WorldWideScience

Sample records for human epidermal rhe

  1. RT-PCR detection of Candida albicans ALS gene expression in the reconstituted human epithelium (RHE) model of oral candidiasis and in model biofilms.

    Science.gov (United States)

    Green, Clayton B; Cheng, Georgina; Chandra, Jyotsna; Mukherjee, Pranab; Ghannoum, Mahmoud A; Hoyer, Lois L

    2004-02-01

    An RT-PCR assay was developed to analyse expression patterns of genes in the Candida albicans ALS (agglutinin-like sequence) family. Inoculation of a reconstituted human buccal epithelium (RHE) model of mucocutaneous candidiasis with strain SC5314 showed destruction of the epithelial layer by C. albicans and also formation of an upper fungal layer that had characteristics similar to a biofilm. RT-PCR analysis of total RNA samples extracted from C. albicans-inoculated buccal RHE showed that ALS1, ALS2, ALS3, ALS4, ALS5 and ALS9 were consistently detected over time as destruction of the RHE progressed. Detection of transcripts from ALS7, and particularly from ALS6, was more sporadic, but not associated with a strictly temporal pattern. The expression pattern of ALS genes in C. albicans cultures used to inoculate the RHE was similar to that observed in the RHE model, suggesting that contact of C. albicans with buccal RHE does little to alter ALS gene expression. RT-PCR analysis of RNA samples extracted from model denture and catheter biofilms showed similar gene expression patterns to the buccal RHE specimens. Results from the RT-PCR analysis of biofilm RNA specimens were consistent between various C. albicans strains during biofilm development and were comparable to gene expression patterns in planktonic cells. The RT-PCR assay described here will be useful for analysis of human clinical specimens and samples from other disease models. The method will provide further insight into the role of ALS genes and their encoded proteins in the diverse interactions between C. albicans and its host.

  2. Polymeric membranes modulate human keratinocyte differentiation in specific epidermal layers.

    Science.gov (United States)

    Salerno, Simona; Morelli, Sabrina; Giordano, Francesca; Gordano, Amalia; Bartolo, Loredana De

    2016-10-01

    In vitro models of human bioengineered skin substitutes are an alternative to animal experimentation for testing the effects and toxicity of drugs, cosmetics and pollutants. For the first time specific and distinct human epidermal strata were engineered by using membranes and keratinocytes. To this purpose, biodegradable membranes of chitosan (CHT), polycaprolactone (PCL) and a polymeric blend of CHT-PCL were prepared by phase-inversion technique and characterized in order to evaluate their morphological, physico-chemical and mechanical properties. The capability of membranes to modulate keratinocyte differentiation inducing specific interactions in epidermal membrane systems was investigated. The overall results demonstrated that the membrane properties strongly influence the cell morpho-functional behaviour of human keratinocytes, modulating their terminal differentiation, with the creation of specific epidermal strata or a fully proliferative epidermal multilayer system. In particular, human keratinocytes adhered on CHT and CHT-PCL membranes, forming the structure of the epidermal top layers, such as the corneum and granulosum strata, characterized by withdrawal or reduction from the cell cycle and cell proliferation. On the PCL membrane, keratinocytes developed an epidermal basal lamina, with high proliferating cells that stratified and migrated over time to form a complete differentiating epidermal multilayer system. Copyright © 2016 Elsevier B.V. All rights reserved.

  3. Evaluation of the medical devices benchmark materials in the controlled human patch testing and in the RhE in vitro skin irritation protocol.

    NARCIS (Netherlands)

    Kandárová, Helena; Bendova, Hana; Letasiova, Silvia; Coleman, Kelly P; De Jong, Wim H; Jírova, Dagmar

    2018-01-01

    Several irritants were used in the in vitro irritation medical device round robin. The objective of this study was to verify their irritation potential using the human patch test (HPT), an in vitro assay, and in vivo data. The irritants were lactic acid (LA), heptanoic acid (HA), sodium dodecyl

  4. Pattern of hormone receptors and human epidermal growth factor ...

    African Journals Online (AJOL)

    Introduction: Breast cancer is the most common cancer among women globally. With immunohistochemistry (IHC), breast cancer is classified into four groups based on IHC profile of estrogen receptor (ER)/progesterone receptor (PR) and human epidermal growth factor receptor 2 (HER2/neu) expression, positive (+) and/or ...

  5. Sensing radiosensitivity of human epidermal stem cells

    International Nuclear Information System (INIS)

    Rachidi, Walid; Harfourche, Ghida; Lemaitre, Gilles; Amiot, Franck; Vaigot, Pierre; Martin, Michele T.

    2007-01-01

    Purpose: Radiosensitivity of stem cells is a matter of debate. For mouse somatic stem cells, both radiosensitive and radioresistant stem cells have been described. By contrast, the response of human stem cells to radiation has been poorly studied. As epidermis is a radiosensitive tissue, we evaluated in the present work the radiosensitivity of cell populations enriched for epithelial stem cells of human epidermis. Methods and materials: The total keratinocyte population was enzymatically isolated from normal human skin. We used flow cytometry and antibodies against cell surface markers to isolate basal cell populations from human foreskin. Cell survival was measured after a dose of 2 Gy with the XTT assay at 72 h after exposure and with a clonogenic assay at 2 weeks. Transcriptome analysis using oligonucleotide microarrays was performed to assess the genomic cell responses to radiation. Results: Cell sorting based on two membrane proteins, α6 integrin and the transferrin receptor CD71, allowed isolation of keratinocyte populations enriched for the two types of cells found in the basal layer of epidermis: stem cells and progenitors. Both the XTT assay and the clonogenic assay showed that the stem cells were radioresistant whereas the progenitors were radiosensitive. We made the hypothesis that upstream DNA damage signalling might be different in the stem cells and used microarray technology to test this hypothesis. The stem cells exhibited a much more reduced gene response to a dose of 2 Gy than the progenitors, as we found that 6% of the spotted genes were regulated in the stem cells and 20% in the progenitors. Using Ingenuity Pathway Analysis software, we found that radiation exposure induced very specific pathways in the stem cells. The most striking responses were the repression of a network of genes involved in apoptosis and the induction of a network of cytokines and growth factors. Conclusion: These results show for the first time that keratinocyte

  6. Radiosensitivity of normal human epidermal cells in culture

    International Nuclear Information System (INIS)

    Dover, R.; Potten, C.S.

    1983-01-01

    Using an in vitro culture system the authors have derived #betta#-radiation survival curves over a dose range 0-8 Gy for the clonogenic cells of normal human epidermis. The culture system used allows the epidermal cells to stratify and form a multi-layered sheet of keratinizing cells. The cultures appear to be a very good model for epidermis in vivo. The survival curves show a population which is apparently more sensitive than murine epidermis in vivo. It remains unclear whether this is an intrinsic difference between the species or is a consequence of the in vitro cultivation of the human cells. (author)

  7. Expression of epidermal growth factor receptors in human endometrial carcinoma

    DEFF Research Database (Denmark)

    Nyholm, H C; Nielsen, Anette Lynge; Ottesen, B

    1993-01-01

    Little data exist on the expression of epidermal growth factor receptors (EGF-Rs) in human endometrial cancer. EGF-R status was studied in 65 patients with endometrial carcinomas and in 26 women with nonmalignant postmenopausal endometria, either inactive/atrophic endometrium or adenomatous...... hyperplasia. EGF-R was identified on frozen tissue sections by means of an indirect immunoperoxidase technique with a monoclonal antibody against the external domain of the EGF-R. Seventy-one percent of the carcinomas expressed positive EGF-R immunoreactivity. In general, staining was most prominent...

  8. Human corpus luteum: presence of epidermal growth factor receptors and binding characteristics

    International Nuclear Information System (INIS)

    Ayyagari, R.R.; Khan-Dawood, F.S.

    1987-01-01

    Epidermal growth factor receptors are present in many reproductive tissues but have not been demonstrated in the human corpus luteum. To determine the presence of epidermal growth factor receptors and its binding characteristics, we carried out studies on the plasma cell membrane fraction of seven human corpora lutea (days 16 to 25) of the menstrual cycle. Specific epidermal growth factor receptors were present in human corpus luteum. Insulin, nerve growth factor, and human chorionic gonadotropin did not competitively displace epidermal growth factor binding. The optimal conditions for corpus luteum-epidermal growth factor receptor binding were found to be incubation for 2 hours at 4 degrees C with 500 micrograms plasma membrane protein and 140 femtomol 125 I-epidermal growth factor per incubate. The number (mean +/- SEM) of epidermal growth factor binding sites was 12.34 +/- 2.99 X 10(-19) mol/micrograms protein; the dissociation constant was 2.26 +/- 0.56 X 10(-9) mol/L; the association constant was 0.59 +/- 0.12 X 10(9) L/mol. In two regressing corpora lutea obtained on days 2 and 3 of the menstrual cycle, there was no detectable specific epidermal growth factor receptor binding activity. Similarly no epidermal growth factor receptor binding activity could be detected in ovarian stromal tissue. Our findings demonstrate that specific receptors for epidermal growth factor are present in the human corpus luteum. The physiologic significance of epidermal growth factor receptors in human corpus luteum is unknown, but epidermal growth factor may be involved in intragonadal regulation of luteal function

  9. Epidermal growth factor receptor in primary human lung cancer

    International Nuclear Information System (INIS)

    Yu Xueyan; Hu Guoqiang; Tian Keli; Wang Mingyun

    1996-01-01

    Cell membranes were prepared from 12 human lung cancers for the study of the expression of epidermal growth factor receptors (EGFR). EGFR concentration was estimated by ligand binding studies using 125 I-radiolabeled EGF. The dissociation constants of the high affinity sites were identical, 1.48 nmol and 1.1 nmol in cancer and normal lung tissues, the EGFR contents were higher in lung cancer tissues (range: 2.25 to 19.39 pmol·g -1 membrane protein) than that in normal tissues from the same patients (range: 0.72 to 7.43 pmol·g -1 membrane protein). These results suggest that EGF and its receptor may play a role in the regulatory mechanisms in the control of lung cellular growth and tumor promotion

  10. Effects of Wnt3a on proliferation and differentiation of human epidermal stem cells

    International Nuclear Information System (INIS)

    Jia Liwei; Zhou Jiaxi; Peng Sha; Li Juxue; Cao Yujing; Duan Enkui

    2008-01-01

    Epidermal stem cells maintain development and homeostasis of mammalian epidermis throughout life. However, the molecular mechanisms involved in the proliferation and differentiation of epidermal stem cells are far from clear. In this study, we investigated the effects of Wnt3a and Wnt/β-catenin signaling on proliferation and differentiation of human fetal epidermal stem cells. We found both Wnt3a and active β-catenin, two key members of the Wnt/β-catenin signaling, were expressed in human fetal epidermis and epidermal stem cells. In addition, Wnt3a protein can promote proliferation and inhibit differentiation of epidermal stem cells in vitro culture. Our results suggest that Wnt/β-catenin signaling plays important roles in human fetal skin development and homeostasis, which also provide new insights on the molecular mechanisms of oncogenesis in human epidermis

  11. Enrichment of unlabeled human Langerhans cells from epidermal cell suspensions by discontinuous density gradient centrifugation

    NARCIS (Netherlands)

    Teunissen, M. B.; Wormmeester, J.; Kapsenberg, M. L.; Bos, J. D.

    1988-01-01

    In this report we introduce an alternative procedure for enrichment of human epidermal Langerhans cells (LC) from epidermal cell suspensions of normal skin. By means of discontinuous Ficoll-Metrizoate density gradient centrifugation, a fraction containing high numbers of viable, more than 80% pure

  12. Homologous radioimmunoassay for human epidermal growth factor (urogastrone)

    International Nuclear Information System (INIS)

    Dailey, G.E.; Kraus, J.W.; Orth, D.N.

    1978-01-01

    Epidermal growth factor (EGF), a polypeptide hormone originally discovered in the mouse submaxillary gland, stimulates growth in a variety of tissues in several species. This hormone has recently been identified in human urine. A homologous RIA for human EGF (RIA-hEGF) has been developed. In general, levels were similar to those recently reported using a heterologous RIA system. Twenty-four-hour urinary excretion of RIA-hEGF by normal adult males and females was 63.0 +- 3.0 and 52.0 +- 3.5 (mean +- SE) μg/total vol, or 29.7 +- 1.1 and 39.8 +- 1.7 μg/g creatinine, respectively. Excretion by females taking oral contraceptives was significantly greater (60.1 +- 2.7 μg/g creatinine; P 0.05). Several of those with very low values had histories of alcohol abuse. Excretion by patients with Cushing's syndrome was normal. Patients with psoriasis or recovering from major burns excreted both abnormally high and abnormally low levels of RIA-hEGF, with no obvious correlation to their clinical condition. There was no apparent diurnal or postprandial variation in urinary RIA-hEGF excretion by normal subjects. An excellent linear correlation was observed between RIA-hEGF and creatinine concentrations in each urine sample for each subject, suggesting that RIA-hEGF concentration in a random urine sample provides a valid index of 24-h RIA-hEGF excretion

  13. Predicting human epidermal melanin concentrations for different skin tones

    CSIR Research Space (South Africa)

    Smit, Jacoba E

    2011-07-01

    Full Text Available epidermal melanin concentrations for different skin tones JE Smit 1 , AE Karsten 2 , RW Sparrow 1 1 CSIR Biosciences, Pretoria, South Africa 2 CSIR National Laser Centre, Pretoria, South Africa Author e-mail address: KSmit...

  14. Effects of soap-water wash on human epidermal penetration.

    Science.gov (United States)

    Zhu, Hanjiang; Jung, Eui-Chang; Phuong, Christina; Hui, Xiaoying; Maibach, Howard

    2016-08-01

    Skin decontamination is a primary interventional method used to decrease dermal absorption of hazardous contaminants, including chemical warfare agents, pesticides and industrial pollutants. Soap and water wash, the most common and readily available decontamination system, may enhance percutaneous absorption through the "wash-in effect." To understand better the effect of soap-water wash on percutaneous penetration, and provide insight to improving skin decontamination methods, in vitro human epidermal penetration rates of four C(14) -labeled model chemicals (hydroquinone, clonidine, benzoic acid and paraoxon) were assayed using flow-through diffusion cells. Stratum corneum (SC) absorption rates of these chemicals at various hydration levels (0-295% of the dry SC weights) were determined and compared with the results of the epidermal penetration study to clarify the effect of SC hydration on skin permeability. Results showed accelerated penetration curves of benzoic acid and paraoxon after surface wash at 30 min postdosing. Thirty minutes after washing (60 min postdosing), penetration rates of hydroquinone and benzoic acid decreased due to reduced amounts of chemical on the skin surface and in the SC. At the end of the experiment (90 min postdosing), a soap-water wash resulted in lower hydroquinone penetration, greater paraoxon penetration and similar levels of benzoic acid and clonidine penetration compared to penetration levels in the non-wash groups. The observed wash-in effect agrees with the enhancement effect of SC hydration on the SC chemical absorption rate. These results suggest SC hydration derived from surface wash to be one cause of the wash-in effect. Further, the occurrence of a wash-in effect is dependent on chemical identity and elapsed time between exposure and onset of decontamination. By reducing chemical residue quantity on skin surface and in the SC reservoir, the soap-water wash may decrease the total quantity of chemical absorbed in the

  15. Epidermal growth factor and its receptors in human pancreatic carcinoma

    International Nuclear Information System (INIS)

    Chen, Y.F.; Pan, G.Z.; Hou, X.; Liu, T.H.; Chen, J.; Yanaihara, C.; Yanaihara, N.

    1990-01-01

    The role of epidermal growth factor (EGF) in oncogenesis and progression of malignant tumors is a subject of vast interest. In this study, radioimmunoassay and radioreceptor assay of EGF were established. EGF contents in malignant and benign pancreatic tumors, in normal pancreas tissue, and in culture media of a human pancreatic carcinoma cell line were determined. EGF receptor binding studies were performed. It was shown that EGF contents in pancreatic carcinomas were significantly higher than those in normal pancreas or benign pancreatic tumors. EGF was also detected in the culture medium of a pancreatic carcinoma cell line. The binding of 125I-EGF to the pancreatic carcinoma cells was time and temperature dependent, reversible, competitive, and specific. Scatchard analysis showed that the dissociation constant of EGF receptor was 2.1 X 10(-9) M, number of binding sites was 1.3 X 10(5) cell. These results indicate that there is an over-expression of EGF/EGF receptors in pancreatic carcinomas, and that an autocrine regulatory mechanism may exist in the growth-promoting effect of EGF on tumor cells

  16. Kinetics of growth and differentiation of cultured human epidermal keratinocytes

    International Nuclear Information System (INIS)

    Albers, K.M.

    1985-01-01

    A study was made of the interrelationship between replication and differentiation in cultures of human epidermal keratinocytes. Measures of both parameters were made using newly developed methods to quantify the rate at which keratinocytes replicate and the rate at which they withdraw from the cell cycle. Keratinocyte replication was measured by determining the cell doubling time, labeling index, and cell cycle duration. Cell cycle length was measured using a double label assay that determines the length of time between two successive phases of DNA synthesis. The first DNA synthesis phase was marked by labeling keratinocytes with 14 C-thymidine. At the next round of DNA synthesis, cells were labeled with bromodeoxyuridine, a heavy analog of thymidine. The cell cycle length is given by the time required for the 14 C-labeled DNA to become double labeled. To measure keratinocyte differentiation, the rate at which cells withdraw from the cell cycle was determined. To measure withdrawal, the percentage of cells labeled by a pulse of 14 C-thymidine that failed to undergo a second cycle of DNA synthesis, as measured by bromodeoxyuridine incorporation, was determined. Cells which failed to undergo a second cycle of synthesis were considered to have differentiated and withdrawn from the cell cycle

  17. Response of human epidermal keratinocytes to UV light

    International Nuclear Information System (INIS)

    Kartasova, A.A.

    1987-01-01

    This thesis presents a study on the response of human epidermal keratinocytes to UV light as well as to other agents like 4-NQO and TPA. The effects of ultraviolet (UV) light on the protein synthesis in cultured keratinocytes are presented in ch. III. The next chapter describes the construction of a cDNA library using mRNA isolated from UV irradiated kernatinocytes. This library was differentially screened with cDNA probes synthesized on mRNA from either UV irradiated or nonirradiated cells. Several groups of cDNA clones corresponding to transcripts whose level in the cytoplasm seem to be affected by exposure to UV light have been isolated and characterized by cross-hybridization, sequencing and Northern blot analysis. More detailed analysis of some of the cDNA clones is presented in the two chapters following ch. IV. The complete cDNA sequence of the proteinase inhibitor cystatin A and the modulation of its expression by UV light and the carcinogen 4-nitroquinoline 1-oxide (4-NQO) in keratinocytes are described in ch. V. Two other groups of cDNA clones have been isolated which do not cross-hybridize with each other on Southern blots. However, the primary structures of the proteins deduced from the nucleotide sequences of these two groups of cDNA clones are very similar. 212 refs.; 33 figs.; 2 tabs

  18. Structural and biophysical characteristics of human skin in maintaining proper epidermal barrier function

    Directory of Open Access Journals (Sweden)

    Magdalena Boer

    2016-02-01

    Full Text Available The complex structure of human skin and its physicochemical properties turn it into an efficient outermost defence line against exogenous factors, and help maintain homeostasis of the human body. This role is played by the epidermal barrier with its major part – stratum corneum. The condition of the epidermal barrier depends on individual and environmental factors. The most important biophysical parameters characterizing the status of this barrier are the skin pH, epidermal hydration, transepidermal water loss and sebum excretion. The knowledge of biophysical skin processes may be useful for the implementation of prophylactic actions whose aim is to restore the barrier function.

  19. Influence of topical human epidermal growth factor on postkeratoplasty re-epithelialisation

    NARCIS (Netherlands)

    M.M. Dellaert; T.A. Casey; S. Wiffen; J. Gordon (Jocelynne); P. Johnson (Jürgen); A.J. Geerards (Annette); W.J. Rijneveld (Wilhelmina); L. Remeijer (Lies); W.H. Beekhuis (Houdijn); P.G.H. Mulder (Paul)

    1997-01-01

    textabstractAIM: To test the efficacy and safety of recombinant human epidermal growth factor (hEGF) on corneal re-epithelialisation following penetrating keratoplasty. METHODS: A prospective, randomised, placebo controlled study was carried out in which patients were

  20. Flow cytometry of human primary epidermal and follicular keratinocytes.

    Science.gov (United States)

    Gragnani, Alfredo; Ipolito, Michelle Zampieri; Sobral, Christiane S; Brunialti, Milena Karina Coló; Salomão, Reinaldo; Ferreira, Lydia Masako

    2008-02-19

    The aim of this study was to characterize using flow cytometry cultured human primary keratinocytes isolated from the epidermis and hair follicles by different methods. Human keratinocytes derived from discarded fragments of total skin and scalp hair follicles from patients who underwent plastic surgery in the Plastic Surgery Division at UNIFESP were used. The epidermal keratinocytes were isolated by using 3 different methods: the standard method, upon exposure to trypsin for 30 minutes; the second, by treatment with dispase for 18 hours and with trypsin for 10 minutes; and the third, by treatment with dispase for 18 hours and with trypsin for 30 minutes. Follicular keratinocytes were isolated using the standard method. On comparing the group treated with dispase for 18 hours and with trypsin for 10 minutes with the group treated with dispase for 18 hours and with trypsin for 30 minutes, it was observed that the first group presented the largest number of viable cells, the smallest number of cells in late apoptosis and necrosis with statistical significance, and no difference in apoptosis. When we compared the group treated with dispase for 18 hours and with trypsin for 10 minutes with the group treated with trypsin, the first group presented the largest number of viable cells, the smallest number of cells in apoptosis with statistical significance, and no difference in late apoptosis and necrosis. When we compared the results of the group treated with dispase for 18 hours and with trypsin for 10 minutes with the results for follical isolation, there was a statistical difference in apoptosis and viable cells. The isolation method of treatment with dispase for 18 hours and with trypsin for 10 minutes produced the largest number of viable cells and the smallest number of cells in apoptosis/necrosis.

  1. Use of etanercept to treat toxic epidermal necrolysis in a human immunodeficiency virus-positive patient

    OpenAIRE

    Yung-Yi Lee; Jui-Hung Ko; Chia-Hung Wei; Wen-Hung Chung

    2013-01-01

    Toxic epidermal necrolysis (TEN) is an uncommon and severe cutaneous adverse drug reaction that causes disseminated necrosis of epidermal cells and mucocutaneous detachment. Here, we report the case of a 32-year-old man with human immunodeficiency virus infection who presented with generalized violaceous macules and blister formation 4 days after the administration of mefenamic acid and amoxicillin for a dental procedure. Additional symptoms included oral ulcers and conjunctivitis. Results of...

  2. Nicotinic acid receptor abnormalities in human skin cancer: implications for a role in epidermal differentiation.

    Directory of Open Access Journals (Sweden)

    Yira Bermudez

    Full Text Available Chronic UV skin exposure leads to epidermal differentiation defects in humans that can be largely restored by pharmacological doses of nicotinic acid. Nicotinic acid has been identified as a ligand for the human G-protein-coupled receptors GPR109A and GPR109B that signal through G(i-mediated inhibition of adenylyl cyclase. We have examined the expression, cellular distribution, and functionality of GPR109A/B in human skin and skin derived epidermal cells.Nicotinic acid increases epidermal differentiation in photodamaged human skin as judged by the terminal differentiation markers caspase 14 and filaggrin. Both GPR109A and GPR109B genes are transcribed in human skin and in epidermal keratinocytes, but expression in dermal fibroblasts is below limits of detection. Receptor transcripts are greatly over-expressed in squamous cell cancers. Receptor protein in normal skin is prominent from the basal through granular layers of the epidermis, with cellular localization more dispersive in the basal layer but predominantly localized at the plasma membrane in more differentiated epidermal layers. In normal human primary and immortalized keratinocytes, nicotinic acid receptors show plasma membrane localization and functional G(i-mediated signaling. In contrast, in a squamous cell carcinoma derived cell line, receptor protein shows a more diffuse cellular localization and the receptors are nearly non-functional.The results of these studies justify future genetic and pharmacological intervention studies to define possible specific role(s of nicotinic acid receptors in human skin homeostasis.

  3. Evolution of the clonogenic potential of human epidermal stem/progenitor cells with age

    Directory of Open Access Journals (Sweden)

    Zobiri O

    2012-02-01

    Full Text Available Olivia Zobiri, Nathalie Deshayes, Michelle Rathman-JosserandDepartment of Biological Research, L'Oréal Advanced Research, Clichy Cedex, FranceAbstract: A number of clinical observations have indicated that the regenerative potential and overall function of the epidermis is modified with age. The epidermis becomes thinner, repairs itself less efficiently after wounding, and presents modified barrier function recovery. In addition, the dermal papillae flatten out with increasing age, suggesting a modification in the interaction between epidermal and dermal compartments. As the epidermal regenerative capacity is dependent upon stem and progenitor cell function, it is naturally of interest to identify and understand age-related changes in these particular keratinocyte populations. Previous studies have indicated that the number of stem cells does not decrease with age in mouse models but little solid evidence is currently available concerning human skin. The objective of this study was to evaluate the clonogenic potential of keratinocyte populations isolated from the epidermis of over 50 human donors ranging from 18 to 71 years old. The data indicate that the number of epidermal cells presenting high regenerative potential does not dramatically decline with age in human skin. The authors believe that changes in the microenvironment controlling epidermal basal cell activity are more likely to explain the differences in epidermal function observed with increasing age.Keywords: skin, epidermal stem cells, aging, colony-forming efficiency test

  4. Grafting of human epidermal cells, presence and perspectives

    Czech Academy of Sciences Publication Activity Database

    Smetana, Karel; Dvořánková, B.; Labský, Jiří; Vacík, Jiří; Holíková, Z.

    2001-01-01

    Roč. 102, č. 1 (2001), s. 1-6 ISSN 0036-5327 R&D Projects: GA ČR GA203/00/1310; GA AV ČR IBS4050005; GA MZd ND6340; GA MŠk LN00A065; GA AV ČR KSK4055109 Institutional research plan: CEZ:AV0Z4050913 Keywords : cell therapy-keratinocyte-epidermal stem cell * skin defect Subject RIV: CD - Macromolecular Chemistry

  5. Human Papilloma Viral DNA Replicates as a Stable Episome in Cultured Epidermal Keratinocytes

    Science.gov (United States)

    Laporta, Robert F.; Taichman, Lorne B.

    1982-06-01

    Human papilloma virus (HPV) is poorly understood because systems for its growth in tissue culture have not been developed. We report here that cultured human epidermal keratinocytes could be infected with HPV from plantar warts and that the viral DNA persisted and replicated as a stable episome. There were 50-200 copies of viral DNA per cell and there was no evidence to indicate integration of viral DNA into the cellular genome. There was also no evidence to suggest that viral DNA underwent productive replication. We conclude that cultured human epidermal keratinocytes may be a model for the study of certain aspects of HPV biology.

  6. Extraction of high-quality epidermal RNA after ammonium thiocyanate-induced dermo-epidermal separation of 4 mm human skin biopsies

    DEFF Research Database (Denmark)

    Clemmensen, Anders; Thomassen, Mads; Clemmensen, Ole

    2009-01-01

    To obtain a separation of the epidermal and dermal compartments to examine compartment specific biological mechanisms in the skin, we incubated 4 mm human skin punch biopsies in ammonium thiocyanate. We wanted to test (i) the histological quality of the dermo-epidermal separation obtained...... by different incubation times; (ii) the amount and quality of extractable epidermal RNA and (iii) its impact on sample RNA expression profiles assessed by large-scale gene expression microarray analysis in both normal and inflamed skin. At 30-min incubation, the split between dermis and epidermis...... and almost completely separated from the dermis of 4 mm skin biopsies by 30 min incubation in 3.8% ammonium thiocyanate combined with curettage of the dermal surface, producing high-quality RNA suitable for transcriptional analysis. Our refined method of dermo-epidermal separation will undoubtedly prove...

  7. Growth of melanocytes in human epidermal cell cultures

    International Nuclear Information System (INIS)

    Staiano-Coico, L.; Hefton, J.M.; Amadeo, C.; Pagan-Charry, I.; Madden, M.R.; Cardon-Cardo, C.

    1990-01-01

    Epidermal cell cultures were grown in keratinocyte-conditioned medium for use as burn wound grafts; the melanocyte composition of the grafts was studied under a variety of conditions. Melanocytes were identified by immunohistochemistry based on a monoclonal antibody (MEL-5) that has previously been shown to react specifically with melanocytes. During the first 7 days of growth in primary culture, the total number of melanocytes in the epidermal cultures decreased to 10% of the number present in normal skin. Beginning on day 2 of culture, bipolar melanocytes were present at a mean cell density of 116 +/- 2/mm2; the keratinocyte to melanocyte ratio was preserved during further primary culture and through three subpassages. Moreover, exposure of cultures to mild UVB irradiation stimulated the melanocytes to proliferate, suggesting that the melanocytes growing in culture maintained their responsiveness to external stimuli. When the sheets of cultured cells were enzymatically detached from the plastic culture flasks before grafting, melanocytes remained in the basal layer of cells as part of the graft applied to the patient

  8. Human epidermal growth factor: molecular forms and application of radioimmunoassay and radioreceptor assay

    International Nuclear Information System (INIS)

    Hirata, Y.; Orth, D.N.

    1981-01-01

    Epidermal growth factor (EGF), a 53 amino acid polypeptide, was first isolated by Cohen. EGF's growth-promoting activity is not limited to epidermal cells, but is expressed on a wide variety of tissues derived from a number of different species. Human EGF (hEGF) was isolated and subsequently purified from human urine. Unexpectedly, a close structural relationship was recognized between mEGF and human β-urogastrone. The authors recently developed both an homologous hEGF radioimmunoassay (RIA) and a radioreceptor assay (RRA) using a human placental membrane fraction. Using these assays, the molecular size of hEGF in human body fluids and tissues was evaluated, and partial characterization of a high molecular weight form of hEGF isolated from human urine was carried out. The concentrations of immunoreactive hEGF were also determined in human tissues and plasma after extraction either with cationic exchange chromatography or with immunoaffinity chromatography. (Auth.)

  9. The organization of human epidermis: functional epidermal units and phi proportionality.

    Science.gov (United States)

    Hoath, Steven B; Leahy, D G

    2003-12-01

    The concept that mammalian epidermis is structurally organized into functional epidermal units has been proposed on the basis of stratum corneum (SC) architecture, proliferation kinetics, melanocyte:keratinocyte ratios (1:36), and, more recently, Langerhans cell: epidermal cell ratios (1:53). This article examines the concept of functional epidermal units in human skin in which the maintenance of phi (1.618034) proportionality provides a central organizing principle. The following empirical measurements were used: 75,346 nucleated epidermal cells per mm2, 1394 Langerhans cells per mm2, 1999 melanocytes per mm2, 16 (SC) layers, 900-microm2 corneocyte surface area, 17,778 corneocytes per mm2, 14-d (SC) turnover time, and 93,124 per mm2 total epidermal cells. Given these empirical data: (1) the number of corneocytes is a mean proportional between the sum of the Langerhans cell + melanocyte populations and the number of epidermal cells, 3393/17,778-17,778/93,124; (2) the ratio of nucleated epidermal cells over corneocytes is phi proportional, 75,346/17,778 approximately phi3; (3) assuming similar 14-d turnover times for the (SC) and Malpighian epidermis, the number of corneocytes results from subtraction of a cellular fraction equal to approximately 2/phi2 x the number of living cells, 75,436 - (2/phi2 x 75,346) approximately 17,778; and (4) if total epidermal turnover time equals (SC) turnover time x the ratio of living/dead cells, then compartmental turnover times are unequal (14 d for (SC) to 45.3 d for nucleated epidermis approximately 1/2phi) and cellular replacement rates are 52.9 corneocytes/69.3 keratinocytes per mm2 per h approximately 2/phi2. These empirically derived equivalences provide logicomathematical support for the presence of functional epidermal units in human skin. Validation of a phi proportional unit architecture in human epidermis will be important for tissue engineering of skin and the design of instruments for skin measurement.

  10. Brief study about the distribution of recombinant human Epidermic Growth Factor (rh-EGF)

    International Nuclear Information System (INIS)

    Rodriguez Garcia, J.C.; De Dios D Espaux, R.; Bello Garciga, J.L.

    1997-01-01

    This report describes results of the study about biodistribution of I-125 recombinant human Epidermic Growth Factor (rhEGF). The radiolabelled product was administrated to Sprague Dawley rats in three different ways: intramuscular, subcutaneous and epidermic; the highest concentration of EGF in blood was found 4 hours after rhEGF administration, with a greater distribution in the plasma with regard to cellular pellet. The slowest plasma clearance corresponded to the intramuscular administration. The highest concentration of radiolabelled rhEGF was found in liver, kidney and intestine. It was found that radiolabelled EGF is excreted mainly throughout urine and faeces although other excretion pathways could exist

  11. Influence of epidermal hydration on the friction of human skin against textiles

    OpenAIRE

    Gerhardt, L.-C; Strässle, V; Lenz, A; Spencer, N.D; Derler, S

    2008-01-01

    Friction and shear forces, as well as moisture between the human skin and textiles are critical factors in the formation of skin injuries such as blisters, abrasions and decubitus. This study investigated how epidermal hydration affects the friction between skin and textiles.

  12. Influence of epidermal hydration on the friction of human skin against textile

    NARCIS (Netherlands)

    Gerhardt, L.C.; Strässle, V.; Lenz, A.; Spencer, N.D.; Derler, S.

    2008-01-01

    Friction and shear forces, as well as moisture between the human skin and textiles are critical factors in the formation of skin injuries such as blisters, abrasions and decubitus. This study investigated how epidermal hydration affects the friction between skin and textiles. The friction between

  13. Toxicity Assessment of Six Titanium Dioxide Nanoparticles in Human Epidermal Keratinocytes

    Science.gov (United States)

    Toxicity Assessment of Six Titanium Dioxide Nanoparticles in Human Epidermal Keratinocytes Nanoparticle uptake in cells may be an important determinant of their potential cytotoxic and inflammatory effects. Six commercial TiO2 NP (A=Alfa Aesar,10nm, A*=Alfa Aesar 32nm, B=P25 27...

  14. Humanized versus murine anti-human epidermal growth factor receptor monoclonal antibodies for immunoscintigraphic studies

    Energy Technology Data Exchange (ETDEWEB)

    Morales, Alejo A. Morales; Duconge, Jorge; Alvarez-Ruiz, Daniel; Becquer-Viart, Maria de Los Angeles; Nunez-Gandolff, Gilda; Fernandez, Eduardo; Caballero-Torres, Idania; Iznaga-Escobar, Normando

    2000-02-01

    The anti-human epidermal growth factor receptor (EGF-R) humanized antibody h-R3 (IgG{sub 1}), which binds to an extracellular domain of EGF-R, was used to evaluate the biodistribution on nude mice xenografted with A431 epidermoid carcinoma cell line. Results are compared with its murine version ior egf/r3 monoclonal antibody (mAb). Twenty-one athymic female 4NMRI nu/nu mice were injected intravenously with 10 {mu}g/100 {mu}Ci of {sup 99m}Tc-labeled mAbs. The mAb ior C5 that recognizes an antigen expressed preferentially on the surface of malignant and cytoplasm of normal colorectal cells was used as negative control. Immunoreactivity of {sup 99m}Tc-labeled mAbs was measured by enzyme linked immunosorbent assay on A431 cell line and the immunoreactive fractions determined by Lindmo method. Among all organs significant accumulation was found in tumor (6.14{+-}2.50 %ID/g, 5.06{+-}2.61 %ID/g for murine and humanized mAbs, respectively) 4 h after injection. The immunoreactive fractions were found to be 0.88 and 0.81 for murine and humanized mAb, respectively. Thus, we expect better results using the humanized mAb h-R3 for diagnostic immunoscintigraphy.

  15. Humanized versus murine anti-human epidermal growth factor receptor monoclonal antibodies for immunoscintigraphic studies

    International Nuclear Information System (INIS)

    Morales, Alejo A. Morales; Duconge, Jorge; Alvarez-Ruiz, Daniel; Becquer-Viart, Maria de Los Angeles; Nunez-Gandolff, Gilda; Fernandez, Eduardo; Caballero-Torres, Idania; Iznaga-Escobar, Normando

    2000-01-01

    The anti-human epidermal growth factor receptor (EGF-R) humanized antibody h-R3 (IgG 1 ), which binds to an extracellular domain of EGF-R, was used to evaluate the biodistribution on nude mice xenografted with A431 epidermoid carcinoma cell line. Results are compared with its murine version ior egf/r3 monoclonal antibody (mAb). Twenty-one athymic female 4NMRI nu/nu mice were injected intravenously with 10 μg/100 μCi of 99m Tc-labeled mAbs. The mAb ior C5 that recognizes an antigen expressed preferentially on the surface of malignant and cytoplasm of normal colorectal cells was used as negative control. Immunoreactivity of 99m Tc-labeled mAbs was measured by enzyme linked immunosorbent assay on A431 cell line and the immunoreactive fractions determined by Lindmo method. Among all organs significant accumulation was found in tumor (6.14±2.50 %ID/g, 5.06±2.61 %ID/g for murine and humanized mAbs, respectively) 4 h after injection. The immunoreactive fractions were found to be 0.88 and 0.81 for murine and humanized mAb, respectively. Thus, we expect better results using the humanized mAb h-R3 for diagnostic immunoscintigraphy

  16. Dermal-epidermal membrane systems by using human keratinocytes and mesenchymal stem cells isolated from dermis

    Energy Technology Data Exchange (ETDEWEB)

    Salerno, Simona, E-mail: s.salerno@itm.cnr.it [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy); Messina, Antonietta [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy); Giordano, Francesca [Department of Pharmacy, Health and Nutritional Sciences, University of Calabria, I-87036 Rende, (CS) (Italy); Bader, Augustinus [Biomedical-Biotechnological Center, BBZ, University of Leipzig, D-04103 Leipzig (Germany); Drioli, Enrico [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy); WCU Energy Engineering Department, Hanyang University, Seoul (Korea, Republic of); De Bartolo, Loredana, E-mail: l.debartolo@itm.cnr.it [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy)

    2017-02-01

    Dermal-epidermal membrane systems were developed by co-culturing human keratinocytes with Skin derived Stem Cells (SSCs), which are Mesenchymal Stem Cells (MSCs) isolated from dermis, on biodegradable membranes of chitosan (CHT), polycaprolactone (PCL) and a polymeric blend of CHT and PCL. The membranes display physico-chemical, morphological, mechanical and biodegradation properties that could satisfy and fulfil specific requirements in skin tissue engineering. CHT membrane exhibits an optimal biodegradation rate for acute wounds; CHT-PCL for the chronic ones. On the other hand, PCL membrane in spite of its very slow biodegradation rate exhibits mechanical properties similar to in vivo dermis, a lower hydrophilic character, and a surface roughness, all properties that make it able to sustain cell adhesion and proliferation for in vitro skin models. Both CHT–PCL and PCL membranes guided epidermal and dermal differentiation of SSCs as pointed out by the expression of cytokeratins and the deposition of the ECM protein fibronectin, respectively. In the dermal-epidermal membrane systems, a more suitable microenvironment for the SSCs differentiation was promoted by the interactions and the mutual interplay with keratinocytes. Being skin tissue-biased stem cells committed to their specific final dermal and/or epidermal cell differentiation, SSCs are more suitable for skin tissue engineering than other adult MSCs with different origin. For this reason, they represent a useful autologous cell source for engineering skin substitutes for both in vivo and in vitro applications.

  17. Hesperetin induces melanin production in adult human epidermal melanocytes.

    Science.gov (United States)

    Usach, Iris; Taléns-Visconti, Raquel; Magraner-Pardo, Lorena; Peris, José-Esteban

    2015-06-01

    One of the major sources of flavonoids for humans are citrus fruits, hesperidin being the predominant flavonoid. Hesperetin (HSP), the aglycon of hesperidin, has been reported to provide health benefits such as antioxidant, anti-inflammatory and anticarcinogenic effects. However, the effect of HSP on skin pigmentation is not clear. Some authors have found that HSP induces melanogenesis in murine B16-F10 melanoma cells, which, if extrapolated to in vivo conditions, might protect skin against photodamage. Since the effect of HSP on normal melanocytes could be different to that observed on melanoma cells, the described effect of HSP on murine melanoma cells has been compared to the effect obtained using normal human melanocytes. HSP concentrations of 25 and 50 µM induced melanin synthesis and tyrosinase activity in human melanocytes in a concentration-dependent manner. Compared to control melanocytes, 25 µM HSP increased melanin production and tyrosinase activity 1.4-fold (p melanin production in human melanocyte cultures could be reproduced on human skin. Copyright © 2015 Elsevier Ltd. All rights reserved.

  18. Use of etanercept to treat toxic epidermal necrolysis in a human immunodeficiency virus-positive patient

    Directory of Open Access Journals (Sweden)

    Yung-Yi Lee

    2013-06-01

    Full Text Available Toxic epidermal necrolysis (TEN is an uncommon and severe cutaneous adverse drug reaction that causes disseminated necrosis of epidermal cells and mucocutaneous detachment. Here, we report the case of a 32-year-old man with human immunodeficiency virus infection who presented with generalized violaceous macules and blister formation 4 days after the administration of mefenamic acid and amoxicillin for a dental procedure. Additional symptoms included oral ulcers and conjunctivitis. Results of skin biopsy were compatible with Stevens–Johnson syndrome (SJS. SJS progressed to TEN within 2 days. Etanercept treatment showed a dramatic improvement in the symptoms of mucocutaneous lesions. To our knowledge, this is the first report on the treatment of TEN using etanercept in a human immunodeficiency virus-positive patient.

  19. Heavy metal-induced cytotoxicity to cultured human epidermal keratinocytes and effects of antioxidants.

    Science.gov (United States)

    Kappus, H; Reinhold, C

    1994-04-01

    Human epidermal keratinocytes which have been cultured were treated with the heavy metal ions of cadmium, mercury, copper and zinc. Cytotoxicity was measured either by protein estimation or by using the neutral red assay. Antioxidants were added in order to find out whether heavy metal-induced cytotoxicity is related to oxidative stress. All metals used showed considerable cytotoxic effects within 24 h in moderate concentrations. None of the antioxidants vitamin E (alpha-tocopherol), pyrogallol, propyl gallate, BHT or ebselen showed any protective or preventive effect. This indicates that oxidative stress may not be involved in the cytotoxicity induced by heavy metals in human epidermal keratinocytes. The cells used are, however, a valuable tool to study mechanisms of cytotoxicity.

  20. Frozen allogeneic human epidermal cultured sheets for the cure of complicated leg ulcers.

    Science.gov (United States)

    Bolívar-Flores, Y J; Kuri-Harcuch, W

    1999-08-01

    Skin ulcers due to venous stasis or diabetes are common among the elderly and are difficult to treat. Repeated applications of cell-based products have been reported to result in cure or improvement of leg ulcers of small size in a fraction of patients. To examine the effects of frozen human allogeneic epidermal cultures for the treatment of acute and chronic ulcers. We treated a series of 10 consecutive patients with leg ulcers of different etiology and duration with frozen human allogeneic epidermal cultures stored frozen and thawed for 5-10 minutes at room temperature before application. Three patients had ulcers with exposed Achilles or extensor tendon. The ulcers treated were as large as 160 cm2 in area and of up to 20-years' duration. After preliminary preparation of the wounds by debridement to remove necrotic tissue and application of silver sulfadiazine to control infection, thawed cultures were applied biweekly from 2 to 15 times depending on the size and complexity of the ulcer. All ulcers healed, including those with tendon exposure. After the first few applications, granulation tissue formed in the ulcer bed and on exposed tendons, and epidermal healing took place through proliferation and migration of cells from the margins of the wound. The time required for complete healing ranged from 1 to 31 weeks after the first application. The use of frozen human allogeneic epidermal cultures is a safe and effective treatment for venous or diabetic ulcers, even those with tendon exposure. It seems possible that any leg ulcer will be amenable to successful treatment by this method.

  1. Autodegradation of 125I-labeled human epidermal cell surface proteins

    International Nuclear Information System (INIS)

    Hashimoto, K.; Singer, K.H.; Lazarus, G.S.

    1982-01-01

    Triton X-100 extracts of cultured human epidermal cells exhibited proteolytic activity as measured by the hydrolysis of [ 3 H]-casein at neutral pH. The majority of endogenous proteolytic activity was inhibited by parahydroxy mercuribenzoate and by mersalyl acid, indicating the enzyme(s) was a thiol class proteinase(s). Crude Triton X-100 extracts were prepared from epidermal cells following labeling of proteins with 125 I. Autodegradation of labeled proteins at 37 degrees C was detected as early as 1 hr and reached a plateau level by 4 hr. Degradation was inhibited by thiol class proteinase inhibitors. Among the detergent-solubilized radiolabeled proteins a polypeptide chain of Mr 155,000 was particularly sensitive to degradation by endogenous thiol proteinase(s)

  2. The peanut lectin-binding glycoproteins of human epidermal keratinocytes

    International Nuclear Information System (INIS)

    Morrison, A.I.; Keeble, S.; Watt, F.M.

    1988-01-01

    The peanut lectin (PNA) is known to bind more strongly to keratinocytes that are undergoing terminal differentiation than to proliferating keratinocytes. In order to investigate the significance of this change in cell-surface carbohydrate authors have identified the PNA-binding glycoproteins of cultured human keratinocytes and antibodies against them. Two heavily glycosylated bands of 110 and 250 kDa were resolved by PAGE of [ 14 C]galactose- or [ 14 C]mannose- and [ 14 C]glucosamine-labeled cell extracts eluted with galactose from PNA affinity columns. The higher molecular weight band was also detected on PNA blots of unlabeled cell extracts transferred to nitrocellulose. Both bands were sensitive to pronase digestion, but only the 250-kDa band was digested with trypsin. A rabbit antiserum that we prepared (anti-PNA-gp) immunoprecipitated both bands from cell extracts. In contrast to PNA, anti-PNA-gp bound equally to proliferating and terminally differentiating cells, indicating that some epitope(s) of the PNA-binding glycoproteins is present on the cell surface prior to terminal differentiation. When keratinocytes grown as a monolayer in low-calcium medium were switched to medium containing 2 mM calcium ions in order to induce desmosome formation and stratification, there was a dramatic redistribution of the PNA-binding glycoproteins, which became concentrated at the boundaries between cells. This may suggest a role for the glycoproteins in cell-cell interactions during stratification

  3. Dermal Contributions to Human Interfollicular Epidermal Architecture and Self-Renewal

    Directory of Open Access Journals (Sweden)

    Kynan T. Lawlor

    2015-11-01

    Full Text Available The human interfollicular epidermis is renewed throughout life by populations of proliferating basal keratinocytes. Though interfollicular keratinocyte stem cells have been identified, it is not known how self-renewal in this compartment is spatially organized. At the epidermal-dermal junction, keratinocytes sit atop a heterogeneous mix of dermal cells that may regulate keratinocyte self-renewal by influencing local tissue architecture and signalling microenvironments. Focusing on the rete ridges and complementary dermal papillae in human skin, we review the identity and organisation of abundant dermal cells types and present evidence for interactions between the dermal microenvironment and the interfollicular keratinocytes.

  4. Urea uptake enhances barrier function and antimicrobial defense in humans by regulating epidermal gene expression

    Science.gov (United States)

    Grether-Beck, Susanne; Felsner, Ingo; Brenden, Heidi; Kohne, Zippora; Majora, Marc; Marini, Alessandra; Jaenicke, Thomas; Rodriguez-Martin, Marina; Trullas, Carles; Hupe, Melanie; Elias, Peter M.; Krutmann, Jean

    2012-01-01

    Urea is an endogenous metabolite, known to enhance stratum corneum hydration. Yet, topical urea anecdotally also improves permeability barrier function, and it appears to exhibit antimicrobial activity. Hence, we hypothesized that urea is not merely a passive metabolite, but a small-molecule regulator of epidermal structure and function. In 21 human volunteers, topical urea improved barrier function in parallel with enhanced antimicrobial peptide (LL-37 and β-defensin-2) expression. Urea both stimulates expression of, and is transported into keratinocytes by two urea transporters, UT-A1 and UT-A2, and by aquaporin 3, 7 and 9. Inhibitors of these urea transporters block the downstream biological effects of urea, which include increased mRNA and protein levels for: (i) transglutaminase-1, involucrin, loricrin and filaggrin; (ii) epidermal lipid synthetic enzymes, and (iii) cathelicidin/LL-37 and β-defensin-2. Finally, we explored the potential clinical utility of urea, showing that topical urea applications normalized both barrier function and antimicrobial peptide expression in a murine model of atopic dermatitis (AD). Together, these results show that urea is a small-molecule regulator of epidermal permeability barrier function and antimicrobial peptide expression after transporter uptake, followed by gene regulatory activity in normal epidermis, with potential therapeutic applications in diseased skin. PMID:22418868

  5. Low calcium culture condition induces mesenchymal cell-like phenotype in normal human epidermal keratinocytes

    International Nuclear Information System (INIS)

    Takagi, Ryo; Yamato, Masayuki; Murakami, Daisuke; Sugiyama, Hiroaki; Okano, Teruo

    2011-01-01

    Highlights: → Normal human epidermal keratinocytes serially cultured under low calcium concentration were cytokeratin and vimentin double positive cells. → The human keratinocytes expressed some epithelial stem/progenitor cell makers, mesenchymal cell markers, and markers of epithelial-mesenchymal transition. → Mesenchymal cell-like phenotype in the keratinocytes was suppressed under high-calcium condition. -- Abstract: Epithelial-mesenchymal transition (EMT) is an important cellular phenomenon in organ developments, cancer invasions, and wound healing, and many types of transformed cell lines are used for investigating for molecular mechanisms of EMT. However, there are few reports for EMT in normal human epithelial cells, which are non-transformed or non-immortalized cells, in vitro. Therefore, normal human epidermal keratinocytes (NHEK) serially cultured in low-calcium concentration medium (LCM) were used for investigating relations between differentiation and proliferation and mesenchymal-like phenotype in the present study, since long-term cultivation of NHEK is achieved in LCM. Interestingly, NHEK serially cultured in LCM consisted essentially of cytokeratin-vimentin double positive cells (98%), although the NHEK exhibited differentiation under high-calcium culture condition with 3T3 feeder layer. The vimentin expression was suppressed under high-calcium condition. These results may indicate the importance of mesenchymal-like phenotype for serially cultivation of NHEK in vitro.

  6. Immunohistochemical localization of epidermal growth factor in the second-trimester human fetus

    DEFF Research Database (Denmark)

    Poulsen, Steen Seier; Kryger-Baggesen, N; Nexø, Ebba

    1996-01-01

    Epidermal growth factor (EGF) is considered to be important in mammalian neonatal growth and development. In order to clarify its developmental role, we have investigated, by immunohistochemistry, the localization of EGF and the time of its first appearance in various organs from a series of 25...... midtrimester human fetuses with a gestational age ranging from 13 to 22 weeks. The first detectable EGF immunoreactivity occurred in week 15-16 fetuses in the placenta, the skin, the distal tubules of the kidney, the surface epithelium of the stomach, and the tips of the small intestinal villi, as well...

  7. Improvement of hydration and epidermal barrier function in human skin by a novel compound isosorbide dicaprylate.

    Science.gov (United States)

    Chaudhuri, R K; Bojanowski, K

    2017-10-01

    The study involved the synthesis of a novel derivative of caprylic acid - isosorbide dicaprylate (IDC) - and the evaluation of its potential in improving water homoeostasis and epidermal barrier function in human skin. The effect of IDC on gene expression was assayed in skin organotypic cultures by DNA microarrays. The results were then confirmed for a few key genes by quantitative PCR, immuno- and cytochemistry. Final validation of skin hydration properties was obtained by four separate clinical studies. Level of hydration was measured by corneometer either by using 2% IDC lotion alone vs placebo or in combination with 2% glycerol lotion vs 2% glycerol only. A direct comparison in skin hydration between 2% IDC and 2% glycerol lotions was also carried out. The epidermal barrier function improvement was assessed by determining changes in transepidermal water loss (TEWL) on the arms before and after treatment with 2% IDC lotion versus placebo. IDC was found to upregulate the expression of AQP3, CD44 and proteins involved in keratinocyte differentiation as well as the formation and function of stratum corneum. A direct comparison between 2% IDC versus 2% glycerol lotions revealed a three-fold advantage of IDC in providing skin hydration. Severely dry skin treated with 2% IDC in combination with 2% glycerol showed 133% improvement, whereas 35% improvement was observed with moderately dry human skin. Topical isosorbide dicaprylate favourably modulates genes involved in the maintenance of skin structure and function, resulting in superior clinical outcomes. By improving skin hydration and epidermal permeability barrier, it offers therapeutic applications in skin ageing. © 2017 Society of Cosmetic Scientists and the Société Française de Cosmétologie.

  8. Leptin regulates the pro-inflammatory response in human epidermal keratinocytes.

    Science.gov (United States)

    Lee, Moonyoung; Lee, Eunyoung; Jin, Sun Hee; Ahn, Sungjin; Kim, Sae On; Kim, Jungmin; Choi, Dalwoong; Lim, Kyung-Min; Lee, Seung-Taek; Noh, Minsoo

    2018-05-01

    The role of leptin in cutaneous wound healing process has been suggested in genetically obese mouse studies. However, the molecular and cellular effects of leptin on human epidermal keratinocytes are still unclear. In this study, the whole-genome-scale microarray analysis was performed to elucidate the effect of leptin on epidermal keratinocyte functions. In the leptin-treated normal human keratinocytes (NHKs), we identified the 151 upregulated and 53 downregulated differentially expressed genes (DEGs). The gene ontology (GO) enrichment analysis with the leptin-induced DEGs suggests that leptin regulates NHKs to promote pro-inflammatory responses, extracellular matrix organization, and angiogenesis. Among the DEGs, the protein expression of IL-8, MMP-1, fibronectin, and S100A7, which play roles in which is important in the regulation of cutaneous inflammation, was confirmed in the leptin-treated NHKs. The upregulation of the leptin-induced proteins is mainly regulated by the STAT3 signaling pathway in NHKs. Among the downregulated DEGs, the protein expression of nucleosome assembly-associated centromere protein A (CENPA) and CENPM was confirmed in the leptin-treated NHKs. However, the expression of CENPA and CENPM was not coupled with those of other chromosome passenger complex like Aurora A kinase, INCENP, and survivin. In cell growth kinetics analysis, leptin had no significant effect on the cell growth curves of NHKs in the normal growth factor-enriched condition. Therefore, leptin-dependent downregulation of CENPA and CENPM in NHKs may not be directly associated with mitotic regulation during inflammation.

  9. Epidermal growth factor increases LRF/Pokemon expression in human prostate cancer cells.

    Science.gov (United States)

    Aggarwal, Himanshu; Aggarwal, Anshu; Agrawal, Devendra K

    2011-10-01

    Leukemia/lymphoma related factor/POK erythroid myeloid ontogenic factor (LRF/Pokemon) is a member of the POK family of proteins that promotes oncogenesis in several forms of cancer. Recently, we found higher LRF expression in human breast and prostate carcinomas compared to the corresponding normal tissues. The aim of this study was to examine the regulation of LRF expression in human prostate cells. Epidermal growth factor (EGF) and its receptors mediate several tumorigenic cascades that regulate cell differentiation, proliferation, migration and survival of prostate cancer cells. There was significantly higher level of LRF expression in the nucleus of LNCaP and PC-3 cells than RWPE-1 cells. A significant increase in LRF expression was observed with increasing doses of EGF in more aggressive and androgen-sensitive prostate cancer cells suggesting that EGF signaling pathway is critical in upregulating the expression of LRF/Pokemon to promote oncogenesis. Copyright © 2011 Elsevier Inc. All rights reserved.

  10. Expression of the epidermal growth factor system in human endometrium during the menstrual cycle

    DEFF Research Database (Denmark)

    Ejskjaer, Kirsten; Sørensen, B S; Poulsen, Steen Seier

    2005-01-01

    The epidermal growth factor (EGF) system is ubiquitous in humans and plays fundamental roles in embryogenesis, development, proliferation and differentiation. As the endometrium of fertile women is characterized by proliferation and differentiation, we hypothesize a role for the EGF system....... Fourteen premenopausal women had endometrial samples removed on day 6 +/- 1 and day 6 +/- 1 and 12 +/- 1 after ovulation during one menstrual cycle. RNA was extracted and analysed by real-time PCR, and immunohistochemistry was performed to localize the components of the EGF system. Human EGF Receptor 1...... (HER1) showed highest expression during the proliferative phase, HER2 and HER4 during the early and HER3 during the late secretory phase. Amphiregulin (AR) and transforming growth factor alpha (TGFalpha) expression is highest in proliferative phase. Heparin binding (HB)-EGF and betacellulin (BCL) show...

  11. In vivo UVB irradiation induces clustering of Fas (CD95) on human epidermal cells

    DEFF Research Database (Denmark)

    Bang, Bo; Gniadecki, Robert; Larsen, Jørgen K

    2003-01-01

    In vitro studies with human cell lines have demonstrated that the death receptor Fas plays a role in ultraviolet (UV)-induced apoptosis. The purpose of the present study was to investigate the relation between Fas expression and apoptosis as well as clustering of Fas in human epidermis after...... a single dose of UVB irradiation. Normal healthy individuals were irradiated with three minimal erythema doses (MED) of UVB on forearm or buttock skin. Suction blisters from unirradiated and irradiated skin were raised, and Fas, FasL, and apoptosis of epidermal cells quantified by flow cytometry....... Clustering of Fas was from skin biopsied. Soluble FasL in suction blister fluid was quantified by ELISA. Flow cytometric analysis demonstrated increased expression intensity of Fas after irradiation, with 1.6-,2.2- and 2.7-fold increased median expression at 24, 48 and 72 h after irradiation, respectively (n...

  12. Insulin binding properties of normal and transformed human epidermal cultured keratinocytes

    International Nuclear Information System (INIS)

    Verrando, P.; Ortonne, J.P.

    1985-01-01

    Insulin binding to its receptors was studied in cultured normal and transformed (A431 line) human epidermal keratinocytes. The specific binding was a temperature-dependent, saturable process. Normal keratinocytes possess a mean value of about 80,000 receptors per cell. Fifteen hours exposure of the cells to insulin lowered their receptor number (about 65% loss in available sites); these reappeared when the hormone was removed from the culture medium. In the A431 epidermoid carcinoma cell line, there is a net decrease in insulin binding (84% of the initial bound/free hormone ratio in comparison with normal cells) essentially related to a loss in receptor affinity for insulin. Thus, cultured human keratinocytes which express insulin receptors may be a useful tool in understanding skin pathology related to insulin disorders

  13. Effects of epidermal growth factor, transferrin, and insulin on lipofection efficiency in human lung carcinoma cells.

    Science.gov (United States)

    Yanagihara, K; Cheng, H; Cheng, P W

    2000-01-01

    Poor transfection efficiency is the major drawback of lipofection. We showed previously that addition of transferrin (TF) to Lipofectin enhanced the expression of a reporter gene in HeLa cells by 120-fold and achieved close to 100% transfection efficiency. The purpose of this study was to determine whether TF and other ligands could improve the efficiency of lipofection in lung carcinoma cells. Confluent A549, Calu3, and H292 cells were transfected for 18 hours with a plasmid DNA (pCMVlacZ) using Lipofectin plus TF, insulin, or epidermal growth factor as the vector. The transfected cells were assessed for transfection efficiency by beta-galactosidase activity (light units/microg protein) and the percentage of blue cells following 5-bromo-4-chloro-3-indolyl beta-D-galactopyranoside staining. Lipofectin supplemented with epidermal growth factor yielded the largest enhancement of lipofection efficiency (lipofection efficiency in A549 and Calu3 cells but not in H292 cells, whereas TF showed significant lipofection efficiency-enhancing effect in Calu3 and H292 cells but not in A549 cells. The transfection efficiency correlated well with the amounts of DNA delivered to the nucleus as well as the amounts of the receptor. These results indicate that the gene delivery strategy employing ligand-facilitated lipofection can achieve high transfection efficiency in human lung carcinoma cells. In addition, enhancement of the expression of the receptor may be a possible strategy for increasing the efficiency of gene targeting.

  14. Immunohistochemical detection of cytochrome P450 isoenzymes in cultured human epidermal cells.

    Science.gov (United States)

    Van Pelt, F N; Meierink, Y J; Blaauboer, B J; Weterings, P J

    1990-12-01

    We used specific monoclonal antibodies (MAb) to human cytochrome P450 isoenzymes to determine the presence of these proteins in human epidermal cells. Two MAb (P450-5 and P450-8) recognize major forms of hepatic cytochrome P450 involved in biotransformation of xenobiotics. A third MAb, to cytochrome P450-9, is not fully characterized. The proteins were determined by the indirect immunoperoxidase technique after fixation with methanol and acetone. Biopsy materials for cultured keratinocytes, i.e., foreskin and hair follicles, contained the two major forms of cytochrome P450. In cultured keratinocytes derived from hair follicles the proteins were undetectable, whereas the keratinocytes derived from foreskin continued to express the two major forms of hepatic cytochrome P450. Cultured human fibroblasts and a human keratinocyte cell line (SVK14) showed staining similar to that of the foreskin keratinocytes. Cytochrome P450-9 was detectable only in human hepatocytes. The results indicate that, under the culture conditions applied, cultured human foreskin cells and the cell line SVK14 continue to express specific cytochrome P450 isoenzymes in culture, in contrast to hair follicle keratinocytes.

  15. Recycling of epidermal growth factor in a human pancreatic carcinoma cell line

    International Nuclear Information System (INIS)

    Korc, M.; Magun, B.E.

    1985-01-01

    PANC-1 human pancreatic carcinoma cells readily bound and internalized 125 I-labeled epidermal growth factor (EGF). Bound 125 I-labeled EGF was then partially processed to a number of high molecular weight acidic species. Percoll gradient centrifugation of cell homogenates indicated that the majority of 125 I activity localized to several intracellular vesicular compartments. Both intact EGF and its processed species were subsequently released into the incubation medium. A major portion of the released radioactivity was capable of rebinding to the cell. Only a small amount of bound 125 I-labeled EGF was degraded to low molecular weight products, and this degradation was completely blocked by methylamine. These findings suggest that in PANC-1 cells, bound EGF undergoes only limited processing. Both intact EGF and its major processed species bypass the cellular degradative pathways, are slowly released from the cell, and then rebind to the cell

  16. Human Epidermal Langerhans Cells Maintain Immune Homeostasis in Skin by Activating Skin Resident Regulatory T Cells

    Science.gov (United States)

    Seneschal, Julien; Clark, Rachael A.; Gehad, Ahmed; Baecher-Allan, Clare M.; Kupper, Thomas S.

    2013-01-01

    Recent discoveries indicate that the skin of a normal individual contains 10-20 billion resident memory T cells ( which include various T helper, T cytotoxic, and T regulatory subsets, that are poised to respond to environmental antigens. Using only autologous human tissues, we report that both in vitro and in vivo, resting epidermal Langerhan cells (LC) selectively and specifically induced the activation and proliferation of skin resident regulatory T cells (Treg), a minor subset of skin resident memory T cells. In the presence of foreign pathogen, however, the same LC activated and induced proliferation of effector memory T (Tem) cells and limited Treg cells activation. These underappreciated properties of LC: namely maintenance of tolerance in normal skin, and activation of protective skin resident memory T cells upon infectious challenge, help clarify the role of LC in skin. PMID:22560445

  17. Cultivation of human dermal fibroblasts and epidermal keratinocytes on keratin-coated silica bead substrates.

    Science.gov (United States)

    Tan, Bee Yi; Nguyen, Luong T H; Kim, Hyo-Sop; Kim, Jae-Ho; Ng, Kee Woei

    2017-10-01

    Human hair keratin is promising as a bioactive material platform for various biomedical applications. To explore its versatility further, human hair keratin was coated onto monolayers of silica beads to produce film-like substrates. This combination was hypothesized to provide a synergistic effect in improving the biochemical properties of the resultant composite. Atomic force microscopy analysis showed uniform coatings of keratin on the silica beads with a slight increase in the resulting surface roughness. Keratin-coated silica beads had higher surface energy and relatively lower negative charge than those of bare silica beads. To investigate cell response, human dermal fibroblasts (HDFs), and human epidermal keratinocytes (HEKs) were cultured on the substrates over 4 days. Results showed that keratin coatings significantly enhanced the metabolic activity of HDFs and encouraged cell spreading but did not exert any significant effects on HEKs. HDF expression of collagen I was significantly more intense on the keratin-coated compared to the bare silica substrates. Furthermore, HDF secretion of various cytokines suggested that keratin coatings triggered active cell responses related to wound healing. Collectively, our study demonstrated that human hair keratin-coated silica bead monolayers have the potential to modulate HDF behavior in culture and may be exploited further. © 2017 Wiley Periodicals, Inc. J Biomed Mater Res Part A: 105A: 2789-2798, 2017. © 2017 Wiley Periodicals, Inc.

  18. Topical Human Epidermal Growth Factor in the Treatment of Senile Purpura and the Prevention of Dermatoporosis.

    Science.gov (United States)

    McKnight, Braden; Seidel, Rachel; Moy, Ron

    2015-10-01

    Senile purpura presents itself as a largely unexplored challenge as it has been long thought of as a benign condition without long-term health sequelae. It is becoming increasingly accepted that skin aging not only results in cosmetic disturbances, but as a functional ones. With modern increases in lifespan, skin atrophy associated with solar damage is presenting as a clinically significant inability to mechanically protect patients. This chronic cutaneous insufficiency/fragility syndrome was recently termed dermatoporosis and senile purpura appears to be a visible marker of early stage dysfunction. To examine the effects of topically human epidermal growth factor on the clinical presence of senile purpura and its effect on skin thickness as measured via cutaneous ultrasound. Six subjects applied human epidermal growth factor morning and night for six weeks. Clinical outcomes were evaluated by comparing initial clinical photos to 6-week photos and performing a blinded investigator's global assessment (IGA). Skin thickness was evaluated via cutaneous ultrasound measurement. Ultrasound measurements indicated a mean skin thickening of 195.2 ± 35.7 um (SEM) over 6 weeks. The average number of purpuric lesions decreased from 15 ± 4.6 (SEM) to 2.3 ± 0.7 (SEM) over that same period. Senile purpura presents itself as a cosmetic disturbance posing significant psychological distress and serves as a marker of the severity of skin thinning. In this study, we demonstrate that topical h-EGF diminishes the appearance of senile purpura by thickening skin and may help prevent the development of late stage dermatoporosis.

  19. Limited human epidermal growth factor receptor 2 discordance in metastatic breast cancer patients treated with trastuzumab, a population based study

    NARCIS (Netherlands)

    van Rooijen, J.M.; de Munck, L.; de Graaf, J.C.; Siesling, Sabine; de Vries, Erik G.; Boers, J.E.

    2014-01-01

    Background Accurate assessment of the human epidermal growth factor receptor 2 (HER2) in breast cancer is essential for proper treatment decisions. HER2 positivity confirmation rates in breast cancer trials by central testing pathology laboratories were reported to be approximately 85%. The aim of

  20. Tumor necrosis factor related apoptosis inducing ligand triggers apoptosis in dividing but not in differentiating human epidermal keratinocytes

    NARCIS (Netherlands)

    Jansen, Bastiaan J. H.; van Ruissen, Fred; Cerneus, Stefanie; Cloin, Wendy; Bergers, Mieke; van Erp, Piet E. J.; Schalkwijk, Joost

    2003-01-01

    Using serial analysis of gene expression we have previously identified the expression of several pro-apoptotic and anti-apoptotic genes in cultured human primary epidermal keratinocytes, including tumor necrosis factor related apoptosis inducing ligand (TRAIL). TRAIL is a potent inducer of apoptosis

  1. Limited human epidermal growth factor receptor 2 discordance in metastatic breast cancer patients treated with trastuzumab, a population based study

    NARCIS (Netherlands)

    van Rooijen, J. M.; de Munck, L.; de Graaf, J. C.; Siesling, S.; de Vries, E. G.; Boers, J. E.

    Background: Accurate assessment of the human epidermal growth factor receptor 2 (HER2) in breast cancer is essential for proper treatment decisions. HER2 positivity confirmation rates in breast cancer trials by central testing pathology laboratories were reported to be approximately 85%. The aim of

  2. Bioengineering a human plasma-based epidermal substitute with efficient grafting capacity and high content in clonogenic cells.

    Science.gov (United States)

    Alexaline, Maia M; Trouillas, Marina; Nivet, Muriel; Bourreau, Emilie; Leclerc, Thomas; Duhamel, Patrick; Martin, Michele T; Doucet, Christelle; Fortunel, Nicolas O; Lataillade, Jean-Jacques

    2015-06-01

    Cultured epithelial autografts (CEAs) produced from a small, healthy skin biopsy represent a lifesaving surgical technique in cases of full-thickness skin burn covering >50% of total body surface area. CEAs also present numerous drawbacks, among them the use of animal proteins and cells, the high fragility of keratinocyte sheets, and the immaturity of the dermal-epidermal junction, leading to heavy cosmetic and functional sequelae. To overcome these weaknesses, we developed a human plasma-based epidermal substitute (hPBES) for epidermal coverage in cases of massive burn, as an alternative to traditional CEA, and set up critical quality controls for preclinical and clinical studies. In this study, phenotypical analyses in conjunction with functional assays (clonal analysis, long-term culture, or in vivo graft) showed that our new substitute fulfills the biological requirements for epidermal regeneration. hPBES keratinocytes showed high potential for cell proliferation and subsequent differentiation similar to healthy skin compared with a well-known reference material, as ascertained by a combination of quality controls. This work highlights the importance of integrating relevant multiparameter quality controls into the bioengineering of new skin substitutes before they reach clinical development. This work involves the development of a new bioengineered epidermal substitute with pertinent functional quality controls. The novelty of this work is based on this quality approach. ©AlphaMed Press.

  3. MLH1-rheMac hereditary nonpolyposis colorectal cancer syndrome in rhesus macaques.

    Science.gov (United States)

    Brammer, David W; Gillespie, Patrick J; Tian, Mei; Young, Daniel; Raveendran, Muthuswamy; Williams, Lawrence E; Gagea, Mihai; Benavides, Fernando J; Perez, Carlos J; Broaddus, Russell R; Bernacky, Bruce J; Barnhart, Kirstin F; Alauddin, Mian M; Bhutani, Manoop S; Gibbs, Richard A; Sidman, Richard L; Pasqualini, Renata; Arap, Wadih; Rogers, Jeffrey; Abee, Christian R; Gelovani, Juri G

    2018-03-13

    Over the past two decades, 33 cases of colonic adenocarcinomas have been diagnosed in rhesus macaques ( Macaca mulatta ) at the nonhuman primate colony of the Keeling Center for Comparative Medicine and Research at The University of Texas MD Anderson Cancer Center. The distinctive feature in these cases, based on PET/computed tomography (CT) imaging, was the presence of two or three tumor lesions in different locations, including proximal to the ileocecal juncture, proximal to the hepatic flexure, and/or in the sigmoid colon. These colon carcinoma lesions selectively accumulated [ 18 F]fluorodeoxyglucose ([ 18 F]FDG) and [ 18 F]fluoroacetate ([ 18 F]FACE) at high levels, reflecting elevated carbohydrate and fatty acid metabolism in these tumors. In contrast, the accumulation of [ 18 F]fluorothymidine ([ 18 F]FLT) was less significant, reflecting slow proliferative activity in these tumors. The diagnoses of colon carcinomas were confirmed by endoscopy. The expression of MLH1, MSH2, and MSH6 proteins and the degree of microsatellite instability (MSI) was assessed in colon carcinomas. The loss of MLH1 protein expression was observed in all tumors and was associated with a deletion mutation in the MLH1 promoter region and/or multiple single-nucleotide polymorphism (SNP) mutations in the MLH1 gene. All tumors exhibited various degrees of MSI. The pedigree analysis of this rhesus macaque population revealed several clusters of affected animals related to each other over several generations, suggesting an autosomal dominant transmission of susceptibility for colon cancer. The newly discovered hereditary nonpolyposis colorectal cancer syndrome in rhesus macaques, termed MLH1 -rheMac, may serve as a model for development of novel approaches to diagnosis and therapy of Lynch syndrome in humans. Copyright © 2018 the Author(s). Published by PNAS.

  4. Upregulation of FOXM1 induces genomic instability in human epidermal keratinocytes

    Directory of Open Access Journals (Sweden)

    Philpott Michael P

    2010-02-01

    Full Text Available Abstract Background The human cell cycle transcription factor FOXM1 is known to play a key role in regulating timely mitotic progression and accurate chromosomal segregation during cell division. Deregulation of FOXM1 has been linked to a majority of human cancers. We previously showed that FOXM1 was upregulated in basal cell carcinoma and recently reported that upregulation of FOXM1 precedes malignancy in a number of solid human cancer types including oral, oesophagus, lung, breast, kidney, bladder and uterus. This indicates that upregulation of FOXM1 may be an early molecular signal required for aberrant cell cycle and cancer initiation. Results The present study investigated the putative early mechanism of UVB and FOXM1 in skin cancer initiation. We have demonstrated that UVB dose-dependently increased FOXM1 protein levels through protein stabilisation and accumulation rather than de novo mRNA expression in human epidermal keratinocytes. FOXM1 upregulation in primary human keratinocytes triggered pro-apoptotic/DNA-damage checkpoint response genes such as p21, p38 MAPK, p53 and PARP, however, without causing significant cell cycle arrest or cell death. Using a high-resolution Affymetrix genome-wide single nucleotide polymorphism (SNP mapping technique, we provided the evidence that FOXM1 upregulation in epidermal keratinocytes is sufficient to induce genomic instability, in the form of loss of heterozygosity (LOH and copy number variations (CNV. FOXM1-induced genomic instability was significantly enhanced and accumulated with increasing cell passage and this instability was increased even further upon exposure to UVB resulting in whole chromosomal gain (7p21.3-7q36.3 and segmental LOH (6q25.1-6q25.3. Conclusion We hypothesise that prolonged and repeated UVB exposure selects for skin cells bearing stable FOXM1 protein causes aberrant cell cycle checkpoint thereby allowing ectopic cell cycle entry and subsequent genomic instability. The aberrant

  5. Human eccrine sweat gland cells turn into melanin-uptaking keratinocytes in dermo-epidermal skin substitutes.

    Science.gov (United States)

    Böttcher-Haberzeth, Sophie; Biedermann, Thomas; Pontiggia, Luca; Braziulis, Erik; Schiestl, Clemens; Hendriks, Bart; Eichhoff, Ossia M; Widmer, Daniel S; Meuli-Simmen, Claudia; Meuli, Martin; Reichmann, Ernst

    2013-02-01

    Recently, Biedermann et al. (2010) have demonstrated that human eccrine sweat gland cells can develop a multilayered epidermis. The question still remains whether these cells can fulfill exclusive and very specific functional properties of epidermal keratinocytes, such as the incorporation of melanin, a feature absent in sweat gland cells. We added human melanocytes to eccrine sweat gland cells to let them develop into an epidermal analog in vivo. The interaction between melanocytes and sweat gland-derived keratinocytes was investigated. The following results were gained: (1) macroscopically, a pigmentation of the substitutes was seen 2-3 weeks after transplantation; (2) we confirmed the development of a multilayered, stratified epidermis with melanocytes distributed evenly throughout the basal layer; (3) melanocytic dendrites projected to suprabasal layers; and (4) melanin was observed to be integrated into former eccrine sweat gland cells. These skin substitutes were similar or equal to skin substitutes cultured from human epidermal keratinocytes. The only differences observed were a delay in pigmentation and less melanin uptake. These data suggest that eccrine sweat gland cells can form a functional epidermal melanin unit, thereby providing striking evidence that they can assume one of the most characteristic keratinocyte properties.

  6. Pharmacologic induction of epidermal melanin and protection against sunburn in a humanized mouse model.

    Science.gov (United States)

    Amaro-Ortiz, Alexandra; Vanover, Jillian C; Scott, Timothy L; D'Orazio, John A

    2013-09-07

    Fairness of skin, UV sensitivity and skin cancer risk all correlate with the physiologic function of the melanocortin 1 receptor, a Gs-coupled signaling protein found on the surface of melanocytes. Mc1r stimulates adenylyl cyclase and cAMP production which, in turn, up-regulates melanocytic production of melanin in the skin. In order to study the mechanisms by which Mc1r signaling protects the skin against UV injury, this study relies on a mouse model with "humanized skin" based on epidermal expression of stem cell factor (Scf). K14-Scf transgenic mice retain melanocytes in the epidermis and therefore have the ability to deposit melanin in the epidermis. In this animal model, wild type Mc1r status results in robust deposition of black eumelanin pigment and a UV-protected phenotype. In contrast, K14-Scf animals with defective Mc1r signaling ability exhibit a red/blonde pigmentation, very little eumelanin in the skin and a UV-sensitive phenotype. Reasoning that eumelanin deposition might be enhanced by topical agents that mimic Mc1r signaling, we found that direct application of forskolin extract to the skin of Mc1r-defective fair-skinned mice resulted in robust eumelanin induction and UV protection (1). Here we describe the method for preparing and applying a forskolin-containing natural root extract to K14-Scf fair-skinned mice and report a method for measuring UV sensitivity by determining minimal erythematous dose (MED). Using this animal model, it is possible to study how epidermal cAMP induction and melanization of the skin affect physiologic responses to UV exposure.

  7. Protective Effect of Liposome-Encapsulated Glutathione in a Human Epidermal Model Exposed to a Mustard Gas Analog

    Directory of Open Access Journals (Sweden)

    Victor Paromov

    2011-01-01

    Full Text Available Sulfur mustard or mustard gas (HD and its monofunctional analog, 2-chloroethyl ethyl sulfide (CEES, or “half-mustard gas,” are alkylating agents that induce DNA damage, oxidative stress, and inflammation. HD/CEES are rapidly absorbed in the skin causing extensive injury. We hypothesize that antioxidant liposomes that deliver both water-soluble and lipid-soluble antioxidants protect skin cells from immediate CEES-induced damage via attenuating oxidative stress. Liposomes containing water-soluble antioxidants and/or lipid-soluble antioxidants were evaluated using in vitro model systems. Initially, we found that liposomes containing encapsulated glutathione (GSH-liposomes increased cell viability and attenuated production of reactive oxygen species (ROS in HaCaT cells exposed to CEES. Next, GSH-liposomes were tested in a human epidermal model, EpiDerm. In the EpiDerm, GSH-liposomes administered simultaneously or 1 hour after CEES exposure (2.5 mM increased cell viability, inhibited CEES-induced loss of ATP and attenuated changes in cellular morphology, but did not reduce caspase-3 activity. These findings paralleled the previously described in vivo protective effect of antioxidant liposomes in the rat lung and established the effectiveness of GSH-liposomes in a human epidermal model. This study provides a rationale for use of antioxidant liposomes against HD toxicity in the skin considering further verification in animal models exposed to HD.

  8. Long-wave ultraviolet light induces phospholipase activation in cultured human epidermal keratinocytes

    International Nuclear Information System (INIS)

    Hanson, D.; DeLeo, V.

    1990-01-01

    Long wave ultraviolet radiation (UVA) has been shown to play an important role in the overall response of skin to solar radiation, including sunburn, tanning, premature aging, and non-melanoma skin cancer. UVA induction of inflammation in human skin is thought to be mediated by membrane lipid derived products. In order to investigate the mechanism of this response we examined the effect of UVA on phospholipid metabolism of human epidermal keratinocytes in culture. Keratinocytes were grown in serum free low calcium medium. The cells were prelabeled with [3H] arachidonic acid or [3H] choline and irradiated with UVA (Honle 2002-Hg vapor lamp). Identification and quantitation of specific membrane phospholipid-derived components was achieved using high-performance liquid chromatography, paper chromatography, and radioimmunoassay. UVA resulted in a linear dose dependent release of [3H] arachidonic acid into medium between 1 and 20 joule/cm2. This response was inhibited in an oxygen-reduced environment. The radiolabel released was predominantly free arachidonate and cyclooxygenase metabolites. Cyclooxygenase metabolites prostaglandin E2 and prostacyclin derivative, 6-keto-prostaglandin F1a, were stimulated following UVA irradiation, but the lipoxygenase metabolite, leukotriene B was not detected. Maximal release was measured immediately after irradiation and changed little over 24 h post-irradiation. UVA stimulated an increase of [3H] choline metabolites glycerophosphorylcholine and phosphorylcholine in media extracts suggesting UVA activation of phospholipase C and phospholipase A2 or diacylglyceride lipase

  9. Human Epidermal Growth Factor Receptor 2 Overexpression in Micropapillary and Other Variants of Urothelial Carcinoma.

    Science.gov (United States)

    Behzatoğlu, Kemal; Yörükoğlu, Kutsal; Demir, Hale; Bal, Nebil

    2016-06-21

    Human epidermal growth factor receptor 2 (HER2) protein overexpression or gene amplification has been shown in urothelial bladder cancer. This could be helpful when using targeted anti-HER2 therapy on these tumors. To evaluate HER2 immunohistochemical expression in conventional urothelial carcinoma (UC), in situ UC, and UC variants primarily in micropapillary urothelial carcinoma (MPUC). The study evaluated 60 MPUC cases; 25 invasive, 20 low-grade noninvasive, and 10 high-grade noninvasive UC cases; 8 in situ UC cases; and 69 UC variant cases. The immunohistochemistry staining was scored according to recommendations of the American Society of Clinical Oncology/College of American Pathologists 2013 HER2 test guideline established for breast cancer and only 3+ staining was considered HER2 overexpression. HER2 overexpression was determined by 3+ staining. 34 of 60 MPUC cases (56%) showed HER2 overexpression (3+ staining). We observed 3+ staining HER2 overexpression in nine of 25 conventional invasive UC cases (36%), four of eight in situ UC cases (50%), and three of six lipid cell variant cases (50%). 3+ staining HER2 overexpression was not seen in eight glandular, six small cell, and five sarcomatoid variant cases. HER2 overexpression was negative in the 20 low-grade noninvasive UC cases but positive in two of the 10 high-grade noninvasive UC cases (20%). We observed HER2 overexpression most commonly in MPUC cases. We also found HER2 overexpression in conventional invasive and in situ UC cases. Pure in situ UC and conventional invasive UC, especially MPUC, could be candidate tumors for treatment with anti-HER2 antibody (trastuzumab therapy). Targeted therapy has a limited place in treatment of bladder cancer. In this study, human epidermal growth factor receptor 2 (HER2) overexpression in bladder carcinomas was evaluated in a large number of cases. Anti-HER2 therapy could be used in bladder cancers, as in breast and gastric cancers. Copyright © 2016 European

  10. Chemical allergens stimulate human epidermal keratinocytes to produce lymphangiogenic vascular endothelial growth factor.

