
Sample records for human epidermal membrane

  1. Polymeric membranes modulate human keratinocyte differentiation in specific epidermal layers. (United States)

    Salerno, Simona; Morelli, Sabrina; Giordano, Francesca; Gordano, Amalia; Bartolo, Loredana De


    In vitro models of human bioengineered skin substitutes are an alternative to animal experimentation for testing the effects and toxicity of drugs, cosmetics and pollutants. For the first time specific and distinct human epidermal strata were engineered by using membranes and keratinocytes. To this purpose, biodegradable membranes of chitosan (CHT), polycaprolactone (PCL) and a polymeric blend of CHT-PCL were prepared by phase-inversion technique and characterized in order to evaluate their morphological, physico-chemical and mechanical properties. The capability of membranes to modulate keratinocyte differentiation inducing specific interactions in epidermal membrane systems was investigated. The overall results demonstrated that the membrane properties strongly influence the cell morpho-functional behaviour of human keratinocytes, modulating their terminal differentiation, with the creation of specific epidermal strata or a fully proliferative epidermal multilayer system. In particular, human keratinocytes adhered on CHT and CHT-PCL membranes, forming the structure of the epidermal top layers, such as the corneum and granulosum strata, characterized by withdrawal or reduction from the cell cycle and cell proliferation. On the PCL membrane, keratinocytes developed an epidermal basal lamina, with high proliferating cells that stratified and migrated over time to form a complete differentiating epidermal multilayer system. Copyright © 2016 Elsevier B.V. All rights reserved.

  2. Dermal-epidermal membrane systems by using human keratinocytes and mesenchymal stem cells isolated from dermis

    Energy Technology Data Exchange (ETDEWEB)

    Salerno, Simona, E-mail: [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy); Messina, Antonietta [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy); Giordano, Francesca [Department of Pharmacy, Health and Nutritional Sciences, University of Calabria, I-87036 Rende, (CS) (Italy); Bader, Augustinus [Biomedical-Biotechnological Center, BBZ, University of Leipzig, D-04103 Leipzig (Germany); Drioli, Enrico [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy); WCU Energy Engineering Department, Hanyang University, Seoul (Korea, Republic of); De Bartolo, Loredana, E-mail: [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy)


    Dermal-epidermal membrane systems were developed by co-culturing human keratinocytes with Skin derived Stem Cells (SSCs), which are Mesenchymal Stem Cells (MSCs) isolated from dermis, on biodegradable membranes of chitosan (CHT), polycaprolactone (PCL) and a polymeric blend of CHT and PCL. The membranes display physico-chemical, morphological, mechanical and biodegradation properties that could satisfy and fulfil specific requirements in skin tissue engineering. CHT membrane exhibits an optimal biodegradation rate for acute wounds; CHT-PCL for the chronic ones. On the other hand, PCL membrane in spite of its very slow biodegradation rate exhibits mechanical properties similar to in vivo dermis, a lower hydrophilic character, and a surface roughness, all properties that make it able to sustain cell adhesion and proliferation for in vitro skin models. Both CHT–PCL and PCL membranes guided epidermal and dermal differentiation of SSCs as pointed out by the expression of cytokeratins and the deposition of the ECM protein fibronectin, respectively. In the dermal-epidermal membrane systems, a more suitable microenvironment for the SSCs differentiation was promoted by the interactions and the mutual interplay with keratinocytes. Being skin tissue-biased stem cells committed to their specific final dermal and/or epidermal cell differentiation, SSCs are more suitable for skin tissue engineering than other adult MSCs with different origin. For this reason, they represent a useful autologous cell source for engineering skin substitutes for both in vivo and in vitro applications.

  3. 125I-human epidermal growth factor specific binding to placentas and fetal membranes from varoius pregnancy states

    International Nuclear Information System (INIS)

    Hofmann, G.E.; Siddiqi, T.A.; Rao, Ch. V.; Carman, F.R.


    Specific binding of 125 I-human epidermal growth factor (hEGF) to homogenates of term human placentas and fetal membranes from normal and appropriate for gestational age (N = 20), intrauterine growth retarded (N = 9), twin (N = 11), White class A/B diabetic (N = 12), and large for gestational age (N = 13) pregnancies was measured. In all pregnancy states, placentas bound approximately four times more 125 I-hEGF than did fetal membranes (P 125 I-hEGF binding to fetal membranes from the various pregnancy states (P 125 I-hEGF specific binding to placentas from intrauterine growth retarded or twin pregnancies was significantly greater compared with placentas from normal and appropriate for gestational age pregnancies (P 125 I-hEGF specific binding did not differ between placentas from intrauterine growth retarded or twin pregnancies (P 125 I-hEGF binding did not vary with fetal sex, maternal race, placental weight, or gestational age between 37 to 42 weeks (P 125 I-hEGF binding increased with increasing infant weight when appropriate for gestational age and large for gestational age infants were included (P<0.05, r = 0.38, N = 32) but not for intrauterine growth retarded, appropriate for gestational age, or large for gestational age infants alone. (author)

  4. /sup 125/I-human epidermal growth factor specific binding to placentas and fetal membranes from varoius pregnancy states

    Energy Technology Data Exchange (ETDEWEB)

    Hofmann, G.E.; Siddiqi, T.A.; Rao, Ch. V.; Carman, F.R.


    Specific binding of /sup 125/I-human epidermal growth factor (hEGF) to homogenates of term human placentas and fetal membranes from normal and appropriate for gestational age (N = 20), intrauterine growth retarded (N = 9), twin (N = 11), White class AB diabetic (N = 12), and large for gestational age (N = 13) pregnancies was measured. In all pregnancy states, placentas bound approximately four times more /sup 125/I-hEGF than did fetal membranes (P<0.0001). There was no significant differnce in /sup 125/I-hEGF binding to fetal membranes from the various pregnancy states (P<0.05). /sup 125/I-hEGF specific binding to placentas from intrauterine growth retarded or twin pregnancies was significantly greater compared with placentas from normal and appropriate for gestational age pregnancies (P<0.05). The binding to placentas from pregnancies complicated by White class AB diabetes or large for gestational age infants, on the other hand, was not significantly different from that to placentas from normal and appropriate for gestational age pregnancies. /sup 125/I-hEGF specific binding did not differ between placentas from intrauterine growth retarded or twin pregnancies (P<0.05). Placental and fetal membrane /sup 125/I-hEGF binding did not vary with fetal sex, maternal race, placental weight, or gestational age between 37 to 42 weeks (P<0.05). Placental but not fetal membrane /sup 125/I-hEGF binding increased with increasing infant weight when appropriate for gestational age and large for gestational age infants were included (P<0.05, r = 0.38, N = 32) but not for intrauterine growth retarded, appropriate for gestational age, or large for gestational age infants alone.

  5. Deposition of nucleosomal antigens (histones and DNA) in the epidermal basement membrane in human lupus nephritis.

    NARCIS (Netherlands)

    Grootscholten, C.; Bruggen, M.C.J. van; Pijl, J.W. van der; Jong, E.M.G.J. de; Ligtenberg, G.; Derksen, R.H.W.M.; Berden, J.H.M.


    OBJECTIVE: Antinuclear autoantibodies complexed to nucleosomes can bind to heparan sulfate (HS) in the glomerular basement membrane. This binding is due to the binding of the positively charged histones to the strongly anionic HS. Nucleosomes and histones have been identified in glomerular deposits

  6. Structure and function of the Juxta membrane domain of the human epidermal growth factor receptor by NMR spectroscopy

    International Nuclear Information System (INIS)

    Choowongkomon, Kiattawee; Carlin, Cathleen; Sonnichsen, Frank D.


    The epidermal growth factor receptor (EGFR) is a member of the receptor tyrosine kinase family involved in the regulation of cellular proliferation and differentiation. Its juxta membrane domain (JX), the region located between the transmembrane and kinase domains, plays important roles in receptor trafficking since both basolateral sorting in polarized epithelial cells and lysosomal sorting signals are identified in this region. In order to understand the regulation of these signals, we characterized the structural properties of recombinant JX domain in dodecyl phosphocholine detergent (DPC) by nuclear magnetic resonance (NMR) spectroscopy. In DPC micelles, structures derived from NMR data showed three amphipathic, helical segments. Two equivalent average structural models on the surface of micelles were obtained that differ only in the relative orientation between the first and second helices. Our data suggests that the activity of sorting signals may be regulated by their membrane association and restricted accessibility in the intact receptor

  7. Human corpus luteum: presence of epidermal growth factor receptors and binding characteristics

    International Nuclear Information System (INIS)

    Ayyagari, R.R.; Khan-Dawood, F.S.


    Epidermal growth factor receptors are present in many reproductive tissues but have not been demonstrated in the human corpus luteum. To determine the presence of epidermal growth factor receptors and its binding characteristics, we carried out studies on the plasma cell membrane fraction of seven human corpora lutea (days 16 to 25) of the menstrual cycle. Specific epidermal growth factor receptors were present in human corpus luteum. Insulin, nerve growth factor, and human chorionic gonadotropin did not competitively displace epidermal growth factor binding. The optimal conditions for corpus luteum-epidermal growth factor receptor binding were found to be incubation for 2 hours at 4 degrees C with 500 micrograms plasma membrane protein and 140 femtomol 125 I-epidermal growth factor per incubate. The number (mean +/- SEM) of epidermal growth factor binding sites was 12.34 +/- 2.99 X 10(-19) mol/micrograms protein; the dissociation constant was 2.26 +/- 0.56 X 10(-9) mol/L; the association constant was 0.59 +/- 0.12 X 10(9) L/mol. In two regressing corpora lutea obtained on days 2 and 3 of the menstrual cycle, there was no detectable specific epidermal growth factor receptor binding activity. Similarly no epidermal growth factor receptor binding activity could be detected in ovarian stromal tissue. Our findings demonstrate that specific receptors for epidermal growth factor are present in the human corpus luteum. The physiologic significance of epidermal growth factor receptors in human corpus luteum is unknown, but epidermal growth factor may be involved in intragonadal regulation of luteal function

  8. Epidermal growth factor receptor in primary human lung cancer

    International Nuclear Information System (INIS)

    Yu Xueyan; Hu Guoqiang; Tian Keli; Wang Mingyun


    Cell membranes were prepared from 12 human lung cancers for the study of the expression of epidermal growth factor receptors (EGFR). EGFR concentration was estimated by ligand binding studies using 125 I-radiolabeled EGF. The dissociation constants of the high affinity sites were identical, 1.48 nmol and 1.1 nmol in cancer and normal lung tissues, the EGFR contents were higher in lung cancer tissues (range: 2.25 to 19.39 pmol·g -1 membrane protein) than that in normal tissues from the same patients (range: 0.72 to 7.43 pmol·g -1 membrane protein). These results suggest that EGF and its receptor may play a role in the regulatory mechanisms in the control of lung cellular growth and tumor promotion

  9. Development of a PVAl/chitosan composite membrane compatible with the dermo-epidermic system

    International Nuclear Information System (INIS)

    Almeida, Tiago Luiz de


    Due to the frequent incidence of people with skin lesions such as burns and ulcers and the lack of available donors, biomaterials with the capacity to mimic skin must be developed. In order to develop these biomaterials, polymers are used in the attempt to achieve characteristics which are closer to the target organ. In this direction, for several years our group has been developing dermo-epidermic substitutes, specifically biodegradable and biocompatible membranes made up of PVAl and chitosan. PVAl, a synthetic polymer, was used to imitate part of the human dermis and chitosan, a polymer of organic origin, was used in this study to stimulate growth and maintenance of the epidermis. Due to the variations of these commercially obtained polymers, the objective of this study was to characterize their physical and chemical properties, comparing them with the membrane previously obtained by our group with the intention of confirming the hypotheses of interferences put forward in this study. The PVAl membranes in the study (PVAl MP) that obtained characteristics most similar to the standard were those irradiated with 13 and 15 kGy; this last was chosen because it was the minimum dose necessary to achieve sterility. These membranes were also those which had the largest percentage of pores between 70 and 100 μm. For chitosan, the principal characteristics studied were the degree of acetylation (DA) and average molecular weight, both results demonstrated different characteristics than commercially indicated. Various membrane preparation protocols were carried out from the chitosan solution (2%). The membrane composed of the solution of chitosan homogenized with glycerol (20%) and dried at room temperature had the best interaction with keratinocytes. To finalize the study, this chitosan solution was poured over a PVAl membrane, lyophilized and impregnated with chitosan (2%) solution and the compound was kept at room temperature until a chitosan film formed on the upper

  10. Nicotinic acid receptor abnormalities in human skin cancer: implications for a role in epidermal differentiation.

    Directory of Open Access Journals (Sweden)

    Yira Bermudez

    Full Text Available Chronic UV skin exposure leads to epidermal differentiation defects in humans that can be largely restored by pharmacological doses of nicotinic acid. Nicotinic acid has been identified as a ligand for the human G-protein-coupled receptors GPR109A and GPR109B that signal through G(i-mediated inhibition of adenylyl cyclase. We have examined the expression, cellular distribution, and functionality of GPR109A/B in human skin and skin derived epidermal cells.Nicotinic acid increases epidermal differentiation in photodamaged human skin as judged by the terminal differentiation markers caspase 14 and filaggrin. Both GPR109A and GPR109B genes are transcribed in human skin and in epidermal keratinocytes, but expression in dermal fibroblasts is below limits of detection. Receptor transcripts are greatly over-expressed in squamous cell cancers. Receptor protein in normal skin is prominent from the basal through granular layers of the epidermis, with cellular localization more dispersive in the basal layer but predominantly localized at the plasma membrane in more differentiated epidermal layers. In normal human primary and immortalized keratinocytes, nicotinic acid receptors show plasma membrane localization and functional G(i-mediated signaling. In contrast, in a squamous cell carcinoma derived cell line, receptor protein shows a more diffuse cellular localization and the receptors are nearly non-functional.The results of these studies justify future genetic and pharmacological intervention studies to define possible specific role(s of nicotinic acid receptors in human skin homeostasis.

  11. Computer-assisted assessment of the Human Epidermal Growth Factor Receptor 2 immunohistochemical assay in imaged histologic sections using a membrane isolation algorithm and quantitative analysis of positive controls

    International Nuclear Information System (INIS)

    Hall, Bonnie H; Ianosi-Irimie, Monica; Javidian, Parisa; Chen, Wenjin; Ganesan, Shridar; Foran, David J


    Breast cancers that overexpress the human epidermal growth factor receptor 2 (HER2) are eligible for effective biologically targeted therapies, such as trastuzumab. However, accurately determining HER2 overexpression, especially in immunohistochemically equivocal cases, remains a challenge. Manual analysis of HER2 expression is dependent on the assessment of membrane staining as well as comparisons with positive controls. In spite of the strides that have been made to standardize the assessment process, intra- and inter-observer discrepancies in scoring is not uncommon. In this manuscript we describe a pathologist assisted, computer-based continuous scoring approach for increasing the precision and reproducibility of assessing imaged breast tissue specimens. Computer-assisted analysis on HER2 IHC is compared with manual scoring and fluorescence in situ hybridization results on a test set of 99 digitally imaged breast cancer cases enriched with equivocally scored (2+) cases. Image features are generated based on the staining profile of the positive control tissue and pixels delineated by a newly developed Membrane Isolation Algorithm. Evaluation of results was performed using Receiver Operator Characteristic (ROC) analysis. A computer-aided diagnostic approach has been developed using a membrane isolation algorithm and quantitative use of positive immunostaining controls. By incorporating internal positive controls into feature analysis a greater Area Under the Curve (AUC) in ROC analysis was achieved than feature analysis without positive controls. Evaluation of HER2 immunostaining that utilized membrane pixels, controls, and percent area stained showed significantly greater AUC than manual scoring, and significantly less false positive rate when used to evaluate immunohistochemically equivocal cases. It has been shown that by incorporating both a membrane isolation algorithm and analysis of known positive controls a computer-assisted diagnostic algorithm was

  12. Computer-assisted assessment of the Human Epidermal Growth Factor Receptor 2 immunohistochemical assay in imaged histologic sections using a membrane isolation algorithm and quantitative analysis of positive controls

    Directory of Open Access Journals (Sweden)

    Ianosi-Irimie Monica


    Full Text Available Abstract Background Breast cancers that overexpress the human epidermal growth factor receptor 2 (HER2 are eligible for effective biologically targeted therapies, such as trastuzumab. However, accurately determining HER2 overexpression, especially in immunohistochemically equivocal cases, remains a challenge. Manual analysis of HER2 expression is dependent on the assessment of membrane staining as well as comparisons with positive controls. In spite of the strides that have been made to standardize the assessment process, intra- and inter-observer discrepancies in scoring is not uncommon. In this manuscript we describe a pathologist assisted, computer-based continuous scoring approach for increasing the precision and reproducibility of assessing imaged breast tissue specimens. Methods Computer-assisted analysis on HER2 IHC is compared with manual scoring and fluorescence in situ hybridization results on a test set of 99 digitally imaged breast cancer cases enriched with equivocally scored (2+ cases. Image features are generated based on the staining profile of the positive control tissue and pixels delineated by a newly developed Membrane Isolation Algorithm. Evaluation of results was performed using Receiver Operator Characteristic (ROC analysis. Results A computer-aided diagnostic approach has been developed using a membrane isolation algorithm and quantitative use of positive immunostaining controls. By incorporating internal positive controls into feature analysis a greater Area Under the Curve (AUC in ROC analysis was achieved than feature analysis without positive controls. Evaluation of HER2 immunostaining that utilized membrane pixels, controls, and percent area stained showed significantly greater AUC than manual scoring, and significantly less false positive rate when used to evaluate immunohistochemically equivocal cases. Conclusion It has been shown that by incorporating both a membrane isolation algorithm and analysis of known

  13. Human epidermal growth factor: molecular forms and application of radioimmunoassay and radioreceptor assay

    International Nuclear Information System (INIS)

    Hirata, Y.; Orth, D.N.


    Epidermal growth factor (EGF), a 53 amino acid polypeptide, was first isolated by Cohen. EGF's growth-promoting activity is not limited to epidermal cells, but is expressed on a wide variety of tissues derived from a number of different species. Human EGF (hEGF) was isolated and subsequently purified from human urine. Unexpectedly, a close structural relationship was recognized between mEGF and human β-urogastrone. The authors recently developed both an homologous hEGF radioimmunoassay (RIA) and a radioreceptor assay (RRA) using a human placental membrane fraction. Using these assays, the molecular size of hEGF in human body fluids and tissues was evaluated, and partial characterization of a high molecular weight form of hEGF isolated from human urine was carried out. The concentrations of immunoreactive hEGF were also determined in human tissues and plasma after extraction either with cationic exchange chromatography or with immunoaffinity chromatography. (Auth.)

  14. Sensing radiosensitivity of human epidermal stem cells

    International Nuclear Information System (INIS)

    Rachidi, Walid; Harfourche, Ghida; Lemaitre, Gilles; Amiot, Franck; Vaigot, Pierre; Martin, Michele T.


    Purpose: Radiosensitivity of stem cells is a matter of debate. For mouse somatic stem cells, both radiosensitive and radioresistant stem cells have been described. By contrast, the response of human stem cells to radiation has been poorly studied. As epidermis is a radiosensitive tissue, we evaluated in the present work the radiosensitivity of cell populations enriched for epithelial stem cells of human epidermis. Methods and materials: The total keratinocyte population was enzymatically isolated from normal human skin. We used flow cytometry and antibodies against cell surface markers to isolate basal cell populations from human foreskin. Cell survival was measured after a dose of 2 Gy with the XTT assay at 72 h after exposure and with a clonogenic assay at 2 weeks. Transcriptome analysis using oligonucleotide microarrays was performed to assess the genomic cell responses to radiation. Results: Cell sorting based on two membrane proteins, α6 integrin and the transferrin receptor CD71, allowed isolation of keratinocyte populations enriched for the two types of cells found in the basal layer of epidermis: stem cells and progenitors. Both the XTT assay and the clonogenic assay showed that the stem cells were radioresistant whereas the progenitors were radiosensitive. We made the hypothesis that upstream DNA damage signalling might be different in the stem cells and used microarray technology to test this hypothesis. The stem cells exhibited a much more reduced gene response to a dose of 2 Gy than the progenitors, as we found that 6% of the spotted genes were regulated in the stem cells and 20% in the progenitors. Using Ingenuity Pathway Analysis software, we found that radiation exposure induced very specific pathways in the stem cells. The most striking responses were the repression of a network of genes involved in apoptosis and the induction of a network of cytokines and growth factors. Conclusion: These results show for the first time that keratinocyte

  15. Pattern of hormone receptors and human epidermal growth factor ...

    African Journals Online (AJOL)

    Introduction: Breast cancer is the most common cancer among women globally. With immunohistochemistry (IHC), breast cancer is classified into four groups based on IHC profile of estrogen receptor (ER)/progesterone receptor (PR) and human epidermal growth factor receptor 2 (HER2/neu) expression, positive (+) and/or ...

  16. The membrane fraction of homogenized rat kidney contains an enzyme that releases epidermal growth factor from the kidney membranes

    DEFF Research Database (Denmark)

    Nexø, Ebba; Poulsen, Steen Seier


    shows that the membrane fraction of homogenized rat kidney contains an enzyme that releases immuno and receptor reactive EGF from the kidney membranes when incubated at 37 degrees C. Gel filtration shows that the EGF reactivity released from the membranes is similar to the EGF reactivity in rat urine......High levels of epidermal growth factor (EGF) are excreted in the urine and high levels of mRNA for the EGF-precursor have been demonstrated in the kidney. The EGF-precursor is a membrane bound peptide in the kidney, but little is known about the renal processing of the precursor. The present study...

  17. Radiosensitivity of normal human epidermal cells in culture

    International Nuclear Information System (INIS)

    Dover, R.; Potten, C.S.


    Using an in vitro culture system the authors have derived #betta#-radiation survival curves over a dose range 0-8 Gy for the clonogenic cells of normal human epidermis. The culture system used allows the epidermal cells to stratify and form a multi-layered sheet of keratinizing cells. The cultures appear to be a very good model for epidermis in vivo. The survival curves show a population which is apparently more sensitive than murine epidermis in vivo. It remains unclear whether this is an intrinsic difference between the species or is a consequence of the in vitro cultivation of the human cells. (author)

  18. Expression of epidermal growth factor receptors in human endometrial carcinoma

    DEFF Research Database (Denmark)

    Nyholm, H C; Nielsen, Anette Lynge; Ottesen, B


    Little data exist on the expression of epidermal growth factor receptors (EGF-Rs) in human endometrial cancer. EGF-R status was studied in 65 patients with endometrial carcinomas and in 26 women with nonmalignant postmenopausal endometria, either inactive/atrophic endometrium or adenomatous...... hyperplasia. EGF-R was identified on frozen tissue sections by means of an indirect immunoperoxidase technique with a monoclonal antibody against the external domain of the EGF-R. Seventy-one percent of the carcinomas expressed positive EGF-R immunoreactivity. In general, staining was most prominent...

  19. Nephritogenic antigen determinants in epidermal and renal basement membranes of kindreds with Alport-type familial nephritis. (United States)

    Kashtan, C; Fish, A J; Kleppel, M; Yoshioka, K; Michael, A F


    We probed epidermal basement membranes (EBM) of acid-urea denatured skin from members of kindreds with Alport-type familial nephritis (FN) for the presence of antigens reactive with Goodpasture sera (GPS) and serum (FNS) from an Alport patient who developed anti-glomerular basement membrane (GBM) nephritis in a renal allograft. By immunoblotting, GPS reacted primarily with the 28,000 molecular weight (mol wt) monomer but also the 24,000 mol wt and 26,000 mol wt monomers of the noncollagenous globular domain (NC1) of type IV collagen from normal human GBM, while FNS identified only the 26,000-mol wt monomer. FNS reacted with EBM of 12 controls and nine unaffected male kindred members but not EBM of eight affected males. Five affected females exhibited interrupted reactivity of FNS with EBM. GPS showed variable reactivity with EBM and was not discriminating with respect to Alport-type FN. FNS did not stain renal basement members of five affected males. However, the EBM, tubular basement membrane, and Bowman's capsules of affected males contained antigens reactive with GPS. These immunochemical studies suggest that the FNS antigen is distinct from Goodpasture antigen(s). The expression of FNS antigen located on the NC1 domain of type IV collagen is altered in basement membranes of patients with Alport-type FN, and the distribution of this antigenic anomaly within kindreds suggests X-linked dominant transmission of a defective gene.

  20. Effects of Wnt3a on proliferation and differentiation of human epidermal stem cells

    International Nuclear Information System (INIS)

    Jia Liwei; Zhou Jiaxi; Peng Sha; Li Juxue; Cao Yujing; Duan Enkui


    Epidermal stem cells maintain development and homeostasis of mammalian epidermis throughout life. However, the molecular mechanisms involved in the proliferation and differentiation of epidermal stem cells are far from clear. In this study, we investigated the effects of Wnt3a and Wnt/β-catenin signaling on proliferation and differentiation of human fetal epidermal stem cells. We found both Wnt3a and active β-catenin, two key members of the Wnt/β-catenin signaling, were expressed in human fetal epidermis and epidermal stem cells. In addition, Wnt3a protein can promote proliferation and inhibit differentiation of epidermal stem cells in vitro culture. Our results suggest that Wnt/β-catenin signaling plays important roles in human fetal skin development and homeostasis, which also provide new insights on the molecular mechanisms of oncogenesis in human epidermis

  1. Enrichment of unlabeled human Langerhans cells from epidermal cell suspensions by discontinuous density gradient centrifugation

    NARCIS (Netherlands)

    Teunissen, M. B.; Wormmeester, J.; Kapsenberg, M. L.; Bos, J. D.


    In this report we introduce an alternative procedure for enrichment of human epidermal Langerhans cells (LC) from epidermal cell suspensions of normal skin. By means of discontinuous Ficoll-Metrizoate density gradient centrifugation, a fraction containing high numbers of viable, more than 80% pure

  2. Homologous radioimmunoassay for human epidermal growth factor (urogastrone)

    International Nuclear Information System (INIS)

    Dailey, G.E.; Kraus, J.W.; Orth, D.N.


    Epidermal growth factor (EGF), a polypeptide hormone originally discovered in the mouse submaxillary gland, stimulates growth in a variety of tissues in several species. This hormone has recently been identified in human urine. A homologous RIA for human EGF (RIA-hEGF) has been developed. In general, levels were similar to those recently reported using a heterologous RIA system. Twenty-four-hour urinary excretion of RIA-hEGF by normal adult males and females was 63.0 +- 3.0 and 52.0 +- 3.5 (mean +- SE) μg/total vol, or 29.7 +- 1.1 and 39.8 +- 1.7 μg/g creatinine, respectively. Excretion by females taking oral contraceptives was significantly greater (60.1 +- 2.7 μg/g creatinine; P 0.05). Several of those with very low values had histories of alcohol abuse. Excretion by patients with Cushing's syndrome was normal. Patients with psoriasis or recovering from major burns excreted both abnormally high and abnormally low levels of RIA-hEGF, with no obvious correlation to their clinical condition. There was no apparent diurnal or postprandial variation in urinary RIA-hEGF excretion by normal subjects. An excellent linear correlation was observed between RIA-hEGF and creatinine concentrations in each urine sample for each subject, suggesting that RIA-hEGF concentration in a random urine sample provides a valid index of 24-h RIA-hEGF excretion

  3. Expression and significance of HMGB1, TLR4 and NF-κB p65 in human epidermal tumors

    International Nuclear Information System (INIS)

    Weng, Hui; Deng, Yunhua; Xie, Yuyan; Liu, Hongbo; Gong, Feili


    High mobility group protein box 1 (HMGB1) is a DNA binding protein located in nucleus. It is released into extracellular fluid where it acts as a novel proinflammatory cytokine which interacts with Toll like receptor 4 (TLR4) to activate nuclear factor-κB (NF-κB). This sequence of events is involved in tumor growth and progression. However, the effects of HMGB1, TLR4 and NF-κB on epidermal tumors remain unclear. Human epidermal tumor specimens were obtained from 96 patients. Immunohistochemistry was used to detect expression of HMGB1, TLR4 and NF-κB p65 in human epidermal tumor and normal skin specimens. Western blot analysis was used to detect the expression of NF-κB p65 in epithelial cell nuclei in human epidermal tumor and normal tissues. Immunohistochemistry and western blot analysis indicated a progressive but statistically significant increase in p65 expression in epithelial nuclei in benign seborrheic keratosis (SK), precancerous lesions (PCL), low malignancy basal cell carcinoma (BCC) and high malignancy squamous cell carcinoma (SCC) (P <0.01). The level of extracellular HMGB1 in SK was significantly higher than in normal skin (NS) (P <0.01), and was higher than in SCC but without statistical significance. The level of TLR4 on epithelial membranes of SCC cells was significantly higher than in SK, PCL, BCC and NS (P <0.01). There was a significant positive correlation between p65 expression in the epithelial nuclei and TLR4 expression on the epithelial cell membranes (r = 0.3212, P <0.01). These findings indicate that inflammation is intensified in parallel with increasing malignancy. They also indicate that the TLR4 signaling pathway, rather than HMGB1, may be the principal mediator of inflammation in high-grade malignant epidermal tumors. Combined detection of p65 in the epithelial nuclei and TLR4 on the epithelial membranes may assist the accurate diagnosis of malignant epidermal tumors

  4. Predicting human epidermal melanin concentrations for different skin tones

    CSIR Research Space (South Africa)

    Smit, Jacoba E


    Full Text Available epidermal melanin concentrations for different skin tones JE Smit 1 , AE Karsten 2 , RW Sparrow 1 1 CSIR Biosciences, Pretoria, South Africa 2 CSIR National Laser Centre, Pretoria, South Africa Author e-mail address: KSmit...

  5. Effects of soap-water wash on human epidermal penetration. (United States)

    Zhu, Hanjiang; Jung, Eui-Chang; Phuong, Christina; Hui, Xiaoying; Maibach, Howard


    Skin decontamination is a primary interventional method used to decrease dermal absorption of hazardous contaminants, including chemical warfare agents, pesticides and industrial pollutants. Soap and water wash, the most common and readily available decontamination system, may enhance percutaneous absorption through the "wash-in effect." To understand better the effect of soap-water wash on percutaneous penetration, and provide insight to improving skin decontamination methods, in vitro human epidermal penetration rates of four C(14) -labeled model chemicals (hydroquinone, clonidine, benzoic acid and paraoxon) were assayed using flow-through diffusion cells. Stratum corneum (SC) absorption rates of these chemicals at various hydration levels (0-295% of the dry SC weights) were determined and compared with the results of the epidermal penetration study to clarify the effect of SC hydration on skin permeability. Results showed accelerated penetration curves of benzoic acid and paraoxon after surface wash at 30 min postdosing. Thirty minutes after washing (60 min postdosing), penetration rates of hydroquinone and benzoic acid decreased due to reduced amounts of chemical on the skin surface and in the SC. At the end of the experiment (90 min postdosing), a soap-water wash resulted in lower hydroquinone penetration, greater paraoxon penetration and similar levels of benzoic acid and clonidine penetration compared to penetration levels in the non-wash groups. The observed wash-in effect agrees with the enhancement effect of SC hydration on the SC chemical absorption rate. These results suggest SC hydration derived from surface wash to be one cause of the wash-in effect. Further, the occurrence of a wash-in effect is dependent on chemical identity and elapsed time between exposure and onset of decontamination. By reducing chemical residue quantity on skin surface and in the SC reservoir, the soap-water wash may decrease the total quantity of chemical absorbed in the

  6. Epidermal growth factor and its receptors in human pancreatic carcinoma

    International Nuclear Information System (INIS)

    Chen, Y.F.; Pan, G.Z.; Hou, X.; Liu, T.H.; Chen, J.; Yanaihara, C.; Yanaihara, N.


    The role of epidermal growth factor (EGF) in oncogenesis and progression of malignant tumors is a subject of vast interest. In this study, radioimmunoassay and radioreceptor assay of EGF were established. EGF contents in malignant and benign pancreatic tumors, in normal pancreas tissue, and in culture media of a human pancreatic carcinoma cell line were determined. EGF receptor binding studies were performed. It was shown that EGF contents in pancreatic carcinomas were significantly higher than those in normal pancreas or benign pancreatic tumors. EGF was also detected in the culture medium of a pancreatic carcinoma cell line. The binding of 125I-EGF to the pancreatic carcinoma cells was time and temperature dependent, reversible, competitive, and specific. Scatchard analysis showed that the dissociation constant of EGF receptor was 2.1 X 10(-9) M, number of binding sites was 1.3 X 10(5) cell. These results indicate that there is an over-expression of EGF/EGF receptors in pancreatic carcinomas, and that an autocrine regulatory mechanism may exist in the growth-promoting effect of EGF on tumor cells

  7. Kinetics of growth and differentiation of cultured human epidermal keratinocytes

    International Nuclear Information System (INIS)

    Albers, K.M.


    A study was made of the interrelationship between replication and differentiation in cultures of human epidermal keratinocytes. Measures of both parameters were made using newly developed methods to quantify the rate at which keratinocytes replicate and the rate at which they withdraw from the cell cycle. Keratinocyte replication was measured by determining the cell doubling time, labeling index, and cell cycle duration. Cell cycle length was measured using a double label assay that determines the length of time between two successive phases of DNA synthesis. The first DNA synthesis phase was marked by labeling keratinocytes with 14 C-thymidine. At the next round of DNA synthesis, cells were labeled with bromodeoxyuridine, a heavy analog of thymidine. The cell cycle length is given by the time required for the 14 C-labeled DNA to become double labeled. To measure keratinocyte differentiation, the rate at which cells withdraw from the cell cycle was determined. To measure withdrawal, the percentage of cells labeled by a pulse of 14 C-thymidine that failed to undergo a second cycle of DNA synthesis, as measured by bromodeoxyuridine incorporation, was determined. Cells which failed to undergo a second cycle of synthesis were considered to have differentiated and withdrawn from the cell cycle

  8. Response of human epidermal keratinocytes to UV light

    International Nuclear Information System (INIS)

    Kartasova, A.A.


    This thesis presents a study on the response of human epidermal keratinocytes to UV light as well as to other agents like 4-NQO and TPA. The effects of ultraviolet (UV) light on the protein synthesis in cultured keratinocytes are presented in ch. III. The next chapter describes the construction of a cDNA library using mRNA isolated from UV irradiated kernatinocytes. This library was differentially screened with cDNA probes synthesized on mRNA from either UV irradiated or nonirradiated cells. Several groups of cDNA clones corresponding to transcripts whose level in the cytoplasm seem to be affected by exposure to UV light have been isolated and characterized by cross-hybridization, sequencing and Northern blot analysis. More detailed analysis of some of the cDNA clones is presented in the two chapters following ch. IV. The complete cDNA sequence of the proteinase inhibitor cystatin A and the modulation of its expression by UV light and the carcinogen 4-nitroquinoline 1-oxide (4-NQO) in keratinocytes are described in ch. V. Two other groups of cDNA clones have been isolated which do not cross-hybridize with each other on Southern blots. However, the primary structures of the proteins deduced from the nucleotide sequences of these two groups of cDNA clones are very similar. 212 refs.; 33 figs.; 2 tabs

  9. Structural and biophysical characteristics of human skin in maintaining proper epidermal barrier function

    Directory of Open Access Journals (Sweden)

    Magdalena Boer


    Full Text Available The complex structure of human skin and its physicochemical properties turn it into an efficient outermost defence line against exogenous factors, and help maintain homeostasis of the human body. This role is played by the epidermal barrier with its major part – stratum corneum. The condition of the epidermal barrier depends on individual and environmental factors. The most important biophysical parameters characterizing the status of this barrier are the skin pH, epidermal hydration, transepidermal water loss and sebum excretion. The knowledge of biophysical skin processes may be useful for the implementation of prophylactic actions whose aim is to restore the barrier function.

  10. Influence of topical human epidermal growth factor on postkeratoplasty re-epithelialisation

    NARCIS (Netherlands)

    M.M. Dellaert; T.A. Casey; S. Wiffen; J. Gordon (Jocelynne); P. Johnson (Jürgen); A.J. Geerards (Annette); W.J. Rijneveld (Wilhelmina); L. Remeijer (Lies); W.H. Beekhuis (Houdijn); P.G.H. Mulder (Paul)


    textabstractAIM: To test the efficacy and safety of recombinant human epidermal growth factor (hEGF) on corneal re-epithelialisation following penetrating keratoplasty. METHODS: A prospective, randomised, placebo controlled study was carried out in which patients were

  11. Flow cytometry of human primary epidermal and follicular keratinocytes. (United States)

    Gragnani, Alfredo; Ipolito, Michelle Zampieri; Sobral, Christiane S; Brunialti, Milena Karina Coló; Salomão, Reinaldo; Ferreira, Lydia Masako


    The aim of this study was to characterize using flow cytometry cultured human primary keratinocytes isolated from the epidermis and hair follicles by different methods. Human keratinocytes derived from discarded fragments of total skin and scalp hair follicles from patients who underwent plastic surgery in the Plastic Surgery Division at UNIFESP were used. The epidermal keratinocytes were isolated by using 3 different methods: the standard method, upon exposure to trypsin for 30 minutes; the second, by treatment with dispase for 18 hours and with trypsin for 10 minutes; and the third, by treatment with dispase for 18 hours and with trypsin for 30 minutes. Follicular keratinocytes were isolated using the standard method. On comparing the group treated with dispase for 18 hours and with trypsin for 10 minutes with the group treated with dispase for 18 hours and with trypsin for 30 minutes, it was observed that the first group presented the largest number of viable cells, the smallest number of cells in late apoptosis and necrosis with statistical significance, and no difference in apoptosis. When we compared the group treated with dispase for 18 hours and with trypsin for 10 minutes with the group treated with trypsin, the first group presented the largest number of viable cells, the smallest number of cells in apoptosis with statistical significance, and no difference in late apoptosis and necrosis. When we compared the results of the group treated with dispase for 18 hours and with trypsin for 10 minutes with the results for follical isolation, there was a statistical difference in apoptosis and viable cells. The isolation method of treatment with dispase for 18 hours and with trypsin for 10 minutes produced the largest number of viable cells and the smallest number of cells in apoptosis/necrosis.

  12. Long-wave ultraviolet light induces phospholipase activation in cultured human epidermal keratinocytes

    International Nuclear Information System (INIS)

    Hanson, D.; DeLeo, V.


    Long wave ultraviolet radiation (UVA) has been shown to play an important role in the overall response of skin to solar radiation, including sunburn, tanning, premature aging, and non-melanoma skin cancer. UVA induction of inflammation in human skin is thought to be mediated by membrane lipid derived products. In order to investigate the mechanism of this response we examined the effect of UVA on phospholipid metabolism of human epidermal keratinocytes in culture. Keratinocytes were grown in serum free low calcium medium. The cells were prelabeled with [3H] arachidonic acid or [3H] choline and irradiated with UVA (Honle 2002-Hg vapor lamp). Identification and quantitation of specific membrane phospholipid-derived components was achieved using high-performance liquid chromatography, paper chromatography, and radioimmunoassay. UVA resulted in a linear dose dependent release of [3H] arachidonic acid into medium between 1 and 20 joule/cm2. This response was inhibited in an oxygen-reduced environment. The radiolabel released was predominantly free arachidonate and cyclooxygenase metabolites. Cyclooxygenase metabolites prostaglandin E2 and prostacyclin derivative, 6-keto-prostaglandin F1a, were stimulated following UVA irradiation, but the lipoxygenase metabolite, leukotriene B was not detected. Maximal release was measured immediately after irradiation and changed little over 24 h post-irradiation. UVA stimulated an increase of [3H] choline metabolites glycerophosphorylcholine and phosphorylcholine in media extracts suggesting UVA activation of phospholipase C and phospholipase A2 or diacylglyceride lipase

  13. Use of etanercept to treat toxic epidermal necrolysis in a human immunodeficiency virus-positive patient


    Yung-Yi Lee; Jui-Hung Ko; Chia-Hung Wei; Wen-Hung Chung


    Toxic epidermal necrolysis (TEN) is an uncommon and severe cutaneous adverse drug reaction that causes disseminated necrosis of epidermal cells and mucocutaneous detachment. Here, we report the case of a 32-year-old man with human immunodeficiency virus infection who presented with generalized violaceous macules and blister formation 4 days after the administration of mefenamic acid and amoxicillin for a dental procedure. Additional symptoms included oral ulcers and conjunctivitis. Results of...

  14. Evolution of the clonogenic potential of human epidermal stem/progenitor cells with age

    Directory of Open Access Journals (Sweden)

    Zobiri O


    Full Text Available Olivia Zobiri, Nathalie Deshayes, Michelle Rathman-JosserandDepartment of Biological Research, L'Oréal Advanced Research, Clichy Cedex, FranceAbstract: A number of clinical observations have indicated that the regenerative potential and overall function of the epidermis is modified with age. The epidermis becomes thinner, repairs itself less efficiently after wounding, and presents modified barrier function recovery. In addition, the dermal papillae flatten out with increasing age, suggesting a modification in the interaction between epidermal and dermal compartments. As the epidermal regenerative capacity is dependent upon stem and progenitor cell function, it is naturally of interest to identify and understand age-related changes in these particular keratinocyte populations. Previous studies have indicated that the number of stem cells does not decrease with age in mouse models but little solid evidence is currently available concerning human skin. The objective of this study was to evaluate the clonogenic potential of keratinocyte populations isolated from the epidermis of over 50 human donors ranging from 18 to 71 years old. The data indicate that the number of epidermal cells presenting high regenerative potential does not dramatically decline with age in human skin. The authors believe that changes in the microenvironment controlling epidermal basal cell activity are more likely to explain the differences in epidermal function observed with increasing age.Keywords: skin, epidermal stem cells, aging, colony-forming efficiency test

  15. Grafting of human epidermal cells, presence and perspectives

    Czech Academy of Sciences Publication Activity Database

    Smetana, Karel; Dvořánková, B.; Labský, Jiří; Vacík, Jiří; Holíková, Z.


    Roč. 102, č. 1 (2001), s. 1-6 ISSN 0036-5327 R&D Projects: GA ČR GA203/00/1310; GA AV ČR IBS4050005; GA MZd ND6340; GA MŠk LN00A065; GA AV ČR KSK4055109 Institutional research plan: CEZ:AV0Z4050913 Keywords : cell therapy-keratinocyte-epidermal stem cell * skin defect Subject RIV: CD - Macromolecular Chemistry

  16. Nephritogenic antigen determinants in epidermal and renal basement membranes of kindreds with Alport-type familial nephritis.


    Kashtan, C; Fish, A J; Kleppel, M; Yoshioka, K; Michael, A F


    We probed epidermal basement membranes (EBM) of acid-urea denatured skin from members of kindreds with Alport-type familial nephritis (FN) for the presence of antigens reactive with Goodpasture sera (GPS) and serum (FNS) from an Alport patient who developed anti-glomerular basement membrane (GBM) nephritis in a renal allograft. By immunoblotting, GPS reacted primarily with the 28,000 molecular weight (mol wt) monomer but also the 24,000 mol wt and 26,000 mol wt monomers of the noncollagenous ...

  17. Human Papilloma Viral DNA Replicates as a Stable Episome in Cultured Epidermal Keratinocytes (United States)

    Laporta, Robert F.; Taichman, Lorne B.


    Human papilloma virus (HPV) is poorly understood because systems for its growth in tissue culture have not been developed. We report here that cultured human epidermal keratinocytes could be infected with HPV from plantar warts and that the viral DNA persisted and replicated as a stable episome. There were 50-200 copies of viral DNA per cell and there was no evidence to indicate integration of viral DNA into the cellular genome. There was also no evidence to suggest that viral DNA underwent productive replication. We conclude that cultured human epidermal keratinocytes may be a model for the study of certain aspects of HPV biology.

  18. Extraction of high-quality epidermal RNA after ammonium thiocyanate-induced dermo-epidermal separation of 4 mm human skin biopsies

    DEFF Research Database (Denmark)

    Clemmensen, Anders; Thomassen, Mads; Clemmensen, Ole


    To obtain a separation of the epidermal and dermal compartments to examine compartment specific biological mechanisms in the skin, we incubated 4 mm human skin punch biopsies in ammonium thiocyanate. We wanted to test (i) the histological quality of the dermo-epidermal separation obtained...... by different incubation times; (ii) the amount and quality of extractable epidermal RNA and (iii) its impact on sample RNA expression profiles assessed by large-scale gene expression microarray analysis in both normal and inflamed skin. At 30-min incubation, the split between dermis and epidermis...... and almost completely separated from the dermis of 4 mm skin biopsies by 30 min incubation in 3.8% ammonium thiocyanate combined with curettage of the dermal surface, producing high-quality RNA suitable for transcriptional analysis. Our refined method of dermo-epidermal separation will undoubtedly prove...

  19. Growth of melanocytes in human epidermal cell cultures

    International Nuclear Information System (INIS)

    Staiano-Coico, L.; Hefton, J.M.; Amadeo, C.; Pagan-Charry, I.; Madden, M.R.; Cardon-Cardo, C.


    Epidermal cell cultures were grown in keratinocyte-conditioned medium for use as burn wound grafts; the melanocyte composition of the grafts was studied under a variety of conditions. Melanocytes were identified by immunohistochemistry based on a monoclonal antibody (MEL-5) that has previously been shown to react specifically with melanocytes. During the first 7 days of growth in primary culture, the total number of melanocytes in the epidermal cultures decreased to 10% of the number present in normal skin. Beginning on day 2 of culture, bipolar melanocytes were present at a mean cell density of 116 +/- 2/mm2; the keratinocyte to melanocyte ratio was preserved during further primary culture and through three subpassages. Moreover, exposure of cultures to mild UVB irradiation stimulated the melanocytes to proliferate, suggesting that the melanocytes growing in culture maintained their responsiveness to external stimuli. When the sheets of cultured cells were enzymatically detached from the plastic culture flasks before grafting, melanocytes remained in the basal layer of cells as part of the graft applied to the patient

  20. The organization of human epidermis: functional epidermal units and phi proportionality. (United States)

    Hoath, Steven B; Leahy, D G


    The concept that mammalian epidermis is structurally organized into functional epidermal units has been proposed on the basis of stratum corneum (SC) architecture, proliferation kinetics, melanocyte:keratinocyte ratios (1:36), and, more recently, Langerhans cell: epidermal cell ratios (1:53). This article examines the concept of functional epidermal units in human skin in which the maintenance of phi (1.618034) proportionality provides a central organizing principle. The following empirical measurements were used: 75,346 nucleated epidermal cells per mm2, 1394 Langerhans cells per mm2, 1999 melanocytes per mm2, 16 (SC) layers, 900-microm2 corneocyte surface area, 17,778 corneocytes per mm2, 14-d (SC) turnover time, and 93,124 per mm2 total epidermal cells. Given these empirical data: (1) the number of corneocytes is a mean proportional between the sum of the Langerhans cell + melanocyte populations and the number of epidermal cells, 3393/17,778-17,778/93,124; (2) the ratio of nucleated epidermal cells over corneocytes is phi proportional, 75,346/17,778 approximately phi3; (3) assuming similar 14-d turnover times for the (SC) and Malpighian epidermis, the number of corneocytes results from subtraction of a cellular fraction equal to approximately 2/phi2 x the number of living cells, 75,436 - (2/phi2 x 75,346) approximately 17,778; and (4) if total epidermal turnover time equals (SC) turnover time x the ratio of living/dead cells, then compartmental turnover times are unequal (14 d for (SC) to 45.3 d for nucleated epidermis approximately 1/2phi) and cellular replacement rates are 52.9 corneocytes/69.3 keratinocytes per mm2 per h approximately 2/phi2. These empirically derived equivalences provide logicomathematical support for the presence of functional epidermal units in human skin. Validation of a phi proportional unit architecture in human epidermis will be important for tissue engineering of skin and the design of instruments for skin measurement.

  1. UVA-induced immune suppression in human skin: protective effect of vitamin E in human epidermal cells in vitro

    International Nuclear Information System (INIS)

    Clement-Lacroix, P.; Michel, L.; Moysan, A.; Morliere, P.; Dubertret, L.


    UVA (320-400 nm) radiation damage to membranes, proteins, DNA and other cellular targets is predominantly related to oxidative processes. In the present study, we demonstrated that cutaneous UVA-induced immunosuppression can be related, at least in part, to the appearance of these oxidative processes. The UVA-induced oxidative processes in freshly isolated epidermal cells were monitored by measuring the thiobarbituric acid reactive substances (TBARS) as an index of peroxidation. The in vitro immunosuppressive effects of UVA were demonstrated by measuring the allogenic lymphocyte proliferation induced by epidermal cells or purified Langerhans cells in the mixed epidermal cell-lymphocyte reaction (MECLR). In addition, the effects of a potent antioxidant (vitamin E) on these two UVA-induced processes were analysed. (author)

  2. Brief study about the distribution of recombinant human Epidermic Growth Factor (rh-EGF)

    International Nuclear Information System (INIS)

    Rodriguez Garcia, J.C.; De Dios D Espaux, R.; Bello Garciga, J.L.


    This report describes results of the study about biodistribution of I-125 recombinant human Epidermic Growth Factor (rhEGF). The radiolabelled product was administrated to Sprague Dawley rats in three different ways: intramuscular, subcutaneous and epidermic; the highest concentration of EGF in blood was found 4 hours after rhEGF administration, with a greater distribution in the plasma with regard to cellular pellet. The slowest plasma clearance corresponded to the intramuscular administration. The highest concentration of radiolabelled rhEGF was found in liver, kidney and intestine. It was found that radiolabelled EGF is excreted mainly throughout urine and faeces although other excretion pathways could exist

  3. Influence of epidermal hydration on the friction of human skin against textiles


    Gerhardt, L.-C; Strässle, V; Lenz, A; Spencer, N.D; Derler, S


    Friction and shear forces, as well as moisture between the human skin and textiles are critical factors in the formation of skin injuries such as blisters, abrasions and decubitus. This study investigated how epidermal hydration affects the friction between skin and textiles.

  4. Influence of epidermal hydration on the friction of human skin against textile

    NARCIS (Netherlands)

    Gerhardt, L.C.; Strässle, V.; Lenz, A.; Spencer, N.D.; Derler, S.


    Friction and shear forces, as well as moisture between the human skin and textiles are critical factors in the formation of skin injuries such as blisters, abrasions and decubitus. This study investigated how epidermal hydration affects the friction between skin and textiles. The friction between

  5. Toxicity Assessment of Six Titanium Dioxide Nanoparticles in Human Epidermal Keratinocytes (United States)

    Toxicity Assessment of Six Titanium Dioxide Nanoparticles in Human Epidermal Keratinocytes Nanoparticle uptake in cells may be an important determinant of their potential cytotoxic and inflammatory effects. Six commercial TiO2 NP (A=Alfa Aesar,10nm, A*=Alfa Aesar 32nm, B=P25 27...

  6. Humanized versus murine anti-human epidermal growth factor receptor monoclonal antibodies for immunoscintigraphic studies

    Energy Technology Data Exchange (ETDEWEB)

    Morales, Alejo A. Morales; Duconge, Jorge; Alvarez-Ruiz, Daniel; Becquer-Viart, Maria de Los Angeles; Nunez-Gandolff, Gilda; Fernandez, Eduardo; Caballero-Torres, Idania; Iznaga-Escobar, Normando


    The anti-human epidermal growth factor receptor (EGF-R) humanized antibody h-R3 (IgG{sub 1}), which binds to an extracellular domain of EGF-R, was used to evaluate the biodistribution on nude mice xenografted with A431 epidermoid carcinoma cell line. Results are compared with its murine version ior egf/r3 monoclonal antibody (mAb). Twenty-one athymic female 4NMRI nu/nu mice were injected intravenously with 10 {mu}g/100 {mu}Ci of {sup 99m}Tc-labeled mAbs. The mAb ior C5 that recognizes an antigen expressed preferentially on the surface of malignant and cytoplasm of normal colorectal cells was used as negative control. Immunoreactivity of {sup 99m}Tc-labeled mAbs was measured by enzyme linked immunosorbent assay on A431 cell line and the immunoreactive fractions determined by Lindmo method. Among all organs significant accumulation was found in tumor (6.14{+-}2.50 %ID/g, 5.06{+-}2.61 %ID/g for murine and humanized mAbs, respectively) 4 h after injection. The immunoreactive fractions were found to be 0.88 and 0.81 for murine and humanized mAb, respectively. Thus, we expect better results using the humanized mAb h-R3 for diagnostic immunoscintigraphy.

  7. Humanized versus murine anti-human epidermal growth factor receptor monoclonal antibodies for immunoscintigraphic studies

    International Nuclear Information System (INIS)

    Morales, Alejo A. Morales; Duconge, Jorge; Alvarez-Ruiz, Daniel; Becquer-Viart, Maria de Los Angeles; Nunez-Gandolff, Gilda; Fernandez, Eduardo; Caballero-Torres, Idania; Iznaga-Escobar, Normando


    The anti-human epidermal growth factor receptor (EGF-R) humanized antibody h-R3 (IgG 1 ), which binds to an extracellular domain of EGF-R, was used to evaluate the biodistribution on nude mice xenografted with A431 epidermoid carcinoma cell line. Results are compared with its murine version ior egf/r3 monoclonal antibody (mAb). Twenty-one athymic female 4NMRI nu/nu mice were injected intravenously with 10 μg/100 μCi of 99m Tc-labeled mAbs. The mAb ior C5 that recognizes an antigen expressed preferentially on the surface of malignant and cytoplasm of normal colorectal cells was used as negative control. Immunoreactivity of 99m Tc-labeled mAbs was measured by enzyme linked immunosorbent assay on A431 cell line and the immunoreactive fractions determined by Lindmo method. Among all organs significant accumulation was found in tumor (6.14±2.50 %ID/g, 5.06±2.61 %ID/g for murine and humanized mAbs, respectively) 4 h after injection. The immunoreactive fractions were found to be 0.88 and 0.81 for murine and humanized mAb, respectively. Thus, we expect better results using the humanized mAb h-R3 for diagnostic immunoscintigraphy

  8. Protein kinase C is differentially regulated by thrombin, insulin, and epidermal growth factor in human mammary tumor cells

    Energy Technology Data Exchange (ETDEWEB)

    Gomez, M.L.; Tellez-Inon, M.T. (Instituto de Ingenieria Genetica y Biologia Molecular, Buenos Aires (Argentina)); Medrano, E.E.; Cafferatta, E.G.A. (Instituto de Investigaciones Bioquimicas Fundacion Campomar, Buenos Aires (Argentina))


    The exposure of serum-deprived mammary tumor cells MCF-7 and T-47D to insulin, thrombin, and epidermal growth factor (EGF) resulted in dramatic modifications in the activity and in the translocation capacity of protein kinase C from cytosol to membrane fractions. Insulin induces a 600% activation of the enzyme after 5 h of exposure to the hormone in MCF-7 cells; thrombin either activates (200% in MCF-7) or down-regulates (in T-47D), and EGF exerts only a moderate effect. Thus, the growth factors studied modulate differentially the protein kinase C activity in human mammary tumor cells. The physiological significance of the results obtained are discussed in terms of the growth response elicited by insulin, thrombin, and EGF.

  9. Biological interactions of quantum dot nanoparticles in skin and in human epidermal keratinocytes

    International Nuclear Information System (INIS)

    Zhang, Leshuai W.; Yu, William W.; Colvin, Vicki L.; Monteiro-Riviere, Nancy A.


    Quantum dots nanoparticles have novel optical properties for biomedical applications and electronics, but little is known about their skin permeability and interaction with cells. QD621 are nail-shaped nanoparticles that contain a cadmium/selenide core with a cadmium sulfide shell coated with polyethylene glycol (PEG) and are soluble in water. QD were topically applied to porcine skin flow-through diffusion cells to assess penetration at 1 μM, 2 μM and 10 μM for 24 h. QD were also studied in human epidermal keratinocytes (HEK) to determine cellular uptake, cytotoxicity and inflammatory potential. Confocal microscopy depicted the penetration of QD621 through the uppermost stratum corneum (SC) layers of the epidermis and fluorescence was found primarily in the SC and near hair follicles. QD were found in the intercellular lipid bilayers of the SC by transmission electron microscopy (TEM). Inductively coupled plasma-optical emission spectroscopy (ICP-OES) analysis for cadmium (Cd) and fluorescence for QD both did not detect Cd nor fluorescence signal in the perfusate at any time point or concentration. In HEK, viability decreased significantly (p < 0.05) from 1.25 nM to 10nM after 24 h and 48 h. There was a significant increase in IL-6 at 1.25 nM to 10 nM, while IL-8 increased from 2.5nM to 10nM after 24 h and 48 h. TEM of HEK treated with 10 nM of QD621 at 24 h depicted QD in cytoplasmic vacuoles and at the periphery of the cell membranes. These results indicate that porcine skin penetration of QD621 is minimal and limited primarily to the outer SC layers, yet if the skin were damaged allowing direct QD exposure to skin or keratinocytes, an inflammatory response could be initiated

  10. Hesperetin induces melanin production in adult human epidermal melanocytes. (United States)

    Usach, Iris; Taléns-Visconti, Raquel; Magraner-Pardo, Lorena; Peris, José-Esteban


    One of the major sources of flavonoids for humans are citrus fruits, hesperidin being the predominant flavonoid. Hesperetin (HSP), the aglycon of hesperidin, has been reported to provide health benefits such as antioxidant, anti-inflammatory and anticarcinogenic effects. However, the effect of HSP on skin pigmentation is not clear. Some authors have found that HSP induces melanogenesis in murine B16-F10 melanoma cells, which, if extrapolated to in vivo conditions, might protect skin against photodamage. Since the effect of HSP on normal melanocytes could be different to that observed on melanoma cells, the described effect of HSP on murine melanoma cells has been compared to the effect obtained using normal human melanocytes. HSP concentrations of 25 and 50 µM induced melanin synthesis and tyrosinase activity in human melanocytes in a concentration-dependent manner. Compared to control melanocytes, 25 µM HSP increased melanin production and tyrosinase activity 1.4-fold (p melanin production in human melanocyte cultures could be reproduced on human skin. Copyright © 2015 Elsevier Ltd. All rights reserved.

  11. Use of etanercept to treat toxic epidermal necrolysis in a human immunodeficiency virus-positive patient

    Directory of Open Access Journals (Sweden)

    Yung-Yi Lee


    Full Text Available Toxic epidermal necrolysis (TEN is an uncommon and severe cutaneous adverse drug reaction that causes disseminated necrosis of epidermal cells and mucocutaneous detachment. Here, we report the case of a 32-year-old man with human immunodeficiency virus infection who presented with generalized violaceous macules and blister formation 4 days after the administration of mefenamic acid and amoxicillin for a dental procedure. Additional symptoms included oral ulcers and conjunctivitis. Results of skin biopsy were compatible with Stevens–Johnson syndrome (SJS. SJS progressed to TEN within 2 days. Etanercept treatment showed a dramatic improvement in the symptoms of mucocutaneous lesions. To our knowledge, this is the first report on the treatment of TEN using etanercept in a human immunodeficiency virus-positive patient.

  12. Heavy metal-induced cytotoxicity to cultured human epidermal keratinocytes and effects of antioxidants. (United States)

    Kappus, H; Reinhold, C


    Human epidermal keratinocytes which have been cultured were treated with the heavy metal ions of cadmium, mercury, copper and zinc. Cytotoxicity was measured either by protein estimation or by using the neutral red assay. Antioxidants were added in order to find out whether heavy metal-induced cytotoxicity is related to oxidative stress. All metals used showed considerable cytotoxic effects within 24 h in moderate concentrations. None of the antioxidants vitamin E (alpha-tocopherol), pyrogallol, propyl gallate, BHT or ebselen showed any protective or preventive effect. This indicates that oxidative stress may not be involved in the cytotoxicity induced by heavy metals in human epidermal keratinocytes. The cells used are, however, a valuable tool to study mechanisms of cytotoxicity.

  13. Frozen allogeneic human epidermal cultured sheets for the cure of complicated leg ulcers. (United States)

    Bolívar-Flores, Y J; Kuri-Harcuch, W


    Skin ulcers due to venous stasis or diabetes are common among the elderly and are difficult to treat. Repeated applications of cell-based products have been reported to result in cure or improvement of leg ulcers of small size in a fraction of patients. To examine the effects of frozen human allogeneic epidermal cultures for the treatment of acute and chronic ulcers. We treated a series of 10 consecutive patients with leg ulcers of different etiology and duration with frozen human allogeneic epidermal cultures stored frozen and thawed for 5-10 minutes at room temperature before application. Three patients had ulcers with exposed Achilles or extensor tendon. The ulcers treated were as large as 160 cm2 in area and of up to 20-years' duration. After preliminary preparation of the wounds by debridement to remove necrotic tissue and application of silver sulfadiazine to control infection, thawed cultures were applied biweekly from 2 to 15 times depending on the size and complexity of the ulcer. All ulcers healed, including those with tendon exposure. After the first few applications, granulation tissue formed in the ulcer bed and on exposed tendons, and epidermal healing took place through proliferation and migration of cells from the margins of the wound. The time required for complete healing ranged from 1 to 31 weeks after the first application. The use of frozen human allogeneic epidermal cultures is a safe and effective treatment for venous or diabetic ulcers, even those with tendon exposure. It seems possible that any leg ulcer will be amenable to successful treatment by this method.

  14. Autodegradation of 125I-labeled human epidermal cell surface proteins

    International Nuclear Information System (INIS)

    Hashimoto, K.; Singer, K.H.; Lazarus, G.S.


    Triton X-100 extracts of cultured human epidermal cells exhibited proteolytic activity as measured by the hydrolysis of [ 3 H]-casein at neutral pH. The majority of endogenous proteolytic activity was inhibited by parahydroxy mercuribenzoate and by mersalyl acid, indicating the enzyme(s) was a thiol class proteinase(s). Crude Triton X-100 extracts were prepared from epidermal cells following labeling of proteins with 125 I. Autodegradation of labeled proteins at 37 degrees C was detected as early as 1 hr and reached a plateau level by 4 hr. Degradation was inhibited by thiol class proteinase inhibitors. Among the detergent-solubilized radiolabeled proteins a polypeptide chain of Mr 155,000 was particularly sensitive to degradation by endogenous thiol proteinase(s)

  15. Human skin basement membrane-associated heparan sulphate proteoglycan: distinctive differences in ultrastructural localization as a function of developmental age

    DEFF Research Database (Denmark)

    Horiguchi, Y; Fine, J D; Couchman, J R


    was identical to that observed in neonatal and adult human skin. These findings demonstrate that active remodelling of the dermo-epidermal junction occurs during at least the first two trimesters, and affects not only basement membrane-associated structures but also specific antigens.......Recent studies have demonstrated that skin basement membrane components are expressed within the dermo-epidermal junction in an orderly sequence during human foetal development. We have investigated the ultrastructural localization of basement membrane-related antigens in human foetal skin...... at different developmental ages using two monoclonal antibodies to a well-characterized basement membrane-associated heparan sulphate proteoglycan. A series of foetal skin specimens (range, 54-142 gestational days) were examined using an immunoperoxidase immunoelectron microscopic technique. In specimens...

  16. The peanut lectin-binding glycoproteins of human epidermal keratinocytes

    International Nuclear Information System (INIS)

    Morrison, A.I.; Keeble, S.; Watt, F.M.


    The peanut lectin (PNA) is known to bind more strongly to keratinocytes that are undergoing terminal differentiation than to proliferating keratinocytes. In order to investigate the significance of this change in cell-surface carbohydrate authors have identified the PNA-binding glycoproteins of cultured human keratinocytes and antibodies against them. Two heavily glycosylated bands of 110 and 250 kDa were resolved by PAGE of [ 14 C]galactose- or [ 14 C]mannose- and [ 14 C]glucosamine-labeled cell extracts eluted with galactose from PNA affinity columns. The higher molecular weight band was also detected on PNA blots of unlabeled cell extracts transferred to nitrocellulose. Both bands were sensitive to pronase digestion, but only the 250-kDa band was digested with trypsin. A rabbit antiserum that we prepared (anti-PNA-gp) immunoprecipitated both bands from cell extracts. In contrast to PNA, anti-PNA-gp bound equally to proliferating and terminally differentiating cells, indicating that some epitope(s) of the PNA-binding glycoproteins is present on the cell surface prior to terminal differentiation. When keratinocytes grown as a monolayer in low-calcium medium were switched to medium containing 2 mM calcium ions in order to induce desmosome formation and stratification, there was a dramatic redistribution of the PNA-binding glycoproteins, which became concentrated at the boundaries between cells. This may suggest a role for the glycoproteins in cell-cell interactions during stratification

  17. Synthetic inhibitors of matrix metalloproteinases prevent sulfur mustard-induced epidermal-dermal separation in human skin pieces

    NARCIS (Netherlands)

    Mol, M.A.E.; Alblas, S.W.; Hammer, A.; Benschop, H.P.


    Degradation of proteins of the basement membrane zone (BMZ) in the skin depends on the activity of proteolytic enzymes, particularly those belonging to the group of matrix metalloproteinases (MMPs). In the present study we have investigated the contribution of these enzymes to the epidermal-dermal

  18. Simultaneous screening of four epidermal growth factor receptor antagonists from Curcuma longa via cell membrane chromatography online coupled with HPLC-MS. (United States)

    Sun, Meng; Ma, Wei-na; Guo, Ying; Hu, Zhi-gang; He, Lang-chong


    The epidermal growth factor receptors (EGFRs) are significant targets for screening active compounds. In this work, an analytical method was established for rapid screening, separation, and identification of EGFRs antagonists from Curcuma longa. Human embryonic kidney 293 cells with a steadily high expression of EGFRs were used to prepare the cell membrane stationary phase in a cell membrane chromatography model for screening active compounds. Separation and identification of the retention chromatographic peaks was achieved by HPLC-MS. The active sites, docking extents and inhibitory effects of the active compounds were also demonstrated. The screening result found that ar-turmerone, curcumin, demethoxycurcumin, and bisdemethoxycurcumin from Curcuma longa could be active components in a similar manner to gefitinib. Biological trials showed that all of four compounds can inhibit EGFRs protein secretion and cell growth in a dose-dependent manner, and downregulate the phosphorylation of EGFRs. This analytical method demonstrated fast and effective characteristics for screening, separation and identification of the active compounds from a complex system and should be useful for drug discovery with natural medicinal herbs. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Dermal Contributions to Human Interfollicular Epidermal Architecture and Self-Renewal

    Directory of Open Access Journals (Sweden)

    Kynan T. Lawlor


    Full Text Available The human interfollicular epidermis is renewed throughout life by populations of proliferating basal keratinocytes. Though interfollicular keratinocyte stem cells have been identified, it is not known how self-renewal in this compartment is spatially organized. At the epidermal-dermal junction, keratinocytes sit atop a heterogeneous mix of dermal cells that may regulate keratinocyte self-renewal by influencing local tissue architecture and signalling microenvironments. Focusing on the rete ridges and complementary dermal papillae in human skin, we review the identity and organisation of abundant dermal cells types and present evidence for interactions between the dermal microenvironment and the interfollicular keratinocytes.

  20. Urea uptake enhances barrier function and antimicrobial defense in humans by regulating epidermal gene expression (United States)

    Grether-Beck, Susanne; Felsner, Ingo; Brenden, Heidi; Kohne, Zippora; Majora, Marc; Marini, Alessandra; Jaenicke, Thomas; Rodriguez-Martin, Marina; Trullas, Carles; Hupe, Melanie; Elias, Peter M.; Krutmann, Jean


    Urea is an endogenous metabolite, known to enhance stratum corneum hydration. Yet, topical urea anecdotally also improves permeability barrier function, and it appears to exhibit antimicrobial activity. Hence, we hypothesized that urea is not merely a passive metabolite, but a small-molecule regulator of epidermal structure and function. In 21 human volunteers, topical urea improved barrier function in parallel with enhanced antimicrobial peptide (LL-37 and β-defensin-2) expression. Urea both stimulates expression of, and is transported into keratinocytes by two urea transporters, UT-A1 and UT-A2, and by aquaporin 3, 7 and 9. Inhibitors of these urea transporters block the downstream biological effects of urea, which include increased mRNA and protein levels for: (i) transglutaminase-1, involucrin, loricrin and filaggrin; (ii) epidermal lipid synthetic enzymes, and (iii) cathelicidin/LL-37 and β-defensin-2. Finally, we explored the potential clinical utility of urea, showing that topical urea applications normalized both barrier function and antimicrobial peptide expression in a murine model of atopic dermatitis (AD). Together, these results show that urea is a small-molecule regulator of epidermal permeability barrier function and antimicrobial peptide expression after transporter uptake, followed by gene regulatory activity in normal epidermis, with potential therapeutic applications in diseased skin. PMID:22418868

  1. Circulating chromatin-anti-chromatin antibody complexes bind with high affinity to dermo-epidermal structures in murine and human lupus nephritis

    DEFF Research Database (Denmark)

    Fismen, S; Hedberg, A; Fenton, K A


    Murine and human lupus nephritis are characterized by glomerular deposits of electron-dense structures (EDS). Dominant components of EDS are chromatin fragments and IgG antibodies. Whether glomerular EDS predispose for similar deposits in skin is unknown. We analysed (i) whether dermo-epidermal i......Murine and human lupus nephritis are characterized by glomerular deposits of electron-dense structures (EDS). Dominant components of EDS are chromatin fragments and IgG antibodies. Whether glomerular EDS predispose for similar deposits in skin is unknown. We analysed (i) whether dermo......-epidermal immune complex deposits have similar molecular composition as glomerular deposits, (ii) whether chromatin fragments bind dermo-epidermal structures, and (iii) whether deposits in nephritic glomeruli predispose for accumulation of similar deposits in skin. Paired skin and kidney biopsies from nephritic...... (NZBxNZW)F1 and MRL-lpr/lpr mice and from five patients with lupus nephritis were analysed by immunofluorescence, immune electron microscopy (IEM) and co-localization TUNEL IEM. Affinity of chromatin fragments for membrane structures was determined by surface plasmon resonance. Results demonstrated (i...

  2. Low calcium culture condition induces mesenchymal cell-like phenotype in normal human epidermal keratinocytes

    International Nuclear Information System (INIS)

    Takagi, Ryo; Yamato, Masayuki; Murakami, Daisuke; Sugiyama, Hiroaki; Okano, Teruo


    Highlights: → Normal human epidermal keratinocytes serially cultured under low calcium concentration were cytokeratin and vimentin double positive cells. → The human keratinocytes expressed some epithelial stem/progenitor cell makers, mesenchymal cell markers, and markers of epithelial-mesenchymal transition. → Mesenchymal cell-like phenotype in the keratinocytes was suppressed under high-calcium condition. -- Abstract: Epithelial-mesenchymal transition (EMT) is an important cellular phenomenon in organ developments, cancer invasions, and wound healing, and many types of transformed cell lines are used for investigating for molecular mechanisms of EMT. However, there are few reports for EMT in normal human epithelial cells, which are non-transformed or non-immortalized cells, in vitro. Therefore, normal human epidermal keratinocytes (NHEK) serially cultured in low-calcium concentration medium (LCM) were used for investigating relations between differentiation and proliferation and mesenchymal-like phenotype in the present study, since long-term cultivation of NHEK is achieved in LCM. Interestingly, NHEK serially cultured in LCM consisted essentially of cytokeratin-vimentin double positive cells (98%), although the NHEK exhibited differentiation under high-calcium culture condition with 3T3 feeder layer. The vimentin expression was suppressed under high-calcium condition. These results may indicate the importance of mesenchymal-like phenotype for serially cultivation of NHEK in vitro.

  3. Immunohistochemical localization of epidermal growth factor in the second-trimester human fetus

    DEFF Research Database (Denmark)

    Poulsen, Steen Seier; Kryger-Baggesen, N; Nexø, Ebba


    Epidermal growth factor (EGF) is considered to be important in mammalian neonatal growth and development. In order to clarify its developmental role, we have investigated, by immunohistochemistry, the localization of EGF and the time of its first appearance in various organs from a series of 25...... midtrimester human fetuses with a gestational age ranging from 13 to 22 weeks. The first detectable EGF immunoreactivity occurred in week 15-16 fetuses in the placenta, the skin, the distal tubules of the kidney, the surface epithelium of the stomach, and the tips of the small intestinal villi, as well...

  4. Improvement of hydration and epidermal barrier function in human skin by a novel compound isosorbide dicaprylate. (United States)

    Chaudhuri, R K; Bojanowski, K


    The study involved the synthesis of a novel derivative of caprylic acid - isosorbide dicaprylate (IDC) - and the evaluation of its potential in improving water homoeostasis and epidermal barrier function in human skin. The effect of IDC on gene expression was assayed in skin organotypic cultures by DNA microarrays. The results were then confirmed for a few key genes by quantitative PCR, immuno- and cytochemistry. Final validation of skin hydration properties was obtained by four separate clinical studies. Level of hydration was measured by corneometer either by using 2% IDC lotion alone vs placebo or in combination with 2% glycerol lotion vs 2% glycerol only. A direct comparison in skin hydration between 2% IDC and 2% glycerol lotions was also carried out. The epidermal barrier function improvement was assessed by determining changes in transepidermal water loss (TEWL) on the arms before and after treatment with 2% IDC lotion versus placebo. IDC was found to upregulate the expression of AQP3, CD44 and proteins involved in keratinocyte differentiation as well as the formation and function of stratum corneum. A direct comparison between 2% IDC versus 2% glycerol lotions revealed a three-fold advantage of IDC in providing skin hydration. Severely dry skin treated with 2% IDC in combination with 2% glycerol showed 133% improvement, whereas 35% improvement was observed with moderately dry human skin. Topical isosorbide dicaprylate favourably modulates genes involved in the maintenance of skin structure and function, resulting in superior clinical outcomes. By improving skin hydration and epidermal permeability barrier, it offers therapeutic applications in skin ageing. © 2017 Society of Cosmetic Scientists and the Société Française de Cosmétologie.

  5. Leptin regulates the pro-inflammatory response in human epidermal keratinocytes. (United States)

    Lee, Moonyoung; Lee, Eunyoung; Jin, Sun Hee; Ahn, Sungjin; Kim, Sae On; Kim, Jungmin; Choi, Dalwoong; Lim, Kyung-Min; Lee, Seung-Taek; Noh, Minsoo


    The role of leptin in cutaneous wound healing process has been suggested in genetically obese mouse studies. However, the molecular and cellular effects of leptin on human epidermal keratinocytes are still unclear. In this study, the whole-genome-scale microarray analysis was performed to elucidate the effect of leptin on epidermal keratinocyte functions. In the leptin-treated normal human keratinocytes (NHKs), we identified the 151 upregulated and 53 downregulated differentially expressed genes (DEGs). The gene ontology (GO) enrichment analysis with the leptin-induced DEGs suggests that leptin regulates NHKs to promote pro-inflammatory responses, extracellular matrix organization, and angiogenesis. Among the DEGs, the protein expression of IL-8, MMP-1, fibronectin, and S100A7, which play roles in which is important in the regulation of cutaneous inflammation, was confirmed in the leptin-treated NHKs. The upregulation of the leptin-induced proteins is mainly regulated by the STAT3 signaling pathway in NHKs. Among the downregulated DEGs, the protein expression of nucleosome assembly-associated centromere protein A (CENPA) and CENPM was confirmed in the leptin-treated NHKs. However, the expression of CENPA and CENPM was not coupled with those of other chromosome passenger complex like Aurora A kinase, INCENP, and survivin. In cell growth kinetics analysis, leptin had no significant effect on the cell growth curves of NHKs in the normal growth factor-enriched condition. Therefore, leptin-dependent downregulation of CENPA and CENPM in NHKs may not be directly associated with mitotic regulation during inflammation.

  6. Epidermal growth factor increases LRF/Pokemon expression in human prostate cancer cells. (United States)

    Aggarwal, Himanshu; Aggarwal, Anshu; Agrawal, Devendra K


    Leukemia/lymphoma related factor/POK erythroid myeloid ontogenic factor (LRF/Pokemon) is a member of the POK family of proteins that promotes oncogenesis in several forms of cancer. Recently, we found higher LRF expression in human breast and prostate carcinomas compared to the corresponding normal tissues. The aim of this study was to examine the regulation of LRF expression in human prostate cells. Epidermal growth factor (EGF) and its receptors mediate several tumorigenic cascades that regulate cell differentiation, proliferation, migration and survival of prostate cancer cells. There was significantly higher level of LRF expression in the nucleus of LNCaP and PC-3 cells than RWPE-1 cells. A significant increase in LRF expression was observed with increasing doses of EGF in more aggressive and androgen-sensitive prostate cancer cells suggesting that EGF signaling pathway is critical in upregulating the expression of LRF/Pokemon to promote oncogenesis. Copyright © 2011 Elsevier Inc. All rights reserved.

  7. Expression of the epidermal growth factor system in human endometrium during the menstrual cycle

    DEFF Research Database (Denmark)

    Ejskjaer, Kirsten; Sørensen, B S; Poulsen, Steen Seier


    The epidermal growth factor (EGF) system is ubiquitous in humans and plays fundamental roles in embryogenesis, development, proliferation and differentiation. As the endometrium of fertile women is characterized by proliferation and differentiation, we hypothesize a role for the EGF system....... Fourteen premenopausal women had endometrial samples removed on day 6 +/- 1 and day 6 +/- 1 and 12 +/- 1 after ovulation during one menstrual cycle. RNA was extracted and analysed by real-time PCR, and immunohistochemistry was performed to localize the components of the EGF system. Human EGF Receptor 1...... (HER1) showed highest expression during the proliferative phase, HER2 and HER4 during the early and HER3 during the late secretory phase. Amphiregulin (AR) and transforming growth factor alpha (TGFalpha) expression is highest in proliferative phase. Heparin binding (HB)-EGF and betacellulin (BCL) show...

  8. In vivo UVB irradiation induces clustering of Fas (CD95) on human epidermal cells

    DEFF Research Database (Denmark)

    Bang, Bo; Gniadecki, Robert; Larsen, Jørgen K


    In vitro studies with human cell lines have demonstrated that the death receptor Fas plays a role in ultraviolet (UV)-induced apoptosis. The purpose of the present study was to investigate the relation between Fas expression and apoptosis as well as clustering of Fas in human epidermis after...... a single dose of UVB irradiation. Normal healthy individuals were irradiated with three minimal erythema doses (MED) of UVB on forearm or buttock skin. Suction blisters from unirradiated and irradiated skin were raised, and Fas, FasL, and apoptosis of epidermal cells quantified by flow cytometry....... Clustering of Fas was from skin biopsied. Soluble FasL in suction blister fluid was quantified by ELISA. Flow cytometric analysis demonstrated increased expression intensity of Fas after irradiation, with 1.6-,2.2- and 2.7-fold increased median expression at 24, 48 and 72 h after irradiation, respectively (n...

  9. Insulin binding properties of normal and transformed human epidermal cultured keratinocytes

    International Nuclear Information System (INIS)

    Verrando, P.; Ortonne, J.P.


