was non-competitive. Retinol was equally potent as an antagonist of the TCDD-induced elevation of CLE formation as compared with retinoic acid. Retinyl palmitate and etretinate were not very effective as TCDD antagonists. Supplementation of hydrocortisone suppressed the TCDD-induced keratinocyte differentiation. It was concluded that CLE biomass quantification provides a reliable and sensitive parameter for keratinocyte differentiation. In this in vitro system it is shown that TCDD strongly induces a switch from proliferation to terminal differentiation and that this effect can be antagonized effectively by retinoic acid and retinol. (orig.)

  17. Maintenance of differentiation potential of human bone marrow mesenchymal stem cells immortalized by human telomerase reverse transcriptase gene despite [corrected] extensive proliferation

    DEFF Research Database (Denmark)

    Abdallah, Basem M; Haack-Sørensen, Mandana; Burns, Jorge S

    2005-01-01

    Human bone marrow mesenchymal stem cells (hMSC) represent a population of stem cells that are capable of differentiation into multiple lineages. However, these cells exhibit senescence-associated growth arrest and phenotypic changes during long-term in vitro culture. We have recently demonstrated...

  18. Cdc42 is crucial for the maturation of primordial cell junctions in keratinocytes independent of Rac1

    DEFF Research Database (Denmark)

    Du, Dan; Pedersen, Esben; Wang, Zhipeng

    2008-01-01

    Cell-cell contacts are crucial for the integrity of all tissues. Contrasting reports have been published about the role of Cdc42 in epithelial cell-cell contacts in vitro. In keratinocytes, it was suggested that Rac1 and not Cdc42 is crucial for the formation of mature epithelial junctions, based...... on dominant negative inhibition experiments. Deletion of the Cdc42 gene in keratinocytes in vivo slowly impaired the maintenance of cell-cell contacts by an increased degradation of beta-catenin. Whether Cdc42 is required for the formation of mature junctions was not tested. We show now that Cdc42-deficient...... immortalized and primary keratinocytes form only punctate primordial cell contacts in vitro, which cannot mature into belt-like junctions. This defect was independent of enhanced degradation of beta-catenin, but correlated to an impaired activation and localization of aPKCzeta in the Cdc42-null keratinocytes...

  19. Coordination of different ligands to copper(II) and cobalt(III) metal centers enhances Zika virus and dengue virus loads in both arthropod cells and human keratinocytes.

    Science.gov (United States)

    Dutta, Shovan; Celestine, Michael J; Khanal, Supreet; Huddleston, Alexis; Simms, Colin; Arca, Jessa Faye; Mitra, Amlan; Heller, Loree; Kraj, Piotr J; Ledizet, Michel; Anderson, John F; Neelakanta, Girish; Holder, Alvin A; Sultana, Hameeda

    2018-01-01

    Trace elements such as copper and cobalt have been associated with virus-host interactions. However, studies to show the effect of conjugation of copper(II) or cobalt(III) metal centers to thiosemicarbazone ligand(s) derived from either food additives or mosquito repellent such as 2-acetylethiazole or citral, respectively, on Zika virus (ZIKV) or dengue virus (serotype 2; DENV2) infections have not been explored. In this study, we show that four compounds comprising of thiosemicarbazone ligand derived from 2-acetylethiazole viz., (E)-N-ethyl-2-[1-(thiazol-2-yl)ethylidene]hydrazinecarbothioamide (acetylethTSC) (compound 1), a copper(II) complex with acetylethTSC as a ligand (compound 2), a thiosemicarbazone ligand-derived from citral (compound 3) and a cobalt(III) complex with a citral-thiosemicarbazone ligand (compound 4) increased DENV2 and ZIKV replication in both mosquito C6/36 cells and human keratinocytes (HaCaT cells). Treatment of both cell lines with compounds 2 or 4 showed increased dengue viral titers at all three tested doses. Enhanced dengue viral plaque formation was also noted at the tested dose of 100μM, suggesting higher production of infectious viral particles. Treatment with the compounds 2 or 4 enhanced ZIKV and DENV2 RNA levels in HeLa cell line and primary cultures of mouse bone marrow derived dendritic cells. Also, pre- or post treatments with conjugated compounds 2 or 4 showed higher loads of ZIKV or DENV2 envelope (E) protein in HaCaT cells. No changes in loads of E-protein were found in ZIKV-infected C6/36 cells, when compounds were treated after infection. In addition, we tested bis(1,10-phenanthroline)copper(II) chloride ([Cu(phen) 2 ]Cl 2 , (compound 5) and tris(1,10-phenanthroline)cobalt(III) chloride ([Co(phen) 3 ]Cl 3 , (compound 6) that also showed enhanced DENV2 loads. Also, we found that copper(II) chloride dehydrate (CuCl 2 ·2H 2 O) or cobalt(II) chloride hexahydrate (CoCl 2 ·6H 2 O) alone had no effects as "free" cations

  20. Inhibition of Genotoxic Effects of UVC Radiation on Human Keratinocyte HaCaT Cells by Echinacea Purpurea (L.) Moench Herbal Extract

    International Nuclear Information System (INIS)

    Kosalec, I.; Segvic Klaric, M.; Kopjar, N.; Milic, M.

    2013-01-01

    Exposure of skin to ultraviolet (UV) radiation might provoke acute and chronic inflammation and oxidative stress which might cause DNA damage leading to skin photoaging and photocarcinogenesis. Previously we showed that Echinacea purpurea (L.) Moench (EH) extract, rich in phenolic acids, has protective effect on human blood lymphocytes exposed to UVC radiation. In this study we checked whether the pre-treatment of human keratinocyte HaCaT cells with lyophilisate of EH (1 and 10 mg/mL) could reduce or prevent primary DNA damage induced by UVC radiation (253.7 nm) in laboratory conditions. Prior to that experiment we examined cell viability using MTT test upon exposure to EH and UVC (30 and 60 min) alone and in combination. Primary DNA damage in HaCaT cells was studied using the alkaline comet assay. Exposure of cells to EH and UVC alone or EH in combination with UV radiation did not reduce cell viability. Opposite to that UV radiation (30 and 60 min) caused a significant increase in the level of primary DNA damage (P < 0.001). Pre-treatment of cells with both concentrations of EH was not genotoxic to HaCaT cells. Only concentration of 1 mg/mL EH successfully protected the cells against the effects of 30 min exposure to UVC radiation. Positive results obtained in this study speak in favour of continuing the research on effectiveness of Echinacea purpurea preparations and their potential application in developing cosmetic products for skin protection.(author)

  1. Arsenic transformation predisposes human skin keratinocytes to UV-induced DNA damage yet enhances their survival apparently by diminishing oxidant response

    International Nuclear Information System (INIS)

    Sun Yang; Kojima, Chikara; Chignell, Colin; Mason, Ronald; Waalkes, Michael P.