    Science.gov (United States)

    Bae, Ok-Nam; Ahn, Seyeon; Jin, Sun Hee; Hong, Soo Hyun; Lee, Jinyoung; Kim, Eun-Sun; Jeong, Tae Cheon; Chun, Young-Jin; Lee, Ai-Young; Noh, Minsoo

    2015-03-01

    Allergic contact dermatitis (ACD) is a cell-mediated immune response that involves skin sensitization in response to contact with various allergens. Angiogenesis and lymphangiogenesis both play roles in the allergic sensitization process. Epidermal keratinocytes can produce vascular endothelial growth factor (VEGF) in response to UV irradiation and during wound healing. However, the effect of haptenic chemical allergens on the VEGF production of human keratinocytes, which is the primary contact site of toxic allergens, has not been thoroughly researched. We systematically investigated whether immune-regulatory cytokines and chemical allergens would lead to the production of VEGF in normal human keratinocytes (NHKs) in culture. VEGF production significantly increased when NHKs were treated with IFNγ, IL-1α, IL-4, IL-6, IL-17A, IL-22 or TNFα. Among the human sensitizers listed in the OECD Test Guideline (TG) 429, we found that CMI/MI, DNCB, 4-phenylenediamine, cobalt chloride, 2-mercaptobenzothiazole, citral, HCA, cinnamic alcohol, imidazolidinyl urea and nickel chloride all significantly upregulated VEGF production in NHKs. In addition, common human haptenic allergens such as avobenzone, formaldehyde and urushiol, also induced the keratinocyte-derived VEGF production. VEGF upregulation by pro-inflammatory stimuli, IFNγ, DNCB or formaldehyde is preceded by the production of IL-8, an acute inflammatory phase cytokine. Lymphangiogenic VEGF-C gene transcription was significantly increased when NHKs were treated with formaldehyde, DNCB or urushiol, while transcription of VEGF-A and VEGF-B did not change. Therefore, the chemical allergen-induced VEGF upregulation is mainly due to the increase in lymphangiogenic VEGF-C transcription in NHKs. These results suggest that keratinocyte-derived VEGF may regulate the lymphangiogenic process during the skin sensitization process of ACD. Copyright © 2015 Elsevier Inc. All rights reserved.

  11. Human epidermal growth factor receptor2 expression in unresectable gastric cancers: Relationship with CT characteristics

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Jeong Sub [Dept. of Radiology, Jeju National University Hospital, Jeju (Korea, Republic of); Kim, Se Hyung; Im, Seock Ah; Kim, Min A; Han, Joon Koo [Seoul National University Hospital, Seoul (Korea, Republic of)

    2017-09-15

    To retrospectively analyze the qualitative CT features that correlate with human epidermal growth factor receptor 2 (HER2)-expression in pathologically-proven gastric cancers. A total of 181 patients with pathologically-proven unresectable gastric cancers with HER2-expression (HER2-positive [n = 32] and negative [n = 149]) were included. CT features of primary gastric and metastatic tumors were reviewed. The prevalence of each CT finding was compared in both groups. Thereafter, binary logistic regression determined the most significant differential CT features. Clinical outcomes were compared using Kaplan-Meier method. HER2-postive cancers showed lower clinical T stage (21.9% vs. 8.1%; p = 0.015), hyperattenuation on portal phase (62.5% vs. 30.9%; p = 0.003), and was more frequently metastasized to the liver (62.5% vs. 32.2%; p = 0.001), than HER2-negative cancers. On binary regression analysis, hyperattenuation of the tumor (odds ratio [OR], 4.68; p < 0.001) and hepatic metastasis (OR, 4.43; p = 0.001) were significant independent factors that predict HER2-positive cancers. Median survival of HER2-positive cancers (13.7 months) was significantly longer than HER2-negative cancers (9.6 months) (p = 0.035). HER2-positive gastric cancers show less-advanced T stage, hyperattenuation on the portal phase, and frequently metastasize to the liver, as compared to HER2-negative cancers.

  12. Recurrent exposure to nicotine differentiates human bronchial epithelial cells via epidermal growth factor receptor activation

    International Nuclear Information System (INIS)

    Martinez-Garcia, Eva; Irigoyen, Marta; Anso, Elena; Martinez-Irujo, Juan Jose; Rouzaut, Ana

    2008-01-01

    Cigarette smoking is the major preventable cause of lung cancer in developed countries. Nicotine (3-(1-methyl-2-pyrrolidinyl)-pyridine) is one of the major alkaloids present in tobacco. Besides its addictive properties, its effects have been described in panoply of cell types. In fact, recent studies have shown that nicotine behaves as a tumor promoter in transformed epithelial cells. This research focuses on the effects of acute repetitive nicotine exposure on normal human bronchial epithelial cells (NHBE cells). Here we show that treatment of NHBE cells with recurrent doses of nicotine up to 500 μM triggered cell differentiation towards a neuronal-like phenotype: cells emitted filopodia and expressed neuronal markers such as neuronal cell adhesion molecule, neurofilament-M and the transcription factors neuronal N and Pax-3. We also demonstrate that nicotine treatment induced NF-kB translocation to the nucleus, phosphorylation of the epidermal growth factor receptor (EGFR), and accumulation of heparin binding-EGF in the extracellular medium. Moreover, addition of AG1478, an inhibitor of EGFR tyrosine phosphorylation, or cetuximab, a monoclonal antibody that precludes ligand binding to the same receptor, prevented cell differentiation by nicotine. Lastly, we show that differentiated cells increased their adhesion to the extracellular matrix and their protease activity. Given that several lung pathologies are strongly related to tobacco consumption, these results may help to better understand the damaging consequences of nicotine exposure

  13. Phosphoproteomic fingerprinting of epidermal growth factor signaling and anticancer drug action in human tumor cells.

    Science.gov (United States)

    Lim, Yoon-Pin; Diong, Lang-Shi; Qi, Robert; Druker, Brian J; Epstein, Richard J

    2003-12-01

    Many proteins regulating cancer cell growth are tyrosine phosphorylated. Using antiphosphotyrosine affinity chromatography, thiourea protein solubilization, two-dimensional PAGE, and mass spectrometry, we report here the characterization of the epidermal growth factor (EGF)-induced phosphoproteome in A431 human epidermoid carcinoma cells. Using this approach, more than 50 distinct tyrosine phosphoproteins are identifiable within five main clusters-cytoskeletal proteins, signaling enzymes, SH2-containing adaptors, chaperones, and focal adhesion proteins. Comparison of the phosphoproteomes induced in vitro by transforming growth factor-alpha and platelet-derived growth factor demonstrates the pathway- and cell-specific nature of the phosphoproteomes induced. Elimination of both basal and ligand-dependent phosphoproteins by cell exposure to the EGF receptor catalytic inhibitor gefitinib (Iressa, ZD1839) suggests either an autocrine growth loop or the presence of a second inhibited kinase in A431 cells. By identifying distinct patterns of phosphorylation involving novel signaling substrates, and by clarifying the mechanism of action of anticancer drugs, these findings illustrate the potential of immunoaffinity-based phosphoproteomics for guiding the discovery of new drug targets and the rational utilization of pathway-specific chemotherapies.

  14. High Efficient Expression, Purification, and Functional Characterization of Native Human Epidermal Growth Factor in Escherichia coli

    Directory of Open Access Journals (Sweden)

    Yi Ma

    2016-01-01

    Full Text Available Human epidermal growth factor (hEGF is a small, mitotic growth polypeptide that promotes the proliferation of various cells and is widely applied in clinical practices. However, high efficient expression of native hEGF in Escherichia coli has not been successful, since three disulfide bonds in monomer hEGF made it unable to fold into correct 3D structure using in vivo system. To tackle this problem, we fused Mxe GyrA intein (Mxe at the C-terminal of hEGF followed by small ubiquitin-related modifier (SUMO and 10x His-tag to construct a chimeric protein hEGF-Mxe-SUMO-H10. The fusion protein was highly expressed at the concentration of 281 mg/L and up to 59.5% of the total cellular soluble proteins. The fusion protein was purified by affinity chromatography and 29.4 mg/L of native hEGF can be released by thiol induced N-terminal cleavage without any proteases. The mitotic activity in Balb/c 3T3 cells is proliferated by commercial and recombinant hEGF measured with methylthiazolyldiphenyl-tetrazolium bromide (MTT assay which indicated that recombinant hEGF protein stimulates the cell proliferation similar to commercial protein. This study significantly improved the yield and reduced the cost of hEGF in the recombinant E. coli system and could be a better strategy to produce native hEGF for pharmaceutical development.

  15. High Efficient Expression, Purification, and Functional Characterization of Native Human Epidermal Growth Factor in Escherichia coli.

    Science.gov (United States)

    Ma, Yi; Yu, Jieying; Lin, Jinglian; Wu, Shaomin; Li, Shan; Wang, Jufang

    2016-01-01

    Human epidermal growth factor (hEGF) is a small, mitotic growth polypeptide that promotes the proliferation of various cells and is widely applied in clinical practices. However, high efficient expression of native hEGF in Escherichia coli has not been successful, since three disulfide bonds in monomer hEGF made it unable to fold into correct 3D structure using in vivo system. To tackle this problem, we fused Mxe GyrA intein (Mxe) at the C-terminal of hEGF followed by small ubiquitin-related modifier (SUMO) and 10x His-tag to construct a chimeric protein hEGF-Mxe-SUMO-H 10 . The fusion protein was highly expressed at the concentration of 281 mg/L and up to 59.5% of the total cellular soluble proteins. The fusion protein was purified by affinity chromatography and 29.4 mg/L of native hEGF can be released by thiol induced N-terminal cleavage without any proteases. The mitotic activity in Balb/c 3T3 cells is proliferated by commercial and recombinant hEGF measured with methylthiazolyldiphenyl-tetrazolium bromide (MTT) assay which indicated that recombinant hEGF protein stimulates the cell proliferation similar to commercial protein. This study significantly improved the yield and reduced the cost of hEGF in the recombinant E. coli system and could be a better strategy to produce native hEGF for pharmaceutical development.

  16. Human epidermal growth factor receptor2 expression in unresectable gastric cancers: Relationship with CT characteristics

    International Nuclear Information System (INIS)

    Lee, Jeong Sub; Kim, Se Hyung; Im, Seock Ah; Kim, Min A; Han, Joon Koo

    2017-01-01

    To retrospectively analyze the qualitative CT features that correlate with human epidermal growth factor receptor 2 (HER2)-expression in pathologically-proven gastric cancers. A total of 181 patients with pathologically-proven unresectable gastric cancers with HER2-expression (HER2-positive [n = 32] and negative [n = 149]) were included. CT features of primary gastric and metastatic tumors were reviewed. The prevalence of each CT finding was compared in both groups. Thereafter, binary logistic regression determined the most significant differential CT features. Clinical outcomes were compared using Kaplan-Meier method. HER2-postive cancers showed lower clinical T stage (21.9% vs. 8.1%; p = 0.015), hyperattenuation on portal phase (62.5% vs. 30.9%; p = 0.003), and was more frequently metastasized to the liver (62.5% vs. 32.2%; p = 0.001), than HER2-negative cancers. On binary regression analysis, hyperattenuation of the tumor (odds ratio [OR], 4.68; p < 0.001) and hepatic metastasis (OR, 4.43; p = 0.001) were significant independent factors that predict HER2-positive cancers. Median survival of HER2-positive cancers (13.7 months) was significantly longer than HER2-negative cancers (9.6 months) (p = 0.035). HER2-positive gastric cancers show less-advanced T stage, hyperattenuation on the portal phase, and frequently metastasize to the liver, as compared to HER2-negative cancers

  17. Brain metastasis in human epidermal growth factor receptor 2-positive breast cancer: from biology to treatment

    Energy Technology Data Exchange (ETDEWEB)

    Koo, Tae Ryool [Dept. of Radiation Oncology, Hallym University Chuncheon Sacred Heart Hospital, Chuncheon (Korea, Republic of); Kim, In Ah [Dept. of Radiation Oncology, Seoul National University Bundang Hospital, Seongnam (Korea, Republic of)

    2016-03-15

    Overexpression of human epidermal growth factor receptor 2 (HER2) is found in about 20% of breast cancer patients. With treatment using trastuzumab, an anti-HER2 monoclonal antibody, systemic control is improved. Nonetheless, the incidence of brain metastasis does not be improved, rather seems to be increased in HER2-positive breast cancer. The mainstay treatment for brain metastases is radiotherapy. According to the number of metastatic lesions and performance status of patients, radiosurgery or whole brain radiotherapy can be performed. The concurrent use of a radiosensitizer further improves intracranial control. Due to its large molecular weight, trastuzumab has a limited ability to cross the blood-brain barrier. However, small tyrosine kinase inhibitors such as lapatinib, has been noted to be a promising agent that can be used as a radiosensitizer to affect HER2-positive breast cancer. This review will outline general management of brain metastases and will focus on preclinical findings regarding the radiosensitizing effect of small molecule HER2 targeting agents.

  18. The effect of wound dressings on a bio-engineered human dermo-epidermal skin substitute in a rat model

    OpenAIRE

    Hüging, Martina; Biedermann, Thomas; Sobrio, Monia; Meyer, Sarah; Böttcher-Haberzeth, Sophie; Manuel, Edith; Horst, Maya; Hynes, Sally; Reichmann, Ernst; Schiestl, Clemens; Hartmann-Fritsch, Fabienne

    2017-01-01

    Autologous bio-engineered dermo-epidermal skin substitutes are a promising treatment for large skin defects such as burns. For their successful clinical application, the graft dressing must protect and support the keratinocyte layer and, in many cases, possess antimicrobial properties. However, silver in many antimicrobial dressings may inhibit keratinocyte growth and differentiation. The purpose of our study is to evaluate the effect of various wound dressings on the healing of a human hydro...

  19. Expression and significance of HMGB1, TLR4 and NF-κB p65 in human epidermal tumors

    International Nuclear Information System (INIS)

    Weng, Hui; Deng, Yunhua; Xie, Yuyan; Liu, Hongbo; Gong, Feili

    2013-01-01

    High mobility group protein box 1 (HMGB1) is a DNA binding protein located in nucleus. It is released into extracellular fluid where it acts as a novel proinflammatory cytokine which interacts with Toll like receptor 4 (TLR4) to activate nuclear factor-κB (NF-κB). This sequence of events is involved in tumor growth and progression. However, the effects of HMGB1, TLR4 and NF-κB on epidermal tumors remain unclear. Human epidermal tumor specimens were obtained from 96 patients. Immunohistochemistry was used to detect expression of HMGB1, TLR4 and NF-κB p65 in human epidermal tumor and normal skin specimens. Western blot analysis was used to detect the expression of NF-κB p65 in epithelial cell nuclei in human epidermal tumor and normal tissues. Immunohistochemistry and western blot analysis indicated a progressive but statistically significant increase in p65 expression in epithelial nuclei in benign seborrheic keratosis (SK), precancerous lesions (PCL), low malignancy basal cell carcinoma (BCC) and high malignancy squamous cell carcinoma (SCC) (P <0.01). The level of extracellular HMGB1 in SK was significantly higher than in normal skin (NS) (P <0.01), and was higher than in SCC but without statistical significance. The level of TLR4 on epithelial membranes of SCC cells was significantly higher than in SK, PCL, BCC and NS (P <0.01). There was a significant positive correlation between p65 expression in the epithelial nuclei and TLR4 expression on the epithelial cell membranes (r = 0.3212, P <0.01). These findings indicate that inflammation is intensified in parallel with increasing malignancy. They also indicate that the TLR4 signaling pathway, rather than HMGB1, may be the principal mediator of inflammation in high-grade malignant epidermal tumors. Combined detection of p65 in the epithelial nuclei and TLR4 on the epithelial membranes may assist the accurate diagnosis of malignant epidermal tumors

  20. Chemical allergens stimulate human epidermal keratinocytes to produce lymphangiogenic vascular endothelial growth factor

    Energy Technology Data Exchange (ETDEWEB)

    Bae, Ok-Nam [College of Pharmacy, Institute of Pharmaceutical Science and Technology, Hanyang University, Ansan 426-791 (Korea, Republic of); Ahn, Seyeon; Jin, Sun Hee; Hong, Soo Hyun; Lee, Jinyoung [College of Pharmacy, Natural Products Research Institute, Seoul National University, Seoul 151-742 (Korea, Republic of); Kim, Eun-Sun [College of Pharmacy, Institute of Pharmaceutical Science and Technology, Hanyang University, Ansan 426-791 (Korea, Republic of); Jeong, Tae Cheon [College of Pharmacy, Yeungnam University, Gyeongsan 712-749 (Korea, Republic of); Chun, Young-Jin [College of Pharmacy, Chung-Ang University, Seoul 156-756 (Korea, Republic of); Lee, Ai-Young, E-mail: leeay@duih.org [Department of Dermatology, Dongguk University Ilsan Hospital, Goyang 410-773 (Korea, Republic of); Noh, Minsoo, E-mail: minsoo@alum.mit.edu [College of Pharmacy, Natural Products Research Institute, Seoul National University, Seoul 151-742 (Korea, Republic of)

    2015-03-01

    Allergic contact dermatitis (ACD) is a cell-mediated immune response that involves skin sensitization in response to contact with various allergens. Angiogenesis and lymphangiogenesis both play roles in the allergic sensitization process. Epidermal keratinocytes can produce vascular endothelial growth factor (VEGF) in response to UV irradiation and during wound healing. However, the effect of haptenic chemical allergens on the VEGF production of human keratinocytes, which is the primary contact site of toxic allergens, has not been thoroughly researched. We systematically investigated whether immune-regulatory cytokines and chemical allergens would lead to the production of VEGF in normal human keratinocytes (NHKs) in culture. VEGF production significantly increased when NHKs were treated with IFNγ, IL-1α, IL-4, IL-6, IL-17A, IL-22 or TNFα. Among the human sensitizers listed in the OECD Test Guideline (TG) 429, we found that CMI/MI, DNCB, 4-phenylenediamine, cobalt chloride, 2-mercaptobenzothiazole, citral, HCA, cinnamic alcohol, imidazolidinyl urea and nickel chloride all significantly upregulated VEGF production in NHKs. In addition, common human haptenic allergens such as avobenzone, formaldehyde and urushiol, also induced the keratinocyte-derived VEGF production. VEGF upregulation by pro-inflammatory stimuli, IFNγ, DNCB or formaldehyde is preceded by the production of IL-8, an acute inflammatory phase cytokine. Lymphangiogenic VEGF-C gene transcription was significantly increased when NHKs were treated with formaldehyde, DNCB or urushiol, while transcription of VEGF-A and VEGF-B did not change. Therefore, the chemical allergen-induced VEGF upregulation is mainly due to the increase in lymphangiogenic VEGF-C transcription in NHKs. These results suggest that keratinocyte-derived VEGF may regulate the lymphangiogenic process during the skin sensitization process of ACD. - Highlights: • Pro-inflammatory cytokines induced VEGF production in normal human

  1. Chemical allergens stimulate human epidermal keratinocytes to produce lymphangiogenic vascular endothelial growth factor

    International Nuclear Information System (INIS)

    Bae, Ok-Nam; Ahn, Seyeon; Jin, Sun Hee; Hong, Soo Hyun; Lee, Jinyoung; Kim, Eun-Sun; Jeong, Tae Cheon; Chun, Young-Jin; Lee, Ai-Young; Noh, Minsoo

    2015-01-01

    Allergic contact dermatitis (ACD) is a cell-mediated immune response that involves skin sensitization in response to contact with various allergens. Angiogenesis and lymphangiogenesis both play roles in the allergic sensitization process. Epidermal keratinocytes can produce vascular endothelial growth factor (VEGF) in response to UV irradiation and during wound healing. However, the effect of haptenic chemical allergens on the VEGF production of human keratinocytes, which is the primary contact site of toxic allergens, has not been thoroughly researched. We systematically investigated whether immune-regulatory cytokines and chemical allergens would lead to the production of VEGF in normal human keratinocytes (NHKs) in culture. VEGF production significantly increased when NHKs were treated with IFNγ, IL-1α, IL-4, IL-6, IL-17A, IL-22 or TNFα. Among the human sensitizers listed in the OECD Test Guideline (TG) 429, we found that CMI/MI, DNCB, 4-phenylenediamine, cobalt chloride, 2-mercaptobenzothiazole, citral, HCA, cinnamic alcohol, imidazolidinyl urea and nickel chloride all significantly upregulated VEGF production in NHKs. In addition, common human haptenic allergens such as avobenzone, formaldehyde and urushiol, also induced the keratinocyte-derived VEGF production. VEGF upregulation by pro-inflammatory stimuli, IFNγ, DNCB or formaldehyde is preceded by the production of IL-8, an acute inflammatory phase cytokine. Lymphangiogenic VEGF-C gene transcription was significantly increased when NHKs were treated with formaldehyde, DNCB or urushiol, while transcription of VEGF-A and VEGF-B did not change. Therefore, the chemical allergen-induced VEGF upregulation is mainly due to the increase in lymphangiogenic VEGF-C transcription in NHKs. These results suggest that keratinocyte-derived VEGF may regulate the lymphangiogenic process during the skin sensitization process of ACD. - Highlights: • Pro-inflammatory cytokines induced VEGF production in normal human

  2. H{sup +}/peptide transporter (PEPT2) is expressed in human epidermal keratinocytes and is involved in skin oligopeptide transport

    Energy Technology Data Exchange (ETDEWEB)

    Kudo, Michiko; Katayoshi, Takeshi; Kobayashi-Nakamura, Kumiko [DHC Corporation Laboratories, Division 2, 2-42 Hamada, Mihama-ku, Chiba 261-0025 (Japan); Akagawa, Mitsugu [Department of Biological Chemistry, Division of Applied Life Science, Graduate School of Life and Environmental Sciences, Osaka Prefecture University, 1-1 Gakuen-cho, Naka-ku, Sakai 599-8531 (Japan); Tsuji-Naito, Kentaro, E-mail: knaito@dhc.co.jp [DHC Corporation Laboratories, Division 2, 2-42 Hamada, Mihama-ku, Chiba 261-0025 (Japan)

    2016-07-08

    Peptide transporter 2 (PEPT2) is a member of the proton-coupled oligopeptide transporter family, which mediates the cellular uptake of oligopeptides and peptide-like drugs. Although PEPT2 is expressed in many tissues, its expression in epidermal keratinocytes remains unclear. We investigated PEPT2 expression profile and functional activity in keratinocytes. We confirmed PEPT2 mRNA expression in three keratinocyte lines (normal human epidermal keratinocytes (NHEKs), immortalized keratinocytes, and malignant keratinocytes) by reverse transcription-polymerase chain reaction (RT-PCR) and quantitative real-time RT-PCR. In contrast to PEPT1, PEPT2 expression in the three keratinocytes was similar or higher than that in HepG2 cells, used as PEPT2-positive cells. Immunolocalization analysis using human skin showed epidermal PEPT2 localization. We studied keratinocyte transport function by measuring the oligopeptide content using liquid chromatography/tandem mass spectrometry. Glycylsarcosine uptake in NHEKs was pH-dependent, suggesting that keratinocytes could absorb small peptides in the presence of an inward H{sup +} gradient. We also performed a skin-permeability test of several oligopeptides using skin substitute, suggesting that di- and tripeptides pass actively through the epidermis. In conclusion, PEPT2 is expressed in keratinocytes and involved in skin oligopeptide uptake. -- Highlights: •PEPT2 is expressed in keratinocytes, which are more common than other skin cells. •Immunolocalization analysis using human skin revealed epidermal PEPT2 localization. •Keratinocytes could absorb small peptides in the presence of an inward H{sup +} gradient. •Di- and tripeptide pass actively through the epidermis.

  3. Dynamic changes in nicotinamide pyridine dinucleotide content in normal human epidermal keratinocytes and their effect on retinoic acid biosynthesis

    International Nuclear Information System (INIS)

    Pinkas-Sarafova, Adriana; Markova, N.G.; Simon, M.

    2005-01-01

    The function of many enzymes that regulate metabolism and transcription depends critically on the nicotinamide pyridine dinucleotides. To understand the role of NAD(P)(H) in physiology and pathophysiology, it is imperative to estimate both their amount and ratios in a given cell type. In human epidermis and in cultured epidermal keratinocytes, we found that the total dinucleotide content is in the low millimolar range. The dinucleotide pattern changes during proliferation and maturation of keratinocytes in culture. Differences in the concentrations of NAD(P)(H) of 1.5- to 12-fold were observed. This resulted in alteration of the NAD(P)H/NAD(P) ratio, which could impact the differential regulation of both transcriptional and metabolic processes. In support of this notion, we provide evidence that the two-step oxidation of retinol to retinoic acid, a nuclear hormone critical for epidermal homeostasis, can be regulated by the relative physiological amounts of the pyridine dinucleotides

  4. Radiolabeled pertuzumab for imaging of human epidermal growth factor receptor 2 expression in ovarian cancer

    Energy Technology Data Exchange (ETDEWEB)

    Jiang, Dawei [Shenzhen University, Guangdong Key Laboratory for Biomedical Measurements and Ultrasound Imaging, School of Biomedical Engineering, Shenzhen (China); University of Wisconsin - Madison, Department of Radiology, Madison, WI (United States); Im, Hyung-Jun [University of Wisconsin - Madison, Department of Radiology, Madison, WI (United States); Seoul National University, Graduate School of Convergence Science and Technology, Seoul (Korea, Republic of); Sun, Haiyan; Cho, Steve Y. [University of Wisconsin - Madison, Department of Radiology, Madison, WI (United States); Valdovinos, Hector F.; England, Christopher G.; Ehlerding, Emily B.; Nickles, Robert J. [University of Wisconsin - Madison, Department of Medical Physics, Madison, WI (United States); Lee, Dong Soo [Seoul National University, Graduate School of Convergence Science and Technology, Seoul (Korea, Republic of); Huang, Peng [Shenzhen University, Guangdong Key Laboratory for Biomedical Measurements and Ultrasound Imaging, School of Biomedical Engineering, Shenzhen (China); Cai, Weibo [University of Wisconsin - Madison, Department of Radiology, Madison, WI (United States); University of Wisconsin - Madison, Department of Medical Physics, Madison, WI (United States); University of Wisconsin Carbone Cancer Center, Madison, WI (United States)

    2017-08-15

    Human epidermal growth factor receptor 2 (HER2) is over-expressed in over 30% of ovarian cancer cases, playing an essential role in tumorigenesis and metastasis. Non-invasive imaging of HER2 is of great interest for physicians as a mean to better detect and monitor the progression of ovarian cancer. In this study, HER2 was assessed as a biomarker for ovarian cancer imaging using {sup 64}Cu-labeled pertuzumab for immunoPET imaging. HER2 expression and binding were examined in three ovarian cancer cell lines (SKOV3, OVCAR3, Caov3) using in vitro techniques, including western blot and saturation binding assays. PET imaging and biodistribution studies in subcutaneous models of ovarian cancer were performed for non-invasive in vivo evaluation of HER2 expression. Additionally, orthotopic models were employed to further validate the imaging capability of {sup 64}Cu-NOTA-pertuzumab. HER2 expression was highest in SKOV3 cells, while OVCAR3 and Caov3 displayed lower HER2 expression. {sup 64}Cu-NOTA-pertuzumab showed high specificity for HER2 (K{sub a} = 3.1 ± 0.6 nM) in SKOV3. In subcutaneous tumors, PET imaging revealed tumor uptake of 41.8 ± 3.8, 10.5 ± 3.9, and 12.1 ± 2.3%ID/g at 48 h post-injection for SKOV3, OVCAR3, and Caov3, respectively (n = 3). In orthotopic models, PET imaging with {sup 64}Cu-NOTA-pertuzumab allowed for rapid and clear delineation of both primary and small peritoneal metastases in HER2-expressing ovarian cancer. {sup 64}Cu-NOTA-pertuzumab is an effective PET tracer for the non-invasive imaging of HER2 expression in vivo, rendering it a potential tracer for treatment monitoring and improved patient stratification. (orig.)

  5. Correlation of human epidermal growth factor receptor protein expression and colorectal cancer.

    Science.gov (United States)

    Yang, Wen-Juan; Shen, Xing-Jie; Ma, Xiao-Xia; Tan, Zhi-Gang; Song, Yan; Guo, Yi-Tong; Yuan, Mei

    2015-07-28

    To investigate the correlation between human epidermal growth factor receptor (HER-2) protein expression and colorectal cancer (CRC) using a case-control study and meta-analysis. Tumor tissue specimens from 162 CRC patients were selected for the case group. Fifty cases were randomly selected, and normal CRC tissue at least 10 cm away from the tumor margins of these cases was used to generate the control group. The expression of the HER-2 protein in the 162 CRC tissue samples and the 50 adjacent normal mucosa tissue samples was detected via immunohistochemistry. The experimental data were analyzed using SPSS 18.0 software, and R software version 3.1.0 was utilized for further verification. The expression of HER-2 protein in the 162 CRC tissue samples was significantly higher than in the normal tissue specimens. The data showed that the expression of HER-2 in CRC was related to the Dukes' stage, the depth of invasion and lymph node metastasis. The HER-2-positive patients had lower 3- and 5-year OS rates than the HER-2-negative patients, but there was no significant difference. However, there was a statistically significant difference in the 3- and 5-year disease-free survival (DFS) rates of HER-2-positive and HER-2-negative patients. The results of the meta-analysis showed that the expression of HER-2 in CRC patients was statistically significantly increased over that of healthy people. The 3-year DFS rate in HER-2-positive patients was markedly lower than that in HER-2-negative patients. Down-regulation of HER-2 expression might be a dependable strategy for CRC therapy.

  6. Biological interactions of quantum dot nanoparticles in skin and in human epidermal keratinocytes

    International Nuclear Information System (INIS)

    Zhang, Leshuai W.; Yu, William W.; Colvin, Vicki L.; Monteiro-Riviere, Nancy A.

    2008-01-01

    Quantum dots nanoparticles have novel optical properties for biomedical applications and electronics, but little is known about their skin permeability and interaction with cells. QD621 are nail-shaped nanoparticles that contain a cadmium/selenide core with a cadmium sulfide shell coated with polyethylene glycol (PEG) and are soluble in water. QD were topically applied to porcine skin flow-through diffusion cells to assess penetration at 1 μM, 2 μM and 10 μM for 24 h. QD were also studied in human epidermal keratinocytes (HEK) to determine cellular uptake, cytotoxicity and inflammatory potential. Confocal microscopy depicted the penetration of QD621 through the uppermost stratum corneum (SC) layers of the epidermis and fluorescence was found primarily in the SC and near hair follicles. QD were found in the intercellular lipid bilayers of the SC by transmission electron microscopy (TEM). Inductively coupled plasma-optical emission spectroscopy (ICP-OES) analysis for cadmium (Cd) and fluorescence for QD both did not detect Cd nor fluorescence signal in the perfusate at any time point or concentration. In HEK, viability decreased significantly (p < 0.05) from 1.25 nM to 10nM after 24 h and 48 h. There was a significant increase in IL-6 at 1.25 nM to 10 nM, while IL-8 increased from 2.5nM to 10nM after 24 h and 48 h. TEM of HEK treated with 10 nM of QD621 at 24 h depicted QD in cytoplasmic vacuoles and at the periphery of the cell membranes. These results indicate that porcine skin penetration of QD621 is minimal and limited primarily to the outer SC layers, yet if the skin were damaged allowing direct QD exposure to skin or keratinocytes, an inflammatory response could be initiated

  7. Cellular processes involved in human epidermal cells exposed to extremely low frequency electric fields.

    Science.gov (United States)

    Collard, J-F; Hinsenkamp, M

    2015-05-01

    We observed on different tissues and organisms a biological response after exposure to pulsed low frequency and low amplitude electric or electromagnetic fields but the precise mechanism of cell response remains unknown. The aim of this publication is to understand, using bioinformatics, the biological relevance of processes involved in the modification of gene expression. The list of genes analyzed was obtained after microarray protocol realized on cultures of human epidermal explants growing on deepidermized human skin exposed to a pulsed low frequency electric field. The directed acyclic graph on a WebGestalt Gene Ontology module shows six categories under the biological process root: "biological regulation", "cellular process", "cell proliferation", "death", "metabolic process" and "response to stimulus". Enriched derived categories are coherent with the type of in vitro culture, the stimulation protocol or with the previous results showing a decrease of cell proliferation and an increase of differentiation. The Kegg module on WebGestalt has highlighted "cell cycle" and "p53 signaling pathway" as significantly involved. The Kegg website brings out interactions between FoxO, MAPK, JNK, p53, p38, PI3K/Akt, Wnt, mTor or NF-KappaB. Some genes expressed by the stimulation are known to have an exclusive function on these pathways. Analyses performed with Pathway Studio linked cell proliferation, cell differentiation, apoptosis, cell cycle, mitosis, cell death etc. with our microarrays results. Medline citation generated by the software and the fold change variation confirms a diminution of the proliferation, activation of the differentiation and a less well-defined role of apoptosis or wound healing. Wnt and DKK functional classes, DKK1, MACF1, ATF3, MME, TXNRD1, and BMP-2 genes proposed in previous publications after a manual analysis are also highlighted with other genes after Pathway Studio automatic procedure. Finally, an analysis conducted on a list of genes

  8. In vivo UVB irradiation induces clustering of Fas (CD95) on human epidermal cells

    DEFF Research Database (Denmark)

    Bang, Bo; Gniadecki, Robert; Larsen, Jørgen K

    2003-01-01

    a single dose of UVB irradiation. Normal healthy individuals were irradiated with three minimal erythema doses (MED) of UVB on forearm or buttock skin. Suction blisters from unirradiated and irradiated skin were raised, and Fas, FasL, and apoptosis of epidermal cells quantified by flow cytometry...

  9. Differences in human skin between the epidermal growth factor receptor distribution detected by EGF binding and monoclonal antibody recognition

    DEFF Research Database (Denmark)

    Green, M R; Couchman, J R

    1985-01-01

    , the eccrine sweat glands, capillary system, and the hair follicle outer root sheath, generally similar in pattern to that previously reported for full-thickness rat skin and human epidermis. The same areas also bound EGF-R1 but in addition the monoclonal antibody recognized a cone of melanin containing......Two methods have been used to examine epidermal growth factor (EGF) receptor distribution in human scalp and foreskin. The first employed [125I]EGF viable explants and autoradiography to determine the EGF binding pattern while the second used a monoclonal antibody to the human EGF receptor to map...... whether EGF-R1 could recognize molecules unrelated to the EGF receptor, the EGF binding and EGF-R1 recognition profiles were compared on cultures of SVK14 cells, a SV40 transformed human keratinocyte cell line. EGF binding and EGF-R1 monoclonal antibody distribution on these cells was found to be similar...

  10. Repair of ultraviolet light damage to the DNA of cultured human epidermal keratinocytes and fibroblasts

    International Nuclear Information System (INIS)

    Taichman, L.B.; Setlow, R.B.

    1979-01-01

    Pure cultures of dermal fibroblasts and epidermal keroatinocytes have been obtained from a single biopsy of newborn foreskin. The cells were labeled, exposed to several doses of uv light, and allowed to repair in the dark for 16 h. The number of pyrimidine dimers before and after repair was assessed by measuring the numbers of sites in the DNA sensitive to a specific uv endonuclease. At all doses used, the extent of repair was similar in the cultured keratinocytes and cultured fibroblasts

  11. Repeated short climatic change affects the epidermal differentiation program and leads to matrix remodeling in a human organotypic skin model.

    Science.gov (United States)

    Boutrand, Laetitia-Barbollat; Thépot, Amélie; Muther, Charlotte; Boher, Aurélie; Robic, Julie; Guéré, Christelle; Vié, Katell; Damour, Odile; Lamartine, Jérôme

    2017-01-01

    Human skin is subject to frequent changes in ambient temperature and humidity and needs to cope with these environmental modifications. To decipher the molecular response of human skin to repeated climatic change, a versatile model of skin equivalent subject to "hot-wet" (40°C, 80% relative humidity [RH]) or "cold-dry" (10°C, 40% RH) climatic stress repeated daily was used. To obtain an exhaustive view of the molecular mechanisms elicited by climatic change, large-scale gene expression DNA microarray analysis was performed and modulated function was determined by bioinformatic annotation. This analysis revealed several functions, including epidermal differentiation and extracellular matrix, impacted by repeated variations in climatic conditions. Some of these molecular changes were confirmed by histological examination and protein expression. Both treatments (hot-wet and cold-dry) reduced the expression of genes encoding collagens, laminin, and proteoglycans, suggesting a profound remodeling of the extracellular matrix. Strong induction of the entire family of late cornified envelope genes after cold-dry exposure, confirmed at protein level, was also observed. These changes correlated with an increase in epidermal differentiation markers such as corneodesmosin and a thickening of the stratum corneum, indicating possible implementation of defense mechanisms against dehydration. This study for the first time reveals the complex pattern of molecular response allowing adaption of human skin to repeated change in its climatic environment.

  12. UVA-induced immune suppression in human skin: protective effect of vitamin E in human epidermal cells in vitro

    International Nuclear Information System (INIS)

    Clement-Lacroix, P.; Michel, L.; Moysan, A.; Morliere, P.; Dubertret, L.

    1996-01-01

    UVA (320-400 nm) radiation damage to membranes, proteins, DNA and other cellular targets is predominantly related to oxidative processes. In the present study, we demonstrated that cutaneous UVA-induced immunosuppression can be related, at least in part, to the appearance of these oxidative processes. The UVA-induced oxidative processes in freshly isolated epidermal cells were monitored by measuring the thiobarbituric acid reactive substances (TBARS) as an index of peroxidation. The in vitro immunosuppressive effects of UVA were demonstrated by measuring the allogenic lymphocyte proliferation induced by epidermal cells or purified Langerhans cells in the mixed epidermal cell-lymphocyte reaction (MECLR). In addition, the effects of a potent antioxidant (vitamin E) on these two UVA-induced processes were analysed. (author)

  13. A nomogram for predicting pathological complete response in patients with human epidermal growth factor receptor 2 negative breast cancer

    International Nuclear Information System (INIS)

    Jin, Xi; Jiang, Yi-Zhou; Chen, Sheng; Yu, Ke-Da; Ma, Ding; Sun, Wei; Shao, Zhi-Min; Di, Gen-Hong

    2016-01-01

    The response to neoadjuvant chemotherapy has been proven to predict long-term clinical benefits for patients. Our research is to construct a nomogram to predict pathological complete response of human epidermal growth factor receptor 2 negative breast cancer patients. We enrolled 815 patients who received neoadjuvant chemotherapy from 2003 to 2015 and divided them into a training set and a validation set. Univariate logistic regression was performed to screen for predictors and construct the nomogram; multivariate logistic regression was performed to identify independent predictors. After performing the univariate logistic regression analysis in the training set, tumor size, hormone receptor status, regimens of neoadjuvant chemotherapy and cycles of neoadjuvant chemotherapy were the final predictors for the construction of the nomogram. The multivariate logistic regression analysis demonstrated that T4 status, hormone receptor status and receiving regimen of paclitaxel and carboplatin were independent predictors of pathological complete response. The area under the receiver operating characteristic curve of the training set and the validation set was 0.779 and 0.701, respectively. We constructed and validated a nomogram to predict pathological complete response in human epidermal growth factor receptor 2 negative breast cancer patients. We also identified tumor size, hormone receptor status and paclitaxel and carboplatin regimen as independent predictors of pathological complete response. The online version of this article (doi:10.1186/s12885-016-2652-z) contains supplementary material, which is available to authorized users

  14. A Premature Termination of Human Epidermal Growth Factor Receptor Transcription in Escherichia coli

    Directory of Open Access Journals (Sweden)

    Jihene Elloumi-Mseddi

    2014-01-01

    Full Text Available Our success in producing an active epidermal growth factor receptor (EGFR tyrosine kinase in Escherichia coli encouraged us to express the full-length receptor in the same host. Despite its large size, we were successful at producing the full-length EGFR protein fused to glutathione S-transferase (GST that was detected by Western blot analysis. Moreover, we obtained a majoritarian truncated GST-EGFR form detectable by gel electrophoresis and Western blot. This truncated protein was purified and confirmed by MALDI-TOF/TOF analysis to belong to the N-terminal extracellular region of the EGFR fused to GST. Northern blot analysis showed two transcripts suggesting the occurrence of a transcriptional arrest.

  15. Phase III randomized study comparing docetaxel plus trastuzumab with vinorelbine plus trastuzumab as first-line therapy of metastatic or locally advanced human epidermal growth factor receptor 2-positive breast cancer: the HERNATA study

    DEFF Research Database (Denmark)

    Andersson, Michael; Lidbrink, Elisabeth; Bjerre, Karsten

    2011-01-01

    To evaluate docetaxel or vinorelbine, both with trastuzumab, as first-line therapy of human epidermal growth factor receptor 2-positive advanced breast cancer.......To evaluate docetaxel or vinorelbine, both with trastuzumab, as first-line therapy of human epidermal growth factor receptor 2-positive advanced breast cancer....

  16. Epidermal growth factor receptor antibody plus recombinant human endostatin in treatment of hepatic metastases after remnant gastric cancer resection

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    We report a 55-year-old male who developed advanced hepatic metastasis and peritoneal carcinomatosis after resection of remnant gastric cancer resection 3 mo ago. The patient only received epidermal growth factor (EGF) receptor antibody (Cetuximab) plus recombinant human endostatin (Endostar).Anti-tumor activity was assessed by 18F-fluorodeoxyglucose (18F-FDG)positron emission tomography/computer tomography (PET/CT) at baseline and then every 4 wk. The case illustrates that 18FDG-PET/CT could make an early prediction of the response to Cetuximab plus Endostar in such clinical situations. 18FDG-PET/CT is a useful molecular imaging modality to evaluate the biological response advanced hepatic metastasis and peritoneal carcinomatosis to Cetuximab plus Endostar in patients after remnant gastric cancer resection.

  17. Direct astatination of a tumour-binding protein, human epidermal growth factor, using nido-carborane as a prosthetic group

    International Nuclear Information System (INIS)

    Sjoestroem, A.; Carlsson, J.; Lundqvist, H.; Koziorowski, J.

    2003-01-01

    A method for direct astatine labeling of proteins has been investigated. Binding sites for astatine were created by coupling of a nido-carborane derivative to a protein, the human epidermal growth factor (hEGF), using two different conjugation methods - by glutaraldehyde cross-linking or by introduction of sulfohydryl groups by Traut's reagent with subsequent linking of ANC-1 with m-maleimidobenzoyl-N-hydroxysulfosuccinimide ester. The conjugates were astatinated using the Chloramine-T method in high yield. The best labeling was obtained by the glutaraldehyde conjugate with an average yield of 68 ± 9%. In vitro stability tests indicated that the glutaraldehyde conjugated label was as stable as hEGF labeled with astatobenzoate. (author)

  18. Protein kinase C is differentially regulated by thrombin, insulin, and epidermal growth factor in human mammary tumor cells

    Energy Technology Data Exchange (ETDEWEB)

    Gomez, M.L.; Tellez-Inon, M.T. (Instituto de Ingenieria Genetica y Biologia Molecular, Buenos Aires (Argentina)); Medrano, E.E.; Cafferatta, E.G.A. (Instituto de Investigaciones Bioquimicas Fundacion Campomar, Buenos Aires (Argentina))

    1988-03-01

    The exposure of serum-deprived mammary tumor cells MCF-7 and T-47D to insulin, thrombin, and epidermal growth factor (EGF) resulted in dramatic modifications in the activity and in the translocation capacity of protein kinase C from cytosol to membrane fractions. Insulin induces a 600% activation of the enzyme after 5 h of exposure to the hormone in MCF-7 cells; thrombin either activates (200% in MCF-7) or down-regulates (in T-47D), and EGF exerts only a moderate effect. Thus, the growth factors studied modulate differentially the protein kinase C activity in human mammary tumor cells. The physiological significance of the results obtained are discussed in terms of the growth response elicited by insulin, thrombin, and EGF.

  19. Harnessing Integrative Omics to Facilitate Molecular Imaging of the Human Epidermal Growth Factor Receptor Family for Precision Medicine.

    Science.gov (United States)

    Pool, Martin; de Boer, H Rudolf; Hooge, Marjolijn N Lub-de; van Vugt, Marcel A T M; de Vries, Elisabeth G E

    2017-01-01

    Cancer is a growing problem worldwide. The cause of death in cancer patients is often due to treatment-resistant metastatic disease. Many molecularly targeted anticancer drugs have been developed against 'oncogenic driver' pathways. However, these treatments are usually only effective in properly selected patients. Resistance to molecularly targeted drugs through selective pressure on acquired mutations or molecular rewiring can hinder their effectiveness. This review summarizes how molecular imaging techniques can potentially facilitate the optimal implementation of targeted agents. Using the human epidermal growth factor receptor (HER) family as a model in (pre)clinical studies, we illustrate how molecular imaging may be employed to characterize whole body target expression as well as monitor drug effectiveness and the emergence of tumor resistance. We further discuss how an integrative omics discovery platform could guide the selection of 'effect sensors' - new molecular imaging targets - which are dynamic markers that indicate treatment effectiveness or resistance.

  20. Thermal analysis of epidermal electronic devices integrated with human skin considering the effects of interfacial thermal resistance

    Science.gov (United States)

    Li, Yuhang; Zhang, Jianpeng; Xing, Yufeng; Song, Jizhou

    2018-05-01

    Epidermal electronic devices (EEDs) have similar mechanical properties as those of human skin such that they can be integrated with human skin for potential applications in monitoring of human vital signs for diagnostic, therapeutic or surgical functions. Thermal management is critical for EEDs in these applications since excessive heating may cause discomfort. Comprehensive analytical studies, finite element analysis and experiments are carried out to study the effects of interfacial thermal resistance between EEDs and human skin on thermal properties of the EED/skin system in this paper. The coupling between the Fourier heat transfer in EEDs and the bio-heat transfer in human skin is accounted in the analytical model based on the transfer matrix method to give accurate predictions on temperatures, which agree well with finite element analysis and experimental measurements. It is shown that the maximum temperature increase of the EED for the case of imperfect bonding between EED and skin is much higher than that of perfect bonding. These results may help the design of EEDs in bi-integrated applications and suggest a valuable route to evaluate the bonding condition between EEDs and biological tissues.

  1. American Society of Clinical Oncology/College of American Pathologists guideline recommendations for human epidermal growth factor receptor 2 testing in breast cancer

    NARCIS (Netherlands)

    Wolff, Antonio C.; Hammond, M. Elizabeth H.; Schwartz, Jared N.; Hagerty, Karen L.; Allred, D. Craig; Cote, Richard J.; Dowsett, Mitchell; Fitzgibbons, Patrick L.; Hanna, Wedad M.; Langer, Amy; McShane, Lisa M.; Paik, Soonmyung; Pegram, Mark D.; Perez, Edith A.; Press, Michael F.; Rhodes, Anthony; Sturgeon, Catharine; Taube, Sheila E.; Tubbs, Raymond; Vance, Gail H.; van de Vijver, Marc; Wheeler, Thomas M.; Hayes, Daniel F.

    2007-01-01

    PURPOSE: To develop a guideline to improve the accuracy of human epidermal growth factor receptor 2 (HER2) testing in invasive breast cancer and its utility as a predictive marker. METHODS: The American Society of Clinical Oncology and the College of American Pathologists convened an expert panel,

  2. Experimental radioimmunotherapy of a xenografted human glioma using [sup 131]I-labeled monoclonal antibody to epidermal growth factor receptor

    Energy Technology Data Exchange (ETDEWEB)

    Takahashi, Hiroshi; Nakazawa, Shozo [Nippon Medical School, Tokyo (Japan); Herlyn, D

    1993-09-01

    [sup 131]I-labeled F (ab')[sub 2] fragments of murine monoclonal antibodies (MAb) 425 specific to the epidermal growth factor receptor expressed on human gliomas were used in experimental human malignant glioma immunotherapy. Two injections of 150 [mu]Ci [sup 131]I-labeled 425 F(ab')[sub 2] achieved growth inhibition of U-87MG human malignant glioma xenografts in nude mice. This radiolabeled specific MAb F(ab')[sub 2] was significantly superior to radiolabeled fragments of an anti-hepatitis virus control MAb A5C3 in influencing tumor growth. However, similar treatment of established human malignant glioma xenografts did not inhibit progressive tumor growth significantly. No clear tumor inhibition was produced by unlabeled MAb 425F(ab')[sub 2]. These studies suggest that [sup 131]I-labeled MAbs have a significant antitumor effect where unmodified antibody is ineffective. Multiple doses of antibody may achieve an increase in labeled MAb concentration in tumors. (author).

  3. Expression of the epidermal growth factor receptor in human small cell lung cancer cell lines

    DEFF Research Database (Denmark)

    Damstrup, L; Rygaard, K; Spang-Thomsen, M

    1992-01-01

    of EGF receptor mRNA in all 10 cell lines that were found to be EGF receptor-positive and in one cell line that was found to be EGF receptor-negative in the radioreceptor assay and affinity labeling. Our results provide, for the first time, evidence that a large proportion of a broad panel of small cell......Epidermal growth factor (EGF) receptor expression was evaluated in a panel of 21 small cell lung cancer cell lines with radioreceptor assay, affinity labeling, and Northern blotting. We found high-affinity receptors to be expressed in 10 cell lines. Scatchard analysis of the binding data...... demonstrated that the cells bound between 3 and 52 fmol/mg protein with a KD ranging from 0.5 x 10(-10) to 2.7 x 10(-10) M. EGF binding to the receptor was confirmed by affinity-labeling EGF to the EGF receptor. The cross-linked complex had a M(r) of 170,000-180,000. Northern blotting showed the expression...

  4. Rho A Regulates Epidermal Growth Factor-Induced Human Osteosarcoma MG63 Cell Migration

    Directory of Open Access Journals (Sweden)

    Jinyang Wang

    2018-05-01

    Full Text Available Osteosarcoma, the most common primary bone tumor, occurs most frequently in children and adolescents and has a 5-year survival rate, which is unsatisfactory. As epidermal growth factor receptor (EGFR positively correlates with TNM (tumor-node-metastasis stage in osteosarcoma, EGFR may play an important role in its progression. The purpose of this study was to explore potential mechanisms underlying this correlation. We found that EGF promotes MG63 cell migration and invasion as well as stress fiber formation via Rho A activation and that these effects can be reversed by inhibiting Rho A expression. In addition, molecules downstream of Rho A, including ROCK1, LIMK2, and Cofilin, are activated by EGF in MG63 cells, leading to actin stress fiber formation and cell migration. Moreover, inhibition of ROCK1, LIMK2, or Cofilin in MG63 cells using known inhibitors or short hairpin RNA (shRNA prevents actin stress fiber formation and cell migration. Thus, we conclude that Rho A/ROCK1/LIMK2/Cofilin signaling mediates actin microfilament formation in MG63 cells upon EGFR activation. This novel pathway provides a promising target for preventing osteosarcoma progression and for treating this cancer.

  5. Niclosamide inhibits epithelial-mesenchymal transition and tumor growth in lapatinib-resistant human epidermal growth factor receptor 2-positive breast cancer.

    Science.gov (United States)

    Liu, Junjun; Chen, Xiaosong; Ward, Toby; Mao, Yan; Bockhorn, Jessica; Liu, Xiaofei; Wang, Gen; Pegram, Mark; Shen, Kunwei

    2016-02-01

    Acquired resistance to lapatinib, a human epidermal growth factor receptor 2 kinase inhibitor, remains a clinical problem for women with human epidermal growth factor receptor 2-positive advanced breast cancer, as metastasis is commonly observed in these patients. Niclosamide, an anti-helminthic agent, has recently been shown to exhibit cytotoxicity to tumor cells with stem-like characteristics. This study was designed to identify the mechanisms underlying lapatinib resistance and to determine whether niclosamide inhibits lapatinib resistance by reversing epithelial-mesenchymal transition. Here, two human epidermal growth factor receptor 2-positive breast cancer cell lines, SKBR3 and BT474, were exposed to increasing concentrations of lapatinib to establish lapatinib-resistant cultures. Lapatinib-resistant SKBR3 and BT474 cells exhibited up-regulation of the phenotypic epithelial-mesenchymal transition markers Snail, vimentin and α-smooth muscle actin, accompanied by activation of nuclear factor-кB and Src and a concomitant increase in stem cell marker expression (CD44(high)/CD24(low)), compared to naive lapatinib-sensitive SKBR3 and BT474 cells, respectively. Interestingly, niclosamide reversed epithelial-mesenchymal transition, induced apoptosis and inhibited cell growth by perturbing aberrant signaling pathway activation in lapatinib-resistant human epidermal growth factor receptor 2-positive cells. The ability of niclosamide to alleviate stem-like phenotype development and invasion was confirmed. Collectively, our results demonstrate that lapatinib resistance correlates with epithelial-mesenchymal transition and that niclosamide inhibits lapatinib-resistant cell viability and epithelial-mesenchymal transition. These findings suggest a role of niclosamide or derivatives optimized for more favorable bioavailability not only in reversing lapatinib resistance but also in reducing metastatic potential during the treatment of human epidermal growth factor receptor

  6. Effects of recombinant human epidermal growth factor (rhEGF) on experimental radiation-induced oral mucositis in rats

    International Nuclear Information System (INIS)

    Jung, Kwon Il; Kim, Sun Hee; Moon, Soo Young; Kim, Yeon Wha; Hong, Joon Pio; Lee, Sang Wook; Kim, Hyun Sook

    2006-01-01

    Oral mucositis is a common toxicity of radiation or chemotherapy, which is used a treatment for head and neck cancer. We investigated effects of recombinant human epidermal growth factor (rhEGF) on radiation-induced oral mucositis in rat model. Spraque-Dawley rats (7 per group) exposed to a single dose of 25 Gy (day 0) on their head, except for one group, were randomly divided into un-treated, vehicle-treated, and two rhEGF-treated groups. Rats were topically applied with rhEGF (15 or 30 μ g/oral cavity/day) or vehicle to their oral mucosa. Survival rate of rats, weight changes, and food intakes were examined from day 0 to 18 after radiation. Histology study was performed from oral mucosa of rats at day 7 and 18 after radiation. rhEGF-treated groups (15 or 30 μ g/day) showed all survival rate 33%, whereas un-treated and vehicle-treated groups showed all survival rate 0% at the end of experiment. rhEGF-treated groups statistically had less weight loss compared to vehicle-treated group from day 2 to 7 after radiation. Food intake of rats with rhEGF treatment turned to increase at day 14 after radiation. At 7 day after radiation, un-treated and vehicle-treated groups showed severe pseudomembraneous of ulcerative oral mucositis. On the other hand, rhEGF-treated groups had no more than cellular swelling and degeneration of epidermal cells in oral mucosa of rats. These results suggest that rhEGF has significantly positive effects on radiation-induced oral mucositis in rats. rhEGF display a therapeutic potential on a clinical level

  7. Cytogenetic evaluation of human glial tumors: correlation of overexpression of epidermal growth factor receptor (EGFB) with abnormalities of chromosome 7

    International Nuclear Information System (INIS)

    Bell, C.W.

    1987-01-01

    Chromosome banding analysis of human glial tumors were performed using G- and Q-banding techniques in an attempt to establish recurring sites of chromosome change. Results revealed a nonrandom karyotypic profile including aneuploidy and considerable variation in chromosome number (range 40 → 200). All tumors examined displayed numerical abnormalities, with the most common numeric change being a gain of chromosome 7. An attempt was then made to correlate the observed chromosome 7 changes with activation of the cellular proto-oncogene c-erb-B, whose produce is the epidermal growth factor receptor (EGFR). Six human glial tumors were analyzed for 125 I-EGF binding, EGFR gene copy number, EGFR gene rearrangement, mRNA expression, and karyotypic profile. Saturation analysis at 4 0 C revealed significant numbers of EGFR's in all 6 tumors. Southern blotting analysis utilizing cDNA probes for the EGFR failed to demonstrate significant amplification or structural rearrangement of the EFGR gene. The results suggest that overexpression of the EGFR may be related to an alternative mechanism, other than gene amplification and elevated mRNA levels, such as the regulation of receptor biosynthesis and degradation. In summary, findings indicate that alterations of chromosome 7 are the most prevalent chromosomal change in human glial tumors, and that these alterations may lead to overexpression of the protooncogene c-erb-B

  8. Assessment of Epidermal Growth Factor Receptor (EGFR expression in human meningioma

    Directory of Open Access Journals (Sweden)

    Perry Arie

    2010-05-01

    Full Text Available Abstract Purpose This study explores whether meningioma expresses epidermal growth factor receptor (EGFR and determines if there is a correlation between the WHO grade of this tumor and the degree of EGFR expression. Methods Following institutional review board approval, 113 meningioma specimens from 89 patients were chosen. Of these, 85 were used for final analysis. After a blinded review, immunohistochemical stains for EGFR were performed. Staining intensity (SI was scored on a scale 0-3 (from no staining to strong staining. Staining percentage of immunoreactive cells (SP was scored 1-5 (from the least to the maximum percent of the specimen staining. Immunohistochemical score (IHS was calculated as the product of SI and SP. Results Eighty-five samples of meningioma were classified in accordance with World Health Organization (WHO criteria: benign 57/85 (67%, atypical 23/85 (27%, and malignant 5/85 (6%. The majority of samples demonstrated a moderate SI for EGFR. IHS for EGFR demonstrated a significant association between SI and histopathologic subtype. Also, there was a correlation between the SP and histopathologic subtype (p = 0.029. A significant association was determined when the benign and the atypical samples were compared to the malignant with respect to the SP (p = 0.009. While there was a range of the IHS for the benign and the atypical histologic subtypes, malignant tumors exhibited the lowest score and were statistically different from the benign and the atypical specimens (p Conclusions To our knowledge, this represents the largest series of meningioma samples analyzed for EGFR expression reported in the literature. EGFR expression is greatest in benign meningiomas and may serve a potential target for therapeutic intervention with selective EGFR inhibitors.

  9. Protective effect of Juglans regia L. against ultraviolet B radiation induced inflammatory responses in human epidermal keratinocytes.

    Science.gov (United States)

    Muzaffer, Umar; Paul, V I; Prasad, Nagarajan Rajendra; Karthikeyan, Ramasamy; Agilan, Balupillai

    2018-03-15

    Juglans regia L. has a history of traditional medicinal use for the treatment of various maladies and have been documented with significant antioxidant and antiinflammatory properties. Although all parts of the plant are medicinally important, but male the flower of the plant has not been yet investigated against the photo-damage. The present study, we sought to determine the photoprotective effect of the male flower of J. regia L. against ultraviolet-B radiation-induced inflammatory responses in human skin cells. The profile of pharmacological active compounds present in the male flower of J. regia was analyzed by GC-MS. Then, the antioxidant property of methanolic extract of J. regia (MEJR) was analyzed by in vitro free radical scavenging assays. Further, we analyzed the sun protection factor of this extract by spectrophotometry. Moreover, we investigated the photoprotective effect of MEJR against UVB induced inflammatory signaling in human epidermal cells. Human skin epidermal keratinocytes (HaCaT) were pretreated with the MEJR (80 µg/ml), 30 min prior to UVB-irradiation at a dose of 20 mJ/cm 2 and were investigated for lipid peroxidation, enzymatic antioxidants activity, apoptosis and inflammatory markers expression level. The GC-MS results showed the presence of good amount of pharmacologically active compounds in the MEJR. We observed that the MEJR possess significant free radical scavenging activity and it was comparable with standard antioxidants. Further, the MEJR exhibits 8.8 sun-protection-factor (SPF) value. Pretreatment with MEJR, 30 min prior to UVB-irradiation, prevented ROS generation, lipid peroxidation and restored the activity of antioxidant status in HaCaT cells. Moreover, MEJR pretreatment significantly prevented UVB activated inflammatory markers like TNF-α, IL-1, IL-6, NF-κB, COX-2 in HaCaT. The present findings suggest that MEJR exhibit photoprotective effects and hence it may be useful for the treatment of inflammation related

  10. Establishment of H2Mab-119, an Anti-Human Epidermal Growth Factor Receptor 2 Monoclonal Antibody, Against Pancreatic Cancer.

    Science.gov (United States)

    Yamada, Shinji; Itai, Shunsuke; Nakamura, Takuro; Chang, Yao-Wen; Harada, Hiroyuki; Suzuki, Hiroyoshi; Kaneko, Mika K; Kato, Yukinari

    2017-12-01

    Human epidermal growth factor receptor 2 (HER2) is overexpressed in breast cancer and is associated with poor clinical outcomes. In addition, HER2 expression has been reported in other cancers, such as gastric, colorectal, lung, and pancreatic cancers. An anti-HER2 humanized antibody, trastuzumab, leads to significant survival benefits in patients with HER2-overexpressing breast cancers and gastric cancers. Herein, we established a novel anti-HER2 monoclonal antibody (mAb), H 2 Mab-119 (IgG 1 , kappa), and characterized its efficacy against pancreatic cancers using flow cytometry, Western blot, and immunohistochemical analyses. H 2 Mab-119 reacted with pancreatic cancer cell lines, such as KLM-1, Capan-2, and MIA PaCa-2, but did not react with PANC-1 in flow cytometry analysis. Western blot analysis also revealed a moderate signal for KLM-1 and a weak signal for MIA PaCa-2, although H 2 Mab-119 reacted strongly with LN229/HER2 cells. Finally, immunohistochemical analyses with H 2 Mab-119 revealed sensitive and specific reactions against breast and colon cancers but did not react with pancreatic cancers, indicating that H 2 Mab-119 is useful for detecting HER2 overexpression in pancreatic cancers using flow cytometry and Western blot analyses.

  11. New Whitening Constituents from Taiwan-Native Pyracantha koidzumii: Structures and Tyrosinase Inhibitory Analysis in Human Epidermal Melanocytes

    Directory of Open Access Journals (Sweden)

    Rong-Dih Lin

    2015-12-01

    Full Text Available Nontoxic natural products useful in skin care cosmetics are of considerable interest. Tyrosinase is a rate-limiting enzyme for which its inhibitor is useful in developing whitening cosmetics. Pyracantha koidzumii (Hayata Rehder is an endemic species in Taiwan that exhibits tyrosinase-inhibitory activity. To find new active natural compounds from P. koidzumii, we performed bioguided isolation and studied the related activity in human epidermal melanocytes. In total, 13 compounds were identified from P. koidzumii in the present study, including two new compounds, 3,6-dihydroxy-2,4-dimethoxy-dibenzofuran (9 and 3,4-dihydroxy-5-methoxybiphenyl-2ʹ-O-β-d-glucopyranoside (13, as well as 11 known compounds. The new compound 13 exhibited maximum potency in inhibiting cellular tyrosinase activity, the protein expression of cellular tyrosinase and tyrosinase-related protein-2, as well as the mRNA expression of Paired box 3 and microphthalmia-associated transcription factor in a concentration-dependent manner. In the enzyme kinetic assay, the new compound 13 acted as an uncompetitive mixed-type inhibitor against the substrate l-3,4-dihydroxyphenylalanine and had a Km value against this substrate of 0.262 mM, as calculated using the Lineweaver–Burk plots. Taken together, our findings show compound 13 exhibits tyrosinase inhibition in human melanocytes and compound 13 may be a potential candidate for use in cosmetics.

  12. Trichloroethylene-mediated cytotoxicity in human epidermal keratinocytes is mediated by the rapid accumulation of intracellular calcium: Interception by naringenin.

    Science.gov (United States)

    Ali, F; Khan, A Q; Khan, R; Sultana, S

    2016-02-01

    Industrial solvents pose a significant threat to the humankind. The mechanisms of their toxicity still remain in debate. Trichloroethylene (TCE) is a widespread industrial solvent responsible for severe liver dysfunction, cutaneous toxicity in occupationally exposed humans. We utilized an in vitro system of human epidermal keratinocyte (HaCaT) cells in this study to avoid complex cell and extracellular interactions. We report the cytotoxicity of organic solvent TCE in HaCaT and its reversal by a natural flavanone, naringenin (Nar). The cytotoxicity was attributed to the rapid intracellular free calcium (Ca(2+)) release, which might lead to the elevation of protein kinase C along with robust free radical generation, instability due to energy depletion, and sensitization of intracellular stress signal transducer nuclear factor κB. These effects were actually seen to induce significant amount of genomic DNA fragmentation. Furthermore, all these effects of TCE were effectively reversed by the treatment of Nar, a natural flavanone. Our studies identify intracellular Ca as a unique target used by organic solvents in the cytotoxicity and highlight the Ca(2+) ion stabilizer properties of Nar. © The Author(s) 2015.

  13. 125I-human epidermal growth factor specific binding to placentas and fetal membranes from varoius pregnancy states

    International Nuclear Information System (INIS)

    Hofmann, G.E.; Siddiqi, T.A.; Rao, Ch. V.; Carman, F.R.

    1988-01-01

    Specific binding of 125 I-human epidermal growth factor (hEGF) to homogenates of term human placentas and fetal membranes from normal and appropriate for gestational age (N = 20), intrauterine growth retarded (N = 9), twin (N = 11), White class A/B diabetic (N = 12), and large for gestational age (N = 13) pregnancies was measured. In all pregnancy states, placentas bound approximately four times more 125 I-hEGF than did fetal membranes (P 125 I-hEGF binding to fetal membranes from the various pregnancy states (P 125 I-hEGF specific binding to placentas from intrauterine growth retarded or twin pregnancies was significantly greater compared with placentas from normal and appropriate for gestational age pregnancies (P 125 I-hEGF specific binding did not differ between placentas from intrauterine growth retarded or twin pregnancies (P 125 I-hEGF binding did not vary with fetal sex, maternal race, placental weight, or gestational age between 37 to 42 weeks (P 125 I-hEGF binding increased with increasing infant weight when appropriate for gestational age and large for gestational age infants were included (P<0.05, r = 0.38, N = 32) but not for intrauterine growth retarded, appropriate for gestational age, or large for gestational age infants alone. (author)

  14. New Whitening Constituents from Taiwan-Native Pyracantha koidzumii: Structures and Tyrosinase Inhibitory Analysis in Human Epidermal Melanocytes

    Science.gov (United States)

    Lin, Rong-Dih; Chen, Mei-Chuan; Liu, Yan-Ling; Lin, Yi-Tzu; Lu, Mei-Kuang; Hsu, Feng-Lin; Lee, Mei-Hsien

    2015-01-01

    Nontoxic natural products useful in skin care cosmetics are of considerable interest. Tyrosinase is a rate-limiting enzyme for which its inhibitor is useful in developing whitening cosmetics. Pyracantha koidzumii (Hayata) Rehder is an endemic species in Taiwan that exhibits tyrosinase-inhibitory activity. To find new active natural compounds from P. koidzumii, we performed bioguided isolation and studied the related activity in human epidermal melanocytes. In total, 13 compounds were identified from P. koidzumii in the present study, including two new compounds, 3,6-dihydroxy-2,4-dimethoxy-dibenzofuran (9) and 3,4-dihydroxy-5-methoxybiphenyl-2ʹ-O-β-d-glucopyranoside (13), as well as 11 known compounds. The new compound 13 exhibited maximum potency in inhibiting cellular tyrosinase activity, the protein expression of cellular tyrosinase and tyrosinase-related protein-2, as well as the mRNA expression of Paired box 3 and microphthalmia-associated transcription factor in a concentration-dependent manner. In the enzyme kinetic assay, the new compound 13 acted as an uncompetitive mixed-type inhibitor against the substrate l-3,4-dihydroxyphenylalanine and had a Km value against this substrate of 0.262 mM, as calculated using the Lineweaver–Burk plots. Taken together, our findings show compound 13 exhibits tyrosinase inhibition in human melanocytes and compound 13 may be a potential candidate for use in cosmetics. PMID:26633381

  15. Comparison of rat epidermal keratinocyte organotypic culture (ROC) with intact human skin

    DEFF Research Database (Denmark)

    Pappinen, Sari; Hermansson, Martin; Kuntsche, Judith

    2008-01-01

    study was to compare the stratum corneum lipid content of ROC with the corresponding material from human skin. The lipid composition was determined by thin-layer chromatography (TLC) and mass-spectrometry, and the thermal phase transitions of stratum corneum were studied by differential scanning...... calorimetry (DSC). All major lipid classes of the stratum corneum were present in ROC in a similar ratio as found in human stratum corneum. Compared to human skin, the level of non-hydroxyacid-sphingosine ceramide (NS) was increased in ROC, while alpha-hydroxyacid-phytosphingosine ceramide (AP) and non...... compared to human skin, in agreement with the results from DSC. ROC underwent a lipid lamellar order to disorder transition (T2) at a slightly lower temperature (68 degrees C) than human skin (74 degrees C). These differences in stratum corneum lipid composition and the thermal phase transitions may...

  16. Inhibition of iodine-125-labeled human follitropin binding to testicular receptor by epidermal growth factor and synthetic peptides

    International Nuclear Information System (INIS)

    Sluss, P.M.; Krystek, S.R. Jr.; Andersen, T.T.; Melson, B.E.; Huston, J.S.; Ridge, R.; Reichert, L.E. Jr.

    1986-01-01

    Two tetrapeptide sequence homologies between mouse epidermal growth factor precursor (mEGFP) and human follitropin (FSH) were revealed by a computer program that identifies identical residues among polypeptide sequences. The two tetrapeptides, Lys-Thr-Cys-Thr (KTCT) and Thr-Arg-Asp-Leu (TRDL), are present in the hormone-specific beta subunit of FSH from all species studied. These tetrapeptides are not present in the alpha subunit, which is common to all pituitary glycoprotein hormones. Both tetrapeptides are also found in mEGFP, and one tetrapeptide, TRDL, is located within the 53-residue form of mEGF purified from mouse submaxillary glands. Computer-generated hydropathy profiles predicted that both tetrapeptides are located in hydrophilic portions of the FSH beta subunit and that TRDL is in a hydrophilic portion of commercially available mEGF. Therefore, the tetrapeptides might be accessible to receptor binding sites for FSH. We report that mEGF inhibits binding of 125 I-labeled human FSH to receptors in testis by 50% (I50) at a concentration of 1.8 X 10(-5) M. No binding inhibition was observed by GnRH or arginine-vasopressin at 10(-4) M, neither of which contain the tetrapeptide sequences. FSH beta subunit, which contains both tetrapeptides, also inhibited binding (I50 = 9 X 10(-8) M) of 125 I-labeled human FSH to testis receptor. Thus, it appears that FSH beta subunit and mEGF are capable of inhibiting binding of FSH to testicular FSH receptors, presumably through interactions that include the homologous tetrapeptides. This presumption was supported by the observation that the synthetic tetrapeptides (KTCT or TRDL) were also active in inhibiting binding of 125 I-labeled human FSH to testis receptor

  17. Development of an affinity-matured humanized anti-epidermal growth factor receptor antibody for cancer immunotherapy.

    Science.gov (United States)

    Nakanishi, Takeshi; Maru, Takamitsu; Tahara, Kazuhiro; Sanada, Hideaki; Umetsu, Mitsuo; Asano, Ryutaro; Kumagai, Izumi

    2013-02-01

    We showed previously that humanization of 528, a murine anti-epidermal growth factor receptor (EGFR) antibody, causes reduced affinity for its target. Here, to improve the affinity of the humanized antibody for use in cancer immunotherapy, we constructed phage display libraries focused on the complementarity-determining regions (CDRs) of the antibody and carried out affinity selection. Two-step selections using libraries constructed in a stepwise manner enabled a 32-fold affinity enhancement of humanized 528 (h528). Thermodynamic analysis of the interactions between the variable domain fragment of h528 (h528Fv) mutants and the soluble extracellular domain of EGFR indicated that the h528Fv mutants obtained from the first selection showed a large increase in negative enthalpy change due to binding, resulting in affinity enhancement. Furthermore, mutants from the second selection showed a decrease in entropy loss, which led to further affinity maturation. These results suggest that a single mutation in the heavy chain variable domain (i.e. Tyr(52) to Trp) enthalpically contributed for overcoming the energetic barrier to the antigen-antibody interaction, which was a major hurdle for the in vitro affinity maturation of h528. We reported previously that the humanized bispecific diabody hEx3 Db, which targets EGFR and CD3, shows strong anti-tumor activity. hEx3 Db mutants, in which the variable domains of h528 were replaced with those of the affinity-enhanced mutants, were prepared and characterized. In a growth inhibition assay of tumor cells, the hEx3 Db mutants showed stronger anti-tumor activity than that of hEx3 Db, suggesting that affinity enhancement of h528Fv enhances the anti-tumor activity of the bispecific diabody.

  18. Homeobox A7 increases cell proliferation by up-regulation of epidermal growth factor receptor expression in human granulosa cells

    Directory of Open Access Journals (Sweden)

    Yanase Toshihiko

    2010-06-01

    Full Text Available Abstract Background Homeobox (HOX genes encode transcription factors, which regulate cell proliferation, differentiation, adhesion, and migration. The deregulation of HOX genes is frequently associated with human reproductive system disorders. However, knowledge regarding the role of HOX genes in human granulosa cells is limited. Methods To determine the role of HOXA7 in the regulation and associated mechanisms of cell proliferation in human granulosa cells, HOXA7 and epidermal growth factor receptor (EGFR expressions were examined in primary granulosa cells (hGCs, an immortalized human granulosa cell line, SVOG, and a granulosa tumor cell line, KGN, by real-time PCR and Western blotting. To manipulate the expression of HOXA7, the HOXA7 specific siRNA was used to knockdown HOXA7 in KGN. Conversely, HOXA7 was overexpressed in SVOG by transfection with the pcDNA3.1-HOAX7 vector. Cell proliferation was measured by the MTT assay. Results Our results show that HOXA7 and EGFR were overexpressed in KGN cells compared to hGCs and SVOG cells. Knockdown of HOXA7 in KGN cells significantly decreased cell proliferation and EGFR expression. Overexpression of HOXA7 in SVOG cells significantly promoted cell growth and EGFR expression. Moreover, the EGF-induced KGN proliferation was abrogated, and the activation of downstream signaling was diminished when HOXA7 was knocked down. Overexpression of HOXA7 in SVOG cells had an opposite effect. Conclusions Our present study reveals a novel mechanistic role for HOXA7 in modulating granulosa cell proliferation via the regulation of EGFR. This finding contributes to the knowledge of the pro-proliferation effect of HOXA7 in granulosa cell growth and differentiation.

  19. Human papillomavirus E6/E7 oncogenes promote mouse ear regeneration by increasing the rate of wound re-epithelization and epidermal growth.

    Science.gov (United States)

    Valencia, Concepción; Bonilla-Delgado, José; Oktaba, Katarzyna; Ocádiz-Delgado, Rodolfo; Gariglio, Patricio; Covarrubias, Luis

    2008-12-01

    Mammals have limited regeneration capacity. We report here that, in transgenic mice (Tg(bK6-E6/E7)), the expression of the E6/E7 oncogenes of human papilloma virus type 16 (HPV16) under the control of the bovine keratin 6 promoter markedly improves the mouse's capacity to repair portions of the ear after being wounded. Increased repair capacity correlates with an increased number of epidermal proliferating cells. In concordance with the expected effects of the E6 and E7 oncogenes, levels of p53 decreased and those of p16 in epidermal cells increased. In addition, we observed that wound re-epithelization proceeded faster in transgenic than in wild-type animals. After the initial re-epithelization, epidermal cell migration from the intact surrounding tissue appears to be a major contributor to the growing epidermis, especially in the repairing tissue of transgenic mice. We also found that there is a significantly higher number of putative epidermal stem cells in Tg(bK6-E6/E7) than in wild-type mice. Remarkably, hair follicles and cartilage regenerated within the repaired ear tissue, without evidence of tumor formation. We propose that the ability to regenerate ear portions is limited by the capacity of the epidermis to repair itself and grow.

  20. Structural model for the interaction of a designed Ankyrin Repeat Protein with the human epidermal growth factor receptor 2.

    Directory of Open Access Journals (Sweden)

    V Chandana Epa

    Full Text Available Designed Ankyrin Repeat Proteins are a class of novel binding proteins that can be selected and evolved to bind to targets with high affinity and specificity. We are interested in the DARPin H10-2-G3, which has been evolved to bind with very high affinity to the human epidermal growth factor receptor 2 (HER2. HER2 is found to be over-expressed in 30% of breast cancers, and is the target for the FDA-approved therapeutic monoclonal antibodies trastuzumab and pertuzumab and small molecule tyrosine kinase inhibitors. Here, we use computational macromolecular docking, coupled with several interface metrics such as shape complementarity, interaction energy, and electrostatic complementarity, to model the structure of the complex between the DARPin H10-2-G3 and HER2. We analyzed the interface between the two proteins and then validated the structural model by showing that selected HER2 point mutations at the putative interface with H10-2-G3 reduce the affinity of binding up to 100-fold without affecting the binding of trastuzumab. Comparisons made with a subsequently solved X-ray crystal structure of the complex yielded a backbone atom root mean square deviation of 0.84-1.14 Ångstroms. The study presented here demonstrates the capability of the computational techniques of structural bioinformatics in generating useful structural models of protein-protein interactions.

  1. EPIDERMAL GROWTH FACTOR RECEPTOR (EGFR AND HUMAN PAPILLOMAVIRUS (HPV L1 CAPSID PROTEIN IN CERVICAL SQUAMOUS INTRAEPITHELIAL LESIONS

    Directory of Open Access Journals (Sweden)

    Balan Raluca

    2010-09-01

    Full Text Available We analyzed the immunohistochemical pattern of epidermal growth factor receptor (EGFR in cervical squamous intraepithelial lesions (SILs in correlation with L1 HPV capsid protein, in order to determine the relationship between EGFR expression and the infection status of human papillomavirus (HPV. The study included 40 cases, 24 LSIL (low grade SIL (CIN1, cervical intraepithelial neoplasia and 16 HSIL (high grade SIL (6 cases of CIN2 and 10 cases of CIN3. The immunoexpression of L1 HPV protein was assessed on conventional cervico-vaginal smears and EGFR was immunohistochemically evaluated on the corresponding cervical biopsies. The HPV L1 capsid protein was expressed in 45.83% of LSIL and 25% of HSIL. EGFR was overexpressed in 62,4% of HSIL (58,4% CIN2 and 41,6% CIN3 and 37,6% LSIL. The immunoexpression of L1 HPV has clinical application in the progression assessment of the cervical precancerous lesions without a correlation to the grade of the cervical SIL. EGFR is expressed by all proliferating squamous epithelial cells, thus corresponding with the grade of SIL. The evaluation of EGFR status, correlated with L1 HPV protein expression, can provide useful data of progression risk of cervical squamous intraepithelial lesions

  2. Evolving landscape of human epidermal growth factor receptor 2-positive breast cancer treatment and the future of biosimilars.

    Science.gov (United States)

    Jackisch, Christian; Lammers, Philip; Jacobs, Ira

    2017-04-01

    Human epidermal growth factor receptor 2-positive (HER2+) breast cancer comprises approximately 15%-20% of all breast cancers and is associated with a poor prognosis. The introduction of anti-HER2 therapy has significantly improved clinical outcomes for patients with HER2+ breast cancer, and multiple HER2-directed agents (ie, trastuzumab, pertuzumab, lapatinib, and ado-trastuzumab emtansine [T-DM1]) are approved for clinical use in various settings. The treatment landscape for patients with HER2+ breast cancer is continuing to evolve. While novel agents and therapeutic strategies are emerging, biologic therapies, particularly trastuzumab, are likely to remain a mainstay of treatment. However, access issues create barriers to the use of biologics, and there is evidence for underuse of trastuzumab worldwide. A biosimilar is a biologic product that is highly similar to a licensed biologic in terms of product safety and effectiveness. Biosimilars of trastuzumab are in development and may soon become available. The introduction of biosimilars may improve access to anti-HER2 therapies by providing additional treatment options and lower-cost alternatives. Because HER2-targeted drugs may be administered for extended periods of time and in combination with other systemic therapies, biosimilars have the potential to result in significant savings for healthcare systems. Herein we review current and emerging treatment options for, and discuss the possible role of biosimilars in, treating patients with HER2+ breast cancer. Copyright © 2017 Authors, Pfizer Inc. Published by Elsevier Ltd.. All rights reserved.

  3. Association of Polymorphisms in Connective Tissue Growth Factor and Epidermal Growth Factor Receptor Genes With Human Longevity.

    Science.gov (United States)

    Donlon, Timothy A; Morris, Brian J; He, Qimei; Chen, Randi; Masaki, Kamal H; Allsopp, Richard C; Willcox, D Craig; Tranah, Gregory J; Parimi, Neeta; Evans, Daniel S; Flachsbart, Friederike; Nebel, Almut; Kim, Duk-Hwan; Park, Joobae; Willcox, Bradley J

    2017-08-01

    Growth pathways play key roles in longevity. The present study tested single-nucleotide polymorphisms (SNPs) in the connective tissue growth factor gene (CTGF) and the epidermal growth factor receptor gene (EGFR) for association with longevity. Comparison of allele and genotype frequencies of 12 CTGF SNPs and 41 EGFR SNPs between 440 American men of Japanese ancestry aged ≥95 years and 374 men of average life span revealed association with longevity at the p cases, consistent with heterozygote advantage in living to extreme old age. No associations of the most significant SNPs were observed in whites or Koreans. In conclusion, the present findings indicate that genetic variation in CTGF and EGFR may contribute to the attainment of extreme old age in Japanese. More research is needed to confirm that genetic variation in CTGF and EGFR contributes to the attainment of extreme old age across human populations. © The Author 2016. Published by Oxford University Press on behalf of The Gerontological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  4. Pattern of distribution of blood group antigens on human epidermal cells during maturation

    DEFF Research Database (Denmark)

    Dabelsteen, Erik; Buschard, Karsten; Hakomori, Sen-Itiroh

    1984-01-01

    The distribution in human epidermis of A, B, and H blood group antigens and of a precursor carbohydrate chain, N-acetyl-lactosamine, was examined using immunofluorescence staining techniques. The material included tissue from 10 blood group A, 4 blood group B, and 9 blood group O persons. Murine...... on the lower spinous cells whereas H antigen was seen predominantly on upper spinous cells or on the granular cells. Epithelia from blood group A or B persons demonstrated A or B antigens, respectively, but only if the tissue sections were trypsinized before staining. In such cases A or B antigens were found...... monoclonal antibodies were used to identify H antigen (type 2 chain) and N-acetyl-lactosamine. Human antisera were used to identify A and B antigens. In all groups N-acetyl-lactosamine and H antigen were found on the cell membranes of the spinous cell layer. N-acetyl-lactosamine was present mainly...

  5. Lipidomic analysis of epidermal lipids: a tool to predict progression of inflammatory skin disease in humans.

    Science.gov (United States)

    Li, Shan; Ganguli-Indra, Gitali; Indra, Arup K

    2016-05-01

    Lipidomics is the large-scale profiling and characterization of lipid species in a biological system using mass spectrometry. The skin barrier is mainly comprised of corneocytes and a lipid-enriched extracellular matrix. The major skin lipids are ceramides, cholesterol and free fatty acids (FFA). Lipid compositions are altered in inflammatory skin disorders with disrupted skin barrier such as atopic dermatitis (AD). Here we discuss some of the recent applications of lipidomics in human skin biology and in inflammatory skin diseases such as AD, psoriasis and Netherton syndrome. We also review applications of lipidomics in human skin equivalent and in pre-clinical animal models of skin diseases to gain insight into the pathogenesis of the skin disease. Expert commentary: Skin lipidomics analysis could be a fast, reliable and noninvasive tool to characterize the skin lipid profile and to monitor the progression of inflammatory skin diseases such as AD.