    Insulin binding to its receptors was studied in cultured normal and transformed (A431 line) human epidermal keratinocytes. The specific binding was a temperature-dependent, saturable process. Normal keratinocytes possess a mean value of about 80,000 receptors per cell. Fifteen hours exposure of the cells to insulin lowered their receptor number (about 65% loss in available sites); these reappeared when the hormone was removed from the culture medium. In the A431 epidermoid carcinoma cell line, there is a net decrease in insulin binding (84% of the initial bound/free hormone ratio in comparison with normal cells) essentially related to a loss in receptor affinity for insulin. Thus, cultured human keratinocytes which express insulin receptors may be a useful tool in understanding skin pathology related to insulin disorders

  10. Effects of epidermal growth factor, transferrin, and insulin on lipofection efficiency in human lung carcinoma cells. (United States)

    Yanagihara, K; Cheng, H; Cheng, P W


    Poor transfection efficiency is the major drawback of lipofection. We showed previously that addition of transferrin (TF) to Lipofectin enhanced the expression of a reporter gene in HeLa cells by 120-fold and achieved close to 100% transfection efficiency. The purpose of this study was to determine whether TF and other ligands could improve the efficiency of lipofection in lung carcinoma cells. Confluent A549, Calu3, and H292 cells were transfected for 18 hours with a plasmid DNA (pCMVlacZ) using Lipofectin plus TF, insulin, or epidermal growth factor as the vector. The transfected cells were assessed for transfection efficiency by beta-galactosidase activity (light units/microg protein) and the percentage of blue cells following 5-bromo-4-chloro-3-indolyl beta-D-galactopyranoside staining. Lipofectin supplemented with epidermal growth factor yielded the largest enhancement of lipofection efficiency (lipofection efficiency in A549 and Calu3 cells but not in H292 cells, whereas TF showed significant lipofection efficiency-enhancing effect in Calu3 and H292 cells but not in A549 cells. The transfection efficiency correlated well with the amounts of DNA delivered to the nucleus as well as the amounts of the receptor. These results indicate that the gene delivery strategy employing ligand-facilitated lipofection can achieve high transfection efficiency in human lung carcinoma cells. In addition, enhancement of the expression of the receptor may be a possible strategy for increasing the efficiency of gene targeting.

  11. Use of a collagen-elastin matrix as transport carrier system to transfer proliferating epidermal cells to human dermis in vitro. (United States)

    Waaijman, Taco; Breetveld, Melanie; Ulrich, Magda; Middelkoop, Esther; Scheper, Rik J; Gibbs, Susan


    This in vitro study describes a novel cell culture, transport, and transfer protocol that may be highly suitable for delivering cultured proliferating keratinocytes and melanocytes to large open skin wounds (e.g., burns). We have taken into account previous limitations identified using other keratinocyte transfer techniques, such as regulatory issues, stability of keratinocytes during transport (single cell suspensions undergo terminal differentiation), ease of handling during application, and the degree of epidermal blistering resulting after transplantation (both related to transplanting keratinocyte sheets). Large numbers of proliferating epidermal cells (EC) (keratinocytes and melanocytes) were generated within 10-14 days and seeded onto a three-dimensional matrix composed of elastin and collagen types I, III, and V (Matriderm®), which enabled easy and stable transport of the EC for up to 24 h under ambient conditions. All culture conditions were in accordance with the regulations set by the Dutch Central Committee on Research Involving Human Subjects (CCMO). As an in vitro model system for clinical in vivo transfer, the EC were then transferred from Matriderm onto human acellular dermis during a period of 3 days. After transfer the EC maintained the ability to regenerate into a fully differentiated epidermis containing melanocytes on the human dermis. Proliferating keratinocytes were located in the basal layer and keratin-10 expression was located in differentiating suprabasal layers similar to that found in human epidermis. No blistering was observed (separation of the epidermis from the basement membrane). Keratin-6 expression was strongly upregulated in the regenerating epidermis similar to normal wound healing. In summary, we show that EC-Matriderm contains viable, metabolically active keratinocytes and melanocytes cultured in a manner that permits easy transportation and contains epidermal cells with the potential to form a pigmented reconstructed

  12. Immunohistochemical detection of cytochrome P450 isoenzymes in cultured human epidermal cells. (United States)

    Van Pelt, F N; Meierink, Y J; Blaauboer, B J; Weterings, P J


    We used specific monoclonal antibodies (MAb) to human cytochrome P450 isoenzymes to determine the presence of these proteins in human epidermal cells. Two MAb (P450-5 and P450-8) recognize major forms of hepatic cytochrome P450 involved in biotransformation of xenobiotics. A third MAb, to cytochrome P450-9, is not fully characterized. The proteins were determined by the indirect immunoperoxidase technique after fixation with methanol and acetone. Biopsy materials for cultured keratinocytes, i.e., foreskin and hair follicles, contained the two major forms of cytochrome P450. In cultured keratinocytes derived from hair follicles the proteins were undetectable, whereas the keratinocytes derived from foreskin continued to express the two major forms of hepatic cytochrome P450. Cultured human fibroblasts and a human keratinocyte cell line (SVK14) showed staining similar to that of the foreskin keratinocytes. Cytochrome P450-9 was detectable only in human hepatocytes. The results indicate that, under the culture conditions applied, cultured human foreskin cells and the cell line SVK14 continue to express specific cytochrome P450 isoenzymes in culture, in contrast to hair follicle keratinocytes.

  13. Recycling of epidermal growth factor in a human pancreatic carcinoma cell line

    International Nuclear Information System (INIS)

    Korc, M.; Magun, B.E.


    PANC-1 human pancreatic carcinoma cells readily bound and internalized 125 I-labeled epidermal growth factor (EGF). Bound 125 I-labeled EGF was then partially processed to a number of high molecular weight acidic species. Percoll gradient centrifugation of cell homogenates indicated that the majority of 125 I activity localized to several intracellular vesicular compartments. Both intact EGF and its processed species were subsequently released into the incubation medium. A major portion of the released radioactivity was capable of rebinding to the cell. Only a small amount of bound 125 I-labeled EGF was degraded to low molecular weight products, and this degradation was completely blocked by methylamine. These findings suggest that in PANC-1 cells, bound EGF undergoes only limited processing. Both intact EGF and its major processed species bypass the cellular degradative pathways, are slowly released from the cell, and then rebind to the cell

  14. Human Epidermal Langerhans Cells Maintain Immune Homeostasis in Skin by Activating Skin Resident Regulatory T Cells (United States)

    Seneschal, Julien; Clark, Rachael A.; Gehad, Ahmed; Baecher-Allan, Clare M.; Kupper, Thomas S.


    Recent discoveries indicate that the skin of a normal individual contains 10-20 billion resident memory T cells ( which include various T helper, T cytotoxic, and T regulatory subsets, that are poised to respond to environmental antigens. Using only autologous human tissues, we report that both in vitro and in vivo, resting epidermal Langerhan cells (LC) selectively and specifically induced the activation and proliferation of skin resident regulatory T cells (Treg), a minor subset of skin resident memory T cells. In the presence of foreign pathogen, however, the same LC activated and induced proliferation of effector memory T (Tem) cells and limited Treg cells activation. These underappreciated properties of LC: namely maintenance of tolerance in normal skin, and activation of protective skin resident memory T cells upon infectious challenge, help clarify the role of LC in skin. PMID:22560445

  15. Cultivation of human dermal fibroblasts and epidermal keratinocytes on keratin-coated silica bead substrates. (United States)

    Tan, Bee Yi; Nguyen, Luong T H; Kim, Hyo-Sop; Kim, Jae-Ho; Ng, Kee Woei


    Human hair keratin is promising as a bioactive material platform for various biomedical applications. To explore its versatility further, human hair keratin was coated onto monolayers of silica beads to produce film-like substrates. This combination was hypothesized to provide a synergistic effect in improving the biochemical properties of the resultant composite. Atomic force microscopy analysis showed uniform coatings of keratin on the silica beads with a slight increase in the resulting surface roughness. Keratin-coated silica beads had higher surface energy and relatively lower negative charge than those of bare silica beads. To investigate cell response, human dermal fibroblasts (HDFs), and human epidermal keratinocytes (HEKs) were cultured on the substrates over 4 days. Results showed that keratin coatings significantly enhanced the metabolic activity of HDFs and encouraged cell spreading but did not exert any significant effects on HEKs. HDF expression of collagen I was significantly more intense on the keratin-coated compared to the bare silica substrates. Furthermore, HDF secretion of various cytokines suggested that keratin coatings triggered active cell responses related to wound healing. Collectively, our study demonstrated that human hair keratin-coated silica bead monolayers have the potential to modulate HDF behavior in culture and may be exploited further. © 2017 Wiley Periodicals, Inc. J Biomed Mater Res Part A: 105A: 2789-2798, 2017. © 2017 Wiley Periodicals, Inc.

  16. Topical Human Epidermal Growth Factor in the Treatment of Senile Purpura and the Prevention of Dermatoporosis. (United States)

    McKnight, Braden; Seidel, Rachel; Moy, Ron


    Senile purpura presents itself as a largely unexplored challenge as it has been long thought of as a benign condition without long-term health sequelae. It is becoming increasingly accepted that skin aging not only results in cosmetic disturbances, but as a functional ones. With modern increases in lifespan, skin atrophy associated with solar damage is presenting as a clinically significant inability to mechanically protect patients. This chronic cutaneous insufficiency/fragility syndrome was recently termed dermatoporosis and senile purpura appears to be a visible marker of early stage dysfunction. To examine the effects of topically human epidermal growth factor on the clinical presence of senile purpura and its effect on skin thickness as measured via cutaneous ultrasound. Six subjects applied human epidermal growth factor morning and night for six weeks. Clinical outcomes were evaluated by comparing initial clinical photos to 6-week photos and performing a blinded investigator's global assessment (IGA). Skin thickness was evaluated via cutaneous ultrasound measurement. Ultrasound measurements indicated a mean skin thickening of 195.2 ± 35.7 um (SEM) over 6 weeks. The average number of purpuric lesions decreased from 15 ± 4.6 (SEM) to 2.3 ± 0.7 (SEM) over that same period. Senile purpura presents itself as a cosmetic disturbance posing significant psychological distress and serves as a marker of the severity of skin thinning. In this study, we demonstrate that topical h-EGF diminishes the appearance of senile purpura by thickening skin and may help prevent the development of late stage dermatoporosis.

  17. Limited human epidermal growth factor receptor 2 discordance in metastatic breast cancer patients treated with trastuzumab, a population based study

    NARCIS (Netherlands)

    van Rooijen, J.M.; de Munck, L.; de Graaf, J.C.; Siesling, Sabine; de Vries, Erik G.; Boers, J.E.


    Background Accurate assessment of the human epidermal growth factor receptor 2 (HER2) in breast cancer is essential for proper treatment decisions. HER2 positivity confirmation rates in breast cancer trials by central testing pathology laboratories were reported to be approximately 85%. The aim of

  18. Tumor necrosis factor related apoptosis inducing ligand triggers apoptosis in dividing but not in differentiating human epidermal keratinocytes

    NARCIS (Netherlands)

    Jansen, Bastiaan J. H.; van Ruissen, Fred; Cerneus, Stefanie; Cloin, Wendy; Bergers, Mieke; van Erp, Piet E. J.; Schalkwijk, Joost


    Using serial analysis of gene expression we have previously identified the expression of several pro-apoptotic and anti-apoptotic genes in cultured human primary epidermal keratinocytes, including tumor necrosis factor related apoptosis inducing ligand (TRAIL). TRAIL is a potent inducer of apoptosis

  19. Limited human epidermal growth factor receptor 2 discordance in metastatic breast cancer patients treated with trastuzumab, a population based study

    NARCIS (Netherlands)

    van Rooijen, J. M.; de Munck, L.; de Graaf, J. C.; Siesling, S.; de Vries, E. G.; Boers, J. E.

    Background: Accurate assessment of the human epidermal growth factor receptor 2 (HER2) in breast cancer is essential for proper treatment decisions. HER2 positivity confirmation rates in breast cancer trials by central testing pathology laboratories were reported to be approximately 85%. The aim of

  20. Bioengineering a human plasma-based epidermal substitute with efficient grafting capacity and high content in clonogenic cells. (United States)

    Alexaline, Maia M; Trouillas, Marina; Nivet, Muriel; Bourreau, Emilie; Leclerc, Thomas; Duhamel, Patrick; Martin, Michele T; Doucet, Christelle; Fortunel, Nicolas O; Lataillade, Jean-Jacques


    Cultured epithelial autografts (CEAs) produced from a small, healthy skin biopsy represent a lifesaving surgical technique in cases of full-thickness skin burn covering >50% of total body surface area. CEAs also present numerous drawbacks, among them the use of animal proteins and cells, the high fragility of keratinocyte sheets, and the immaturity of the dermal-epidermal junction, leading to heavy cosmetic and functional sequelae. To overcome these weaknesses, we developed a human plasma-based epidermal substitute (hPBES) for epidermal coverage in cases of massive burn, as an alternative to traditional CEA, and set up critical quality controls for preclinical and clinical studies. In this study, phenotypical analyses in conjunction with functional assays (clonal analysis, long-term culture, or in vivo graft) showed that our new substitute fulfills the biological requirements for epidermal regeneration. hPBES keratinocytes showed high potential for cell proliferation and subsequent differentiation similar to healthy skin compared with a well-known reference material, as ascertained by a combination of quality controls. This work highlights the importance of integrating relevant multiparameter quality controls into the bioengineering of new skin substitutes before they reach clinical development. This work involves the development of a new bioengineered epidermal substitute with pertinent functional quality controls. The novelty of this work is based on this quality approach. ©AlphaMed Press.

  1. Epidermal growth factor-induced mobilization of a ganglioside-specific sialidase (NEU3) to membrane ruffles

    International Nuclear Information System (INIS)

    Yamaguchi, Kazunori; Hata, Keiko; Wada, Tadashi; Moriya, Setsuko; Miyagi, Taeko


    Human ganglioside-specific sialidase, NEU3, localized at cell membranes is thought to regulate various biological processes at cell surfaces. We here explored functional subcellular localization of the sialidase by immunofluorescence and found accumulation at leading edges of cell membranes in the presence of serum in culture. In response to EGF, the sialidase redistributed rapidly to ruffling cell membranes of squamous carcinoma A431 cells and co-localized with Rac-1. NEU3 overexpression enhanced Rac-1 activation and cell migration as compared with controls in HeLa cells as well as in A431 cells. Consistent with co-localization with Rac-1 by immunofluorescence, NEU3 was found to co-precipitate with activated Rac bound to GST-PAK-1 fusion protein. NEU3 silencing by siRNA, in contrast, resulted in inhibition of Rac-1 activation. These results indicate that NEU3 is able to mobilize to membrane ruffles in response to growth stimuli and activate the Rac-1 signaling by co-localization with Rac-1, leading to increased cell motility

  2. Upregulation of FOXM1 induces genomic instability in human epidermal keratinocytes

    Directory of Open Access Journals (Sweden)

    Philpott Michael P


    Full Text Available Abstract Background The human cell cycle transcription factor FOXM1 is known to play a key role in regulating timely mitotic progression and accurate chromosomal segregation during cell division. Deregulation of FOXM1 has been linked to a majority of human cancers. We previously showed that FOXM1 was upregulated in basal cell carcinoma and recently reported that upregulation of FOXM1 precedes malignancy in a number of solid human cancer types including oral, oesophagus, lung, breast, kidney, bladder and uterus. This indicates that upregulation of FOXM1 may be an early molecular signal required for aberrant cell cycle and cancer initiation. Results The present study investigated the putative early mechanism of UVB and FOXM1 in skin cancer initiation. We have demonstrated that UVB dose-dependently increased FOXM1 protein levels through protein stabilisation and accumulation rather than de novo mRNA expression in human epidermal keratinocytes. FOXM1 upregulation in primary human keratinocytes triggered pro-apoptotic/DNA-damage checkpoint response genes such as p21, p38 MAPK, p53 and PARP, however, without causing significant cell cycle arrest or cell death. Using a high-resolution Affymetrix genome-wide single nucleotide polymorphism (SNP mapping technique, we provided the evidence that FOXM1 upregulation in epidermal keratinocytes is sufficient to induce genomic instability, in the form of loss of heterozygosity (LOH and copy number variations (CNV. FOXM1-induced genomic instability was significantly enhanced and accumulated with increasing cell passage and this instability was increased even further upon exposure to UVB resulting in whole chromosomal gain (7p21.3-7q36.3 and segmental LOH (6q25.1-6q25.3. Conclusion We hypothesise that prolonged and repeated UVB exposure selects for skin cells bearing stable FOXM1 protein causes aberrant cell cycle checkpoint thereby allowing ectopic cell cycle entry and subsequent genomic instability. The aberrant

  3. Human eccrine sweat gland cells turn into melanin-uptaking keratinocytes in dermo-epidermal skin substitutes. (United States)

    Böttcher-Haberzeth, Sophie; Biedermann, Thomas; Pontiggia, Luca; Braziulis, Erik; Schiestl, Clemens; Hendriks, Bart; Eichhoff, Ossia M; Widmer, Daniel S; Meuli-Simmen, Claudia; Meuli, Martin; Reichmann, Ernst


    Recently, Biedermann et al. (2010) have demonstrated that human eccrine sweat gland cells can develop a multilayered epidermis. The question still remains whether these cells can fulfill exclusive and very specific functional properties of epidermal keratinocytes, such as the incorporation of melanin, a feature absent in sweat gland cells. We added human melanocytes to eccrine sweat gland cells to let them develop into an epidermal analog in vivo. The interaction between melanocytes and sweat gland-derived keratinocytes was investigated. The following results were gained: (1) macroscopically, a pigmentation of the substitutes was seen 2-3 weeks after transplantation; (2) we confirmed the development of a multilayered, stratified epidermis with melanocytes distributed evenly throughout the basal layer; (3) melanocytic dendrites projected to suprabasal layers; and (4) melanin was observed to be integrated into former eccrine sweat gland cells. These skin substitutes were similar or equal to skin substitutes cultured from human epidermal keratinocytes. The only differences observed were a delay in pigmentation and less melanin uptake. These data suggest that eccrine sweat gland cells can form a functional epidermal melanin unit, thereby providing striking evidence that they can assume one of the most characteristic keratinocyte properties.

  4. Pharmacologic induction of epidermal melanin and protection against sunburn in a humanized mouse model. (United States)

    Amaro-Ortiz, Alexandra; Vanover, Jillian C; Scott, Timothy L; D'Orazio, John A


    Fairness of skin, UV sensitivity and skin cancer risk all correlate with the physiologic function of the melanocortin 1 receptor, a Gs-coupled signaling protein found on the surface of melanocytes. Mc1r stimulates adenylyl cyclase and cAMP production which, in turn, up-regulates melanocytic production of melanin in the skin. In order to study the mechanisms by which Mc1r signaling protects the skin against UV injury, this study relies on a mouse model with "humanized skin" based on epidermal expression of stem cell factor (Scf). K14-Scf transgenic mice retain melanocytes in the epidermis and therefore have the ability to deposit melanin in the epidermis. In this animal model, wild type Mc1r status results in robust deposition of black eumelanin pigment and a UV-protected phenotype. In contrast, K14-Scf animals with defective Mc1r signaling ability exhibit a red/blonde pigmentation, very little eumelanin in the skin and a UV-sensitive phenotype. Reasoning that eumelanin deposition might be enhanced by topical agents that mimic Mc1r signaling, we found that direct application of forskolin extract to the skin of Mc1r-defective fair-skinned mice resulted in robust eumelanin induction and UV protection (1). Here we describe the method for preparing and applying a forskolin-containing natural root extract to K14-Scf fair-skinned mice and report a method for measuring UV sensitivity by determining minimal erythematous dose (MED). Using this animal model, it is possible to study how epidermal cAMP induction and melanization of the skin affect physiologic responses to UV exposure.

  5. Cell wall accumulation of fluorescent proteins derived from a trans-Golgi cisternal membrane marker and paramural bodies in interdigitated Arabidopsis leaf epidermal cells. (United States)

    Akita, Kae; Kobayashi, Megumi; Sato, Mayuko; Kutsuna, Natsumaro; Ueda, Takashi; Toyooka, Kiminori; Nagata, Noriko; Hasezawa, Seiichiro; Higaki, Takumi


    In most dicotyledonous plants, leaf epidermal pavement cells develop jigsaw puzzle-like shapes during cell expansion. The rapid growth and complicated cell shape of pavement cells is suggested to be achieved by targeted exocytosis that is coordinated with cytoskeletal rearrangement to provide plasma membrane and/or cell wall materials for lobe development during their morphogenesis. Therefore, visualization of membrane trafficking in leaf pavement cells should contribute an understanding of the mechanism of plant cell morphogenesis. To reveal membrane trafficking in pavement cells, we observed monomeric red fluorescent protein-tagged rat sialyl transferases, which are markers of trans-Golgi cisternal membranes, in the leaf epidermis of Arabidopsis thaliana. Quantitative fluorescence imaging techniques and immunoelectron microscopic observations revealed that accumulation of the red fluorescent protein occurred mostly in the curved regions of pavement cell borders and guard cell ends during leaf expansion. Transmission electron microscopy observations revealed that apoplastic vesicular membrane structures called paramural bodies were more frequent beneath the curved cell wall regions of interdigitated pavement cells and guard cell ends in young leaf epidermis. In addition, pharmacological studies showed that perturbations in membrane trafficking resulted in simple cell shapes. These results suggested possible heterogeneity of the curved regions of plasma membranes, implying a relationship with pavement cell morphogenesis.

  6. Protective Effect of Liposome-Encapsulated Glutathione in a Human Epidermal Model Exposed to a Mustard Gas Analog

    Directory of Open Access Journals (Sweden)

    Victor Paromov


    Full Text Available Sulfur mustard or mustard gas (HD and its monofunctional analog, 2-chloroethyl ethyl sulfide (CEES, or “half-mustard gas,” are alkylating agents that induce DNA damage, oxidative stress, and inflammation. HD/CEES are rapidly absorbed in the skin causing extensive injury. We hypothesize that antioxidant liposomes that deliver both water-soluble and lipid-soluble antioxidants protect skin cells from immediate CEES-induced damage via attenuating oxidative stress. Liposomes containing water-soluble antioxidants and/or lipid-soluble antioxidants were evaluated using in vitro model systems. Initially, we found that liposomes containing encapsulated glutathione (GSH-liposomes increased cell viability and attenuated production of reactive oxygen species (ROS in HaCaT cells exposed to CEES. Next, GSH-liposomes were tested in a human epidermal model, EpiDerm. In the EpiDerm, GSH-liposomes administered simultaneously or 1 hour after CEES exposure (2.5 mM increased cell viability, inhibited CEES-induced loss of ATP and attenuated changes in cellular morphology, but did not reduce caspase-3 activity. These findings paralleled the previously described in vivo protective effect of antioxidant liposomes in the rat lung and established the effectiveness of GSH-liposomes in a human epidermal model. This study provides a rationale for use of antioxidant liposomes against HD toxicity in the skin considering further verification in animal models exposed to HD.

  7. Human Epidermal Growth Factor Receptor 2 Overexpression in Micropapillary and Other Variants of Urothelial Carcinoma. (United States)

    Behzatoğlu, Kemal; Yörükoğlu, Kutsal; Demir, Hale; Bal, Nebil


    Human epidermal growth factor receptor 2 (HER2) protein overexpression or gene amplification has been shown in urothelial bladder cancer. This could be helpful when using targeted anti-HER2 therapy on these tumors. To evaluate HER2 immunohistochemical expression in conventional urothelial carcinoma (UC), in situ UC, and UC variants primarily in micropapillary urothelial carcinoma (MPUC). The study evaluated 60 MPUC cases; 25 invasive, 20 low-grade noninvasive, and 10 high-grade noninvasive UC cases; 8 in situ UC cases; and 69 UC variant cases. The immunohistochemistry staining was scored according to recommendations of the American Society of Clinical Oncology/College of American Pathologists 2013 HER2 test guideline established for breast cancer and only 3+ staining was considered HER2 overexpression. HER2 overexpression was determined by 3+ staining. 34 of 60 MPUC cases (56%) showed HER2 overexpression (3+ staining). We observed 3+ staining HER2 overexpression in nine of 25 conventional invasive UC cases (36%), four of eight in situ UC cases (50%), and three of six lipid cell variant cases (50%). 3+ staining HER2 overexpression was not seen in eight glandular, six small cell, and five sarcomatoid variant cases. HER2 overexpression was negative in the 20 low-grade noninvasive UC cases but positive in two of the 10 high-grade noninvasive UC cases (20%). We observed HER2 overexpression most commonly in MPUC cases. We also found HER2 overexpression in conventional invasive and in situ UC cases. Pure in situ UC and conventional invasive UC, especially MPUC, could be candidate tumors for treatment with anti-HER2 antibody (trastuzumab therapy). Targeted therapy has a limited place in treatment of bladder cancer. In this study, human epidermal growth factor receptor 2 (HER2) overexpression in bladder carcinomas was evaluated in a large number of cases. Anti-HER2 therapy could be used in bladder cancers, as in breast and gastric cancers. Copyright © 2016 European

  8. Chemical allergens stimulate human epidermal keratinocytes to produce lymphangiogenic vascular endothelial growth factor. (United States)

    Bae, Ok-Nam; Ahn, Seyeon; Jin, Sun Hee; Hong, Soo Hyun; Lee, Jinyoung; Kim, Eun-Sun; Jeong, Tae Cheon; Chun, Young-Jin; Lee, Ai-Young; Noh, Minsoo


    Allergic contact dermatitis (ACD) is a cell-mediated immune response that involves skin sensitization in response to contact with various allergens. Angiogenesis and lymphangiogenesis both play roles in the allergic sensitization process. Epidermal keratinocytes can produce vascular endothelial growth factor (VEGF) in response to UV irradiation and during wound healing. However, the effect of haptenic chemical allergens on the VEGF production of human keratinocytes, which is the primary contact site of toxic allergens, has not been thoroughly researched. We systematically investigated whether immune-regulatory cytokines and chemical allergens would lead to the production of VEGF in normal human keratinocytes (NHKs) in culture. VEGF production significantly increased when NHKs were treated with IFNγ, IL-1α, IL-4, IL-6, IL-17A, IL-22 or TNFα. Among the human sensitizers listed in the OECD Test Guideline (TG) 429, we found that CMI/MI, DNCB, 4-phenylenediamine, cobalt chloride, 2-mercaptobenzothiazole, citral, HCA, cinnamic alcohol, imidazolidinyl urea and nickel chloride all significantly upregulated VEGF production in NHKs. In addition, common human haptenic allergens such as avobenzone, formaldehyde and urushiol, also induced the keratinocyte-derived VEGF production. VEGF upregulation by pro-inflammatory stimuli, IFNγ, DNCB or formaldehyde is preceded by the production of IL-8, an acute inflammatory phase cytokine. Lymphangiogenic VEGF-C gene transcription was significantly increased when NHKs were treated with formaldehyde, DNCB or urushiol, while transcription of VEGF-A and VEGF-B did not change. Therefore, the chemical allergen-induced VEGF upregulation is mainly due to the increase in lymphangiogenic VEGF-C transcription in NHKs. These results suggest that keratinocyte-derived VEGF may regulate the lymphangiogenic process during the skin sensitization process of ACD. Copyright © 2015 Elsevier Inc. All rights reserved.

  9. A role for the epidermal growth factor receptor signaling in development of intestinal serrated polyps in mice and humans. (United States)

    Bongers, Gerold; Muniz, Luciana R; Pacer, Michelle E; Iuga, Alina C; Thirunarayanan, Nanthakumar; Slinger, Erik; Smit, Martine J; Reddy, E Premkumar; Mayer, Lloyd; Furtado, Glaucia C; Harpaz, Noam; Lira, Sergio A


    Epithelial cancers can be initiated by activating mutations in components of the mitogen-activated protein kinase signaling pathway such as v-raf murine sarcoma viral oncogene homolog B1 (BRAF), v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog (KRAS), or epidermal growth factor receptor (EGFR). Human intestinal serrated polyps are a heterogeneous group of benign lesions, but some progress to colorectal cancer. Tumors that arise from these polyps frequently contain activating mutations in BRAF or KRAS, but little is known about the role of EGFR activation in their development. Polyp samples were obtained from adults during screening colonoscopies at Mount Sinai Hospital in New York. We measured levels of EGFR protein and phosphorylation in human serrated polyps by immunohistochemical and immunoblot analyses. We generated transgenic mice that express the ligand for EGFR, Heparin-binding EGF-like growth factor (HB-EGF), in the intestine. EGFR and the extracellular-regulated kinases (ERK)1/2 were phosphorylated in serrated areas of human hyperplastic polyps (HPPs), sessile serrated adenomas, and traditional serrated adenomas. EGFR and ERK1/2 were phosphorylated in the absence of KRAS or BRAF activating mutations in a subset of HPP. Transgenic expression of the EGFR ligand HB-EGF in the intestines of mice promoted development of small cecal serrated polyps. Mice that expressed a combination of HB-EGF and US28 (a constitutively active, G-protein-coupled receptor that increases processing of HB-EGF from the membrane) rapidly developed large cecal serrated polyps. These polyps were similar to HPPs and had increased phosphorylation of EGFR and ERK1/2 within the serrated epithelium. Administration of pharmacologic inhibitors of EGFR or MAPK to these transgenic mice significantly reduced polyp development. Activation of EGFR signaling in the intestine of mice promotes development of serrated polyps. EGFR signaling also is activated in human HPPs, sessile serrated adenomas

  10. Evaluation of dermal-epidermal skin equivalents ('composite-skin') of human keratinocytes in a collagen-glycosaminoglycan matrix(Integra artificial skin). (United States)

    Kremer, M; Lang, E; Berger, A C


    Integra artificial skin (Integra LifeSciences Corp., Plainsboro, NJ, USA) is a dermal template consisting of bovine collagen, chondroitin-6-sulphate and a silastic membrane manufactured as Integra. This product has gained widespread use in the clinical treatment of third degree burn wounds and full thickness skin defects of different aetiologies. The product was designed to significantly reduce the time needed to achieve final wound closure in the treatment of major burn wounds, to optimise the sparse autologous donor skin resources and to improve the durable mechanical quality of the skin substitute. The clinical procedure requires two stages. The first step creates a self neodermis, the second creates a self epidermis on the neodermis. However, it is desirable to cover major burn wounds early in a single step by a skin substitute consisting of a dermal equivalent seeded in vitro with autologous keratinocytes ('composite-skin') out of which a full thickness skin develops in vivo.The goal of this experimental study was to develop a method to integrate human keratinocytes in homogeneous distribution and depth into Integra Artificial Skin. The seeded cell-matrix composites were grafted onto athymic mice in order to evaluate their potential to reconstitute a human epidermis in vivo. We were able to demonstrate that the inoculated human keratinocytes reproducibly displayed a homogeneous pattern of distribution, adherence, proliferation and confluence. The cell-matrix composites grafted in this model exhibited good wound adherence, complete healing, minor wound contraction and had the potential to reconstitute an elastic, functional and durable human skin. Histologically we were able to show that the inoculated human keratinocytes in vivo colonised the matrix in a histomorphologically characteristic epidermal pattern (keratomorula, keratinocyte bubbling) and developed a persisting, stratified, keratinising epidermis which immunohistologically proved to be of human

  11. Human epidermal growth factor receptor2 expression in unresectable gastric cancers: Relationship with CT characteristics

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Jeong Sub [Dept. of Radiology, Jeju National University Hospital, Jeju (Korea, Republic of); Kim, Se Hyung; Im, Seock Ah; Kim, Min A; Han, Joon Koo [Seoul National University Hospital, Seoul (Korea, Republic of)


    To retrospectively analyze the qualitative CT features that correlate with human epidermal growth factor receptor 2 (HER2)-expression in pathologically-proven gastric cancers. A total of 181 patients with pathologically-proven unresectable gastric cancers with HER2-expression (HER2-positive [n = 32] and negative [n = 149]) were included. CT features of primary gastric and metastatic tumors were reviewed. The prevalence of each CT finding was compared in both groups. Thereafter, binary logistic regression determined the most significant differential CT features. Clinical outcomes were compared using Kaplan-Meier method. HER2-postive cancers showed lower clinical T stage (21.9% vs. 8.1%; p = 0.015), hyperattenuation on portal phase (62.5% vs. 30.9%; p = 0.003), and was more frequently metastasized to the liver (62.5% vs. 32.2%; p = 0.001), than HER2-negative cancers. On binary regression analysis, hyperattenuation of the tumor (odds ratio [OR], 4.68; p < 0.001) and hepatic metastasis (OR, 4.43; p = 0.001) were significant independent factors that predict HER2-positive cancers. Median survival of HER2-positive cancers (13.7 months) was significantly longer than HER2-negative cancers (9.6 months) (p = 0.035). HER2-positive gastric cancers show less-advanced T stage, hyperattenuation on the portal phase, and frequently metastasize to the liver, as compared to HER2-negative cancers.

  12. Recurrent exposure to nicotine differentiates human bronchial epithelial cells via epidermal growth factor receptor activation

    International Nuclear Information System (INIS)

    Martinez-Garcia, Eva; Irigoyen, Marta; Anso, Elena; Martinez-Irujo, Juan Jose; Rouzaut, Ana


    Cigarette smoking is the major preventable cause of lung cancer in developed countries. Nicotine (3-(1-methyl-2-pyrrolidinyl)-pyridine) is one of the major alkaloids present in tobacco. Besides its addictive properties, its effects have been described in panoply of cell types. In fact, recent studies have shown that nicotine behaves as a tumor promoter in transformed epithelial cells. This research focuses on the effects of acute repetitive nicotine exposure on normal human bronchial epithelial cells (NHBE cells). Here we show that treatment of NHBE cells with recurrent doses of nicotine up to 500 μM triggered cell differentiation towards a neuronal-like phenotype: cells emitted filopodia and expressed neuronal markers such as neuronal cell adhesion molecule, neurofilament-M and the transcription factors neuronal N and Pax-3. We also demonstrate that nicotine treatment induced NF-kB translocation to the nucleus, phosphorylation of the epidermal growth factor receptor (EGFR), and accumulation of heparin binding-EGF in the extracellular medium. Moreover, addition of AG1478, an inhibitor of EGFR tyrosine phosphorylation, or cetuximab, a monoclonal antibody that precludes ligand binding to the same receptor, prevented cell differentiation by nicotine. Lastly, we show that differentiated cells increased their adhesion to the extracellular matrix and their protease activity. Given that several lung pathologies are strongly related to tobacco consumption, these results may help to better understand the damaging consequences of nicotine exposure

  13. Phosphoproteomic fingerprinting of epidermal growth factor signaling and anticancer drug action in human tumor cells. (United States)

    Lim, Yoon-Pin; Diong, Lang-Shi; Qi, Robert; Druker, Brian J; Epstein, Richard J


    Many proteins regulating cancer cell growth are tyrosine phosphorylated. Using antiphosphotyrosine affinity chromatography, thiourea protein solubilization, two-dimensional PAGE, and mass spectrometry, we report here the characterization of the epidermal growth factor (EGF)-induced phosphoproteome in A431 human epidermoid carcinoma cells. Using this approach, more than 50 distinct tyrosine phosphoproteins are identifiable within five main clusters-cytoskeletal proteins, signaling enzymes, SH2-containing adaptors, chaperones, and focal adhesion proteins. Comparison of the phosphoproteomes induced in vitro by transforming growth factor-alpha and platelet-derived growth factor demonstrates the pathway- and cell-specific nature of the phosphoproteomes induced. Elimination of both basal and ligand-dependent phosphoproteins by cell exposure to the EGF receptor catalytic inhibitor gefitinib (Iressa, ZD1839) suggests either an autocrine growth loop or the presence of a second inhibited kinase in A431 cells. By identifying distinct patterns of phosphorylation involving novel signaling substrates, and by clarifying the mechanism of action of anticancer drugs, these findings illustrate the potential of immunoaffinity-based phosphoproteomics for guiding the discovery of new drug targets and the rational utilization of pathway-specific chemotherapies.

  14. High Efficient Expression, Purification, and Functional Characterization of Native Human Epidermal Growth Factor in Escherichia coli

    Directory of Open Access Journals (Sweden)

    Yi Ma


    Full Text Available Human epidermal growth factor (hEGF is a small, mitotic growth polypeptide that promotes the proliferation of various cells and is widely applied in clinical practices. However, high efficient expression of native hEGF in Escherichia coli has not been successful, since three disulfide bonds in monomer hEGF made it unable to fold into correct 3D structure using in vivo system. To tackle this problem, we fused Mxe GyrA intein (Mxe at the C-terminal of hEGF followed by small ubiquitin-related modifier (SUMO and 10x His-tag to construct a chimeric protein hEGF-Mxe-SUMO-H10. The fusion protein was highly expressed at the concentration of 281 mg/L and up to 59.5% of the total cellular soluble proteins. The fusion protein was purified by affinity chromatography and 29.4 mg/L of native hEGF can be released by thiol induced N-terminal cleavage without any proteases. The mitotic activity in Balb/c 3T3 cells is proliferated by commercial and recombinant hEGF measured with methylthiazolyldiphenyl-tetrazolium bromide (MTT assay which indicated that recombinant hEGF protein stimulates the cell proliferation similar to commercial protein. This study significantly improved the yield and reduced the cost of hEGF in the recombinant E. coli system and could be a better strategy to produce native hEGF for pharmaceutical development.

  15. High Efficient Expression, Purification, and Functional Characterization of Native Human Epidermal Growth Factor in Escherichia coli. (United States)

    Ma, Yi; Yu, Jieying; Lin, Jinglian; Wu, Shaomin; Li, Shan; Wang, Jufang


    Human epidermal growth factor (hEGF) is a small, mitotic growth polypeptide that promotes the proliferation of various cells and is widely applied in clinical practices. However, high efficient expression of native hEGF in Escherichia coli has not been successful, since three disulfide bonds in monomer hEGF made it unable to fold into correct 3D structure using in vivo system. To tackle this problem, we fused Mxe GyrA intein (Mxe) at the C-terminal of hEGF followed by small ubiquitin-related modifier (SUMO) and 10x His-tag to construct a chimeric protein hEGF-Mxe-SUMO-H 10 . The fusion protein was highly expressed at the concentration of 281 mg/L and up to 59.5% of the total cellular soluble proteins. The fusion protein was purified by affinity chromatography and 29.4 mg/L of native hEGF can be released by thiol induced N-terminal cleavage without any proteases. The mitotic activity in Balb/c 3T3 cells is proliferated by commercial and recombinant hEGF measured with methylthiazolyldiphenyl-tetrazolium bromide (MTT) assay which indicated that recombinant hEGF protein stimulates the cell proliferation similar to commercial protein. This study significantly improved the yield and reduced the cost of hEGF in the recombinant E. coli system and could be a better strategy to produce native hEGF for pharmaceutical development.

  16. Human epidermal growth factor receptor2 expression in unresectable gastric cancers: Relationship with CT characteristics

    International Nuclear Information System (INIS)

    Lee, Jeong Sub; Kim, Se Hyung; Im, Seock Ah; Kim, Min A; Han, Joon Koo


    To retrospectively analyze the qualitative CT features that correlate with human epidermal growth factor receptor 2 (HER2)-expression in pathologically-proven gastric cancers. A total of 181 patients with pathologically-proven unresectable gastric cancers with HER2-expression (HER2-positive [n = 32] and negative [n = 149]) were included. CT features of primary gastric and metastatic tumors were reviewed. The prevalence of each CT finding was compared in both groups. Thereafter, binary logistic regression determined the most significant differential CT features. Clinical outcomes were compared using Kaplan-Meier method. HER2-postive cancers showed lower clinical T stage (21.9% vs. 8.1%; p = 0.015), hyperattenuation on portal phase (62.5% vs. 30.9%; p = 0.003), and was more frequently metastasized to the liver (62.5% vs. 32.2%; p = 0.001), than HER2-negative cancers. On binary regression analysis, hyperattenuation of the tumor (odds ratio [OR], 4.68; p < 0.001) and hepatic metastasis (OR, 4.43; p = 0.001) were significant independent factors that predict HER2-positive cancers. Median survival of HER2-positive cancers (13.7 months) was significantly longer than HER2-negative cancers (9.6 months) (p = 0.035). HER2-positive gastric cancers show less-advanced T stage, hyperattenuation on the portal phase, and frequently metastasize to the liver, as compared to HER2-negative cancers

  17. Brain metastasis in human epidermal growth factor receptor 2-positive breast cancer: from biology to treatment

    Energy Technology Data Exchange (ETDEWEB)

    Koo, Tae Ryool [Dept. of Radiation Oncology, Hallym University Chuncheon Sacred Heart Hospital, Chuncheon (Korea, Republic of); Kim, In Ah [Dept. of Radiation Oncology, Seoul National University Bundang Hospital, Seongnam (Korea, Republic of)


    Overexpression of human epidermal growth factor receptor 2 (HER2) is found in about 20% of breast cancer patients. With treatment using trastuzumab, an anti-HER2 monoclonal antibody, systemic control is improved. Nonetheless, the incidence of brain metastasis does not be improved, rather seems to be increased in HER2-positive breast cancer. The mainstay treatment for brain metastases is radiotherapy. According to the number of metastatic lesions and performance status of patients, radiosurgery or whole brain radiotherapy can be performed. The concurrent use of a radiosensitizer further improves intracranial control. Due to its large molecular weight, trastuzumab has a limited ability to cross the blood-brain barrier. However, small tyrosine kinase inhibitors such as lapatinib, has been noted to be a promising agent that can be used as a radiosensitizer to affect HER2-positive breast cancer. This review will outline general management of brain metastases and will focus on preclinical findings regarding the radiosensitizing effect of small molecule HER2 targeting agents.

  18. The effect of wound dressings on a bio-engineered human dermo-epidermal skin substitute in a rat model


    Hüging, Martina; Biedermann, Thomas; Sobrio, Monia; Meyer, Sarah; Böttcher-Haberzeth, Sophie; Manuel, Edith; Horst, Maya; Hynes, Sally; Reichmann, Ernst; Schiestl, Clemens; Hartmann-Fritsch, Fabienne


    Autologous bio-engineered dermo-epidermal skin substitutes are a promising treatment for large skin defects such as burns. For their successful clinical application, the graft dressing must protect and support the keratinocyte layer and, in many cases, possess antimicrobial properties. However, silver in many antimicrobial dressings may inhibit keratinocyte growth and differentiation. The purpose of our study is to evaluate the effect of various wound dressings on the healing of a human hydro...

  19. Chemical allergens stimulate human epidermal keratinocytes to produce lymphangiogenic vascular endothelial growth factor

    Energy Technology Data Exchange (ETDEWEB)

    Bae, Ok-Nam [College of Pharmacy, Institute of Pharmaceutical Science and Technology, Hanyang University, Ansan 426-791 (Korea, Republic of); Ahn, Seyeon; Jin, Sun Hee; Hong, Soo Hyun; Lee, Jinyoung [College of Pharmacy, Natural Products Research Institute, Seoul National University, Seoul 151-742 (Korea, Republic of); Kim, Eun-Sun [College of Pharmacy, Institute of Pharmaceutical Science and Technology, Hanyang University, Ansan 426-791 (Korea, Republic of); Jeong, Tae Cheon [College of Pharmacy, Yeungnam University, Gyeongsan 712-749 (Korea, Republic of); Chun, Young-Jin [College of Pharmacy, Chung-Ang University, Seoul 156-756 (Korea, Republic of); Lee, Ai-Young, E-mail: [Department of Dermatology, Dongguk University Ilsan Hospital, Goyang 410-773 (Korea, Republic of); Noh, Minsoo, E-mail: [College of Pharmacy, Natural Products Research Institute, Seoul National University, Seoul 151-742 (Korea, Republic of)


    Allergic contact dermatitis (ACD) is a cell-mediated immune response that involves skin sensitization in response to contact with various allergens. Angiogenesis and lymphangiogenesis both play roles in the allergic sensitization process. Epidermal keratinocytes can produce vascular endothelial growth factor (VEGF) in response to UV irradiation and during wound healing. However, the effect of haptenic chemical allergens on the VEGF production of human keratinocytes, which is the primary contact site of toxic allergens, has not been thoroughly researched. We systematically investigated whether immune-regulatory cytokines and chemical allergens would lead to the production of VEGF in normal human keratinocytes (NHKs) in culture. VEGF production significantly increased when NHKs were treated with IFNγ, IL-1α, IL-4, IL-6, IL-17A, IL-22 or TNFα. Among the human sensitizers listed in the OECD Test Guideline (TG) 429, we found that CMI/MI, DNCB, 4-phenylenediamine, cobalt chloride, 2-mercaptobenzothiazole, citral, HCA, cinnamic alcohol, imidazolidinyl urea and nickel chloride all significantly upregulated VEGF production in NHKs. In addition, common human haptenic allergens such as avobenzone, formaldehyde and urushiol, also induced the keratinocyte-derived VEGF production. VEGF upregulation by pro-inflammatory stimuli, IFNγ, DNCB or formaldehyde is preceded by the production of IL-8, an acute inflammatory phase cytokine. Lymphangiogenic VEGF-C gene transcription was significantly increased when NHKs were treated with formaldehyde, DNCB or urushiol, while transcription of VEGF-A and VEGF-B did not change. Therefore, the chemical allergen-induced VEGF upregulation is mainly due to the increase in lymphangiogenic VEGF-C transcription in NHKs. These results suggest that keratinocyte-derived VEGF may regulate the lymphangiogenic process during the skin sensitization process of ACD. - Highlights: • Pro-inflammatory cytokines induced VEGF production in normal human

  20. Chemical allergens stimulate human epidermal keratinocytes to produce lymphangiogenic vascular endothelial growth factor

    International Nuclear Information System (INIS)

    Bae, Ok-Nam; Ahn, Seyeon; Jin, Sun Hee; Hong, Soo Hyun; Lee, Jinyoung; Kim, Eun-Sun; Jeong, Tae Cheon; Chun, Young-Jin; Lee, Ai-Young; Noh, Minsoo


    Allergic contact dermatitis (ACD) is a cell-mediated immune response that involves skin sensitization in response to contact with various allergens. Angiogenesis and lymphangiogenesis both play roles in the allergic sensitization process. Epidermal keratinocytes can produce vascular endothelial growth factor (VEGF) in response to UV irradiation and during wound healing. However, the effect of haptenic chemical allergens on the VEGF production of human keratinocytes, which is the primary contact site of toxic allergens, has not been thoroughly researched. We systematically investigated whether immune-regulatory cytokines and chemical allergens would lead to the production of VEGF in normal human keratinocytes (NHKs) in culture. VEGF production significantly increased when NHKs were treated with IFNγ, IL-1α, IL-4, IL-6, IL-17A, IL-22 or TNFα. Among the human sensitizers listed in the OECD Test Guideline (TG) 429, we found that CMI/MI, DNCB, 4-phenylenediamine, cobalt chloride, 2-mercaptobenzothiazole, citral, HCA, cinnamic alcohol, imidazolidinyl urea and nickel chloride all significantly upregulated VEGF production in NHKs. In addition, common human haptenic allergens such as avobenzone, formaldehyde and urushiol, also induced the keratinocyte-derived VEGF production. VEGF upregulation by pro-inflammatory stimuli, IFNγ, DNCB or formaldehyde is preceded by the production of IL-8, an acute inflammatory phase cytokine. Lymphangiogenic VEGF-C gene transcription was significantly increased when NHKs were treated with formaldehyde, DNCB or urushiol, while transcription of VEGF-A and VEGF-B did not change. Therefore, the chemical allergen-induced VEGF upregulation is mainly due to the increase in lymphangiogenic VEGF-C transcription in NHKs. These results suggest that keratinocyte-derived VEGF may regulate the lymphangiogenic process during the skin sensitization process of ACD. - Highlights: • Pro-inflammatory cytokines induced VEGF production in normal human

  1. H{sup +}/peptide transporter (PEPT2) is expressed in human epidermal keratinocytes and is involved in skin oligopeptide transport

    Energy Technology Data Exchange (ETDEWEB)

    Kudo, Michiko; Katayoshi, Takeshi; Kobayashi-Nakamura, Kumiko [DHC Corporation Laboratories, Division 2, 2-42 Hamada, Mihama-ku, Chiba 261-0025 (Japan); Akagawa, Mitsugu [Department of Biological Chemistry, Division of Applied Life Science, Graduate School of Life and Environmental Sciences, Osaka Prefecture University, 1-1 Gakuen-cho, Naka-ku, Sakai 599-8531 (Japan); Tsuji-Naito, Kentaro, E-mail: [DHC Corporation Laboratories, Division 2, 2-42 Hamada, Mihama-ku, Chiba 261-0025 (Japan)


    Peptide transporter 2 (PEPT2) is a member of the proton-coupled oligopeptide transporter family, which mediates the cellular uptake of oligopeptides and peptide-like drugs. Although PEPT2 is expressed in many tissues, its expression in epidermal keratinocytes remains unclear. We investigated PEPT2 expression profile and functional activity in keratinocytes. We confirmed PEPT2 mRNA expression in three keratinocyte lines (normal human epidermal keratinocytes (NHEKs), immortalized keratinocytes, and malignant keratinocytes) by reverse transcription-polymerase chain reaction (RT-PCR) and quantitative real-time RT-PCR. In contrast to PEPT1, PEPT2 expression in the three keratinocytes was similar or higher than that in HepG2 cells, used as PEPT2-positive cells. Immunolocalization analysis using human skin showed epidermal PEPT2 localization. We studied keratinocyte transport function by measuring the oligopeptide content using liquid chromatography/tandem mass spectrometry. Glycylsarcosine uptake in NHEKs was pH-dependent, suggesting that keratinocytes could absorb small peptides in the presence of an inward H{sup +} gradient. We also performed a skin-permeability test of several oligopeptides using skin substitute, suggesting that di- and tripeptides pass actively through the epidermis. In conclusion, PEPT2 is expressed in keratinocytes and involved in skin oligopeptide uptake. -- Highlights: •PEPT2 is expressed in keratinocytes, which are more common than other skin cells. •Immunolocalization analysis using human skin revealed epidermal PEPT2 localization. •Keratinocytes could absorb small peptides in the presence of an inward H{sup +} gradient. •Di- and tripeptide pass actively through the epidermis.

  2. Dynamic changes in nicotinamide pyridine dinucleotide content in normal human epidermal keratinocytes and their effect on retinoic acid biosynthesis

    International Nuclear Information System (INIS)

    Pinkas-Sarafova, Adriana; Markova, N.G.; Simon, M.


    The function of many enzymes that regulate metabolism and transcription depends critically on the nicotinamide pyridine dinucleotides. To understand the role of NAD(P)(H) in physiology and pathophysiology, it is imperative to estimate both their amount and ratios in a given cell type. In human epidermis and in cultured epidermal keratinocytes, we found that the total dinucleotide content is in the low millimolar range. The dinucleotide pattern changes during proliferation and maturation of keratinocytes in culture. Differences in the concentrations of NAD(P)(H) of 1.5- to 12-fold were observed. This resulted in alteration of the NAD(P)H/NAD(P) ratio, which could impact the differential regulation of both transcriptional and metabolic processes. In support of this notion, we provide evidence that the two-step oxidation of retinol to retinoic acid, a nuclear hormone critical for epidermal homeostasis, can be regulated by the relative physiological amounts of the pyridine dinucleotides

  3. Radiolabeled pertuzumab for imaging of human epidermal growth factor receptor 2 expression in ovarian cancer

    Energy Technology Data Exchange (ETDEWEB)

    Jiang, Dawei [Shenzhen University, Guangdong Key Laboratory for Biomedical Measurements and Ultrasound Imaging, School of Biomedical Engineering, Shenzhen (China); University of Wisconsin - Madison, Department of Radiology, Madison, WI (United States); Im, Hyung-Jun [University of Wisconsin - Madison, Department of Radiology, Madison, WI (United States); Seoul National University, Graduate School of Convergence Science and Technology, Seoul (Korea, Republic of); Sun, Haiyan; Cho, Steve Y. [University of Wisconsin - Madison, Department of Radiology, Madison, WI (United States); Valdovinos, Hector F.; England, Christopher G.; Ehlerding, Emily B.; Nickles, Robert J. [University of Wisconsin - Madison, Department of Medical Physics, Madison, WI (United States); Lee, Dong Soo [Seoul National University, Graduate School of Convergence Science and Technology, Seoul (Korea, Republic of); Huang, Peng [Shenzhen University, Guangdong Key Laboratory for Biomedical Measurements and Ultrasound Imaging, School of Biomedical Engineering, Shenzhen (China); Cai, Weibo [University of Wisconsin - Madison, Department of Radiology, Madison, WI (United States); University of Wisconsin - Madison, Department of Medical Physics, Madison, WI (United States); University of Wisconsin Carbone Cancer Center, Madison, WI (United States)


    Human epidermal growth factor receptor 2 (HER2) is over-expressed in over 30% of ovarian cancer cases, playing an essential role in tumorigenesis and metastasis. Non-invasive imaging of HER2 is of great interest for physicians as a mean to better detect and monitor the progression of ovarian cancer. In this study, HER2 was assessed as a biomarker for ovarian cancer imaging using {sup 64}Cu-labeled pertuzumab for immunoPET imaging. HER2 expression and binding were examined in three ovarian cancer cell lines (SKOV3, OVCAR3, Caov3) using in vitro techniques, including western blot and saturation binding assays. PET imaging and biodistribution studies in subcutaneous models of ovarian cancer were performed for non-invasive in vivo evaluation of HER2 expression. Additionally, orthotopic models were employed to further validate the imaging capability of {sup 64}Cu-NOTA-pertuzumab. HER2 expression was highest in SKOV3 cells, while OVCAR3 and Caov3 displayed lower HER2 expression. {sup 64}Cu-NOTA-pertuzumab showed high specificity for HER2 (K{sub a} = 3.1 ± 0.6 nM) in SKOV3. In subcutaneous tumors, PET imaging revealed tumor uptake of 41.8 ± 3.8, 10.5 ± 3.9, and 12.1 ± 2.3%ID/g at 48 h post-injection for SKOV3, OVCAR3, and Caov3, respectively (n = 3). In orthotopic models, PET imaging with {sup 64}Cu-NOTA-pertuzumab allowed for rapid and clear delineation of both primary and small peritoneal metastases in HER2-expressing ovarian cancer. {sup 64}Cu-NOTA-pertuzumab is an effective PET tracer for the non-invasive imaging of HER2 expression in vivo, rendering it a potential tracer for treatment monitoring and improved patient stratification. (orig.)

  4. Correlation of human epidermal growth factor receptor protein expression and colorectal cancer. (United States)

    Yang, Wen-Juan; Shen, Xing-Jie; Ma, Xiao-Xia; Tan, Zhi-Gang; Song, Yan; Guo, Yi-Tong; Yuan, Mei


    To investigate the correlation between human epidermal growth factor receptor (HER-2) protein expression and colorectal cancer (CRC) using a case-control study and meta-analysis. Tumor tissue specimens from 162 CRC patients were selected for the case group. Fifty cases were randomly selected, and normal CRC tissue at least 10 cm away from the tumor margins of these cases was used to generate the control group. The expression of the HER-2 protein in the 162 CRC tissue samples and the 50 adjacent normal mucosa tissue samples was detected via immunohistochemistry. The experimental data were analyzed using SPSS 18.0 software, and R software version 3.1.0 was utilized for further verification. The expression of HER-2 protein in the 162 CRC tissue samples was significantly higher than in the normal tissue specimens. The data showed that the expression of HER-2 in CRC was related to the Dukes' stage, the depth of invasion and lymph node metastasis. The HER-2-positive patients had lower 3- and 5-year OS rates than the HER-2-negative patients, but there was no significant difference. However, there was a statistically significant difference in the 3- and 5-year disease-free survival (DFS) rates of HER-2-positive and HER-2-negative patients. The results of the meta-analysis showed that the expression of HER-2 in CRC patients was statistically significantly increased over that of healthy people. The 3-year DFS rate in HER-2-positive patients was markedly lower than that in HER-2-negative patients. Down-regulation of HER-2 expression might be a dependable strategy for CRC therapy.

  5. Pattern of distribution of blood group antigens on human epidermal cells during maturation

    DEFF Research Database (Denmark)

    Dabelsteen, Erik; Buschard, Karsten; Hakomori, Sen-Itiroh


    The distribution in human epidermis of A, B, and H blood group antigens and of a precursor carbohydrate chain, N-acetyl-lactosamine, was examined using immunofluorescence staining techniques. The material included tissue from 10 blood group A, 4 blood group B, and 9 blood group O persons. Murine...... on the lower spinous cells whereas H antigen was seen predominantly on upper spinous cells or on the granular cells. Epithelia from blood group A or B persons demonstrated A or B antigens, respectively, but only if the tissue sections were trypsinized before staining. In such cases A or B antigens were found...... monoclonal antibodies were used to identify H antigen (type 2 chain) and N-acetyl-lactosamine. Human antisera were used to identify A and B antigens. In all groups N-acetyl-lactosamine and H antigen were found on the cell membranes of the spinous cell layer. N-acetyl-lactosamine was present mainly...

  6. Cellular processes involved in human epidermal cells exposed to extremely low frequency electric fields. (United States)

    Collard, J-F; Hinsenkamp, M


    We observed on different tissues and organisms a biological response after exposure to pulsed low frequency and low amplitude electric or electromagnetic fields but the precise mechanism of cell response remains unknown. The aim of this publication is to understand, using bioinformatics, the biological relevance of processes involved in the modification of gene expression. The list of genes analyzed was obtained after microarray protocol realized on cultures of human epidermal explants growing on deepidermized human skin exposed to a pulsed low frequency electric field. The directed acyclic graph on a WebGestalt Gene Ontology module shows six categories under the biological process root: "biological regulation", "cellular process", "cell proliferation", "death", "metabolic process" and "response to stimulus". Enriched derived categories are coherent with the type of in vitro culture, the stimulation protocol or with the previous results showing a decrease of cell proliferation and an increase of differentiation. The Kegg module on WebGestalt has highlighted "cell cycle" and "p53 signaling pathway" as significantly involved. The Kegg website brings out interactions between FoxO, MAPK, JNK, p53, p38, PI3K/Akt, Wnt, mTor or NF-KappaB. Some genes expressed by the stimulation are known to have an exclusive function on these pathways. Analyses performed with Pathway Studio linked cell proliferation, cell differentiation, apoptosis, cell cycle, mitosis, cell death etc. with our microarrays results. Medline citation generated by the software and the fold change variation confirms a diminution of the proliferation, activation of the differentiation and a less well-defined role of apoptosis or wound healing. Wnt and DKK functional classes, DKK1, MACF1, ATF3, MME, TXNRD1, and BMP-2 genes proposed in previous publications after a manual analysis are also highlighted with other genes after Pathway Studio automatic procedure. Finally, an analysis conducted on a list of genes

  7. In vivo UVB irradiation induces clustering of Fas (CD95) on human epidermal cells

    DEFF Research Database (Denmark)

    Bang, Bo; Gniadecki, Robert; Larsen, Jørgen K


    a single dose of UVB irradiation. Normal healthy individuals were irradiated with three minimal erythema doses (MED) of UVB on forearm or buttock skin. Suction blisters from unirradiated and irradiated skin were raised, and Fas, FasL, and apoptosis of epidermal cells quantified by flow cytometry...

  8. Triggering Apoptotic Death of Human Epidermal Keratinocytes by Malic Acid: Involvement of Endoplasmic Reticulum Stress- and Mitochondria-Dependent Signaling Pathways

    Directory of Open Access Journals (Sweden)

    Yu-Ping Hsiao


    Full Text Available Malic acid (MA has been commonly used in cosmetic products, but the safety reports in skin are sparse. To investigate the biological effects of MA in human skin keratinocytes, we investigated the potential cytotoxicity and apoptotic effects of MA in human keratinocyte cell lines (HaCaT. The data showed that MA induced apoptosis based on the observations of DAPI staining, DNA fragmentation, and sub-G1 phase in HaCaT cells and normal human epidermal keratinocytes (NHEKs. Flow cytometric assays also showed that MA increased the production of mitochondrial superoxide (mito-SOX but decreased the mitochondrial membrane potential. Analysis of bioenergetics function with the XF 24 analyzer Seahorse extracellular flux analyzer demonstrated that oxygen consumption rate (OCR was significantly decreased whereas extracellular acidification rate (ECAR was increased in MA-treated keratinocytes. The occurrence of apoptosis was proved by the increased expressions of FasL, Fas, Bax, Bid, caspases-3, -8, -9, cytochrome c, and the declined expressions of Bcl-2, PARP. MA also induced endoplasmic reticulum stress associated protein expression such as GRP78, GADD153, and ATF6α. We demonstrated that MA had anti-proliferative effect in HaCaT cell through the inhibition of cell cycle progression at G0/G1, and the induction of programmed cell death through endoplasmic reticulum stress- and mitochondria-dependent pathways.

  9. Differences in human skin between the epidermal growth factor receptor distribution detected by EGF binding and monoclonal antibody recognition

    DEFF Research Database (Denmark)

    Green, M R; Couchman, J R


    , the eccrine sweat glands, capillary system, and the hair follicle outer root sheath, generally similar in pattern to that previously reported for full-thickness rat skin and human epidermis. The same areas also bound EGF-R1 but in addition the monoclonal antibody recognized a cone of melanin containing......Two methods have been used to examine epidermal growth factor (EGF) receptor distribution in human scalp and foreskin. The first employed [125I]EGF viable explants and autoradiography to determine the EGF binding pattern while the second used a monoclonal antibody to the human EGF receptor to map...... whether EGF-R1 could recognize molecules unrelated to the EGF receptor, the EGF binding and EGF-R1 recognition profiles were compared on cultures of SVK14 cells, a SV40 transformed human keratinocyte cell line. EGF binding and EGF-R1 monoclonal antibody distribution on these cells was found to be similar...

  10. Repair of ultraviolet light damage to the DNA of cultured human epidermal keratinocytes and fibroblasts

    International Nuclear Information System (INIS)

    Taichman, L.B.; Setlow, R.B.


    Pure cultures of dermal fibroblasts and epidermal keroatinocytes have been obtained from a single biopsy of newborn foreskin. The cells were labeled, exposed to several doses of uv light, and allowed to repair in the dark for 16 h. The number of pyrimidine dimers before and after repair was assessed by measuring the numbers of sites in the DNA sensitive to a specific uv endonuclease. At all doses used, the extent of repair was similar in the cultured keratinocytes and cultured fibroblasts

  11. Repeated short climatic change affects the epidermal differentiation program and leads to matrix remodeling in a human organotypic skin model. (United States)

    Boutrand, Laetitia-Barbollat; Thépot, Amélie; Muther, Charlotte; Boher, Aurélie; Robic, Julie; Guéré, Christelle; Vié, Katell; Damour, Odile; Lamartine, Jérôme


    Human skin is subject to frequent changes in ambient temperature and humidity and needs to cope with these environmental modifications. To decipher the molecular response of human skin to repeated climatic change, a versatile model of skin equivalent subject to "hot-wet" (40°C, 80% relative humidity [RH]) or "cold-dry" (10°C, 40% RH) climatic stress repeated daily was used. To obtain an exhaustive view of the molecular mechanisms elicited by climatic change, large-scale gene expression DNA microarray analysis was performed and modulated function was determined by bioinformatic annotation. This analysis revealed several functions, including epidermal differentiation and extracellular matrix, impacted by repeated variations in climatic conditions. Some of these molecular changes were confirmed by histological examination and protein expression. Both treatments (hot-wet and cold-dry) reduced the expression of genes encoding collagens, laminin, and proteoglycans, suggesting a profound remodeling of the extracellular matrix. Strong induction of the entire family of late cornified envelope genes after cold-dry exposure, confirmed at protein level, was also observed. These changes correlated with an increase in epidermal differentiation markers such as corneodesmosin and a thickening of the stratum corneum, indicating possible implementation of defense mechanisms against dehydration. This study for the first time reveals the complex pattern of molecular response allowing adaption of human skin to repeated change in its climatic environment.

  12. A nomogram for predicting pathological complete response in patients with human epidermal growth factor receptor 2 negative breast cancer

    International Nuclear Information System (INIS)

    Jin, Xi; Jiang, Yi-Zhou; Chen, Sheng; Yu, Ke-Da; Ma, Ding; Sun, Wei; Shao, Zhi-Min; Di, Gen-Hong


    The response to neoadjuvant chemotherapy has been proven to predict long-term clinical benefits for patients. Our research is to construct a nomogram to predict pathological complete response of human epidermal growth factor receptor 2 negative breast cancer patients. We enrolled 815 patients who received neoadjuvant chemotherapy from 2003 to 2015 and divided them into a training set and a validation set. Univariate logistic regression was performed to screen for predictors and construct the nomogram; multivariate logistic regression was performed to identify independent predictors. After performing the univariate logistic regression analysis in the training set, tumor size, hormone receptor status, regimens of neoadjuvant chemotherapy and cycles of neoadjuvant chemotherapy were the final predictors for the construction of the nomogram. The multivariate logistic regression analysis demonstrated that T4 status, hormone receptor status and receiving regimen of paclitaxel and carboplatin were independent predictors of pathological complete response. The area under the receiver operating characteristic curve of the training set and the validation set was 0.779 and 0.701, respectively. We constructed and validated a nomogram to predict pathological complete response in human epidermal growth factor receptor 2 negative breast cancer patients. We also identified tumor size, hormone receptor status and paclitaxel and carboplatin regimen as independent predictors of pathological complete response. The online version of this article (doi:10.1186/s12885-016-2652-z) contains supplementary material, which is available to authorized users

  13. A Premature Termination of Human Epidermal Growth Factor Receptor Transcription in Escherichia coli

    Directory of Open Access Journals (Sweden)

    Jihene Elloumi-Mseddi


    Full Text Available Our success in producing an active epidermal growth factor receptor (EGFR tyrosine kinase in Escherichia coli encouraged us to express the full-length receptor in the same host. Despite its large size, we were successful at producing the full-length EGFR protein fused to glutathione S-transferase (GST that was detected by Western blot analysis. Moreover, we obtained a majoritarian truncated GST-EGFR form detectable by gel electrophoresis and Western blot. This truncated protein was purified and confirmed by MALDI-TOF/TOF analysis to belong to the N-terminal extracellular region of the EGFR fused to GST. Northern blot analysis showed two transcripts suggesting the occurrence of a transcriptional arrest.

  14. Phase III randomized study comparing docetaxel plus trastuzumab with vinorelbine plus trastuzumab as first-line therapy of metastatic or locally advanced human epidermal growth factor receptor 2-positive breast cancer: the HERNATA study

    DEFF Research Database (Denmark)

    Andersson, Michael; Lidbrink, Elisabeth; Bjerre, Karsten


    To evaluate docetaxel or vinorelbine, both with trastuzumab, as first-line therapy of human epidermal growth factor receptor 2-positive advanced breast cancer.......To evaluate docetaxel or vinorelbine, both with trastuzumab, as first-line therapy of human epidermal growth factor receptor 2-positive advanced breast cancer....

  15. Nuclear accumulation of epidermal growth factor receptor and acceleration of G1/S stage by Epstein-Barr-encoded oncoprotein latent membrane protein 1

    International Nuclear Information System (INIS)

    Tao Yongguang; Song Xing; Deng Xiyun; Xie Daxin; Lee, Leo M.; Liu Yiping; Li Wei; Li Lili; Deng Lin; Wu Qiao; Gong Jianping; Cao Ya


    Epstein-Barr virus (EBV)-encoded latent membrane protein 1 (LMP1) is considered to be the major oncogenic protein of EBV-encoded proteins and has always been the core of the oncogenic mechanism of EBV. Advanced studies on nuclear translocation of the epidermal growth factor receptor (EGFR) family have greatly improved our knowledge of the biological function of cell surface receptors. In this study, we used the Tet-on LMP1 HNE2 cell line as a cell model, which is a dual-stable LMP1-integrated nasopharyngeal carcinoma (NPC) cell line and the expression of LMP1 which could be regulated by the Tet system. We found that LMP1 could regulate the nuclear accumulation of EGFR in a dose-dependent manner quantitatively and qualitatively. We also demonstrated that the nuclear localization sequence of EGFR played some roles in the location of the protein within the nucleus under LMP1 regulation and EGFR in the nucleus could bind to the promoters of cyclinD1 and cyclinE, respectively. We further demonstrated that EGFR is involved in the acceleration of the G1/S phase transition by LMP1 through binding to cyclinD1 and cyclinE directly. These findings provided a novel view that the acceleration of LMP1 on the G1/S transition via the nuclear accumulation of EGFR was critical in the process of nasopharyngeal carcinoma

  16. Epidermal growth factor receptor antibody plus recombinant human endostatin in treatment of hepatic metastases after remnant gastric cancer resection

    Institute of Scientific and Technical Information of China (English)


    We report a 55-year-old male who developed advanced hepatic metastasis and peritoneal carcinomatosis after resection of remnant gastric cancer resection 3 mo ago. The patient only received epidermal growth factor (EGF) receptor antibody (Cetuximab) plus recombinant human endostatin (Endostar).Anti-tumor activity was assessed by 18F-fluorodeoxyglucose (18F-FDG)positron emission tomography/computer tomography (PET/CT) at baseline and then every 4 wk. The case illustrates that 18FDG-PET/CT could make an early prediction of the response to Cetuximab plus Endostar in such clinical situations. 18FDG-PET/CT is a useful molecular imaging modality to evaluate the biological response advanced hepatic metastasis and peritoneal carcinomatosis to Cetuximab plus Endostar in patients after remnant gastric cancer resection.

  17. Direct astatination of a tumour-binding protein, human epidermal growth factor, using nido-carborane as a prosthetic group

    International Nuclear Information System (INIS)

    Sjoestroem, A.; Carlsson, J.; Lundqvist, H.; Koziorowski, J.


    A method for direct astatine labeling of proteins has been investigated. Binding sites for astatine were created by coupling of a nido-carborane derivative to a protein, the human epidermal growth factor (hEGF), using two different conjugation methods - by glutaraldehyde cross-linking or by introduction of sulfohydryl groups by Traut's reagent with subsequent linking of ANC-1 with m-maleimidobenzoyl-N-hydroxysulfosuccinimide ester. The conjugates were astatinated using the Chloramine-T method in high yield. The best labeling was obtained by the glutaraldehyde conjugate with an average yield of 68 ± 9%. In vitro stability tests indicated that the glutaraldehyde conjugated label was as stable as hEGF labeled with astatobenzoate. (author)

  18. Harnessing Integrative Omics to Facilitate Molecular Imaging of the Human Epidermal Growth Factor Receptor Family for Precision Medicine. (United States)

    Pool, Martin; de Boer, H Rudolf; Hooge, Marjolijn N Lub-de; van Vugt, Marcel A T M; de Vries, Elisabeth G E


    Cancer is a growing problem worldwide. The cause of death in cancer patients is often due to treatment-resistant metastatic disease. Many molecularly targeted anticancer drugs have been developed against 'oncogenic driver' pathways. However, these treatments are usually only effective in properly selected patients. Resistance to molecularly targeted drugs through selective pressure on acquired mutations or molecular rewiring can hinder their effectiveness. This review summarizes how molecular imaging techniques can potentially facilitate the optimal implementation of targeted agents. Using the human epidermal growth factor receptor (HER) family as a model in (pre)clinical studies, we illustrate how molecular imaging may be employed to characterize whole body target expression as well as monitor drug effectiveness and the emergence of tumor resistance. We further discuss how an integrative omics discovery platform could guide the selection of 'effect sensors' - new molecular imaging targets - which are dynamic markers that indicate treatment effectiveness or resistance.

  19. Thermal analysis of epidermal electronic devices integrated with human skin considering the effects of interfacial thermal resistance (United States)

    Li, Yuhang; Zhang, Jianpeng; Xing, Yufeng; Song, Jizhou


    Epidermal electronic devices (EEDs) have similar mechanical properties as those of human skin such that they can be integrated with human skin for potential applications in monitoring of human vital signs for diagnostic, therapeutic or surgical functions. Thermal management is critical for EEDs in these applications since excessive heating may cause discomfort. Comprehensive analytical studies, finite element analysis and experiments are carried out to study the effects of interfacial thermal resistance between EEDs and human skin on thermal properties of the EED/skin system in this paper. The coupling between the Fourier heat transfer in EEDs and the bio-heat transfer in human skin is accounted in the analytical model based on the transfer matrix method to give accurate predictions on temperatures, which agree well with finite element analysis and experimental measurements. It is shown that the maximum temperature increase of the EED for the case of imperfect bonding between EED and skin is much higher than that of perfect bonding. These results may help the design of EEDs in bi-integrated applications and suggest a valuable route to evaluate the bonding condition between EEDs and biological tissues.

  20. Protein structure of fetal antigen 1 (FA1). A novel circulating human epidermal-growth-factor-like protein expressed in neuroendocrine tumors and its relation to the gene products of dlk and pG2

    DEFF Research Database (Denmark)

    Jensen, Charlotte Harken; Krogh, Thomas N; Højrup, Peter


    The present paper describes the primary structure, glycosylation and tissue localization of fetal antigen 1 (FA1) isolated from second-trimester human amniotic fluid. FA1 is a single-chained, heterogeneous glycoprotein of 225-262 amino acid residues. FA1 has six well conserved epidermal...... extends with minor corrections to the human adrenal-specific mRNA, pG2 as well. Immunohistochemical analysis demonstrated the presence of FA1 in 10 out of 14 lung tumors containing neuroendocrine elements, and in the placental villi where FA1 was exclusively seen in stromal cells in close contact...... to the vascular structure. In the pancreas, FA1 co-localized with insulin in the insulin secretory granules of the beta cells within the islets of Langerhans. Our findings suggest that FA1 is synthesized as a membrane anchored protein and released into the circulation after enzymic cleavage, and that circulating...

  1. American Society of Clinical Oncology/College of American Pathologists guideline recommendations for human epidermal growth factor receptor 2 testing in breast cancer

    NARCIS (Netherlands)

    Wolff, Antonio C.; Hammond, M. Elizabeth H.; Schwartz, Jared N.; Hagerty, Karen L.; Allred, D. Craig; Cote, Richard J.; Dowsett, Mitchell; Fitzgibbons, Patrick L.; Hanna, Wedad M.; Langer, Amy; McShane, Lisa M.; Paik, Soonmyung; Pegram, Mark D.; Perez, Edith A.; Press, Michael F.; Rhodes, Anthony; Sturgeon, Catharine; Taube, Sheila E.; Tubbs, Raymond; Vance, Gail H.; van de Vijver, Marc; Wheeler, Thomas M.; Hayes, Daniel F.


    PURPOSE: To develop a guideline to improve the accuracy of human epidermal growth factor receptor 2 (HER2) testing in invasive breast cancer and its utility as a predictive marker. METHODS: The American Society of Clinical Oncology and the College of American Pathologists convened an expert panel,

  2. Phosphorylation of chloroform soluble compounds in plasma membranes of human epidermoid carcinoma A431 cells

    International Nuclear Information System (INIS)

    Brautigan, D.L.; Randazzo, P.; Shriner, C.; Fain, J.N.


    This study investigated a possible role for the epidermal growth factor (EGF) receptor protein tyrosine kinase in phosphoinositide metabolism with plasma membrane vesicles from human epidermoid carcinoma (A431) cells. The authors found a novel chloroform-soluble product radiolabeled with [gamma- 32 P]ATP that did not migrate from the origin in the thin layer system designed to separate the phosphoinositides, appeared as a single band of Mr = 3500 on polyacrylamide gels in the presence of dodecyl sulfate, had an ultraviolet absorbance spectrum with a maximum at 275 nm and stained with Coomassie dye. Based on these properties this phosphorylation product is referred to as a proteolipid. The 32 P label was not detected in phosphotyrosine [Tyr(P)], phosphoserine [Ser(P)] or phosphothreonine [Thr(P)] and was lost during acid or base hydrolysis. Phosphorylation of proteolipid was increased significantly by EGF, whereas phosphorylation of phosphatidic acid was decreased and labeling of phosphoinositides was unaffected. Thus, it appears that in A431 membranes the EGF receptor/kinase does not utilize phosphatidylinositol as a substrate, but does phosphorylate a membrane proteolipid

  3. Experimental radioimmunotherapy of a xenografted human glioma using [sup 131]I-labeled monoclonal antibody to epidermal growth factor receptor

    Energy Technology Data Exchange (ETDEWEB)

    Takahashi, Hiroshi; Nakazawa, Shozo [Nippon Medical School, Tokyo (Japan); Herlyn, D


    [sup 131]I-labeled F (ab')[sub 2] fragments of murine monoclonal antibodies (MAb) 425 specific to the epidermal growth factor receptor expressed on human gliomas were used in experimental human malignant glioma immunotherapy. Two injections of 150 [mu]Ci [sup 131]I-labeled 425 F(ab')[sub 2] achieved growth inhibition of U-87MG human malignant glioma xenografts in nude mice. This radiolabeled specific MAb F(ab')[sub 2] was significantly superior to radiolabeled fragments of an anti-hepatitis virus control MAb A5C3 in influencing tumor growth. However, similar treatment of established human malignant glioma xenografts did not inhibit progressive tumor growth significantly. No clear tumor inhibition was produced by unlabeled MAb 425F(ab')[sub 2]. These studies suggest that [sup 131]I-labeled MAbs have a significant antitumor effect where unmodified antibody is ineffective. Multiple doses of antibody may achieve an increase in labeled MAb concentration in tumors. (author).

  4. Expression of the epidermal growth factor receptor in human small cell lung cancer cell lines

    DEFF Research Database (Denmark)

    Damstrup, L; Rygaard, K; Spang-Thomsen, M


    of EGF receptor mRNA in all 10 cell lines that were found to be EGF receptor-positive and in one cell line that was found to be EGF receptor-negative in the radioreceptor assay and affinity labeling. Our results provide, for the first time, evidence that a large proportion of a broad panel of small cell......Epidermal growth factor (EGF) receptor expression was evaluated in a panel of 21 small cell lung cancer cell lines with radioreceptor assay, affinity labeling, and Northern blotting. We found high-affinity receptors to be expressed in 10 cell lines. Scatchard analysis of the binding data...... demonstrated that the cells bound between 3 and 52 fmol/mg protein with a KD ranging from 0.5 x 10(-10) to 2.7 x 10(-10) M. EGF binding to the receptor was confirmed by affinity-labeling EGF to the EGF receptor. The cross-linked complex had a M(r) of 170,000-180,000. Northern blotting showed the expression...

  5. Rho A Regulates Epidermal Growth Factor-Induced Human Osteosarcoma MG63 Cell Migration

    Directory of Open Access Journals (Sweden)

    Jinyang Wang


    Full Text Available Osteosarcoma, the most common primary bone tumor, occurs most frequently in children and adolescents and has a 5-year survival rate, which is unsatisfactory. As epidermal growth factor receptor (EGFR positively correlates with TNM (tumor-node-metastasis stage in osteosarcoma, EGFR may play an important role in its progression. The purpose of this study was to explore potential mechanisms underlying this correlation. We found that EGF promotes MG63 cell migration and invasion as well as stress fiber formation via Rho A activation and that these effects can be reversed by inhibiting Rho A expression. In addition, molecules downstream of Rho A, including ROCK1, LIMK2, and Cofilin, are activated by EGF in MG63 cells, leading to actin stress fiber formation and cell migration. Moreover, inhibition of ROCK1, LIMK2, or Cofilin in MG63 cells using known inhibitors or short hairpin RNA (shRNA prevents actin stress fiber formation and cell migration. Thus, we conclude that Rho A/ROCK1/LIMK2/Cofilin signaling mediates actin microfilament formation in MG63 cells upon EGFR activation. This novel pathway provides a promising target for preventing osteosarcoma progression and for treating this cancer.