    2011-01-01

    Inorganic arsenic and UV, both human skin carcinogens, may act together as skin co-carcinogens. We find human skin keratinocytes (HaCaT cells) are malignantly transformed by low-level arsenite (100 nM, 30 weeks; termed As-TM cells) and with transformation concurrently undergo full adaptation to arsenic toxicity involving reduced apoptosis and oxidative stress response to high arsenite concentrations. Oxidative DNA damage (ODD) is a possible mechanism in arsenic carcinogenesis and a hallmark of UV-induced skin cancer. In the current work, inorganic arsenite exposure (100 nM) did not induce ODD during the 30 weeks required for malignant transformation. Although acute UV-treatment (UVA, 25 J/cm 2 ) increased ODD in passage-matched control cells, once transformed by arsenic to As-TM cells, acute UV actually further increased ODD (> 50%). Despite enhanced ODD, As-TM cells were resistant to UV-induced apoptosis. The response of apoptotic factors and oxidative stress genes was strongly mitigated in As-TM cells after UV exposure including increased Bcl2/Bax ratio and reduced Caspase-3, Nrf2, and Keap1 expression. Several Nrf2-related genes (HO-1, GCLs, SOD) showed diminished responses in As-TM cells after UV exposure consistent with reduced oxidant stress response. UV-exposed As-TM cells showed increased expression of cyclin D1 (proliferation gene) and decreased p16 (tumor suppressor). UV exposure enhanced the malignant phenotype of As-TM cells. Thus, the co-carcinogenicity between UV and arsenic in skin cancer might involve adaptation to chronic arsenic exposure generally mitigating the oxidative stress response, allowing apoptotic by-pass after UV and enhanced cell survival even in the face of increased UV-induced oxidative stress and increased ODD. - Highlights: → Arsenic transformation adapted to UV-induced apoptosis. → Arsenic transformation diminished oxidant response. → Arsenic transformation enhanced UV-induced DNA damage.

  2. N-Acetylglutaminoyl-S-farnesyl-L-cysteine (SIG-1191): an anti-inflammatory molecule that increases the expression of the aquaglyceroporin, aquaporin-3, in human keratinocytes.

    Science.gov (United States)

    Fernández, José R; Webb, Corey; Rouzard, Karl; Voronkov, Michael; Huber, Kristen L; Stock, Jeffry B; Stock, Maxwell; Gordon, Joel S; Perez, Eduardo

    2017-03-01

    Isoprenylcysteine (IPC) small molecules were discovered as signal transduction modulating compounds ~25 years ago. More recently, IPC molecules have demonstrated antioxidant and anti-inflammatory properties in a variety of dermal cells as well as antimicrobial activity, representing a novel class of compounds to ameliorate skin conditions and disease. Here, we demonstrate a new IPC compound, N-acetylglutaminoyl-S-farnesyl-L-cysteine (SIG-1191), which inhibits UVB-induced inflammation blocking pro-inflammatory cytokine interleukin-6 (IL-6) and tumor necrosis factor alpha (TNF-α) production. To investigate further the previously reported hydrating potential of IPC compounds, SIG-1191 was tested for its ability to modulate aquaporin expression. Specifically, aquaporin 3 (AQP3) the most abundant aquaporin found in skin has been reported to play a key role in skin hydration, elasticity and barrier repair. Results show here for the first time that SIG-1191 increases AQP3 expression in both cultured normal human epidermal keratinocytes as well as when applied topically in a three-dimensional (3D) reconstructed human skin equivalent. Additionally, SIG-1191 dose dependently increased AQP3 protein levels, as determined by specific antibody staining, in the epidermis of the 3D skin equivalents. To begin to elucidate which signaling pathways SIG-1191 may be modulating to increase AQP3 levels, we used several pharmacological pathway inhibitors and determined that AQP3 expression is mediated by the Mitogen-activated protein kinase/Extracellular signal-regulated kinase kinase (MEK) pathway. Altogether, these data suggest SIG-1191 represents a new IPC derivative with anti-inflammatory activity that may also promote increased skin hydration based on its ability to increase AQP3 levels.

  3. Comparative study of four immortalized human brain capillary endothelial cell lines, hCMEC/D3, hBMEC, TY10, and BB19, and optimization of culture conditions, for an in vitro blood–brain barrier model for drug permeability studies

    OpenAIRE

    Eigenmann, Daniela E; Xue, Gongda; Kim, Kwang S; Moses, Ashlee V; Hamburger, Matthias; Oufir, Mouhssin

    2013-01-01

    Background: Reliable human in vitro blood brain barrier (BBB) models suitable for high throughput screening are urgently needed in early drug discovery and development for assessing the ability of promising bioactive compounds to overcome the BBB. To establish an improved human in vitro BBB model we compared four currently available and well characterized immortalized human brain capillary endothelial cell lines hCMEC/D3 hBMEC TY10 and BB19 with respect to barrier tightness and paracellular p...

  4. Suppression of Innate Immune Response by Primary Human Keratinocytes Expressing HPV-16 E6 and E7

    National Research Council Canada - National Science Library

    Guess, Jennifer L

    2005-01-01

    Human papillomavims (HPV) types infect the skin and mucosal epithelium. Lesions resulting from HPV infection can linger for months or years suggesting that HPV - presence goes unnoticed by the host immune system...

  5. Maintenance of differentiation potential of human bone marrow mesenchymal stem cells immortalized by human telomerase reverse transcriptase gene despite of extensive proliferation

    International Nuclear Information System (INIS)

    Abdallah, Basem M.; Haack-Sorensen, Mandana; Burns, Jorge S.; Elsnab, Birgitte; Jakob, Franz; Hokland, Peter; Kassem, Moustapha

    2005-01-01

    Human bone marrow mesenchymal stem cells (hMSC) represent a population of stem cells that are capable of differentiation into multiple lineages. However, these cells exhibit senescence-associated growth arrest and phenotypic changes during long-term in vitro culture. We have recently demonstrated that overexpression of human telomerase reverse transcriptase (hTERT) in hMSC reconstitutes telomerase activity and extends life span of the cells [Nat. Biotechnol. 20 (2002) 592]. In the present study, we have performed extensive characterization of three independent cell lines derived from the parental hMSC-TERT cell line based on different plating densities during expansion in culture: 1:2 (hMSC-TERT2), 1:4 (hMSC-TERT4), and 1:20 (hMSC-TERT20). The 3 cell lines exhibited differences in morphology and growth rates but they all maintained the characteristics of self-renewing stem cells and the ability to differentiate into multiple mesoderm-type cell lineages: osteoblasts, adipocytes, chondrocytes, and endothelial-like cells over a 3-year period in culture. Also, surface marker studies using flow cytometry showed a pattern similar to that known from normal hMSC. Thus, telomerization of hMSC by hTERT overexpression maintains the stem cell phenotype of hMSC and it may be a useful tool for obtaining enough number of cells with a stable phenotype for mechanistic studies of cell differentiation and for tissue engineering protocols

  6. Ultraviolet radiation (UVR) induces cell-surface Ro/SSA antigen expression by human keratinocytes in vitro: a possible mechanism for the UVR induction of cutaneous lupus lesions

    International Nuclear Information System (INIS)

    Jones, S.K.

