WorldWideScience

Sample records for human cdna sequence

  1. Sequence of human protamine 2 cDNA

    Energy Technology Data Exchange (ETDEWEB)

    Domenjoud, L; Fronia, C; Uhde, F; Engel, W [Universitaet Goettingen (West Germany)

    1988-08-11

    The authors report the cloning and sequencing of a cDNA clone for human protamine 2 (hp2), isolated from a human testis cDNA library cloned in the vector {lambda}-gt11. A 66mer oligonucleotide, that corresponds to an amino acid sequence which is highly conserved between hp2 and mouse protamine 2 (mp2) served as hybridization probe. The homology between the amino acid sequence deduced from our cDNA and the published amino acid sequence for hp2 is 100%.

  2. Complete cDNA sequence coding for human docking protein

    Energy Technology Data Exchange (ETDEWEB)

    Hortsch, M; Labeit, S; Meyer, D I

    1988-01-11

    Docking protein (DP, or SRP receptor) is a rough endoplasmic reticulum (ER)-associated protein essential for the targeting and translocation of nascent polypeptides across this membrane. It specifically interacts with a cytoplasmic ribonucleoprotein complex, the signal recognition particle (SRP). The nucleotide sequence of cDNA encoding the entire human DP and its deduced amino acid sequence are given.

  3. Sequence of a cloned cDNA encoding human ribosomal protein S11

    Energy Technology Data Exchange (ETDEWEB)

    Lott, J B; Mackie, G A

    1988-02-11

    The authors have isolated a cloned cDNA that encodes human ribosomal protein (rp) S11 by screening a human fibroblast cDNA library with a labelled 204 bp DNA fragment encompassing residues 212-416 of pRS11, a rat rp Sll cDNA clone. The human rp S11 cloned cDNA consists of 15 residues of the 5' leader, the entire coding sequence and all 51 residues of the 3' untranslated region. The predicted amino acid sequence of 158 residues is identical to rat rpS11. The nucleotide sequence in the coding region differs, however, from that in rat in the first position in two codons and in the third position in 44 codons.

  4. cDNA cloning, sequence analysis, and chromosomal localization of the gene for human carnitine palmitoyltransferase

    International Nuclear Information System (INIS)

    Finocchiaro, G.; Taroni, F.; Martin, A.L.; Colombo, I.; Tarelli, G.T.; DiDonato, S.; Rocchi, M.

    1991-01-01

    The authors have cloned and sequenced a cDNA encoding human liver carnitine palmitoyltransferase an inner mitochondrial membrane enzyme that plays a major role in the fatty acid oxidation pathway. Mixed oligonucleotide primers whose sequences were deduced from one tryptic peptide obtained from purified CPTase were used in a polymerase chain reaction, allowing the amplification of a 0.12-kilobase fragment of human genomic DNA encoding such a peptide. A 60-base-pair (bp) oligonucleotide synthesized on the basis of the sequence from this fragment was used for the screening of a cDNA library from human liver and hybridized to a cDNA insert of 2255 bp. This cDNA contains an open reading frame of 1974 bp that encodes a protein of 658 amino acid residues including 25 residues of an NH 2 -terminal leader peptide. The assignment of this open reading frame to human liver CPTase is confirmed by matches to seven different amino acid sequences of tryptic peptides derived from pure human CPTase and by the 82.2% homology with the amino acid sequence of rat CPTase. The NH 2 -terminal region of CPTase contains a leucine-proline motif that is shared by carnitine acetyl- and octanoyltransferases and by choline acetyltransferase. The gene encoding CPTase was assigned to human chromosome 1, region 1q12-1pter, by hybridization of CPTase cDNA with a DNA panel of 19 human-hanster somatic cell hybrids

  5. Cloning, sequencing, and expression of cDNA for human β-glucuronidase

    International Nuclear Information System (INIS)

    Oshima, A.; Kyle, J.W.; Miller, R.D.

    1987-01-01

    The authors report here the cDNA sequence for human placental β-glucuronidase (β-D-glucuronoside glucuronosohydrolase, EC 3.2.1.31) and demonstrate expression of the human enzyme in transfected COS cells. They also sequenced a partial cDNA clone from human fibroblasts that contained a 153-base-pair deletion within the coding sequence and found a second type of cDNA clone from placenta that contained the same deletion. Nuclease S1 mapping studies demonstrated two types of mRNAs in human placenta that corresponded to the two types of cDNA clones isolated. The NH 2 -terminal amino acid sequence determined for human spleen β-glucuronidase agreed with that inferred from the DNA sequence of the two placental clones, beginning at amino acid 23, suggesting a cleaved signal sequence of 22 amino acids. When transfected into COS cells, plasmids containing either placental clone expressed an immunoprecipitable protein that contained N-linked oligosaccharides as evidenced by sensitivity to endoglycosidase F. However, only transfection with the clone containing the 153-base-pair segment led to expression of human β-glucuronidase activity. These studies provide the sequence for the full-length cDNA for human β-glucuronidase, demonstrate the existence of two populations of mRNA for β-glucuronidase in human placenta, only one of which specifies a catalytically active enzyme, and illustrate the importance of expression studies in verifying that a cDNA is functionally full-length

  6. The nucleotide sequence of human transition protein 1 cDNA

    Energy Technology Data Exchange (ETDEWEB)

    Luerssen, H; Hoyer-Fender, S; Engel, W [Universitaet Goettingen (West Germany)

    1988-08-11

    The authors have screened a human testis cDNA library with an oligonucleotide of 81 mer prepared according to a part of the published nucleotide sequence of the rat transition protein TP 1. They have isolated a cDNA clone with the length of 441 bp containing the coding region of 162 bp for human transition protein 1. There is about 84% homology in the coding region of the sequence compared to rat. The human cDNA-clone encodes a polypeptide of 54 amino acids of which 7 are different to that of rat.

  7. Molecular cloning and nucleotide sequence of cDNA for human liver arginase

    International Nuclear Information System (INIS)

    Haraguchi, Y.; Takiguchi, M.; Amaya, Y.; Kawamoto, S.; Matsuda, I.; Mori, M.

    1987-01-01

    Arginase (EC3.5.3.1) catalyzes the last step of the urea cycle in the liver of ureotelic animals. Inherited deficiency of the enzyme results in argininemia, an autosomal recessive disorder characterized by hyperammonemia. To facilitate investigation of the enzyme and gene structures and to elucidate the nature of the mutation in argininemia, the authors isolated cDNA clones for human liver arginase. Oligo(dT)-primed and random primer human liver cDNA libraries in λ gt11 were screened using isolated rat arginase cDNA as a probe. Two of the positive clones, designated λ hARG6 and λ hARG109, contained an overlapping cDNA sequence with an open reading frame encoding a polypeptide of 322 amino acid residues (predicted M/sub r/, 34,732), a 5'-untranslated sequence of 56 base pairs, a 3'-untranslated sequence of 423 base pairs, and a poly(A) segment. Arginase activity was detected in Escherichia coli cells transformed with the plasmid carrying λ hARG6 cDNA insert. RNA gel blot analysis of human liver RNA showed a single mRNA of 1.6 kilobases. The predicted amino acid sequence of human liver arginase is 87% and 41% identical with those of the rat liver and yeast enzymes, respectively. There are several highly conserved segments among the human, rat, and yeast enzymes

  8. Human pro. cap alpha. 1(III) collagen: cDNA sequence for the 3' end

    Energy Technology Data Exchange (ETDEWEB)

    Mankoo, B S; Dalgleish, R

    1988-03-25

    The authors have previously isolated two overlapping cDNA clones, pIII-21 and pIII-33, which encode the C-terminal end of human type III procollagen. They now present the sequence of 2520 bases encoded in these cDNAs which overlaps other previously published sequences for the same gene. The sequence presented differs from previously published sequences at five positions.

  9. Complete amino acid sequence of human intestinal aminopeptidase N as deduced from cloned cDNA

    DEFF Research Database (Denmark)

    Cowell, G M; Kønigshøfer, E; Danielsen, E M

    1988-01-01

    The complete primary structure (967 amino acids) of an intestinal human aminopeptidase N (EC 3.4.11.2) was deduced from the sequence of a cDNA clone. Aminopeptidase N is anchored to the microvillar membrane via an uncleaved signal for membrane insertion. A domain constituting amino acid 250...

  10. Human tissue factor: cDNA sequence and chromosome localization of the gene

    International Nuclear Information System (INIS)

    Scarpati, E.M.; Wen, D.; Broze, G.J. Jr.; Miletich, J.P.; Flandermeyer, R.R.; Siegel, N.R.; Sadler, J.E.

    1987-01-01

    A human placenta cDNA library in λgt11 was screened for the expression of tissue factor antigens with rabbit polyclonal anti-human tissue factor immunoglobulin G. Among 4 million recombinant clones screened, one positive, λHTF8, expressed a protein that shared epitopes with authentic human brain tissue factor. The 1.1-kilobase cDNA insert of λHTF8 encoded a peptide that contained the amino-terminal protein sequence of human brain tissue factor. Northern blotting identified a major mRNA species of 2.2 kilobases and a minor species of ∼ 3.2 kilobases in poly(A) + RNA of placenta. Only 2.2-kilobase mRNA was detected in human brain and in the human monocytic U937 cell line. In U937 cells, the quantity of tissue factor mRNA was increased several fold by exposure of the cells to phorbol 12-myristate 13-acetate. Additional cDNA clones were selected by hybridization with the cDNA insert of λHTF8. These overlapping isolates span 2177 base pairs of the tissue factor cDNA sequence that includes a 5'-noncoding region of 75 base pairs, an open reading frame of 885 base pairs, a stop codon, a 3'-noncoding region of 1141 base pairs, and a poly(a) tail. The open reading frame encodes a 33-kilodalton protein of 295 amino acids. The predicted sequence includes a signal peptide of 32 or 34 amino acids, a probable extracellular factor VII binding domain of 217 or 219 amino acids, a transmembrane segment of 23 acids, and a cytoplasmic tail of 21 amino acids. There are three potential glycosylation sites with the sequence Asn-X-Thr/Ser. The 3'-noncoding region contains an inverted Alu family repetitive sequence. The tissue factor gene was localized to chromosome 1 by hybridization of the cDNA insert of λHTF8 to flow-sorted human chromosomes

  11. cDNA sequence of human transforming gene hst and identification of the coding sequence required for transforming activity

    International Nuclear Information System (INIS)

    Taira, M.; Yoshida, T.; Miyagawa, K.; Sakamoto, H.; Terada, M.; Sugimura, T.