  6. Niclosamide inhibits epithelial-mesenchymal transition and tumor growth in lapatinib-resistant human epidermal growth factor receptor 2-positive breast cancer. (United States)

    Liu, Junjun; Chen, Xiaosong; Ward, Toby; Mao, Yan; Bockhorn, Jessica; Liu, Xiaofei; Wang, Gen; Pegram, Mark; Shen, Kunwei


    Acquired resistance to lapatinib, a human epidermal growth factor receptor 2 kinase inhibitor, remains a clinical problem for women with human epidermal growth factor receptor 2-positive advanced breast cancer, as metastasis is commonly observed in these patients. Niclosamide, an anti-helminthic agent, has recently been shown to exhibit cytotoxicity to tumor cells with stem-like characteristics. This study was designed to identify the mechanisms underlying lapatinib resistance and to determine whether niclosamide inhibits lapatinib resistance by reversing epithelial-mesenchymal transition. Here, two human epidermal growth factor receptor 2-positive breast cancer cell lines, SKBR3 and BT474, were exposed to increasing concentrations of lapatinib to establish lapatinib-resistant cultures. Lapatinib-resistant SKBR3 and BT474 cells exhibited up-regulation of the phenotypic epithelial-mesenchymal transition markers Snail, vimentin and α-smooth muscle actin, accompanied by activation of nuclear factor-кB and Src and a concomitant increase in stem cell marker expression (CD44(high)/CD24(low)), compared to naive lapatinib-sensitive SKBR3 and BT474 cells, respectively. Interestingly, niclosamide reversed epithelial-mesenchymal transition, induced apoptosis and inhibited cell growth by perturbing aberrant signaling pathway activation in lapatinib-resistant human epidermal growth factor receptor 2-positive cells. The ability of niclosamide to alleviate stem-like phenotype development and invasion was confirmed. Collectively, our results demonstrate that lapatinib resistance correlates with epithelial-mesenchymal transition and that niclosamide inhibits lapatinib-resistant cell viability and epithelial-mesenchymal transition. These findings suggest a role of niclosamide or derivatives optimized for more favorable bioavailability not only in reversing lapatinib resistance but also in reducing metastatic potential during the treatment of human epidermal growth factor receptor

  7. Effects of recombinant human epidermal growth factor (rhEGF) on experimental radiation-induced oral mucositis in rats

    International Nuclear Information System (INIS)

    Jung, Kwon Il; Kim, Sun Hee; Moon, Soo Young; Kim, Yeon Wha; Hong, Joon Pio; Lee, Sang Wook; Kim, Hyun Sook


    Oral mucositis is a common toxicity of radiation or chemotherapy, which is used a treatment for head and neck cancer. We investigated effects of recombinant human epidermal growth factor (rhEGF) on radiation-induced oral mucositis in rat model. Spraque-Dawley rats (7 per group) exposed to a single dose of 25 Gy (day 0) on their head, except for one group, were randomly divided into un-treated, vehicle-treated, and two rhEGF-treated groups. Rats were topically applied with rhEGF (15 or 30 μ g/oral cavity/day) or vehicle to their oral mucosa. Survival rate of rats, weight changes, and food intakes were examined from day 0 to 18 after radiation. Histology study was performed from oral mucosa of rats at day 7 and 18 after radiation. rhEGF-treated groups (15 or 30 μ g/day) showed all survival rate 33%, whereas un-treated and vehicle-treated groups showed all survival rate 0% at the end of experiment. rhEGF-treated groups statistically had less weight loss compared to vehicle-treated group from day 2 to 7 after radiation. Food intake of rats with rhEGF treatment turned to increase at day 14 after radiation. At 7 day after radiation, un-treated and vehicle-treated groups showed severe pseudomembraneous of ulcerative oral mucositis. On the other hand, rhEGF-treated groups had no more than cellular swelling and degeneration of epidermal cells in oral mucosa of rats. These results suggest that rhEGF has significantly positive effects on radiation-induced oral mucositis in rats. rhEGF display a therapeutic potential on a clinical level

  8. Skin Basement Membrane: The Foundation of Epidermal Integrity—BM Functions and Diverse Roles of Bridging Molecules Nidogen and Perlecan

    Directory of Open Access Journals (Sweden)

    Dirk Breitkreutz


    Full Text Available The epidermis functions in skin as first defense line or barrier against environmental impacts, resting on extracellular matrix (ECM of the dermis underneath. Both compartments are connected by the basement membrane (BM, composed of a set of distinct glycoproteins and proteoglycans. Herein we are reviewing molecular aspects of BM structure, composition, and function regarding not only (i the dermoepidermal interface but also (ii the resident microvasculature, primarily focusing on the per se nonscaffold forming components perlecan and nidogen-1 and nidogen-2. Depletion or functional deficiencies of any BM component are lethal at some stage of development or around birth, though BM defects vary between organs and tissues. Lethality problems were overcome by developmental stage- and skin-specific gene targeting or by cell grafting and organotypic (3D cocultures of normal or defective cells, which allows recapitulating BM formation de novo. Thus, evidence is accumulating that BM assembly and turnover rely on mechanical properties and composition of the adjacent ECM and the dynamics of molecular assembly, including further “minor” local components, nidogens largely functioning as catalysts or molecular adaptors and perlecan as bridging stabilizer. Collectively, orchestration of BM assembly, remodeling, and the role of individual players herein are determined by the developmental, tissue-specific, or functional context.

  9. Cytogenetic evaluation of human glial tumors: correlation of overexpression of epidermal growth factor receptor (EGFB) with abnormalities of chromosome 7

    International Nuclear Information System (INIS)

    Bell, C.W.


    Chromosome banding analysis of human glial tumors were performed using G- and Q-banding techniques in an attempt to establish recurring sites of chromosome change. Results revealed a nonrandom karyotypic profile including aneuploidy and considerable variation in chromosome number (range 40 → 200). All tumors examined displayed numerical abnormalities, with the most common numeric change being a gain of chromosome 7. An attempt was then made to correlate the observed chromosome 7 changes with activation of the cellular proto-oncogene c-erb-B, whose produce is the epidermal growth factor receptor (EGFR). Six human glial tumors were analyzed for 125 I-EGF binding, EGFR gene copy number, EGFR gene rearrangement, mRNA expression, and karyotypic profile. Saturation analysis at 4 0 C revealed significant numbers of EGFR's in all 6 tumors. Southern blotting analysis utilizing cDNA probes for the EGFR failed to demonstrate significant amplification or structural rearrangement of the EFGR gene. The results suggest that overexpression of the EGFR may be related to an alternative mechanism, other than gene amplification and elevated mRNA levels, such as the regulation of receptor biosynthesis and degradation. In summary, findings indicate that alterations of chromosome 7 are the most prevalent chromosomal change in human glial tumors, and that these alterations may lead to overexpression of the protooncogene c-erb-B

  10. Assessment of Epidermal Growth Factor Receptor (EGFR expression in human meningioma

    Directory of Open Access Journals (Sweden)

    Perry Arie


    Full Text Available Abstract Purpose This study explores whether meningioma expresses epidermal growth factor receptor (EGFR and determines if there is a correlation between the WHO grade of this tumor and the degree of EGFR expression. Methods Following institutional review board approval, 113 meningioma specimens from 89 patients were chosen. Of these, 85 were used for final analysis. After a blinded review, immunohistochemical stains for EGFR were performed. Staining intensity (SI was scored on a scale 0-3 (from no staining to strong staining. Staining percentage of immunoreactive cells (SP was scored 1-5 (from the least to the maximum percent of the specimen staining. Immunohistochemical score (IHS was calculated as the product of SI and SP. Results Eighty-five samples of meningioma were classified in accordance with World Health Organization (WHO criteria: benign 57/85 (67%, atypical 23/85 (27%, and malignant 5/85 (6%. The majority of samples demonstrated a moderate SI for EGFR. IHS for EGFR demonstrated a significant association between SI and histopathologic subtype. Also, there was a correlation between the SP and histopathologic subtype (p = 0.029. A significant association was determined when the benign and the atypical samples were compared to the malignant with respect to the SP (p = 0.009. While there was a range of the IHS for the benign and the atypical histologic subtypes, malignant tumors exhibited the lowest score and were statistically different from the benign and the atypical specimens (p Conclusions To our knowledge, this represents the largest series of meningioma samples analyzed for EGFR expression reported in the literature. EGFR expression is greatest in benign meningiomas and may serve a potential target for therapeutic intervention with selective EGFR inhibitors.

  11. Membrane transport of anandamide through resealed human red blood cell membranes

    DEFF Research Database (Denmark)

    Bojesen, I.N.; Hansen, Harald S.


    The use of resealed red blood cell membranes (ghosts) allows the study of the transport of a compound in a nonmetabolizing system with a biological membrane. Transmembrane movements of anandamide (N-arachidonoylethanolamine, arachidonoylethanolamide) have been studied by exchange efflux experiments...... at 0°C and pH 7.3 with albumin-free and albumin-filled human red blood cell ghosts. The efflux kinetics is biexponential and is analyzed in terms of compartment models. The distribution of anandamide on the membrane inner to outer leaflet pools is determined to be 0.275 ± 0.023, and the rate constant...... of unidirectional flux from inside to outside is 0.361 ± 0.023 s. The rate constant of unidirectional flux from the membrane to BSA in the medium ([BSA]) increases with the square root of [BSA] in accordance with the theory of an unstirred layer around ghosts. Anandamide passed through the red blood cell membrane...

  12. Protective effect of Juglans regia L. against ultraviolet B radiation induced inflammatory responses in human epidermal keratinocytes. (United States)

    Muzaffer, Umar; Paul, V I; Prasad, Nagarajan Rajendra; Karthikeyan, Ramasamy; Agilan, Balupillai


    Juglans regia L. has a history of traditional medicinal use for the treatment of various maladies and have been documented with significant antioxidant and antiinflammatory properties. Although all parts of the plant are medicinally important, but male the flower of the plant has not been yet investigated against the photo-damage. The present study, we sought to determine the photoprotective effect of the male flower of J. regia L. against ultraviolet-B radiation-induced inflammatory responses in human skin cells. The profile of pharmacological active compounds present in the male flower of J. regia was analyzed by GC-MS. Then, the antioxidant property of methanolic extract of J. regia (MEJR) was analyzed by in vitro free radical scavenging assays. Further, we analyzed the sun protection factor of this extract by spectrophotometry. Moreover, we investigated the photoprotective effect of MEJR against UVB induced inflammatory signaling in human epidermal cells. Human skin epidermal keratinocytes (HaCaT) were pretreated with the MEJR (80 µg/ml), 30 min prior to UVB-irradiation at a dose of 20 mJ/cm 2 and were investigated for lipid peroxidation, enzymatic antioxidants activity, apoptosis and inflammatory markers expression level. The GC-MS results showed the presence of good amount of pharmacologically active compounds in the MEJR. We observed that the MEJR possess significant free radical scavenging activity and it was comparable with standard antioxidants. Further, the MEJR exhibits 8.8 sun-protection-factor (SPF) value. Pretreatment with MEJR, 30 min prior to UVB-irradiation, prevented ROS generation, lipid peroxidation and restored the activity of antioxidant status in HaCaT cells. Moreover, MEJR pretreatment significantly prevented UVB activated inflammatory markers like TNF-α, IL-1, IL-6, NF-κB, COX-2 in HaCaT. The present findings suggest that MEJR exhibit photoprotective effects and hence it may be useful for the treatment of inflammation related

  13. Establishment of H2Mab-119, an Anti-Human Epidermal Growth Factor Receptor 2 Monoclonal Antibody, Against Pancreatic Cancer. (United States)

    Yamada, Shinji; Itai, Shunsuke; Nakamura, Takuro; Chang, Yao-Wen; Harada, Hiroyuki; Suzuki, Hiroyoshi; Kaneko, Mika K; Kato, Yukinari


    Human epidermal growth factor receptor 2 (HER2) is overexpressed in breast cancer and is associated with poor clinical outcomes. In addition, HER2 expression has been reported in other cancers, such as gastric, colorectal, lung, and pancreatic cancers. An anti-HER2 humanized antibody, trastuzumab, leads to significant survival benefits in patients with HER2-overexpressing breast cancers and gastric cancers. Herein, we established a novel anti-HER2 monoclonal antibody (mAb), H 2 Mab-119 (IgG 1 , kappa), and characterized its efficacy against pancreatic cancers using flow cytometry, Western blot, and immunohistochemical analyses. H 2 Mab-119 reacted with pancreatic cancer cell lines, such as KLM-1, Capan-2, and MIA PaCa-2, but did not react with PANC-1 in flow cytometry analysis. Western blot analysis also revealed a moderate signal for KLM-1 and a weak signal for MIA PaCa-2, although H 2 Mab-119 reacted strongly with LN229/HER2 cells. Finally, immunohistochemical analyses with H 2 Mab-119 revealed sensitive and specific reactions against breast and colon cancers but did not react with pancreatic cancers, indicating that H 2 Mab-119 is useful for detecting HER2 overexpression in pancreatic cancers using flow cytometry and Western blot analyses.

  14. New Whitening Constituents from Taiwan-Native Pyracantha koidzumii: Structures and Tyrosinase Inhibitory Analysis in Human Epidermal Melanocytes

    Directory of Open Access Journals (Sweden)

    Rong-Dih Lin


    Full Text Available Nontoxic natural products useful in skin care cosmetics are of considerable interest. Tyrosinase is a rate-limiting enzyme for which its inhibitor is useful in developing whitening cosmetics. Pyracantha koidzumii (Hayata Rehder is an endemic species in Taiwan that exhibits tyrosinase-inhibitory activity. To find new active natural compounds from P. koidzumii, we performed bioguided isolation and studied the related activity in human epidermal melanocytes. In total, 13 compounds were identified from P. koidzumii in the present study, including two new compounds, 3,6-dihydroxy-2,4-dimethoxy-dibenzofuran (9 and 3,4-dihydroxy-5-methoxybiphenyl-2ʹ-O-β-d-glucopyranoside (13, as well as 11 known compounds. The new compound 13 exhibited maximum potency in inhibiting cellular tyrosinase activity, the protein expression of cellular tyrosinase and tyrosinase-related protein-2, as well as the mRNA expression of Paired box 3 and microphthalmia-associated transcription factor in a concentration-dependent manner. In the enzyme kinetic assay, the new compound 13 acted as an uncompetitive mixed-type inhibitor against the substrate l-3,4-dihydroxyphenylalanine and had a Km value against this substrate of 0.262 mM, as calculated using the Lineweaver–Burk plots. Taken together, our findings show compound 13 exhibits tyrosinase inhibition in human melanocytes and compound 13 may be a potential candidate for use in cosmetics.

  15. Trichloroethylene-mediated cytotoxicity in human epidermal keratinocytes is mediated by the rapid accumulation of intracellular calcium: Interception by naringenin. (United States)

    Ali, F; Khan, A Q; Khan, R; Sultana, S


    Industrial solvents pose a significant threat to the humankind. The mechanisms of their toxicity still remain in debate. Trichloroethylene (TCE) is a widespread industrial solvent responsible for severe liver dysfunction, cutaneous toxicity in occupationally exposed humans. We utilized an in vitro system of human epidermal keratinocyte (HaCaT) cells in this study to avoid complex cell and extracellular interactions. We report the cytotoxicity of organic solvent TCE in HaCaT and its reversal by a natural flavanone, naringenin (Nar). The cytotoxicity was attributed to the rapid intracellular free calcium (Ca(2+)) release, which might lead to the elevation of protein kinase C along with robust free radical generation, instability due to energy depletion, and sensitization of intracellular stress signal transducer nuclear factor κB. These effects were actually seen to induce significant amount of genomic DNA fragmentation. Furthermore, all these effects of TCE were effectively reversed by the treatment of Nar, a natural flavanone. Our studies identify intracellular Ca as a unique target used by organic solvents in the cytotoxicity and highlight the Ca(2+) ion stabilizer properties of Nar. © The Author(s) 2015.

  16. New Whitening Constituents from Taiwan-Native Pyracantha koidzumii: Structures and Tyrosinase Inhibitory Analysis in Human Epidermal Melanocytes (United States)

    Lin, Rong-Dih; Chen, Mei-Chuan; Liu, Yan-Ling; Lin, Yi-Tzu; Lu, Mei-Kuang; Hsu, Feng-Lin; Lee, Mei-Hsien


    Nontoxic natural products useful in skin care cosmetics are of considerable interest. Tyrosinase is a rate-limiting enzyme for which its inhibitor is useful in developing whitening cosmetics. Pyracantha koidzumii (Hayata) Rehder is an endemic species in Taiwan that exhibits tyrosinase-inhibitory activity. To find new active natural compounds from P. koidzumii, we performed bioguided isolation and studied the related activity in human epidermal melanocytes. In total, 13 compounds were identified from P. koidzumii in the present study, including two new compounds, 3,6-dihydroxy-2,4-dimethoxy-dibenzofuran (9) and 3,4-dihydroxy-5-methoxybiphenyl-2ʹ-O-β-d-glucopyranoside (13), as well as 11 known compounds. The new compound 13 exhibited maximum potency in inhibiting cellular tyrosinase activity, the protein expression of cellular tyrosinase and tyrosinase-related protein-2, as well as the mRNA expression of Paired box 3 and microphthalmia-associated transcription factor in a concentration-dependent manner. In the enzyme kinetic assay, the new compound 13 acted as an uncompetitive mixed-type inhibitor against the substrate l-3,4-dihydroxyphenylalanine and had a Km value against this substrate of 0.262 mM, as calculated using the Lineweaver–Burk plots. Taken together, our findings show compound 13 exhibits tyrosinase inhibition in human melanocytes and compound 13 may be a potential candidate for use in cosmetics. PMID:26633381

  17. Human Lipoproteins at Model Cell Membranes

    DEFF Research Database (Denmark)

    Browning, K L; Lind, T K; Maric, S


    High and low density lipoproteins (HDL and LDL) are thought to play vital roles in the onset and development of atherosclerosis; the biggest killer in the western world. Key issues of initial lipoprotein (LP) interactions at cellular membranes need to be addressed including LP deposition and lipid...... exchange. Here we present a protocol for monitoring the in situ kinetics of lipoprotein deposition and lipid exchange/removal at model cellular membranes using the non-invasive, surface sensitive methods of neutron reflection and quartz crystal microbalance with dissipation. For neutron reflection, lipid...... support the notion of HDL acting as the 'good' cholesterol, removing lipid material from lipid-loaded cells, whereas LDL acts as the 'bad' cholesterol, depositing lipid material into the vascular wall....

  18. Urinary transforming growth factors in neoplasia: separation of 125I-labeled transforming growth factor-alpha from epidermal growth factor in human urine

    International Nuclear Information System (INIS)

    Stromberg, K.; Hudgins, W.R.


    Purified human epidermal growth factor (hEGF) from urine promotes anchorage-independent cell growth in soft agar medium. This growth is enhanced by transforming growth factor-beta (TGF-beta), and is specifically inhibited by hEGF antiserum. Transforming growth factors of the alpha type (TGF-alpha), potentially present in normal human urine or urine from tumor-bearing patients, also promote anchorage-independent cell growth and compete with EGF for membrane receptor binding. Consequently, TGF-alpha cannot be distinguished from urinary hEGF by these two functional assays. Therefore, a technique for separation of TGF-alpha and related peptides from urinary EGF based on biochemical characteristics would be useful. Radioiodination of characterized growth factors [mouse EGF (mEGF), hEGF, and rat TGF-alpha (rTGF-alpha)], which were then separately added to human urine, was used to evaluate a resolution scheme that separates TGF-alpha from the high level of background hEGF present in human urine. Methyl bonded microparticulate silica efficiently adsorbed the 125 I-labeled mEGF, 125 I-labeled hEGF, and 125 I-labeled rTGF-alpha that were added to 24-h human urine samples. Fractional elution with acetonitrile (MeCN) of the adsorbed silica released approximately 70 to 80% of the 125 I-labeled mEGF and 125 I-labeled hEGF between 25 and 30% MeCN, and over 80% of the 125 I-labeled rTGF-alpha between 15 and 25% MeCN, with retention after dialysis of less than 0.2 and 1.7% of the original urinary protein, respectively. A single-step enrichment of about 400-fold for mEGF and hEGF, and 50-fold for rTGF-alpha were achieved rapidly. 125 I-labeled mEGF and 125 I-labeled hEGF eluted later than would be predicted on the basis of their reported molecular weight of approximately 6000, whereas 125 I-labeled rTGF-alpha eluted from Bio-Gel P-10 at an approximate molecular weight of 8000 to 9000

  19. Suppressors for Human Epidermal Growth Factor Receptor 2/4 (HER2/4): A New Family of Anti-Toxoplasmic Agents in ARPE-19 Cells. (United States)

    Kim, Yeong Hoon; Bhatt, Lokraj; Ahn, Hye-Jin; Yang, Zhaoshou; Lee, Won-Kyu; Nam, Ho-Woo


    The effects of tyrosine kinase inhibitors (TKIs) were evaluated on growth inhibition of intracellular Toxoplasma gondii in host ARPE-19 cells. The number of tachyzoites per parasitophorous vacuolar membrane (PVM) was counted after treatment with TKIs. T. gondii protein expression was assessed by western blot. Immunofluorescence assay was performed using Programmed Cell Death 4 (PDCD4) and T. gondii GRA3 antibodies. The TKIs were divided into 3 groups; non-epidermal growth factor receptor (non-EGFR), anti-human EGFR 2 (anti-HER2), and anti-HER2/4 TKIs, respectively. Group I TKIs (nintedanib, AZD9291, and sunitinib) were unable to inhibit proliferation without destroying host cells. Group II TKIs (lapatinib, gefitinib, erlotinib, and AG1478) inhibited proliferation up to 98% equivalent to control pyrimethamine (5 μM) at 20 μM and higher, without affecting host cells. Group III TKIs (neratinib, dacomitinib, afatinib, and pelitinib) inhibited proliferation up to 98% equivalent to pyrimethamine at 1-5 μM, but host cells were destroyed at 10-20 μM. In Group I, TgHSP90 and SAG1 inhibitions were weak, and GRA3 expression was moderately inhibited. In Group II, TgHSP90 and SAG1 expressions seemed to be slightly enhanced, while GRA3 showed none to mild inhibition; however, AG1478 inhibited all proteins moderately. Protein expression was blocked in Group III, comparable to pyrimethamine. PDCD4 and GRA3 were well localized inside the nuclei in Group I, mildly disrupted in Group II, and were completely disrupted in Group III. This study suggests the possibility of a vital T. gondii TK having potential HER2/4 properties, thus anti-HER2/4 TKIs may inhibit intracellular parasite proliferation with minimal adverse effects on host cells.

  20. Comparison of rat epidermal keratinocyte organotypic culture (ROC) with intact human skin

    DEFF Research Database (Denmark)

    Pappinen, Sari; Hermansson, Martin; Kuntsche, Judith


    study was to compare the stratum corneum lipid content of ROC with the corresponding material from human skin. The lipid composition was determined by thin-layer chromatography (TLC) and mass-spectrometry, and the thermal phase transitions of stratum corneum were studied by differential scanning...... calorimetry (DSC). All major lipid classes of the stratum corneum were present in ROC in a similar ratio as found in human stratum corneum. Compared to human skin, the level of non-hydroxyacid-sphingosine ceramide (NS) was increased in ROC, while alpha-hydroxyacid-phytosphingosine ceramide (AP) and non...... compared to human skin, in agreement with the results from DSC. ROC underwent a lipid lamellar order to disorder transition (T2) at a slightly lower temperature (68 degrees C) than human skin (74 degrees C). These differences in stratum corneum lipid composition and the thermal phase transitions may...

  1. Inhibition of iodine-125-labeled human follitropin binding to testicular receptor by epidermal growth factor and synthetic peptides

    International Nuclear Information System (INIS)

    Sluss, P.M.; Krystek, S.R. Jr.; Andersen, T.T.; Melson, B.E.; Huston, J.S.; Ridge, R.; Reichert, L.E. Jr.


    Two tetrapeptide sequence homologies between mouse epidermal growth factor precursor (mEGFP) and human follitropin (FSH) were revealed by a computer program that identifies identical residues among polypeptide sequences. The two tetrapeptides, Lys-Thr-Cys-Thr (KTCT) and Thr-Arg-Asp-Leu (TRDL), are present in the hormone-specific beta subunit of FSH from all species studied. These tetrapeptides are not present in the alpha subunit, which is common to all pituitary glycoprotein hormones. Both tetrapeptides are also found in mEGFP, and one tetrapeptide, TRDL, is located within the 53-residue form of mEGF purified from mouse submaxillary glands. Computer-generated hydropathy profiles predicted that both tetrapeptides are located in hydrophilic portions of the FSH beta subunit and that TRDL is in a hydrophilic portion of commercially available mEGF. Therefore, the tetrapeptides might be accessible to receptor binding sites for FSH. We report that mEGF inhibits binding of 125 I-labeled human FSH to receptors in testis by 50% (I50) at a concentration of 1.8 X 10(-5) M. No binding inhibition was observed by GnRH or arginine-vasopressin at 10(-4) M, neither of which contain the tetrapeptide sequences. FSH beta subunit, which contains both tetrapeptides, also inhibited binding (I50 = 9 X 10(-8) M) of 125 I-labeled human FSH to testis receptor. Thus, it appears that FSH beta subunit and mEGF are capable of inhibiting binding of FSH to testicular FSH receptors, presumably through interactions that include the homologous tetrapeptides. This presumption was supported by the observation that the synthetic tetrapeptides (KTCT or TRDL) were also active in inhibiting binding of 125 I-labeled human FSH to testis receptor

  2. Development of an affinity-matured humanized anti-epidermal growth factor receptor antibody for cancer immunotherapy. (United States)

    Nakanishi, Takeshi; Maru, Takamitsu; Tahara, Kazuhiro; Sanada, Hideaki; Umetsu, Mitsuo; Asano, Ryutaro; Kumagai, Izumi


    We showed previously that humanization of 528, a murine anti-epidermal growth factor receptor (EGFR) antibody, causes reduced affinity for its target. Here, to improve the affinity of the humanized antibody for use in cancer immunotherapy, we constructed phage display libraries focused on the complementarity-determining regions (CDRs) of the antibody and carried out affinity selection. Two-step selections using libraries constructed in a stepwise manner enabled a 32-fold affinity enhancement of humanized 528 (h528). Thermodynamic analysis of the interactions between the variable domain fragment of h528 (h528Fv) mutants and the soluble extracellular domain of EGFR indicated that the h528Fv mutants obtained from the first selection showed a large increase in negative enthalpy change due to binding, resulting in affinity enhancement. Furthermore, mutants from the second selection showed a decrease in entropy loss, which led to further affinity maturation. These results suggest that a single mutation in the heavy chain variable domain (i.e. Tyr(52) to Trp) enthalpically contributed for overcoming the energetic barrier to the antigen-antibody interaction, which was a major hurdle for the in vitro affinity maturation of h528. We reported previously that the humanized bispecific diabody hEx3 Db, which targets EGFR and CD3, shows strong anti-tumor activity. hEx3 Db mutants, in which the variable domains of h528 were replaced with those of the affinity-enhanced mutants, were prepared and characterized. In a growth inhibition assay of tumor cells, the hEx3 Db mutants showed stronger anti-tumor activity than that of hEx3 Db, suggesting that affinity enhancement of h528Fv enhances the anti-tumor activity of the bispecific diabody.

  3. Homeobox A7 increases cell proliferation by up-regulation of epidermal growth factor receptor expression in human granulosa cells

    Directory of Open Access Journals (Sweden)

    Yanase Toshihiko


    Full Text Available Abstract Background Homeobox (HOX genes encode transcription factors, which regulate cell proliferation, differentiation, adhesion, and migration. The deregulation of HOX genes is frequently associated with human reproductive system disorders. However, knowledge regarding the role of HOX genes in human granulosa cells is limited. Methods To determine the role of HOXA7 in the regulation and associated mechanisms of cell proliferation in human granulosa cells, HOXA7 and epidermal growth factor receptor (EGFR expressions were examined in primary granulosa cells (hGCs, an immortalized human granulosa cell line, SVOG, and a granulosa tumor cell line, KGN, by real-time PCR and Western blotting. To manipulate the expression of HOXA7, the HOXA7 specific siRNA was used to knockdown HOXA7 in KGN. Conversely, HOXA7 was overexpressed in SVOG by transfection with the pcDNA3.1-HOAX7 vector. Cell proliferation was measured by the MTT assay. Results Our results show that HOXA7 and EGFR were overexpressed in KGN cells compared to hGCs and SVOG cells. Knockdown of HOXA7 in KGN cells significantly decreased cell proliferation and EGFR expression. Overexpression of HOXA7 in SVOG cells significantly promoted cell growth and EGFR expression. Moreover, the EGF-induced KGN proliferation was abrogated, and the activation of downstream signaling was diminished when HOXA7 was knocked down. Overexpression of HOXA7 in SVOG cells had an opposite effect. Conclusions Our present study reveals a novel mechanistic role for HOXA7 in modulating granulosa cell proliferation via the regulation of EGFR. This finding contributes to the knowledge of the pro-proliferation effect of HOXA7 in granulosa cell growth and differentiation.

  4. Anti-inflammatory Elafin in human fetal membranes. (United States)

    Stalberg, Cecilia; Noda, Nathalia; Polettini, Jossimara; Jacobsson, Bo; Menon, Ramkumar


    Elafin is a low molecular weight protein with antileukoproteinase, anti-inflammatory, antibacterial and immunomodulating properties. The profile of Elafin in fetal membranes is not well characterized. This study determined the changes in Elafin expression and concentration in human fetal membrane from patients with preterm prelabor rupture of membranes (PPROM) and in vitro in response to intra-amniotic polymicrobial pathogens. Elafin messenger RNA (mRNA) expressions were studied in fetal membranes from PPROM, normal term as well as in normal term not in labor membranes in an organ explant system treated (24 h) with lipopolysaccharide (LPS), using quantitative reverse transcription-polymerase chain reaction (RT-PCR). Enzyme-linked immunosorbent assay (ELISA) measured Elafin concentrations in culture supernatants from tissues treated with LPS and polybacterial combinations of heat-inactivated Mycoplasma hominis (MH), Ureaplasma urealyticum (UU) and Gardnerella vaginalis (GV). Elafin mRNA expression in fetal membranes from women with PPROM was significantly higher compared to women who delivered at term after normal pregnancy (5.09±3.50 vs. 11.71±2.21; Pmembranes showed a significantly increased Elafin m-RNA expression (Pmembranes also showed no changes in Elafin protein concentrations compared to untreated controls. Higher Elafin expression in PPROM fetal membranes suggests a host response to an inflammatory pathology. However, lack of Elafin response to LPS and polymicrobial treatment is indicative of the minimal anti-inflammatory impact of this molecule in fetal membranes.

  5. Human papillomavirus E6/E7 oncogenes promote mouse ear regeneration by increasing the rate of wound re-epithelization and epidermal growth. (United States)

    Valencia, Concepción; Bonilla-Delgado, José; Oktaba, Katarzyna; Ocádiz-Delgado, Rodolfo; Gariglio, Patricio; Covarrubias, Luis


    Mammals have limited regeneration capacity. We report here that, in transgenic mice (Tg(bK6-E6/E7)), the expression of the E6/E7 oncogenes of human papilloma virus type 16 (HPV16) under the control of the bovine keratin 6 promoter markedly improves the mouse's capacity to repair portions of the ear after being wounded. Increased repair capacity correlates with an increased number of epidermal proliferating cells. In concordance with the expected effects of the E6 and E7 oncogenes, levels of p53 decreased and those of p16 in epidermal cells increased. In addition, we observed that wound re-epithelization proceeded faster in transgenic than in wild-type animals. After the initial re-epithelization, epidermal cell migration from the intact surrounding tissue appears to be a major contributor to the growing epidermis, especially in the repairing tissue of transgenic mice. We also found that there is a significantly higher number of putative epidermal stem cells in Tg(bK6-E6/E7) than in wild-type mice. Remarkably, hair follicles and cartilage regenerated within the repaired ear tissue, without evidence of tumor formation. We propose that the ability to regenerate ear portions is limited by the capacity of the epidermis to repair itself and grow.

  6. Structural model for the interaction of a designed Ankyrin Repeat Protein with the human epidermal growth factor receptor 2.

    Directory of Open Access Journals (Sweden)

    V Chandana Epa

    Full Text Available Designed Ankyrin Repeat Proteins are a class of novel binding proteins that can be selected and evolved to bind to targets with high affinity and specificity. We are interested in the DARPin H10-2-G3, which has been evolved to bind with very high affinity to the human epidermal growth factor receptor 2 (HER2. HER2 is found to be over-expressed in 30% of breast cancers, and is the target for the FDA-approved therapeutic monoclonal antibodies trastuzumab and pertuzumab and small molecule tyrosine kinase inhibitors. Here, we use computational macromolecular docking, coupled with several interface metrics such as shape complementarity, interaction energy, and electrostatic complementarity, to model the structure of the complex between the DARPin H10-2-G3 and HER2. We analyzed the interface between the two proteins and then validated the structural model by showing that selected HER2 point mutations at the putative interface with H10-2-G3 reduce the affinity of binding up to 100-fold without affecting the binding of trastuzumab. Comparisons made with a subsequently solved X-ray crystal structure of the complex yielded a backbone atom root mean square deviation of 0.84-1.14 Ångstroms. The study presented here demonstrates the capability of the computational techniques of structural bioinformatics in generating useful structural models of protein-protein interactions.


    Directory of Open Access Journals (Sweden)

    Balan Raluca


    Full Text Available We analyzed the immunohistochemical pattern of epidermal growth factor receptor (EGFR in cervical squamous intraepithelial lesions (SILs in correlation with L1 HPV capsid protein, in order to determine the relationship between EGFR expression and the infection status of human papillomavirus (HPV. The study included 40 cases, 24 LSIL (low grade SIL (CIN1, cervical intraepithelial neoplasia and 16 HSIL (high grade SIL (6 cases of CIN2 and 10 cases of CIN3. The immunoexpression of L1 HPV protein was assessed on conventional cervico-vaginal smears and EGFR was immunohistochemically evaluated on the corresponding cervical biopsies. The HPV L1 capsid protein was expressed in 45.83% of LSIL and 25% of HSIL. EGFR was overexpressed in 62,4% of HSIL (58,4% CIN2 and 41,6% CIN3 and 37,6% LSIL. The immunoexpression of L1 HPV has clinical application in the progression assessment of the cervical precancerous lesions without a correlation to the grade of the cervical SIL. EGFR is expressed by all proliferating squamous epithelial cells, thus corresponding with the grade of SIL. The evaluation of EGFR status, correlated with L1 HPV protein expression, can provide useful data of progression risk of cervical squamous intraepithelial lesions

  8. Evolving landscape of human epidermal growth factor receptor 2-positive breast cancer treatment and the future of biosimilars. (United States)

    Jackisch, Christian; Lammers, Philip; Jacobs, Ira


    Human epidermal growth factor receptor 2-positive (HER2+) breast cancer comprises approximately 15%-20% of all breast cancers and is associated with a poor prognosis. The introduction of anti-HER2 therapy has significantly improved clinical outcomes for patients with HER2+ breast cancer, and multiple HER2-directed agents (ie, trastuzumab, pertuzumab, lapatinib, and ado-trastuzumab emtansine [T-DM1]) are approved for clinical use in various settings. The treatment landscape for patients with HER2+ breast cancer is continuing to evolve. While novel agents and therapeutic strategies are emerging, biologic therapies, particularly trastuzumab, are likely to remain a mainstay of treatment. However, access issues create barriers to the use of biologics, and there is evidence for underuse of trastuzumab worldwide. A biosimilar is a biologic product that is highly similar to a licensed biologic in terms of product safety and effectiveness. Biosimilars of trastuzumab are in development and may soon become available. The introduction of biosimilars may improve access to anti-HER2 therapies by providing additional treatment options and lower-cost alternatives. Because HER2-targeted drugs may be administered for extended periods of time and in combination with other systemic therapies, biosimilars have the potential to result in significant savings for healthcare systems. Herein we review current and emerging treatment options for, and discuss the possible role of biosimilars in, treating patients with HER2+ breast cancer. Copyright © 2017 Authors, Pfizer Inc. Published by Elsevier Ltd.. All rights reserved.

  9. Association of Polymorphisms in Connective Tissue Growth Factor and Epidermal Growth Factor Receptor Genes With Human Longevity. (United States)

    Donlon, Timothy A; Morris, Brian J; He, Qimei; Chen, Randi; Masaki, Kamal H; Allsopp, Richard C; Willcox, D Craig; Tranah, Gregory J; Parimi, Neeta; Evans, Daniel S; Flachsbart, Friederike; Nebel, Almut; Kim, Duk-Hwan; Park, Joobae; Willcox, Bradley J


    Growth pathways play key roles in longevity. The present study tested single-nucleotide polymorphisms (SNPs) in the connective tissue growth factor gene (CTGF) and the epidermal growth factor receptor gene (EGFR) for association with longevity. Comparison of allele and genotype frequencies of 12 CTGF SNPs and 41 EGFR SNPs between 440 American men of Japanese ancestry aged ≥95 years and 374 men of average life span revealed association with longevity at the p cases, consistent with heterozygote advantage in living to extreme old age. No associations of the most significant SNPs were observed in whites or Koreans. In conclusion, the present findings indicate that genetic variation in CTGF and EGFR may contribute to the attainment of extreme old age in Japanese. More research is needed to confirm that genetic variation in CTGF and EGFR contributes to the attainment of extreme old age across human populations. © The Author 2016. Published by Oxford University Press on behalf of The Gerontological Society of America. All rights reserved. For permissions, please e-mail:

  10. The human skin/chick chorioallantoic membrane model accurately predicts the potency of cosmetic allergens. (United States)

    Slodownik, Dan; Grinberg, Igor; Spira, Ram M; Skornik, Yehuda; Goldstein, Ronald S


    The current standard method for predicting contact allergenicity is the murine local lymph node assay (LLNA). Public objection to the use of animals in testing of cosmetics makes the development of a system that does not use sentient animals highly desirable. The chorioallantoic membrane (CAM) of the chick egg has been extensively used for the growth of normal and transformed mammalian tissues. The CAM is not innervated, and embryos are sacrificed before the development of pain perception. The aim of this study was to determine whether the sensitization phase of contact dermatitis to known cosmetic allergens can be quantified using CAM-engrafted human skin and how these results compare with published EC3 data obtained with the LLNA. We studied six common molecules used in allergen testing and quantified migration of epidermal Langerhans cells (LC) as a measure of their allergic potency. All agents with known allergic potential induced statistically significant migration of LC. The data obtained correlated well with published data for these allergens generated using the LLNA test. The human-skin CAM model therefore has great potential as an inexpensive, non-radioactive, in vivo alternative to the LLNA, which does not require the use of sentient animals. In addition, this system has the advantage of testing the allergic response of human, rather than animal skin.

  11. Lipidomic analysis of epidermal lipids: a tool to predict progression of inflammatory skin disease in humans. (United States)

    Li, Shan; Ganguli-Indra, Gitali; Indra, Arup K


    Lipidomics is the large-scale profiling and characterization of lipid species in a biological system using mass spectrometry. The skin barrier is mainly comprised of corneocytes and a lipid-enriched extracellular matrix. The major skin lipids are ceramides, cholesterol and free fatty acids (FFA). Lipid compositions are altered in inflammatory skin disorders with disrupted skin barrier such as atopic dermatitis (AD). Here we discuss some of the recent applications of lipidomics in human skin biology and in inflammatory skin diseases such as AD, psoriasis and Netherton syndrome. We also review applications of lipidomics in human skin equivalent and in pre-clinical animal models of skin diseases to gain insight into the pathogenesis of the skin disease. Expert commentary: Skin lipidomics analysis could be a fast, reliable and noninvasive tool to characterize the skin lipid profile and to monitor the progression of inflammatory skin diseases such as AD.

  12. Materials and optimized designs for human-machine interfaces via epidermal electronics. (United States)

    Jeong, Jae-Woong; Yeo, Woon-Hong; Akhtar, Aadeel; Norton, James J S; Kwack, Young-Jin; Li, Shuo; Jung, Sung-Young; Su, Yewang; Lee, Woosik; Xia, Jing; Cheng, Huanyu; Huang, Yonggang; Choi, Woon-Seop; Bretl, Timothy; Rogers, John A


    Thin, soft, and elastic electronics with physical properties well matched to the epidermis can be conformally and robustly integrated with the skin. Materials and optimized designs for such devices are presented for surface electromyography (sEMG). The findings enable sEMG from wide ranging areas of the body. The measurements have quality sufficient for advanced forms of human-machine interface. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Linking γ-aminobutyric acid A receptor to epidermal growth factor receptor pathways activation in human prostate cancer. (United States)

    Wu, Weijuan; Yang, Qing; Fung, Kar-Ming; Humphreys, Mitchell R; Brame, Lacy S; Cao, Amy; Fang, Yu-Ting; Shih, Pin-Tsen; Kropp, Bradley P; Lin, Hsueh-Kung


    Neuroendocrine (NE) differentiation has been attributed to the progression of castration-resistant prostate cancer (CRPC). Growth factor pathways including the epidermal growth factor receptor (EGFR) signaling have been implicated in the development of NE features and progression to a castration-resistant phenotype. However, upstream molecules that regulate the growth factor pathway remain largely unknown. Using androgen-insensitive bone metastasis PC-3 cells and androgen-sensitive lymph node metastasis LNCaP cells derived from human prostate cancer (PCa) patients, we demonstrated that γ-aminobutyric acid A receptor (GABA(A)R) ligand (GABA) and agonist (isoguvacine) stimulate cell proliferation, enhance EGF family members expression, and activate EGFR and a downstream signaling molecule, Src, in both PC-3 and LNCaP cells. Inclusion of a GABA(A)R antagonist, picrotoxin, or an EGFR tyrosine kinase inhibitor, Gefitinib (ZD1839 or Iressa), blocked isoguvacine and GABA-stimulated cell growth, trans-phospohorylation of EGFR, and tyrosyl phosphorylation of Src in both PCa cell lines. Spatial distributions of GABAAR α₁ and phosphorylated Src (Tyr416) were studied in human prostate tissues by immunohistochemistry. In contrast to extremely low or absence of GABA(A)R α₁-positive immunoreactivity in normal prostate epithelium, elevated GABA(A)R α₁ immunoreactivity was detected in prostate carcinomatous glands. Similarly, immunoreactivity of phospho-Src (Tyr416) was specifically localized and limited to the nucleoli of all invasive prostate carcinoma cells, but negative in normal tissues. Strong GABAAR α₁ immunoreactivity was spatially adjacent to the neoplastic glands where strong phospho-Src (Tyr416)-positive immunoreactivity was demonstrated, but not in adjacent to normal glands. These results suggest that the GABA signaling is linked to the EGFR pathway and may work through autocrine or paracine mechanism to promote CRPC progression. Copyright © 2013 Elsevier

  14. Optical properties of the human round window membrane (United States)

    Höhl, Martin; DeTemple, Daphne; Lyutenski, Stefan; Leuteritz, Georg; Varkentin, Arthur; Schmitt, Heike Andrea; Lenarz, Thomas; Roth, Bernhard; Meinhardt-Wollweber, Merve; Morgner, Uwe


    Optical techniques are effective tools for diagnostic applications in medicine and are particularly attractive for the noninvasive analysis of biological tissues and fluids in vivo. Noninvasive examinations of substances via a fiber optic probe need to consider the optical properties of biological tissues obstructing the optical path. This applies to the analysis of the human perilymph, which is located behind the round window membrane. The composition of this inner ear liquid is directly correlated to inner ear hearing loss. In this work, experimental methods for studying the optical properties of the human round window membrane ex vivo are presented. For the first time, a comprehensive investigation of this tissue is performed, including optical transmission, forward scattering, and Raman scattering. The results obtained suggest the application of visible wavelengths (>400 nm) for investigating the perilymph behind the round window membrane in future.

  15. The erythrocyte membrane in human muscular dystrophy

    NARCIS (Netherlands)

    W. Ruitenbeek (Willem)


    textabstractMore than 250 different forms of human neuromuscular diseases are known. They differ in age of onset, severity of weakness, rate of progression, type of inheritance, groups of muscles affected, frequency of incidence. Sometimes the clinical symptoms are not restricted to nervous

  16. Ionic channels and membrane hyperpolarization in human macrophages

    NARCIS (Netherlands)

    Ince, C.; van Duijn, B.; Ypey, D. L.; van Bavel, E.; Weidema, F.; Leijh, P. C.


    Microelectrode impalement of human macrophages evokes a transient hyperpolarizing response (HR) of the membrane potential. This HR was found to be dependent on the extracellular concentration of K+ but not on that of Na+ or Cl-. It was not influenced by low temperature (12 degrees C) or by 0.2 mM

  17. Differential regulation of type I interferon and epidermal growth factor pathways by a human Respirovirus virulence factor.

    Directory of Open Access Journals (Sweden)

    Grégory Caignard


    Full Text Available A number of paramyxoviruses are responsible for acute respiratory infections in children, elderly and immuno-compromised individuals, resulting in airway inflammation and exacerbation of chronic diseases like asthma. To understand the molecular pathogenesis of these infections, we searched for cellular targets of the virulence protein C of human parainfluenza virus type 3 (hPIV3-C. We found that hPIV3-C interacts directly through its C-terminal domain with STAT1 and GRB2, whereas C proteins from measles or Nipah viruses failed to do so. Binding to STAT1 explains the previously reported capacity of hPIV3-C to block type I interferon signaling, but the interaction with GRB2 was unexpected. This adaptor protein bridges Epidermal Growth Factor (EGF receptor to MAPK/ERK pathway, a signaling cascade recently found to be involved in airway inflammatory response. We report that either hPIV3 infection or transient expression of hPIV3-C both increase cellular response to EGF, as assessed by Elk1 transactivation and phosphorylation levels of ERK1/2, 40S ribosomal subunit protein S6 and translation initiation factor 4E (eIF4E. Furthermore, inhibition of MAPK/ERK pathway with U0126 prevented viral protein expression in infected cells. Altogether, our data provide molecular basis to explain the role of hPIV3-C as a virulence factor and determinant of pathogenesis and demonstrate that Paramyxoviridae have evolved a single virulence factor to block type I interferon signaling and to boost simultaneous cellular response to growth factors.

  18. Human epidermal growth factor receptor 2 status of gastric cancer patients in Asia: results from a large, multicountry study. (United States)

    Pathmanathan, Nirmala; Geng, Jing-Shu; Li, Wencai; Nie, Xiu; Veloso, Januario; Wang, John; Hill, Julie; Mccloud, Philip; Bilous, Michael


    Current estimates of the human epidermal growth factor receptor 2 (HER2)-positivity rate in gastric cancer vary widely in the literature, and there are limited data from countries in Asia. The primary aim of this study was to conduct a clinical audit of laboratories across seven countries in Asia to determine the incidence of HER2-positive gastric cancer in this region. Pathologists were asked to collect data on patient gender, age, cancer site, specimen type, tumor spread, type and grade, HER2 test results, including protein and/or gene copy enumeration, and final HER2 status on consecutive gastric cancer cases tested for HER2 in their laboratory over a 2-year period. HER2 results from 5,301 gastric cancers were submitted by 50 laboratories. The overall HER2-positivity rate was 9.7% which, after the exclusion of China, increased to 18.1%. The rate between countries ranged from 0% to 23.1%, and from 0% to 50.0% between laboratories. An equivocal HER2 result was recorded in 19.5% of cases. Despite the lack of centralized testing to confirm the accuracy of HER2 diagnoses, the incidence of HER2-positive gastric cancer observed here was comparable to that reported in the literature. Nevertheless, rates were highly variable between countries and laboratories, which suggests a lack of HER2 testing expertise in gastric cancer. Given that the mortality rates for gastric cancer in Eastern Asia are the highest in the world, efforts should focus on improving HER2 testing expertise in the region so that patients receive the appropriate treatment early in their disease. © 2016 The Authors. Asia-Pacific Journal of Clinical Oncology Published by John Wiley & Sons Australia, Ltd.

  19. Eps15 is recruited to the plasma membrane upon epidermal growth factor receptor activation and localizes to components of the endocytic pathway during receptor internalization

    DEFF Research Database (Denmark)

    Torrisi, M R; Lotti, L V; Belleudi, F


    Eps15 is a substrate for the tyrosine kinase of the epidermal growth factor receptor (EGFR) and is characterized by the presence of a novel protein:protein interaction domain, the EH domain. Eps15 also stably binds the clathrin adaptor protein complex AP-2. Previous work demonstrated an essential...

  20. Epidermal changes following application of 7,12-dimethylbenz(a)anthracene and 12-O-tetradecanoylphorbol-13-acetate to human skin transplanted to nude mice studied with histological species markers

    International Nuclear Information System (INIS)

    Graem, N.


    Effects of the tumor initiator 7,12-dimethylbenz(a)anthracene (DMBA) and of the tumor promoter 12-O-tetradecanoylphorbol-13-acetate (TPA) on epidermis of human fetal and adult skin were studied in the nude mouse/human skin model. Human skin grafts on NC nude mice were exposed to two topical applications of 1 mg of DMBA in 50 microliter of acetone with an interval of 3 days and/or to applications of 10 micrograms of TPA in 50 microliter of acetone twice weekly. In some animals, it was attempted to augment the susceptibility of the grafts to the tumor-initiating effect of DMBA by pretreatment with TPA or ultraviolet light. The mice were sacrificed 8-32 wk after the initial treatment. Tumors did not appear in the central portions of any of the grafts, but epidermal tumors were seen at the graft border in 34.9% of the DMBA-treated animals. To identify human epidermis on the grafts and to determine the species origin of the induced tumors, two independently working histological marker methods were applied. (a) The first is detection of a human Blood Group B-like antigen present in mouse epidermis and in chemically induced murine epidermal tumors. This antigen cannot be demonstrated in human epidermis and in epidermal tumors of human patients. (b) The second is histological staining with the DNA-specific fluorochrome, bisbenzimide, displaying a characteristic pattern of 5-10 intranuclear fluorescent bodies in murine nonneoplastic epidermal cells and in murine epidermal tumor cells. Such a pattern is not seen in human epidermis and in epidermal tumors of human patients. The studies showed that TPA treatment resulted in epidermal hyperplasia in both the human epidermis and the adjacent mouse epidermis and that the induced tumors were derived from murine tissue

  1. Matriptase and prostasin are expressed in human skin in an inverse trend over the course of differentiation and are targeted to different regions of the plasma membrane

    Directory of Open Access Journals (Sweden)

    Chih-Hsin Lai


    Full Text Available Matriptase and prostasin, acting as a tightly coupled proteolytic cascade, were reported to be required for epidermal barrier formation in mouse skin. Here we show that, in human skin, matriptase and prostasin are expressed with an inverse pattern over the course of differentiation. Matriptase was detected primarily in epidermal basal keratinocytes and the basaloid cells in the outer root sheath of hair follicles and the sebaceous gland, where prostasin was not detected. In contrast, prostasin was detected primarily in differentiated cells in the epidermal granular layer, the inner root sheath of hair follicles, and the sebaceous gland, where matriptase expression is negligible. While co-expressed in the middle stage of differentiation, prostasin was detected as polarized patches, and matriptase at intercellular junctions. Targeting to different subcellular localizations is also observed in HaCaT human keratinocytes, in which matriptase was detected primarily at intercellular junctions, and prostasin primarily on membrane protrusion. Furthermore, upon induction of zymogen activation, free active prostasin remains cell-associated and free active matriptase is rapidly shed into the extracellular milieu. Our data suggest that matriptase and prostasin likely function as independent entities in human skin rather than as a tightly coupled proteolytic cascade as observed in mouse skin.

  2. Keratin 17 is overexpressed and predicts poor survival in estrogen receptor-negative/human epidermal growth factor receptor-2-negative breast cancer. (United States)

    Merkin, Ross D; Vanner, Elizabeth A; Romeiser, Jamie L; Shroyer, A Laurie W; Escobar-Hoyos, Luisa F; Li, Jinyu; Powers, Robert S; Burke, Stephanie; Shroyer, Kenneth R


    Clinicopathological features of breast cancer have limited accuracy to predict survival. By immunohistochemistry (IHC), keratin 17 (K17) expression has been correlated with triple-negative status (estrogen receptor [ER]/progesterone receptor/human epidermal growth factor receptor-2 [HER2] negative) and decreased survival, but K17 messenger RNA (mRNA) expression has not been evaluated in breast cancer. K17 is a potential prognostic cancer biomarker, targeting p27, and driving cell cycle progression. This study compared K17 protein and mRNA expression to ER/progesterone receptor/HER2 receptor status and event-free survival. K17 IHC was performed on 164 invasive breast cancers and K17 mRNA was evaluated in 1097 breast cancers. The mRNA status of other keratins (16/14/9) was evaluated in 113 ER - /HER2 - ductal carcinomas. IHC demonstrated intense cytoplasmic and membranous K17 localization in myoepithelial cells of benign ducts and lobules and tumor cells of ductal carcinoma in situ. In ductal carcinomas, K17 protein was detected in most triple-negative tumors (28/34, 82%), some non-triple-negative tumors (52/112, 46%), but never in lobular carcinomas (0/15). In ductal carcinomas, high K17 mRNA was associated with reduced 5-year event-free survival in advanced tumor stage (n = 149, hazard ratio [HR] = 3.68, P = .018), and large (n = 73, HR = 3.95, P = .047), triple-negative (n = 103, HR = 2.73, P = .073), and ER - /HER2 - (n = 113, HR = 2.99, P = .049) tumors. There were significant correlations among keratins 17, 16, 14, and 9 mRNA levels suggesting these keratins (all encoded on chromosome 17) could be coordinately expressed in breast cancer. Thus, K17 is expressed in a subset of triple-negative breast cancers, and is a marker of poor prognosis in patients with advanced stage and ER - /HER2 - breast cancer. Copyright © 2016 Elsevier Inc. All rights reserved.

  3. Solubilization of human erythrocyte membranes by ASB detergents

    Directory of Open Access Journals (Sweden)

    C.C. Domingues


    Full Text Available Understanding the membrane solubilization process and finding effective solubilizing agents are crucial challenges in biochemical research. Here we report results on the interaction of the novel linear alkylamido propyl dimethyl amino propanosulfonate detergents, ASB-14 and ASB-16, with human erythrocyte membranes. An estimation of the critical micelle concentration of these zwitterionic detergents (ASB-14 = 100 µM and ASB-16 = 10 µM was obtained using electron paramagnetic resonance. The amount of proteins and cholesterol solubilized from erythrocytes by these detergents was then determined. The hemolytic activities of the ASB detergents were assayed and the detergent/lipid molar ratios for the onset of hemolysis (Re sat and total lysis (Re sol were calculated, allowing the determination of the membrane binding constants (Kb. ASB-14 presented lower membrane affinity (Kb = 7050 M-1 than ASB-16 (Kb = 15610 M-1. The amount of proteins and cholesterol solubilized by both ASB detergents was higher while Re sat values (0.22 and 0.08 detergent/lipid for ASB-14 and ASB-16, respectively were smaller than those observed with the classic detergents CHAPS and Triton X-100. These results reveal that, besides their well-known use as membrane protein solubilizers to enhance the resolution of two dimensional electrophoresis/mass spectrometry, ASB-14 and ASB-16 are strong hemolytic agents. We propose that the physicochemical properties of ASB detergents determine their membrane disruption efficiency and can help to explain the improvement in the solubilization of membrane proteins, as reported in the literature.

  4. Membrane alterations induced by nonstructural proteins of human norovirus.

    Directory of Open Access Journals (Sweden)

    Sylvie Y Doerflinger


    Full Text Available Human noroviruses (huNoV are the most frequent cause of non-bacterial acute gastroenteritis worldwide, particularly genogroup II genotype 4 (GII.4 variants. The viral nonstructural (NS proteins encoded by the ORF1 polyprotein induce vesical clusters harboring the viral replication sites. Little is known so far about the ultrastructure of these replication organelles or the contribution of individual NS proteins to their biogenesis. We compared the ultrastructural changes induced by expression of norovirus ORF1 polyproteins with those induced upon infection with murine norovirus (MNV. Characteristic membrane alterations induced by ORF1 expression resembled those found in MNV infected cells, consisting of vesicle accumulations likely built from the endoplasmic reticulum (ER which included single membrane vesicles (SMVs, double membrane vesicles (DMVs and multi membrane vesicles (MMVs. In-depth analysis using electron tomography suggested that MMVs originate through the enwrapping of SMVs with tubular structures similar to mechanisms reported for picornaviruses. Expression of GII.4 NS1-2, NS3 and NS4 fused to GFP revealed distinct membrane alterations when analyzed by correlative light and electron microscopy. Expression of NS1-2 induced proliferation of smooth ER membranes forming long tubular structures that were affected by mutations in the active center of the putative NS1-2 hydrolase domain. NS3 was associated with ER membranes around lipid droplets (LDs and induced the formation of convoluted membranes, which were even more pronounced in case of NS4. Interestingly, NS4 was the only GII.4 protein capable of inducing SMV and DMV formation when expressed individually. Our work provides the first ultrastructural analysis of norovirus GII.4 induced vesicle clusters and suggests that their morphology and biogenesis is most similar to picornaviruses. We further identified NS4 as a key factor in the formation of membrane alterations of huNoV and

  5. Pharmacokinetics, biodistribution and dosimetry of {sup 99m}Tc-labeled anti-human epidermal growth factor receptor humanized monoclonal antibody R3 in rats

    Energy Technology Data Exchange (ETDEWEB)

    Escobar, Normando Iznaga; Morales, Alejo Morales; Duconge, Jorge; Torres, Idania Caballero; Fernandez, Eduardo; Gomez, Jose A


    The pharmacokinetics, biodistribution and dosimetry of {sup 99m}Tc-labeled anti-human epidermal growth factor receptor (anti-hEGF-r) humanized monoclonal antibody (MAb) R3 was investigated following intravenous injection in normal Wistar rats. Serum disappearance curves were best fit by a two-compartment model having a mean distribution half-life (t{sub (1(2{alpha}}{sub ))}) of 0.250 h and a mean elimination (t{sub (1(2{beta}}{sub ))}) of 13.89 h. Among the various organs, a little accumulation of the radiolabeled antibody was found only in kidneys. Biodistribution and dosimetry studies in humans were performed by extrapolation of the animal data to humans. Absorbed dose to normal organs and the remainder of the whole body were estimated using the medical internal radiation dose formula, and dose contributions from radioactivity in transit through the gastrointestinal tract were estimated using a compartment model. Extrapolated values of radiation absorbed dose to normal organs in rads per millicurie administered were whole body, 0.0085; lower large intestine wall, 0.0898; small intestine, 0.0530; upper large intestine wall, 0.0731; and kidneys, 0.0455. The effective dose equivalent predicted was 0.0162 rem/mCi and the effective dose was found to be 0.015 rem/mCi. On the basis of the pharmacokinetics, biodistribution and internal radiation dosimetry information obtained in this study, a diagnostic phase I clinical trial with {sup 99m}Tc-labeled humanized MAb R3 conjugate in patients should be supported.

  6. Pharmacokinetics, biodistribution and dosimetry of 99mTc-labeled anti-human epidermal growth factor receptor humanized monoclonal antibody R3 in rats

    International Nuclear Information System (INIS)

    Escobar, Normando Iznaga; Morales, Alejo Morales; Duconge, Jorge; Torres, Idania Caballero; Fernandez, Eduardo; Gomez, Jose A.


    The pharmacokinetics, biodistribution and dosimetry of 99m Tc-labeled anti-human epidermal growth factor receptor (anti-hEGF-r) humanized monoclonal antibody (MAb) R3 was investigated following intravenous injection in normal Wistar rats. Serum disappearance curves were best fit by a two-compartment model having a mean distribution half-life (t (1(2α)) ) of 0.250 h and a mean elimination (t (1(2β)) ) of 13.89 h. Among the various organs, a little accumulation of the radiolabeled antibody was found only in kidneys. Biodistribution and dosimetry studies in humans were performed by extrapolation of the animal data to humans. Absorbed dose to normal organs and the remainder of the whole body were estimated using the medical internal radiation dose formula, and dose contributions from radioactivity in transit through the gastrointestinal tract were estimated using a compartment model. Extrapolated values of radiation absorbed dose to normal organs in rads per millicurie administered were whole body, 0.0085; lower large intestine wall, 0.0898; small intestine, 0.0530; upper large intestine wall, 0.0731; and kidneys, 0.0455. The effective dose equivalent predicted was 0.0162 rem/mCi and the effective dose was found to be 0.015 rem/mCi. On the basis of the pharmacokinetics, biodistribution and internal radiation dosimetry information obtained in this study, a diagnostic phase I clinical trial with 99m Tc-labeled humanized MAb R3 conjugate in patients should be supported

  7. Basement membrane reconstruction in human skin equivalents is regulated by fibroblasts and/or exogenously activated keratinocytes. (United States)

    El Ghalbzouri, Abdoelwaheb; Jonkman, Marcel F; Dijkman, Remco; Ponec, Maria


    This study was undertaken to examine the role fibroblasts play in the formation of the basement membrane (BM) in human skin equivalents. For this purpose, keratinocytes were seeded on top of fibroblast-free or fibroblast-populated collagen matrix or de-epidermized dermis and cultured in the absence of serum and exogenous growth factors. The expression of various BM components was analyzed on the protein and mRNA level. Irrespective of the presence or absence of fibroblasts, keratin 14, hemidesmosomal proteins plectin, BP230 and BP180, and integrins alpha1beta1, alpha2beta1, alpha3beta1, and alpha6beta4 were expressed but laminin 1 was absent. Only in the presence of fibroblasts or of various growth factors, laminin 5 and laminin 10/11, nidogen, uncein, type IV and type VII collagen were decorating the dermal/epidermal junction. These findings indicate that the attachment of basal keratinocytes to the dermal matrix is most likely mediated by integrins alpha1beta1 and alpha2beta1, and not by laminins that bind to integrin alpha6beta4 and that the epithelial-mesenchymal cross-talk plays an important role in synthesis and deposition of various BM components.

  8. Impact of palbociclib combinations on treatment of advanced estrogen receptor-positive/human epidermal growth factor 2-negative breast cancer

    Directory of Open Access Journals (Sweden)

    Boér K


    Full Text Available Katalin Boér Department of Medical Oncology, Szent Margit Hospital, Budapest, Hungary Abstract: Breast cancer is a heterogeneous disease with multiple subgroups based on clinical and molecular characteristics. For the largest subgroup of breast cancers, hormone receptor-positive/human epidermal growth factor 2 (HER2-negative tumors, hormone treatment is the mainstay of therapy and is likely to result in significant improvement in disease outcomes. However, some of these cancers demonstrate de novo or acquired resistance to endocrine therapy. Despite intensive research to develop new strategies to enhance the efficacy of currently available treatment options for hormone receptor-positive breast cancer, progress has been slow, and there were few advances for a period of 10 years. In 2012, a new molecularly targeted therapeutic strategy, inhibition of mammalian target of rapamycin with everolimus, was introduced into clinical practice. Everolimus, in combination with a steroidal aromatase inhibitor, exemestane, resulted in an increase in progression-free survival, but not overall survival in patients with estrogen receptor (ER+ve advanced disease who had progressed on hormone therapy. In 2015, the first cyclin-dependent kinases 4/6 (CDK4/6 inhibitor, palbociclib, received accelerated US Food and Drug Administration approval for use in combination with letrozole for the treatment of postmenopausal ER+ve/HER2-ve advanced breast cancer as initial, endocrine-based therapy. The addition of palbociclib to endocrine therapy resulted in longer progression-free survival than letrozole alone. One year later, palbociclib received a new indication, use in combination with fulvestrant, in both premenopausal and postmenopausal females with advanced breast cancer of the same subtype with disease progression following endocrine therapy. Adding palbociclib to fulvestrant resulted in a significantly increased median progression-free survival compared to fulvestrant

  9. Human epidermal growth factor receptor 2-positive breast cancer: which cytotoxic agent best complements trastuzumab's efficacy in vitro?

    Directory of Open Access Journals (Sweden)

    Hurrell T


    Full Text Available Tracey Hurrell, Kim OuthoffDepartment of Pharmacology, University of Pretoria, Pretoria, South AfricaIntroduction: Despite trastuzumab having enhanced selectivity for human epidermal growth factor receptor 2 (HER-2 overexpressing breast cancer cells, treatment is hampered by interindividual variation and tumors with high mitogenic potential. The lack of significant clinical benefit in certain patient cohorts suggests that HER-2 expression is ineffective as a sole prognostic indicator of response to therapy. Therefore, optimizing the clinical role of trastuzumab in drug combinations remains critical for clinical success.Aim: To investigate the effects of trastuzumab in combination with either doxorubicin or geldanamycin on in vitro cell viability, cell cycling, apoptosis and relative HER-2 expression in HER-2-positive (SK-BR-3 and estrogen receptor-positive (MCF-7 breast adenocarcinoma models.Results: HER-2-rich SK-BR-3 cells demonstrated a greater sensitivity to the effects of doxorubicin than MCF-7 cells. Concurrent trastuzumab exposure resulted in a further reduction in cell viability. This decreased cell viability induced by doxorubicin was associated with activation of executioner caspases as well as with alterations in cell-cycle kinetics, primarily promoting S-phase accumulation. Doxorubicin had no effect on surface HER-2 density expression. Geldanamycin reduced cell viability significantly greater in SK-BR-3 than MCF-7 cells, and was associated with G2 cell-cycle accumulation. The addition of trastuzumab did not augment these effects. Geldanamycin promoted substantial reductions in relative surface HER-2 density in SK-BR-3 cells.Conclusion: The in vitro data supported the rationale for using doxorubicin in trastuzumab-based therapies. Therefore, despite the incidence of cardiotoxicity, doxorubicin could retain a fundamental role in treating HER-2-positive breast cancer. While geldanamycin is a potent cytotoxic agent, its concurrent use

  10. Targeted delivery of polyamidoamine-paclitaxel conjugate functionalized with anti-human epidermal growth factor receptor 2 trastuzumab

    Directory of Open Access Journals (Sweden)

    Ma P


    Full Text Available Pengkai Ma,1 Xuemei Zhang,1 Ling Ni,2 Jinming Li,2 Fengpu Zhang,1 Zheng Wang,1 Shengnan Lian,1 Kaoxiang Sun1 1School of Pharmacy, Yantai University, Yantai, Shandong Province, People’s Republic of China; 2State Key Laboratory of Long-acting and Targeting Drug Delivery System, Yantai, Shandong Province, People’s Republic of China Background: Antibody-dendrimer conjugates have the potential to improve the targeting and release of chemotherapeutic drugs at the tumor site while reducing adverse side effects caused by drug accumulation in healthy tissues. In this study, trastuzumab (TMAB, which binds to human epidermal growth factor receptor 2 (HER2, was used as a targeting agent in a TMAB-polyamidoamine (PAMAM conjugate carrying paclitaxel (PTX specifically to cells overexpressing HER2. Methods: TMAB was covalently linked to a PAMAM dendrimer via bifunctional polyethylene glycol (PEG. PTX was conjugated to PAMAM using succinic anhydride as a cross-linker, yielding TMAB-PEG-PAMAM-PTX. Dynamic light scattering and transmission electron microscopy were used to characterize the conjugates. The cellular uptake and in vivo biodistribution were studied by fluorescence microscopy, flow cytometry, and Carestream In Vivo FX, respectively. Results: Nuclear magnetic resonance spectroscopy demonstrated that PEG, PTX, fluorescein isothiocyanate, and cyanine7 were conjugated to PAMAM. Ultraviolet-visible spectroscopy and sodium dodecyl sulfate polyacrylamide gel electrophoresis demonstrated that TMAB was conjugated to PEG-PAMAM. Dynamic light scattering and transmission electron microscopy measurements revealed that the different conjugates ranged in size between 10 and 35 nm and had a spherical shape. In vitro cellular uptake demonstrated that the TMAB-conjugated PAMAM was taken up by HER2-overexpressing BT474 cells more efficiently than MCF-7 cells that expressed lower levels of HER2. Co-localization experiments indicated that TMAB-conjugated PAMAM was

  11. Alternative Sources of Adult Stem Cells: Human Amniotic Membrane (United States)

    Wolbank, Susanne; van Griensven, Martijn; Grillari-Voglauer, Regina; Peterbauer-Scherb, Anja

    Human amniotic membrane is a highly promising cell source for tissue engineering. The cells thereof, human amniotic epithelial cells (hAEC) and human amniotic mesenchymal stromal cells (hAMSC), may be immunoprivileged, they represent an early developmental status, and their application is ethically uncontroversial. Cell banking strategies may use freshly isolated cells or involve in vitro expansion to increase cell numbers. Therefore, we have thoroughly characterized the effect of in vitro cultivation on both phenotype and differentiation potential of hAEC. Moreover, we present different strategies to improve expansion including replacement of animal-derived supplements by human platelet products or the introduction of the catalytic subunit of human telomerase to extend the in vitro lifespan of amniotic cells. Characterization of the resulting cultures includes phenotype, growth characteristics, and differentiation potential, as well as immunogenic and immunomodulatory properties.

  12. Effects of recombinant human epidermal growth factor on the proliferation and radiation survival of human fibroblast cell lines in vitro

    International Nuclear Information System (INIS)

    Kim, Hyun Sook; Kang, Ki Mun; Na, Jae Boem; Chai, Gyu Young; Lee, Sang Wook


    To explore the effect of recombinant human EGF on the proliferation and survival of human fibroblast cell lines following irradiation. Fibroblast was originated human skin and primary cultured. The trypan blue stain assay and MTT assay were used to study the proliferative effects of EGF on human fibroblast cell lines in vitro. An incubation of fibroblasts with rhEGF for 24 hours immediately after irradiation was counted everyday. Cell cycle distributions were analyzed by FACS analysis. Number of fibroblast was significant more increased rhEGF (1.0 nM, 10 nM, 100 nM, 1,000 nM) treated cell than control after 8 Gy irradiation. Most effective dose of rhEGF was at 160 nM. These survival differences were maintained at 1 week later. Proportion of S phase was significantly increased on rhEGF treated cells. rhEGF cause increased fibroblast proliferation following irradiation. We expect that rhEGF was effective for radiation induced wound healing

  13. Autophagy participates in isoliquiritigenin-induced melanin degradation in human epidermal keratinocytes through PI3K/AKT/mTOR signaling. (United States)

    Yang, Zhibo; Zeng, Biyun; Pan, Yi; Huang, Pan; Wang, Chang


    Melanin is the pigment responsible for the color of human skin and hair. Melanin serves as a double-edge sword which can exert both protective and spot-causing effects on skin. Although melanin has an important role in protecting the skin against UV damage, an excessive or uneven melanin production can lead to the formation of freckles and age spots. Isoliquiritigenin (ISL) has been reported to inhibit melanin synthesis; however, its role in melanin degradation remains unclear. In the present study, we evaluated the detailed function of ISL in melanin degradation in human epidermal keratinocytes. Since autophagy has been reported to be related to melanin degradation, we also examined the activation of autophagy by ISL treatment in keratinocytes by measurement of autophagy-related proteins, ATG7, LC3 and p62. Moreover, si-ATG7-induced ATG7 knockdown and autophagy inhibitor 3-MA decreased LC3 II protein levels and increased PMEL17, p62 and melanin levels in HaCaT cells, which could be partially reversed by ISL treatment, indicating that autophagy participated in melanin degradation. The decreased p-AKT and p-mTOR proteins upon ISL treatment indicated the involvement of PI3K/AKT/mTOR signaling in ISL-induced melanin degradation. Taken together, we demonstrated that autophagy participates in ISL-induced melanin degradation in human epidermal keratinocytes through PI3K/AKT/mTOR signaling. Copyright © 2017. Published by Elsevier Masson SAS.

  14. Radiosensitivity of angiogenic and mitogenic factors in human amniotic membrane

    International Nuclear Information System (INIS)

    Deocaris, Custer C.; De Guzman, Zenaida M.; Deocaris, Chester C.; Jacinto, Sonia D.


    Amniotic membrane as a temporary biological dressing remains as a beneficial and cost-effective means of treating burns in developing countries. This medical application is attributed mainly to placental structural and biochemical features that are important for maintaining proper embryonic development. Since fresh amnions are nevertheless for straightforward clinical use and for preservation, radiation-sterilization is been performed to improve the safety of this placental material. However, like any other sterilization method, gamma-radiation may induce physical and chemical changes that may influence the biological property of the material. Thus, the aim of this study is to compare the effects of various levels of radiation-sterilization protocols for human amnions on angiogenic (neovascularization) and epithelial-mitogenic activities, both of which are physiological processes fundamental to wound healing. Water-soluble extract of non-irradiated amnions demonstrates a strong stimulatory effect on both cell proliferation and angiogenesis. No change in biological activity is seen in amnions irradiated at 25 kGy, the sterilization dose used by the Philippine Nuclear Research Institute (PNRI) for the production of radiation-sterilized human amniotic membranes (RSHAM). However, it appears that amniotic angiogenic factors are more radiosensitive than its mitogenic components, evident from the depressed vascularization of the chorioallantoic membrane (CAM) exposed to 35 kGy-irradiated amnions. The dose of 35 kGy is at present the medical sterilization dose used at the Central Tissue Bank in Warsaw (Poland) for the preparation of their amnion allografts. (Authors)

  15. Basement membrane abnormalities in human eyes with diabetic retinopathy

    DEFF Research Database (Denmark)

    Ljubimov, A V; Burgeson, R E; Butkowski, R J


    Vascular and parenchymal basement membranes (BMs) are thickened in diabetes, but alterations in individual BM components in diabetic eyes, especially in diabetic retinopathy (DR), are obscure. To identify abnormalities in the distribution of specific constituents, we analyzed cryostat sections...... of human eyes obtained at autopsy (seven normal, five diabetic without DR, and 13 diabetic with DR) by immunofluorescence with antibodies to 30 BM and extracellular matrix components. In non-DR eyes, no qualitative changes of ocular BM components were seen. In some DR corneas, epithelial BM was stained...... discontinuously for laminin-1, entactin/nidogen, and alpha3-alpha4 Type IV collagen, in contrast to non-DR corneas. Major BM alterations were found in DR retinas compared to normals and non-DR diabetics. The inner limiting membrane (retinal BM) of DR eyes had accumulations of fibronectin (including cellular...

  16. Human epidermal growth factor receptor 2/neu overexpression in urothelial carcinoma of the bladder and its prognostic significance: Is it worth hype?

    Directory of Open Access Journals (Sweden)

    Santosh Kumar


    Full Text Available Aims: In urothelial tumors of the urinary bladder, human epidermal growth factor receptor 2 (HER-2/neu expression has been reported over 10 years, but there is no clear correlation between prognosis and recurrence rate. The present study evaluates prognostic implication of HER-2/neu expression. Subjects and Methods: In this study, 100 formalin-fixed paraffin-embedded specimens of primary transitional cell carcinoma of the bladder were processed. HER-2/neu monoclonal antibody immunohistochemistry staining procedure used for the study. Results: A total of 70 (70% patients were positive for overexpression of HER-2/neu. HER-2/neu was positive in patients with 42 (70% superficial tumor, 28 (70% muscle invasive tumor, 41 (75.9% high-grade tumor, 29 (63% low grade tumor, 31 (68.9% recurrent tumor, and 6 (66.6% had positive lymph nodes. Conclusions: Human epidermal growth factor receptor 2/neu over expression was not correlated with the tumor stage, lymphnode metastasis or recurrence of the disease. HER-2/neu overexpression was statistically insignificantly correlated with the differentiation grade (P < 0.161 as compared to previous studies. Future studies on HER-2 expression with chemo-sensitivity and efficacy of HER-2-targeted therapies in urothelial carcinomas is needed.

  17. Functional imaging of human epidermal growth factor receptor 2-positive metastatic breast cancer using (64)Cu-DOTA-trastuzumab PET. (United States)

    Mortimer, Joanne E; Bading, James R; Colcher, David M; Conti, Peter S; Frankel, Paul H; Carroll, Mary I; Tong, Shan; Poku, Erasmus; Miles, Joshua K; Shively, John E; Raubitschek, Andrew A


    Women with human epidermal growth factor receptor 2 (HER2)-positive breast cancer are candidates for treatment with the anti-HER2 antibody trastuzumab. Assessment of HER2 status in recurrent disease is usually made by core needle biopsy of a single lesion, which may not represent the larger tumor mass or other sites of disease. Our long-range goal is to develop PET of radiolabeled trastuzumab for systemically assessing tumor HER2 expression and identifying appropriate use of anti-HER2 therapies. The purpose of this study was to evaluate PET/CT of (64)Cu-DOTA-trastuzumab for detecting and measuring tumor uptake of trastuzumab in patients with HER2-positive metastatic breast cancer. Eight women with biopsy-confirmed HER2-positive metastatic breast cancer and no anti-HER2 therapy for 4 mo or longer underwent complete staging, including (18)F-FDG PET/CT. For 6 of the 8 patients, (64)Cu-DOTA-trastuzumab injection (364-512 MBq, 5 mg of trastuzumab) was preceded by trastuzumab infusion (45 mg). PET/CT (PET scan duration 1 h) was performed 21-25 (day 1) and 47-49 (day 2) h after (64)Cu-DOTA-trastuzumab injection. Scan fields of view were chosen on the basis of (18)F-FDG PET/CT. Tumor detection sensitivity and uptake analyses were limited to lesions identifiable on CT; lesions visualized relative to adjacent tissue on PET were considered PET-positive. Radiolabel uptake in prominent lesions was measured as maximum single-voxel standardized uptake value (SUVmax). Liver uptake of (64)Cu was reduced approximately 75% with the 45-mg trastuzumab predose, without significant effect on tumor uptake. The study included 89 CT-positive lesions. Detection sensitivity was 77%, 89%, and 93% for day 1, day 2, and (18)F-FDG, respectively. On average, tumor uptake was similar for (64)Cu-DOTA-trastuzumab and (18)F-FDG (SUVmax and range, 8.1 and 3.0-22.5 for day 1 [n = 48]; 8.9 and 0.9-28.9 for day 2 [n = 38]; 9.7 and 3.3-25.4 for (18)F-FDG [n = 56]), but same-lesion SUVmax was not correlated

  18. Influence of estrogenic pesticides on membrane integrity and membrane transfer of monosaccharide into the human red cell

    International Nuclear Information System (INIS)

    Ingermann, R.L.


    Some natural and synthetic estrogens inhibit carrier-mediated transport of glucose into human red blood cells and membrane vesicles from the placenta. The inhibitory action of these estrogens on transport appears to be a direct effect at the membrane and does not involve receptor binding and protein synthesis. It is not clear, however, whether such inhibition is a common feature among estrogenic agents. Several chlorinated hydrocarbon pesticides have been shown to possess estrogenic activity. These pesticides could have inhibitory effects on the human sodium-independent glucose transporter. Owing to the apparent importance of this membrane transporter in human tissues, direct interaction of hormones and xenobiotics with the glucose transporter is of fundamental significance. Some pesticides have been shown to alter membrane structure directly and alter the passive permeability of membranes. Whether the estrogenic pesticides influence passive diffusion of sugars across membranes has not been established. Finally, preliminary observations have suggested that some estrogens and pesticides have lytic effects on intact cells. Consequently, this study focuses on the ability of several estrogens and estrogenic pesticides to disrupt the cell membrane, influence the monosaccharide transporter, and alter the rate of monosaccharide permeation through the membrane by simple diffusion

  19. The cell-penetrating peptide domain from human heparin-binding epidermal growth factor-like growth factor (HB-EGF) has anti-inflammatory activity in vitro and in vivo

    International Nuclear Information System (INIS)

    Lee, Jue-Yeon; Seo, Yoo-Na; Park, Hyun-Jung; Park, Yoon-Jeong; Chung, Chong-Pyoung


    Highlights: ► HBP sequence identified from HB-EGF has cell penetration activity. ► HBP inhibits the NF-κB dependent inflammatory responses. ► HBP directly blocks phosphorylation and degradation of IκBα. ► HBP inhibits nuclear translocation of NF-κB p65 subunit. -- Abstract: A heparin-binding peptide (HBP) sequence from human heparin-binding epidermal growth factor-like growth factor (HB-EGF) was identified and was shown to exhibit cell penetration activity. This cell penetration induced an anti-inflammatory reaction in lipopolysaccharide (LPS)-treated RAW 264.7 macrophages. HBP penetrated the cell membrane during the 10 min treatment and reduced the LPS-induced production of nitric oxide (NO), inducible nitric oxide synthase (iNOS), and cytokines (TNF-α and IL-6) in a concentration-dependent manner. Additionally, HBP inhibited the LPS-induced upregulation of cytokines, including TNF-α and IL-6, and decreased the interstitial infiltration of polymorphonuclear leukocytes in a lung inflammation model. HBP inhibited NF-κB-dependent inflammatory responses by directly blocking the phosphorylation and degradation of IκBα and by subsequently inhibiting the nuclear translocation of the p65 subunit of NF-κB. Taken together, this novel HBP may be potentially useful candidate for anti-inflammatory treatments and can be combined with other drugs of interest to transport attached molecules into cells.