    1992-01-01

    Antinuclear antibodies are useful markers of connective tissue disease. In this study, UVB but not UVA induced the expression of Ro/SSA antigen on keratinocyte surfaces in vitro. This expression was also found with the extractable nuclear antigens RnP and Sm, but not with single or double-stranded DNA. The expression was prevented by blocking protein synthesis, suggesting that it was an active process. The results suggest that UVB exposure may result in the expression of Ro/SSA antigen on the surfaces of basal keratinocytes in vivo. This antigen could then bind circulating antibody leading to the cutaneous lesions in neonatal and subacute cutaneous lupus erythematosus. (Author)

  7. Shining a Light on Black Holes in Keratinocytes.

    Science.gov (United States)

    Bowman, Shanna L; Marks, Michael S

    2018-03-01

    The mechanisms by which melanins are transferred from melanocytes and stored within keratinocytes to generate skin pigmentation are hotly debated. Correia et al. and Hurbain et al. provide evidence that melanin cores of melanosomes are secreted from melanocytes and taken up and stored within non-degradative membranous organelles in keratinocytes in the basal epidermis of human skin. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  8. Periodicity and Immortality in Reversible Computing

    OpenAIRE

    Kari , Jarkko; Ollinger , Nicolas

    2008-01-01

    Additional material available on the web at http://www.lif.univ-mrs.fr/~nollinge/rec/gnirut/; We investigate the decidability of the periodicity and the immortality problems in three models of reversible computation: reversible counter machines, reversible Turing machines and reversible one-dimensional cellular automata. Immortality and periodicity are properties that describe the behavior of the model starting from arbitrary initial configurations: immortality is the property of having at le...

  9. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  10. Toxicity of jet fuel aliphatic and aromatic hydrocarbon mixtures on human epidermal Keratinocytes: evaluation based on in vitro cytotoxicity and interleukin-8 release

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Jen-Hung (Chung-Shan Medical University Hospital, Department of Dermatology, Taichung, Taiwan, R.O.C); Lee, Chia-Hue; Tsang, Chau-Loong [National Chung-Hsing University, College of Veterinary Medicine, Taichung (Taiwan); Monteiro-Riviere, Nancy A.; Riviere, Jim E. [North Carolina State University, Center for Chemical Toxicology Research and Pharmacokinetics (CCTRP), Raleigh, NC (United States); Chou, Chi-Chung [National Chung-Hsing University, College of Veterinary Medicine, Taichung (Taiwan); National Chung-Hsing University, College of Veterinary Medicine, Taichung (Taiwan)

    2006-08-15

    Jet fuels are complex mixtures of aliphatic (ALI) and aromatic (ARO) hydrocarbons that vary significantly in individual cytotoxicity and proinflammatory activity in human epidermal keratinocytes (HEK). In order to delineate the toxicological interactions among individual hydrocarbons in a mixture and their contributions to cutaneous toxicity, nine ALI and five ARO hydrocarbons were each divided into five (high/medium/low cytotoxic and strong/weak IL-8 induction) groups and intra/inter-mixed to assess for their mixture effects on HEK mortality and IL-8 release. Addition of single hydrocarbon to JP-8 fuel was also evaluated for their changes in fuel dermatotoxicity. The results indicated that when hydrocarbons were mixed, HEK mortality and IL-8 release were not all predictable by their individual ability affecting these two parameters. The lowest HEK mortality (7%) and the highest IL-8 production were induced with mixtures including high cytotoxic and weak IL-8 inductive ARO hydrocarbons. Antagonistic reactions not consistently correlated with ALI carbon chain length and ARO structure were evident and carried different weight in the overall mixture toxicities. Single addition of benzene, toluene, xylene or ethylbenzene for up to tenfold in JP-8 did not increase HEK mortality while single addition of ALI hydrocarbons exhibited dose-related differential response in IL-8. In an all ALI environment, no single hydrocarbon is the dominating factor in the determination of HEK cytotoxicity while deletion of hexadecane resulted in a 2.5-fold increase in IL-8 production. Overall, decane, undecane and dodecane were the major hydrocarbons associated with high cytotoxicity while tetradecane, pentadecane and hexadecane were those which had the greatest buffering effect attenuating dermatotoxicity. The mixture effects must be considered when evaluating jet fuel toxicity to HEK. (orig.)

  11. Direct biological effects of fractional ultrapulsed CO2 laser irradiation on keratinocytes and fibroblasts in human organotypic full-thickness 3D skin models.

    Science.gov (United States)

    Schmitt, L; Huth, S; Amann, P M; Marquardt, Y; Heise, R; Fietkau, K; Huth, L; Steiner, T; Hölzle, F; Baron, J M

    2018-05-01

    Molecular effects of various ablative and non-ablative laser treatments on human skin cells-especially primary effects on epidermal keratinocytes and dermal fibroblasts-are not yet fully understood. We present the first study addressing molecular effects of fractional non-sequential ultrapulsed CO 2 laser treatment using a 3D skin model that allows standardized investigations of time-dependent molecular changes ex vivo. While histological examination was performed to assess morphological changes, we utilized gene expression profiling using microarray and qRT-PCR analyses to identify molecular effects of laser treatment. Irradiated models exhibited dose-dependent morphological changes resulting in an almost complete recovery of the epidermis 5 days after irradiation. On day 5 after laser injury with a laser fluence of 100 mJ/cm 2 , gene array analysis identified an upregulation of genes associated with tissue remodeling and wound healing (e.g., COL12A1 and FGF7), genes that are involved in the immune response (e.g., CXCL12 and CCL8) as well as members of the heat shock protein family (e.g., HSPB3). On the other hand, we detected a downregulation of matrix metalloproteinases (e.g., MMP3), differentiation markers (e.g., LOR and S100A7), and the pro-inflammatory cytokine IL1α.Overall, our findings substantiate the understanding of time-dependent molecular changes after CO 2 laser treatment. The utilized 3D skin model system proved to be a reliable, accurate, and reproducible tool to explore the effects of various laser settings both on skin morphology and gene expression during wound healing.

  12. Phenotype and Functional Features of Human Telomerase Reverse Transcriptase Immortalized Human Airway Smooth Muscle Cells from Asthmatic and Non-Asthmatic Donors.