    1987-01-01

    The hst gene was originally identified as a transforming gene in DNAs from human stomach cancers and from a noncancerous portion of stomach mucosa by DNA-mediated transfection assay using NIH3T3 cells. cDNA clones of hst were isolated from the cDNA library constructed from poly(A) + RNA of a secondary transformant induced by the DNA from a stomach cancer. The sequence analysis of the hst cDNA revealed the presence of two open reading frames. When this cDNA was inserted into an expression vector containing the simian virus 40 promoter, it efficiently induced the transformation of NIH3T3 cells upon transfection. It was found that one of the reading frames, which coded for 206 amino acids, was responsible for the transforming activity

  12. Epitopes of human testis-specific lactate dehydrogenase deduced from a cDNA sequence

    International Nuclear Information System (INIS)

    Millan, J.L.; Driscoll, C.E.; LeVan, K.M.; Goldberg, E.

    1987-01-01

    The sequence and structure of human testis-specific L-lactate dehydrogenase [LDHC 4 , LDHX; (L)-lactate:NAD + oxidoreductase, EC 1.1.1.27] has been derived from analysis of a complementary DNA (cDNA) clone comprising the complete protein coding region of the enzyme. From the deduced amino acid sequence, human LDHC 4 is as different from rodent LDHC 4 (73% homology) as it is from human LDHA 4 (76% homology) and porcine LDHB 4 (68% homology). Subunit homologies are consistent with the conclusion that the LDHC gene arose by at least two independent duplication events. Furthermore, the lower degree of homology between mouse and human LDHC 4 and the appearance of this isozyme late in evolution suggests a higher rate of mutation in the mammalian LDHC genes than in the LDHA and -B genes. Comparison of exposed amino acid residues of discrete anti-genic determinants of mouse and human LDHC 4 reveals significant differences. Knowledge of the human LDHC 4 sequence will help design human-specific peptides useful in the development of a contraceptive vaccine

  13. Nucleotide sequence of cloned cDNA for human sphingolipid activator protein 1 precursor

    International Nuclear Information System (INIS)

    Dewji, N.N.; Wenger, D.A.; O'Brien, J.S.

    1987-01-01

    Two cDNA clones encoding prepro-sphingolipid activator protein 1 (SAP-1) were isolated from a λ gt11 human hepatoma expression library using polyclonal antibodies. These had inserts of ≅ 2 kilobases (λ-S-1.2 and λ-S-1.3) and both were both homologous with a previously isolated clone (λ-S-1.1) for mature SAP-1. The authors report here the nucleotide sequence of the longer two EcoRI fragments of S-1.2 and S-1.3 that were not the same and the derived amino acid sequences of mature SAP-1 and its prepro form. The open reading frame encodes 19 amino acids, which are colinear with the amino-terminal sequence of mature SAP-1, and extends far beyond the predicted carboxyl terminus of mature SAP-1, indicating extensive carboxyl-terminal processing. The nucleotide sequence of cDNA encoding prepro-SAP-1 includes 1449 bases from the assigned initiation codon ATG at base-pair 472 to the stop codon TGA at base-pair 1921. The first 23 amino acids coded after the initiation ATG are characteristic of a signal peptide. The calculated molecular mass for a polypeptide encoded by 1449 bases is ≅ 53 kDa, in keeping with the reported value for pro-SAP-1. The data indicate that after removal of the signal peptide mature SAP-1 is generated by removing an additional 7 amino acids from the amino terminus and ≅ 373 amino acids from the carboxyl terminus. One potential glycosylation site was previously found in mature SAP-1. Three additional potential glycosylation sites are present in the processed carboxyl-terminal polypeptide, which they designate as P-2

  14. Molecular cloning of a human glycophorin B cDNA: nucleotide sequence and genomic relationship to glycophorin A

    International Nuclear Information System (INIS)

    Siebert, P.D.; Fukuda, M.

    1987-01-01

    The authors describe the isolation and nucleotide sequence of a human glycophorin B cDNA. The cDNA was identified by differential hybridization of synthetic oligonucleotide probes to a human erythroleukemic cell line (K562) cDNA library constructed in phage vector λgt10. The nucleotide sequence of the glycophorin B cDNA was compared with that of a previously cloned glycophorin A cDNA. The nucleotide sequences encoding the NH 2 -terminal leader peptide and first 26 amino acids of the two proteins are nearly identical. This homologous region is followed by areas specific to either glycophorin A or B and a number of small regions of homology, which in turn are followed by a very homologous region encoding the presumed membrane-spanning portion of the proteins. They used RNA blot hybridization with both cDNA and synthetic oligonucleotide probes to prove our previous hypothesis that glycophorin B is encoded by a single 0.5- to 0.6-kb mRNA and to show that glycophorins A and B are negatively and coordinately regulated by a tumor-promoting phorbol ester, phorbol 12-myristate 13-acetate. They established the intron/exon structure of the glycophorin A and B genes by oligonucleotide mapping; the results suggest a complex evolution of the glycophorin genes

  15. Cloning and cDNA sequence of the dihydrolipoamide dehydrogenase component of human α-ketoacid dehydrogenase complexes

    International Nuclear Information System (INIS)

    Pons, G.; Raefsky-Estrin, C.; Carothers, D.J.; Pepin, R.A.; Javed, A.A.; Jesse, B.W.; Ganapathi, M.K.; Samols, D.; Patel, M.S.

    1988-01-01

    cDNA clones comprising the entire coding region for human dihydrolipoamide dehydrogenase have been isolated from a human liver cDNA library. The cDNA sequence of the largest clone consisted of 2082 base pairs and contained a 1527-base open reading frame that encodes a precursor dihydrolipoamide dehydrogenase of 509 amino acid residues. The first 35-amino acid residues of the open reading frame probably correspond to a typical mitochondrial import leader sequence. The predicted amino acid sequence of the mature protein, starting at the residue number 36 of the open reading frame, is almost identical (>98% homology) with the known partial amino acid sequence of the pig heart dihydrolipoamide dehydrogenase. The cDNA clone also contains a 3' untranslated region of 505 bases with an unusual polyadenylylation signal (TATAAA) and a short poly(A) track. By blot-hybridization analysis with the cDNA as probe, two mRNAs, 2.2 and 2.4 kilobases in size, have been detected in human tissues and fibroblasts, whereas only one mRNA (2.4 kilobases) was detected in rat tissues

  16. Human liver phosphatase 2A: cDNA and amino acid sequence of two catalytic subunit isotypes

    International Nuclear Information System (INIS)

    Arino, J.; Woon, Chee Wai; Brautigan, D.L.; Miller, T.B. Jr.; Johnson, G.L.

    1988-01-01

    Two cDNA clones were isolated from a human liver library that encode two phosphatase 2A catalytic subunits. The two cDNAs differed in eight amino acids (97% identity) with three nonconservative substitutions. All of the amino acid substitutions were clustered in the amino-terminal domain of the protein. Amino acid sequence of one human liver clone (HL-14) was identical to the rabbit skeletal muscle phosphatase 2A cDNA (with 97% nucleotide identity). The second human liver clone (HL-1) is encoded by a separate gene, and RNA gel blot analysis indicates that both mRNAs are expressed similarly in several human clonal cell lines. Sequence comparison with phosphatase 1 and 2A indicates highly divergent amino acid sequences at the amino and carboxyl termini of the proteins and identifies six highly conserved regions between the two proteins that are predicted to be important for phosphatase enzymatic activity

  17. Human uroporphyrinogen III synthase: Molecular cloning, nucleotide sequence, and expression of a full-length cDNA

    International Nuclear Information System (INIS)

    Tsai, Shihfeng; Bishop, D.F.; Desnick, R.J.

    1988-01-01

    Uroporphyrinogen III synthase, the fourth enzyme in the heme biosynthetic pathway, is responsible for conversion of the linear tetrapyrrole, hydroxymethylbilane, to the cyclic tetrapyrrole, uroporphyrinogen III. The deficient activity of URO-synthase is the enzymatic defect in the autosomal recessive disorder congenital erythropoietic porphyria. To facilitate the isolation of a full-length cDNA for human URO-synthase, the human erythrocyte enzyme was purified to homogeneity and 81 nonoverlapping amino acids were determined by microsequencing the N terminus and four tryptic peptides. Two synthetic oligonucleotide mixtures were used to screen 1.2 x 10 6 recombinants from a human adult liver cDNA library. Eight clones were positive with both oligonucleotide mixtures. Of these, dideoxy sequencing of the 1.3 kilobase insert from clone pUROS-2 revealed 5' and 3' untranslated sequences of 196 and 284 base pairs, respectively, and an open reading frame of 798 base pairs encoding a protein of 265 amino acids with a predicted molecular mass of 28,607 Da. The isolation and expression of this full-length cDNA for human URO-synthase should facilitate studies of the structure, organization, and chromosomal localization of this heme biosynthetic gene as well as the characterization of the molecular lesions causing congenital erythropoietic porphyria

  18. Nucleotide sequence of a human cDNA encoding a ras-related protein (rap1B)

    Energy Technology Data Exchange (ETDEWEB)

    Pizon, V; Lerosey, I; Chardin, P; Tavitian, A [INSERM, Paris (France)

    1988-08-11

    The authors have previously characterized two human ras-related genes rap1 and rap2. Using the rap1 clone as probe they isolated and sequenced a new rap cDNA encoding the 184aa rap1B protein. The rap1B protein is 95% identical to rap1 and shares several properties with the ras protein suggesting that it could bind GTP/GDP and have a membrane location. As for rap1, the structural characteristics of rap1B suggest that the rap and ras proteins might interact on the same effector.

  19. cDNA cloning and sequencing of human fibrillarin, a conserved nucleolar protein recognized by autoimmune antisera

    International Nuclear Information System (INIS)

    Aris, J.P.; Blobel, G.