  20. Cultivation and irradiation of human fibroblasts in a medium enriched with platelet lysate for obtaining feeder layer in epidermal cell culture

    International Nuclear Information System (INIS)

    Yoshito, Daniele


    For over 30 years, the use of culture medium, enriched with bovine serum, and murines fibroblasts, with the rate of proliferation controlled by irradiation or by share anticarcinogenic drugs, has been playing successfully its role in assisting in the development of keratinocytes in culture, for clinical purposes. However, currently there is a growing concern about the possibility of transmitting prions and animals viruses to transplanted patients. Taking into account this concern, the present work aims to cultivate human fibroblasts in a medium enriched with human platelets lysate and determine the irradiation dose of these cells, for obtaining feeder layer in epidermal cell culture. For carrying out the proposed objective, platelets lysis has standardized, this lysate was used for human fibroblasts cultivation and the irradiation dose enough to inhibit its duplication was evaluated. Human keratinocytes were cultivated in these feeder layers, in culture medium enriched with the lysate. With these results we conclude that the 10% platelets lysate promoted a better adhesion and proliferation of human fibroblasts and in all dose levels tested (60 to 300 Gy), these had their mitotic activity inactivated by ionizing irradiation, being that the feeder layers obtained with doses from 70 to 150 Gy were those that provided the best development of keratinocytes in medium containing 2.5% of human platelet lysate. Therefore, it was possible to standardize both the cultivation of human fibroblasts as its inactivation for use as feeder layer in culture of keratinocytes, so as to eliminate xenobiotics components. (author)

  1. Stevens-Johnson Syndrome (SJS) and Toxic Epidermal Necrolysis ...

    African Journals Online (AJOL)

    REVIEW. Introduction. Stevens-Johnson syndrome (SJS) and toxic epidermal ... that affect the skin and mucous membranes. ... Open Access article distributed under the terms of the .... pathogenic components are removed from plasma. The.

  2. Lipid-protein interactions in plasma membranes of fiber cells isolated from the human eye lens. (United States)

    Raguz, Marija; Mainali, Laxman; O'Brien, William J; Subczynski, Witold K


    The protein content in human lens membranes is extremely high, increases with age, and is higher in the nucleus as compared with the cortex, which should strongly affect the organization and properties of the lipid bilayer portion of intact membranes. To assess these effects, the intact cortical and nuclear fiber cell plasma membranes isolated from human lenses from 41- to 60-year-old donors were studied using electron paramagnetic resonance spin-labeling methods. Results were compared with those obtained for lens lipid membranes prepared from total lipid extracts from human eyes of the same age group [Mainali, L., Raguz, M., O'Brien, W. J., and Subczynski, W. K. (2013) Biochim. Biophys. Acta]. Differences were considered to be mainly due to the effect of membrane proteins. The lipid-bilayer portions of intact membranes were significantly less fluid than lipid bilayers of lens lipid membranes, prepared without proteins. The intact membranes were found to contain three distinct lipid environments termed the bulk lipid domain, boundary lipid domain, and trapped lipid domain. However, the cholesterol bilayer domain, which was detected in cortical and nuclear lens lipid membranes, was not detected in intact membranes. The relative amounts of bulk and trapped lipids were evaluated. The amount of lipids in domains uniquely formed due to the presence of membrane proteins was greater in nuclear membranes than in cortical membranes. Thus, it is evident that the rigidity of nuclear membranes is greater than that of cortical membranes. Also the permeability coefficients for oxygen measured in domains of nuclear membranes were significantly lower than appropriate coefficients measured in cortical membranes. Relationships between the organization of lipids into lipid domains in fiber cells plasma membranes and the organization of membrane proteins are discussed. Copyright © 2014 Elsevier Ltd. All rights reserved.

  3. The biological activity of the human epidermal growth factor receptor is positively regulated by its C-terminal tyrosines

    DEFF Research Database (Denmark)

    Helin, K; Velu, T; Martin, P


    mutants in the full length receptor. EGF-dependent transforming ability of the single point mutants is similar to that of the wild type, while that of double mutants is decreased and an even lower activity is present in the triple mutant. In each bioassay, including EGF-dependent focal transformation...... biologically. The EGF-R kinase activity is affected by tyrosine substitution since in vitro phosphorylation of exogenous substrates is reduced in the double and triple mutants. Autophosphorylation, in vivo and in vitro, is also reduced, but not totally abolished in the triple point mutant and Dc123 indicating......The epidermal growth factor receptor (EGF-R) C-terminus contains three conserved tyrosines (Y-1068, Y-1148, Y-1173) which are phosphorylated upon EGF activation. To clarify the functional role of these tyrosines, each has been mutated to phenylalanine and studied as single, double and triple...

  4. Toxic epidermal necrolysis successfully treated with etanercept. (United States)

    Gubinelli, Emanuela; Canzona, Flora; Tonanzi, Tiziano; Raskovic, Desanka; Didona, Biagio


    Toxic epidermal necrolysis (TEN) is a rare and acute severe adverse reaction to drugs, characterised by massive apoptosis and widespread epidermal and mucosal detachment. Although no gold standard therapy exists, human i.v. immunoglobulins have recently been described as an effective treatment for this disease. We report a case of phenobarbital-induced TEN in a 59-year-old white woman where the epidermal detachment stopped 48 h after beginning the etanercept treatment with complete healing after 20 days. To the best of our knowledge, this is only the second reported case of TEN successfully treated with etanercept.

  5. Treatment challenges for community oncologists treating postmenopausal women with endocrine-resistant, hormone receptor-positive, human epidermal growth factor receptor 2-negative advanced breast cancer

    International Nuclear Information System (INIS)

    Gradishar, William J


    Community-based oncologists are faced with challenges and opportunities when delivering quality patient care, including high patient volumes and diminished resources; however, there may be the potential to deliver increased patient education and subsequently improve outcomes. This review discusses the treatment of postmenopausal women with endocrine-resistant, hormone receptor-positive, human epidermal growth factor receptor 2- negative advanced breast cancer in order to illustrate considerations in the provision of pertinent quality education in the treatment of these patients and the management of therapy-related adverse events. An overview of endocrine-resistant breast cancer and subsequent treatment challenges is also provided. Approved treatment options for endocrine-resistant breast cancer include hormonal therapies and mammalian target of rapamycin inhibitors. Compounds under clinical investigation are also discussed

  6. Establishment and characterization of a new cell line, FPS-1, derived from human undifferentiated pleomorphic sarcoma, overexpressing epidermal growth factor receptor and cyclooxygenase-2. (United States)

    Hakozaki, Michiyuki; Hojo, Hiroshi; Sato, Michiko; Tajino, Takahiro; Yamada, Hitoshi; Kikuchi, Shinichi; Abe, Masafumi


    Undifferentiated pleomorphic sarcoma (UPS) is among the most common soft tissue sarcomas in adults. In order to improve its aggressive course or prognosis and establish new therapeutic methods, molecular genetic and biological characterizations of UPS are required. A new human UPS cell line (FPS-1) was established from UPS of the upper arm of a 79-year-old man. The cell line has been maintained for over 14 months with more than 60 passages. FPS-1 cells were characterized using molecular biological methods. FPS-1 cells showed the same morphological and immunophenotypical characteristics as the primary tumor. Cytogenetic and molecular analyses revealed a nonsense mutation in exon 6 of the p53 gene. Epidermal growth factor receptor (EGFR) and cyclooxygenase-2 (COX-2) were expressed in FPS-1 cells. FPS-1 cells might be useful for investigating biological behavior and developing new molecular targeting antitumor drugs for UPS with EGFR or COX-2 expression.

  7. Response to Therapy and Outcomes in Oropharyngeal Cancer Are Associated With Biomarkers Including Human Papillomavirus, Epidermal Growth Factor Receptor, Gender, and Smoking

    International Nuclear Information System (INIS)

    Kumar, Bhavna; Cordell, Kitrina G.; Lee, Julia S.; Prince, Mark E.; Tran, Huong H.; Wolf, Gregory T.; Urba, Susan G.; Worden, Francis P.; Chepeha, Douglas B.; Teknos, Theodoros N.; Eisbruch, Avraham; Tsien, Christina I.; Taylor, Jeremy; D'Silva, Nisha J.; Yang, Kun; Kurnit, David M.; Bradford, Carol R.


    Induction chemotherapy and concurrent chemoradiation for responders or immediate surgery for non-responders is an effective treatment strategy head and neck squamous cell carcinoma (HNSCC) of the larynx and oropharynx. Biomarkers that predict outcome would be valuable in selecting patients for therapy. In this study, the presence and titer of high risk human papilloma virus (HPV) and expression of epidermal growth factor receptor (EGFR) in pre-treatment biopsies, as well as smoking and gender were examined in oropharynx cancer patients enrolled in an organ sparing trial. HPV16 copy number was positively associated with response to therapy and with overall and disease specific survival, whereas EGFR expression, current or former smoking behavior, and female gender (in this cohort) were associated with poor response and poor survival in multivariate analysis. Smoking cessation and strategies to target EGFR may be useful adjuncts for therapy to improve outcome in the cases with the poorest biomarker profile

  8. Trastuzumab beyond progression in human epidermal growth factor receptor 2-positive advanced breast cancer: a german breast group 26/breast international group 03-05 study

    DEFF Research Database (Denmark)

    von Minckwitz, Gunter; du Bois, Andreas; Schmidt, Marcus


    PURPOSE: Trastuzumab shows clinical activity in human epidermal growth factor receptor 2 (HER-2)-positive early and advanced breast cancer. In the German Breast Group 26/Breast International Group 03-05 trial, we investigated if trastuzumab treatment should be continued beyond progression. METHODS......: Patients with HER-2-positive breast cancer that progresses during treatment with trastuzumab were randomly assigned to receive capecitabine (2,500 mg/m(2) body-surface area on days 1 through 14 [1,250 mg/m(2) semi-daily]) alone or with continuation of trastuzumab (6 mg/kg body weight) in 3-week cycles....... The primary end point was time to progression. RESULTS: We randomly assigned 78 patients to capecitabine and 78 patients to capecitabine plus trastuzumab. Sixty-five events and 38 deaths in the capecitabine group and 62 events and 33 deaths in the capecitabine-plus-trastuzumab group occurred during 15...

  9. Prognostic significance of equivocal human epidermal growth factor receptor 2 results and clinical utility of alternative chromosome 17 genes in patients with invasive breast cancer: A cohort study. (United States)

    Sneige, Nour; Hess, Kenneth R; Multani, Asha S; Gong, Yun; Ibrahim, Nuhad K


    The 2013 testing guidelines for determining the human epidermal growth factor receptor 2 (HER2) status include new cutoff points for the HER2/chromosome enumeration probe 17 (CEP17) ratio and the average HER2 copy number per cell, and they recommend using a reflex test with alternative chromosome 17 probes (Ch17Ps) to resolve equivocal HER2 results. This study sought to determine the clinical utility of alternative Ch17Ps in equivocal cases and the effects of equivocal results and/or a change in the HER2 status on patients' outcomes. The University of Texas MD Anderson Cancer Center database of HER2 dual-probe fluorescence in situ hybridization results from 2000 to 2010 was searched for cases of invasive breast cancer with HER2/CEP17 ratios Cancer 2017;123:1115-1123. © 2016 American Cancer Society. © 2016 American Cancer Society.

  10. A practical guide for the identification of membrane and plasma membrane proteins in human embryonic stem cells and human embryonal carcinoma cells. (United States)

    Dormeyer, Wilma; van Hoof, Dennis; Mummery, Christine L; Krijgsveld, Jeroen; Heck, Albert J R


    The identification of (plasma) membrane proteins in cells can provide valuable insights into the regulation of their biological processes. Pluripotent cells such as human embryonic stem cells and embryonal carcinoma cells are capable of unlimited self-renewal and share many of the biological mechanisms that regulate proliferation and differentiation. The comparison of their membrane proteomes will help unravel the biological principles of pluripotency, and the identification of biomarker proteins in their plasma membranes is considered a crucial step to fully exploit pluripotent cells for therapeutic purposes. For these tasks, membrane proteomics is the method of choice, but as indicated by the scarce identification of membrane and plasma membrane proteins in global proteomic surveys it is not an easy task. In this minireview, we first describe the general challenges of membrane proteomics. We then review current sample preparation steps and discuss protocols that we found particularly beneficial for the identification of large numbers of (plasma) membrane proteins in human tumour- and embryo-derived stem cells. Our optimized assembled protocol led to the identification of a large number of membrane proteins. However, as the composition of cells and membranes is highly variable we still recommend adapting the sample preparation protocol for each individual system.

  11. Immunochemical identification of human trophoblast membrane antigens using monoclonal antibodies

    Energy Technology Data Exchange (ETDEWEB)

    Brown, P J; Molloy, C M; Johnson, P M [Liverpool Univ. (UK). Dept. of Immunology


    Human trophoblast membrane antigens recognised by monoclonal antibodies (H310, H315, H316 and H317) have been identified using combinations of radioimmunoprecipitation, SDS-PAGE, electroblotting, chromatographic and ELISA-type techniques. H317 is known to identify heat-stable placental-type alkaline phosphatase and accordingly was shown to react with a protein of subunit Msub(r) of 68000. H310 and H316 both recognise an antigen with a subunit Msub(r) of 34000 under reducing conditions. In non-reducing conditions, the H310/316 antigen gave oligomers of a component of Msub(r) 62000. It is unknown whether this 62000 dalton component is a dimer of the 34000 dalton protein with either itself or a second protein chain of presumed Msub(r) around 28000. H315 recognises an antigen with subunit Msub(r) of 36000; in non-reducing conditions this component readily associates to oligomeric structures. The epitope recognised by H315 may be sensitive to SDS. The two proteins recognised by H310/316 and H315 have been termed the p34 and p36 trophoblast membrane proteins, respectively.

  12. The Membrane-anchored Serine Protease Prostasin (CAP1/PRSS8) Supports Epidermal Development and Postnatal Homeostasis Independent of Its Enzymatic Activity

    DEFF Research Database (Denmark)

    Peters, Diane E; Szabo, Roman; Friis, Stine


    The membrane-anchored serine protease prostasin (CAP1/PRSS8) is part of a cell surface proteolytic cascade that is essential for epithelial barrier formation and homeostasis. Here, we report the surprising finding that prostasin executes these functions independent of its own enzymatic activity. ...

  13. Cell-cell adhesion mediated by binding of membrane-anchored transforming growth factor α to epidermal growth factor receptors promotes cell proliferation

    International Nuclear Information System (INIS)

    Anklesaria, P.; Greenberger, J.S.; Teixido, J.; Laiho, M.; Massague, J.; Pierce, J.H.


    The precursor for transforming growth factor α, pro-TGF-α, is a cell surface glycoprotein that can establish contact with epidermal growth factor (EGF) receptors on adjacent cells. To examine whether the pro-TGF-α/EGF receptor pair can simultaneously mediate cell adhesion and promote cell proliferation, the authors have expressed pro-TGF-α in a bone marrow stromal cell line labeled with [ 35 S] cysteine. Expression of pro-TGF-α allows these cells to support long-term attachment of an EGF/interleukin-3-dependent hematopoietic progenitor cell line that expresses EGF receptors but is unable to adhere to normal stroma. This interaction is inhibited by soluble EGF receptor ligands. Further, the hematopoietic progenitor cells replicate their DNA while they are attached to the stromal cell layer and become foci of sustained cell proliferation. Thus, pro-TGF-α and the EGF receptor can function as mediators of intercellular adhesion and this interaction may promote a mitogenic response. They propose the term juxtacrine to designate this form of stimulation between adjacent cells

  14. Gemcitabine Plus Docetaxel Versus Docetaxel in Patients With Predominantly Human Epidermal Growth Factor Receptor 2-Negative Locally Advanced or Metastatic Breast Cancer: A Randomized, Phase III Study by the Danish Breast Cancer Cooperative Group

    DEFF Research Database (Denmark)

    Nielsen, Dorte L; Bjerre, Karsten D; Jakobsen, Erik H


    PURPOSE The objective of this phase III study was to compare the efficacy of gemcitabine plus docetaxel (GD) versus docetaxel in patients with advanced breast cancer. PATIENTS AND METHODS Predominantly human epidermal growth factor receptor 2 (HER2) -negative patients were randomly assigned...

  15. A comprehensive two-dimensional gel protein database of noncultured unfractionated normal human epidermal keratinocytes: towards an integrated approach to the study of cell proliferation, differentiation and skin diseases

    DEFF Research Database (Denmark)

    Celis, J E; Madsen, Peder; Rasmussen, H H


    A two-dimensional (2-D) gel database of cellular proteins from noncultured, unfractionated normal human epidermal keratinocytes has been established. A total of 2651 [35S]methionine-labeled cellular proteins (1868 isoelectric focusing, 783 nonequilibrium pH gradient electrophoresis) were resolved...

  16. Herceptin Enhances the Antitumor Effect of Natural Killer Cells on Breast Cancer Cells Expressing Human Epidermal Growth Factor Receptor-2

    Directory of Open Access Journals (Sweden)

    Xiao Tian


    Full Text Available Optimal adoptive cell therapy (ACT should contribute to effective cancer treatment. The unique ability of natural killer (NK cells to kill cancer cells independent of major histocompatibility requirement makes them suitable as ACT tools. Herceptin, an antihuman epidermal growth factor receptor-2 (anti-HER2 monoclonal antibody, is used to treat HER2+ breast cancer. However, it has limited effectiveness and possible severe cardiotoxicity. Given that Herceptin may increase the cytotoxicity of lymphocytes, we explored the possible augmentation of NK cell cytotoxicity against HER2+ breast cancer cells by Herceptin. We demonstrated that Herceptin could interact with CD16 on NK cells to expand the cytotoxic NK (specifically, CD56dim cell population. Additionally, Herceptin increased NK cell migration and cytotoxicity against HER2+ breast cancer cells. In a pilot study, Herceptin-treated NK cells shrunk lung nodular metastasis in a woman with HER2+ breast cancer who could not tolerate the cardiotoxic side effects of Herceptin. Our findings support the therapeutic potential of Herceptin-treated NK cells in patients with HER2+ and Herceptin-intolerant breast cancer.

  17. Ultra-weak photon emission as a non-invasive tool for monitoring of oxidative processes in the epidermal cells of human skin: comparative study on the dorsal and the palm side of the hand. (United States)

    Rastogi, Anshu; Pospísil, Pavel


    All living organisms emit spontaneous ultra-weak photon emission as a result of cellular metabolic processes. Exposure of living organisms to exogenous factors results in oxidative processes and enhancement in ultra-weak photon emission. Here, hydrogen peroxide (H(2)O(2)), as a strongly oxidizing molecule, was used to induce oxidative processes and enhance ultra-weak photon emission in human hand skin. The presented work intends to compare both spontaneous and peroxide-induced ultra-weak photon emission from the epidermal cells on the dorsal and the palm side of the hand. A highly sensitive photomultiplier tube and a charge-coupled device camera were used to detect ultra-weak photon emission from human hand skin. Spontaneous ultra-weak photon emission from the epidermal cells on the dorsal side of the hand was 4 counts/s. Topical application of 500 mM H(2)O(2) to the dorsal side of the hand caused enhancement in ultra-weak photon emission to 40 counts/s. Interestingly, both spontaneous and peroxide-induced ultra-weak photon emission from the epidermal cells on the palm side of the hand were observed to increase twice their values, i.e. 8 and 80 counts/s, respectively. Similarly, the two-dimensional image of ultra-weak photon emission observed after topical application of H(2)O(2) to human skin reveals that photon emission from the palm side exceeds the photon emission from the dorsal side of the hand. The results presented indicate that the ultra-weak photon emission originating from the epidermal cells on the dorsal and the palm side of the hand is related to the histological structure of the human hand skin. Ultra-weak photon emission is shown as a non-destructive technique for monitoring of oxidative processes in the epidermal cells of the human hand skin and as a diagnostic tool for skin diseases.

  18. Real-time three-dimensional imaging of epidermal splitting and removal by high-definition optical coherence tomography. (United States)

    Boone, Marc; Draye, Jean Pierre; Verween, Gunther; Pirnay, Jean-Paul; Verbeken, Gilbert; De Vos, Daniel; Rose, Thomas; Jennes, Serge; Jemec, Gregor B E; Del Marmol, Véronique


    While real-time 3-D evaluation of human skin constructs is needed, only 2-D non-invasive imaging techniques are available. The aim of this paper is to evaluate the potential of high-definition optical coherence tomography (HD-OCT) for real-time 3-D assessment of the epidermal splitting and decellularization. Human skin samples were incubated with four different agents: Dispase II, NaCl 1 M, sodium dodecyl sulphate (SDS) and Triton X-100. Epidermal splitting, dermo-epidermal junction, acellularity and 3-D architecture of dermal matrices were evaluated by High-definition optical coherence tomography before and after incubation. Real-time 3-D HD-OCT assessment was compared with 2-D en face assessment by reflectance confocal microscopy (RCM). (Immuno) histopathology was used as control. HD-OCT imaging allowed real-time 3-D visualization of the impact of selected agents on epidermal splitting, dermo-epidermal junction, dermal architecture, vascular spaces and cellularity. RCM has a better resolution (1 μm) than HD-OCT (3 μm), permitting differentiation of different collagen fibres, but HD-OCT imaging has deeper penetration (570 μm) than RCM imaging (200 μm). Dispase II and NaCl treatments were found to be equally efficient in the removal of the epidermis from human split-thickness skin allografts. However, a different epidermal splitting level at the dermo-epidermal junction could be observed and confirmed by immunolabelling of collagen type IV and type VII. Epidermal splitting occurred at the level of the lamina densa with dispase II and above the lamina densa (in the lamina lucida) with NaCl. The 3-D architecture of dermal papillae and dermis was more affected by Dispase II on HD-OCT which corresponded with histopathologic (orcein staining) fragmentation of elastic fibres. With SDS treatment, the epidermal removal was incomplete as remnants of the epidermal basal cell layer remained attached to the basement membrane on the dermis. With Triton X-100 treatment

  19. Incorporation of Human Recombinant Tropoelastin into Silk Fibroin Membranes with the View to Repairing Bruch’s Membrane

    Directory of Open Access Journals (Sweden)

    Audra M. A. Shadforth


    Full Text Available Bombyx mori silk fibroin membranes provide a potential delivery vehicle for both cells and extracellular matrix (ECM components into diseased or injured tissues. We have previously demonstrated the feasibility of growing retinal pigment epithelial cells (RPE on fibroin membranes with the view to repairing the retina of patients afflicted with age-related macular degeneration (AMD. The goal of the present study was to investigate the feasibility of incorporating the ECM component elastin, in the form of human recombinant tropoelastin, into these same membranes. Two basic strategies were explored: (1 membranes prepared from blended solutions of fibroin and tropoelastin; and (2 layered constructs prepared from sequentially cast solutions of fibroin, tropoelastin, and fibroin. Optimal conditions for RPE attachment were achieved using a tropoelastin-fibroin blend ratio of 10 to 90 parts by weight. Retention of tropoelastin within the blend and layered constructs was confirmed by immunolabelling and Fourier-transform infrared spectroscopy (FTIR. In the layered constructs, the bulk of tropoelastin was apparently absorbed into the initially cast fibroin layer. Blend membranes displayed higher elastic modulus, percentage elongation, and tensile strength (p < 0.01 when compared to the layered constructs. RPE cell response to fibroin membranes was not affected by the presence of tropoelastin. These findings support the potential use of fibroin membranes for the co-delivery of RPE cells and tropoelastin.

  20. Suppression of the epidermal growth factor receptor inhibits epithelial-mesenchymal transition in human pancreatic cancer PANC-1 cells. (United States)

    Chang, Zhi-Gang; Wei, Jun-Min; Qin, Chang-Fu; Hao, Kun; Tian, Xiao-Dong; Xie, Kun; Xie, Xue-Hai; Yang, Yin-Mo


    Aberrant expression of epidermal growth factor receptor (EGFR) has been detected in pancreatic cancer; however, the mechanisms of EGFR in inducing pancreatic cancer development have not been adequately elucidated. The objective of this study was to determine the role of EGFR in mediating epithelial-mesenchymal transition (EMT) in pancreatic cancer cells. Pancreatic cancer cell line PANC-1 was transfected with small interfering RNA of EGFR by use of a lentiviral expression vector to establish an EGFR-knockdown cell line (si-PANC-1). PANC-1 cells transfected with lentiviral vector expressing negative control sequence were used as negative control (NC-PANC-1). Scratch assay and transwell study were used to analyze cell migration and invasion. Real-time PCR and Western blotting were used to detect the expression of EMT markers E-cadherin, N-cadherin, vimentin, and fibronectin and transcription factors snail, slug, twist1, and sip1 in PANC-1, NC-PANC-1, and si-PANC-1 cells. Immunofluorescent staining with these antibodies and confocal microscopy were used to observe their cellular location and morphologic changes. After RNA interference of EGFR, the migration and invasion ability of si-PANC-1 cells decreased significantly. The expression of epithelial phenotype marker E-cadherin increased and the expression of mesenchymal phenotype markers N-cadherin, vimentin, and fibronectin decreased, indicating reversion of EMT. We also observed intracellular translocation of E-cadherin. Expression of transcription factors snail and slug in si-PANC-1 cells decreased significantly. Suppression of EGFR expression can significantly inhibit EMT of pancreatic cancer PANC-1 cells. The mechanism may be related with the down-regulation of the expression of transcription factors snail and slug.

  1. Inositol phosphates influence the membrane bound Ca2+/Mg2+ stimulated ATPase from human erythrocyte membranes

    International Nuclear Information System (INIS)

    Kester, M.; Ekholm, J.; Kumar, R.; Hanahan, D.J.


    The modulation by exogenous inositol phosphates of the membrane Ca 2+ /Mg 2+ ATPase from saponin/EGTA lysed human erythrocytes was determined in a buffer (pH 7.6) containing histidine, 80 mM, MgCl 2 , 3.3 mM, NaCl, 74 mM, KCl, 30 mM, Na 2 ATP, 2.3 mM, ouabain, 0.83 mM, with variable amounts of CaCl 2 and EGTA. The ATPase assay was linear with time at 44 0 C. The inositol phosphates were commercially obtained and were also prepared from 32 P labeled rabbit platelet inositol phospholipids. Inositol triphosphate (IP 3 ) elevated the Ca 2+ /Mg 2+ ATPase activity over basal levels in a dose, time, and calcium dependent manner and were increased up to 85% of control values. Activities for the Na + /K + -ATPase and a Mg 2+ ATPase were not effected by IP 3 . Ca 2+ /Mg 2+ APTase activity with IP 2 or IP 3 could be synergistically elevated with calmodulin addition. The activation of the ATPase with IP 3 was calcium dependent in a range from .001 to .02 mM. The apparent Km and Vmax values were determined for IP 3 stimulated Ca 2+ /Mg 2+ ATPase

  2. Biodistribution of 99mTc-labeled anti-human epidermal growth factor receptor (EGF-R) humanized monoclonal antibody h-R3 in a xenograft model of human lung adenocarcinoma

    International Nuclear Information System (INIS)

    Morales-Morales, Alejo; Duconge, Jorge; Caballero-Torres, Idania; Nunez-Gandolff, Gilda; Fernandez, Eduardo; Iznaga-Escobar, Normando


    The anti-human epidermal growth factor receptor (EGF-R) humanized monoclonal antibody (MAb) h-R3 is an (IgG 1 ), which binds to an extracellular domain of EGF-R. It was used to evaluate the biodistribution on nude mice xenografted with H-125 human lung adenocarcinoma cell line. Results were compared with its murine version of the MAb ior-egf/r3. Twenty-one athymic female 4NMRI nu/nu mice were injected intraperitoneally with 10 μg/100 μCi of 99m Tc-labeled MAbs. Immunoreactivity of 99m Tc-labeled MAbs were measured by enzyme-linked immunosorbent assay (ELISA) on H-125 cell line and the immunoreactive fractions was determined by the Lindmo method. Among all organs, significant accumulation was found in serum (27.05 ± 2.08 %ID/g) and tumor (3.903 ± 0.89 %ID/g) at 4 h after injection. These values decreased to 5.03 ± 0.50 %ID/g and 2.19 ± 0.56 %ID/g for serum and tumor, respectively. The immunoreactive fraction was found to be 0.70, with a correlation coefficient r=0.9984. With the good biodistribution and tumor uptake of the 99m Tc-labeled humanized antibody h-R3, a phase I diagnostic clinical trial of tumor with epithelial origin should be pursued

  3. Biodistribution of {sup 99m}Tc-labeled anti-human epidermal growth factor receptor (EGF-R) humanized monoclonal antibody h-R3 in a xenograft model of human lung adenocarcinoma

    Energy Technology Data Exchange (ETDEWEB)

    Morales-Morales, Alejo; Duconge, Jorge; Caballero-Torres, Idania; Nunez-Gandolff, Gilda; Fernandez, Eduardo; Iznaga-Escobar, Normando E-mail:


    The anti-human epidermal growth factor receptor (EGF-R) humanized monoclonal antibody (MAb) h-R3 is an (IgG{sub 1}), which binds to an extracellular domain of EGF-R. It was used to evaluate the biodistribution on nude mice xenografted with H-125 human lung adenocarcinoma cell line. Results were compared with its murine version of the MAb ior-egf/r3. Twenty-one athymic female 4NMRI nu/nu mice were injected intraperitoneally with 10 {mu}g/100 {mu}Ci of {sup 99m}Tc-labeled MAbs. Immunoreactivity of {sup 99m}Tc-labeled MAbs were measured by enzyme-linked immunosorbent assay (ELISA) on H-125 cell line and the immunoreactive fractions was determined by the Lindmo method. Among all organs, significant accumulation was found in serum (27.05 {+-} 2.08 %ID/g) and tumor (3.903 {+-} 0.89 %ID/g) at 4 h after injection. These values decreased to 5.03 {+-} 0.50 %ID/g and 2.19 {+-} 0.56 %ID/g for serum and tumor, respectively. The immunoreactive fraction was found to be 0.70, with a correlation coefficient r=0.9984. With the good biodistribution and tumor uptake of the {sup 99m}Tc-labeled humanized antibody h-R3, a phase I diagnostic clinical trial of tumor with epithelial origin should be pursued.

  4. A cell culture technique for human epiretinal membranes to describe cell behavior and membrane contraction in vitro. (United States)

    Wertheimer, Christian; Eibl-Lindner, Kirsten H; Compera, Denise; Kueres, Alexander; Wolf, Armin; Docheva, Denitsa; Priglinger, Siegfried G; Priglinger, Claudia; Schumann, Ricarda G


    To introduce a human cell culture technique for investigating in-vitro behavior of primary epiretinal cells and membrane contraction of fibrocellular tissue surgically removed from eyes with idiopathic macular pucker. Human epiretinal membranes were harvested from ten eyes with idiopathic macular pucker during standard vitrectomy. Specimens were fixed on cell culture plastic using small entomological pins to apply horizontal stress to the tissue, and then transferred to standard cell culture conditions. Cell behavior of 400 epiretinal cells from 10 epiretinal membranes was observed in time-lapse microscopy and analyzed in terms of cell migration, cell velocity, and membrane contraction. Immunocytochemistry was performed for cell type-specific antigens. Cell specific differences in migration behavior were observed comprising two phenotypes: (PT1) epiretinal cells moving fast, less directly, with small round phenotype and (PT2) epiretinal cells moving slowly, directly, with elongated large phenotype. No mitosis, no outgrowth and no migration onto the plastic were seen. Horizontal contraction measurements showed variation between specimens. Masses of epiretinal cells with a myofibroblast-like phenotype expressed cytoplasmatic α-SMA stress fibers and correlated with cell behavior characteristics (PT2). Fast moving epiretinal cells (PT1) were identified as microglia by immunostaining. This in-vitro technique using traction application allows for culturing surgically removed epiretinal membranes from eyes with idiopathic macular pucker, demonstrating cell behavior and membrane contraction of primary human epiretinal cells. Our findings emphasize the abundance of myofibroblasts, the presence of microglia and specific differences of cell behavior in these membranes. This technique has the potential to improve the understanding of pathologies at the vitreomacular interface and might be helpful in establishing anti-fibrotic treatment strategies.

  5. [Study on the interface of human hepatocyte/micropore polypropylene ultrafiltration membrane]. (United States)

    Peng, Cheng-Hong; Han, Bao-San; Gao, Chang-You; Ma, Zu-Wei; Zhao, Zhi-Ming; Wang, Yong; Liu, Hong; Zhang, Gui-di; Yang, Mei-Juan


    To found a new interface of human hepatocyte/micropore polypropylene ultrafiltration membrane (MPP) with good cytocompatibility so as to construct bioartificial bioreactor with polypropylene hollow fibers in future. MPP ultrafiltration membrane underwent chemical grafting modification through ultraviolet irradiation and Fe(2+) reduction. The contact angles of MPP and the modified MPP membranes were measured. Human hepatic cells L-02 were cultured. MPP and modified MPP membranes were spread on the wells of culture plate and human hepatic cells and cytodex 3 were inoculated on them. Different kinds of microscopy were used to observe the morphology of these cells. The water contact angle of MPP and the modified MPP membranes decreased from 78 degrees +/- 5 degrees to 27 degrees +/- 4 degrees (P < 0.05), which indicated that the hydrophilicity of the membrane was improved obviously after the grafting modification. Human hepatocyte L-02 did not adhere to and spread on the modified MPP membrane surface, and only grew on the microcarrier cytodex 3 with higher density and higher proliferation ratio measured by MTT. Grafting modification of acrylamide on MPP membrane is a good method to improve the human hepatocyte cytocompatibility with MPP ultrafiltration membrane.

  6. Epidermal growth factor inhibits glycylsarcosine transport and hPepT1 expression in a human intestinal cell line

    DEFF Research Database (Denmark)

    Nielsen, C U; Amstrup, J; Steffansen, B


    (max) decreased from 2.61 +/- 0.4 to 1.06 +/- 0.1 nmol x cm(-2) x min(-1) (n = 3, P PepT1 mRNA (using glucose-6-phosphate dehydrogenase mRNA as control......) in cells treated with EGF. Western blotting indicated a decrease in hPepT1 protein in cell lysates. We conclude that EGF treatment decreases Gly-Sar transport in Caco-2 cells by decreasing the number of peptide transporter molecules in the apical membrane....

  7. Rapid Visualization of Human Tumor Xenografts through Optical Imaging with a Near-Infrared Fluorescent Anti–Epidermal Growth Factor Receptor Nanobody

    Directory of Open Access Journals (Sweden)

    Sabrina Oliveira


    Full Text Available Given that overexpression of the epidermal growth factor receptor (EGFR is found in many types of human epithelial cancers, noninvasive molecular imaging of this receptor is of great interest. A number of studies have employed monoclonal antibodies as probes; however, their characteristic long half-life in the bloodstream has encouraged the development of smaller probes. In this study, an anti-EGFR nanobody-based probe was developed and tested in comparison with cetuximab for application in optical molecular imaging. To this aim, the anti-EGFR nanobody 7D12 and cetuximab were conjugated to the near-infrared fluorophore IRDye800CW. 7D12-IR allowed the visualization of tumors as early as 30 minutes postinjection, whereas with cetuximab-IR, no signal above background was observed at the tumor site. Quantification of the IR-conjugated proteins in the tumors revealed ≈ 17% of injected dose per gram 2 hours after injection of 7D12-IR, which was significantly higher than the tumor uptake obtained 24 hours after injection of cetuximab-IR. This difference is associated with the superior penetration and distribution of 7D12-IR within the tumor. These results demonstrate that this anti-EGFR nanobody conjugated to the NIR fluorophore has excellent properties for rapid preclinical optical imaging, which holds promise for its future use as a complementary diagnostic tool in humans.

  8. Blood-group-Ii-active gangliosides of human erythrocyte membranes

    International Nuclear Information System (INIS)

    Feizi, T.; Childs, R.A.; Hakomori, S.-I.; Powell, M.E.


    More than ten new types of gangliosides, in addition to haematoside and sialosylparagloboside, were isolated from human erythrocyte membranes. These were separated by successive chromatographies on DAEA-Sephadex, on porous silica-gel columns and on thin-layer silica gel as acetylated compounds. Highly potent blood-group-Ii and moderate blood-group-H activities were demonstrated in some of the ganglioside fractions. The gangliosides incorporated into chlolesterol/phosphatidylcholine liposomes stoicheiometrically inhibited binding of anti-(blood-group-I and i) antibodies to a radioiodinated blood-group-Ii-active glycoprotein. The fraction with the highest blood-group-I activity, I(g) fraction, behaved like sialosyl-deca- to dodeca-glycosylceramides on t.l.c. Certain blood-group-I and most of the i-determinants were in partially or completely cryptic form and could be unmasked by sialidase treatment. Thus the I and i antigens, which are known to occur on internal structures of blood-group-ABH-active glycoproteins in secretions, also occur in the interior of the carbohydrate chains of erythrocyte gangliosides. (author)

  9. Purification and differentiation of human adipose-derived stem cells by membrane filtration and membrane migration methods (United States)

    Lin, Hong Reng; Heish, Chao-Wen; Liu, Cheng-Hui; Muduli, Saradaprasan; Li, Hsing-Fen; Higuchi, Akon; Kumar, S. Suresh; Alarfaj, Abdullah A.; Munusamy, Murugan A.; Hsu, Shih-Tien; Chen, Da-Chung; Benelli, Giovanni; Murugan, Kadarkarai; Cheng, Nai-Chen; Wang, Han-Chow; Wu, Gwo-Jang


    Human adipose-derived stem cells (hADSCs) are easily isolated from fat tissue without ethical concerns, but differ in purity, pluripotency, differentiation ability, and stem cell marker expression, depending on the isolation method. We isolated hADSCs from a primary fat tissue solution using: (1) conventional culture, (2) a membrane filtration method, (3) a membrane migration method where the primary cell solution was permeated through membranes, adhered hADSCs were cultured, and hADSCs migrated out from the membranes. Expression of mesenchymal stem cell markers and pluripotency genes, and osteogenic differentiation were compared for hADSCs isolated by different methods using nylon mesh filter membranes with pore sizes ranging from 11 to 80 μm. hADSCs isolated by the membrane migration method had the highest MSC surface marker expression and efficient differentiation into osteoblasts. Osteogenic differentiation ability of hADSCs and MSC surface marker expression were correlated, but osteogenic differentiation ability and pluripotent gene expression were not. PMID:28071738

  10. Upregulated epidermal growth factor receptor expression following near-infrared irradiation simulating solar radiation in a three-dimensional reconstructed human corneal epithelial tissue culture model. (United States)

    Tanaka, Yohei; Nakayama, Jun


    Humans are increasingly exposed to near-infrared (NIR) radiation from both natural (eg, solar) and artificial (eg, electrical appliances) sources. Although the biological effects of sun and ultraviolet (UV) exposure have been extensively investigated, the biological effect of NIR radiation is still unclear. We previously reported that NIR as well as UV induces photoaging and standard UV-blocking materials, such as sunglasses, do not sufficiently block NIR. The objective of this study was to investigate changes in gene expression in three-dimensional reconstructed corneal epithelial tissue culture exposed to broad-spectrum NIR irradiation to simulate solar NIR radiation that reaches human tissues. DNA microarray and quantitative real-time polymerase chain reaction analysis were used to assess gene expression levels in a three-dimensional reconstructed corneal epithelial model composed of normal human corneal epithelial cells exposed to water-filtered broad-spectrum NIR irradiation with a contact cooling (20°C). The water-filter allowed 1,000-1,800 nm wavelengths and excluded 1,400-1,500 nm wavelengths. A DNA microarray with >62,000 different probes showed 25 and 150 genes that were up- or downregulated by at least fourfold and twofold, respectively, after NIR irradiation. In particular, epidermal growth factor receptor (EGFR) was upregulated by 19.4-fold relative to control cells. Quantitative real-time polymerase chain reaction analysis revealed that two variants of EGFR in human corneal epithelial tissue were also significantly upregulated after five rounds of 10 J/cm(2) irradiation (Psolar energy reaching the Earth is in the NIR region, which cannot be adequately blocked by eyewear and thus can induce eye damage with intensive or long-term exposure, protection from both UV and NIR radiation may prevent changes in gene expression and in turn eye damage.

  11. In vivo production of novel vitamin D2 hydroxy-derivatives by human placentas, epidermal keratinocytes, Caco-2 colon cells and the adrenal gland (United States)

    Slominski, Andrzej T.; Kim, Tae-Kang; Shehabi, Haleem Z.; Tang, Edith; Benson, Heather A. E.; Semak, Igor; Lin, Zongtao; Yates, Charles R.; Wang, Jin; Li, Wei; Tuckey, Robert C.


    We investigated the metabolism of vitamin D2 to hydroxyvitamin D2 metabolites ((OH)D2) by human placentas ex-utero, adrenal glands ex-vivo and cultured human epidermal keratinocytes and colonic Caco-2 cells, and identified 20(OH)D2, 17,20(OH)2D2, 1,20(OH)2D2, 25(OH)D2 and 1,25(OH)2D2 as products. Inhibition of product formation by 22R-hydroxycholesterol indicated involvement of CYP11A1 in 20- and 17-hydroxylation of vitamin D2, while use of ketoconazole indicated involvement of CYP27B1 in 1α-hydroxylation of products. Studies with purified human CYP11A1 confirmed the ability of this enzyme to convert vitamin D2 to 20(OH)D2 and 17,20(OH)2D2. In placentas and Caco-2 cells, production of 20(OH)D2 was higher than 25(OH)D2 while in human keratinocytes the production of 20(OH)D2 and 25(OH)D2 were comparable. HaCaT keratinocytes showed high accumulation of 1,20(OH)2D2 relative to 20(OH)D2 indicating substantial CYP27B1 activity. This is the first in vivo evidence for a novel pathway of vitamin D2 metabolism initiated by CYP11A1 and modified by CYP27B1, with the product profile showing tissue- and cell-type specificity. PMID:24382416

  12. Epidermal cell-shape regulation and subpopulation kinetics during butyrate-induced terminal maturation of normal and SV40-transformed human keratinocytes: epithelial models of differentiation therapy. (United States)

    Staiano-Coico, L; Steinberg, M; Higgins, P J


    Recent data indicate that malignant human epidermal cells may be appropriate targets for sodium butyrate (NaB)-mediated differentiation therapy. The response of pre- and post-crisis populations of SV40-transformed human keratinocytes (SVKs) to this differentiation-inducing agent was assessed, therefore, within the framework of NaB-directed normal human keratinocyte (NHK) maturation. NaB augmented cornified envelope (CE) production in NHK and pre-crisis SVK cultures; the time-course and efficiency of induced maturation were similar in the 2 cell systems. In NHKs, the percentage of amplifying ("B" substate) cells decreased with time in NaB correlating with increases in both "C" stage keratinocytes and CEs. The latter formed over one or 2 layers of nucleated basal-like cells. Inductions were accompanied by immediate cell cycle blocks (in both the G1 and G2/M phases), reorganization within the actin cytoskeleton, and transient early increases in cellular actin content. Increased NHK and pre-crisis SVK cytoskeletal-associated actin reached a maximum approximately 48 hr after NaB addition and preceded development of CEs. The CE precursors, thus, probably reside in the "B" substate. Post-crisis SVKs, in contrast, were refractive to NaB-induced terminal maturation or cell-cycle perturbation, failed to initiate actin filament rearrangements, and retained a basal cell-like phenotype. Stable transformation of human SVKs in post-crisis phase, therefore, appears to be associated with loss of maturation "competence" within the "B" keratinocyte subpopulation.

  13. Development of a living membrane comprising a functional human renal proximal tubule cell monolayer on polyethersulfone polymeric membrane. (United States)

    Schophuizen, Carolien M S; De Napoli, Ilaria E; Jansen, Jitske; Teixeira, Sandra; Wilmer, Martijn J; Hoenderop, Joost G J; Van den Heuvel, Lambert P W; Masereeuw, Rosalinde; Stamatialis, Dimitrios


    The need for improved renal replacement therapies has stimulated innovative research for the development of a cell-based renal assist device. A key requirement for such a device is the formation of a "living membrane", consisting of a tight kidney cell monolayer with preserved functional organic ion transporters on a suitable artificial membrane surface. In this work, we applied a unique conditionally immortalized proximal tubule epithelial cell (ciPTEC) line with an optimized coating strategy on polyethersulfone (PES) membranes to develop a living membrane with a functional proximal tubule epithelial cell layer. PES membranes were coated with combinations of 3,4-dihydroxy-l-phenylalanine and human collagen IV (Coll IV). The optimal coating time and concentrations were determined to achieve retention of vital blood components while preserving high water transport and optimal ciPTEC adhesion. The ciPTEC monolayers obtained were examined through immunocytochemistry to detect zona occludens 1 tight junction proteins. Reproducible monolayers were formed when using a combination of 2 mg ml(-1) 3,4-dihydroxy-l-phenylalanine (4 min coating, 1h dissolution) and 25 μg ml(-1) Coll IV (4 min coating). The successful transport of (14)C-creatinine through the developed living membrane system was used as an indication for organic cation transporter functionality. The addition of metformin or cimetidine significantly reduced the creatinine transepithelial flux, indicating active creatinine uptake in ciPTECs, most likely mediated by the organic cation transporter, OCT2 (SLC22A2). In conclusion, this study shows the successful development of a living membrane consisting of a reproducible ciPTEC monolayer on PES membranes, an important step towards the development of a bioartificial kidney. Copyright © 2014 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

  14. Characterization of receptors for recombinant human tumor necrosis factor-alpha from human placental membranes

    International Nuclear Information System (INIS)

    Aiyer, R.A.; Aggarwal, B.B.


    High affinity receptors for recombinant human tumor necrosis factor-alpha (rhTNF-alpha) were identified on membranes prepared from full term human placenta. Highly purified rhTNF-alpha iodinated by the iodogen method was found to bind placental membranes in a displaceable manner with an approximate dissociation constant (KD) of 1.9 nM. The membrane bound TNF-alpha receptor could be solubilized by several detergents with optimum extraction being obtained with 1% Triton X-100. The binding of 125I-rhTNF-alpha to the solubilized receptor was found to be time and temperature dependent, yielding maximum binding within 1 h, 24 h and 48 h at 37 degrees C, 24 degrees C and 4 degrees C, respectively. However, the maximum binding obtainable at 4 degrees C was only 40% of that at 37 degrees C. The binding 125I-rhTNF-alpha to solubilized placental membrane extracts was displaceable by unlabeled rhTNF-alpha, but not by a related protein recombinant human tumor necrosis factor-beta (rhTNF-beta; previously called lymphotoxin). This is similar to the behavior of TNF-alpha receptors derived from detergent-solubilized cell extracts, although on intact cells, both rhTNF-alpha and rhTNF-beta bind with equal affinity to TNF receptors. The Scatchard analysis of the binding data of the solubilized receptor revealed high affinity binding sites with a KD of approximately 0.5 nM and a receptor concentration of about 1 pmole/mg protein. Gel filtration of the solubilized receptor-ligand complexes on Sephacryl S-300 revealed two different peaks of radioactivity at approximate molecular masses of 50,000 Da and 400,000 Da. The 400,000 dalton peak corresponded to the receptor-ligand complex. Overall, our results suggest that high affinity receptors for TNF-alpha are present on human placental membranes and provide evidence that these receptors may be different from that of rhTNF-beta

  15. Epidermal growth factor and insulin-like growth factor I upregulate the expression of the epidermal growth factor system in rat liver

    DEFF Research Database (Denmark)

    Bor, M V; Sørensen, B S; Vinter-Jensen, L


    BACKGROUND/AIM: Both epidermal growth factor and insulin-like growth factor I play a role in connection with the liver. In the present study, the possible interaction of these two growth factor systems was studied by investigating the effect of epidermal growth factor or insulin-like growth factor...... I treatment on the expression of the epidermal growth factor receptor, and its activating ligands, transforming growth factor-alpha and epidermal growth factor. METHODS: Fifty-five male rats received no treatment, human recombinant epidermal growth factor or human recombinant insulin-like growth.......8+/-1.6 fmol/mg protein epidermal growth factor and 144+/-22 fmol/mg protein transforming growth factor-alpha. Both epidermal growth factor and insulin-like growth factor I treatment increased the expression of mRNA for transforming growth factor-alpha and epidermal growth factor receptor, as well...

  16. Direct visualization of epidermal growth factor receptors (EGFR) in A431 and placental cell membrane by western blot with 125I-EGF

    International Nuclear Information System (INIS)

    Lin, P.H.; Selinfreund, R.; Wharton, W.


    Using the western blot technique, they have devised a new procedure that allowed the direct visualization of both the 150KD and the 170KD forms of EGFR by its natural ligand, 125 I-EGF. A431, and placental plasmalemma were purified and solubilized in either SDS-PAGE buffer (without DTT, EDTA) or Triton X-100 (0.5%), resolved on PAGE and electrophoretically transferred onto nitrocellulose (NC) paper. In the absence of boiling, SDS did not denature the EGFR. Although EGER band can be detected after hybridization with 125 I-EGF, the receptor signal was considerably improved with the addition of 0.1% Tween-20. The binding of 125 I-EGF to the both the 150KD and the 170KD bands of the EGFR was specific, reversible and increased with the amount of membrane protein present. The direct visualization of the EGFR using its natural ligand eliminated the necessity for the time consuming antibody preparation. Presently, they are using this technique to identify specific receptors for other ligands

  17. Effects of Thermal Resistance on One-Dimensional Thermal Analysis of the Epidermal Flexible Electronic Devices Integrated with Human Skin (United States)

    Li, He; Cui, Yun


    Nowadays, flexible electronic devices are increasingly used in direct contact with human skin to monitor the real-time health of human body. Based on the Fourier heat conduction equation and Pennes bio-heat transfer equation, this paper deduces the analytical solutions of one - dimensional heat transfer for flexible electronic devices integrated with human skin under the condition of a constant power. The influence of contact thermal resistance between devices and skin is considered as well. The corresponding finite element model is established to verify the correctness of analytical solutions. The results show that the finite element analysis agrees well with the analytical solution. With bigger thermal resistance, temperature increase of skin surface will decrease. This result can provide guidance for the design of flexible electronic devices to reduce the negative impact that exceeding temperature leave on human skin.


    Epidemiological studies have implicated zinc in the toxicity of ambient particulate matter (PM) inhalation. We previously showed that exposure to metal-laden PM inhibits protein tyrosine phosphatase (PTP) activity in human primary bronchial epithelial cells (HAEC) and leads t...

  19. Cell membrane softening in human breast and cervical cancer cells (United States)

    Händel, Chris; Schmidt, B. U. Sebastian; Schiller, Jürgen; Dietrich, Undine; Möhn, Till; Kießling, Tobias R.; Pawlizak, Steve; Fritsch, Anatol W.; Horn, Lars-Christian; Briest, Susanne; Höckel, Michael; Zink, Mareike; Käs, Josef A.


    Biomechanical properties are key to many cellular functions such as cell division and cell motility and thus are crucial in the development and understanding of several diseases, for instance cancer. The mechanics of the cellular cytoskeleton have been extensively characterized in cells and artificial systems. The rigidity of the plasma membrane, with the exception of red blood cells, is unknown and membrane rigidity measurements only exist for vesicles composed of a few synthetic lipids. In this study, thermal fluctuations of giant plasma membrane vesicles (GPMVs) directly derived from the plasma membranes of primary breast and cervical cells, as well as breast cell lines, are analyzed. Cell blebs or GPMVs were studied via thermal membrane fluctuations and mass spectrometry. It will be shown that cancer cell membranes are significantly softer than their non-malignant counterparts. This can be attributed to a loss of fluid raft forming lipids in malignant cells. These results indicate that the reduction of membrane rigidity promotes aggressive blebbing motion in invasive cancer cells.

  20. Epidermal growth factor receptor signalling in human breast cancer cells operates parallel to estrogen receptor α signalling and results in tamoxifen insensitive proliferation

    International Nuclear Information System (INIS)

    Moerkens, Marja; Zhang, Yinghui; Wester, Lynn; Water, Bob van de; Meerman, John HN


    Tamoxifen resistance is a major problem in the treatment of estrogen receptor (ER) α -positive breast cancer patients. Although the mechanisms behind tamoxifen resistance are still not completely understood, clinical data suggests that increased expression of receptor tyrosine kinases is involved. Here, we studied the estrogen and anti-estrogen sensitivity of human breast cancer MCF7 cells that have a moderate, retroviral-mediated, ectopic expression of epidermal growth factor receptor (MCF7-EGFR). Proliferation of MCF7-EGFR and parental cells was induced by 17β-estradiol (E2), epidermal growth factor (EGF) or a combination of these. Inhibition of proliferation under these conditions was investigated with 4-hydroxy-tamoxifen (TAM) or fulvestrant at 10 -12 to 10 -6 M. Cells were lysed at different time points to determine the phosphorylation status of EGFR, MAPK 1/3 , AKT and the expression of ERα. Knockdown of target genes was established using smartpool siRNAs. Transcriptomics analysis was done 6 hr after stimulation with growth factors using Affymetrix HG-U133 PM array plates. While proliferation of parental MCF7 cells could only be induced by E2, proliferation of MCF7-EGFR cells could be induced by either E2 or EGF. Treatment with TAM or fulvestrant did significantly inhibit proliferation of MCF7-EGFR cells stimulated with E2 alone. EGF treatment of E2/TAM treated cells led to a marked cell proliferation thereby overruling the anti-estrogen-mediated inhibition of cell proliferation. Under these conditions, TAM however did still inhibit ERα- mediated transcription. While siRNA-mediated knock-down of EGFR inhibited the EGF- driven proliferation under TAM/E2/EGF condition, knock down of ERα did not. The TAM resistant cell proliferation mediated by the conditional EGFR-signaling may be dependent on the PI3K/Akt pathway but not the MEK/MAPK pathway, since a MEK inhibitor (U0126), did not block the proliferation. Transcriptomic analysis under the various E2/TAM

  1. Radionecrosis skin model induced an athymic mouse nude (Nu/Nu) for development of dermal-epidermal human substitute based regenerative therapy

    International Nuclear Information System (INIS)

    Mosca, Rodrigo Crespo


    The neoplasms incidence has increased significantly in recent years and continued population growth and aging will increase the statistics of this illness in the world's diseases. The cancer treatment usually consists in individual or combined use of chemotherapy, surgery and radiotherapy depending on the etiology of the tumor. In cases where radiotherapy is used in addition to the therapeutic effects of radiation, specific complications can occur, and in the skin, these complications can be present with a clinical expression ranging from erythema to radionecrosis, and this latter being the adverse effect with greater severity. The radionecrosis treatment consists in debridement necrotic areas and covering the surgical wounds. Autologous grafts are most commonly used for this covering, however when large areas are affected, allografts can be used for occlusive treatment and the keratinocytes and adipose derived stem cells (ADSC) addition becomes an alternative, due to the knowing for immunomodulatory and regenerative response. For that reason, aiming to simulate the radionecrosis adverse effects, an animal model of induced cutaneous radionecrosis was created, in athymic mouse Nude (Nu/Nu), for developing regenerative therapies based on human dermal-epidermal substitutes containing keratinocytes and ADSC, which proved occlusive as an efficient treatment, furthermore, having this radionecrosis animal model established, new possibilities for treatment of diseases involving dermal regeneration, can be tested. (author)

  2. Altered growth, differentiation, and responsiveness to epidermal growth factor of human embryonic mesenchymal cells of palate by persistent rubella virus infection

    International Nuclear Information System (INIS)

    Yoneda, T.; Urade, M.; Sakuda, M.; Miyazaki, T.


    We previously demonstrated that human embryonic mesenchymal cells derived from the palate (HEMP cells) retain alkaline phosphatase (ALP) content and capacity for collagen synthesis after long-term culture, and their growth is markedly stimulated by epidermal growth factor (EGF). There was a dramatic decrease in ALP content and capacity to synthesize collagen in HEMP cells (HEMP-RV cells) persistently infected with rubella virus (RV). EGF increased ALP activity and decreased collagen synthesis in HEMP cells, whereas EGF showed no effect on these activities in HEMP-RV cells. Growth of HEMP-RV cells was slightly reduced compared with that of HEMP cells. EGF stimulated growth of HEMP cells and to a lesser extent of HEMP-RV cells. Binding of 125 I-EGF to cell-surface receptors in HEMP-RV cells was, to our surprise, twice as much as that in HEMP cells. However, internalization of bound 125 I-EGF in HEMP-RV cells was profoundly diminished. Thus, persistent RV infection causes not only changes in HEMP cell growth and differentiation but a decrease in or loss of HEMP cell responsiveness to EGF. The effects of persistent RV infection on palatal cell differentiation as well as growth may be responsible for the pathogenesis of congenital rubella. Furthermore, since HEMP cells appear to be closely related to osteoblasts, these results suggest a mechanism for RV-induced osseous abnormalities manifested in congenital rubella patients

  3. Comet assay in reconstructed 3D human epidermal skin models—investigation of intra- and inter-laboratory reproducibility with coded chemicals (United States)

    Pfuhler, Stefan


    Reconstructed 3D human epidermal skin models are being used increasingly for safety testing of chemicals. Based on EpiDerm™ tissues, an assay was developed in which the tissues were topically exposed to test chemicals for 3h followed by cell isolation and assessment of DNA damage using the comet assay. Inter-laboratory reproducibility of the 3D skin comet assay was initially demonstrated using two model genotoxic carcinogens, methyl methane sulfonate (MMS) and 4-nitroquinoline-n-oxide, and the results showed good concordance among three different laboratories and with in vivo data. In Phase 2 of the project, intra- and inter-laboratory reproducibility was investigated with five coded compounds with different genotoxicity liability tested at three different laboratories. For the genotoxic carcinogens MMS and N-ethyl-N-nitrosourea, all laboratories reported a dose-related and statistically significant increase (P 30% cell loss), and the overall response was comparable in all laboratories despite some differences in doses tested. The results of the collaborative study for the coded compounds were generally reproducible among the laboratories involved and intra-laboratory reproducibility was also good. These data indicate that the comet assay in EpiDerm™ skin models is a promising model for the safety assessment of compounds with a dermal route of exposure. PMID:24150594

  4. Recommendations on disease management for patients with advanced human epidermal growth factor receptor 2-positive breast cancer and brain metastases: American Society of Clinical Oncology clinical practice guideline. (United States)

    Ramakrishna, Naren; Temin, Sarah; Chandarlapaty, Sarat; Crews, Jennie R; Davidson, Nancy E; Esteva, Francisco J; Giordano, Sharon H; Gonzalez-Angulo, Ana M; Kirshner, Jeffrey J; Krop, Ian; Levinson, Jennifer; Modi, Shanu; Patt, Debra A; Perez, Edith A; Perlmutter, Jane; Winer, Eric P; Lin, Nancy U


    To provide formal expert consensus-based recommendations to practicing oncologists and others on the management of brain metastases for patients with human epidermal growth factor receptor 2 (HER2) -positive advanced breast cancer. The American Society of Clinical Oncology (ASCO) convened a panel of medical oncology, radiation oncology, guideline implementation, and advocacy experts and conducted a systematic review of the literature. When that failed to yield sufficiently strong quality evidence, the Expert Panel undertook a formal expert consensus-based process to produce these recommendations. ASCO used a modified Delphi process. The panel members drafted recommendations, and a group of other experts joined them for two rounds of formal ratings of the recommendations. No studies or existing guidelines met the systematic review criteria; therefore, ASCO conducted a formal expert consensus-based process. Patients with brain metastases should receive appropriate local therapy and systemic therapy, if indicated. Local therapies include surgery, whole-brain radiotherapy, and stereotactic radiosurgery. Treatments depend on factors such as patient prognosis, presence of symptoms, resectability, number and size of metastases, prior therapy, and whether metastases are diffuse. Other options include systemic therapy, best supportive care, enrollment onto a clinical trial, and/or palliative care. Clinicians should not perform routine magnetic resonance imaging (MRI) to screen for brain metastases, but rather should have a low threshold for MRI of the brain because of the high incidence of brain metastases among patients with HER2-positive advanced breast cancer. © 2014 by American Society of Clinical Oncology.

  5. From bench to bedside: What do we know about hormone receptor-positive and human epidermal growth factor receptor 2-positive breast cancer? (United States)

    Wu, Victoria Shang; Kanaya, Noriko; Lo, Chiao; Mortimer, Joanne; Chen, Shiuan


    Breast cancer is a heterogeneous disease. Thanks to extensive efforts from research scientists and clinicians, treatment for breast cancer has advanced into the era of targeted medicine. With the use of several well-established biomarkers, such as hormone receptors (HRs) (i.e., estrogen receptor [ER] and progesterone receptor [PgR]) and human epidermal growth factor receptor-2 (HER2), breast cancer patients can be categorized into multiple subgroups with specific targeted treatment strategies. Although therapeutic strategies for HR-positive (HR+) HER2-negative (HER2-) breast cancer and HR-negative (HR-) HER2-positive (HER2+) breast cancer are well-defined, HR+ HER2+ breast cancer is still an overlooked subgroup without tailored therapeutic options. In this review, we have summarized the molecular characteristics, etiology, preclinical tools and therapeutic options for HR+ HER2+ breast cancer. We hope to raise the attention of both the research and the medical community on HR+ HER2+ breast cancer, and to advance patient care for this subtype of disease. Copyright © 2015 Elsevier Ltd. All rights reserved.

  6. Characteristics and treatment of human epidermal growth factor receptor 2 positive breast cancer: 43,485 cases from the National Cancer Database treated in 2010 and 2011. (United States)

    Killelea, Brigid K; Chagpar, Anees B; Horowitz, Nina R; Lannin, Donald R


    Although identification of human epidermal growth factor receptor 2 (Her2) positive breast cancer represents one of the greatest advances over the past 3 decades, it has not been studied extensively on a national level. The National Cancer Database is a joint project of the American Cancer Society and the American College of Surgeons and contains data on about 70% of the cancer cases in the United States. Data on Her2 have been collected since 2010 and was used for this study. Of 298,937 cases of invasive breast cancer with known Her2 status diagnosed in 2010 and 2011, 43,485 (14.5%) were Her2 positive. Her2 positivity was greatest in Asian/Pacific Islanders and least in non-Hispanic Whites and was markedly more common in younger women. The incidence of Her2 positive tumors ranged from a low of 13.9% in the Mountain West region to a high of 16.0% in the West South Central region (P breast preservation (odds ratio = .78, confidence interval = .76 to .80). Her2 positive tumors have distinct epidemiologic, clinical, and treatment characteristics. Copyright © 2016 Elsevier Inc. All rights reserved.

  7. Human epidermal growth factor receptor 2 testing in invasive breast cancer: should histological grade, type and oestrogen receptor status influence the decision to repeat testing? (United States)

    Rakha, Emad A; Pigera, Marian; Shin, Sandra J; D'Alfonso, Timothy; Ellis, Ian O; Lee, Andrew H S


    The recent American Society of Clinical Oncology/College of American Pathologists guidelines for human epidermal growth factor receptor 2 (HER2) testing in breast cancer recommend repeat testing based on tumour grade, tumour type, and hormone receptor status. The aim of this study was to test the value of these criteria. HER2 status was concordant in the core biopsies and excision specimens in 392 of 400 invasive carcinomas. The major reasons for discordance were amplification around the cut-off for positivity and tumour heterogeneity. Of 116 grade 3 carcinomas that were HER2-negative in the core biopsy, four were HER2-positive in the excision specimen. Three of these four either showed borderline negative amplification in the core biopsy or were heterogeneous. None of the 55 grade 1 carcinomas were HER2-positive. Review of repeat testing of HER2 in routine practice suggested that it may also be of value for multifocal tumours and if recommended by the person assessing the in-situ hybridization. Mandatory repeat HER2 testing of grade 3 HER2-negative carcinomas is not appropriate. This is particularly true if repeat testing is performed after borderline negative amplification in the core biopsy or in HER2-negative heterogeneous carcinomas. © 2015 John Wiley & Sons Ltd.

  8. Punicalagin and (-)-Epigallocatechin-3-Gallate Rescue Cell Viability and Attenuate Inflammatory Responses of Human Epidermal Keratinocytes Exposed to Airborne Particulate Matter PM10. (United States)

    Seok, Jin Kyung; Lee, Jeong-Won; Kim, Young Mi; Boo, Yong Chool


    Airborne particulate matter with a diameter of < 10 µm (PM10) causes oxidative damage, inflammation, and premature skin aging. In this study, we evaluated whether polyphenolic antioxidants attenuate the inflammatory responses of PM10-exposed keratinocytes. Primary human epidermal keratinocytes were exposed in vitro to PM10 in the absence or presence of punicalagin and (-)-epigallocatechin-3-gallate (EGCG), which are the major polyphenolic antioxidants found in pomegranate and green tea, respectively. Assays were performed to determine cell viability, production of reactive oxygen species (ROS), and expression of NADPH oxidases (NOX), proinflammatory cytokines, and matrix metalloproteinase (MMP)-1. PM10 decreased cell viability and increased ROS production in a dose-dependent manner. It also increased the expression levels of NOX-1, NOX-2, tumor necrosis factor-α (TNF-α), interleukin (IL)-1β, IL-6, IL-8, and MMP-1. Punicalagin was not cytotoxic up to 300 μM, and (-)-EGCG was cytotoxic above 30 μM, respectively. Further, punicalagin (3-30 μM) and EGCG (3-10 μM) rescued the viability of PM10-exposed cells. They also attenuated ROS production and the expression of NOX-1, NOX-2, TNF-α, IL-1β, IL-6, IL-8, and MMP-1 stimulated by PM10. This study demonstrates that polyphenolic antioxidants, such as punicalagin and (-)-EGCG, rescue keratinocyte viability and attenuate the inflammatory responses of these cells due to airborne particles. © 2018 S. Karger AG, Basel.

  9. Real world cost of human epidermal receptor 2-positive metastatic breast cancer patients: a longitudinal incidence-based observational costing study in the Netherlands and Belgium. (United States)

    Frederix, G W J; Severens, J L; Hövels, A M; van Hasselt, J G C; Hooiveld, M J J; Neven, P; Raaijmakers, J A M; Schellens, J H M


    Currently, no country-specific metastatic breast cancer (MBC) observational costing data are available for the Netherlands and Belgium. Our aim is to describe country-specific resource use and costs of human epidermal receptor 2 (HER-2)-positive MBC in the Netherlands and Belgium, making use of real-world data. The eligibility period for patient selection was from April 2004 to April 2010. Inclusion and retrospective data collection begins at the time of first diagnosis of HER-2-positive MBC during the eligibility period and ends 24 months post-index diagnosis of MBC or at patient death. We identified 88 eligible patients in the Netherlands and 44 patients in Belgium. The total costs of medical treatment and other resource use utilisation per patient was €48,301 in the Netherlands and €37,431 in Belgium. Majority of costs was related to the use of trastuzumab in both countries, which was 50% of the total costs in the Netherlands and 56% in Belgium respectively. Our study provides estimates of resource use and costs for HER-2-positive MBC in the Netherlands and Belgium. We noticed various differences in resource use patterns between both countries demonstrating caution is needed when transferring cost estimates between countries. © 2014 John Wiley & Sons Ltd.

  10. Effect of Standardized Boesenbergia pandurata Extract and Its Active Compound Panduratin A on Skin Hydration and Barrier Function in Human Epidermal Keratinocytes. (United States)

    Woo, Seon Wook; Rhim, Dong-Bin; Kim, Changhee; Hwang, Jae-Kwan


    The skin plays a key role in protecting the body from the environment and from water loss. Cornified envelope (CE) and natural moisturizing factor (NMF) are considered as the primary regulators of skin hydration and barrier function. The CE prevents loss of water from the body and is formed by cross-linking of several proteins. Among these proteins, filaggrin is an important protein because NMF is produced by the degradation of filaggrin. Proteases, including matriptase and prostasin, stimulate the generation of filaggrin from profilaggrin and caspase-14 plays a role in the degradation of filaggrin. This study elucidated the effects of an ethanol extract of Boesenbergia pandurata (Roxb.) Schltr., known as fingerroot, and its active compound panduratin A on CE formation and filaggrin processing in HaCaT, human epidermal keratinocytes. B. pandurata extract (BPE) and panduratin A significantly stimulated not only CE formation but also the expression of CE proteins, such as loricrin, involucrin, and transglutaminase, which were associated with PPARα expression. The mRNA and protein levels of filaggrin and filaggrin-related enzymes, such as matriptase, prostasin, and caspase-14 were also up-regulated by BPE and panduratin A treatment. These results suggest that BPE and panduratin A are potential nutraceuticals which can enhance skin hydration and barrier function based on their CE formation and filaggrin processing.

  11. Specific receptors for epidermal growth factor in human bone tumour cells and its effect on synthesis of prostaglandin E2 by cultured osteosarcoma cell line

    International Nuclear Information System (INIS)

    Hirata, Y.; Uchihashi, M.; Nakashima, H.; Fujita, T.; Matsukura, S.; Matsui, K.


    Using tumour cell lines derived from human bone tumours, specific binding sites for epidermal growth factor (EGF), a potent growth stimulator in many tissues, and its effect on synthesis of prostaglandin (PG) E 2 , a potent bone-resorbing factor, by cultured osteosarcoma cell line were studied. Three tumour cell lines, one osteosarcoma (HOSO) and two giant cell tumours of the bone (G-1 and G-2), all possessed specific binding sites for 125 I-labelled EGF: the apparent dissociation constant was approximately 4-10 x 10 -10 M and the maximal binding capacity was 50 000-80 000 sites/cell. EGF had no mitogenic effect in these cell lines. However, these cell lines did not have specific binding sites for 125 I-labelled parathyroid hormone (PTH) or calcitonin. HOSO line produced and secreted PGE 2 into medium, while no significant amount of PGE 2 was demonstrated in G-1 or G-2 line. EGF significantly stimulated PGE 2 production in HOSO line in a dose-dependent manner (0.5-50 ng/ml); its stimulatory effect was completely abolished by indomethacin, an inhibitor of PG biosynthesis. Exogenous PGE 1 significantly stimulated cyclic AMP formation in HOSO line, whereas PGFsub(2α) PTH, calcitonin, or EGF had no effect. None of these calcium-regulating hormones affected cyclic AMP generation in either G-1 of G-2 line. These data indicate that human bone tumour cells have specific EGF receptors unrelated to cell growth, and suggest that EGF may be involved in bone resorption through a PGE 2 -mediated process in human osseous tissues. (author)


    Directory of Open Access Journals (Sweden)

    Ana Maria Abreu Velez


    Full Text Available Autoimmune bullous skin diseases (ABDs are uncommon, potentially fatal diseases of skin and mucous membranes which are associated with deposits of autoantibodies and complement against distinct molecules of the epidermis and dermal/epidermal basement membrane zone (BMZ. These autoantibodies lead to a loss in skin molecular integrity, which manifests clinically as formation of blisters or erosions. In pemphigus vulgaris, loss of adhesion occurs within the epidermis. The pioneering work of Ernst H. Beutner, Ph.D. and Robert E. Jordon, M.D. confirmed the autoimmune nature of these diseases. Walter F. Lever, M.D. contributed significantly to our understanding of the histopathologic features of these diseases. Walter Lever, M.D. and Ken Hashimoto, M.D. contributed electron microscopic studies of these diseases, especially in pemphigus vulgaris and bullous pemphigoid. In bullous pemphigoid (BP, linear IgA bullous dermatosis, epidermolysis bullosa acquisita (EBA and dermatitis herpetiformis (DH, loss of adhesion takes place within or underneath the BMZ. Classic EBA demonstrates extensive skin fragility; DH is commonly associated with gluten-sensitive enteropathy, and manifests clinically with pruritic papulovesicles on the extensor surfaces of the extremities and the lumbosacral area. The clinical spectrum of bullous pemphigoid includes tense blisters, urticarial plaques, and prurigo-like eczematous lesions. Pemphigoid gestationis mostly occurs during the last trimester of pregnancy, and mucous membrane pemphigoid primarily involves the oral mucosa and conjunctivae and leads to scarring. Linear IgA bullous dermatosis manifests with tense blisters in a „cluster of jewels”-like pattern in childhood (chronic bullous disease of childhood and is more clinically heterogeneous in adulthood. Many of the autoantigens in these disorders are known and have been well characterized. ABDs may be influenced by both genetic and exogenous factors. The diagnoses of

  13. Galactose oxidase labeling of membrane proteins from human brain white matter

    International Nuclear Information System (INIS)

    Hukkanen, V.; Frey, H.; Salmi, A.


    Membrane proteins of human autopsy brain white matter were subjected to a galactose oxidase/NaB 3 H 4 labeling procedure and the membranes labeled by this method or by [ 3 H]acetic anhydride techniques were studied by lectin affinity chromatography using Lens culinaris phytohemagglutinin (lentil lectin) attached to Sepharose 4B beads. (Auth.)

  14. Training-induced changes in membrane transport proteins of human skeletal muscle

    DEFF Research Database (Denmark)

    Juel, C.


    Training improves human physical performance by inducing structural and cardiovascular changes, metabolic changes, and changes in the density of membrane transport proteins. This review focuses on the training-induced changes in proteins involved in sarcolemmal membrane transport. It is concluded...

  15. The epidermal growth factor-like domains of the human EMR2 receptor mediate cell attachment through chondroitin sulfate glycosaminoglycans

    NARCIS (Netherlands)

    Stacey, Martin; Chang, Gin-Wen; Davies, John Q.; Kwakkenbos, Mark J.; Sanderson, Ralph D.; Hamann, Jörg; Gordon, Siamon; Lin, Hsi-Hsien


    Using multivalent protein probes, an evolutionarily conserved endogenous ligand for EMR2, a human myeloid cell-restricted EGF-TM7 receptor, was identified on the surface of a number of adherent cell lines. In addition, in situ staining of the ligand has revealed specific in vivo patterns consistent

  16. The Acinar Cage: Basement Membranes Determine Molecule Exchange and Mechanical Stability of Human Breast Cell Acini.

    Directory of Open Access Journals (Sweden)

    Aljona Gaiko-Shcherbak

    Full Text Available The biophysical properties of the basement membrane that surrounds human breast glands are poorly understood, but are thought to be decisive for normal organ function and malignancy. Here, we characterize the breast gland basement membrane with a focus on molecule permeation and mechanical stability, both crucial for organ function. We used well-established and nature-mimicking MCF10A acini as 3D cell model for human breast glands, with ether low- or highly-developed basement membrane scaffolds. Semi-quantitative dextran tracer (3 to 40 kDa experiments allowed us to investigate the basement membrane scaffold as a molecule diffusion barrier in human breast acini in vitro. We demonstrated that molecule permeation correlated positively with macromolecule size and intriguingly also with basement membrane development state, revealing a pore size of at least 9 nm. Notably, an intact collagen IV mesh proved to be essential for this permeation function. Furthermore, we performed ultra-sensitive atomic force microscopy to quantify the response of native breast acini and of decellularized basement membrane shells against mechanical indentation. We found a clear correlation between increasing acinar force resistance and basement membrane formation stage. Most important native acini with highly-developed basement membranes as well as cell-free basement membrane shells could both withstand physiologically relevant loads (≤ 20 nN without loss of structural integrity. In contrast, low-developed basement membranes were significantly softer and more fragile. In conclusion, our study emphasizes the key role of the basement membrane as conductor of acinar molecule influx and mechanical stability of human breast glands, which are fundamental for normal organ function.

  17. A variety of human monoclonal antibodies against epidermal growth factor receptor isolated from a phage antibody library. (United States)

    Kurosawa, Gene; Kondo, Mariko; Kurosawa, Yoshikazu


    When the technology for constructing human antibody (Ab) libraries using a phage-display system was developed, many researchers in Ab-related fields anticipated that it would be widely applied to the development of pharmaceutical drugs against various diseases, including cancers. However, successful examples of such applications are very limited. Moreover, researchers who utilize phage-display technology now show divergent ways of thinking about phage Ab libraries. For example, there is debate about what should be the source of V H and V L genes for the construction of libraries to cover the whole repertoire of Abs present in the human body. In the immune system, the introduction of mutations into V genes followed by selection based on binding activity, termed Ab maturation, is required for the production of Abs exhibiting high affinity to the antigen (Ag). Therefore, introduction of mutations and selection are required for isolation of Abs with high affinity after isolation of clones from phage Ab libraries. We constructed a large human Ab library termed AIMS, developed a screening method termed ICOS, and succeeded in isolating many human monoclonal Abs (mAbs) that specifically and strongly bind to various tumor-associated Ags. Eight anti-EGFR mAbs were included, which we characterized. These mAbs showed various different activities against EGFR-expressing cancer cells. In this paper, we describe these data and discuss the possibility and necessity that the mAbs isolated from the AIMS library might be developed as therapeutic drugs against cancers without introduction of mutations. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  18. Atomic force microscopy on plasma membranes from Xenopus laevis oocytes containing human aquaporin 4. (United States)

    Orsini, Francesco; Santacroce, Massimo; Cremona, Andrea; Gosvami, Nitya N; Lascialfari, Alessandro; Hoogenboom, Bart W


    Atomic force microscopy (AFM) is a unique tool for imaging membrane proteins in near-native environment (embedded in a membrane and in buffer solution) at ~1 nm spatial resolution. It has been most successful on membrane proteins reconstituted in 2D crystals and on some specialized and densely packed native membranes. Here, we report on AFM imaging of purified plasma membranes from Xenopus laevis oocytes, a commonly used system for the heterologous expression of membrane proteins. Isoform M23 of human aquaporin 4 (AQP4-M23) was expressed in the X. laevis oocytes following their injection with AQP4-M23 cRNA. AQP4-M23 expression and incorporation in the plasma membrane were confirmed by the changes in oocyte volume in response to applied osmotic gradients. Oocyte plasma membranes were then purified by ultracentrifugation on a discontinuous sucrose gradient, and the presence of AQP4-M23 proteins in the purified membranes was established by Western blotting analysis. Compared with membranes without over-expressed AQP4-M23, the membranes from AQP4-M23 cRNA injected oocytes showed clusters of structures with lateral size of about 10 nm in the AFM topography images, with a tendency to a fourfold symmetry as may be expected for higher-order arrays of AQP4-M23. In addition, but only infrequently, AQP4-M23 tetramers could be resolved in 2D arrays on top of the plasma membrane, in good quantitative agreement with transmission electron microscopy analysis and the current model of AQP4. Our results show the potential and the difficulties of AFM studies on cloned membrane proteins in native eukaryotic membranes. Copyright © 2014 John Wiley & Sons, Ltd.