    Science.gov (United States)

    Burgess, J K; Ketheson, A; Faiz, A; Limbert Rempel, K A; Oliver, B G; Ward, J P T; Halayko, A J

    2018-01-16

    Asthma is an obstructive respiratory disease characterised by chronic inflammation with airway hyperresponsiveness. In asthmatic airways, there is an increase in airway smooth muscle (ASM) cell bulk, which differs from non-asthmatic ASM in characteristics. This study aimed to assess the usefulness of hTERT immortalisation of human ASM cells as a research tool. Specifically we compared proliferative capacity, inflammatory mediator release and extracellular matrix (ECM) production in hTERT immortalised and parent primary ASM cells from asthmatic and non-asthmatic donors. Our studies revealed no significant differences in proliferation, IL-6 and eotaxin-1 production, or CTGF synthesis between donor-matched parent and hTERT immortalised ASM cell lines. However, deposition of ECM proteins fibronectin and fibulin-1 was significantly lower in immortalised ASM cells compared to corresponding primary cells. Notably, previously reported differences in proliferation and inflammatory mediator release between asthmatic and non-asthmatic ASM cells were retained, but excessive ECM protein deposition in asthmatic ASM cells was lost in hTERT ASM cells. This study shows that hTERT immortalised ASM cells mirror primary ASM cells in proliferation and inflammatory profile characteristics. Moreover, we demonstrate both strengths and weaknesses of this immortalised cell model as a representation of primary ASM cells for future asthma pathophysiological research.

  13. A new cell culture model to genetically dissect the complete human papillomavirus life cycle.

    Science.gov (United States)

    Bienkowska-Haba, Malgorzata; Luszczek, Wioleta; Myers, Julia E; Keiffer, Timothy R; DiGiuseppe, Stephen; Polk, Paula; Bodily, Jason M; Scott, Rona S; Sapp, Martin

    2018-03-01

    Herein, we describe a novel infection model that achieves highly efficient infection of primary keratinocytes with human papillomavirus type 16 (HPV16). This cell culture model does not depend on immortalization and is amenable to extensive genetic analyses. In monolayer cell culture, the early but not late promoter was active and yielded a spliced viral transcript pattern similar to HPV16-immortalized keratinocytes. However, relative levels of the E8^E2 transcript increased over time post infection suggesting the expression of this viral repressor is regulated independently of other early proteins and that it may be important for the shift from the establishment to the maintenance phase of the viral life cycle. Both the early and the late promoter were strongly activated when infected cells were subjected to differentiation by growth in methylcellulose. When grown as organotypic raft cultures, HPV16-infected cells expressed late E1^E4 and L1 proteins and replication foci were detected, suggesting that they supported the completion of the viral life cycle. As a proof of principle that the infection system may be used for genetic dissection of viral factors, we analyzed E1, E6 and E7 translation termination linker mutant virus for establishment of infection and genome maintenance. E1 but not E6 and E7 was essential to establish infection. Furthermore, E6 but not E7 was required for episomal genome maintenance. Primary keratinocytes infected with wild type HPV16 immortalized, whereas keratinocytes infected with E6 and E7 knockout virus began to senesce 25 to 35 days post infection. The novel infection model provides a powerful genetic tool to study the role of viral proteins throughout the viral life cycle but especially for immediate early events and enables us to compare low- and high-risk HPV types in the context of infection.

  14. A new cell culture model to genetically dissect the complete human papillomavirus life cycle.

    Directory of Open Access Journals (Sweden)

    Malgorzata Bienkowska-Haba

    2018-03-01

    Full Text Available Herein, we describe a novel infection model that achieves highly efficient infection of primary keratinocytes with human papillomavirus type 16 (HPV16. This cell culture model does not depend on immortalization and is amenable to extensive genetic analyses. In monolayer cell culture, the early but not late promoter was active and yielded a spliced viral transcript pattern similar to HPV16-immortalized keratinocytes. However, relative levels of the E8^E2 transcript increased over time post infection suggesting the expression of this viral repressor is regulated independently of other early proteins and that it may be important for the shift from the establishment to the maintenance phase of the viral life cycle. Both the early and the late promoter were strongly activated when infected cells were subjected to differentiation by growth in methylcellulose. When grown as organotypic raft cultures, HPV16-infected cells expressed late E1^E4 and L1 proteins and replication foci were detected, suggesting that they supported the completion of the viral life cycle. As a proof of principle that the infection system may be used for genetic dissection of viral factors, we analyzed E1, E6 and E7 translation termination linker mutant virus for establishment of infection and genome maintenance. E1 but not E6 and E7 was essential to establish infection. Furthermore, E6 but not E7 was required for episomal genome maintenance. Primary keratinocytes infected with wild type HPV16 immortalized, whereas keratinocytes infected with E6 and E7 knockout virus began to senesce 25 to 35 days post infection. The novel infection model provides a powerful genetic tool to study the role of viral proteins throughout the viral life cycle but especially for immediate early events and enables us to compare low- and high-risk HPV types in the context of infection.

  15. Y chromosome and vimentin used to trace the fate of allogeneic keratinocytes delivered to the wound by the recombined human/pig skin

    Czech Academy of Sciences Publication Activity Database

    Pokorná, Eva; Brož, L.; Veselý, Pavel; Matoušková, Eva

    2001-01-01

    Roč. 47, č. 4 (2001), s. 128-134 ISSN 0015-5500 R&D Projects: GA MZd IZ4368; GA MZd NK6126 Keywords : allogeneic keratinocytes * xenodermis * Y-chromosome FISH Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 0.519, year: 2001

  16. Establishment of primary keratinocyte culture from horse tissue biopsates

    Directory of Open Access Journals (Sweden)

    Jernej OGOREVC

    2015-12-01

    Full Text Available Primary cell lines established from skin tissue can be used in immunological, proteomic and genomic studies as in vitro skin models. The goal of our study was to establish a primary keratinocyte cell culture from tissue biopsates of two horses. The primary keratinocyte cell culture was obtained by mechanical and enzymatic dissociation and with explant culture method. The result was a heterogeneous primary culture comprised of keratinocytes and fibroblasts. To distinguish epithelial and mesenchymal cells immunofluorescent characterisation was performed, using antibodies against cytokeratin 14 and vimentin. We successfully at attained a primary cell line of keratinocytes, which could potentially be used to study equine skin diseases, as an animal model for human diseases, and for cosmetic and therapeutic product testing.

  17. Keratinocytes at the uppermost layer of epidermis might act as sensors of atmospheric pressure change.

    Science.gov (United States)

    Denda, Mitsuhiro

    2016-01-01

    It has long been suggested that climate, especially atmospheric pressure change, can cause health problems ranging from migraine to myocardial infarction. Here, I hypothesize that the sensory system of epidermal keratinocytes mediates the influence of atmospheric pressure change on the human physiological condition. We previously demonstrated that even subtle changes of atmospheric pressure (5-20 hPa) induce elevation of intracellular calcium level in cultured human keratinocytes (excitation of keratinocytes). It is also established that communication occurs between epidermal keratinocytes and peripheral nerve systems. Moreover, various neurotransmitters and hormones that influence multiple systems (nervous, cardiovascular, endocrine, and immune systems) are generated and released from epidermal keratinocytes in response to various external stimuli. Thus, I suggest that pathophysiological phenomena induced by atmospheric pressure changes might be triggered by epidermal keratinocytes.