    1991-01-01

    The authors have isolated a 1.1-kilobase cDNA clone that encodes human fibrillarin by screening a hepatoma library in parallel with DNA probes derived from the fibrillarin genes of Saccharomyces cerevisiae (NOP1) and Xenopus laevis. RNA blot analysis indicates that the corresponding mRNA is ∼1,300 nucleotides in length. Human fibrillarin expressed in vitro migrates on SDS gels as a 36-kDa protein that is specifically immunoprecipitated by antisera from humans with scleroderma autoimmune disease. Human fibrillarin contains an amino-terminal repetitive domain ∼75-80 amino acids in length that is rich in glycine and arginine residues and is similar to amino-terminal domains in the yeast and Xenopus fibrillarins. The occurrence of a putative RNA-binding domain and an RNP consensus sequence within the protein is consistent with the association of fibrillarin with small nucleolar RNAs. Protein sequence alignments show that 67% of amino acids from human fibrillarin are identical to those in yeast fibrillarin and that 81% are identical to those in Xenopus fibrillarin. This identity suggests the evolutionary conservation of an important function early in the pathway for ribosome biosynthesis

  20. Isolation and characterization of human glycophorin A cDNA clones by a synthetic oligonucleotide approach: nucleotide sequence and mRNA structure

    International Nuclear Information System (INIS)

    Siebert, P.D.; Fukuda, M.

    1986-01-01

    In an effort to understand the relationships among and the regulation of human glycophorins, the authors have isolated and characterized several glycophorin A-specific cDNA clones obtained from a human erythroleukemic K562 cell cDNA library. This was accomplished by using mixed synthetic oligonucleotides, corresponding to various regions of the known amino acid sequence, to prime the synthesis of the cDNA as well as to screen the cDNA library. They also used synthetic oligonucleotides to sequence the largest of the glycophorin cDNAs. The nucleotide sequence obtained suggests the presence of a potential leader peptide, consistent with the membrane localization of this glycoprotein. Examination of the structure of glycophorin mRNA by blot hybridization revealed the existence of several electrophoretically distinct mRNAs numbering three or four, depending on the size of the glycophorin cDNA used as a hybridization probe. The smaller cDNA hybridized to three mRNAs of approximately 2.8, 1.7, and 1.0 kilobases. In contrast, the larger cDNA hybridized to an additional mRNA of approximately 0.6 kilobases. Further examination of the relationships between these multiple mRNAs by blot hybridization was conducted with the use of exact-sequence oligonucleotide probes constructed from various regions of the cDNA representing portions of the amino acid sequence of glycophorin A with or without known homology with glycophorin B. In total, the results obtained are consistent with the hypothesis that the three larger mRNAs represent glycophorin A gene transcripts and that the smallest (0.6 kilobase) mRNA may be specific for glycophorin B

  1. Isolation and sequencing of a cDNA coding for the human DF3 breast carcinoma-associated antigen

    International Nuclear Information System (INIS)

    Siddiqui, J.; Abe, M.; Hayes, D.; Shani, E.; Yunis, E.; Kufe, D.

    1988-01-01

    The murine monoclonal antibody (mAb) DF3 reacts with a high molecular weight glycoprotein detectable in human breast carcinomas. DF3 antigen expression correlates with human breast tumor differentiation, and the detection of a cross-reactive species in human milk has suggested that this antigen might be useful as a marker of differentiated mammary epithelium. To further characterize DF3 antigen expression, the authors have isolated a cDNA clone from a λgt11 library by screening with mAb DF3. The results demonstrate that this 309-base-pair cDNA, designated pDF9.3, codes for the DF3 epitope. Southern blot analyses of EcoRI-digested DNAs from six human tumor cell lines with 32 P-labeled pDF9.3 have revealed a restriction fragment length polymorphism. Variations in size of the alleles detected by pDF9.3 were also identified in Pst I, but not in HindIII, DNA digests. Furthermore, hybridization of 32 P-labeled pDF9.3 with total cellular RNA from each of these cell lines demonstrated either one or two transcripts that varied from 4.1 to 7.1 kilobases in size. The presence of differently sized transcripts detected by pDF9.3 was also found to correspond with the polymorphic expression of DF3 glycoproteins. Nucleotide sequence analysis of pDF9.3 has revealed a highly conserved (G + C)-rich 60-base-pair tandem repeat. These findings suggest that the variation in size of alleles coding for the polymorphic DF3 glycoprotein may represent different numbers of repeats

  2. Nucleotide sequence of a cDNA coding for the amino-terminal region of human prepro. alpha. 1(III) collagen

    Energy Technology Data Exchange (ETDEWEB)

    Toman, P D; Ricca, G A [Rorer Biotechnology, Inc., Springfield, VA (USA); de Crombrugghe, B [National Institutes of Health, Bethesda, MD (USA)

    1988-07-25

    Type III Collagen is synthesized in a variety of tissues as a precursor macromolecule containing a leader sequence, a N-propeptide, a N-telopeptide, the triple helical region, a C-telopeptide, and C-propeptide. To further characterize the human type III collagen precursor, a human placental cDNA library was constructed in gt11 using an oligonucleotide derived from a partial cDNA sequence corresponding to the carboxy-terminal part of the 1(III) collagen. A cDNA was identified which contains the leader sequence, the N-propeptide and N-telopeptide regions. The DNA sequence of these regions are presented here. The triple helical, C-telopeptide and C-propeptide amino acid sequence for human type III collagen has been determined previously. A comparison of the human amino acid sequence with mouse, chicken, and calf sequence shows 81%, 81%, and 92% similarity, respectively. At the DNA level, the sequence similarity between human and mouse or chicken type III collagen sequences in this area is 82% and 77%, respectively.

  3. Increased mRNA expression of a laminin-binding protein in human colon carcinoma: Complete sequence of a full-length cDNA encoding the protein

    International Nuclear Information System (INIS)

    Yow, Hsiukang; Wong, Jau Min; Chen, Hai Shiene; Lee, C.; Steele, G.D. Jr.; Chen, Lanbo

    1988-01-01

    Reliable markers to distinguish human colon carcinoma from normal colonic epithelium are needed particularly for poorly differentiated tumors where no useful marker is currently available. To search for markers the authors constructed cDNA libraries from human colon carcinoma cell lines and screened for clones that hybridize to a greater degree with mRNAs of colon carcinomas than with their normal counterparts. Here they report one such cDNA clone that hybridizes with a 1.2-kilobase (kb) mRNA, the level of which is ∼9-fold greater in colon carcinoma than in adjacent normal colonic epithelium. Blot hybridization of total RNA from a variety of human colon carcinoma cell lines shows that the level of this 1.2-kb mRNA in poorly differentiated colon carcinomas is as high as or higher than that in well-differentiated carcinomas. Molecular cloning and complete sequencing of cDNA corresponding to the full-length open reading frame of this 1.2-kb mRNA unexpectedly show it to contain all the partial cDNA sequence encoding 135 amino acid residues previously reported for a human laminin receptor. The deduced amino acid sequence suggests that this putative laminin-binding protein from human colon carcinomas consists of 295 amino acid residues with interesting features. There is an unusual C-terminal 70-amino acid segment, which is trypsin-resistant and highly negatively charged

  4. Cloning and sequencing of cDNA encoding human DNA topoisomerase II and localization of the gene to chromosome region 17q21-22

    International Nuclear Information System (INIS)

    Tsai-Pflugfelder, M.; Liu, L.F.; Liu, A.A.; Tewey, K.M.; Whang-Peng, J.; Knutsen, T.; Huebner, K.; Croce, C.M.; Wang, J.C.

    1988-01-01

    Two overlapping cDNA clones encoding human DNA topoisomerase II were identified by two independent methods. In one, a human cDNA library in phage λ was screened by hybridization with a mixed oligonucleotide probe encoding a stretch of seven amino acids found in yeast and Drosophila DNA topoisomerase II; in the other, a different human cDNA library in a λgt11 expression vector was screened for the expression of antigenic determinants that are recognized by rabbit antibodies specific to human DNA topoisomerase II. The entire coding sequences of the human DNA topoisomerase II gene were determined from these and several additional clones, identified through the use of the cloned human TOP2 gene sequences as probes. Hybridization between the cloned sequences and mRNA and genomic DNA indicates that the human enzyme is encoded by a single-copy gene. The location of the gene was mapped to chromosome 17q21-22 by in situ hybridization of a cloned fragment to metaphase chromosomes and by hybridization analysis with a panel of mouse-human hybrid cell lines, each retaining a subset of human chromosomes

  5. Identification and complete sequencing of novel human transcripts through the use of mouse orthologs and testis cDNA sequences

    DEFF Research Database (Denmark)

    Ferreira, Elisa N; Pires, Lilian C; Parmigiani, Raphael B

    2004-01-01

    The correct identification of all human genes, and their derived transcripts, has not yet been achieved, and it remains one of the major aims of the worldwide genomics community. Computational programs suggest the existence of 30,000 to 40,000 human genes. However, definitive gene identification ...

  6. Human pro. cap alpha. 1)(I) collagen: cDNA sequence for the C-propeptide domain

    Energy Technology Data Exchange (ETDEWEB)

    Maekelae, J K; Raassina, M; Virta, A; Vuorio, E

    1988-01-11

    The authors have previously constructed a cDNA clone pHCAL1, covering most of the C-terminal propeptide domain of human pro..cap alpha..1(I) collagen mRNA,by inserting a 678 bp EcoRI-XhoI fragment of cDNA into pBR322. Since the XhoI/SalI ligation prevented removal of the insert, they used the same strategy to obtain a similar clone in pUC8. RNA was isolated from fetal calvarial bones. The cDNA was digested with EcoRI and XhoI and fractionated on a 1 % agarose gel. Fragments of 650-700 bp were cloned in pUC8 at the polylinker site, which now permits easy removal of the insert. The new clone was named pHCAL1U since the RNA was isolated from another individual. The approach outlined is useful for studies on individual variation which is important to recognize when searching for disease-related mutations in type I collagen.

  7. Human thyroid peroxidase: complete cDNA and protein sequence, chromosome mapping, and identification of two alternately spliced mRNAs

    International Nuclear Information System (INIS)

    Kimura, S.; Kotani, T.; McBride, O.W.; Umeki, K.; Hirai, K.; Nakayama, T.; Ohtaki, S.