  19. Upregulated epidermal growth factor receptor expression following near-infrared irradiation simulating solar radiation in a three-dimensional reconstructed human corneal epithelial tissue culture model

    Directory of Open Access Journals (Sweden)

    Tanaka Y


    Full Text Available Yohei Tanaka,1,2 Jun Nakayama2 1Department of Plastic Surgery, Clinica Tanaka Plastic, Reconstructive Surgery and Anti-aging Center, 2Department of Molecular Pathology, Shinshu University Graduate School of Medicine, Matsumoto, Nagano, Japan Background and objective: Humans are increasingly exposed to near-infrared (NIR radiation from both natural (eg, solar and artificial (eg, electrical appliances sources. Although the biological effects of sun and ultraviolet (UV exposure have been extensively investigated, the biological effect of NIR radiation is still unclear. We previously reported that NIR as well as UV induces photoaging and standard UV-blocking materials, such as sunglasses, do not sufficiently block NIR. The objective of this study was to investigate changes in gene expression in three-dimensional reconstructed corneal epithelial tissue culture exposed to broad-spectrum NIR irradiation to simulate solar NIR radiation that reaches human tissues.Materials and methods: DNA microarray and quantitative real-time polymerase chain reaction analysis were used to assess gene expression levels in a three-dimensional reconstructed corneal epithelial model composed of normal human corneal epithelial cells exposed to water-filtered broad-spectrum NIR irradiation with a contact cooling (20°C. The water-filter allowed 1,000–1,800 nm wavelengths and excluded 1,400–1,500 nm wavelengths.Results: A DNA microarray with >62,000 different probes showed 25 and 150 genes that were up- or downregulated by at least fourfold and twofold, respectively, after NIR irradiation. In particular, epidermal growth factor receptor (EGFR was upregulated by 19.4-fold relative to control cells. Quantitative real-time polymerase chain reaction analysis revealed that two variants of EGFR in human corneal epithelial tissue were also significantly upregulated after five rounds of 10 J/cm2 irradiation (P<0.05.Conclusion: We found that NIR irradiation induced the

  20. Effects of phenylpropanolamine (PPA) on in vitro human erythrocyte membranes and molecular models

    Energy Technology Data Exchange (ETDEWEB)

    Suwalsky, Mario, E-mail: [Faculty of Chemical Sciences, University of Concepcion, Concepcion (Chile); Zambrano, Pablo; Mennickent, Sigrid [Faculty of Pharmacy, University of Concepcion, Concepcion (Chile); Villena, Fernando [Faculty of Biological Sciences, University of Concepcion, Concepcion (Chile); Sotomayor, Carlos P.; Aguilar, Luis F. [Instituto de Quimica, Pontificia Universidad Catolica de Valparaiso, Valparaiso (Chile); Bolognin, Silvia [CNR-Institute for Biomedical Technologies, University of Padova, Padova (Italy)


    Research highlights: {yields} PPA is a common ingredient in cough-cold medication and appetite suppressants. {yields} Reports on its effects on human erythrocytes are very scarce. {yields} We found that PPA induced in vitro morphological changes to human erythrocytes. {yields} PPA interacted with isolated unsealed human erythrocyte membranes. {yields} PPA interacted with class of lipid present in the erythrocyte membrane outer monolayer. -- Abstract: Norephedrine, also called phenylpropanolamine (PPA), is a synthetic form of the ephedrine alkaloid. After reports of the occurrence of intracranial hemorrhage and other adverse effects, including several deaths, PPA is no longer sold in USA and Canada. Despite the extensive information about PPA toxicity, reports on its effects on cell membranes are scarce. With the aim to better understand the molecular mechanisms of the interaction of PPA with cell membranes, ranges of concentrations were incubated with intact human erythrocytes, isolated unsealed human erythrocyte membranes (IUM), and molecular models of cell membranes. The latter consisted in bilayers built-up of dimyristoylphosphatidylcholine (DMPC) and dimyristoylphosphatidylethanolamine (DMPE), phospholipid classes present in the outer and inner monolayers of most plasmatic cell membranes, respectively. The capacity of PPA to perturb the bilayer structures of DMPC and DMPE was assessed by X-ray diffraction, DMPC large unilamellar vesicles (LUV) and IUM were studied by fluorescence spectroscopy, and intact human erythrocytes were observed by scanning electron microscopy (SEM). This study presents evidence that PPA affects human red cell membranes as follows: (a) in SEM studies on human erythrocytes it was observed that 0.5 mM PPA induced shape changes; (b) in IUM PPA induced a sharp decrease in the fluorescence anisotropy in the lipid bilayer acyl chains in a concentration range lower than 100 {mu}M; (c) X-ray diffraction studies showed that PPA in the 0.1-0.5 m

  1. Concurrent Autophagy Inhibition Overcomes the Resistance of Epidermal Growth Factor Receptor Tyrosine Kinase Inhibitors in Human Bladder Cancer Cells. (United States)

    Kang, Minyong; Lee, Kyoung-Hwa; Lee, Hye Sun; Jeong, Chang Wook; Kwak, Cheol; Kim, Hyeon Hoe; Ku, Ja Hyeon


    Despite the potential therapeutic efficacy of epithelial growth factor receptor (EGFR) inhibitors in the treatment of advanced stage bladder cancer, there currently is no clear evidence to support this hypothesis. In this study, we investigate whether the concurrent treatment of autophagy-blocking agents with EGFR inhibitors exerts synergistic anti-cancer effects in T24 and J82 human bladder cancer cells. Lapatinib and gefitinib were used as EGFR inhibitors, and bafilomycin A1 (BFA1), chloroquine (CQ) and 3-methyladenine (3-MA) were used as the pharmacologic inhibitors of autophagy activities. To assess the proliferative and self-renewal capabilities, the Cell Counting Kit-8 (CCK-8) assay and a clonogenic assay were performed, respectively. To examine apoptotic cell death, flow cytometry using annexin-V/propidium iodide (PI) was used. To measure the autophagy activities, the expression levels of LC3I and II was determined by Western blot analysis. To validate the synergistic effects of autophagy inhibition with EGFR inhibitors, we specifically blocked key autophagy regulatory gene ATG12 by transfection of small interference RNA and examined the phenotypic changes. Of note, lapatinib and gefitinib triggered autophagy activities in T24 and J82 human bladder cancer cells, as indicated by upregulation of LC3II. More importantly, inhibiting autophagy activities with pharmacologic inhibitors (BFA1, CQ or 3-MA) remarkably reduced the cell viabilities and clonal proliferation of T24 and J82 cells, compared to those treated with either of the agents alone. We also obtained similar results of the enhanced anti-cancer effects of EGFR inhibitors by suppressing the expression of ATG12. Notably, the apoptotic assay showed that synergistic anti-cancer effects were induced via the increase of apoptotic cell death. In summary, concomitant inhibition of autophagy activities potentiated the anti-cancer effects of EGFR inhibitors in human bladder cancer cells, indicating a novel

  2. Concurrent Autophagy Inhibition Overcomes the Resistance of Epidermal Growth Factor Receptor Tyrosine Kinase Inhibitors in Human Bladder Cancer Cells

    Directory of Open Access Journals (Sweden)

    Minyong Kang


    Full Text Available Despite the potential therapeutic efficacy of epithelial growth factor receptor (EGFR inhibitors in the treatment of advanced stage bladder cancer, there currently is no clear evidence to support this hypothesis. In this study, we investigate whether the concurrent treatment of autophagy-blocking agents with EGFR inhibitors exerts synergistic anti-cancer effects in T24 and J82 human bladder cancer cells. Lapatinib and gefitinib were used as EGFR inhibitors, and bafilomycin A1 (BFA1, chloroquine (CQ and 3-methyladenine (3-MA were used as the pharmacologic inhibitors of autophagy activities. To assess the proliferative and self-renewal capabilities, the Cell Counting Kit-8 (CCK-8 assay and a clonogenic assay were performed, respectively. To examine apoptotic cell death, flow cytometry using annexin-V/propidium iodide (PI was used. To measure the autophagy activities, the expression levels of LC3I and II was determined by Western blot analysis. To validate the synergistic effects of autophagy inhibition with EGFR inhibitors, we specifically blocked key autophagy regulatory gene ATG12 by transfection of small interference RNA and examined the phenotypic changes. Of note, lapatinib and gefitinib triggered autophagy activities in T24 and J82 human bladder cancer cells, as indicated by upregulation of LC3II. More importantly, inhibiting autophagy activities with pharmacologic inhibitors (BFA1, CQ or 3-MA remarkably reduced the cell viabilities and clonal proliferation of T24 and J82 cells, compared to those treated with either of the agents alone. We also obtained similar results of the enhanced anti-cancer effects of EGFR inhibitors by suppressing the expression of ATG12. Notably, the apoptotic assay showed that synergistic anti-cancer effects were induced via the increase of apoptotic cell death. In summary, concomitant inhibition of autophagy activities potentiated the anti-cancer effects of EGFR inhibitors in human bladder cancer cells, indicating

  3. Hypoxia changes the expression of the epidermal growth factor (EGF) system in human hearts and cultured cardiomyocytes

    DEFF Research Database (Denmark)

    Munk, Mathias; Memon, Ashfaque Ahmed; Goetze, Jens Peter


    by treatment with trastuzumab (20 nM). This resulted in inhibition of cardiomyocyte proliferation, but interestingly only in hypoxic cells. Co-treatment of HL-1 cells with HB-EGF (10 nM) but not with NRG-1 (5 ng/ml) rescued the cardiomyocytes from HER2 inhibition. HL-1 cardiomyocytes exposed to hypoxia...... revealed nuclear translocation of activated MAPK and the activity of this downstream signaling molecule was decreased by HER2 inhibition (20 nM trastuzumab), and re-established by HB-EGF (10 nM). CONCLUSIONS/SIGNIFICANCE: Hypoxia in the human heart alters the expression of the EGF system. Mimicking the HER...

  4. Ginsenosides Rb1 and Rg1 Stimulate Melanogenesis in Human Epidermal Melanocytes via PKA/CREB/MITF Signaling

    Directory of Open Access Journals (Sweden)

    Mao Lin


    Full Text Available Reduced or defective melanin skin pigmentation may cause many hypopigmentation disorders and increase the risk of damage to the skin triggered by UV irradiation. Ginsenosides Rb1 and Rg1 have many molecular targets including the cAMP-response element-binding protein (CREB, which is involved in melanogenesis. This study aimed to investigate the effects of ginsenosides Rb1 and Rg1 on melanogenesis in human melanocytes and their related mechanisms. The effects of Rb1 and Rg1 on cell viability, tyrosinase activity, cellular melanin content and protein levels of tyrosinase, microphthalmia-associated transcription factor (MITF, and activation of CREB in melanocytes were assessed. Results showed that Rb1 or Rg1 significantly increased cellular melanin content and tyrosinase activity in a dose-dependent manner. By contrast, the cell viability of melanocytes remained unchanged. After exposure to Rb1 or Rg1, the protein levels of tyrosinase, MITF, and phosphorylated CREB were significantly increased. Furthermore, pretreatment with the selective PKA inhibitor H-89 significantly blocked the Rb1- or Rg1-induced increase of melanin content. These findings indicated that Rb1 and Rg1 increased melanogenesis and tyrosinase activity in human melanocytes, which was associated with activation of PKA/CREB/MITF signaling. The effects and mechanisms of Rb1 or Rg1 on skin pigmentation deserve further study.

  5. Assembly factors for the membrane arm of human complex I. (United States)

    Andrews, Byron; Carroll, Joe; Ding, Shujing; Fearnley, Ian M; Walker, John E


    Mitochondrial respiratory complex I is a product of both the nuclear and mitochondrial genomes. The integration of seven subunits encoded in mitochondrial DNA into the inner membrane, their association with 14 nuclear-encoded membrane subunits, the construction of the extrinsic arm from 23 additional nuclear-encoded proteins, iron-sulfur clusters, and flavin mononucleotide cofactor require the participation of assembly factors. Some are intrinsic to the complex, whereas others participate transiently. The suppression of the expression of the NDUFA11 subunit of complex I disrupted the assembly of the complex, and subcomplexes with masses of 550 and 815 kDa accumulated. Eight of the known extrinsic assembly factors plus a hydrophobic protein, C3orf1, were associated with the subcomplexes. The characteristics of C3orf1, of another assembly factor, TMEM126B, and of NDUFA11 suggest that they all participate in constructing the membrane arm of complex I.

  6. Human antibody fragments specific for the epidermal growth factor receptor selected from large non-immunised phage display libraries. (United States)

    Souriau, Christelle; Rothacker, Julie; Hoogenboom, Hennie R; Nice, Edouard


    Antibodies to EGFR have been shown to display anti-tumour effects mediated in part by inhibition of cellular proliferation and angiogenesis, and by enhancement of apoptosis. Humanised antibodies are preferred for clinical use to reduce complications with HAMA and HAHA responses frequently seen with murine and chimaeric antibodies. We have used depletion and subtractive selection strategies on cells expressing the EGFR to sample two large antibody fragment phage display libraries for the presence of human antibodies which are specific for the EGFR. Four Fab fragments and six scFv fragments were identified, with affinities of up to 2.2nM as determined by BIAcore analysis using global fitting of the binding curves to obtain the individual rate constants (ka and kd). This overall approach offers a generic screening method for the identification of growth factor specific antibodies and antibody fragments from large expression libraries and has potential for the rapid development of new therapeutic and diagnostic reagents.

  7. A novel role of RASSF9 in maintaining epidermal homeostasis.

    Directory of Open Access Journals (Sweden)

    Chiou-Mei Lee

    Full Text Available The physiological role of RASSF9, a member of the Ras-association domain family (RASSF, is currently unclear. Here, we report a mouse line in which an Epstein-Barr virus Latent Membrane Protein 1 (LMP1 transgene insertion has created a 7.2-kb chromosomal deletion, which abolished RASSF9 gene expression. The RASSF9-null mice exhibited interesting phenotypes that resembled human ageing, including growth retardation, short lifespan, less subcutaneous adipose layer and alopecia. In the wild-type mice, RASSF9 is predominantly expressed in the epidermal keratinocytes of skin, as determined by quantitative reverse-transcription PCR, immunofluorescence and in situ hybridization. In contrast, RASSF9-/- mice presented a dramatic change in epithelial organization of skin with increased proliferation and aberrant differentiation as detected by bromodeoxyuridine incorporation assays and immunofluorescence analyses. Furthermore, characteristic functions of RASSF9-/- versus wild type (WT mouse primary keratinocytes showed significant proliferation linked to a reduction of p21Cip1 expression under growth or early differentiation conditions. Additionally, in RASSF9-/- keratinocytes there was a drastic down-modulation of terminal differentiation markers, which could be rescued by infection with a recombinant adenovirus, Adv/HA-RASSF9. Our results indicate a novel and significant role of RASSF9 in epidermal homeostasis.

  8. A practical guide for the identification of membrane and plasma membrane proteins in human embryonic stem cells and human embryonal carcinoma cells.

    NARCIS (Netherlands)

    Dormeyer, W.; van Hoof, D.; Mummery, C.L.; Krijgsveld, J.; Heck, A.


    The identification of (plasma) membrane proteins in cells can provide valuable insights into the regulation of their biological processes. Pluripotent cells such as human embryonic stem cells and embryonal carcinoma cells are capable of unlimited self-renewal and share many of the biological

  9. Everolimus Plus Endocrine Therapy for Postmenopausal Women With Estrogen Receptor-Positive, Human Epidermal Growth Factor Receptor 2-Negative Advanced Breast Cancer: A Clinical Trial. (United States)

    Royce, Melanie; Bachelot, Thomas; Villanueva, Cristian; Özgüroglu, Mustafa; Azevedo, Sergio J; Cruz, Felipe Melo; Debled, Marc; Hegg, Roberto; Toyama, Tatsuya; Falkson, Carla; Jeong, Joon; Srimuninnimit, Vichien; Gradishar, William J; Arce, Christina; Ridolfi, Antonia; Lin, Chinjune; Cardoso, Fatima


    Cotargeting the mammalian target of rapamycin pathway and estrogen receptor may prevent or delay endocrine resistance in patients receiving first-line treatment for advanced breast cancer. To investigate the combination of everolimus plus endocrine therapy in first-line and second-line treatment settings for postmenopausal women with estrogen receptor-positive, human epidermal growth receptor 2-negative advanced breast cancer. In the multicenter, open-label, single-arm, phase 2 BOLERO-4 (Breast Cancer Trials of Oral Everolimus) clinical trial, 245 patients were screened for eligibility; 202 were enrolled between March 7, 2013, and December 17, 2014. A median follow-up of 29.5 months had been achieved by the data cutoff date (December 17, 2016). Patients received first-line treatment with everolimus, 10 mg/d, plus letrozole, 2.5 mg/d. Second-line treatment with everolimus, 10 mg/d, plus exemestane, 25 mg/d, was offered at the investigator's discretion upon initial disease progression. The primary end point was investigator-assessed progression-free survival in the first-line setting per Response Evaluation Criteria in Solid Tumors, version 1.0. Safety was assessed in patients who received at least 1 dose of study medication and at least 1 postbaseline safety assessment. A total of 202 women treated in the first-line setting had a median age of 64.0 years (interquartile range, 58.0-70.0 years) with metastatic (194 [96.0%]) or locally advanced (8 [4.0%]) breast cancer. Median progression-free survival was 22.0 months (95% CI, 18.1-25.1 months) with everolimus and letrozole. Median overall survival was not reached; 24-month estimated overall survival rate was 78.7% (95% CI, 72.1%-83.9%). Fifty patients started second-line treatment; median progression-free survival was 3.7 months (95% CI, 1.9-7.4 months). No new safety signals were observed. In the first-line setting, the most common all-grade adverse event was stomatitis (139 [68.8%]); the most common grade 3 to 4

  10. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)


    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  11. Phase II study of paclitaxel given once per week along with trastuzumab and pertuzumab in patients with human epidermal growth factor receptor 2-positive metastatic breast cancer. (United States)

    Dang, Chau; Iyengar, Neil; Datko, Farrah; D'Andrea, Gabriella; Theodoulou, Maria; Dickler, Maura; Goldfarb, Shari; Lake, Diana; Fasano, Julie; Fornier, Monica; Gilewski, Theresa; Modi, Shanu; Gajria, Devika; Moynahan, Mary Ellen; Hamilton, Nicola; Patil, Sujata; Jochelson, Maxine; Norton, Larry; Baselga, Jose; Hudis, Clifford


    The CLEOPATRA (Clinical Evaluation of Trastuzumab and Pertuzumab) study demonstrated superior progression-free survival (PFS) and overall survival when pertuzumab was added to trastuzumab and docetaxel. Paclitaxel given once per week is effective and less toxic than docetaxel. We performed a phase II study to evaluate the efficacy and safety of pertuzumab and trastuzumab with paclitaxel given once per week. Patients with metastatic human epidermal growth factor receptor 2-positive breast cancer with zero to one prior therapy were enrolled. Treatment consisted of paclitaxel 80 mg/m(2) once per week plus trastuzumab (8 mg/kg loading dose → 6 mg/kg) once every 3 weeks plus pertuzumab (840 mg loading dose → 420 mg) once every 3 weeks, all given intravenously. The primary end point was 6-month PFS assessed by Kaplan-Meier methods. From January 2011 to December 2013, we enrolled 69 patients: 51 (74%) and 18 (26%) treated in first- and second-line metastatic settings, respectively. At a median follow-up of 21 months (range, 3 to 38 months), 6-month PFS was 86% (95% CI, 75% to 92%). The median PFS was 19.5 months (95% CI, 14 to 26 months) overall. PFS was 24.2 months (95% CI, 14 months to not reached [NR]) and 16.4 months (95% CI, 8.5 months to NR) for those without and with prior treatment, respectively. At 1 year, Kaplan-Meier PFS was 70% (95% CI, 56% to 79%) overall, 71% (95% CI, 55% to 82%) for those without prior therapy, and 66% (95% CI, 40% to 83%) for those with prior therapy. Treatment was well-tolerated; there was no febrile neutropenia or symptomatic left ventricular systolic dysfunction. Paclitaxel given once per week with trastuzumab and pertuzumab is highly active and well tolerated and seems to be an effective alternative to docetaxel-based combination therapy. © 2014 by American Society of Clinical Oncology.

  12. Suppression of the Epidermal Growth Factor-like Domain 7 and Inhibition of Migration and Epithelial-Mesenchymal Transition in Human Pancreatic Cancer PANC-1 Cells. (United States)

    Wang, Yun-Liang; Dong, Feng-Lin; Yang, Jian; Li, Zhi; Zhi, Qiao-Ming; Zhao, Xin; Yang, Yong; Li, De-Chun; Shen, Xiao-Chun; Zhou, Jin


    Epidermal growth factor-like domain multiple 7 (EGFL7), a secreted protein specifically expressed by endothelial cells during embryogenesis, recently was identified as a critical gene in tumor metastasis. Epithelial-mesenchymal transition (EMT) was found to be closely related with tumor progression. Accordingly, it is important to investigate the migration and EMT change after knock-down of EGFL7 gene expression in human pancreatic cancer cells. EGFL7 expression was firstly testified in 4 pancreatic cancer cell lines by real-time polymerase chain reaction (Real-time PCR) and western blot, and the highest expression of EGFL7 was found in PANC-1 cell line. Then, PANC-1 cells transfected with small interference RNA (siRNA) of EGFL7 using plasmid vector were named si-PANC-1, while transfected with negative control plasmid vector were called NC-PANC-1. Transwell assay was used to analyze the migration of PANC-1 cells. Real-time PCR and western blotting were used to detect the expression change of EGFL7 gene, EMT markers like E-Cadherin, N-Cadherin, Vimentin, Fibronectin and transcription factors like snail, slug in PANC-1, NC- PANC-1, and si-PANC-1 cells, respectively. After successful plasmid transfection, EGFL7 gene were dramatically knock-down by RNA interference in si-PANC-1 group. Meanwhile, migration ability decreased significantly, compared with PANC-1 and NC-PANC-1 group. Meanwhile, the expression of epithelial phenotype marker E-Cadherin increased and that of mesenchymal phenotype markers N-Cadherin, Vimentin, Fibronectin dramatically decreased in si-PANC-1 group, indicating a reversion of EMT. Also, transcription factors snail and slug decreased significantly after RNA interference. Current study suggested that highly-expressed EGFL7 promotes migration of PANC-1 cells and acts through transcription factors snail and slug to induce EMT, and further study is needed to confirm this issue.

  13. Molecular subclassification determined by human papillomavirus and epidermal growth factor receptor status is associated with the prognosis of oropharyngeal squamous cell carcinoma. (United States)

    Nakano, Takafumi; Yamamoto, Hidetaka; Nakashima, Torahiko; Nishijima, Toshimitsu; Satoh, Masanobu; Hatanaka, Yui; Shiratsuchi, Hideki; Yasumatsu, Ryuji; Toh, Satoshi; Komune, Shizuo; Oda, Yoshinao


    Human papillomavirus (HPV) infection is an indicator of good response to chemoradiotherapy in oropharyngeal squamous cell carcinoma (OPSCC), and epidermal growth factor receptor (EGFR) is a molecular-therapeutic target in head and neck squamous cell carcinoma. Here we investigated the prevalence and prognostic significance of HPV infection and EGFR alteration in OPSCC. We analyzed the presence of high-risk HPV using in situ hybridization, protein expressions of p16 and EGFR using immunohistochemistry, and the EGFR gene copy number gain using chromogenic in situ hybridization (CISH) in 105 cases of OPSCC. The biopsy specimens before chemoradiotherapy were used for these analyses. HPV infection and p16 protein overexpression were detected in 53.3% and 52.4% of the OPSCCs, and each factor was associated with better overall survival (P = .0026 and P = .0026) and nonkeratinizing histology (P = .0002 and P = .0004), respectively. EGFR gene copy number gain (high polysomy or amplification) was detected in 12.4% of the OPSCCs and was correlated with EGFR protein overexpression (P = .0667) and worse overall survival (P CISH positive) were mutually exclusive. The HPV-negative/EGFR CISH-positive OPSCCs had significantly worse overall survival than did the HPV-positive/EGFR CISH-negative OPSCCs and HPV-negative/EGFR CISH-negative OPSCCs (P CISH-negative OPSCCs had favorable prognosis irrespective of HPV infection. Our results suggest that EGFR gene copy number gain-positive tumors represent an HPV-negative, aggressive subgroup of OPSCCs. The molecular subclassification of OPSCCs based on HPV infection and EGFR status may serve as important information for appropriate therapeutic strategy. Copyright © 2015 Elsevier Inc. All rights reserved.

  14. The curative effects of radiotherapy-based therapies for human epidermal growth factor receptor 2-positive breast cancer: A meta-analysis. (United States)

    Shao, Minghai; Zhang, Chi; Qin, Qin; Zhang, Zhaoyue; Zhu, Hongcheng; Di, Xiaoke; Sun, Xinchen


    This meta-analysis was designed to fully assess the curative effects of radiotherapy-based therapies for human epidermal growth factor receptor 2-positive (HER2+) breast cancer (BC). English articles were retrieved through searching Cochrane library, PubMed, and Embase databases updated to February 2017. Studies were selected based on the inclusion and exclusion criteria. The curative effects of radiotherapy-based therapies forHER2+ BC patients were assessed using hazard rates (HRs) or odds ratios (ORs), as well as their 95% confidence intervals (CIs). In addition, Egger test was used to assess publication bias, followed by sensitivity analysis. All statistic methods were conducted using R 3.12 software. A total of 9 eligible studies were included into this meta-analysis, which involved 2236 HER2+ BC patients. Egger test showed that the eligible studies had no publication bias (t = 2.198, P = .05918). Sensitivity analysis demonstrated that the results were stable. HER2+ BC patients in radiotherapy group had lower locoregional recurrences than those in other groups. Moreover, meta-analysis showed that no significant difference was found between HER2+ BC patients in radiotherapy group and other groups on the 1-year overall survival (P = 0.5263, I = 65.4%), 3-year overall survival (P = 0.4591, I = 0), and 5-year overall survival (P = 0.06277, I = 0). Radiotherapy-based therapies might have certain advantages in treating HER2+ BC patients.

  15. Disease management patterns for postmenopausal women in Europe with hormone-receptor-positive, human epidermal growth factor receptor-2 negative advanced breast cancer. (United States)

    André, Fabrice; Neven, Patrick; Marinsek, Nina; Zhang, Jie; Baladi, Jean-Francois; Degun, Ravi; Benelli, Giancarlo; Saletan, Stephen; Jerusalem, Guy


    International guidelines for hormone-receptor-positive (HR(+)), human epidermal growth factor receptor-2 negative (HER2(-)) advanced breast cancer (BC) recommend sequential lines of hormonal therapy (HT), and only recommend chemotherapy for patients with extensive visceral involvement or rapidly progressive disease. This study evaluated actual physician-reported treatments for advanced BC in Europe. We conducted a retrospective chart review of 355 postmenopausal women with HR(+), HER2(-) advanced BC who progressed on ≥1 line of HT (adjuvant or advanced) and completed ≥1 line of chemotherapy (advanced). Treatment choice was evaluated for each line of therapy. Of 355 patients, 111 (31%) received first-line chemotherapy, whereas 218 (61%) and 26 (7%) switched from HT to chemotherapy in second and third line, respectively. More patients receiving first-line HT had bone metastases (73% vs 27% chemotherapy). Patients treated with first-line chemotherapy had more brain (12% vs 3% HT) or extensive liver (13% vs 6% HT) metastases. Subgroup analysis of 188 patients who received first-line HT and had de novo advanced BC or relapsed/recurrent disease more than 1 year after adjuvant therapy found that the majority (89%; n = 167) of these patients switched to chemotherapy in second line. However, among these 167 patients, 27% had no significant changes in metastases between first and second line. Among the 73% of patients who had significant changes in metastases, 20% had no brain metastases or extensive visceral disease. Our study suggests that the guideline-recommended use of multiple HT lines is open to interpretation and that optimal treatment for European postmenopausal women with HR(+), HER2(-) advanced BC who responded to HT may not be achieved.

  16. Patterns of resource utilization and cost for postmenopausal women with hormone-receptor–positive, human epidermal growth factor receptor-2–negative advanced breast cancer in Europe

    International Nuclear Information System (INIS)

    Jerusalem, Guy; Neven, Patrick; Marinsek, Nina; Zhang, Jie; Degun, Ravi; Benelli, Giancarlo; Saletan, Stephen; Ricci, Jean-François; Andre, Fabrice


    Healthcare resource utilization in breast cancer varies by disease characteristics and treatment choices. However, lack of clarity in guidelines can result in varied interpretation and heterogeneous treatment management and costs. In Europe, the extent of this variability is unclear. Therefore, evaluation of chemotherapy use and costs versus hormone therapy across Europe is needed. This retrospective chart review (N = 355) examined primarily direct costs for chemotherapy versus hormone therapy in postmenopausal women with hormone-receptor–positive (HR+), human epidermal growth factor receptor-2–negative (HER2–) advanced breast cancer across 5 European countries (France, Germany, The Netherlands, Belgium, and Sweden). Total direct costs across the first 3 treatment lines were approximately €10 000 to €14 000 lower for an additional line of hormone therapy-based treatment versus switching to chemotherapy-based treatment. Direct cost difference between chemotherapy-based and hormone therapy-based regimens was approximately €1900 to €2500 per month. Chemotherapy-based regimens were associated with increased resource utilization (managing side effects; concomitant targeted therapy use; and increased frequencies of hospitalizations, provider visits, and monitoring tests). The proportion of patients taking sick leave doubled after switching from hormone therapy to chemotherapy. These results suggest chemotherapy is associated with increased direct costs and potentially with increased indirect costs (lower productivity of working patients) versus hormone therapy in HR+, HER2– advanced breast cancer. The online version of this article (doi:10.1186/s12885-015-1762-3) contains supplementary material, which is available to authorized users

  17. GEP100/Arf6 is required for epidermal growth factor-induced ERK/Rac1 signaling and cell migration in human hepatoma HepG2 cells.

    Directory of Open Access Journals (Sweden)

    ZhenZhen Hu

    Full Text Available BACKGROUND: Epidermal growth factor (EGF signaling is implicated in the invasion and metastasis of hepatoma cells. However, the signaling pathways for EGF-induced motility of hepatoma cells remain undefined. METHODOLOGY/PRINCIPAL FINDINGS: We found that EGF dose-dependently stimulated the migration of human hepatoma cells HepG2, with the maximal effect at 10 ng/mL. Additionally, EGF increased Arf6 activity, and ectopic expression of Arf6 T27N, a dominant negative Arf6 mutant, largely abolish EGF-induced cell migration. Blocking GEP100 with GEP100 siRNA or GEP100-△PH, a pleckstrin homology (PH domain deletion mutant of GEP100, blocked EGF-induced Arf6 activity and cell migration. EGF also increased ERK and Rac1 activity. Ectopic expression GEP100 siRNA, GEP100-△PH, or Arf6-T27N suppressed EGF-induced ERK and Rac1 activity. Furthermore, blocking ERK signaling with its inhibitor U0126 remarkably inhibited both EGF-induced Rac1 activation as well as cell migration, and ectopic expression of inactive mutant form of Rac1 (Rac1-T17N also largely abolished EGF-induced cell migration. CONCLUSIONS/SIGNIFICANCE: Taken together, this study highlights the function of the PH domain of GEP100 and its regulated Arf6/ERK/Rac1 signaling cascade in EGF-induced hepatoma cell migration. These findings could provide a rationale for designing new therapy based on inhibition of hepatoma metastasis.

  18. Evaluation of human epidermal growth factor receptor 2 (HER2) single nucleotide polymorphisms (SNPs) in normal and breast tumor tissues and their link with breast cancer prognostic factors. (United States)

    Furrer, Daniela; Lemieux, Julie; Côté, Marc-André; Provencher, Louise; Laflamme, Christian; Barabé, Frédéric; Jacob, Simon; Michaud, Annick; Diorio, Caroline


    Amplification of the human epidermal growth factor receptor 2 (HER2) gene is associated with worse prognosis and decreased overall survival in breast cancer patients. The HER2 gene contains several polymorphisms; two of the best-characterized HER2 polymorphisms are Ile655Val and Ala1170Pro. The aim of this study was to evaluate the association between these two HER2 polymorphisms in normal breast and breast cancer tissues and known breast cancer prognostic factors in a retrospective cohort study of 73 women with non-metastatic HER2-positive breast cancer. HER2 polymorphisms were assessed in breast cancer tissue and normal breast tissue using TaqMan assay. Ala1170Pro polymorphism in normal breast tissue was associated with age at diagnosis (p = 0.007), tumor size (p = 0.004) and lymphovascular invasion (p = 0.06). Similar significant associations in cancer tissues were observed. No association between the Ile655Val polymorphism and prognostic factors were observed. However, we found significant differences in the distribution of Ile655Val (p = 0.03) and Ala1170Pro (p = 0.01) genotypes between normal breast and breast tumor tissues. This study demonstrates that only the Ala1170Pro polymorphism is associated with prognostic factors in HER2-positive breast cancer patients. Moreover, our results suggest that both HER2 polymorphisms could play a significant role in carcinogenesis in non-metastatic HER2-positive breast cancer women. Copyright © 2016 Elsevier Ltd. All rights reserved.

  19. Gene expression profiling of histologically normal breast tissue in females with human epidermal growth factor receptor 2‑positive breast cancer. (United States)

    Zubor, Pavol; Hatok, Jozef; Moricova, Petra; Kapustova, Ivana; Kajo, Karol; Mendelova, Andrea; Sivonova, Monika Kmetova; Danko, Jan


    Gene expression profile‑based taxonomy of breast cancer (BC) has been described as a significant breakthrough in comprehending the differences in the origin and behavior of cancer to allow individually tailored therapeutic approaches. In line with this, we hypothesized that the gene expression profile of histologically normal epithelium (HNEpi) could harbor certain genetic abnormalities predisposing breast tissue cells to develop human epidermal growth factor receptor 2 (HER2)‑positive BC. Thus, the aim of the present study was to assess gene expression in normal and BC tissue (BCTis) from patients with BC in order to establish its value as a potential diagnostic marker for cancer development. An array study evaluating a panel of 84 pathway‑ and disease‑specific genes in HER2‑positive BC and tumor‑adjacent HNEpi was performed using quantitative polymerase chain reaction in 12 patients using microdissected samples from frozen tissue. Common prognostic and predictive parameters of BC were assessed by immunohistochemistry and in situ hybridization. In the BCTis and HNEpi samples of 12 HER2‑positive subjects with BC, the expression of 2,016 genes was assessed. A total of 39.3% of genes were deregulated at a minimal two‑fold deregulation rate and 10.7% at a five‑fold deregulation rate in samples of HNEpi or BCTis. Significant differences in gene expression between BCTis and HNEpi samples were revealed for BCL2L2, CD44, CTSD, EGFR, ERBB2, ITGA6, NGFB, RPL27, SCBG2A1 and SCGB1D2 genes (Pbreast tissue revealed gene expression abnormalities that may represent potential markers of increased risk for HER2‑positive malignant transformation of breast tissue, and may be able to be employed as predictors of prognosis.

  20. Phase I study of neratinib in combination with temsirolimus in patients with human epidermal growth factor receptor 2-dependent and other solid tumors. (United States)

    Gandhi, Leena; Bahleda, Rastislav; Tolaney, Sara M; Kwak, Eunice L; Cleary, James M; Pandya, Shuchi S; Hollebecque, Antoine; Abbas, Richat; Ananthakrishnan, Revathi; Berkenblit, Anna; Krygowski, Mizue; Liang, Yali; Turnbull, Kathleen W; Shapiro, Geoffrey I; Soria, Jean-Charles


    Human epidermal growth factor (HER) -mediated signaling is critical in many cancers, including subsets of breast and lung cancer. HER family members signal via the phosphatidylinositide 3-kinase (PI3K) -AKT/protein kinase B-mammalian target of rapamycin (mTOR) cascade; mTOR activation is critical for the expression of multiple contributors to tumor growth and invasion. On the basis of preclinical data suggesting synergy of HER2 inhibition and mTOR inhibition in breast and lung cancer models, we conducted a phase I combination study of neratinib, a small-molecule irreversible pan-HER tyrosine kinase inhibitor, and temsirolimus, an mTOR inhibitor, in patients with advanced solid tumors. This study enrolled patients to dosing combinations of neratinib and temsirolimus. The primary objective was to estimate the toxicity contour of the combination and establish recommended phase II doses. Sixty patients were treated on 12 of 16 possible dosing combinations. Diarrhea was the most common drug-related (93%) and dose-limiting toxicity (DLT), constituting four of 10 DLTs. Dose-limiting grade 3 metabolic abnormalities were also observed. Other frequent drug-related toxicities included nausea, stomatitis (both 53%), and anemia (48%). Two maximum-tolerated dose combinations were identified: 200 mg of neratinib/25 mg of temsirolimus and 160 mg of neratinib/50 mg of temsirolimus. Responses were noted in patients with HER2-amplified breast cancer resistant to trastuzumab, HER2-mutant non-small-cell lung cancer, and tumor types without identified mutations in the HER-PI3K-mTOR pathway. The combination of neratinib and temsirolimus was tolerable and demonstrated antitumor activity in multiple tumor types, warranting further evaluation.

  1. Gene protein detection platform--a comparison of a new human epidermal growth factor receptor 2 assay with conventional immunohistochemistry and fluorescence in situ hybridization platforms. (United States)

    Stålhammar, Gustav; Farrajota, Pedro; Olsson, Ann; Silva, Cristina; Hartman, Johan; Elmberger, Göran


    Human epidermal growth factor receptor 2 (HER2) immunohistochemistry (IHC) and fluorescence in situ hybridization (FISH) are widely used semiquantitative assays for selecting breast cancer patients for HER2 antibody therapy. However, both techniques have been shown to have disadvantages. Our aim was to test a recent automated technique of combined IHC and brightfield dual in situ hybridization-gene protein detection platform (GPDP)-in breast cancer HER2 protein, gene, and chromosome 17 centromere status evaluations, comparing the results in accordance to the American Society of Clinical Oncology/College of American Pathologists recommendations for HER2 testing in breast cancer from both 2007 and 2013. The GPDP technique performance was evaluated on 52 consecutive whole slide invasive breast cancer cases with HER2 IHC 2/3+ scoring results. Applying in turns the American Society of Clinical Oncology/College of American Pathologists recommendations for HER2 testing in breast cancer from 2007 and 2013 to both FISH and GPDP DISH assays, the HER2 gene amplification results showed 100% concordance among amplified/nonamplified cases, but there was a shift in 4 cases toward positive from equivocal results and toward equivocal from negative results. This might be related to the emphasis on the average HER2 copy number in the 2013 criteria. HER2 expression by IVD market IHC kit (Pathway®) has a strong correlation with GPDP HER2 protein, including a full concordance for all cases scored as 3+ and a reduction from 2+ to 1+ in 7 cases corresponding to nonamplified cases. Gene protein detection platform HER2 protein "solo" could have spared the need for 7 FISH studies. In addition, the platform offered advantages on interpretation reassurance including selecting areas for counting gene signals paralleled with protein IHC expression, on heterogeneity detection, interpretation time, technical time, and tissue expense. Copyright © 2015 Elsevier Inc. All rights reserved.

  2. Toxicity of jet fuel aliphatic and aromatic hydrocarbon mixtures on human epidermal Keratinocytes: evaluation based on in vitro cytotoxicity and interleukin-8 release

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Jen-Hung (Chung-Shan Medical University Hospital, Department of Dermatology, Taichung, Taiwan, R.O.C); Lee, Chia-Hue; Tsang, Chau-Loong [National Chung-Hsing University, College of Veterinary Medicine, Taichung (Taiwan); Monteiro-Riviere, Nancy A.; Riviere, Jim E. [North Carolina State University, Center for Chemical Toxicology Research and Pharmacokinetics (CCTRP), Raleigh, NC (United States); Chou, Chi-Chung [National Chung-Hsing University, College of Veterinary Medicine, Taichung (Taiwan); National Chung-Hsing University, College of Veterinary Medicine, Taichung (Taiwan)


    Jet fuels are complex mixtures of aliphatic (ALI) and aromatic (ARO) hydrocarbons that vary significantly in individual cytotoxicity and proinflammatory activity in human epidermal keratinocytes (HEK). In order to delineate the toxicological interactions among individual hydrocarbons in a mixture and their contributions to cutaneous toxicity, nine ALI and five ARO hydrocarbons were each divided into five (high/medium/low cytotoxic and strong/weak IL-8 induction) groups and intra/inter-mixed to assess for their mixture effects on HEK mortality and IL-8 release. Addition of single hydrocarbon to JP-8 fuel was also evaluated for their changes in fuel dermatotoxicity. The results indicated that when hydrocarbons were mixed, HEK mortality and IL-8 release were not all predictable by their individual ability affecting these two parameters. The lowest HEK mortality (7%) and the highest IL-8 production were induced with mixtures including high cytotoxic and weak IL-8 inductive ARO hydrocarbons. Antagonistic reactions not consistently correlated with ALI carbon chain length and ARO structure were evident and carried different weight in the overall mixture toxicities. Single addition of benzene, toluene, xylene or ethylbenzene for up to tenfold in JP-8 did not increase HEK mortality while single addition of ALI hydrocarbons exhibited dose-related differential response in IL-8. In an all ALI environment, no single hydrocarbon is the dominating factor in the determination of HEK cytotoxicity while deletion of hexadecane resulted in a 2.5-fold increase in IL-8 production. Overall, decane, undecane and dodecane were the major hydrocarbons associated with high cytotoxicity while tetradecane, pentadecane and hexadecane were those which had the greatest buffering effect attenuating dermatotoxicity. The mixture effects must be considered when evaluating jet fuel toxicity to HEK. (orig.)

  3. Safety and efficacy of neratinib in combination with capecitabine in patients with metastatic human epidermal growth factor receptor 2-positive breast cancer. (United States)

    Saura, Cristina; Garcia-Saenz, Jose A; Xu, Binghe; Harb, Wael; Moroose, Rebecca; Pluard, Timothy; Cortés, Javier; Kiger, Corinne; Germa, Caroline; Wang, Kongming; Martin, Miguel; Baselga, José; Kim, Sung-Bae


    Neratinib is a potent irreversible pan-tyrosine kinase inhibitor with antitumor activity and acceptable tolerability in patients with human epidermal growth factor receptor 2 (HER2) -positive breast cancer. A multinational, open-label, phase I/II trial was conducted to determine the maximum-tolerated dose (MTD) of neratinib plus capecitabine in patients with solid tumors (part one) and to evaluate the safety and efficacy of neratinib plus capecitabine in patients with HER2-positive metastatic breast cancer (part two). Part one was a 3 + 3 dose-escalation study in which patients with advanced solid tumors received oral neratinib once per day continuously plus capecitabine twice per day on days 1 to 14 of a 21-day cycle at predefined dose levels. In part two, patients with trastuzumab-pretreated HER2-positive metastatic breast cancer received neratinib plus capecitabine at the MTD. The primary end point in part two was objective response rate (ORR). In part one (n = 33), the combination of neratinib 240 mg per day plus capecitabine 1,500 mg/m(2) per day was defined as the MTD, which was further evaluated in part 2 (n = 72). The most common drug-related adverse events were diarrhea (88%) and palmar-plantar erythrodysesthesia syndrome (48%). In part two, the ORR was 64% (n = 39 of 61) in patients with no prior lapatinib exposure and 57% (n = 4 of 7) in patients previously treated with lapatinib. Median progression-free survival was 40.3 and 35.9 weeks, respectively. Neratinib in combination with capecitabine had a manageable toxicity profile and showed promising antitumor activity in patients with HER2-positive metastatic breast cancer pretreated with trastuzumab and lapatinib. © 2014 by American Society of Clinical Oncology.

  4. Human Papillomavirus and Epidermal Growth Factor Receptor in Oral Cavity and Oropharyngeal Squamous Cell Carcinoma: Correlation With Dynamic Contrast-Enhanced MRI Parameters. (United States)

    Choi, Yoon Seong; Park, Mina; Kwon, Hyeong Ju; Koh, Yoon Woo; Lee, Seung-Koo; Kim, Jinna


    The objective of this study was to investigate differences in dynamic contrast-enhanced MRI (DCE-MRI) parameters on the basis of the status of human papillomavirus (HPV) and epidermal growth factor receptor (EGFR) biomarkers in patients with squamous cell carcinoma (SCC) of the oral cavity and oropharynx by use of histogram analysis. A total of 22 consecutive patients with oral cavity and oropharyngeal SCC underwent DCE-MRI before receiving treatment. DCE parameter maps of the volume transfer constant (K(trans)), the flux rate constant (kep), and the extravascular extracellular volume fraction (ve) were obtained. The histogram parameters were calculated using the entire enhancing tumor volume and were compared between the patient subgroups on the basis of HPV and EGFR biomarker statuses. The cumulative histogram parameters of K(trans) and kep showed lower values in the HPV-negative and EFGR-overexpression group than in the HPV-positive EGFR-negative group. These differences were statistically significant for the mean (p = 0.009), 25th, 50th, and 75th percentile values of K(trans) and for the 25th percentile value of kep when correlated with HPV status in addition to the mean K(trans) value (p = 0.047) and kep value (p = 0.004) when correlated with EGFR status. No statistically significant difference in ve was found on the basis of HPV and EGFR status. DCE-MRI is useful for the assessment of the tumor microenvironment associated with HPV and EGFR biomarkers before treatment of patients with oral cavity and oropharyngeal SCC.

  5. Detection of Alpha-Toxin and Other Virulence Factors in Biofilms of Staphylococcus aureus on Polystyrene and a Human Epidermal Model. (United States)

    den Reijer, P M; Haisma, E M; Lemmens-den Toom, N A; Willemse, J; Koning, R I; Koning, R A; Demmers, J A A; Dekkers, D H W; Rijkers, E; El Ghalbzouri, A; Nibbering, P H; van Wamel, W


    The ability of Staphylococcus aureus to successfully colonize (a)biotic surfaces may be explained by biofilm formation and the actions of virulence factors. The aim of the present study was to establish the presence of 52 proteins, including virulence factors such as alpha-toxin, during biofilm formation of five different (methicillin resistant) S. aureus strains on Leiden human epidermal models (LEMs) and polystyrene surfaces (PS) using a competitive Luminex-based assay. All five S. aureus strains formed biofilms on PS, whereas only three out of five strains formed biofilms on LEMs. Out of the 52 tested proteins, six functionally diverse proteins (ClfB, glucosaminidase, IsdA, IsaA, SACOL0688 and nuclease) were detected in biofilms of all strains on both PS and LEMs. At the same time, four toxins (alpha-toxin, gamma-hemolysin B and leukocidins D and E), two immune modulators (formyl peptide receptor-like inhibitory protein and Staphylococcal superantigen-like protein 1), and two other proteins (lipase and LytM) were detectable in biofilms by all five S. aureus strains on LEMs, but not on PS. In contrast, fibronectin-binding protein B (FnbpB) was detectable in biofilms by all S. aureus biofilms on PS, but not on LEMs. These data were largely confirmed by the results from proteomic and transcriptomic analyses and in case of alpha-toxin additionally by GFP-reporter technology. Functionally diverse virulence factors of (methicillin-resistant) S. aureus are present during biofilm formation on LEMs and PS. These results could aid in identifying novel targets for future treatment strategies against biofilm-associated infections.

  6. Utility of the CPS+EG staging system in hormone receptor-positive, human epidermal growth factor receptor 2-negative breast cancer treated with neoadjuvant chemotherapy. (United States)

    Marmé, Frederik; Lederer, Bianca; Blohmer, Jens-Uwe; Costa, Serban Dan; Denkert, Carsten; Eidtmann, Holger; Gerber, Bernd; Hanusch, Claus; Hilfrich, Jörn; Huober, Jens; Jackisch, Christian; Kümmel, Sherko; Loibl, Sibylle; Paepke, Stefan; Untch, Michael; von Minckwitz, Gunter; Schneeweiss, Andreas


    Pathologic complete response after neoadjuvant chemotherapy (NACT) correlates with overall survival (OS) in primary breast cancer. A recently described staging system based on pre-treatment clinical stage (CS), final pathological stage (PS), estrogen receptor (ER) status and nuclear grade (NG) leads to a refined estimation of prognosis in unselected patients. Its performance in luminal type breast cancers has not been determined. This study investigates the clinical utility of this CPS+EG score when restricted to hormone receptor-positive (HR+)/human epidermal growth factor receptor 2-negative (HER2-) patients and compares the results to a cohort of unselected patients. The CPS+EG score was calculated for 6637 unselected patients and 2454 patients with HR+/HER2- tumours who received anthracycline/taxane-based NACT within 8 prospective German trials. Five-year disease-free survival (DFS) and OS were 75.6% and 84.1% for the unselected cohort and 80.6% and 87.8% for the HR+/HER2- subgroup, respectively. The CPS+EG system distinguished different prognostic groups with 5-year DFS ranging from 0% to 91%. The CPS+EG system leads to an improved categorisation of patients by outcome compared to CS, PS, ER or NG alone. When applying the CPS+EG score to the HR+/HER2- subgroup, a shift to lower scores was observed compared to the overall population, but 5-year DFS and OS for the individual scores were identical to that observed in the overall population. In HR+/HER2- patients, the CPS+EG staging system retains its ability to facilitate a refined stratification of patients according to outcome. It can help to select candidates for post-neoadjuvant clinical trials in luminal breast cancer. Copyright © 2015 Elsevier Ltd. All rights reserved.

  7. The Effect of Adjuvant Trastuzumab on Locoregional Recurrence of Human Epidermal Growth Factor Receptor 2-Positive Breast Cancer Treated with Mastectomy. (United States)

    Lanning, Ryan M; Morrow, Monica; Riaz, Nadeem; McArthur, Heather L; Dang, Chau; Moo, Tracy-Ann; El-Tamer, Mahmoud; Krause, Kate; Siu, Chun; Hsu, Meier; Zhang, Zhigang; Pei, Xin; McCormick, Beryl; Powell, Simon N; Ho, Alice


    Human epidermal growth factor receptor 2 (HER2) overexpression was associated with locoregional recurrence (LRR) in the preadjuvant trastuzumab era. This study aimed to examine the effect of trastuzumab on LRR in mastectomy patients and whether it varied with postmastectomy radiation (PMRT). From the authors' institutional database, 501 women with stages I-III HER2-positive breast cancer who underwent mastectomy from 1998 to 2007 were identified. A landmark analysis was performed to compare two cohorts: 170 women who received trastuzumab and 281 who did not. Kaplan-Meier methods were used to estimate locoregional recurrence-free survival (LRRFS). A propensity score analysis was used to balance the treatment groups with respect to multiple covariates. Analogous methods were used to study the effect of PMRT. The women in the trastuzumab group were more likely to be node positive and to receive systemic therapy or PMRT (p < 0.01). The 5-year LRRFS was 98 % in the trastuzumab troup versus 94 % in the no trastuzumab group [hazard ratio (HR) 0.31; 95 % confidence interval (CI) 0.09-1.09; p = 0.07]. After adjustment for multiple covariates, including receipt of chemotherapy and PMRT, trastuzumab decreased LRR rates (HR 0.21; 95 % CI 0.04-0.94; p = 0.04). Among the women who received PMRT, trastuzumab reduced the 5-year LRR rate (0 vs 5 %; p = 0.06). Among those who did not receive PMRT, trastuzumab did not significantly decrease LRR (3 vs 6 %; p = 0.26). High rates of locoregional control (5-year rate, 98 %) were observed among patients who received trastuzumab and mastectomy ± PMRT. Trastuzumab decreased LRR in HER2-positive women who received mastectomy and PMRT, suggesting that the largest benefit is seen in a higher-risk subset of patients.

  8. Strain-dependent augmentation of tight-junction barrier function in human primary epidermal keratinocytes by Lactobacillus and Bifidobacterium lysates. (United States)

    Sultana, Reshma; McBain, Andrew J; O'Neill, Catherine A


    In this study, we investigated whether probiotic lysates can modify the tight-junction function of human primary keratinocytes. The keratinocytes were grown on cell culture inserts and treated with lysates from Bifidobacterium longum, Lactobacillus plantarum, Lactobacillus reuteri, Lactobacillus fermentum, or Lactobacillus rhamnosus GG. With the exception of L. fermentum (which decreased cell viability), all strains markedly enhanced tight-junction barrier function within 24 h, as assessed by measurements of transepithelial electrical resistance (TEER). However, B. longum and L. rhamnosus GG were the most efficacious, producing dose-dependent increases in resistance that were maintained for 4 days. These increases in TEER correlated with elevated expression of tight-junction protein components. Neutralization of Toll-like receptor 2 abolished both the increase in TEER and expression of tight-junction proteins induced by B. longum, but not L. rhamnosus GG. These data suggest that some bacterial strains increase tight-junction function via modulation of protein components but the different pathways involved may vary depending on the bacterial strain.

  9. Reactive oxygen species-mediated DNA damage and apoptosis in human skin epidermal cells after exposure to nickel nanoparticles. (United States)

    Alarifi, Saud; Ali, Daoud; Alakhtani, Saad; Al Suhaibani, Entissar S; Al-Qahtani, Ahmed A


    Nickel nanoparticles (NiNPs) are increasingly used in various applications due to their unique properties. However, there is little information concerning the toxicity of NiNPs in the human skin cell (A431). The present study was designed to investigate the cytotoxicity, apoptosis, and DNA damage due to NiNPs in A431 cells. A cellular proliferative capacity test showed that NiNPs induce significant cytotoxicity in a dose- and time-dependent manner. NiNPs were also found to induce oxidative stress evidenced by the generation of reactive oxygen species (ROS) and depletion of glutathione (GSH). Further, co-treatment with the antioxidant N-acetylcysteine (NAC) mitigated the ROS generation due to NiNPs, suggesting the potential mechanism of oxidative stress. NiNPs also induced significant elevation of lipid peroxidation, catalase, and superoxide dismutase and caspase-3 activity in A431 cells. In addition, NAC suppressed NiNP-induced caspase-3 activity. DNA fragmentation analysis using the comet assay showed that the NiNPs cause genotoxicity in a dose- and time-dependent manner. Therefore, the study points out the capability of the NiNPs to induce oxidative stress resulting in apoptosis and genotoxicity. This study warrants more careful assessment of NiNPs before their industrial applications.

  10. Detergent-resistant membranes in human erythrocytes and their ...

    Indian Academy of Sciences (India)


    SLP, stomatin-like-protein-2; TX-100, Triton X-100. ... via electrostatic interactions that can be disrupted by the simultaneous increase in pH and ionic strength of the solubilization .... dentified components of the DRMs and the membrane ..... Analysis of proteins and cholesterol in 6 ... Band 3, the main integral protein of the.

  11. Expression and Prognostic Significance of Human Epidermal Growth Factor Receptors 1, 2 and 3 in Periampullary Adenocarcinoma.

    Directory of Open Access Journals (Sweden)

    Jacob Elebro

    Full Text Available Periampullary adenocarcinoma, including pancreatic cancer, is a heterogeneous group of tumours with dismal prognosis, for which there is an urgent need to identify novel treatment strategies. The human epithelial growth factor receptors EGFR, HER2 and HER3 have been studied in several tumour types, and HER-targeting drugs have a beneficial effect on survival in selected types of cancer. However, these effects have not been evident in pancreatic cancer, and remain unexplored in other types of periampullary cancer. The prognostic impact of HER-expression in these cancers also remains unclear. The aim of this study was therefore to examine the expression and prognostic value of EGFR, HER2 and HER3 in periampullary cancer, with particular reference to histological subtype. To this end, protein expression of EGFR, HER2 and HER3, and HER2 gene amplification was assessed by immunohistochemistry and silver in situ hybridization, respectively, on tissue microarrays with tumours from 175 periampullary adenocarcinomas, with follow-up data on recurrence-free survival (RFS and overall survival (OS for up to 5 years. EGFR expression was similar in pancreatobiliary (PB and intestinal (I type tumours, but high HER2 and HER3 expression was significantly more common in I-type tumours. In PB-type cases receiving adjuvant gemcitabine, but not in untreated cases, high EGFR expression was significantly associated with a shorter OS and RFS, with a significant treatment interaction in relation to OS (pinteraction = 0.042. In I-type cases, high EGFR expression was associated with a shorter OS and RFS in univariable, but not in multivariable, analysis. High HER3 expression was associated with a prolonged RFS in univariable, but not in multivariable, analysis. Neither HER2 protein expression nor gene amplification was prognostic. The finding of a potential interaction between the expression of EGFR and response to adjuvant chemotherapy in PB-type tumours needs validation

  12. In vitro human epidermal permeation of nicotine from electronic cigarette refill liquids and implications for dermal exposure assessment. (United States)

    Frasch, H Frederick; Barbero, Ana M


    Nicotine plus flavorings in a propylene glycol (PG) vehicle are the components of electronic cigarette liquids (e-liquids), which are vaporized and inhaled by the user. Dermal exposure to nicotine and e-liquids may occur among workers in mixing and filling of e-cigarettes in the manufacturing process. Inadvertent skin contact among consumers is also a concern. In vitro nicotine permeation studies using heat-separated human epidermis were performed with surrogate and two commercial e-liquids, neat and aqueous nicotine donor formulations. Steady-state fluxes (J ss ), and lag times (t lag ) were measured for each formulation. In addition, transient (4 h) exposure and finite dose (1-10 μl/cm 2 ) experiments were undertaken using one commercial e-liquid. Average J ss (μg/cm 2 /h) from formulations were: nicotine in PG (24 mg/ml): 3.97; commercial e-liquid containing menthol (25 mg/ml nicotine): 10.2; commercial e-liquid containing limonene (25 mg/ml nicotine): 23.7; neat nicotine: 175. E-liquid lag times ranged from 5 to 10 h. Absorbed fraction of nicotine from finite doses was ≈0.3 at 48 h. The data were applied to transient exposure and finite dose dermal exposure assessment models and to a simple pharmacokinetic model. Three illustrative exposure scenarios demonstrate use of the data to predict systemic uptake and plasma concentrations from dermal exposure. The data demonstrate the potential for significant nicotine absorption through skin contact with e-cigarette refill solutions and the neat nicotine used to mix them.

  13. Retinoid inhibition of in vitro invasion of human amnion basement membrane by human tumor cells

    International Nuclear Information System (INIS)

    Fazely, F.; Ledinko, N.; Smith, D.J.


    The biological activity of retinoids was assayed in an in vitro quantitative assay of human tumor cell invasion using human amnion basement membrane (BM). The effects measured were the inhibition of tumor cell migration through the BM and tumor cell degradative enzyme activity on 14 C-proline labeled collagenous and noncollagenous components of the BM. The human lung carcinoma A549 or the human Ewing's sarcoma TC-106 cell lines treated with retinoids for two days were incubated on the BM in the absence of retinoids. A dose-dependent inhibition of cell invasion was produced by retinoids. Among the retinoids tested, the most powerful was retinol acetate which inhibited invasion by 50% of A549 cells at a concentration of 0.009 μg/mL, and of TC-106 cells at 0.07 μg/mL. Retinol acetate inhibited A549 and TC-106 cell growth by approximately 50% at levels over 100-fold higher than those needed for antiinvasive activity. Retinol acetate was about 20 times more potent than retinoic acid and 30 times more potent than retinol palmitate. The model system will be useful for investigating antiinvasive activity of other retinoids as well as other compounds

  14. Recruitment of human aquaporin 3 to internal membranes in the Plasmodium falciparum infected erythrocyte. (United States)

    Bietz, Sven; Montilla, Irine; Külzer, Simone; Przyborski, Jude M; Lingelbach, Klaus


    The molecular mechanisms underlying the formation of the parasitophorous vacuolar membrane in Plasmodium falciparum infected erythrocytes are incompletely understood, and the protein composition of this membrane is still enigmatic. Although the differentiated mammalian erythrocyte lacks the machinery required for endocytosis, some reports have described a localisation of host cell membrane proteins at the parasitophorous vacuolar membrane. Aquaporin 3 is an abundant plasma membrane protein of various cells, including mammalian erythrocytes where it is found in distinct oligomeric states. Here we show that human aquaporin 3 is internalized into infected erythrocytes, presumably during or soon after invasion. It is integrated into the PVM where it is organized in novel oligomeric states which are not found in non-infected cells.

  15. Effect of some radiosensitising drugs on human erythrocyte membrane - - spin label study

    Energy Technology Data Exchange (ETDEWEB)

    Mishra, K P [Bhabha Atomic Research Centre, Bombay (India). Biology and Agriculture Div.


    Electron spin resonance and spin label techniques have been employed to study the effects of local anaesthetic drugs, procaine and tetracaine, on human erythrocyte membrane. Both the drugs altered the protein and lipid arrangements in the membrane and these changes were reversible. Procaine had greater effect on the labels attached to proteins while tetracaine fluidized interior of lipid bilayer to a greater extent. The differential effects of these drugs on the protein and lipid labels have been interpreted in terms of their relative penetrability in the membrane. Present results have explained that radiation induced enhanced killing of cells in the presence of these drugs might be due to the alterations in membrane, particularly proteins both structural and enzymatic. In addition, these results indicate a possible relationship between drug-induced structural changes in membrane and their anaesthetic potency.

  16. Membrane-bound 2,3-diphosphoglycerate phosphatase of human erythrocytes. (United States)

    Schröter, W; Neuvians, M


    Gradual osmotic hemolysis of human erythrocytes reduces the cell content of whole protein, hemoglobin, 2,3-diphosphoglycerate and triosephosphate isomerase extensively, but not that of membrane protein and 2,3-diphosphoglycerate phosphatase. After the refilling of the ghosts with 2,3-diphosphoglycerate and reconstitution of the membrane, the 2,3-diphosphoglycerate phosphatase activity equals that of intact red cells. The membrane-bound 2,3-diphosphoglycerate phosphatase can be activated by sodium hyposulfite. The enzyme system of ghosts seems to differ from that of intact red cells with regard to the optima of pH and temperature. It remains to be elucidated if the membrane binding of the 2,3-diphosphoglycerate phosphatase is related to the transfer of inorganic phosphate across the red cell membrane.

  17. Surface and protein analyses of normal human cell attachment on PIII-modified chitosan membranes

    International Nuclear Information System (INIS)

    Saranwong, N.; Inthanon, K.; Wongkham, W.; Wanichapichart, P.; Suwannakachorn, D.; Yu, L.D.


    Surface of chitosan membrane was modified with argon (Ar) and nitrogen (N) plasma immersion ion implantation (PIII) for human skin fibroblasts F1544 cell attachment. The modified surfaces were characterized by Fourier transform infrared spectroscopy (FTIR) and atomic force microscopy (AFM). Cell attachment patterns were evaluated by scanning electron microscopy (SEM). The enzyme-linked immunosorbent assay (ELISA) was used to quantify levels of focal adhesion kinase (FAK). The results showed that Ar PIII had an enhancement effect on the cell attachment while N-PIII had an inhibition effect. Filopodial analysis revealed more microfilament cytoplasmic spreading on the edge of cells attached on the Ar-treated membranes than N-treated membranes. Higher level FAK was found in Ar-treated membranes than that in N-treated membranes.

  18. The human multidrug resistance-associated protein MRP is a plasma membrane drug-efflux pump

    NARCIS (Netherlands)

    Zaman, G. J.; Flens, M. J.; van Leusden, M. R.; de Haas, M.; Mülder, H. S.; Lankelma, J.; Pinedo, H. M.; Scheper, R. J.; Baas, F.; Broxterman, H. J.


    The multidrug-resistance associated protein MRP is a 180- to 195-kDa membrane protein associated with resistance of human tumor cells to cytotoxic drugs. We have investigated how MRP confers drug resistance in SW-1573 human lung carcinoma cells by generating a subline stably transfected with an

  19. Apoptosis in the human periodontal membrane evaluated in primary and permanent teeth

    DEFF Research Database (Denmark)

    Bille, Marie-Louise Bastholm; Thomsen, Bjarke; Kjær, Inger


    that resorption is connected to apoptosis of the epithelial cells of Malassez. The purpose of this study is to localize cells undergoing apoptosis in the periodontal membrane of human primary and permanent teeth. Materials and methods. Human primary and permanent teeth were examined immunohistochemically...... for apoptosis and epithelial cells of Malassez in the periodontal membrane. All teeth examined were extracted in connection with treatment. Results. Apoptosis was seen in close proximity to the root surface and within the epithelial cells of Malassez. This pattern of apoptotis is similar in the periodontal...... membrane in primary and permanent teeth. Conclusions. The inter-relationship between apoptotis and root resorption cannot be concluded from the present study. Apoptosis seen in close proximity to the root surface presumably corresponds to the highly innervated layer of the periodontal membrane...

  20. IL-27 induces a pro-inflammatory response in human fetal membranes mediating preterm birth. (United States)

    Yin, Nanlin; Wang, Hanbing; Zhang, Hua; Ge, Huisheng; Tan, Bing; Yuan, Yu; Luo, Xiaofang; Olson, David M; Baker, Philip N; Qi, Hongbo


    Inflammation at the maternal-fetal interface has been shown to be involved in the pathogenesis of preterm birth. Interleukin 27 (IL-27), a heterodimeric cytokine, is known to mediate an inflammatory response in some pregnancy complications. In this study, we aimed to determine whether IL-27 could induce an inflammatory reaction at the maternal-fetal interface that would mediate the onset of preterm birth. We found elevated expression of IL-27 in human peripheral serum and elevated expression of its specific receptor (wsx-1) on fetal membranes in cases of preterm birth. Moreover, the release of inflammatory markers (CXCL10, IFN-γ, MCP-1, IL-6, IL-1β and TNF-α), especially CXCL10, was markedly augmented upon stimulation of IL-27 in the fetal membranes. Additionally, IL-27 and IFN-γ cooperated to amplify the expression of CXCL10 in the fetal membranes. Moreover, the production of CXCL10 was increased in IL-27-treated fetal membrane through JNK, PI3K or Erk signaling pathways. Finally, MMP2 and MMP9 were activated by IL-27 in human fetal membranes, which may be related to the onset of preterm premature rupture of membranes (pPROM). In conclusion, for the first time, we reported that the aberrant expression of IL-27 could mediate an excessive inflammatory response in fetal membranes through the JNK, PI3K or Erk signaling pathways, which contributes to preterm birth. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. Proteome profiling of human neutrophil granule subsets, secretory vesicles, and cell membrane

    DEFF Research Database (Denmark)

    Rørvig, Sara; Østergaard, Ole; Heegaard, Niels Henrik Helweg


    granules, SVs, and plasma membrane has been performed before. Here, we performed subcellular fractionation on freshly isolated human neutrophils by nitrogen cavitation and density centrifugation on a four-layer Percoll gradient. Granule subsets were pooled and subjected to SDS-PAGE, and gel pieces were in...... subcellular proteome profiles presented here may be used as a database in combination with the mRNA array database to predict and test the presence and localization of proteins in neutrophil granules and membranes....

  2. An acid phosphatase in the plasma membranes of human astrocytoma showing marked specificity toward phosphotyrosine protein.


    Leis, J F; Kaplan, N O


    The plasma membrane from the human tumor astrocytoma contains an active acid phosphatase activity based on hydrolysis of p-nitrophenyl phosphate. Other acid phosphatase substrates--beta-glycerophosphate, O-phosphorylcholine, and 5'-AMP--are not hydrolyzed significantly. The phosphatase activity is tartrate insensitive and is stimulated by Triton X-100 and EDTA. Of the three known phosphoamino acids, only free O-phosphotyrosine is hydrolyzed by the membrane phosphatase activity. Other acid pho...

  3. Toxic epidermal necrolysis and Stevens-Johnson syndrome

    Directory of Open Access Journals (Sweden)

    French Lars E


    Full Text Available Abstract Toxic epidermal necrolysis (TEN and Stevens Johnson Syndrome (SJS are severe adverse cutaneous drug reactions that predominantly involve the skin and mucous membranes. Both are rare, with TEN and SJS affecting approximately 1or 2/1,000,000 annually, and are considered medical emergencies as they are potentially fatal. They are characterized by mucocutaneous tenderness and typically hemorrhagic erosions, erythema and more or less severe epidermal detachment presenting as blisters and areas of denuded skin. Currently, TEN and SJS are considered to be two ends of a spectrum of severe epidermolytic adverse cutaneous drug reactions, differing only by their extent of skin detachment. Drugs are assumed or identified as the main cause of SJS/TEN in most cases, but Mycoplasma pneumoniae and Herpes simplex virus infections are well documented causes alongside rare cases in which the aetiology remains unknown. Several drugs are at "high" risk of inducing TEN/SJS including: Allopurinol, Trimethoprim-sulfamethoxazole and other sulfonamide-antibiotics, aminopenicillins, cephalosporins, quinolones, carbamazepine, phenytoin, phenobarbital and NSAID's of the oxicam-type. Genetic susceptibility to SJS and TEN is likely as exemplified by the strong association observed in Han Chinese between a genetic marker, the human leukocyte antigen HLA-B*1502, and SJS induced by carbamazepine. Diagnosis relies mainly on clinical signs together with the histological analysis of a skin biopsy showing typical full-thickness epidermal necrolysis due to extensive keratinocyte apoptosis. Differential diagnosis includes linear IgA dermatosis and paraneoplastic pemphigus, pemphigus vulgaris and bullous pemphigoid, acute generalized exanthematous pustulosis (AGEP, disseminated fixed bullous drug eruption and staphyloccocal scalded skin syndrome (SSSS. Due to the high risk of mortality, management of patients with SJS/TEN requires rapid diagnosis, evaluation of the prognosis

  4. Amplification and high-level expression of heat shock protein 90 marks aggressive phenotypes of human epidermal growth factor receptor 2 negative breast cancer. (United States)

    Cheng, Qing; Chang, Jeffrey T; Geradts, Joseph; Neckers, Leonard M; Haystead, Timothy; Spector, Neil L; Lyerly, H Kim


    Although human epidermal growth factor receptor 2 (HER2) positive or estrogen receptor (ER) positive breast cancers are treated with clinically validated anti-HER2 or anti-estrogen therapies, intrinsic and acquired resistance to these therapies appears in a substantial proportion of breast cancer patients and new therapies are needed. Identification of additional molecular factors, especially those characterized by aggressive behavior and poor prognosis, could prioritize interventional opportunities to improve the diagnosis and treatment of breast cancer. We compiled a collection of 4,010 breast tumor gene expression data derived from 23 datasets that have been posted on the National Center for Biotechnology Information (NCBI) Gene Expression Omnibus (GEO) database. We performed a genome-scale survival analysis using Cox-regression survival analyses, and validated using Kaplan-Meier Estimates survival and Cox Proportional-Hazards Regression survival analyses. We conducted a genome-scale analysis of chromosome alteration using 481 breast cancer samples obtained from The Cancer Genome Atlas (TCGA), from which combined expression and copy number data were available. We assessed the correlation between somatic copy number alterations and gene expression using analysis of variance (ANOVA). Increased expression of each of the heat shock protein (HSP) 90 isoforms, as well as HSP transcriptional factor 1 (HSF1), was correlated with poor prognosis in different subtypes of breast cancer. High-level expression of HSP90AA1 and HSP90AB1, two cytoplasmic HSP90 isoforms, was driven by chromosome coding region amplifications and were independent factors that led to death from breast cancer among patients with triple-negative (TNBC) and HER2-/ER+ subtypes, respectively. Furthermore, amplification of HSF1 was correlated with higher HSP90AA1 and HSP90AB1 mRNA expression among the breast cancer cells without amplifications of these two genes. A collection of HSP90AA1, HSP90AB1 and HSF

  5. Characterization of hormonal receptors and human epidermal growth factor receptor-2 in tissues of women with breast cancer at Muhimbili National Hospital, Dar es salaam, Tanzania. (United States)

    Mwakigonja, Amos Rodger; Lushina, Nyanda Elias; Mwanga, Ally


    Breast cancer is a leading cause of morbidity and deaths among women worldwide. In Tanzania there is no published data on human epidermal growth receptor-2 (HER2/neu) expression in breast carcinoma. Hormonal receptors and HER2/neu status reportedly influence post-mastectomy adjuvant therapy and predict treatment outcome and prognosis. Here we evaluate hormonal receptors and HER-2 status in biopsies of women with breast cancer at Muhimbili National Hospital (MNH). A cross-sectional study of female breast post-modified radical mastectomy (MRM)/incisional biopsies confirmed to be carcinoma at the Histopathology Unit (January-December 2013). Tissue blocks having poor morphology, without tumor, secondary tumors, cases outside the study period and male patients were excluded. Routine staining was done followed by immunohistochemistry for estrogen (ER), and progesterone (PgR) receptors and HER2. Data analyzed using Statistical Package for Social Sciences (SPSS). A total of 218 cases were confirmed to be carcinoma including 70 meeting inclusion criteria. Age at diagnosis ranged 18-75 years and mean age was 48.36 years. Majority (64.3%) were in the 36-55 years age-group. Histologically, most (88.6%) women had invasive ductal carcinoma including 43.1% of intermediate grade. A great majority (78%) were stage three. Due to logistical constrains, 75.7% ( n  = 53/70) cases where immunostained for hormones including 43.4% (ER+), 26.4% (PgR+), and 28% (ER+/PgR+). Furthermore, 65.7% ( n  = 46/70) cases were immunostained for HER-2 and 15.2% ( n  = 7/46) were positive, 45.6% were triple negative (ER-,PgR-,HER2-), 23.9% (ER+,PgR+,HER2-) or luminal B, 2.2% (ER+,PgR-,HER2+),13% (ER-,PgR-,HER2+) and 15% (ER+,PgR-,HER2-) with none being triple positive. Hormonal receptors and HER2 expression at MNH appears to be comparable to previous Africans/African Americans reports but not with studies among Caucasians and the current proportion of triple negative breast carcinomas (TNBC) is

  6. Characterization of hormonal receptors and human epidermal growth factor receptor-2 in tissues of women with breast cancer at Muhimbili National Hospital, Dar es salaam, Tanzania

    Directory of Open Access Journals (Sweden)

    Amos Rodger Mwakigonja


    Full Text Available Abstract Background Breast cancer is a leading cause of morbidity and deaths among women worldwide. In Tanzania there is no published data on human epidermal growth receptor-2 (HER2/neu expression in breast carcinoma. Hormonal receptors and HER2/neu status reportedly influence post-mastectomy adjuvant therapy and predict treatment outcome and prognosis. Here we evaluate hormonal receptors and HER-2 status in biopsies of women with breast cancer at Muhimbili National Hospital (MNH. Methods A cross-sectional study of female breast post-modified radical mastectomy (MRM/incisional biopsies confirmed to be carcinoma at the Histopathology Unit (January–December 2013. Tissue blocks having poor morphology, without tumor, secondary tumors, cases outside the study period and male patients were excluded. Routine staining was done followed by immunohistochemistry for estrogen (ER, and progesterone (PgR receptors and HER2. Data analyzed using Statistical Package for Social Sciences (SPSS. Results A total of 218 cases were confirmed to be carcinoma including 70 meeting inclusion criteria. Age at diagnosis ranged 18–75 years and mean age was 48.36 years. Majority (64.3% were in the 36–55 years age-group. Histologically, most (88.6% women had invasive ductal carcinoma including 43.1% of intermediate grade. A great majority (78% were stage three. Due to logistical constrains, 75.7% (n = 53/70 cases where immunostained for hormones including 43.4% (ER+, 26.4% (PgR+, and 28% (ER+/PgR+. Furthermore, 65.7% (n = 46/70 cases were immunostained for HER-2 and 15.2% (n = 7/46 were positive, 45.6% were triple negative (ER-,PgR-,HER2-, 23.9% (ER+,PgR+,HER2- or luminal B, 2.2% (ER+,PgR-,HER2+,13% (ER-,PgR-,HER2+ and 15% (ER+,PgR-,HER2- with none being triple positive. Conclusions Hormonal receptors and HER2 expression at MNH appears to be comparable to previous Africans/African Americans reports but not with studies among Caucasians and the current proportion

  7. Budget impact analysis of everolimus for the treatment of hormone receptor positive, human epidermal growth factor receptor-2 negative (HER2-) advanced breast cancer in the United States. (United States)

    Xie, Jipan; Diener, Melissa; De, Gourab; Yang, Hongbo; Wu, Eric Q; Namjoshi, Madhav


    To estimate the budget impact of everolimus as the first and second treatment option after letrozole or anastrozole (L/A) failure for post-menopausal women with hormone receptor positive (HR+), human epidermal growth factor receptor-2 negative (HER2-) advanced breast cancer (ABC). Pharmacy and medical budget impacts (2011 USD) were estimated over the first year of everolimus use in HR+, HER2- ABC from a US payer perspective. Epidemiology data were used to estimate target population size. Pre-everolimus entry treatment options included exemestane, fulvestrant, and tamoxifen. Pre- and post-everolimus entry market shares were estimated based on market research and assumptions. Drug costs were based on wholesale acquisition cost. Patients were assumed to be on treatment until progression or death. Annual medical costs were calculated as the average of pre- and post-progression medical costs weighted by the time in each period, adjusted for survival. One-way and two-way sensitivity analyses were conducted to assess the model robustness. In a hypothetical 1,000,000 member plan, 72 and 159 patients were expected to be candidates for everolimus treatment as first and second treatment option, respectively, after L/A failure. The total budget impact for the first year post-everolimus entry was $0.044 per member per month [PMPM] (pharmacy budget: $0.058 PMPM; medical budget: -$0.014 PMPM), assuming 10% of the target population would receive everolimus. The total budget impacts for the first and second treatment options after L/A failure were $0.014 PMPM (pharmacy budget: $0.018; medical budget: -$0.004) and $0.030 PMPM (pharmacy budget: $0.040; medical budget: -$0.010), respectively. Results remained robust in sensitivity analyses. Assumptions about some model input parameters were necessary and may impact results. Increased pharmacy costs for HR+, HER2- ABC following everolimus entry are expected to be partially offset by reduced medical service costs. Pharmacy and total

  8. Relationship between body mass index and the expression of hormone receptors or human epidermal growth factor receptor 2 with respect to breast cancer survival

    International Nuclear Information System (INIS)

    Jeon, Ye Won; Kang, Su Hwan; Park, Min Ho; Lim, Woosung; Cho, Se Heun; Suh, Young Jin


    The association between body mass index (BMI) at the time of breast cancer diagnosis and the prognosis of breast cancer patients remains controversial. Furthermore, the association between BMI and prognosis with respect to different breast cancer subtypes is not clearly defined. We analyzed data from 41,021 invasive breast cancer patients between January 1988 and February 2008 from the Korean Breast Cancer Registry (KBCR) database. Overall survival (OS) and breast cancer-specific survival (BCSS) were analyzed using the Kaplan-Meier method and Cox’s proportional hazard regression model among all patients and specific breast cancer subtypes with respect to BMI categories. A U-shaped association between BMI and mortality was observed in the total cohort. Underweight and obese individuals exhibited worse OS (hazard ratio, 1.23 [95 % confidence interval {CI}, 1.05 to 1.44] and 1.29 [1.13 to 1.48], respectively) and BCSS (1.26 [1.03 to 1.54] and 1.21 [1.02 to 1.43], respectively) than normal-weight individuals. In the estrogen receptor (ER) and/or progesterone receptor (PR)+/human epidermal growth factor receptor 2 (HER2) - subgroup, obese individuals exhibited worse OS (1.48 [1.18 to 1.85]) and BCSS (1.31 [1.13 to 1.52]) than normal-weight individuals. Conversely, in the ER and PR-/HER2+ subgroup, underweight individuals exhibited worse OS (1.68 [1.12 to 2.47]) and BCSS (1.79 [1.11 to 2.90]) than normal-weight individuals. We observed a U-shaped relationship between BMI at diagnosis and poor OS and BCSS among all breast cancer patients. However, obesity in the ER and/or PR+/HER2- subgroup and underweight in the ER and PR-/HER2+ subgroup were poor prognostic factors. Therefore, BMI at diagnosis and breast cancer subtype should be considered simultaneously in various treatment decision processes and surveillance schedules

  9. Translational Breast Cancer Research Consortium (TBCRC) 022: A Phase II Trial of Neratinib for Patients With Human Epidermal Growth Factor Receptor 2-Positive Breast Cancer and Brain Metastases. (United States)

    Freedman, Rachel A; Gelman, Rebecca S; Wefel, Jeffrey S; Melisko, Michelle E; Hess, Kenneth R; Connolly, Roisin M; Van Poznak, Catherine H; Niravath, Polly A; Puhalla, Shannon L; Ibrahim, Nuhad; Blackwell, Kimberly L; Moy, Beverly; Herold, Christina; Liu, Minetta C; Lowe, Alarice; Agar, Nathalie Y R; Ryabin, Nicole; Farooq, Sarah; Lawler, Elizabeth; Rimawi, Mothaffar F; Krop, Ian E; Wolff, Antonio C; Winer, Eric P; Lin, Nancy U


    Evidence-based treatments for metastatic, human epidermal growth factor receptor 2 (HER2)-positive breast cancer in the CNS are limited. Neratinib is an irreversible inhibitor of erbB1, HER2, and erbB4, with promising activity in HER2-positive breast cancer; however, its activity in the CNS is unknown. We evaluated the efficacy of treatment with neratinib in patients with HER2-positive breast cancer brain metastases in a multicenter, phase II open-label trial. Eligible patients were those with HER2-positive brain metastases (≥ 1 cm in longest dimension) who experienced progression in the CNS after one or more line of CNS-directed therapy, such as whole-brain radiotherapy, stereotactic radiosurgery, and/or surgical resection. Patients received neratinib 240 mg orally once per day, and tumors were assessed every two cycles. The primary endpoint was composite CNS objective response rate (ORR), requiring all of the following: ≥ 50% reduction in volumetric sum of target CNS lesions and no progression of non-target lesions, new lesions, escalating corticosteroids, progressive neurologic signs/symptoms, or non-CNS progression--the threshold for success was five of 40 responders. Forty patients were enrolled between February 2012 and June 2013; 78% of patients had previous whole-brain radiotherapy. Three women achieved a partial response (CNS objective response rate, 8%; 95% CI, 2% to 22%). The median number of cycles received was two (range, one to seven cycles), with a median progression-free survival of 1.9 months. Five women received six or more cycles. The most common grade ≥ 3 event was diarrhea (occurring in 21% of patients taking prespecified loperamide prophylaxis and 28% of those without prophylaxis). Patients in the study experienced a decreased quality of life over time. Although neratinib had low activity and did not meet our threshold for success, 12.5% of patients received six or more cycles. Studies combining neratinib with chemotherapy in patients

  10. Lapatinib or Trastuzumab Plus Taxane Therapy for Human Epidermal Growth Factor Receptor 2-Positive Advanced Breast Cancer: Final Results of NCIC CTG MA.31. (United States)

    Gelmon, Karen A; Boyle, Frances M; Kaufman, Bella; Huntsman, David G; Manikhas, Alexey; Di Leo, Angelo; Martin, Miguel; Schwartzberg, Lee S; Lemieux, Julie; Aparicio, Samuel; Shepherd, Lois E; Dent, Susan; Ellard, Susan L; Tonkin, Katia; Pritchard, Kathleen I; Whelan, Timothy J; Nomikos, Dora; Nusch, Arnd; Coleman, Robert E; Mukai, Hirofumi; Tjulandin, Sergei; Khasanov, Rustem; Rizel, Shulamith; Connor, Anne P; Santillana, Sergio L; Chapman, Judith-Anne W; Parulekar, Wendy R


    The efficacy of lapatinib versus trastuzumab combined with taxanes in the first-line setting of human epidermal growth factor receptor 2 (HER2) -positive metastatic breast cancer (BC) is unknown. The MA.31 trial compared a combination of first-line anti-HER2 therapy (lapatinib or trastuzumab) and taxane therapy for 24 weeks, followed by the same anti-HER2 monotherapy until progression. Stratification was by prior (neo)adjuvant anti-HER2 therapy, prior (neo)adjuvant taxane, planned taxane, and liver metastases. The primary end point was intention-to-treat (ITT) progression-free survival (PFS), defined as time from random assignment to progression by RECIST (version 1.0) criteria, or death for patients with locally assessed HER2-positive tumors. The primary test statistic was a stratified log-rank test for noninferiority. PFS was also assessed for patients with centrally confirmed HER2-positive tumors. From July 17, 2008, to December 1, 2011, 652 patients were accrued from 21 countries, resulting in 537 patients with centrally confirmed HER2-positive tumors. Median follow-up was 21.5 months. Median ITT PFS was 9.0 months with lapatinib and 11.3 months with trastuzumab. By ITT analysis, PFS was inferior for lapatinib compared with trastuzumab, with a stratified hazard ratio (HR) of 1.37 (95% CI, 1.13 to 1.65; P = .001). In patients with centrally confirmed HER2-positive tumors, median PFS was 9.1 months with lapatinib and 13.6 months with trastuzumab (HR, 1.48; 95% CI, 1.20 to 1.83; P < .001). More grade 3 or 4 diarrhea and rash were observed with lapatinib (P < .001). PFS results were supported by the secondary end point of overall survival, with an ITT HR of 1.28 (95% CI, 0.95 to 1.72; P = .11); in patients with centrally confirmed HER2-positive tumors, the HR was 1.47 (95% CI, 1.03 to 2.09; P = .03). As first-line therapy for HER2-positive metastatic BC, lapatinib combined with taxane was associated with shorter PFS and more toxicity compared with trastuzumab

  11. Retinoid inhibition of in vitro invasion of human amnion basement membrane by human tumor cells

    International Nuclear Information System (INIS)

    Fazely, F.