  18. Inactivation of p16INK4a, with retention of pRB and p53/p21cip1 function, in human MRC5 fibroblasts that overcome a telomere-independent crisis during immortalization.

    Science.gov (United States)

    Taylor, Lisa M; James, Alexander; Schuller, Christine E; Brce, Jesena; Lock, Richard B; Mackenzie, Karen L

    2004-10-15

    Recent investigations, including our own, have shown that specific strains of fibroblasts expressing telomerase reverse transcriptase (hTERT) have an extended lifespan, but are not immortal. We previously demonstrated that hTERT-transduced MRC5 fetal lung fibroblasts (MRC5hTERTs) bypassed senescence but eventually succumbed to a second mortality barrier (crisis). In the present study, 67 MRC5hTERT clones were established by limiting dilution of a mass culture. Whereas 39/67 clones had an extended lifespan, all 39 extended lifespan clones underwent crisis. 11 of 39 clones escaped crisis and were immortalized. There was no apparent relationship between the fate of clones at crisis and the level of telomerase activity. Telomeres were hyperextended in the majority of the clones analyzed. There was no difference in telomere length of pre-crisis compared with post-crisis and immortal clones, indicating that hyperextended telomeres were conducive for immortalization and confirming that crisis was independent of telomere length. Immortalization of MRC5hTERT cells was associated with repression of the cyclin-dependent kinase inhibitor p16INK4a and up-regulation of pRB. However, the regulation of pRB phosphorylation and the response of the p53/p21cip1/waf1 pathway were normal in immortal cells subject to genotoxic stress. Overexpression of oncogenic ras failed to de-repress p16INK4a in immortal cells. Furthermore, expression of ras enforced senescent-like growth arrest in p16INK4a-positive, but not p16INK4a-negative MRC5hTERT cells. Immortal cells expressing ras formed small, infrequent colonies in soft agarose, but were non-tumorigenic. Overall, these results implicate the inactivation of p16INK4a as a critical event for overcoming telomere-independent crisis, immortalizing MRC5 fibroblasts and overcoming ras-induced premature senescence.

  19. Platelet-Released Growth Factors Induce Differentiation of Primary Keratinocytes

    Science.gov (United States)

    Tohidnezhad, Mersedeh; Lammel, Justus; Lippross, Sebastian; Behrendt, Peter; Klüter, Tim; Pufe, Thomas; Jahr, Holger; Cremer, Jochen; Rademacher, Franziska; Gläser, Regine; Harder, Jürgen

    2017-01-01

    Autologous thrombocyte concentrate lysates, for example, platelet-released growth factors, (PRGFs) or their clinically related formulations (e.g., Vivostat PRF®) came recently into the physicians' focus as they revealed promising effects in regenerative and reparative medicine such as the support of healing of chronic wounds. To elucidate the underlying mechanisms, we analyzed the influence of PRGF and Vivostat PRF on human keratinocyte differentiation in vitro and on epidermal differentiation status of skin wounds in vivo. Therefore, we investigated the expression of early (keratin 1 and keratin 10) and late (transglutaminase-1 and involucrin) differentiation markers. PRGF treatment of primary human keratinocytes decreased keratin 1 and keratin 10 gene expression but induced involucrin and transglutaminase-1 gene expression in an epidermal growth factor receptor- (EGFR-) dependent manner. In concordance with these results, microscopic analyses revealed that PRGF-treated human keratinocytes displayed morphological features typical of keratinocytes undergoing terminal differentiation. In vivo treatment of artificial human wounds with Vivostat PRF revealed a significant induction of involucrin and transglutaminase-1 gene expression. Together, our results indicate that PRGF and Vivostat PRF induce terminal differentiation of primary human keratinocytes. This potential mechanism may contribute to the observed beneficial effects in the treatment of hard-to-heal wounds with autologous thrombocyte concentrate lysates in vivo. PMID:28808357

  20. Platelet-Released Growth Factors Induce Differentiation of Primary Keratinocytes

    Directory of Open Access Journals (Sweden)

    Andreas Bayer

    2017-01-01

    Full Text Available Autologous thrombocyte concentrate lysates, for example, platelet-released growth factors, (PRGFs or their clinically related formulations (e.g., Vivostat PRF® came recently into the physicians’ focus as they revealed promising effects in regenerative and reparative medicine such as the support of healing of chronic wounds. To elucidate the underlying mechanisms, we analyzed the influence of PRGF and Vivostat PRF on human keratinocyte differentiation in vitro and on epidermal differentiation status of skin wounds in vivo. Therefore, we investigated the expression of early (keratin 1 and keratin 10 and late (transglutaminase-1 and involucrin differentiation markers. PRGF treatment of primary human keratinocytes decreased keratin 1 and keratin 10 gene expression but induced involucrin and transglutaminase-1 gene expression in an epidermal growth factor receptor- (EGFR- dependent manner. In concordance with these results, microscopic analyses revealed that PRGF-treated human keratinocytes displayed morphological features typical of keratinocytes undergoing terminal differentiation. In vivo treatment of artificial human wounds with Vivostat PRF revealed a significant induction of involucrin and transglutaminase-1 gene expression. Together, our results indicate that PRGF and Vivostat PRF induce terminal differentiation of primary human keratinocytes. This potential mechanism may contribute to the observed beneficial effects in the treatment of hard-to-heal wounds with autologous thrombocyte concentrate lysates in vivo.

  1. Cystathionine metabolic enzymes play a role in the inflammation resolution of human keratinocytes in response to sub-cytotoxic formaldehyde exposure

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Eunyoung [College of Pharmacy, Seoul National University, Seoul 08826 (Korea, Republic of); Natural Products Research Institute, Seoul National University, Seoul 08826 (Korea, Republic of); Kim, Hyoung-June [Basic Research and Innovation Division, AmorePacific Corporation R& D Center, Yongin, Gyeounggi-do 17074 (Korea, Republic of); Lee, Moonyoung [College of Pharmacy, Seoul National University, Seoul 08826 (Korea, Republic of); Jin, Sun Hee; Hong, Soo Hyun; Ahn, Seyeon; Kim, Sae On [College of Pharmacy, Seoul National University, Seoul 08826 (Korea, Republic of); Natural Products Research Institute, Seoul National University, Seoul 08826 (Korea, Republic of); Shin, Dong Wook [Basic Research and Innovation Division, AmorePacific Corporation R& D Center, Yongin, Gyeounggi-do 17074 (Korea, Republic of); Lee, Seung-Taek [Department of Biochemistry, College of Life Science and Biotechnology, Yonsei University, Seoul 03722 (Korea, Republic of); Noh, Minsoo, E-mail: minsoonoh@snu.ac.kr [College of Pharmacy, Seoul National University, Seoul 08826 (Korea, Republic of); Natural Products Research Institute, Seoul National University, Seoul 08826 (Korea, Republic of)