    1987-01-01

    Two forms of human thyroid peroxidase cDNAs were isolated from a λgt11 cDNA library, prepared from Graves disease thyroid tissue mRNA, by use of oligonucleotides. The longest complete cDNA, designated phTPO-1, has 3048 nucleotides and an open reading frame consisting of 933 amino acids, which would encode a protein with a molecular weight of 103,026. Five potential asparagine-linked glycosylation sites are found in the deduced amino acid sequence. The second peroxidase cDNA, designated phTPO-2, is almost identical to phTPO-1 beginning 605 base pairs downstream except that it contains 1-base-pair difference and lacks 171 base pairs in the middle of the sequence. This results in a loss of 57 amino acids corresponding to a molecular weight of 6282. Interestingly, this 171-nucleotide sequence has GT and AG at its 5' and 3' boundaries, respectively, that are in good agreement with donor and acceptor splice site consensus sequences. Using specific oligonucleotide probes for the mRNAs derived from the cDNA sequences hTOP-1 and hTOP-2, the authors show that both are expressed in all thyroid tissues examined and the relative level of two mRNAs is different in each sample. The results suggest that two thyroid peroxidase proteins might be generated through alternate splicing of the same gene. By using somatic cell hybrid lines, the thyroid peroxidase gene was mapped to the short arm of human chromosome 2

  8. cDNA sequence quality data - Budding yeast cDNA sequencing project | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available List Contact us Budding yeast cDNA sequencing project cDNA sequence quality data Data detail Data name cDNA sequence quality... data DOI 10.18908/lsdba.nbdc00838-003 Description of data contents Phred's quality score. P...tion Download License Update History of This Database Site Policy | Contact Us cDNA sequence quality

  9. Localization of the human fibromodulin gene (FMOD) to chromosome 1q32 and completion of the cDNA sequence

    Energy Technology Data Exchange (ETDEWEB)

    Sztrolovics, R.; Grover, J.; Roughley, P.J. [McGill Univ., Montreal (Canada)] [and others

    1994-10-01

    This report describes the cloning of the 3{prime}-untranslated region of the human fibromodulin cDNA and its use to map the gene. For somatic cell hybrids, the generation of the PCR product was concordant with the presence of chromosome 1 and discordant with the presence of all other chromosomes, confirming that the fibromodulin gene is located within region q32 of chromosome 1. The physical mapping of genes is a critical step in the process of identifying which genes may be responsible for various inherited disorders. Specifically, the mapping of the fibromodulin gene now provides the information necessary to evaluate its potential role in genetic disorders of connective tissues. The analysis of previously reported diseases mapped to chromosome 1 reveals two genes located in the proximity of the fibromodulin locus. These are Usher syndrome type II, a recessive disorder characterized by hearing loss and retinitis pigmentosa, and Van der Woude syndrome, a dominant condition associated with abnormalities such as cleft lip and palate and hyperdontia. The genes for both of these disorders have been projected to be localized to 1q32 of a physical map that integrates available genetic linkage and physical data. However, it seems improbable that either of these disorders, exhibiting restricted tissue involvement, could be linked to the fibromodulin gene, given the wide tissue distribution of the encoded proteoglycan, although it remains possible that the relative importance of the quantity and function of the proteoglycan may avry between tissues. 11 refs., 1 fig.

  10. Cloning of the cDNA for human 12-lipoxygenase

    International Nuclear Information System (INIS)

    Izumi, T.; Hoshiko, S.; Radmark, O.; Samuelsson, B.

    1990-01-01

    A full-length cDNA clone encoding 12-lipoxygenase was isolated from a human platelet cDNA library by using a cDNA for human reticulocyte 15-lipoxygenase as probe for the initial screening. The cDNA had an open reading frame encoding 662 amino acid residues with a calculated molecular weight of 75,590. Three independent clones revealed minor heterogeneities in their DNA sequences. Thus, in three positions of the deduced amino acid sequence, there is a choice between two different amino acids. The deduced sequence from the clone plT3 showed 65% identity with human reticulocyte 15-lipoxygenase and 42% identity with human leukocyte 5-lipoxygenase. The 12-lipoxygenase cDNA recognized a 3.0-kilobase mRNA species in platelets and human erythroleukemia cells (HEL cells). Phorbol 12-tetradecanoyl 13-acetate induced megakaryocytic differentiation of HEL cells and 12-lipoxygenase activity and increased mRNA for 12-lipoxygenase. The identity of the cloned 12-lipoxygenase was assured by expression in a mammalian cell line (COS cells). Human platelet 12-lipoxygenase has been difficult to purify to homogeneity. The cloning of this cDNA will increase the possibilities to elucidate the structure and function of this enzyme

  11. Cloning and characterization of the human colipase cDNA

    International Nuclear Information System (INIS)

    Lowe, M.E.; Rosenblum, J.L.; McEwen, P.; Strauss, A.W.

    1990-01-01

    Pancreatic lipase hydrolyzes dietary triglycerides to monoglycerides and fatty acids. In the presence of bile salts, the activity of pancreatic lipase is markedly decreased. The activity can be restored by the addition of colipase, a low molecular weight protein secreted by the pancreas. The action of pancreatic lipase in the gut lumen is dependent upon its interaction with colipase. As a first step in elucidating the molecular events governing the interaction of lipase and colipase with each other and with fatty acids, a cDNA encoding human colipase was isolated from a λgt11 cDNA library with a rabbit polyclonal anti-human colipase antibody. The full-length 525 bp cDNA contained an open reading frame encoding 112 amino acids, including a 17 amino acid signal peptide. The predicted sequence contains 100% of the published protein sequence for human colipase determined by chemical methods, but predicts the presence of five additional NH 2 -terminal amino acids and four additional COOH-terminal amino acids. Comparison of the predicted protein sequence with the known sequences of colipase from other species reveals regions of extensive identity. The authors report, for the first time, a cDNA for colipase. The cDNA predicts a human procolipase an suggests that there may also be processing at the COOH-terminus. The regions of identity with colipase from other species will aid in defining the interaction with lipase and lipids through site-specific mutagenesis

  12. Complete cDNA sequence of human complement C1s and close physical linkage of the homologous genes C1s and C1r

    International Nuclear Information System (INIS)

    Tosi, M.; Duponchel, C.; Meo, T.; Julier, C.

    1987-01-01

    Overlapping molecular clones encoding the complement subcomponent C1s were isolated from a human liver cDNA library. The nucleotide sequence reconstructed from these clones spans about 85% of the length of the liver C1s messenger RNAs, which occur in three distinct size classes around 3 kilobases in length. Comparisons with the sequence of C1r, the other enzymatic subcomponent of C1, reveal 40% amino acid identity and conservation of all the cysteine residues. Beside the serine protease domain, the following sequence motifs, previously described in C1r, were also found in C1s: (a) two repeats of the type found in the Ba fragment of complement factor B and in several other complement but also noncomplement proteins, (b) a cysteine-rich segment homologous to the repeats of epidermal growth factor precursor, and (c) a duplicated segment found only in C1r and C1s. Differences in each of these structural motifs provide significant clues for the interpretation of the functional divergence of these interacting serine protease zymogens. Hybridizations of C1r and C1s probes to restriction endonuclease fragments of genomic DNA demonstrate close physical linkage of the corresponding genes. The implications of this finding are discussed with respect to the evolution of C1r and C1s after their origin by tandem gene duplication and to the previously observed combined hereditary deficiencies of Clr and Cls

  13. Brain cDNA clone for human cholinesterase

    International Nuclear Information System (INIS)

    McTiernan, C.; Adkins, S.; Chatonnet, A.; Vaughan, T.A.; Bartels, C.F.; Kott, M.; Rosenberry, T.L.; La Du, B.N.; Lockridge, O.

    1987-01-01

    A cDNA library from human basal ganglia was screened with oligonucleotide probes corresponding to portions of the amino acid sequence of human serum cholinesterase. Five overlapping clones, representing 2.4 kilobases, were isolated. The sequenced cDNA contained 207 base pairs of coding sequence 5' to the amino terminus of the mature protein in which there were four ATG translation start sites in the same reading frame as the protein. Only the ATG coding for Met-(-28) lay within a favorable consensus sequence for functional initiators. There were 1722 base pairs of coding sequence corresponding to the protein found circulating in human serum. The amino acid sequence deduced from the cDNA exactly matched the 574 amino acid sequence of human serum cholinesterase, as previously determined by Edman degradation. Therefore, our clones represented cholinesterase rather than acetylcholinesterase. It was concluded that the amino acid sequences of cholinesterase from two different tissues, human brain and human serum, were identical. Hybridization of genomic DNA blots suggested that a single gene, or very few genes coded for cholinesterase

  14. Mouse tetranectin: cDNA sequence, tissue-specific expression, and chromosomal mapping

    DEFF Research Database (Denmark)

    Ibaraki, K; Kozak, C A; Wewer, U M

    1995-01-01

    regulation, mouse tetranectin cDNA was cloned from a 16-day-old mouse embryo library. Sequence analysis revealed a 992-bp cDNA with an open reading frame of 606 bp, which is identical in length to the human tetranectin cDNA. The deduced amino acid sequence showed high homology to the human cDNA with 76......(s) of tetranectin. The sequence analysis revealed a difference in both sequence and size of the noncoding regions between mouse and human cDNAs. Northern analysis of the various tissues from mouse, rat, and cow showed the major transcript(s) to be approximately 1 kb, which is similar in size to that observed...

  15. Cloning, sequencing and expression of cDNA encoding growth ...

    Indian Academy of Sciences (India)

    Unknown

    of medicine, animal husbandry, fish farming and animal ..... northern pike (Esox lucius) growth hormone; Mol. Mar. Biol. ... prolactin 1-luciferase fusion gene in African catfish and ... 1988 Cloning and sequencing of cDNA that encodes goat.

  16. Analysis of a cDNA clone expressing a human autoimmune antigen: full-length sequence of the U2 small nuclear RNA-associated B antigen

    International Nuclear Information System (INIS)

    Habets, W.J.; Sillekens, P.T.G.; Hoet, M.H.; Schalken, J.A.; Roebroek, A.J.M.; Leunissen, J.A.M.; Van de Ven, W.J.M.; Van Venrooij, W.J.