    The effects measured were the inhibition of tumor cell migration through the basement membrane (BM) and tumor cell degradative enzyme activity on 3 H-proline labeled collagenous and non collagenous components of the BM. The human lung carcinoma A549 or the human Ewing's sarcoma TC-106 cell lines treated with retinoids for two days were incubated on the BM in the absence of retinoids. A dose-dependent inhibition of cell invasion was produced by retinoids. Among the retinoids tested the most powerful was retinol acetate which inhibited invasion by 50% of A549 cells at a concentration of 0.09 μg/ml, and TC-106 cells at 0.08 μg/ml. Retinol acetate inhibited A549 and TC-106 cell growth by approximately 50% at levels almost 100-fold higher than those needed for antiinvasive activity. Retinol acetate was about 20 times more potent than retinoic acid and 30 times more than retinol palmitate. Furthermore, A549 cells treated with retinol acetate, under conditions whereby an anti-invasive state was induced,showed an increase in the number of cellular retinoic acid binding proteins (CRABP), a decrease in the activity of type IV collagenase and ectosialyltransferase, and no change in the activity of transglutaminase

  12. Induction of interleukin-6 production by ultraviolet radiation in normal human epidermal keratinocytes and in a human keratinocyte cell line is mediated by DNA damage

    NARCIS (Netherlands)

    Petit-Frère, C.; Clingen, P.H.; Grewe, M.; Krutmann, J.; Roza, L.; Arlett, C.F.; Green, M.H.L.


    The sunburn reaction is the most common consequence of human exposure to ultraviolet radiation (UVR), and is mediated at least in part by interleukin- 6 (IL-6). The aim of this study was to determine if DNA is a major chromophore involved in the induction of IL-6 following UV irradiation of a human

  13. Cultivation and irradiation of human fibroblasts in a medium enriched with platelet lysate for obtaining feeder layer in epidermal cell culture; Cultivo e irradiacao de fibroblastos humanos em meio enriquecido com lisado de plaquetas para obtencao de camada de sustentacao em culturas de celulas da epiderme

    Energy Technology Data Exchange (ETDEWEB)

    Yoshito, Daniele


    For over 30 years, the use of culture medium, enriched with bovine serum, and murines fibroblasts, with the rate of proliferation controlled by irradiation or by share anticarcinogenic drugs, has been playing successfully its role in assisting in the development of keratinocytes in culture, for clinical purposes. However, currently there is a growing concern about the possibility of transmitting prions and animals viruses to transplanted patients. Taking into account this concern, the present work aims to cultivate human fibroblasts in a medium enriched with human platelets lysate and determine the irradiation dose of these cells, for obtaining feeder layer in epidermal cell culture. For carrying out the proposed objective, platelets lysis has standardized, this lysate was used for human fibroblasts cultivation and the irradiation dose enough to inhibit its duplication was evaluated. Human keratinocytes were cultivated in these feeder layers, in culture medium enriched with the lysate. With these results we conclude that the 10% platelets lysate promoted a better adhesion and proliferation of human fibroblasts and in all dose levels tested (60 to 300 Gy), these had their mitotic activity inactivated by ionizing irradiation, being that the feeder layers obtained with doses from 70 to 150 Gy were those that provided the best development of keratinocytes in medium containing 2.5% of human platelet lysate. Therefore, it was possible to standardize both the cultivation of human fibroblasts as its inactivation for use as feeder layer in culture of keratinocytes, so as to eliminate xenobiotics components. (author)

  14. Deorphanizing the human transmembrane genome: A landscape of uncharacterized membrane proteins. (United States)

    Babcock, Joseph J; Li, Min


    The sequencing of the human genome has fueled the last decade of work to functionally characterize genome content. An important subset of genes encodes membrane proteins, which are the targets of many drugs. They reside in lipid bilayers, restricting their endogenous activity to a relatively specialized biochemical environment. Without a reference phenotype, the application of systematic screens to profile candidate membrane proteins is not immediately possible. Bioinformatics has begun to show its effectiveness in focusing the functional characterization of orphan proteins of a particular functional class, such as channels or receptors. Here we discuss integration of experimental and bioinformatics approaches for characterizing the orphan membrane proteome. By analyzing the human genome, a landscape reference for the human transmembrane genome is provided.

  15. Secretion of human epidermal growth factor (EGF) in autotrophic culture by a recombinant hydrogen-utilizing bacterium, Pseudomonas pseudoflava, carrying broad-host-range EGF secretion vector pKSEGF2.


    Hayase, N; Ishiyama, A; Niwano, M


    We constructed the broad-host-range human epidermal growth factor (EGF) secretion plasmid pKSEGF2 by inserting the Escherichia coli tac promoter, the signal sequence of Pseudomonas stutzeri amylase, and the synthesized EGF gene into the broad-host-range vector pKT230. E. coli JM109 carrying pKSEGF2 secreted EGF into the periplasm and the culture medium under the control of the tac promoter. Pseudomonas aeruginosa PAO1161 carrying pKSEGF2 and Pseudomonas putida AC10 carrying pKSEGF2 secreted E...

  16. Possible evidence that dehydroepiandrosterone sulfate (DHA-S) stimulates cervical ripening by a membrane-mediated process: Specific binding-sites in plasma membrane from human uterine cervix

    International Nuclear Information System (INIS)

    Ohno, T.; Imai, A.; Tamaya, T.


    Fetal adrenal steroid, dehydroepiandrosterone sulfate (DHA-S) is well known to promote cervical ripening in late pregnancy. The presence of sites specifically binding the DHA-S in plasma membrane was studied in human cervical fibroblasts prepared from pregnant uterus. The fibroblasts were incubated with 3 H DHA-S and then fractionated into plasma membranes, cytosol, nuclei, and other organella debris. The specific activity of 3H-count in the plasma membrane fraction was enriched ∼ 7-fold compared with the whole homogenate. When the isolated plasma membrane preparations from the fibroblasts were exposed to 3 H DHA-S, the binding showed saturation kinetics; an apparent equilibrium dissociation constant (Kd) of 12 nM, and the binding capacity (Bmax) of 1.25 pmol/mg protein. The present results suggest that DHA is bound to and recognized by components in plasma membrane, and may exert its action on cervical ripening through the membrane-mediated processes

  17. [Effect of low-energy 633 nm red light stimulation on proliferation and reactive oxygen species level of human epidermal cell line HaCaT]. (United States)

    Chen, Z Y; Li, D L; Duan, X D; Peng, D Z


    To investigate the changes of proliferative activity and reactive oxygen species level of human epidermal cell line HaCaT after being irradiated with low-energy 633 nm red light. Irradiation distance was determined through preliminary experiment. HaCaT cells were conventionally sub-cultured with RPMI 1640 culture medium containing 10% fetal calf serum, 100 U/mL penicillin, and 100 μg/mL streptomycin. Cells of the third passage were used in the following experiments. (1) Cells were divided into blank control group and 0.082, 0.164, 0.245, 0.491, 1.472, 2.453, 4.910, and 9.810 J/cm(2) irradiation groups according to the random number table, with 3 wells in each group. Cells in blank control group were not irradiated, while cells in the latter 8 irradiation groups were irradiated with 633 nm red light for 10, 20, 30, 60, 180, 300, 600, and 1 200 s in turn. Cells were reirradiated once every 8 hours. After being irradiated for 48 hours (6 times) in irradiation groups, the proliferative activity of cells in 9 groups was determined with cell counting kit 8 and microplate reader (denoted as absorbance value). (2) Another batch of cells were grouped and irradiated as in experiment (1). After being irradiated for once in irradiation groups, cells in 9 groups were conventionally cultured for 60 min with detection reagent of reactive oxygen species. At post culture minute (PCM) 0 (immediately), 30, 60, and 120, reactive oxygen species level of cells was determined with microplate reader (denoted as absorbance value). (3) Another batch of cells were divided into blank control group, 0.082, 0.491, 2.453, and 9.810 J/cm(2) irradiation groups, and positive control group. Cells in blank control group and positive control group were not irradiated (positive control reagent of reactive oxygen species was added to cells in positive control group), and cells in irradiation groups were irradiated as in experiment (1) for once. The expression of reactive oxygen species in cells of each

  18. Binding of (/sup 3/H)imipramine to human platelet membranes with compensation for saturable binding to filters and its implication for binding studies with brain membranes

    Energy Technology Data Exchange (ETDEWEB)

    Phillips, O.M.; Wood, K.M.; Williams, D.C.


    Apparent specific binding of (/sup 3/H)imipramine to human platelet membranes at high concentrations of imipramine showed deviation from that expected of a single binding site, a result consistent with a low-affinity binding site. The deviation was due to displaceable, saturable binding to the glass fibre filters used in the assays. Imipramine, chloripramine, desipramine, and fluoxetine inhibited binding to filters whereas 5-hydroxytryptamine and ethanol were ineffective. Experimental conditions were developed that eliminated filter binding, allowing assay of high- and low-affinity binding to membranes. Failure to correct for filter binding may lead to overestimation of binding parameters, Bmax and KD for high-affinity binding to membranes, and may also be misinterpreted as indicating a low-affinity binding component in both platelet and brain membranes. Low-affinity binding (KD less than 2 microM) of imipramine to human platelet membranes was demonstrated and its significance discussed.

  19. Inhibition of Epidermal Growth Factor Receptor and Vascular Endothelial Growth Factor Receptor Phosphorylation on Tumor-Associated Endothelial Cells Leads to Treatment of Orthotopic Human Colon Cancer in Nude Mice

    Directory of Open Access Journals (Sweden)

    Takamitsu Sasaki


    Full Text Available The purpose of our study was to determine whether the dual inhibition of epidermal growth factor receptor (EGFR and vascular endothelial growth factor receptor (VEGFR signaling pathways in tumor-associated endothelial cells can inhibit the progressive growth of human colon carcinoma in the cecum of nude mice. SW620CE2 human colon cancer cells growing in culture and orthotopically in the cecum of nude mice expressed a high level of transforming growth factor alpha (TGF-α and vascular endothelial growth factor (VEGF but were negative for EGFR, human epidermal growth factor receptor 2 (HER2, VEGFR. Double immunofluorescence staining revealed that tumorassociated endothelial cells expressed EGFR, VEGFR2, phosphorylated EGFR (pEGFR, phosphorylated VEGFR (pVEGFR. Treatment of mice with either 7H-pyrrolo [2,3-d]-pyrimidine lead scaffold (AEE788; an inhibitor of EGFR and VEGFR tyrosine kinase or CPT-11 as single agents significantly inhibited the growth of cecal tumors (P < .01; this decrease was even more pronounced with AEE788 combined with CPT-11 (P < .001. AEE788 alone or combined with CPT-11 also inhibited the expression of pEGFR and pVEGFR on tumor-associated endothelial cells, significantly decreased vascularization and tumor cell proliferation, increased the level of apoptosis in both tumorassociated endothelial cells and tumor cells. These data demonstrate that targeting EGFR and VEGFR signaling on tumor-associated endothelial cells provides a viable approach for the treatment of colon cancer.

  20. Plasma membrane organization promotes virulence of the human fungal pathogen Candida albicans. (United States)

    Douglas, Lois M; Konopka, James B


    Candida albicans is a human fungal pathogen capable of causing lethal systemic infections. The plasma membrane plays key roles in virulence because it not only functions as a protective barrier, it also mediates dynamic functions including secretion of virulence factors, cell wall synthesis, invasive hyphal morphogenesis, endocytosis, and nutrient uptake. Consistent with this functional complexity, the plasma membrane is composed of a wide array of lipids and proteins. These components are organized into distinct domains that will be the topic of this review. Some of the plasma membrane domains that will be described are known to act as scaffolds or barriers to diffusion, such as MCC/eisosomes, septins, and sites of contact with the endoplasmic reticulum. Other zones mediate dynamic processes, including secretion, endocytosis, and a special region at hyphal tips that facilitates rapid growth. The highly organized architecture of the plasma membrane facilitates the coordination of diverse functions and promotes the pathogenesis of C. albicans.

  1. Plasma membrane organization promotes virulence of the human fungal pathogen Candida albicans (United States)

    Douglas, Lois M.; Konopka, James. B.


    Candida albicans is a human fungal pathogen capable of causing lethal systemic infections. The plasma membrane plays key roles in virulence because it not only functions as a protective barrier, it also mediates dynamic functions including secretion of virulence factors, cell wall synthesis, invasive hyphal morphogenesis, endocytosis, and nutrient uptake. Consistent with this functional complexity, the plasma membrane is composed of a wide array of lipids and proteins. These components are organized into distinct domains that will be the topic of this review. Some of the plasma membrane domains that will be described are known to act as scaffolds or barriers to diffusion, such as MCC/eisosomes, septins, and sites of contact with the endoplasmic reticulum. Other zones mediate dynamic processes, including secretion, endocytosis, and a special region at hyphal tips that facilitates rapid growth. The highly organized architecture of the plasma membrane facilitates the coordination of diverse functions and promotes the pathogenesis of C. albicans. PMID:26920878

  2. Group B streptococcus activates transcriptomic pathways related to premature birth in human extraplacental membranes in vitro. (United States)

    Park, Hae-Ryung; Harris, Sean M; Boldenow, Erica; McEachin, Richard C; Sartor, Maureen; Chames, Mark; Loch-Caruso, Rita


    Streptococcus agalactiae (group B streptococcus [GBS]) infection in pregnant women is the leading cause of infectious neonatal morbidity and mortality in the United States. Although inflammation during infection has been associated with preterm birth, the contribution of GBS to preterm birth is less certain. Moreover, the early mechanisms by which GBS interacts with the gestational tissue to affect adverse pregnancy outcomes are poorly understood. We hypothesized that short-term GBS inoculation activates pathways related to inflammation and premature birth in human extraplacental membranes. We tested this hypothesis using GBS-inoculated human extraplacental membranes in vitro. In agreement with our hypothesis, a microarray-based transcriptomics analysis of gene expression changes in GBS-inoculated membranes revealed that GBS activated pathways related to inflammation and preterm birth with significant gene expression changes occurring as early as 4 h postinoculation. In addition, pathways related to DNA replication and repair were downregulated with GBS treatment. Conclusions based on our transcriptomics data were further supported by responses of prostaglandin E2 (PGE2), and matrix metalloproteinases 1 (MMP1) and 3 (MMP3), all of which are known to be involved in parturition and premature rupture of membranes. These results support our initial hypothesis and provide new information on molecular targets of GBS infection in human extraplacental membranes.

  3. Assembly of the membrane domain of ATP synthase in human mitochondria. (United States)

    He, Jiuya; Ford, Holly C; Carroll, Joe; Douglas, Corsten; Gonzales, Evvia; Ding, Shujing; Fearnley, Ian M; Walker, John E


    The ATP synthase in human mitochondria is a membrane-bound assembly of 29 proteins of 18 kinds. All but two membrane components are encoded in nuclear genes, synthesized on cytoplasmic ribosomes, and imported into the matrix of the organelle, where they are assembled into the complex with ATP6 and ATP8, the products of overlapping genes in mitochondrial DNA. Disruption of individual human genes for the nuclear-encoded subunits in the membrane portion of the enzyme leads to the formation of intermediate vestigial ATPase complexes that provide a description of the pathway of assembly of the membrane domain. The key intermediate complex consists of the F 1 -c 8 complex inhibited by the ATPase inhibitor protein IF 1 and attached to the peripheral stalk, with subunits e, f, and g associated with the membrane domain of the peripheral stalk. This intermediate provides the template for insertion of ATP6 and ATP8, which are synthesized on mitochondrial ribosomes. Their association with the complex is stabilized by addition of the 6.8 proteolipid, and the complex is coupled to ATP synthesis at this point. A structure of the dimeric yeast F o membrane domain is consistent with this model of assembly. The human 6.8 proteolipid (yeast j subunit) locks ATP6 and ATP8 into the membrane assembly, and the monomeric complexes then dimerize via interactions between ATP6 subunits and between 6.8 proteolipids (j subunits). The dimers are linked together back-to-face by DAPIT (diabetes-associated protein in insulin-sensitive tissue; yeast subunit k), forming long oligomers along the edges of the cristae.

  4. Extracellular Matrix as a Regulator of Epidermal Stem Cell Fate. (United States)

    Chermnykh, Elina; Kalabusheva, Ekaterina; Vorotelyak, Ekaterina


    Epidermal stem cells reside within the specific anatomic location, called niche, which is a microenvironment that interacts with stem cells to regulate their fate. Regulation of many important processes, including maintenance of stem cell quiescence, self-renewal, and homeostasis, as well as the regulation of division and differentiation, are common functions of the stem cell niche. As it was shown in multiple studies, extracellular matrix (ECM) contributes a lot to stem cell niches in various tissues, including that of skin. In epidermis, ECM is represented, primarily, by a highly specialized ECM structure, basement membrane (BM), which separates the epidermal and dermal compartments. Epidermal stem cells contact with BM, but when they lose the contact and migrate to the overlying layers, they undergo terminal differentiation. When considering all of these factors, ECM is of fundamental importance in regulating epidermal stem cells maintenance, proper mobilization, and differentiation. Here, we summarize the remarkable progress that has recently been made in the research of ECM role in regulating epidermal stem cell fate, paying special attention to the hair follicle stem cell niche. We show that the destruction of ECM components impairs epidermal stem cell morphogenesis and homeostasis. A deep understanding of ECM molecular structure as well as the development of in vitro system for stem cell maintaining by ECM proteins may bring us to developing new approaches for regenerative medicine.

  5. Membrane-associated signaling in human B-lymphoma lines

    Energy Technology Data Exchange (ETDEWEB)

    Tauzin, Sebastien; Ding, Heidrun; Burdevet, Dimitri [Department of Pathology and Immunology, Centre medical universitaire, 1, rue Michel-Servet, 1211 Geneva 11 (Switzerland); Borisch, Bettina [Department of Social and Preventive Medicine, Centre medical universitaire, 1, rue Michel-Servet, 1211 Geneva 11 (Switzerland); Hoessli, Daniel C., E-mail: [Department of Pathology and Immunology, Centre medical universitaire, 1, rue Michel-Servet, 1211 Geneva 11 (Switzerland)


    In B-non-Hodgkin lymphomas, Lyn and Cbp/PAG constitute the core of an oncogenic signalosome that captures the Phosphatidylinositol-3-kinase, the Spleen tyrosine kinase and the Signal transducer and activator of transcription-3 to generate pro-survival and proliferative signals. Lymphoma lines corresponding to follicular, mantle-cell and Burkitt-derived lymphomas display type-specific signalosome organizations that differentially activate PI3K, Syk and STAT3. In the follicular lymphoma line, PI3K, Syk and STAT3 were optimally activated upon association with the Lyn-Cbp/PAG signalosome, while in the Burkitt lymphoma-derived line, the association with Cbp/PAG and activation of PI3K were interfered with by the latent membrane proteins encoded by the Epstein-Barr virus. In the Jeko-1 mantle-cell line, a weak association of Syk with the Lyn-Cbp/PAG signalosome resulted in poor activation of Syk, but in those cells, as in the follicular and Burkitt-derived lines, efficient apoptosis induction by the Syk inhibitor R406 indicated that Syk is nonetheless an important prosurvival element and therefore a valuable therapeutic target. In all configurations described herein is the Lyn-Cbp/PAG signalosome independent of external signals and provides efficient means of activation for its associated lipid and protein kinases. In follicular and Burkitt-derived lines, Syk appears to be activated following binding to Cbp/PAG and no longer requires B-cell receptor-associated activation motifs for activation. Assessment of the different modalities of Lyn-Cbp/PAG signalosome organization could help in selecting the appropriate combination of kinase inhibitors to eliminate a particular type of lymphoma cells.

  6. Agrin is a major heparan sulfate proteoglycan in the human glomerular basement membrane

    NARCIS (Netherlands)

    Groffen, Alexander J.; Ruegg, Markus A.; Dijkman, Henri; Van De Velden, Thea J.; Buskens, Carin A.; Van Den Born, Jacob; Assmann, Karel J.; Monnens, Leo A.; Veerkamp, Jacques H.; Van Den Heuvel, Lambert P.

    Agrin is a heparan sulfate proteoglycan (HSPG) that is highly concentrated in the synaptic basal lamina at the neuromuscular junction (NMJ). Agrin-like immunoreactivity is also detected outside the NMJ. Here we show that agrin is a major HSPG component of the human glomerular basement membrane

  7. Parallel artificial liquid membrane extraction as an efficient tool for removal of phospholipids from human plasma

    DEFF Research Database (Denmark)

    Ask, Kristine Skoglund; Bardakci, Turgay; Parmer, Marthe Petrine


    Generic Parallel Artificial Liquid Membrane Extraction (PALME) methods for non-polar basic and non-polar acidic drugs from human plasma were investigated with respect to phospholipid removal. In both cases, extractions in 96-well format were performed from plasma (125μL), through 4μL organic...

  8. Antisense imaging of epidermal growth factor-induced p21{sup WAF-1/CIP-1} gene expression in MDA-MB-468 human breast cancer xenografts

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Judy; Chen, Paul; Mrkobrada, Marko [Leslie Dan Faculty of Pharmacy, University of Toronto, 19 Russell Street, M5S 2S2, Toronto, Ontario (Canada); Hu, Meiduo [Leslie Dan Faculty of Pharmacy, University of Toronto, 19 Russell Street, M5S 2S2, Toronto, Ontario (Canada); Department of Pharmaceutical Sciences, University of Toronto, Toronto, Ontario (Canada); Vallis, Katherine A. [Department of Radiation Oncology, Princess Margaret Hospital, University Health Network, 610 University Avenue, Toronto, Ontario (Canada); Department of Radiation Oncology, University of Toronto, Toronto, Ontario (Canada); Department of Medical Biophysics, University of Toronto, Toronto, Ontario (Canada); Reilly, Raymond M. [Department of Medical Imaging, University of Toronto, Toronto, Ontario (Canada)


    Molecular imaging of the expression of key genes which determine the response to DNA damage following cancer treatment may predict the effectiveness of a particular treatment strategy. A prominent early response gene for DNA damage is the gene encoding p21{sup WAF-1/CIP-1}, a cyclin-dependent kinase inhibitor that regulates progression through the cell cycle. In this study, we explored the feasibility of imaging p21{sup WAF-1/CIP-1} gene expression at the mRNA level using an 18-mer phosphorothioated antisense oligodeoxynucleotide (ODN) labeled with {sup 111}In. The known induction of the p21{sup WAF-1/CIP-1} gene in MDA-MB-468 human breast cancer cells following exposure to epidermal growth factor (EGF) was used as an experimental tool. Treatment of MDA-MB-468 cells in vitro with EGF (20 nM) increased the ratio of p21{sup WAF-1/CIP-1} mRNA/{beta}-actin mRNA threefold within 2 h as measured by the reverse transcription polymerase chain reaction (RT-PCR). A concentration-dependent inhibition of EGF-induced p21{sup WAF-1/CIP-1} protein expression was achieved in MDA-MB-468 cells by treatment with antisense ODNs with up to a tenfold decrease observed at 1 {mu}M. There was a fourfold lower inhibition of p21{sup WAF-1/CIP-1} protein expression by control sense or random sequence ODNs. Intratumoral injections of EGF (15 {mu}g/day x 3 days) were employed to induce p21{sup WAF-1/CIP-1} gene expression in MDA-MB-468 xenografts implanted subcutaneously into athymic mice. RT-PCR of explanted tumors showed a threefold increased level of p21{sup WAF-1/CIP-1} mRNA compared with normal saline-treated tumors. Successful imaging of EGF-induced p21{sup WAF-1/CIP-1} gene expression in MDA-MB-468 xenografts was achieved at 48 h post injection of {sup 111}In-labeled antisense ODNs (3.7 MBq; 2 {mu}g). Tumors displaying basal levels of p21{sup WAF-1/CIP-1} gene expression in the absence of EGF treatment could not be visualized. Biodistribution studies showed a significantly higher tumor

  9. Grape extract protects against γ-radiation-induced membrane damage strains of human erythrocytes

    International Nuclear Information System (INIS)

    Das, Subir Kumar


    The membrane integrity of circulating red blood cells (RBCs) is compromised by the deleterious actions of γ-radiation in humans. Grapes are the richest source of antioxidants due to presence of potentially bioactive phytochemicals. The objective of the present study was to assess the radioprotective actions of grape extracts against the γ-radiation-induced membrane permeability of human erythrocytes. The scavenging activities in seeds of grape in DPPH, hydrogen peroxide and hydroxyl radicals, were higher than skin or pulp of different cultivars. Grape extracts also showed appreciable extent of total antioxidant capacity and effective antihemolytic action. Grape extracts significantly ameliorated the γ-radiation-induced increase of the levels of thiobarbituric acid-reactive substances (TBARS, an index of lipid peroxidation) in the RBC membrane ghosts. Stored blood showed higher levels of K + ion as compared to the normal blood which was elevated by γ-radiation. Membrane ATPase was inhibited by the exposure to γ-radiation.Treatment of RBCs with the grape extracts prior to the exposure of γ-radiation significantly mitigated these changes in the erythrocyte membranes caused by the lower dose of radiation (4 Gy). (author)

  10. Altered Decorin and Smad Expression in Human Fetal Membranes in PPROM1 (United States)

    Horgan, Casie E.; Roumimper, Hailey; Tucker, Richard; Lechner, Beatrice E.


    ABSTRACT Humans with Ehlers-Danlos syndrome, a subtype of which is caused by abnormal decorin expression, are at increased risk of preterm birth due to preterm premature rupture of fetal membranes (PPROM). In the mouse model, the absence of decorin leads to fetal membrane abnormalities, preterm birth, and dysregulation of decorin's downstream pathway components, including the transcription factor p-Smad-2. However, the role of decorin and p-Smad-2 in idiopathic human PPROM is unknown. Fetal membranes from 20–25 pregnancies per group were obtained as a cross-sectional sample of births at one institution between January 2010 and December 2012. The groups were term, preterm without PPROM, and preterm with PPROM. Immunohistochemical analysis of fetal membranes was performed for decorin and p-Smad-2 using localization and quantification assessment. Decorin expression is developmentally regulated in fetal membranes and is decreased in preterm birth with PPROM compared to preterm birth without PPROM. In preterm with PPROM samples, the presence of infection is associated with significant decorin downregulation compared to preterm with PPROM samples without infection. The preterm with PPROM group exhibited decreased p-Smad-2 staining compared to both the term controls and the preterm-without-PPROM group. Our findings suggest that dysregulation of decorin and its downstream pathway component p-Smad-2 occurs in fetal membranes during the second trimester in pathological pregnancies, thus supporting a role for decorin and p-Smad-2 in the pathophysiology of fetal membranes and adverse pregnancy outcomes. These findings may lead to the discovery of new targets for the diagnosis and treatment of PPROM. PMID:25232019

  11. Epidermal stem cells: location, potential and contribution to cancer. (United States)

    Ambler, C A; Määttä, A


    Epidermal stem cells have been classically characterized as slow-cycling, long-lived cells that reside in discrete niches in the skin. Gene expression studies of niche-resident cells have revealed a number of stem cell markers and regulators, including the Wnt/beta-catenin, Notch, p63, c-Myc and Hedgehog pathways. A new study challenges the traditional developmental paradigm of slow-cycling stem cells and rapid-cycling transit amplifying cells in some epidermal regions, and there is mounting evidence to suggest that multi-lineage epidermal progenitors can be isolated from highly proliferative, non-niche regions. Whether there is a unique microenvironment surrounding these progenitors remains to be determined. Interestingly, cancer stem cells derived from epidermal tumours exist independent of the classic skin stem cell niche, yet also have stem cell properties, including multi-lineage differentiation. This review summarizes recent studies identifying the location and regulators of mouse and human epidermal stem cells and highlights the strategies used to identify cancer stem cells, including expression of normal epidermal stem cell markers, expression of cancer stem cell markers identified in other epidermal tumours and characterization of side-population tumour cells.

  12. Some biological properties of the human amniotic membrane interferon

    Directory of Open Access Journals (Sweden)

    P. C. P. Ferreira


    Full Text Available Human amniotic interferon was investigated to define the species specificity of its antiviral action and compare its anti-cellular and NK cell stimulating activities with those of other human interferons. The antiviral effect was titrated in bovine (RV-IAL and monkey (VERO cells. Amniotic interferon exhibited, in bovine cells, 5% of the activity seen in monkey cells, while alpha interferon displayed 200%. No effect was detected with either beta or gamma interferon in bovine cells. Daudi cells were exposed to different concentrations of various interferons and the cell numbers were determined. The anticellular effect of the amniotic interferon reached its peak on the third day of incubation. Results suggested a higher activity for alpha and gamma interferons and a lower activity for beta when compared to amniotic interferon. Using total mononuclear cells as effector cells and K 562 as target cell in a 51Cr release assay, it was demonstrated that low concentrations of amniotic interferon consistently stimulated NK cell activity in cells derived from several donors, the results indicating a higher level of activity with this interferon than with alpha and beta interferons.

  13. Parallel artificial liquid membrane extraction of acidic drugs from human plasma

    DEFF Research Database (Denmark)

    Roldan-Pijuan, Mercedes; Pedersen-Bjergaard, Stig; Gjelstad, Astrid


    The new sample preparation concept “Parallel artificial liquid membrane extraction (PALME)” was evaluated for extraction of the acidic drugs ketoprofen, fenoprofen, diclofenac, flurbiprofen, ibuprofen, and gemfibrozil from human plasma samples. Plasma samples (250 μL) were loaded into individual......-performance liquid chromatography-ultraviolet detection of the individual acceptor solutions. Important PALME parameters including the chemical composition of the liquid membrane, extraction time, and sample pH were optimized, and the extraction performance was evaluated. Except for flurbiprofen, exhaustive...

  14. Membrane damage induced in cultured human skin fibroblasts by UVA irradiation

    International Nuclear Information System (INIS)

    Gaboriau, F.; Morliere, P.; Marquis, I.; Moysan, A.; Geze, M.; Dubertret, L.


    Irradiation of cultured human skin fibroblasts with ultraviolet light from 320 to 400 nm (UVA) leads to a decrease in the membrane fluidity exemplified by an enhanced fluorescence anisotropy of the lipophilic fluorescent probe 1-[4-trimethylamino)-phenyl]-6-phenylhexa-1,3,5-triene. This UVA-induced decrease in fluidity is associated with lactate dehydrogenase leakage in the supernatant. Vitamin E, an inhibitor of lipid peroxidation, exerts a protective effect on both phenomena. Therefore, this UVA-induced damage in membrane properties may be related to lipid peroxidation processes. Moreover, exponentially growing cells are more sensitive to these UVA-induced alterations than confluent cells. (Author)

  15. Effect of the Human Amniotic Membrane on Liver Regeneration in Rats

    Directory of Open Access Journals (Sweden)

    Mesut Sipahi


    Full Text Available Introduction. Operations are performed for broader liver surgery indications for a better understanding of hepatic anatomy/physiology and developments in operation technology. Surgery can cure some patients with liver metastasis of some tumors. Nevertheless, postoperative liver failure is the most feared complication causing mortality in patients who have undergone excision of a large liver mass. The human amniotic membrane has regenerative effects. Thus, we investigated the effects of the human amniotic membrane on regeneration of the resected liver. Methods. Twenty female Wistar albino rats were divided into control and experimental groups and underwent a 70% hepatectomy. The human amniotic membrane was placed over the residual liver in the experimental group. Relative liver weight, histopathological features, and biochemical parameters were assessed on postoperative day 3. Results. Total protein and albumin levels were significantly lower in the experimental group than in the control group. No difference in relative liver weight was observed between the groups. Hepatocyte mitotic count was significantly higher in the experimental group than in the control group. Hepatic steatosis was detected in the experimental group. Conclusion. Applying the amniotic membrane to residual liver adversely affected liver regeneration. However, mesenchymal stem cell research has the potential to accelerate liver regeneration investigations.

  16. [Progress in epidermal stem cells]. (United States)

    Wang, Li-Juan; Wang, You-Liang; Yang, Xiao


    Mammalian skin epidermis contains different epidermal stem cell pools which contribute to the homeostasis and repair of skin epithelium. Epidermal stem cells possess two essential features common to all stem cells: self-renewal and differentiation. Disturbing the balance between self-renewal and differentiation of epidermal stem cell often causes tumors or other skin diseases. Epidermal stem cell niches provide a special microenvironment that maintains a balance of stem cell quiescence and activity. This review primarily concentrates on the following points of the epidermal stem cells: the existing evidences, the self-renewal and differentiation, the division pattern, the signal pathways regulating self-renewal and differentiation, and the microenvironment (niche) and macroenvironment maintaining the homeostasis of stem cells.

  17. Presence of fucosyl residues on the oligosaccharide antennae of membrane glycopeptides of human neuroblastoma cells

    International Nuclear Information System (INIS)

    Santer, U.V.; Glick, M.C.


    Fucosyl residues linked alpha 1 leads to 3 or 4 to N-acetylglucosamine were found in large amounts on glycopeptides from the membranes of human tumor cells of neurectodermal origin but not on membrane glycopeptides from human fibroblasts. The fucosyl residues were detected by release of radioactive fucose from the glycopeptides with an almond alpha-L-fucosidase specific for fucosyl alpha 1 leads to 3(4)-N-acetylglucosamine. In other studies, the linkage was shown to be alpha 1 leads to 3 by nuclear magnetic resonance analysis. Glycopeptides containing these fucosyl residues from four human neuroblastoma cell lines were defined by binding to immobilized lectins. In addition, the glycopeptides from one human neuroblastoma cell line, CHP-134, were further characterized by enzyme degradation and columns calibrated for size and charge. The antennary position of fucosyl alpha 1 leads to 3-N-acetylglucosamine on the glycopeptides was demonstrated by the use of exoglycosidases and endoglycosidase D, since complete degradation to yield fucosyl-N-acetylglucosaminylasparagine was obtained only after treatment with almond alpha-L-fucosidase prior to the sequential degradation. Fucosyl alpha 1 leads to 3-N-acetylglucosamine was present on most size and charge classes of membrane glycopeptides and therefore was not limited to a few glycoproteins. Since the almond alpha-L-fucosidase cleaves fucosyl residues from glycoproteins, the physiological effects of the increased specific fucosylation on human tumors of neurectodermal origin can be examined

  18. Viscoelastic properties of the human tympanic membrane studied with stroboscopic holography and finite element modeling. (United States)

    De Greef, Daniel; Aernouts, Jef; Aerts, Johan; Cheng, Jeffrey Tao; Horwitz, Rachelle; Rosowski, John J; Dirckx, Joris J J


    A new anatomically-accurate Finite Element (FE) model of the tympanic membrane (TM) and malleus was combined with measurements of the sound-induced motion of the TM surface and the bony manubrium, in an isolated TM-malleus preparation. Using the results, we were able to address two issues related to how sound is coupled to the ossicular chain: (i) Estimate the viscous damping within the tympanic membrane itself, the presence of which may help smooth the broadband response of a potentially highly resonant TM, and (ii) Investigate the function of a peculiar feature of human middle-ear anatomy, the thin mucosal epithelial fold that couples the mid part of the human manubrium to the TM. Sound induced motions of the surface of ex vivo human eardrums and mallei were measured with stroboscopic holography, which yields maps of the amplitude and phase of the displacement of the entire membrane surface at selected frequencies. The results of these measurements were similar, but not identical to measurements made in intact ears. The holography measurements were complemented by laser-Doppler vibrometer measurements of sound-induced umbo velocity, which were made with fine-frequency resolution. Comparisons of these measurements to predictions from a new anatomically accurate FE model with varied membrane characteristics suggest the TM contains viscous elements, which provide relatively low damping, and that the epithelial fold that connects the central section of the human manubrium to the TM only loosely couples the TM to the manubrium. The laser-Doppler measurements in two preparations also suggested the presence of significant variation in the complex modulus of the TM between specimens. Some animations illustrating the model results are available at our website ( Copyright © 2014 Elsevier B.V. All rights reserved.

  19. Transport of 3-bromopyruvate across the human erythrocyte membrane. (United States)

    Sadowska-Bartosz, Izabela; Soszyński, Mirosław; Ułaszewski, Stanisław; Ko, Young; Bartosz, Grzegorz


    3-Bromopyruvic acid (3-BP) is a promising anticancer compound because it is a strong inhibitor of glycolytic enzymes, especially glyceraldehyde 3-phosphate dehydrogenase. The Warburg effect means that malignant cells are much more dependent on glycolysis than normal cells. Potential complications of anticancer therapy with 3-BP are side effects due to its interaction with normal cells, especially erythrocytes. Transport into cells is critical for 3-BP to have intracellular effects. The aim of our study was the kinetic characterization of 3-BP transport into human erythrocytes. 3-BP uptake by erythrocytes was linear within the first 3 min and pH-dependent. The transport rate decreased with increasing pH in the range of 6.0-8.0. The Km and Vm values for 3-BP transport were 0.89 mM and 0.94 mmol/(l cells x min), respectively. The transport was inhibited competitively by pyruvate and significantly inhibited by DIDS, SITS, and 1-cyano-4-hydroxycinnamic acid. Flavonoids also inhibited 3-BP transport: the most potent inhibition was found for luteolin and quercetin.

  20. Effects of prolonged recombinant human erythropoietin administration on muscle membrane transport systems and metabolic marker enzymes

    DEFF Research Database (Denmark)

    Juel, C; Thomsen, J J; Rentsch, R L


    on the expression of muscle membrane transport proteins. Likewise, improvements in performance may involve upregulation of metabolic enzymes. Since Epo is known to augment performance we tested the effect of rHuEpo on some marker enzymes that are related to aerobic capacity. For these purposes eight subjects...... performance by approximately 54%. Membrane transport systems and carbonic anhydrases involved in pH regulation remained unchanged. Of the Na(+), K(+)-pump isoforms only the density of the alpha2 subunit was decreased (by 22%) after treatment. The marker enzymes cytochrom c and hexokinase remained unchanged......Adaptations to chronic hypoxia involve changes in membrane transport proteins. The underlying mechanism of this response may be related to concomitant occurring changes in erythropoietin (Epo) levels. We therefore tested the direct effects of recombinant human erythropoietin (rHuEpo) treatment...

  1. Comparative proteomic analysis of plasma membrane proteins between human osteosarcoma and normal osteoblastic cell lines

    International Nuclear Information System (INIS)

    Zhang, Zhiyu; Ma, Fang; Cai, Zhengdong; Zhang, Lijun; Hua, Yingqi; Jia, Xiaofang; Li, Jian; Hu, Shuo; Peng, Xia; Yang, Pengyuan; Sun, Mengxiong


    Osteosarcoma (OS) is the most common primary malignant tumor of bone in children and adolescents. However, the knowledge in diagnostic modalities has progressed less. To identify new biomarkers for the early diagnosis of OS as well as for potential novel therapeutic candidates, we performed a sub-cellular comparative proteomic research. An osteosarcoma cell line (MG-63) and human osteoblastic cells (hFOB1.19) were used as our comparative model. Plasma membrane (PM) was obtained by aqueous two-phase partition. Proteins were analyzed through iTRAQ-based quantitative differential LC/MS/MS. The location and function of differential proteins were analyzed through GO database. Protein-protein interaction was examined through String software. One of differentially expressed proteins was verified by immunohistochemistry. 342 non-redundant proteins were identified, 68 of which were differentially expressed with 1.5-fold difference, with 25 up-regulated and 43 down-regulated. Among those differential proteins, 69% ware plasma membrane, which are related to the biological processes of binding, cell structure, signal transduction, cell adhesion, etc., and interaction with each other. One protein--CD151 located in net nodes was verified to be over-expressed in osteosarcoma tissue by immunohistochemistry. It is the first time to use plasma membrane proteomics for studying the OS membrane proteins according to our knowledge. We generated preliminary but comprehensive data about membrane protein of osteosarcoma. Among these, CD151 was further validated in patient samples, and this small molecule membrane might be a new target for OS research. The plasma membrane proteins identified in this study may provide new insight into osteosarcoma biology and potential diagnostic and therapeutic biomarkers

  2. Effect of fibrin glue on the biomechanical properties of human Descemet's membrane.

    Directory of Open Access Journals (Sweden)

    Shyam S Chaurasia

    Full Text Available BACKGROUND: Corneal transplantation has rapidly evolved from full-thickness penetrating keratoplasty (PK to selective tissue corneal transplantation, where only the diseased portions of the patient's corneal tissue are replaced with healthy donor tissue. Descemet's membrane endothelial keratoplasty (DMEK performed in patients with corneal endothelial dysfunction is one such example where only a single layer of endothelial cells with its basement membrane (10-15 µm in thickness, Descemet's membrane (DM is replaced. It is challenging to replace this membrane due to its intrinsic property to roll in an aqueous environment. The main objective of this study was to determine the effects of fibrin glue (FG on the biomechanical properties of DM using atomic force microscopy (AFM and relates these properties to membrane folding propensity. METHODOLOGY/PRINCIPAL FINDINGS: Fibrin glue was sprayed using the EasySpray applicator system, and the biomechanical properties of human DM were determined by AFM. We studied the changes in the "rolling up" tendency of DM by examining the changes in the elasticity and flexural rigidity after the application of FG. Surface topography was assessed using scanning electron microscopy (SEM and AFM imaging. Treatment with FG not only stabilized and stiffened DM but also led to a significant increase in hysteresis of the glue-treated membrane. In addition, flexural or bending rigidity values also increased in FG-treated membranes. CONCLUSIONS/SIGNIFICANCE: Our results suggest that fibrin glue provides rigidity to the DM/endothelial cell complex that may aid in subsequent manipulation by maintaining tissue integrity.

  3. Effect of Fibrin Glue on the Biomechanical Properties of Human Descemet's Membrane (United States)

    Chaurasia, Shyam S.; Champakalakshmi, Ravi; Li, Ang; Poh, Rebekah; Tan, Xiao Wei; Lakshminarayanan, Rajamani; Lim, Chwee T.; Tan, Donald T.; Mehta, Jodhbir S.


    Background Corneal transplantation has rapidly evolved from full-thickness penetrating keratoplasty (PK) to selective tissue corneal transplantation, where only the diseased portions of the patient's corneal tissue are replaced with healthy donor tissue. Descemet's membrane endothelial keratoplasty (DMEK) performed in patients with corneal endothelial dysfunction is one such example where only a single layer of endothelial cells with its basement membrane (10–15 µm in thickness), Descemet's membrane (DM) is replaced. It is challenging to replace this membrane due to its intrinsic property to roll in an aqueous environment. The main objective of this study was to determine the effects of fibrin glue (FG) on the biomechanical properties of DM using atomic force microscopy (AFM) and relates these properties to membrane folding propensity. Methodology/Principal Findings Fibrin glue was sprayed using the EasySpray applicator system, and the biomechanical properties of human DM were determined by AFM. We studied the changes in the “rolling up” tendency of DM by examining the changes in the elasticity and flexural rigidity after the application of FG. Surface topography was assessed using scanning electron microscopy (SEM) and AFM imaging. Treatment with FG not only stabilized and stiffened DM but also led to a significant increase in hysteresis of the glue-treated membrane. In addition, flexural or bending rigidity values also increased in FG-treated membranes. Conclusions/Significance Our results suggest that fibrin glue provides rigidity to the DM/endothelial cell complex that may aid in subsequent manipulation by maintaining tissue integrity. PMID:22662156

  4. Zymosterol is located in the plasma membrane of cultured human fibroblasts

    International Nuclear Information System (INIS)

    Echevarria, F.; Norton, R.A.; Nes, W.D.; Lange, Y.


    Zymosterol (5 alpha-cholesta-8(9),24-dien-3 beta-ol) comprised a negligible fraction of the mass of sterol in cultured human fibroblasts but was well labeled biosynthetically with radioactive acetate. Treatment of cells with triparanol, a potent inhibitor of sterol delta 24-reductase, led to a marked increase in labeled zymosterol while its mass rose to 1 mol% of total sterol. All of this sterol could be chased into cholesterol. Furthermore, cell homogenates converted exogenous radiolabeled zymosterol to cholesterol. Three lines of evidence suggested that biosynthetically labeled zymosterol was associated with the plasma membrane. (1) About 80% of radiolabeled zymosterol was oxidized by the impermeant enzyme, cholesterol oxidase, in glutaraldehyde-fixed intact cells. (2) Sucrose density gradient analysis of homogenates showed that the equilibrium buoyant density profile of newly synthesized zymosterol was identical with that of the plasma membrane. (3) Newly synthesized zymosterol was transferred as readily from fixed intact fibroblasts to exogenous acceptors as was cholesterol. Given that cholesterol is synthesized within the cell, it is unclear why most of the zymosterol is in the plasma membrane. The pathway of cholesterol biosynthesis may compel zymosterol to flux through the plasma membrane. Alternatively, plasma membrane zymosterol may represent a separate pool, in equilibrium with the zymosterol in the intracellular biosynthetic pool

  5. Membrane-Wrapping Contributions to Malaria Parasite Invasion of the Human Erythrocyte (United States)

    Dasgupta, Sabyasachi; Auth, Thorsten; Gov, Nir S.; Satchwell, Timothy J.; Hanssen, Eric; Zuccala, Elizabeth S.; Riglar, David T.; Toye, Ashley M.; Betz, Timo; Baum, Jake; Gompper, Gerhard


    The blood stage malaria parasite, the merozoite, has a small window of opportunity during which it must successfully target and invade a human erythrocyte. The process of invasion is nonetheless remarkably rapid. To date, mechanistic models of invasion have focused predominantly on the parasite actomyosin motor contribution to the energetics of entry. Here, we have conducted a numerical analysis using dimensions for an archetypal merozoite to predict the respective contributions of the host-parasite interactions to invasion, in particular the role of membrane wrapping. Our theoretical modeling demonstrates that erythrocyte membrane wrapping alone, as a function of merozoite adhesive and shape properties, is sufficient to entirely account for the first key step of the invasion process, that of merozoite reorientation to its apex and tight adhesive linkage between the two cells. Next, parasite-induced reorganization of the erythrocyte cytoskeleton and release of parasite-derived membrane can also account for a considerable energetic portion of actual invasion itself, through membrane wrapping. Thus, contrary to the prevailing dogma, wrapping by the erythrocyte combined with parasite-derived membrane release can markedly reduce the expected contributions of the merozoite actomyosin motor to invasion. We therefore propose that invasion is a balance between parasite and host cell contributions, evolved toward maximal efficient use of biophysical forces between the two cells. PMID:24988340

  6. "Cut-and-paste" manufacture of multiparametric epidermal electronic systems (United States)

    Lu, Nanshu; Yang, Shixuan; Wang, Pulin


    Epidermal electronics is a class of noninvasive and unobstructive skin-mounted, tattoo-like sensors and electronics capable of vital sign monitoring and establishing human-machine interface. The high cost of manpower, materials, vacuum equipment, and photolithographic facilities associated with its manufacture greatly hinders the widespread use of disposable epidermal electronics. Here we report a cost and time effective, completely dry, benchtop "cut-and-paste" method for the freeform and portable manufacture of multiparametric epidermal sensor systems (ESS) within minutes. This versatile method works for all types of thin metal and polymeric sheets and is compatible with any tattoo adhesives or medical tapes. The resulting ESS are multimaterial and multifunctional and have been demonstrated to noninvasively but accurately measure electrophysiological signals, skin temperature, skin hydration, as well as respiratory rate. In addition, planar stretchable coils exploiting double-stranded serpentine design have been successfully applied as wireless, passive epidermal strain sensors.

  7. Epidermal Growth Factor and Intestinal Barrier Function

    Directory of Open Access Journals (Sweden)

    Xiaopeng Tang


    Full Text Available Epidermal growth factor (EGF is a 53-amino acid peptide that plays an important role in regulating cell growth, survival, migration, apoptosis, proliferation, and differentiation. In addition, EGF has been established to be an effective intestinal regulator helping to protect intestinal barrier integrity, which was essential for the absorption of nutrients and health in humans and animals. Several researches have demonstrated that EGF via binding to the EGF receptor and subsequent activation of Ras/MAPK, PI3K/AKT, PLC-γ/PKC, and STATS signal pathways regulates intestinal barrier function. In this review, the relationship between epidermal growth factor and intestinal development and intestinal barrier is described, to provide a better understanding of the effects of EGF on intestine development and health.

  8. An acid phosphatase in the plasma membranes of human astrocytoma showing marked specificity toward phosphotyrosine protein. (United States)

    Leis, J F; Kaplan, N O


    The plasma membrane from the human tumor astrocytoma contains an active acid phosphatase activity based on hydrolysis of p-nitrophenyl phosphate. Other acid phosphatase substrates--beta-glycerophosphate, O-phosphorylcholine, and 5'-AMP--are not hydrolyzed significantly. The phosphatase activity is tartrate insensitive and is stimulated by Triton X-100 and EDTA. Of the three known phosphoamino acids, only free O-phosphotyrosine is hydrolyzed by the membrane phosphatase activity. Other acid phosphatases tested from potato, wheat germ, milk, and bovine prostate did not show this degree of specificity. The plasma membrane activity also dephosphorylated phosphotyrosine histone at a much greater rate than did the other acid phosphatases. pH profiles for free O-phosphotyrosine and phosphotyrosine histone showed a shift toward physiological pH, indicating possible physiological significance. Phosphotyrosine histone dephosphorylation activity was nearly 10 times greater than that seen for phosphoserine histone dephosphorylation, and Km values were much lower for phosphotyrosine histone dephosphorylation (0.5 microM vs. 10 microM). Fluoride and zinc significantly inhibited phosphoserine histone dephosphorylation. Vanadate, on the other hand, was a potent inhibitor of phosphotyrosine histone dephosphorylation (50% inhibition at 0.5 microM) but not of phosphoserine histone. ATP stimulated phosphotyrosine histone dephosphorylation (160-250%) but inhibited phosphoserine histone dephosphorylation (95%). These results suggest the existence of a highly specific phosphotyrosine protein phosphatase activity associated with the plasma membrane of human astrocytoma.

  9. Membrane microdomain-associated uroplakin IIIa contributes to Src-dependent mechanisms of anti-apoptotic proliferation in human bladder carcinoma cells

    Directory of Open Access Journals (Sweden)

    Shigeru Kihira


    Our previous study demonstrated that tyrosine phosphorylation of p145met/β-subunit of hepatocyte growth factor receptor by epidermal growth factor receptor and Src contributes to the anti-apoptotic growth of human bladder carcinoma cell 5637 under serum-starved conditions. Here, we show that some other cell lines of human bladder carcinoma, but not other types of human cancer cells, also exhibit Src-dependent, anti-apoptotic proliferation under serum-starved conditions, and that low-density, detergent-insoluble membrane microdomains (MD serve as a structural platform for signaling events involving p145met, EGFR, and Src. As an MD-associated molecule that may contribute to bladder carcinoma-specific cellular function, we identified uroplakin IIIa (UPIIIa, an urothelium-specific protein. Results obtained so far revealed: 1 UPIIIa undergoes partial proteolysis in serum-starved cells; 2 a specific antibody to the extracellular domain of UPIIIa inhibits the proteolysis of UPIIIa and the activation of Src, and promotes apoptosis in serum-starved cells; and 3 knockdown of UPIIIa by short interfering RNA also promotes apoptosis in serum-starved cells. GM6001, a potent inhibitor of matrix metalloproteinase (MMP, inhibits the proteolysis of UPIIIa and promotes apoptosis in serum-starved cells. Furthermore, serum starvation promotes expression and secretion of the heparin-binding EGF-like growth factor in a manner that depends on the functions of MMP, Src, and UPIIIa. These results highlight a hitherto unknown signaling network involving a subset of MD-associated molecules in the anti-apoptotic mechanisms of human bladder carcinoma cells.

  10. Inhibition of Epidermal Growth Factor Receptor and PI3K/Akt Signaling Suppresses Cell Proliferation and Survival through Regulation of Stat3 Activation in Human Cutaneous Squamous Cell Carcinoma

    International Nuclear Information System (INIS)

    Bito, T.; Sumita, N.; Ashida, M.; Budiyanto, A.; Ueda, M.; Ichihashi, M.; Nishigori, C.; Tokura, Y.; Bito, T.


    Recent studies have emphasized the important role of Stat3 activation in a number of human tumors from the viewpoint of its oncogenic and anti apoptotic activity. In this study, we examined the role and related signaling molecules of Stat3 in the carcinogenesis of human cutaneous squamous cell carcinoma (SCC). In 35 human cutaneous SCC samples, 86% showed overexpression of phosphorylated (p)-Stat3, and most of those simultaneously over expressed p-EGFR or p-Akt. Constitutive activation of EGFR and Stat3 was observed in three SCC cell lines and four of five SCC tissues. AG1478, an inhibitor of the EGFR, down regulated Stat3 activation in HSC-1 human SCC cells. AG1478 inhibited cell proliferation and induced apoptosis of HSC-1 cells but did not inhibit the growth of normal human epidermal keratinocytes that did not show Stat3 activation. Furthermore, a PI3K inhibitor also suppressed Stat3 activation in HSC-1 cells to some degree. Combined treatment with the PI3K inhibitor and AG1478 strongly suppressed Stat3 activity and dramatically induced apoptosis of HSC-1 cells. These data suggest that Stat3 activation through EGFR and/or PI3K/Akt activation plays a critical role in the proliferation and survival of human cutaneous SCC.

  11. A Preliminary Study of Human Amniotic Membrane as a Potential Chondrocyte Carrier

    Directory of Open Access Journals (Sweden)

    L Boo


    Full Text Available PURPOSE: To investigate the feasibility of using processed human amniotic membrane (HAM to support the attachment and proliferation of chondrocytes in vitro which in turn can be utilised as a cell delivery vehicle in tissue engineering applications. METHODS: Fresh HAM obtained from patients undergoing routine elective caesarean sections was harvested, processed and dried using either freeze drying (FD or air drying (AD methods prior to sterilisation by gamma irradiation. Isolated, processed and characterised rabbit autologous chondrocytes were seeded on processed HAM and cultured for up to three weeks. Cell attachment and proliferation were examined qualitatively using inverted brightfield microscopy. RESULTS: Processed HAM appeared to allow cell attachment when implanted with chondrocytes. Although cells seeded on AD and FD HAM did not appear to attach as strongly as those seeded on glycerol preserved intact human amniotic membrane, these cells to be proliferated in cell culture conditions. CONCLUSION: Preliminary results show that processed HAM promotes chondrocyte attachment and proliferation.

  12. Transport and Biodistribution of Dendrimers Across Human Fetal Membranes: Implications for Intravaginal Administration of Dendrimers (United States)

    Menjoge, Anupa R.; Navath, Raghavendra S.; Asad, Abbas; Kannan, Sujatha; Kim, Chong Jai; Romero, Roberto; Kannan, Rangaramanujam M.


    Dendrimers are emerging as promising topical antimicrobial agents, and as targeted nanoscale drug delivery vehicles. Topical intravaginal antimicrobial agents are prescribed to treat the ascending genital infections in pregnant women. The fetal membranes separate the extra-amniotic space and fetus. The purpose of the study is to determine if the dendrimers can be selectively used for local intravaginal application to pregnant women without crossing the membranes into the fetus. In the present study, the transport and permeability of PAMAM (poly(amidoamine)) dendrimers, across human fetal membrane (using a side-by-side diffusion chamber), and its biodistribution (using immunofluorescence) are evaluated ex-vivo. Transport across human fetal membranes (from the maternal side) was evaluated using Fluorescein (FITC), an established transplacental marker (positive control, size~ 400 Da) and fluorophore-tagged G4-PAMAM dendrimers (~ 16 kDa). The fluorophore-tagged G4-PAMAM dendrimers were synthesized and characterized using 1H NMR, MALDI TOF-MS and HPLC analysis. Transfer was measured across the intact fetal membrane (chorioamnion), and the separated chorion and amnion layers. Over a five hour period, the dendrimer transport across all the three membranes was less than transport of FITC was relatively fast with as much as 49% transport across the amnion. The permeability of FITC (7.9 × 10-7 cm2/s) through the chorioamnion was 7-fold higher than that of the dendrimer (5.8 × 10-8 cm2/s). The biodistribution showed that the dendrimers were largely present in interstitial spaces in the decidual stromal cells and the chorionic trophoblast cells (in 2.5 to 4 h) and surprisingly, to a smaller extent internalized in nuclei of trophoblast cells and nuclei and cytoplasm of stromal cells. Passive diffusion and paracellular transport appear to be the major route for dendrimer transport. The overall findings further suggest that entry of drugs conjugated to dendrimers would be

  13. Faster DNA Repair of Ultraviolet-Induced Cyclobutane Pyrimidine Dimers and Lower Sensitivity to Apoptosis in Human Corneal Epithelial Cells than in Epidermal Keratinocytes.

    Directory of Open Access Journals (Sweden)

    Justin D Mallet

    Full Text Available Absorption of UV rays by DNA generates the formation of mutagenic cyclobutane pyrimidine dimers (CPD and pyrimidine (6-4 pyrimidone photoproducts (6-4PP. These damages are the major cause of skin cancer because in turn, they can lead to signature UV mutations. The eye is exposed to UV light, but the cornea is orders of magnitude less prone to UV-induced cancer. In an attempt to shed light on this paradox, we compared cells of the corneal epithelium and the epidermis for UVB-induced DNA damage frequency, repair and cell death sensitivity. We found similar CPD levels but a 4-time faster UVB-induced CPD, but not 6-4PP, repair and lower UV-induced apoptosis sensitivity in corneal epithelial cells than epidermal. We then investigated levels of DDB2, a UV-induced DNA damage recognition protein mostly impacting CPD repair, XPC, essential for the repair of both CPD and 6-4PP and p53 a protein upstream of the genotoxic stress response. We found more DDB2, XPC and p53 in corneal epithelial cells than in epidermal cells. According to our results analyzing the protein stability of DDB2 and XPC, the higher level of DDB2 and XPC in corneal epithelial cells is most likely due to an increased stability of the protein. Taken together, our results show that corneal epithelial cells have a better efficiency to repair UV-induced mutagenic CPD. On the other hand, they are less prone to UV-induced apoptosis, which could be related to the fact that since the repair is more efficient in the HCEC, the need to eliminate highly damaged cells by apoptosis is reduced.

  14. Substrate Specificity, Membrane Topology, and Activity Regulation of Human Alkaline Ceramidase 2 (ACER2)*


    Sun, Wei; Jin, Junfei; Xu, Ruijuan; Hu, Wei; Szulc, Zdzislaw M.; Bielawski, Jacek; Obeid, Lina M.; Mao, Cungui


    Human alkaline ceramidase 2 (ACER2) plays an important role in cellular responses by regulating the hydrolysis of ceramides in cells. Here we report its biochemical characterization, membrane topology, and activity regulation. Recombinant ACER2 was expressed in yeast mutant cells (Δypc1Δydc1) that lack endogenous ceramidase activity, and microsomes from ACER2-expressiong yeast cells were used to biochemically characterize ACER2. ACER2 catalyzed the hydrolysis of various ceramides and followed...

  15. Biotransformation of endorphins by a synaptosomal plasma membrane preparation of rat brain and by human serum

    NARCIS (Netherlands)

    Burbach, J.P.H.; Loeber, J.G.; Verhoef, J.; Kloet, E.R. de; Wied, D. de


    β-Endorphin (β-LPH 61–91), γ-endorphin (61–77), des-tyrosine-γ-endorphin (62–77), α-endorphin (61–76), and β-LPH 61–69 either labeled with [125I] at the N-terminal 61-tyrosine residue or unlabeled were incubated with a crude synaptosomal plasma membrane fraction of rat brain or in human serum. At

  16. Glycine uptake by microvillous and basal plasma membrane vesicles from term human placentae. (United States)

    Dicke, J M; Verges, D; Kelley, L K; Smith, C H


    Like most amino acids, glycine is present in higher concentrations in the fetus than in the mother. Unlike most amino acids, animal studies suggest fetal concentrations of glycine are minimally in excess of those required for protein synthesis. Abnormal glycine utilization has also been demonstrated in small-for-gestational age human fetuses. The mechanism(s) of glycine uptake in the human placenta are unknown. In other mammalian cells glycine is a substrate for the A, ASC and Gly amino acid transport systems. In this study human placental glycine uptake was characterized using microvillous and basal plasma membrane vesicles each prepared from the same placenta. In both membranes glycine uptake was mediated predominantly by the sodium-dependent A system. Competitive inhibition studies suggest that in microvillous vesicles the small percentage of sodium-dependent glycine uptake not inhibited by methylaminoisobutyric acid (MeAIB) shares a transport system with glycine methyl ester and sarcosine, substrates of the Gly system in other tissues. In addition there are mediated sodium-independent and non-selective transport mechanisms in both plasma membranes. If fetal glycine availability is primarily contingent upon the common and highly regulated A system, glycine must compete with many other substrates potentially resulting in marginal fetal reserves, abnormal utilization and impaired growth.

  17. Transport of acidic amino acids by human jejunal brush-border membrane vesicles

    International Nuclear Information System (INIS)

    Rajendran, V.M.; Harig, J.M.; Adams, M.B.; Ramaswamy, K.


    This study characterizes the transport of radiolabeled acidic amino acids into brush-border membrane vesicles prepared from human jejunum. The uptakes of L-glutamic, L-aspartic, and D-aspartic acids were stimulated by a Na + gradient. Concentrative uptake (resulting in an overshoot phenomenon) of these dicarboxylic amino acids occurred when there was an outward K + gradient. In addition, increasing K + gradients resulted in enhanced uptake of L-glutamic acid. This K + requirement is somewhat specific as Rb + and Cs + could enhance uptake to a limited extent, whereas Li + and choline + showed no enhancement. The presence of a K + gradient did not affect the affinity of the carrier system for L-glutamic acid but it did increase the V/sub max/. The presence of extravesicular anions having differing membrane permeabilities did not altar L-glutamic acid uptake indicating an absence of an effect of membrane potential on the transport process. Finally, the human transport system for L-glutamic acid appears to be specific for acidic amino acids as demonstrated by inhibition studies. The studies demonstrate a transport system in human jejunum specific for acidic amino acids that is energized by an inward Na + gradient and an outward K + gradient

  18. Distinct human and mouse membrane trafficking systems for sweet taste receptors T1r2 and T1r3. (United States)

    Shimizu, Madoka; Goto, Masao; Kawai, Takayuki; Yamashita, Atsuko; Kusakabe, Yuko


    The sweet taste receptors T1r2 and T1r3 are included in the T1r taste receptor family that belongs to class C of the G protein-coupled receptors. Heterodimerization of T1r2 and T1r3 is required for the perception of sweet substances, but little is known about the mechanisms underlying this heterodimerization, including membrane trafficking. We developed tagged mouse T1r2 and T1r3, and human T1R2 and T1R3 and evaluated membrane trafficking in human embryonic kidney 293 (HEK293) cells. We found that human T1R3 surface expression was only observed when human T1R3 was coexpressed with human T1R2, whereas mouse T1r3 was expressed without mouse T1r2 expression. A domain-swapped chimera and truncated human T1R3 mutant showed that the Venus flytrap module and cysteine-rich domain (CRD) of human T1R3 contain a region related to the inhibition of human T1R3 membrane trafficking and coordinated regulation of human T1R3 membrane trafficking. We also found that the Venus flytrap module of both human T1R2 and T1R3 are needed for membrane trafficking, suggesting that the coexpression of human T1R2 and T1R3 is required for this event. These results suggest that the Venus flytrap module and CRD receive taste substances and play roles in membrane trafficking of human T1R2 and T1R3. These features are different from those of mouse receptors, indicating that human T1R2 and T1R3 are likely to have a novel membrane trafficking system.

  19. GLUT4 expression at the plasma membrane is related to fibre volume in human skeletal muscle fibres

    DEFF Research Database (Denmark)

    Gaster, M; Vach, W; Beck-Nielsen, H


    In this study we examined the relationship between GLUT4 expression at the plasma membrane and muscle fibre size in fibre-typed human muscle fibres by immunocytochemistry and morphometry in order to gain further insight into the regulation of GLUT4 expression. At the site of the plasma membrane...

  20. Evidence for the existence of multiple heparan sulfate proteoglycans in the human glomerular basement membrane and mesangial matrix

    NARCIS (Netherlands)

    Groffen, Alexander J A; Hop, Frank W H; Tryggvason, Karl; Dijkman, Henri; Assmann, Karel J M; Veerkamp, Jacques H.; Monnens, Leo A H; Van Den Heuvel, Lambert P W J


    Heparan sulfate proteoglycans (HSPGs) are essential components of the glomerular basement membrane (GBM) carrying a strong anionic charge. A well- characterized extracellular HSPG is perlecan, ubiquitously expressed in basement membranes. A cDNA construct encoding domains I and II of human perlecan

  1. Epidermal CYP2 family cytochromes P450

    International Nuclear Information System (INIS)

    Du Liping; Hoffman, Susan M.G.; Keeney, Diane S.


    Skin is the largest and most accessible drug-metabolizing organ. In mammals, it is the competent barrier that protects against exposure to harmful stimuli in the environment and in the systemic circulation. Skin expresses many cytochromes P450 that have critical roles in exogenous and endogenous substrate metabolism. Here, we review evidence for epidermal expression of genes from the large CYP2 gene family, many of which are expressed preferentially in extrahepatic tissues or specifically in epithelia at the environmental interface. At least 13 CYP2 genes (CYP2A6, 2A7, 2B6, 2C9, 2C18, 2C19, 2D6, 2E1, 2J2, 2R1, 2S1, 2U1, and 2W1) are expressed in skin from at least some human individuals, and the majority of these genes are expressed in epidermis or cultured keratinocytes. Where epidermal expression has been localized in situ by hybridization or immunocytochemistry, CYP2 transcripts and proteins are most often expressed in differentiated keratinocytes comprising the outer (suprabasal) cell layers of the epidermis and skin appendages. The tissue-specific transcriptional regulation of CYP2 genes in the epidermis, and in other epithelia that interface with the environment, suggests important roles for at least some CYP2 gene products in the production and disposition of molecules affecting competency of the epidermal barrier

  2. Adjuvant Lapatinib and Trastuzumab for Early Human Epidermal Growth Factor Receptor 2–Positive Breast Cancer: Results From the Randomized Phase III Adjuvant Lapatinib and/or Trastuzumab Treatment Optimization Trial (United States)

    Holmes, Eileen; Baselga, José; de Azambuja, Evandro; Dueck, Amylou C.; Viale, Giuseppe; Zujewski, Jo Anne; Goldhirsch, Aron; Armour, Alison; Pritchard, Kathleen I.; McCullough, Ann E.; Dolci, Stella; McFadden, Eleanor; Holmes, Andrew P.; Tonghua, Liu; Eidtmann, Holger; Dinh, Phuong; Di Cosimo, Serena; Harbeck, Nadia; Tjulandin, Sergei; Im, Young-Hyuck; Huang, Chiun-Sheng; Diéras, Véronique; Hillman, David W.; Wolff, Antonio C.; Jackisch, Christian; Lang, Istvan; Untch, Michael; Smith, Ian; Boyle, Frances; Xu, Binghe; Gomez, Henry; Suter, Thomas; Gelber, Richard D.; Perez, Edith A.


    Background Lapatinib (L) plus trastuzumab (T) improves outcomes for metastatic human epidermal growth factor 2–positive breast cancer and increases the pathologic complete response in the neoadjuvant setting, but their role as adjuvant therapy remains uncertain. Methods In the Adjuvant Lapatinib and/or Trastuzumab Treatment Optimization trial, patients with centrally confirmed human epidermal growth factor 2–positive early breast cancer were randomly assigned to 1 year of adjuvant therapy with T, L, their sequence (T→L), or their combination (L+T). The primary end point was disease-free survival (DFS), with 850 events required for 80% power to detect a hazard ratio (HR) of 0.8 for L+T versus T. Results Between June 2007 and July 2011, 8,381 patients were enrolled. In 2011, due to futility to demonstrate noninferiority of L versus T, the L arm was closed, and patients free of disease were offered adjuvant T. A protocol modification required P ≤ .025 for the two remaining pairwise comparisons. At a protocol-specified analysis with a median follow-up of 4.5 years, a 16% reduction in the DFS hazard rate was observed with L+T compared with T (555 DFS events; HR, 0.84; 97.5% CI, 0.70 to 1.02; P = .048), and a 4% reduction was observed with T→L compared with T (HR, 0.96; 97.5% CI, 0.80 to 1.15; P = .61). L-treated patients experienced more diarrhea, cutaneous rash, and hepatic toxicity compared with T-treated patients. The incidence of cardiac toxicity was low in all treatment arms. Conclusion Adjuvant treatment that includes L did not significantly improve DFS compared with T alone and added toxicity. One year of adjuvant T remains standard of care. PMID:26598744

  3. Adjuvant Lapatinib and Trastuzumab for Early Human Epidermal Growth Factor Receptor 2-Positive Breast Cancer: Results From the Randomized Phase III Adjuvant Lapatinib and/or Trastuzumab Treatment Optimization Trial. (United States)

    Piccart-Gebhart, Martine; Holmes, Eileen; Baselga, José; de Azambuja, Evandro; Dueck, Amylou C; Viale, Giuseppe; Zujewski, Jo Anne; Goldhirsch, Aron; Armour, Alison; Pritchard, Kathleen I; McCullough, Ann E; Dolci, Stella; McFadden, Eleanor; Holmes, Andrew P; Tonghua, Liu; Eidtmann, Holger; Dinh, Phuong; Di Cosimo, Serena; Harbeck, Nadia; Tjulandin, Sergei; Im, Young-Hyuck; Huang, Chiun-Sheng; Diéras, Véronique; Hillman, David W; Wolff, Antonio C; Jackisch, Christian; Lang, Istvan; Untch, Michael; Smith, Ian; Boyle, Frances; Xu, Binghe; Gomez, Henry; Suter, Thomas; Gelber, Richard D; Perez, Edith A


    Lapatinib (L) plus trastuzumab (T) improves outcomes for metastatic human epidermal growth factor 2-positive breast cancer and increases the pathologic complete response in the neoadjuvant setting, but their role as adjuvant therapy remains uncertain. In the Adjuvant Lapatinib and/or Trastuzumab Treatment Optimization trial, patients with centrally confirmed human epidermal growth factor 2-positive early breast cancer were randomly assigned to 1 year of adjuvant therapy with T, L, their sequence (T→L), or their combination (L+T). The primary end point was disease-free survival (DFS), with 850 events required for 80% power to detect a hazard ratio (HR) of 0.8 for L+T versus T. Between June 2007 and July 2011, 8,381 patients were enrolled. In 2011, due to futility to demonstrate noninferiority of L versus T, the L arm was closed, and patients free of disease were offered adjuvant T. A protocol modification required P ≤ .025 for the two remaining pairwise comparisons. At a protocol-specified analysis with a median follow-up of 4.5 years, a 16% reduction in the DFS hazard rate was observed with L+T compared with T (555 DFS events; HR, 0.84; 97.5% CI, 0.70 to 1.02; P = .048), and a 4% reduction was observed with T→L compared with T (HR, 0.96; 97.5% CI, 0.80 to 1.15; P = .61). L-treated patients experienced more diarrhea, cutaneous rash, and hepatic toxicity compared with T-treated patients. The incidence of cardiac toxicity was low in all treatment arms. Adjuvant treatment that includes L did not significantly improve DFS compared with T alone and added toxicity. One year of adjuvant T remains standard of care. © 2015 by American Society of Clinical Oncology.

  4. Toxic epidermal necrolysis. (United States)

    Pereira, Frederick A; Mudgil, Adarsh Vijay; Rosmarin, David M


    Toxic epidermal necrolysis (TEN) is an unpredictable, life-threatening drug reaction associated with a 30% mortality. Massive keratinocyte apoptosis is the hallmark of TEN. Cytotoxic T lymphocytes appear to be the main effector cells and there is experimental evidence for involvement of both the Fas-Fas ligand and perforin/granzyme pathways. Optimal treatment for these patients remains to be clarified. Discontinuation of the offending drug and prompt referral to a burn unit are generally agreed upon steps. Beyond that, however, considerable controversy exists. Evidence both pro and con exists for the use of IVIG, systemic corticosteroid, and other measures. There is also evidence suggesting that combination therapies may be of value. All the clinical data, however, is anecdotal or based on observational or retrospective studies. Definitive answers are not yet available. Given the rarity of TEN and the large number of patients required for a study to be statistically meaningful, placebo controlled trials are logistically difficult to accomplish. The absence of an animal model further hampers research into this condition. This article reviews recent data concerning clinical presentation, pathogenesis and treatment of TEN. At the conclusion of this learning activity, participants should have acquired a more comprehensive knowledge of our current understanding of the classification, clinical presentation, etiology, pathophysiology, prognosis, and treatment of TEN.

  5. Tight junction regulates epidermal calcium ion gradient and differentiation

    International Nuclear Information System (INIS)

    Kurasawa, Masumi; Maeda, Tetsuo; Oba, Ai; Yamamoto, Takuya; Sasaki, Hiroyuki


    Research highlights: → We disrupted epidermal tight junction barrier in reconstructed epidermis. → It altered Ca 2+ distribution and consequentially differentiation state as well. → Tight junction should affect epidermal homeostasis by maintaining Ca 2+ gradient. -- Abstract: It is well known that calcium ions (Ca 2+ ) induce keratinocyte differentiation. Ca 2+ distributes to form a vertical gradient that peaks at the stratum granulosum. It is thought that the stratum corneum (SC) forms the Ca 2+ gradient since it is considered the only permeability barrier in the skin. However, the epidermal tight junction (TJ) in the granulosum has recently been suggested to restrict molecular movement to assist the SC as a secondary barrier. The objective of this study was to clarify the contribution of the TJ to Ca 2+ gradient and epidermal differentiation in reconstructed human epidermis. When the epidermal TJ barrier was disrupted by sodium caprate treatment, Ca 2+ flux increased and the gradient changed in ion-capture cytochemistry images. Alterations of ultrastructures and proliferation/differentiation markers revealed that both hyperproliferation and precocious differentiation occurred regionally in the epidermis. These results suggest that the TJ plays a crucial role in maintaining epidermal homeostasis by controlling the Ca 2+ gradient.

  6. Adenovirus E4-ORF1 Dysregulates Epidermal Growth Factor and Insulin/Insulin-Like Growth Factor Receptors To Mediate Constitutive Myc Expression


    Kong, Kathleen; Kumar, Manish; Taruishi, Midori; Javier, Ronald T.


    The E4-ORF1 protein encoded by human adenovirus stimulates viral replication in human epithelial cells by binding and activating cellular phosphatidylinositol 3-kinase (PI3K) at the plasma membrane and cellular Myc in the nucleus. In this study, we showed that E4-ORF1 hijacks the tyrosine kinase activities of cellular epidermal growth factor receptor (EGFR) and insulin receptor (InsR)/insulin-like growth factor receptor 1 (IGF1R), as well as the lipid kinase activity of PI3K, to mediate const...

  7. Yeast-expressed human membrane protein aquaporin-1 yields excellent resolution of solid-state MAS NMR spectra

    International Nuclear Information System (INIS)

    Emami, Sanaz; Fan Ying; Munro, Rachel; Ladizhansky, Vladimir; Brown, Leonid S.


    One of the biggest challenges in solid-state NMR studies of membrane proteins is to obtain a homogeneous natively folded sample giving high spectral resolution sufficient for structural studies. Eukaryotic membrane proteins are especially difficult and expensive targets in this respect. Methylotrophic yeast Pichia pastoris is a reliable producer of eukaryotic membrane proteins for crystallography and a promising economical source of isotopically labeled proteins for NMR. We show that eukaryotic membrane protein human aquaporin 1 can be doubly ( 13 C/ 15 N) isotopically labeled in this system and functionally reconstituted into phospholipids, giving excellent resolution of solid-state magic angle spinning NMR spectra.