    2016-11-01

    Low-level formaldehyde exposure is inevitable in industrialized countries. Although daily-life formaldehyde exposure level is practically impossible to induce cell death, most of mechanistic studies related to formaldehyde toxicity have been performed in cytotoxic concentrations enough to trigger cell death mechanism. Currently, toxicological mechanisms underlying the sub-cytotoxic exposure to formaldehyde are not clearly elucidated in skin cells. In this study, the genome-scale transcriptional analysis in normal human keratinocytes (NHKs) was performed to investigate cutaneous biological pathways associated with daily life formaldehyde exposure. We selected the 175 upregulated differentially expressed genes (DEGs) and 116 downregulated DEGs in NHKs treated with 200 μM formaldehyde. In the Gene Ontology (GO) enrichment analysis of the 175 upregulated DEGs, the endoplasmic reticulum (ER) unfolded protein response (UPR) was identified as the most significant GO biological process in the formaldeyde-treated NHKs. Interestingly, the sub-cytotoxic formaldehyde affected NHKs to upregulate two enzymes important in the cellular transsulfuration pathway, cystathionine γ-lyase (CTH) and cystathionine-β-synthase (CBS). In the temporal expression analysis, the upregulation of the pro-inflammatory DEGs such as MMP1 and PTGS2 was detected earlier than that of CTH, CBS and other ER UPR genes. The metabolites of CTH and CBS, L-cystathionine and L-cysteine, attenuated the formaldehyde-induced upregulation of pro-inflammatory DEGs, MMP1, PTGS2, and CXCL8, suggesting that CTH and CBS play a role in the negative feedback regulation of formaldehyde-induced pro-inflammatory responses in NHKs. In this regard, the sub-cytotoxic formaldehyde-induced CBS and CTH may regulate inflammation fate decision to resolution by suppressing the early pro-inflammatory response. - Highlights: • Sub-cytotoxic formaldehyde upregulates ER UPR-associated genes in NHKs. • Formaldehyde-induced ER UPR

  2. Life Beyond the Physical Body: The Possibilities of Digital Immortality

    OpenAIRE

    Galvão, Vinícius F.; Maciél, Cristiano; Garcia, Ana Cristina B.; Viterbo, José

    2017-01-01

    We are on the verge of a major shift in the way we perceive digital life, what may cause a significant impact to the real world. Gradually, through increasing knowledge in the areas of artificial intelligence, big data and machine learning, computers have been emulating deceased human beings and, symbolically, with the aid of technology, have been managing to conquer death. This article seeks to understand and problematize the ways in which digital immortality has manifested itself, particula...

  3. Antioxidant Opuntia ficus-indica Extract Activates AHR-NRF2 Signaling and Upregulates Filaggrin and Loricrin Expression in Human Keratinocytes.

    Science.gov (United States)

    Nakahara, Takeshi; Mitoma, Chikage; Hashimoto-Hachiya, Akiko; Takahara, Masakazu; Tsuji, Gaku; Uchi, Hiroshi; Yan, Xianghong; Hachisuka, Junichi; Chiba, Takahito; Esaki, Hitokazu; Kido-Nakahara, Makiko; Furue, Masutaka

    2015-10-01

    Opuntia ficus-indica (OFI) is a cactus species widely used as an anti-inflammatory, antilipidemic, and hypoglycemic agent. It has been shown that OFI extract (OFIE) inhibits oxidative stress in animal models of diabetes and hepatic disease; however, its antioxidant mechanism remains largely unknown. In this study, we demonstrated that OFIE exhibited potent antioxidant activity through the activation of nuclear factor erythroid 2-related factor 2 (NRF2) and the downstream antioxidant enzyme quinone oxidoreductase 1 (NQO1), which inhibited the generation of reactive oxygen species in keratinocytes challenged with tumor necrosis factor α or benzo[α]pyrene. The antioxidant capacity of OFIE was canceled in NRF2 knockdown keratinocytes. OFIE exerted this NRF2-NQO1 upregulation through activation of the aryl hydrocarbon receptor (AHR). Moreover, the ligation of AHR by OFIE upregulated the expression of epidermal barrier proteins: filaggrin and loricrin. OFIE also prevented TH2 cytokine-mediated downregulation of filaggrin and loricrin expression in an AHR-dependent manner because it was canceled in AHR knockdown keratinocytes. Antioxidant OFIE is a potent activator of AHR-NRF2-NQO1 signaling and may be beneficial in treating barrier-disrupted skin disorders.

  4. Effect of Wnt3a on Keratinocytes Utilizing in Vitro and Bioinformatics Analysis

    Directory of Open Access Journals (Sweden)

    Ju-Suk Nam

    2014-03-01

    Full Text Available Wingless-type (Wnt signaling proteins participate in various cell developmental processes. A suppressive role of Wnt5a on keratinocyte growth has already been observed. However, the role of other Wnt proteins in proliferation and differentiation of keratinocytes remains unknown. Here, we investigated the effects of the Wnt ligand, Wnt3a, on proliferation and differentiation of keratinocytes. Keratinocytes from normal human skin were cultured and treated with recombinant Wnt3a alone or in combination with the inflammatory cytokine, tumor necrosis factor α (TNFα. Furthermore, using bioinformatics, we analyzed the biochemical parameters, molecular evolution, and protein–protein interaction network for the Wnt family. Application of recombinant Wnt3a showed an anti-proliferative effect on keratinocytes in a dose-dependent manner. After treatment with TNFα, Wnt3a still demonstrated an anti-proliferative effect on human keratinocytes. Exogenous treatment of Wnt3a was unable to alter mRNA expression of differentiation markers of keratinocytes, whereas an altered expression was observed in TNFα-stimulated keratinocytes. In silico phylogenetic, biochemical, and protein–protein interaction analysis showed several close relationships among the family members of the Wnt family. Moreover, a close phylogenetic and biochemical similarity was observed between Wnt3a and Wnt5a. Finally, we proposed a hypothetical mechanism to illustrate how the Wnt3a protein may inhibit the process of proliferation in keratinocytes, which would be useful for future researchers.

  5. Expression of Mitochondrial Non-coding RNAs (ncRNAs) Is Modulated by High Risk Human Papillomavirus (HPV) Oncogenes*

    Science.gov (United States)

    Villota, Claudio; Campos, América; Vidaurre, Soledad; Oliveira-Cruz, Luciana; Boccardo, Enrique; Burzio, Verónica A.; Varas, Manuel; Villegas, Jaime; Villa, Luisa L.; Valenzuela, Pablo D. T.; Socías, Miguel; Roberts, Sally; Burzio, Luis O.