  6. Materials and optimized designs for human-machine interfaces via epidermal electronics.

    Science.gov (United States)

    Jeong, Jae-Woong; Yeo, Woon-Hong; Akhtar, Aadeel; Norton, James J S; Kwack, Young-Jin; Li, Shuo; Jung, Sung-Young; Su, Yewang; Lee, Woosik; Xia, Jing; Cheng, Huanyu; Huang, Yonggang; Choi, Woon-Seop; Bretl, Timothy; Rogers, John A

    2013-12-17

    Thin, soft, and elastic electronics with physical properties well matched to the epidermis can be conformally and robustly integrated with the skin. Materials and optimized designs for such devices are presented for surface electromyography (sEMG). The findings enable sEMG from wide ranging areas of the body. The measurements have quality sufficient for advanced forms of human-machine interface. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. Linking γ-aminobutyric acid A receptor to epidermal growth factor receptor pathways activation in human prostate cancer.

    Science.gov (United States)

    Wu, Weijuan; Yang, Qing; Fung, Kar-Ming; Humphreys, Mitchell R; Brame, Lacy S; Cao, Amy; Fang, Yu-Ting; Shih, Pin-Tsen; Kropp, Bradley P; Lin, Hsueh-Kung

    2014-03-05

    Neuroendocrine (NE) differentiation has been attributed to the progression of castration-resistant prostate cancer (CRPC). Growth factor pathways including the epidermal growth factor receptor (EGFR) signaling have been implicated in the development of NE features and progression to a castration-resistant phenotype. However, upstream molecules that regulate the growth factor pathway remain largely unknown. Using androgen-insensitive bone metastasis PC-3 cells and androgen-sensitive lymph node metastasis LNCaP cells derived from human prostate cancer (PCa) patients, we demonstrated that γ-aminobutyric acid A receptor (GABA(A)R) ligand (GABA) and agonist (isoguvacine) stimulate cell proliferation, enhance EGF family members expression, and activate EGFR and a downstream signaling molecule, Src, in both PC-3 and LNCaP cells. Inclusion of a GABA(A)R antagonist, picrotoxin, or an EGFR tyrosine kinase inhibitor, Gefitinib (ZD1839 or Iressa), blocked isoguvacine and GABA-stimulated cell growth, trans-phospohorylation of EGFR, and tyrosyl phosphorylation of Src in both PCa cell lines. Spatial distributions of GABAAR α₁ and phosphorylated Src (Tyr416) were studied in human prostate tissues by immunohistochemistry. In contrast to extremely low or absence of GABA(A)R α₁-positive immunoreactivity in normal prostate epithelium, elevated GABA(A)R α₁ immunoreactivity was detected in prostate carcinomatous glands. Similarly, immunoreactivity of phospho-Src (Tyr416) was specifically localized and limited to the nucleoli of all invasive prostate carcinoma cells, but negative in normal tissues. Strong GABAAR α₁ immunoreactivity was spatially adjacent to the neoplastic glands where strong phospho-Src (Tyr416)-positive immunoreactivity was demonstrated, but not in adjacent to normal glands. These results suggest that the GABA signaling is linked to the EGFR pathway and may work through autocrine or paracine mechanism to promote CRPC progression. Copyright © 2013 Elsevier

  8. /sup 125/I-human epidermal growth factor specific binding to placentas and fetal membranes from varoius pregnancy states

    Energy Technology Data Exchange (ETDEWEB)

    Hofmann, G.E.; Siddiqi, T.A.; Rao, Ch. V.; Carman, F.R.

    1988-01-01

    Specific binding of /sup 125/I-human epidermal growth factor (hEGF) to homogenates of term human placentas and fetal membranes from normal and appropriate for gestational age (N = 20), intrauterine growth retarded (N = 9), twin (N = 11), White class AB diabetic (N = 12), and large for gestational age (N = 13) pregnancies was measured. In all pregnancy states, placentas bound approximately four times more /sup 125/I-hEGF than did fetal membranes (P<0.0001). There was no significant differnce in /sup 125/I-hEGF binding to fetal membranes from the various pregnancy states (P<0.05). /sup 125/I-hEGF specific binding to placentas from intrauterine growth retarded or twin pregnancies was significantly greater compared with placentas from normal and appropriate for gestational age pregnancies (P<0.05). The binding to placentas from pregnancies complicated by White class AB diabetes or large for gestational age infants, on the other hand, was not significantly different from that to placentas from normal and appropriate for gestational age pregnancies. /sup 125/I-hEGF specific binding did not differ between placentas from intrauterine growth retarded or twin pregnancies (P<0.05). Placental and fetal membrane /sup 125/I-hEGF binding did not vary with fetal sex, maternal race, placental weight, or gestational age between 37 to 42 weeks (P<0.05). Placental but not fetal membrane /sup 125/I-hEGF binding increased with increasing infant weight when appropriate for gestational age and large for gestational age infants were included (P<0.05, r = 0.38, N = 32) but not for intrauterine growth retarded, appropriate for gestational age, or large for gestational age infants alone.

  9. A role for the epidermal growth factor receptor signaling in development of intestinal serrated polyps in mice and humans.

    Science.gov (United States)

    Bongers, Gerold; Muniz, Luciana R; Pacer, Michelle E; Iuga, Alina C; Thirunarayanan, Nanthakumar; Slinger, Erik; Smit, Martine J; Reddy, E Premkumar; Mayer, Lloyd; Furtado, Glaucia C; Harpaz, Noam; Lira, Sergio A

    2012-09-01

    Epithelial cancers can be initiated by activating mutations in components of the mitogen-activated protein kinase signaling pathway such as v-raf murine sarcoma viral oncogene homolog B1 (BRAF), v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog (KRAS), or epidermal growth factor receptor (EGFR). Human intestinal serrated polyps are a heterogeneous group of benign lesions, but some progress to colorectal cancer. Tumors that arise from these polyps frequently contain activating mutations in BRAF or KRAS, but little is known about the role of EGFR activation in their development. Polyp samples were obtained from adults during screening colonoscopies at Mount Sinai Hospital in New York. We measured levels of EGFR protein and phosphorylation in human serrated polyps by immunohistochemical and immunoblot analyses. We generated transgenic mice that express the ligand for EGFR, Heparin-binding EGF-like growth factor (HB-EGF), in the intestine. EGFR and the extracellular-regulated kinases (ERK)1/2 were phosphorylated in serrated areas of human hyperplastic polyps (HPPs), sessile serrated adenomas, and traditional serrated adenomas. EGFR and ERK1/2 were phosphorylated in the absence of KRAS or BRAF activating mutations in a subset of HPP. Transgenic expression of the EGFR ligand HB-EGF in the intestines of mice promoted development of small cecal serrated polyps. Mice that expressed a combination of HB-EGF and US28 (a constitutively active, G-protein-coupled receptor that increases processing of HB-EGF from the membrane) rapidly developed large cecal serrated polyps. These polyps were similar to HPPs and had increased phosphorylation of EGFR and ERK1/2 within the serrated epithelium. Administration of pharmacologic inhibitors of EGFR or MAPK to these transgenic mice significantly reduced polyp development. Activation of EGFR signaling in the intestine of mice promotes development of serrated polyps. EGFR signaling also is activated in human HPPs, sessile serrated adenomas

  10. Circulating chromatin-anti-chromatin antibody complexes bind with high affinity to dermo-epidermal structures in murine and human lupus nephritis

    DEFF Research Database (Denmark)

    Fismen, S; Hedberg, A; Fenton, K A

    2009-01-01

    Murine and human lupus nephritis are characterized by glomerular deposits of electron-dense structures (EDS). Dominant components of EDS are chromatin fragments and IgG antibodies. Whether glomerular EDS predispose for similar deposits in skin is unknown. We analysed (i) whether dermo-epidermal i......Murine and human lupus nephritis are characterized by glomerular deposits of electron-dense structures (EDS). Dominant components of EDS are chromatin fragments and IgG antibodies. Whether glomerular EDS predispose for similar deposits in skin is unknown. We analysed (i) whether dermo......-epidermal immune complex deposits have similar molecular composition as glomerular deposits, (ii) whether chromatin fragments bind dermo-epidermal structures, and (iii) whether deposits in nephritic glomeruli predispose for accumulation of similar deposits in skin. Paired skin and kidney biopsies from nephritic...... (NZBxNZW)F1 and MRL-lpr/lpr mice and from five patients with lupus nephritis were analysed by immunofluorescence, immune electron microscopy (IEM) and co-localization TUNEL IEM. Affinity of chromatin fragments for membrane structures was determined by surface plasmon resonance. Results demonstrated (i...

  11. Differential regulation of type I interferon and epidermal growth factor pathways by a human Respirovirus virulence factor.

    Directory of Open Access Journals (Sweden)

    Grégory Caignard

    2009-09-01

    Full Text Available A number of paramyxoviruses are responsible for acute respiratory infections in children, elderly and immuno-compromised individuals, resulting in airway inflammation and exacerbation of chronic diseases like asthma. To understand the molecular pathogenesis of these infections, we searched for cellular targets of the virulence protein C of human parainfluenza virus type 3 (hPIV3-C. We found that hPIV3-C interacts directly through its C-terminal domain with STAT1 and GRB2, whereas C proteins from measles or Nipah viruses failed to do so. Binding to STAT1 explains the previously reported capacity of hPIV3-C to block type I interferon signaling, but the interaction with GRB2 was unexpected. This adaptor protein bridges Epidermal Growth Factor (EGF receptor to MAPK/ERK pathway, a signaling cascade recently found to be involved in airway inflammatory response. We report that either hPIV3 infection or transient expression of hPIV3-C both increase cellular response to EGF, as assessed by Elk1 transactivation and phosphorylation levels of ERK1/2, 40S ribosomal subunit protein S6 and translation initiation factor 4E (eIF4E. Furthermore, inhibition of MAPK/ERK pathway with U0126 prevented viral protein expression in infected cells. Altogether, our data provide molecular basis to explain the role of hPIV3-C as a virulence factor and determinant of pathogenesis and demonstrate that Paramyxoviridae have evolved a single virulence factor to block type I interferon signaling and to boost simultaneous cellular response to growth factors.

  12. Human epidermal growth factor receptor 2 status of gastric cancer patients in Asia: results from a large, multicountry study.

    Science.gov (United States)

    Pathmanathan, Nirmala; Geng, Jing-Shu; Li, Wencai; Nie, Xiu; Veloso, Januario; Wang, John; Hill, Julie; Mccloud, Philip; Bilous, Michael

    2017-06-01

    Current estimates of the human epidermal growth factor receptor 2 (HER2)-positivity rate in gastric cancer vary widely in the literature, and there are limited data from countries in Asia. The primary aim of this study was to conduct a clinical audit of laboratories across seven countries in Asia to determine the incidence of HER2-positive gastric cancer in this region. Pathologists were asked to collect data on patient gender, age, cancer site, specimen type, tumor spread, type and grade, HER2 test results, including protein and/or gene copy enumeration, and final HER2 status on consecutive gastric cancer cases tested for HER2 in their laboratory over a 2-year period. HER2 results from 5,301 gastric cancers were submitted by 50 laboratories. The overall HER2-positivity rate was 9.7% which, after the exclusion of China, increased to 18.1%. The rate between countries ranged from 0% to 23.1%, and from 0% to 50.0% between laboratories. An equivocal HER2 result was recorded in 19.5% of cases. Despite the lack of centralized testing to confirm the accuracy of HER2 diagnoses, the incidence of HER2-positive gastric cancer observed here was comparable to that reported in the literature. Nevertheless, rates were highly variable between countries and laboratories, which suggests a lack of HER2 testing expertise in gastric cancer. Given that the mortality rates for gastric cancer in Eastern Asia are the highest in the world, efforts should focus on improving HER2 testing expertise in the region so that patients receive the appropriate treatment early in their disease. © 2016 The Authors. Asia-Pacific Journal of Clinical Oncology Published by John Wiley & Sons Australia, Ltd.

  13. Epidermal changes following application of 7,12-dimethylbenz(a)anthracene and 12-O-tetradecanoylphorbol-13-acetate to human skin transplanted to nude mice studied with histological species markers

    International Nuclear Information System (INIS)

    Graem, N.

    1986-01-01

    Effects of the tumor initiator 7,12-dimethylbenz(a)anthracene (DMBA) and of the tumor promoter 12-O-tetradecanoylphorbol-13-acetate (TPA) on epidermis of human fetal and adult skin were studied in the nude mouse/human skin model. Human skin grafts on NC nude mice were exposed to two topical applications of 1 mg of DMBA in 50 microliter of acetone with an interval of 3 days and/or to applications of 10 micrograms of TPA in 50 microliter of acetone twice weekly. In some animals, it was attempted to augment the susceptibility of the grafts to the tumor-initiating effect of DMBA by pretreatment with TPA or ultraviolet light. The mice were sacrificed 8-32 wk after the initial treatment. Tumors did not appear in the central portions of any of the grafts, but epidermal tumors were seen at the graft border in 34.9% of the DMBA-treated animals. To identify human epidermis on the grafts and to determine the species origin of the induced tumors, two independently working histological marker methods were applied. (a) The first is detection of a human Blood Group B-like antigen present in mouse epidermis and in chemically induced murine epidermal tumors. This antigen cannot be demonstrated in human epidermis and in epidermal tumors of human patients. (b) The second is histological staining with the DNA-specific fluorochrome, bisbenzimide, displaying a characteristic pattern of 5-10 intranuclear fluorescent bodies in murine nonneoplastic epidermal cells and in murine epidermal tumor cells. Such a pattern is not seen in human epidermis and in epidermal tumors of human patients. The studies showed that TPA treatment resulted in epidermal hyperplasia in both the human epidermis and the adjacent mouse epidermis and that the induced tumors were derived from murine tissue

  14. The effects of IL-20 subfamily cytokines on reconstituted human epidermis suggest potential roles in cutaneous innate defense and pathogenic adaptive immunity in psoriasis.

    Science.gov (United States)

    Sa, Susan M; Valdez, Patricia A; Wu, Jianfeng; Jung, Kenneth; Zhong, Fiona; Hall, Linda; Kasman, Ian; Winer, Jane; Modrusan, Zora; Danilenko, Dimitry M; Ouyang, Wenjun

    2007-02-15

    IL-19, IL-20, IL-22, IL-24, and IL-26 are members of the IL-10 family of cytokines that have been shown to be up-regulated in psoriatic skin. Contrary to IL-10, these cytokines signal using receptor complex R1 subunits that are preferentially expressed on cells of epithelial origin; thus, we henceforth refer to them as the IL-20 subfamily cytokines. In this study, we show that primary human keratinocytes (KCs) express receptors for these cytokines and that IL-19, IL-20, IL-22, and IL-24 induce acanthosis in reconstituted human epidermis (RHE) in a dose-dependent manner. These cytokines also induce expression of the psoriasis-associated protein S100A7 and keratin 16 in RHE and cause persistent activation of Stat3 with nuclear localization. IL-22 had the most pronounced effects on KC proliferation and on the differentiation of KCs in RHE, inducing a decrease in the granular cell layer (hypogranulosis). Furthermore, gene expression analysis performed on cultured RHE treated with these cytokines showed that IL-19, IL-20, IL-22, and IL-24 regulate many of these same genes to variable degrees, inducing a gene expression profile consistent with inflammatory responses, wound healing re-epithelialization, and altered differentiation. Many of these genes have also been found to be up-regulated in psoriatic skin, including several chemokines, beta-defensins, S100 family proteins, and kallikreins. These results confirm that IL-20 subfamily cytokines are important regulators of epidermal KC biology with potentially pivotal roles in the immunopathology of psoriasis.

  15. An epidermal equivalent assay for identification and ranking potency of contact sensitizers

    Energy Technology Data Exchange (ETDEWEB)

    Gibbs, Susan, E-mail: S.Gibbs@VUMC.nl [Department of Dermatology, VU University Medical Centre, Dept of Oral Cell Biology, ACTA, Amsterdam (Netherlands); Corsini, Emanuela [Laboratory of Toxicology, DiSFeB, Università degli Studi di Milano (Italy); Spiekstra, Sander W. [Department of Dermatology, VU University Medical Centre, Dept of Oral Cell Biology, ACTA, Amsterdam (Netherlands); Galbiati, Valentina [Laboratory of Toxicology, DiSFeB, Università degli Studi di Milano (Italy); Fuchs, Horst W. [CellSystems GmbH, Troisdorf (Germany); DeGeorge, George; Troese, Matthew [MB Research Labs, Spinnerstown, PA (United States); Hayden, Patrick; Deng, Wei [MatTek Corporation, Ashland, MA (United States); Roggen, Erwin [3Rs Management and Consultancy (Denmark)

    2013-10-15

    The purpose of this study was to explore the possibility of combining the epidermal equivalent (EE) potency assay with the assay which assesses release of interleukin-18 (IL-18) to provide a single test for identification and classification of skin sensitizing chemicals, including chemicals of low water solubility or stability. A protocol was developed using different 3D-epidermal models including in house VUMC model, epiCS® (previously EST1000™), MatTek EpiDerm™ and SkinEthic™ RHE and also the impact of different vehicles (acetone:olive oil 4:1, 1% DMSO, ethanol, water) was investigated. Following topical exposure for 24 h to 17 contact allergens and 13 non-sensitizers a robust increase in IL-18 release was observed only after exposure to contact allergens. A putative prediction model is proposed from data obtained from two laboratories yielding 95% accuracy. Correlating the in vitro EE sensitizer potency data, which assesses the chemical concentration which results in 50% cytotoxicity (EE-EC{sub 50}) with human and animal data showed a superior correlation with human DSA{sub 05} (μg/cm{sup 2}) data (Spearman r = 0.8500; P value (two-tailed) = 0.0061) compared to LLNA data (Spearman r = 0.5968; P value (two-tailed) = 0.0542). DSA{sub 05} = induction dose per skin area that produces a positive response in 5% of the tested population Also a good correlation was observed for release of IL-18 (SI-2) into culture supernatants with human DSA{sub 05} data (Spearman r = 0.8333; P value (two-tailed) = 0.0154). This easily transferable human in vitro assay appears to be very promising, but additional testing of a larger chemical set with the different EE models is required to fully evaluate the utility of this assay and to establish a definitive prediction model. - Highlights: • A potential epidermal equivalent assay to label and classify sensitizers • Il-18 release distinguishes sensitizers from non sensitizers • IL-18 release can rank sensitizer potency

  16. An epidermal equivalent assay for identification and ranking potency of contact sensitizers

    International Nuclear Information System (INIS)

    Gibbs, Susan; Corsini, Emanuela; Spiekstra, Sander W.; Galbiati, Valentina; Fuchs, Horst W.; DeGeorge, George; Troese, Matthew; Hayden, Patrick; Deng, Wei; Roggen, Erwin

    2013-01-01

    The purpose of this study was to explore the possibility of combining the epidermal equivalent (EE) potency assay with the assay which assesses release of interleukin-18 (IL-18) to provide a single test for identification and classification of skin sensitizing chemicals, including chemicals of low water solubility or stability. A protocol was developed using different 3D-epidermal models including in house VUMC model, epiCS® (previously EST1000™), MatTek EpiDerm™ and SkinEthic™ RHE and also the impact of different vehicles (acetone:olive oil 4:1, 1% DMSO, ethanol, water) was investigated. Following topical exposure for 24 h to 17 contact allergens and 13 non-sensitizers a robust increase in IL-18 release was observed only after exposure to contact allergens. A putative prediction model is proposed from data obtained from two laboratories yielding 95% accuracy. Correlating the in vitro EE sensitizer potency data, which assesses the chemical concentration which results in 50% cytotoxicity (EE-EC 50 ) with human and animal data showed a superior correlation with human DSA 05 (μg/cm 2 ) data (Spearman r = 0.8500; P value (two-tailed) = 0.0061) compared to LLNA data (Spearman r = 0.5968; P value (two-tailed) = 0.0542). DSA 05 = induction dose per skin area that produces a positive response in 5% of the tested population Also a good correlation was observed for release of IL-18 (SI-2) into culture supernatants with human DSA 05 data (Spearman r = 0.8333; P value (two-tailed) = 0.0154). This easily transferable human in vitro assay appears to be very promising, but additional testing of a larger chemical set with the different EE models is required to fully evaluate the utility of this assay and to establish a definitive prediction model. - Highlights: • A potential epidermal equivalent assay to label and classify sensitizers • Il-18 release distinguishes sensitizers from non sensitizers • IL-18 release can rank sensitizer potency • EC50 (chemical

  17. Synthetic inhibitors of matrix metalloproteinases prevent sulfur mustard-induced epidermal-dermal separation in human skin pieces

    NARCIS (Netherlands)

    Mol, M.A.E.; Alblas, S.W.; Hammer, A.; Benschop, H.P.

    2000-01-01

    Degradation of proteins of the basement membrane zone (BMZ) in the skin depends on the activity of proteolytic enzymes, particularly those belonging to the group of matrix metalloproteinases (MMPs). In the present study we have investigated the contribution of these enzymes to the epidermal-dermal

  18. Use of a collagen-elastin matrix as transport carrier system to transfer proliferating epidermal cells to human dermis in vitro.

    Science.gov (United States)

    Waaijman, Taco; Breetveld, Melanie; Ulrich, Magda; Middelkoop, Esther; Scheper, Rik J; Gibbs, Susan

    2010-01-01

    This in vitro study describes a novel cell culture, transport, and transfer protocol that may be highly suitable for delivering cultured proliferating keratinocytes and melanocytes to large open skin wounds (e.g., burns). We have taken into account previous limitations identified using other keratinocyte transfer techniques, such as regulatory issues, stability of keratinocytes during transport (single cell suspensions undergo terminal differentiation), ease of handling during application, and the degree of epidermal blistering resulting after transplantation (both related to transplanting keratinocyte sheets). Large numbers of proliferating epidermal cells (EC) (keratinocytes and melanocytes) were generated within 10-14 days and seeded onto a three-dimensional matrix composed of elastin and collagen types I, III, and V (Matriderm®), which enabled easy and stable transport of the EC for up to 24 h under ambient conditions. All culture conditions were in accordance with the regulations set by the Dutch Central Committee on Research Involving Human Subjects (CCMO). As an in vitro model system for clinical in vivo transfer, the EC were then transferred from Matriderm onto human acellular dermis during a period of 3 days. After transfer the EC maintained the ability to regenerate into a fully differentiated epidermis containing melanocytes on the human dermis. Proliferating keratinocytes were located in the basal layer and keratin-10 expression was located in differentiating suprabasal layers similar to that found in human epidermis. No blistering was observed (separation of the epidermis from the basement membrane). Keratin-6 expression was strongly upregulated in the regenerating epidermis similar to normal wound healing. In summary, we show that EC-Matriderm contains viable, metabolically active keratinocytes and melanocytes cultured in a manner that permits easy transportation and contains epidermal cells with the potential to form a pigmented reconstructed

  19. Pharmacokinetics, biodistribution and dosimetry of {sup 99m}Tc-labeled anti-human epidermal growth factor receptor humanized monoclonal antibody R3 in rats

    Energy Technology Data Exchange (ETDEWEB)

    Escobar, Normando Iznaga; Morales, Alejo Morales; Duconge, Jorge; Torres, Idania Caballero; Fernandez, Eduardo; Gomez, Jose A

    1998-01-01

    The pharmacokinetics, biodistribution and dosimetry of {sup 99m}Tc-labeled anti-human epidermal growth factor receptor (anti-hEGF-r) humanized monoclonal antibody (MAb) R3 was investigated following intravenous injection in normal Wistar rats. Serum disappearance curves were best fit by a two-compartment model having a mean distribution half-life (t{sub (1(2{alpha}}{sub ))}) of 0.250 h and a mean elimination (t{sub (1(2{beta}}{sub ))}) of 13.89 h. Among the various organs, a little accumulation of the radiolabeled antibody was found only in kidneys. Biodistribution and dosimetry studies in humans were performed by extrapolation of the animal data to humans. Absorbed dose to normal organs and the remainder of the whole body were estimated using the medical internal radiation dose formula, and dose contributions from radioactivity in transit through the gastrointestinal tract were estimated using a compartment model. Extrapolated values of radiation absorbed dose to normal organs in rads per millicurie administered were whole body, 0.0085; lower large intestine wall, 0.0898; small intestine, 0.0530; upper large intestine wall, 0.0731; and kidneys, 0.0455. The effective dose equivalent predicted was 0.0162 rem/mCi and the effective dose was found to be 0.015 rem/mCi. On the basis of the pharmacokinetics, biodistribution and internal radiation dosimetry information obtained in this study, a diagnostic phase I clinical trial with {sup 99m}Tc-labeled humanized MAb R3 conjugate in patients should be supported.

  20. Pharmacokinetics, biodistribution and dosimetry of 99mTc-labeled anti-human epidermal growth factor receptor humanized monoclonal antibody R3 in rats

    International Nuclear Information System (INIS)

    Escobar, Normando Iznaga; Morales, Alejo Morales; Duconge, Jorge; Torres, Idania Caballero; Fernandez, Eduardo; Gomez, Jose A.

    1998-01-01

    The pharmacokinetics, biodistribution and dosimetry of 99m Tc-labeled anti-human epidermal growth factor receptor (anti-hEGF-r) humanized monoclonal antibody (MAb) R3 was investigated following intravenous injection in normal Wistar rats. Serum disappearance curves were best fit by a two-compartment model having a mean distribution half-life (t (1(2α)) ) of 0.250 h and a mean elimination (t (1(2β)) ) of 13.89 h. Among the various organs, a little accumulation of the radiolabeled antibody was found only in kidneys. Biodistribution and dosimetry studies in humans were performed by extrapolation of the animal data to humans. Absorbed dose to normal organs and the remainder of the whole body were estimated using the medical internal radiation dose formula, and dose contributions from radioactivity in transit through the gastrointestinal tract were estimated using a compartment model. Extrapolated values of radiation absorbed dose to normal organs in rads per millicurie administered were whole body, 0.0085; lower large intestine wall, 0.0898; small intestine, 0.0530; upper large intestine wall, 0.0731; and kidneys, 0.0455. The effective dose equivalent predicted was 0.0162 rem/mCi and the effective dose was found to be 0.015 rem/mCi. On the basis of the pharmacokinetics, biodistribution and internal radiation dosimetry information obtained in this study, a diagnostic phase I clinical trial with 99m Tc-labeled humanized MAb R3 conjugate in patients should be supported

  1. Impact of palbociclib combinations on treatment of advanced estrogen receptor-positive/human epidermal growth factor 2-negative breast cancer

    Directory of Open Access Journals (Sweden)

    Boér K

    2016-10-01

    Full Text Available Katalin Boér Department of Medical Oncology, Szent Margit Hospital, Budapest, Hungary Abstract: Breast cancer is a heterogeneous disease with multiple subgroups based on clinical and molecular characteristics. For the largest subgroup of breast cancers, hormone receptor-positive/human epidermal growth factor 2 (HER2-negative tumors, hormone treatment is the mainstay of therapy and is likely to result in significant improvement in disease outcomes. However, some of these cancers demonstrate de novo or acquired resistance to endocrine therapy. Despite intensive research to develop new strategies to enhance the efficacy of currently available treatment options for hormone receptor-positive breast cancer, progress has been slow, and there were few advances for a period of 10 years. In 2012, a new molecularly targeted therapeutic strategy, inhibition of mammalian target of rapamycin with everolimus, was introduced into clinical practice. Everolimus, in combination with a steroidal aromatase inhibitor, exemestane, resulted in an increase in progression-free survival, but not overall survival in patients with estrogen receptor (ER+ve advanced disease who had progressed on hormone therapy. In 2015, the first cyclin-dependent kinases 4/6 (CDK4/6 inhibitor, palbociclib, received accelerated US Food and Drug Administration approval for use in combination with letrozole for the treatment of postmenopausal ER+ve/HER2-ve advanced breast cancer as initial, endocrine-based therapy. The addition of palbociclib to endocrine therapy resulted in longer progression-free survival than letrozole alone. One year later, palbociclib received a new indication, use in combination with fulvestrant, in both premenopausal and postmenopausal females with advanced breast cancer of the same subtype with disease progression following endocrine therapy. Adding palbociclib to fulvestrant resulted in a significantly increased median progression-free survival compared to fulvestrant

  2. Human epidermal growth factor receptor 2-positive breast cancer: which cytotoxic agent best complements trastuzumab's efficacy in vitro?

    Directory of Open Access Journals (Sweden)

    Hurrell T

    2013-06-01

    Full Text Available Tracey Hurrell, Kim OuthoffDepartment of Pharmacology, University of Pretoria, Pretoria, South AfricaIntroduction: Despite trastuzumab having enhanced selectivity for human epidermal growth factor receptor 2 (HER-2 overexpressing breast cancer cells, treatment is hampered by interindividual variation and tumors with high mitogenic potential. The lack of significant clinical benefit in certain patient cohorts suggests that HER-2 expression is ineffective as a sole prognostic indicator of response to therapy. Therefore, optimizing the clinical role of trastuzumab in drug combinations remains critical for clinical success.Aim: To investigate the effects of trastuzumab in combination with either doxorubicin or geldanamycin on in vitro cell viability, cell cycling, apoptosis and relative HER-2 expression in HER-2-positive (SK-BR-3 and estrogen receptor-positive (MCF-7 breast adenocarcinoma models.Results: HER-2-rich SK-BR-3 cells demonstrated a greater sensitivity to the effects of doxorubicin than MCF-7 cells. Concurrent trastuzumab exposure resulted in a further reduction in cell viability. This decreased cell viability induced by doxorubicin was associated with activation of executioner caspases as well as with alterations in cell-cycle kinetics, primarily promoting S-phase accumulation. Doxorubicin had no effect on surface HER-2 density expression. Geldanamycin reduced cell viability significantly greater in SK-BR-3 than MCF-7 cells, and was associated with G2 cell-cycle accumulation. The addition of trastuzumab did not augment these effects. Geldanamycin promoted substantial reductions in relative surface HER-2 density in SK-BR-3 cells.Conclusion: The in vitro data supported the rationale for using doxorubicin in trastuzumab-based therapies. Therefore, despite the incidence of cardiotoxicity, doxorubicin could retain a fundamental role in treating HER-2-positive breast cancer. While geldanamycin is a potent cytotoxic agent, its concurrent use

  3. Targeted delivery of polyamidoamine-paclitaxel conjugate functionalized with anti-human epidermal growth factor receptor 2 trastuzumab

    Directory of Open Access Journals (Sweden)

    Ma P

    2015-03-01

    Full Text Available Pengkai Ma,1 Xuemei Zhang,1 Ling Ni,2 Jinming Li,2 Fengpu Zhang,1 Zheng Wang,1 Shengnan Lian,1 Kaoxiang Sun1 1School of Pharmacy, Yantai University, Yantai, Shandong Province, People’s Republic of China; 2State Key Laboratory of Long-acting and Targeting Drug Delivery System, Yantai, Shandong Province, People’s Republic of China Background: Antibody-dendrimer conjugates have the potential to improve the targeting and release of chemotherapeutic drugs at the tumor site while reducing adverse side effects caused by drug accumulation in healthy tissues. In this study, trastuzumab (TMAB, which binds to human epidermal growth factor receptor 2 (HER2, was used as a targeting agent in a TMAB-polyamidoamine (PAMAM conjugate carrying paclitaxel (PTX specifically to cells overexpressing HER2. Methods: TMAB was covalently linked to a PAMAM dendrimer via bifunctional polyethylene glycol (PEG. PTX was conjugated to PAMAM using succinic anhydride as a cross-linker, yielding TMAB-PEG-PAMAM-PTX. Dynamic light scattering and transmission electron microscopy were used to characterize the conjugates. The cellular uptake and in vivo biodistribution were studied by fluorescence microscopy, flow cytometry, and Carestream In Vivo FX, respectively. Results: Nuclear magnetic resonance spectroscopy demonstrated that PEG, PTX, fluorescein isothiocyanate, and cyanine7 were conjugated to PAMAM. Ultraviolet-visible spectroscopy and sodium dodecyl sulfate polyacrylamide gel electrophoresis demonstrated that TMAB was conjugated to PEG-PAMAM. Dynamic light scattering and transmission electron microscopy measurements revealed that the different conjugates ranged in size between 10 and 35 nm and had a spherical shape. In vitro cellular uptake demonstrated that the TMAB-conjugated PAMAM was taken up by HER2-overexpressing BT474 cells more efficiently than MCF-7 cells that expressed lower levels of HER2. Co-localization experiments indicated that TMAB-conjugated PAMAM was

  4. Effects of recombinant human epidermal growth factor on the proliferation and radiation survival of human fibroblast cell lines in vitro

    International Nuclear Information System (INIS)

    Kim, Hyun Sook; Kang, Ki Mun; Na, Jae Boem; Chai, Gyu Young; Lee, Sang Wook

    2006-01-01

    To explore the effect of recombinant human EGF on the proliferation and survival of human fibroblast cell lines following irradiation. Fibroblast was originated human skin and primary cultured. The trypan blue stain assay and MTT assay were used to study the proliferative effects of EGF on human fibroblast cell lines in vitro. An incubation of fibroblasts with rhEGF for 24 hours immediately after irradiation was counted everyday. Cell cycle distributions were analyzed by FACS analysis. Number of fibroblast was significant more increased rhEGF (1.0 nM, 10 nM, 100 nM, 1,000 nM) treated cell than control after 8 Gy irradiation. Most effective dose of rhEGF was at 160 nM. These survival differences were maintained at 1 week later. Proportion of S phase was significantly increased on rhEGF treated cells. rhEGF cause increased fibroblast proliferation following irradiation. We expect that rhEGF was effective for radiation induced wound healing

  5. Autophagy participates in isoliquiritigenin-induced melanin degradation in human epidermal keratinocytes through PI3K/AKT/mTOR signaling.

    Science.gov (United States)

    Yang, Zhibo; Zeng, Biyun; Pan, Yi; Huang, Pan; Wang, Chang

    2018-01-01

    Melanin is the pigment responsible for the color of human skin and hair. Melanin serves as a double-edge sword which can exert both protective and spot-causing effects on skin. Although melanin has an important role in protecting the skin against UV damage, an excessive or uneven melanin production can lead to the formation of freckles and age spots. Isoliquiritigenin (ISL) has been reported to inhibit melanin synthesis; however, its role in melanin degradation remains unclear. In the present study, we evaluated the detailed function of ISL in melanin degradation in human epidermal keratinocytes. Since autophagy has been reported to be related to melanin degradation, we also examined the activation of autophagy by ISL treatment in keratinocytes by measurement of autophagy-related proteins, ATG7, LC3 and p62. Moreover, si-ATG7-induced ATG7 knockdown and autophagy inhibitor 3-MA decreased LC3 II protein levels and increased PMEL17, p62 and melanin levels in HaCaT cells, which could be partially reversed by ISL treatment, indicating that autophagy participated in melanin degradation. The decreased p-AKT and p-mTOR proteins upon ISL treatment indicated the involvement of PI3K/AKT/mTOR signaling in ISL-induced melanin degradation. Taken together, we demonstrated that autophagy participates in ISL-induced melanin degradation in human epidermal keratinocytes through PI3K/AKT/mTOR signaling. Copyright © 2017. Published by Elsevier Masson SAS.

  6. Human epidermal growth factor receptor 2/neu overexpression in urothelial carcinoma of the bladder and its prognostic significance: Is it worth hype?

    Directory of Open Access Journals (Sweden)

    Santosh Kumar

    2015-01-01

    Full Text Available Aims: In urothelial tumors of the urinary bladder, human epidermal growth factor receptor 2 (HER-2/neu expression has been reported over 10 years, but there is no clear correlation between prognosis and recurrence rate. The present study evaluates prognostic implication of HER-2/neu expression. Subjects and Methods: In this study, 100 formalin-fixed paraffin-embedded specimens of primary transitional cell carcinoma of the bladder were processed. HER-2/neu monoclonal antibody immunohistochemistry staining procedure used for the study. Results: A total of 70 (70% patients were positive for overexpression of HER-2/neu. HER-2/neu was positive in patients with 42 (70% superficial tumor, 28 (70% muscle invasive tumor, 41 (75.9% high-grade tumor, 29 (63% low grade tumor, 31 (68.9% recurrent tumor, and 6 (66.6% had positive lymph nodes. Conclusions: Human epidermal growth factor receptor 2/neu over expression was not correlated with the tumor stage, lymphnode metastasis or recurrence of the disease. HER-2/neu overexpression was statistically insignificantly correlated with the differentiation grade (P < 0.161 as compared to previous studies. Future studies on HER-2 expression with chemo-sensitivity and efficacy of HER-2-targeted therapies in urothelial carcinomas is needed.

  7. Evaluation of dermal-epidermal skin equivalents ('composite-skin') of human keratinocytes in a collagen-glycosaminoglycan matrix(Integra artificial skin).

    Science.gov (United States)

    Kremer, M; Lang, E; Berger, A C

    2000-09-01

    Integra artificial skin (Integra LifeSciences Corp., Plainsboro, NJ, USA) is a dermal template consisting of bovine collagen, chondroitin-6-sulphate and a silastic membrane manufactured as Integra. This product has gained widespread use in the clinical treatment of third degree burn wounds and full thickness skin defects of different aetiologies. The product was designed to significantly reduce the time needed to achieve final wound closure in the treatment of major burn wounds, to optimise the sparse autologous donor skin resources and to improve the durable mechanical quality of the skin substitute. The clinical procedure requires two stages. The first step creates a self neodermis, the second creates a self epidermis on the neodermis. However, it is desirable to cover major burn wounds early in a single step by a skin substitute consisting of a dermal equivalent seeded in vitro with autologous keratinocytes ('composite-skin') out of which a full thickness skin develops in vivo.The goal of this experimental study was to develop a method to integrate human keratinocytes in homogeneous distribution and depth into Integra Artificial Skin. The seeded cell-matrix composites were grafted onto athymic mice in order to evaluate their potential to reconstitute a human epidermis in vivo. We were able to demonstrate that the inoculated human keratinocytes reproducibly displayed a homogeneous pattern of distribution, adherence, proliferation and confluence. The cell-matrix composites grafted in this model exhibited good wound adherence, complete healing, minor wound contraction and had the potential to reconstitute an elastic, functional and durable human skin. Histologically we were able to show that the inoculated human keratinocytes in vivo colonised the matrix in a histomorphologically characteristic epidermal pattern (keratomorula, keratinocyte bubbling) and developed a persisting, stratified, keratinising epidermis which immunohistologically proved to be of human

  8. Functional imaging of human epidermal growth factor receptor 2-positive metastatic breast cancer using (64)Cu-DOTA-trastuzumab PET.

    Science.gov (United States)

    Mortimer, Joanne E; Bading, James R; Colcher, David M; Conti, Peter S; Frankel, Paul H; Carroll, Mary I; Tong, Shan; Poku, Erasmus; Miles, Joshua K; Shively, John E; Raubitschek, Andrew A

    2014-01-01

    Women with human epidermal growth factor receptor 2 (HER2)-positive breast cancer are candidates for treatment with the anti-HER2 antibody trastuzumab. Assessment of HER2 status in recurrent disease is usually made by core needle biopsy of a single lesion, which may not represent the larger tumor mass or other sites of disease. Our long-range goal is to develop PET of radiolabeled trastuzumab for systemically assessing tumor HER2 expression and identifying appropriate use of anti-HER2 therapies. The purpose of this study was to evaluate PET/CT of (64)Cu-DOTA-trastuzumab for detecting and measuring tumor uptake of trastuzumab in patients with HER2-positive metastatic breast cancer. Eight women with biopsy-confirmed HER2-positive metastatic breast cancer and no anti-HER2 therapy for 4 mo or longer underwent complete staging, including (18)F-FDG PET/CT. For 6 of the 8 patients, (64)Cu-DOTA-trastuzumab injection (364-512 MBq, 5 mg of trastuzumab) was preceded by trastuzumab infusion (45 mg). PET/CT (PET scan duration 1 h) was performed 21-25 (day 1) and 47-49 (day 2) h after (64)Cu-DOTA-trastuzumab injection. Scan fields of view were chosen on the basis of (18)F-FDG PET/CT. Tumor detection sensitivity and uptake analyses were limited to lesions identifiable on CT; lesions visualized relative to adjacent tissue on PET were considered PET-positive. Radiolabel uptake in prominent lesions was measured as maximum single-voxel standardized uptake value (SUVmax). Liver uptake of (64)Cu was reduced approximately 75% with the 45-mg trastuzumab predose, without significant effect on tumor uptake. The study included 89 CT-positive lesions. Detection sensitivity was 77%, 89%, and 93% for day 1, day 2, and (18)F-FDG, respectively. On average, tumor uptake was similar for (64)Cu-DOTA-trastuzumab and (18)F-FDG (SUVmax and range, 8.1 and 3.0-22.5 for day 1 [n = 48]; 8.9 and 0.9-28.9 for day 2 [n = 38]; 9.7 and 3.3-25.4 for (18)F-FDG [n = 56]), but same-lesion SUVmax was not correlated

  9. Cultivation and irradiation of human fibroblasts in a medium enriched with platelet lysate for obtaining feeder layer in epidermal cell culture

    International Nuclear Information System (INIS)

    Yoshito, Daniele

    2011-01-01

    For over 30 years, the use of culture medium, enriched with bovine serum, and murines fibroblasts, with the rate of proliferation controlled by irradiation or by share anticarcinogenic drugs, has been playing successfully its role in assisting in the development of keratinocytes in culture, for clinical purposes. However, currently there is a growing concern about the possibility of transmitting prions and animals viruses to transplanted patients. Taking into account this concern, the present work aims to cultivate human fibroblasts in a medium enriched with human platelets lysate and determine the irradiation dose of these cells, for obtaining feeder layer in epidermal cell culture. For carrying out the proposed objective, platelets lysis has standardized, this lysate was used for human fibroblasts cultivation and the irradiation dose enough to inhibit its duplication was evaluated. Human keratinocytes were cultivated in these feeder layers, in culture medium enriched with the lysate. With these results we conclude that the 10% platelets lysate promoted a better adhesion and proliferation of human fibroblasts and in all dose levels tested (60 to 300 Gy), these had their mitotic activity inactivated by ionizing irradiation, being that the feeder layers obtained with doses from 70 to 150 Gy were those that provided the best development of keratinocytes in medium containing 2.5% of human platelet lysate. Therefore, it was possible to standardize both the cultivation of human fibroblasts as its inactivation for use as feeder layer in culture of keratinocytes, so as to eliminate xenobiotics components. (author)

  10. Structure and function of the Juxta membrane domain of the human epidermal growth factor receptor by NMR spectroscopy

    International Nuclear Information System (INIS)

    Choowongkomon, Kiattawee; Carlin, Cathleen; Sonnichsen, Frank D.

    2005-10-01

    The epidermal growth factor receptor (EGFR) is a member of the receptor tyrosine kinase family involved in the regulation of cellular proliferation and differentiation. Its juxta membrane domain (JX), the region located between the transmembrane and kinase domains, plays important roles in receptor trafficking since both basolateral sorting in polarized epithelial cells and lysosomal sorting signals are identified in this region. In order to understand the regulation of these signals, we characterized the structural properties of recombinant JX domain in dodecyl phosphocholine detergent (DPC) by nuclear magnetic resonance (NMR) spectroscopy. In DPC micelles, structures derived from NMR data showed three amphipathic, helical segments. Two equivalent average structural models on the surface of micelles were obtained that differ only in the relative orientation between the first and second helices. Our data suggests that the activity of sorting signals may be regulated by their membrane association and restricted accessibility in the intact receptor

  11. The biological activity of the human epidermal growth factor receptor is positively regulated by its C-terminal tyrosines

    DEFF Research Database (Denmark)

    Helin, K; Velu, T; Martin, P

    1991-01-01

    mutants in the full length receptor. EGF-dependent transforming ability of the single point mutants is similar to that of the wild type, while that of double mutants is decreased and an even lower activity is present in the triple mutant. In each bioassay, including EGF-dependent focal transformation...... biologically. The EGF-R kinase activity is affected by tyrosine substitution since in vitro phosphorylation of exogenous substrates is reduced in the double and triple mutants. Autophosphorylation, in vivo and in vitro, is also reduced, but not totally abolished in the triple point mutant and Dc123 indicating......The epidermal growth factor receptor (EGF-R) C-terminus contains three conserved tyrosines (Y-1068, Y-1148, Y-1173) which are phosphorylated upon EGF activation. To clarify the functional role of these tyrosines, each has been mutated to phenylalanine and studied as single, double and triple...

  12. Toxic epidermal necrolysis successfully treated with etanercept.

    Science.gov (United States)

    Gubinelli, Emanuela; Canzona, Flora; Tonanzi, Tiziano; Raskovic, Desanka; Didona, Biagio

    2009-03-01

    Toxic epidermal necrolysis (TEN) is a rare and acute severe adverse reaction to drugs, characterised by massive apoptosis and widespread epidermal and mucosal detachment. Although no gold standard therapy exists, human i.v. immunoglobulins have recently been described as an effective treatment for this disease. We report a case of phenobarbital-induced TEN in a 59-year-old white woman where the epidermal detachment stopped 48 h after beginning the etanercept treatment with complete healing after 20 days. To the best of our knowledge, this is only the second reported case of TEN successfully treated with etanercept.

  13. Treatment challenges for community oncologists treating postmenopausal women with endocrine-resistant, hormone receptor-positive, human epidermal growth factor receptor 2-negative advanced breast cancer

    International Nuclear Information System (INIS)

    Gradishar, William J

    2016-01-01

    Community-based oncologists are faced with challenges and opportunities when delivering quality patient care, including high patient volumes and diminished resources; however, there may be the potential to deliver increased patient education and subsequently improve outcomes. This review discusses the treatment of postmenopausal women with endocrine-resistant, hormone receptor-positive, human epidermal growth factor receptor 2- negative advanced breast cancer in order to illustrate considerations in the provision of pertinent quality education in the treatment of these patients and the management of therapy-related adverse events. An overview of endocrine-resistant breast cancer and subsequent treatment challenges is also provided. Approved treatment options for endocrine-resistant breast cancer include hormonal therapies and mammalian target of rapamycin inhibitors. Compounds under clinical investigation are also discussed

  14. Establishment and characterization of a new cell line, FPS-1, derived from human undifferentiated pleomorphic sarcoma, overexpressing epidermal growth factor receptor and cyclooxygenase-2.

    Science.gov (United States)

    Hakozaki, Michiyuki; Hojo, Hiroshi; Sato, Michiko; Tajino, Takahiro; Yamada, Hitoshi; Kikuchi, Shinichi; Abe, Masafumi

    2006-01-01

    Undifferentiated pleomorphic sarcoma (UPS) is among the most common soft tissue sarcomas in adults. In order to improve its aggressive course or prognosis and establish new therapeutic methods, molecular genetic and biological characterizations of UPS are required. A new human UPS cell line (FPS-1) was established from UPS of the upper arm of a 79-year-old man. The cell line has been maintained for over 14 months with more than 60 passages. FPS-1 cells were characterized using molecular biological methods. FPS-1 cells showed the same morphological and immunophenotypical characteristics as the primary tumor. Cytogenetic and molecular analyses revealed a nonsense mutation in exon 6 of the p53 gene. Epidermal growth factor receptor (EGFR) and cyclooxygenase-2 (COX-2) were expressed in FPS-1 cells. FPS-1 cells might be useful for investigating biological behavior and developing new molecular targeting antitumor drugs for UPS with EGFR or COX-2 expression.

  15. Response to Therapy and Outcomes in Oropharyngeal Cancer Are Associated With Biomarkers Including Human Papillomavirus, Epidermal Growth Factor Receptor, Gender, and Smoking

    International Nuclear Information System (INIS)

    Kumar, Bhavna; Cordell, Kitrina G.; Lee, Julia S.; Prince, Mark E.; Tran, Huong H.; Wolf, Gregory T.; Urba, Susan G.; Worden, Francis P.; Chepeha, Douglas B.; Teknos, Theodoros N.; Eisbruch, Avraham; Tsien, Christina I.; Taylor, Jeremy; D'Silva, Nisha J.; Yang, Kun; Kurnit, David M.; Bradford, Carol R.

    2007-01-01

    Induction chemotherapy and concurrent chemoradiation for responders or immediate surgery for non-responders is an effective treatment strategy head and neck squamous cell carcinoma (HNSCC) of the larynx and oropharynx. Biomarkers that predict outcome would be valuable in selecting patients for therapy. In this study, the presence and titer of high risk human papilloma virus (HPV) and expression of epidermal growth factor receptor (EGFR) in pre-treatment biopsies, as well as smoking and gender were examined in oropharynx cancer patients enrolled in an organ sparing trial. HPV16 copy number was positively associated with response to therapy and with overall and disease specific survival, whereas EGFR expression, current or former smoking behavior, and female gender (in this cohort) were associated with poor response and poor survival in multivariate analysis. Smoking cessation and strategies to target EGFR may be useful adjuncts for therapy to improve outcome in the cases with the poorest biomarker profile

  16. Trastuzumab beyond progression in human epidermal growth factor receptor 2-positive advanced breast cancer: a german breast group 26/breast international group 03-05 study

    DEFF Research Database (Denmark)

    von Minckwitz, Gunter; du Bois, Andreas; Schmidt, Marcus

    2009-01-01

    PURPOSE: Trastuzumab shows clinical activity in human epidermal growth factor receptor 2 (HER-2)-positive early and advanced breast cancer. In the German Breast Group 26/Breast International Group 03-05 trial, we investigated if trastuzumab treatment should be continued beyond progression. METHODS......: Patients with HER-2-positive breast cancer that progresses during treatment with trastuzumab were randomly assigned to receive capecitabine (2,500 mg/m(2) body-surface area on days 1 through 14 [1,250 mg/m(2) semi-daily]) alone or with continuation of trastuzumab (6 mg/kg body weight) in 3-week cycles....... The primary end point was time to progression. RESULTS: We randomly assigned 78 patients to capecitabine and 78 patients to capecitabine plus trastuzumab. Sixty-five events and 38 deaths in the capecitabine group and 62 events and 33 deaths in the capecitabine-plus-trastuzumab group occurred during 15...

  17. Prognostic significance of equivocal human epidermal growth factor receptor 2 results and clinical utility of alternative chromosome 17 genes in patients with invasive breast cancer: A cohort study.

    Science.gov (United States)

    Sneige, Nour; Hess, Kenneth R; Multani, Asha S; Gong, Yun; Ibrahim, Nuhad K

    2017-04-01

    The 2013 testing guidelines for determining the human epidermal growth factor receptor 2 (HER2) status include new cutoff points for the HER2/chromosome enumeration probe 17 (CEP17) ratio and the average HER2 copy number per cell, and they recommend using a reflex test with alternative chromosome 17 probes (Ch17Ps) to resolve equivocal HER2 results. This study sought to determine the clinical utility of alternative Ch17Ps in equivocal cases and the effects of equivocal results and/or a change in the HER2 status on patients' outcomes. The University of Texas MD Anderson Cancer Center database of HER2 dual-probe fluorescence in situ hybridization results from 2000 to 2010 was searched for cases of invasive breast cancer with HER2/CEP17 ratios Cancer 2017;123:1115-1123. © 2016 American Cancer Society. © 2016 American Cancer Society.

  18. Gemcitabine Plus Docetaxel Versus Docetaxel in Patients With Predominantly Human Epidermal Growth Factor Receptor 2-Negative Locally Advanced or Metastatic Breast Cancer: A Randomized, Phase III Study by the Danish Breast Cancer Cooperative Group

    DEFF Research Database (Denmark)

    Nielsen, Dorte L; Bjerre, Karsten D; Jakobsen, Erik H

    2011-01-01

    PURPOSE The objective of this phase III study was to compare the efficacy of gemcitabine plus docetaxel (GD) versus docetaxel in patients with advanced breast cancer. PATIENTS AND METHODS Predominantly human epidermal growth factor receptor 2 (HER2) -negative patients were randomly assigned...

  19. A comprehensive two-dimensional gel protein database of noncultured unfractionated normal human epidermal keratinocytes: towards an integrated approach to the study of cell proliferation, differentiation and skin diseases

    DEFF Research Database (Denmark)

    Celis, J E; Madsen, Peder; Rasmussen, H H

    1991-01-01

    A two-dimensional (2-D) gel database of cellular proteins from noncultured, unfractionated normal human epidermal keratinocytes has been established. A total of 2651 [35S]methionine-labeled cellular proteins (1868 isoelectric focusing, 783 nonequilibrium pH gradient electrophoresis) were resolved...

  20. Herceptin Enhances the Antitumor Effect of Natural Killer Cells on Breast Cancer Cells Expressing Human Epidermal Growth Factor Receptor-2

    Directory of Open Access Journals (Sweden)

    Xiao Tian

    2017-10-01

    Full Text Available Optimal adoptive cell therapy (ACT should contribute to effective cancer treatment. The unique ability of natural killer (NK cells to kill cancer cells independent of major histocompatibility requirement makes them suitable as ACT tools. Herceptin, an antihuman epidermal growth factor receptor-2 (anti-HER2 monoclonal antibody, is used to treat HER2+ breast cancer. However, it has limited effectiveness and possible severe cardiotoxicity. Given that Herceptin may increase the cytotoxicity of lymphocytes, we explored the possible augmentation of NK cell cytotoxicity against HER2+ breast cancer cells by Herceptin. We demonstrated that Herceptin could interact with CD16 on NK cells to expand the cytotoxic NK (specifically, CD56dim cell population. Additionally, Herceptin increased NK cell migration and cytotoxicity against HER2+ breast cancer cells. In a pilot study, Herceptin-treated NK cells shrunk lung nodular metastasis in a woman with HER2+ breast cancer who could not tolerate the cardiotoxic side effects of Herceptin. Our findings support the therapeutic potential of Herceptin-treated NK cells in patients with HER2+ and Herceptin-intolerant breast cancer.

  1. Ultra-weak photon emission as a non-invasive tool for monitoring of oxidative processes in the epidermal cells of human skin: comparative study on the dorsal and the palm side of the hand.

    Science.gov (United States)

    Rastogi, Anshu; Pospísil, Pavel

    2010-08-01

    All living organisms emit spontaneous ultra-weak photon emission as a result of cellular metabolic processes. Exposure of living organisms to exogenous factors results in oxidative processes and enhancement in ultra-weak photon emission. Here, hydrogen peroxide (H(2)O(2)), as a strongly oxidizing molecule, was used to induce oxidative processes and enhance ultra-weak photon emission in human hand skin. The presented work intends to compare both spontaneous and peroxide-induced ultra-weak photon emission from the epidermal cells on the dorsal and the palm side of the hand. A highly sensitive photomultiplier tube and a charge-coupled device camera were used to detect ultra-weak photon emission from human hand skin. Spontaneous ultra-weak photon emission from the epidermal cells on the dorsal side of the hand was 4 counts/s. Topical application of 500 mM H(2)O(2) to the dorsal side of the hand caused enhancement in ultra-weak photon emission to 40 counts/s. Interestingly, both spontaneous and peroxide-induced ultra-weak photon emission from the epidermal cells on the palm side of the hand were observed to increase twice their values, i.e. 8 and 80 counts/s, respectively. Similarly, the two-dimensional image of ultra-weak photon emission observed after topical application of H(2)O(2) to human skin reveals that photon emission from the palm side exceeds the photon emission from the dorsal side of the hand. The results presented indicate that the ultra-weak photon emission originating from the epidermal cells on the dorsal and the palm side of the hand is related to the histological structure of the human hand skin. Ultra-weak photon emission is shown as a non-destructive technique for monitoring of oxidative processes in the epidermal cells of the human hand skin and as a diagnostic tool for skin diseases.

  2. Triggering Apoptotic Death of Human Epidermal Keratinocytes by Malic Acid: Involvement of Endoplasmic Reticulum Stress- and Mitochondria-Dependent Signaling Pathways

    Directory of Open Access Journals (Sweden)

    Yu-Ping Hsiao

    2015-01-01

    Full Text Available Malic acid (MA has been commonly used in cosmetic products, but the safety reports in skin are sparse. To investigate the biological effects of MA in human skin keratinocytes, we investigated the potential cytotoxicity and apoptotic effects of MA in human keratinocyte cell lines (HaCaT. The data showed that MA induced apoptosis based on the observations of DAPI staining, DNA fragmentation, and sub-G1 phase in HaCaT cells and normal human epidermal keratinocytes (NHEKs. Flow cytometric assays also showed that MA increased the production of mitochondrial superoxide (mito-SOX but decreased the mitochondrial membrane potential. Analysis of bioenergetics function with the XF 24 analyzer Seahorse extracellular flux analyzer demonstrated that oxygen consumption rate (OCR was significantly decreased whereas extracellular acidification rate (ECAR was increased in MA-treated keratinocytes. The occurrence of apoptosis was proved by the increased expressions of FasL, Fas, Bax, Bid, caspases-3, -8, -9, cytochrome c, and the declined expressions of Bcl-2, PARP. MA also induced endoplasmic reticulum stress associated protein expression such as GRP78, GADD153, and ATF6α. We demonstrated that MA had anti-proliferative effect in HaCaT cell through the inhibition of cell cycle progression at G0/G1, and the induction of programmed cell death through endoplasmic reticulum stress- and mitochondria-dependent pathways.

  3. Suppression of the epidermal growth factor receptor inhibits epithelial-mesenchymal transition in human pancreatic cancer PANC-1 cells.

    Science.gov (United States)

    Chang, Zhi-Gang; Wei, Jun-Min; Qin, Chang-Fu; Hao, Kun; Tian, Xiao-Dong; Xie, Kun; Xie, Xue-Hai; Yang, Yin-Mo

    2012-05-01

    Aberrant expression of epidermal growth factor receptor (EGFR) has been detected in pancreatic cancer; however, the mechanisms of EGFR in inducing pancreatic cancer development have not been adequately elucidated. The objective of this study was to determine the role of EGFR in mediating epithelial-mesenchymal transition (EMT) in pancreatic cancer cells. Pancreatic cancer cell line PANC-1 was transfected with small interfering RNA of EGFR by use of a lentiviral expression vector to establish an EGFR-knockdown cell line (si-PANC-1). PANC-1 cells transfected with lentiviral vector expressing negative control sequence were used as negative control (NC-PANC-1). Scratch assay and transwell study were used to analyze cell migration and invasion. Real-time PCR and Western blotting were used to detect the expression of EMT markers E-cadherin, N-cadherin, vimentin, and fibronectin and transcription factors snail, slug, twist1, and sip1 in PANC-1, NC-PANC-1, and si-PANC-1 cells. Immunofluorescent staining with these antibodies and confocal microscopy were used to observe their cellular location and morphologic changes. After RNA interference of EGFR, the migration and invasion ability of si-PANC-1 cells decreased significantly. The expression of epithelial phenotype marker E-cadherin increased and the expression of mesenchymal phenotype markers N-cadherin, vimentin, and fibronectin decreased, indicating reversion of EMT. We also observed intracellular translocation of E-cadherin. Expression of transcription factors snail and slug in si-PANC-1 cells decreased significantly. Suppression of EGFR expression can significantly inhibit EMT of pancreatic cancer PANC-1 cells. The mechanism may be related with the down-regulation of the expression of transcription factors snail and slug.

  4. Biodistribution of 99mTc-labeled anti-human epidermal growth factor receptor (EGF-R) humanized monoclonal antibody h-R3 in a xenograft model of human lung adenocarcinoma

    International Nuclear Information System (INIS)

    Morales-Morales, Alejo; Duconge, Jorge; Caballero-Torres, Idania; Nunez-Gandolff, Gilda; Fernandez, Eduardo; Iznaga-Escobar, Normando

    1999-01-01

    The anti-human epidermal growth factor receptor (EGF-R) humanized monoclonal antibody (MAb) h-R3 is an (IgG 1 ), which binds to an extracellular domain of EGF-R. It was used to evaluate the biodistribution on nude mice xenografted with H-125 human lung adenocarcinoma cell line. Results were compared with its murine version of the MAb ior-egf/r3. Twenty-one athymic female 4NMRI nu/nu mice were injected intraperitoneally with 10 μg/100 μCi of 99m Tc-labeled MAbs. Immunoreactivity of 99m Tc-labeled MAbs were measured by enzyme-linked immunosorbent assay (ELISA) on H-125 cell line and the immunoreactive fractions was determined by the Lindmo method. Among all organs, significant accumulation was found in serum (27.05 ± 2.08 %ID/g) and tumor (3.903 ± 0.89 %ID/g) at 4 h after injection. These values decreased to 5.03 ± 0.50 %ID/g and 2.19 ± 0.56 %ID/g for serum and tumor, respectively. The immunoreactive fraction was found to be 0.70, with a correlation coefficient r=0.9984. With the good biodistribution and tumor uptake of the 99m Tc-labeled humanized antibody h-R3, a phase I diagnostic clinical trial of tumor with epithelial origin should be pursued

  5. Biodistribution of {sup 99m}Tc-labeled anti-human epidermal growth factor receptor (EGF-R) humanized monoclonal antibody h-R3 in a xenograft model of human lung adenocarcinoma

    Energy Technology Data Exchange (ETDEWEB)

    Morales-Morales, Alejo; Duconge, Jorge; Caballero-Torres, Idania; Nunez-Gandolff, Gilda; Fernandez, Eduardo; Iznaga-Escobar, Normando E-mail: normando@ict.cim.sld.cu

    1999-04-01

    The anti-human epidermal growth factor receptor (EGF-R) humanized monoclonal antibody (MAb) h-R3 is an (IgG{sub 1}), which binds to an extracellular domain of EGF-R. It was used to evaluate the biodistribution on nude mice xenografted with H-125 human lung adenocarcinoma cell line. Results were compared with its murine version of the MAb ior-egf/r3. Twenty-one athymic female 4NMRI nu/nu mice were injected intraperitoneally with 10 {mu}g/100 {mu}Ci of {sup 99m}Tc-labeled MAbs. Immunoreactivity of {sup 99m}Tc-labeled MAbs were measured by enzyme-linked immunosorbent assay (ELISA) on H-125 cell line and the immunoreactive fractions was determined by the Lindmo method. Among all organs, significant accumulation was found in serum (27.05 {+-} 2.08 %ID/g) and tumor (3.903 {+-} 0.89 %ID/g) at 4 h after injection. These values decreased to 5.03 {+-} 0.50 %ID/g and 2.19 {+-} 0.56 %ID/g for serum and tumor, respectively. The immunoreactive fraction was found to be 0.70, with a correlation coefficient r=0.9984. With the good biodistribution and tumor uptake of the {sup 99m}Tc-labeled humanized antibody h-R3, a phase I diagnostic clinical trial of tumor with epithelial origin should be pursued.

  6. Rapid Visualization of Human Tumor Xenografts through Optical Imaging with a Near-Infrared Fluorescent Anti–Epidermal Growth Factor Receptor Nanobody

    Directory of Open Access Journals (Sweden)

    Sabrina Oliveira

    2012-01-01

    Full Text Available Given that overexpression of the epidermal growth factor receptor (EGFR is found in many types of human epithelial cancers, noninvasive molecular imaging of this receptor is of great interest. A number of studies have employed monoclonal antibodies as probes; however, their characteristic long half-life in the bloodstream has encouraged the development of smaller probes. In this study, an anti-EGFR nanobody-based probe was developed and tested in comparison with cetuximab for application in optical molecular imaging. To this aim, the anti-EGFR nanobody 7D12 and cetuximab were conjugated to the near-infrared fluorophore IRDye800CW. 7D12-IR allowed the visualization of tumors as early as 30 minutes postinjection, whereas with cetuximab-IR, no signal above background was observed at the tumor site. Quantification of the IR-conjugated proteins in the tumors revealed ≈ 17% of injected dose per gram 2 hours after injection of 7D12-IR, which was significantly higher than the tumor uptake obtained 24 hours after injection of cetuximab-IR. This difference is associated with the superior penetration and distribution of 7D12-IR within the tumor. These results demonstrate that this anti-EGFR nanobody conjugated to the NIR fluorophore has excellent properties for rapid preclinical optical imaging, which holds promise for its future use as a complementary diagnostic tool in humans.

  7. Upregulated epidermal growth factor receptor expression following near-infrared irradiation simulating solar radiation in a three-dimensional reconstructed human corneal epithelial tissue culture model.

    Science.gov (United States)

    Tanaka, Yohei; Nakayama, Jun

    2016-01-01

    Humans are increasingly exposed to near-infrared (NIR) radiation from both natural (eg, solar) and artificial (eg, electrical appliances) sources. Although the biological effects of sun and ultraviolet (UV) exposure have been extensively investigated, the biological effect of NIR radiation is still unclear. We previously reported that NIR as well as UV induces photoaging and standard UV-blocking materials, such as sunglasses, do not sufficiently block NIR. The objective of this study was to investigate changes in gene expression in three-dimensional reconstructed corneal epithelial tissue culture exposed to broad-spectrum NIR irradiation to simulate solar NIR radiation that reaches human tissues. DNA microarray and quantitative real-time polymerase chain reaction analysis were used to assess gene expression levels in a three-dimensional reconstructed corneal epithelial model composed of normal human corneal epithelial cells exposed to water-filtered broad-spectrum NIR irradiation with a contact cooling (20°C). The water-filter allowed 1,000-1,800 nm wavelengths and excluded 1,400-1,500 nm wavelengths. A DNA microarray with >62,000 different probes showed 25 and 150 genes that were up- or downregulated by at least fourfold and twofold, respectively, after NIR irradiation. In particular, epidermal growth factor receptor (EGFR) was upregulated by 19.4-fold relative to control cells. Quantitative real-time polymerase chain reaction analysis revealed that two variants of EGFR in human corneal epithelial tissue were also significantly upregulated after five rounds of 10 J/cm(2) irradiation (Psolar energy reaching the Earth is in the NIR region, which cannot be adequately blocked by eyewear and thus can induce eye damage with intensive or long-term exposure, protection from both UV and NIR radiation may prevent changes in gene expression and in turn eye damage.

  8. In vivo production of novel vitamin D2 hydroxy-derivatives by human placentas, epidermal keratinocytes, Caco-2 colon cells and the adrenal gland

    Science.gov (United States)

    Slominski, Andrzej T.; Kim, Tae-Kang; Shehabi, Haleem Z.; Tang, Edith; Benson, Heather A. E.; Semak, Igor; Lin, Zongtao; Yates, Charles R.; Wang, Jin; Li, Wei; Tuckey, Robert C.

    2014-01-01

    We investigated the metabolism of vitamin D2 to hydroxyvitamin D2 metabolites ((OH)D2) by human placentas ex-utero, adrenal glands ex-vivo and cultured human epidermal keratinocytes and colonic Caco-2 cells, and identified 20(OH)D2, 17,20(OH)2D2, 1,20(OH)2D2, 25(OH)D2 and 1,25(OH)2D2 as products. Inhibition of product formation by 22R-hydroxycholesterol indicated involvement of CYP11A1 in 20- and 17-hydroxylation of vitamin D2, while use of ketoconazole indicated involvement of CYP27B1 in 1α-hydroxylation of products. Studies with purified human CYP11A1 confirmed the ability of this enzyme to convert vitamin D2 to 20(OH)D2 and 17,20(OH)2D2. In placentas and Caco-2 cells, production of 20(OH)D2 was higher than 25(OH)D2 while in human keratinocytes the production of 20(OH)D2 and 25(OH)D2 were comparable. HaCaT keratinocytes showed high accumulation of 1,20(OH)2D2 relative to 20(OH)D2 indicating substantial CYP27B1 activity. This is the first in vivo evidence for a novel pathway of vitamin D2 metabolism initiated by CYP11A1 and modified by CYP27B1, with the product profile showing tissue- and cell-type specificity. PMID:24382416

  9. Epidermal cell-shape regulation and subpopulation kinetics during butyrate-induced terminal maturation of normal and SV40-transformed human keratinocytes: epithelial models of differentiation therapy.

    Science.gov (United States)

    Staiano-Coico, L; Steinberg, M; Higgins, P J

    1990-10-15

    Recent data indicate that malignant human epidermal cells may be appropriate targets for sodium butyrate (NaB)-mediated differentiation therapy. The response of pre- and post-crisis populations of SV40-transformed human keratinocytes (SVKs) to this differentiation-inducing agent was assessed, therefore, within the framework of NaB-directed normal human keratinocyte (NHK) maturation. NaB augmented cornified envelope (CE) production in NHK and pre-crisis SVK cultures; the time-course and efficiency of induced maturation were similar in the 2 cell systems. In NHKs, the percentage of amplifying ("B" substate) cells decreased with time in NaB correlating with increases in both "C" stage keratinocytes and CEs. The latter formed over one or 2 layers of nucleated basal-like cells. Inductions were accompanied by immediate cell cycle blocks (in both the G1 and G2/M phases), reorganization within the actin cytoskeleton, and transient early increases in cellular actin content. Increased NHK and pre-crisis SVK cytoskeletal-associated actin reached a maximum approximately 48 hr after NaB addition and preceded development of CEs. The CE precursors, thus, probably reside in the "B" substate. Post-crisis SVKs, in contrast, were refractive to NaB-induced terminal maturation or cell-cycle perturbation, failed to initiate actin filament rearrangements, and retained a basal cell-like phenotype. Stable transformation of human SVKs in post-crisis phase, therefore, appears to be associated with loss of maturation "competence" within the "B" keratinocyte subpopulation.

  10. Reconstructed human epidermis: A model to study the barrier function

    Energy Technology Data Exchange (ETDEWEB)

    Barbotteau, Y. [CENBG-IN2P3/CNRS, BP 120, 33175 Gradignan cedex (France); Gontier, E. [CENBG-IN2P3/CNRS, BP 120, 33175 Gradignan cedex (France); Barberet, P. [CENBG-IN2P3/CNRS, BP 120, 33175 Gradignan cedex (France); Cappadoro, M. [Institut de recherche Pierre FABRE, 31320 Castanet Tolosan (France); De Wever, B. [Institut de recherche Pierre FABRE, 31320 Castanet Tolosan (France); Habchi, C. [CENBG-IN2P3/CNRS, BP 120, 33175 Gradignan cedex (France); Incerti, S. [CENBG-IN2P3/CNRS, BP 120, 33175 Gradignan cedex (France); Mavon, A. [SkinEthic Laboratories, 45 rue St. Philippe, 06000 Nice (France); Moretto, P. [CENBG-IN2P3/CNRS, BP 120, 33175 Gradignan cedex (France)]. E-mail: moretto@cenbg.in2p3.fr; Pouthier, T. [CENBG-IN2P3/CNRS, BP 120, 33175 Gradignan cedex (France); Smith, R.W. [CENBG-IN2P3/CNRS, BP 120, 33175 Gradignan cedex (France); Ynsa, M.D. [CENBG-IN2P3/CNRS, BP 120, 33175 Gradignan cedex (France)

    2005-04-01

    The use of in vitro reconstructed human epidermis (RHE) by the cosmetic and pharmaceutical industries is increasing because of its similar physiological mechanisms to native human skin. With the advent of ethic laws on animal experimentation, RHE provides an helpful alternative for the test of formulations. The aim of this study is to check that the RHE mineral status is comparable to that of human native skin by investigating the elemental distributions in the epidermis strata. In addition, possible deleterious effects of the transport on the epidermis ionic content were studied by nuclear microscopy.

  11. Reconstructed human epidermis: A model to study the barrier function

    International Nuclear Information System (INIS)

    Barbotteau, Y.; Gontier, E.; Barberet, P.; Cappadoro, M.; De Wever, B.; Habchi, C.; Incerti, S.; Mavon, A.; Moretto, P.; Pouthier, T.; Smith, R.W.; Ynsa, M.D.

    2005-01-01

    The use of in vitro reconstructed human epidermis (RHE) by the cosmetic and pharmaceutical industries is increasing because of its similar physiological mechanisms to native human skin. With the advent of ethic laws on animal experimentation, RHE provides an helpful alternative for the test of formulations. The aim of this study is to check that the RHE mineral status is comparable to that of human native skin by investigating the elemental distributions in the epidermis strata. In addition, possible deleterious effects of the transport on the epidermis ionic content were studied by nuclear microscopy

  12. Epidermal growth factor and insulin-like growth factor I upregulate the expression of the epidermal growth factor system in rat liver

    DEFF Research Database (Denmark)

    Bor, M V; Sørensen, B S; Vinter-Jensen, L

    2000-01-01

    BACKGROUND/AIM: Both epidermal growth factor and insulin-like growth factor I play a role in connection with the liver. In the present study, the possible interaction of these two growth factor systems was studied by investigating the effect of epidermal growth factor or insulin-like growth factor...... I treatment on the expression of the epidermal growth factor receptor, and its activating ligands, transforming growth factor-alpha and epidermal growth factor. METHODS: Fifty-five male rats received no treatment, human recombinant epidermal growth factor or human recombinant insulin-like growth.......8+/-1.6 fmol/mg protein epidermal growth factor and 144+/-22 fmol/mg protein transforming growth factor-alpha. Both epidermal growth factor and insulin-like growth factor I treatment increased the expression of mRNA for transforming growth factor-alpha and epidermal growth factor receptor, as well...

  13. Effects of Thermal Resistance on One-Dimensional Thermal Analysis of the Epidermal Flexible Electronic Devices Integrated with Human Skin

    Science.gov (United States)

    Li, He; Cui, Yun

    2017-12-01

    Nowadays, flexible electronic devices are increasingly used in direct contact with human skin to monitor the real-time health of human body. Based on the Fourier heat conduction equation and Pennes bio-heat transfer equation, this paper deduces the analytical solutions of one - dimensional heat transfer for flexible electronic devices integrated with human skin under the condition of a constant power. The influence of contact thermal resistance between devices and skin is considered as well. The corresponding finite element model is established to verify the correctness of analytical solutions. The results show that the finite element analysis agrees well with the analytical solution. With bigger thermal resistance, temperature increase of skin surface will decrease. This result can provide guidance for the design of flexible electronic devices to reduce the negative impact that exceeding temperature leave on human skin.

  14. INHIBITION OF PROTEIN TYROSINE PHOSPHATASE ACTIVITY MEDIATES EPIDERMAL GROWTH FACTOR RECEPTOR SIGNALING IN HUMAN AIRWAY EPITHELIAL CELLS

    Science.gov (United States)

    Epidemiological studies have implicated zinc in the toxicity of ambient particulate matter (PM) inhalation. We previously showed that exposure to metal-laden PM inhibits protein tyrosine phosphatase (PTP) activity in human primary bronchial epithelial cells (HAEC) and leads t...

  15. Epidermal growth factor receptor signalling in human breast cancer cells operates parallel to estrogen receptor α signalling and results in tamoxifen insensitive proliferation

    International Nuclear Information System (INIS)

    Moerkens, Marja; Zhang, Yinghui; Wester, Lynn; Water, Bob van de; Meerman, John HN

    2014-01-01

    Tamoxifen resistance is a major problem in the treatment of estrogen receptor (ER) α -positive breast cancer patients. Although the mechanisms behind tamoxifen resistance are still not completely understood, clinical data suggests that increased expression of receptor tyrosine kinases is involved. Here, we studied the estrogen and anti-estrogen sensitivity of human breast cancer MCF7 cells that have a moderate, retroviral-mediated, ectopic expression of epidermal growth factor receptor (MCF7-EGFR). Proliferation of MCF7-EGFR and parental cells was induced by 17β-estradiol (E2), epidermal growth factor (EGF) or a combination of these. Inhibition of proliferation under these conditions was investigated with 4-hydroxy-tamoxifen (TAM) or fulvestrant at 10 -12 to 10 -6 M. Cells were lysed at different time points to determine the phosphorylation status of EGFR, MAPK 1/3 , AKT and the expression of ERα. Knockdown of target genes was established using smartpool siRNAs. Transcriptomics analysis was done 6 hr after stimulation with growth factors using Affymetrix HG-U133 PM array plates. While proliferation of parental MCF7 cells could only be induced by E2, proliferation of MCF7-EGFR cells could be induced by either E2 or EGF. Treatment with TAM or fulvestrant did significantly inhibit proliferation of MCF7-EGFR cells stimulated with E2 alone. EGF treatment of E2/TAM treated cells led to a marked cell proliferation thereby overruling the anti-estrogen-mediated inhibition of cell proliferation. Under these conditions, TAM however did still inhibit ERα- mediated transcription. While siRNA-mediated knock-down of EGFR inhibited the EGF- driven proliferation under TAM/E2/EGF condition, knock down of ERα did not. The TAM resistant cell proliferation mediated by the conditional EGFR-signaling may be dependent on the PI3K/Akt pathway but not the MEK/MAPK pathway, since a MEK inhibitor (U0126), did not block the proliferation. Transcriptomic analysis under the various E2/TAM

  16. Radionecrosis skin model induced an athymic mouse nude (Nu/Nu) for development of dermal-epidermal human substitute based regenerative therapy

    International Nuclear Information System (INIS)

    Mosca, Rodrigo Crespo

    2014-01-01

    The neoplasms incidence has increased significantly in recent years and continued population growth and aging will increase the statistics of this illness in the world's diseases. The cancer treatment usually consists in individual or combined use of chemotherapy, surgery and radiotherapy depending on the etiology of the tumor. In cases where radiotherapy is used in addition to the therapeutic effects of radiation, specific complications can occur, and in the skin, these complications can be present with a clinical expression ranging from erythema to radionecrosis, and this latter being the adverse effect with greater severity. The radionecrosis treatment consists in debridement necrotic areas and covering the surgical wounds. Autologous grafts are most commonly used for this covering, however when large areas are affected, allografts can be used for occlusive treatment and the keratinocytes and adipose derived stem cells (ADSC) addition becomes an alternative, due to the knowing for immunomodulatory and regenerative response. For that reason, aiming to simulate the radionecrosis adverse effects, an animal model of induced cutaneous radionecrosis was created, in athymic mouse Nude (Nu/Nu), for developing regenerative therapies based on human dermal-epidermal substitutes containing keratinocytes and ADSC, which proved occlusive as an efficient treatment, furthermore, having this radionecrosis animal model established, new possibilities for treatment of diseases involving dermal regeneration, can be tested. (author)

  17. Altered growth, differentiation, and responsiveness to epidermal growth factor of human embryonic mesenchymal cells of palate by persistent rubella virus infection

    International Nuclear Information System (INIS)

    Yoneda, T.; Urade, M.; Sakuda, M.; Miyazaki, T.

    1986-01-01

    We previously demonstrated that human embryonic mesenchymal cells derived from the palate (HEMP cells) retain alkaline phosphatase (ALP) content and capacity for collagen synthesis after long-term culture, and their growth is markedly stimulated by epidermal growth factor (EGF). There was a dramatic decrease in ALP content and capacity to synthesize collagen in HEMP cells (HEMP-RV cells) persistently infected with rubella virus (RV). EGF increased ALP activity and decreased collagen synthesis in HEMP cells, whereas EGF showed no effect on these activities in HEMP-RV cells. Growth of HEMP-RV cells was slightly reduced compared with that of HEMP cells. EGF stimulated growth of HEMP cells and to a lesser extent of HEMP-RV cells. Binding of 125 I-EGF to cell-surface receptors in HEMP-RV cells was, to our surprise, twice as much as that in HEMP cells. However, internalization of bound 125 I-EGF in HEMP-RV cells was profoundly diminished. Thus, persistent RV infection causes not only changes in HEMP cell growth and differentiation but a decrease in or loss of HEMP cell responsiveness to EGF. The effects of persistent RV infection on palatal cell differentiation as well as growth may be responsible for the pathogenesis of congenital rubella. Furthermore, since HEMP cells appear to be closely related to osteoblasts, these results suggest a mechanism for RV-induced osseous abnormalities manifested in congenital rubella patients

  18. Comet assay in reconstructed 3D human epidermal skin models—investigation of intra- and inter-laboratory reproducibility with coded chemicals

    Science.gov (United States)

    Pfuhler, Stefan

    2013-01-01

    Reconstructed 3D human epidermal skin models are being used increasingly for safety testing of chemicals. Based on EpiDerm™ tissues, an assay was developed in which the tissues were topically exposed to test chemicals for 3h followed by cell isolation and assessment of DNA damage using the comet assay. Inter-laboratory reproducibility of the 3D skin comet assay was initially demonstrated using two model genotoxic carcinogens, methyl methane sulfonate (MMS) and 4-nitroquinoline-n-oxide, and the results showed good concordance among three different laboratories and with in vivo data. In Phase 2 of the project, intra- and inter-laboratory reproducibility was investigated with five coded compounds with different genotoxicity liability tested at three different laboratories. For the genotoxic carcinogens MMS and N-ethyl-N-nitrosourea, all laboratories reported a dose-related and statistically significant increase (P 30% cell loss), and the overall response was comparable in all laboratories despite some differences in doses tested. The results of the collaborative study for the coded compounds were generally reproducible among the laboratories involved and intra-laboratory reproducibility was also good. These data indicate that the comet assay in EpiDerm™ skin models is a promising model for the safety assessment of compounds with a dermal route of exposure. PMID:24150594

  19. Recommendations on disease management for patients with advanced human epidermal growth factor receptor 2-positive breast cancer and brain metastases: American Society of Clinical Oncology clinical practice guideline.

    Science.gov (United States)

    Ramakrishna, Naren; Temin, Sarah; Chandarlapaty, Sarat; Crews, Jennie R; Davidson, Nancy E; Esteva, Francisco J; Giordano, Sharon H; Gonzalez-Angulo, Ana M; Kirshner, Jeffrey J; Krop, Ian; Levinson, Jennifer; Modi, Shanu; Patt, Debra A; Perez, Edith A; Perlmutter, Jane; Winer, Eric P; Lin, Nancy U

    2014-07-01

    To provide formal expert consensus-based recommendations to practicing oncologists and others on the management of brain metastases for patients with human epidermal growth factor receptor 2 (HER2) -positive advanced breast cancer. The American Society of Clinical Oncology (ASCO) convened a panel of medical oncology, radiation oncology, guideline implementation, and advocacy experts and conducted a systematic review of the literature. When that failed to yield sufficiently strong quality evidence, the Expert Panel undertook a formal expert consensus-based process to produce these recommendations. ASCO used a modified Delphi process. The panel members drafted recommendations, and a group of other experts joined them for two rounds of formal ratings of the recommendations. No studies or existing guidelines met the systematic review criteria; therefore, ASCO conducted a formal expert consensus-based process. Patients with brain metastases should receive appropriate local therapy and systemic therapy, if indicated. Local therapies include surgery, whole-brain radiotherapy, and stereotactic radiosurgery. Treatments depend on factors such as patient prognosis, presence of symptoms, resectability, number and size of metastases, prior therapy, and whether metastases are diffuse. Other options include systemic therapy, best supportive care, enrollment onto a clinical trial, and/or palliative care. Clinicians should not perform routine magnetic resonance imaging (MRI) to screen for brain metastases, but rather should have a low threshold for MRI of the brain because of the high incidence of brain metastases among patients with HER2-positive advanced breast cancer. © 2014 by American Society of Clinical Oncology.

  20. From bench to bedside: What do we know about hormone receptor-positive and human epidermal growth factor receptor 2-positive breast cancer?

    Science.gov (United States)

    Wu, Victoria Shang; Kanaya, Noriko; Lo, Chiao; Mortimer, Joanne; Chen, Shiuan

    2015-09-01

    Breast cancer is a heterogeneous disease. Thanks to extensive efforts from research scientists and clinicians, treatment for breast cancer has advanced into the era of targeted medicine. With the use of several well-established biomarkers, such as hormone receptors (HRs) (i.e., estrogen receptor [ER] and progesterone receptor [PgR]) and human epidermal growth factor receptor-2 (HER2), breast cancer patients can be categorized into multiple subgroups with specific targeted treatment strategies. Although therapeutic strategies for HR-positive (HR+) HER2-negative (HER2-) breast cancer and HR-negative (HR-) HER2-positive (HER2+) breast cancer are well-defined, HR+ HER2+ breast cancer is still an overlooked subgroup without tailored therapeutic options. In this review, we have summarized the molecular characteristics, etiology, preclinical tools and therapeutic options for HR+ HER2+ breast cancer. We hope to raise the attention of both the research and the medical community on HR+ HER2+ breast cancer, and to advance patient care for this subtype of disease. Copyright © 2015 Elsevier Ltd. All rights reserved.