  8. Characterization of membrane lipid fluidity in human embryo cells malignantly transfer med post 238Pu α irradiation

    International Nuclear Information System (INIS)

    Qi Zirong; Sun Ling; Liu Guolian; Shen Zhiyuan


    The membrane lipid fluidity of malignantly transformed human embryo cells following 238 Pu α particlce irradiation in vitro has been studied. The results indicate that the ontogenesis depends on irradiation dose (Gy) and the membrane lipid fluidity in malignantly transformed cells is higher than that in normal embryo cells. With the microviscosity (η) of cells plotted against the cell counts, the correlation coefficient (γ) is calculated to be between 0.9936 and 0.9999. Since the malignant transformation of irradiated embryo cells is manifested early on cell membrane lipid, the fluidity of membrane lipid can be used as an oncologic marker

  9. MHC Class II and CD9 in Human Eosinophils Localize to Detergent-Resistant Membrane Microdomains (United States)

    Akuthota, Praveen; Melo, Rossana C. N.; Spencer, Lisa A.


    Eosinophils function in murine allergic airways inflammation as professional antigen-presenting cells (APCs). In murine professional APC cell types, optimal functioning of MHC Class II depends on its lateral association in plasma membranes and colocalization with the tetraspanin CD9 into detergent-resistant membrane microdomains (DRMs). With human eosinophils, we evaluated the localization of MHC Class II (HLA-DR) to DRMs and the functional significance of such localization. In granulocyte-macrophage colony-stimulating factor–stimulated human eosinophils, antibody cross-linked HLA-DR colocalized by immunofluorescence microscopy focally on plasma membranes with CD9 and the DRM marker ganglioside GM1. In addition, HLA-DR coimmunoprecipitates with CD9 after chemical cross-linking of CD9. HLA-DR and CD9 were localized by Western blotting in eosinophil DRM subcellular fractions. DRM disruption with the cholesterol-depleting agent methyl-β-cyclodextrin decreased eosinophil surface expression of HLA-DR and CD9. We show that CD9 is abundant on the surface of eosinophils, presenting the first electron microscopy data of the ultrastructural immunolocalization of CD9 in human eosinophils. Disruption of HLA-DR–containing DRMs decreased the ability of superantigen-loaded human eosinophils to stimulate CD4+ T-cell activation (CD69 expression), proliferation, and cytokine production. Our results, which demonstrate that eosinophil MHC Class II localizes to DRMs in association with CD9 in a functionally significant manner, represent a novel insight into the organization of the antigen presentation complex of human eosinophils. PMID:21885678

  10. MHC Class II and CD9 in human eosinophils localize to detergent-resistant membrane microdomains. (United States)

    Akuthota, Praveen; Melo, Rossana C N; Spencer, Lisa A; Weller, Peter F


    Eosinophils function in murine allergic airways inflammation as professional antigen-presenting cells (APCs). In murine professional APC cell types, optimal functioning of MHC Class II depends on its lateral association in plasma membranes and colocalization with the tetraspanin CD9 into detergent-resistant membrane microdomains (DRMs). With human eosinophils, we evaluated the localization of MHC Class II (HLA-DR) to DRMs and the functional significance of such localization. In granulocyte-macrophage colony-stimulating factor-stimulated human eosinophils, antibody cross-linked HLA-DR colocalized by immunofluorescence microscopy focally on plasma membranes with CD9 and the DRM marker ganglioside GM1. In addition, HLA-DR coimmunoprecipitates with CD9 after chemical cross-linking of CD9. HLA-DR and CD9 were localized by Western blotting in eosinophil DRM subcellular fractions. DRM disruption with the cholesterol-depleting agent methyl-β-cyclodextrin decreased eosinophil surface expression of HLA-DR and CD9. We show that CD9 is abundant on the surface of eosinophils, presenting the first electron microscopy data of the ultrastructural immunolocalization of CD9 in human eosinophils. Disruption of HLA-DR-containing DRMs decreased the ability of superantigen-loaded human eosinophils to stimulate CD4(+) T-cell activation (CD69 expression), proliferation, and cytokine production. Our results, which demonstrate that eosinophil MHC Class II localizes to DRMs in association with CD9 in a functionally significant manner, represent a novel insight into the organization of the antigen presentation complex of human eosinophils.

  11. Maculoplasty for age-related macular degeneration: reengineering Bruch's membrane and the human macula. (United States)

    Del Priore, Lucian V; Tezel, Tongalp H; Kaplan, Henry J


    Age-related macular degeneration (AMD) is the leading cause of blindness in the western world. Over the last decade, there have been significant advances in the management of exudative AMD with the introduction of anti-VEGF drugs; however, many patients with exudative AMD continue to lose vision and there are no effective treatments for advanced exudative AMD or geographic atrophy. Initial attempts at macular reconstruction using cellular transplantation have not been effective in reversing vision loss. Herein we discuss the current status of surgical attempts to reconstruct damaged subretinal anatomy in advanced AMD. We reinforce the concept of maculoplasty for advanced AMD, which is defined as reconstruction of macular anatomy in patients with advanced vision loss. Successful maculoplasty is a three-step process that includes replacing or repairing damaged cells (using transplantation, translocation or stimulation of autologous cell proliferation); immune suppression (if allografts are used to replace damaged cells); and reconstruction or replacement of Bruch's membrane (to restore the integrity of the substrate for proper cell attachment). In the current article we will review the rationale for maculoplasty in advanced AMD, and discuss the results of initial clinical attempts at macular reconstruction. We will then discuss the role of Bruch's membrane damage in limiting transplant survival and visual recovery, and discuss the effects of age-related changes within human Bruch's membrane on the initial attachment and subsequent proliferation of transplanted cells. We will discuss attempts to repair Bruch's membrane by coating with extracellular matrix ligands, anatomic reconstitution of the inner collagen layer, and the effects of Bruch's membrane reconstruction of ultrastuctural anatomy and subsequent cell behavior. Lastly, we will emphasize the importance of continued efforts required for successful maculoplasty.

  12. Quantitative membrane proteomics reveals a role for tetraspanin enriched microdomains during entry of human cytomegalovirus.

    Directory of Open Access Journals (Sweden)

    Kasinath Viswanathan

    Full Text Available Human cytomegalovirus (HCMV depends on and modulates multiple host cell membrane proteins during each stage of the viral life cycle. To gain a global view of the impact of HCMV-infection on membrane proteins, we analyzed HCMV-induced changes in the abundance of membrane proteins in fibroblasts using stable isotope labeling with amino acids (SILAC, membrane fractionation and protein identification by two-dimensional liquid chromatography and tandem mass spectrometry. This systematic approach revealed that CD81, CD44, CD98, caveolin-1 and catenin delta-1 were down-regulated during infection whereas GRP-78 was up-regulated. Since CD81 downregulation was also observed during infection with UV-inactivated virus we hypothesized that this tetraspanin is part of the viral entry process. Interestingly, additional members of the tetraspanin family, CD9 and CD151, were also downregulated during HCMV-entry. Since tetraspanin-enriched microdomains (TEM cluster host cell membrane proteins including known CMV receptors such as integrins, we studied whether TEMs are required for viral entry. When TEMs were disrupted with the cholesterol chelator methyl-β-cylcodextrin, viral entry was inhibited and this inhibition correlated with reduced surface levels of CD81, CD9 and CD151, whereas integrin levels remained unchanged. Furthermore, simultaneous siRNA-mediated knockdown of multiple tetraspanins inhibited viral entry whereas individual knockdown had little effect suggesting essential, but redundant roles for individual tetraspanins during entry. Taken together, our data suggest that TEM act as platforms for receptors utilized by HCMV for entry into cells.

  13. Integrated forward osmosis-membrane distillation process for human urine treatment. (United States)

    Liu, Qianliang; Liu, Caihong; Zhao, Lei; Ma, Weichao; Liu, Huiling; Ma, Jun


    This study demonstrated a forward osmosis-membrane distillation (FO-MD) hybrid system for real human urine treatment. A series of NaCl solutions at different concentrations were adopted for draw solutions in FO process, which were also the feed solutions of MD process. To establish a stable and continuous integrated FO-MD system, individual FO process with different NaCl concentrations and individual direct contact membrane distillation (DCMD) process with different feed temperatures were firstly investigated separately. Four stable equilibrium conditions were obtained from matching the water transfer rates of individual FO and MD processes. It was found that the integrated system is stable and sustainable when the water transfer rate of FO subsystem is equal to that of MD subsystem. The rejections to main contaminants in human urine were also investigated. Although individual FO process had relatively high rejection to Total Organic Carbon (TOC), Total Nitrogen (TN) and Ammonium Nitrogen (NH4(+)-N) in human urine, these contaminants could also accumulate in draw solution after long term performance. The MD process provided an effective rejection to contaminants in draw solution after FO process and the integrated system revealed nearly complete rejection to TOC, TN and NH4(+)-N. This work provided a potential treatment process for human urine in some fields such as water regeneration in space station and water or nutrient recovery from source-separated urine. Copyright © 2016 Elsevier Ltd. All rights reserved.

  14. Near Infrared Optical Visualization of Epidermal Growth Factor Receptors Levels in COLO205 Colorectal Cell Line, Orthotopic Tumor in Mice and Human Biopsies

    Directory of Open Access Journals (Sweden)

    Philip Lazarovici


    Full Text Available In this study, we present the applicability of imaging epidermal growth factor (EGF receptor levels in preclinical models of COLO205 carcinoma cells in vitro, mice with orthotopic tumors and ex vivo colorectal tumor biopsies, using EGF-labeled with IRDye800CW (EGF-NIR. The near infrared (NIR bio-imaging of COLO205 cultures indicated specific and selective binding, reflecting EGF receptors levels. In vivo imaging of tumors in mice showed that the highest signal/background ratio between tumor and adjacent tissue was achieved 48 hours post-injection. Dissected colorectal cancer tissues from different patients demonstrated ex vivo specific imaging using the NIR bio-imaging platform of the heterogeneous distributed EGF receptors. Moreover, in the adjacent gastrointestinal tissue of the same patients, which by Western blotting was demonstrated as EGF receptor negative, no labeling with EGF-NIR probe was detected. Present results support the concept of tumor imaging by measuring EGF receptor levels using EGF-NIR probe. This platform is advantageous for EGF receptor bio-imaging of the NCI-60 recommended panel of tumor cell lines including 6–9 colorectal cell lines, since it avoids radioactive probes and is appropriate for use in the clinical setting using NIR technologies in a real-time manner.

  15. Resveratrol modulates MED28 (Magicin/EG-1) expression and inhibits epidermal growth factor (EGF)-induced migration in MDA-MB-231 human breast cancer cells. (United States)

    Lee, Ming-Fen; Pan, Min-Hsiung; Chiou, Yi-Siou; Cheng, An-Chin; Huang, Han


    Resveratrol and pterostilbene exhibit diverse biological activities. MED28, a subunit of the mammalian Mediator complex for transcription, was also identified as magicin, an actin cytoskeleton Grb2-associated protein, and as endothelial-derived gene (EG-1). Several tumors exhibit aberrant MED28 expression, whereas the underlying mechanism is unclear. Triple-negative breast cancers, often expressing epidermal growth factor (EGF) receptor (EGFR), are associated with metastasis and poor survival. The objective of this study is to compare the effect of resveratrol and pterostilbene and to investigate the role of MED28 in EGFR-overexpressing MDA-MB-231 breast cancer cells. Pretreatment of resveratrol, but not pterostlbene, suppressed EGF-mediated migration and expression of MED28 and matrix metalloproteinase (MMP)-9 in MDA-MB-231 cells. Moreover, overexpression of MED28 increased migration, and the addition of EGF further enhanced migration. Our data indicate that resveratrol modulates the effect of MED28 on cellular migration, presumably through the EGFR/phosphatidylinositol 3-kinase (PI3K) signaling pathway, in breast cancer cells.

  16. Ultraviolet radiation induces changes in membrane metabolism of human keratinocytes in culture

    International Nuclear Information System (INIS)

    De Leo, V.A.; Horlick, H.; Hanson, D.; Eisinger, M.; Harber, L.C.


    Human keratinocytes in culture were prelabeled with [ 3 H]arachidonic acid (AA) and then exposed to ultraviolet B radiation. Irradiated cells released labeled AA metabolites into media in a dose-dependent manner when compared to sham-irradiated cells. The response began immediately and continued for 24 h. Extracts from media were examined by high-performance liquid chromatography for identification of specific AA metabolites. Irradiated cells were stimulated to produce prostaglandin-like material (PGE2 and PGF2 alpha). These findings support the concept that the cell membrane of keratinocytes participates directly or indirectly in initiating the sunburn response. It is also felt that the metabolites formed following injury to the membrane are an integral component in the mediation of that response

  17. Immunochemical and ultrastructural assessment of the nature of the pericellular basement membrane of human decidual cells

    DEFF Research Database (Denmark)

    Wewer, U M; Faber, M; Liotta, L A


    Human decidual cells of early and late pregnancy were studied immunochemically and ultrastructurally with respect to the presence and nature of pericellular basement membrane material. The most prominent cell type in decidual tissue of both early and late pregnancy were large, mature epithelioid......-linked immunosorbent assay. Biosynthesis of laminin was shown by [35S]methionine labeling of short term organ cultures of decidual tissue followed by immunoprecipation, sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and fluorography. The laminin chains migrated with the apparent molecular weights of 300...... and 200 kilodaltons under reducing conditions. Two other separate populations of cells were apparent in the decidual tissue of early pregnancy. A smaller group of rounded intermediate sized (15 to 25 micron) decidual cells had focal deposits basement membrane immunoreactive material scattered at the cell...

  18. Potential antitumor therapeutic strategies of human amniotic membrane and amniotic fluid-derived stem cells. (United States)

    Kang, N-H; Hwang, K-A; Kim, S U; Kim, Y-B; Hyun, S-H; Jeung, E-B; Choi, K-C


    As stem cells are capable of self-renewal and can generate differentiated progenies for organ development, they are considered as potential source for regenerative medicine and tissue replacement after injury or disease. Along with this capacity, stem cells have the therapeutic potential for treating human diseases including cancers. According to the origins, stem cells are broadly classified into two types: embryonic stem cells (ESCs) and adult stem cells. In terms of differentiation potential, ESCs are pluripotent and adult stem cells are multipotent. Amnion, which is a membranous sac that contains the fetus and amniotic fluid and functions in protecting the developing embryo during gestation, is another stem cell source. Amnion-derived stem cells are classified as human amniotic membrane-derived epithelial stem cells, human amniotic membrane-derived mesenchymal stem cells and human amniotic fluid-derived stem cells. They are in an intermediate stage between pluripotent ESCs and lineage-restricted adult stem cells, non-tumorigenic, and contribute to low immunogenicity and anti-inflammation. Furthermore, they are easily available and do not cause any controversial issues in their recovery and applications. Not only are amnion-derived stem cells applicable in regenerative medicine, they have anticancer capacity. In non-engineered stem cells transplantation strategies, amnion-derived stem cells effectively target the tumor and suppressed the tumor growth by expressing cytotoxic cytokines. Additionally, they also have a potential as novel delivery vehicles transferring therapeutic genes to the cancer formation sites in gene-directed enzyme/prodrug combination therapy. Owing to their own advantageous properties, amnion-derived stem cells are emerging as a new candidate in anticancer therapy.

  19. Human catechol-O-methyltransferase: Cloning and expression of the membrane-associated form

    International Nuclear Information System (INIS)

    Bertocci, B.; Miggiano, V.; Da Prada, M.; Dembic, Z.; Lahm, H.W.; Malherbe, P.


    A cDNA clone for human catechol-O-methyltransferase was isolated from a human hepatoma cell line (Hep G2) cDNA library by hybridization screening with a porcine cDNA probe. The cDNA clone was sequenced and found to have an insert of 1226 nucleotides. The deduced primary structure of hCOMT is composed of 271 amino acid residues with the predicted molecular mass of 30 kDa. At its N terminus it has a hydrophobic segment of 21 amino acid residues that may be responsible for insertion of hCOMT into the endoplasmic reticulum membrane. The primary structure of hCOMT exhibits high homology to the porcine partial cDNA sequence (93%). The deduced amino acid sequence contains two tryptic peptide sequences (T-22, T-33) found in porcine liver catechol-O-methyltransferase (CEMT). The coding region of hCOMT cDNA was placed under the control of the cytomegalovirus promoter to transfect human kidney 293 cells. The recombinant hCOMT was shown by immunoblot analysis to be mainly associated with the membrane fraction. RNA blot analysis revealed one COMT mRNA transcript of 1.4 kilobases in Hep G2 poly(A) + RNA

  20. Recombinant production of human Aquaporin-1 to an exceptional high membrane density in Saccharomyces cerevisiae.

    Directory of Open Access Journals (Sweden)

    Julie Bomholt

    Full Text Available In the present paper we explored the capacity of yeast Saccharomyces cerevisiae as host for heterologous expression of human Aquaporin-1. Aquaporin-1 cDNA was expressed from a galactose inducible promoter situated on a plasmid with an adjustable copy number. Human Aquaporin-1 was C-terminally tagged with yeast enhanced GFP for quantification of functional expression, determination of sub-cellular localization, estimation of in vivo folding efficiency and establishment of a purification protocol. Aquaporin-1 was found to constitute 8.5 percent of total membrane protein content after expression at 15°C in a yeast host over-producing the Gal4p transcriptional activator and growth in amino acid supplemented minimal medium. In-gel fluorescence combined with western blotting showed that low accumulation of correctly folded recombinant Aquaporin-1 at 30°C was due to in vivo mal-folding. Reduction of the expression temperature to 15°C almost completely prevented Aquaporin-1 mal-folding. Bioimaging of live yeast cells revealed that recombinant Aquaporin-1 accumulated in the yeast plasma membrane. A detergent screen for solubilization revealed that CYMAL-5 was superior in solubilizing recombinant Aquaporin-1 and generated a monodisperse protein preparation. A single Ni-affinity chromatography step was used to obtain almost pure Aquaporin-1. Recombinant Aquaporin-1 produced in S. cerevisiae was not N-glycosylated in contrast to the protein found in human erythrocytes.

  1. Increased oxidative stress in human fetal membranes overlying the cervix from term non-labouring and post labour deliveries. (United States)

    Chai, M; Barker, G; Menon, R; Lappas, M


    Enzymatic breakdown of the collagen-rich extracellular matrix (ECM) that connects the amnion and chorion layers of the fetal membranes is one of the key events leading to rupture of membranes. Oxidant stress caused by increased formation of reactive oxygen species and/or reduced antioxidant capacity may predispose to membrane rupture, a major cause of preterm birth. The aim of this study was to determine the effect of human labour and supracervical (SC) apposition on antioxidant enzymes and 8-isoprostane (a marker of lipid peroxidation). To determine the effect of human labour on oxidative stress status, fetal membranes from the SC site (SCS) were collected from women at term Caesarean section (no labour), and from the site of membrane rupture (SOR) after spontaneous labour onset and delivery (post labour). To determine the effect of SC apposition on oxidative stress status, amnion was collected from the SCS and a distal site (DS) in women at term Caesarean section in the absence of labour. The release of 8-isoprostane was significantly higher in amnion from the SCS compared to DS, and in fetal membranes from the SOR compared to the SCS. Glutathione peroxidase (GPx) and superoxide dismutase (SOD) activity were lower in amnion from the SC compared to DS. SOD gene expression and enzyme activity were lower in fetal membranes after labour. There was no difference in expression or activity in catalase, GPx and glutathione reductase (GSR) between no labour and post labour fetal membranes. In primary amnion cells, SOD supplementation significantly augmented IL-1β induced MMP-9 expression and activity. In summary, non-labouring SC fetal membranes are characterised by reduced antioxidant enzyme activity when compared to distal membranes, and, as such, may be more susceptible to oxidative damage and thus membrane rupture. Copyright © 2012 Elsevier Ltd. All rights reserved.

  2. Isolation of a human anti-epidermal growth factor receptor Fab antibody, EG-19-11, with subnanomolar affinity from naïve immunoglobulin repertoires using a hierarchical antibody library system. (United States)

    Hur, Byung-ung; Yoon, Jae-bong; Liu, Li-Kun; Cha, Sang-hoon


    Specific antibodies that possess a subnanomolar affinity are very difficult to obtain from human naïve immunoglobulin repertoires without the use of lengthy affinity optimization procedures. Here, we designed a hierarchical phage-displayed antibody library system to generate an enormous diversity of combinatorial Fab fragments (6×10(17)) and attempted to isolate high-affinity Fabs against the human epidermal growth factor receptor (EGFR). A primary antibody library, designated HuDVFab-8L, comprising 4.5×10(9) human naïve heavy chains and eight unspecified human naïve light chains was selected against the EGFR-Fc protein by biopanning, and four anti-EGFR Fab clones were isolated. Because one of the Fab clones, denoted EG-L2-11, recognized a native EGFR expressed on A431 cells, the heavy chain of the Fab was shuffled with a human naïve light chain repertoire with a diversity of 1.4×10(8) and selected a second time against the EGFR-Fc protein again. One EG-L2-11 variant, denoted EG-19-11, recognized an EGFR epitope that was almost the same as that bound by cetuximab and had a K(D) of approximately 540 pM for soluble EGFR, which is about 7-fold higher than that of the FabC225 derived from cetuximab. This variant was also internalized by A431 cells, likely via receptor-mediated endocytosis, and it efficiently inhibited EGF-mediated tyrosine phosphorylation of the EGFR. These results demonstrate that the use of our hierarchical antibody library system is advantageous in generating fully human antibodies especially with a therapeutic purpose. Copyright © 2010 Elsevier B.V. All rights reserved.

  3. Time Average Holography Study of Human Tympanic Membrane with Altered Middle Ear Ossicular Chain (United States)

    Cheng, Jeffrey T.; Ravicz, Michael E.; Rosowski, John J.; Hulli, Nesim; Hernandez-Montes, Maria S.; Furlong, Cosme


    Computer-assisted time average holographic interferometry was used to study the vibration of the human tympanic membrane (TM) in cadaveric temporal bones before and after alterations of the ossicular chain. Simultaneous laser Doppler vibrometer measurements of stapes velocity were performed to estimate the conductive hearing loss caused by ossicular alterations. The quantified TM motion described from holographic images was correlated with stapes velocity to define relations between TM motion and stapes velocity in various ossicular disorders. The results suggest that motions of the TM are relatively uncoupled from stapes motion at frequencies above 1000 Hz.

  4. Plasma membrane proteomics of human embryonic stem cells and human embryonal carcinoma cells.

    NARCIS (Netherlands)

    Dormeyer, W.; van Hoof, D.; Braam, S.R.; Heck, A.J.R.; Mummery, C.L.; Krijgsveld, J.


    Human embryonic stem cells (hESCs) are of immense interest in regenerative medicine as they can self-renew indefinitely and can give rise to any adult cell type. Human embryonal carcinoma cells (hECCs) are the malignant counterparts of hESCs found in testis tumors. hESCs that have acquired

  5. The hemostatic agent ethamsylate enhances P-selectin membrane expression in human platelets and cultured endothelial cells. (United States)

    Alvarez-Guerra, Miriam; Hernandez, Maria Rosa; Escolar, Ginés; Chiavaroli, Carlo; Garay, Ricardo P; Hannaert, Patrick


    Ethamsylate possesses antihemorrhagic properties, but whether or not it directly activates blood platelets is unclear. Here we investigated the platelet activation potential of ethamsylate, by measuring membrane P-selectin expression with flow cytometry in human whole blood and also by immunofluorescence imaging of isolated human platelets. Moreover, we measured membrane P-selectin expression in the SV40-transformed aortic rat endothelial cell line (SVAREC) and 14C-ethamsylate membrane binding and/or uptake in platelets and endothelial cells. Whole blood flow cytometry showed a modest, but statistically significant increase by ethamsylate in the percentage of platelets expressing P-selectin (from 2% to 4-5%, p ethamsylate tested (1 microM), with maximal enhancement of P-selectin expression (75-90%) at 10 microM ethamsylate. Similar results were obtained in SVAREC endothelial cells. 14C-ethamsylate specifically bound to platelets and endothelial cell membranes, without significant uptake into the cell interior. In conclusion, ethamsylate enhances membrane P-selectin expression in human platelets and in cultured endothelial cells. Ethamsylate specifically binds to some protein receptor in platelet and endothelial cell membranes, receptor which can signal for membrane P-selectin expression. These results support the view that ethamsylate acts on the first step of hemostasis, by improving platelet adhesiveness and restoring capillary resistance. Copyright 2002 Elsevier Science Ltd.

  6. Removal properties of human enteric viruses in a pilot-scale membrane bioreactor (MBR) process. (United States)

    Miura, Takayuki; Okabe, Satoshi; Nakahara, Yoshihito; Sano, Daisuke


    In order to evaluate removal properties of human enteric viruses from wastewater by a membrane bioreactor (MBR), influent, anoxic and oxic mixed liquor, and membrane effluent samples were collected in a pilot-scale anoxic-oxic MBR process for 16 months, and concentrations of enteroviruses, norovirus GII, and sapoviruses were determined by real-time PCR using murine norovirus as a process control. Mixed liquor samples were separated into liquid and solid phases by centrifugation, and viruses in the bulk solution and those associated with mixed liquor suspended solids (MLSS) were quantified. Enteroviruses, norovirus GII, and sapoviruses were detected in the influent throughout the sampling period (geometrical mean, 4.0, 3.1, and 4.4 log copies/mL, respectively). Enterovirus concentrations in the solid phase of mixed liquor were generally lower than those in the liquid phase, and the mean log reduction value between influent and anoxic mixed liquor was 0.40 log units. In contrast, norovirus GII and sapovirus concentrations in the solid phase were equal to or higher than those in the liquid phase, and higher log reduction values (1.3 and 1.1 log units, respectively) were observed between influent and anoxic mixed liquor. This suggested that enteroviruses were less associated with MLSS than norovirus GII and sapoviruses, resulting in lower enterovirus removal in the activated sludge process. Enteroviruses and norovirus GII were detected in the MBR effluent but sapoviruses were not in any effluent samples. When MLSS concentration was reduced to 50-60% of a normal operation level, passages of enteroviruses and norovirus GII through a PVDF microfiltration membrane were observed. Since rejection of viruses by the membrane was not related to trans-membrane pressure which was monitored as a parameter of membrane fouling, the results indicated that adsorption to MLSS plays an important role in virus removal by an MBR, and removal properties vary by viruses reflecting different

  7. In an in-vitro model using human fetal membranes, 17-α hydroxyprogesterone caproate is not an optimal progestogen for inhibition of fetal membrane weakening. (United States)

    Kumar, Deepak; Moore, Robert M; Mercer, Brian M; Mansour, Joseph M; Mesiano, Sam; Schatz, Frederick; Lockwood, Charles J; Moore, John J


    The progestogen 17-α hydroxyprogesterone caproate (17-OHPC) is 1 of only 2 agents recommended for clinical use in the prevention of spontaneous preterm delivery, and studies of its efficacy have been conflicting. We have developed an in-vitro model to study the fetal membrane weakening process that leads to rupture in preterm premature rupture of the fetal membranes (pPROM). Inflammation/infection associated with tumor necrosis factor-α (TNF-α) induction and decidual bleeding/abruption associated thrombin release are leading causes of preterm premature rupture of the fetal membranes. Both agents (TNF-α and thrombin) cause fetal membrane weakening in the model system. Furthermore, granulocyte-macrophage colony-stimulating factor (GM-CSF) is a critical intermediate for both TNF-α and thrombin-induced fetal membrane weakening. In a previous report, we demonstrated that 3 progestogens, progesterone, 17-alpha hydroxyprogesterone (17-OHP), and medroxyprogesterone acetate (MPA), each inhibit both TNF-α- and thrombin-induced fetal membrane weakening at 2 distinct points of the fetal membrane weakening pathway. Each block both the production of and the downstream action of the critical intermediate granulocyte-macrophage colony-stimulating factor. The objective of the study was to characterize the inhibitory effects of 17-OHPC on TNF-α- and thrombin-induced fetal membrane weakening in vitro. Full-thickness human fetal membrane fragments from uncomplicated term repeat cesarean deliveries were mounted in 2.5 cm Transwell inserts and cultured with/without 17-alpha hydroxyprogesterone caproate (10 -9 to 10 -7 M). After 24 hours, medium (supernatant) was removed and replaced with/without the addition of tumor necrosis factor-alpha (20 ng/mL) or thrombin (10 U/mL) or granulocyte-macrophage colony-stimulating factor (200 ng/mL). After 48 hours of culture, medium from the maternal side compartment of the model was assayed for granulocyte-macrophage colony

  8. Dried Human Amniotic Membrane Does Not Alleviate Inflammation and Fibrosis in Experimental Strabismus Surgery

    Directory of Open Access Journals (Sweden)

    Bo Young Chun


    Full Text Available Purpose. The purpose of this study was to evaluate the efficacy of dried human amniotic membrane (AM in reducing the postoperative inflammatory response and scarring after strabismus surgery. Methods. The inflammatory response at the extraocular muscle reattachment site was analyzed after superior rectus (SR resection in 12 rabbits. Dried human AM (Ambiodry2 was applied between the resected SR muscle plane and Tenon’s capsule of the left eyes of rabbits. As a control, the right eyes of rabbits underwent SR resection only. The surgeon randomly ordered which eye gets operated first during the experiment. Two weeks later, enucleation was performed. Six sagittal sections were made for each eye at the insertion of the SR muscle. The grade of postoperative inflammation and the presence of fibrosis were evaluated in histological examinations. Results. There was no statistically significant difference in the intensity of inflammation and fibrous proliferation between the eyes treated with dried human AM after SR resection and those treated with SR resection only. Conclusions. The use of dried human AM was not effective in controlling the postoperative inflammation and scarring in rabbit eyes after extraocular muscle surgery. However, this may be due to the devitalized dry preparation of human AM (Ambiodry2, which may have lost the expected anti-inflammatory and anti-scarring properties, and further studies on humans may be necessary.

  9. C5a binding to human polymorphonuclear leukocyte plasma membrane (PMNLM) receptors

    International Nuclear Information System (INIS)

    Conway, R.G.; Mollison, K.W.; Carter, G.W.; Lane, B.


    Previous investigations of the C5a receptor have been performed using intact human PMNL. To circumvent some of the potential problems with such whole cell assays (e.g. internalization or metabolism of radioligand) the authors have developed a PMNLM binding assay. Human PMNLM were prepared by nitrogen cavitation and Percoll gradient centrifugation. Specific binding of [ 125 I]C5a to PMNLM was: high affinity, K/sub D/ = 0.6 nM; saturable, B/sub max/ = 8.7 pmol/mg protein; and reversible. Kinetic measurements agree with the K/sub D/ value obtained by Scatchard analysis. Furthermore, the binding activity of C5a correlates with biological activity as measured by myeloperoxidase release from human PMNL. Human serum C5a and recombinant C5a bind with similar affinities when measured by competition or direct binding and label the same number of sites in human PMNLM. The nonhydrolyzable GTP analog, GppNHp, induces a low affinity state of the C5a receptor (4-6 fold shift in K/sub D/) with little effect on B/sub max/. In summary, the criteria have been satisfied for identification of a biologically relevant C5a binding site in human PMNLM. Regulation of the C5a receptor and its membrane transduction mechanism(s) appears to involve guanyl nucleotides, as has been found for other chemoattractant receptors

  10. Spontaneous transfer of stearic acids between human serum albumin and PEG:2000-grafted DPPC membranes. (United States)

    Pantusa, Manuela; Stirpe, Andrea; Sportelli, Luigi; Bartucci, Rosa


    Electron spin resonance (ESR) spectroscopy is used to study the transfer of stearic acids between human serum albumin (HSA) and sterically stabilized liposomes (SSL) composed of dipalmitoylphosphatidylcholine (DPPC) and of submicellar content of poly(ethylene glycol:2000)-dipalmitoylphosphatidylethanolamine (PEG:2000-DPPE). Protein/lipid dispersions are considered in which spin-labelled stearic acids at the 16th carbon atom along the acyl chain (16-SASL) are inserted either in the protein or in the SSL. Two component ESR spectra with different rotational mobility are obtained over a broad range of temperature and membrane composition. Indeed, superimposed to an anisotropic protein-signal, appears a more isotropic lipid-signal. Since in the samples only one matrix (protein or membranes) is spin-labelled, the other component accounts for the transfer of 16-SASL between albumin and membranes. The two components have been resolved and quantified by spectral subtractions, and the fraction, f (p) (16-SASL), of spin labels bound non-covalently to the protein has been used to monitor the transfer. It is found that it depends on the type of donor and acceptor matrix, on the physical state of the membranes and on the grafting density of the polymer-lipids. Indeed, it is favoured from SSL to HSA and the fraction of stearic acids transferred increases with temperature in both directions of transfer. Moreover, in the presence of polymer-lipids, the transfer from HSA to SSL is slightly attenuated, especially in the brush regime of the polymer-chains. Instead, the transfer from SSL to HSA is favoured by the polymer-lipids much more in the mushroom than in the brush regime.

  11. Atomic force microscopy on plasma membranes from Xenopus laevis oocytes containing human aquaporin 4.


    Orsini, F.; Santacroce, M.; Cremona, A.; Gosvami, N. N.; Lascialfari, A.; Hoogenboom, B. W.


    Atomic force microscopy (AFM) is a unique tool for imaging membrane proteins in near-native environment (embedded in a membrane and in buffer solution) at ~1 nm spatial resolution. It has been most successful on membrane proteins reconstituted in 2D crystals and on some specialized and densely packed native membranes. Here, we report on AFM imaging of purified plasma membranes from Xenopus laevis oocytes, a commonly used system for the heterologous expression of membrane proteins. Isoform M23...

  12. Evaluation of a Silicone Membrane as an Alternative to Human Skin for Determining Skin Permeation Parameters of Chemical Compounds. (United States)

    Uchida, Takashi; Yakumaru, Masafumi; Nishioka, Keisuke; Higashi, Yoshihiro; Sano, Tomohiko; Todo, Hiroaki; Sugibayashi, Kenji


    We evaluated the effectiveness of a silicone membrane as an alternative to human skin using the skin permeation parameters of chemical compounds. An in vitro permeation study using 15 model compounds was conducted, and permeation parameters comprising permeability coefficient (P), diffusion parameter (DL(-2)), and partition parameter (KL) were calculated from each permeation profile. Significant correlations were obtained in log P, log DL(-2), and log KL values between the silicone membrane and human skin. DL(-2) values of model compounds, except flurbiprofen, in the silicone membrane were independent of the lipophilicity of the model compounds and were 100-fold higher than those in human skin. For antipyrine and caffeine, which are hydrophilic, KL values in the silicone membrane were 100-fold lower than those in human skin, and P values, calculated as the product of a DL(-2) and KL, were similar. For lipophilic compounds, such as n-butyl paraben and flurbiprofen, KL values for silicone were similar to or 10-fold higher than those in human skin, and P values for silicone were 100-fold higher than those in human skin. Furthermore, for amphiphilic compounds with log Ko/w values from 0.5 to 3.5, KL values in the silicone membrane were 10-fold lower than those in human skin, and P values for silicone were 10-fold higher than those in human skin. The silicone membrane was useful as a human skin alternative in an in vitro skin permeation study. However, depending on the lipophilicity of the model compounds, some parameters may be over- or underestimated.

  13. Graphene oxide improves the biocompatibility of collagen membranes in an in vitro model of human primary gingival fibroblasts. (United States)

    De Marco, Patrizia; Zara, Susi; De Colli, Marianna; Radunovic, Milena; Lazović, Vladimir; Ettorre, Valeria; Di Crescenzo, Antonello; Piattelli, Adriano; Cataldi, Amelia; Fontana, Antonella


    Commercial collagen membranes are used in oral surgical procedures as scaffolds for bone deposition in guided bone regeneration. Here, we have enriched them with graphene oxide (GO) via a simple non-covalent functionalization, exploiting the capacity of oxygenated carbon functional moieties of GO to interact through hydrogen bonding with collagen. In the present paper, the GO-coated membranes have been characterized in terms of stability, nano-roughness, biocompatibility and induction of inflammatory response in human primary gingival fibroblast cells. The obtained coated membranes are demonstrated not to leak GO in the bulk solution, and to change some features of the membrane, such as stiffness and adhesion between the membrane and the atomic force microscopy (AFM) tip. Moreover, the presence of GO increases the roughness and the total surface exposed to the cells, as demonstrated by AFM analyses. The obtained material is biocompatible, and does not induce inflammation in the tested cells.

  14. Co-inhibition of epidermal growth factor receptor and insulin-like growth factor receptor 1 enhances radiosensitivity in human breast cancer cells

    International Nuclear Information System (INIS)

    Li, Ping; Veldwijk, Marlon R; Zhang, Qing; Li, Zhao-bin; Xu, Wen-cai; Fu, Shen


    Over-expression of epidermal growth factor receptor (EGFR) or insulin-like growth factor-1 receptor (IGF-1R) have been shown to closely correlate with radioresistance of breast cancer cells. This study aimed to investigate the impact of co-inhibition of EGFR and IGF-1R on the radiosensitivity of two breast cancer cells with different profiles of EGFR and IGF-1R expression. The MCF-7 (EGFR +/−, IGF-1R +++) and MDA-MB-468 (EGFR +++, IGF-1R +++) breast cancer cell lines were used. Radiosensitizing effects were determined by colony formation assay. Apoptosis and cell cycle distribution were measured by flow cytometry. Phospho-Akt and phospho-Erk1/2 were quantified by western blot. In vivo studies were conducted using MDA-MB-468 cells xenografted in nu/nu mice. In MDA-MB-468 cells, the inhibition of IGF-1R upregulated the p-EGFR expression. Either EGFR (AG1478) or IGF-1R inhibitor (AG1024) radiosensitized MDA-MB-468 cells. In MCF-7 cells, radiosensitivity was enhanced by AG1024, but not by AG1478. Synergistical radiosensitizing effect was observed by co-inhibition of EGFR and IGF-1R only in MDA-MB-468 cells with a DMF 10% of 1.90. The co-inhibition plus irradiation significantly induced more apoptosis and arrested the cells at G0/G1 phase in MDA-MB-468 cells. Only co-inhibition of EGFR and IGF-1R synergistically diminished the expression of p-Akt and p-Erk1/2 in MDA-MB-468 cells. In vivo studies further verified the radiosensitizing effects by co-inhibition of both pathways in a MDA-MB-468 xenograft model. Our data suggested that co-inhibition of EGFR and IGF-1R synergistically radiosensitized breast cancer cells with both EGFR and IGF-1R high expression. The approach may have an important therapeutic implication in the treatment of breast cancer patients with high expression of EGFR and IGF-1R

  15. Analysis of plasma membrane Ca(2+)-ATPase expression in control and SV40-transformed human fibroblasts. (United States)

    Reisner, P D; Brandt, P C; Vanaman, T C


    It has been long known that neoplastic transformation is accompanied by a lowered requirement for extracellular Ca2+ for growth. The studies presented here demonstrate that human fibroblastic cell lines produce the two commonly found 'housekeeping' isoforms of the plasma membrane Ca(2+)-ATPase (PMCA), PMCA1b and 4b, and at the expression of both is demonstrably lower in cell lines neoplastically transformed by SV40 than in the corresponding parental cell lines. Western blot analyses of lysates from control (GM00037) and SV40-transformed (GM00637) skin fibroblasts revealed a 138 kDa PMCA whose level was significantly lower in the SV40-transformed cells relative to either total cellular protein or alpha-tubulin. Similar analyses of plasma membrane preparations from control WI-38) and SV40-transformed (WI-38VA13) lung fibroblasts revealed 3-4-fold lower levels of PMCA in the SV40-transformed cells. Competitive ELISAs performed on detergent solubilized plasma membrane preparations indicated at least 3-4-fold lower levels of PMCA in the SV40-transformed cell lines compared to controls. Reverse transcriptase coupled-PCR analyses showed that PMCA1b and PMCA4b were the only isoforms expressed in all four cell lines. The PMCA4b mRNA level detected by Northern analysis also was substantially lower in SV40 transformed skin fibroblasts than in non-transformed fibroblasts. Quantitative RT-PCR analyses showed levels of PMCA1b and 4b mRNAs to be 5 and 10-fold lower, respectively, in GM00637 than in GM00037 when the levels of PCR products were normalized to glyceraldehyde-3-phosphate dehydrogenase (G3PDH) mRNA. These results demonstrate that the expression of these distinct PMCA genes is substantially lower in SV40 transformed human skin and lung fibroblasts and may be coordinately regulated in these cells.

  16. Membrane permeability of the human granulocyte to water, dimethyl sulfoxide, glycerol, propylene glycol and ethylene glycol. (United States)

    Vian, Alex M; Higgins, Adam Z


    Granulocytes are currently transfused as soon as possible after collection because they rapidly deteriorate after being removed from the body. This short shelf life complicates the logistics of granulocyte collection, banking, and safety testing. Cryopreservation has the potential to significantly increase shelf life; however, cryopreservation of granulocytes has proven to be difficult. In this study, we investigate the membrane permeability properties of human granulocytes, with the ultimate goal of using membrane transport modeling to facilitate development of improved cryopreservation methods. We first measured the equilibrium volume of human granulocytes in a range of hypo- and hypertonic solutions and fit the resulting data using a Boyle-van't Hoff model. This yielded an isotonic cell volume of 378 μm(3) and an osmotically inactive volume of 165 μm(3). To determine the permeability of the granulocyte membrane to water and cryoprotectant (CPA), cells were injected into well-mixed CPA solution while collecting volume measurements using a Coulter Counter. These experiments were performed at temperatures ranging from 4 to 37°C for exposure to dimethyl sulfoxide, glycerol, ethylene glycol, and propylene glycol. The best-fit water permeability was similar in the presence of all of the CPAs, with an average value at 21°C of 0.18 μmatm(-1)min(-1). The activation energy for water transport ranged from 41 to 61 kJ/mol. The CPA permeability at 21°C was 6.4, 1.0, 8.4, and 4.0 μm/min for dimethyl sulfoxide, glycerol, ethylene glycol, and propylene glycol, respectively, and the activation energy for CPA transport ranged between 59 and 68 kJ/mol. Copyright © 2013 Elsevier Inc. All rights reserved.

  17. alpha isoforms of soluble and membrane-linked folate-binding protein in human blood

    DEFF Research Database (Denmark)

    Hoier-Madsen, M.; Holm, J.; Hansen, S.I.


    supported the hypothesis that serum FBP (29 kDa) mainly originates from neutrophils. The presence of FBP/FR alpha isoforms were established for the first time in human blood using antibodies specifically directed against human milk FBP alpha. The alpha isoforms identified on erythrocyte membranes......, and in granulocytes and serum, only constituted an almost undetectable fraction of the functional FBP The FBP alpha in neutrophil granulocytes was identified as a cytoplasmic component by indirect immunofluorescence. Gel filtration of serum revealed a peak of FBP alpha (>120 kDa), which could represent receptor...... fragments from decomposed erythrocytes and granulocytes. The soluble FBPs may exert bacteriostatic effects and protect folates in plasma from biological degradation, whereas FRs on the surface of blood cells could be involved in intracellular folate uptake or serve as signal proteins. The latter receptors...

  18. Oral mucosa: an alternative epidermic cell source to develop autologous dermal-epidermal substitutes from diabetic subjects

    Directory of Open Access Journals (Sweden)

    Daniela GUZMÁN-URIBE

    Full Text Available Abstract Oral mucosa has been highlighted as a suitable source of epidermal cells due to its intrinsic characteristics such as its higher proliferation rate and its obtainability. Diabetic ulcers have a worldwide prevalence that is variable (1%-11%, meanwhile treatment of this has been proven ineffective. Tissue-engineered skin plays an important role in wound care focusing on strategies such autologous dermal-epidermal substitutes. Objective The aim of this study was to obtain autologous dermal-epidermal skin substitutes from oral mucosa from diabetic subjects as a first step towards a possible clinical application for cases of diabetic foot. Material and Methods Oral mucosa was obtained from diabetic and healthy subjects (n=20 per group. Epidermal cells were isolated and cultured using autologous fibrin to develop dermal-epidermal in vitro substitutes by the air-liquid technique with autologous human serum as a supplement media. Substitutes were immunocharacterized with collagen IV and cytokeratin 5-14 as specific markers. A Student´s t- test was performed to assess the differences between both groups. Results It was possible to isolate epidermal cells from the oral mucosa of diabetic and healthy subjects and develop autologous dermal-epidermal skin substitutes using autologous serum as a supplement. Differences in the expression of specific markers were observed and the cytokeratin 5-14 expression was lower in the diabetic substitutes, and the collagen IV expression was higher in the diabetic substitutes when compared with the healthy group, showing a significant difference. Conclusion Cells from oral mucosa could be an alternative and less invasive source for skin substitutes and wound healing. A difference in collagen production of diabetic cells suggests diabetic substitutes could improve diabetic wound healing. More research is needed to determine the crosstalk between components of these skin substitutes and damaged tissues.

  19. Phase II Study of Neoadjuvant Anthracycline-Based Regimens Combined With Nanoparticle Albumin-Bound Paclitaxel and Trastuzumab for Human Epidermal Growth Factor Receptor 2-Positive Operable Breast Cancer. (United States)

    Tanaka, Satoru; Iwamoto, Mitsuhiko; Kimura, Kosei; Matsunami, Nobuki; Morishima, Hirotaka; Yoshidome, Katsuhide; Nomura, Takashi; Morimoto, Takashi; Yamamoto, Daigo; Tsubota, Yu; Kobayashi, Toshihiro; Uchiyama, Kazuhisa


    We treated patients with operable human epidermal growth factor receptor 2-positive breast cancer with neoadjuvant anthracycline regimens followed by nanoparticle albumin-bound paclitaxel plus trastuzumab. Of the 44 patients, 49% achieved a pathologic complete response (pCR). The pCR rate was 36% and 71% in the patients with estrogen receptor-positive and -negative cancer, respectively. Neoadjuvant therapy using this combination appears to be effective and safe. Introduction: Neoadjuvant chemotherapy plus trastuzumab. Neoadjuvant chemotherapy plus trastuzumab results in a 30% to 50% pathologic complete response (pCR) rate in human epidermal growth factor receptor 2 (HER2)-positive breast cancer and has been associated with improved therapeutic outcomes. Thus, the pCR rate can be useful in evaluating novel agents in this patient population. Nanoparticle albumin-bound (nab)-paclitaxel (PTX) can reduce the toxicity of PTX while maintaining its efficacy. The present study evaluated the activity and safety of nab-PTX as a neoadjuvant treatment of HER2(+) breast cancer. We treated patients with stage I to IIIA breast cancer using neoadjuvant epirubicin/cyclophosphamide (EC) or 5-fluorouracil/epirubicin/cyclophosphamide every 3 weeks (q3w) for 4 cycles, followed by nab-PTX (260 mg/m(2)) plus trastuzumab q3w for 4 cycles. The primary endpoint was the pCR rate. The secondary endpoints included the clinical response rate, disease-free survival, pathologic response rate (defined as pCR or minimal residual invasive disease only in the breast), breast-conserving surgery rate, and safety. Forty-six patients were enrolled. One patient met the exclusion criteria because of the coexistence of another malignant disease; therefore, we evaluated 45 patients in the entire study. One patient experienced rapid disease progression during EC therapy, leaving 44 patients evaluable for nab-PTX treatment. Of the 45 patients, 49% achieved a pCR. The pCR rate was 36% and 71% in those with

  20. Capsid protein VP4 of human rhinovirus induces membrane permeability by the formation of a size-selective multimeric pore.

    Directory of Open Access Journals (Sweden)

    Anusha Panjwani


    Full Text Available Non-enveloped viruses must deliver their viral genome across a cell membrane without the advantage of membrane fusion. The mechanisms used to achieve this remain poorly understood. Human rhinovirus, a frequent cause of the common cold, is a non-enveloped virus of the picornavirus family, which includes other significant pathogens such as poliovirus and foot-and-mouth disease virus. During picornavirus cell entry, the small myristoylated capsid protein VP4 is released from the virus, interacts with the cell membrane and is implicated in the delivery of the viral RNA genome into the cytoplasm to initiate replication. In this study, we have produced recombinant C-terminal histidine-tagged human rhinovirus VP4 and shown it can induce membrane permeability in liposome model membranes. Dextran size-exclusion studies, chemical crosslinking and electron microscopy demonstrated that VP4 forms a multimeric membrane pore, with a channel size consistent with transfer of the single-stranded RNA genome. The membrane permeability induced by recombinant VP4 was influenced by pH and was comparable to permeability induced by infectious virions. These findings present a molecular mechanism for the involvement of VP4 in cell entry and provide a model system which will facilitate exploration of VP4 as a novel antiviral target for the picornavirus family.

  1. Ridge Preservation Comparing a Nonresorbable PTFE Membrane to a Resorbable Collagen Membrane: A Clinical and Histologic Study in Humans. (United States)

    Arbab, Hussain; Greenwell, Henry; Hill, Margaret; Morton, Dean; Vidal, Ricardo; Shumway, Brian; Allan, Nicholas D


    The primary aim of this randomized, controlled, blinded clinical trial was to compare the effect of a resorbable collagen membrane (CM group) versus a nonresorbable high-density polytetrafluoroethylene membrane (PTFE group) on the clinical and histologic outcomes of a ridge preservation procedure. All 24 sites received an intrasocket cancellous allograft and a buccal overlay bovine derived xenograft. The change in horizontal crestal ridge width was -1.4 ± 1.2 mm for the CM group, whereas the PTFE group lost -2.2 ± 1.5 mm, which was not statistically significant between groups (P > 0.05). Vertical ridge height change was -1.2 ± 1.5 for the CM group, whereas the PTFE group lost -0.5 ± 1.6, which was not significantly different between groups (P > 0.05). The percent vital bone was similar and not significantly different between groups. Primary closure was not obtained and the exposed membrane portion over the socket opening healed with keratinized tissue. The choice of a resorbable versus a nonresorbable barrier membrane did not affect the clinical or the histologic outcome of ridge preservation treatment.

  2. Partitioning the proteome: phase separation for targeted analysis of membrane proteins in human post-mortem brain.

    Directory of Open Access Journals (Sweden)

    Jane A English

    Full Text Available Neuroproteomics is a powerful platform for targeted and hypothesis driven research, providing comprehensive insights into cellular and sub-cellular disease states, Gene × Environmental effects, and cellular response to medication effects in human, animal, and cell culture models. Analysis of sub-proteomes is becoming increasingly important in clinical proteomics, enriching for otherwise undetectable proteins that are possible markers for disease. Membrane proteins are one such sub-proteome class that merit in-depth targeted analysis, particularly in psychiatric disorders. As membrane proteins are notoriously difficult to analyse using traditional proteomics methods, we evaluate a paradigm to enrich for and study membrane proteins from human post-mortem brain tissue. This is the first study to extensively characterise the integral trans-membrane spanning proteins present in human brain. Using Triton X-114 phase separation and LC-MS/MS analysis, we enriched for and identified 494 membrane proteins, with 194 trans-membrane helices present, ranging from 1 to 21 helices per protein. Isolated proteins included glutamate receptors, G proteins, voltage gated and calcium channels, synaptic proteins, and myelin proteins, all of which warrant quantitative proteomic investigation in psychiatric and neurological disorders. Overall, our sub-proteome analysis reduced sample complexity and enriched for integral membrane proteins by 2.3 fold, thus allowing for more manageable, reproducible, and targeted proteomics in case vs. control biomarker studies. This study provides a valuable reference for future neuroproteomic investigations of membrane proteins, and validates the use Triton X-114 detergent phase extraction on human post mortem brain.

  3. Interaction of a peptide derived from C-terminus of human TRPA1 channel with model membranes mimicking the inner leaflet of the plasma membrane. (United States)

    Witschas, Katja; Jobin, Marie-Lise; Korkut, Dursun Nizam; Vladan, Maria Magdalena; Salgado, Gilmar; Lecomte, Sophie; Vlachova, Viktorie; Alves, Isabel D


    The transient receptor potential ankyrin 1 channel (TRPA1) belongs to the TRP cation channel superfamily that responds to a panoply of stimuli such as changes in temperature, calcium levels, reactive oxygen and nitrogen species and lipid mediators among others. The TRP superfamily has been implicated in diverse pathological states including neurodegenerative disorders, kidney diseases, inflammation, pain and cancer. The intracellular C-terminus is an important regulator of TRP channel activity. Studies with this and other TRP superfamily members have shown that the C-terminus association with lipid bilayer alters channel sensitivity and activation, especially interactions occurring through basic residues. Nevertheless, it is not yet clear how this process takes place and which regions in the C-terminus would be responsible for such membrane recognition. With that in mind, herein the first putative membrane interacting region of the C-terminus of human TRPA1, (corresponding to a 29 residue peptide, IAEVQKHASLKRIAMQVELHTSLEKKLPL) named H1 due to its potential helical character was chosen for studies of membrane interaction. The affinity of H1 to lipid membranes, H1 structural changes occurring upon this interaction as well as effects of this interaction in lipid organization and integrity were investigated using a biophysical approach. Lipid models systems composed of zwitterionic and anionic lipids, namely those present in the lipid membrane inner leaflet, where H1 is prone to interact, where used. The study reveals a strong interaction and affinity of H1 as well as peptide structuration especially with membranes containing anionic lipids. Moreover, the interactions and peptide structure adoption are headgroup specific. Copyright © 2015 Elsevier B.V. All rights reserved.

  4. Fatty acids are required for epidermal permeability barrier function. (United States)

    Mao-Qiang, M; Elias, P M; Feingold, K R


    The permeability barrier is mediated by a mixture of ceramides, sterols, and free fatty acids arranged as extracellular lamellar bilayers in the stratum corneum. Whereas prior studies have shown that cholesterol and ceramides are required for normal barrier function, definitive evidence for the importance of nonessential fatty acids is not available. To determine whether epidermal fatty acid synthesis also is required for barrier homeostasis, we applied 5-(tetradecyloxy)-2-furancarboxylic acid (TOFA), an inhibitor of acetyl CoA carboxylase, after disruption of the barrier by acetone or tape stripping. TOFA inhibits epidermal fatty acid by approximately 50% and significantly delays barrier recovery. Moreover, coadministration of palmitate with TOFA normalizes barrier recovery, indicating that the delay is due to a deficiency in bulk fatty acids. Furthermore, TOFA treatment also delays the return of lipids to the stratum corneum and results in abnormalities in the structure of lamellar bodies, the organelle which delivers lipid to the stratum corneum. In addition, the organization of secreted lamellar body material into lamellar bilayers within the stratum corneum interstices is disrupted by TOFA treatment. Finally, these abnormalities in lamellar body and stratum corneum membrane structure are corrected by coapplication of palmitate with TOFA. These results demonstrate a requirement for bulk fatty acids in barrier homeostasis. Thus, inhibiting the epidermal synthesis of any of the three key lipids that form the extracellular, lipid-enriched membranes of the stratum corneum results in an impairment in barrier homeostasis.

  5. Plasma membrane proteomic analysis of human Gastric Cancer tissues: revealing flotillin 1 as a marker for Gastric Cancer

    International Nuclear Information System (INIS)

    Gao, Wen; Xu, Jing; Wang, Fuqiang; Zhang, Long; Peng, Rui; Shu, Yongqian; Wu, Jindao; Tang, Qiyun; Zhu, Yunxia


    Gastric cancer remains the second leading cause of cancer-related deaths in the world. Successful early gastric cancer detection is hampered by lack of highly sensitive and specific biomarkers. Plasma membrane proteins participate and/or have a central role in the metastatic process of cancer cells and are potentially useful for cancer therapy due to easy accessibility of the targets. In the present research, TMT method followed by mass spectrometry analysis was used to compare the relative expression levels of plasma membrane proteins between noncancer and gastric cancer tissues. Of a total data set that included 501 identified proteins, about 35% of the identified proteins were found to be plasma membrane and associated proteins. Among them, 82 proteins were at least 1.5-fold up- or down-regulated in gastric cancer compared with the adherent normal tissues. A number of markers (e.g. annexin A6, caveolin 1, epidermal growth factor receptor, integrin beta 4) were previously reported as biomarkers of GC. Additionally, several potential biomarkers participated in endocytosis pathway and integrin signaling pathways were firstly identified as differentially expressed proteins in GC samples. Our findings also supported the notion that flotillin 1 is a potential biomarker that could be exploited for molecular imaging-based detection of gastric cancer. Together, the results show that subcellular proteomics of tumor tissue is a feasible and promising avenue for exploring oncogenesis. The online version of this article (doi:10.1186/s12885-015-1343-5) contains supplementary material, which is available to authorized users

  6. New Approaches towards the Elucidation of Epidermal-Dermal Separation in Sulfur Mustard-Exposed Human Skin and Directions for Therapy

    National Research Council Canada - National Science Library

    Mol, Marijke


    .... Results of experiments with a human skin ex vivo model show that apoptosis and metalloprotease activity are key elements in HD-induced skin pathogenesis, and that intervention in these two processes...

  7. Degradation of endothelial basement membrane by human breast cancer cell lines

    International Nuclear Information System (INIS)

    Yee, C.; Shiu, R.P.


    During metastasis, it is believed that tumor cells destroy the basement membrane (BM) of blood vessels in order to disseminate through the circulatory system. By radioactively labeling the extracellular matrix produced by primary endothelial cells in vitro, the ability of human breast cancer cells to degrade BM components was studied. We found that T-47D, a human breast cancer line, was able to degrade significant amounts of [35S]methionine-labeled and [3H]proline-labeled BM, but not 35SO4-labeled BM. Six other tumor cell lines of human breast origin were assayed in the same manner and were found to degrade BM to varying degrees. Several non-tumor cell lines tested showed relatively little degrading activity. The use of serum-free medium greatly enhanced degradation of the BM by tumor cells, suggesting a role for naturally occurring enzyme inhibitors in the serum. Direct cell contact with the BM was required for BM degradation, suggesting that the active enzymes are cell associated. The addition of hormones implicated in the etiology of breast cancer did not significantly alter the ability of T-47D cells to degrade the BM. The use of this assay affords future studies on the mechanism of invasion and metastasis of human breast cancer

  8. Gene transfer and expression in human neutrophils. The phox homology domain of p47phox translocates to the plasma membrane but not to the membrane of mature phagosomes

    Directory of Open Access Journals (Sweden)

    Brzezinska Agnieszka A


    Full Text Available Abstract Background Neutrophils are non-dividing cells with poor survival after isolation. Consequently, exogenous gene expression in neutrophils is challenging. We report here the transfection of genes and expression of active proteins in human primary peripheral neutrophils using nucleofection. Results Exogenous gene expression in human neutrophils was achieved 2 h post-transfection. We show that neutrophils transfected by nucleofection are functional cells, able to respond to soluble and particulate stimuli. They conserved the ability to undergo physiological processes including phagocytosis. Using this technique, we were able to show that the phox homology (PX domain of p47phox localizes to the plasma membrane in human neutrophils. We also show that RhoB, but not the PX domain of p47phox, is translocated to the membrane of mature phagosomes. Conclusion We demonstrated that cDNA transfer and expression of exogenous protein in human neutrophils is compatible with cell viability and is no longer a limitation for the study of protein function in human neutrophils.

  9. Tissue eosinophilia induced by recombinant human interleukin-5 in the hamster cheek pouch membrane

    Directory of Open Access Journals (Sweden)

    M. Minnicozzi


    Full Text Available Interleukin-5 (IL-5 is a cytokine that preferentially effects the development and function of eosinophils, and is considered important in the pathophysiology of allergic inflammation. In this study, we evaluated the ability of recombinant human IL-5 (rHu IL-5 to promote tissue eosinophilia and the importance of this eosinophilia to pathological alterations in vascular function. Repetitive subcutaneous administration for 18 days of rHu IL-5 resulted in a 7-fold increase in the number of eosinophils found in the ipsilateral hamster cheek pouch membrane. The contralateral cheek pouch membrane and peritoneum of these animals showed lesser but significant elevations in the number of eosinophils. In contrast, denatured rHu IL-5 did not elevate eosinophils in these tissues. Through the use of intravital microscopy and fluorometric analysis, rHu IL-5 treated hamster cheek pouch membranes were evaluated for alterations in microvascular permeability, using plasma clearance of FITC-dextran 150 as an index. Despite promoting a prominent tissue eosinophilia, the repetitive subcutaneous injections of rHu IL-5 did not alter the clearance of FITC-dextran 150. Topical application of rHu IL-5 to the cheek pouch, also, had no effect on the clearance of FITC-dextran 150. Immunofluorescence observations using an antibody to the granule protein, eosinophil peroxidase, indicated that the recruited cells had not degranulated. Our results support the importance of IL-5 in the recruitment of tissue eosinophils, but further stimulation is probably required to cause degranulation of these cells and the ensuing tissue damage.

  10. An Improved 2-Dimensional Gel Electrophoresis Method for Resolving Human Erythrocyte Membrane Proteins. (United States)

    Kumar, Manoj; Singh, Rajendra; Meena, Anil; Patidar, Bhagwan S; Prasad, Rajendra; Chhabra, Sunil K; Bansal, Surendra K


    The 2-dimensional gel electrophoresis (2-DE) technique is widely used for the analysis of complex protein mixtures extracted from biological samples. It is one of the most commonly used analytical techniques in proteomics to study qualitative and quantitative protein changes between different states of a cell or an organism (eg, healthy and diseased), conditionally expressed proteins, posttranslational modifications, and so on. The 2-DE technique is used for its unparalleled ability to separate thousands of proteins simultaneously. The resolution of the proteins by 2-DE largely depends on the quality of sample prepared during protein extraction which increases results in terms of reproducibility and minimizes protein modifications that may result in artifactual spots on 2-DE gels. The buffer used for the extraction and solubilization of proteins influences the quality and reproducibility of the resolution of proteins on 2-DE gel. The purification by cleanup kit is another powerful process to prevent horizontal streaking which occurs during isoelectric focusing due to the presence of contaminants such as salts, lipids, nucleic acids, and detergents. Erythrocyte membrane proteins serve as prototypes for multifunctional proteins in various erythroid and nonerythroid cells. In this study, we therefore optimized the selected major conditions of 2-DE for resolving various proteins of human erythrocyte membrane. The modification included the optimization of conditions for sample preparation, cleanup of protein sample, isoelectric focusing, equilibration, and storage of immobilized pH gradient strips, which were further carefully examined to achieve optimum conditions for improving the quality of protein spots on 2-DE gels. The present improved 2-DE analysis method enabled better detection of protein spots with higher quality and reproducibility. Therefore, the conditions established in this study may be used for the 2-DE analysis of erythrocyte membrane proteins for

  11. Hemocompatible control of sulfobetaine-grafted polypropylene fibrous membranes in human whole blood via plasma-induced surface zwitterionization. (United States)

    Chen, Sheng-Han; Chang, Yung; Lee, Kueir-Rarn; Wei, Ta-Chin; Higuchi, Akon; Ho, Feng-Ming; Tsou, Chia-Chun; Ho, Hsin-Tsung; Lai, Juin-Yih


    In this work, the hemocompatibility of zwitterionic polypropylene (PP) fibrous membranes with varying grafting coverage of poly(sulfobetaine methacrylate) (PSBMA) via plasma-induced surface polymerization was studied. Charge neutrality of PSBMA-grafted layers on PP membrane surfaces was controlled by the low-pressure and atmospheric plasma treatment in this study. The effects of grafting composition, surface hydrophilicity, and hydration capability on blood compatibility of the membranes were determined. Protein adsorption onto the different PSBMA-grafted PP membranes from human fibrinogen solutions was measured by enzyme-linked immunosorbent assay (ELISA) with monoclonal antibodies. Blood platelet adhesion and plasma clotting time measurements from a recalcified platelet-rich plasma solution were used to determine if platelet activation depends on the charge bias of the grafted PSBMA layer. The charge bias of PSBMA layer deviated from the electrical balance of positively and negatively charged moieties can be well-controlled via atmospheric plasma-induced interfacial zwitterionization and was further tested with human whole blood. The optimized PSBMA surface graft layer in overall charge neutrality has a high hydration capability and keeps its original blood-inert property of antifouling, anticoagulant, and antithrmbogenic activities when it comes into contact with human blood. This work suggests that the hemocompatible nature of grafted PSBMA polymers by controlling grafting quality via atmospheric plasma treatment gives a great potential in the surface zwitterionization of hydrophobic membranes for use in human whole blood.

  12. Clinical Usefulness of a One-Tube Nested Reverse Transcription Quantitative Polymerase Chain Reaction Assay for Evaluating Human Epidermal Growth Factor Receptor 2 mRNA Overexpression in Formalin-Fixed and Paraffin-Embedded Breast Cancer Tissue Samples. (United States)

    Wang, Hye-Young; Ahn, Sungwoo; Park, Sunyoung; Kim, SeungIl; Lee, Hyeyoung


    Currently, the two main methods used to analyze human epidermal growth factor receptor 2 (HER2) amplification or overexpression have a limited accuracy and high costs. These limitations can be overcome by the development of complementary quantitative methods. In this study, we analyzed HER2 mRNA expression in clinical formalin-fixed and paraffin-embedded (FFPE) samples using a one-tube nested reverse transcription quantitative polymerase chain reaction (RT-qPCR) assay. We measured expression relative to 3 reference genes and compared the results to those obtained by conventional immunohistochemistry (IHC) and fluorescence in situ hybridization (FISH) assays with 226 FFPE breast cancer tissue samples. The one-tube nested RT-qPCR assay proved to be highly sensitive and specific based on comparisons with IHC (96.9 and 97.7%, respectively) and FISH (92.4 and 92.9%, respectively) obtained with the validation set. Comparisons with clinicopathological data revealed significant associations between HER2 overexpression and TNM stage (p < 0.01), histological type (p < 0.01), ER status (p < 0.001), PR status (p < 0.05), HER2 status (p < 0.001), and molecular subtypes (p < 0.001). Based on these findings, our one-tube nested RT-qPCR assay is a potentially useful and complementary screening tool for the detection of HER2 mRNA overexpression. © 2016 S. Karger AG, Basel.

  13. Ultraviolet B, melanin and mitochondrial DNA: Photo-damage in human epidermal keratinocytes and melanocytes modulated by alpha-melanocyte-stimulating hormone [version 1; referees: 2 approved

    Directory of Open Access Journals (Sweden)

    Markus Böhm


    Full Text Available Alpha-melanocyte-stimulating hormone (alpha-MSH increases melanogenesis and protects from UV-induced DNA damage. However, its effect on mitochondrial DNA (mtDNA damage is unknown. We have addressed this issue in a pilot study using human epidermal keratinocytes and melanocytes incubated with alpha-MSH and irradiated with UVB. Real-time touchdown PCR was used to quantify total and deleted mtDNA. The deletion detected encompassed the common deletion but was more sensitive to detection. There were 4.4 times more mtDNA copies in keratinocytes than in melanocytes. Irradiation alone did not affect copy numbers. Alpha-MSH slightly increased copy numbers in both cell types in the absence of UVB and caused a similar small decrease in copy number with dose in both cell types. Deleted copies were nearly twice as frequent in keratinocytes as in melanocytes. Alpha-MSH reduced the frequency of deleted copies by half in keratinocytes but not in melanocytes. UVB dose dependently led to an increase in the deleted copy number in alpha-MSH-treated melanocytes. UVB irradiation had little effect on deleted copy number in alpha-MSH-treated keratinocytes. In summary, alpha-MSH enhances mtDNA damage in melanocytes presumably by increased melanogenesis, while α-MSH is protective in keratinocytes, the more so in the absence of irradiation.

  14. Prospective study of the impact of the Prosigna assay on adjuvant clinical decision-making in unselected patients with estrogen receptor positive, human epidermal growth factor receptor negative, node negative early-stage breast cancer. (United States)

    Martín, Miguel; González-Rivera, Milagros; Morales, Serafín; de la Haba-Rodriguez, Juan; González-Cortijo, Lucía; Manso, Luis; Albanell, Joan; González-Martín, Antonio; González, Sónia; Arcusa, Angels; de la Cruz-Merino, Luis; Rojo, Federico; Vidal, María; Galván, Patricia; Aguirre, Elena; Morales, Cristina; Ferree, Sean; Pompilio, Kristen; Casas, Maribel; Caballero, Rosalía; Goicoechea, Uxue; Carrasco, Eva; Michalopoulos, Steven; Hornberger, John; Prat, Aleix


    Improved understanding of risk of recurrence (ROR) is needed to reduce cases of recurrence and more effectively treat breast cancer patients. The purpose of this study was to examine how a gene-expression profile (GEP), identified by Prosigna, influences physician adjuvant treatment selection for early breast cancer (EBC) and the effects of this influence on optimizing adjuvant treatment recommendations in clinical practice. A prospective, observational, multicenter study was carried out in 15 hospitals across Spain. Participating medical oncologists completed pre-assessment, post-assessment, and follow-up questionnaires recording their treatment recommendations and confidence in these recommendations, before and after knowing the patient's ROR. Patients completed questionnaires on decision-making, anxiety, and health status. Between June 2013 and January 2014, 217 patients enrolled and a final 200 were included in the study. Patients were postmenopausal, estrogen receptor positive, human epidermal growth hormone factor negative, and node negative with either stage 1 or stage 2 tumors. After receiving the GEP results, treatment recommendations were changed for 40 patients (20%). The confidence of medical oncologists in their treatment recommendations increased in 41.6% and decreased in 6.5% of total cases. Patients reported lower anxiety after physicians made treatment recommendations based on the GEP results (p anxiety about the selected adjuvant therapy decreased with use of the GEP.

  15. Night work and breast cancer risk defined by human epidermal growth factor receptor-2 (HER2) and hormone receptor status: A population-based case-control study in France. (United States)

    Cordina-Duverger, Emilie; Koudou, Yves; Truong, Thérèse; Arveux, Patrick; Kerbrat, Pierre; Menegaux, Florence; Guénel, Pascal

    Night work has been associated with risk of breast cancer but this association needs to be confirmed. Because breast cancer is an etiologically heterogeneous disease, we explored the association of night work with breast cancer subtypes defined by tumor status (positive of negative) for estrogen-receptor (ER), progesterone-receptor (PR) and human epidermal growth factor-receptor 2 (HER2). Using the data from a case-control study in France including 975 cases and 1317 controls, we found that the odds ratios for ER+, PR+ or HER2+ breast cancers subtypes were significantly elevated, while no association with night shift work was observed for ER, PR or HER2-negative tumors. After stratification by menopausal status, the associations of night work with receptor-positive breast tumor subtypes were clearly seen in premenopausal women (odds ratios 2.04, 1.98 and 2.80, respectively) but did not appear in postmenopausal women. This study provides evidence that working at night may increase risk of ER, PR and HER2-positive subtypes of breast cancer particularly among premenopausal women.

  16. Differentiation of human keratinocytes: changes in lipid synthesis, plasma membrane lipid composition, and 125I-EGF binding upon administration of 25-hydroxycholesterol and mevinolin

    International Nuclear Information System (INIS)

    Ponec, M.; Kempenaar, J.; Weerheim, A.; Boonstra, J.


    We have studied the relationship between differentiation capacity, plasma membrane composition, and epidermal growth factor (EGF) receptor expression of normal keratinocytes in vitro. The plasma membrane composition of the cells was modulated experimentally by cholesterol depletion, using specific inhibitors of cholesterol synthesis, such as 25-hydroxycholesterol and mevinolin. Exposure of the cells towards these inhibitors resulted in a drastic decrease of cholesterol biosynthesis, as determined from 14 C-acetate incorporation into the various lipid fractions. This effect on cholesterol biosynthesis was reflected by changes in plasma membrane composition, as determined by lipid analysis of isolated plasma membrane fractions, these resulting in a decreased cholesterol-phospholipid ratio. The experimental modulation of plasma membrane composition by 25-hydroxycholesterol or mevinolin were accompanied by a decreased cornified envelope formation and by high expression of EGF binding sites. These phenomena were more pronounced in cells induced to differentiate by exposure of cells grown under low Ca2+ to normal Ca2+ concentrations, as compared to cells grown persistently under low Ca2+ concentrations. These results suggest a close correlation between plasma membrane composition, differentiation capacity, and EGF receptor expression

  17. Molecular cloning of human protein 4.2: A major component of the erythrocyte membrane

    International Nuclear Information System (INIS)

    Sung, L.A.; Chien, Shu; Lambert, K.; Chang, Longsheng; Bliss, S.A.; Bouhassira, E.E.; Nagel, R.L.; Schwartz, R.S.; Rybicki, A.C.


    Protein 4.2 (P4.2) comprises ∼5% of the protein mass of human erythrocyte (RBC) membranes. Anemia occurs in patients with RBCs deficient in P4.2, suggesting a role for this protein in maintaining RBC stability and integrity. The authors now report the molecular cloning and characterization of human RBC P4.2 cDNAs. By immunoscreening a human reticulocyte cDNA library and by using the polymerase chain reaction, two cDNA sequences of 2.4 and 2.5 kilobases (kb) were obtained. These cDNAs differ only by a 90-base-air insert in the longer isoform located three codons downstream from the putative initiation site. The 2.4- and 2.5-kb cDNAs predict proteins of ∼77 and ∼80 kDa, respectively, and the authenticity was confirmed by sequence identity with 46 amino acids of three cyanogen bromide-cleaved peptides of P4.2. Northern blot analysis detected a major 2.4-kb RNA species in reticulocytes. Isolation of two P4.2 cDNAs implies existence of specific regulation of P4.2 expression in human RBCs. Human RBC P4.2 has significant homology with human factor XIII subunit a and guinea pig liver transglutaminase. Sequence alignment of P4.2 with these two transglutaminases, however, revealed that P4.2 lacks the critical cysteine residue required for the enzymatic crosslinking of substrates

  18. Localized ridge defect augmentation using human pericardium membrane and demineralized bone matrix. (United States)

    Vidyadharan, Arun Kumar; Ravindran, Anjana


    Patient wanted to restore her lost teeth with implants in the lower left first molar and second premolar region. Cone beam computerized tomography (CBCT) revealed inadequate bone width and height around future implant sites. The extraction socket of second premolar area revealed inadequate socket healing with sparse bone fill after 4 months of extraction. To evaluate the clinical feasibility of using a collagen physical resorbable barrier made of human pericardium (HP) to augment localized alveolar ridge defects for the subsequent placement of dental implants. Ridge augmentation was done in the compromised area using Puros® demineralized bone matrix (DBM) Putty with chips and an HP allograft membrane. Horizontal (width) and vertical hard tissue measurements with CBCT were recorded on the day of ridge augmentation surgery, 4 month and 7 months follow-up. Intra oral periapical taken 1 year after implant installation showed minimal crestal bone loss. Bone volume achieved through guided bone regeneration was a gain of 4.8 mm horizontally (width) and 6.8 mm vertically in the deficient ridge within a period of 7 months following the procedure. The results suggested that HP Allograft membrane may be a suitable component for augmentation of localized alveolar ridge defects in conjunction with DBM with bone chips.

  19. Agrin is a major heparan sulfate proteoglycan in the human glomerular basement membrane. (United States)

    Groffen, A J; Ruegg, M A; Dijkman, H; van de Velden, T J; Buskens, C A; van den Born, J; Assmann, K J; Monnens, L A; Veerkamp, J H; van den Heuvel, L P


    Agrin is a heparan sulfate proteoglycan (HSPG) that is highly concentrated in the synaptic basal lamina at the neuromuscular junction (NMJ). Agrin-like immunoreactivity is also detected outside the NMJ. Here we show that agrin is a major HSPG component of the human glomerular basement membrane (GBM). This is in addition to perlecan, a previously characterized HSPG of basement membranes. Antibodies against agrin and against an unidentified GBM HSPG produced a strong staining of the GBM and the NMJ, different from that observed with anti-perlecan antibodies. In addition, anti-agrin antisera recognized purified GBM HSPG and competed with an anti-GBM HSPG monoclonal antibody in ELISA. Furthermore, both antibodies recognized a molecule that migrated in SDS-PAGE as a smear and had a molecular mass of approximately 200-210 kD after deglycosylation. In immunoelectron microscopy, agrin showed a linear distribution along the GBM and was present throughout the width of the GBM. This was again different from perlecan, which was exclusively present on the endothelial side of the GBM and was distributed in a nonlinear manner. Quantitative ELISA showed that, compared with perlecan, the agrin-like GBM HSPG showed a sixfold higher molarity in crude glomerular extract. These results show that agrin is a major component of the GBM, indicating that it may play a role in renal ultrafiltration and cell matrix interaction. (J Histochem Cytochem 46:19-27, 1998)

  20. Parallel artificial liquid membrane extraction as an efficient tool for removal of phospholipids from human plasma. (United States)

    Ask, Kristine Skoglund; Bardakci, Turgay; Parmer, Marthe Petrine; Halvorsen, Trine Grønhaug; Øiestad, Elisabeth Leere; Pedersen-Bjergaard, Stig; Gjelstad, Astrid


    Generic Parallel Artificial Liquid Membrane Extraction (PALME) methods for non-polar basic and non-polar acidic drugs from human plasma were investigated with respect to phospholipid removal. In both cases, extractions in 96-well format were performed from plasma (125μL), through 4μL organic solvent used as supported liquid membranes (SLMs), and into 50μL aqueous acceptor solutions. The acceptor solutions were subsequently analysed by liquid chromatography-tandem mass spectrometry (LC-MS/MS) using in-source fragmentation and monitoring the m/z 184→184 transition for investigation of phosphatidylcholines (PC), sphingomyelins (SM), and lysophosphatidylcholines (Lyso-PC). In both generic methods, no phospholipids were detected in the acceptor solutions. Thus, PALME appeared to be highly efficient for phospholipid removal. To further support this, qualitative (post-column infusion) and quantitative matrix effects were investigated with fluoxetine, fluvoxamine, and quetiapine as model analytes. No signs of matrix effects were observed. Finally, PALME was evaluated for the aforementioned drug substances, and data were in accordance with European Medicines Agency (EMA) guidelines. Copyright © 2016 Elsevier B.V. All rights reserved.

  1. Influence of membrane fluidity on human immunodeficiency virus type 1 entry

    International Nuclear Information System (INIS)

    Harada, Shinji; Yusa, Keisuke; Monde, Kazuaki; Akaike, Takaaki; Maeda, Yosuke


    For penetration of human immunodeficiency virus type 1 (HIV-1), formation of fusion-pores might be required for accumulating critical numbers of fusion-activated gp41, followed by multiple-site binding of gp120 with receptors, with the help of fluidization of the plasma membrane and viral envelope. Correlation between HIV-1 infectivity and fluidity was observed by treatment of fluidity-modulators, indicating that infectivity was dependent on fluidity. A 5% decrease in fluidity suppressed the HIV-1 infectivity by 56%. Contrarily, a 5% increase in fluidity augmented the infectivity by 2.4-fold. An increased temperature of 40 deg C or treatment of 0.2% xylocaine after viral adsorption at room temperature enhanced the infectivity by 2.6- and 1.5-fold, respectively. These were inhibited by anti-CXCR4 peptide, implying that multiple-site binding was accelerated at 40 deg C or by xylocaine. Thus, fluidity of both the plasma membrane and viral envelope was required to form the fusion-pore and to complete the entry of HIV-1

  2. The Effect of Covalently-Attached ATRP-Synthesized Polymers on Membrane Stability and Cytoprotection in Human Erythrocytes. (United States)

    Clafshenkel, William P; Murata, Hironobu; Andersen, Jill; Creeger, Yehuda; Koepsel, Richard R; Russell, Alan J


    Erythrocytes have been described as advantageous drug delivery vehicles. In order to ensure an adequate circulation half-life, erythrocytes may benefit from protective enhancements that maintain membrane integrity and neutralize oxidative damage of membrane proteins that otherwise facilitate their premature clearance from circulation. Surface modification of erythrocytes using rationally designed polymers, synthesized via atom-transfer radical polymerization (ATRP), may further expand the field of membrane-engineered red blood cells. This study describes the fate of ATRP-synthesized polymers that were covalently attached to human erythrocytes as well as the effect of membrane engineering on cell stability under physiological and oxidative conditions in vitro. The biocompatible, membrane-reactive polymers were homogenously retained on the periphery of modified erythrocytes for at least 24 hours. Membrane engineering stabilized the erythrocyte membrane and effectively neutralized oxidative species, even in the absence of free-radical scavenger-containing polymers. The targeted functionalization of Band 3 protein by NHS-pDMAA-Cy3 polymers stabilized its monomeric form preventing aggregation in the presence of the crosslinking reagent, bis(sulfosuccinimidyl)suberate (BS3). A free radical scavenging polymer, NHS-pDMAA-TEMPO˙, provided additional protection of surface modified erythrocytes in an in vitro model of oxidative stress. Preserving or augmenting cytoprotective mechanisms that extend circulation half-life is an important consideration for the use of red blood cells for drug delivery in various pathologies, as they are likely to encounter areas of imbalanced oxidative stress as they circuit the vascular system.