    2012-01-01

    The study of RNA and DNA oncogenic viruses has proved invaluable in the discovery of key cellular pathways that are rendered dysfunctional during cancer progression. An example is high risk human papillomavirus (HPV), the etiological agent of cervical cancer. The role of HPV oncogenes in cellular immortalization and transformation has been extensively investigated. We reported the differential expression of a family of human mitochondrial non-coding RNAs (ncRNAs) between normal and cancer cells. Normal cells express a sense mitochondrial ncRNA (SncmtRNA) that seems to be required for cell proliferation and two antisense transcripts (ASncmtRNAs). In contrast, the ASncmtRNAs are down-regulated in cancer cells. To shed some light on the mechanisms that trigger down-regulation of the ASncmtRNAs, we studied human keratinocytes (HFK) immortalized with HPV. Here we show that immortalization of HFK with HPV-16 or 18 causes down-regulation of the ASncmtRNAs and induces the expression of a new sense transcript named SncmtRNA-2. Transduction of HFK with both E6 and E7 is sufficient to induce expression of SncmtRNA-2. Moreover, E2 oncogene is involved in down-regulation of the ASncmtRNAs. Knockdown of E2 in immortalized cells reestablishes in a reversible manner the expression of the ASncmtRNAs, suggesting that endogenous cellular factors(s) could play functions analogous to E2 during non-HPV-induced oncogenesis. PMID:22539350

  6. Expression of mitochondrial non-coding RNAs (ncRNAs) is modulated by high risk human papillomavirus (HPV) oncogenes.

    Science.gov (United States)

    Villota, Claudio; Campos, América; Vidaurre, Soledad; Oliveira-Cruz, Luciana; Boccardo, Enrique; Burzio, Verónica A; Varas, Manuel; Villegas, Jaime; Villa, Luisa L; Valenzuela, Pablo D T; Socías, Miguel; Roberts, Sally; Burzio, Luis O

    2012-06-15

    The study of RNA and DNA oncogenic viruses has proved invaluable in the discovery of key cellular pathways that are rendered dysfunctional during cancer progression. An example is high risk human papillomavirus (HPV), the etiological agent of cervical cancer. The role of HPV oncogenes in cellular immortalization and transformation has been extensively investigated. We reported the differential expression of a family of human mitochondrial non-coding RNAs (ncRNAs) between normal and cancer cells. Normal cells express a sense mitochondrial ncRNA (SncmtRNA) that seems to be required for cell proliferation and two antisense transcripts (ASncmtRNAs). In contrast, the ASncmtRNAs are down-regulated in cancer cells. To shed some light on the mechanisms that trigger down-regulation of the ASncmtRNAs, we studied human keratinocytes (HFK) immortalized with HPV. Here we show that immortalization of HFK with HPV-16 or 18 causes down-regulation of the ASncmtRNAs and induces the expression of a new sense transcript named SncmtRNA-2. Transduction of HFK with both E6 and E7 is sufficient to induce expression of SncmtRNA-2. Moreover, E2 oncogene is involved in down-regulation of the ASncmtRNAs. Knockdown of E2 in immortalized cells reestablishes in a reversible manner the expression of the ASncmtRNAs, suggesting that endogenous cellular factors(s) could play functions analogous to E2 during non-HPV-induced oncogenesis.

  7. Change alone is eternal, perpetual, immortal : pharmacological immortality in science fiction

    OpenAIRE

    Grech, Victor E.; Vassallo, Clare; Callus, Ivan

    2012-01-01

    Immortality is a common feature in science-fiction (SF). This paper lists the ways in which the pharmacological induction of immortality has been depicted in SF, and the resultant outcomes. Immortality or extreme longevity are often melded with infertility in order to eliminate the overpopulation issues that would inevitably arise. This is only one way in which theoretical utopias which afford life extension become dystopias, cautionary tales that admonish against hubris. In this fashion, SF ...

  8. Transduction of the E6 and E7 genes of epidermodysplasia-verruciformis-associated human papillomaviruses alters human keratinocyte growth and differentiation in organotypic cultures

    NARCIS (Netherlands)

    Boxman, I. L.; Mulder, L. H.; Noya, F.; de Waard, V.; Gibbs, S.; Broker, T. R.; ten Kate, F.; Chow, L. T.; ter Schegget, J.

    2001-01-01

    Epidermodysplasia-verruciformis-associated human papilloma virus DNA has been detected in skin cancers, in premalignant and benign skin lesions, and in plucked hairs from immunocompetent and immunosuppressed patients. The role of epidermodysplasia-verruciformis-associated human papilloma virus in

  9. Psidium guajava extract inhibits thymus and activation-regulated chemokine (TARC/CCL17) production in human keratinocytes by inducing heme oxygenase-1 and blocking NF-κB and STAT1 activation.

    Science.gov (United States)

    Han, Eun Hee; Hwang, Yong Pil; Choi, Jae Ho; Yang, Ji Hye; Seo, Jong Kwon; Chung, Young Chul; Jeong, Hye Gwang

    2011-09-01

    Psidium guajava (P. guajava) is a food and medicinal plant with antioxidant, anti-inflammatory, and anti-allergic activities that support its traditional uses. The aim of this study was to determine the effects of P. guajava ethyl acetate extract (PGEA) on atopic dermatitis and to investigate the possible mechanisms by which PGEA inhibits cytokine-induced Th2 chemokine expression in HaCaT human keratinocyte cells. We found that PGEA suppressed the IFN-γ/TNF-α-co-induced production of thymus and activation-regulated chemokine (TARC) protein and mRNA in HaCaT cells. Additionally, PGEA inhibited the TNF-α/IFN-γ-co-induced activation of NF-κB and STAT1 and increased the expression of heme oxygenase-1 (HO-1) protein and mRNA. HO-1 inhibitor enhanced the suppressive effects of PGEA on TNF-α/IFN-γ-co-induced TARC production and gene expression. Collectively, these data demonstrate that PGEA inhibits chemokine expression in keratinocytes by inducing HO-1 expression and it suggests a possible therapeutic application in atopic dermatitis and other inflammatory skin diseases. Copyright © 2011 Elsevier B.V. All rights reserved.

  10. Radiation-induced transformation of SV40-immortalized human thyroid epithelial cells by single and fractionated exposure to γ-irradiation in vitro

    International Nuclear Information System (INIS)

    Riches, A.C.; Herceg, Z.; Bryant, P.E.; Wynford-Thomas, D.