  1. Characteristics and treatment of human epidermal growth factor receptor 2 positive breast cancer: 43,485 cases from the National Cancer Database treated in 2010 and 2011.

    Science.gov (United States)

    Killelea, Brigid K; Chagpar, Anees B; Horowitz, Nina R; Lannin, Donald R

    2017-02-01

    Although identification of human epidermal growth factor receptor 2 (Her2) positive breast cancer represents one of the greatest advances over the past 3 decades, it has not been studied extensively on a national level. The National Cancer Database is a joint project of the American Cancer Society and the American College of Surgeons and contains data on about 70% of the cancer cases in the United States. Data on Her2 have been collected since 2010 and was used for this study. Of 298,937 cases of invasive breast cancer with known Her2 status diagnosed in 2010 and 2011, 43,485 (14.5%) were Her2 positive. Her2 positivity was greatest in Asian/Pacific Islanders and least in non-Hispanic Whites and was markedly more common in younger women. The incidence of Her2 positive tumors ranged from a low of 13.9% in the Mountain West region to a high of 16.0% in the West South Central region (P breast preservation (odds ratio = .78, confidence interval = .76 to .80). Her2 positive tumors have distinct epidemiologic, clinical, and treatment characteristics. Copyright © 2016 Elsevier Inc. All rights reserved.

  2. Human epidermal growth factor receptor 2 testing in invasive breast cancer: should histological grade, type and oestrogen receptor status influence the decision to repeat testing?

    Science.gov (United States)

    Rakha, Emad A; Pigera, Marian; Shin, Sandra J; D'Alfonso, Timothy; Ellis, Ian O; Lee, Andrew H S

    2016-07-01

    The recent American Society of Clinical Oncology/College of American Pathologists guidelines for human epidermal growth factor receptor 2 (HER2) testing in breast cancer recommend repeat testing based on tumour grade, tumour type, and hormone receptor status. The aim of this study was to test the value of these criteria. HER2 status was concordant in the core biopsies and excision specimens in 392 of 400 invasive carcinomas. The major reasons for discordance were amplification around the cut-off for positivity and tumour heterogeneity. Of 116 grade 3 carcinomas that were HER2-negative in the core biopsy, four were HER2-positive in the excision specimen. Three of these four either showed borderline negative amplification in the core biopsy or were heterogeneous. None of the 55 grade 1 carcinomas were HER2-positive. Review of repeat testing of HER2 in routine practice suggested that it may also be of value for multifocal tumours and if recommended by the person assessing the in-situ hybridization. Mandatory repeat HER2 testing of grade 3 HER2-negative carcinomas is not appropriate. This is particularly true if repeat testing is performed after borderline negative amplification in the core biopsy or in HER2-negative heterogeneous carcinomas. © 2015 John Wiley & Sons Ltd.

  3. Punicalagin and (-)-Epigallocatechin-3-Gallate Rescue Cell Viability and Attenuate Inflammatory Responses of Human Epidermal Keratinocytes Exposed to Airborne Particulate Matter PM10.

    Science.gov (United States)

    Seok, Jin Kyung; Lee, Jeong-Won; Kim, Young Mi; Boo, Yong Chool

    2018-01-01

    Airborne particulate matter with a diameter of < 10 µm (PM10) causes oxidative damage, inflammation, and premature skin aging. In this study, we evaluated whether polyphenolic antioxidants attenuate the inflammatory responses of PM10-exposed keratinocytes. Primary human epidermal keratinocytes were exposed in vitro to PM10 in the absence or presence of punicalagin and (-)-epigallocatechin-3-gallate (EGCG), which are the major polyphenolic antioxidants found in pomegranate and green tea, respectively. Assays were performed to determine cell viability, production of reactive oxygen species (ROS), and expression of NADPH oxidases (NOX), proinflammatory cytokines, and matrix metalloproteinase (MMP)-1. PM10 decreased cell viability and increased ROS production in a dose-dependent manner. It also increased the expression levels of NOX-1, NOX-2, tumor necrosis factor-α (TNF-α), interleukin (IL)-1β, IL-6, IL-8, and MMP-1. Punicalagin was not cytotoxic up to 300 μM, and (-)-EGCG was cytotoxic above 30 μM, respectively. Further, punicalagin (3-30 μM) and EGCG (3-10 μM) rescued the viability of PM10-exposed cells. They also attenuated ROS production and the expression of NOX-1, NOX-2, TNF-α, IL-1β, IL-6, IL-8, and MMP-1 stimulated by PM10. This study demonstrates that polyphenolic antioxidants, such as punicalagin and (-)-EGCG, rescue keratinocyte viability and attenuate the inflammatory responses of these cells due to airborne particles. © 2018 S. Karger AG, Basel.

  4. Real world cost of human epidermal receptor 2-positive metastatic breast cancer patients: a longitudinal incidence-based observational costing study in the Netherlands and Belgium.

    Science.gov (United States)

    Frederix, G W J; Severens, J L; Hövels, A M; van Hasselt, J G C; Hooiveld, M J J; Neven, P; Raaijmakers, J A M; Schellens, J H M

    2015-05-01

    Currently, no country-specific metastatic breast cancer (MBC) observational costing data are available for the Netherlands and Belgium. Our aim is to describe country-specific resource use and costs of human epidermal receptor 2 (HER-2)-positive MBC in the Netherlands and Belgium, making use of real-world data. The eligibility period for patient selection was from April 2004 to April 2010. Inclusion and retrospective data collection begins at the time of first diagnosis of HER-2-positive MBC during the eligibility period and ends 24 months post-index diagnosis of MBC or at patient death. We identified 88 eligible patients in the Netherlands and 44 patients in Belgium. The total costs of medical treatment and other resource use utilisation per patient was €48,301 in the Netherlands and €37,431 in Belgium. Majority of costs was related to the use of trastuzumab in both countries, which was 50% of the total costs in the Netherlands and 56% in Belgium respectively. Our study provides estimates of resource use and costs for HER-2-positive MBC in the Netherlands and Belgium. We noticed various differences in resource use patterns between both countries demonstrating caution is needed when transferring cost estimates between countries. © 2014 John Wiley & Sons Ltd.

  5. Effect of Standardized Boesenbergia pandurata Extract and Its Active Compound Panduratin A on Skin Hydration and Barrier Function in Human Epidermal Keratinocytes.

    Science.gov (United States)

    Woo, Seon Wook; Rhim, Dong-Bin; Kim, Changhee; Hwang, Jae-Kwan

    2015-03-01

    The skin plays a key role in protecting the body from the environment and from water loss. Cornified envelope (CE) and natural moisturizing factor (NMF) are considered as the primary regulators of skin hydration and barrier function. The CE prevents loss of water from the body and is formed by cross-linking of several proteins. Among these proteins, filaggrin is an important protein because NMF is produced by the degradation of filaggrin. Proteases, including matriptase and prostasin, stimulate the generation of filaggrin from profilaggrin and caspase-14 plays a role in the degradation of filaggrin. This study elucidated the effects of an ethanol extract of Boesenbergia pandurata (Roxb.) Schltr., known as fingerroot, and its active compound panduratin A on CE formation and filaggrin processing in HaCaT, human epidermal keratinocytes. B. pandurata extract (BPE) and panduratin A significantly stimulated not only CE formation but also the expression of CE proteins, such as loricrin, involucrin, and transglutaminase, which were associated with PPARα expression. The mRNA and protein levels of filaggrin and filaggrin-related enzymes, such as matriptase, prostasin, and caspase-14 were also up-regulated by BPE and panduratin A treatment. These results suggest that BPE and panduratin A are potential nutraceuticals which can enhance skin hydration and barrier function based on their CE formation and filaggrin processing.

  6. Specific receptors for epidermal growth factor in human bone tumour cells and its effect on synthesis of prostaglandin E2 by cultured osteosarcoma cell line

    International Nuclear Information System (INIS)

    Hirata, Y.; Uchihashi, M.; Nakashima, H.; Fujita, T.; Matsukura, S.; Matsui, K.

    1984-01-01

    Using tumour cell lines derived from human bone tumours, specific binding sites for epidermal growth factor (EGF), a potent growth stimulator in many tissues, and its effect on synthesis of prostaglandin (PG) E 2 , a potent bone-resorbing factor, by cultured osteosarcoma cell line were studied. Three tumour cell lines, one osteosarcoma (HOSO) and two giant cell tumours of the bone (G-1 and G-2), all possessed specific binding sites for 125 I-labelled EGF: the apparent dissociation constant was approximately 4-10 x 10 -10 M and the maximal binding capacity was 50 000-80 000 sites/cell. EGF had no mitogenic effect in these cell lines. However, these cell lines did not have specific binding sites for 125 I-labelled parathyroid hormone (PTH) or calcitonin. HOSO line produced and secreted PGE 2 into medium, while no significant amount of PGE 2 was demonstrated in G-1 or G-2 line. EGF significantly stimulated PGE 2 production in HOSO line in a dose-dependent manner (0.5-50 ng/ml); its stimulatory effect was completely abolished by indomethacin, an inhibitor of PG biosynthesis. Exogenous PGE 1 significantly stimulated cyclic AMP formation in HOSO line, whereas PGFsub(2α) PTH, calcitonin, or EGF had no effect. None of these calcium-regulating hormones affected cyclic AMP generation in either G-1 of G-2 line. These data indicate that human bone tumour cells have specific EGF receptors unrelated to cell growth, and suggest that EGF may be involved in bone resorption through a PGE 2 -mediated process in human osseous tissues. (author)

  7. The epidermal growth factor-like domains of the human EMR2 receptor mediate cell attachment through chondroitin sulfate glycosaminoglycans

    NARCIS (Netherlands)

    Stacey, Martin; Chang, Gin-Wen; Davies, John Q.; Kwakkenbos, Mark J.; Sanderson, Ralph D.; Hamann, Jörg; Gordon, Siamon; Lin, Hsi-Hsien

    2003-01-01

    Using multivalent protein probes, an evolutionarily conserved endogenous ligand for EMR2, a human myeloid cell-restricted EGF-TM7 receptor, was identified on the surface of a number of adherent cell lines. In addition, in situ staining of the ligand has revealed specific in vivo patterns consistent

  8. A variety of human monoclonal antibodies against epidermal growth factor receptor isolated from a phage antibody library.

    Science.gov (United States)

    Kurosawa, Gene; Kondo, Mariko; Kurosawa, Yoshikazu

    2016-11-04

    When the technology for constructing human antibody (Ab) libraries using a phage-display system was developed, many researchers in Ab-related fields anticipated that it would be widely applied to the development of pharmaceutical drugs against various diseases, including cancers. However, successful examples of such applications are very limited. Moreover, researchers who utilize phage-display technology now show divergent ways of thinking about phage Ab libraries. For example, there is debate about what should be the source of V H and V L genes for the construction of libraries to cover the whole repertoire of Abs present in the human body. In the immune system, the introduction of mutations into V genes followed by selection based on binding activity, termed Ab maturation, is required for the production of Abs exhibiting high affinity to the antigen (Ag). Therefore, introduction of mutations and selection are required for isolation of Abs with high affinity after isolation of clones from phage Ab libraries. We constructed a large human Ab library termed AIMS, developed a screening method termed ICOS, and succeeded in isolating many human monoclonal Abs (mAbs) that specifically and strongly bind to various tumor-associated Ags. Eight anti-EGFR mAbs were included, which we characterized. These mAbs showed various different activities against EGFR-expressing cancer cells. In this paper, we describe these data and discuss the possibility and necessity that the mAbs isolated from the AIMS library might be developed as therapeutic drugs against cancers without introduction of mutations. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  9. Upregulated epidermal growth factor receptor expression following near-infrared irradiation simulating solar radiation in a three-dimensional reconstructed human corneal epithelial tissue culture model

    Directory of Open Access Journals (Sweden)

    Tanaka Y

    2016-08-01

    Full Text Available Yohei Tanaka,1,2 Jun Nakayama2 1Department of Plastic Surgery, Clinica Tanaka Plastic, Reconstructive Surgery and Anti-aging Center, 2Department of Molecular Pathology, Shinshu University Graduate School of Medicine, Matsumoto, Nagano, Japan Background and objective: Humans are increasingly exposed to near-infrared (NIR radiation from both natural (eg, solar and artificial (eg, electrical appliances sources. Although the biological effects of sun and ultraviolet (UV exposure have been extensively investigated, the biological effect of NIR radiation is still unclear. We previously reported that NIR as well as UV induces photoaging and standard UV-blocking materials, such as sunglasses, do not sufficiently block NIR. The objective of this study was to investigate changes in gene expression in three-dimensional reconstructed corneal epithelial tissue culture exposed to broad-spectrum NIR irradiation to simulate solar NIR radiation that reaches human tissues.Materials and methods: DNA microarray and quantitative real-time polymerase chain reaction analysis were used to assess gene expression levels in a three-dimensional reconstructed corneal epithelial model composed of normal human corneal epithelial cells exposed to water-filtered broad-spectrum NIR irradiation with a contact cooling (20°C. The water-filter allowed 1,000–1,800 nm wavelengths and excluded 1,400–1,500 nm wavelengths.Results: A DNA microarray with >62,000 different probes showed 25 and 150 genes that were up- or downregulated by at least fourfold and twofold, respectively, after NIR irradiation. In particular, epidermal growth factor receptor (EGFR was upregulated by 19.4-fold relative to control cells. Quantitative real-time polymerase chain reaction analysis revealed that two variants of EGFR in human corneal epithelial tissue were also significantly upregulated after five rounds of 10 J/cm2 irradiation (P<0.05.Conclusion: We found that NIR irradiation induced the

  10. Urinary transforming growth factors in neoplasia: separation of 125I-labeled transforming growth factor-alpha from epidermal growth factor in human urine

    International Nuclear Information System (INIS)

    Stromberg, K.; Hudgins, W.R.

    1986-01-01

    Purified human epidermal growth factor (hEGF) from urine promotes anchorage-independent cell growth in soft agar medium. This growth is enhanced by transforming growth factor-beta (TGF-beta), and is specifically inhibited by hEGF antiserum. Transforming growth factors of the alpha type (TGF-alpha), potentially present in normal human urine or urine from tumor-bearing patients, also promote anchorage-independent cell growth and compete with EGF for membrane receptor binding. Consequently, TGF-alpha cannot be distinguished from urinary hEGF by these two functional assays. Therefore, a technique for separation of TGF-alpha and related peptides from urinary EGF based on biochemical characteristics would be useful. Radioiodination of characterized growth factors [mouse EGF (mEGF), hEGF, and rat TGF-alpha (rTGF-alpha)], which were then separately added to human urine, was used to evaluate a resolution scheme that separates TGF-alpha from the high level of background hEGF present in human urine. Methyl bonded microparticulate silica efficiently adsorbed the 125 I-labeled mEGF, 125 I-labeled hEGF, and 125 I-labeled rTGF-alpha that were added to 24-h human urine samples. Fractional elution with acetonitrile (MeCN) of the adsorbed silica released approximately 70 to 80% of the 125 I-labeled mEGF and 125 I-labeled hEGF between 25 and 30% MeCN, and over 80% of the 125 I-labeled rTGF-alpha between 15 and 25% MeCN, with retention after dialysis of less than 0.2 and 1.7% of the original urinary protein, respectively. A single-step enrichment of about 400-fold for mEGF and hEGF, and 50-fold for rTGF-alpha were achieved rapidly. 125 I-labeled mEGF and 125 I-labeled hEGF eluted later than would be predicted on the basis of their reported molecular weight of approximately 6000, whereas 125 I-labeled rTGF-alpha eluted from Bio-Gel P-10 at an approximate molecular weight of 8000 to 9000

  11. Concurrent Autophagy Inhibition Overcomes the Resistance of Epidermal Growth Factor Receptor Tyrosine Kinase Inhibitors in Human Bladder Cancer Cells.

    Science.gov (United States)

    Kang, Minyong; Lee, Kyoung-Hwa; Lee, Hye Sun; Jeong, Chang Wook; Kwak, Cheol; Kim, Hyeon Hoe; Ku, Ja Hyeon

    2017-02-04

    Despite the potential therapeutic efficacy of epithelial growth factor receptor (EGFR) inhibitors in the treatment of advanced stage bladder cancer, there currently is no clear evidence to support this hypothesis. In this study, we investigate whether the concurrent treatment of autophagy-blocking agents with EGFR inhibitors exerts synergistic anti-cancer effects in T24 and J82 human bladder cancer cells. Lapatinib and gefitinib were used as EGFR inhibitors, and bafilomycin A1 (BFA1), chloroquine (CQ) and 3-methyladenine (3-MA) were used as the pharmacologic inhibitors of autophagy activities. To assess the proliferative and self-renewal capabilities, the Cell Counting Kit-8 (CCK-8) assay and a clonogenic assay were performed, respectively. To examine apoptotic cell death, flow cytometry using annexin-V/propidium iodide (PI) was used. To measure the autophagy activities, the expression levels of LC3I and II was determined by Western blot analysis. To validate the synergistic effects of autophagy inhibition with EGFR inhibitors, we specifically blocked key autophagy regulatory gene ATG12 by transfection of small interference RNA and examined the phenotypic changes. Of note, lapatinib and gefitinib triggered autophagy activities in T24 and J82 human bladder cancer cells, as indicated by upregulation of LC3II. More importantly, inhibiting autophagy activities with pharmacologic inhibitors (BFA1, CQ or 3-MA) remarkably reduced the cell viabilities and clonal proliferation of T24 and J82 cells, compared to those treated with either of the agents alone. We also obtained similar results of the enhanced anti-cancer effects of EGFR inhibitors by suppressing the expression of ATG12. Notably, the apoptotic assay showed that synergistic anti-cancer effects were induced via the increase of apoptotic cell death. In summary, concomitant inhibition of autophagy activities potentiated the anti-cancer effects of EGFR inhibitors in human bladder cancer cells, indicating a novel

  12. Concurrent Autophagy Inhibition Overcomes the Resistance of Epidermal Growth Factor Receptor Tyrosine Kinase Inhibitors in Human Bladder Cancer Cells

    Directory of Open Access Journals (Sweden)

    Minyong Kang

    2017-02-01

    Full Text Available Despite the potential therapeutic efficacy of epithelial growth factor receptor (EGFR inhibitors in the treatment of advanced stage bladder cancer, there currently is no clear evidence to support this hypothesis. In this study, we investigate whether the concurrent treatment of autophagy-blocking agents with EGFR inhibitors exerts synergistic anti-cancer effects in T24 and J82 human bladder cancer cells. Lapatinib and gefitinib were used as EGFR inhibitors, and bafilomycin A1 (BFA1, chloroquine (CQ and 3-methyladenine (3-MA were used as the pharmacologic inhibitors of autophagy activities. To assess the proliferative and self-renewal capabilities, the Cell Counting Kit-8 (CCK-8 assay and a clonogenic assay were performed, respectively. To examine apoptotic cell death, flow cytometry using annexin-V/propidium iodide (PI was used. To measure the autophagy activities, the expression levels of LC3I and II was determined by Western blot analysis. To validate the synergistic effects of autophagy inhibition with EGFR inhibitors, we specifically blocked key autophagy regulatory gene ATG12 by transfection of small interference RNA and examined the phenotypic changes. Of note, lapatinib and gefitinib triggered autophagy activities in T24 and J82 human bladder cancer cells, as indicated by upregulation of LC3II. More importantly, inhibiting autophagy activities with pharmacologic inhibitors (BFA1, CQ or 3-MA remarkably reduced the cell viabilities and clonal proliferation of T24 and J82 cells, compared to those treated with either of the agents alone. We also obtained similar results of the enhanced anti-cancer effects of EGFR inhibitors by suppressing the expression of ATG12. Notably, the apoptotic assay showed that synergistic anti-cancer effects were induced via the increase of apoptotic cell death. In summary, concomitant inhibition of autophagy activities potentiated the anti-cancer effects of EGFR inhibitors in human bladder cancer cells, indicating

  13. Hypoxia changes the expression of the epidermal growth factor (EGF) system in human hearts and cultured cardiomyocytes

    DEFF Research Database (Denmark)

    Munk, Mathias; Memon, Ashfaque Ahmed; Goetze, Jens Peter

    2012-01-01

    by treatment with trastuzumab (20 nM). This resulted in inhibition of cardiomyocyte proliferation, but interestingly only in hypoxic cells. Co-treatment of HL-1 cells with HB-EGF (10 nM) but not with NRG-1 (5 ng/ml) rescued the cardiomyocytes from HER2 inhibition. HL-1 cardiomyocytes exposed to hypoxia...... revealed nuclear translocation of activated MAPK and the activity of this downstream signaling molecule was decreased by HER2 inhibition (20 nM trastuzumab), and re-established by HB-EGF (10 nM). CONCLUSIONS/SIGNIFICANCE: Hypoxia in the human heart alters the expression of the EGF system. Mimicking the HER...

  14. Ginsenosides Rb1 and Rg1 Stimulate Melanogenesis in Human Epidermal Melanocytes via PKA/CREB/MITF Signaling

    Directory of Open Access Journals (Sweden)

    Mao Lin

    2014-01-01

    Full Text Available Reduced or defective melanin skin pigmentation may cause many hypopigmentation disorders and increase the risk of damage to the skin triggered by UV irradiation. Ginsenosides Rb1 and Rg1 have many molecular targets including the cAMP-response element-binding protein (CREB, which is involved in melanogenesis. This study aimed to investigate the effects of ginsenosides Rb1 and Rg1 on melanogenesis in human melanocytes and their related mechanisms. The effects of Rb1 and Rg1 on cell viability, tyrosinase activity, cellular melanin content and protein levels of tyrosinase, microphthalmia-associated transcription factor (MITF, and activation of CREB in melanocytes were assessed. Results showed that Rb1 or Rg1 significantly increased cellular melanin content and tyrosinase activity in a dose-dependent manner. By contrast, the cell viability of melanocytes remained unchanged. After exposure to Rb1 or Rg1, the protein levels of tyrosinase, MITF, and phosphorylated CREB were significantly increased. Furthermore, pretreatment with the selective PKA inhibitor H-89 significantly blocked the Rb1- or Rg1-induced increase of melanin content. These findings indicated that Rb1 and Rg1 increased melanogenesis and tyrosinase activity in human melanocytes, which was associated with activation of PKA/CREB/MITF signaling. The effects and mechanisms of Rb1 or Rg1 on skin pigmentation deserve further study.

  15. Human antibody fragments specific for the epidermal growth factor receptor selected from large non-immunised phage display libraries.

    Science.gov (United States)

    Souriau, Christelle; Rothacker, Julie; Hoogenboom, Hennie R; Nice, Edouard

    2004-09-01

    Antibodies to EGFR have been shown to display anti-tumour effects mediated in part by inhibition of cellular proliferation and angiogenesis, and by enhancement of apoptosis. Humanised antibodies are preferred for clinical use to reduce complications with HAMA and HAHA responses frequently seen with murine and chimaeric antibodies. We have used depletion and subtractive selection strategies on cells expressing the EGFR to sample two large antibody fragment phage display libraries for the presence of human antibodies which are specific for the EGFR. Four Fab fragments and six scFv fragments were identified, with affinities of up to 2.2nM as determined by BIAcore analysis using global fitting of the binding curves to obtain the individual rate constants (ka and kd). This overall approach offers a generic screening method for the identification of growth factor specific antibodies and antibody fragments from large expression libraries and has potential for the rapid development of new therapeutic and diagnostic reagents.

  16. Everolimus Plus Endocrine Therapy for Postmenopausal Women With Estrogen Receptor-Positive, Human Epidermal Growth Factor Receptor 2-Negative Advanced Breast Cancer: A Clinical Trial.

    Science.gov (United States)

    Royce, Melanie; Bachelot, Thomas; Villanueva, Cristian; Özgüroglu, Mustafa; Azevedo, Sergio J; Cruz, Felipe Melo; Debled, Marc; Hegg, Roberto; Toyama, Tatsuya; Falkson, Carla; Jeong, Joon; Srimuninnimit, Vichien; Gradishar, William J; Arce, Christina; Ridolfi, Antonia; Lin, Chinjune; Cardoso, Fatima

    2018-03-22

    Cotargeting the mammalian target of rapamycin pathway and estrogen receptor may prevent or delay endocrine resistance in patients receiving first-line treatment for advanced breast cancer. To investigate the combination of everolimus plus endocrine therapy in first-line and second-line treatment settings for postmenopausal women with estrogen receptor-positive, human epidermal growth receptor 2-negative advanced breast cancer. In the multicenter, open-label, single-arm, phase 2 BOLERO-4 (Breast Cancer Trials of Oral Everolimus) clinical trial, 245 patients were screened for eligibility; 202 were enrolled between March 7, 2013, and December 17, 2014. A median follow-up of 29.5 months had been achieved by the data cutoff date (December 17, 2016). Patients received first-line treatment with everolimus, 10 mg/d, plus letrozole, 2.5 mg/d. Second-line treatment with everolimus, 10 mg/d, plus exemestane, 25 mg/d, was offered at the investigator's discretion upon initial disease progression. The primary end point was investigator-assessed progression-free survival in the first-line setting per Response Evaluation Criteria in Solid Tumors, version 1.0. Safety was assessed in patients who received at least 1 dose of study medication and at least 1 postbaseline safety assessment. A total of 202 women treated in the first-line setting had a median age of 64.0 years (interquartile range, 58.0-70.0 years) with metastatic (194 [96.0%]) or locally advanced (8 [4.0%]) breast cancer. Median progression-free survival was 22.0 months (95% CI, 18.1-25.1 months) with everolimus and letrozole. Median overall survival was not reached; 24-month estimated overall survival rate was 78.7% (95% CI, 72.1%-83.9%). Fifty patients started second-line treatment; median progression-free survival was 3.7 months (95% CI, 1.9-7.4 months). No new safety signals were observed. In the first-line setting, the most common all-grade adverse event was stomatitis (139 [68.8%]); the most common grade 3 to 4

  17. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  18. Phase II study of paclitaxel given once per week along with trastuzumab and pertuzumab in patients with human epidermal growth factor receptor 2-positive metastatic breast cancer.

    Science.gov (United States)

    Dang, Chau; Iyengar, Neil; Datko, Farrah; D'Andrea, Gabriella; Theodoulou, Maria; Dickler, Maura; Goldfarb, Shari; Lake, Diana; Fasano, Julie; Fornier, Monica; Gilewski, Theresa; Modi, Shanu; Gajria, Devika; Moynahan, Mary Ellen; Hamilton, Nicola; Patil, Sujata; Jochelson, Maxine; Norton, Larry; Baselga, Jose; Hudis, Clifford

    2015-02-10

    The CLEOPATRA (Clinical Evaluation of Trastuzumab and Pertuzumab) study demonstrated superior progression-free survival (PFS) and overall survival when pertuzumab was added to trastuzumab and docetaxel. Paclitaxel given once per week is effective and less toxic than docetaxel. We performed a phase II study to evaluate the efficacy and safety of pertuzumab and trastuzumab with paclitaxel given once per week. Patients with metastatic human epidermal growth factor receptor 2-positive breast cancer with zero to one prior therapy were enrolled. Treatment consisted of paclitaxel 80 mg/m(2) once per week plus trastuzumab (8 mg/kg loading dose → 6 mg/kg) once every 3 weeks plus pertuzumab (840 mg loading dose → 420 mg) once every 3 weeks, all given intravenously. The primary end point was 6-month PFS assessed by Kaplan-Meier methods. From January 2011 to December 2013, we enrolled 69 patients: 51 (74%) and 18 (26%) treated in first- and second-line metastatic settings, respectively. At a median follow-up of 21 months (range, 3 to 38 months), 6-month PFS was 86% (95% CI, 75% to 92%). The median PFS was 19.5 months (95% CI, 14 to 26 months) overall. PFS was 24.2 months (95% CI, 14 months to not reached [NR]) and 16.4 months (95% CI, 8.5 months to NR) for those without and with prior treatment, respectively. At 1 year, Kaplan-Meier PFS was 70% (95% CI, 56% to 79%) overall, 71% (95% CI, 55% to 82%) for those without prior therapy, and 66% (95% CI, 40% to 83%) for those with prior therapy. Treatment was well-tolerated; there was no febrile neutropenia or symptomatic left ventricular systolic dysfunction. Paclitaxel given once per week with trastuzumab and pertuzumab is highly active and well tolerated and seems to be an effective alternative to docetaxel-based combination therapy. © 2014 by American Society of Clinical Oncology.

  19. Suppression of the Epidermal Growth Factor-like Domain 7 and Inhibition of Migration and Epithelial-Mesenchymal Transition in Human Pancreatic Cancer PANC-1 Cells.

    Science.gov (United States)

    Wang, Yun-Liang; Dong, Feng-Lin; Yang, Jian; Li, Zhi; Zhi, Qiao-Ming; Zhao, Xin; Yang, Yong; Li, De-Chun; Shen, Xiao-Chun; Zhou, Jin

    2015-01-01

    Epidermal growth factor-like domain multiple 7 (EGFL7), a secreted protein specifically expressed by endothelial cells during embryogenesis, recently was identified as a critical gene in tumor metastasis. Epithelial-mesenchymal transition (EMT) was found to be closely related with tumor progression. Accordingly, it is important to investigate the migration and EMT change after knock-down of EGFL7 gene expression in human pancreatic cancer cells. EGFL7 expression was firstly testified in 4 pancreatic cancer cell lines by real-time polymerase chain reaction (Real-time PCR) and western blot, and the highest expression of EGFL7 was found in PANC-1 cell line. Then, PANC-1 cells transfected with small interference RNA (siRNA) of EGFL7 using plasmid vector were named si-PANC-1, while transfected with negative control plasmid vector were called NC-PANC-1. Transwell assay was used to analyze the migration of PANC-1 cells. Real-time PCR and western blotting were used to detect the expression change of EGFL7 gene, EMT markers like E-Cadherin, N-Cadherin, Vimentin, Fibronectin and transcription factors like snail, slug in PANC-1, NC- PANC-1, and si-PANC-1 cells, respectively. After successful plasmid transfection, EGFL7 gene were dramatically knock-down by RNA interference in si-PANC-1 group. Meanwhile, migration ability decreased significantly, compared with PANC-1 and NC-PANC-1 group. Meanwhile, the expression of epithelial phenotype marker E-Cadherin increased and that of mesenchymal phenotype markers N-Cadherin, Vimentin, Fibronectin dramatically decreased in si-PANC-1 group, indicating a reversion of EMT. Also, transcription factors snail and slug decreased significantly after RNA interference. Current study suggested that highly-expressed EGFL7 promotes migration of PANC-1 cells and acts through transcription factors snail and slug to induce EMT, and further study is needed to confirm this issue.

  20. Molecular subclassification determined by human papillomavirus and epidermal growth factor receptor status is associated with the prognosis of oropharyngeal squamous cell carcinoma.

    Science.gov (United States)

    Nakano, Takafumi; Yamamoto, Hidetaka; Nakashima, Torahiko; Nishijima, Toshimitsu; Satoh, Masanobu; Hatanaka, Yui; Shiratsuchi, Hideki; Yasumatsu, Ryuji; Toh, Satoshi; Komune, Shizuo; Oda, Yoshinao

    2016-04-01

    Human papillomavirus (HPV) infection is an indicator of good response to chemoradiotherapy in oropharyngeal squamous cell carcinoma (OPSCC), and epidermal growth factor receptor (EGFR) is a molecular-therapeutic target in head and neck squamous cell carcinoma. Here we investigated the prevalence and prognostic significance of HPV infection and EGFR alteration in OPSCC. We analyzed the presence of high-risk HPV using in situ hybridization, protein expressions of p16 and EGFR using immunohistochemistry, and the EGFR gene copy number gain using chromogenic in situ hybridization (CISH) in 105 cases of OPSCC. The biopsy specimens before chemoradiotherapy were used for these analyses. HPV infection and p16 protein overexpression were detected in 53.3% and 52.4% of the OPSCCs, and each factor was associated with better overall survival (P = .0026 and P = .0026) and nonkeratinizing histology (P = .0002 and P = .0004), respectively. EGFR gene copy number gain (high polysomy or amplification) was detected in 12.4% of the OPSCCs and was correlated with EGFR protein overexpression (P = .0667) and worse overall survival (P CISH positive) were mutually exclusive. The HPV-negative/EGFR CISH-positive OPSCCs had significantly worse overall survival than did the HPV-positive/EGFR CISH-negative OPSCCs and HPV-negative/EGFR CISH-negative OPSCCs (P CISH-negative OPSCCs had favorable prognosis irrespective of HPV infection. Our results suggest that EGFR gene copy number gain-positive tumors represent an HPV-negative, aggressive subgroup of OPSCCs. The molecular subclassification of OPSCCs based on HPV infection and EGFR status may serve as important information for appropriate therapeutic strategy. Copyright © 2015 Elsevier Inc. All rights reserved.

  1. The curative effects of radiotherapy-based therapies for human epidermal growth factor receptor 2-positive breast cancer: A meta-analysis.

    Science.gov (United States)

    Shao, Minghai; Zhang, Chi; Qin, Qin; Zhang, Zhaoyue; Zhu, Hongcheng; Di, Xiaoke; Sun, Xinchen

    2017-09-01

    This meta-analysis was designed to fully assess the curative effects of radiotherapy-based therapies for human epidermal growth factor receptor 2-positive (HER2+) breast cancer (BC). English articles were retrieved through searching Cochrane library, PubMed, and Embase databases updated to February 2017. Studies were selected based on the inclusion and exclusion criteria. The curative effects of radiotherapy-based therapies forHER2+ BC patients were assessed using hazard rates (HRs) or odds ratios (ORs), as well as their 95% confidence intervals (CIs). In addition, Egger test was used to assess publication bias, followed by sensitivity analysis. All statistic methods were conducted using R 3.12 software. A total of 9 eligible studies were included into this meta-analysis, which involved 2236 HER2+ BC patients. Egger test showed that the eligible studies had no publication bias (t = 2.198, P = .05918). Sensitivity analysis demonstrated that the results were stable. HER2+ BC patients in radiotherapy group had lower locoregional recurrences than those in other groups. Moreover, meta-analysis showed that no significant difference was found between HER2+ BC patients in radiotherapy group and other groups on the 1-year overall survival (P = 0.5263, I = 65.4%), 3-year overall survival (P = 0.4591, I = 0), and 5-year overall survival (P = 0.06277, I = 0). Radiotherapy-based therapies might have certain advantages in treating HER2+ BC patients.

  2. Disease management patterns for postmenopausal women in Europe with hormone-receptor-positive, human epidermal growth factor receptor-2 negative advanced breast cancer.

    Science.gov (United States)

    André, Fabrice; Neven, Patrick; Marinsek, Nina; Zhang, Jie; Baladi, Jean-Francois; Degun, Ravi; Benelli, Giancarlo; Saletan, Stephen; Jerusalem, Guy

    2014-06-01

    International guidelines for hormone-receptor-positive (HR(+)), human epidermal growth factor receptor-2 negative (HER2(-)) advanced breast cancer (BC) recommend sequential lines of hormonal therapy (HT), and only recommend chemotherapy for patients with extensive visceral involvement or rapidly progressive disease. This study evaluated actual physician-reported treatments for advanced BC in Europe. We conducted a retrospective chart review of 355 postmenopausal women with HR(+), HER2(-) advanced BC who progressed on ≥1 line of HT (adjuvant or advanced) and completed ≥1 line of chemotherapy (advanced). Treatment choice was evaluated for each line of therapy. Of 355 patients, 111 (31%) received first-line chemotherapy, whereas 218 (61%) and 26 (7%) switched from HT to chemotherapy in second and third line, respectively. More patients receiving first-line HT had bone metastases (73% vs 27% chemotherapy). Patients treated with first-line chemotherapy had more brain (12% vs 3% HT) or extensive liver (13% vs 6% HT) metastases. Subgroup analysis of 188 patients who received first-line HT and had de novo advanced BC or relapsed/recurrent disease more than 1 year after adjuvant therapy found that the majority (89%; n = 167) of these patients switched to chemotherapy in second line. However, among these 167 patients, 27% had no significant changes in metastases between first and second line. Among the 73% of patients who had significant changes in metastases, 20% had no brain metastases or extensive visceral disease. Our study suggests that the guideline-recommended use of multiple HT lines is open to interpretation and that optimal treatment for European postmenopausal women with HR(+), HER2(-) advanced BC who responded to HT may not be achieved.

  3. Patterns of resource utilization and cost for postmenopausal women with hormone-receptor–positive, human epidermal growth factor receptor-2–negative advanced breast cancer in Europe

    International Nuclear Information System (INIS)

    Jerusalem, Guy; Neven, Patrick; Marinsek, Nina; Zhang, Jie; Degun, Ravi; Benelli, Giancarlo; Saletan, Stephen; Ricci, Jean-François; Andre, Fabrice

    2015-01-01

    Healthcare resource utilization in breast cancer varies by disease characteristics and treatment choices. However, lack of clarity in guidelines can result in varied interpretation and heterogeneous treatment management and costs. In Europe, the extent of this variability is unclear. Therefore, evaluation of chemotherapy use and costs versus hormone therapy across Europe is needed. This retrospective chart review (N = 355) examined primarily direct costs for chemotherapy versus hormone therapy in postmenopausal women with hormone-receptor–positive (HR+), human epidermal growth factor receptor-2–negative (HER2–) advanced breast cancer across 5 European countries (France, Germany, The Netherlands, Belgium, and Sweden). Total direct costs across the first 3 treatment lines were approximately €10 000 to €14 000 lower for an additional line of hormone therapy-based treatment versus switching to chemotherapy-based treatment. Direct cost difference between chemotherapy-based and hormone therapy-based regimens was approximately €1900 to €2500 per month. Chemotherapy-based regimens were associated with increased resource utilization (managing side effects; concomitant targeted therapy use; and increased frequencies of hospitalizations, provider visits, and monitoring tests). The proportion of patients taking sick leave doubled after switching from hormone therapy to chemotherapy. These results suggest chemotherapy is associated with increased direct costs and potentially with increased indirect costs (lower productivity of working patients) versus hormone therapy in HR+, HER2– advanced breast cancer. The online version of this article (doi:10.1186/s12885-015-1762-3) contains supplementary material, which is available to authorized users

  4. GEP100/Arf6 is required for epidermal growth factor-induced ERK/Rac1 signaling and cell migration in human hepatoma HepG2 cells.

    Directory of Open Access Journals (Sweden)

    ZhenZhen Hu

    Full Text Available BACKGROUND: Epidermal growth factor (EGF signaling is implicated in the invasion and metastasis of hepatoma cells. However, the signaling pathways for EGF-induced motility of hepatoma cells remain undefined. METHODOLOGY/PRINCIPAL FINDINGS: We found that EGF dose-dependently stimulated the migration of human hepatoma cells HepG2, with the maximal effect at 10 ng/mL. Additionally, EGF increased Arf6 activity, and ectopic expression of Arf6 T27N, a dominant negative Arf6 mutant, largely abolish EGF-induced cell migration. Blocking GEP100 with GEP100 siRNA or GEP100-△PH, a pleckstrin homology (PH domain deletion mutant of GEP100, blocked EGF-induced Arf6 activity and cell migration. EGF also increased ERK and Rac1 activity. Ectopic expression GEP100 siRNA, GEP100-△PH, or Arf6-T27N suppressed EGF-induced ERK and Rac1 activity. Furthermore, blocking ERK signaling with its inhibitor U0126 remarkably inhibited both EGF-induced Rac1 activation as well as cell migration, and ectopic expression of inactive mutant form of Rac1 (Rac1-T17N also largely abolished EGF-induced cell migration. CONCLUSIONS/SIGNIFICANCE: Taken together, this study highlights the function of the PH domain of GEP100 and its regulated Arf6/ERK/Rac1 signaling cascade in EGF-induced hepatoma cell migration. These findings could provide a rationale for designing new therapy based on inhibition of hepatoma metastasis.

  5. Evaluation of human epidermal growth factor receptor 2 (HER2) single nucleotide polymorphisms (SNPs) in normal and breast tumor tissues and their link with breast cancer prognostic factors.

    Science.gov (United States)

    Furrer, Daniela; Lemieux, Julie; Côté, Marc-André; Provencher, Louise; Laflamme, Christian; Barabé, Frédéric; Jacob, Simon; Michaud, Annick; Diorio, Caroline

    2016-12-01

    Amplification of the human epidermal growth factor receptor 2 (HER2) gene is associated with worse prognosis and decreased overall survival in breast cancer patients. The HER2 gene contains several polymorphisms; two of the best-characterized HER2 polymorphisms are Ile655Val and Ala1170Pro. The aim of this study was to evaluate the association between these two HER2 polymorphisms in normal breast and breast cancer tissues and known breast cancer prognostic factors in a retrospective cohort study of 73 women with non-metastatic HER2-positive breast cancer. HER2 polymorphisms were assessed in breast cancer tissue and normal breast tissue using TaqMan assay. Ala1170Pro polymorphism in normal breast tissue was associated with age at diagnosis (p = 0.007), tumor size (p = 0.004) and lymphovascular invasion (p = 0.06). Similar significant associations in cancer tissues were observed. No association between the Ile655Val polymorphism and prognostic factors were observed. However, we found significant differences in the distribution of Ile655Val (p = 0.03) and Ala1170Pro (p = 0.01) genotypes between normal breast and breast tumor tissues. This study demonstrates that only the Ala1170Pro polymorphism is associated with prognostic factors in HER2-positive breast cancer patients. Moreover, our results suggest that both HER2 polymorphisms could play a significant role in carcinogenesis in non-metastatic HER2-positive breast cancer women. Copyright © 2016 Elsevier Ltd. All rights reserved.

  6. Gene expression profiling of histologically normal breast tissue in females with human epidermal growth factor receptor 2‑positive breast cancer.

    Science.gov (United States)

    Zubor, Pavol; Hatok, Jozef; Moricova, Petra; Kapustova, Ivana; Kajo, Karol; Mendelova, Andrea; Sivonova, Monika Kmetova; Danko, Jan

    2015-02-01

    Gene expression profile‑based taxonomy of breast cancer (BC) has been described as a significant breakthrough in comprehending the differences in the origin and behavior of cancer to allow individually tailored therapeutic approaches. In line with this, we hypothesized that the gene expression profile of histologically normal epithelium (HNEpi) could harbor certain genetic abnormalities predisposing breast tissue cells to develop human epidermal growth factor receptor 2 (HER2)‑positive BC. Thus, the aim of the present study was to assess gene expression in normal and BC tissue (BCTis) from patients with BC in order to establish its value as a potential diagnostic marker for cancer development. An array study evaluating a panel of 84 pathway‑ and disease‑specific genes in HER2‑positive BC and tumor‑adjacent HNEpi was performed using quantitative polymerase chain reaction in 12 patients using microdissected samples from frozen tissue. Common prognostic and predictive parameters of BC were assessed by immunohistochemistry and in situ hybridization. In the BCTis and HNEpi samples of 12 HER2‑positive subjects with BC, the expression of 2,016 genes was assessed. A total of 39.3% of genes were deregulated at a minimal two‑fold deregulation rate and 10.7% at a five‑fold deregulation rate in samples of HNEpi or BCTis. Significant differences in gene expression between BCTis and HNEpi samples were revealed for BCL2L2, CD44, CTSD, EGFR, ERBB2, ITGA6, NGFB, RPL27, SCBG2A1 and SCGB1D2 genes (Pbreast tissue revealed gene expression abnormalities that may represent potential markers of increased risk for HER2‑positive malignant transformation of breast tissue, and may be able to be employed as predictors of prognosis.

  7. Suppressors for Human Epidermal Growth Factor Receptor 2/4 (HER2/4): A New Family of Anti-Toxoplasmic Agents in ARPE-19 Cells.

    Science.gov (United States)

    Kim, Yeong Hoon; Bhatt, Lokraj; Ahn, Hye-Jin; Yang, Zhaoshou; Lee, Won-Kyu; Nam, Ho-Woo

    2017-10-01

    The effects of tyrosine kinase inhibitors (TKIs) were evaluated on growth inhibition of intracellular Toxoplasma gondii in host ARPE-19 cells. The number of tachyzoites per parasitophorous vacuolar membrane (PVM) was counted after treatment with TKIs. T. gondii protein expression was assessed by western blot. Immunofluorescence assay was performed using Programmed Cell Death 4 (PDCD4) and T. gondii GRA3 antibodies. The TKIs were divided into 3 groups; non-epidermal growth factor receptor (non-EGFR), anti-human EGFR 2 (anti-HER2), and anti-HER2/4 TKIs, respectively. Group I TKIs (nintedanib, AZD9291, and sunitinib) were unable to inhibit proliferation without destroying host cells. Group II TKIs (lapatinib, gefitinib, erlotinib, and AG1478) inhibited proliferation up to 98% equivalent to control pyrimethamine (5 μM) at 20 μM and higher, without affecting host cells. Group III TKIs (neratinib, dacomitinib, afatinib, and pelitinib) inhibited proliferation up to 98% equivalent to pyrimethamine at 1-5 μM, but host cells were destroyed at 10-20 μM. In Group I, TgHSP90 and SAG1 inhibitions were weak, and GRA3 expression was moderately inhibited. In Group II, TgHSP90 and SAG1 expressions seemed to be slightly enhanced, while GRA3 showed none to mild inhibition; however, AG1478 inhibited all proteins moderately. Protein expression was blocked in Group III, comparable to pyrimethamine. PDCD4 and GRA3 were well localized inside the nuclei in Group I, mildly disrupted in Group II, and were completely disrupted in Group III. This study suggests the possibility of a vital T. gondii TK having potential HER2/4 properties, thus anti-HER2/4 TKIs may inhibit intracellular parasite proliferation with minimal adverse effects on host cells.

  8. Phase I study of neratinib in combination with temsirolimus in patients with human epidermal growth factor receptor 2-dependent and other solid tumors.

    Science.gov (United States)

    Gandhi, Leena; Bahleda, Rastislav; Tolaney, Sara M; Kwak, Eunice L; Cleary, James M; Pandya, Shuchi S; Hollebecque, Antoine; Abbas, Richat; Ananthakrishnan, Revathi; Berkenblit, Anna; Krygowski, Mizue; Liang, Yali; Turnbull, Kathleen W; Shapiro, Geoffrey I; Soria, Jean-Charles

    2014-01-10

    Human epidermal growth factor (HER) -mediated signaling is critical in many cancers, including subsets of breast and lung cancer. HER family members signal via the phosphatidylinositide 3-kinase (PI3K) -AKT/protein kinase B-mammalian target of rapamycin (mTOR) cascade; mTOR activation is critical for the expression of multiple contributors to tumor growth and invasion. On the basis of preclinical data suggesting synergy of HER2 inhibition and mTOR inhibition in breast and lung cancer models, we conducted a phase I combination study of neratinib, a small-molecule irreversible pan-HER tyrosine kinase inhibitor, and temsirolimus, an mTOR inhibitor, in patients with advanced solid tumors. This study enrolled patients to dosing combinations of neratinib and temsirolimus. The primary objective was to estimate the toxicity contour of the combination and establish recommended phase II doses. Sixty patients were treated on 12 of 16 possible dosing combinations. Diarrhea was the most common drug-related (93%) and dose-limiting toxicity (DLT), constituting four of 10 DLTs. Dose-limiting grade 3 metabolic abnormalities were also observed. Other frequent drug-related toxicities included nausea, stomatitis (both 53%), and anemia (48%). Two maximum-tolerated dose combinations were identified: 200 mg of neratinib/25 mg of temsirolimus and 160 mg of neratinib/50 mg of temsirolimus. Responses were noted in patients with HER2-amplified breast cancer resistant to trastuzumab, HER2-mutant non-small-cell lung cancer, and tumor types without identified mutations in the HER-PI3K-mTOR pathway. The combination of neratinib and temsirolimus was tolerable and demonstrated antitumor activity in multiple tumor types, warranting further evaluation.

  9. Gene protein detection platform--a comparison of a new human epidermal growth factor receptor 2 assay with conventional immunohistochemistry and fluorescence in situ hybridization platforms.

    Science.gov (United States)

    Stålhammar, Gustav; Farrajota, Pedro; Olsson, Ann; Silva, Cristina; Hartman, Johan; Elmberger, Göran

    2015-08-01

    Human epidermal growth factor receptor 2 (HER2) immunohistochemistry (IHC) and fluorescence in situ hybridization (FISH) are widely used semiquantitative assays for selecting breast cancer patients for HER2 antibody therapy. However, both techniques have been shown to have disadvantages. Our aim was to test a recent automated technique of combined IHC and brightfield dual in situ hybridization-gene protein detection platform (GPDP)-in breast cancer HER2 protein, gene, and chromosome 17 centromere status evaluations, comparing the results in accordance to the American Society of Clinical Oncology/College of American Pathologists recommendations for HER2 testing in breast cancer from both 2007 and 2013. The GPDP technique performance was evaluated on 52 consecutive whole slide invasive breast cancer cases with HER2 IHC 2/3+ scoring results. Applying in turns the American Society of Clinical Oncology/College of American Pathologists recommendations for HER2 testing in breast cancer from 2007 and 2013 to both FISH and GPDP DISH assays, the HER2 gene amplification results showed 100% concordance among amplified/nonamplified cases, but there was a shift in 4 cases toward positive from equivocal results and toward equivocal from negative results. This might be related to the emphasis on the average HER2 copy number in the 2013 criteria. HER2 expression by IVD market IHC kit (Pathway®) has a strong correlation with GPDP HER2 protein, including a full concordance for all cases scored as 3+ and a reduction from 2+ to 1+ in 7 cases corresponding to nonamplified cases. Gene protein detection platform HER2 protein "solo" could have spared the need for 7 FISH studies. In addition, the platform offered advantages on interpretation reassurance including selecting areas for counting gene signals paralleled with protein IHC expression, on heterogeneity detection, interpretation time, technical time, and tissue expense. Copyright © 2015 Elsevier Inc. All rights reserved.

  10. Toxicity of jet fuel aliphatic and aromatic hydrocarbon mixtures on human epidermal Keratinocytes: evaluation based on in vitro cytotoxicity and interleukin-8 release

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Jen-Hung (Chung-Shan Medical University Hospital, Department of Dermatology, Taichung, Taiwan, R.O.C); Lee, Chia-Hue; Tsang, Chau-Loong [National Chung-Hsing University, College of Veterinary Medicine, Taichung (Taiwan); Monteiro-Riviere, Nancy A.; Riviere, Jim E. [North Carolina State University, Center for Chemical Toxicology Research and Pharmacokinetics (CCTRP), Raleigh, NC (United States); Chou, Chi-Chung [National Chung-Hsing University, College of Veterinary Medicine, Taichung (Taiwan); National Chung-Hsing University, College of Veterinary Medicine, Taichung (Taiwan)

    2006-08-15

    Jet fuels are complex mixtures of aliphatic (ALI) and aromatic (ARO) hydrocarbons that vary significantly in individual cytotoxicity and proinflammatory activity in human epidermal keratinocytes (HEK). In order to delineate the toxicological interactions among individual hydrocarbons in a mixture and their contributions to cutaneous toxicity, nine ALI and five ARO hydrocarbons were each divided into five (high/medium/low cytotoxic and strong/weak IL-8 induction) groups and intra/inter-mixed to assess for their mixture effects on HEK mortality and IL-8 release. Addition of single hydrocarbon to JP-8 fuel was also evaluated for their changes in fuel dermatotoxicity. The results indicated that when hydrocarbons were mixed, HEK mortality and IL-8 release were not all predictable by their individual ability affecting these two parameters. The lowest HEK mortality (7%) and the highest IL-8 production were induced with mixtures including high cytotoxic and weak IL-8 inductive ARO hydrocarbons. Antagonistic reactions not consistently correlated with ALI carbon chain length and ARO structure were evident and carried different weight in the overall mixture toxicities. Single addition of benzene, toluene, xylene or ethylbenzene for up to tenfold in JP-8 did not increase HEK mortality while single addition of ALI hydrocarbons exhibited dose-related differential response in IL-8. In an all ALI environment, no single hydrocarbon is the dominating factor in the determination of HEK cytotoxicity while deletion of hexadecane resulted in a 2.5-fold increase in IL-8 production. Overall, decane, undecane and dodecane were the major hydrocarbons associated with high cytotoxicity while tetradecane, pentadecane and hexadecane were those which had the greatest buffering effect attenuating dermatotoxicity. The mixture effects must be considered when evaluating jet fuel toxicity to HEK. (orig.)

  11. Safety and efficacy of neratinib in combination with capecitabine in patients with metastatic human epidermal growth factor receptor 2-positive breast cancer.

    Science.gov (United States)

    Saura, Cristina; Garcia-Saenz, Jose A; Xu, Binghe; Harb, Wael; Moroose, Rebecca; Pluard, Timothy; Cortés, Javier; Kiger, Corinne; Germa, Caroline; Wang, Kongming; Martin, Miguel; Baselga, José; Kim, Sung-Bae

    2014-11-10

    Neratinib is a potent irreversible pan-tyrosine kinase inhibitor with antitumor activity and acceptable tolerability in patients with human epidermal growth factor receptor 2 (HER2) -positive breast cancer. A multinational, open-label, phase I/II trial was conducted to determine the maximum-tolerated dose (MTD) of neratinib plus capecitabine in patients with solid tumors (part one) and to evaluate the safety and efficacy of neratinib plus capecitabine in patients with HER2-positive metastatic breast cancer (part two). Part one was a 3 + 3 dose-escalation study in which patients with advanced solid tumors received oral neratinib once per day continuously plus capecitabine twice per day on days 1 to 14 of a 21-day cycle at predefined dose levels. In part two, patients with trastuzumab-pretreated HER2-positive metastatic breast cancer received neratinib plus capecitabine at the MTD. The primary end point in part two was objective response rate (ORR). In part one (n = 33), the combination of neratinib 240 mg per day plus capecitabine 1,500 mg/m(2) per day was defined as the MTD, which was further evaluated in part 2 (n = 72). The most common drug-related adverse events were diarrhea (88%) and palmar-plantar erythrodysesthesia syndrome (48%). In part two, the ORR was 64% (n = 39 of 61) in patients with no prior lapatinib exposure and 57% (n = 4 of 7) in patients previously treated with lapatinib. Median progression-free survival was 40.3 and 35.9 weeks, respectively. Neratinib in combination with capecitabine had a manageable toxicity profile and showed promising antitumor activity in patients with HER2-positive metastatic breast cancer pretreated with trastuzumab and lapatinib. © 2014 by American Society of Clinical Oncology.

  12. Human Papillomavirus and Epidermal Growth Factor Receptor in Oral Cavity and Oropharyngeal Squamous Cell Carcinoma: Correlation With Dynamic Contrast-Enhanced MRI Parameters.

    Science.gov (United States)

    Choi, Yoon Seong; Park, Mina; Kwon, Hyeong Ju; Koh, Yoon Woo; Lee, Seung-Koo; Kim, Jinna

    2016-02-01

    The objective of this study was to investigate differences in dynamic contrast-enhanced MRI (DCE-MRI) parameters on the basis of the status of human papillomavirus (HPV) and epidermal growth factor receptor (EGFR) biomarkers in patients with squamous cell carcinoma (SCC) of the oral cavity and oropharynx by use of histogram analysis. A total of 22 consecutive patients with oral cavity and oropharyngeal SCC underwent DCE-MRI before receiving treatment. DCE parameter maps of the volume transfer constant (K(trans)), the flux rate constant (kep), and the extravascular extracellular volume fraction (ve) were obtained. The histogram parameters were calculated using the entire enhancing tumor volume and were compared between the patient subgroups on the basis of HPV and EGFR biomarker statuses. The cumulative histogram parameters of K(trans) and kep showed lower values in the HPV-negative and EFGR-overexpression group than in the HPV-positive EGFR-negative group. These differences were statistically significant for the mean (p = 0.009), 25th, 50th, and 75th percentile values of K(trans) and for the 25th percentile value of kep when correlated with HPV status in addition to the mean K(trans) value (p = 0.047) and kep value (p = 0.004) when correlated with EGFR status. No statistically significant difference in ve was found on the basis of HPV and EGFR status. DCE-MRI is useful for the assessment of the tumor microenvironment associated with HPV and EGFR biomarkers before treatment of patients with oral cavity and oropharyngeal SCC.

  13. Detection of Alpha-Toxin and Other Virulence Factors in Biofilms of Staphylococcus aureus on Polystyrene and a Human Epidermal Model.

    Science.gov (United States)

    den Reijer, P M; Haisma, E M; Lemmens-den Toom, N A; Willemse, J; Koning, R I; Koning, R A; Demmers, J A A; Dekkers, D H W; Rijkers, E; El Ghalbzouri, A; Nibbering, P H; van Wamel, W

    2016-01-01

    The ability of Staphylococcus aureus to successfully colonize (a)biotic surfaces may be explained by biofilm formation and the actions of virulence factors. The aim of the present study was to establish the presence of 52 proteins, including virulence factors such as alpha-toxin, during biofilm formation of five different (methicillin resistant) S. aureus strains on Leiden human epidermal models (LEMs) and polystyrene surfaces (PS) using a competitive Luminex-based assay. All five S. aureus strains formed biofilms on PS, whereas only three out of five strains formed biofilms on LEMs. Out of the 52 tested proteins, six functionally diverse proteins (ClfB, glucosaminidase, IsdA, IsaA, SACOL0688 and nuclease) were detected in biofilms of all strains on both PS and LEMs. At the same time, four toxins (alpha-toxin, gamma-hemolysin B and leukocidins D and E), two immune modulators (formyl peptide receptor-like inhibitory protein and Staphylococcal superantigen-like protein 1), and two other proteins (lipase and LytM) were detectable in biofilms by all five S. aureus strains on LEMs, but not on PS. In contrast, fibronectin-binding protein B (FnbpB) was detectable in biofilms by all S. aureus biofilms on PS, but not on LEMs. These data were largely confirmed by the results from proteomic and transcriptomic analyses and in case of alpha-toxin additionally by GFP-reporter technology. Functionally diverse virulence factors of (methicillin-resistant) S. aureus are present during biofilm formation on LEMs and PS. These results could aid in identifying novel targets for future treatment strategies against biofilm-associated infections.

  14. Utility of the CPS+EG staging system in hormone receptor-positive, human epidermal growth factor receptor 2-negative breast cancer treated with neoadjuvant chemotherapy.

    Science.gov (United States)

    Marmé, Frederik; Lederer, Bianca; Blohmer, Jens-Uwe; Costa, Serban Dan; Denkert, Carsten; Eidtmann, Holger; Gerber, Bernd; Hanusch, Claus; Hilfrich, Jörn; Huober, Jens; Jackisch, Christian; Kümmel, Sherko; Loibl, Sibylle; Paepke, Stefan; Untch, Michael; von Minckwitz, Gunter; Schneeweiss, Andreas

    2016-01-01

    Pathologic complete response after neoadjuvant chemotherapy (NACT) correlates with overall survival (OS) in primary breast cancer. A recently described staging system based on pre-treatment clinical stage (CS), final pathological stage (PS), estrogen receptor (ER) status and nuclear grade (NG) leads to a refined estimation of prognosis in unselected patients. Its performance in luminal type breast cancers has not been determined. This study investigates the clinical utility of this CPS+EG score when restricted to hormone receptor-positive (HR+)/human epidermal growth factor receptor 2-negative (HER2-) patients and compares the results to a cohort of unselected patients. The CPS+EG score was calculated for 6637 unselected patients and 2454 patients with HR+/HER2- tumours who received anthracycline/taxane-based NACT within 8 prospective German trials. Five-year disease-free survival (DFS) and OS were 75.6% and 84.1% for the unselected cohort and 80.6% and 87.8% for the HR+/HER2- subgroup, respectively. The CPS+EG system distinguished different prognostic groups with 5-year DFS ranging from 0% to 91%. The CPS+EG system leads to an improved categorisation of patients by outcome compared to CS, PS, ER or NG alone. When applying the CPS+EG score to the HR+/HER2- subgroup, a shift to lower scores was observed compared to the overall population, but 5-year DFS and OS for the individual scores were identical to that observed in the overall population. In HR+/HER2- patients, the CPS+EG staging system retains its ability to facilitate a refined stratification of patients according to outcome. It can help to select candidates for post-neoadjuvant clinical trials in luminal breast cancer. Copyright © 2015 Elsevier Ltd. All rights reserved.

  15. The Effect of Adjuvant Trastuzumab on Locoregional Recurrence of Human Epidermal Growth Factor Receptor 2-Positive Breast Cancer Treated with Mastectomy.

    Science.gov (United States)

    Lanning, Ryan M; Morrow, Monica; Riaz, Nadeem; McArthur, Heather L; Dang, Chau; Moo, Tracy-Ann; El-Tamer, Mahmoud; Krause, Kate; Siu, Chun; Hsu, Meier; Zhang, Zhigang; Pei, Xin; McCormick, Beryl; Powell, Simon N; Ho, Alice

    2015-08-01

    Human epidermal growth factor receptor 2 (HER2) overexpression was associated with locoregional recurrence (LRR) in the preadjuvant trastuzumab era. This study aimed to examine the effect of trastuzumab on LRR in mastectomy patients and whether it varied with postmastectomy radiation (PMRT). From the authors' institutional database, 501 women with stages I-III HER2-positive breast cancer who underwent mastectomy from 1998 to 2007 were identified. A landmark analysis was performed to compare two cohorts: 170 women who received trastuzumab and 281 who did not. Kaplan-Meier methods were used to estimate locoregional recurrence-free survival (LRRFS). A propensity score analysis was used to balance the treatment groups with respect to multiple covariates. Analogous methods were used to study the effect of PMRT. The women in the trastuzumab group were more likely to be node positive and to receive systemic therapy or PMRT (p < 0.01). The 5-year LRRFS was 98 % in the trastuzumab troup versus 94 % in the no trastuzumab group [hazard ratio (HR) 0.31; 95 % confidence interval (CI) 0.09-1.09; p = 0.07]. After adjustment for multiple covariates, including receipt of chemotherapy and PMRT, trastuzumab decreased LRR rates (HR 0.21; 95 % CI 0.04-0.94; p = 0.04). Among the women who received PMRT, trastuzumab reduced the 5-year LRR rate (0 vs 5 %; p = 0.06). Among those who did not receive PMRT, trastuzumab did not significantly decrease LRR (3 vs 6 %; p = 0.26). High rates of locoregional control (5-year rate, 98 %) were observed among patients who received trastuzumab and mastectomy ± PMRT. Trastuzumab decreased LRR in HER2-positive women who received mastectomy and PMRT, suggesting that the largest benefit is seen in a higher-risk subset of patients.

  16. Strain-dependent augmentation of tight-junction barrier function in human primary epidermal keratinocytes by Lactobacillus and Bifidobacterium lysates.

    Science.gov (United States)

    Sultana, Reshma; McBain, Andrew J; O'Neill, Catherine A

    2013-08-01

    In this study, we investigated whether probiotic lysates can modify the tight-junction function of human primary keratinocytes. The keratinocytes were grown on cell culture inserts and treated with lysates from Bifidobacterium longum, Lactobacillus plantarum, Lactobacillus reuteri, Lactobacillus fermentum, or Lactobacillus rhamnosus GG. With the exception of L. fermentum (which decreased cell viability), all strains markedly enhanced tight-junction barrier function within 24 h, as assessed by measurements of transepithelial electrical resistance (TEER). However, B. longum and L. rhamnosus GG were the most efficacious, producing dose-dependent increases in resistance that were maintained for 4 days. These increases in TEER correlated with elevated expression of tight-junction protein components. Neutralization of Toll-like receptor 2 abolished both the increase in TEER and expression of tight-junction proteins induced by B. longum, but not L. rhamnosus GG. These data suggest that some bacterial strains increase tight-junction function via modulation of protein components but the different pathways involved may vary depending on the bacterial strain.

  17. Reactive oxygen species-mediated DNA damage and apoptosis in human skin epidermal cells after exposure to nickel nanoparticles.

    Science.gov (United States)

    Alarifi, Saud; Ali, Daoud; Alakhtani, Saad; Al Suhaibani, Entissar S; Al-Qahtani, Ahmed A

    2014-01-01

    Nickel nanoparticles (NiNPs) are increasingly used in various applications due to their unique properties. However, there is little information concerning the toxicity of NiNPs in the human skin cell (A431). The present study was designed to investigate the cytotoxicity, apoptosis, and DNA damage due to NiNPs in A431 cells. A cellular proliferative capacity test showed that NiNPs induce significant cytotoxicity in a dose- and time-dependent manner. NiNPs were also found to induce oxidative stress evidenced by the generation of reactive oxygen species (ROS) and depletion of glutathione (GSH). Further, co-treatment with the antioxidant N-acetylcysteine (NAC) mitigated the ROS generation due to NiNPs, suggesting the potential mechanism of oxidative stress. NiNPs also induced significant elevation of lipid peroxidation, catalase, and superoxide dismutase and caspase-3 activity in A431 cells. In addition, NAC suppressed NiNP-induced caspase-3 activity. DNA fragmentation analysis using the comet assay showed that the NiNPs cause genotoxicity in a dose- and time-dependent manner. Therefore, the study points out the capability of the NiNPs to induce oxidative stress resulting in apoptosis and genotoxicity. This study warrants more careful assessment of NiNPs before their industrial applications.

  18. Expression and Prognostic Significance of Human Epidermal Growth Factor Receptors 1, 2 and 3 in Periampullary Adenocarcinoma.

    Directory of Open Access Journals (Sweden)

    Jacob Elebro

    Full Text Available Periampullary adenocarcinoma, including pancreatic cancer, is a heterogeneous group of tumours with dismal prognosis, for which there is an urgent need to identify novel treatment strategies. The human epithelial growth factor receptors EGFR, HER2 and HER3 have been studied in several tumour types, and HER-targeting drugs have a beneficial effect on survival in selected types of cancer. However, these effects have not been evident in pancreatic cancer, and remain unexplored in other types of periampullary cancer. The prognostic impact of HER-expression in these cancers also remains unclear. The aim of this study was therefore to examine the expression and prognostic value of EGFR, HER2 and HER3 in periampullary cancer, with particular reference to histological subtype. To this end, protein expression of EGFR, HER2 and HER3, and HER2 gene amplification was assessed by immunohistochemistry and silver in situ hybridization, respectively, on tissue microarrays with tumours from 175 periampullary adenocarcinomas, with follow-up data on recurrence-free survival (RFS and overall survival (OS for up to 5 years. EGFR expression was similar in pancreatobiliary (PB and intestinal (I type tumours, but high HER2 and HER3 expression was significantly more common in I-type tumours. In PB-type cases receiving adjuvant gemcitabine, but not in untreated cases, high EGFR expression was significantly associated with a shorter OS and RFS, with a significant treatment interaction in relation to OS (pinteraction = 0.042. In I-type cases, high EGFR expression was associated with a shorter OS and RFS in univariable, but not in multivariable, analysis. High HER3 expression was associated with a prolonged RFS in univariable, but not in multivariable, analysis. Neither HER2 protein expression nor gene amplification was prognostic. The finding of a potential interaction between the expression of EGFR and response to adjuvant chemotherapy in PB-type tumours needs validation

  19. In vitro human epidermal permeation of nicotine from electronic cigarette refill liquids and implications for dermal exposure assessment.

    Science.gov (United States)

    Frasch, H Frederick; Barbero, Ana M

    2017-11-01

    Nicotine plus flavorings in a propylene glycol (PG) vehicle are the components of electronic cigarette liquids (e-liquids), which are vaporized and inhaled by the user. Dermal exposure to nicotine and e-liquids may occur among workers in mixing and filling of e-cigarettes in the manufacturing process. Inadvertent skin contact among consumers is also a concern. In vitro nicotine permeation studies using heat-separated human epidermis were performed with surrogate and two commercial e-liquids, neat and aqueous nicotine donor formulations. Steady-state fluxes (J ss ), and lag times (t lag ) were measured for each formulation. In addition, transient (4 h) exposure and finite dose (1-10 μl/cm 2 ) experiments were undertaken using one commercial e-liquid. Average J ss (μg/cm 2 /h) from formulations were: nicotine in PG (24 mg/ml): 3.97; commercial e-liquid containing menthol (25 mg/ml nicotine): 10.2; commercial e-liquid containing limonene (25 mg/ml nicotine): 23.7; neat nicotine: 175. E-liquid lag times ranged from 5 to 10 h. Absorbed fraction of nicotine from finite doses was ≈0.3 at 48 h. The data were applied to transient exposure and finite dose dermal exposure assessment models and to a simple pharmacokinetic model. Three illustrative exposure scenarios demonstrate use of the data to predict systemic uptake and plasma concentrations from dermal exposure. The data demonstrate the potential for significant nicotine absorption through skin contact with e-cigarette refill solutions and the neat nicotine used to mix them.

  20. Amplification and high-level expression of heat shock protein 90 marks aggressive phenotypes of human epidermal growth factor receptor 2 negative breast cancer.

    Science.gov (United States)

    Cheng, Qing; Chang, Jeffrey T; Geradts, Joseph; Neckers, Leonard M; Haystead, Timothy; Spector, Neil L; Lyerly, H Kim

    2012-04-17

    Although human epidermal growth factor receptor 2 (HER2) positive or estrogen receptor (ER) positive breast cancers are treated with clinically validated anti-HER2 or anti-estrogen therapies, intrinsic and acquired resistance to these therapies appears in a substantial proportion of breast cancer patients and new therapies are needed. Identification of additional molecular factors, especially those characterized by aggressive behavior and poor prognosis, could prioritize interventional opportunities to improve the diagnosis and treatment of breast cancer. We compiled a collection of 4,010 breast tumor gene expression data derived from 23 datasets that have been posted on the National Center for Biotechnology Information (NCBI) Gene Expression Omnibus (GEO) database. We performed a genome-scale survival analysis using Cox-regression survival analyses, and validated using Kaplan-Meier Estimates survival and Cox Proportional-Hazards Regression survival analyses. We conducted a genome-scale analysis of chromosome alteration using 481 breast cancer samples obtained from The Cancer Genome Atlas (TCGA), from which combined expression and copy number data were available. We assessed the correlation between somatic copy number alterations and gene expression using analysis of variance (ANOVA). Increased expression of each of the heat shock protein (HSP) 90 isoforms, as well as HSP transcriptional factor 1 (HSF1), was correlated with poor prognosis in different subtypes of breast cancer. High-level expression of HSP90AA1 and HSP90AB1, two cytoplasmic HSP90 isoforms, was driven by chromosome coding region amplifications and were independent factors that led to death from breast cancer among patients with triple-negative (TNBC) and HER2-/ER+ subtypes, respectively. Furthermore, amplification of HSF1 was correlated with higher HSP90AA1 and HSP90AB1 mRNA expression among the breast cancer cells without amplifications of these two genes. A collection of HSP90AA1, HSP90AB1 and HSF

  1. Characterization of hormonal receptors and human epidermal growth factor receptor-2 in tissues of women with breast cancer at Muhimbili National Hospital, Dar es salaam, Tanzania.

    Science.gov (United States)

    Mwakigonja, Amos Rodger; Lushina, Nyanda Elias; Mwanga, Ally

    2017-01-01

    Breast cancer is a leading cause of morbidity and deaths among women worldwide. In Tanzania there is no published data on human epidermal growth receptor-2 (HER2/neu) expression in breast carcinoma. Hormonal receptors and HER2/neu status reportedly influence post-mastectomy adjuvant therapy and predict treatment outcome and prognosis. Here we evaluate hormonal receptors and HER-2 status in biopsies of women with breast cancer at Muhimbili National Hospital (MNH). A cross-sectional study of female breast post-modified radical mastectomy (MRM)/incisional biopsies confirmed to be carcinoma at the Histopathology Unit (January-December 2013). Tissue blocks having poor morphology, without tumor, secondary tumors, cases outside the study period and male patients were excluded. Routine staining was done followed by immunohistochemistry for estrogen (ER), and progesterone (PgR) receptors and HER2. Data analyzed using Statistical Package for Social Sciences (SPSS). A total of 218 cases were confirmed to be carcinoma including 70 meeting inclusion criteria. Age at diagnosis ranged 18-75 years and mean age was 48.36 years. Majority (64.3%) were in the 36-55 years age-group. Histologically, most (88.6%) women had invasive ductal carcinoma including 43.1% of intermediate grade. A great majority (78%) were stage three. Due to logistical constrains, 75.7% ( n  = 53/70) cases where immunostained for hormones including 43.4% (ER+), 26.4% (PgR+), and 28% (ER+/PgR+). Furthermore, 65.7% ( n  = 46/70) cases were immunostained for HER-2 and 15.2% ( n  = 7/46) were positive, 45.6% were triple negative (ER-,PgR-,HER2-), 23.9% (ER+,PgR+,HER2-) or luminal B, 2.2% (ER+,PgR-,HER2+),13% (ER-,PgR-,HER2+) and 15% (ER+,PgR-,HER2-) with none being triple positive. Hormonal receptors and HER2 expression at MNH appears to be comparable to previous Africans/African Americans reports but not with studies among Caucasians and the current proportion of triple negative breast carcinomas (TNBC) is

  2. Characterization of hormonal receptors and human epidermal growth factor receptor-2 in tissues of women with breast cancer at Muhimbili National Hospital, Dar es salaam, Tanzania

    Directory of Open Access Journals (Sweden)

    Amos Rodger Mwakigonja

    2017-11-01

    Full Text Available Abstract Background Breast cancer is a leading cause of morbidity and deaths among women worldwide. In Tanzania there is no published data on human epidermal growth receptor-2 (HER2/neu expression in breast carcinoma. Hormonal receptors and HER2/neu status reportedly influence post-mastectomy adjuvant therapy and predict treatment outcome and prognosis. Here we evaluate hormonal receptors and HER-2 status in biopsies of women with breast cancer at Muhimbili National Hospital (MNH. Methods A cross-sectional study of female breast post-modified radical mastectomy (MRM/incisional biopsies confirmed to be carcinoma at the Histopathology Unit (January–December 2013. Tissue blocks having poor morphology, without tumor, secondary tumors, cases outside the study period and male patients were excluded. Routine staining was done followed by immunohistochemistry for estrogen (ER, and progesterone (PgR receptors and HER2. Data analyzed using Statistical Package for Social Sciences (SPSS. Results A total of 218 cases were confirmed to be carcinoma including 70 meeting inclusion criteria. Age at diagnosis ranged 18–75 years and mean age was 48.36 years. Majority (64.3% were in the 36–55 years age-group. Histologically, most (88.6% women had invasive ductal carcinoma including 43.1% of intermediate grade. A great majority (78% were stage three. Due to logistical constrains, 75.7% (n = 53/70 cases where immunostained for hormones including 43.4% (ER+, 26.4% (PgR+, and 28% (ER+/PgR+. Furthermore, 65.7% (n = 46/70 cases were immunostained for HER-2 and 15.2% (n = 7/46 were positive, 45.6% were triple negative (ER-,PgR-,HER2-, 23.9% (ER+,PgR+,HER2- or luminal B, 2.2% (ER+,PgR-,HER2+,13% (ER-,PgR-,HER2+ and 15% (ER+,PgR-,HER2- with none being triple positive. Conclusions Hormonal receptors and HER2 expression at MNH appears to be comparable to previous Africans/African Americans reports but not with studies among Caucasians and the current proportion

  3. Budget impact analysis of everolimus for the treatment of hormone receptor positive, human epidermal growth factor receptor-2 negative (HER2-) advanced breast cancer in the United States.

    Science.gov (United States)

    Xie, Jipan; Diener, Melissa; De, Gourab; Yang, Hongbo; Wu, Eric Q; Namjoshi, Madhav

    2013-01-01

    To estimate the budget impact of everolimus as the first and second treatment option after letrozole or anastrozole (L/A) failure for post-menopausal women with hormone receptor positive (HR+), human epidermal growth factor receptor-2 negative (HER2-) advanced breast cancer (ABC). Pharmacy and medical budget impacts (2011 USD) were estimated over the first year of everolimus use in HR+, HER2- ABC from a US payer perspective. Epidemiology data were used to estimate target population size. Pre-everolimus entry treatment options included exemestane, fulvestrant, and tamoxifen. Pre- and post-everolimus entry market shares were estimated based on market research and assumptions. Drug costs were based on wholesale acquisition cost. Patients were assumed to be on treatment until progression or death. Annual medical costs were calculated as the average of pre- and post-progression medical costs weighted by the time in each period, adjusted for survival. One-way and two-way sensitivity analyses were conducted to assess the model robustness. In a hypothetical 1,000,000 member plan, 72 and 159 patients were expected to be candidates for everolimus treatment as first and second treatment option, respectively, after L/A failure. The total budget impact for the first year post-everolimus entry was $0.044 per member per month [PMPM] (pharmacy budget: $0.058 PMPM; medical budget: -$0.014 PMPM), assuming 10% of the target population would receive everolimus. The total budget impacts for the first and second treatment options after L/A failure were $0.014 PMPM (pharmacy budget: $0.018; medical budget: -$0.004) and $0.030 PMPM (pharmacy budget: $0.040; medical budget: -$0.010), respectively. Results remained robust in sensitivity analyses. Assumptions about some model input parameters were necessary and may impact results. Increased pharmacy costs for HR+, HER2- ABC following everolimus entry are expected to be partially offset by reduced medical service costs. Pharmacy and total

  4. Relationship between body mass index and the expression of hormone receptors or human epidermal growth factor receptor 2 with respect to breast cancer survival

    International Nuclear Information System (INIS)

    Jeon, Ye Won; Kang, Su Hwan; Park, Min Ho; Lim, Woosung; Cho, Se Heun; Suh, Young Jin

    2015-01-01

    The association between body mass index (BMI) at the time of breast cancer diagnosis and the prognosis of breast cancer patients remains controversial. Furthermore, the association between BMI and prognosis with respect to different breast cancer subtypes is not clearly defined. We analyzed data from 41,021 invasive breast cancer patients between January 1988 and February 2008 from the Korean Breast Cancer Registry (KBCR) database. Overall survival (OS) and breast cancer-specific survival (BCSS) were analyzed using the Kaplan-Meier method and Cox’s proportional hazard regression model among all patients and specific breast cancer subtypes with respect to BMI categories. A U-shaped association between BMI and mortality was observed in the total cohort. Underweight and obese individuals exhibited worse OS (hazard ratio, 1.23 [95 % confidence interval {CI}, 1.05 to 1.44] and 1.29 [1.13 to 1.48], respectively) and BCSS (1.26 [1.03 to 1.54] and 1.21 [1.02 to 1.43], respectively) than normal-weight individuals. In the estrogen receptor (ER) and/or progesterone receptor (PR)+/human epidermal growth factor receptor 2 (HER2) - subgroup, obese individuals exhibited worse OS (1.48 [1.18 to 1.85]) and BCSS (1.31 [1.13 to 1.52]) than normal-weight individuals. Conversely, in the ER and PR-/HER2+ subgroup, underweight individuals exhibited worse OS (1.68 [1.12 to 2.47]) and BCSS (1.79 [1.11 to 2.90]) than normal-weight individuals. We observed a U-shaped relationship between BMI at diagnosis and poor OS and BCSS among all breast cancer patients. However, obesity in the ER and/or PR+/HER2- subgroup and underweight in the ER and PR-/HER2+ subgroup were poor prognostic factors. Therefore, BMI at diagnosis and breast cancer subtype should be considered simultaneously in various treatment decision processes and surveillance schedules

  5. Keratin 17 is overexpressed and predicts poor survival in estrogen receptor-negative/human epidermal growth factor receptor-2-negative breast cancer.

    Science.gov (United States)

    Merkin, Ross D; Vanner, Elizabeth A; Romeiser, Jamie L; Shroyer, A Laurie W; Escobar-Hoyos, Luisa F; Li, Jinyu; Powers, Robert S; Burke, Stephanie; Shroyer, Kenneth R

    2017-04-01

    Clinicopathological features of breast cancer have limited accuracy to predict survival. By immunohistochemistry (IHC), keratin 17 (K17) expression has been correlated with triple-negative status (estrogen receptor [ER]/progesterone receptor/human epidermal growth factor receptor-2 [HER2] negative) and decreased survival, but K17 messenger RNA (mRNA) expression has not been evaluated in breast cancer. K17 is a potential prognostic cancer biomarker, targeting p27, and driving cell cycle progression. This study compared K17 protein and mRNA expression to ER/progesterone receptor/HER2 receptor status and event-free survival. K17 IHC was performed on 164 invasive breast cancers and K17 mRNA was evaluated in 1097 breast cancers. The mRNA status of other keratins (16/14/9) was evaluated in 113 ER - /HER2 - ductal carcinomas. IHC demonstrated intense cytoplasmic and membranous K17 localization in myoepithelial cells of benign ducts and lobules and tumor cells of ductal carcinoma in situ. In ductal carcinomas, K17 protein was detected in most triple-negative tumors (28/34, 82%), some non-triple-negative tumors (52/112, 46%), but never in lobular carcinomas (0/15). In ductal carcinomas, high K17 mRNA was associated with reduced 5-year event-free survival in advanced tumor stage (n = 149, hazard ratio [HR] = 3.68, P = .018), and large (n = 73, HR = 3.95, P = .047), triple-negative (n = 103, HR = 2.73, P = .073), and ER - /HER2 - (n = 113, HR = 2.99, P = .049) tumors. There were significant correlations among keratins 17, 16, 14, and 9 mRNA levels suggesting these keratins (all encoded on chromosome 17) could be coordinately expressed in breast cancer. Thus, K17 is expressed in a subset of triple-negative breast cancers, and is a marker of poor prognosis in patients with advanced stage and ER - /HER2 - breast cancer. Copyright © 2016 Elsevier Inc. All rights reserved.

  6. Translational Breast Cancer Research Consortium (TBCRC) 022: A Phase II Trial of Neratinib for Patients With Human Epidermal Growth Factor Receptor 2-Positive Breast Cancer and Brain Metastases.