  3. The Effect of Covalently-Attached ATRP-Synthesized Polymers on Membrane Stability and Cytoprotection in Human Erythrocytes.

    Directory of Open Access Journals (Sweden)

    William P Clafshenkel

    Full Text Available Erythrocytes have been described as advantageous drug delivery vehicles. In order to ensure an adequate circulation half-life, erythrocytes may benefit from protective enhancements that maintain membrane integrity and neutralize oxidative damage of membrane proteins that otherwise facilitate their premature clearance from circulation. Surface modification of erythrocytes using rationally designed polymers, synthesized via atom-transfer radical polymerization (ATRP, may further expand the field of membrane-engineered red blood cells. This study describes the fate of ATRP-synthesized polymers that were covalently attached to human erythrocytes as well as the effect of membrane engineering on cell stability under physiological and oxidative conditions in vitro. The biocompatible, membrane-reactive polymers were homogenously retained on the periphery of modified erythrocytes for at least 24 hours. Membrane engineering stabilized the erythrocyte membrane and effectively neutralized oxidative species, even in the absence of free-radical scavenger-containing polymers. The targeted functionalization of Band 3 protein by NHS-pDMAA-Cy3 polymers stabilized its monomeric form preventing aggregation in the presence of the crosslinking reagent, bis(sulfosuccinimidylsuberate (BS3. A free radical scavenging polymer, NHS-pDMAA-TEMPO˙, provided additional protection of surface modified erythrocytes in an in vitro model of oxidative stress. Preserving or augmenting cytoprotective mechanisms that extend circulation half-life is an important consideration for the use of red blood cells for drug delivery in various pathologies, as they are likely to encounter areas of imbalanced oxidative stress as they circuit the vascular system.

  4. Cortactin overexpression results in sustained epidermal growth factor receptor signaling by preventing ligand-induced receptor degradation in human carcinoma cells

    NARCIS (Netherlands)

    van Rossum, AGSH; Gibcus, J; van der Wal, J; Schuuring, E


    The chromosome 11q13 region is frequently amplified in human carcinomas and results in an increased expression of various genes including cortactin, and is also associated with an increased invasive potential. Cortactin acts as an important regulator of the actin cytoskeleton. It is therefore very

  5. Curative Metatarsal Bone Surgery Combined with Intralesional Administration of Recombinant Human Epidermal Growth Factor in Diabetic Neuropathic Ulceration of the Forefoot: A Prospective, Open, Uncontrolled, Nonrandomized, Observational Study

    Directory of Open Access Journals (Sweden)

    Aristides L. Garcia Herrera, MD, PhD


    Conclusions: The combination of curative metatarsal bone surgery with intralesional administration of recombinant human EGF resulted in a significant reduction in the re-epithelization time, recidivism, and development of new diabetic lesions. The safety profile was appropriate. However, more randomized, triple-blind, and placebo trials are needed to evaluate the efficacy and safety of this new therapy.

  6. Neutron scattering studies on protein dynamics using the human myelin peripheral membrane protein P2

    Directory of Open Access Journals (Sweden)

    Laulumaa Saara


    Full Text Available Myelin is a multilayered proteolipid membrane structure surrounding selected axons in the vertebrate nervous system, which allows the rapid saltatory conduction of nerve impulses. Deficits in myelin formation and maintenance may lead to chronic neurological disease. P2 is an abundant myelin protein from peripheral nerves, binding between two apposing lipid bilayers. We studied the dynamics of the human myelin protein P2 and its mutated P38G variant in hydrated powders using elastic incoherent neutron scattering. The local harmonic vibrations at low temperatures were very similar for both samples, but the mutant protein had increased flexibility and softness close to physiological temperatures. The results indicate that a drastic mutation of proline to glycine at a functional site can affect protein dynamics, and in the case of P2, they may explain functional differences between the two proteins.

  7. Online determination of biophysical parameters of mucous membranes of a human body

    Energy Technology Data Exchange (ETDEWEB)

    Lisenko, S A; Kugeiko, M M [Belarusian State University, Minsk (Belarus)


    We have developed a method for online determination of biophysical parameters of mucous membranes (MMs) of a human body (transport scattering coefficient, scattering anisotropy factor, haemoglobin concentration, degrees of blood oxygenation, average diameter of capillaries with blood) from measurements of spectral and spatial characteristics of diffuse reflection. The method is based on regression relationships between linearly independent components of the measured light signals and the unknown parameters of MMs, obtained by simulation of the radiation transfer in the MM under conditions of its general variability. We have proposed and justified the calibration-free fibre-optic method for determining the concentration of haemoglobin in MMs by measuring the light signals diffusely reflected by the tissue in four spectral regions at two different distances from the illumination spot. We have selected the optimal wavelengths of optical probing for the implementation of the method. (laser applications in biology and medicine)

  8. Neutron scattering studies on protein dynamics using the human myelin peripheral membrane protein P2 (United States)

    Laulumaa, Saara; Kursula, Petri; Natali, Francesca


    Myelin is a multilayered proteolipid membrane structure surrounding selected axons in the vertebrate nervous system, which allows the rapid saltatory conduction of nerve impulses. Deficits in myelin formation and maintenance may lead to chronic neurological disease. P2 is an abundant myelin protein from peripheral nerves, binding between two apposing lipid bilayers. We studied the dynamics of the human myelin protein P2 and its mutated P38G variant in hydrated powders using elastic incoherent neutron scattering. The local harmonic vibrations at low temperatures were very similar for both samples, but the mutant protein had increased flexibility and softness close to physiological temperatures. The results indicate that a drastic mutation of proline to glycine at a functional site can affect protein dynamics, and in the case of P2, they may explain functional differences between the two proteins.

  9. [Molecular organization of glutamate-sensitive chemoexcitatory membranes of nerve cells. Comparative analysis of glutamate-binding membrane proteins from the cerebral cortex of rats and humans]. (United States)

    Dambinova, S A; Gorodinskiĭ, A I; Lekomtseva, T M; Koreshonkov, O N


    The kinetics of 3H-L-glutamate binding to human brain synaptic membranes revealed the existence of one type of binding sites with Kd and Vmax comparable with those for freshly isolated rat brain membranes. The fraction of glutamate-binding proteins (GBP) was shown to contain three components with Mr of 14, 60 and 280 kD whose stoichiometry is specific for human and rat brain. All fractions were found to bind the radiolabeled neurotransmitter and to dissociate into subunits with Mr of 14 kD after treatment with-potent detergents (with the exception of the 56-60 kD component). Study of association-dissociation of GBP protein subunits by high performance liquid chromatography confirmed the hypothesis on the oligomeric structure of glutamate receptors which are made up of low molecular weight glycoprotein-lipid subunits and which form ionic channels by way of repeated association. Despite the similarity of antigen determinants in the active center of glutamate receptors from human and rat brain, it was assumed that the stoichiometry of structural organization of receptor subunits isolated from different sources is different. The functional role of structural complexity of human brain glutamate receptors is discussed.

  10. Comprehensive quantitative comparison of the membrane proteome, phosphoproteome, and sialiome of human embryonic and neural stem cells

    DEFF Research Database (Denmark)

    Melo-Braga, Marcella Nunes; Schulz, Melanie; Liu, Qiuyue


    Human embryonic stem cells (hESCs) can differentiate into neural stem cells (NSCs), which can further be differentiated into neurons and glia cells. Therefore, these cells have huge potential as source for treatment of neurological diseases. Membrane-associated proteins are very important......ESCs and NSCs as well as to investigate potential new markers for these two cell stages, we performed large-scale quantitative membrane-proteomic of hESCs and NSCs. This approach employed membrane purification followed by peptide dimethyl labeling and peptide enrichment to study the membrane subproteome as well...... in which 78% of phosphopeptides were identified with ≥99% confidence in site assignment and 1810 unique formerly sialylated N-linked glycopeptides. Several proteins were identified as significantly regulated in hESCs and NSC, including proteins involved in the early embryonic and neural development...

  11. Fibronectin-synthesizing activity of free and membrane-bound polyribosomes from human embryonic fibroblasts and chick embryos

    International Nuclear Information System (INIS)

    Belkin, V.M.; Volodarskaya, S.M.


    The fibronectin-synthesizing activity of membrane-bound and free polyribosomes in a cell-free system was studied using immunochemical methods. It was found that fibronectin biosynthesis on membrane-bound polyribosomes from human embryonic fibroblasts accounts for 4.9% and those from 10-day-old chick embryos for 1.1% of the total amount of newly synthesized proteins, whereas on free polyribosomes it is 1.0 and 0.3%, respectively. Fibronectin monomers with a molecular weight of 220,000 were found only in the material of the cell-free system containing heavy fractions of membrane-bound polyribosomes newly synthesized in the presence of spermidine. Thus, it was shown that fibronectin is synthesized primarily on membrane-bound polyribosomes

  12. Effects of cobalt-60 ionizing radiation on human erythrocyte and its membrane proteins

    International Nuclear Information System (INIS)

    Amancio, Francisco Fernandes


    Ionizing radiation has several uses, as sterilization and radiotherapy, by its effects on living beings. recently, it has been used, at relatively lower doses (25 Gy), on blood for transfusions, mainly to eliminate undesirable graft host reactions, for use in multi transfused or immunocompromised patients. Here, we study the effect of larger doses of cobalt-60 ionizing radiation (25-1600 Gy) on human erythrocytes, by cytometric, physiologic, biochemical and immunological methods, looking for its effects and its detection. The red cells presented a clear dose-dependent increase in this volume, when irradiated in doses higher than 200 Gy, more significant in stored blood, but without hemolysis. Osmotic fragility was increased only after irradiation of more than 400 Gy. By ektacytometry, there was a lower deformability of irradiated red cells, at low stress (0.3 Pa), similar to capillary flow, but without alteration in higher stress (3 Pa), found in cardiac chambers. By SDS-PAGE, it was demonstrated that irradiated isolated erythrocyte membranes had aggregation of spectrin molecules, and decay of bands with lower molecular mass. This effect could be attributed to the radiation-induced hydroxyl radical, by specific scavenger studies. Those modifications were both antigenic and immunogenic in experimental animals, and the induced antibodies recognizes, by ELISA and immunoblot, both native or irradiated membrane proteins. They recognize rather irradiated whole erythrocyte than native ones, by hemagglutination, indirect immunofluorescence or flow cytometry assays. Our data suggests that human red cells could be irradiated at higher doses than those usually employed, with possible effect on other contaminant pathogens, without loss of viability of its use in transfusions. After improvements, irradiation induced epitopes detection could be a new tool in biological dosimetry. (author)

  13. Permeability of human placenta and fetal membranes to thyrotropin-stimulating hormone in vitro. (United States)

    Bajoria, R; Fisk, N M


    We determined the placental transfer of TSH in an in vitro model of dually perfused isolated lobule in 28 human term placentas by adding varying concentrations (5-60 microIU mL(-1)) of TSH as a single bolus dose to the closed maternal circulation. Transmembrane transfer of TSH was also studied by adding 45 microIU mL(-1) to the maternal or fetal compartment of a dual chamber of fetal membranes in culture. Passage of freely diffusible markers creatinine and antipyrine were also studied in this model. TSH concentration was measured by third generation chemiluminescence assay with a sensitivity of 10 mIU mL(-1). In the perfusion experiments, at physiologic concentrations the slow decline of TSH in the maternal circulation was associated with a small linear increase in fetal levels to 0.11 +/- 0.04% of initial dose at 2 h. The placental transfer rate was 0.08 microIU min(-1). Increasing maternal concentrations of TSH were associated with proportional increases in transfer rate (y = 0.002x; R2 = 0.99) and placental uptake (y = 0.01x; R2 = 0.97). The placental permeability of TSH was 2.4 x 10(-4) mL min(-1) g(-1) and was proportional to its coefficients of diffusion in water and molecular size. The transmembrane transfer and permeability of TSH was comparable to those of the placenta. We conclude that TSH crosses the human term placenta and fetal membranes sparingly.

  14. Effects of ionizing radiation on glycerolated amniotic membranes as a substract for cultured human epithelium

    International Nuclear Information System (INIS)

    Paggiaro, Andre Oliveira


    The amniotic membrane (AM) is a biomaterial with biological properties that are beneficial to tissue repair. It has been used as a temporary coverage to threat burns and chronic wounds. Recently, it has been served as a substrate for keratinocytes culture to construct a living skin equivalent. However, MA is a biological material, and its transplantation could cause infectious disease for receptors. So, it must be preserved and sterilized before clinical use. The aim of this study was to evaluate the radiation effects on glycerol-preserved MA, considering its compatibility to support human keratinocytes culture. Four MA were stored in high concentrations of glycerol (> 85%) and half of them were radio sterilized with a dose of 25 kGy. Then, we established two groups: nonirradiated MA (MA-ni) and irradiated MA (MA-i). Both groups was deepithelialized by a standardized protocol and was investigated morphologically, immunohistochemical and ultrastructural. Subsequently human keratinocytes were cultivated immersed and in air-liquid interface on denuded surface of MA-i and MA-ni. The results were compared at 14 and 21 days of culture by light and electron microscopy. After epithelial denudation, analyses demonstrated the continuity of the basement membrane in MA-ni group, whereas in the irradiated group, there was no indication of the basement membrane’s presence on the surface of MA. The cell cultures showed that in the non-irradiated group, there was growth of a multi-layered and differentiated epithelium, with a stratum corneum’s formation in air-liquid interface. In the irradiated group, the epithelium had only two or three layer, little cell differentiation, with the same results immersed or air-liquid interface system. Glycerol-preserved MA was biocompatible with the growth of a cultivated epithelium, showing its potential as a skin substitute. Irradiation at 25 kGy cause structural damage to the tissue, making changes in basement membrane, that facilitates

  15. Evolution of dinosaur epidermal structures. (United States)

    Barrett, Paul M; Evans, David C; Campione, Nicolás E


    Spectacularly preserved non-avian dinosaurs with integumentary filaments/feathers have revolutionized dinosaur studies and fostered the suggestion that the dinosaur common ancestor possessed complex integumentary structures homologous to feathers. This hypothesis has major implications for interpreting dinosaur biology, but has not been tested rigorously. Using a comprehensive database of dinosaur skin traces, we apply maximum-likelihood methods to reconstruct the phylogenetic distribution of epidermal structures and interpret their evolutionary history. Most of these analyses find no compelling evidence for the appearance of protofeathers in the dinosaur common ancestor and scales are usually recovered as the plesiomorphic state, but results are sensitive to the outgroup condition in pterosaurs. Rare occurrences of ornithischian filamentous integument might represent independent acquisitions of novel epidermal structures that are not homologous with theropod feathers. © 2015 The Author(s) Published by the Royal Society. All rights reserved.

  16. An in vitro study on the antioxidant capacity of usnic acid on human erythrocytes and molecular models of its membrane. (United States)

    Suwalsky, M; Jemiola-Rzeminska, M; Astudillo, C; Gallardo, M J; Staforelli, J P; Villena, F; Strzalka, K


    Usnic acid (UA) has been associated with chronic diseases through its antioxidant action. Its main target is the cell membrane; however, its effect on that of human erythrocytes has been scarcely investigated. To gain insight into the molecular mechanisms of the interaction between UA and cell membranes human erythrocytes and molecular models of its membrane have been utilized. Dimyristoylphosphatidylcholine (DMPC) and dimyristoylphosphatidylethanolamine (DMPE) were chosen as representative of phospholipid classes located in the outer and inner monolayers of the erythrocyte membrane, respectively. Results by X-ray diffraction showed that UA produced structural perturbations on DMPC and DMPE bilayers. DSC studies have indicated that thermotropic behavior of DMPE was most strongly distorted by UA than DMPC, whereas the latter is mainly affected on the pretransition. Scanning electron (SEM) and defocusing microscopy (DM) showed that UA induced alterations to erythrocytes from the normal discoid shape to echinocytes. These results imply that UA molecules were located in the outer monolayer of the erythrocyte membrane. Results of its antioxidant properties showed that UA neutralized the oxidative capacity of HClO on DMPC and DMPE bilayers; SEM, DM and hemolysis assays demonstrated the protective effect of UA against the deleterious oxidant effects of HClO upon human erythrocytes. Copyright © 2015 Elsevier B.V. All rights reserved.

  17. Epidermal Growth Factor Cytoplasmic Domain Affects ErbB Protein Degradation by the Lysosomal and Ubiquitin-Proteasome Pathway in Human Cancer Cells

    Directory of Open Access Journals (Sweden)

    Aleksandra Glogowska


    Full Text Available The cytoplasmic domains of EGF-like ligands, including EGF cytoplasmic domain (EGFcyt, have important biological functions. Using specific constructs and peptides of human EGF cytoplasmic domain, we demonstrate that EGFcyt facilitates lysosomal and proteasomal protein degradation, and this coincided with growth inhibition of human thyroid and glioma carcinoma cells. EGFcyt and exon 22–23-encoded peptide (EGF22.23 enhanced procathepsin B (procathB expression and procathB-mediated lysosomal degradation of EGFR/ErbB1 as determined by inhibitors for procathB and the lysosomal ATPase inhibitor BafA1. Presence of mbEGFctF, EGFcyt, EGF22.23, and exon 23-encoded peptides suppressed the expression of the deubiqitinating enzyme ubiquitin C-terminal hydrolase-L1 (UCH-L1. This coincided with hyperubiquitination of total cellular proteins and ErbB1/2 and reduced proteasome activity. Upon small interfering RNA-mediated silencing of endogenously expressed UCH-L1, a similar hyperubiquitinylation phenotype, reduced ErbB1/2 content, and attenuated growth was observed. The exon 23-encoded peptide region of EGFcyt was important for these biologic actions. Structural homology modeling of human EGFcyt showed that this molecular region formed an exposed surface loop. Peptides derived from this EGFcyt loop structure may aid in the design of novel peptide therapeutics aimed at inhibiting growth of cancer cells.

  18. Transport and biodistribution of dendrimers across human fetal membranes: implications for intravaginal administration of dendrimer-drug conjugates. (United States)

    Menjoge, Anupa R; Navath, Raghavendra S; Asad, Abbas; Kannan, Sujatha; Kim, Chong J; Romero, Roberto; Kannan, Rangaramanujam M


    Dendrimers are emerging as promising topical antimicrobial agents, and as targeted nanoscale drug delivery vehicles. Topical intravaginal antimicrobial agents are prescribed to treat the ascending genital infections in pregnant women. The fetal membranes separate the extra-amniotic space and fetus. The purpose of the study is to determine if the dendrimers can be selectively used for local intravaginal application to pregnant women without crossing the membranes into the fetus. In the present study, the transport and permeability of PAMAM (poly (amidoamine)) dendrimers, across human fetal membrane (using a side by side diffusion chamber), and its biodistribution (using immunofluorescence) are evaluated ex-vivo. Transport across human fetal membranes (from the maternal side) was evaluated using Fluorescein (FITC), an established transplacental marker (positive control, size approximately 400 Da) and fluorophore-tagged G(4)-PAMAM dendrimers (approximately 16 kDa). The fluorophore-tagged G(4)-PAMAM dendrimers were synthesized and characterized using (1)H NMR, MALDI TOF MS and HPLC analysis. Transfer was measured across the intact fetal membrane (chorioamnion), and the separated chorion and amnion layers. Over a 5 h period, the dendrimer transport across all the three membranes was less than dendrimer (5.8 x 10(-8) cm(2)/s). The biodistribution showed that the dendrimers were largely present in interstitial spaces in the decidual stromal cells and the chorionic trophoblast cells (in 2.5-4 h) and surprisingly, to a smaller extent internalized in nuclei of trophoblast cells and nuclei and cytoplasm of stromal cells. Passive diffusion and paracellular transport appear to be the major route for dendrimer transport. The overall findings further suggest that entry of drugs conjugated to dendrimers would be restricted across the human fetal membranes when administered topically by intravaginal route, suggesting new ways of selectively delivering therapeutics to the mother

  19. Evaluation of resorbable membrane in treatment of human gingival isolated buccal recession

    Directory of Open Access Journals (Sweden)

    Sumit Narang


    Conclusion: Resorbable membrane is a versatile treatment modality for coverage of isolated buccal gingival recession. Although membrane exposure occurred in four patients, it did not interfere with post operative healing.

  20. The human membrane cofactor CD46 is a receptor for species B adenovirus serotype 3. (United States)

    Sirena, Dominique; Lilienfeld, Benjamin; Eisenhut, Markus; Kälin, Stefan; Boucke, Karin; Beerli, Roger R; Vogt, Lorenz; Ruedl, Christiane; Bachmann, Martin F; Greber, Urs F; Hemmi, Silvio


    Many human adenovirus (Ad) serotypes use the coxsackie B virus-Ad receptor (CAR). Recently, CD46 was suggested to be a receptor of species B Ad serotype 11 (Ad11), Ad14, Ad16, Ad21, Ad35, and Ad50. Using Sindbis virus-mediated cDNA library expression, we identify here the membrane cofactor protein CD46 as a surface receptor of species B Ad3. All four major CD46 transcripts and one minor CD46 transcript expressed in nucleated human cells were isolated. Rodent BHK cells stably expressing the BC1 form of CD46 bound radiolabeled Ad3 with a dissociation constant of 0.3 nM, identical to that of CD46-positive HeLa cells expressing twice as many Ad3 binding sites. Pull-down experiments with recombinant Ad3 fibers and a soluble form of the CD46 extracellular domain linked to the Fc portion of human immunoglobulin G (CD46ex-Fc) indicated direct interactions of the Ad3 fiber knob with CD46ex-Fc but not CARex-Fc (Fc-linked extracellular domain of CAR). Ad3 colocalized with cell surface CD46 in both rodent and human cells at the light and electron microscopy levels. Anti-CD46 antibodies and CD46ex-Fc inhibited Ad3 binding to CD46-expressing BHK cells more than 10-fold and to human cells 2-fold. In CD46-expressing BHK cells, wild-type Ad3 and a chimeric Ad consisting of the Ad5 capsid and the Ad3 fiber elicited dose-dependent cytopathic effects and transgene expression, albeit less efficiently than in human cells. Together, our results show that all of the major splice forms of CD46 are predominant and functional binding sites of Ad3 on CD46-expressing rodent and human cells but may not be the sole receptor of species B Ads on human cells. These results have implications for understanding viral pathogenesis and therapeutic gene delivery.

  1. Biochemistry of epidermal stem cells. (United States)

    Eckert, Richard L; Adhikary, Gautam; Balasubramanian, Sivaprakasam; Rorke, Ellen A; Vemuri, Mohan C; Boucher, Shayne E; Bickenbach, Jackie R; Kerr, Candace


    The epidermis is an important protective barrier that is essential for maintenance of life. Maintaining this barrier requires continuous cell proliferation and differentiation. Moreover, these processes must be balanced to produce a normal epidermis. The stem cells of the epidermis reside in specific locations in the basal epidermis, hair follicle and sebaceous glands and these cells are responsible for replenishment of this tissue. A great deal of effort has gone into identifying protein epitopes that mark stem cells, in identifying stem cell niche locations, and in understanding how stem cell populations are related. We discuss these studies as they apply to understanding normal epidermal homeostasis and skin cancer. An assortment of stem cell markers have been identified that permit assignment of stem cells to specific regions of the epidermis, and progress has been made in understanding the role of these cells in normal epidermal homeostasis and in conditions of tissue stress. A key finding is the multiple stem cell populations exist in epidermis that give rise to different structures, and that multiple stem cell types may contribute to repair in damaged epidermis. Understanding epidermal stem cell biology is likely to lead to important therapies for treating skin diseases and cancer, and will also contribute to our understanding of stem cells in other systems. This article is part of a Special Issue entitled Biochemistry of Stem Cells. Copyright © 2012 Elsevier B.V. All rights reserved.

  2. Biochemistry of epidermal stem cells☆ (United States)

    Eckert, Richard L.; Adhikary, Gautam; Balasubramanian, Sivaprakasam; Rorke, Ellen A.; Vemuri, Mohan C.; Boucher, Shayne E.; Bickenbach, Jackie R.; Kerr, Candace


    Background The epidermis is an important protective barrier that is essential for maintenance of life. Maintaining this barrier requires continuous cell proliferation and differentiation. Moreover, these processes must be balanced to produce a normal epidermis. The stem cells of the epidermis reside in specific locations in the basal epidermis, hair follicle and sebaceous glands and these cells are responsible for replenishment of this tissue. Scope of review A great deal of effort has gone into identifying protein epitopes that mark stem cells, in identifying stem cell niche locations, and in understanding how stem cell populations are related. We discuss these studies as they apply to understanding normal epidermal homeostasis and skin cancer. Major conclusions An assortment of stem cell markers have been identified that permit assignment of stem cells to specific regions of the epidermis, and progress has been made in understanding the role of these cells in normal epidermal homeostasis and in conditions of tissue stress. A key finding is the multiple stem cell populations exist in epidermis that give rise to different structures, and that multiple stem cell types may contribute to repair in damaged epidermis. General significance Understanding epidermal stem cell biology is likely to lead to important therapies for treating skin diseases and cancer, and will also contribute to our understanding of stem cells in other systems. This article is part of a Special Issue entitled Biochemistry of Stem Cells. PMID:22820019

  3. Programmed Fetal Membrane Senescence and Exosome-Mediated Signaling: A Mechanism Associated With Timing of Human Parturition

    Directory of Open Access Journals (Sweden)

    Ramkumar Menon


    Full Text Available Human parturition is an inflammatory process that involves both fetal and maternal compartments. The precise immune cell interactions have not been well delineated in human uterine tissues during parturition, but insights into human labor initiation have been informed by studies in animal models. Unfortunately, the timing of parturition relative to fetal maturation varies among viviparous species—indicative of different phylogenetic clocks and alarms—but what is clear is that important common pathways must converge to control the birth process. Herein, we hypothesize a novel signaling mechanism initiated by human fetal membrane aging and senescence-associated inflammation. Programmed events of fetal membrane aging coincide with fetal growth and organ maturation. Mechanistically, senescence involves in telomere shortening and activation of p38 mitogen-activated signaling kinase resulting in aging-associated phenotypic transition. Senescent tissues release inflammatory signals that are propagated via exosomes to cause functional changes in maternal uterine tissues. In vitro, oxidative stress causes increased release of inflammatory mediators (senescence-associated secretory phenotype and damage-associated molecular pattern markers that can be packaged inside the exosomes. These exosomes traverse through tissues layers, reach maternal tissues to increase overall inflammatory load transitioning them from a quiescent to active state. Animal model studies have shown that fetal exosomes can travel from fetal to the maternal side. Thus, aging fetal membranes and membrane-derived exosomes cargo fetal signals to the uterus and cervix and may trigger parturition. This review highlights a novel hypothesis in human parturition research based on data from ongoing research using human fetal membrane model system.

  4. Human islet viability and function is maintained during high density shipment in silicone rubber membrane vessels (United States)

    Kitzmann, Jennifer P; Pepper, Andrew R; Lopez, Boris G; Pawlick, Rena; Kin, Tatsuya; O’Gorman, Doug; Mueller, Kathryn R; Gruessner, Angelika C; Avgoustiniatos, Efstathios S; Karatzas, Theodore; Szot, Greg L; Posselt, Andrew M; Stock, Peter G; Wilson, John R; Shapiro, AM; Papas, Klearchos K


    The shipment of human islets from processing centers to distant laboratories is beneficial for both research and clinical applications. The maintenance of islet viability and function in transit is critically important. Gas-permeable silicone rubber membrane (SRM) vessels reduce the risk of hypoxia-induced death or dysfunction during high-density islet culture or shipment. SRM vessels may offer additional advantages: they are cost-effective (fewer flasks, less labor needed), safer (lower contamination risk), and simpler (culture vessel can also be used for shipment). Human islets(IE) were isolated from two manufacturing centers and shipped in 10cm2 surface area SRM vessels in temperature and pressure controlled containers to a distant center following at least two days of culture (n = 6). Three conditions were examined: low density (LD), high density (HD), and a micro centrifuge tube negative control (NC). LD was designed to mimic the standard culture density for human islet preparations (200 IE/cm2), while HD was designed to have a 20-fold higher tissue density, which would enable the culture of an entire human isolation in 1–3 vessels. Upon receipt, islets were assessed for viability, measured by oxygen consumption rate normalized to DNA content (OCR/DNA), and quantity, measured by DNA, and, when possible, potency and function with dynamic glucose-stimulated insulin secretion (GSIS) measurements and transplants in immunodeficient B6 rag mice. Post-shipment OCR/DNA was not reduced in HD versus LD, and was substantially reduced in the NC condition. HD islets exhibited normal function post-shipment. Based on the data we conclude that entire islet isolations (up to 400,000 IE) may be shipped using a single, larger SRM vessel with no negative effect on viability and ex vivo and in vivo function. PMID:25131090

  5. Cryopreserved Ultra-Thick Human Amniotic Membrane for Conjunctival Surface Reconstruction After Excision of Conjunctival Tumors. (United States)

    Tanaka, Thais S; Demirci, Hakan


    Cryopreserved ultra-thick human amniotic membrane (AM) is used for glaucoma surgery. We evaluated the use of cryopreserved ultra-thick human AM for conjunctival surface reconstruction after excision of a conjunctival tumor. We retrospectively reviewed the medical records of 28 patients who underwent conjunctival surface reconstruction with cryopreserved ultra-thick human AM after excision of the tumor. The AM was secured to the surrounding conjunctiva and underlying sclera with interrupted 8-0 Vicryl sutures. Clinical data regarding demographics, diagnosis, size and location of conjunctival tumors, patient outcome, and complications were gathered. Of 28 patients, 6 (21.4%) had malignant melanoma, 4 (14.3%) had squamous cell carcinoma, 6 (21.4%) had conjunctival intraepithelial neoplasia, 1 (3.6%) had sebaceous carcinoma, 1 (3.6%) had mucoepidermoid carcinoma, 1 (3.6%) had conjunctival intraepithelial dysplasia, 5 (17.9%) had pterygium, 2 (7.1%) had compound nevus, 1 (3.6%) had a large epithelial inclusion cyst, and 1 (3.6%) patient had a granuloma. The mean area of graft size was 156 ± 120 mm2. Postoperatively, the graft was well tolerated with no failure, discomfort, or dehiscence. During the 17-month mean follow-up, symblepharon, which was clinically nonsignificant, developed in 3 (11%) patients and partial stem cell deficiency was noted in 5 (18%) patients. Cryopreserved ultra-thick human AM is a well-tolerated, effective graft material that is easy to handle. It is a viable alternative for conjunctival surface reconstruction after excision of a conjunctival tumor.

  6. The human periodontal membrane: focusing on the spatial interrelation between the epithelial layer of Malassez, fibers, and innervation

    DEFF Research Database (Denmark)

    Kjaer, Inger; Nolting, Dorrit


    OBJECTIVE: The purpose of the present study was to map the spatial interrelation of fibers, peripheral nerves, and epithelial layer of Malassez in human periodontal membrane in areas close to the root surfaces. MATERIAL AND METHODS: Four healthy permanent teeth extracted from four patients during...

  7. Analysis of Vibrant Soundbridge placement against the round window membrane in a human cadaveric temporal bone model.

    NARCIS (Netherlands)

    Pennings, R.J.E.; Ho, A.; Brown, J.; Wijhe, R.G. van; Bance, M.


    OBJECTIVE: To evaluate optimal placement of the Floating Mass Transducer of the Vibrant Soundbridge (Med-El, Innsbruck, Austria) against the round window membrane, particularly the impact of interposed coupling fascia and of covering materials. METHOD: : Six fresh human cadaveric temporal bones were

  8. Differential expression profiling of membrane proteins by quantitative proteomics in a human mesenchymal stem cell line undergoing osteoblast differentiation

    DEFF Research Database (Denmark)

    Foster, Leonard J; Zeemann, Patricia A; Li, Chen


    in a cell model of hMSCs established by overexpression of human telomerase reverse-transcriptase gene. We identified 463 unique proteins with extremely high confidence, including all known markers of hMSCs (e.g., SH3 [CD71], SH2 [CD105], CD166, CD44, Thy1, CD29, and HOP26 [CD63]) among 148 integral membrane...

  9. Nukbone® promotes proliferation and osteoblastic differentiation of mesenchymal stem cells from human amniotic membrane

    International Nuclear Information System (INIS)

    Rodríguez-Fuentes, Nayeli; Rodríguez-Hernández, Ana G.; Enríquez-Jiménez, Juana; Alcántara-Quintana, Luz E.; Fuentes-Mera, Lizeth; Piña-Barba, María C.; Zepeda-Rodríguez, Armando


    Highlights: •Nukbone showed to be a good scaffold for adhesion, proliferation and differentiation of stem cells. •Nukbone induced osteoblastic differentiation of human mesenchymal stem cells. •Results showed that Nukbone offer an excellent option for bone tissue regeneration due to properties. -- Abstract: Bovine bone matrix Nukbone® (NKB) is an osseous tissue-engineering biomaterial that retains its mineral and organic phases and its natural bone topography and has been used as a xenoimplant for bone regeneration in clinics. There are not studies regarding its influence of the NKB in the behavior of cells during the repairing processes. The aim of this research is to demonstrate that NKB has an osteoinductive effect in human mesenchymal stem cells from amniotic membrane (AM-hMSCs). Results indicated that NKB favors the AM-hMSCs adhesion and proliferation up to 7 days in culture as shown by the scanning electron microscopy and proliferation measures using an alamarBlue assay. Furthermore, as demonstrated by reverse transcriptase polymerase chain reaction, it was detected that two gene expression markers of osteoblastic differentiation: the core binding factor and osteocalcin were higher for AM-hMSCs co-cultured with NKB in comparison with cultivated cells in absence of the biomaterial. As the results indicate, NKB possess the capability for inducing successfully the osteoblastic differentiation of AM-hMSC, so that, NKB is an excellent xenoimplant option for repairing bone tissue defects

  10. Nukbone® promotes proliferation and osteoblastic differentiation of mesenchymal stem cells from human amniotic membrane

    Energy Technology Data Exchange (ETDEWEB)

    Rodríguez-Fuentes, Nayeli; Rodríguez-Hernández, Ana G. [Depto. Microbiología y Parasitología, Facultad de Medicina, Universidad Nacional Autónoma de México (UNAM), Mexico City 04510 (Mexico); Enríquez-Jiménez, Juana [Depto. Biología de la Reproducción, Instituto Nacional de Ciencias Médicas y Nutrición Salvador Zubirán (INCMNSZ), México City 14000 (Mexico); Alcántara-Quintana, Luz E. [Subd. de Investigación, Centro Nacional de la Transfusión Sanguínea, Secretaria de Salud, Mexico City 07370 (Mexico); Fuentes-Mera, Lizeth [Depto. Biología Molecular e Histocompatibilidad, Hospital General “Dr. Manuel Gea González”, México City 4800 (Mexico); Piña-Barba, María C. [Depto. Materiales Metálicos y Cerámicos, Instituto de Investigaciones en Materiales, Universidad Nacional Autónoma de México (UNAM), México City 04510 (Mexico); Zepeda-Rodríguez, Armando [Depto. Biología Celular y Tisular, Facultad de Medicina, Universidad Nacional Autónoma de México (UNAM), México City 04510 (Mexico); and others


    Highlights: •Nukbone showed to be a good scaffold for adhesion, proliferation and differentiation of stem cells. •Nukbone induced osteoblastic differentiation of human mesenchymal stem cells. •Results showed that Nukbone offer an excellent option for bone tissue regeneration due to properties. -- Abstract: Bovine bone matrix Nukbone® (NKB) is an osseous tissue-engineering biomaterial that retains its mineral and organic phases and its natural bone topography and has been used as a xenoimplant for bone regeneration in clinics. There are not studies regarding its influence of the NKB in the behavior of cells during the repairing processes. The aim of this research is to demonstrate that NKB has an osteoinductive effect in human mesenchymal stem cells from amniotic membrane (AM-hMSCs). Results indicated that NKB favors the AM-hMSCs adhesion and proliferation up to 7 days in culture as shown by the scanning electron microscopy and proliferation measures using an alamarBlue assay. Furthermore, as demonstrated by reverse transcriptase polymerase chain reaction, it was detected that two gene expression markers of osteoblastic differentiation: the core binding factor and osteocalcin were higher for AM-hMSCs co-cultured with NKB in comparison with cultivated cells in absence of the biomaterial. As the results indicate, NKB possess the capability for inducing successfully the osteoblastic differentiation of AM-hMSC, so that, NKB is an excellent xenoimplant option for repairing bone tissue defects.

  11. Biological Activity Alterations of Human Amniotic Membrane Pre and Post Irradiation Tissue Banking. (United States)

    Nemr, Waleed; Bashandy, A S; Araby, Eman; Khamiss, O

    Innate immunity of Human Amniotic Membrane (HAM) and its highly active secretome that rich with various types of growth factors and anti-inflammatory substances proposed it as a promising material for many medical studies and applications. This study evaluate the biological activity of cultivated HAM pre and post tissue banking process in which freeze-dried HAM was sterilized by 25 KGray (kGy) dose of γ radiation. The HAM's antimicrobial activity, viability, growth of isolated human amniotic epithelial cells (HAECs), hematopoietic stimulation of co-cultivated murine bone marrow cells (mammalian model), scaffold efficiency for fish brain building up (non-mammalian model) and self re-epithelialization after trypsin denuding treatment were examined as supposed biological activity features. Native HAM revealed viability indications and was active to kill all tested microorganisms; 6 bacterial species (3 Gram-positive and 3 Gram-negative) and Candida albicans as a pathogenic fungus. Also, HAM activity promoted colony formation of murine hematopoietic cells, Tilapia nilotica brain fragment building-up and self re-epithelialization after trypsin treatment. In contrary, radiation-based tissue banking of HAM caused HAM cellular death and consequently lacked almost all of examined biological activity features. Viable HAM was featured with biological activity than fixed HAM prepared by irradiation tissue banking.

  12. Selective radiolabeling and isolation of the hydrophobic membrane-binding domain of human erythrocyte acetylcholinesterase

    International Nuclear Information System (INIS)

    Roberts, W.L.; Rosenberry, T.L.


    The hydrophobic, membrane-binding domain of purified human erythrocyte acetylcholinesterase was labeled with the photoactivated reagent 3-(trifluoromethyl)-3-(m-[ 125 I]iodophenyl)diazirine. The radiolabel was incorporated when the enzyme was prepared in detergent-free aggregates, in detergent micelles, or in phospholipid liposomes, but the highest percentage of labeling occurred in the detergent-free aggregates. Papain digestion of the enzyme released the hydrophobic domain, and polyacrylamide gel electrophoresis in sodium dodecyl sulfate or gel exclusion chromatography demonstrated that the label was localized exclusively in the cleaved hydrophobic domain fragment. This fragment was purified in a three-step procedure. Digestion was conducted with papain attached to Sepharose CL-4B, and the supernatant was adsorbed to acridinium affinity resin to remove the hydrophilic enzyme fragment. The nonretained fragment associated with Triton X-100 micelles was then chromatographed on Sepharose CL-6B, and finally detergent was removed by chromatography on Sephadex LH-60 in an ethanol-formic acid solvent. The fragment exhibited an apparent molecular weight of 3100 on the Sephadex LH-60 column when compared with peptide standards. However, amino acid analysis of the purified fragment revealed only 1 mol each of histidine and glycine per mole of fragment in contrast to the 25-30 mole of amino acids expected on the basis of the molecular weight estimate. This result suggests a novel non-amino acid structure for the hydrophobic domain of human erythrocyte acetylcholinesterase

  13. Epidermal Growth Factor Receptor in Pancreatic Cancer

    International Nuclear Information System (INIS)

    Oliveira-Cunha, Melissa; Newman, William G.; Siriwardena, Ajith K.


    Pancreatic cancer is the fourth leading cause of cancer related death. The difficulty in detecting pancreatic cancer at an early stage, aggressiveness and the lack of effective therapy all contribute to the high mortality. Epidermal growth factor receptor (EGFR) is a transmembrane glycoprotein, which is expressed in normal human tissues. It is a member of the tyrosine kinase family of growth factors receptors and is encoded by proto-oncogenes. Several studies have demonstrated that EGFR is over-expressed in pancreatic cancer. Over-expression correlates with more advanced disease, poor survival and the presence of metastases. Therefore, inhibition of the EGFR signaling pathway is an attractive therapeutic target. Although several combinations of EGFR inhibitors with chemotherapy demonstrate inhibition of tumor-induced angiogenesis, tumor cell apoptosis and regression in xenograft models, these benefits remain to be confirmed. Multimodality treatment incorporating EGFR-inhibition is emerging as a novel strategy in the treatment of pancreatic cancer

  14. In vivo anticancer evaluation of the hyperthermic efficacy of anti-human epidermal growth factor receptor-targeted PEG-based nanocarrier containing magnetic nanoparticles

    Directory of Open Access Journals (Sweden)

    Baldi G


    Full Text Available Giovanni Baldi,1 Costanza Ravagli,1 Filippo Mazzantini,1 George Loudos,2 Jaume Adan,3 Marc Masa,3 Dimitrios Psimadas,2 Eirini A Fragogeorgi,2 Erica Locatelli,4 Claudia Innocenti,5,6 Claudio Sangregorio,5,7 Mauro Comes Franchini4 1CERICOL, Sovigliana-Vinci, Italy; 2Technological Educational Institute of Athens, Athens, Greece; 3Leitat Technological Center, Barcelona, Spain; 4Department of Industrial Chemistry Toso Montanari, University of Bologna, Bologna, 5Consorzio Interuniversitario Nazionale per la Scienza e Tecnologia dei Materiali (INSTM, 6Dipartimento di Chimica U Schiff, Università di Firenze, Firenze, 7Centro Nazionale delle Ricerche (ICCOM – CNR, Firenze, Italy Abstract: Polymeric nanoparticles with targeting moieties containing magnetic nanoparticles as theranostic agents have considerable potential for the treatment of cancer. Here we report the chemical synthesis and characterization of a poly(D,L-lactide-co-glycolide-b-poly(ethylene glycol-based nanocarrier containing iron oxide nanoparticles and human epithelial growth factor receptor on the outer shell. The nanocarrier was also radiolabeled with 99mTc and tested as a theranostic nanomedicine, ie, it was investigated for both its diagnostic ability in vivo and its therapeutic hyperthermic effects in a standard A431 human tumor cell line. Following radiolabeling with 99mTc, the biodistribution and therapeutic hyperthermic effects of the nanosystem were studied noninvasively in vivo in tumor-bearing mice. A substantial decrease in tumor size correlated with an increase in both nanoparticle concentration and local temperature was achieved, confirming the possibility of using this multifunctional nanosystem as a therapeutic tool for epidermoid carcinoma. Keywords: magnetic nanoparticles, polymeric nanocarriers, skin cancer, hyperthermia, single-photon emission computed tomography, imaging

  15. The impact of thickness of resorbable membrane of human origin on the ossification of bone defects: A pathohistologic study

    Directory of Open Access Journals (Sweden)

    Bubalo Marija


    Full Text Available Background/Aim. A wide range of resorbable and nonresorbable membranes have been investigated over the last two decades. The barrier membrane protects the defect from ingrowth of soft tissue cells and allows bone progenitor cells to develop bone within a blood clot that is formed beneath the barrier membrane. The membranes are applied to reconstruct small bony defect prior to implantation, to cover dehiscences and fenestrations around dental implants. The aim of this study was to evaluate the influence of human resorbable demineralized membrane (RHDM thickness on bone regeneration. Methods. The experiment, approved by Ethical Committee, was performed on 6 dogs and conducted into three phases. Bone defects were created in all the 6 dogs on the left side of the mandible, 8 weeks after extraction of second, third and fourth premolars. One defect was covered with RHDM 100 μ thick, one with RHDM 200 μ thick, and the third defect left empty (control defect. The histopathological analysis was done 2, 4 and 6 months after the surgery. In the third phase samples of bone tissue were taken and subjected to histopathological analysis. Results. In all the 6 dogs the defects treated with RHDM 200 μ thick showed higher level of bone regeneration in comparison with the defect treated with RHDM 100 μ thick and especially with empty defect. Conclusion. Our results demonstrated that the thicker membrane showed the least soft tissue ingrowths and promoted better bone formation at 6 months compared with a thinner one.

  16. The Human ABCG1 Transporter Mobilizes Plasma Membrane and Late Endosomal Non-Sphingomyelin-Associated-Cholesterol for Efflux and Esterification

    Directory of Open Access Journals (Sweden)

    Edward B. Neufeld


    Full Text Available We have previously shown that GFP-tagged human ABCG1 on the plasma membrane (PM and in late endosomes (LE mobilizes sterol on both sides of the membrane lipid bilayer, thereby increasing cellular cholesterol efflux to lipid surfaces. In the present study, we examined ABCG1-induced changes in membrane cholesterol distribution, organization, and mobility. ABCG1-GFP expression increased the amount of mobile, non-sphingomyelin(SM-associated cholesterol at the PM and LE, but not the amount of SM-associated-cholesterol or SM. ABCG1-mobilized non-SM-associated-cholesterol rapidly cycled between the PM and LE and effluxed from the PM to extracellular acceptors, or, relocated to intracellular sites of esterification. ABCG1 increased detergent-soluble pools of PM and LE cholesterol, generated detergent-resistant, non-SM-associated PM cholesterol, and increased resistance to both amphotericin B-induced (cholesterol-mediated and lysenin-induced (SM-mediated cytolysis, consistent with altered organization of both PM cholesterol and SM. ABCG1 itself resided in detergent-soluble membrane domains. We propose that PM and LE ABCG1 residing at the phase boundary between ordered (Lo and disordered (Ld membrane lipid domains alters SM and cholesterol organization thereby increasing cholesterol flux between Lo and Ld, and hence, the amount of cholesterol available for removal by acceptors on either side of the membrane bilayer for either efflux or esterification.

  17. Antibody-induced dimerization activates the epidermal growth factor receptor tyrosine kinase

    NARCIS (Netherlands)

    Spaargaren, M.; Defize, L. H.; Boonstra, J.; de Laat, S. W.


    The relationship between epidermal growth factor receptor (EGF-R) protein tyrosine kinase activation and ligand-induced receptor dimerization was investigated using several bivalent anti-EGF-R antibodies directed against various receptor epitopes. In A431 membrane preparations and permeabilized

  18. Atomic resolution view into the structure–function relationships of the human myelin peripheral membrane protein P2

    Energy Technology Data Exchange (ETDEWEB)

    Ruskamo, Salla [University of Oulu, Oulu (Finland); University of Oulu, Oulu (Finland); Yadav, Ravi P. [Banaras Hindu University, Varanasi (India); Helmholtz Centre for Infection Research (CSSB-HZI), German Electron Synchrotron (DESY), Hamburg (Germany); Sharma, Satyan; Lehtimäki, Mari [University of Oulu, Oulu (Finland); University of Oulu, Oulu (Finland); Laulumaa, Saara [University of Oulu, Oulu (Finland); University of Oulu, Oulu (Finland); Helmholtz Centre for Infection Research (CSSB-HZI), German Electron Synchrotron (DESY), Hamburg (Germany); Aggarwal, Shweta; Simons, Mikael [Max Planck Institute for Experimental Medicine, Göttingen (Germany); Bürck, Jochen; Ulrich, Anne S. [Karlsruhe Institute for Technology (KIT), Karlsruhe (Germany); Juffer, André H. [University of Oulu, Oulu (Finland); University of Oulu, Oulu (Finland); Kursula, Inari [University of Oulu, Oulu (Finland); Helmholtz Centre for Infection Research (CSSB-HZI), German Electron Synchrotron (DESY), Hamburg (Germany); Kursula, Petri, E-mail: [University of Oulu, Oulu (Finland); University of Oulu, Oulu (Finland); Helmholtz Centre for Infection Research (CSSB-HZI), German Electron Synchrotron (DESY), Hamburg (Germany); University of Hamburg, Hamburg (Germany)


    The structure of the human myelin peripheral membrane protein P2 has been refined at 0.93 Å resolution. In combination with functional experiments in vitro, in vivo and in silico, the fine details of the structure–function relationships in P2 are emerging. P2 is a fatty acid-binding protein expressed in vertebrate peripheral nerve myelin, where it may function in bilayer stacking and lipid transport. P2 binds to phospholipid membranes through its positively charged surface and a hydrophobic tip, and accommodates fatty acids inside its barrel structure. The structure of human P2 refined at the ultrahigh resolution of 0.93 Å allows detailed structural analyses, including the full organization of an internal hydrogen-bonding network. The orientation of the bound fatty-acid carboxyl group is linked to the protonation states of two coordinating arginine residues. An anion-binding site in the portal region is suggested to be relevant for membrane interactions and conformational changes. When bound to membrane multilayers, P2 has a preferred orientation and is stabilized, and the repeat distance indicates a single layer of P2 between membranes. Simulations show the formation of a double bilayer in the presence of P2, and in cultured cells wild-type P2 induces membrane-domain formation. Here, the most accurate structural and functional view to date on P2, a major component of peripheral nerve myelin, is presented, showing how it can interact with two membranes simultaneously while going through conformational changes at its portal region enabling ligand transfer.

  19. Clinical effects of prior trastuzumab on combination eribulin mesylate plus trastuzumab as first-line treatment for human epidermal growth factor receptor 2 positive locally recurrent or metastatic breast cancer: results from a Phase II, single-arm, multicenter study

    Directory of Open Access Journals (Sweden)

    Puhalla S


    Full Text Available Shannon Puhalla,1 Sharon Wilks,2 Adam M Brufsky,1 Joyce O’Shaughnessy,3 Lee S Schwartzberg,4 Erhan Berrak,5 James Song,5 Linda Vahdat6 1Department of Hematology and Oncology, University of Pittsburgh Medical Center, Pittsburgh, PA, 2Department of Hematology Oncology, US Oncology-Cancer Care Centers of South Texas, San Antonio, TX, 3Department of Medical Oncology, Texas Oncology-Baylor Charles A. Sammons Cancer Center US Oncology, Dallas, TX, 4Department of Hematology/Oncology, West Cancer Center, University of Tennessee Health Science Center, Memphis, TN, 5Department of Medical Affairs, Formerly of Eisai Inc., Woodcliff Lake, NJ, 6Department of Medicine, Weill Cornell Medical College, New York, NY, USA Abstract: Eribulin mesylate, a novel nontaxane microtubule dynamics inhibitor in the halichondrin class of antineoplastic drugs, is indicated for the treatment of patients with metastatic breast cancer who previously received ≥2 chemotherapy regimens in the metastatic setting. Primary data from a Phase II trial for the first-line combination of ­eribulin plus trastuzumab in human epidermal growth factor receptor 2 positive patients showed a 71% objective response rate and tolerability consistent with the known profile of these agents. Here, we present prespecified analyses of efficacy of this combination based on prior trastuzumab use. Patients received eribulin mesylate 1.4 mg/m2 (equivalent to 1.23 mg/m2 eribulin [expressed as free base] intravenously on days 1 and 8 plus trastuzumab (8 mg/kg intravenously/cycle 1, then 6 mg/kg on day 1 of each 21-day cycle. Objective response rates, progression-free survival, and tolerability were assessed in patients who had and had not received prior adjuvant or neoadjuvant (neo/adjuvant trastuzumab treatment. Fifty-two patients (median age: 59.5 years received eribulin/trastuzumab for a median treatment duration of ~31 weeks; 40.4% (n=21 had been previously treated with neo/adjuvant trastuzumab prior to

  20. In vitro effects of the anti-Alzheimer drug memantine on the human erythrocyte membrane and molecular models

    International Nuclear Information System (INIS)

    Zambrano, Pablo; Suwalsky, Mario; Villena, Fernando; Jemiola-Rzeminska, Malgorzata; Strzalka, Kazimierz


    Memantine is a NMDA antagonist receptor clinically used for treating Alzheimer's disease. NMDA receptors are present in the human neurons and erythrocyte membranes. The aim of the present study was to investigate the effects of memantine on human erythrocytes. With this purpose, the drug was developed to in vitro interact with human red cells and bilayers built-up of dimyristoylphosphatidylcholine (DMPC) and dimyristoylphosphatidylethanolamine (DMPE). The latter represent lipids respectively present in both outer and inner monolayers of the red cell membrane. Results obtained by scanning electron microscopy (SEM) showed that memantine changed the normal biconcave shape of red cells to cup-shaped stomatocytes. According to the bilayer-couple hypothesis the drug intercalated into the inner monolayer of the erythrocyte membrane. Experimental results obtained by X-ray diffraction on multibilayers of DMPC and DMPE, and by differential scanning calorimetry on multilamellar vesicles indicated that memantine preferentially interacted with DMPC in a concentration-dependent manner. Thus, it can be concluded that in the low therapeutic plasma concentration of circa 1 μM memantine is located in NMDA receptor channel without affecting the erythrocyte shape. However, at higher concentrations, once the receptors became saturated excess of memantine molecules (20 μM) would interact with phosphoinositide lipids present in the inner monolayer of the erythrocyte membrane inducing the formation of stomatocytes. However, 40–50 μM memantine was required to interact with isolated phosphatidylcholine bilayers. - Highlights: • The interaction of memantine with human erythrocytes and lipid bilayers were assessed. • Memantine induced morphological changes to human erythrocytes. • Memantine interacted with classes of phospholipids present in the erythrocyte membrane. • Results support the hypothesis that memantine interacts with NMDA receptors.

  1. The Effect of Scala Tympani Morphology on Basilar Membrane Contact With a Straight Electrode Array: A Human Temporal Bone Study. (United States)

    Verberne, Juul; Risi, Frank; Campbell, Luke; Chambers, Scott; O'Leary, Stephen


    Scala tympani morphology influences the insertion dynamics and intra-scalar position of straight electrode arrays. Hearing preservation is the goal of cochlear implantation with current thin straight electrode arrays. These hug the lateral wall, facilitating full, atraumatic insertions. However, most studies still report some postoperative hearing loss. This study explores the influence of scala tympani morphology on array position relative to the basilar membrane and its possible contribution to postoperative hearing loss. Twenty-six fresh-frozen human temporal bones implanted with a straight electrode array were three-dimensionally reconstructed from micro-photographic histological sections. Insertion depth and the proximity between the array and basilar membrane were recorded. Lateral wall shape was quantified as a curvature ratio. Insertion depths ranged from 233 to 470 degrees. The mean first point of contact between the array and basilar membrane was 185 degrees; arrays tended to remain in contact with the membrane after first contacting it. Eighty-nine and 93% of arrays that reached the upper basal (>240-360 degrees) and second (>360-720 degrees) turns respectively contacted the basilar membrane in these regions. Scalar wall curvature ratio decreased significantly (the wall became steeper) from the basal to second turns. This shift correlated with a reduced distance between the array and basilar membrane. Scala tympani morphology influences the insertion dynamics and intra-scalar position of a straight electrode array. In addition to gross trauma of cochlear structures, contact between the array and basilar membrane and how this impacts membrane function should be considered in hearing preservation cases.

  2. Phase II Study of Paclitaxel Given Once per Week Along With Trastuzumab and Pertuzumab in Patients With Human Epidermal Growth Factor Receptor 2–Positive Metastatic Breast Cancer (United States)

    Dang, Chau; Iyengar, Neil; Datko, Farrah; D'Andrea, Gabriella; Theodoulou, Maria; Dickler, Maura; Goldfarb, Shari; Lake, Diana; Fasano, Julie; Fornier, Monica; Gilewski, Theresa; Modi, Shanu; Gajria, Devika; Moynahan, Mary Ellen; Hamilton, Nicola; Patil, Sujata; Jochelson, Maxine; Norton, Larry; Baselga, Jose; Hudis, Clifford


    Purpose The CLEOPATRA (Clinical Evaluation of Trastuzumab and Pertuzumab) study demonstrated superior progression-free survival (PFS) and overall survival when pertuzumab was added to trastuzumab and docetaxel. Paclitaxel given once per week is effective and less toxic than docetaxel. We performed a phase II study to evaluate the efficacy and safety of pertuzumab and trastuzumab with paclitaxel given once per week. Patients and Methods Patients with metastatic human epidermal growth factor receptor 2–positive breast cancer with zero to one prior therapy were enrolled. Treatment consisted of paclitaxel 80 mg/m2 once per week plus trastuzumab (8 mg/kg loading dose → 6 mg/kg) once every 3 weeks plus pertuzumab (840 mg loading dose → 420 mg) once every 3 weeks, all given intravenously. The primary end point was 6-month PFS assessed by Kaplan-Meier methods. Results From January 2011 to December 2013, we enrolled 69 patients: 51 (74%) and 18 (26%) treated in first- and second-line metastatic settings, respectively. At a median follow-up of 21 months (range, 3 to 38 months), 6-month PFS was 86% (95% CI, 75% to 92%). The median PFS was 19.5 months (95% CI, 14 to 26 months) overall. PFS was 24.2 months (95% CI, 14 months to not reached [NR]) and 16.4 months (95% CI, 8.5 months to NR) for those without and with prior treatment, respectively. At 1 year, Kaplan-Meier PFS was 70% (95% CI, 56% to 79%) overall, 71% (95% CI, 55% to 82%) for those without prior therapy, and 66% (95% CI, 40% to 83%) for those with prior therapy. Treatment was well-tolerated; there was no febrile neutropenia or symptomatic left ventricular systolic dysfunction. Conclusion Paclitaxel given once per week with trastuzumab and pertuzumab is highly active and well tolerated and seems to be an effective alternative to docetaxel-based combination therapy. PMID:25547504

  3. Quantification of human epidermal growth factor receptor 2 immunohistochemistry using the Ventana Image Analysis System: correlation with gene amplification by fluorescence in situ hybridization: the importance of instrument validation for achieving high (>95%) concordance rate. (United States)

    Dennis, Jake; Parsa, Rezvaneh; Chau, Donnie; Koduru, Prasad; Peng, Yan; Fang, Yisheng; Sarode, Venetia Rumnong


    The use of computer-based image analysis for scoring human epidermal growth factor receptor 2 (HER2) immunohistochemistry (IHC) has gained a lot of interest recently. We investigated the performance of the Ventana Image Analysis System (VIAS) in HER2 quantification by IHC and its correlation with fluorescence in situ hybridization (FISH). We specifically compared the 3+ IHC results using the manufacturer's machine score cutoffs versus laboratory-defined cutoffs with the FISH assay. Using the manufacturer's 3+ cutoff (VIAS score; 2.51 to 3.5), 181/536 (33.7%) were scored 3+, and FISH was positive in 147/181 (81.2%), 2 (1.1%) were equivocal, and 32 (17.6%) were FISH (-). Using the laboratory-defined 3+ cutoff (VIAS score 3.5), 52 (28.7%) cases were downgraded to 2+, of which 29 (55.7%) were FISH (-), and 23 (44.2%) were FISH (+). With the revised cutoff, there were improvements in the concordance rate from 89.1% to 97.0% and in the positive predictive value from 82.1% to 97.6%. The false-positive rate for 3+ decreased from 9.0% to 0.8%. Six of 175 (3.4%) IHC (-) cases were FISH (+). Three cases with a VIAS score 3.5 showed polysomy of chromosome 17. In conclusion, the VIAS may be a valuable tool for assisting pathologists in HER2 scoring; however, the positive cutoff defined by the manufacturer is associated with a high false-positive rate. This study highlights the importance of instrument validation/calibration to reduce false-positive results.

  4. Differences in expression of the cancer stem cell marker aldehyde dehydrogenase 1 among estrogen receptor-positive/human epidermal growth factor receptor type 2-negative breast cancer cases with early, late, and no recurrence. (United States)

    Miyoshi, Yuichiro; Shien, Tadahiko; Ogiya, Akiko; Ishida, Naoko; Yamazaki, Kieko; Horii, Rie; Horimoto, Yoshiya; Masuda, Norikazu; Yasojima, Hiroyuki; Inao, Touko; Osako, Tomofumi; Takahashi, Masato; Tomioka, Nobumoto; Endo, Yumi; Hosoda, Mitsuchika; Doihara, Hiroyoshi; Miyoshi, Shinichiro; Yamashita, Hiroko


    The significance of the expression of aldehyde dehydrogenase 1 (ALDH1), a cancer stem cell marker, for predicting the recurrence of estrogen receptor (ER)-positive/human epidermal growth factor receptor type 2 (HER2)-negative breast cancer is still poorly understood. The value of ALDH1 in predicting the time of recurrence remains unknown. In total, 184 patients with early distant recurrence, 134 patients with late distant recurrence, and 321 control patients without recurrence for more than 10 years after starting initial treatment for ER-positive/HER2-negative breast cancer, registered in 9 institutions, were analyzed. We assessed relationships between ALDH1 and other clinicopathological features, and ALDH1 expression was compared among the three groups. The relationship between ALDH1 expression and overall survival after recurrence was also evaluated in each group. The rates of ALDH1 expression positivity (more than 1 %) in the early, late, and no recurrence groups were 18.4 %, 13.4 %, and 8.4 %, respectively. ALDH1 expression correlated significantly with lymph node metastases (p = 0.048) and the Ki-67 labeling index (p factor independently predicting overall survival after the detection of recurrence (adjusted OR 1.451, 95 % CI 0.985-2.085, p = 0.059). Among patients with ER-positive/HER2-negative breast cancer, ALDH1 expression was more common in those with early recurrence, and this expression was found to be associated with a more aggressive breast cancer phenotype than that in the patients without recurrence. Further study is needed to clarify the prognostic significance of the heterogeneity of cancer stem cells and to confirm their role in resistance to chemotherapy.

  5. The relationship between quantitative human epidermal growth factor receptor 2 gene expression by the 21-gene reverse transcriptase polymerase chain reaction assay and adjuvant trastuzumab benefit in Alliance N9831. (United States)

    Perez, Edith A; Baehner, Frederick L; Butler, Steven M; Thompson, E Aubrey; Dueck, Amylou C; Jamshidian, Farid; Cherbavaz, Diana; Yoshizawa, Carl; Shak, Steven; Kaufman, Peter A; Davidson, Nancy E; Gralow, Julie; Asmann, Yan W; Ballman, Karla V


    The N9831 trial demonstrated the efficacy of adjuvant trastuzumab for patients with human epidermal growth factor receptor 2 (HER2) locally positive tumors by protein or gene analysis. We used the 21-gene assay to examine the association of quantitative HER2 messenger RNA (mRNA) gene expression and benefit from trastuzumab. N9831 tested the addition of trastuzumab to chemotherapy in stage I-III HER2-positive breast cancer. For two of the arms of the trial, doxorubicin and cyclophosphamide followed by paclitaxel (AC-T) and doxorubicin and cyclophosphamide followed by paclitaxel and trastuzumab concurrent chemotherapy-trastuzumab (AC-TH), recurrence score (RS) and HER2 mRNA expression were determined by the 21-gene assay (Oncotype DX®) (negative 10 % positive cells = positive), 91 % for RT-PCR versus central fluorescence in situ hybridization (FISH) (≥2.0 = positive) and 94 % for central IHC versus central FISH. In the primary analysis, the association of HER2 expression by 21-gene assay with trastuzumab benefit was marginally nonsignificant (nonlinear p = 0.057). In hormone receptor-positive patients (local IHC) the association was significant (p = 0.002). The association was nonlinear with the greatest estimated benefit at lower and higher HER2 expression levels. Concordance among HER2 assessments by central IHC, FISH, and RT-PCR were similar and high. Association of HER2 mRNA expression with trastuzumab benefit as measured by time to distant recurrence was nonsignificant. A consistent benefit of trastuzumab irrespective of mHER2 levels was observed in patients with either IHC-positive or FISH-positive tumors. Trend for benefit was observed also for the small groups of patients with negative results by any or all of the central assays. NCT00005970 . Registered 5 July 2000.

  6. Patient-reported outcomes from EMILIA, a randomized phase 3 study of trastuzumab emtansine (T-DM1) versus capecitabine and lapatinib in human epidermal growth factor receptor 2-positive locally advanced or metastatic breast cancer. (United States)

    Welslau, Manfred; Diéras, Veronique; Sohn, Joo-Hyuk; Hurvitz, Sara A; Lalla, Deepa; Fang, Liang; Althaus, Betsy; Guardino, Ellie; Miles, David


    This report describes the results of an analysis of patient-reported outcomes from EMILIA (TDM4370g/BO21977), a randomized phase 3 study of the antibody-drug conjugate trastuzumab emtansine (T-DM1) versus capecitabine and lapatinib in human epidermal growth factor receptor 2 (HER2)-positive locally advanced or metastatic breast cancer. A secondary endpoint of the EMILIA study was time to symptom worsening (time from randomization to the first documentation of a ≥ 5-point decrease from baseline) as measured by the Trial Outcome Index Physical/Functional/Breast (TOI-PFB) subset of the Functional Assessment of Cancer Therapy-Breast questionnaire. Predefined exploratory patient-reported outcome endpoints included proportion of patients with a clinically significant improvement in symptoms (per TOI-PFB) and proportion of patients with diarrhea symptoms (per Diarrhea Assessment Scale). In the T-DM1 arm, 450 of 495 patients had a baseline and ≥ 1 postbaseline TOI-PFB score versus 445 of 496 patients in the capecitabine-plus-lapatinib arm. Time to symptom worsening was delayed in the T-DM1 arm versus the capecitabine-plus-lapatinib arm (7.1 months versus 4.6 months, respectively; hazard ratio = 0.796; P = .0121). In the T-DM1 arm, 55.3% of patients developed clinically significant improvement in symptoms from baseline versus 49.4% in the capecitabine-plus-lapatinib arm (P = .0842). Although similar at baseline, the number of patients reporting diarrhea symptoms increased 1.5- to 2-fold during treatment with capecitabine and lapatinib but remained near baseline levels in the T-DM1 arm. Together with the EMILIA primary data, these results support the concept that T-DM1 has greater efficacy and tolerability than capecitabine plus lapatinib, which may translate into improvements in health-related quality of life. © 2013 American Cancer Society.

  7. Laboratory compliance with the American Society of Clinical Oncology/college of American Pathologists guidelines for human epidermal growth factor receptor 2 testing: a College of American Pathologists survey of 757 laboratories. (United States)

    Nakhleh, Raouf E; Grimm, Erin E; Idowu, Michael O; Souers, Rhona J; Fitzgibbons, Patrick L


    To ensure quality human epidermal growth receptor 2 (HER2) testing in breast cancer, the American Society of Clinical Oncology/College of American Pathologists guidelines were introduced with expected compliance by 2008. To assess the effect these guidelines have had on pathology laboratories and their ability to address key components. In late 2008, a survey was distributed with the HER2 immunohistochemistry (IHC) proficiency testing program. It included questions regarding pathology practice characteristics and assay validation using fluorescence in situ hybridization or another IHC laboratory assay and assessed pathologist HER2 scoring competency. Of the 907 surveys sent, 757 (83.5%) were returned. The median laboratory accessioned 15 000 cases and performed 190 HER2 tests annually. Quantitative computer image analysis was used by 33% of laboratories. In-house fluorescence in situ hybridization was performed in 23% of laboratories, and 60% of laboratories addressed the 6- to 48-hour tissue fixation requirement by embedding tissue on the weekend. HER2 testing was performed on the initial biopsy in 40%, on the resection specimen in 6%, and on either in 56% of laboratories. Testing was validated with only fluorescence in situ hybridization in 47% of laboratories, whereas 10% of laboratories used another IHC assay only; 13% used both assays, and 12% and 15% of laboratories had not validated their assays or chose "not applicable" on the survey question, respectively. The 90% concordance rate with fluorescence in situ hybridization results was achieved by 88% of laboratories for IHC-negative findings and by 81% of laboratories for IHC-positive cases. The 90% concordance rate for laboratories using another IHC assay was achieved by 80% for negative findings and 75% for positive cases. About 91% of laboratories had a pathologist competency assessment program. This survey demonstrates the extent and characteristics of HER2 testing. Although some American Society of

  8. A comparative in vitro study of the viability of human keratinocytes grown on irradiated human amnion membrane and fibrin glue scaffolds

    International Nuclear Information System (INIS)

    Dorai, A.A.; Lim, C.K.; Azman, W.S.; Halim, A.S.


    Full text: The dried irradiated human amnion membrane has been used as a biological dressing for various clinical conditions. Being another biological membrane its potential as a scaffold to grow human keratinocytes is not known yet. To compare the growth patterns and cell viability of keratinocytes using fibrin glue and air dried amnion membrane as a scaffold. Keratinocytes were obtained from skin samples of six patients undergoing elective surgery. Fibrin glue (Tisseel, Baxter ) was diluted and used to coat the wells. Human dried amnion membrane was obtained and placed into the 24 well plates. Keratinocytes were seeded into the fibrin and amnion scaffold. Cell viability assay (MTT) was performed after 24, 48 and 72 hours. Finally the measurements were done by the Enzyme-Linked Immunosorbent Assay (ELISA) reader at 570 nm. Six patients consented for the study. The cells growing on the amnion scaffold showed a decreasing trend (20.67%, 17.94% and 16.78% respectively for 24, 48 and 72 hours). The cells growing on the fibrin scaffold showed a steady increase in number at 24, 48 and 72 hours (73.03%, 74.12% and 79.66%). The percentage of growth of normal human keratinocytes were significantly greater in the fibrin scaffold group (Mann - Whitney p = 0.002) for 24, 48 and 72 hours. The air dried irradiated human amnion membrane can be used as a scaffold to grow keratinocytes but however the growth pattern does not sustain with time. Fibrin glue supports the growth of human keratinocytes and shows an increasing pattern of growth with time. (Author)

  9. Novel Monoclonal Antibodies Recognizing Human Prostate-Specific Membrane Antigen (PSMA) as Research and Theranostic Tools. (United States)

    Nováková, Zora; Foss, Catherine A; Copeland, Benjamin T; Morath, Volker; Baranová, Petra; Havlínová, Barbora; Skerra, Arne; Pomper, Martin G; Barinka, Cyril


    Prostate-specific membrane antigen (PSMA) is a validated target for the imaging and therapy of prostate cancer. Here, we report the detailed characterization of four novel murine monoclonal antibodies (mAbs) recognizing human PSMA as well as PSMA orthologs from different species. Performance of purified mAbs was assayed using a comprehensive panel of in vitro experimental setups including Western blotting, immunofluorescence, immunohistochemistry, ELISA, flow cytometry, and surface-plasmon resonance. Furthermore, a mouse xenograft model of prostate cancer was used to compare the suitability of the mAbs for in vivo applications. All mAbs demonstrate high specificity for PSMA as documented by the lack of cross-reactivity to unrelated human proteins. The 3F11 and 1A11 mAbs bind linear epitopes spanning residues 226-243 and 271-288 of human PSMA, respectively. 3F11 is also suitable for the detection of PSMA orthologs from mouse, pig, dog, and rat in experimental setups where the denatured form of PSMA is used. 5D3 and 5B1 mAbs recognize distinct surface-exposed conformational epitopes and are useful for targeting PSMA in its native conformation. Most importantly, using a mouse xenograft model of prostate cancer we show that both the intact 5D3 and its Fab fragment are suitable for in vivo imaging. With apparent affinities of 0.14 and 1.2 nM as determined by ELISA and flow cytometry, respectively, 5D3 has approximately 10-fold higher affinity for PSMA than the clinically validated mAb J591 and, therefore, is a prime candidate for the development of next-generation theranostics to target PSMA. Prostate 77:749-764, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  10. E3B1, a human homologue of the mouse gene product Abi-1, sensitizes activation of Rap1 in response to epidermal growth factor

    International Nuclear Information System (INIS)

    Jenei, Veronika; Andersson, Tommy; Jakus, Judit; Dib, Karim


    E3B1, a human homologue of the mouse gene product Abi-1, has been implicated in growth-factor-mediated regulation of the small GTPases p21 Ras and Rac. E3b1 is a regulator of Rac because it can form a complex with Sos-1 and eps8, and such a Sos-1-e3B1-eps8 complex serves as a guanine nucleotide exchange factor for Rac. In the present study, we found that overexpression of e3B1 in NIH3T3/EGFR cells sensitized EGF-induced activation of Rac1, whereas it had no impact on EGF-induced activation of p21 Ras . Remarkably, we found that EGF-induced activation of the p21 Ras -related GTPase Rap1 was also sensitized in NIH3T3/EGFR-e3B1 cells. Thus, in NIH3T3/EGFR-e3B1 cells, maximal EGF-induced activation of Rap1 occurs with a dose of EGF much lower than in NIH3T3/EGFR cells. We also report that overexpression of e3B1 in NIH3T3/EGFR cells renders EGF-induced activation of Rap1 completely dependent on Src tyrosine kinases but not on c-Abl. However, EGF-induced tyrosine phosphorylation of the Rap GEF C3G occurred regardless of whether e3B1 was overexpressed or not, and this did not involve Src tyrosine kinases. Accordingly, we propose that overexpression of e3B1 in NIH3T3/EGFR cells leads to mobilization of Src tyrosine kinases that participate in EGF-induced activation of Rap1 and inhibition of cell proliferation

  11. Epidermal Overexpression of Xenobiotic Receptor PXR Impairs the Epidermal Barrier and Triggers Th2 Immune Response. (United States)

    Elentner, Andreas; Schmuth, Matthias; Yannoutsos, Nikolaos; Eichmann, Thomas O; Gruber, Robert; Radner, Franz P W; Hermann, Martin; Del Frari, Barbara; Dubrac, Sandrine


    The skin is in daily contact with environmental pollutants, but the long-term effects of such exposure remain underinvestigated. Many of these toxins bind and activate the pregnane X receptor (PXR), a ligand-activated transcription factor that regulates genes central to xenobiotic metabolism. The objective of this work was to investigate the effect of constitutive activation of PXR in the basal layer of the skin to mimic repeated skin exposure to noxious molecules. We designed a transgenic mouse model that overexpresses the human PXR gene linked to the herpes simplex VP16 domain under the control of the keratin 14 promoter. We show that transgenic mice display increased transepidermal water loss and elevated skin pH, abnormal stratum corneum lipids, focal epidermal hyperplasia, activated keratinocytes expressing more thymic stromal lymphopoietin, a T helper type 2/T helper type 17 skin immune response, and increased serum IgE. Furthermore, the cutaneous barrier dysfunction precedes development of the T helper type 2/T helper type 17 inflammation in transgenic mice, thereby mirroring the time course of atopic dermatitis development in humans. Moreover, further experiments suggest increased PXR signaling in the skin of patients with atopic dermatitis when compared with healthy skin. Thus, PXR activation by environmental pollutants may compromise epidermal barrier function and favor an immune response resembling atopic dermatitis. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  12. The random co-polymer glatiramer acetate rapidly kills primary human leukocytes through sialic-acid-dependent cell membrane damage

    DEFF Research Database (Denmark)

    Christiansen, Stig Hill; Zhang, Xianwei; Juul-Madsen, Kristian


    in innate immunity. It shares the positive charge and amphipathic character of GA, and, as shown here, also the ability to kill human leukocyte. The cytotoxicity of both compounds depends on sialic acid in the cell membrane. The killing was associated with the generation of CD45 + debris, derived from cell...... membrane deformation. Nanoparticle tracking analysis confirmed the formation of such debris, even at low GA concentrations. Electric cell-substrate impedance sensing measurements also recorded stable alterations in T lymphocytes following such treatment. LL-37 forms oligomers through weak hydrophobic...

  13. Structural remodeling and oligomerization of human cathelicidin on membranes suggest fibril-like structures as active species

    DEFF Research Database (Denmark)

    Sancho-Vaello, Enea; François, Patrice; Bonetti, Eve-Julie


    Antimicrobial peptides as part of the mammalian innate immune system target and remove major bacterial pathogens, often through irreversible damage of their cellular membranes. To explore the mechanism by which the important cathelicidin peptide LL-37 of the human innate immune system interacts w...... that these supramolecular structures represent the LL-37-membrane active state. Collectively, our study provides new insights into the fascinating plasticity of LL-37 demonstrated at atomic resolution and opens the venue for LL-37-based molecules as novel antibiotics....

  14. Effects of a human plasma membrane-associated sialidase siRNA on prostate cancer invasion

    Energy Technology Data Exchange (ETDEWEB)

    Li, Xiaojie [Department of Pathophysiology, Prostate Diseases Prevention and Treatment Research Centre, Norman Bethune Medical School, Jilin University, Changchun (China); Taizhou Polytechnic College, Taizhou (China); Zhang, Ling; Shao, Yueting; Liang, Zuowen; Shao, Chen; Wang, Bo; Guo, Baofeng; Li, Na; Zhao, Xuejian [Department of Pathophysiology, Prostate Diseases Prevention and Treatment Research Centre, Norman Bethune Medical School, Jilin University, Changchun (China); Li, Yang, E-mail: [Department of Pathophysiology, Prostate Diseases Prevention and Treatment Research Centre, Norman Bethune Medical School, Jilin University, Changchun (China); Xu, Deqi [Laboratory of Enteric and Sexually Transmitted Diseases, Center for Biologics Evaluation and Research, Food and Drug Administration, Bethesda, MD (United States)


    Highlights: Black-Right-Pointing-Pointer Neu3 is as one of the sialidases and regulates cell surface functions. Black-Right-Pointing-Pointer A Neu3-specific siRNA inhibited prostrate cancer cell invasion and migration. Black-Right-Pointing-Pointer The Neu3-specific siRNA inhibited prostate cancer metastasis in mice. Black-Right-Pointing-Pointer Targeting Neu3 may have utility for gene-based therapy of human cancer metastasis. -- Abstract: Human plasma membrane-associated sialidase (Neu3) is one of several sialidases that hydrolyze sialic acids in the terminal position of the carbohydrate groups of glycolipids and glycoproteins. Neu3 is mainly localized in plasma membranes and plays crucial roles in the regulation of cell surface functions. In this study, we investigated the effects and molecular mechanisms of Neu3 on cell invasion and migration in vivo and in vitro. Initially, we found that the levels of Neu3 expression were higher in prostate cancer tissues and cell lines than in normal prostate tissues based on RT-PCR and Western blotting analyses. We then applied a Neu3 siRNA approach to block Neu3 signaling using PC-3M cells as model cells. Transwell invasion assays and wound assays showed significantly decreased invasion and migration potential in the Neu3 siRNA-transfected cells. RT-PCR and Western blotting analyses revealed that Neu3 knockdown decreased the expressions of the matrix metalloproteinases MMP-2 and MMP-9. In vivo, mice injected with PC-3M cell tumors were evaluated by SPECT/CT to determine the presence of bone metastases. Mice treated with attenuated Salmonella carrying the Neu3 siRNA developed fewer bone metastases than mice treated with attenuated Salmonella carrying a control Scramble siRNA, attenuated Salmonella alone or PBS. The results for bone metastasis detection by pathology were consistent with the data obtained by SPECT/CT. Tumor blocks were evaluated by histochemical, RT-PCR and Western blotting analyses. The results revealed

  15. Association of canalicular membrane enzymes with bile acid micelles and lipid aggregates in human and rat bile. (United States)

    Accatino, L; Pizarro, M; Solís, N; Koenig, C S


    This study was undertaken to gain insights into the characteristics of the polymolecular association between canalicular membrane enzymes, bile acids, cholesterol and phospholipids in bile and into the celular mechanisms whereby the enzymes are secreted into bile. With this purpose, we studied the distribution of bile acids, cholesterol, phospholipids, proteins and representative canalicular membrane enzymes (alkaline phosphatase, 5'-nucleotidase and gamma-glutamyl transpeptidase), which can be considered specific marker constituents, in bile fractions enriched in phospholipid-cholesterol lamellar structures (multilamellar and unilamellar vesicles) and bile acid-mixed micelles. These fractions were isolated by ultracentrifugation from human hepatic bile, normal rat bile and bile of rats treated with diosgenin, a steroid that induces a