    1994-01-01

    Radiation-induced transformation of a human thyroid epithelial cell line (HTori-3) has been investigated following exposure to single and fractionated doses of γ-irradiation. The human epithelial cells were irradiated in vitro and following passaging, transplanted to the athymic nude mouse. Following a single exposure to γ-irradiation in the range 0.5-4Gy, 22 tumours were observed in 45 recipients and following three equal fractions in the range 0.5-4Gy per fraction, 18 tumours were observed in 31 recipients. Tumours were undifferentiated carcinomas and were observed from 7 to 20 weeks after transplantation. They occurred after similar radiation doses to those received by the children in the Belarus region of Ukraine, who developed thyroid tumours. The number of tumours observed, in each group receiving cells irradiated with a single dose of γ-irradiation in the range 0.5-4 Gy, was similar. Cell lines were established from some tumours and the tumorigenicity confirmed by retransplantation. These tumour cell lines were more radiosensitive than the human thyroid epithelial cell line they were derived from. This indicates that transformed cells were not being selected from a subpopulation within the parent cell line but that radiation-induced transformants were being induced de novo. The human origin of the tumours was established by karyotyping, immunocytochemical demonstration of human epithelial cytokeratins and p53 analysis. DNA fingerprinting confirmed that the tumours were derived from the original cell line. (author)

  11. The immortality of humoral immunity.

    Science.gov (United States)

    Elgueta, Raul; de Vries, Victor C; Noelle, Randolph J

    2010-07-01

    Decades of high-titered antibody are sustained due to the persistence of memory B cells and long-lived plasma cells (PCs). The differentiation of each of these subsets is antigen- and T-cell driven and is dependent on signals acquired and integrated during the germinal center response. Inherent in the primary immune response must be the delivery of signals to B cells to create these populations, which have virtual immortality. Differences in biology and chemotactic behavior disperse memory B cells and long-lived PCs to a spectrum of anatomic sites. Each subset must rely on survival factors that can support their longevity. This review focuses on the generation of each of these subsets, their survival, and renewal, which must occur to sustain serological memory. In this context, we discuss the role of antigen, bystander inflammation, and cellular niches. The contribution of BAFF (B-cell activating factor belonging to the tumor necrosis factor family) and APRIL (a proliferation-inducing ligand) to the persistence of memory B cells and PCs are also detailed. Insights that have been provided over the past few years in the regulation of long-lived B-cell responses will have profound impact on vaccine development, the treatment of pre-sensitized patients for organ transplantation, and therapeutic interventions in both antibody- and T-cell-mediated autoimmunity.

  12. Chemosensory Information Processing between Keratinocytes and Trigeminal Neurons

    Science.gov (United States)

    Sondersorg, Anna Christina; Busse, Daniela; Kyereme, Jessica; Rothermel, Markus; Neufang, Gitta; Gisselmann, Günter; Hatt, Hanns; Conrad, Heike

    2014-01-01

    Trigeminal fibers terminate within the facial mucosa and skin and transmit tactile, proprioceptive, chemical, and nociceptive sensations. Trigeminal sensations can arise from the direct stimulation of intraepithelial free nerve endings or indirectly through information transmission from adjacent cells at the peripheral innervation area. For mechanical and thermal cues, communication processes between skin cells and somatosensory neurons have already been suggested. High concentrations of most odors typically provoke trigeminal sensations in vivo but surprisingly fail to activate trigeminal neuron monocultures. This fact favors the hypothesis that epithelial cells may participate in chemodetection and subsequently transmit signals to neighboring trigeminal fibers. Keratinocytes, the major cell type of the epidermis, express various receptors that enable reactions to multiple environmental stimuli. Here, using a co-culture approach, we show for the first time that exposure to the odorant chemicals induces a chemical communication between human HaCaT keratinocytes and mouse trigeminal neurons. Moreover, a supernatant analysis of stimulated keratinocytes and subsequent blocking experiments with pyrodoxalphosphate-6-azophenyl-2′,4′-disulfonate revealed that ATP serves as the mediating transmitter molecule released from skin cells after odor stimulation. We show that the ATP release resulting from Javanol® stimulation of keratinocytes was mediated by pannexins. Consequently, keratinocytes act as chemosensors linking the environment and the trigeminal system via ATP signaling. PMID:24790106

  13. Immortalization of normal human mammary epithelial cells in two steps by direct targeting of senescence barriers does not require gross genomic alterations

    Czech Academy of Sciences Publication Activity Database

    Garbe, J.C.; Vrba, Lukáš; Sputova, K.; Fuchs, L.; Novák, Petr; Brothman, A.R.; Jackson, M.; Chin, K.; LaBarge, M.A.; Watts, G.; Futscher, B. W.; Stampfer, M.R.

    2014-01-01

    Roč. 13, č. 21 (2014), s. 3423-3435 ISSN 1538-4101 Institutional support: RVO:60077344 Keywords : genomic instability * human mammary epithelial cells * telomerase Subject RIV: EB - Genetics ; Molecular Biology OBOR OECD: Cell biology Impact factor: 4.565, year: 2014

  14. Avian Influenza Virus Infection of Immortalized Human Respiratory Epithelial Cells Depends upon a Delicate Balance between Hemagglutinin Acid Stability and Endosomal pH.

    Science.gov (United States)

    Daidoji, Tomo; Watanabe, Yohei; Ibrahim, Madiha S; Yasugi, Mayo; Maruyama, Hisataka; Masuda, Taisuke; Arai, Fumihito; Ohba, Tomoyuki; Honda, Ayae; Ikuta, Kazuyoshi; Nakaya, Takaaki

    2015-04-24

    The highly pathogenic avian influenza (AI) virus, H5N1, is a serious threat to public health worldwide. Both the currently circulating H5N1 and previously circulating AI viruses recognize avian-type receptors; however, only the H5N1 is highly infectious and virulent in humans. The mechanism(s) underlying this difference in infectivity remains unclear. The aim of this study was to clarify the mechanisms responsible for the difference in infectivity between the current and previously circulating strains. Primary human small airway epithelial cells (SAECs) were transformed with the SV40 large T-antigen to establish a series of clones (SAEC-Ts). These clones were then used to test the infectivity of AI strains. Human SAEC-Ts could be broadly categorized into two different types based on their susceptibility (high or low) to the viruses. SAEC-T clones were poorly susceptible to previously circulating AI but were completely susceptible to the currently circulating H5N1. The hemagglutinin (HA) of the current H5N1 virus showed greater membrane fusion activity at higher pH levels than that of previous AI viruses, resulting in broader cell tropism. Moreover, the endosomal pH was lower in high susceptibility SAEC-T clones than that in low susceptibility SAEC-T clones. Taken together, the results of this study suggest that the infectivity of AI viruses, including H5N1, depends upon a delicate balance between the acid sensitivity of the viral HA and the pH within the endosomes of the target cell. Thus, one of the mechanisms underlying H5N1 pathogenesis in humans relies on its ability to fuse efficiently with the endosomes in human airway epithelial cells. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  15. Determination of acute lethal and chronic lethal dose thresholds of valproic acid using 3D spheroids constructed from the immortal human hepatocyte cell line HepG2/C3A

    DEFF Research Database (Denmark)

    Fey, S. J.; Wrzesinski, K.

    2013-01-01

    describe here a culture system based on 3D spheroid culture of immortal hepatocytes which can determine the toxicity of valproic acid (or structurally or functionally related molecules) in vitro. The spheroids were used to follow changes in ATP production, glucose uptake and adenylate kinase following...

  16. SNOM and AFM microscopy techniques to study the effect of non-ionizing radiation on the morphological and biochemical properties of human keratinocytes cell line (HaCaT).