    1987-01-01

    A U2 small nuclear RNA-associated protein, designated B'', was recently identified as the target antigen for autoimmune sera from certain patients with systemic lupus erythematosus and other rheumatic diseases. Such antibodies enabled them to isolate cDNA clone λHB''-1 from a phage λgt11 expression library. This clone appeared to code for the B'' protein as established by in vitro translation of hybrid-selected mRNA. The identity of clone λHB''-1 was further confirmed by partial peptide mapping and analysis of the reactivity of the recombinant antigen with monospecific and monoclonal antibodies. Analysis of the nucleotide sequence of the 1015-base-pair cDNA insert of clone λHB''-1 revealed a large open reading frame of 800 nucleotides containing the coding sequence for a polypeptide of 25,457 daltons. In vitro transcription of the λHB''-1 cDNA insert and subsequent translation resulted in a protein product with the molecular size of the B'' protein. These data demonstrate that clone λHB''-1 contains the complete coding sequence of this antigen. The deduced polypeptide sequence contains three very hydrophilic regions that might constitute RNA binding sites and/or antigenic determinants. These findings might have implications both for the understanding of the pathogenesis of rheumatic diseases as well as for the elucidation of the biological function of autoimmune antigens

  17. Cloning of cDNA sequences of a progestin-regulated mRNA from MCF7 human breast cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Chalbos, D; Westley, B; Alibert, C; Rochefort, H

    1986-01-24

    A cDNA clone corresponding to an mRNA regulated by the progestin R5020, has been isolated by differential screening of a cDNA library from the MCF7 breast cancer cell line, which contains estrogen and progesterone receptors. This probe hybridized with a single species of poly A + RNA of 8-kb molecular weight as shown by Northern blot analysis and could also be used to total RNA preparation. This recombinant cone hybridized specifically to an mRNA coding for a 250,000 daltons protein when translated in vitro. This protein was identical to the 250 kDa progestin-regulated protein that the authors previously described as shown by immunoprecipitation with specific rabbit polyclonal antibodies. Dose-response curve and specificity studies show that the accumulation of the Pg8 mRNA and that of the 250-kDa protein was increased by 5 to 30-fold following progestin treatment and that this effect was mediated by the progesterone receptor. Time course of induction indicated that the accumulation of mRNA was rapid and preceded that of the protein. This is the first report on a cloned cDNA probe of progestin-regulated mRNA in human cell lines.

  18. cDNA, genomic sequence cloning and overexpression of ribosomal ...

    African Journals Online (AJOL)

    RPS16 of eukaryote is a component of the 40S small ribosomal subunit encoded by RPS16 gene and is also a homolog of prokaryotic RPS9. The cDNA and genomic sequence of RPS16 was cloned successfully for the first time from the Giant Panda (Ailuropoda melanoleuca) using reverse transcription-polymerase chain ...

  19. cDNA library construction of two human Demodexspecies.

    Science.gov (United States)

    Niu, DongLing; Wang, RuiLing; Zhao, YaE; Yang, Rui; Hu, Li; Lei, YuYang; Dan, WeiChao

    2017-06-01

    The research of Demodex, a type of pathogen causing various dermatoses in animals and human beings, is lacking at RNA level. This study aims at extracting RNA and constructing cDNA library for Demodex. First, P. cuniculiand D. farinaewere mixed to establish homogenization method for RNA extraction. Second, D. folliculorumand D. breviswere collected and preserved in Trizol, which were mixed with D. farinaerespectively to extract RNA. Finally, cDNA library was constructed and its quality was assessed. The results indicated that for D. folliculorum& D. farinae, the recombination rate of cDNA library was 90.67% and the library titer was 7.50 × 104 pfu/ml. 17 of the 59 positive clones were predicted to be of D. folliculorum; For D. brevis& D. farinae, the recombination rate was 90.96% and the library titer was 7.85 x104 pfu/ml. 40 of the 59 positive clones were predicted to be of D. brevis. Further detection by specific primers demonstrated that mtDNA cox1, cox3and ATP6 detected from cDNA libraries had 96.52%-99.73% identities with the corresponding sequences in GenBank. In conclusion, the cDNA libraries constructed for Demodexmixed with D. farinaewere successful and could satisfy the requirements for functional genes detection.

  20. cDNA encoding a polypeptide including a hevein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, Natasha V. (Okemos, MI); Broekaert, Willem F. (Dilbeek, BE); Chua, Nam-Hai (Scarsdale, NY); Kush, Anil (New York, NY)

    1993-02-16

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a pu GOVERNMENT RIGHTS This application was funded under Department of Energy Contract DE-AC02-76ER01338. The U.S. Government has certain rights under this application and any patent issuing thereon.

  1. The cDNA sequence of a neutral horseradish peroxidase.

    Science.gov (United States)

    Bartonek-Roxå, E; Eriksson, H; Mattiasson, B

    1991-02-16

    A cDNA clone encoding a horseradish (Armoracia rusticana) peroxidase has been isolated and characterized. The cDNA contains 1378 nucleotides excluding the poly(A) tail and the deduced protein contains 327 amino acids which includes a 28 amino acid leader sequence. The predicted amino acid sequence is nine amino acids shorter than the major isoenzyme belonging to the horseradish peroxidase C group (HRP-C) and the sequence shows 53.7% identity with this isoenzyme. The described clone encodes nine cysteines of which eight correspond well with the cysteines found in HRP-C. Five potential N-glycosylation sites with the general sequence Asn-X-Thr/Ser are present in the deduced sequence. Compared to the earlier described HRP-C this is three glycosylation sites less. The shorter sequence and fewer N-glycosylation sites give the native isoenzyme a molecular weight of several thousands less than the horseradish peroxidase C isoenzymes. Comparison with the net charge value of HRP-C indicates that the described cDNA clone encodes a peroxidase which has either the same or a slightly less basic pI value, depending on whether the encoded protein is N-terminally blocked or not. This excludes the possibility that HRP-n could belong to either the HRP-A, -D or -E groups. The low sequence identity (53.7%) with HRP-C indicates that the described clone does not belong to the HRP-C isoenzyme group and comparison of the total amino acid composition with the HRP-B group does not place the described clone within this isoenzyme group. Our conclusion is that the described cDNA clone encodes a neutral horseradish peroxidase which belongs to a new, not earlier described, horseradish peroxidase group.

  2. cDNA sequencing improves the detection of P53 missense mutations in colorectal cancer

    International Nuclear Information System (INIS)

    Szybka, Malgorzata; Kordek, Radzislaw; Zakrzewska, Magdalena; Rieske, Piotr; Pasz-Walczak, Grazyna; Kulczycka-Wojdala, Dominika; Zawlik, Izabela; Stawski, Robert; Jesionek-Kupnicka, Dorota; Liberski, Pawel P

    2009-01-01

    Recently published data showed discrepancies beteween P53 cDNA and DNA sequencing in glioblastomas. We hypothesised that similar discrepancies may be observed in other human cancers. To this end, we analyzed 23 colorectal cancers for P53 mutations and gene expression using both DNA and cDNA sequencing, real-time PCR and immunohistochemistry. We found P53 gene mutations in 16 cases (15 missense and 1 nonsense). Two of the 15 cases with missense mutations showed alterations based only on cDNA, and not DNA sequencing. Moreover, in 6 of the 15 cases with a cDNA mutation those mutations were difficult to detect in the DNA sequencing, so the results of DNA analysis alone could be misinterpreted if the cDNA sequencing results had not also been available. In all those 15 cases, we observed a higher ratio of the mutated to the wild type template by cDNA analysis, but not by the DNA analysis. Interestingly, a similar overexpression of P53 mRNA was present in samples with and without P53 mutations. In terms of colorectal cancer, those discrepancies might be explained under three conditions: 1, overexpression of mutated P53 mRNA in cancer cells as compared with normal cells; 2, a higher content of cells without P53 mutation (normal cells and cells showing K-RAS and/or APC but not P53 mutation) in samples presenting P53 mutation; 3, heterozygous or hemizygous mutations of P53 gene. Additionally, for heterozygous mutations unknown mechanism(s) causing selective overproduction of mutated allele should also be considered. Our data offer new clues for studying discrepancy in P53 cDNA and DNA sequencing analysis

  3. CDNA encoding a polypeptide including a hevein sequence

    Science.gov (United States)

    Raikhel, Natasha V.; Broekaert, Willem F.; Chua, Nam-Hai; Kush, Anil

    1995-03-21

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

  4. cDNA encoding a polypeptide including a hevein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.

    2000-07-04

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

  5. cDNA encoding a polypeptide including a hevein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.

    1999-05-04

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli. 12 figs.

  6. cDNA encoding a polypeptide including a hevein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, Natasha V. (Okemos, MI); Broekaert, Willem F. (Dilbeek, BE); Chua, Nam-Hai (Scarsdale, NY); Kush, Anil (New York, NY)

    1999-05-04

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

  7. cDNA encoding a polypeptide including a hevein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.

    1995-03-21

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1,018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli. 11 figures.

  8. cDNA sequences of two apolipoproteins from lamprey

    International Nuclear Information System (INIS)

    Pontes, M.; Xu, X.; Graham, D.; Riley, M.; Doolittle, R.F.

    1987-01-01

    The messages for two small but abundant apolipoproteins found in lamprey blood plasma were cloned with the aid of oligonucleotide probes based on amino-terminal sequences. In both cases, numerous clones were identified in a lamprey liver cDNA library, consistent with the great abundance of these proteins in lamprey blood. One of the cDNAs (LAL1) has a coding region of 105 amino acids that corresponds to a 21-residue signal peptide, a putative 8-residue propeptide, and the 76-residue mature protein found in blood. The other cDNA (LAL2) codes for a total of 191 residues, the first 23 of which constitute a signal peptide. The two proteins, which occur in the high-density lipoprotein fraction of ultracentrifuged plasma, have amino acid compositions similar to those of apolipoproteins found in mammalian blood; computer analysis indicates that the sequences are largely helix-permissive. When the sequences were searched against an amino acid sequence data base, rat apolipoprotein IV was the best matching candidate in both cases. Although a reasonable alignment can be made with that sequence and LAL1, definitive assignment of the two lamprey proteins to typical mammalian classes cannot be made at this point

  9. Cloning and functional expression of a human pancreatic islet glucose-transporter cDNA

    International Nuclear Information System (INIS)

    Permutt, M.A.; Koranyi, L.; Keller, K.; Lacy, P.E.; Scharp, D.W.; Mueckler, M.

    1989-01-01

    Previous studies have suggested that pancreatic islet glucose transport is mediated by a high-K m , low-affinity facilitated transporter similar to that expressed in liver. To determine the relationship between islet and liver glucose transporters, liver-type glucose-transporter cDNA clones were isolated from a human liver cDNA library. The liver-type glucose-transporter cDNA clone hybridized to mRNA transcripts of the same size in human liver and pancreatic islet RNA. A cDNA library was prepared from purified human pancreatic islet tissue and screened with human liver-type glucose-transporter cDNA. The authors isolated two overlapping cDNA clones encompassing 2600 base pairs, which encode a pancreatic islet protein identical in sequence to that of the putative liver-type glucose-transporter protein. Xenopus oocytes injected with synthetic mRNA transcribed from a full-length cDNA construct exhibited increased uptake of 2-deoxyglucose, confirming the functional identity of the clone. These cDNA clones can now be used to study regulation of expression of the gene and to assess the role of inherited defects in this gene as a candidate for inherited susceptibility to non-insulin-dependent diabetes mellitus

  10. Cloning and sequencing of Indian Water buffalo (Bubalus bubalis) interleukin-3 cDNA

    KAUST Repository

    Sugumar, Thennarasu

    2011-12-12

    Full-length cDNA (435 bp) of the interleukin-3(IL-3) gene of the Indian water buffalo was amplified by reverse transcriptase-polymerase chain reaction and sequenced. This sequence had 96% nucleotide identity and 92% amino acid identity with bovine IL-3. There are 10 amino acid substitutions in buffalo compared with that of bovine. The amino acid sequence of buffalo IL-3 also showed very high identity with that of other ruminants, indicating functional cross-reactivity. Structural homology modelling of buffalo IL-3 protein with human IL-3 showed the presence of five helical structures.