    Science.gov (United States)

    Freedman, Rachel A; Gelman, Rebecca S; Wefel, Jeffrey S; Melisko, Michelle E; Hess, Kenneth R; Connolly, Roisin M; Van Poznak, Catherine H; Niravath, Polly A; Puhalla, Shannon L; Ibrahim, Nuhad; Blackwell, Kimberly L; Moy, Beverly; Herold, Christina; Liu, Minetta C; Lowe, Alarice; Agar, Nathalie Y R; Ryabin, Nicole; Farooq, Sarah; Lawler, Elizabeth; Rimawi, Mothaffar F; Krop, Ian E; Wolff, Antonio C; Winer, Eric P; Lin, Nancy U

    2016-03-20

    Evidence-based treatments for metastatic, human epidermal growth factor receptor 2 (HER2)-positive breast cancer in the CNS are limited. Neratinib is an irreversible inhibitor of erbB1, HER2, and erbB4, with promising activity in HER2-positive breast cancer; however, its activity in the CNS is unknown. We evaluated the efficacy of treatment with neratinib in patients with HER2-positive breast cancer brain metastases in a multicenter, phase II open-label trial. Eligible patients were those with HER2-positive brain metastases (≥ 1 cm in longest dimension) who experienced progression in the CNS after one or more line of CNS-directed therapy, such as whole-brain radiotherapy, stereotactic radiosurgery, and/or surgical resection. Patients received neratinib 240 mg orally once per day, and tumors were assessed every two cycles. The primary endpoint was composite CNS objective response rate (ORR), requiring all of the following: ≥ 50% reduction in volumetric sum of target CNS lesions and no progression of non-target lesions, new lesions, escalating corticosteroids, progressive neurologic signs/symptoms, or non-CNS progression--the threshold for success was five of 40 responders. Forty patients were enrolled between February 2012 and June 2013; 78% of patients had previous whole-brain radiotherapy. Three women achieved a partial response (CNS objective response rate, 8%; 95% CI, 2% to 22%). The median number of cycles received was two (range, one to seven cycles), with a median progression-free survival of 1.9 months. Five women received six or more cycles. The most common grade ≥ 3 event was diarrhea (occurring in 21% of patients taking prespecified loperamide prophylaxis and 28% of those without prophylaxis). Patients in the study experienced a decreased quality of life over time. Although neratinib had low activity and did not meet our threshold for success, 12.5% of patients received six or more cycles. Studies combining neratinib with chemotherapy in patients

  7. Lapatinib or Trastuzumab Plus Taxane Therapy for Human Epidermal Growth Factor Receptor 2-Positive Advanced Breast Cancer: Final Results of NCIC CTG MA.31.

    Science.gov (United States)

    Gelmon, Karen A; Boyle, Frances M; Kaufman, Bella; Huntsman, David G; Manikhas, Alexey; Di Leo, Angelo; Martin, Miguel; Schwartzberg, Lee S; Lemieux, Julie; Aparicio, Samuel; Shepherd, Lois E; Dent, Susan; Ellard, Susan L; Tonkin, Katia; Pritchard, Kathleen I; Whelan, Timothy J; Nomikos, Dora; Nusch, Arnd; Coleman, Robert E; Mukai, Hirofumi; Tjulandin, Sergei; Khasanov, Rustem; Rizel, Shulamith; Connor, Anne P; Santillana, Sergio L; Chapman, Judith-Anne W; Parulekar, Wendy R

    2015-05-10

    The efficacy of lapatinib versus trastuzumab combined with taxanes in the first-line setting of human epidermal growth factor receptor 2 (HER2) -positive metastatic breast cancer (BC) is unknown. The MA.31 trial compared a combination of first-line anti-HER2 therapy (lapatinib or trastuzumab) and taxane therapy for 24 weeks, followed by the same anti-HER2 monotherapy until progression. Stratification was by prior (neo)adjuvant anti-HER2 therapy, prior (neo)adjuvant taxane, planned taxane, and liver metastases. The primary end point was intention-to-treat (ITT) progression-free survival (PFS), defined as time from random assignment to progression by RECIST (version 1.0) criteria, or death for patients with locally assessed HER2-positive tumors. The primary test statistic was a stratified log-rank test for noninferiority. PFS was also assessed for patients with centrally confirmed HER2-positive tumors. From July 17, 2008, to December 1, 2011, 652 patients were accrued from 21 countries, resulting in 537 patients with centrally confirmed HER2-positive tumors. Median follow-up was 21.5 months. Median ITT PFS was 9.0 months with lapatinib and 11.3 months with trastuzumab. By ITT analysis, PFS was inferior for lapatinib compared with trastuzumab, with a stratified hazard ratio (HR) of 1.37 (95% CI, 1.13 to 1.65; P = .001). In patients with centrally confirmed HER2-positive tumors, median PFS was 9.1 months with lapatinib and 13.6 months with trastuzumab (HR, 1.48; 95% CI, 1.20 to 1.83; P < .001). More grade 3 or 4 diarrhea and rash were observed with lapatinib (P < .001). PFS results were supported by the secondary end point of overall survival, with an ITT HR of 1.28 (95% CI, 0.95 to 1.72; P = .11); in patients with centrally confirmed HER2-positive tumors, the HR was 1.47 (95% CI, 1.03 to 2.09; P = .03). As first-line therapy for HER2-positive metastatic BC, lapatinib combined with taxane was associated with shorter PFS and more toxicity compared with trastuzumab

  8. Induction of interleukin-6 production by ultraviolet radiation in normal human epidermal keratinocytes and in a human keratinocyte cell line is mediated by DNA damage

    NARCIS (Netherlands)

    Petit-Frère, C.; Clingen, P.H.; Grewe, M.; Krutmann, J.; Roza, L.; Arlett, C.F.; Green, M.H.L.

    1998-01-01

    The sunburn reaction is the most common consequence of human exposure to ultraviolet radiation (UVR), and is mediated at least in part by interleukin- 6 (IL-6). The aim of this study was to determine if DNA is a major chromophore involved in the induction of IL-6 following UV irradiation of a human

  9. Cultivation and irradiation of human fibroblasts in a medium enriched with platelet lysate for obtaining feeder layer in epidermal cell culture; Cultivo e irradiacao de fibroblastos humanos em meio enriquecido com lisado de plaquetas para obtencao de camada de sustentacao em culturas de celulas da epiderme

    Energy Technology Data Exchange (ETDEWEB)

    Yoshito, Daniele

    2011-07-01

    For over 30 years, the use of culture medium, enriched with bovine serum, and murines fibroblasts, with the rate of proliferation controlled by irradiation or by share anticarcinogenic drugs, has been playing successfully its role in assisting in the development of keratinocytes in culture, for clinical purposes. However, currently there is a growing concern about the possibility of transmitting prions and animals viruses to transplanted patients. Taking into account this concern, the present work aims to cultivate human fibroblasts in a medium enriched with human platelets lysate and determine the irradiation dose of these cells, for obtaining feeder layer in epidermal cell culture. For carrying out the proposed objective, platelets lysis has standardized, this lysate was used for human fibroblasts cultivation and the irradiation dose enough to inhibit its duplication was evaluated. Human keratinocytes were cultivated in these feeder layers, in culture medium enriched with the lysate. With these results we conclude that the 10% platelets lysate promoted a better adhesion and proliferation of human fibroblasts and in all dose levels tested (60 to 300 Gy), these had their mitotic activity inactivated by ionizing irradiation, being that the feeder layers obtained with doses from 70 to 150 Gy were those that provided the best development of keratinocytes in medium containing 2.5% of human platelet lysate. Therefore, it was possible to standardize both the cultivation of human fibroblasts as its inactivation for use as feeder layer in culture of keratinocytes, so as to eliminate xenobiotics components. (author)

  10. Secretion of human epidermal growth factor (EGF) in autotrophic culture by a recombinant hydrogen-utilizing bacterium, Pseudomonas pseudoflava, carrying broad-host-range EGF secretion vector pKSEGF2.

    OpenAIRE

    Hayase, N; Ishiyama, A; Niwano, M

    1994-01-01

    We constructed the broad-host-range human epidermal growth factor (EGF) secretion plasmid pKSEGF2 by inserting the Escherichia coli tac promoter, the signal sequence of Pseudomonas stutzeri amylase, and the synthesized EGF gene into the broad-host-range vector pKT230. E. coli JM109 carrying pKSEGF2 secreted EGF into the periplasm and the culture medium under the control of the tac promoter. Pseudomonas aeruginosa PAO1161 carrying pKSEGF2 and Pseudomonas putida AC10 carrying pKSEGF2 secreted E...

  11. [Effect of low-energy 633 nm red light stimulation on proliferation and reactive oxygen species level of human epidermal cell line HaCaT].

    Science.gov (United States)

    Chen, Z Y; Li, D L; Duan, X D; Peng, D Z

    2016-09-20

    To investigate the changes of proliferative activity and reactive oxygen species level of human epidermal cell line HaCaT after being irradiated with low-energy 633 nm red light. Irradiation distance was determined through preliminary experiment. HaCaT cells were conventionally sub-cultured with RPMI 1640 culture medium containing 10% fetal calf serum, 100 U/mL penicillin, and 100 μg/mL streptomycin. Cells of the third passage were used in the following experiments. (1) Cells were divided into blank control group and 0.082, 0.164, 0.245, 0.491, 1.472, 2.453, 4.910, and 9.810 J/cm(2) irradiation groups according to the random number table, with 3 wells in each group. Cells in blank control group were not irradiated, while cells in the latter 8 irradiation groups were irradiated with 633 nm red light for 10, 20, 30, 60, 180, 300, 600, and 1 200 s in turn. Cells were reirradiated once every 8 hours. After being irradiated for 48 hours (6 times) in irradiation groups, the proliferative activity of cells in 9 groups was determined with cell counting kit 8 and microplate reader (denoted as absorbance value). (2) Another batch of cells were grouped and irradiated as in experiment (1). After being irradiated for once in irradiation groups, cells in 9 groups were conventionally cultured for 60 min with detection reagent of reactive oxygen species. At post culture minute (PCM) 0 (immediately), 30, 60, and 120, reactive oxygen species level of cells was determined with microplate reader (denoted as absorbance value). (3) Another batch of cells were divided into blank control group, 0.082, 0.491, 2.453, and 9.810 J/cm(2) irradiation groups, and positive control group. Cells in blank control group and positive control group were not irradiated (positive control reagent of reactive oxygen species was added to cells in positive control group), and cells in irradiation groups were irradiated as in experiment (1) for once. The expression of reactive oxygen species in cells of each

  12. Inhibition of Epidermal Growth Factor Receptor and Vascular Endothelial Growth Factor Receptor Phosphorylation on Tumor-Associated Endothelial Cells Leads to Treatment of Orthotopic Human Colon Cancer in Nude Mice

    Directory of Open Access Journals (Sweden)

    Takamitsu Sasaki

    2007-12-01

    Full Text Available The purpose of our study was to determine whether the dual inhibition of epidermal growth factor receptor (EGFR and vascular endothelial growth factor receptor (VEGFR signaling pathways in tumor-associated endothelial cells can inhibit the progressive growth of human colon carcinoma in the cecum of nude mice. SW620CE2 human colon cancer cells growing in culture and orthotopically in the cecum of nude mice expressed a high level of transforming growth factor alpha (TGF-α and vascular endothelial growth factor (VEGF but were negative for EGFR, human epidermal growth factor receptor 2 (HER2, VEGFR. Double immunofluorescence staining revealed that tumorassociated endothelial cells expressed EGFR, VEGFR2, phosphorylated EGFR (pEGFR, phosphorylated VEGFR (pVEGFR. Treatment of mice with either 7H-pyrrolo [2,3-d]-pyrimidine lead scaffold (AEE788; an inhibitor of EGFR and VEGFR tyrosine kinase or CPT-11 as single agents significantly inhibited the growth of cecal tumors (P < .01; this decrease was even more pronounced with AEE788 combined with CPT-11 (P < .001. AEE788 alone or combined with CPT-11 also inhibited the expression of pEGFR and pVEGFR on tumor-associated endothelial cells, significantly decreased vascularization and tumor cell proliferation, increased the level of apoptosis in both tumorassociated endothelial cells and tumor cells. These data demonstrate that targeting EGFR and VEGFR signaling on tumor-associated endothelial cells provides a viable approach for the treatment of colon cancer.

  13. Antisense imaging of epidermal growth factor-induced p21{sup WAF-1/CIP-1} gene expression in MDA-MB-468 human breast cancer xenografts

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Judy; Chen, Paul; Mrkobrada, Marko [Leslie Dan Faculty of Pharmacy, University of Toronto, 19 Russell Street, M5S 2S2, Toronto, Ontario (Canada); Hu, Meiduo [Leslie Dan Faculty of Pharmacy, University of Toronto, 19 Russell Street, M5S 2S2, Toronto, Ontario (Canada); Department of Pharmaceutical Sciences, University of Toronto, Toronto, Ontario (Canada); Vallis, Katherine A. [Department of Radiation Oncology, Princess Margaret Hospital, University Health Network, 610 University Avenue, Toronto, Ontario (Canada); Department of Radiation Oncology, University of Toronto, Toronto, Ontario (Canada); Department of Medical Biophysics, University of Toronto, Toronto, Ontario (Canada); Reilly, Raymond M. [Department of Medical Imaging, University of Toronto, Toronto, Ontario (Canada)

    2003-09-01

    Molecular imaging of the expression of key genes which determine the response to DNA damage following cancer treatment may predict the effectiveness of a particular treatment strategy. A prominent early response gene for DNA damage is the gene encoding p21{sup WAF-1/CIP-1}, a cyclin-dependent kinase inhibitor that regulates progression through the cell cycle. In this study, we explored the feasibility of imaging p21{sup WAF-1/CIP-1} gene expression at the mRNA level using an 18-mer phosphorothioated antisense oligodeoxynucleotide (ODN) labeled with {sup 111}In. The known induction of the p21{sup WAF-1/CIP-1} gene in MDA-MB-468 human breast cancer cells following exposure to epidermal growth factor (EGF) was used as an experimental tool. Treatment of MDA-MB-468 cells in vitro with EGF (20 nM) increased the ratio of p21{sup WAF-1/CIP-1} mRNA/{beta}-actin mRNA threefold within 2 h as measured by the reverse transcription polymerase chain reaction (RT-PCR). A concentration-dependent inhibition of EGF-induced p21{sup WAF-1/CIP-1} protein expression was achieved in MDA-MB-468 cells by treatment with antisense ODNs with up to a tenfold decrease observed at 1 {mu}M. There was a fourfold lower inhibition of p21{sup WAF-1/CIP-1} protein expression by control sense or random sequence ODNs. Intratumoral injections of EGF (15 {mu}g/day x 3 days) were employed to induce p21{sup WAF-1/CIP-1} gene expression in MDA-MB-468 xenografts implanted subcutaneously into athymic mice. RT-PCR of explanted tumors showed a threefold increased level of p21{sup WAF-1/CIP-1} mRNA compared with normal saline-treated tumors. Successful imaging of EGF-induced p21{sup WAF-1/CIP-1} gene expression in MDA-MB-468 xenografts was achieved at 48 h post injection of {sup 111}In-labeled antisense ODNs (3.7 MBq; 2 {mu}g). Tumors displaying basal levels of p21{sup WAF-1/CIP-1} gene expression in the absence of EGF treatment could not be visualized. Biodistribution studies showed a significantly higher tumor

  14. Epidermal stem cells: location, potential and contribution to cancer.

    Science.gov (United States)

    Ambler, C A; Määttä, A

    2009-01-01

    Epidermal stem cells have been classically characterized as slow-cycling, long-lived cells that reside in discrete niches in the skin. Gene expression studies of niche-resident cells have revealed a number of stem cell markers and regulators, including the Wnt/beta-catenin, Notch, p63, c-Myc and Hedgehog pathways. A new study challenges the traditional developmental paradigm of slow-cycling stem cells and rapid-cycling transit amplifying cells in some epidermal regions, and there is mounting evidence to suggest that multi-lineage epidermal progenitors can be isolated from highly proliferative, non-niche regions. Whether there is a unique microenvironment surrounding these progenitors remains to be determined. Interestingly, cancer stem cells derived from epidermal tumours exist independent of the classic skin stem cell niche, yet also have stem cell properties, including multi-lineage differentiation. This review summarizes recent studies identifying the location and regulators of mouse and human epidermal stem cells and highlights the strategies used to identify cancer stem cells, including expression of normal epidermal stem cell markers, expression of cancer stem cell markers identified in other epidermal tumours and characterization of side-population tumour cells.

  15. [Progress in epidermal stem cells].

    Science.gov (United States)

    Wang, Li-Juan; Wang, You-Liang; Yang, Xiao

    2010-03-01

    Mammalian skin epidermis contains different epidermal stem cell pools which contribute to the homeostasis and repair of skin epithelium. Epidermal stem cells possess two essential features common to all stem cells: self-renewal and differentiation. Disturbing the balance between self-renewal and differentiation of epidermal stem cell often causes tumors or other skin diseases. Epidermal stem cell niches provide a special microenvironment that maintains a balance of stem cell quiescence and activity. This review primarily concentrates on the following points of the epidermal stem cells: the existing evidences, the self-renewal and differentiation, the division pattern, the signal pathways regulating self-renewal and differentiation, and the microenvironment (niche) and macroenvironment maintaining the homeostasis of stem cells.

  16. Protein structure of fetal antigen 1 (FA1). A novel circulating human epidermal-growth-factor-like protein expressed in neuroendocrine tumors and its relation to the gene products of dlk and pG2

    DEFF Research Database (Denmark)

    Jensen, Charlotte Harken; Krogh, Thomas N; Højrup, Peter

    1994-01-01

    The present paper describes the primary structure, glycosylation and tissue localization of fetal antigen 1 (FA1) isolated from second-trimester human amniotic fluid. FA1 is a single-chained, heterogeneous glycoprotein of 225-262 amino acid residues. FA1 has six well conserved epidermal...... extends with minor corrections to the human adrenal-specific mRNA, pG2 as well. Immunohistochemical analysis demonstrated the presence of FA1 in 10 out of 14 lung tumors containing neuroendocrine elements, and in the placental villi where FA1 was exclusively seen in stromal cells in close contact...... to the vascular structure. In the pancreas, FA1 co-localized with insulin in the insulin secretory granules of the beta cells within the islets of Langerhans. Our findings suggest that FA1 is synthesized as a membrane anchored protein and released into the circulation after enzymic cleavage, and that circulating...

  17. "Cut-and-paste" manufacture of multiparametric epidermal electronic systems

    Science.gov (United States)

    Lu, Nanshu; Yang, Shixuan; Wang, Pulin

    2016-05-01

    Epidermal electronics is a class of noninvasive and unobstructive skin-mounted, tattoo-like sensors and electronics capable of vital sign monitoring and establishing human-machine interface. The high cost of manpower, materials, vacuum equipment, and photolithographic facilities associated with its manufacture greatly hinders the widespread use of disposable epidermal electronics. Here we report a cost and time effective, completely dry, benchtop "cut-and-paste" method for the freeform and portable manufacture of multiparametric epidermal sensor systems (ESS) within minutes. This versatile method works for all types of thin metal and polymeric sheets and is compatible with any tattoo adhesives or medical tapes. The resulting ESS are multimaterial and multifunctional and have been demonstrated to noninvasively but accurately measure electrophysiological signals, skin temperature, skin hydration, as well as respiratory rate. In addition, planar stretchable coils exploiting double-stranded serpentine design have been successfully applied as wireless, passive epidermal strain sensors.

  18. Epidermal Growth Factor and Intestinal Barrier Function

    Directory of Open Access Journals (Sweden)

    Xiaopeng Tang

    2016-01-01

    Full Text Available Epidermal growth factor (EGF is a 53-amino acid peptide that plays an important role in regulating cell growth, survival, migration, apoptosis, proliferation, and differentiation. In addition, EGF has been established to be an effective intestinal regulator helping to protect intestinal barrier integrity, which was essential for the absorption of nutrients and health in humans and animals. Several researches have demonstrated that EGF via binding to the EGF receptor and subsequent activation of Ras/MAPK, PI3K/AKT, PLC-γ/PKC, and STATS signal pathways regulates intestinal barrier function. In this review, the relationship between epidermal growth factor and intestinal development and intestinal barrier is described, to provide a better understanding of the effects of EGF on intestine development and health.

  19. Inhibition of Epidermal Growth Factor Receptor and PI3K/Akt Signaling Suppresses Cell Proliferation and Survival through Regulation of Stat3 Activation in Human Cutaneous Squamous Cell Carcinoma

    International Nuclear Information System (INIS)

    Bito, T.; Sumita, N.; Ashida, M.; Budiyanto, A.; Ueda, M.; Ichihashi, M.; Nishigori, C.; Tokura, Y.; Bito, T.

    2011-01-01

    Recent studies have emphasized the important role of Stat3 activation in a number of human tumors from the viewpoint of its oncogenic and anti apoptotic activity. In this study, we examined the role and related signaling molecules of Stat3 in the carcinogenesis of human cutaneous squamous cell carcinoma (SCC). In 35 human cutaneous SCC samples, 86% showed overexpression of phosphorylated (p)-Stat3, and most of those simultaneously over expressed p-EGFR or p-Akt. Constitutive activation of EGFR and Stat3 was observed in three SCC cell lines and four of five SCC tissues. AG1478, an inhibitor of the EGFR, down regulated Stat3 activation in HSC-1 human SCC cells. AG1478 inhibited cell proliferation and induced apoptosis of HSC-1 cells but did not inhibit the growth of normal human epidermal keratinocytes that did not show Stat3 activation. Furthermore, a PI3K inhibitor also suppressed Stat3 activation in HSC-1 cells to some degree. Combined treatment with the PI3K inhibitor and AG1478 strongly suppressed Stat3 activity and dramatically induced apoptosis of HSC-1 cells. These data suggest that Stat3 activation through EGFR and/or PI3K/Akt activation plays a critical role in the proliferation and survival of human cutaneous SCC.

  20. Faster DNA Repair of Ultraviolet-Induced Cyclobutane Pyrimidine Dimers and Lower Sensitivity to Apoptosis in Human Corneal Epithelial Cells than in Epidermal Keratinocytes.

    Directory of Open Access Journals (Sweden)

    Justin D Mallet

    Full Text Available Absorption of UV rays by DNA generates the formation of mutagenic cyclobutane pyrimidine dimers (CPD and pyrimidine (6-4 pyrimidone photoproducts (6-4PP. These damages are the major cause of skin cancer because in turn, they can lead to signature UV mutations. The eye is exposed to UV light, but the cornea is orders of magnitude less prone to UV-induced cancer. In an attempt to shed light on this paradox, we compared cells of the corneal epithelium and the epidermis for UVB-induced DNA damage frequency, repair and cell death sensitivity. We found similar CPD levels but a 4-time faster UVB-induced CPD, but not 6-4PP, repair and lower UV-induced apoptosis sensitivity in corneal epithelial cells than epidermal. We then investigated levels of DDB2, a UV-induced DNA damage recognition protein mostly impacting CPD repair, XPC, essential for the repair of both CPD and 6-4PP and p53 a protein upstream of the genotoxic stress response. We found more DDB2, XPC and p53 in corneal epithelial cells than in epidermal cells. According to our results analyzing the protein stability of DDB2 and XPC, the higher level of DDB2 and XPC in corneal epithelial cells is most likely due to an increased stability of the protein. Taken together, our results show that corneal epithelial cells have a better efficiency to repair UV-induced mutagenic CPD. On the other hand, they are less prone to UV-induced apoptosis, which could be related to the fact that since the repair is more efficient in the HCEC, the need to eliminate highly damaged cells by apoptosis is reduced.

  1. Epidermal CYP2 family cytochromes P450

    International Nuclear Information System (INIS)

    Du Liping; Hoffman, Susan M.G.; Keeney, Diane S.

    2004-01-01

    Skin is the largest and most accessible drug-metabolizing organ. In mammals, it is the competent barrier that protects against exposure to harmful stimuli in the environment and in the systemic circulation. Skin expresses many cytochromes P450 that have critical roles in exogenous and endogenous substrate metabolism. Here, we review evidence for epidermal expression of genes from the large CYP2 gene family, many of which are expressed preferentially in extrahepatic tissues or specifically in epithelia at the environmental interface. At least 13 CYP2 genes (CYP2A6, 2A7, 2B6, 2C9, 2C18, 2C19, 2D6, 2E1, 2J2, 2R1, 2S1, 2U1, and 2W1) are expressed in skin from at least some human individuals, and the majority of these genes are expressed in epidermis or cultured keratinocytes. Where epidermal expression has been localized in situ by hybridization or immunocytochemistry, CYP2 transcripts and proteins are most often expressed in differentiated keratinocytes comprising the outer (suprabasal) cell layers of the epidermis and skin appendages. The tissue-specific transcriptional regulation of CYP2 genes in the epidermis, and in other epithelia that interface with the environment, suggests important roles for at least some CYP2 gene products in the production and disposition of molecules affecting competency of the epidermal barrier

  2. Adjuvant Lapatinib and Trastuzumab for Early Human Epidermal Growth Factor Receptor 2–Positive Breast Cancer: Results From the Randomized Phase III Adjuvant Lapatinib and/or Trastuzumab Treatment Optimization Trial

    Science.gov (United States)

    Holmes, Eileen; Baselga, José; de Azambuja, Evandro; Dueck, Amylou C.; Viale, Giuseppe; Zujewski, Jo Anne; Goldhirsch, Aron; Armour, Alison; Pritchard, Kathleen I.; McCullough, Ann E.; Dolci, Stella; McFadden, Eleanor; Holmes, Andrew P.; Tonghua, Liu; Eidtmann, Holger; Dinh, Phuong; Di Cosimo, Serena; Harbeck, Nadia; Tjulandin, Sergei; Im, Young-Hyuck; Huang, Chiun-Sheng; Diéras, Véronique; Hillman, David W.; Wolff, Antonio C.; Jackisch, Christian; Lang, Istvan; Untch, Michael; Smith, Ian; Boyle, Frances; Xu, Binghe; Gomez, Henry; Suter, Thomas; Gelber, Richard D.; Perez, Edith A.

    2016-01-01

    Background Lapatinib (L) plus trastuzumab (T) improves outcomes for metastatic human epidermal growth factor 2–positive breast cancer and increases the pathologic complete response in the neoadjuvant setting, but their role as adjuvant therapy remains uncertain. Methods In the Adjuvant Lapatinib and/or Trastuzumab Treatment Optimization trial, patients with centrally confirmed human epidermal growth factor 2–positive early breast cancer were randomly assigned to 1 year of adjuvant therapy with T, L, their sequence (T→L), or their combination (L+T). The primary end point was disease-free survival (DFS), with 850 events required for 80% power to detect a hazard ratio (HR) of 0.8 for L+T versus T. Results Between June 2007 and July 2011, 8,381 patients were enrolled. In 2011, due to futility to demonstrate noninferiority of L versus T, the L arm was closed, and patients free of disease were offered adjuvant T. A protocol modification required P ≤ .025 for the two remaining pairwise comparisons. At a protocol-specified analysis with a median follow-up of 4.5 years, a 16% reduction in the DFS hazard rate was observed with L+T compared with T (555 DFS events; HR, 0.84; 97.5% CI, 0.70 to 1.02; P = .048), and a 4% reduction was observed with T→L compared with T (HR, 0.96; 97.5% CI, 0.80 to 1.15; P = .61). L-treated patients experienced more diarrhea, cutaneous rash, and hepatic toxicity compared with T-treated patients. The incidence of cardiac toxicity was low in all treatment arms. Conclusion Adjuvant treatment that includes L did not significantly improve DFS compared with T alone and added toxicity. One year of adjuvant T remains standard of care. PMID:26598744

  3. Adjuvant Lapatinib and Trastuzumab for Early Human Epidermal Growth Factor Receptor 2-Positive Breast Cancer: Results From the Randomized Phase III Adjuvant Lapatinib and/or Trastuzumab Treatment Optimization Trial.

    Science.gov (United States)

    Piccart-Gebhart, Martine; Holmes, Eileen; Baselga, José; de Azambuja, Evandro; Dueck, Amylou C; Viale, Giuseppe; Zujewski, Jo Anne; Goldhirsch, Aron; Armour, Alison; Pritchard, Kathleen I; McCullough, Ann E; Dolci, Stella; McFadden, Eleanor; Holmes, Andrew P; Tonghua, Liu; Eidtmann, Holger; Dinh, Phuong; Di Cosimo, Serena; Harbeck, Nadia; Tjulandin, Sergei; Im, Young-Hyuck; Huang, Chiun-Sheng; Diéras, Véronique; Hillman, David W; Wolff, Antonio C; Jackisch, Christian; Lang, Istvan; Untch, Michael; Smith, Ian; Boyle, Frances; Xu, Binghe; Gomez, Henry; Suter, Thomas; Gelber, Richard D; Perez, Edith A

    2016-04-01

    Lapatinib (L) plus trastuzumab (T) improves outcomes for metastatic human epidermal growth factor 2-positive breast cancer and increases the pathologic complete response in the neoadjuvant setting, but their role as adjuvant therapy remains uncertain. In the Adjuvant Lapatinib and/or Trastuzumab Treatment Optimization trial, patients with centrally confirmed human epidermal growth factor 2-positive early breast cancer were randomly assigned to 1 year of adjuvant therapy with T, L, their sequence (T→L), or their combination (L+T). The primary end point was disease-free survival (DFS), with 850 events required for 80% power to detect a hazard ratio (HR) of 0.8 for L+T versus T. Between June 2007 and July 2011, 8,381 patients were enrolled. In 2011, due to futility to demonstrate noninferiority of L versus T, the L arm was closed, and patients free of disease were offered adjuvant T. A protocol modification required P ≤ .025 for the two remaining pairwise comparisons. At a protocol-specified analysis with a median follow-up of 4.5 years, a 16% reduction in the DFS hazard rate was observed with L+T compared with T (555 DFS events; HR, 0.84; 97.5% CI, 0.70 to 1.02; P = .048), and a 4% reduction was observed with T→L compared with T (HR, 0.96; 97.5% CI, 0.80 to 1.15; P = .61). L-treated patients experienced more diarrhea, cutaneous rash, and hepatic toxicity compared with T-treated patients. The incidence of cardiac toxicity was low in all treatment arms. Adjuvant treatment that includes L did not significantly improve DFS compared with T alone and added toxicity. One year of adjuvant T remains standard of care. © 2015 by American Society of Clinical Oncology.

  4. Toxic epidermal necrolysis.

    Science.gov (United States)

    Pereira, Frederick A; Mudgil, Adarsh Vijay; Rosmarin, David M

    2007-02-01

    Toxic epidermal necrolysis (TEN) is an unpredictable, life-threatening drug reaction associated with a 30% mortality. Massive keratinocyte apoptosis is the hallmark of TEN. Cytotoxic T lymphocytes appear to be the main effector cells and there is experimental evidence for involvement of both the Fas-Fas ligand and perforin/granzyme pathways. Optimal treatment for these patients remains to be clarified. Discontinuation of the offending drug and prompt referral to a burn unit are generally agreed upon steps. Beyond that, however, considerable controversy exists. Evidence both pro and con exists for the use of IVIG, systemic corticosteroid, and other measures. There is also evidence suggesting that combination therapies may be of value. All the clinical data, however, is anecdotal or based on observational or retrospective studies. Definitive answers are not yet available. Given the rarity of TEN and the large number of patients required for a study to be statistically meaningful, placebo controlled trials are logistically difficult to accomplish. The absence of an animal model further hampers research into this condition. This article reviews recent data concerning clinical presentation, pathogenesis and treatment of TEN. At the conclusion of this learning activity, participants should have acquired a more comprehensive knowledge of our current understanding of the classification, clinical presentation, etiology, pathophysiology, prognosis, and treatment of TEN.

  5. Tight junction regulates epidermal calcium ion gradient and differentiation

    International Nuclear Information System (INIS)

    Kurasawa, Masumi; Maeda, Tetsuo; Oba, Ai; Yamamoto, Takuya; Sasaki, Hiroyuki

    2011-01-01

    Research highlights: → We disrupted epidermal tight junction barrier in reconstructed epidermis. → It altered Ca 2+ distribution and consequentially differentiation state as well. → Tight junction should affect epidermal homeostasis by maintaining Ca 2+ gradient. -- Abstract: It is well known that calcium ions (Ca 2+ ) induce keratinocyte differentiation. Ca 2+ distributes to form a vertical gradient that peaks at the stratum granulosum. It is thought that the stratum corneum (SC) forms the Ca 2+ gradient since it is considered the only permeability barrier in the skin. However, the epidermal tight junction (TJ) in the granulosum has recently been suggested to restrict molecular movement to assist the SC as a secondary barrier. The objective of this study was to clarify the contribution of the TJ to Ca 2+ gradient and epidermal differentiation in reconstructed human epidermis. When the epidermal TJ barrier was disrupted by sodium caprate treatment, Ca 2+ flux increased and the gradient changed in ion-capture cytochemistry images. Alterations of ultrastructures and proliferation/differentiation markers revealed that both hyperproliferation and precocious differentiation occurred regionally in the epidermis. These results suggest that the TJ plays a crucial role in maintaining epidermal homeostasis by controlling the Ca 2+ gradient.

  6. Incidence of rheumatoid arthritis, psoriatic arthritis and polymyalgia rheumatica in an inland area of central Italy: results of the CAMPO-RHE study.

    Science.gov (United States)

    De Socio, Antonia; Perrotta, Fabio Massimo; Grasso, Guido Maria; Lubrano, Ennio

    2018-01-01

    The aim of the CAMPO-RHE study was to determine the incidence of rheumatoid arthritis (RA), psoriatic arthritis (PsA) and polymyalgia rheumatica (PMR) in patients attending a rheumatologic outpatient's clinic of a new institution in Campobasso, Italy. Campobasso is a small town of approximately 50,000 inhabitants located in the inland territory of central Italy (Molise), and Public Health is managed from a single health authority. In Italy, all citizens are registered with a National Health System of General Practitioner (GP) Physicians. Between the 1 st of June 2014 and the 31 st of May 2016, all consecutive adult patients, sent by a GP, of Campobasso with any diagnosis of musculoskeletal symptoms/signs/complaints were evaluated in a single rheumatology outpatient clinic of our Academic Unit. The clinic represents the first and unique reference for GPs about rheumatic diseases in the territory. Subjects were classified using the 2010 EULAR criteria for RA, the CASPAR criteria for PsA and the 2012 ACR classification criteria for PMR. 1003 adult patients, sent by GPs, with articular or musculoskeletal complaints visited our clinic. Of these, 409 inhabitants of the municipality of Campobasso were evaluated for the study. During the 2-year study period we diagnosed 18, 19 and 12 new cases of RA, PsA and PMR respectively, with a new incident cases rate of 21.4, 22.59 and 27.43/100,000/year on the population at risk. The results of our study could contribute to better define the incidence of these rheumatic diseases classified with the new classification criteria.

  7. Near Infrared Optical Visualization of Epidermal Growth Factor Receptors Levels in COLO205 Colorectal Cell Line, Orthotopic Tumor in Mice and Human Biopsies

    Directory of Open Access Journals (Sweden)

    Philip Lazarovici

    2013-07-01

    Full Text Available In this study, we present the applicability of imaging epidermal growth factor (EGF receptor levels in preclinical models of COLO205 carcinoma cells in vitro, mice with orthotopic tumors and ex vivo colorectal tumor biopsies, using EGF-labeled with IRDye800CW (EGF-NIR. The near infrared (NIR bio-imaging of COLO205 cultures indicated specific and selective binding, reflecting EGF receptors levels. In vivo imaging of tumors in mice showed that the highest signal/background ratio between tumor and adjacent tissue was achieved 48 hours post-injection. Dissected colorectal cancer tissues from different patients demonstrated ex vivo specific imaging using the NIR bio-imaging platform of the heterogeneous distributed EGF receptors. Moreover, in the adjacent gastrointestinal tissue of the same patients, which by Western blotting was demonstrated as EGF receptor negative, no labeling with EGF-NIR probe was detected. Present results support the concept of tumor imaging by measuring EGF receptor levels using EGF-NIR probe. This platform is advantageous for EGF receptor bio-imaging of the NCI-60 recommended panel of tumor cell lines including 6–9 colorectal cell lines, since it avoids radioactive probes and is appropriate for use in the clinical setting using NIR technologies in a real-time manner.

  8. Resveratrol modulates MED28 (Magicin/EG-1) expression and inhibits epidermal growth factor (EGF)-induced migration in MDA-MB-231 human breast cancer cells.

    Science.gov (United States)

    Lee, Ming-Fen; Pan, Min-Hsiung; Chiou, Yi-Siou; Cheng, An-Chin; Huang, Han

    2011-11-09

    Resveratrol and pterostilbene exhibit diverse biological activities. MED28, a subunit of the mammalian Mediator complex for transcription, was also identified as magicin, an actin cytoskeleton Grb2-associated protein, and as endothelial-derived gene (EG-1). Several tumors exhibit aberrant MED28 expression, whereas the underlying mechanism is unclear. Triple-negative breast cancers, often expressing epidermal growth factor (EGF) receptor (EGFR), are associated with metastasis and poor survival. The objective of this study is to compare the effect of resveratrol and pterostilbene and to investigate the role of MED28 in EGFR-overexpressing MDA-MB-231 breast cancer cells. Pretreatment of resveratrol, but not pterostlbene, suppressed EGF-mediated migration and expression of MED28 and matrix metalloproteinase (MMP)-9 in MDA-MB-231 cells. Moreover, overexpression of MED28 increased migration, and the addition of EGF further enhanced migration. Our data indicate that resveratrol modulates the effect of MED28 on cellular migration, presumably through the EGFR/phosphatidylinositol 3-kinase (PI3K) signaling pathway, in breast cancer cells.

  9. Isolation of a human anti-epidermal growth factor receptor Fab antibody, EG-19-11, with subnanomolar affinity from naïve immunoglobulin repertoires using a hierarchical antibody library system.

    Science.gov (United States)

    Hur, Byung-ung; Yoon, Jae-bong; Liu, Li-Kun; Cha, Sang-hoon

    2010-11-30

    Specific antibodies that possess a subnanomolar affinity are very difficult to obtain from human naïve immunoglobulin repertoires without the use of lengthy affinity optimization procedures. Here, we designed a hierarchical phage-displayed antibody library system to generate an enormous diversity of combinatorial Fab fragments (6×10(17)) and attempted to isolate high-affinity Fabs against the human epidermal growth factor receptor (EGFR). A primary antibody library, designated HuDVFab-8L, comprising 4.5×10(9) human naïve heavy chains and eight unspecified human naïve light chains was selected against the EGFR-Fc protein by biopanning, and four anti-EGFR Fab clones were isolated. Because one of the Fab clones, denoted EG-L2-11, recognized a native EGFR expressed on A431 cells, the heavy chain of the Fab was shuffled with a human naïve light chain repertoire with a diversity of 1.4×10(8) and selected a second time against the EGFR-Fc protein again. One EG-L2-11 variant, denoted EG-19-11, recognized an EGFR epitope that was almost the same as that bound by cetuximab and had a K(D) of approximately 540 pM for soluble EGFR, which is about 7-fold higher than that of the FabC225 derived from cetuximab. This variant was also internalized by A431 cells, likely via receptor-mediated endocytosis, and it efficiently inhibited EGF-mediated tyrosine phosphorylation of the EGFR. These results demonstrate that the use of our hierarchical antibody library system is advantageous in generating fully human antibodies especially with a therapeutic purpose. Copyright © 2010 Elsevier B.V. All rights reserved.

  10. Co-inhibition of epidermal growth factor receptor and insulin-like growth factor receptor 1 enhances radiosensitivity in human breast cancer cells

    International Nuclear Information System (INIS)

    Li, Ping; Veldwijk, Marlon R; Zhang, Qing; Li, Zhao-bin; Xu, Wen-cai; Fu, Shen

    2013-01-01

    Over-expression of epidermal growth factor receptor (EGFR) or insulin-like growth factor-1 receptor (IGF-1R) have been shown to closely correlate with radioresistance of breast cancer cells. This study aimed to investigate the impact of co-inhibition of EGFR and IGF-1R on the radiosensitivity of two breast cancer cells with different profiles of EGFR and IGF-1R expression. The MCF-7 (EGFR +/−, IGF-1R +++) and MDA-MB-468 (EGFR +++, IGF-1R +++) breast cancer cell lines were used. Radiosensitizing effects were determined by colony formation assay. Apoptosis and cell cycle distribution were measured by flow cytometry. Phospho-Akt and phospho-Erk1/2 were quantified by western blot. In vivo studies were conducted using MDA-MB-468 cells xenografted in nu/nu mice. In MDA-MB-468 cells, the inhibition of IGF-1R upregulated the p-EGFR expression. Either EGFR (AG1478) or IGF-1R inhibitor (AG1024) radiosensitized MDA-MB-468 cells. In MCF-7 cells, radiosensitivity was enhanced by AG1024, but not by AG1478. Synergistical radiosensitizing effect was observed by co-inhibition of EGFR and IGF-1R only in MDA-MB-468 cells with a DMF 10% of 1.90. The co-inhibition plus irradiation significantly induced more apoptosis and arrested the cells at G0/G1 phase in MDA-MB-468 cells. Only co-inhibition of EGFR and IGF-1R synergistically diminished the expression of p-Akt and p-Erk1/2 in MDA-MB-468 cells. In vivo studies further verified the radiosensitizing effects by co-inhibition of both pathways in a MDA-MB-468 xenograft model. Our data suggested that co-inhibition of EGFR and IGF-1R synergistically radiosensitized breast cancer cells with both EGFR and IGF-1R high expression. The approach may have an important therapeutic implication in the treatment of breast cancer patients with high expression of EGFR and IGF-1R

  11. AUTOIMMUNE EPIDERMAL BLISTERING DISEASES

    Directory of Open Access Journals (Sweden)

    Ana Maria Abreu Velez

    2013-11-01

    Full Text Available Autoimmune bullous skin diseases (ABDs are uncommon, potentially fatal diseases of skin and mucous membranes which are associated with deposits of autoantibodies and complement against distinct molecules of the epidermis and dermal/epidermal basement membrane zone (BMZ. These autoantibodies lead to a loss in skin molecular integrity, which manifests clinically as formation of blisters or erosions. In pemphigus vulgaris, loss of adhesion occurs within the epidermis. The pioneering work of Ernst H. Beutner, Ph.D. and Robert E. Jordon, M.D. confirmed the autoimmune nature of these diseases. Walter F. Lever, M.D. contributed significantly to our understanding of the histopathologic features of these diseases. Walter Lever, M.D. and Ken Hashimoto, M.D. contributed electron microscopic studies of these diseases, especially in pemphigus vulgaris and bullous pemphigoid. In bullous pemphigoid (BP, linear IgA bullous dermatosis, epidermolysis bullosa acquisita (EBA and dermatitis herpetiformis (DH, loss of adhesion takes place within or underneath the BMZ. Classic EBA demonstrates extensive skin fragility; DH is commonly associated with gluten-sensitive enteropathy, and manifests clinically with pruritic papulovesicles on the extensor surfaces of the extremities and the lumbosacral area. The clinical spectrum of bullous pemphigoid includes tense blisters, urticarial plaques, and prurigo-like eczematous lesions. Pemphigoid gestationis mostly occurs during the last trimester of pregnancy, and mucous membrane pemphigoid primarily involves the oral mucosa and conjunctivae and leads to scarring. Linear IgA bullous dermatosis manifests with tense blisters in a „cluster of jewels”-like pattern in childhood (chronic bullous disease of childhood and is more clinically heterogeneous in adulthood. Many of the autoantigens in these disorders are known and have been well characterized. ABDs may be influenced by both genetic and exogenous factors. The diagnoses of

  12. Oral mucosa: an alternative epidermic cell source to develop autologous dermal-epidermal substitutes from diabetic subjects

    Directory of Open Access Journals (Sweden)

    Daniela GUZMÁN-URIBE

    Full Text Available Abstract Oral mucosa has been highlighted as a suitable source of epidermal cells due to its intrinsic characteristics such as its higher proliferation rate and its obtainability. Diabetic ulcers have a worldwide prevalence that is variable (1%-11%, meanwhile treatment of this has been proven ineffective. Tissue-engineered skin plays an important role in wound care focusing on strategies such autologous dermal-epidermal substitutes. Objective The aim of this study was to obtain autologous dermal-epidermal skin substitutes from oral mucosa from diabetic subjects as a first step towards a possible clinical application for cases of diabetic foot. Material and Methods Oral mucosa was obtained from diabetic and healthy subjects (n=20 per group. Epidermal cells were isolated and cultured using autologous fibrin to develop dermal-epidermal in vitro substitutes by the air-liquid technique with autologous human serum as a supplement media. Substitutes were immunocharacterized with collagen IV and cytokeratin 5-14 as specific markers. A Student´s t- test was performed to assess the differences between both groups. Results It was possible to isolate epidermal cells from the oral mucosa of diabetic and healthy subjects and develop autologous dermal-epidermal skin substitutes using autologous serum as a supplement. Differences in the expression of specific markers were observed and the cytokeratin 5-14 expression was lower in the diabetic substitutes, and the collagen IV expression was higher in the diabetic substitutes when compared with the healthy group, showing a significant difference. Conclusion Cells from oral mucosa could be an alternative and less invasive source for skin substitutes and wound healing. A difference in collagen production of diabetic cells suggests diabetic substitutes could improve diabetic wound healing. More research is needed to determine the crosstalk between components of these skin substitutes and damaged tissues.

  13. Phase II Study of Neoadjuvant Anthracycline-Based Regimens Combined With Nanoparticle Albumin-Bound Paclitaxel and Trastuzumab for Human Epidermal Growth Factor Receptor 2-Positive Operable Breast Cancer.

    Science.gov (United States)

    Tanaka, Satoru; Iwamoto, Mitsuhiko; Kimura, Kosei; Matsunami, Nobuki; Morishima, Hirotaka; Yoshidome, Katsuhide; Nomura, Takashi; Morimoto, Takashi; Yamamoto, Daigo; Tsubota, Yu; Kobayashi, Toshihiro; Uchiyama, Kazuhisa

    2015-06-01

    We treated patients with operable human epidermal growth factor receptor 2-positive breast cancer with neoadjuvant anthracycline regimens followed by nanoparticle albumin-bound paclitaxel plus trastuzumab. Of the 44 patients, 49% achieved a pathologic complete response (pCR). The pCR rate was 36% and 71% in the patients with estrogen receptor-positive and -negative cancer, respectively. Neoadjuvant therapy using this combination appears to be effective and safe. Introduction: Neoadjuvant chemotherapy plus trastuzumab. Neoadjuvant chemotherapy plus trastuzumab results in a 30% to 50% pathologic complete response (pCR) rate in human epidermal growth factor receptor 2 (HER2)-positive breast cancer and has been associated with improved therapeutic outcomes. Thus, the pCR rate can be useful in evaluating novel agents in this patient population. Nanoparticle albumin-bound (nab)-paclitaxel (PTX) can reduce the toxicity of PTX while maintaining its efficacy. The present study evaluated the activity and safety of nab-PTX as a neoadjuvant treatment of HER2(+) breast cancer. We treated patients with stage I to IIIA breast cancer using neoadjuvant epirubicin/cyclophosphamide (EC) or 5-fluorouracil/epirubicin/cyclophosphamide every 3 weeks (q3w) for 4 cycles, followed by nab-PTX (260 mg/m(2)) plus trastuzumab q3w for 4 cycles. The primary endpoint was the pCR rate. The secondary endpoints included the clinical response rate, disease-free survival, pathologic response rate (defined as pCR or minimal residual invasive disease only in the breast), breast-conserving surgery rate, and safety. Forty-six patients were enrolled. One patient met the exclusion criteria because of the coexistence of another malignant disease; therefore, we evaluated 45 patients in the entire study. One patient experienced rapid disease progression during EC therapy, leaving 44 patients evaluable for nab-PTX treatment. Of the 45 patients, 49% achieved a pCR. The pCR rate was 36% and 71% in those with

  14. New Approaches towards the Elucidation of Epidermal-Dermal Separation in Sulfur Mustard-Exposed Human Skin and Directions for Therapy

    National Research Council Canada - National Science Library

    Mol, Marijke

    2005-01-01

    .... Results of experiments with a human skin ex vivo model show that apoptosis and metalloprotease activity are key elements in HD-induced skin pathogenesis, and that intervention in these two processes...

  15. THE CONTRIBUTION OF TP-AGB AND RHeB STARS TO THE NEAR-IR LUMINOSITY OF LOCAL GALAXIES: IMPLICATIONS FOR STELLAR MASS MEASUREMENTS OF HIGH-REDSHIFT GALAXIES

    International Nuclear Information System (INIS)

    Melbourne, J.; Williams, Benjamin F.; Dalcanton, Julianne J.; Rosenfield, Philip; Weisz, D.

    2012-01-01

    Using high spatial resolution Hubble Space Telescope WFC3 and Advanced Camera for Surveys imaging of resolved stellar populations, we constrain the contribution of thermally pulsing asymptotic giant branch (TP-AGB) stars and red helium burning (RHeB) stars to the 1.6 μm near-infrared (NIR) luminosities of 23 nearby galaxies, including dwarfs and spirals. The TP-AGB phase contributes as much as 17% of the integrated F160W flux, even when the red giant branch is well populated. The RHeB population contribution can match or even exceed the TP-AGB contribution, providing as much as 21% (18% after a statistical correction for foreground) of the integrated F160W light. We estimate that these two short-lived phases may account for up to 70% of the rest-frame NIR flux at higher redshift. The NIR mass-to-light (M/L) ratio should therefore be expected to vary significantly due to fluctuations in the star formation rate (SFR) over timescales from 25 Myr to several Gyr, an effect that may be responsible for some of the lingering scatter in NIR galaxy scaling relations such as the Tully-Fisher and metallicity-luminosity relations. We compare our observational results to predictions based on optically derived star formation histories and stellar population synthesis (SPS) models, including models based on the 2008 Padova isochrones (used in popular SPS programs) and the updated 2010 Padova isochrones, which shorten the lifetimes of low-mass (old) low-metallicity TP-AGB populations. The updated (2010) SPS models generally reproduce the expected numbers of TP-AGB stars in the sample; indeed, for 65% of the galaxies, the discrepancy between modeled and observed numbers is smaller than the measurement uncertainties. The weighted mean model/data number ratio for TP-AGB stars is 1.5 (1.4 with outliers removed) with a standard deviation of 0.5. The same SPS models, however, give a larger discrepancy in the F160W flux contribution from the TP-AGB stars, overpredicting the flux by a

  16. The cell-penetrating peptide domain from human heparin-binding epidermal growth factor-like growth factor (HB-EGF) has anti-inflammatory activity in vitro and in vivo

    International Nuclear Information System (INIS)

    Lee, Jue-Yeon; Seo, Yoo-Na; Park, Hyun-Jung; Park, Yoon-Jeong; Chung, Chong-Pyoung

    2012-01-01

    Highlights: ► HBP sequence identified from HB-EGF has cell penetration activity. ► HBP inhibits the NF-κB dependent inflammatory responses. ► HBP directly blocks phosphorylation and degradation of IκBα. ► HBP inhibits nuclear translocation of NF-κB p65 subunit. -- Abstract: A heparin-binding peptide (HBP) sequence from human heparin-binding epidermal growth factor-like growth factor (HB-EGF) was identified and was shown to exhibit cell penetration activity. This cell penetration induced an anti-inflammatory reaction in lipopolysaccharide (LPS)-treated RAW 264.7 macrophages. HBP penetrated the cell membrane during the 10 min treatment and reduced the LPS-induced production of nitric oxide (NO), inducible nitric oxide synthase (iNOS), and cytokines (TNF-α and IL-6) in a concentration-dependent manner. Additionally, HBP inhibited the LPS-induced upregulation of cytokines, including TNF-α and IL-6, and decreased the interstitial infiltration of polymorphonuclear leukocytes in a lung inflammation model. HBP inhibited NF-κB-dependent inflammatory responses by directly blocking the phosphorylation and degradation of IκBα and by subsequently inhibiting the nuclear translocation of the p65 subunit of NF-κB. Taken together, this novel HBP may be potentially useful candidate for anti-inflammatory treatments and can be combined with other drugs of interest to transport attached molecules into cells.

  17. Clinical Usefulness of a One-Tube Nested Reverse Transcription Quantitative Polymerase Chain Reaction Assay for Evaluating Human Epidermal Growth Factor Receptor 2 mRNA Overexpression in Formalin-Fixed and Paraffin-Embedded Breast Cancer Tissue Samples.

    Science.gov (United States)

    Wang, Hye-Young; Ahn, Sungwoo; Park, Sunyoung; Kim, SeungIl; Lee, Hyeyoung

    2017-01-01

    Currently, the two main methods used to analyze human epidermal growth factor receptor 2 (HER2) amplification or overexpression have a limited accuracy and high costs. These limitations can be overcome by the development of complementary quantitative methods. In this study, we analyzed HER2 mRNA expression in clinical formalin-fixed and paraffin-embedded (FFPE) samples using a one-tube nested reverse transcription quantitative polymerase chain reaction (RT-qPCR) assay. We measured expression relative to 3 reference genes and compared the results to those obtained by conventional immunohistochemistry (IHC) and fluorescence in situ hybridization (FISH) assays with 226 FFPE breast cancer tissue samples. The one-tube nested RT-qPCR assay proved to be highly sensitive and specific based on comparisons with IHC (96.9 and 97.7%, respectively) and FISH (92.4 and 92.9%, respectively) obtained with the validation set. Comparisons with clinicopathological data revealed significant associations between HER2 overexpression and TNM stage (p < 0.01), histological type (p < 0.01), ER status (p < 0.001), PR status (p < 0.05), HER2 status (p < 0.001), and molecular subtypes (p < 0.001). Based on these findings, our one-tube nested RT-qPCR assay is a potentially useful and complementary screening tool for the detection of HER2 mRNA overexpression. © 2016 S. Karger AG, Basel.

  18. Ultraviolet B, melanin and mitochondrial DNA: Photo-damage in human epidermal keratinocytes and melanocytes modulated by alpha-melanocyte-stimulating hormone [version 1; referees: 2 approved

    Directory of Open Access Journals (Sweden)

    Markus Böhm

    2016-05-01

    Full Text Available Alpha-melanocyte-stimulating hormone (alpha-MSH increases melanogenesis and protects from UV-induced DNA damage. However, its effect on mitochondrial DNA (mtDNA damage is unknown. We have addressed this issue in a pilot study using human epidermal keratinocytes and melanocytes incubated with alpha-MSH and irradiated with UVB. Real-time touchdown PCR was used to quantify total and deleted mtDNA. The deletion detected encompassed the common deletion but was more sensitive to detection. There were 4.4 times more mtDNA copies in keratinocytes than in melanocytes. Irradiation alone did not affect copy numbers. Alpha-MSH slightly increased copy numbers in both cell types in the absence of UVB and caused a similar small decrease in copy number with dose in both cell types. Deleted copies were nearly twice as frequent in keratinocytes as in melanocytes. Alpha-MSH reduced the frequency of deleted copies by half in keratinocytes but not in melanocytes. UVB dose dependently led to an increase in the deleted copy number in alpha-MSH-treated melanocytes. UVB irradiation had little effect on deleted copy number in alpha-MSH-treated keratinocytes. In summary, alpha-MSH enhances mtDNA damage in melanocytes presumably by increased melanogenesis, while α-MSH is protective in keratinocytes, the more so in the absence of irradiation.

  19. Prospective study of the impact of the Prosigna assay on adjuvant clinical decision-making in unselected patients with estrogen receptor positive, human epidermal growth factor receptor negative, node negative early-stage breast cancer.

    Science.gov (United States)

    Martín, Miguel; González-Rivera, Milagros; Morales, Serafín; de la Haba-Rodriguez, Juan; González-Cortijo, Lucía; Manso, Luis; Albanell, Joan; González-Martín, Antonio; González, Sónia; Arcusa, Angels; de la Cruz-Merino, Luis; Rojo, Federico; Vidal, María; Galván, Patricia; Aguirre, Elena; Morales, Cristina; Ferree, Sean; Pompilio, Kristen; Casas, Maribel; Caballero, Rosalía; Goicoechea, Uxue; Carrasco, Eva; Michalopoulos, Steven; Hornberger, John; Prat, Aleix

    2015-06-01

    Improved understanding of risk of recurrence (ROR) is needed to reduce cases of recurrence and more effectively treat breast cancer patients. The purpose of this study was to examine how a gene-expression profile (GEP), identified by Prosigna, influences physician adjuvant treatment selection for early breast cancer (EBC) and the effects of this influence on optimizing adjuvant treatment recommendations in clinical practice. A prospective, observational, multicenter study was carried out in 15 hospitals across Spain. Participating medical oncologists completed pre-assessment, post-assessment, and follow-up questionnaires recording their treatment recommendations and confidence in these recommendations, before and after knowing the patient's ROR. Patients completed questionnaires on decision-making, anxiety, and health status. Between June 2013 and January 2014, 217 patients enrolled and a final 200 were included in the study. Patients were postmenopausal, estrogen receptor positive, human epidermal growth hormone factor negative, and node negative with either stage 1 or stage 2 tumors. After receiving the GEP results, treatment recommendations were changed for 40 patients (20%). The confidence of medical oncologists in their treatment recommendations increased in 41.6% and decreased in 6.5% of total cases. Patients reported lower anxiety after physicians made treatment recommendations based on the GEP results (p anxiety about the selected adjuvant therapy decreased with use of the GEP.

  20. Night work and breast cancer risk defined by human epidermal growth factor receptor-2 (HER2) and hormone receptor status: A population-based case-control study in France.

    Science.gov (United States)

    Cordina-Duverger, Emilie; Koudou, Yves; Truong, Thérèse; Arveux, Patrick; Kerbrat, Pierre; Menegaux, Florence; Guénel, Pascal

    Night work has been associated with risk of breast cancer but this association needs to be confirmed. Because breast cancer is an etiologically heterogeneous disease, we explored the association of night work with breast cancer subtypes defined by tumor status (positive of negative) for estrogen-receptor (ER), progesterone-receptor (PR) and human epidermal growth factor-receptor 2 (HER2). Using the data from a case-control study in France including 975 cases and 1317 controls, we found that the odds ratios for ER+, PR+ or HER2+ breast cancers subtypes were significantly elevated, while no association with night shift work was observed for ER, PR or HER2-negative tumors. After stratification by menopausal status, the associations of night work with receptor-positive breast tumor subtypes were clearly seen in premenopausal women (odds ratios 2.04, 1.98 and 2.80, respectively) but did not appear in postmenopausal women. This study provides evidence that working at night may increase risk of ER, PR and HER2-positive subtypes of breast cancer particularly among premenopausal women.

  1. Cortactin overexpression results in sustained epidermal growth factor receptor signaling by preventing ligand-induced receptor degradation in human carcinoma cells

    NARCIS (Netherlands)

    van Rossum, AGSH; Gibcus, J; van der Wal, J; Schuuring, E

    2005-01-01

    The chromosome 11q13 region is frequently amplified in human carcinomas and results in an increased expression of various genes including cortactin, and is also associated with an increased invasive potential. Cortactin acts as an important regulator of the actin cytoskeleton. It is therefore very

  2. Curative Metatarsal Bone Surgery Combined with Intralesional Administration of Recombinant Human Epidermal Growth Factor in Diabetic Neuropathic Ulceration of the Forefoot: A Prospective, Open, Uncontrolled, Nonrandomized, Observational Study

    Directory of Open Access Journals (Sweden)

    Aristides L. Garcia Herrera, MD, PhD

    2017-01-01

    Conclusions: The combination of curative metatarsal bone surgery with intralesional administration of recombinant human EGF resulted in a significant reduction in the re-epithelization time, recidivism, and development of new diabetic lesions. The safety profile was appropriate. However, more randomized, triple-blind, and placebo trials are needed to evaluate the efficacy and safety of this new therapy.

  3. Evolution of dinosaur epidermal structures.

    Science.gov (United States)

    Barrett, Paul M; Evans, David C; Campione, Nicolás E

    2015-06-01

    Spectacularly preserved non-avian dinosaurs with integumentary filaments/feathers have revolutionized dinosaur studies and fostered the suggestion that the dinosaur common ancestor possessed complex integumentary structures homologous to feathers. This hypothesis has major implications for interpreting dinosaur biology, but has not been tested rigorously. Using a comprehensive database of dinosaur skin traces, we apply maximum-likelihood methods to reconstruct the phylogenetic distribution of epidermal structures and interpret their evolutionary history. Most of these analyses find no compelling evidence for the appearance of protofeathers in the dinosaur common ancestor and scales are usually recovered as the plesiomorphic state, but results are sensitive to the outgroup condition in pterosaurs. Rare occurrences of ornithischian filamentous integument might represent independent acquisitions of novel epidermal structures that are not homologous with theropod feathers. © 2015 The Author(s) Published by the Royal Society. All rights reserved.

  4. Epidermal Growth Factor Cytoplasmic Domain Affects ErbB Protein Degradation by the Lysosomal and Ubiquitin-Proteasome Pathway in Human Cancer Cells

    Directory of Open Access Journals (Sweden)

    Aleksandra Glogowska

    2012-05-01

    Full Text Available The cytoplasmic domains of EGF-like ligands, including EGF cytoplasmic domain (EGFcyt, have important biological functions. Using specific constructs and peptides of human EGF cytoplasmic domain, we demonstrate that EGFcyt facilitates lysosomal and proteasomal protein degradation, and this coincided with growth inhibition of human thyroid and glioma carcinoma cells. EGFcyt and exon 22–23-encoded peptide (EGF22.23 enhanced procathepsin B (procathB expression and procathB-mediated lysosomal degradation of EGFR/ErbB1 as determined by inhibitors for procathB and the lysosomal ATPase inhibitor BafA1. Presence of mbEGFctF, EGFcyt, EGF22.23, and exon 23-encoded peptides suppressed the expression of the deubiqitinating enzyme ubiquitin C-terminal hydrolase-L1 (UCH-L1. This coincided with hyperubiquitination of total cellular proteins and ErbB1/2 and reduced proteasome activity. Upon small interfering RNA-mediated silencing of endogenously expressed UCH-L1, a similar hyperubiquitinylation phenotype, reduced ErbB1/2 content, and attenuated growth was observed. The exon 23-encoded peptide region of EGFcyt was important for these biologic actions. Structural homology modeling of human EGFcyt showed that this molecular region formed an exposed surface loop. Peptides derived from this EGFcyt loop structure may aid in the design of novel peptide therapeutics aimed at inhibiting growth of cancer cells.

  5. Biochemistry of epidermal stem cells.

    Science.gov (United States)

    Eckert, Richard L; Adhikary, Gautam; Balasubramanian, Sivaprakasam; Rorke, Ellen A; Vemuri, Mohan C; Boucher, Shayne E; Bickenbach, Jackie R; Kerr, Candace

    2013-02-01

    The epidermis is an important protective barrier that is essential for maintenance of life. Maintaining this barrier requires continuous cell proliferation and differentiation. Moreover, these processes must be balanced to produce a normal epidermis. The stem cells of the epidermis reside in specific locations in the basal epidermis, hair follicle and sebaceous glands and these cells are responsible for replenishment of this tissue. A great deal of effort has gone into identifying protein epitopes that mark stem cells, in identifying stem cell niche locations, and in understanding how stem cell populations are related. We discuss these studies as they apply to understanding normal epidermal homeostasis and skin cancer. An assortment of stem cell markers have been identified that permit assignment of stem cells to specific regions of the epidermis, and progress has been made in understanding the role of these cells in normal epidermal homeostasis and in conditions of tissue stress. A key finding is the multiple stem cell populations exist in epidermis that give rise to different structures, and that multiple stem cell types may contribute to repair in damaged epidermis. Understanding epidermal stem cell biology is likely to lead to important therapies for treating skin diseases and cancer, and will also contribute to our understanding of stem cells in other systems. This article is part of a Special Issue entitled Biochemistry of Stem Cells. Copyright © 2012 Elsevier B.V. All rights reserved.

  6. Biochemistry of epidermal stem cells☆

    Science.gov (United States)

    Eckert, Richard L.; Adhikary, Gautam; Balasubramanian, Sivaprakasam; Rorke, Ellen A.; Vemuri, Mohan C.; Boucher, Shayne E.; Bickenbach, Jackie R.; Kerr, Candace

    2014-01-01

    Background The epidermis is an important protective barrier that is essential for maintenance of life. Maintaining this barrier requires continuous cell proliferation and differentiation. Moreover, these processes must be balanced to produce a normal epidermis. The stem cells of the epidermis reside in specific locations in the basal epidermis, hair follicle and sebaceous glands and these cells are responsible for replenishment of this tissue. Scope of review A great deal of effort has gone into identifying protein epitopes that mark stem cells, in identifying stem cell niche locations, and in understanding how stem cell populations are related. We discuss these studies as they apply to understanding normal epidermal homeostasis and skin cancer. Major conclusions An assortment of stem cell markers have been identified that permit assignment of stem cells to specific regions of the epidermis, and progress has been made in understanding the role of these cells in normal epidermal homeostasis and in conditions of tissue stress. A key finding is the multiple stem cell populations exist in epidermis that give rise to different structures, and that multiple stem cell types may contribute to repair in damaged epidermis. General significance Understanding epidermal stem cell biology is likely to lead to important therapies for treating skin diseases and cancer, and will also contribute to our understanding of stem cells in other systems. This article is part of a Special Issue entitled Biochemistry of Stem Cells. PMID:22820019

  7. Epidermal Growth Factor Receptor in Pancreatic Cancer

    International Nuclear Information System (INIS)

    Oliveira-Cunha, Melissa; Newman, William G.; Siriwardena, Ajith K.

    2011-01-01

    Pancreatic cancer is the fourth leading cause of cancer related death. The difficulty in detecting pancreatic cancer at an early stage, aggressiveness and the lack of effective therapy all contribute to the high mortality. Epidermal growth factor receptor (EGFR) is a transmembrane glycoprotein, which is expressed in normal human tissues. It is a member of the tyrosine kinase family of growth factors receptors and is encoded by proto-oncogenes. Several studies have demonstrated that EGFR is over-expressed in pancreatic cancer. Over-expression correlates with more advanced disease, poor survival and the presence of metastases. Therefore, inhibition of the EGFR signaling pathway is an attractive therapeutic target. Although several combinations of EGFR inhibitors with chemotherapy demonstrate inhibition of tumor-induced angiogenesis, tumor cell apoptosis and regression in xenograft models, these benefits remain to be confirmed. Multimodality treatment incorporating EGFR-inhibition is emerging as a novel strategy in the treatment of pancreatic cancer

  8. In vivo anticancer evaluation of the hyperthermic efficacy of anti-human epidermal growth factor receptor-targeted PEG-based nanocarrier containing magnetic nanoparticles

    Directory of Open Access Journals (Sweden)

    Baldi G

    2014-06-01

    Full Text Available Giovanni Baldi,1 Costanza Ravagli,1 Filippo Mazzantini,1 George Loudos,2 Jaume Adan,3 Marc Masa,3 Dimitrios Psimadas,2 Eirini A Fragogeorgi,2 Erica Locatelli,4 Claudia Innocenti,5,6 Claudio Sangregorio,5,7 Mauro Comes Franchini4 1CERICOL, Sovigliana-Vinci, Italy; 2Technological Educational Institute of Athens, Athens, Greece; 3Leitat Technological Center, Barcelona, Spain; 4Department of Industrial Chemistry Toso Montanari, University of Bologna, Bologna, 5Consorzio Interuniversitario Nazionale per la Scienza e Tecnologia dei Materiali (INSTM, 6Dipartimento di Chimica U Schiff, Università di Firenze, Firenze, 7Centro Nazionale delle Ricerche (ICCOM – CNR, Firenze, Italy Abstract: Polymeric nanoparticles with targeting moieties containing magnetic nanoparticles as theranostic agents have considerable potential for the treatment of cancer. Here we report the chemical synthesis and characterization of a poly(D,L-lactide-co-glycolide-b-poly(ethylene glycol-based nanocarrier containing iron oxide nanoparticles and human epithelial growth factor receptor on the outer shell. The nanocarrier was also radiolabeled with 99mTc and tested as a theranostic nanomedicine, ie, it was investigated for both its diagnostic ability in vivo and its therapeutic hyperthermic effects in a standard A431 human tumor cell line. Following radiolabeling with 99mTc, the biodistribution and therapeutic hyperthermic effects of the nanosystem were studied noninvasively in vivo in tumor-bearing mice. A substantial decrease in tumor size correlated with an increase in both nanoparticle concentration and local temperature was achieved, confirming the possibility of using this multifunctional nanosystem as a therapeutic tool for epidermoid carcinoma. Keywords: magnetic nanoparticles, polymeric nanocarriers, skin cancer, hyperthermia, single-photon emission computed tomography, imaging

  9. Clinical effects of prior trastuzumab on combination eribulin mesylate plus trastuzumab as first-line treatment for human epidermal growth factor receptor 2 positive locally recurrent or metastatic breast cancer: results from a Phase II, single-arm, multicenter study

    Directory of Open Access Journals (Sweden)

    Puhalla S

    2016-12-01

    Full Text Available Shannon Puhalla,1 Sharon Wilks,2 Adam M Brufsky,1 Joyce O’Shaughnessy,3 Lee S Schwartzberg,4 Erhan Berrak,5 James Song,5 Linda Vahdat6 1Department of Hematology and Oncology, University of Pittsburgh Medical Center, Pittsburgh, PA, 2Department of Hematology Oncology, US Oncology-Cancer Care Centers of South Texas, San Antonio, TX, 3Department of Medical Oncology, Texas Oncology-Baylor Charles A. Sammons Cancer Center US Oncology, Dallas, TX, 4Department of Hematology/Oncology, West Cancer Center, University of Tennessee Health Science Center, Memphis, TN, 5Department of Medical Affairs, Formerly of Eisai Inc., Woodcliff Lake, NJ, 6Department of Medicine, Weill Cornell Medical College, New York, NY, USA Abstract: Eribulin mesylate, a novel nontaxane microtubule dynamics inhibitor in the halichondrin class of antineoplastic drugs, is indicated for the treatment of patients with metastatic breast cancer who previously received ≥2 chemotherapy regimens in the metastatic setting. Primary data from a Phase II trial for the first-line combination of ­eribulin plus trastuzumab in human epidermal growth factor receptor 2 positive patients showed a 71% objective response rate and tolerability consistent with the known profile of these agents. Here, we present prespecified analyses of efficacy of this combination based on prior trastuzumab use. Patients received eribulin mesylate 1.4 mg/m2 (equivalent to 1.23 mg/m2 eribulin [expressed as free base] intravenously on days 1 and 8 plus trastuzumab (8 mg/kg intravenously/cycle 1, then 6 mg/kg on day 1 of each 21-day cycle. Objective response rates, progression-free survival, and tolerability were assessed in patients who had and had not received prior adjuvant or neoadjuvant (neo/adjuvant trastuzumab treatment. Fifty-two patients (median age: 59.5 years received eribulin/trastuzumab for a median treatment duration of ~31 weeks; 40.4% (n=21 had been previously treated with neo/adjuvant trastuzumab prior to

  10. Phase II Study of Paclitaxel Given Once per Week Along With Trastuzumab and Pertuzumab in Patients With Human Epidermal Growth Factor Receptor 2–Positive Metastatic Breast Cancer

    Science.gov (United States)

    Dang, Chau; Iyengar, Neil; Datko, Farrah; D'Andrea, Gabriella; Theodoulou, Maria; Dickler, Maura; Goldfarb, Shari; Lake, Diana; Fasano, Julie; Fornier, Monica; Gilewski, Theresa; Modi, Shanu; Gajria, Devika; Moynahan, Mary Ellen; Hamilton, Nicola; Patil, Sujata; Jochelson, Maxine; Norton, Larry; Baselga, Jose; Hudis, Clifford

    2015-01-01

    Purpose The CLEOPATRA (Clinical Evaluation of Trastuzumab and Pertuzumab) study demonstrated superior progression-free survival (PFS) and overall survival when pertuzumab was added to trastuzumab and docetaxel. Paclitaxel given once per week is effective and less toxic than docetaxel. We performed a phase II study to evaluate the efficacy and safety of pertuzumab and trastuzumab with paclitaxel given once per week. Patients and Methods Patients with metastatic human epidermal growth factor receptor 2–positive breast cancer with zero to one prior therapy were enrolled. Treatment consisted of paclitaxel 80 mg/m2 once per week plus trastuzumab (8 mg/kg loading dose → 6 mg/kg) once every 3 weeks plus pertuzumab (840 mg loading dose → 420 mg) once every 3 weeks, all given intravenously. The primary end point was 6-month PFS assessed by Kaplan-Meier methods. Results From January 2011 to December 2013, we enrolled 69 patients: 51 (74%) and 18 (26%) treated in first- and second-line metastatic settings, respectively. At a median follow-up of 21 months (range, 3 to 38 months), 6-month PFS was 86% (95% CI, 75% to 92%). The median PFS was 19.5 months (95% CI, 14 to 26 months) overall. PFS was 24.2 months (95% CI, 14 months to not reached [NR]) and 16.4 months (95% CI, 8.5 months to NR) for those without and with prior treatment, respectively. At 1 year, Kaplan-Meier PFS was 70% (95% CI, 56% to 79%) overall, 71% (95% CI, 55% to 82%) for those without prior therapy, and 66% (95% CI, 40% to 83%) for those with prior therapy. Treatment was well-tolerated; there was no febrile neutropenia or symptomatic left ventricular systolic dysfunction. Conclusion Paclitaxel given once per week with trastuzumab and pertuzumab is highly active and well tolerated and seems to be an effective alternative to docetaxel-based combination therapy. PMID:25547504

  11. Quantification of human epidermal growth factor receptor 2 immunohistochemistry using the Ventana Image Analysis System: correlation with gene amplification by fluorescence in situ hybridization: the importance of instrument validation for achieving high (>95%) concordance rate.

    Science.gov (United States)

    Dennis, Jake; Parsa, Rezvaneh; Chau, Donnie; Koduru, Prasad; Peng, Yan; Fang, Yisheng; Sarode, Venetia Rumnong

    2015-05-01

    The use of computer-based image analysis for scoring human epidermal growth factor receptor 2 (HER2) immunohistochemistry (IHC) has gained a lot of interest recently. We investigated the performance of the Ventana Image Analysis System (VIAS) in HER2 quantification by IHC and its correlation with fluorescence in situ hybridization (FISH). We specifically compared the 3+ IHC results using the manufacturer's machine score cutoffs versus laboratory-defined cutoffs with the FISH assay. Using the manufacturer's 3+ cutoff (VIAS score; 2.51 to 3.5), 181/536 (33.7%) were scored 3+, and FISH was positive in 147/181 (81.2%), 2 (1.1%) were equivocal, and 32 (17.6%) were FISH (-). Using the laboratory-defined 3+ cutoff (VIAS score 3.5), 52 (28.7%) cases were downgraded to 2+, of which 29 (55.7%) were FISH (-), and 23 (44.2%) were FISH (+). With the revised cutoff, there were improvements in the concordance rate from 89.1% to 97.0% and in the positive predictive value from 82.1% to 97.6%. The false-positive rate for 3+ decreased from 9.0% to 0.8%. Six of 175 (3.4%) IHC (-) cases were FISH (+). Three cases with a VIAS score 3.5 showed polysomy of chromosome 17. In conclusion, the VIAS may be a valuable tool for assisting pathologists in HER2 scoring; however, the positive cutoff defined by the manufacturer is associated with a high false-positive rate. This study highlights the importance of instrument validation/calibration to reduce false-positive results.

  12. Differences in expression of the cancer stem cell marker aldehyde dehydrogenase 1 among estrogen receptor-positive/human epidermal growth factor receptor type 2-negative breast cancer cases with early, late, and no recurrence.

    Science.gov (United States)

    Miyoshi, Yuichiro; Shien, Tadahiko; Ogiya, Akiko; Ishida, Naoko; Yamazaki, Kieko; Horii, Rie; Horimoto, Yoshiya; Masuda, Norikazu; Yasojima, Hiroyuki; Inao, Touko; Osako, Tomofumi; Takahashi, Masato; Tomioka, Nobumoto; Endo, Yumi; Hosoda, Mitsuchika; Doihara, Hiroyoshi; Miyoshi, Shinichiro; Yamashita, Hiroko

    2016-07-02

    The significance of the expression of aldehyde dehydrogenase 1 (ALDH1), a cancer stem cell marker, for predicting the recurrence of estrogen receptor (ER)-positive/human epidermal growth factor receptor type 2 (HER2)-negative breast cancer is still poorly understood. The value of ALDH1 in predicting the time of recurrence remains unknown. In total, 184 patients with early distant recurrence, 134 patients with late distant recurrence, and 321 control patients without recurrence for more than 10 years after starting initial treatment for ER-positive/HER2-negative breast cancer, registered in 9 institutions, were analyzed. We assessed relationships between ALDH1 and other clinicopathological features, and ALDH1 expression was compared among the three groups. The relationship between ALDH1 expression and overall survival after recurrence was also evaluated in each group. The rates of ALDH1 expression positivity (more than 1 %) in the early, late, and no recurrence groups were 18.4 %, 13.4 %, and 8.4 %, respectively. ALDH1 expression correlated significantly with lymph node metastases (p = 0.048) and the Ki-67 labeling index (p factor independently predicting overall survival after the detection of recurrence (adjusted OR 1.451, 95 % CI 0.985-2.085, p = 0.059). Among patients with ER-positive/HER2-negative breast cancer, ALDH1 expression was more common in those with early recurrence, and this expression was found to be associated with a more aggressive breast cancer phenotype than that in the patients without recurrence. Further study is needed to clarify the prognostic significance of the heterogeneity of cancer stem cells and to confirm their role in resistance to chemotherapy.

  13. The relationship between quantitative human epidermal growth factor receptor 2 gene expression by the 21-gene reverse transcriptase polymerase chain reaction assay and adjuvant trastuzumab benefit in Alliance N9831.

    Science.gov (United States)

    Perez, Edith A; Baehner, Frederick L; Butler, Steven M; Thompson, E Aubrey; Dueck, Amylou C; Jamshidian, Farid; Cherbavaz, Diana; Yoshizawa, Carl; Shak, Steven; Kaufman, Peter A; Davidson, Nancy E; Gralow, Julie; Asmann, Yan W; Ballman, Karla V

    2015-10-01

    The N9831 trial demonstrated the efficacy of adjuvant trastuzumab for patients with human epidermal growth factor receptor 2 (HER2) locally positive tumors by protein or gene analysis. We used the 21-gene assay to examine the association of quantitative HER2 messenger RNA (mRNA) gene expression and benefit from trastuzumab. N9831 tested the addition of trastuzumab to chemotherapy in stage I-III HER2-positive breast cancer. For two of the arms of the trial, doxorubicin and cyclophosphamide followed by paclitaxel (AC-T) and doxorubicin and cyclophosphamide followed by paclitaxel and trastuzumab concurrent chemotherapy-trastuzumab (AC-TH), recurrence score (RS) and HER2 mRNA expression were determined by the 21-gene assay (Oncotype DX®) (negative 10 % positive cells = positive), 91 % for RT-PCR versus central fluorescence in situ hybridization (FISH) (≥2.0 = positive) and 94 % for central IHC versus central FISH. In the primary analysis, the association of HER2 expression by 21-gene assay with trastuzumab benefit was marginally nonsignificant (nonlinear p = 0.057). In hormone receptor-positive patients (local IHC) the association was significant (p = 0.002). The association was nonlinear with the greatest estimated benefit at lower and higher HER2 expression levels. Concordance among HER2 assessments by central IHC, FISH, and RT-PCR were similar and high. Association of HER2 mRNA expression with trastuzumab benefit as measured by time to distant recurrence was nonsignificant. A consistent benefit of trastuzumab irrespective of mHER2 levels was observed in patients with either IHC-positive or FISH-positive tumors. Trend for benefit was observed also for the small groups of patients with negative results by any or all of the central assays. Clinicaltrials.gov NCT00005970 . Registered 5 July 2000.

  14. Patient-reported outcomes from EMILIA, a randomized phase 3 study of trastuzumab emtansine (T-DM1) versus capecitabine and lapatinib in human epidermal growth factor receptor 2-positive locally advanced or metastatic breast cancer.

    Science.gov (United States)

    Welslau, Manfred; Diéras, Veronique; Sohn, Joo-Hyuk; Hurvitz, Sara A; Lalla, Deepa; Fang, Liang; Althaus, Betsy; Guardino, Ellie; Miles, David

    2014-03-01

    This report describes the results of an analysis of patient-reported outcomes from EMILIA (TDM4370g/BO21977), a randomized phase 3 study of the antibody-drug conjugate trastuzumab emtansine (T-DM1) versus capecitabine and lapatinib in human epidermal growth factor receptor 2 (HER2)-positive locally advanced or metastatic breast cancer. A secondary endpoint of the EMILIA study was time to symptom worsening (time from randomization to the first documentation of a ≥ 5-point decrease from baseline) as measured by the Trial Outcome Index Physical/Functional/Breast (TOI-PFB) subset of the Functional Assessment of Cancer Therapy-Breast questionnaire. Predefined exploratory patient-reported outcome endpoints included proportion of patients with a clinically significant improvement in symptoms (per TOI-PFB) and proportion of patients with diarrhea symptoms (per Diarrhea Assessment Scale). In the T-DM1 arm, 450 of 495 patients had a baseline and ≥ 1 postbaseline TOI-PFB score versus 445 of 496 patients in the capecitabine-plus-lapatinib arm. Time to symptom worsening was delayed in the T-DM1 arm versus the capecitabine-plus-lapatinib arm (7.1 months versus 4.6 months, respectively; hazard ratio = 0.796; P = .0121). In the T-DM1 arm, 55.3% of patients developed clinically significant improvement in symptoms from baseline versus 49.4% in the capecitabine-plus-lapatinib arm (P = .0842). Although similar at baseline, the number of patients reporting diarrhea symptoms increased 1.5- to 2-fold during treatment with capecitabine and lapatinib but remained near baseline levels in the T-DM1 arm. Together with the EMILIA primary data, these results support the concept that T-DM1 has greater efficacy and tolerability than capecitabine plus lapatinib, which may translate into improvements in health-related quality of life. © 2013 American Cancer Society.

  15. Laboratory compliance with the American Society of Clinical Oncology/college of American Pathologists guidelines for human epidermal growth factor receptor 2 testing: a College of American Pathologists survey of 757 laboratories.