  11. Generation and Analysis of Full-length cDNA Sequences from Elephant Shark (Callorhinchus milii)

    KAUST Repository

    Kodzius, Rimantas

    2009-03-17

    Cartilaginous fishes are the oldest living group of jawed vertebrates and therefore is an important group for understanding the evolution of vertebrate genomes including the human genome. Our laboratory has proposed elephant shark (C. milii) as a model cartilaginous fish genome because of its relatively small genome size (910 Mb). The whole genome of C. milii is being sequenced (first cartilaginous fish genome to be sequenced completely). To characterize the transcriptome of C. milii and to assist in annotating exon-intron boundaries, transcriptional start sites and alternatively spliced transcripts, we are generating full-length cDNA sequences from C. milii.

  12. Signal sequence and keyword trap in silico for selection of full-length human cDNAs encoding secretion or membrane proteins from oligo-capped cDNA libraries.

    Science.gov (United States)

    Otsuki, Tetsuji; Ota, Toshio; Nishikawa, Tetsuo; Hayashi, Koji; Suzuki, Yutaka; Yamamoto, Jun-ichi; Wakamatsu, Ai; Kimura, Kouichi; Sakamoto, Katsuhiko; Hatano, Naoto; Kawai, Yuri; Ishii, Shizuko; Saito, Kaoru; Kojima, Shin-ichi; Sugiyama, Tomoyasu; Ono, Tetsuyoshi; Okano, Kazunori; Yoshikawa, Yoko; Aotsuka, Satoshi; Sasaki, Naokazu; Hattori, Atsushi; Okumura, Koji; Nagai, Keiichi; Sugano, Sumio; Isogai, Takao

    2005-01-01

    We have developed an in silico method of selection of human full-length cDNAs encoding secretion or membrane proteins from oligo-capped cDNA libraries. Fullness rates were increased to about 80% by combination of the oligo-capping method and ATGpr, software for prediction of translation start point and the coding potential. Then, using 5'-end single-pass sequences, cDNAs having the signal sequence were selected by PSORT ('signal sequence trap'). We also applied 'secretion or membrane protein-related keyword trap' based on the result of BLAST search against the SWISS-PROT database for the cDNAs which could not be selected by PSORT. Using the above procedures, 789 cDNAs were primarily selected and subjected to full-length sequencing, and 334 of these cDNAs were finally selected as novel. Most of the cDNAs (295 cDNAs: 88.3%) were predicted to encode secretion or membrane proteins. In particular, 165(80.5%) of the 205 cDNAs selected by PSORT were predicted to have signal sequences, while 70 (54.2%) of the 129 cDNAs selected by 'keyword trap' preserved the secretion or membrane protein-related keywords. Many important cDNAs were obtained, including transporters, receptors, and ligands, involved in significant cellular functions. Thus, an efficient method of selecting secretion or membrane protein-encoding cDNAs was developed by combining the above four procedures.

  13. Molecular cloning and mammalian expression of human beta 2-glycoprotein I cDNA

    DEFF Research Database (Denmark)

    Kristensen, Torsten; Schousboe, Inger; Boel, Espen

    1991-01-01

    Human β2-glycoprotein (β2gpI) cDNA was isolated from a liver cDNA library and sequenced. The cDNA encoded a 19-residue hydrophobic signal peptide followed by the mature β2gpI of 326 amino acid residues. In liver and in the hepatoma cell line HepG2 there are two mRNA species of about 1.4 and 4.3 kb......, respectively, hybridizing specifically with the β2gpI cDNA. Upon isoelectric focusing, recombinant β2gpI obtained from expression of β2gpI cDNA in baby hamster kidney cells showed the same pattern of bands as β2gpI isolated from plasma, and at least 5 polypeptides were visible...

  14. Cloning of the human androgen receptor cDNA

    International Nuclear Information System (INIS)

    Govindan, M.V.; Burelle, M.; Cantin, C.; Kabrie, C.; Labrie, F.; Lachance, Y.; Leblanc, G.; Lefebvre, C.; Patel, P.; Simard, J.

    1988-01-01

    The authors discuss how in order to define the functional domains of the human androgen receptor, complementary DNA (cDNA) clones encoding the human androgen receptor (hAR) have been isolated from a human testis λgtll cDNA library using synthetic oligonnucleotide probes, homologous to segments of the human glucocorticoid, estradiol and progesterone receptors. The cDNA clones corresponding to the human glucocorticoid, estradiol and progesterone receptors were eliminated after cross-hybridization with their respective cDNA probes and/or after restriction mapping of the cDNA clones. The remaining cDNA clones were classified into different groups after analysis by restriction digestion and cross-hybridization. Two of the largest cDNA clones from each group were inserted into an expression vector in both orientations. The linearized plasmids were used as templates in in vitro transcription with T7 RNA polymerase. Subsequent in vitro translation of the purified transcripts in rabbit reticulocyte lysate followed by sodium dodecylsulfate polyacrylamide gel electrophoresis (SDS-PAGE) permitted the characterization of the encoded polyeptides. The expressed proteins larger than 30,000 Da were analyzed for their ability to bind tritium-labelled dihydrotestosterone ([ 3 H] DHT) with high affinity and specificity

  15. Benchmarking of the Oxford Nanopore MinION sequencing for quantitative and qualitative assessment of cDNA populations.

    Science.gov (United States)

    Oikonomopoulos, Spyros; Wang, Yu Chang; Djambazian, Haig; Badescu, Dunarel; Ragoussis, Jiannis

    2016-08-24

    To assess the performance of the Oxford Nanopore Technologies MinION sequencing platform, cDNAs from the External RNA Controls Consortium (ERCC) RNA Spike-In mix were sequenced. This mix mimics mammalian mRNA species and consists of 92 polyadenylated transcripts with known concentration. cDNA libraries were generated using a template switching protocol to facilitate the direct comparison between different sequencing platforms. The MinION performance was assessed for its ability to sequence the cDNAs directly with good accuracy in terms of abundance and full length. The abundance of the ERCC cDNA molecules sequenced by MinION agreed with their expected concentration. No length or GC content bias was observed. The majority of cDNAs were sequenced as full length. Additionally, a complex cDNA population derived from a human HEK-293 cell line was sequenced on an Illumina HiSeq 2500, PacBio RS II and ONT MinION platforms. We observed that there was a good agreement in the measured cDNA abundance between PacBio RS II and ONT MinION (rpearson = 0.82, isoforms with length more than 700bp) and between Illumina HiSeq 2500 and ONT MinION (rpearson = 0.75). This indicates that the ONT MinION can sequence quantitatively both long and short full length cDNA molecules.

  16. Cloning and expression of a cDNA coding for a human monocyte-derived plasminogen activator inhibitor.

    OpenAIRE

    Antalis, T M; Clark, M A; Barnes, T; Lehrbach, P R; Devine, P L; Schevzov, G; Goss, N H; Stephens, R W; Tolstoshev, P

    1988-01-01

    Human monocyte-derived plasminogen activator inhibitor (mPAI-2) was purified to homogeneity from the U937 cell line and partially sequenced. Oligonucleotide probes derived from this sequence were used to screen a cDNA library prepared from U937 cells. One positive clone was sequenced and contained most of the coding sequence as well as a long incomplete 3' untranslated region (1112 base pairs). This cDNA sequence was shown to encode mPAI-2 by hybrid-select translation. A cDNA clone encoding t...

  17. Full-length cDNA sequences from Rhesus monkey placenta tissue: analysis and utility for comparative mapping

    Directory of Open Access Journals (Sweden)

    Lee Sang-Rae

    2010-07-01

    Full Text Available Abstract Background Rhesus monkeys (Macaca mulatta are widely-used as experimental animals in biomedical research and are closely related to other laboratory macaques, such as cynomolgus monkeys (Macaca fascicularis, and to humans, sharing a last common ancestor from about 25 million years ago. Although rhesus monkeys have been studied extensively under field and laboratory conditions, research has been limited by the lack of genetic resources. The present study generated placenta full-length cDNA libraries, characterized the resulting expressed sequence tags, and described their utility for comparative mapping with human RefSeq mRNA transcripts. Results From rhesus monkey placenta full-length cDNA libraries, 2000 full-length cDNA sequences were determined and 1835 rhesus placenta cDNA sequences longer than 100 bp were collected. These sequences were annotated based on homology to human genes. Homology search against human RefSeq mRNAs revealed that our collection included the sequences of 1462 putative rhesus monkey genes. Moreover, we identified 207 genes containing exon alterations in the coding region and the untranslated region of rhesus monkey transcripts, despite the highly conserved structure of the coding regions. Approximately 10% (187 of all full-length cDNA sequences did not represent any public human RefSeq mRNAs. Intriguingly, two rhesus monkey specific exons derived from the transposable elements of AluYRa2 (SINE family and MER11B (LTR family were also identified. Conclusion The 1835 rhesus monkey placenta full-length cDNA sequences described here could expand genomic resources and information of rhesus monkeys. This increased genomic information will greatly contribute to the development of evolutionary biology and biomedical research.

  18. cDNA encoding a polypeptide including a hevein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, N.V.; Broekaert, W.F.; Namhai Chua; Kush, A.

    1993-02-16

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1,018 nucleotides long and includes an open reading frame of 204 amino acids.

  19. cDNA sequences of two inducible T-cell genes

    Energy Technology Data Exchange (ETDEWEB)

    Kwon, B.S. (Indiana Univ. School of Medicine, Indianapolis (USA) Guthrie Research Institute, Sayre, PA (USA)); Weissman, S.M. (Yale Univ., New Haven, CT (USA))

    1989-03-01

    The authors have previously described a set of human T-lymphocyte-specific cDNA clones isolated by a modified differential screening procedure. Apparent full-length cDNAs containing the sequences of 14 of the 16 initial isolates were sequenced and were found to represent five different species of mRNA; three of the five species were identical to previously reported cDNA sequences of preproenkephalin, T-cell-replacing factor, and a serine esterase, respectively. The other two species, 4-1BB and L2G25B, were inducible sequences found in mRNA from both a cytolytic T-lymphocyte and a helper T-lymphocyte clone and were not previously described in T-cell mRNA; these mRNA sequences encode peptides of 256 and 92 amino acids, respectively. Both peptides contain putative leader sequences. The protein encoded by 4-1BB also has a potential membrane anchor segment and other features also seen in known receptor proteins.

  20. Complete cDNA sequence of the preproform of human pregnancy-associated plasma protein-A. Evidence for expression in the brain and induction by cAMP

    DEFF Research Database (Denmark)

    Haaning, Jesper; Oxvig, Claus; Overgaard, Michael Toft

    1996-01-01

    A cDNA that encodes the prepropeptide of pregnancy-associated plasma protein-A (preproPAPP-A), a putative metalloproteinase, has been cloned and sequenced. PAPP-A is synthesized in the placenta as a 1627-residue precursor preproprotein with a putative 22-residue signal peptide and a highly basic...

  1. Microarray and cDNA sequence analysis of transcription during nerve-dependent limb regeneration

    Directory of Open Access Journals (Sweden)

    Bryant Susan V

    2009-01-01

    Full Text Available Abstract Background Microarray analysis and 454 cDNA sequencing were used to investigate a centuries-old problem in regenerative biology: the basis of nerve-dependent limb regeneration in salamanders. Innervated (NR and denervated (DL forelimbs of Mexican axolotls were amputated and transcripts were sampled after 0, 5, and 14 days of regeneration. Results Considerable similarity was observed between NR and DL transcriptional programs at 5 and 14 days post amputation (dpa. Genes with extracellular functions that are critical to wound healing were upregulated while muscle-specific genes were downregulated. Thus, many processes that are regulated during early limb regeneration do not depend upon nerve-derived factors. The majority of the transcriptional differences between NR and DL limbs were correlated with blastema formation; cell numbers increased in NR limbs after 5 dpa and this yielded distinct transcriptional signatures of cell proliferation in NR limbs at 14 dpa. These transcriptional signatures were not observed in DL limbs. Instead, gene expression changes within DL limbs suggest more diverse and protracted wound-healing responses. 454 cDNA sequencing complemented the microarray analysis by providing deeper sampling of transcriptional programs and associated biological processes. Assembly of new 454 cDNA sequences with existing expressed sequence tag (EST contigs from the Ambystoma EST database more than doubled (3935 to 9411 the number of non-redundant human-A. mexicanum orthologous sequences. Conclusion Many new candidate gene sequences were discovered for the first time and these will greatly enable future studies of wound healing, epigenetics, genome stability, and nerve-dependent blastema formation and outgrowth using the axolotl model.

  2. The function analysis of full-length cDNA sequence from IRM-2 mouse cDNA library

    International Nuclear Information System (INIS)

    Wang Qin; Liu Xiaoqiu; Xu Chang; Du Liqing; Sun Zhijuan; Wang Yan; Liu Qiang; Song Li; Li Jin; Fan Feiyue

    2013-01-01

    Objective: To identify the function of full-length cDNA sequence from IRM-2 mouse cDNA library. Methods: Full-length cDNA products were amplified by PCR from IRM-2 mouse cDNA library according to twenty-one pieces of expressed sequence tag. The expression of full-length cDNAs were detected after mouse embryonic fibroblasts were exposed to 6.5 Gy γ-ray radiation. And the effect on the growth of radiosensitivity cells AT5B1VA transfected with full-length cDNAs was investigated. Results: The expression of No.4, 5 and 2 full-length cDNAs from IRM-2 mouse were higher than that of parental ICR and 615 mouse after mouse embryonic fibroblasts irradiated with γ-ray radiation. And the survival rate of AT5B1VA cells transfected with No.4, 5 and 2 full-length cDNAs was high. Conclusion: No.4, 5 and 2 full-length cDNAs of IRM-2 mouse are of high radioresistance. (authors)

  3. Two human cDNA molecules coding for the Duchenne muscular dystrophy (DMD) locus are highly homologous

    Energy Technology Data Exchange (ETDEWEB)

    Rosenthal, A.; Speer, A.; Billwitz, H. (Zentralinstitut fuer Molekularbiologie, Berlin-Buch (Germany Democratic Republic)); Cross, G.S.; Forrest, S.M.; Davies, K.E. (Univ. of Oxford (England))

    1989-07-11

    Recently the complete sequence of the human fetal cDNA coding for the Duchenne muscular dystrophy (DMD) locus was reported and a 3,685 amino acid long, rod-shaped cytoskeletal protein (dystrophin) was predicted as the protein product. Independently, the authors have isolated and sequenced different DMD cDNA molecules from human adult and fetal muscle. The complete 12.5 kb long sequence of all their cDNA clones has now been determined and they report here the nucleotide (nt) and amino acid (aa) differences between the sequences of both groups. The cDNA sequence comprises the whole coding region but lacks the first 110 nt from the 5{prime}-untranslated region and the last 1,417 nt of the 3{prime}-untranslated region. They have found 11 nt differences (approximately 99.9% homology) from which 7 occurred at the aa level.

  4. Isolation of cDNA clones coding for human tissue factor: primary structure of the protein and cDNA

    International Nuclear Information System (INIS)

    Spicer, E.K.; Horton, R.; Bloem, L.

    1987-01-01

    Tissue factor is a membrane-bound procoagulant protein that activates the extrinsic pathway of blood coagulation in the presence of factor VII and calcium. λ Phage containing the tissue factor gene were isolated from a human placental cDNA library. The amino acid sequence deduced from the nucleotide sequence of the cDNAs indicates that tissue factor is synthesized as a higher molecular weight precursor with a leader sequence of 32 amino acids, while the mature protein is a single polypeptide chain composed of 263 residues. The derived primary structure of tissue factor has been confirmed by comparison to protein and peptide sequence data. The sequence of the mature protein suggests that there are three distinct domains: extracellular, residues 1-219; hydrophobic, residues 220-242; and cytoplasmic, residues 243-263. Three potential N-linked carbohydrate attachment sites occur in the extracellular domain. The amino acid sequence of tissue factor shows no significant homology with the vitamin K-dependent serine proteases, coagulation cofactors, or any other protein in the National Biomedical Research Foundation sequence data bank (Washington, DC)

  5. Cloning and expression of human deoxycytidine kinase cDNA

    International Nuclear Information System (INIS)

    Chottiner, E.G.; Shewach, D.S.; Datta, N.S.; Ashcraft, E.; Gribbin, D.; Ginsburg, D.; Fox, I.H.; Mitchell, B.S.

    1991-01-01

    Deoxycytidine (dCyd) kinase is required for the phosphorylation of several deoxyribonucleosides and certain nucleoside analogs widely employed as antiviral and chemotherapeutic agents. Detailed analysis of this enzyme has been limited, however, by its low abundance and instability. Using oligonucleotides based on primary amino acid sequence derived from purified dCyd kinase, the authors have screened T-lymphoblast cDNA libraries and identified a cDNA sequence that encodes a 30.5-kDa protein corresponding to the subunit molecular mass of the purified protein. Expression of the cDNA in Escherichia coli results in a 40-fold increase in dCyd kinase activity over control levels. Northern blot analysis reveals a single 2.8-kilobase mRNA expressed in T lymphoblasts at 5- to 10-fold higher levels than in B lymphoblasts, and decreased dCyd kinase mRNA levels are present in T-lymphoblast cell lines resistant to arabinofuranosylcytosine and dideoxycytidine. These findings document that this cDNA encodes the T-lymphoblast dCyd kinase responsible for the phosphorylation of dAdo and dGuo as well as dCyd and arabinofuranosylcytosine

  6. Cloning and expression of a cDNA encoding human sterol carrier protein 2

    International Nuclear Information System (INIS)

    Yamamoto, Ritsu; Kallen, C.B.; Babalola, G.O.; Rennert, H.; Strauss, J.F. III; Billheimer, J.T.

    1991-01-01

    The authors report the cloning and expression of a cDNA encoding human sterol carrier protein 2 (SCP 2 ). The 1.3-kilobase (kb) cDNA contains an open reading frame which encompasses a 143-amino acid sequence which is 89% identical to the rat SCP 2 amino acid sequence. The deduced amino acid sequence of the polypeptide reveals a 20-residue amino-terminal leader sequence in front of the mature polypeptide, which contains a carboxyl-terminal tripeptide (Ala-Lys-Leu) related to the peroxisome targeting sequence. The expressed cDNA in COS-7 cells yields a 15.3-kDa polypeptide and increased amounts of a 13.2-kDa polypeptide, both reacting with a specific rabbit antiserum to rat liver SCP 2 . The cDNA insert hybridizes with 3.2- and 1.8-kb mRNA species in human liver poly(A) + RNA. In human fibroblasts and placenta the 1.8-kb mRNA was most abundant. Southern blot analysis suggests either that there are multiple copies of the SCP 2 gene in the human genome or that the SCP 2 gene is very large. Coexpression of the SCP 2 cDNA with expression vectors for cholesterol side-chain cleavage enzyme and adrenodoxin resulted in a 2.5-fold enhancement of progestin synthesis over that obtained with expression of the steroidogenic enzyme system alone. These findings are concordant with the notion that SCP 2 plays a role in regulating steroidogenesis, among other possible functions

  7. Characterization of the cDNA encoding human nucleophosmin and studies of its role in normal and abnormal growth

    International Nuclear Information System (INIS)

    Chan, Waiyee; Liu, Qingrong; Borjigin, J.; Busch, H.; Rennert, O.M.; Tease, L.A.; Chan, Puikwong

    1989-01-01

    A cDNA encoding human nucleophosmin (protein B23) was obtained by screening a human placental cDNA library in δgtll first with monoclonal antibody to rat nucleophosmin and then with confirmed partial cDNA of human nucleophosmin as probes. The cDNA had 1,311 bp with a coding sequence encoding a protein of 294 amino acids. The identity of the cDNA was confirmed by the presence of encoded amino acid sequences identical with those determined by sequencing pure rat nucleophosmin (a total of 138 amino acids). The most striking feature of the sequence is an acidic cluster located in the middle of the molecule. The cluster consists of 26 Asp/Glu and 1 Phe and Ala. Comparison of human nucleophosmin and Xenopus nucleolar protein NO38 shows 64.3% sequence identity. The N-terminal 130 amino acids of human nucleophosmin also bear 50% identity with that of Xenopus nucleoplasmin. Northern blot analysis of rat liver total RNA with a partial nucleophosmin cDNA as probe demonstrated a homogeneous mRNA band of about 1.6 kb. Similar observations were made in hypertrophic rat liver and Novikoff hepatoma. When the protein levels were compared with Western blot immunoassays, Navikoff hepatoma showed 20 times more nucleophosmin, while only about 5 times more nucleophosmin was observed in hypertrophic rat liver than in unstimulated normal liver

  8. Characterization and immunological identification of cDNA clones encoding two human DNA topoisomerase II isozymes

    International Nuclear Information System (INIS)

    Chung, T.D.Y.; Drake, F.H.; Tan, K.B.; Per, S.R.; Crooke, S.T.; Mirabelli, C.K.