    Science.gov (United States)

    Nakhleh, Raouf E; Grimm, Erin E; Idowu, Michael O; Souers, Rhona J; Fitzgibbons, Patrick L

    2010-05-01

    To ensure quality human epidermal growth receptor 2 (HER2) testing in breast cancer, the American Society of Clinical Oncology/College of American Pathologists guidelines were introduced with expected compliance by 2008. To assess the effect these guidelines have had on pathology laboratories and their ability to address key components. In late 2008, a survey was distributed with the HER2 immunohistochemistry (IHC) proficiency testing program. It included questions regarding pathology practice characteristics and assay validation using fluorescence in situ hybridization or another IHC laboratory assay and assessed pathologist HER2 scoring competency. Of the 907 surveys sent, 757 (83.5%) were returned. The median laboratory accessioned 15 000 cases and performed 190 HER2 tests annually. Quantitative computer image analysis was used by 33% of laboratories. In-house fluorescence in situ hybridization was performed in 23% of laboratories, and 60% of laboratories addressed the 6- to 48-hour tissue fixation requirement by embedding tissue on the weekend. HER2 testing was performed on the initial biopsy in 40%, on the resection specimen in 6%, and on either in 56% of laboratories. Testing was validated with only fluorescence in situ hybridization in 47% of laboratories, whereas 10% of laboratories used another IHC assay only; 13% used both assays, and 12% and 15% of laboratories had not validated their assays or chose "not applicable" on the survey question, respectively. The 90% concordance rate with fluorescence in situ hybridization results was achieved by 88% of laboratories for IHC-negative findings and by 81% of laboratories for IHC-positive cases. The 90% concordance rate for laboratories using another IHC assay was achieved by 80% for negative findings and 75% for positive cases. About 91% of laboratories had a pathologist competency assessment program. This survey demonstrates the extent and characteristics of HER2 testing. Although some American Society of

  16. E3B1, a human homologue of the mouse gene product Abi-1, sensitizes activation of Rap1 in response to epidermal growth factor

    International Nuclear Information System (INIS)

    Jenei, Veronika; Andersson, Tommy; Jakus, Judit; Dib, Karim

    2005-01-01

    E3B1, a human homologue of the mouse gene product Abi-1, has been implicated in growth-factor-mediated regulation of the small GTPases p21 Ras and Rac. E3b1 is a regulator of Rac because it can form a complex with Sos-1 and eps8, and such a Sos-1-e3B1-eps8 complex serves as a guanine nucleotide exchange factor for Rac. In the present study, we found that overexpression of e3B1 in NIH3T3/EGFR cells sensitized EGF-induced activation of Rac1, whereas it had no impact on EGF-induced activation of p21 Ras . Remarkably, we found that EGF-induced activation of the p21 Ras -related GTPase Rap1 was also sensitized in NIH3T3/EGFR-e3B1 cells. Thus, in NIH3T3/EGFR-e3B1 cells, maximal EGF-induced activation of Rap1 occurs with a dose of EGF much lower than in NIH3T3/EGFR cells. We also report that overexpression of e3B1 in NIH3T3/EGFR cells renders EGF-induced activation of Rap1 completely dependent on Src tyrosine kinases but not on c-Abl. However, EGF-induced tyrosine phosphorylation of the Rap GEF C3G occurred regardless of whether e3B1 was overexpressed or not, and this did not involve Src tyrosine kinases. Accordingly, we propose that overexpression of e3B1 in NIH3T3/EGFR cells leads to mobilization of Src tyrosine kinases that participate in EGF-induced activation of Rap1 and inhibition of cell proliferation

  17. Epidermal Overexpression of Xenobiotic Receptor PXR Impairs the Epidermal Barrier and Triggers Th2 Immune Response.

    Science.gov (United States)

    Elentner, Andreas; Schmuth, Matthias; Yannoutsos, Nikolaos; Eichmann, Thomas O; Gruber, Robert; Radner, Franz P W; Hermann, Martin; Del Frari, Barbara; Dubrac, Sandrine

    2018-01-01

    The skin is in daily contact with environmental pollutants, but the long-term effects of such exposure remain underinvestigated. Many of these toxins bind and activate the pregnane X receptor (PXR), a ligand-activated transcription factor that regulates genes central to xenobiotic metabolism. The objective of this work was to investigate the effect of constitutive activation of PXR in the basal layer of the skin to mimic repeated skin exposure to noxious molecules. We designed a transgenic mouse model that overexpresses the human PXR gene linked to the herpes simplex VP16 domain under the control of the keratin 14 promoter. We show that transgenic mice display increased transepidermal water loss and elevated skin pH, abnormal stratum corneum lipids, focal epidermal hyperplasia, activated keratinocytes expressing more thymic stromal lymphopoietin, a T helper type 2/T helper type 17 skin immune response, and increased serum IgE. Furthermore, the cutaneous barrier dysfunction precedes development of the T helper type 2/T helper type 17 inflammation in transgenic mice, thereby mirroring the time course of atopic dermatitis development in humans. Moreover, further experiments suggest increased PXR signaling in the skin of patients with atopic dermatitis when compared with healthy skin. Thus, PXR activation by environmental pollutants may compromise epidermal barrier function and favor an immune response resembling atopic dermatitis. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  18. Clinical Translation and Validation of a Predictive Biomarker for Patritumab, an Anti-human Epidermal Growth Factor Receptor 3 (HER3) Monoclonal Antibody, in Patients With Advanced Non-small Cell Lung Cancer.

    Science.gov (United States)

    Mendell, Jeanne; Freeman, Daniel J; Feng, Wenqin; Hettmann, Thore; Schneider, Matthias; Blum, Sabine; Ruhe, Jens; Bange, Johannes; Nakamaru, Kenji; Chen, Shuquan; Tsuchihashi, Zenta; von Pawel, Joachim; Copigneaux, Catherine; Beckman, Robert A

    2015-03-01

    During early clinical development, prospective identification of a predictive biomarker and validation of an assay method may not always be feasible. Dichotomizing a continuous biomarker measure to classify responders also leads to challenges. We present a case study of a prospective-retrospective approach for a continuous biomarker identified after patient enrollment but defined prospectively before the unblinding of data. An analysis of the strengths and weaknesses of this approach and the challenges encountered in its practical application are also provided. HERALD (NCT02134015) was a double-blind, phase 2 study in patients with non-small cell lung cancer (NSCLC) randomized to erlotinib with placebo or with high or low doses of patritumab, a monoclonal antibody targeted against human epidermal growth factor receptor 3 (HER3). While the primary objective was to assess safety and progression-free survival (PFS), a secondary objective was to determine a single predictive biomarker hypothesis to identify subjects most likely to benefit from the addition of patritumab. Although not identified as the primary biomarker in the study protocol, on the basis of preclinical results from 2 independent laboratories, expression levels of the HER3 ligand heregulin (HRG) were prospectively declared the predictive biomarker before data unblinding but after subject enrollment. An assay to measure HRG mRNA was developed and validated. Other biomarkers, such as epidermal growth factor receptor (EGFR) mutation status, were also evaluated in an exploratory fashion. The cutoff value for high vs. low HRG mRNA levels was set at the median delta threshold cycle. A maximum likelihood analysis was performed to evaluate the provisional cutoff. The relationship of HRG values to PFS hazard ratios (HRs) was assessed as a measure of internal validation. Additional NSCLC samples were analyzed to characterize HRG mRNA distribution. The subgroup of patients with high HRG mRNA levels ("HRG

  19. Immunohistochemical localization of epidermal growth factor in rat and man

    DEFF Research Database (Denmark)

    Poulsen, Steen Seier; Nexø, Ebba

    1986-01-01

    Epidermal growth factor (EGF) is a peptide which stimulates cell mitotic activity and differentiation, has a cytoprotective effect on the gastroduodenal mucosa, and inhibits gastric acid secretion. The immunohistochemical localization of EGF in the Brunner's glands and the submandibular glands is...... antisera against human urinary EGF worked in rat as well as man. EGF was found only in cells with an exocrine function.......Epidermal growth factor (EGF) is a peptide which stimulates cell mitotic activity and differentiation, has a cytoprotective effect on the gastroduodenal mucosa, and inhibits gastric acid secretion. The immunohistochemical localization of EGF in the Brunner's glands and the submandibular glands...... is well documented. The localization of EGF in other tissues is still unclarified. In the present study, the immunohistochemical localization of EGF in tissues from rat, man and a 20 week human fetus were investigated. In man and rat, immunoreaction was found in the submandibular glands, the serous glands...

  20. Endothelin B Receptors on Primary Chicken Müller Cells and the Human MIO-M1 Müller Cell Line Activate ERK Signaling via Transactivation of Epidermal Growth Factor Receptors.

    Directory of Open Access Journals (Sweden)

    Mohammad Harun-Or-Rashid

    Full Text Available Injury to the eye or retina triggers Müller cells, the major glia cell of the retina, to dedifferentiate and proliferate. In some species they attain retinal progenitor properties and have the capacity to generate new neurons. The epidermal growth factor receptor (EGFR system and extracellular signal-regulated kinase (ERK signaling are key regulators of these processes in Müller cells. The extracellular signals that modulate and control these processes are not fully understood. In this work we studied whether endothelin receptor signaling can activate EGFR and ERK signaling in Müller cells. Endothelin expression is robustly upregulated at retinal injury and endothelin receptors have been shown to transactivate EGFRs in other cell types. We analyzed the endothelin signaling system in chicken retina and cultured primary chicken Müller cells as well as the human Müller cell line MIO-M1. The Müller cells were stimulated with receptor agonists and treated with specific blockers to key enzymes in the signaling pathway or with siRNAs. We focused on endothelin receptor mediated transactivation of EGFRs by using western blot analysis, quantitative reverse transcriptase PCR and immunocytochemistry. The results showed that chicken Müller cells and the human Müller cell line MIO-M1 express endothelin receptor B. Stimulation by the endothelin receptor B agonist IRL1620 triggered phosphorylation of ERK1/2 and autophosphorylation of (Y1173 EGFR. The effects could be blocked by Src-kinase inhibitors (PP1, PP2, EGFR-inhibitor (AG1478, EGFR-siRNA and by inhibitors to extracellular matrix metalloproteinases (GM6001, consistent with a Src-kinase mediated endothelin receptor response that engage ligand-dependent and ligand-independent EGFR activation. Our data suggest a mechanism for how injury-induced endothelins, produced in the retina, may modulate the Müller cell responses by Src-mediated transactivation of EGFRs. The data give support to a view in

  1. Computer-assisted assessment of the Human Epidermal Growth Factor Receptor 2 immunohistochemical assay in imaged histologic sections using a membrane isolation algorithm and quantitative analysis of positive controls

    International Nuclear Information System (INIS)

    Hall, Bonnie H; Ianosi-Irimie, Monica; Javidian, Parisa; Chen, Wenjin; Ganesan, Shridar; Foran, David J

    2008-01-01

    Breast cancers that overexpress the human epidermal growth factor receptor 2 (HER2) are eligible for effective biologically targeted therapies, such as trastuzumab. However, accurately determining HER2 overexpression, especially in immunohistochemically equivocal cases, remains a challenge. Manual analysis of HER2 expression is dependent on the assessment of membrane staining as well as comparisons with positive controls. In spite of the strides that have been made to standardize the assessment process, intra- and inter-observer discrepancies in scoring is not uncommon. In this manuscript we describe a pathologist assisted, computer-based continuous scoring approach for increasing the precision and reproducibility of assessing imaged breast tissue specimens. Computer-assisted analysis on HER2 IHC is compared with manual scoring and fluorescence in situ hybridization results on a test set of 99 digitally imaged breast cancer cases enriched with equivocally scored (2+) cases. Image features are generated based on the staining profile of the positive control tissue and pixels delineated by a newly developed Membrane Isolation Algorithm. Evaluation of results was performed using Receiver Operator Characteristic (ROC) analysis. A computer-aided diagnostic approach has been developed using a membrane isolation algorithm and quantitative use of positive immunostaining controls. By incorporating internal positive controls into feature analysis a greater Area Under the Curve (AUC) in ROC analysis was achieved than feature analysis without positive controls. Evaluation of HER2 immunostaining that utilized membrane pixels, controls, and percent area stained showed significantly greater AUC than manual scoring, and significantly less false positive rate when used to evaluate immunohistochemically equivocal cases. It has been shown that by incorporating both a membrane isolation algorithm and analysis of known positive controls a computer-assisted diagnostic algorithm was

  2. Alterations of the genes involved in the PI3K and estrogen-receptor pathways influence outcome in human epidermal growth factor receptor 2-positive and hormone receptor-positive breast cancer patients treated with trastuzumab-containing neoadjuvant chemotherapy

    International Nuclear Information System (INIS)

    Takada, Mamoru; Miyazaki, Masaru; Sato-Otsubo, Aiko; Ogawa, Seishi; Kaneko, Yasuhiko; Higuchi, Toru; Tozuka, Katsunori; Takei, Hiroyuki; Haruta, Masayuki; Watanabe, Junko; Kasai, Fumio; Inoue, Kenichi; Kurosumi, Masafumi

    2013-01-01

    Chemotherapy with trastuzumab is widely used for patients with human epidermal growth factor receptor 2-positive (HER2+) breast cancer, but a significant number of patients with the tumor fail to respond, or relapse. The mechanisms of recurrence and biomarkers that indicate the response to the chemotherapy and outcome are not fully investigated. Genomic alterations were analyzed using single-nucleotide polymorphism arrays in 46 HER2 immunohistochemistry (IHC) 3+ or 2+/fluorescent in situ hybridization (FISH)+ breast cancers that were treated with neoadjuvant chemotherapy with paclitaxel, cyclophosphamid, epirubicin, fluorouracil, and trastuzumab. Patients were classified into two groups based on presence or absence of alterations of 65 cancer-associated genes, and the two groups were further classified into four groups based on genomic HER2 copy numbers or hormone receptor status (HR+/−). Pathological complete response (pCR) and relapse-free survival (RFS) rates were compared between any two of the groups. The pCR rate was 54% in 37 patients, and the RFS rate at 3 years was 72% (95% CI, 0.55-0.89) in 42 patients. The analysis disclosed 8 tumors with nonamplified HER2 and 38 tumors with HER2 amplification, indicating the presence of discordance in tumors diagnosed using current HER2 testing. The 8 patients showed more difficulty in achieving pCR (P=0.019), more frequent relapse (P=0.018), and more frequent alterations of genes in the PI3K pathway (P=0.009) than the patients with HER2 amplification. The alterations of the PI3K and estrogen receptor (ER) pathway genes generally indicated worse RFS rates. The prognostic significance of the alterations was shown in patients with a HR+ tumor, but not in patients with a HR- tumor when divided. Alterations of the PI3K and ER pathway genes found in patients with a HR+ tumor with poor outcome suggested that crosstalk between the two pathways may be involved in resistance to the current chemotherapy with trastuzumab. We

  3. Randomized Phase III Trial of Trastuzumab Plus Capecitabine With or Without Pertuzumab in Patients With Human Epidermal Growth Factor Receptor 2-Positive Metastatic Breast Cancer Who Experienced Disease Progression During or After Trastuzumab-Based Therapy.

    Science.gov (United States)

    Urruticoechea, Ander; Rizwanullah, Mohammed; Im, Seock-Ah; Ruiz, Antonio Carlos Sánchez; Láng, István; Tomasello, Gianluca; Douthwaite, Hannah; Badovinac Crnjevic, Tanja; Heeson, Sarah; Eng-Wong, Jennifer; Muñoz, Montserrat

    2017-09-10

    Purpose To assess the efficacy and safety of trastuzumab plus capecitabine with or without pertuzumab in patients with human epidermal growth factor receptor 2-positive metastatic breast cancer who experienced disease progression during or after trastuzumab-based therapy and received a prior taxane. Patients and Methods Patients were randomly assigned to arm A: trastuzumab 8 mg/kg → 6 mg/kg once every 3 weeks plus capecitabine 1,250 mg/m 2 twice a day (2 weeks on, 1 week off, every 3 weeks); or arm B: pertuzumab 840 mg → 420 mg once every 3 weeks plus trastuzumab at the same dose and schedule as arm A plus capecitabine 1,000 mg/m 2 on the same schedule as arm A. The primary end point was independent review facility-assessed progression-free survival (IRF PFS). Secondary end points included overall survival (OS) and safety. Hierarchical testing procedures were used to control type I error for statistical testing of IRF PFS, OS, and objective response rate. Results Randomly assigned (intent-to-treat) populations were 224 and 228 patients in arms A and B, respectively. Median IRF PFS at 28.6 and 25.3 months' median follow-up was 9.0 v 11.1 months (hazard ratio, 0.82; 95% CI, 0.65 to 1.02; P = .0731) and interim OS was 28.1 v 36.1 months (hazard ratio, 0.68; 95% CI, 0.51 to 0.90). The most common adverse events (all grades; incidence of ≥ 10% in either arm and ≥ 5% difference between arms) were hand-foot syndrome, nausea, and neutropenia in arm A, and diarrhea, rash, and nasopharyngitis in arm B. Conclusion The addition of pertuzumab to trastuzumab and capecitabine did not significantly improve IRF PFS. An 8-month increase in median OS to 36.1 months with pertuzumab was observed. Statistical significance for OS cannot be claimed because of the hierarchical testing of OS after the primary PFS end point; however, the magnitude of OS difference is in keeping with prior experience of pertuzumab in metastatic breast cancer. No new safety signals were identified.

  4. Translational Breast Cancer Research Consortium (TBCRC) 022: A Phase II Trial of Neratinib for Patients With Human Epidermal Growth Factor Receptor 2–Positive Breast Cancer and Brain Metastases

    Science.gov (United States)

    Gelman, Rebecca S.; Wefel, Jeffrey S.; Melisko, Michelle E.; Hess, Kenneth R.; Connolly, Roisin M.; Van Poznak, Catherine H.; Niravath, Polly A.; Puhalla, Shannon L.; Ibrahim, Nuhad; Blackwell, Kimberly L.; Moy, Beverly; Herold, Christina; Liu, Minetta C.; Lowe, Alarice; Agar, Nathalie Y.R.; Ryabin, Nicole; Farooq, Sarah; Lawler, Elizabeth; Rimawi, Mothaffar F.; Krop, Ian E.; Wolff, Antonio C.; Winer, Eric P.; Lin, Nancy U.

    2016-01-01

    Purpose Evidence-based treatments for metastatic, human epidermal growth factor receptor 2 (HER2)–positive breast cancer in the CNS are limited. Neratinib is an irreversible inhibitor of erbB1, HER2, and erbB4, with promising activity in HER2-positive breast cancer; however, its activity in the CNS is unknown. We evaluated the efficacy of treatment with neratinib in patients with HER2-positive breast cancer brain metastases in a multicenter, phase II open-label trial. Patients and Methods Eligible patients were those with HER2-positive brain metastases (≥ 1 cm in longest dimension) who experienced progression in the CNS after one or more line of CNS-directed therapy, such as whole-brain radiotherapy, stereotactic radiosurgery, and/or surgical resection. Patients received neratinib 240 mg orally once per day, and tumors were assessed every two cycles. The primary endpoint was composite CNS objective response rate (ORR), requiring all of the following: ≥50% reduction in volumetric sum of target CNS lesions and no progression of non-target lesions, new lesions, escalating corticosteroids, progressive neurologic signs/symptoms, or non-CNS progression—the threshold for success was five of 40 responders. Results Forty patients were enrolled between February 2012 and June 2013; 78% of patients had previous whole-brain radiotherapy. Three women achieved a partial response (CNS objective response rate, 8%; 95% CI, 2% to 22%). The median number of cycles received was two (range, one to seven cycles), with a median progression-free survival of 1.9 months. Five women received six or more cycles. The most common grade ≥ 3 event was diarrhea (occurring in 21% of patients taking prespecified loperamide prophylaxis and 28% of those without prophylaxis). Patients in the study experienced a decreased quality of life over time. Conclusion Although neratinib had low activity and did not meet our threshold for success, 12.5% of patients received six or more cycles. Studies

  5. Computer-assisted assessment of the Human Epidermal Growth Factor Receptor 2 immunohistochemical assay in imaged histologic sections using a membrane isolation algorithm and quantitative analysis of positive controls

    Directory of Open Access Journals (Sweden)

    Ianosi-Irimie Monica

    2008-06-01

    Full Text Available Abstract Background Breast cancers that overexpress the human epidermal growth factor receptor 2 (HER2 are eligible for effective biologically targeted therapies, such as trastuzumab. However, accurately determining HER2 overexpression, especially in immunohistochemically equivocal cases, remains a challenge. Manual analysis of HER2 expression is dependent on the assessment of membrane staining as well as comparisons with positive controls. In spite of the strides that have been made to standardize the assessment process, intra- and inter-observer discrepancies in scoring is not uncommon. In this manuscript we describe a pathologist assisted, computer-based continuous scoring approach for increasing the precision and reproducibility of assessing imaged breast tissue specimens. Methods Computer-assisted analysis on HER2 IHC is compared with manual scoring and fluorescence in situ hybridization results on a test set of 99 digitally imaged breast cancer cases enriched with equivocally scored (2+ cases. Image features are generated based on the staining profile of the positive control tissue and pixels delineated by a newly developed Membrane Isolation Algorithm. Evaluation of results was performed using Receiver Operator Characteristic (ROC analysis. Results A computer-aided diagnostic approach has been developed using a membrane isolation algorithm and quantitative use of positive immunostaining controls. By incorporating internal positive controls into feature analysis a greater Area Under the Curve (AUC in ROC analysis was achieved than feature analysis without positive controls. Evaluation of HER2 immunostaining that utilized membrane pixels, controls, and percent area stained showed significantly greater AUC than manual scoring, and significantly less false positive rate when used to evaluate immunohistochemically equivocal cases. Conclusion It has been shown that by incorporating both a membrane isolation algorithm and analysis of known

  6. Human epidermal growth factor receptor 2 assessment in a case-control study: comparison of fluorescence in situ hybridization and quantitative reverse transcription polymerase chain reaction performed by central laboratories.

    Science.gov (United States)

    Baehner, Frederick L; Achacoso, Ninah; Maddala, Tara; Shak, Steve; Quesenberry, Charles P; Goldstein, Lynn C; Gown, Allen M; Habel, Laurel A

    2010-10-01

    The optimal method to assess human epidermal growth factor receptor 2 (HER2) status remains highly controversial. Before reporting patient HER2 results, American Society of Clinical Oncology (ASCO)/College of American Pathologists (CAP) guidelines mandate that laboratories demonstrate ≥ 95% concordance to another approved laboratory or methodology. Here, we compare central laboratory HER2 assessed by fluorescence in situ hybridization (FISH) and quantitative reverse transcriptase polymerase chain reaction (RT-PCR) using Oncotype DX in lymph node-negative, chemotherapy-untreated patients from a large Kaiser Permanente case-control study. Breast cancer specimens from the Kaiser-Genomic Health study were examined. Central FISH assessment of HER2 amplification and polysomy 17 was conducted by PhenoPath Laboratories (ratios > 2.2, 1.8 to 2.2, and < 1.8 define HER2 positive, HER2 equivocal, and HER2 negative, respectively). HER2 expression by RT-PCR was conducted using Oncotype DX by Genomic Health (normalized expression units ≥ 11.5, 10.7 to < 11.5, and < 10.7 define HER2 positive, HER2 equivocal, and HER2 negative, respectively). Concordance analyses followed ASCO/CAP guidelines. HER2 concordance by central FISH and central RT-PCR was 97% (95% CI, 96% to 99%). Twelve percent (67 of 568 patients) and 11% (60 of 568 patients) of patients were HER2 positive by RT-PCR and FISH, respectively. HER2-positive patients had increased odds of dying from breast cancer compared with HER2-negative patients. Polysomy 17 was demonstrated in 12.5% of all patients and 33% of FISH-positive patients. Nineteen of 20 FISH-positive patients with polysomy 17 were also RT-PCR HER2 positive. Although not statistically significantly different, HER2-positive/polysomy 17 patients tended to have the worst prognosis, followed by HER2-positive/eusomic, HER2-negative/polysomy 17, and HER2-negative/eusomic patients. There is a high degree of concordance between central FISH and quantitative RT

  7. A Retrospective Survival Analysis of Anatomic and Prognostic Stage Group Based on the American Joint Committee on Cancer 8th Edition Cancer Staging Manual in Luminal B Human Epidermal Growth Factor Receptor 2-negative Breast Cancer.

    Science.gov (United States)

    Xu, Ling; Li, Jiang-Hong; Ye, Jing-Ming; Duan, Xue-Ning; Cheng, Yuan-Jia; Xin, Ling; Liu, Qian; Zhou, Bin; Liu, Yin-Hua

    2017-08-20

    Current understanding of tumor biology suggests that breast cancer is a group of diseases with different intrinsic molecular subtypes. Anatomic staging system alone is insufficient to provide future outcome information. The American Joint Committee on Cancer (AJCC) expert panel updated the 8th edition of the staging manual with prognostic stage groups by incorporating biomarkers into the anatomic stage groups. In this study, we retrospectively analyzed the data from our center in China using the anatomic and prognostic staging system based on the AJCC 8th edition staging manual. We reviewed the data from January 2008 to December 2014 for cases with Luminal B Human Epidermal Growth Factor Receptor 2 (HER2)-negative breast cancer in our center. All cases were restaged using the AJCC 8th edition anatomic and prognostic staging system. The Kaplan-Meier method and log-rank test were used to compare the survival differences between different subgroups. SPSS software version 19.0 (IBM Corp., Armonk, NY, USA) was used for the statistical analyses. This study consisted of 796 patients with Luminal B HER-negative breast cancer. The 5-year disease-free survival (DFS) of 769 Stage I-III patients was 89.7%, and the 5-year overall survival (OS) of all 796 patients was 91.7%. Both 5-year DFS and 5-year OS were significantly different in the different anatomic and prognostic stage groups. There were 372 cases (46.7%) assigned to a different group. The prognostic Stage II and III patients restaged from anatomic Stage III had significant differences in 5-year DFS (χ2 = 11.319, P= 0.001) and 5-year OS (χ2 = 5.225, P= 0.022). In addition, cases restaged as prognostic Stage I, II, or III from the anatomic Stage II group had statistically significant differences in 5-year DFS (χ2 = 6.510, P= 0.039) but no significant differences in 5-year OS (χ2 = 5.087, P= 0.079). However, the restaged prognostic Stage I and II cases from anatomic Stage I had no statistically significant

  8. Benefit of adjuvant chemotherapy with or without trastuzumab in pT1ab node-negative human epidermal growth factor receptor 2-positive breast carcinomas: results of a national multi-institutional study.

    Science.gov (United States)

    de Nonneville, Alexandre; Gonçalves, Anthony; Zemmour, Christophe; Classe, Jean M; Cohen, Monique; Lambaudie, Eric; Reyal, Fabien; Scherer, Christophe; Muracciole, Xavier; Colombo, Pierre E; Giard, Sylvia; Rouzier, Roman; Villet, Richard; Chopin, Nicolas; Darai, Emile; Garbay, Jean R; Gimbergues, Pierre; Sabiani, Laura; Coutant, Charles; Sabatier, Renaud; Bertucci, François; Boher, Jean M; Houvenaeghel, Gilles

    2017-04-01

    Benefit of adjuvant trastuzumab-based chemotherapy for node-positive and/or >1 cm human epidermal growth factor receptor 2-positive (HER2+) breast carcinomas has been clearly demonstrated in randomized clinical trials. Yet, evidence that adjuvant chemotherapy with or without trastuzumab is effective in pT1abN0 HER2+ tumors is still limited. The primary objective of this study was to investigate the impact of adjuvant chemotherapy ± trastuzumab on outcome in this subpopulation. A total of 356 cases of pT1abN0M0 HER2 + breast cancers were retrospectively identified from a large cohort of 22,334 patients, including 1248 HER2+ patients who underwent primary surgery at 17 French centers, between December 1994 and January 2014. The primary end point was disease-free survival (DFS). A multivariate Cox model was built, including adjuvant chemotherapy, tumor size, hormone receptor status, and Scarff Bloom Richardson (SBR) grade. A total of 138 cases (39%) were treated with trastuzumab-based chemotherapy, 29 (8%) with chemotherapy alone, and 189 (53%) received neither trastuzumab nor chemotherapy. Adjuvant chemotherapy ± trastuzumab was associated with a significant DFS benefit (3-year 99 vs. 90%, and 5-year 96 vs. 84%, Hazard ratio, HR 0.26 [0.10-0.67]; p = 0.003, logrank test) which was maintained in multivariate analysis (HR 0.19 [0.07-0.52]; p = 0.001). Metastasis-free survival was also increased (HR 0.25 [0.07-0.86]; p = 0.018, logrank test) at 3-year (99 vs. 95%) and 5-year (98 vs. 89%) censoring. Exploratory subgroup analysis found DFS benefit to be significant in hormone receptor-negative, hormone receptor-positive, and pT1b tumors, but not in pT1a tumors. Adjuvant chemotherapy ± trastuzumab is associated with a significantly reduced risk of recurrence in subcentimeter node-negative HER2+ breast cancers. Most of the benefit may be driven by pT1b tumors.

  9. The SystHERs registry: an observational cohort study of treatment patterns and outcomes in patients with human epidermal growth factor receptor 2–positive metastatic breast cancer

    International Nuclear Information System (INIS)

    Tripathy, Debu; Lai, Catherine; Masaquel, Anthony; Hurvitz, Sara; Rugo, Hope S; Kaufman, Peter A; Swain, Sandra; O’Shaughnessy, Joyce; Jahanzeb, Mohammad; Mason, Ginny; Beattie, Mary; Yoo, Bongin

    2014-01-01

    Amplification of the human epidermal growth factor receptor 2 (HER2) gene occurs in approximately 20% of invasive breast cancer cases and is associated with a more aggressive disease course than HER2-negative breast cancer. HER2-targeted therapies have altered the natural history of HER2-positive breast cancer, a trend that will likely further improve with the recent approval of new agents. A prospective, observational cohort study was designed and initiated to provide real-world insights into current treatment patterns, long-term survival, and patients’ experiences with initial and subsequent treatments for HER2-positive metastatic breast cancer (MBC). The Systematic Therapies for HER2-positive Metastatic Breast Cancer Study (SystHERs) is a US-based prospective observational cohort study enrolling patients ≥18 years of age with recently diagnosed HER2-positive MBC not previously treated with systemic therapy in the metastatic setting. The primary objective of the study is to identify treatment patterns and clinical outcomes in recently diagnosed patients in a variety of practice settings. Secondary objectives include comparative efficacy, safety, and patient-reported outcomes (PROs). Healthcare resource utilization is an exploratory end point. Tumor tissue and blood sample collection is optional. The SystHERs registry will enroll approximately 1000 patients over a 3-year period, after which the study will continue for ≥5 years, allowing for a maximum follow-up of 8 years. The treating physician will determine all care and the frequency of visits. PRO measures will be completed at study enrollment and every 90 days. Clinical data will be abstracted quarterly from patient records. The first patient was enrolled in June 2012, and preliminary descriptive data based on 25% to 30% of the final study population are expected at the end of 2013, and as of April 25, 2014, 386 patients are enrolled. SystHERs is expected to provide in-depth data on demographic

  10. Epidermal growth factor receptor expression in urinary bladder cancer

    Directory of Open Access Journals (Sweden)

    Dayalu S.L. Naik

    2011-01-01

    Full Text Available Objective : To evaluate the expression pattern of epidermal growth factor receptor (EGFR in urinary bladder cancer and its association with human epidermal growth factor receptor 2 (HER2, epidermal growth factor (EGF, interleukin-6 (IL-6, and high risk human papilloma virus (HPV types 16 and 18. Materials and Methods : Thirty cases of urothelial carcinoma were analyzed. EGFR, HER2, EGF, and IL-6 expressions in the tissue were evaluated by immunohistochemical staining. For HPV, DNA from tissue samples was extracted and detection of HPV was done by PCR technique. Furthermore, evaluation of different intracellular molecules associated with EGFR signaling pathways was performed by the western blot method using lysates from various cells and tissues. Results : In this study, the frequencies of immunopositivity for EGFR, HER2, EGF, and IL-6 were 23%, 60%, 47%, and 80%, respectively. No cases were positive for HPV-18, whereas HPV-16 was detected in 10% cases. Overall, expression of EGFR did not show any statistically significant association with the studied parameters. However, among male patients, a significant association was found only between EGFR and HER2. Conclusions : Overexpression of EGFR and/or HER2, two important members of the same family of growth factor receptors, was observed in a considerable proportion of cases. Precise knowledge in this subject would be helpful to formulate a rational treatment strategy in patients with urinary bladder cancer.

  11. An Epidermal Biosensor for Carcinoembryonic Antigen

    National Research Council Canada - National Science Library

    Schwartz, Pauline

    2001-01-01

    ...). An epidermal biosensor is a new approach for the early continuous, in vivo detection of the onset of disease by the using genetically modified skin cells to respond to molecules secreted by tumor cells...

  12. An Epidermal Biosensor for Carcinoembryonic Antigen

    National Research Council Canada - National Science Library

    Schwartz, Pauline

    2003-01-01

    ...) An epidermal biosensor was conceived as a new approach for the early continuous, in vivo detection of the onset of disease by the using genetically modified skin cells to respond to molecules secreted by tumor cells...

  13. Epidermal growth in the bottlenose dolphin, Tursiops truncatus

    International Nuclear Information System (INIS)

    Hicks, B.D.; St Aubin, D.J.; Geraci, J.R.; Brown, W.R.

    1985-01-01

    Epidermal growth in two mature female bottlenose dolphins, Tursiops truncatus, was investigated by following the movement of a cohort of tritiated thymidine-labeled epidermal cells for 59 days. The majority of the cells migrated in a cluster which was estimated to reach the skin surface in 73 days. The authors calculate that the outermost cell layer is sloughed 12 times per day. Turnover time and sloughing rate are estimated to be 1.7 times longer and 8.5 times faster than the respective values for epidermal cell kinetics in humans. This apparent inconsistency of slow transit time and rapid sloughing rate is reconciled by the convoluted structure of the stratum germinativum in the dolphin which results in a ratio of germinatival to superficial cells of 876:1. The stratum germinativum of dolphin epidermis appears to lack morphologically distinct, spatially segregated subpopulations of anchoring and stem cells. Dolphin epidermis has a large capacity for cell population, relatively long turnover time, and rapid sloughing rate. The adaptive advantages of these characteristics are discussed

  14. Epidermal growth in the bottlenose dolphin, Tursiops truncatus

    Energy Technology Data Exchange (ETDEWEB)

    Hicks, B.D.; St. Aubin, D.J.; Geraci, J.R.; Brown, W.R.

    1985-07-01

    Epidermal growth in two mature female bottlenose dolphins, Tursiops truncatus, was investigated by following the movement of a cohort of tritiated thymidine-labeled epidermal cells for 59 days. The majority of the cells migrated in a cluster which was estimated to reach the skin surface in 73 days. The authors calculate that the outermost cell layer is sloughed 12 times per day. Turnover time and sloughing rate are estimated to be 1.7 times longer and 8.5 times faster than the respective values for epidermal cell kinetics in humans. This apparent inconsistency of slow transit time and rapid sloughing rate is reconciled by the convoluted structure of the stratum germinativum in the dolphin which results in a ratio of germinatival to superficial cells of 876:1. The stratum germinativum of dolphin epidermis appears to lack morphologically distinct, spatially segregated subpopulations of anchoring and stem cells. Dolphin epidermis has a large capacity for cell population, relatively long turnover time, and rapid sloughing rate. The adaptive advantages of these characteristics are discussed.

  15. Epidermal growth factor in the rat prostate

    DEFF Research Database (Denmark)

    Tørring, Niels; Jørgensen, P E; Poulsen, Steen Seier

    1998-01-01

    Epidermal growth factor (EGF) induces proliferation in prostate epithelial and stromal cells in primary culture. This investigation was set up to characterize the time and spatial expression of EGF in the rat prostate.......Epidermal growth factor (EGF) induces proliferation in prostate epithelial and stromal cells in primary culture. This investigation was set up to characterize the time and spatial expression of EGF in the rat prostate....

  16. Foliar Epidermal Studies of Plants in Euphorbiaceae

    Directory of Open Access Journals (Sweden)

    H. A. Thakur

    2014-03-01

    Full Text Available This paper describes foliar epidermal structure in 17 species belonging to 17 genera of the family Euphoprbiaceae. Anomocytic stomata is predominant, rarely they are anisocytic, paracytic on the same foliar surface with different combinations. Leaves are hypostomatic and rarely amphistomatic. The foliar surface is smooth, rarely striated. The foliar epidermal cell walls are straight or undulate. Distribution of stomata, stomatal index, stomatal frequency, stomatal size and other cell wall contours are described in detail.

  17. Epidermal Inclusion Cysts of The Breast

    Directory of Open Access Journals (Sweden)

    Amir R. Motabar

    2009-02-01

    Full Text Available Epidermal inclusion cysts are uncommon in the breast, but the consequences can besevere when these cysts occur in the breast parenchyma. Here,we report two suchcases. The patient in case 1 was an 37-year-old woman with a 3-cm palpable mass inthe right breast. Mammography revealed a round and smoothly outlined mass, whichindicated a benign tumor, and sonography showed an irregularly shaped and heterogeneoushypoechoic mass, fibroadenoma was suspected on the basis of clinical andimage findings, but excisional biopsy revealed an epidermal inclusion cyst. The patientin case 2 was a 50-year-old woman with a 2.5-cm lesion in the left breast. Mammographyrevealed a round, dense, smoothly outlined mass, and sonography showeda well-defined, central hyperechoic mass. . Breast cancer was suspected on the basisof the sonographic findings and the age of the patient, but the resected specimen revealedan epidermal inclusion cyst. Although epidermal inclusion cysts are benign,occasionally they may play a role in the origin of squamous carcinoma of the breast. .Mammographic and sonographic features of an epidermal cyst may mimic a malignantlesion. Malignant change appears to occur more frequently in epidermal inclusioncysts in the mammary gland, compared to common epidermal inclusion cysts,and this may be associated with origination of mammary epidermal inclusion cystsfrom squamous metaplasia of the mammary duct epithelium.Epidermmoid inclusion cyst of the breast is potentially serious, although such cystsare rare, and differentiation from a malignant or benign breast tumor is required. Excisionis probably the most appropriate treatment, and can eliminate the possible riskof malignant transformation.

  18. A review of toxic epidermal necrolysis management in Japan

    Directory of Open Access Journals (Sweden)

    Yuri Kinoshita

    2017-01-01

    Full Text Available Toxic epidermal necrolysis (TEN is a severe adverse drug reaction characterized by necrosis of the epidermis. Its incidence is approximately 1 per million a year and average mortality rate is high at 25–50%. TEN has a flu-like prodrome, followed by atypical, targetoid erythematous or purpuric macules on the skin. These macules coalesce to form flaccid blisters that slough off as areas of epidermal necrosis. Drugs such as allopurinol, sulfonamides, and carbamazepine are the most common causes. The human leukocyte antigen (HLA-B*15:02 in Asians being administered carbamazepine and the HLA-B*58:01 antigen in patients of all ethnicities being administered allopurinol are known to be high-risk factors. Rapid diagnosis, discontinuation of the causative drug, and supportive treatment are essential for better prognosis and improvement of sequelae. Till now, systemic corticosteroids and intravenous immunoglobulins have been used as the most common active interventions; however, no gold standard has been established. In Japan, physicians follow a unique diagnostic criteria and treatment guideline to improve the diagnosis rate and streamline treatments. This may be a contributing factor for the lower mortality rate (14.3%. The efficacy of systemic corticosteroids, immunoglobulins, and plasmapheresis may have been beneficial as well. In Japan, TEN is defined as an epidermal detachment of over 10% of the body surface area (BSA, while the globally accepted definition established by Bastuji-Garin describes it as an epidermal detachment of over 30% of the BSA. In Japanese individuals, HLA-A*02:06, HLA-A*02:07, HLA-A*31:01 and HLA-B*51:01 may be linked to higher risks of TEN.

  19. Commonly Employed African Neonatal Skin Care Products Compromise Epidermal Function in Mice.

    Science.gov (United States)

    Man, Mao-Qiang; Sun, Richard; Man, George; Lee, Dale; Hill, Zelee; Elias, Peter M

    2016-09-01

    Neonatal mortality is much higher in the developing world than in developed countries. Infections are a major cause of neonatal death, particularly in preterm infants, in whom defective epidermal permeability barrier function facilitates transcutaneous pathogen invasion. The objective was to determine whether neonatal skin care products commonly used in Africa benefit or compromise epidermal functions in murine skin. After twice-daily treatment of 6- to 8-week-old hairless mice with each skin care product for 3 days, epidermal permeability barrier function, skin surface pH, stratum corneum hydration, and barrier recovery were measured using a multiprobe adapter system physiology monitor. For products showing some benefits in these initial tests, the epidermal permeability barrier homeostasis was assessed 1 and 5 hours after a single application to acutely disrupted skin. All of the skin care products compromised basal permeability barrier function and barrier repair kinetics. Moreover, after 3 days of treatment, most of the products also reduced stratum corneum hydration while elevating skin surface pH to abnormal levels. Some neonatal skin care products that are widely used in Africa perturb important epidermal functions, including permeability barrier homeostasis in mice. Should these products have similar effects on newborn human skin, they could cause a defective epidermal permeability barrier, which can increase body fluid loss, impair thermoregulation, and contribute to the high rates of neonatal morbidity and mortality seen in Africa. Accordingly, alternative products that enhance permeability barrier function should be identified, particularly for use in preterm infants. © 2016 Wiley Periodicals, Inc.

  20. Simultaneous absorption of vitamins C and E from topical microemulsions using reconstructed human epidermis as a skin model.

    Science.gov (United States)

    Rozman, Branka; Gasperlin, Mirjana; Tinois-Tessoneaud, Estelle; Pirot, Fabrice; Falson, Francoise

    2009-05-01

    Antioxidants provide the mainstay for skin protection against free radical damage. The structure of microemulsions (ME), colloidal thermodynamically stable dispersions of water, oil and surfactant, allows the incorporation of both lipophilic (vitamin E) and hydrophilic (vitamin C) antioxidants in the same system. The objective of this work was to investigate the potential of non-thickened (o/w, w/o and gel-like) and thickened (with colloidal silica) ME as carriers for the two vitamins using reconstructed human epidermis (RHE). The amounts of these vitamins accumulated in and permeated across the RHE were determined, together with factors affecting skin deposition and permeation. Notable differences were observed between formulations. The absorption of vitamins C and E in RHE layers was in general enhanced by ME compared to solutions. The incorporation of vitamins in the outer phase of ME resulted in greater absorption than that when vitamins were in the inner phase. The location of the antioxidants in the ME and affinity for the vehicle appear to be crucial in the case of non-thickened ME. Addition of thickener enhanced the deposition of vitamins E and C in the RHE. By varying the composition of ME, RHE absorption of the two vitamins can be significantly modulated.

  1. Hybrid Enhanced Epidermal SpaceSuit Design Approaches

    Science.gov (United States)

    Jessup, Joseph M.

    A Space suit that does not rely on gas pressurization is a multi-faceted problem that requires major stability controls to be incorporated during design and construction. The concept of Hybrid Epidermal Enhancement space suit integrates evolved human anthropomorphic and physiological adaptations into its functionality, using commercially available bio-medical technologies to address shortcomings of conventional gas pressure suits, and the impracticalities of MCP suits. The prototype HEE Space Suit explored integumentary homeostasis, thermal control and mobility using advanced bio-medical materials technology and construction concepts. The goal was a space suit that functions as an enhanced, multi-functional bio-mimic of the human epidermal layer that works in attunement with the wearer rather than as a separate system. In addressing human physiological requirements for design and construction of the HEE suit, testing regimes were devised and integrated into the prototype which was then subject to a series of detailed tests using both anatomical reproduction methods and human subject.

  2. Human endometrial milk fat globule-epidermal growth factor 8 (MFGE8) is up regulated by estradiol at the transcriptional level, and its secretion via microvesicles is stimulated by human chorionic gonadotropin (hCG)

    KAUST Repository

    Sarhan, Abbaa

    2013-10-17

    Objective: We have recently showed that MFGE8, a novel epithelial cell protein in the human endometrium, upregulated during the window of implantation. We hypothesized that MFGE8 may act as a key modulator of endometrial remodeling and trophoblast invasion. The aims of this study were (i) to investigate the in vitro regulation of human endometrial epithelial cells MFGE8 transcription, translation, and secretion by sex steroids and hCG; and (ii) to examine the possibility of MFGE8 secretion via microvesicles. Design: Experimental in vitro study using Ishikawa cells. Setting: University center. Interventions: Treatment with estradiol (E2), progesterone (P4), and human chorionic gonatropin (hCG). Main outcome measures: MFGE8 mRNA and protein expression, and identification of secreted microvesicles by mass spectrometry (MS) and immunoblotting. Results: E2, but not P4 or hCG, significantly upregulated MFGE8 mRNA expression. hCG significantly increased MFGE8 secretion. Microvesicels obtained after ultracentrifugation were visualized with atomic force microscopy ranging from ~100 to 200 nm. In addition to the expected 46 kD protein, the microvesicles contained a second form of secreted MFGE8 measuring ~30 kD which was confirmed by MS. Conclusions: We demonstrated (i) dual effects of E2 and hCG on the regulation of MFGE8, and (ii) MFGE8 protein secretion in association with microvesicles. MFGE8 has the potential to modulate endometrial function and implantation via exocrine and/ or paracrine-autocrine effects. To the best of our knowledge, this is the first demonstration of microvesicular secretion of any regulatory protein by endometrial epithelial cells, providing initial evidence suggestive of microvesicular participation in cellular trafficking information in the non-pregnant and pregnant endometrium.

  3. Microneedle fractional radiofrequency increases epidermal hyaluronan and reverses age-related epidermal dysfunction.

    Science.gov (United States)

    Lee, Hee Jung; Seo, Seong Rak; Yoon, Moon Soo; Song, Ji-Ye; Lee, Eun Young; Lee, Sang Eun

    2016-02-01

    Skin aging results in physiological alterations in keratinocyte activities and epidermal function, as well as dermal changes. Yet, the cellular and molecular mechanisms that cause epidermal dysfunction during skin aging are not well understood. Recently, the role of epidermal hyaluronan (HA) as an active regulator of dynamic cellular processes is getting attention and alterations in HA metabolism are thought to be important in age-related epidermal dysfunction. Microneedle fractional radiofrequency (RF) has shown effects for improving cutaneous aging. However, little is known about the effects of fractional RF on the epidermal HA and epidermal function. We investigated the effect of microneedle fractional RF on the expression of epidermal HA in young and aged mice epidermis. We performed fractional RF on the dorsal skin of 30 8-week-old (young) hairless mice and 15 47-week-old (aged) C57BL/6J mice. Skin samples were collected on day 1, 3, and 7. HA content was measured by ELISA. Gene expressions of CD 44, HABP4, and HAS3 were measured using real time RT-PCR. Immunohistochemistry for detection of HA, CD44, PCNA, and filaggrin were performed. HA content and the mRNA levels of HABP4, CD44, and HAS3 were upregulated in the epidermis of both young and aged mice after microneedle fractional RF treatment. The expression was increased from day 1 after treatment and increased expression persisted on day 7. Fractional RF treatment significantly increased PCNA and filaggrin expression only in the aged mice skin. Microneedle fractional RF increased epidermal HA and CD44 expression in both young and aged mice and reversed age-related epidermal dysfunction especially in aged mice, suggesting a new mechanism involved in the skin rejuvenation effect of microneedle fractional RF. © 2015 Wiley Periodicals, Inc.

  4. Genetic and pharmacological analysis identifies a physiological role for the AHR in epidermal differentiation

    NARCIS (Netherlands)

    Bogaard, E.H. van den; Podolsky, M.A.; Smits, J.P.H.; Cui, X.; John, C.; Gowda, K.; Desai, D.; Amin, S.G.; Schalkwijk, J.; Perdew, G.H.; Glick, A.B.

    2015-01-01

    Stimulation of the aryl hydrocarbon receptor (AHR) by xenobiotics is known to affect epidermal differentiation and skin barrier formation. The physiological role of endogenous AHR signaling in keratinocyte differentiation is not known. We used murine and human skin models to address the hypothesis

  5. Possible role of epidermal keratinocytes in the construction of acupuncture meridians.

    Science.gov (United States)

    Denda, Mitsuhiro; Tsutsumi, Moe

    2014-04-01

    Acupuncture meridians consist of a network of acupuncture points on the skin, stimulation of which is well established to have a variety of physiological effects. We have previously demonstrated that epidermal keratinocytes contain multiple sensory systems for temperature, mechanical stimuli, electric potentials and other stimuli. These sensory systems generate changes in the calcium-ion concentration in the epidermis, so epidermal keratinocytes can generate spatially-localized electro-physiological patterns in the skin. We have previously demonstrated signaling between epidermal keratinocytes and peripheral nerve systems. Therefore, stimuli sensed by epidermal keratinocytes might be transferred to the unmyelinated nerve fibers that are known to exist in the epidermis and, thence, to the spinal cord and brain. We propose that epidermal keratinocytes form an information-gathering network in the skin and that this network plays a key role in whole-body homeostasis in response to the changing environment. We also hypothesize that this network corresponds to the acupuncture meridians. As supporting examples, we present some striking calcium propagation patterns observed in cultured human keratinocytes after adenosine-triphosphate (ATP) stimulation. These results support the ideas that keratinocytes can generate spatially-restricted signaling patterns after environmental stimulation and that the cultures might be in-vitro models of meridians as an information-gathering network in skin. Copyright © 2014. Published by Elsevier B.V.

  6. Ultrathin epidermal strain sensor based on an elastomer nanosheet with an inkjet-printed conductive polymer

    Science.gov (United States)

    Tetsu, Yuma; Yamagishi, Kento; Kato, Akira; Matsumoto, Yuya; Tsukune, Mariko; Kobayashi, Yo; Fujie, Masakatsu G.; Takeoka, Shinji; Fujie, Toshinori

    2017-08-01

    To minimize the interference that skin-contact strain sensors cause natural skin deformation, physical conformability to the epidermal structure is critical. Here, we developed an ultrathin strain sensor made from poly(3,4-ethylenedioxythiophene):poly(styrene sulfonate) (PEDOT:PSS) inkjet-printed on a polystyrene-polybutadiene-polystyrene (SBS) nanosheet. The sensor, whose total thickness and gauge factor were ˜1 µm and 0.73 ± 0.10, respectively, deeply conformed to the epidermal structure and successfully detected the small skin strain (˜2%) while interfering minimally with the natural deformation of the skin. Such an epidermal strain sensor will open a new avenue for precisely detecting the motion of human skin and artificial soft-robotic skin.

  7. EPIDERMAL MORPHOLOGY OF WEST AFRICAN OKRA ...

    African Journals Online (AJOL)

    Administrator

    stem peels were obtained from a slight cut on the tenth internodes. Peels from fruit ... xia l su rfa ce. A b a xia l su rfa ce. Adaxial surface. Abaxial surface. L e n g th. (µ m. ) ..... Variations in epidermal cell shape of both adaxial and abaxial surfaces ...

  8. FOLIAR EPIDERMAL AND PHYTOCHEMICAL STUDIES OF THE ...

    African Journals Online (AJOL)

    Administrator

    alkaloid, saponin, inulin, cellulose, tannin and lignin; Eragrostis tremula tested negative for lignin and positive for cellulose, saponin and alkaloids while Axonopus compressus tested negative for lignin, but positive for alkaloid, saponin, inulin, cellulose and tannin respectively. Leaf epidermal studies help to determine ...

  9. Stevens Johnsons syndrom og toksisk epidermal nekrolyse

    DEFF Research Database (Denmark)

    Kaur-Knudsen, Diljit; Zachariae, Claus; Thomsen, Simon Francis

    2013-01-01

    Stevens-Johnson syndrome and toxic epidermal necrolysis are acute mucocutaneous diseases primarily due to drug intake. The diseases are characterised by the separation of epidermis from dermis which can be life-threatening. Mortality is often caused by sepsis and multiple organ failure. The most...

  10. Toxic epidermal necrolysis and Stevens-Johnson syndrome

    Directory of Open Access Journals (Sweden)

    French Lars E

    2010-12-01

    Full Text Available Abstract Toxic epidermal necrolysis (TEN and Stevens Johnson Syndrome (SJS are severe adverse cutaneous drug reactions that predominantly involve the skin and mucous membranes. Both are rare, with TEN and SJS affecting approximately 1or 2/1,000,000 annually, and are considered medical emergencies as they are potentially fatal. They are characterized by mucocutaneous tenderness and typically hemorrhagic erosions, erythema and more or less severe epidermal detachment presenting as blisters and areas of denuded skin. Currently, TEN and SJS are considered to be two ends of a spectrum of severe epidermolytic adverse cutaneous drug reactions, differing only by their extent of skin detachment. Drugs are assumed or identified as the main cause of SJS/TEN in most cases, but Mycoplasma pneumoniae and Herpes simplex virus infections are well documented causes alongside rare cases in which the aetiology remains unknown. Several drugs are at "high" risk of inducing TEN/SJS including: Allopurinol, Trimethoprim-sulfamethoxazole and other sulfonamide-antibiotics, aminopenicillins, cephalosporins, quinolones, carbamazepine, phenytoin, phenobarbital and NSAID's of the oxicam-type. Genetic susceptibility to SJS and TEN is likely as exemplified by the strong association observed in Han Chinese between a genetic marker, the human leukocyte antigen HLA-B*1502, and SJS induced by carbamazepine. Diagnosis relies mainly on clinical signs together with the histological analysis of a skin biopsy showing typical full-thickness epidermal necrolysis due to extensive keratinocyte apoptosis. Differential diagnosis includes linear IgA dermatosis and paraneoplastic pemphigus, pemphigus vulgaris and bullous pemphigoid, acute generalized exanthematous pustulosis (AGEP, disseminated fixed bullous drug eruption and staphyloccocal scalded skin syndrome (SSSS. Due to the high risk of mortality, management of patients with SJS/TEN requires rapid diagnosis, evaluation of the prognosis

  11. Epidermal stem cells response to radiative genotoxic stress

    International Nuclear Information System (INIS)

    Marie, Melanie

    2013-01-01

    Human skin is the first organ exposed to various environmental stresses, which requires the development by skin stem cells of specific mechanisms to protect themselves and to ensure tissue homeostasis. As stem cells are responsible for the maintenance of epidermis during individual lifetime, the preservation of genomic integrity in these cells is essential. My PhD aimed at exploring the mechanisms set up by epidermal stem cells in order to protect themselves from two genotoxic stresses, ionizing radiation (Gamma Rays) and ultraviolet radiation (UVB). To begin my PhD, I have taken part of the demonstration of protective mechanisms used by keratinocyte stem cells after ionizing radiation. It has been shown that these cells are able to rapidly repair most types of radiation-induced DNA damage. Furthermore, we demonstrated that this repair is activated by the fibroblast growth factor 2 (FGF2). In order to know if this protective mechanism is also operating in cutaneous carcinoma stem cells, we investigated the response to gamma Rays of carcinoma stem cells isolated from a human carcinoma cell line. As in normal keratinocyte stem cells, we demonstrated that cancer stem cells could rapidly repair radio-induced DNA damage. Furthermore, fibroblast growth factor 2 also mediates this repair, notably thanks to its nuclear isoforms. The second project of my PhD was to study human epidermal stem cells and progenitors responses to UVB radiation. Once cytometry and irradiation conditions were set up, the toxicity of UVB radiation has been evaluate in the primary cell model. We then characterized UVB photons effects on cell viability, proliferation and repair of DNA damage. This study allowed us to bring out that responses of stem cells and their progeny to UVB are different, notably at the level of part of their repair activity of DNA damage. Moreover, progenitors and stem cells transcriptomic responses after UVB irradiation have been study in order to analyze the global

  12. 'Reframing Healthcare Services through the Lens of Co-Production' (RheLaunCh): a study protocol for a mixed methods evaluation of mechanisms by which healthcare and social services impact the health and well-being of patients with COPD and CHF in the USA and The Netherlands.

    Science.gov (United States)

    Hesselink, Gijs; Johnson, Julie; Batalden, Paul; Carlson, Michelle; Geense, Wytske; Groenewoud, Stef; Jones, Sylvester; Roy, Brita; Sansone, Christina; Wolf, Judith R L M; Bart, Bradley; Wollersheim, Hub

    2017-09-07

    The USA lags behind other high-income countries in many health indicators. Outcome differences are associated with differences in the relative spending between healthcare and social services at the national level. The impact of the ratio and delivery of social and healthcare services on the individual patient's health is however unknown. ' Reframing Healthcare Services through the Lens of Co-Production ' (RheLaunCh) will be a cross-Atlantic comparative study of the mechanisms by which healthcare and social service delivery may impact patient health with chronic conditions. Insight into these mechanisms is needed to better and cost-effectively organise healthcare and social services. We designed a mixed methods study to compare the socioeconomic background, needs of and service delivery to patients with congestive heart failure and chronic obstructive pulmonary disease in the USA and the Netherlands. We will conduct: (1) a literature scan to compare national and regional healthcare and social service systems; (2) a retrospective database study to compare patient's socioeconomic and clinical characteristics and the service use and spending at the national, regional and hospital level; (3) a survey to compare patient perceived quality of life, receipt and experience of service delivery and ability of these services to meet patient needs; and (4) multiple case studies to understand what patients need to better govern their quality of life and how needs are met by services. Ethics approval was granted by the ethics committee of the Radboud University Medical Center (2016-2423) in the Netherlands and by the Human Subjects Research Committee of the Hennepin Health Care System, Inc. (HSR #16-4230) in the USA. Multiple approaches will be used for dissemination of results, including (inter)national research presentations and peer-reviewed publications. A website will be established to support the development of a community of practice. © Article author(s) (or their employer

  13. A novel role of RASSF9 in maintaining epidermal homeostasis.

    Directory of Open Access Journals (Sweden)

    Chiou-Mei Lee

    Full Text Available The physiological role of RASSF9, a member of the Ras-association domain family (RASSF, is currently unclear. Here, we report a mouse line in which an Epstein-Barr virus Latent Membrane Protein 1 (LMP1 transgene insertion has created a 7.2-kb chromosomal deletion, which abolished RASSF9 gene expression. The RASSF9-null mice exhibited interesting phenotypes that resembled human ageing, including growth retardation, short lifespan, less subcutaneous adipose layer and alopecia. In the wild-type mice, RASSF9 is predominantly expressed in the epidermal keratinocytes of skin, as determined by quantitative reverse-transcription PCR, immunofluorescence and in situ hybridization. In contrast, RASSF9-/- mice presented a dramatic change in epithelial organization of skin with increased proliferation and aberrant differentiation as detected by bromodeoxyuridine incorporation assays and immunofluorescence analyses. Furthermore, characteristic functions of RASSF9-/- versus wild type (WT mouse primary keratinocytes showed significant proliferation linked to a reduction of p21Cip1 expression under growth or early differentiation conditions. Additionally, in RASSF9-/- keratinocytes there was a drastic down-modulation of terminal differentiation markers, which could be rescued by infection with a recombinant adenovirus, Adv/HA-RASSF9. Our results indicate a novel and significant role of RASSF9 in epidermal homeostasis.

  14. Extraordinarily Stretchable All-Carbon Collaborative Nanoarchitectures for Epidermal Sensors

    KAUST Repository

    Cai, Yichen

    2017-06-16

    Multifunctional microelectronic components featuring large stretchability, high sensitivity, high signal-to-noise ratio (SNR), and broad sensing range have attracted a huge surge of interest with the fast developing epidermal electronic systems. Here, the epidermal sensors based on all-carbon collaborative percolation network are demonstrated, which consist 3D graphene foam and carbon nanotubes (CNTs) obtained by two-step chemical vapor deposition processes. The nanoscaled CNT networks largely enhance the stretchability and SNR of the 3D microarchitectural graphene foams, endowing the strain sensor with a gauge factor as high as 35, a wide reliable sensing range up to 85%, and excellent cyclic stability (>5000 cycles). The flexible and reversible strain sensor can be easily mounted on human skin as a wearable electronic device for real-time and high accuracy detecting of electrophysiological stimuli and even for acoustic vibration recognition. The rationally designed all-carbon nanoarchitectures are scalable, low cost, and promising in practical applications requiring extraordinary stretchability and ultrahigh SNRs.

  15. Extraordinarily Stretchable All-Carbon Collaborative Nanoarchitectures for Epidermal Sensors

    KAUST Repository

    Cai, Yichen; Shen, Jie; Dai, Ziyang; Zang, Xiaoxian; Dong, Qiuchun; Guan, Guofeng; Li, Lain-Jong; Huang, Wei; Dong, Xiaochen

    2017-01-01

    Multifunctional microelectronic components featuring large stretchability, high sensitivity, high signal-to-noise ratio (SNR), and broad sensing range have attracted a huge surge of interest with the fast developing epidermal electronic systems. Here, the epidermal sensors based on all-carbon collaborative percolation network are demonstrated, which consist 3D graphene foam and carbon nanotubes (CNTs) obtained by two-step chemical vapor deposition processes. The nanoscaled CNT networks largely enhance the stretchability and SNR of the 3D microarchitectural graphene foams, endowing the strain sensor with a gauge factor as high as 35, a wide reliable sensing range up to 85%, and excellent cyclic stability (>5000 cycles). The flexible and reversible strain sensor can be easily mounted on human skin as a wearable electronic device for real-time and high accuracy detecting of electrophysiological stimuli and even for acoustic vibration recognition. The rationally designed all-carbon nanoarchitectures are scalable, low cost, and promising in practical applications requiring extraordinary stretchability and ultrahigh SNRs.

  16. Real-time three-dimensional imaging of epidermal splitting and removal by high-definition optical coherence tomography.

    Science.gov (United States)

    Boone, Marc; Draye, Jean Pierre; Verween, Gunther; Pirnay, Jean-Paul; Verbeken, Gilbert; De Vos, Daniel; Rose, Thomas; Jennes, Serge; Jemec, Gregor B E; Del Marmol, Véronique

    2014-10-01

    While real-time 3-D evaluation of human skin constructs is needed, only 2-D non-invasive imaging techniques are available. The aim of this paper is to evaluate the potential of high-definition optical coherence tomography (HD-OCT) for real-time 3-D assessment of the epidermal splitting and decellularization. Human skin samples were incubated with four different agents: Dispase II, NaCl 1 M, sodium dodecyl sulphate (SDS) and Triton X-100. Epidermal splitting, dermo-epidermal junction, acellularity and 3-D architecture of dermal matrices were evaluated by High-definition optical coherence tomography before and after incubation. Real-time 3-D HD-OCT assessment was compared with 2-D en face assessment by reflectance confocal microscopy (RCM). (Immuno) histopathology was used as control. HD-OCT imaging allowed real-time 3-D visualization of the impact of selected agents on epidermal splitting, dermo-epidermal junction, dermal architecture, vascular spaces and cellularity. RCM has a better resolution (1 μm) than HD-OCT (3 μm), permitting differentiation of different collagen fibres, but HD-OCT imaging has deeper penetration (570 μm) than RCM imaging (200 μm). Dispase II and NaCl treatments were found to be equally efficient in the removal of the epidermis from human split-thickness skin allografts. However, a different epidermal splitting level at the dermo-epidermal junction could be observed and confirmed by immunolabelling of collagen type IV and type VII. Epidermal splitting occurred at the level of the lamina densa with dispase II and above the lamina densa (in the lamina lucida) with NaCl. The 3-D architecture of dermal papillae and dermis was more affected by Dispase II on HD-OCT which corresponded with histopathologic (orcein staining) fragmentation of elastic fibres. With SDS treatment, the epidermal removal was incomplete as remnants of the epidermal basal cell layer remained attached to the basement membrane on the dermis. With Triton X-100 treatment

  17. Epidermal cell death in frogs with chytridiomycosis

    Directory of Open Access Journals (Sweden)

    Laura A. Brannelly

    2017-02-01

    Full Text Available Background Amphibians are declining at an alarming rate, and one of the major causes of decline is the infectious disease chytridiomycosis. Parasitic fungal sporangia occur within epidermal cells causing epidermal disruption, but these changes have not been well characterised. Apoptosis (planned cell death can be a damaging response to the host but may alternatively be a mechanism of pathogen removal for some intracellular infections. Methods In this study we experimentally infected two endangered amphibian species Pseudophryne corroboree and Litoria verreauxii alpina with the causal agent of chytridiomycosis. We quantified cell death in the epidermis through two assays: terminal transferase-mediated dUTP nick end-labelling (TUNEL and caspase 3/7. Results Cell death was positively associated with infection load and morbidity of clinically infected animals. In infected amphibians, TUNEL positive cells were concentrated in epidermal layers, correlating to the localisation of infection within the skin. Caspase activity was stable and low in early infection, where pathogen loads were light but increasing. In animals that recovered from infection, caspase activity gradually returned to normal as the infection cleared. Whereas, in amphibians that did not recover, caspase activity increased dramatically when infection loads peaked. Discussion Increased cell death may be a pathology of the fungal parasite, likely contributing to loss of skin homeostatic functions, but it is also possible that apoptosis suppression may be used initially by the pathogen to help establish infection. Further research should explore the specific mechanisms of cell death and more specifically apoptosis regulation during fungal infection.

  18. Antitumor activity of ZD6126, a novel vascular-targeting agent, is enhanced when combined with ZD1839, an epidermal growth factor receptor tyrosine kinase inhibitor, and potentiates the effects of radiation in a human non-small cell lung cancer xenograft model.

    Science.gov (United States)

    Raben, David; Bianco, Cataldo; Damiano, Vincenzo; Bianco, Roberto; Melisi, Davide; Mignogna, Chiara; D'Armiento, Francesco Paolo; Cionini, Luca; Bianco, A Raffaele; Tortora, Giampaolo; Ciardiello, Fortunato; Bunn, Paul

    2004-08-01

    Targeting the tumor vasculature may offer an alternative or complementary therapeutic approach to targeting growth factor signaling in lung cancer. The aim of these studies was to evaluate the antitumor effects in vivo of the combination of ZD6126, a tumor-selective vascular-targeting agent; ZD1839 (gefitinib, Iressa), an epidermal growth factor receptor tyrosine kinase inhibitor; and ionizing radiation in the treatment of non-small cell lung cancer xenograft model. Athymic nude mice with established flank A549 human non-small cell lung cancer xenograft model xenografts were treated with fractionated radiation therapy, ZD6126, ZD1839, or combinations of each treatment. ZD6126 (150 mg/kg) was given i.p. the day after each course of radiation. Animals treated with ZD1839 received 100 mg/kg per dose per animal, 5 or 7 days/wk for 2 weeks. Immunohistochemistry was done to evaluate the effects on tumor growth using an anti-Ki67 monoclonal antibody. Effects on tumor-induced vascularization were quantified using an anti-factor VIII-related antigen monoclonal antibody. ZD6126 attenuated the growth of human A549 flank xenografts compared with untreated animals. Marked antitumor effects were observed when animals were treated with a combination of ZD6126 and fractionated radiation therapy with protracted tumor regression. ZD6126 + ZD1839 resulted in a greater tumor growth delay than either agent alone. Similar additive effects were seen with ZD1839 + fractionated radiation. Finally, the addition of ZD6126 to ZD1839 and radiation therapy seemed to further improve tumor growth control, with a significant tumor growth delay compared with animals treated with single agent or with double combinations. Immunohistochemistry showed that ZD1839 induced a marked reduction in A549 tumor cell proliferation. Both ZD1839 and ZD6126 treatment substantially reduced tumor-induced angiogenesis. ZD6126 caused marked vessel destruction through loss of endothelial cells and thrombosis

  19. Stevens–Johnson syndrome/toxic epidermal necrolysis caused by cefadroxil in a cat

    Directory of Open Access Journals (Sweden)

    Roberta Sartori

    2016-06-01

    Full Text Available Case summary A 5-year-old, spayed female, indoor-only domestic shorthair cat was referred with an acute history of multifocal cutaneous and mucocutaneous erosive-ulcerative lesions and skin detachment. The lesions occurred on the seventh day of therapy with cefadroxil. Erosive-ulcerative and occasionally crusted lesions were apparent on the medial and lateral canthus of both eyes, ventral neck, abdomen, perivulvar region, periungual skin and medial aspect of the front and hindlimbs. Diffuse and severe exfoliation was present on the dorsum and tail base and in both external ear canals. The cat was also dehydrated, tachycardic and febrile. Histopathological examination revealed extensive epidermal ulceration, interface dermatitis with vacuolar degeneration, apoptosis at multiple epidermal levels and basal, suprabasal and spinous dermoepidermal detachment. The histopathological diagnosis was consistent with Stevens–Johnson syndrome/toxic epidermal necrolysis (SJS/TEN. The recently reported Algorithm of Drug Causality in Epidermal Necrolysis (ALDEN, currently used in human medicine, was applied and a score of +6 was calculated; this supported the view that SJS/TEN in this cat was very likely to be associated with cefadroxil administration. Relevance and novel information This clinical communication reports cefadroxil as a very probable cause of SJS/TEN in a cat; the ALDEN was applied in this case and supported diagnosis.

  20. Reptured Epidermal Inclusion Cyst in the Axilla: A Case Report

    International Nuclear Information System (INIS)

    Kim, Kyu Soon; Kim, Hak Hee; Shin, Hee Jeong; Yang, Hye Rin; Sohn, Jeong Hee; Kwon, Gui Young; Gong, Gyung Yub

    2006-01-01

    Epidermal inclusion cysts, the most common type of simple epithelial cyst, are typically well-encapsulated, subepidermal and mobile nodules. They may occur anywhere, but are mostly found on the scalp, face, neck, trunk, and back. Less than 10% of epidermal inclusion cysts occur on the extremities, and even fewer are found on the palms, soles, and breasts. If epidermal inclusion cysts rupture, foreign body reaction, granulomatous reaction or abscess formation could follow. We described here the sonographic findings of ruptured epidermal inclusion cyst of the right axilla in a 33-year-old woman who presented with a palpable axillary mass forming an inflammatory abscess

  1. Culture technique of rabbit primary epidermal keratinocytes

    Directory of Open Access Journals (Sweden)

    Marini M

    2012-10-01

    Full Text Available The epidermis is the protective covering outer layer of the mammalian skin. The epidermal cells are stratified squamous epithelia which undergo continuous differentiation of loss and replacement of cells. Ninety per cent of epidermal cells consist of keratinocytes that are found in the basal layer of the stratified epithelium called epidermis. Keratinocytes are responsible for forming tight junctions with the nerves of the skin as well as in the process of wound healing. This article highlights the method of isolation and culture of rabbit primary epidermal keratinocytes in vitro. Approximately 2cm x 2cm oval shaped line was drawn on the dorsum of the rabbit to mark the surgical area. Then, the skin was carefully excised using a surgical blade and the target skin specimens harvested from the rabbits were placed in transport medium comprising of Dulbecco’s Modified Eagle Medium (DMEM and 1% of antibiotic-antimycotic solution. The specimens were transferred into a petri dish containing 70% ethanol and washed for 5 min followed by a wash in 1 x Dulbecco’s Phosphate Buffered Saline (DBPS. Then, the skin specimens were placed in DMEM and minced into small pieces using a scalpel. The minced pieces were placed in a centrifuge tube containing 0.6% Dispase and 1% antibiotic-antimycotic solution overnight at 4°C in a horizontal orientation. The epidermis layer (whitish, semi-transparent was separated from the dermis (pink, opaque, gooey with the aid of curved forceps by fixing the dermis with one pair of forceps while detaching the epidermis with the second pair. The cells were cultured at a density of 4 x 104 cells/cm2 in culture flask at 37°C and 5% CO2. The cell morphology of the keratinocytes was analyzed using inverted microscope.

  2. Epidermal protection with cryogen spray cooling during high fluence pulsed dye laser irradiation: an ex vivo study.

    Science.gov (United States)

    Tunnell, J W; Nelson, J S; Torres, J H; Anvari, B

    2000-01-01

    Higher laser fluences than currently used in therapy (5-10 J/cm(2)) are expected to result in more effective treatment of port wine stain (PWS) birthmarks. However, higher incident fluences increase the risk of epidermal damage caused by absorption of light by melanin. Cryogen spray cooling offers an effective method to reduce epidermal injury during laser irradiation. The objective of this study was to determine whether high laser incident fluences (15-30 J/cm(2)) could be used while still protecting the epidermis in ex vivo human skin samples. Non-PWS skin from a human cadaver was irradiated with a Candela ScleroPlus Laser (lambda = 585 nm; pulse duration = 1.5 msec) by using various incident fluences (8-30 J/cm(2)) without and with cryogen spray cooling (refrigerant R-134a; spurt durations: 40-250 msec). Assessment of epidermal damage was based on histologic analysis. Relatively short spurt durations (40-100 msec) protected the epidermis for laser incident fluences comparable to current therapeutic levels (8-10 J/cm(2)). However, longer spurt durations (100-250 msec) increased the fluence threshold for epidermal damage by a factor of three (up to 30 J/cm(2)) in these ex vivo samples. Results of this ex vivo study show that epidermal protection from high laser incident fluences can be achieved by increasing the cryogen spurt duration immediately before pulsed laser exposure. Copyright 2000 Wiley-Liss, Inc.

  3. The Epidermal Growth Factor Receptor Is a Regulator of Epidermal Complement Component Expression and Complement Activation

    DEFF Research Database (Denmark)

    Abu-Humaidan, Anas H A; Ananthoju, Nageshwar; Mohanty, Tirthankar

    2014-01-01

    The complement system is activated in response to tissue injury. During wound healing, complement activation seems beneficial in acute wounds but may be detrimental in chronic wounds. We found that the epidermal expression of many complement components was only increased to a minor extent in skin...

  4. Radionecrosis skin model induced an athymic mouse nude (Nu/Nu) for development of dermal-epidermal human substitute based regenerative therapy; Modelo de radionecrose cutanea induzida em camundongos Nude (Nu/Nu) para desenvolvimento de terapias regenerativas baseadas em substitutos dermo-epidermicos humanos

    Energy Technology Data Exchange (ETDEWEB)

    Mosca, Rodrigo Crespo

    2014-07-01

    The neoplasms incidence has increased significantly in recent years and continued population growth and aging will increase the statistics of this illness in the world's diseases. The cancer treatment usually consists in individual or combined use of chemotherapy, surgery and radiotherapy depending on the etiology of the tumor. In cases where radiotherapy is used in addition to the therapeutic effects of radiation, specific complications can occur, and in the skin, these complications can be present with a clinical expression ranging from erythema to radionecrosis, and this latter being the adverse effect with greater severity. The radionecrosis treatment consists in debridement necrotic areas and covering the surgical wounds. Autologous grafts are most commonly used for this covering, however when large areas are affected, allografts can be used for occlusive treatment and the keratinocytes and adipose derived stem cells (ADSC) addition becomes an alternative, due to the knowing for immunomodulatory and regenerative response. For that reason, aiming to simulate the radionecrosis adverse effects, an animal model of induced cutaneous radionecrosis was created, in athymic mouse Nude (Nu/Nu), for developing regenerative therapies based on human dermal-epidermal substitutes containing keratinocytes and ADSC, which proved occlusive as an efficient treatment, furthermore, having this radionecrosis animal model established, new possibilities for treatment of diseases involving dermal regeneration, can be tested. (author)

  5. Vaccine-induced toxic epidermal necrolysis: A case and systematic review

    OpenAIRE

    Chahal, Dev; Aleshin, Maria; Turegano, Mamina; Chiu, Melvin; Worswick, Scott

    2018-01-01

    Background: Erythema multiforme (EM), Stevens-Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN) are cutaneous hypersensitivityreactions that develop in response to specific triggers such as medications and certain infections. Vaccines, which undergo rigorous safety testing prior to use in humans, are a rare cause of SJS/TEN and little is known about the frequency of such events and corresponding pathogenesis. Objective: Herein, we discuss a case of suspected TEN in a 19-yea...

  6. Functional Role of Cyclin-Dependent Kinase 5 in the Regulation of Melanogenesis and Epidermal Structure

    OpenAIRE

    Dong, Changsheng; Yang, Shanshan; Fan, Ruiwen; Ji, Kaiyuan; Zhang, Junzhen; Liu, Xuexian; Hu, Shuaipeng; Xie, Jianshan; Liu, Yu; Gao, Wenjun; Wang, Haidong; Yao, Jianbo; Smith, George W; Herrid, Muren

    2017-01-01

    The mammalian integumentary system plays important roles in body homeostasis, and dysfunction of melanogenesis or epidermal development may lead to a variety of skin diseases, including melanoma. Skin pigmentation in humans and coat color in fleece-producing animals are regulated by many genes. Among them, microphthalmia-associated transcription factor (MITF) and paired-box 3 (PAX3) are at the top of the cascade and regulate activities of many important melanogenic enzymes. Here, we report fo...

  7. Etanercept therapy for toxic epidermal necrolysis.

    Science.gov (United States)

    Paradisi, Andrea; Abeni, Damiano; Bergamo, Fabio; Ricci, Francesco; Didona, Dario; Didona, Biagio

    2014-08-01

    Toxic epidermal necrolysis (TEN) is a severe and potentially lethal drug reaction for which no standard treatment is available. To describe a case series of patients with TEN treated with a single dose of etanercept. We observed 10 consecutive patients with TEN. For each patient, we recorded the presence of comorbidities and all the drugs recently started (ie, in the last month). In all cases, 50 mg of etanercept was administered in a single subcutaneous injection. The clinical severity of disease was computed using the SCORe of Toxic Epidermal Necrosis (SCORTEN) scale. Using the probabilities of death linked to each level of SCORTEN score, we calculated the expected probability of death in our patients. Healing was defined as complete reepithelialization, and a time to healing curve was then obtained using the Kaplan-Meier method. All patients promptly responded to treatment, reaching complete reepithelialization without complications or side effects. The median time to healing was 8.5 days. This is a small, uncontrolled case series. These preliminary results suggest the possibility that tumor necrosis factor-alfa may be an effective target for control of TEN, a dangerous skin condition for which no effective cure has yet been found. Copyright © 2014 American Academy of Dermatology, Inc. Published by Mosby, Inc. All rights reserved.

  8. Heparin-binding epidermal growth factor-like growth factor promotes neuroblastoma differentiation.

    Science.gov (United States)

    Gaviglio, Angela L; Knelson, Erik H; Blobe, Gerard C

    2017-05-01

    High-risk neuroblastoma is characterized by undifferentiated neuroblasts and low schwannian stroma content. The tumor stroma contributes to the suppression of tumor growth by releasing soluble factors that promote neuroblast differentiation. Here we identify heparin-binding epidermal growth factor-like growth factor (HBEGF) as a potent prodifferentiating factor in neuroblastoma. HBEGF mRNA expression is decreased in human neuroblastoma tumors compared with benign tumors, with loss correlating with decreased survival. HBEGF protein is expressed only in stromal compartments of human neuroblastoma specimens, with tissue from high-stage disease containing very little stroma or HBEGF expression. In 3 human neuroblastoma cell lines (SK-N-AS, SK-N-BE2, and SH-SY5Y), soluble HBEGF is sufficient to promote neuroblast differentiation and decrease proliferation. Heparan sulfate proteoglycans and heparin derivatives further enhance HBEGF-induced differentiation by forming a complex with the epidermal growth factor receptor, leading to activation of the ERK1/2 and STAT3 pathways and up-regulation of the inhibitor of DNA binding transcription factor. These data support a role for loss of HBEGF in the neuroblastoma tumor microenvironment in neuroblastoma pathogenesis.-Gaviglio, A. L., Knelson, E. H., Blobe, G. C. Heparin-binding epidermal growth factor-like growth factor promotes neuroblastoma differentiation. © FASEB.

  9. Post-female-circumcision clitoral epidermal inclusion cyst: a case ...

    African Journals Online (AJOL)

    Keywords: complication, epidermal inclusion cyst, female circumcision. Pediatric Urology Division, Department of Urology, ... transplantation of the epidermis into the subcutaneous tissue with subsequent proliferation of epidermal ... The evolution of the practice of FGM, from being performed by traditional birth attendants to.

  10. Herbal medicines that benefit epidermal permeability barrier function

    Directory of Open Access Journals (Sweden)

    Lizhi Hu

    2015-06-01

    Full Text Available Epidermal permeability barrier function plays a critical role in regulating cutaneous functions. Hence, researchers have been searching for effective and affordable regimens to enhance epidermal permeability barrier function. In addition to topical stratum corneum lipids, peroxisome proliferator-activated receptor, and liver X receptor ligands, herbal medicines have been proven to benefit epidermal permeability barrier function in both normal and diseased skin, including atopic dermatitis, glucocorticoid-induced skin damage, and UVB-damaged skin. The potential mechanisms by which herbal medicines improve the permeability barrier include stimulation of epidermal differentiation, lipid production, antimicrobial peptide expression, and antioxidation. Therefore, utilization of herbal medicines could be a valuable alternative approach to enhance epidermal permeability barrier function in order to prevent and/or treat skin disorders associated with permeability barrier abnormalities.

  11. Genetic analysis of Ras genes in epidermal development and tumorigenesis

    Science.gov (United States)

    Drosten, Matthias; Lechuga, Carmen G; Barbacid, Mariano

    2013-01-01

    Proliferation and differentiation of epidermal keratinocytes are tightly controlled to ensure proper development and homeostasis of the epidermis. The Ras family of small GTPases has emerged as a central node in the coordination of cell proliferation in the epidermis. Recent genetic evidence from mouse models has revealed that the intensity of Ras signaling modulates the proliferative capacity of epidermal keratinocytes. Interfering with Ras signaling either by combined elimination of the 3 Ras genes from the basal layer of the epidermis or by overexpression of dominant-negative Ras isoforms caused epidermal thinning due to hypoproliferation of keratinocytes. In contrast, overexpression of oncogenic Ras mutants in different epidermal cell layers led to hyperproliferative phenotypes including the development of papillomas and squamous cell carcinomas. Here, we discuss the value of loss- and gain-of-function studies in mouse models to assess the role of Ras signaling in the control of epidermal proliferation. PMID:24150175

  12. 99m Tc-anti-epidermal growth factor receptor nanobody for tumor imaging.

    Science.gov (United States)

    Piramoon, Majid; Hosseinimehr, Seyed Jalal; Omidfar, Kobra; Noaparast, Zohreh; Abedi, Seyed Mohammad

    2017-04-01

    Nanobodies are important biomolecules for tumor targeting. In this study, we synthesized and labeled anti-epidermal growth factor receptor (EGFR) nanobody OA-cb6 with 99m Tc(CO) 3 + and evaluated its characteristics for targeting the EGFR in the A431 human epidermal carcinoma cell line. Nanobody radiolabeling was achieved with high yield and radiochemical purity, and the radioconjugate was stable. Biodistribution results in nude mice exhibited a favorable tumor-to-muscle ratio at 4-hr postinjection, and tumor location was visualized at 4 hr after injection of radiolabeled nanobody. Our result showed that the OA-cb6- 99m Tc-tricarbonyl radiolabeled nanobody is a promising radiolabeled biomolecule for tumor imaging in cancers with high EGFR overexpression. © 2016 John Wiley & Sons A/S.

  13. Spatiotemporal Expression of p63 in Mouse Epidermal Commitment

    Directory of Open Access Journals (Sweden)

    Qian Zhao

    2015-12-01

    Full Text Available The embryonic surface ectoderm is a simple flat epithelium consisting of cells that express the cytokeratins K8/K18. Before stratification, K5/K14 expression substitutes K8/K18 expression, marking the event called epidermal commitment. Previous studies show that the transcription factor p63 plays an essential role in epidermal commitment. However, detailed expression information of p63 during early epidermal development in mice is still unclear. We systematically studied the expression pattern of p63 in mouse epidermal commitment, together with K8 and K5. We show that p63 expression could be detected as early as E8.5 in mouse embryos preceding epidermal commitment. p63 expression first appears near the newly formed somites and the posterior part of the embryo, further expanding to the whole embryonic surface with particular enrichment in the first branchial arches and the limb buds. ΔNp63 is the major class of isoforms expressed in this period. Relative expression intensity of p63 depends on the embryonic position. In summary, there is a sequential and regular expression pattern of K8, p63 and K5 in mouse epidermal commitment. Our study not only contributes to understanding the early events during epidermal development but also provides a basal tool to study the function of p63 in mammals.

  14. Basaloid Squamous Cell Carcinoma of the Head and Neck: Subclassification into Basal, Ductal, and Mixed Subtypes Based on Comparison of Clinico-pathologic Features and Expression of p53, Cyclin D1, Epidermal Growth Factor Receptor, p16, and Human Papillomavirus

    Directory of Open Access Journals (Sweden)

    Kyung-Ja Cho

    2017-07-01

    Full Text Available Background Basaloid squamous cell carcinoma (BSCC is a rare variant of squamous cell carcinoma with distinct pathologic characteristics. The histogenesis of BSCC is not fully understood, and the cancer has been suggested to originate from a totipotent primitive cell in the basal cell layer of the surface epithelium or in the proximal duct of secretory glands. Methods Twenty-six cases of head and neck BSCC from Asan Medical Center, Seoul, Korea, reported during a 14-year-period were subclassified into basal, ductal, and mixed subtypes according to the expression of basal (cytokeratin [CK] 5/6, p63 or ductal markers (CK7, CK8/18. The cases were also subject to immunohistochemical study for CK19, p53, cyclin D1, epidermal growth factor receptor (EGFR, and p16 and to in situ hybridization for human papillomavirus (HPV, and the results were clinico-pathologically compared. Results Mixed subtype (12 cases was the most common, and these cases showed hypopharyngeal predilection, older age, and higher expression of CK19, p53, and EGFR than other subtypes. The basal subtype (nine cases showed frequent comedo-necrosis and high expression of cyclin D1. The ductal subtype (five cases showed the lowest expression of p53, cyclin D1, and EGFR. A small number of p16- and/or HPV-positive cases were not restricted to one subtype. BSCC was the cause of death in 19 patients, and the average follow-up period for all patients was 79.5 months. Overall survival among the three subtypes was not significantly different. Conclusions The results of this study suggest a heterogeneous pathogenesis of head and neck BSCC. Each subtype showed variable histology and immunoprofiles, although the clinical implication of heterogeneity was not determined in this study.

  15. PALOMA-3: Phase III Trial of Fulvestrant With or Without Palbociclib in Premenopausal and Postmenopausal Women With Hormone Receptor-Positive, Human Epidermal Growth Factor Receptor 2-Negative Metastatic Breast Cancer That Progressed on Prior Endocrine Therapy-Safety and Efficacy in Asian Patients.

    Science.gov (United States)

    Iwata, Hiroji; Im, Seock-Ah; Masuda, Norikazu; Im, Young-Hyuck; Inoue, Kenichi; Rai, Yoshiaki; Nakamura, Rikiya; Kim, Jee Hyun; Hoffman, Justin T; Zhang, Ke; Giorgetti, Carla; Iyer, Shrividya; Schnell, Patrick T; Bartlett, Cynthia Huang; Ro, Jungsil

    2017-08-01

    To assess efficacy and safety of palbociclib plus fulvestrant in Asians with endocrine therapy-resistant metastatic breast cancer. The Palbociclib Ongoing Trials in the Management of Breast Cancer 3 (PALOMA-3) trial, a double-blind phase III study, included 521 patients with hormone receptor-positive/human epidermal growth factor receptor 2-negative metastatic breast cancer with disease progression on endocrine therapy. Patient-reported outcomes (PROs) were assessed on study treatment and at the end of treatment. This preplanned subgroup analysis of the PALOMA-3 study included premenopausal and postmenopausal Asians taking palbociclib plus fulvestrant (n = 71) or placebo plus fulvestrant (n = 31). Palbociclib plus fulvestrant improved progression-free survival (PFS) compared with fulvestrant alone. Median PFS was not reached with palbociclib plus fulvestrant (95% CI, 9.2 months to not reached) but was 5.8 months with placebo plus fulvestrant (95% CI, 3.5 to 9.2 months; hazard ratio, 0.485; 95% CI, 0.270 to 0.869; P = .0065). The most common all-cause grade 3 or 4 adverse events in the palbociclib arm were neutropenia (92%) and leukopenia (29%); febrile neutropenia occurred in 4.1% of patients. Within-patient mean trough concentration comparisons across subgroups indicated similar palbociclib exposure between Asians and non-Asians. Global quality of life was maintained; no statistically significant changes from baseline were observed for patient-reported outcome scores with palbociclib plus fulvestrant. This is the first report, to our knowledge, showing that palbociclib plus fulvestrant improves PFS in asian patients. Palbociclib plus fulvestrant was well tolerated in this study.

  16. PALOMA-3: Phase III Trial of Fulvestrant With or Without Palbociclib in Premenopausal and Postmenopausal Women With Hormone Receptor–Positive, Human Epidermal Growth Factor Receptor 2–Negative Metastatic Breast Cancer That Progressed on Prior Endocrine Therapy—Safety and Efficacy in Asian Patients

    Science.gov (United States)

    Im, Seock-Ah; Masuda, Norikazu; Im, Young-Hyuck; Inoue, Kenichi; Rai, Yoshiaki; Nakamura, Rikiya; Kim, Jee Hyun; Hoffman, Justin T.; Zhang, Ke; Giorgetti, Carla; Iyer, Shrividya; Schnell, Patrick T.; Bartlett, Cynthia Huang; Ro, Jungsil

    2017-01-01

    Purpose To assess efficacy and safety of palbociclib plus fulvestrant in Asians with endocrine therapy–resistant metastatic breast cancer. Patients and Methods The Palbociclib Ongoing Trials in the Management of Breast Cancer 3 (PALOMA-3) trial, a double-blind phase III study, included 521 patients with hormone receptor–positive/human epidermal growth factor receptor 2–negative metastatic breast cancer with disease progression on endocrine therapy. Patient-reported outcomes (PROs) were assessed on study treatment and at the end of treatment. Results This preplanned subgroup analysis of the PALOMA-3 study included premenopausal and postmenopausal Asians taking palbociclib plus fulvestrant (n = 71) or placebo plus fulvestrant (n = 31). Palbociclib plus fulvestrant improved progression-free survival (PFS) compared with fulvestrant alone. Median PFS was not reached with palbociclib plus fulvestrant (95% CI, 9.2 months to not reached) but was 5.8 months with placebo plus fulvestrant (95% CI, 3.5 to 9.2 months; hazard ratio, 0.485; 95% CI, 0.270 to 0.869; P = .0065). The most common all-cause grade 3 or 4 adverse events in the palbociclib arm were neutropenia (92%) and leukopenia (29%); febrile neutropenia occurred in 4.1% of patients. Within-patient mean trough concentration comparisons across subgroups indicated similar palbociclib exposure between Asians and non-Asians. Global quality of life was maintained; no statistically significant changes from baseline were observed for patient-reported outcome scores with palbociclib plus fulvestrant. Conclusion This is the first report, to our knowledge, showing that palbociclib plus fulvestrant improves PFS in asian patients. Palbociclib plus fulvestrant was well tolerated in this study. PMID:28831437

  17. PALOMA-3: Phase III Trial of Fulvestrant With or Without Palbociclib in Premenopausal and Postmenopausal Women With Hormone Receptor–Positive, Human Epidermal Growth Factor Receptor 2–Negative Metastatic Breast Cancer That Progressed on Prior Endocrine Therapy—Safety and Efficacy in Asian Patients

    Directory of Open Access Journals (Sweden)

    Hiroji Iwata

    2017-08-01

    Full Text Available Purpose: To assess efficacy and safety of palbociclib plus fulvestrant in Asians with endocrine therapy–resistant metastatic breast cancer. Patients and Methods: The Palbociclib Ongoing Trials in the Management of Breast Cancer 3 (PALOMA-3 trial, a double-blind phase III study, included 521 patients with hormone receptor–positive/human epidermal growth factor receptor 2–negative metastatic breast cancer with disease progression on endocrine therapy. Patient-reported outcomes (PROs were assessed on study treatment and at the end of treatment. Results: This preplanned subgroup analysis of the PALOMA-3 study included premenopausal and postmenopausal Asians taking palbociclib plus fulvestrant (n = 71 or placebo plus fulvestrant (n = 31. Palbociclib plus fulvestrant improved progression-free survival (PFS compared with fulvestrant alone. Median PFS was not reached with palbociclib plus fulvestrant (95% CI, 9.2 months to not reached but was 5.8 months with placebo plus fulvestrant (95% CI, 3.5 to 9.2 months; hazard ratio, 0.485; 95% CI, 0.270 to 0.869; P = .0065. The most common all-cause grade 3 or 4 adverse events in the palbociclib arm were neutropenia (92% and leukopenia (29%; febrile neutropenia occurred in 4.1% of patients. Within-patient mean trough concentration comparisons across subgroups indicated similar palbociclib exposure between Asians and non-Asians. Global quality of life was maintained; no statistically significant changes from baseline were observed for patient-reported outcome scores with palbociclib plus fulvestrant. Conclusion: This is the first report, to our knowledge, showing that palbociclib plus fulvestrant improves PFS in asian patients. Palbociclib plus fulvestrant was well tolerated in this study.

  18. Seven-Year Follow-Up Assessment of Cardiac Function in NSABP B-31, a Randomized Trial Comparing Doxorubicin and Cyclophosphamide Followed by Paclitaxel (ACP) With ACP Plus Trastuzumab As Adjuvant Therapy for Patients With Node-Positive, Human Epidermal Growth Factor Receptor 2–Positive Breast Cancer

    Science.gov (United States)

    Romond, Edward H.; Jeong, Jong-Hyeon; Rastogi, Priya; Swain, Sandra M.; Geyer, Charles E.; Ewer, Michael S.; Rathi, Vikas; Fehrenbacher, Louis; Brufsky, Adam; Azar, Catherine A.; Flynn, Patrick J.; Zapas, John L.; Polikoff, Jonathan; Gross, Howard M.; Biggs, David D.; Atkins, James N.; Tan-Chiu, Elizabeth; Zheng, Ping; Yothers, Greg; Mamounas, Eleftherios P.; Wolmark, Norman

    2012-01-01

    Purpose Cardiac dysfunction (CD) is a recognized risk associated with the addition of trastuzumab to adjuvant chemotherapy for human epidermal growth factor receptor 2–positive breast cancer, especially when the treatment regimen includes anthracyclines. Given the demonstrated efficacy of trastuzumab, ongoing assessment of cardiac safety and identification of risk factors for CD are important for optimal patient care. Patients and Methods In National Surgical Adjuvant Breast and Bowel Project B-31, a phase III adjuvant trial, 1,830 patients who met eligibility criteria for initiation of trastuzumab were evaluated for CD. Recovery from CD was also assessed. A statistical model was developed to estimate the risk of severe congestive heart failure (CHF). Baseline patient characteristics associated with anthracycline-related decline in cardiac function were also identified. Results At 7-year follow-up, 37 (4.0%) of 944 patients who received trastuzumab experienced a cardiac event (CE) versus 10 (1.3%) of 743 patients in the control arm. One cardiac-related death has occurred in each arm of the protocol. A Cardiac Risk Score, calculated using patient age and baseline left ventricular ejection fraction (LVEF) by multiple-gated acquisition scan, statistically correlates with the risk of a CE. After stopping trastuzumab, the majority of patients who experienced CD recovered LVEF in the normal range, although some decline from baseline often persists. Only two CEs occurred more than 2 years after initiation of trastuzumab. Conclusion The late development of CHF after the addition of trastuzumab to paclitaxel after doxorubicin/ cyclophosphamide chemotherapy is uncommon. The risk versus benefit of trastuzumab as given in this regimen remains strongly in favor of trastuzumab. PMID:22987084

  19. Long-Term Follow-Up of Cardiac Function and Quality of Life for Patients in NSABP Protocol B-31/NRG Oncology: A Randomized Trial Comparing the Safety and Efficacy of Doxorubicin and Cyclophosphamide (AC) Followed by Paclitaxel With AC Followed by Paclitaxel and Trastuzumab in Patients With Node-Positive Breast Cancer With Tumors Overexpressing Human Epidermal Growth Factor Receptor 2.

    Science.gov (United States)

    Ganz, Patricia A; Romond, Edward H; Cecchini, Reena S; Rastogi, Priya; Geyer, Charles E; Swain, Sandra M; Jeong, Jong-Hyeon; Fehrenbacher, Louis; Gross, Howard M; Brufsky, Adam M; Flynn, Patrick J; Wahl, Tanya A; Seay, Thomas E; Wade, James L; Biggs, David D; Atkins, James N; Polikoff, Jonathan; Zapas, John L; Mamounas, Eleftherios P; Wolmark, Norman

    2017-12-10

    Purpose Early cardiac toxicity is a risk associated with adjuvant chemotherapy plus trastuzumab. However, objective measures of cardiac function and health-related quality of life are lacking in long-term follow-up of patients who remain cancer free after completion of adjuvant treatment. Patients and Methods Patients in NSABP Protocol B-31 received anthracycline and taxane chemotherapy with or without trastuzumab for adjuvant treatment of node-positive, human epidermal growth factor receptor 2-positive early-stage breast cancer. A long-term follow-up assessment was undertaken for patients who were alive and disease free, which included measurement of left ventricular ejection fraction by multigated acquisition scan along with patient-reported outcomes using the Duke Activity Status Index (DASI), the Medical Outcomes Study questionnaire, and a review of current medications and comorbid conditions. Results At a median follow-up of 8.8 years among eligible participants, five (4.5%) of 110 in the control group and 10 (3.4%) of 297 in the trastuzumab group had a > 10% decline in left ventricular ejection fraction from baseline to a value < 50%. Lower DASI scores correlated with age and use of medications for hypertension, cardiac conditions, diabetes, and hyperlipidemia, but not with whether patients had received trastuzumab. Conclusion In patients without underlying cardiac disease at baseline, the addition of trastuzumab to adjuvant anthracycline and taxane-based chemotherapy does not result in long-term worsening of cardiac function, cardiac symptoms, or health-related quality of life. The DASI questionnaire may provide a simple and useful tool for monitoring patient-reported changes that reflect cardiac function.

  20. UVB-induced epidermal hyperproliferation is modified by a single, topical treatment with a mitosis inhibitory epidermal pentapeptide

    International Nuclear Information System (INIS)

    Olsen, W.M.; Elgjo, K.

    1990-01-01

    A single application of a water-miscible cream base containing the recently identified mitosis inhibitory epidermal pentapeptide pyroGlu-Glu-Asp-Ser-GlyOH (EPP) to hairless mouse skin is followed by a long-lasting period of reduced epidermal cell proliferation. To examine if a similar growth inhibition could be achieved in stimulated and rapidly proliferating epidermis, EPP was applied at two different concentrations, 0.005 or 0.02%, to hairless mouse skin immediately after exposure of the left flank to an erythemic dose of ultraviolet B light (UVB). This dose of UVB alone induces a sustained period of rapid epidermal cell proliferation, starting at about 18 h after the irradiation. Epidermal cell proliferation was followed from 18 to 54 h (0.005% cream) or from 18 to 30 h (0.02% cream) after the treatment by estimating the rate of G2-M cell flux (the mitotic rate) by means of Colcemid, and epidermal DNA synthesis by counting labeled cells after pulse-labeling with 3H-thymidine. The unirradiated side of the mice was used as reference. The results showed that topical treatment with a 0.02% EPP cream partially inhibited UVB-induced epidermal hyperproliferation, while the 0.005% EPP cream inhibited as well as stimulated the UVB-induced hyperproliferation. Thus, EPP is effective even in rapidly proliferating epidermal cell populations, but the outcome is obviously dose-dependent in this test system

  1. Lemon (Citrus limon, Burm.f.) essential oil enhances the trans-epidermal release of lipid-(A, E) and water-(B6, C) soluble vitamins from topical emulsions in reconstructed human epidermis.

    Science.gov (United States)

    Valgimigli, L; Gabbanini, S; Berlini, E; Lucchi, E; Beltramini, C; Bertarelli, Y L

    2012-08-01

    Topical bioavailability of lipid- and water-soluble vitamins is a critical issue for protecting or anti-ageing formulations. Using 17-day-old SkinEthic(®) reconstructed human epidermis, we investigated (at 34°C) the role of lemon EO in enhancing the penetration of α-tocopherol (E) and retinyl acetate (A), pyridoxine (B(6)) and ascorbic acid (C), released from O/W or W/O emulsions. D-limonene, α-pinene and p-cymene (65.9, 2.2 and 0.5%w/w of the oil) had skin permeability coefficients Ps (10(-3) cm h(-1)) of 0.56 ± 0.03 (or 0.73 ± 0.02), 0.72 ± 0.05 (or 0.98 ± 0.05) and 0.84 ± 0.04 (or 1.14 ± 0.04), respectively, when incorporated in a W/O (or O/W) emulsion. Vitamins B6, C and A had Ps values of (3.0 ± 0.4) × 10(-3), (7.9 ± 0.6) × 10(-3) and (0.37 ± 0.02) × 10(-5) cm h(-1), respectively, and their flux through the skin was enhanced by a factor of 4.1, 3.4 and 5.8, respectively, in the presence of lemon EO. The penetration of vitamin E was nine-fold enhanced. Lemon EO produced only reversible modification of TEWL, and it is a safe and effective penetration enhancer for topical administration of lipid- and water-soluble vitamins. © 2012 The Authors. ICS © 2012 Society of Cosmetic Scientists and the Société Française de Cosmétologie.

  2. Antitumor efficacy of triple monoclonal antibody inhibition of epidermal growth factor receptor (EGFR) with MM151 in EGFR-dependent and in cetuximab-resistant human colorectal cancer cells

    Science.gov (United States)

    Napolitano, Stefania; Martini, Giulia; Martinelli, Erika; Della Corte, Carminia Maria; Morgillo, Floriana; Belli, Valentina; Cardone, Claudia; Matrone, Nunzia; Ciardiello, Fortunato; Troiani, Teresa

    2017-01-01

    Purpose We investigated the effect of triple monoclonal antibody inhibition of EGFR to overcome acquired resistance to first generation of anti-EGFR inhibitors. Experimental design MM151 is a mixture of three different monoclonal IgG1 antibodies directed toward three different, non-overlapping, epitopes of the EGFR. We performed an in vivo study by using human CRC cell lines (SW48, LIM 1215 and CACO2) which are sensitive to EGFR inhibitors, in order to evaluate the activity of MM151 as compared to standard anti-EGFR mAbs, such as cetuximab, as single agent or in a sequential strategy of combination MM151 with irinotecan (induction therapy) followed by MM151 with a selective MEK1/2 inhibitor (MEKi) (maintenance therapy). Furthermore, the ability of MM151 to overcome acquired resistance to cetuximab has been also evaluated in cetuximab-refractory CRC models. Results MM151 shown stronger antitumor activity as compared to cetuximab. The maintenance treatment with MM151 plus MEKi resulted the most effective therapeutic modality. In fact, this combination caused an almost complete suppression of tumor growth in SW48, LIM 1215 and CACO2 xenografts model at 30 week. Moreover, in this treatment group, mice with no evidence of tumor were more than double as compared to single agent treated mice. Its superior activity has also been demonstrated, in cetuximab-refractory CRC models. Conclusions These results provide experimental evidence that more efficient and complete EGFR blockade may determine better antitumor activity and could contribute to prevent and/or overcome acquired resistance to EGFR inhibitors. PMID:29137301

  3. Fatal toxic epidermal necrolysis associated with minoxidil.

    Science.gov (United States)

    Karaoui, Lamis R; Chahine-Chakhtoura, Corinne

    2009-04-01

    Minoxidil is a direct-acting peripheral vasodilator for the treatment of symptomatic hypertension, or refractory hypertension associated with target organ damage, that is not manageable with a diuretic and two other antihypertensive drugs. The most frequent adverse events associated with minoxidil include hypertrichosis and cardiovascular events related to its powerful antihypertensive effect, and less frequently, rashes, bullous eruptions, and Stevens-Johnson syndrome (SJS). Evidence suggests that SJS and toxic epidermal necrolysis (TEN) are variants of a single disease with common causes and mechanisms, but differing severities. Epidermal detachment is mild in SJS, moderate in overlap SJS-TEN, and severe (> 30% of body surface area) in TEN. We describe a case of minoxidil-associated SJS that evolved into fatal TEN. A 69-year-old African-American woman with a history of chronic kidney disease was admitted to the hospital for a cerebrovascular accident and uncontrolled hypertension. On hospital day 12, oral minoxidil was added to her drug regimen. On day 23, she developed a maculopapular rash on her face that gradually diffused to her chest and back. Vesicles and papular lesions extended to her extremities and mucosal membranes; results of a skin biopsy revealed SJS. A positive Nikolsky's sign (blisters spread on application of pressure) was detected. On days 27-31, diffuse bullae developed with rash exacerbation. Skin detachment exceeded 30% and was consistent with TEN. The patient died on day 39. An evaluation of the causality and time course suggested that minoxidil was the most likely culpable drug, with a Naranjo adverse drug reaction probability scale score indicating that the likelihood of the association was possible (score of 3). The mechanism of this reaction has not been well elucidated. It may be related to an impaired clearance of the minoxidil metabolite, or an immune stimulation resulting in apoptosis and epidermis destruction. To our knowledge, this

  4. Stevens-Johnson Syndrome (SJS) and Toxic Epidermal Necrolysis ...

    African Journals Online (AJOL)

    REVIEW. Introduction. Stevens-Johnson syndrome (SJS) and toxic epidermal ... that affect the skin and mucous membranes. ... Open Access article distributed under the terms of the .... pathogenic components are removed from plasma. The.

  5. Epidermal and dermal integumentary structures of ankylosaurian dinosaurs.

    Science.gov (United States)

    Arbour, Victoria M; Burns, Michael E; Bell, Phil R; Currie, Philip J

    2014-01-01

    Ankylosaurian dinosaurs are most notable for their abundant and morphologically diverse osteoderms, which would have given them a spiky appearance in life. Isolated osteoderms are relatively common and provide important information about the structure of the ankylosaur dermis, but fossilized impressions of the soft-tissue epidermis of ankylosaurs are rare. Nevertheless, well-preserved integument exists on several ankylosaur fossils that shows osteoderms were covered by a single epidermal scale, but one or many millimeter-sized ossicles may be present under polygonal, basement epidermal scales. Evidence for the taxonomic utility of ankylosaurid epidermal scale architecture is presented for the first time. This study builds on previous osteological work that argues for a greater diversity of ankylosaurids in the Dinosaur Park Formation of Alberta than has been traditionally recognized and adds to the hypothesis that epidermal skin impressions are taxonomically relevant across diverse dinosaur clades. Copyright © 2013 Wiley Periodicals, Inc.

  6. Epidermal Nevus Syndrome Associated with Brain Malformations and Medulloblastoma

    Directory of Open Access Journals (Sweden)

    J Gordon Millichap

    2013-01-01

    Full Text Available Researchers at Juntendo University and Tokyo Women’s Medical University, Japan; and University of California, San Francisco, Ca, report a male infant with epidermal nevus syndrome associated with brainstem and cerebellar malformations and neonatal medulloblastoma.

  7. Real-time three-dimensional imaging of epidermal splitting and removal by high-definition optical coherence tomography

    DEFF Research Database (Denmark)

    Boone, Marc; Draye, Jean Pierre; Verween, Gunther

    2014-01-01

    While real-time 3-D evaluation of human skin constructs is needed, only 2-D non-invasive imaging techniques are available. The aim of this paper is to evaluate the potential of high-definition optical coherence tomography (HD-OCT) for real-time 3-D assessment of the epidermal splitting and decell......While real-time 3-D evaluation of human skin constructs is needed, only 2-D non-invasive imaging techniques are available. The aim of this paper is to evaluate the potential of high-definition optical coherence tomography (HD-OCT) for real-time 3-D assessment of the epidermal splitting...... before and after incubation. Real-time 3-D HD-OCT assessment was compared with 2-D en face assessment by reflectance confocal microscopy (RCM). (Immuno) histopathology was used as control. HD-OCT imaging allowed real-time 3-D visualization of the impact of selected agents on epidermal splitting, dermo......-epidermal junction, dermal architecture, vascular spaces and cellularity. RCM has a better resolution (1 μm) than HD-OCT (3 μm), permitting differentiation of different collagen fibres, but HD-OCT imaging has deeper penetration (570 μm) than RCM imaging (200 μm). Dispase II and NaCl treatments were found...

  8. TMEM45A Is Dispensable for Epidermal Morphogenesis, Keratinization and Barrier Formation.

    Directory of Open Access Journals (Sweden)

    Aurélie Hayez

    Full Text Available TMEM45A gene encodes an initially uncharacterized predicted transmembrane protein. We previously showed that this gene is highly expressed in keratinocytes where its expression correlates with keratinization, suggesting a role in normal epidermal physiology. To test this hypothesis, we generated TMEM45A knockout mice and found that these mice develop without any evident phenotype. The morphology of the epidermis assessed by histology and by labelling differentiation markers in immunofluorescence was not altered. Toluidine blue permeability assay showed that the epidermal barrier develops normally during embryonic development. We also showed that depletion of TMEM45A in human keratinocytes does not alter their potential to form in vitro 3D-reconstructed epidermis. Indeed, epidermis with normal morphogenesis were generated from TMEM45A-silenced keratinocytes. Their expression of differentiation markers quantified by RT-qPCR and evidenced by immunofluorescence labelling as well as their barrier function estimated by Lucifer yellow permeability were similar to the control epidermis. In summary, TMEM45A gene expression is dispensable for epidermal morphogenesis, keratinization and barrier formation. If this protein plays a role in the epidermis, its experimental depletion can possibly be compensated by other proteins in the two experimental models analyzed in this study.

  9. Conformable liquid metal printed epidermal electronics for smart physiological monitoring and simulation treatment

    Science.gov (United States)

    Wang, Xuelin; Zhang, Yuxin; Guo, Rui; Wang, Hongzhang; Yuan, Bo; Liu, Jing

    2018-03-01

    Conformable epidermal printed electronics enabled from gallium-based liquid metals (LMs), highly conductive and low-melting-point alloys, are proposed as the core to achieving immediate contact between skin surface and electrodes, which can avoid the skin deformation often caused by conventional rigid electrodes. When measuring signals, LMs can eliminate resonance problems with shorter time to reach steady state than Pt and gelled Pt electrodes. By comparing the contact resistance under different working conditions, it is demonstrated that both ex vivo and in vivo LM electrode-skin models have the virtues of direct and immediate contact with skin surface without the deformation encountered with conventional rigid electrodes. In addition, electrocardio electrodes composed of conformable LM printed epidermal electronics are adopted as smart devices to monitor electrocardiogram signals of rabbits. Furthermore, simulation treatment for smart defibrillation offers a feasible way to demonstrate the effect of liquid metal electrodes (LMEs) on the human body with less energy loss. The remarkable features of soft epidermal LMEs such as high conformability, good conductivity, better signal stability, and fine biocompatibility represent a critical step towards accurate medical monitoring and future smart treatments.

  10. Roles of p63 in epidermal development and tumorigenesis

    Directory of Open Access Journals (Sweden)

    Jeng-Yuan Yao

    2012-12-01

    Full Text Available pidermis is composed mainly of keratinocytes and is the ma­jor barrier of human body. The development and maintenance of normal epithelial structures and functions require the transcrip­tion factor p63. The p63 gene encodes proteins with structures simi­lar to that of p53, including an N-terminal transacti­vation (TA domain, a DNA-binding domain and a car­boxy-oligomerization domain. TAp63 and ΔNp63 (p63 isoforms without TA domain regulate a wide range of target genes that are important for embryonal development and epithelial integrity. Mutations of p63 gene cause epider­mal abnormalities characterized by ectodermal dysplasia. Recent reports have indicated that p63 plays important role in tumorigenesis as well. However, the relative importance of TAp63 and ΔNp63 in epidermal development and tumorigenesis re­mains mostly unclear and awaits further investigation. In this review, we summarize the current knowledge on the structure and function of p63 and its isoforms.

  11. Intranasal epidermal growth factor treatment rescues neonatal brain injury

    Science.gov (United States)

    Scafidi, Joseph; Hammond, Timothy R.; Scafidi, Susanna; Ritter, Jonathan; Jablonska, Beata; Roncal, Maria; Szigeti-Buck, Klara; Coman, Daniel; Huang, Yuegao; McCarter, Robert J.; Hyder, Fahmeed; Horvath, Tamas L.; Gallo, Vittorio

    2014-02-01

    There are no clinically relevant treatments available that improve function in the growing population of very preterm infants (less than 32 weeks' gestation) with neonatal brain injury. Diffuse white matter injury (DWMI) is a common finding in these children and results in chronic neurodevelopmental impairments. As shown recently, failure in oligodendrocyte progenitor cell maturation contributes to DWMI. We demonstrated previously that the epidermal growth factor receptor (EGFR) has an important role in oligodendrocyte development. Here we examine whether enhanced EGFR signalling stimulates the endogenous response of EGFR-expressing progenitor cells during a critical period after brain injury, and promotes cellular and behavioural recovery in the developing brain. Using an established mouse model of very preterm brain injury, we demonstrate that selective overexpression of human EGFR in oligodendrocyte lineage cells or the administration of intranasal heparin-binding EGF immediately after injury decreases oligodendroglia death, enhances generation of new oligodendrocytes from progenitor cells and promotes functional recovery. Furthermore, these interventions diminish ultrastructural abnormalities and alleviate behavioural deficits on white-matter-specific paradigms. Inhibition of EGFR signalling with a molecularly targeted agent used for cancer therapy demonstrates that EGFR activation is an important contributor to oligodendrocyte regeneration and functional recovery after DWMI. Thus, our study provides direct evidence that targeting EGFR in oligodendrocyte progenitor cells at a specific time after injury is clinically feasible and potentially applicable to the treatment of premature children with white matter injury.

  12. Optimal allocation of leaf epidermal area for gas exchange

    OpenAIRE

    de Boer, Hugo J.; Price, Charles A.; Wagner-Cremer, Friederike; Dekker, Stefan C.; Franks, Peter J.; Veneklaas, Erik J.

    2016-01-01

    Summary A long?standing research focus in phytology has been to understand how plants allocate leaf epidermal space to stomata in order to achieve an economic balance between the plant's carbon needs and water use. Here, we present a quantitative theoretical framework to predict allometric relationships between morphological stomatal traits in relation to leaf gas exchange and the required allocation of epidermal area to stomata. Our theoretical framework was derived from first principles of ...

  13. Role of Pin1 in UVA-induced cell proliferation and malignant transformation in epidermal cells

    International Nuclear Information System (INIS)

    Han, Chang Yeob; Hien, Tran Thi; Lim, Sung Chul; Kang, Keon Wook

    2011-01-01

    Highlights: → Pin1 expression is enhanced by low energy UVA irradiation in both skin tissues of hairless mice and JB6 C141 epidermal cells. → UVA irradiation increases activator protein-1 activity and cyclin D1 in a Pin1-dependent manner. → UVA potentiates EGF-inducible, anchorage-independent growth of epidermal cells, and this is suppressed by Pin1 inhibition or by anti-oxidant. -- Abstract: Ultraviolet A (UVA) radiation (λ = 320-400 nm) is considered a major cause of human skin cancer. Pin1, a peptidyl prolyl isomerase, is overexpressed in most types of cancer tissues and plays an important role in cell proliferation and transformation. Here, we demonstrated that Pin1 expression was enhanced by low energy UVA (300-900 mJ/cm 2 ) irradiation in both skin tissues of hairless mice and JB6 C141 epidermal cells. Exposure of epidermal cells to UVA radiation increased cell proliferation and cyclin D1 expression, and these changes were blocked by Pin1 inhibition. UVA irradiation also increased activator protein-1 (AP-1) minimal reporter activity and nuclear levels of c-Jun, but not c-Fos, in a Pin1-dependent manner. The increases in Pin1 expression and in AP-1 reporter activity in response to UVA were abolished by N-acetylcysteine (NAC) treatment. Finally, we found that pre-exposure of JB6 C141 cells to UVA potentiated EGF-inducible, anchorage-independent growth, and this effect was significantly suppressed by Pin1inhibition or by NAC.

  14. Extracellular Matrix as a Regulator of Epidermal Stem Cell Fate.

    Science.gov (United States)

    Chermnykh, Elina; Kalabusheva, Ekaterina; Vorotelyak, Ekaterina

    2018-03-27

    Epidermal stem cells reside within the specific anatomic location, called niche, which is a microenvironment that interacts with stem cells to regulate their fate. Regulation of many important processes, including maintenance of stem cell quiescence, self-renewal, and homeostasis, as well as the regulation of division and differentiation, are common functions of the stem cell niche. As it was shown in multiple studies, extracellular matrix (ECM) contributes a lot to stem cell niches in various tissues, including that of skin. In epidermis, ECM is represented, primarily, by a highly specialized ECM structure, basement membrane (BM), which separates the epidermal and dermal compartments. Epidermal stem cells contact with BM, but when they lose the contact and migrate to the overlying layers, they undergo terminal differentiation. When considering all of these factors, ECM is of fundamental importance in regulating epidermal stem cells maintenance, proper mobilization, and differentiation. Here, we summarize the remarkable progress that has recently been made in the research of ECM role in regulating epidermal stem cell fate, paying special attention to the hair follicle stem cell niche. We show that the destruction of ECM components impairs epidermal stem cell morphogenesis and homeostasis. A deep understanding of ECM molecular structure as well as the development of in vitro system for stem cell maintaining by ECM proteins may bring us to developing new approaches for regenerative medicine.

  15. Antimicrobial peptides and pro-inflammatory cytokines are differentially regulated across epidermal layers following bacterial stimuli.

    Science.gov (United States)

    Percoco, Giuseppe; Merle, Chloé; Jaouen, Thomas; Ramdani, Yasmina; Bénard, Magalie; Hillion, Mélanie; Mijouin, Lily; Lati, Elian; Feuilloley, Marc; Lefeuvre, Luc; Driouich, Azeddine; Follet-Gueye, Marie-Laure

    2013-12-01

    The skin is a natural barrier between the body and the environment and is colonised by a large number of microorganisms. Here, we report a complete analysis of the response of human skin explants to microbial stimuli. Using this ex vivo model, we analysed at both the gene and protein level the response of epidermal cells to Staphylococcus epidermidis (S. epidermidis) and Pseudomonas fluorescens (P. fluorescens), which are present in the cutaneous microbiota. We showed that both bacterial species affect the structure of skin explants without penetrating the living epidermis. We showed by real-time quantitative polymerase chain reaction (qPCR) that S. epidermidis and P. fluorescens increased the levels of transcripts that encode antimicrobial peptides (AMPs), including human β defensin (hBD)2 and hBD3, and the pro-inflammatory cytokines interleukin (IL)-1α and (IL)-1-β, as well as IL-6. In addition, we analysed the effects of bacterial stimuli on the expression profiles of genes related to innate immunity and the inflammatory response across the epidermal layers, using laser capture microdissection (LCM) coupled to qPCR. We showed that AMP transcripts were principally upregulated in suprabasal keratinocytes. Conversely, the expression of pro-inflammatory cytokines was upregulated in the lower epidermis. These findings were confirmed by protein localisation using specific antibodies coupled to optical or electron microscopy. This work underscores the potential value of further studies that use LCM on human skin explants model to study the roles and effects of the epidermal microbiota on human skin physiology. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  16. Deletion of ALS5, ALS6 or ALS7 increases adhesion of Candida albicans to human vascular endothelial and buccal epithelial cells

    OpenAIRE

    ZHAO, XIAOMIN; OH, SOON-HWAN; HOYER, LOIS L.

    2007-01-01

    C. albicans yeast forms deleted for ALS5, ALS6 or ALS7 are more adherent than a relevant control strain to human vascular endothelial cell monolayers and buccal epithelial cells. In the buccal and vaginal reconstituted human epithelium (RHE) disease models, however, mutant and control strains caused a similar degree of tissue destruction. Deletion of ALS5 or ALS6 significantly slowed growth of the mutant strain; this phenotype was not affected by addition of excess uridine to the culture medi...

  17. Epidermal growth factor and growth in vivo

    International Nuclear Information System (INIS)

    Rhodes, J.A.

    1986-01-01

    Epidermal growth factor (EGF) causes a dose-dependent thickening of the epidermis in suckling mice. The cellular mechanisms underlying this thickening were analyzed by measuring the effect of EGF on the cell-cycle. Neonatal mice were given daily injections of either 2ug EGF/g body weight/day or an equivalent volume of saline, and on the seventh day received a single injection of 3 H-thymidine. At various times the mice were perfused with fixative; 1um sections of skin were stained with a modification of Harris' hematoxylin and were autoradiographed. The sections were analyzed using three methods based on the dependence on time after injection of 3 H-thymidine of: frequency of labelled mitoses, labelling index, and reciprocal grains/nucleus. It was found that EGF caused a two-fold increase in the cell production rate. The effect of exogenous EGF on the morphology of gastric mucosa and incisors of suckling mice was also studied. The gastric mucosa appeared thicker in EGF-treated animals, but the effect was not statistically significant. In contrast to its effect on epidermis and gastric mucosa, EGF caused a significant, dose-dependent decrease in the size of the incisors. Because the mouse submandibular salivary gland is the major source of EGF the effect of sialoadenectomy on female reproductive functions was examined. Ablation of the submandibular gland had no effect on: length of estrus cycle, ability of the female to produce litters, length of the gestation period, litter size, and weight of the litter at birth. There was also no effect on survival of the offspring or on age at which the eyelids separated

  18. Human epidermal growth factor receptor (HER 2)/neu expression ...

    African Journals Online (AJOL)

    use

    2011-11-23

    Nov 23, 2011 ... expression and gene amplification in colorectal cancer. Wei Deng 1, Wei-Guo .... patients whose clinical data (include diagnosis, age, sex, address, disease history, etc) intact ..... Anal Cell Pathol.10: 149-160. Tapia C, Glatz K, ...

  19. Pattern of hormone receptors and human epidermal growth factor ...

    African Journals Online (AJOL)

    2015-02-05

    Feb 5, 2015 ... Department of Pathology, University of Uyo, Uyo, Nigeria. E‑mail: ... Although breast cancer incidence is said to be .... one of the biggest private medical laboratories in Nigeria. ... were extracted from the establishment computer database ... Vision Autostainer 480S (clones ER‑SP1; PR‑SP2; Company:.

  20. Melanoma cells influence the differentiation pattern of human epidermal keratinocytes

    Czech Academy of Sciences Publication Activity Database

    Kodet, O.; Lacina, L.; Krejčí, E.; Dvořáková, B.; Grim, M.; Štork, J.; Kodetová, D.; Vlček, Čestmír; Šáchová, Jana; Kolář, Michal; Strnad, Hynek; Smetana, K.

    2015-01-01

    Roč. 14, č. 1 (2015), s. 1-1 ISSN 1476-4598 R&D Projects: GA ČR GAP304/12/1333; GA MZd(CZ) NT13488; GA MŠk(CZ) ED1.1.00/02.0109 Grant - others:Charles University in Prague(CZ) PRVOUK 27 – 1; Charles University in Prague(CZ) UNCE 204013 Institutional support: RVO:68378050 Keywords : Melanoma * Cancer microenvironment * Melanocyte Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.888, year: 2015

  1. Human epidermal growth factor receptor 2 (HER2) immunoreactivity

    DEFF Research Database (Denmark)

    Rasmussen, Anne-Sofie Schrohl; Pedersen, Hans Christian; Jensen, Sussie Steen

    2011-01-01

    The availability of specific antibody-based test systems is essential to testing of HER2 protein expression. Here, we mapped epitopes recognized by three pharmacodiagnostic HER2 antibodies and investigated their specificity towards peptides and fusion proteins homologous to the intracellular doma...... domains of HER1, HER2, HER3 and HER4. The investigated antibodies were PATHWAY(®) HER2 (clone 4B5; Ventana Medical Systems Inc., Tucson, AZ, USA), HercepTest™ (Dako Denmark A/S, Glostrup, Denmark), and Oracle(®) HER2 (clone CB11; Leica Microsystems GmbH, Wetzlar, Germany)....

  2. Implementation, availability and regulatory status of an OECD accepted Reconstructed Human Epidermis model in Brazil

    Directory of Open Access Journals (Sweden)

    Rodrigo De Vecchi

    2018-02-01

    Full Text Available Introduction: In 2014, Brazil has joined the growing list of countries to ban cosmetic products from being tested on animal models. The new legislation comes into force in 2019. As a result, the interest for validated alternative testing methods for safety assessment has been increasing in academia, industry and associations. However, the lack of specific legislation on the use of biological material of human origin for toxicological tests makes the access to alternative in vitro models difficult. Furthermore, importation to Brazil is not possible on timely manner. Method: In this article, we report the implementation process of a Reconstructed Human Epidermis (SkinEthic™ RHE, an alternative model internationally accepted by OECD, through a technology transfer from EPISKIN® Lyon to Brazil. Regulatory evolution has been motivating the implementation and wide use of alternative methods to animal testing in several industry segments including cosmetic and pharmaceutical. Results: Protocol has been shown to be robust and highly reproducible. Quality control parameters (histological analysis, barrier function test and tissue viability were performed on 24 batches assembled in Brazil. SkinEthic™ RHE model use allows the full replacement of animal test methods for skin hazards identification. It has regulatory acceptance for several toxicological endpoints, such as the Draize test for skin irritation and corrosion. It allows the reduction and refining of pre-clinical protocols through tiered strategies. Implementation of SkinEthic™ RHE protocol is just a first and important step towards a new approach of toxicological safety testing in Brazil. Conclusion: The implementation was successfully done and reported here. However, in order to follow completely the new legislation up to 2019, the availability of validated models is essential. Quality control tests done on RHE batches produced in Brazil demonstrate that the model met OECD acceptance

  3. The Significance of Epidermal Lipid Metabolism in Whole-Body Physiology

    DEFF Research Database (Denmark)

    Kruse, Vibeke; Neess, Ditte; Færgeman, Nils J

    2017-01-01

    The skin is the largest sensory organ of the human body. The skin not only prevents loss of water and other components of the body, but also is involved in regulation of body temperature and serves as an essential barrier, protecting mammals from both routine and extreme environments. Given...... the importance of the skin in temperature regulation, it is surprising that adaptive alterations in skin functions and morphology only vaguely have been associated with systemic physiological responses. Despite that impaired lipid metabolism in the skin often impairs the epidermal permeability barrier...... and insulation properties of the skin, its role in regulating systemic physiology and metabolism is yet to be recognized....

  4. Immune sensitization against epidermal antigens in polymorphous light eruption

    International Nuclear Information System (INIS)

    Gonzalez-Amaro, R.; Baranda, L.; Salazar-Gonzalez, J.F.; Abud-Mendoza, C.; Moncada, B.

    1991-01-01

    To get further insight into the pathogenesis of polymorphous light eruption, we studied nine patients with polymorphous light eruption and six healthy persons. Two skin biopsy specimens were obtained from each person, one from previously ultraviolet light-irradiated skin and another one from unirradiated skin. An epidermal cell suspension, skin homogenate, or both were prepared from each specimen. Autologous cultures were made with peripheral blood mononuclear cells combined with irradiated or unirradiated skin homogenate and peripheral blood mononuclear cells combined with irradiated or unirradiated epidermal cell suspension. Cell proliferation was assessed by 3H-thymidine incorporation assay. The response of peripheral blood mononuclear cells to unirradiated epidermal cells or unirradiated skin homogenate was similar in both patients and controls. However, peripheral blood mononuclear cells from patients with polymorphous light eruption showed a significantly increased proliferative response to both irradiated epidermal cells and irradiated skin homogenate. Our results indicate that ultraviolet light increases the stimulatory capability of polymorphous light eruption epidermal cells in a unidirectional mixed culture with autologous peripheral blood mononuclear cells. This suggests that an immune sensitization against autologous ultraviolet light-modified skin antigens occurs in polymorphous light eruption

  5. Radiotherapy and receptor of epidermal growth factor

    International Nuclear Information System (INIS)

    Deberne, M.

    2009-01-01

    The expression level of the receptor of the epidermal growth factor is in correlation with the tumor cells radiosensitivity. An overexpression of the E.G.F.R. is often present in the bronchi cancer, epidermoid carcinomas of the O.R.L. sphere, esophagus, uterine cervix, and anal duct but also in the rectum cancers and glioblastomas. At the clinical level, the E.G.F.R. expression is in correlation with an unfavourable prognosis after radiotherapy in numerous tumoral localizations. In the rectum cancers it is an independent prognosis factor found in multifactorial analysis: increase of the rate of nodes and local recurrence when the E.G.F.R. is over expressed. In the uterine cervix cancers, the survival is is negatively affected in multifactorial analysis by the E.G.F.R. membranes expression level. At the therapy level, the development of anti E.G.F.R. targeted therapies (tyrosine kinase inhibitors and monoclonal antibodies) opens a new therapy field at radio-sensitivity potentiality. The irradiation makes an activation of the E.G.F.R. way that would be partially responsible of the post irradiation tumoral repopulation. This activation leads the phosphorylation of the PI3 kinase ways and M.A.P. kinase ones, then the Akt protein one that acts an apoptotic modulator part. It has been shown that blocking the E.G.F.R. way acts on three levels: accumulation of ells in phase G1, reduction of the cell repair and increasing of apoptosis. he inhibition of post irradiation action of the E.G.F.R. signal way is a factor explaining the ionizing radiation - anti E.G.F.R. synergy. The preclinical data suggest that the E.G.F.R. blocking by the monoclonal antibodies is more important than the use of tyrosine kinase inhibitors. A first positive randomized study with the cetuximab, published in 2006 in the epidermoid carcinomas of the O.R.L. sphere lead to its authorization on the market with the radiotherapy for this localization. The use of cetuximab in other indication with or in

  6. Comparative SAXS and DSC study on stratum corneum structural organization in an epidermal cell culture model (ROC)

    DEFF Research Database (Denmark)

    Kuntsche, Judith; Herre, Angela; Fahr, Alfred

    2013-01-01

    barrier similar to that of human stratum corneum is, however, a prerequisite. In this study, the stratum corneum lipid organization in an epidermal cell culture model based on rat epidermal keratinocytes (REK organotypic culture, ROC) was investigated by small-angle X-ray scattering (SAXS) in dependence......Cell cultured skin equivalents present an alternative for dermatological in vitro evaluations of drugs and excipients as they provide the advantage of availability, lower variability and higher assay robustness compared to native skin. For penetration/permeation studies, an adequate stratum corneum...... and SC lipid organization. Cultivation for 21days resulted in further minor changes in the structural organization of ROC SC. The SAXS patterns of ROC SC had overall large similarities with that of human SC and point to the presence of a long periodicity phase with a repeat distance of about 122Å, e...

  7. Signalling in the epidermis: the E2F cell cycle regulatory pathway in epidermal morphogenesis, regeneration and transformation.

    Science.gov (United States)

    Ivanova, Iordanka A; D'Souza, Sudhir J A; Dagnino, Lina

    2005-01-01

    The epidermis is the outermost layer in the skin, and it is the first line of defence against the environment. The epidermis also provides a barrier against loss of fluids and electrolytes, which is crucial for life. Essential in the maintenance of this tissue is its ability to continually self-renew and regenerate after injury. These two characteristics are critically dependent on the ability of the principal epidermal cell type, the keratinocyte, to proliferate and to respond to differentiation cues. Indeed, the epidermis is a multilayered tissue composed of keratinocyte stem cells and their differentiated progeny. Central for the control of cell proliferation is the E2F transcription factor regulatory network. This signaling network also includes cyclins, cdk, cdk inhibitors and the retinoblastoma (pRb) family of proteins. The biological importance of the E2F/pRb pathway is emphasized by the fact that a majority of human tumours exhibit alterations that disrupt the ability of pRb proteins to inhibit E2F, leading to permanent activation of the latter. Further, E2F is essential for normal epidermal regeneration after injury. Other member of the E2F signaling pathway are also involved in epidermal development and pathophysiology. Thus, whereas the pRb family of proteins is essential for epidermal morphogenesis, abnormal regulation of cyclins and E2F proteins results in tumorgenesis in this tissue. In this review, we discuss the role of each member of this important growth regulatory network in epidermal formation, homeostasis and carcinogenesis.

  8. An in vitro method for detecting chemical sensitization using human reconstructed skin models and its applicability to cosmetic, pharmaceutical, and medical device safety testing.

    Science.gov (United States)

    McKim, James M; Keller, Donald J; Gorski, Joel R

    2012-12-01

    Chemical sensitization is a serious condition caused by small reactive molecules and is characterized by a delayed type hypersensitivity known as allergic contact dermatitis (ACD). Contact with these molecules via dermal exposure represent a significant concern for chemical manufacturers. Recent legislation in the EU has created the need to develop non-animal alternative methods for many routine safety studies including sensitization. Although most of the alternative research has focused on pure chemicals that possess reasonable solubility properties, it is important for any successful in vitro method to have the ability to test compounds with low aqueous solubility. This is especially true for the medical device industry where device extracts must be prepared in both polar and non-polar vehicles in order to evaluate chemical sensitization. The aim of this research was to demonstrate the functionality and applicability of the human reconstituted skin models (MatTek Epiderm(®) and SkinEthic RHE) as a test system for the evaluation of chemical sensitization and its potential use for medical device testing. In addition, the development of the human 3D skin model should allow the in vitro sensitization assay to be used for finished product testing in the personal care, cosmetics, and pharmaceutical industries. This approach combines solubility, chemical reactivity, cytotoxicity, and activation of the Nrf2/ARE expression pathway to identify and categorize chemical sensitizers. Known chemical sensitizers representing extreme/strong-, moderate-, weak-, and non-sensitizing potency categories were first evaluated in the skin models at six exposure concentrations ranging from 0.1 to 2500 µM for 24 h. The expression of eight Nrf2/ARE, one AhR/XRE and two Nrf1/MRE controlled gene were measured by qRT-PCR. The fold-induction at each exposure concentration was combined with reactivity and cytotoxicity data to determine the sensitization potential. The results demonstrated that

  9. Inhibition of epidermal cell proliferation by borderline rays

    Energy Technology Data Exchange (ETDEWEB)

    Born, W [Freiburg Univ.; Daikeler, G

    1976-08-01

    Treatment of guinea pig flanks with very soft x-rays (borderline rays) directly caused a partial block of epidermal DNA synthesis which had been determined by measuring the /sup 3/H-Tdr incorporation. Higher doses and repeated applications would undoubtedly cause lasting damage to the tissue. The enhanced epidermal DNA synthesis which is sometimes observed should not be misinterpreted as a sign of a directly biopositive utilisation of the quantum energy supplied. Rather, it is a secondary repair process following initial phases of depression. A reparative increase in DNA synthesis may also occur as a primary process if the radiation is almost completely absorbed above the germinative layer.

  10. Epidermal growth factor in mammary glands and milk from rats

    DEFF Research Database (Denmark)

    Thulesen, J; Raaberg, Lasse; Nexø, Ebba

    1993-01-01

    Epidermal growth factor (EGF) is one of the major growth-promoting agents in milk. Using immunohistochemistry we localized EGF in the mammary glands of lactating rats to the luminal border of the secretory cells. Following proteolytic pretreatment of the histological sections, the EGF-immunoreact......Epidermal growth factor (EGF) is one of the major growth-promoting agents in milk. Using immunohistochemistry we localized EGF in the mammary glands of lactating rats to the luminal border of the secretory cells. Following proteolytic pretreatment of the histological sections, the EGF...

  11. Influence of epidermal growth factor on liver regeneration after partial hepatectomy in rats

    DEFF Research Database (Denmark)

    Olsen, Peter Skov; Boesby, S.; Kirkegaard, P.

    2013-01-01

    The role of epidermal growth factor on liver regeneration after partial hepatectomy in rats was investigated. After a 70% hepatectomy in rats, the concentration of epidermal growth factor in portal venous blood was unchanged compared with unoperated controls. However, small amounts of epidermal...... growth factor could be identified in portal venous blood after intestinal instillation of epidermal growth factor. Brunner's glands and the submandibular glands secrete epidermal growth factor. Extirpation of Brunner's glands decreased liver regeneration, whereas removal of the submandibular glands had...... no effect on liver regeneration. Epidermal growth factor antiserum reduced liver regeneration significantly. Oral or s.c. administration of epidermal growth factor had no effect on liver regeneration, whereas epidermal growth factor enhanced the effect of insulin and glucagon on liver regeneration...

  12. An Epidermal Biosensor for Carcinoembryonic Antigen

    National Research Council Canada - National Science Library

    Schwartz, Pauline

    2001-01-01

    .... The research we have conducted during the first and second year of the grant has allowed us to conclude that human keratinocytes in vitro can be engineered to express a chimeric cell surface receptor...

  13. An Epidermal Biosensor for Carcinoembryonic Antigen

    National Research Council Canada - National Science Library

    Schwartz, Pauline

    2003-01-01

    .... The research we have conducted has allowed us to conclude that human keratinocytes in vitro can be engineered to express a chimeric cell surface receptor and that these modified cells could recognize...

  14. In vitro dermal and epidermal cellular response to titanium alloy implants fabricated with electron beam melting.

    Science.gov (United States)

    Springer, Jessica Collins; Harrysson, Ola L A; Marcellin-Little, Denis J; Bernacki, Susan H

    2014-10-01

    Transdermal osseointegrated prostheses (TOPs) are emerging as an alternative to socket prostheses. Electron beam melting (EBM) is a promising additive manufacturing technology for manufacture of custom, freeform titanium alloy (Ti6Al4V) implants. Skin ongrowth for infection resistance and mechanical stability are critically important to the success of TOP, which can be influenced by material composition and surface characteristics. We assessed viability and proliferation of normal human epidermal keratinocytes (NHEK) and normal human dermal fibroblasts (NHDF) on several Ti6Al4V surfaces: solid polished commercial, solid polished EBM, solid unpolished EBM and porous unpolished EBM. Cell proliferation was evaluated at days 2 and 7 using alamarBlue(®) and cell viability was analyzed with a fluorescence-based live-dead assay after 1 week. NHDF and NHEK were viable and proliferated on all Ti6Al4V surfaces. NHDF proliferation was highest on commercial and EBM polished surfaces. NHEK was highest on commercial polished surfaces. All EBM Ti6Al4V discs exhibited an acceptable biocompatibility profile compared to solid Ti6Al4V discs from a commercial source for dermal and epidermal cells. EBM may be considered as an option for fabrication of custom transdermal implants. Copyright © 2014 IPEM. Published by Elsevier Ltd. All rights reserved.

  15. Genetic Markers and Danger Signals in Stevens-Johnson Syndrome and Toxic Epidermal Necrolysis

    Directory of Open Access Journals (Sweden)

    Wen-Hung Chung

    2010-01-01

    Full Text Available Stevens-Johnson syndrome (SJS and toxic epidermal necrolysis (TEN are life-threatening adverse reactions, which could be induced by a variety of drugs. It was proposed that human leukocyte antigen (HLA-restricted presentation of antigens (drugs or their metabolites to T lymphocytes initiates the immune reactions of SJS/ TEN. However, the genetic susceptibility and the exact pathogenesis were not clear until the recent studies. We first identified that HLA-B*1502 is strongly associated with carbamazepine (CBZ-induced SJS/TEN and HLA-B*5801 with allopurinol-SJS/TEN in Han Chinese. The same associations had been validated across different human populations. For the downstream danger signals, Fas-Fas ligand (FasL and perforin/granzyme B had been advocated as cytotoxic mediators for keratinocyte death in SJS/TEN. However, expression levels of these cytotoxic proteins from the skin lesions were too low to explain the distinct and extensive epidermal necrosis. Our recent study identified that the granulysin, a cytotoxic protein released from cytotoxic T cells or natural killer (NK cells, is a key mediator for disseminated keratinocyte death in SJS/TEN. This article aims to provide an overview of both of the genomic and immunologic perspectives of SJS/TEN. These studies give us a better understanding of the immune mechanisms, biomarkers for disease prevention and early diagnosis, as well as providing the therapeutic targets for the treatments of SJS/TEN.

  16. Higher Expression of Epidermal Growth Factor Receptor Is Associated with Extracellular Matrix Metalloprotease Inducer in Colorectal Adenocarcinoma: Tissue Microarray Analysis of Immunostaining Score with Clinicopathological Parameters

    Directory of Open Access Journals (Sweden)

    Jong-Shiaw Jin

    2006-01-01

    Full Text Available Aim: Extracellular matrix metalloprotease inducer (EMMPRIN expression was demonstrated in several cancers, but its expression profile in colorectal cancers remains unclear. Epidermal growth factor receptor (EGFR was reported to regulate EMMPRIN expression in human epithelial cancers. Our purpose was to determine EMMPRIN expression and its relationship with EGFR in colorectal cancers.

  17. Hair Follicle and Sebaceous Gland De Novo Regeneration With Cultured Epidermal Stem Cells and Skin-Derived Precursors.

    Science.gov (United States)

    Wang, Xiaoxiao; Wang, Xusheng; Liu, Jianjun; Cai, Ting; Guo, Ling; Wang, Shujuan; Wang, Jinmei; Cao, Yanpei; Ge, Jianfeng; Jiang, Yuyang; Tredget, Edward E; Cao, Mengjun; Wu, Yaojiong

    2016-12-01

    : Stem cell-based organ regeneration is purported to enable the replacement of impaired organs in the foreseeable future. Here, we demonstrated that a combination of cultured epidermal stem cells (Epi-SCs) derived from the epidermis and skin-derived precursors (SKPs) was capable of reconstituting functional hair follicles and sebaceous glands (SG). When Epi-SCs and SKPs were mixed in a hydrogel and implanted into an excisional wound in nude mice, the Epi-SCs formed de novo epidermis along with hair follicles, and SKPs contributed to dermal papilla in the neogenic hair follicles. Notably, a combination of culture-expanded Epi-SCs and SKPs derived from the adult human scalp were sufficient to generate hair follicles and hair. Bone morphogenetic protein 4, but not Wnts, sustained the expression of alkaline phosphatase in SKPs in vitro and the hair follicle-inductive property in vivo when SKPs were engrafted with neonatal epidermal cells into excisional wounds. In addition, Epi-SCs were capable of differentiating into sebocytes and formed de novo SGs, which excreted lipids as do normal SGs. Thus our results indicate that cultured Epi-SCs and SKPs are sufficient to generate de novo hair follicles and SGs, implying great potential to develop novel bioengineered skin substitutes with appendage genesis capacity. In postpartum humans, skin appendages lost in injury are not regenerated, despite the considerable achievement made in skin bioengineering. In this study, transplantation of a combination of culture-expanded epidermal stem cells and skin-derived progenitors from mice and adult humans led to de novo regeneration of functional hair follicles and sebaceous glands. The data provide transferable knowledge for the development of novel bioengineered skin substitutes with epidermal appendage regeneration capacity. ©AlphaMed Press.

  18. Novel targeted approaches to treating biliary tract cancer: the dual epidermal growth factor receptor and ErbB-2 tyrosine kinase inhibitor NVP-AEE788 is more efficient than the epidermal growth factor receptor inhibitors gefitinib and erlotinib.

    Science.gov (United States)

    Wiedmann, Marcus; Feisthammel, Jürgen; Blüthner, Thilo; Tannapfel, Andrea; Kamenz, Thomas; Kluge, Annett; Mössner, Joachim; Caca, Karel

    2006-08-01

    Aberrant activation of the epidermal growth factor receptor is frequently observed in neoplasia, notably in tumors of epithelial origin. Attempts to treat such tumors with epidermal growth factor receptor antagonists resulted in remarkable success in recent studies. Little is known, however, about the efficacy of this therapy in biliary tract cancer. Protein expression of epidermal growth factor receptor, ErbB-2, and vascular endothelial growth factor receptor-2 was assessed in seven human biliary tract cancer cell lines by immunoblotting. In addition, histological sections from 19 patients with extrahepatic cholangiocarcinoma were analyzed for epidermal growth factor receptor, ErbB-2 and vascular endothelial growth factor receptor-2 expression by immunohistochemistry. Moreover, we sequenced the cDNA products representing the entire epidermal growth factor receptor coding region of the seven cell lines, and searched for genomic epidermal growth factor receptor amplifications and polysomy by fluorescence in-situ hybridization. Cell growth inhibition by gefitinib erlotinib and NVP-AEE788 was studied in vitro by automated cell counting. In addition, the anti-tumoral effect of erlotinib and NVP-AEE788 was studied in a chimeric mouse model. The anti-tumoral drug mechanism in this model was assessed by MIB-1 antibody staining, terminal deoxynucleotidyl transfer-mediated dUTP nick end-labelling assay, von Willebrand factor staining, and immunoblotting for p-p42/44 (p-Erk1/2, p-MAPK) and p-AKT. Immunoblotting revealed expression of epidermal growth factor receptor, ErbB-2, and vascular endothelial growth factor receptor-2 in all biliary tract cancer cell lines. EGFR was detectable in six of 19 (32%) extrahepatic human cholangiocarcinoma tissue samples, ErbB-2 in 16 of 19 (84%), and vascular endothelial growth factor receptor-2 in nine of 19 (47%). Neither epidermal growth factor receptor mutations nor amplifications or polysomy were found in the seven biliary tract cancer

  19. Fractional sunburn threshold UVR doses generate equivalent vitamin D and DNA damage in skin types I-VI, but with epidermal DNA damage gradient correlated to skin darkness.

    Science.gov (United States)

    Shih, Barbara B; Farrar, Mark D; Cooke, Marcus S; Osman, Joanne; Langton, Abigail K; Kift, Richard; Webb, Ann R; Berry, Jacqueline L; Watson, Rachel E B; Vail, Andy; de Gruijl, Frank R; Rhodes, Lesley E

    2018-05-03

    Public health guidance recommends limiting sun-exposure to sub-sunburn levels, but it's unknown whether these can gain vitamin D (for musculoskeletal health) whilst avoiding epidermal DNA damage (initiates skin cancer). Well-characterised healthy humans of all skin types (I-VI; lightest to darkest skin) were exposed to a low dose-series of solar simulated UVR of 20-80% their individual sunburn threshold dose (minimal erythemal dose, MED). Significant UVR dose-responses were seen for serum 25(OH)D and whole epidermal CPD, with as little as 0.2 MED concurrently producing 25(OH)D and CPD. Notably, fractional MEDs generated equivalent levels of whole epidermal CPD and 25(OH)D across all skin types. Crucially, we demonstrated an epidermal gradient of CPD formation strongly correlated with skin darkness (r=0.74; Pskin types, ranging from darkest skin, where high CPD levels occurred superficially with none in the germinative basal layer, through to lightest skin where CPD were induced evenly across the epidermal depth. Darker skin people can be encouraged to utilise sub-sunburn UVR-exposure to enhance their vitamin D. In lighter skin people, basal cell damage occurs concurrent with vitamin D synthesis at exquisitely low UVR levels, providing an explanation for their high skin cancer incidence; greater caution is required. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

  20. Micromorphology and development of the epicuticular structure on the epidermal cell of ginseng leaves

    Directory of Open Access Journals (Sweden)

    Kyounghwan Lee

    2015-04-01

    Conclusion: The outwardly projected cuticle and epidermal cell wall (i.e., an epicuticular wrinkle acts as a major barrier to block out sunlight in ginseng leaves. The small vesicles in the peripheral region of epidermal cells may suppress the cuticle and parts of epidermal wall, push it upward, and consequently contribute to the formation of the epicuticular structure.

  1. Retrospective Study of Epidermal Parasitic Skin Diseases amongst ...

    African Journals Online (AJOL)

    ADOWIE PERE

    ABSTRACT: A ten year retrospective study (1997-2006) was undertaken to determine the prevalence of. Epidermal Parasitic Skin Diseases (EPSD) among out-patients from the skin diseases hospital in Maiduguri, Borno state. Out of 10,000 out-patients examined during the study period, 3527(35.27%) where infected with ...

  2. An immunologic approach to induction of epidermal growth factor deficiency

    DEFF Research Database (Denmark)

    Raaberg, Lasse; Nexø, Ebba; Poulsen, Steen Seier

    1995-01-01

    Epidermal growth factor (EGF) in pharmacologic doses is able to induce growth and development in the fetus and the newborn. To investigate the opposite situation, the effects of insufficient amounts of EGF during development, we wanted to establish an in vivo model with a state of EGF deficiency....

  3. Clinical Studies on conformal radiotherapy combined with epidermal ...

    African Journals Online (AJOL)

    Purpose: To study the effect of conformal radiotherapy combined with epidermal growth factor receptor-tyrosine kinase inhibitor (EGFR-TKI) in the second-line treatment of non-small cell lung cancer (NSCLC). Methods: A total of 316 patients attending Shanghai Pulmonary Hospital affiliated to Tongji University, were divided ...

  4. Assessment of the Developmental Toxicity of Epidermal Growth ...

    African Journals Online (AJOL)

    Purpose: To determine whether epidermal growth factor (EGF) is involved in reproductive developmental toxicity, using the embryonic stem cell test (EST), as well as ascertain how EGF influences embryonic development. Methods: To predict developmental toxicity on the basis of reducing cell viability and inhibition of ...

  5. Adding a Piece to the Leaf Epidermal Cell Shape Puzzle.

    Science.gov (United States)

    von Wangenheim, Daniel; Wells, Darren M; Bennett, Malcolm J

    2017-11-06

    The jigsaw puzzle-shaped pavement cells in the leaf epidermis collectively function as a load-bearing tissue that controls organ growth. In this issue of Developmental Cell, Majda et al. (2017) shed light on how the jigsaw shape can arise from localized variations in wall stiffness between adjacent epidermal cells. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. Gastric luminal epidermal growth factor is affected by diet | Iputo ...

    African Journals Online (AJOL)

    Objective. Diet is an area of major interest to those investigating the causes of cancer of the oesophagus in the Transkei. This study looked at the associations between intragastric epidermal growth factor level, diet and intragastric pH. Setting and subjects. A dietary survey was co-ordinated with studies of gastric luminal ...

  7. Epidermal hydration levels in rosacea patients improve after minocycline therapy.

    LENUS (Irish Health Repository)

    Ní Raghallaigh, S

    2013-12-06

    Patients with rosacea frequently report increased skin sensitivity, with features suggestive of an abnormal stratum corneum (SC) permeability barrier. Sebum, pH and hydration levels influence epidermal homeostasis. The correlation of the change in these parameters with clinically effective treatment has not been previously analysed.

  8. Inflammatory linear verrucous epidermal naevus: Report of three ...

    African Journals Online (AJOL)

    Background: Epidermal naevi are congenital harmatomas that arise from embryonal ectodermal cells. The inflammatory linear verrucous variant is rare and presents with disturbing symptoms. In blacks the classical erythema is not common but pruritus and discharge are the commonest features. Methods and results: We ...

  9. Identification of grazed grasses using epidermal characters | R ...

    African Journals Online (AJOL)

    The use of anatomical features of the abaxial epidermis of grasses is discussed for the identification of fragments of epidermis present in samples of rumen. The reliability of this technique, and the variation of the epidermal characters in two widely distributed species of grass, is given. A "Key" to identity certain genera of ...

  10. Improvement of arbutin trans-epidermal delivery using ...

    African Journals Online (AJOL)

    Purpose: To assess the ability of radiofrequency (RF) microporation to promote trans-epidermal delivery of arbutin. Methods: To investigate the enhancing effect of RF microchannels on skin permeation of arbutin, in vitro skin permeability studies were performed with RF microporation-treated Hartley albino guinea pig skin ...

  11. Automated measurement of epidermal thickness from optical coherence tomography images using line region growing

    Science.gov (United States)

    Delacruz, Jomer; Weissman, Jesse; Gossage, Kirk

    2010-02-01

    Optical Coherence Tomography (OCT) is a non-invasive imaging modality that acquires cross sectional images of tissue in-vivo. It accelerates skin diagnosis by eliminating invasive biopsy and laborious histology in the process. Dermatologists have widely used it for looking at morphology of skin diseases such as psoriasis, dermatitis, basal cell carcinoma etc. Skin scientists have also successfully used it for looking at differences in epidermal thickness and its underlying structure with respect to age, body sites, ethnicity, gender, and other related factors. Similar to other in-vivo imaging systems, OCT images suffer from a high degree of speckle and noise content, which hinders examination of tissue structures. Most of the previous work in OCT segmentation of skin was done manually. This compromised the quality of the results by limiting the analyses to a few frames per area. In this paper, we discuss a region growing method for automatic identification of the upper and lower boundaries of the epidermis in living human skin tissue. This image analysis method utilizes images obtained from a frequency-domain OCT. This system is high-resolution and high-speed, and thus capable of capturing volumetric images of the skin in short time. The three-dimensional (3D) data provides additional information that is used in the segmentation process to help compensate for the inherent noise in the images. This method not only provides a better estimation of the epidermal thickness, but also generates a 3D surface map of the epidermal-dermal junction, from which underlying topography can be visualized and further quantified.

  12. Comparative Genomics Identifies Epidermal Proteins Associated with the Evolution of the Turtle Shell.

    Science.gov (United States)

    Holthaus, Karin Brigit; Strasser, Bettina; Sipos, Wolfgang; Schmidt, Heiko A; Mlitz, Veronika; Sukseree, Supawadee; Weissenbacher, Anton; Tschachler, Erwin; Alibardi, Lorenzo; Eckhart, Leopold

    2016-03-01

    The evolution of reptiles, birds, and mammals was associated with the origin of unique integumentary structures. Studies on lizards, chicken, and humans have suggested that the evolution of major structural proteins of the outermost, cornified layers of the epidermis was driven by the diversification of a gene cluster called Epidermal Differentiation Complex (EDC). Turtles have evolved unique defense mechanisms that depend on mechanically resilient modifications of the epidermis. To investigate whether the evolution of the integument in these reptiles was associated with specific adaptations of the sequences and expression patterns of EDC-related genes, we utilized newly available genome sequences to determine the epidermal differentiation gene complement of turtles. The EDC of the western painted turtle (Chrysemys picta bellii) comprises more than 100 genes, including at least 48 genes that encode proteins referred to as beta-keratins or corneous beta-proteins. Several EDC proteins have evolved cysteine/proline contents beyond 50% of total amino acid residues. Comparative genomics suggests that distinct subfamilies of EDC genes have been expanded and partly translocated to loci outside of the EDC in turtles. Gene expression analysis in the European pond turtle (Emys orbicularis) showed that EDC genes are differentially expressed in the skin of the various body sites and that a subset of beta-keratin genes within the EDC as well as those located outside of the EDC are expressed predominantly in the shell. Our findings give strong support to the hypothesis that the evolutionary innovation of the turtle shell involved specific molecular adaptations of epidermal differentiation. © The Author 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  13. Getting under the skin of epidermal morphogenesis.

    Science.gov (United States)

    Fuchs, Elaine; Raghavan, Srikala

    2002-03-01

    At the surface of the skin, the epidermis serves as the armour for the body. Scientists are now closer than ever to understanding how the epidermis accomplishes this extraordinary feat, and is able to survive and replenish itself under the harshest conditions that face any tissue. By combining genetic engineering with cell-biological studies and with human genome data analyses, skin biologists are discovering the mechanisms that underlie the development and differentiation of the epidermis and hair follicles of the skin. This explosion of knowledge paves the way for new discoveries into the genetic bases of human skin disorders and for developing new therapeutics.

  14. A gene-protein assay for human epidermal growth factor receptor 2 (HER2: brightfield tricolor visualization of HER2 protein, the HER2 gene, and chromosome 17 centromere (CEN17 in formalin-fixed, paraffin-embedded breast cancer tissue sections

    Directory of Open Access Journals (Sweden)

    Nitta Hiroaki

    2012-05-01

    Full Text Available Abstract Background The eligibility of breast cancer patients for human epidermal growth factor receptor 2 (HER2-directed therapies is determined by the HER2 gene amplification and/or HER2 protein overexpression status of the breast tumor as determined by in situ hybridization (ISH or immunohistochemistry (IHC, respectively. Our objective was to combine the US Food and Drug Administration (FDA-approved HER2 & chromosome 17 centromere (CEN17 brightfield ISH (BISH and HER2 IHC assays into a single automated HER2 gene-protein assay allowing simultaneous detection of all three targets in a single tissue section. Methods The HER2 gene-protein assay was optimized using formalin-fixed, paraffin-embedded (FFPE samples of the xenograft tumors MCF7 [HER2 negative (non-amplified gene, protein negative] and Calu-3 [HER2 positive (amplified gene, protein positive]. HER2 IHC was performed using a rabbit monoclonal anti-HER2 antibody (clone 4B5 and a conventional 3,3'-diaminobenzidine IHC detection. The HER2 & CEN17 BISH signals were visualized using horseradish peroxidase-based silver and alkaline phosphatase-based red detection systems, respectively with a cocktail of 2,4-dinitrophenyl-labeled HER2 and digoxigenin-labeled CEN17 probes. The performance of the gene-protein assay on tissue microarray slides containing 189 randomly selected FFPE clinical breast cancer tissue cores was compared to that of the separate HER2 IHC and HER2 & CEN17 BISH assays. Results HER2 protein detection was optimal when the HER2 IHC protocol was used before (rather than after the BISH protocol. The sequential use of HER2 IHC and HER2 & CEN17 BISH detection steps on FFPE xenograft tumor sections appropriately co-localized the HER2 protein, HER2 gene, and CEN17 signals after mitigating the silver background staining by using a naphthol phosphate-containing hybridization buffer for the hybridization step. The HER2 protein and HER2 gene status obtained using the multiplex HER2 gene

  15. Sulindac metabolites inhibit epidermal growth factor receptor activation and expression

    Directory of Open Access Journals (Sweden)

    Ahnen Dennis

    2005-01-01

    Full Text Available Abstract Background Regular use of nonsteroidal anti-inflammatory drugs (NSAIDs is associated with a decreased mortality from colorectal cancer (CRC. NSAIDs induce apoptotic cell death in colon cancer cells in vitro and inhibit growth of neoplastic colonic mucosa in vivo however, the biochemical mechanisms required for these growth inhibitory effects are not well defined. We previously reported that metabolites of the NSAID sulindac downregulate extracellular-signal regulated kinase 1/2 (ERK1/2 signaling and that this effect is both necessary and sufficient for the apoptotic effects of these drugs. The goal of this project was to specifically test the hypothesis that sulindac metabolites block activation and/or expression of the epidermal growth factor (EGF receptor (EGFR. Methods HT29 human colon cancer cells were treated with EGF, alone, or in the presence of sulindac sulfide or sulindac sulfone. Cells lysates were assayed by immunoblotting for phosphorylated EGFR (pEGFR, pY1068, total EGFR, phosphorylated ERK1/2 (pERK1/2, total ERK1/2, activated caspase-3, and α-tubulin. Results EGF treatment rapidly induced phosphorylation of both EGFR and ERK1/2 in HT29 colon cancer cells. Pretreatment with sulindac metabolites for 24 h blocked EGF-induced phosphorylation of both EGFR and ERK1/2 and decreased total EGFR protein expression. Under basal conditions, downregulation of pEGFR and total EGFR was detected as early as 12 h following sulindac sulfide treatment and persisted through at least 48 h. Sulindac sulfone induced downregulation of pEGFR and total EGFR was detected as early as 1 h and 24 h, respectively, following drug treatment, and persisted through at least 72 h. EGFR downregulation by sulindac metabolites was observed in three different CRC cell lines, occurred prior to the observed downregulation of pERK1/2 and induction of apoptosis by these drugs, and was not dependent of caspase activation. Conclusion These results suggest that

  16. Optical Molecular Imaging of Epidermal Growth Factor Receptor Expression to Improve Detection of Oral Neoplasia

    Directory of Open Access Journals (Sweden)

    Nitin Nitin

    2009-06-01

    Full Text Available Background: The development of noninvasive molecular imaging approaches has the potential to improve management of cancer. Methods: In this study, we demonstrate the potential of noninvasive topical delivery of an epidermal growth factor-Alexa 647 (EGF-Alexa 647 conjugate to image changes in epidermal growth factor receptor expression associated with oral neoplasia. We report a series of preclinical analyses to evaluate the optical contrast achieved after topical delivery of EGF-Alexa 647 in a variety of model systems, including cells, three-dimensional tissue cultures, and intact human tissue specimens using wide-field and high-resolution fluorescence imaging. Data were collected from 17 different oral cancer patients: eight pairs of normal and abnormal biopsies and nine resected tumors were examined. Results: The EGF-dye conjugate can be uniformly delivered throughout the oral epithelium with a penetration depth exceeding 500 µm and incubation time of less than 30 minutes. After EGF-Alexa 647 incubation, the presence of oral neoplasia is associated with a 1.5- to 6.9-fold increase in fluorescence contrast compared with grossly normal mucosa from the same patient with both wide-field and high-resolution fluorescence imaging. Conclusions: Results illustrate the potential of EGF-targeted fluorescent agents for in vivo molecular imaging, a technique that may aid in the diagnosis and characterization of oral neoplasia and allow real-time detection of tumor margins.

  17. Aberrant Wound Healing in an Epidermal Interleukin-4 Transgenic Mouse Model of Atopic Dermatitis

    Science.gov (United States)

    Zhao, Yan; Bao, Lei; Chan, Lawrence S.; DiPietro, Luisa A.; Chen, Lin

    2016-01-01

    Wound healing in a pre-existing Th2-dominated skin milieu was assessed by using an epidermal specific interleukin-4 (IL-4) transgenic (Tg) mouse model, which develops a pruritic inflammatory skin condition resembling human atopic dermatitis. Our results demonstrated that IL-4 Tg mice had delayed wound closure and re-epithelialization even though these mice exhibited higher degrees of epithelial cell proliferation. Wounds in IL-4 Tg mice also showed a marked enhancement in expression of inflammatory cytokines/chemokines, elevated infiltration of inflammatory cells including neutrophils, macrophages, CD3+ lymphocytes, and epidermal dendritic T lymphocytes. In addition, these mice exhibited a significantly higher level of angiogenesis as compared to wild type mice. Furthermore, wounds in IL-4 Tg mice presented with larger amounts of granulation tissue, but had less expression and deposition of collagen. Taken together, an inflamed skin condition induced by IL-4 has a pronounced negative influence on the healing process. Understanding more about the pathogenesis of wound healing in a Th2- dominated environment may help investigators explore new potential therapeutic strategies. PMID:26752054

  18. Stepwise Progress in Epidermal Growth Factor Receptor/Radiation Studies for Head and Neck Cancer

    International Nuclear Information System (INIS)

    Harari, Paul M.

    2007-01-01

    The U.S. Food and Drug Administration approval of four new epidermal growth factor receptor (EGFR) inhibitors for cancer therapy (cetuximab, panitumumab, gefitinib, and erlotinib) over the last 3 years is a remarkable milestone in oncology. Indeed, molecular inhibition of EGFR signaling represents one of the most promising current arenas for the development of molecular-targeted cancer therapies. Epidermal growth factor receptor inhibitors from both the monoclonal antibody and tyrosine kinase inhibitor class have demonstrated clinical activity in the treatment of a broad spectrum of common human malignancies. For the discipline of radiation oncology, the 2006 report of a phase III trial demonstrating a survival advantage for advanced head and neck cancer patients with the addition of weekly cetuximab during a 7-week course of radiation is particularly gratifying. Indeed, this is the first phase III trial to confirm a survival advantage with the addition of a molecular-targeted agent to radiation. Furthermore, this result seems to have been achieved with only a modest increment in overall treatment toxicity and with very high compliance to the prescribed treatment regimen. Nevertheless, much remains to be learned regarding the rational integration of EGFR inhibitors into cancer treatment regimens, as well as methods to optimize the selection of patients most likely to benefit from EGFR inhibitor strategies

  19. Altered [125I]epidermal growth factor binding and receptor distribution in psoriasis

    International Nuclear Information System (INIS)

    Nanney, L.B.; Stoscheck, C.M.; Magid, M.; King, L.E. Jr.

    1986-01-01

    Stimulation of growth and differentiation of human epidermis by epidermal growth factor (EGF) is mediated by its binding to specific receptors. Whether EGF receptors primarily mediate cell division or differentiation in hyperproliferative disease such as psoriasis vulgaris is unclear. To study the pathogenesis of psoriasis, 4-mm2 punch biopsy specimens of normal, uninvolved, and involved psoriatic skin were assayed for EGF receptors by autoradiographic, immunohistochemical, and biochemical methods. Using autoradiographic and immunohistochemical methods, basal keratinocytes were found to contain the greatest number of EGF binding sites and immunoreactive receptors as compared to the upper layers of the epidermis in both normal epidermis and psoriatic skin. No EGF receptor differences between normal and psoriatic epidermis were observed in this layer. In the upper layers of the epidermis, a 2-fold increase in EGF binding capacity was observed in psoriatic skin as compared with normal thin or thick skin. Biochemical methods indicated that [ 125 I]EGF binding was increased in psoriatic epidermis as compared with similar thickness normal epidermis when measured on a protein basis. Epidermal growth factor was shown to increase phosphorylation of the EGF receptor in skin. EGF receptors retained in the nonmitotic stratum spinosum and parakeratotic stratum corneum may reflect the incomplete, abnormal differentiation that occurs in active psoriatic lesions. Alternatively, retained EGF receptors may play a direct role in inhibiting cellular differentiation in the suprabasal layers

  20. Functional Role of Cyclin-Dependent Kinase 5 in the Regulation of Melanogenesis and Epidermal Structure.

    Science.gov (United States)

    Dong, Changsheng; Yang, Shanshan; Fan, Ruiwen; Ji, Kaiyuan; Zhang, Junzhen; Liu, Xuexian; Hu, Shuaipeng; Xie, Jianshan; Liu, Yu; Gao, Wenjun; Wang, Haidong; Yao, Jianbo; Smith, George W; Herrid, Muren

    2017-10-23

    The mammalian integumentary system plays important roles in body homeostasis, and dysfunction of melanogenesis or epidermal development may lead to a variety of skin diseases, including melanoma. Skin pigmentation in humans and coat color in fleece-producing animals are regulated by many genes. Among them, microphthalmia-associated transcription factor (MITF) and paired-box 3 (PAX3) are at the top of the cascade and regulate activities of many important melanogenic enzymes. Here, we report for the first time that cyclin-dependent kinase 5 (Cdk5) is an essential regulator of MITF and PAX3. Cdk5 knockdown in mice causes a lightened coat color, a polarized distribution of melanin and hyperproliferation of basal keratinocytes. Reduced expression of Keratin 10 (K10) resulting from Cdk5 knockdown may be responsible for an abnormal epidermal structure. In contrast, overexpression of Cdk5 in sheep (Ovis aries) only produces brown patches on a white background, with no other observable abnormalities. Collectively, our findings show that Cdk5 has an important functional role in the regulation of melanin production and transportation and in normal development of the integumentary system.

  1. Brain imaging signatures of the relationship between epidermal nerve fibers and heat pain perception.

    Science.gov (United States)

    Tseng, Ming-Tsung; Kong, Yazhuo; Chiang, Ming-Chang; Chao, Chi-Chao; Tseng, Wen-Yih I; Hsieh, Sung-Tsang

    2015-11-15

    Although the small-diameter primary afferent fibers in the skin promptly respond to nociceptive stimuli and convey sensory inputs to the central nervous system, the neural signatures that underpin the relationship between cutaneous afferent fibers and pain perception remain elusive. We combined skin biopsy at the lateral aspect of the distal leg, which is used to quantify cutaneous afferent fibers, with fMRI, which is used to assess brain responses and functional connectivity, to investigate the relationship between cutaneous sensory nerves and the corresponding pain perception in the brain after applying heat pain stimulation to the dorsum of the right foot in healthy subjects. During painful stimulation, the degree of cutaneous innervation, as measured by epidermal nerve fiber density, was correlated with individual blood oxygen level-dependent (BOLD) signals of the posterior insular cortex and of the thalamus, periaqueductal gray, and rostral ventromedial medulla. Pain perception was associated with the activation of the anterior insular cortex and with the functional connectivity from the anterior insular cortex to the primary somatosensory cortex during painful stimulation. Most importantly, both epidermal nerve fiber density and activity in the posterior insular cortex showed a positive correlation with the strength of coupling under pain between the anterior insular cortex and the primary somatosensory cortex. Thus, our findings support the notion that the neural circuitry subserving pain perception interacts with the cerebral correlates of peripheral nociceptive fibers, which implicates an indirect role for skin nerves in human pain perception. Copyright © 2015 Elsevier Inc. All rights reserved.

  2. The epidermal biosynthesis of cholecalciferol (vitamin D3)

    International Nuclear Information System (INIS)

    Beadle, P.C.

    1977-01-01

    An attempt has been made to calculate the rate of ultraviolet absorption by 7-dehydrocholesterol, provitamin D 3 , in the epidermis as a function of latitude, season and skin type, in the hope that it will provide an upper-limit estimate of the epidermal vitamin production. The results indicate that a significant fraction of the total epidermal production may occur in the stratum corneum with figures of 15 and 31% being found for non-pigmented and pigmented epidermises, respectively. Total production in negroid epidermis is predicted to be about 40% of that in the caucasian one and the latitudinal variation is greater than the seasonal variation, in agreement with the behaviour of the available solar ultraviolet. Overall production rates were sufficiently high for it to be unnecessary to invoke an enhanced absorption mechanism for the provitamin, although the results do indicate that there may be a risk of deficient production above about 40 0 N. (author)

  3. Metabolic epidermal necrosis in two dogs with different underlying diseases.

    Science.gov (United States)

    Bond, R; McNeil, P E; Evans, H; Srebernik, N

    1995-05-06

    Two dogs with metabolic epidermal necrosis had hyperkeratosis of the footpads accompanied by erythematous, erosive and crusting lesions affecting the muzzle, external genitalia, perineum and periocular regions. Histopathological examination of skin biopsies revealed a superficial hydropic dermatitis with marked parakeratosis. Both dogs had high plasma activities of alkaline phosphatase and alanine aminotransferase and high concentrations of glucose, and also a marked hypoaminoacidaemia. Despite these similarities, the cutaneous eruptions were associated with different underlying diseases. One dog had a pancreatic carcinoma which had metastasised widely; the primary tumour and the metastases showed glucagon immunoreactivity on immunocytochemical staining, and the dog's plasma glucagon concentration was markedly greater than that of control dogs. The other dog had diffuse hepatic disease; its plasma glucagon concentration was similar to that of control samples and cirrhosis was identified post mortem. Metabolic epidermal necrosis in dogs is a distinct cutaneous reaction pattern which may be associated with different underlying systemic diseases; however, the pathogenesis of the skin lesions remains unclear.

  4. Steroid hormone and epidermal growth factor receptors in meningiomas.

    Science.gov (United States)

    Horsfall, D J; Goldsmith, K G; Ricciardelli, C; Skinner, J M; Tilley, W D; Marshall, V R

    1989-11-01

    A prospective study of steroid hormone and epidermal growth factor receptor expression in 57 meningiomas is presented. Scatchard analysis of radioligand binding identified 20% of meningiomas as expressing classical oestrogen receptors (ER) at levels below that normally accepted for positivity, the remainder being negative. ER could not be visualized in any meningioma using immunocytochemistry. Alternatively, 74% of meningiomas demonstrated the presence of progesterone receptors (PR) by Scatchard analysis, the specificity of which could not be attributed to glucocorticoid or androgen receptors. Confirmation of classical PR presence was determined by immunocytochemical staining. The presence of epidermal growth factor receptor (EGFR) was demonstrated in 100% of meningiomas using immunocytochemical staining. These data are reviewed in the context of previously reported results and are discussed in relation to the potential for medical therapy as an adjunct to surgery.

  5. UVB radiation generates sunburn pain and affects skin by activating epidermal TRPV4 ion channels and triggering endothelin-1 signaling.

    Science.gov (United States)

    Moore, Carlene; Cevikbas, Ferda; Pasolli, H Amalia; Chen, Yong; Kong, Wei; Kempkes, Cordula; Parekh, Puja; Lee, Suk Hee; Kontchou, Nelly-Ange; Yeh, Iwei; Ye, Iwei; Jokerst, Nan Marie; Fuchs, Elaine; Steinhoff, Martin; Liedtke, Wolfgang B

    2013-08-20

    At our body surface, the epidermis absorbs UV radiation. UV overexposure leads to sunburn with tissue injury and pain. To understand how, we focus on TRPV4, a nonselective cation channel highly expressed in epithelial skin cells and known to function in sensory transduction, a property shared with other transient receptor potential channels. We show that following UVB exposure mice with induced Trpv4 deletions, specifically in keratinocytes, are less sensitive to noxious thermal and mechanical stimuli than control animals. Exploring the mechanism, we find that epidermal TRPV4 orchestrates UVB-evoked skin tissue damage and increased expression of the proalgesic/algogenic mediator endothelin-1. In culture, UVB causes a direct, TRPV4-dependent Ca(2+) response in keratinocytes. In mice, topical treatment with a TRPV4-selective inhibitor decreases UVB-evoked pain behavior, epidermal tissue damage, and endothelin-1 expression. In humans, sunburn enhances epidermal expression of TRPV4 and endothelin-1, underscoring the potential of keratinocyte-derived TRPV4 as a therapeutic target for UVB-induced sunburn, in particular pain.

  6. On the physics of laser-induced selective photothermolysis of hair follicles: Influence of wavelength, pulse duration, and epidermal cooling.

    Science.gov (United States)

    Svaasand, Lars O; Nelson, J Stuart

    2004-01-01

    The physical basis for optimization of wavelength, pulse duration, and cooling for laser-induced selective photothermolysis of hair follicles in human skin is discussed. The results indicate that the most important optimization parameter is the cooling efficiency of the technique utilized for epidermal protection. The optical penetration is approximately the same for lasers at 694, 755, and 800 nm. The penetration of radiation from Nd:yttrium-aluminum-garnet lasers at 1064 nm is, however, somewhat larger. Photothermal damage to the follicle is shown to be almost independent of laser pulse duration up to 100 ms. The results reveal that epidermal cooling by a 30-80-ms-long cryogen spurt immediately before laser exposure is the only efficient technique for laser pulse durations less than 10 ms. For longer pulse durations in the 30-100 ms range, protection can be done efficiently by skin cooling during laser exposure. For laser pulses of 100 ms, an extended precooling period, e.g., by bringing a cold object into good thermal contact with the skin for about 1 s, can be of value. Thermal quenching of laser induced epidermal temperature rise after pulsed exposure can most efficiently be done with a 20 ms cryogen spurt applied immediately after irradiation. (c) 2004 Society of Photo-Optical Instrumentation Engineers.

  7. Epidermal electronics with advanced capabilities in near-field communication.

    Science.gov (United States)

    Kim, Jeonghyun; Banks, Anthony; Cheng, Huanyu; Xie, Zhaoqian; Xu, Sheng; Jang, Kyung-In; Lee, Jung Woo; Liu, Zhuangjian; Gutruf, Philipp; Huang, Xian; Wei, Pinghung; Liu, Fei; Li, Kan; Dalal, Mitul; Ghaffari, Roozbeh; Feng, Xue; Huang, Yonggang; Gupta, Sanjay; Paik, Ungyu; Rogers, John A

    2015-02-25

    Epidermal electronics with advanced capabilities in near field communications (NFC) are presented. The systems include stretchable coils and thinned NFC chips on thin, low modulus stretchable adhesives, to allow seamless, conformal contact with the skin and simultaneous capabilities for wireless interfaces to any standard, NFC-enabled smartphone, even under extreme deformation and after/during normal daily activities. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Expression and analysis of exogenous proteins in epidermal cells.

    Science.gov (United States)

    Dagnino, Lina; Ho, Ernest; Chang, Wing Y

    2010-01-01

    In this chapter we review protocols for transient transfection of primary keratinocytes. The ability to transfect primary epidermal cells regardless of their differentiation status allows the biochemical and molecular characterization of multiple proteins. We review methods to analyze exogenous protein abundance in transfected keratinocytes by immunoblot and immunoprecipitation. We also present protocols to determine the subcellular distribution of these proteins by indirect immunofluorescence microscopy approaches.

  9. "Cut-and-Paste" Manufacture of Multiparametric Epidermal Sensor Systems.

    Science.gov (United States)

    Yang, Shixuan; Chen, Ying-Chen; Nicolini, Luke; Pasupathy, Praveenkumar; Sacks, Jacob; Su, Becky; Yang, Russell; Sanchez, Daniel; Chang, Yao-Feng; Wang, Pulin; Schnyer, David; Neikirk, Dean; Lu, Nanshu

    2015-11-04

    Multifunctional epidermal sensor systems (ESS) are manufactured with a highly cost and time effective, benchtop, and large-area "cut-and-paste" method. The ESS made out of thin and stretchable metal and conductive polymer ribbons can be noninvasively laminated onto the skin surface to sense electrophysiological signals, skin temperature, skin hydration, and respiratory rate. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. Fatty acids are required for epidermal permeability barrier function.

    Science.gov (United States)

    Mao-Qiang, M; Elias, P M; Feingold, K R

    1993-08-01

    The permeability barrier is mediated by a mixture of ceramides, sterols, and free fatty acids arranged as extracellular lamellar bilayers in the stratum corneum. Whereas prior studies have shown that cholesterol and ceramides are required for normal barrier function, definitive evidence for the importance of nonessential fatty acids is not available. To determine whether epidermal fatty acid synthesis also is required for barrier homeostasis, we applied 5-(tetradecyloxy)-2-furancarboxylic acid (TOFA), an inhibitor of acetyl CoA carboxylase, after disruption of the barrier by acetone or tape stripping. TOFA inhibits epidermal fatty acid by approximately 50% and significantly delays barrier recovery. Moreover, coadministration of palmitate with TOFA normalizes barrier recovery, indicating that the delay is due to a deficiency in bulk fatty acids. Furthermore, TOFA treatment also delays the return of lipids to the stratum corneum and results in abnormalities in the structure of lamellar bodies, the organelle which delivers lipid to the stratum corneum. In addition, the organization of secreted lamellar body material into lamellar bilayers within the stratum corneum interstices is disrupted by TOFA treatment. Finally, these abnormalities in lamellar body and stratum corneum membrane structure are corrected by coapplication of palmitate with TOFA. These results demonstrate a requirement for bulk fatty acids in barrier homeostasis. Thus, inhibiting the epidermal synthesis of any of the three key lipids that form the extracellular, lipid-enriched membranes of the stratum corneum results in an impairment in barrier homeostasis.

  11. Optimal allocation of leaf epidermal area for gas exchange.

    Science.gov (United States)

    de Boer, Hugo J; Price, Charles A; Wagner-Cremer, Friederike; Dekker, Stefan C; Franks, Peter J; Veneklaas, Erik J

    2016-06-01

    A long-standing research focus in phytology has been to understand how plants allocate leaf epidermal space to stomata in order to achieve an economic balance between the plant's carbon needs and water use. Here, we present a quantitative theoretical framework to predict allometric relationships between morphological stomatal traits in relation to leaf gas exchange and the required allocation of epidermal area to stomata. Our theoretical framework was derived from first principles of diffusion and geometry based on the hypothesis that selection for higher anatomical maximum stomatal conductance (gsmax ) involves a trade-off to minimize the fraction of the epidermis that is allocated to stomata. Predicted allometric relationships between stomatal traits were tested with a comprehensive compilation of published and unpublished data on 1057 species from all major clades. In support of our theoretical framework, stomatal traits of this phylogenetically diverse sample reflect spatially optimal allometry that minimizes investment in the allocation of epidermal area when plants evolve towards higher gsmax . Our results specifically highlight that the stomatal morphology of angiosperms evolved along spatially optimal allometric relationships. We propose that the resulting wide range of viable stomatal trait combinations equips angiosperms with developmental and evolutionary flexibility in leaf gas exchange unrivalled by gymnosperms and pteridophytes. © 2016 The Authors New Phytologist © 2016 New Phytologist Trust.

  12. Glucocorticoid receptor, but not mineralocorticoid receptor, mediates cortisol regulation of epidermal ionocyte development and ion transport in zebrafish (danio rerio.

    Directory of Open Access Journals (Sweden)

    Shelly Abad Cruz

    Full Text Available Cortisol is the major endogenous glucocorticoid (GC both in human and fish, mediated by corticosteroid receptors. Due to the absence of aldosterone production in teleost fish, cortisol is also traditionally accepted to function as mineralocorticoid (MC; but whether it acts through the glucocorticoid receptor (GR or the mineralocorticoid receptor (MR remains a subject of debate. Here, we used loss-of-function and rescue assays to determine whether cortisol affects zebrafish epidermal ionocyte development and function via the GR and/or the MR. GR knockdown morphants displayed a significant decrease in the major ionocytes, namely Na(+-K(+-ATPase-rich cells (NaRCs and H(+-ATPase-rich cells (HRCs, as well as other cells, including epidermal stem cells (ESCs, keratinocytes, and mucus cells; conversely, cell numbers were unaffected in MR knockdown morphants. In agreement, GR morphants, but not MR morphants, exhibited decreased NaRC-mediated Ca(2+ uptake and HRC-mediated H(+ secretion. Rescue via GR capped mRNA injection or exogenous cortisol incubation normalized the number of epidermal ionocytes in GR morphants. We also provide evidence for GR localization in epidermal cells. At the transcript level, GR mRNA is ubiquitously expressed in gill sections and present in both NaRCs and HRCs, supporting the knockdown and functional assay results in embryo. Altogether, we have provided solid molecular evidence that GR is indeed present on ionocytes, where it mediates the effects of cortisol on ionocyte development and function. Hence, cortisol-GR axis performs the roles of both GC and MC in zebrafish skin and gills.

  13. Hollow silicon microneedle array based trans-epidermal antiemetic patch for efficient management of chemotherapy induced nausea and vomiting

    Science.gov (United States)

    Kharbikar, Bhushan N.; Kumar S., Harish; Kr., Sindhu; Srivastava, Rohit

    2015-12-01

    Chemotherapy Induced Nausea and Vomiting (CINV) is a serious health concern in the treatment of cancer patients. Conventional routes for administering anti-emetics (i.e. oral and parenteral) have several drawbacks such as painful injections, poor patient compliance, dependence on skilled personnel, non-affordability to majority of population (parenteral), lack of programmability and suboptimal bioavailability (oral). Hence, we have developed a trans-epidermal antiemetic drug delivery patch using out-of-plane hollow silicon microneedle array. Microneedles are pointed micron-scale structures that pierce the epidermal layer of skin to reach dermal blood vessels and can directly release the drug in their vicinity. They are painless by virtue of avoiding significant contact with dermal sensory nerve endings. This alternate approach gives same pharmacodynamic effects as par- enteral route at a sparse drug-dose requirement, hence negligible side-effects and improved patient compliance. Microneedle design attributes were derived by systematic study of human skin anatomy, natural micron-size structures like wasp-sting and cactus-spine and multi-physics simulations. We used deep reactive ion etching with Bosch process and optimized recipe of gases to fabricate high-aspect-ratio hollow silicon microneedle array. Finally, microneedle array and polydimethylsiloxane drug reservoir were assembled to make finished anti-emetic patch. We assessed microneedles mechanical stability, physico-chemical properties and performed in-vitro, ex- vivo and in-vivo studies. These studies established functional efficacy of the device in trans-epidermal delivery of anti-emetics, its programmability, ease of use and biosafety. Thus, out-of-plane hollow silicon microneedle array trans-epidermal antiemetic patch is a promising strategy for painless and effective management of CINV at low cost in mainstream healthcare.

  14. A transcription factor active on the epidermal growth factor receptor gene

    International Nuclear Information System (INIS)

    Kageyama, R.; Merlino, G.T.; Pastan, I.

    1988-01-01

    The authors have developed an in vitro transcription system for the epidermal growth factor receptor (EGFR) oncogene by using nuclear extracts of A431 human epidermoid carcinoma cells, which overproduce EGFR. They found that a nuclear factor, termed EGFR-specific transcription factor (ETF), specifically stimulated EGFR transcription by 5- to 10-fold. In this report, ETF, purified by using sequence-specific oligonucleotide affinity chromatography, is shown by renaturing material eluted from a NaDodSO 4 /polyacrylamide gel to be a protein with a molecular mass of 120 kDa. ETF binds to the promoter region, as measured by DNase I footprinting and gel-mobility-shift assays, and specifically stimulates the transcription of the EGFR gene in a reconstituted in vitro transcription system. These results suggest that ETF could play a role in the overexpression of the cellular oncogene EGFR

  15. ErbB2 resembles an autoinhibited invertebrate epidermal growth factor receptor

    Energy Technology Data Exchange (ETDEWEB)

    Alvarado, Diego; Klein, Daryl E.; Lemmon, Mark A.; (UPENN-MED)

    2009-09-25

    The orphan receptor tyrosine kinase ErbB2 (also known as HER2 or Neu) transforms cells when overexpressed, and it is an important therapeutic target in human cancer. Structural studies have suggested that the oncogenic (and ligand-independent) signalling properties of ErbB2 result from the absence of a key intramolecular 'tether' in the extracellular region that autoinhibits other human ErbB receptors, including the epidermal growth factor (EGF) receptor. Although ErbB2 is unique among the four human ErbB receptors, here we show that it is the closest structural relative of the single EGF receptor family member in Drosophila melanogaster (dEGFR). Genetic and biochemical data show that dEGFR is tightly regulated by growth factor ligands, yet a crystal structure shows that it, too, lacks the intramolecular tether seen in human EGFR, ErbB3 and ErbB4. Instead, a distinct set of autoinhibitory interdomain interactions hold unliganded dEGFR in an inactive state. All of these interactions are maintained (and even extended) in ErbB2, arguing against the suggestion that ErbB2 lacks autoinhibition. We therefore suggest that normal and pathogenic ErbB2 signalling may be regulated by ligands in the same way as dEGFR. Our findings have important implications for ErbB2 regulation in human cancer, and for developing therapeutic approaches that target novel aspects of this orphan receptor.

  16. Europium-labeled epidermal growth factor and neurotensin: novel probes for receptor-binding studies.

    Science.gov (United States)

    Mazor, Ohad; Hillairet de Boisferon, Marc; Lombet, Alain; Gruaz-Guyon, Anne; Gayer, Batya; Skrzydelsky, Delphine; Kohen, Fortune; Forgez, Patricia; Scherz, Avigdor; Rostene, William; Salomon, Yoram

    2002-02-01

    We investigated the possibility of labeling two biologically active peptides, epidermal growth factor (EGF) and neurotensin (NT), with europium (Eu)-diethylenetriaminepentaacetic acid. More specifically, we tested them as probes in studying receptor binding using time-resolved fluorescence of Eu3+. The relatively simple synthesis yields ligands with acceptable binding characteristics similar to isotopically labeled derivatives. The binding affinity (Kd) of labeled Eu-EGF to human A431 epidermal carcinoid cells was 3.6 +/- 1.2 nM, similar to the reported Kd values of EGF, whereas the Kd of Eu-NT to human HT29 colon cancer cells (7.4 +/- 0.5 nM) or to Chinese hamster ovary (CHO) cells transfected with the high-affinity NT receptor (CHO-NT1) were about 10-fold higher than the Kd values of NT. The bioactivity of the Eu-labeled EGF as determined by stimulation of cultured murine D1 hematopoietic cell proliferation was nearly the same as that obtained with native EGF. The maximal stimulation of Ca2+ influx with NT and Eu-NT in CHO-NT1 cells was similar, but the respective K0.5 values were 20 pM and 1 nM, corresponding to differences in the binding affinities previously described. The results of these studies indicate that Eu labeling of peptide hormones and growth factor molecules ranging from 10(3) to 10(5) Da can be conveniently accomplished. Importantly, the Eu-labeled products are stable for approximately 2 years and are completely safe for laboratory use compared to the biohazardous radioligands. Thus, Eu-labeled peptides present an attractive alternative for commonly used radiolabeled ligands in biological studies in general and in receptor assays in particular.

  17. Arctigenin induced gallbladder cancer senescence through modulating epidermal growth factor receptor pathway.

    Science.gov (United States)

    Zhang, Mingdi; Cai, Shizhong; Zuo, Bin; Gong, Wei; Tang, Zhaohui; Zhou, Di; Weng, Mingzhe; Qin, Yiyu; Wang, Shouhua; Liu, Jun; Ma, Fei; Quan, Zhiwei

    2017-05-01

    Gallbladder cancer has poor prognosis and limited therapeutic options. Arctigenin, a representative dibenzylbutyrolactone lignan, occurs in a variety of plants. However, the molecular mechanisms involved in the antitumor effect of arctigenin on gallbladder cancer have not been fully elucidated. The expression levels of epidermal growth factor receptor were examined in 100 matched pairs of gallbladder cancer tissues. A positive correlation between high epidermal growth factor receptor expression levels and poor prognosis was observed in gallbladder cancer tissues. Pharmacological inhibition or inhibition via RNA interference of epidermal growth factor receptor induced cellular senescence in gallbladder cancer cells. The antitumor effect of arctigenin on gallbladder cancer cells was primarily achieved by inducing cellular senescence. In gallbladder cancer cells treated with arctigenin, the expression level of epidermal growth factor receptor significantly decreased. The analysis of the activity of the kinases downstream of epidermal growth factor receptor revealed that the RAF-MEK-ERK signaling pathway was significantly inhibited. Furthermore, the cellular senescence induced by arctigenin could be reverted by pcDNA-epidermal growth factor receptor. Arctigenin also potently inhibited the growth of tumor xenografts, which was accompanied by the downregulation of epidermal growth factor receptor and induction of senescence. This study demonstrates arctigenin could induce cellular senescence in gallbladder cancer through the modulation of epidermal growth factor receptor pathway. These data identify epidermal growth factor receptor as a key regulator in arctigenin-induced gallbladder cancer senescence.

  18. Radiologic Findings of Epidermal Cysts in the Trunk

    International Nuclear Information System (INIS)

    Kim, Myung Hyun; Chung, Jae Joon; Park, Kyoung Seuk; Park, Su Mi

    2005-01-01

    To evaluate the ultrasonographic (US) or computer tomography (CT) findings of surgically proven epidermal cysts in the trunk, and to compare the echogenicity of cysts with internal contents. Forty-five patients were retrospectively evaluated. US and CT findings of epidermal cysts were assessed in regard to location, size, shape, number, echogenicity, posterior sound enhancement, internal density, septa, mural nodule and calcification, perilesional infiltration, contrast enhancement, and internal contents. All 45 patients (M:F=29:16; US in 26, CT in 19) had only one cyst, and they were located in the buttocks (n=19), back (n=13), inguinal (n=4), posterior neck (n=3), perineum (n=2), abdominal wall (n=2), presternal (n=1), and axilla (n=1). Of 26 patients who underwent US, there were 8 cases of homogeneously hypoechoic mass (30.8%), 8 of inhomogeneously hypoechoic mass (30.8%), 7 of homogeneously hypoechoic mass with internal hypoechoic lines and echogenic spots (26.9%) and 3 of homogeneously hypoechoic mass with internal echogenic spots (11.5%). Posterior sound enhancement was noted in 21 patients (80.8%). Of 19 patients who underwent CT, there were 14 cases of simple cyst (73.7%) and 5 of abscess-like lesion (26.3%). Overlying skin thickening (n=13), contrast enhancement of cystic wall (n=11), perilesional infiltration (n=7), and internal septa (n=6) were demonstrated. The internal contents of the cysts were keratinous (n=27, 60.0%) or greasy (n=15, 33.3%) material. There was no statistical significance between the echogenicity of the cysts and the internal contents (p > 0.2). Epidermal cysts showed homogeneous or inhomogeneous hypoechoic mass with posterior sound enhancement on US. There was no relationship between the echogenicity of the cysts and the internal contents. In the case of ruptured cyst, an abscess-like lesion with wall enhancement and perilesional infiltration was noted on CT scan

  19. Exudative epidermitis in pigs caused by toxigenic Staphylococcus chromogenes.

    Science.gov (United States)

    Andresen, Lars Ole; Ahrens, Peter; Daugaard, Lise; Bille-Hansen, Vivi

    2005-02-25

    Staphylococcus chromogenes is closely related to Staphylococcus hyicus, which is recognised as the causative agent of exudative epidermitis (EE) in pigs. S. chromogenes is part of the normal skin flora of pigs, cattle and poultry and has so far been considered non-pathogenic to pigs. A strain of S. chromogenes producing exfoliative toxin type B, ExhB, was identified by the use of a multiplex PCR specific for the exfoliative toxins from S. hyicus. The exfoliative toxin from S. chromogenes reacted in immunoblot analysis with polyclonal and monoclonal antibodies specific to ExhB from S. hyicus and had an apparent molecular weight of 30 kDa. Sequencing the gene encoding the exfoliative toxin from S. chromogenes revealed that the molecular weight of the toxin with the signal peptide and the mature toxin was 30,553 and 26,694 Da, respectively. Comparison of the exhB genes from S. chromogenes strain VA654 and S. hyicus strain 1289D-88 showed differences in seven base pairs of the DNA sequences and in two amino acid residues in the deduced amino acid sequences. Pigs were experimentally inoculated with S. chromogenes strain VA654. By clinical observations and histopathological evaluation of the skin alterations, all pigs revealed development of generalized exudative epidermitis. No toxin producing S. hyicus was isolated from the pigs and all ExhB-positive bacterial isolates were identified as S. chromogenes. This confirmed that the disease-causing agent was the inoculated S. chromogenes strain VA654. The results of this study show that S. chromogenes may cause exudative epidermitis in pigs.

  20. Renal origin of rat urinary epidermal growth factor

    DEFF Research Database (Denmark)

    Nexø, Ebba; Poulsen, Steen Seier

    1984-01-01

    The origin of rat urinary epidermal growth factor (EGF) has been investigated. Unilateral nephrectomy decreased the concentration, total output of EGF and EGF/creatinine ratio by approximately 50%, while the output of creatinine was unchanged. Removal of the submandibular glands and duodenal...... Brunner's glands, organs known to produce EGF, had no influence on the output of EGF in urine. Renal clearance of EGF exceeded that of creatinine, and after bilateral nephrectomy or bilateral ligation of the ureters, the concentration of creatinine in serum increased, while the concentration of EGF...

  1. Isolation and In Vitro Characterization of Epidermal Stem Cells

    DEFF Research Database (Denmark)

    Moestrup, Kasper S; Andersen, Marianne Stemann; Jensen, Kim Bak

    2017-01-01

    flow cytometry. Using markers that define the spatial origin of epidermal cells, it is possible to interrogate the specific characteristics of subpopulations of cells based on their in vivo credentials. Here, we describe how to isolate, culture, and characterize keratinocytes from murine back and tail......Colony-forming assays represent prospective methods, where cells isolated from enzymatically dissociated tissues or from tissue cultures are assessed for their proliferative capacity in vitro. Complex tissues such as the epithelial component of the skin (the epidermis) are characterized...

  2. Acyl-CoA binding protein and epidermal barrier function

    DEFF Research Database (Denmark)

    Bloksgaard, Maria; Neess, Ditte; Færgeman, Nils J

    2014-01-01

    The acyl-CoA binding protein (ACBP) is a 10kDa intracellular protein expressed in all eukaryotic species and mammalian tissues investigated. It binds acyl-CoA esters with high specificity and affinity and is thought to act as an intracellular transporter of acyl-CoA esters between different...... includes tousled and greasy fur, development of alopecia and scaling of the skin with age. Furthermore, epidermal barrier function is compromised causing a ~50% increase in transepidermal water loss relative to that of wild type mice. Lipidomic analyses indicate that this is due to significantly reduced...

  3. Secreted aspartic proteases are not required for invasion of reconstituted human epithelia by Candida albicans.

    Science.gov (United States)

    Lermann, Ulrich; Morschhäuser, Joachim

    2008-11-01

    A well-known virulence attribute of the human-pathogenic yeast Candida albicans is the secretion of aspartic proteases (Saps), which may contribute to colonization and infection of different host niches by degrading tissue barriers, destroying host defence molecules, or digesting proteins for nutrient supply. The role of individual Sap isoenzymes, which are encoded by a large gene family, for the pathogenicity of C. albicans has been investigated by assessing the virulence of mutants lacking specific SAP genes and by studying the expression pattern of the SAP genes in various models of superficial and systemic infections. We used a recombination-based genetic reporter system to detect the induction of the SAP1-SAP6 genes during infection of reconstituted human vaginal epithelium. Only SAP5, but none of the other tested SAP genes, was detectably activated in this in vitro infection model. To directly address the importance of the SAP1-SAP6 genes for invasion of reconstituted human epithelia (RHE), we constructed a set of mutants of the wild-type C. albicans model strain SC5314 in which either single or multiple SAP genes were specifically deleted. Even mutants lacking all of the SAP1-SAP3 or the SAP4-SAP6 genes displayed the same capacity to invade and damage both oral and vaginal RHE as their wild-type parental strain, in contrast to a nonfilamentous efg1Delta mutant that was avirulent under these conditions. We therefore conclude from these results that the secreted aspartic proteases Sap1p-Sap6p are not required for invasion of RHE by C. albicans.

  4. Oxygen dependency of epidermal growth factor receptor binding and DNA synthesis of rat hepatocytes

    International Nuclear Information System (INIS)

    Hirose, Tetsuro; Terajima, Hiroaki; Yamauchi, Akira

    1997-01-01

    Background/Aims: Changes in oxygen availability modulate replicative responses in several cell types, but the effects on hepatocyte replication remain unclear. We have studied the effects of transient nonlethal hypoxia on epidermal growth factor receptor binding and epidermal growth factor-induced DNA synthesis of rat hepatocytes. Methods: Lactate dehydrogenase activity in culture supernatant, intracellular adenosine triphosphate content, 125 I-epidermal growth factor specific binding, epidermal growth factor receptor protein expression, and 3 H-thymidine incorporation were compared between hepatocytes cultured in hypoxia and normoxia. Results: Hypoxia up to 3 h caused no significant increase in lactate dehydrogenase activity in the culture supernatant, while intracellular adenosine triphosphate content decreased time-dependently and was restored to normoxic levels by reoxygenation (nonlethal hypoxia). Concomitantly, 125 I-epidermal growth factor specific binding to hepatocytes decreased time-dependently (to 54.1% of normoxia) and was restored to control levels by reoxygenation, although 125 I-insulin specific binding was not affected. The decrease in 125 I-epidermal growth factor specific binding was explained by the decrease in the number or available epidermal growth factor receptors (21.37±3.08 to 12.16±1.42 fmol/10 5 cells), while the dissociation constant of the receptor was not affected. The change in the number of available receptors was not considered to be due to receptor degradation-resynthesis, since immuno-detection of the epidermal growth factor receptor revealed that the receptor protein expression did not change during hypoxia and reoxygenation, and since neither actinomycin D nor cycloheximide affected the recovery of 125 I-epidermal growth factor binding by reoxygenation. Inhibition of epidermal growth factor-induced DNA synthesis after hypoxia (to 75.4% of normoxia by 3 h hypoxia) paralleled the decrease in 125 I-epidermal growth factor binding

  5. Tissue remodeling induced by hypersecreted epidermal growth factor and amphiregulin in the airway after an acute asthma attack.

    Science.gov (United States)

    Enomoto, Yukinori; Orihara, Kanami; Takamasu, Tetsuya; Matsuda, Akio; Gon, Yasuhiro; Saito, Hirohisa; Ra, Chisei; Okayama, Yoshimichi

    2009-11-01

    Epidermal growth factor receptor ligands, such as epidermal growth factor (EGF) and amphiregulin, may play key roles in tissue remodeling in asthma. However, the kinetics of EGF and amphiregulin secretion in the airway after an acute asthma attack and the effect of prolonged airway exposure to these ligands on airway remodeling are unknown. To measure the EGF and amphiregulin concentrations in sputa obtained from patients with asthma under various conditions, and to examine the effects of EGF and amphiregulin on the proliferation or differentiation of airway structural cells. Epidermal growth factor and amphiregulin levels were measured by ELISA in sputum specimens collected from 14 hospitalized children with asthma during an acute asthma attack, 13 stable outpatients with asthma, 8 healthy control children, and 7 children with respiratory tract infections. The effects of EGF and amphiregulin on the proliferation and/or differentiation of normal human bronchial epithelial cells (NHBE), bronchial smooth muscle cells (BSMC), and normal human lung fibroblasts (NHLF) were examined. The sputum levels of EGF were significantly higher for about a week after an acute asthma attack compared with the levels in stable subjects with asthma and control subjects. In contrast, upregulation of amphiregulin in the sputa of patients with asthma was observed only during the acute attack. EGF caused proliferation of NHBE, BSMC, and NHLF, whereas amphiregulin induced proliferation of only NHBE. Prolonged exposure of NHBE to EGF and amphiregulin induced mucous cell metaplasia in an IL-13-independent manner. Acute asthma attacks are associated with hypersecretion of EGF and amphiregulin in the airway. Recurrent acute attacks may aggravate airway remodeling.

  6. A synthetic C16 omega-hydroxyphytoceramide improves skin barrier functions from diversely perturbed epidermal conditions.

    Science.gov (United States)

    Oh, Myoung Jin; Nam, Jin Ju; Lee, Eun Ok; Kim, Jin Wook; Park, Chang Seo

    2016-10-01

    Omega-hydroxyceramides (ω-OH-Cer) play a crucial role in maintaining the integrity of skin barrier. ω-OH-Cer are the primary lipid constituents of the corneocyte lipid envelope (CLE) covalently attached to the outer surface of the cornified envelope linked to involucrin to become bound form lipids in stratum corneum (SC). CLE becomes a hydrophobic impermeable layer of matured corneocyte preventing loss of natural moisturizing factor inside the corneocytes. More importantly, CLE may also play an important role in the formation of proper orientation of intercellular lipid lamellar structure by interdigitating with the intercellular lipids in a comb-like fashion. Abnormal barrier conditions associated with atopic dermatitis but also UVB-irradiated skins are known to have lowered level of bound lipids, especially ω-OH-Cer, which indicate that ω-OH-Cer play an important role in maintaining the integrity of skin barrier. In this study, protective effects of a novel synthetic C16 omega-hydroxyphytoceramides (ω-OH-phytoceramide) on skin barrier function were investigated. Epidermal barrier disruption was induced by UVB irradiation, tape-stripping in hairless mouse and human skin. Protective effect of damaged epidermis was evaluated using the measurement of transepidermal water loss and cohesion of SC. Increased keratinocyte differentiation was verified using cultured keratinocyte through western blot. Results clearly demonstrated that a synthetic C16 ω-OH-phytoceramide enhanced the integrity of SC and accelerated the recovery of damaged skin barrier function by stimulating differentiation process. In a conclusion, a synthetic C16 ω-OH-phytoceramide treatment improved epidermal homeostasis in several disrupted conditions.

  7. Development of a PVAl/chitosan composite membrane compatible with the dermo-epidermic system

    International Nuclear Information System (INIS)

    Almeida, Tiago Luiz de

    2009-03-01

    Due to the frequent incidence of people with skin lesions such as burns and ulcers and the lack of available donors, biomaterials with the capacity to mimic skin must be developed. In order to develop these biomaterials, polymers are used in the attempt to achieve characteristics which are closer to the target organ. In this direction, for several years our group has been developing dermo-epidermic substitutes, specifically biodegradable and biocompatible membranes made up of PVAl and chitosan. PVAl, a synthetic polymer, was used to imitate part of the human dermis and chitosan, a polymer of organic origin, was used in this study to stimulate growth and maintenance of the epidermis. Due to the variations of these commercially obtained polymers, the objective of this study was to characterize their physical and chemical properties, comparing them with the membrane previously obtained by our group with the intention of confirming the hypotheses of interferences put forward in this study. The PVAl membranes in the study (PVAl MP) that obtained characteristics most similar to the standard were those irradiated with 13 and 15 kGy; this last was chosen because it was the minimum dose necessary to achieve sterility. These membranes were also those which had the largest percentage of pores between 70 and 100 μm. For chitosan, the principal characteristics studied were the degree of acetylation (DA) and average molecular weight, both results demonstrated different characteristics than commercially indicated. Various membrane preparation protocols were carried out from the chitosan solution (2%). The membrane composed of the solution of chitosan homogenized with glycerol (20%) and dried at room temperature had the best interaction with keratinocytes. To finalize the study, this chitosan solution was poured over a PVAl membrane, lyophilized and impregnated with chitosan (2%) solution and the compound was kept at room temperature until a chitosan film formed on the upper

  8. Keratinocyte-derived IL-24 plays a role in the positive feedback regulation of epidermal inflammation in response to environmental and endogenous toxic stressors.

    Science.gov (United States)

    Jin, Sun Hee; Choi, Dalwoong; Chun, Young-Jin; Noh, Minsoo

    2014-10-15

    Keratinocytes are the major cellular components of human epidermis and play a key role in the modulating cutaneous inflammation and toxic responses. In human chronic skin diseases, the common skin inflammatory phenotypes like skin barrier disruption and epidermal hyperplasia are manifested in epidermal keratinocytes by interactions with T helper (Th) cells. To find a common gene expression signature of human keratinocytes in chronic skin diseases, we performed a whole genome microarray analysis on normal human epidermal keratinocytes (NHKs) treated with IFNγ, IL-4, IL-17A or IL-22, major cytokines from Th1, Th2, Th17 or Th22 cells, respectively. The microarray results showed that the four genes, IL-24, PDZK1IP1, H19 and filaggrin, had common expression profiles in NHKs exposed to Th cell cytokines. In addition, the acute phase pro-inflammatory cytokines, IL-1β, IL-6 and TNFα, also change the gene transcriptional profile of IL-24, PDZK1IP1, H19, and filaggrin in NHKs as those of Th cytokines. Therefore, the signature gene set, consisting of IL-24, PDZK1IP1, H19, and filaggrin, provides essential insights for understanding the process of cutaneous inflammation and toxic responses. We demonstrate that environmental toxic stressors, such as chemical irritants and ultraviolet irradiation stimulate the production of IL-24 in NHKs. IL-24 stimulates the JAK1-STAT3 and MAPK pathways in NHKs, and promotes the secretion of pro-inflammatory mediators IL-8, PGE2, and MMP-1. These results suggest that keratinocyte-derived IL-24 participates in the positive feedback regulation of epidermal inflammation in response to both endogenous and environmental toxic stressors. Copyright © 2014 Elsevier Inc. All rights reserved.

  9. Bioengineering of cultured epidermis from adult epidermal stem cells using Mebio gel sutable as autologous graft material

    Directory of Open Access Journals (Sweden)

    Lakshmana K Yerneni

    2007-01-01

    quicker healing proving the importance and usefulness of the method. With this new approach a large number of moderate to severely burned patients could be saved in several burn centers across our country with reduced hospitalization period. However, the cell based therapeutic option in burn-wound healing by the application of in vitro - cultivated sheets of epidermis from autologous epidermal keratinocyte stem cells uses no matrix. This technque is sufficient for burn wounds of 2nd & 3rd mixed degree. The burn wounds predominantly of 3rd?and 4th?mixed degree can not be healed by the thin cultured epidermis, thus requiring a cellular or cellular scaffold that more or less mimic for graft take in deeper burns. With this aim, we are presently attempting to create such a scaffold using Mebiol gel, which could support the cultured epidermis for better transfer to the wound bed. Additionally, the usefulness of Mebiol gel in growing epidermal sheets without the necessity of FBS and/or animal origin feeder cells but using human feeder cells will also be tested.

  10. Epidermolytic hyperkeratosis in inflammatory linear verrucous epidermal nevus

    Directory of Open Access Journals (Sweden)

    Naser Tayyebi Meibodi

    2011-01-01

    Full Text Available Epidermolytic hyperkeratosis presents with perinuclear vacuolization of the keratinocytes in spinous and granular layers, keratinocytes with ill-defined limits, which leads to a reticulate appearance of the epidermis, an increased number of variously shaped and sized basophilic keratohyalin granules and the same sized eosinophilic trichohyalin granules, at any level of epidermis, mainly in the stratum granulosum, and compact hyperkeratosis. This minor reactive pathologic reaction pattern of skin is found in large variety of diseases. This paper is the first case report of such pattern in inflammatory linear verrucous epidermal nevus. Our case is of a 23-year-old man with pruritic verrucous lesions of trunk and extremities initiated since 13 years ago. Physical examination revealed white linear hyperkeratotic lesions, some of them on erythematous background and also classic epidermal nevus. No skeletal, ophthalmic, and nervous system involvement was detected. Microscopic study of pruritic verrucous lesions showed psoriasiform acanthosis, mild papillomatous, hyperkeratosis, and epidermolytic hyperkeratotic changes in hair follicles and acrosyrinx accompanied with moderate perivascular inflammation.

  11. Flexible pH-Sensing Hydrogel Fibers for Epidermal Applications.

    Science.gov (United States)

    Tamayol, Ali; Akbari, Mohsen; Zilberman, Yael; Comotto, Mattia; Lesha, Emal; Serex, Ludovic; Bagherifard, Sara; Chen, Yu; Fu, Guoqing; Ameri, Shideh Kabiri; Ruan, Weitong; Miller, Eric L; Dokmeci, Mehmet R; Sonkusale, Sameer; Khademhosseini, Ali

    2016-03-01

    Epidermal pH is an indication of the skin's physiological condition. For example, pH of wound can be correlated to angiogenesis, protease activity, bacterial infection, etc. Chronic nonhealing wounds are known to have an elevated alkaline environment, while healing process occurs more readily in an acidic environment. Thus, dermal patches capable of continuous pH measurement can be used as point-of-care systems for monitoring skin disorder and the wound healing process. Here, pH-responsive hydrogel fibers are presented that can be used for long-term monitoring of epidermal wound condition. pH-responsive dyes are loaded into mesoporous microparticles and incorporated into hydrogel fibers using a microfluidic spinning system. The fabricated pH-responsive microfibers are flexible and can create conformal contact with skin. The response of pH-sensitive fibers with different compositions and thicknesses are characterized. The suggested technique is scalable and can be used to fabricate hydrogel-based wound dressings with clinically relevant dimensions. Images of the pH-sensing fibers during real-time pH measurement can be captured with a smart phone camera for convenient readout on-site. Through image processing, a quantitative pH map of the hydrogel fibers and the underlying tissue can be extracted. The developed skin dressing can act as a point-of-care device for monitoring the wound healing process. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Steven johnsons syndrome and toxic epidermal necrolysis: A review

    Directory of Open Access Journals (Sweden)

    Sri ram Anne

    2014-12-01

    Full Text Available Toxic epidermal necrolysis (TEN and Stevens Johnson Syndrome (SJS are severe adverse cutaneous drug reactions that predominantly involve the skin and mucous membranes. They are characterized by mucocutaneous tenderness and typically hemorrhagic erosions, erythema and more or less severe epidermal detachment presenting as blisters and areas of denuded skin. Drugs are assumed or identified as the main cause of SJS/TEN in most cases, but Mycoplasma pneumoniae and Herpes simplex virus infections are well documented causes alongside rare cases in which the etiology remains unknown. Several drugs are at "high" risk of inducing TEN/SJS including: Allopurinol, Trimethoprim-sulfamethoxazole and other sulfonamide-antibiotics, aminopenicillins, cephalosporins, quinolones, carbamazepine, phenytoin, phenobarbital and NSAID's of the oxicam-type. Differential diagnosis includes linear IgA dermatosis and paraneoplastic pemphigus, pemphigus vulgaris and bullous pemphigoid, acute generalized exanthematous pustulosis (AGEP, disseminated fixed bullous drug eruption and staphyloccocal scalded skin syndrome (SSSS. Due to the high risk of mortality, management of patients with SJS/TEN requires rapid diagnosis, identification and interruption of the culprit drug, specialized supportive care ideally in an intensive care unit, and consideration of immunomodulating agents such as high-dose intravenous immunoglobulin therapy.

  13. The SKINT1-like gene is inactivated in hominoids but not in all primate species: implications for the origin of dendritic epidermal T cells.

    Directory of Open Access Journals (Sweden)

    Rania Hassan Mohamed

    Full Text Available Dendritic epidermal T cells, which express an invariant Vγ5Vδ1 T-cell receptor and account for 95% of all resident T cells in the mouse epidermis, play a critical role in skin immune surveillance. These γδ T cells are generated by positive selection in the fetal thymus, after which they migrate to the skin. The development of dendritic epidermal T cells is critically dependent on the Skint1 gene expressed specifically in keratinocytes and thymic epithelial cells, suggesting an indispensable role for Skint1 in the selection machinery for specific intraepithelial lymphocytes. Phylogenetically, rodents have functional SKINT1 molecules, but humans and chimpanzees have a SKINT1-like (SKINT1L gene with multiple inactivating mutations. In the present study, we analyzed SKINT1L sequences in representative primate species and found that all hominoid species have a common inactivating mutation, but that Old World monkeys such as olive baboons, green monkeys, cynomolgus macaques and rhesus macaques have apparently functional SKINT1L sequences, indicating that SKINT1L was inactivated in a common ancestor of hominoids. Interestingly, the epidermis of cynomolgus macaques contained a population of dendritic-shaped γδ T cells expressing a semi-invariant Vγ10/Vδ1 T-cell receptor. However, this population of macaque T cells differed from rodent dendritic epidermal T cells in that their Vγ10/Vδ1 T-cell receptors displayed junctional diversity and expression of Vγ10 was not epidermis-specific. Therefore, macaques do not appear to have rodent-type dendritic epidermal T cells despite having apparently functional SKINT1L. Comprehensive bioinformatics analysis indicates that SKINT1L emerged in an ancestor of placental mammals but was inactivated or lost multiple times in mammalian evolution and that Skint1 arose by gene duplication in a rodent lineage, suggesting that authentic dendritic epidermal T cells are presumably unique to rodents.

  14. Epidermal Expression and Regulation of Interleukin-33 during Homeostasis and Inflammation: Strong Species Differences.

    Science.gov (United States)

    Sundnes, Olav; Pietka, Wojciech; Loos, Tamara; Sponheim, Jon; Rankin, Andrew L; Pflanz, Stefan; Bertelsen, Vibeke; Sitek, Jan C; Hol, Johanna; Haraldsen, Guttorm; Khnykin, Denis

    2015-07-01

    IL-33 is a novel IL-1 family member with a putative role in inflammatory skin disorders and a complex biology. Therefore, recent conflicting data regarding its function in experimental models justify a close assessment of its tissue expression and regulation. Indeed, we report here that there are strong species differences in the expression and regulation of epidermal IL-33. In murine epidermis, IL-33 behaved similar to an alarmin, being constitutively expressed in keratinocyte nuclei and rapidly lost during acute inflammation. By contrast, human and porcine IL-33 were weakly expressed or absent in keratinocytes of noninflamed skin but induced during acute inflammation. To this end, we observed that expression of IL-33 in human keratinocytes but not murine keratinocytes was strongly induced by IFN-γ, and this upregulation completely depended on the presence of EGFR ligands. Accordingly, IFN-γ increased the expression of IL-33 in the basal layers of the epidermis in human ex vivo skin cultures only, despite good evidence of IFN-γ activity in cultures from both species. Together these findings demonstrate that a full understanding of IL-33 function in clinical settings must take species-specific differences into account.

  15. Identification of SLURP-1 as an epidermal neuromodulator explains the clinical phenotype of Mal de Meleda

    DEFF Research Database (Denmark)

    Chimienti, Fabrice; Hogg, Ronald C; Plantard, Laure

    2003-01-01

    alpha 7 nicotinic acetylcholine receptors that are present in keratinocytes. These results identify SLURP-1 as a secreted epidermal neuromodulator which is likely to be essential for both epidermal homeostasis and inhibition of TNF-alpha release by macrophages during wound healing. This explains both...

  16. Periostin contributes to epidermal hyperplasia in psoriasis common to atopic dermatitis

    Directory of Open Access Journals (Sweden)

    Kazuhiko Arima

    2015-01-01

    Conclusions: Periostin plays an important role during epidermal hyperplasia in IMQ-induced skin inflammation, independently of the IL-23–IL-17/IL-22 axis. Periostin appears to be a mediator for epidermal hyperplasia that is common to AD and psoriasis.

  17. Excision of pyrimidine dimers from epidermal DNA and nonsemiconservative epidermal DNA synthesis following ultraviolet irradiation of mouse skin

    International Nuclear Information System (INIS)

    Bowden, G.T.; Trosko, J.E.; Shapas, B.G.; Boutwell, R.K.

    1975-01-01

    Pyrimidine dimer production and excision in epidermal DNA were studied at five different dose levels of ultraviolet light in the skin of intact mice. Dimer production increased with dose up to 50,400 ergs/sq mm. Approximately 30 percent of the thymine-containing dimers were excised by 24 hr after irradiation at three lower dose levels of ultraviolet light. Nonsemiconservative DNA replication in ultraviolet-irradiated mouse skin was shown to continue for at least 18 hr. The rate of nonsemiconservative replication decreased with time, but did so slowly. The initial rates of nonsemiconservative replication increased with ultraviolet light dose levels up to about 4200 ergs/sq mm, after which the initial rates were decreased. Semiconservative epidermal DNA synthesis was shown to be inhibited by hydroxyurea, but hydroxyurea had no effect on ultraviolet light-induced nonsemiconservative DNA replication. The observed pyrimidine dimer excision and nonsemiconservative DNA replication suggest that in the intact mouse the cells of the epidermis are capable of DNA excision repair after ultraviolet irradiation of mouse skin

  18. Epidermal growth factor in alkali-burned corneal epithelial wound healing.

    Science.gov (United States)

    Singh, G; Foster, C S

    1987-06-15

    We conducted a double-masked study to evaluate the effect of epidermal growth factor on epithelial wound healing and recurrent erosions in alkali-burned rabbit corneas. Epithelial wounds 10 mm in diameter healed completely under the influence of topical epidermal growth factor, whereas the control corneas did not resurface in the center. On reversal of treatment, the previously nonhealing epithelial defects healed when treated with topical epidermal growth factor eyedrops. Conversely, the epidermal growth factor-treated and resurfaced corneas developed epithelial defects when treatment was discontinued. Histopathologic examination disclosed hyperplastic epithelium growing over the damaged stroma laden with polymorphonuclear leukocytes when treated with epidermal growth factor eyedrops, but it did not adhere to the underlying tissue. Hydropic changes were seen intracellularly as well as between the epithelial cells and the stroma.

  19. Penile epidermal inclusion cyst: a late complication of penile girth enhancement surgery.

    Science.gov (United States)

    Park, Hyun Jun; Park, Nam Cheol; Park, Sung Woo; Jern, Tae Kyung; Choi, Kyung-Un

    2008-09-01

    Epidermal inclusion cysts are benign lesions that can develop in any part of the body. However, the finding of an epidermal inclusion cyst in the penis is rare. The aim of this article was to present the management of a case of a penile epidermal inclusion cyst that occurred because of late complications of a penile girth enhancement surgery. A 52-year-old man presented with a painless, slowly growing mass in the penis, which was first noted after a penile girth enhancement surgery 20 years ago. A cystic mobile mass about 2 cm in depth was found surrounding the coronal sulcus. Excision of the mass was performed for diagnosis and treatment. There was no communication with the urethra. The pathological diagnosis was an epidermal inclusion cyst of the penis. A penile epidermal inclusion cyst in adult men is rare. It can develop after an inadequate procedure for penile girth enhancement, and should be treated by complete resection.

  20. De-Escalation Strategies in Human Epidermal Growth Factor Receptor 2 (HER2)-Positive Early Breast Cancer (BC): Final Analysis of the West German Study Group Adjuvant Dynamic Marker-Adjusted Personalized Therapy Trial Optimizing Risk Assessment and Therapy Response Prediction in Early BC HER2- and Hormone Receptor-Positive Phase II Randomized Trial-Efficacy, Safety, and Predictive Markers for 12 Weeks of Neoadjuvant Trastuzumab Emtansine With or Without Endocrine Therapy (ET) Versus Trastuzumab Plus ET.

    Science.gov (United States)

    Harbeck, Nadia; Gluz, Oleg; Christgen, Matthias; Kates, Ronald Ernest; Braun, Michael; Küemmel, Sherko; Schumacher, Claudia; Potenberg, Jochem; Kraemer, Stefan; Kleine-Tebbe, Anke; Augustin, Doris; Aktas, Bahriye; Forstbauer, Helmut; Tio, Joke; von Schumann, Raquel; Liedtke, Cornelia; Grischke, Eva-Maria; Schumacher, Johannes; Wuerstlein, Rachel; Kreipe, Hans Heinrich; Nitz, Ulrike Anneliese

    2017-09-10

    Purpose Human epidermal growth factor receptor 2 (HER2)-positive/hormone receptor (HR)-positive breast cancer is a distinct subgroup associated with lower chemotherapy sensitivity and slightly better outcome than HER2-positive/HR-negative disease. Little is known about the efficacy of the combination of endocrine therapy (ET) with trastuzumab or with the potent antibody-cytotoxic, anti-HER2 compound trastuzumab emtansine (T-DM1) with or without ET for this subgroup. The West German Study Group trial, ADAPT (Adjuvant Dynamic Marker-Adjusted Personalized Therapy Trial Optimizing Risk Assessment and Therapy Response Prediction in Early Breast Cancer) compares pathologic complete response (pCR) rates of T-DM1 versus trastuzumab with ET in early HER2-positive/HR-positive breast cancer. Patients and Methods In this prospective, neoadjuvant, phase II trial, 375 patients with early breast cancer with HER2-positive and HR-positive status (n = 463 screened) were randomly assigned to 12 weeks of T-DM1 with or without ET or to trastuzumab with ET. The primary end point was pCR (ypT0/is/ypN0). Early response was assessed in 3-week post-therapeutic core biopsies (proliferation decrease ≥ 30% Ki-67 or cellularity response). Secondary end points included safety and predictive impact of early response on pCR. Adjuvant therapy followed national standards. Results Baseline characteristics were well balanced among the arms. More than 90% of patients completed the therapy per protocol. pCR was observed in 41.0% of patients treated with T-DM1, 41.5% of patients treated with T-DM1 and ET, and 15.1% with trastuzumab and ET ( P < .001). Early responders (67% of patients with assessable response) achieved pCR in 35.7% compared with 19.8% in nonresponders (odds ratio, 2.2; 95% CI, 1.24 to 4.19). T-DM1 was associated with a significantly higher prevalence of grade 1 to 2 toxicities, especially thrombocytopenia, nausea, and elevation of liver enzymes. Overall toxicity was low; seventeen

  1. Inhibition of cyclobutane pyrimidine dimer formation in epidermal p53 gene of UV-irradiated mice by alpha-tocopherol

    International Nuclear Information System (INIS)

    Chen, W.; Barthelman, M.; Martinez, J.; Alberts, D.; Gensler, H.L.

    1997-01-01

    Mutations or alterations in the p53 gene have been observed in 50-100% of ultraviolet light (UV)-induced squamous cell carcinoma in humans and animals. Most of the mutations occurred at dipyrimidine sequences, suggesting that pyrimidine dimers in the p53 gene play a role in the pathogenesis of cutaneous squamous cell carcinoma. We previously showed that topical alpha-tocopherol prevents UV-induced skin carcinogenesis in the mouse. In the present study we asked whether topical alpha-tocopherol reduces the level of UV-induced cyclobutane pyrimidine dimers in the murine epidermal p53 gene. Mice received six dorsal applications of 25 mg each of alpha-tocopherol, on alternate days, before exposure to 500 J/m2 of UV-B irradiation. Mice were killed at selected times after irradiation. The level of dimers in the epidermal p53 gene was measured using the T4 endonuclease V assay with quantitative Southern hybridization. Topical alpha-tocopherol caused a 55% reduction in the formation of cyclobutane pyrimidine dimers in the epidermal p53 gene. The rate of reduction of pyrimidine dimers between 1 and 10 hours after irradiation was similar in UV-irradiated mice, regardless of alpha-tocopherol treatment. Therefore, the lower level of cyclobutane pyrimidine dimers in UV-irradiated mice treated with alpha-tocopherol than in control UV-irradiated mice resulted from the prevention of formation of the dimers, and not from enhanced repair of these lesions. Our results indicate that alpha-tocopherol acts as an effective sunscreen in vivo, preventing the formation of premutagenic DNA lesions in a gene known to be important in skin carcinogenesis

  2. Perforated Sigmoid Diverticulitis in the Presence of Toxic Epidermal Necrolysis

    Directory of Open Access Journals (Sweden)

    P. Heye

    2014-02-01

    Full Text Available Even though the incidence of toxic epidermal necrolysis (TEN is low, it is also associated with a high mortality rate. The condition predominantly affects the skin, but may also affect the gastrointestinal tract, dramatically increasing mortality. We present a case of perforated sigmoid diverticulitis in the presence of TEN. The patient was taking medication, known to be a risk factor, and presented an affected total body surface area and temporal development similar to previously reported cases of TEN. Characteristic abdominal symptoms, however, were missing. Gastrointestinal involvement in TEN appears to be a poor prognostic factor; medical staff must therefore be alert to patients with TEN who complain of abdominal discomfort. The exact pathogenesis, however, remains unclear.

  3. Epidermal Growth Factor Receptor (EGFR) Crosstalks in Liver Cancer

    International Nuclear Information System (INIS)

    Berasain, Carmen; Latasa, María Ujue; Urtasun, Raquel; Goñi, Saioa; Elizalde, María; Garcia-Irigoyen, Oihane; Azcona, María; Prieto, Jesús; Ávila, Matías A.

    2011-01-01

    Hepatocarcinogenesis is a complex multistep process in which many different molecular pathways have been implicated. Hepatocellular carcinoma (HCC) is refractory to conventional chemotherapeutic agents, and the new targeted therapies are meeting with limited success. Interreceptor crosstalk and the positive feedback between different signaling systems are emerging as mechanisms of targeted therapy resistance. The identification of such interactions is therefore of particular relevance to improve therapeutic efficacy. Among the different signaling pathways activated in hepatocarcinogenesis the epidermal growth factor receptor (EGFR) system plays a prominent role, being recognized as a “signaling hub” where different extracellular growth and survival signals converge. EGFR can be transactivated in response to multiple heterologous ligands through the physical interaction with multiple receptors, the activity of intracellular kinases or the shedding of EGFR-ligands. In this article we review the crosstalk between the EGFR and other signaling pathways that could be relevant to liver cancer development and treatment

  4. Epidermal segmentation in high-definition optical coherence tomography.

    Science.gov (United States)

    Li, Annan; Cheng, Jun; Yow, Ai Ping; Wall, Carolin; Wong, Damon Wing Kee; Tey, Hong Liang; Liu, Jiang

    2015-01-01

    Epidermis segmentation is a crucial step in many dermatological applications. Recently, high-definition optical coherence tomography (HD-OCT) has been developed and applied to imaging subsurface skin tissues. In this paper, a novel epidermis segmentation method using HD-OCT is proposed in which the epidermis is segmented by 3 steps: the weighted least square-based pre-processing, the graph-based skin surface detection and the local integral projection-based dermal-epidermal junction detection respectively. Using a dataset of five 3D volumes, we found that this method correlates well with the conventional method of manually marking out the epidermis. This method can therefore serve to effectively and rapidly delineate the epidermis for study and clinical management of skin diseases.

  5. Exudative epidermitis in pigs caused by toxigenic Staphylococcus chromogenes

    DEFF Research Database (Denmark)

    Andresen, Lars Ole; Ahrens, Peter; Daugaard, Lise

    2005-01-01

    Staphylococcus chromogenes is closely related to Staphylococcus hyicus, which is recognised as the causative agent of exudative epidermitis (EE) in pigs. S. chromogenes is part of the normal skin flora of pigs, cattle and poultry and has so far been considered non-pathogenic to pigs. A strain of S....... chromogenes producing exfoliative toxin type B, ExhB, was identified by the use of a multiplex PCR specific for the exfoliative toxins from S. hyicus. The exfoliative toxin from S. chromogenes reacted in immunoblot analysis with polyclonal and monoclonal antibodies specific to ExhB from S. hyicus and had...... an apparent molecular weight of 30 kDa. Sequencing the gene encoding the exfoliative toxin from S. chromogenes revealed that the molecular weight of the toxin with the signal peptide and the mature toxin was 30,553 and 26,694 Da, respectively. Comparison of the exhB genes from S. chromogenes strain VA654...

  6. EPIDERMAL CHARACTERS OF BACCHARIS (ASTERACEAE SPECIES USED IN TRADITIONAL MEDICINE

    Directory of Open Access Journals (Sweden)

    FREIRE SUSANA E.

    2007-06-01

    Full Text Available A morphological study of 38 species of Baccharis used in traditional medicinewas carried out to provide some epidermal characters that will contribute to theknowledge of the genus. The present study revealed: 1 seven different types oftrichomes: conical, aseptate fl agellate, fi liform fl agellate, 1-armed, 2-4-armed,bulbiferous fl agellate, and glandular biseriate; 2 that 28 of the total of 38 specieshave trichomes in tufts; 3 six different types of stomata: anomocytic, anisocytic,cyclocytic, actinocytic, tetracytic, and staurocytic; 4 that some trichome types,such as 2-4-armed (B. dracunculifolia and aseptate fl agellate branched (B. trinervis,show a high diagnostic value; 5 that the stomata types can be used to differentiatespecies with similar trichomes type (e.g. B. trimera and B. articulata.Illustrations of the studied characters are provided.

  7. Epidermal growth factor pathway substrate 15, Eps15

    DEFF Research Database (Denmark)

    Salcini, A E; Chen, H; Iannolo, G

    1999-01-01

    Eps15 was originally identified as a substrate for the kinase activity of the epidermal growth factor receptor (EGFR). Eps15 has a tripartite structure comprising a NH2-terminal portion, which contains three EH domains, a central putative coiled-coil region, and a COOH-terminal domain containing...... multiple copies of the amino acid triplet Aspartate-Proline-Phenylalanine. A pool of Eps15 is localized at clathrin coated pits where it interacts with the clathrin assembly complex AP-2 and a novel AP-2 binding protein, Epsin. Perturbation of Eps15 and Epsin function inhibits receptor-mediated endocytosis...... of EGF and transferrin, demonstrating that both proteins are components of the endocytic machinery. Since the family of EH-containing proteins is implicated in various aspects of intracellular sorting, biomolecular strategies aimed at interfering with these processes can now be envisioned...

  8. Effect of glucocorticoids and gamma radiation on epidermal Langerhans cells

    International Nuclear Information System (INIS)

    Belsito, D.V.; Baer, R.L.; Thorbecke, G.J.; Gigli, I.

    1984-01-01

    The effect of 750 rads of gamma radiation on the rate of return of epidermal Langerhans cells (LC) following suppressive doses of topical glucorticoids was studied in guinea pigs. Gamma radiation alone had no effect on the LC as assessed by staining for cell membrane ATPase activity and Ia antigen. It did, however, delay the expected return of Ia but not ATPase surface markers on the LC after perturbation with glucocorticoids. The delayed return of surface Ia antigen is possibly related to a radiation-induced defect in the production of a required lymphokine and/or in intracellular Ia transport. Although our data do not rule out a cytolytic effect of steroids on the LC, they do strongly suggest that, at least in part, glucocorticoids act on the LC by altering cell surface characteristics

  9. Analysis of E2F factors during epidermal differentiation.

    Science.gov (United States)

    Chang, Wing Y; Dagnino, Lina

    2005-01-01

    The multigene E2F family of transcription factors is central in the control of cell cycle progression. The expression and activity of E2F proteins is tightly regulated transcriptionally and posttranslationally as a function of the proliferation and differentiation status of the cell. In this chapter, we review protocols designed to determine E2F mRNA abundance in tissues by in situ hybridization techniques. The ability to culture primary epidermal keratinocytes and maintain them as either undifferentiated or terminally differentiated cells allows the biochemical and molecular characterization of changes in E2F expression and activity. Thus, we also discuss in detail methods to analyze E2F protein abundance by immunoblot and their ability to bind DNA in cultured cells using electrophoretic mobility shift assays.

  10. Collagen sheet dressings for cutaneous lesions of toxic epidermal necrolysis

    Directory of Open Access Journals (Sweden)

    S Bhattacharya

    2011-01-01

    Full Text Available Toxic epidermal necrolysis (TEN is associated with a significant mortality of 30-50% and long-term sequelae. Treatment includes early admission to a burn unit, where management with precise fluid, electrolyte, protein, and energy supplementation, moderate mechanical ventilation, and expert wound care can be provided. Specific treatment with immunosuppressive drugs or immunoglobulins did not show an improved outcome in most studies and remains controversial. We have treated the cutaneous lesions of seven patients of TEN with collagen sheet dressings and have found a significant reduction in morbidity. The sheets are a one-time dressing, easy to apply and they reduce fluid loss, prevent infection, reduce pain, avoid repeated dressings and gradually peal off as the underlying lesions heal.

  11. Epidermal differential impedance sensor for conformal skin hydration monitoring.

    Science.gov (United States)

    Huang, Xian; Yeo, Woon-Hong; Liu, Yuhao; Rogers, John A

    2012-12-01

    We present the design and use of an ultrathin, stretchable sensor system capable of conformal lamination onto the skin, for precision measurement and spatial mapping of levels of hydration. This device, which we refer to as a class of 'epidermal electronics' due to its 'skin-like' construction and mode of intimate integration with the body, contains miniaturized arrays of impedance-measurement electrodes arranged in a differential configuration to compensate for common-mode disturbances. Experimental results obtained with different frequencies and sensor geometries demonstrate excellent precision and accuracy, as benchmarked against conventional, commercial devices. The reversible, non-invasive soft contact of this device with the skin makes its operation appealing for applications ranging from skin care, to athletic monitoring to health/wellness assessment.

  12. Toxic epidermal necrolysis associated with deflazacort therapy with nephrotic syndrome

    Directory of Open Access Journals (Sweden)

    Eun Chae Lee

    2014-12-01

    Full Text Available Toxic epidermal necrolysis (TEN is a drug-related fatal disease. Extensive necrosis of the epidermis can lead to serious complications. This report describes two cases of TEN, associated with deflazacort (DFZ, in two boys, aged 4 years and 14 years, with nephrotic syndrome (NS. The 14-year-old male teenager received DFZ following NS relapse. After 17 days, pruritic papules appeared on the lower extremities. Another case involved a 4-year-old boy receiving DFZ and enalapril. After a 41-day DFZ treatment period, erythematous papules appeared on the palms and soles. Within 3 days, both boys developed widespread skin lesions (>50% and were admitted to the intensive care unit for resuscitative and supportive treatment. The patients showed improvement after intravenous immunoglobulin-G therapy. Owing to the rapid, fatal course of TEN, clinicians need to be aware of the adverse effects of this drug when treating cases of NS.

  13. BAG-1 enhances cell-cell adhesion, reduces proliferation and induces chaperone-independent suppression of hepatocyte growth factor-induced epidermal keratinocyte migration

    International Nuclear Information System (INIS)

    Hinitt, C.A.M.; Wood, J.; Lee, S.S.; Williams, A.C.; Howarth, J.L.; Glover, C.P.; Uney, J.B.; Hague, A.

    2010-01-01

    Cell motility is important in maintaining tissue homeostasis, facilitating epithelial wound repair and in tumour formation and progression. The aim of this study was to determine whether BAG-1 isoforms regulate epidermal cell migration in in vitro models of wound healing. In the human epidermal cell line HaCaT, endogenous BAG-1 is primarily nuclear and increases with confluence. Both transient and stable p36-Bag-1 overexpression resulted in increased cellular cohesion. Stable transfection of either of the three human BAG-1 isoforms p36-Bag-1 (BAG-1S), p46-Bag-1 (BAG-1M) and p50-Bag-1 (BAG-1L) inhibited growth and wound closure in serum-containing medium. However, in response to hepatocyte growth factor (HGF) in serum-free medium, BAG-1S/M reduced communal motility and colony scattering, but BAG-1L did not. In the presence of HGF, p36-Bag-1 transfectants retained proliferative response to HGF with no change in ERK1/2 activation. However, the cells retained E-cadherin localisation at cell-cell junctions and exhibited pronounced cortical actin. Point mutations in the BAG domain showed that BAG-1 inhibition of motility is independent of its function as a chaperone regulator. These findings are the first to suggest that BAG-1 plays a role in regulating cell-cell adhesion and suggest an important function in epidermal cohesion.

  14. Frozen cultured sheets of epidermal keratinocytes in reepithelialization and repair of the cornea after photorefractive keratectomy.

    Science.gov (United States)

    Castro-Muñozledo, Federico; Ozorno-Zarate, Jorge; Naranjo-Tackman, Ramon; Kuri-Harcuch, Walid

    2002-09-01

    To determine whether frozen cultured sheets of human allogeneic epidermal keratinocytes (CEAK) improved wound repair after experimental corneal ablation by photorefractive keratectomy (PRK). Hospital "Luis Sanchez Bulnes" de la Asociación para Evitar la Ceguera en Mexico, I.A.P, and Department of Cell Biology, CINVESTAV-IPN, Mexico City, Mexico. Transepithelial PRK was performed in the right eye of male albino rabbits to obtain a 112 microm deep and 6.0 mm diameter ablation zone. In 17 eyes, the ablations were covered with frozen CEAK; in 11 eyes, the ablations were covered with a disposable contact lens without the cultured sheets; and in the control group (13 eyes), the ablations were not covered. Subepithelial fibrosis and reepithelialization of the ablated zone were evaluated in serial paraffin-embedded tissue sections from all wounds. Treatment with CEAK reduced fibroblast proliferation and the inflammatory response beneath the ablated zone and produced better organization of the newly formed epithelium by eliminating significant hyperplasia or discontinuities in the periodic acid Shiff-stained basement membrane. It also led to accelerated reepithelialization. The use of frozen CEAK as a biologically active wound dressing improved tissue repair at 1 month in corneas ablated by transepithelial PRK in the male albino rabbit model. Treatment with CEAK could improve the outcome of PRK in humans.

  15. Epidermal growth factor receptor expression in radiation-induced dog lung tumors by immunocytochemical localization

    Energy Technology Data Exchange (ETDEWEB)

    Leung, F.L.; Park, J.F.; Dagle, G.E.

    1993-06-01

    In studies to determine the role of growth factors in radiation-induced lung cancer, epidermal growth factor (EGFR) expression was examined by immunocytochemistry in 51 lung tumors from beagle dogs exposed to inhaled plutonium; 21 of 51 (41%) tumors were positive for EGFR. The traction of tumors positive for EGFR and the histological type of EGFR-positive tumors in the plutonium-exposed dogs were not different from spontaneous dog lung tumors, In which 36% were positive for EGFR. EGFR involvement in Pu-induced lung tumors appeared to be similar to that in spontaneous lung tumors. However, EGFR-positive staining was observed in only 1 of 16 tumors at the three lowest Pu exposure levels, compared to 20 of 35 tumors staining positive at the two highest Pu exposure levels. The results in dogs were in good agreement with the expression of EGFR reported in human non-small cell carcinoma of the lung, suggesting that Pu-induced lung tumors in the dog may be a suitable animal model to investigate the role of EGFR expression in lung carcinogenesis. In humans, EGFR expression in lung tumors has been primarily related to histological tumor types. In individual dogs with multiple primary lung tumors, the tumors were either all EGFR positive or EGFR negative, suggesting that EGFR expression may be related to the response of the individual dog as well as to the histological type of tumor.

  16. The Antiaging Properties of Andrographis paniculata by Activation Epidermal Cell Stemness.

    Science.gov (United States)

    You, Jiyoung; Roh, Kyung-Baeg; Li, Zidan; Liu, Guangrong; Tang, Jian; Shin, Seoungwoo; Park, Deokhoon; Jung, Eunsun

    2015-09-22

    Andrographis paniculata (A. paniculata, Chuanxinlian), a medicinal herb with an extremely bitter taste that is native to China and other parts of Southeast Asia, possesses immense therapeutic value; however, its therapeutic properties have rarely been applied in the field of skin care. In this study, we investigated the effect of an A. paniculata extract (APE) on human epidermal stem cells (EpSCs), and confirmed its anti-aging effect through in vitro, ex vivo, and in vivo study. An MTT assay was used to determine cell proliferation. A flow cytometric analysis, with propidium iodide, was used to evaluate the cell cycle. The expression of integrin β1 (CD29), the stem cell marker, was detected with antibodies, using flow cytometry in vitro, and immunohistochemical assays in ex vivo. Type 1 collagen and VEGF (vascular endothelial growth factor) were measured using an enzyme-linked immunosorbent assay (ELISA). During the clinical study, skin hydration, elasticity, wrinkling, sagging, and dermal density were evaluated before treatment and at four and eight weeks after the treatment with the test product (containing the APE) on the face. The proliferation of the EpSCs, treated with the APE, increased significantly. In the cell cycle analysis, the APE increased the G2/M and S stages in a dose-dependent manner. The expression of integrin β1, which is related to epidermal progenitor cell expansion, was up-regulated in the APE-treated EpSCs and skin explants. In addition, the production of VEGF in the EpSCs increased significantly in response to the APE treatment. Consistent with these results, the VEGF and APE-treated EpSCs conditioned medium enhanced the Type 1 collagen production in normal human fibroblasts (NHFs). In the clinical study, the APE improved skin hydration, dermal density, wrinkling, and sagging significantly. Our findings revealed that the APE promotes a proliferation of EpSCs, through the up-regulation of the integrin β1 and VEGF expression. The VEGF

  17. The Antiaging Properties of Andrographis paniculata by Activation Epidermal Cell Stemness

    Directory of Open Access Journals (Sweden)

    Jiyoung You

    2015-09-01

    Full Text Available Andrographis paniculata (A. paniculata, Chuanxinlian, a medicinal herb with an extremely bitter taste that is native to China and other parts of Southeast Asia, possesses immense therapeutic value; however, its therapeutic properties have rarely been applied in the field of skin care. In this study, we investigated the effect of an A. paniculata extract (APE on human epidermal stem cells (EpSCs, and confirmed its anti-aging effect through in vitro, ex vivo, and in vivo study. An MTT assay was used to determine cell proliferation. A flow cytometric analysis, with propidium iodide, was used to evaluate the cell cycle. The expression of integrin β1 (CD29, the stem cell marker, was detected with antibodies, using flow cytometry in vitro, and immunohistochemical assays in ex vivo. Type 1 collagen and VEGF (vascular endothelial growth factor were measured using an enzyme-linked immunosorbent assay (ELISA. During the clinical study, skin hydration, elasticity, wrinkling, sagging, and dermal density were evaluated before treatment and at four and eight weeks after the treatment with the test product (containing the APE on the face. The proliferation of the EpSCs, treated with the APE, increased significantly. In the cell cycle analysis, the APE increased the G2/M and S stages in a dose-dependent manner. The expression of integrin β1, which is related to epidermal progenitor cell expansion, was up-regulated in the APE-treated EpSCs and skin explants. In addition, the production of VEGF in the EpSCs increased significantly in response to the APE treatment. Consistent with these results, the VEGF and APE-treated EpSCs conditioned medium enhanced the Type 1 collagen production in normal human fibroblasts (NHFs. In the clinical study, the APE improved skin hydration, dermal density, wrinkling, and sagging significantly. Our findings revealed that the APE promotes a proliferation of EpSCs, through the up-regulation of the integrin β1 and VEGF expression

  18. Gloss, colour and grip: multifunctional epidermal cell shapes in bee- and bird-pollinated flowers.

    Science.gov (United States)

    Papiorek, Sarah; Junker, Robert R; Lunau, Klaus

    2014-01-01

    Flowers bear the function of filters supporting the attraction of pollinators as well as the deterrence of floral antagonists. The effect of epidermal cell shape on the visual display and tactile properties of flowers has been evaluated only recently. In this study we quantitatively measured epidermal cell shape, gloss and spectral reflectance of flowers pollinated by either bees or birds testing three hypotheses: The first two hypotheses imply that bee-pollinated flowers might benefit from rough surfaces on visually-active parts produced by conical epidermal cells, as they may enhance the colour signal of flowers as well as the grip on flowers for bees. In contrast, bird-pollinated flowers might benefit from flat surfaces produced by flat epidermal cells, by avoiding frequent visitation from non-pollinating bees due to a reduced colour signal, as birds do not rely on specific colour parameters while foraging. Moreover, flat petal surfaces in bird-pollinated flowers may hamper grip for bees that do not touch anthers and stigmas while consuming nectar and thus, are considered as nectar thieves. Beside this, the third hypothesis implies that those flower parts which are vulnerable to nectar robbing of bee- as well as bird-pollinated flowers benefit from flat epidermal cells, hampering grip for nectar robbing bees. Our comparative data show in fact that conical epidermal cells are restricted to visually-active parts of bee-pollinated flowers, whereas robbing-sensitive parts of bee-pollinated as well as the entire floral surface of bird-pollinated flowers possess on average flat epidermal cells. However, direct correlations between epidermal cell shape and colour parameters have not been found. Our results together with published experimental studies show that epidermal cell shape as a largely neglected flower trait might act as an important feature in pollinator attraction and avoidance of antagonists, and thus may contribute to the partitioning of flower-visitors.

  19. Gloss, colour and grip: multifunctional epidermal cell shapes in bee- and bird-pollinated flowers.

    Directory of Open Access Journals (Sweden)

    Sarah Papiorek

    Full Text Available Flowers bear the function of filters supporting the attraction of pollinators as well as the deterrence of floral antagonists. The effect of epidermal cell shape on the visual display and tactile properties of flowers has been evaluated only recently. In this study we quantitatively measured epidermal cell shape, gloss and spectral reflectance of flowers pollinated by either bees or birds testing three hypotheses: The first two hypotheses imply that bee-pollinated flowers might benefit from rough surfaces on visually-active parts produced by conical epidermal cells, as they may enhance the colour signal of flowers as well as the grip on flowers for bees. In contrast, bird-pollinated flowers might benefit from flat surfaces produced by flat epidermal cells, by avoiding frequent visitation from non-pollinating bees due to a reduced colour signal, as birds do not rely on specific colour parameters while foraging. Moreover, flat petal surfaces in bird-pollinated flowers may hamper grip for bees that do not touch anthers and stigmas while consuming nectar and thus, are considered as nectar thieves. Beside this, the third hypothesis implies that those flower parts which are vulnerable to nectar robbing of bee- as well as bird-pollinated flowers benefit from flat epidermal cells, hampering grip for nectar robbing bees. Our comparative data show in fact that conical epidermal cells are restricted to visually-active parts of bee-pollinated flowers, whereas robbing-sensitive parts of bee-pollinated as well as the entire floral surface of bird-pollinated flowers possess on average flat epidermal cells. However, direct correlations between epidermal cell shape and colour parameters have not been found. Our results together with published experimental studies show that epidermal cell shape as a largely neglected flower trait might act as an important feature in pollinator attraction and avoidance of antagonists, and thus may contribute to the partitioning of

  20. Comparative study between reconstructed and native human epidermis using nuclear microscopy

    International Nuclear Information System (INIS)

    Ynsa, M.D.; Gontier, E.; Mavon, A.; Moretto, P.; Rosdy, M.

    2006-01-01

    The physiological status of native skin is suffering from large inter-individual variations, especially in terms of inorganic ions content. For this reason, together with the advent of ethic laws on animal experimentation, reconstructed skin or epidermis models are extensively employed nowadays in penetration studies for cosmetic or pharmacological applications. It has been already verified that reconstructed human epidermis (RHE) has similar physiological mechanisms to native human skin, but until now, there are few studies where the elemental concentrations of both skins, reconstructed and native, are compared. In this work, freeze-dried thin sections of human native skin obtained from surgery have been characterized using PIXE, RBS and STIM at the CENBG nuclear microprobe. RHE samples were treated and analyzed in the same conditions for comparison. The combination of the different imaging and analysis techniques made possible a clear delimitation and identification of skin ultrastructure. The elemental concentrations of P, S, Cl, K and Ca were measured in the different strata. For both skins, concentrations have been compared and significant differences in terms of elemental concentrations have been determined using statistical approaches. Similar physiological characteristics were pointed out in both skin models, in particular the Ca gradient presumably involved in the regulation of the barrier effect

  1. Comparative study between reconstructed and native human epidermis using nuclear microscopy

    Energy Technology Data Exchange (ETDEWEB)

    Ynsa, M.D. [Centre d' Etudes Nucleaires de Bordeaux-Gradignan, IN2P3-CNRS/Unite Interface Physique-Biologie, BP 120, Le Haut Vigneau, 33175 Gradignan Cedex (France)]. E-mail: ynsa@cenbg.in2p3.fr; Gontier, E. [Centre d' Etudes Nucleaires de Bordeaux-Gradignan, IN2P3-CNRS/Unite Interface Physique-Biologie, BP 120, Le Haut Vigneau, 33175 Gradignan Cedex (France); Mavon, A. [Institut de Recherche Pierre FABRE, Castanet Tolosan (France); Moretto, P. [Centre d' Etudes Nucleaires de Bordeaux-Gradignan, IN2P3-CNRS/Unite Interface Physique-Biologie, BP 120, Le Haut Vigneau, 33175 Gradignan Cedex (France); Rosdy, M. [SkinEthic Laboratories, 45 rue St. Philippe, 06000 Nice (France)

    2006-08-15

    The physiological status of native skin is suffering from large inter-individual variations, especially in terms of inorganic ions content. For this reason, together with the advent of ethic laws on animal experimentation, reconstructed skin or epidermis models are extensively employed nowadays in penetration studies for cosmetic or pharmacological applications. It has been already verified that reconstructed human epidermis (RHE) has similar physiological mechanisms to native human skin, but until now, there are few studies where the elemental concentrations of both skins, reconstructed and native, are compared. In this work, freeze-dried thin sections of human native skin obtained from surgery have been characterized using PIXE, RBS and STIM at the CENBG nuclear microprobe. RHE samples were treated and analyzed in the same conditions for comparison. The combination of the different imaging and analysis techniques made possible a clear delimitation and identification of skin ultrastructure. The elemental concentrations of P, S, Cl, K and Ca were measured in the different strata. For both skins, concentrations have been compared and significant differences in terms of elemental concentrations have been determined using statistical approaches. Similar physiological characteristics were pointed out in both skin models, in particular the Ca gradient presumably involved in the regulation of the barrier effect.

  2. Epidermal stem cells - role in normal, wounded and pathological psoriatic and cancer skin

    DEFF Research Database (Denmark)

    Kamstrup, M.; Faurschou, A.; Gniadecki, R.

    2008-01-01

    In this review we focus on epidermal stem cells in the normal regeneration of the skin as well as in wounded and psoriatic skin. Furthermore, we discuss current data supporting the idea of cancer stem cells in the pathogenesis of skin carcinoma and malignant melanoma. Epidermal stem cells present...... or transit amplifying cells constitute a primary pathogenetic factor in the epidermal hyperproliferation seen in psoriasis. In cutaneous malignancies mounting evidence supports a stem cell origin in skin carcinoma and malignant melanoma and a possible existence of cancer stem cells Udgivelsesdato: 2008/5...

  3. Bioactive potency of epidermal mucus extracts from greasy grouper, Epinephelus tauvina (Forsskal, 1775

    Directory of Open Access Journals (Sweden)

    Ganesh Manikantan

    2016-07-01

    Full Text Available Objective: To study the bio-potency of epidermal mucus from Epinephelus tauvina. Methods: Mucus was extracted with acidic, organic and aqueous solvents. Protein, carbohydrate, lipid, amino acid and fatty acid content of mucus extracts were quantified by UV-spectrophotometer, high performance liquid chromatography and gas chromatographymass spectrometer, respectively. Antimicrobial activity was tested against five human and fish pathogens by using agar well diffusion method. The molecular weight of peptides was determined using sodium dodecyl sulfate-polyacrylamide gel electrophoresis. The haemolytic activity of extracts was tested against chick, goat, cow and human red blood cell. Results: Protein contributed with maximum of 26.25% in crude mucus. Arginine was recorded maximum of (133.9 nmol/mL in crude mucus. 2,4,6-Decatrienoic acid and bis (a-chloroethyl sulfone were confirmed in organic extract. The antimicrobial activity of aci