    1989-01-01

    Several DNA topoisomerase II partial cDNA clones obtained from a human Raji-HN2 cDNA library were sequenced and two classes of nucleotide sequences were found. One member of the first class, SP1, was identical to an internal fragment of human HeLa cell Topo II cDNA described earlier. A member of the second class, SP11, shared extensive nucleotide (75%) and predicted peptide (92%) sequence similarities with the first two-thirds of HeLa Topo II. Each class of cDNAs hybridized to unique, nonoverlapping restriction enzyme fragments of genomic DNA from several human cell lines. Synthetic 24-mer oligonucleotide probes specific for each cDNA class hybridized to 6.5-kilobase mRNAs; furthermore, hybridization of probe specific for one class was not blocked by probe specific for the other. Antibodies raised against a synthetic SP1-encoded dodecapeptide specifically recognized the 170-kDa form of Topo II, while antibodies raised against the corresponding SP11-encoded dodecapeptide, or a second unique SP11-encoded tridecapeptide, selectively recognized the 180-kDa form of Topo II. These data provide genetic and immunochemical evidence for two Topo II isozymes

  9. Three human alcohol dehydrogenase subunits: cDNA structure and molecular and evolutionary divergence

    International Nuclear Information System (INIS)

    Ikuta, T.; Szeto, S.; Yoshida, A.

    1986-01-01

    Class I human alcohol dehydrogenase (ADH; alcohol:NAD + oxidoreductase, EC 1.1.1.1) consists of several homo- and heterodimers of α, β, and γ subunits that are governed by the ADH1, ADH2, and ADH3 loci. The authors previously cloned a full length of cDNA for the β subunit, and the complete sequence of 374 amino acid residues was established. cDNAs for the α and γ subunits were cloned and characterized. A human liver cDNA library, constructed in phage λgt11, was screened by using a synthetic oligonucleotide probe that was matched to the γ but not to the β sequence. Clone pUCADHγ21 and clone pUCADHα15L differed from β cDNA with respect to restriction sites and hybridization with the nucleotide probe. Clone pUCADHγ21 contained an insertion of 1.5 kilobase pairs (kbp) and encodes 374 amino acid residues compatible with the reported amino acid sequence of the γ subunit. Clone pUCADHα15L contained an insertion of 2.4 kbp and included nucleotide sequences that encode 374 amino acid residues for another subunit, the γ subunit. In addition, this clone contained the sequences that encode the COOH-terminal part of the β subunit at its extended 5' region. The amino acid sequences and coding regions of the cDNAs of the three subunits are very similar. A high degree of resemblance is observed also in their 3' noncoding regions. However, distinctive differences exist in the vicinity of the Zn-binding cysteine residue at position 46. Based on the cDNA sequences and the deduced amino acid sequences of the three subunits, their structural and evolutionary relationships are discussed

  10. Sequence of a cDNA encoding turtle high mobility group 1 protein.

    Science.gov (United States)

    Zheng, Jifang; Hu, Bi; Wu, Duansheng

    2005-07-01

    In order to understand sequence information about turtle HMG1 gene, a cDNA encoding HMG1 protein of the Chinese soft-shell turtle (Pelodiscus sinensis) was amplified by RT-PCR from kidney total RNA, and was cloned, sequenced and analyzed. The results revealed that the open reading frame (ORF) of turtle HMG1 cDNA is 606 bp long. The ORF codifies 202 amino acid residues, from which two DNA-binding domains and one polyacidic region are derived. The DNA-binding domains share higher amino acid identity with homologues sequences of chicken (96.5%) and mammalian (74%) than homologues sequence of rainbow trout (67%). The polyacidic region shows 84.6% amino acid homology with the equivalent region of chicken HMG1 cDNA. Turtle HMG1 protein contains 3 Cys residues located at completely conserved positions. Conservation in sequence and structure suggests that the functions of turtle HMG1 cDNA may be highly conserved during evolution. To our knowledge, this is the first report of HMG1 cDNA sequence in any reptilian.

  11. Cloning of the cDNA and gene for a human D2 dopamine receptor

    International Nuclear Information System (INIS)

    Grady, D.K.; Makam, H.; Stofko, R.E.; Bunzow, J.R.; Civelli, O.; Marchionni, M.A.; Alfano, M.; Frothingham, L.; Fischer, J.B.; Burke-Howie, K.J.; Server, A.C.

    1989-01-01

    A clone encoding a human D 2 dopamine receptor was isolated from a pituitary cDNA library and sequenced. The deduced protein sequence is 96% identical with that of the cloned rat receptor with one major difference: the human receptor contains an additional 29 amino acids in its putative third cytoplasmic loop. Southern blotting demonstrated the presence of only one human D 2 receptor gene. Two overlapping phage containing the gene were isolated and characterized. DNA sequence analysis of these clones showed that the coding sequence is interrupted by six introns and that the additional amino acids present in the human pituitary receptor are encoded by a single exon of 87 base pairs. The involvement of this sequence in alternative splicing and its biological significance are discussed

  12. Cloning and sequencing of Indian Water buffalo (Bubalus bubalis) interleukin-3 cDNA

    KAUST Repository

    Sugumar, Thennarasu; Harishankar, M.; Dhinakar Raj, G.

    2011-01-01

    Full-length cDNA (435 bp) of the interleukin-3(IL-3) gene of the Indian water buffalo was amplified by reverse transcriptase-polymerase chain reaction and sequenced. This sequence had 96% nucleotide identity and 92% amino acid identity with bovine

  13. Molecular cloning and sequence analysis of hamster CENP-A cDNA

    Directory of Open Access Journals (Sweden)

    Valdivia Manuel M

    2002-05-01

    Full Text Available Abstract Background The centromere is a specialized locus that mediates chromosome movement during mitosis and meiosis. This chromosomal domain comprises a uniquely packaged form of heterochromatin that acts as a nucleus for the assembly of the kinetochore a trilaminar proteinaceous structure on the surface of each chromatid at the primary constriction. Kinetochores mediate interactions with the spindle fibers of the mitotic apparatus. Centromere protein A (CENP-A is a histone H3-like protein specifically located to the inner plate of kinetochore at active centromeres. CENP-A works as a component of specialized nucleosomes at centromeres bound to arrays of repeat satellite DNA. Results We have cloned the hamster homologue of human and mouse CENP-A. The cDNA isolated was found to contain an open reading frame encoding a polypeptide consisting of 129 amino acid residues with a C-terminal histone fold domain highly homologous to those of CENP-A and H3 sequences previously released. However, significant sequence divergence was found at the N-terminal region of hamster CENP-A that is five and eleven residues shorter than those of mouse and human respectively. Further, a human serine 7 residue, a target site for Aurora B kinase phosphorylation involved in the mechanism of cytokinesis, was not found in the hamster protein. A human autoepitope at the N-terminal region of CENP-A described in autoinmune diseases is not conserved in the hamster protein. Conclusions We have cloned the hamster cDNA for the centromeric protein CENP-A. Significant differences on protein sequence were found at the N-terminal tail of hamster CENP-A in comparison with that of human and mouse. Our results show a high degree of evolutionary divergence of kinetochore CENP-A proteins in mammals. This is related to the high diverse nucleotide repeat sequences found at the centromere DNA among species and support a current centromere model for kinetochore function and structural

  14. Cloning and sequence analysis of cDNA coding for rat nucleolar protein C23

    International Nuclear Information System (INIS)

    Ghaffari, S.H.; Olson, M.O.J.

    1986-01-01

    Using synthetic oligonucleotides as primers and probes, the authors have isolated and sequenced cDNA clones encoding protein C23, a putative nucleolus organizer protein. Poly(A + ) RNA was isolated from rat Novikoff hepatoma cells and enriched in C23 mRNA by sucrose density gradient ultracentrifugation. Two deoxyoligonuleotides, a 48- and a 27-mer, were synthesized on the basis of amino acid sequence from the C-terminal half of protein C23 and cDNA sequence data from CHO cell protein. The 48-mer was used a primer for synthesis of cDNA which was then inserted into plasmid pUC9. Transformed bacterial colonies were screened by hybridization with 32 P labeled 27-mer. Two clones among 5000 gave a strong positive signal. Plasmid DNAs from these clones were purified and characterized by blotting and nucleotide sequence analysis. The length of C23 mRNA was estimated to be 3200 bases in a northern blot analysis. The sequence of a 267 b.p. insert shows high homology with the CHO cDNA with only 9 nucleotide differences and an identical amino acid sequence. These studies indicate that this region of the protein is highly conserved

  15. Budding yeast cDNA sequencing project: S03036-05_I15 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available EST - Link to UCSC Genome Browser - Sequence >S03036-05_I15.phd NNNTNNTNNNNCNCTCACATANAAGACGGANNAGNNNGCTGGGC...CAATGCGTTCCATATGCG AAAATTCTTGGNCAATGTATTCTCTAGCAATCTNTNCTTTTGTACANTCGGAGGNTTNTC ATGNTCCTTTCATANATTATANAAANNG

  16. A putative peroxidase cDNA from turnip and analysis of the encoded protein sequence.

    Science.gov (United States)

    Romero-Gómez, S; Duarte-Vázquez, M A; García-Almendárez, B E; Mayorga-Martínez, L; Cervantes-Avilés, O; Regalado, C

    2008-12-01

    A putative peroxidase cDNA was isolated from turnip roots (Brassica napus L. var. purple top white globe) by reverse transcriptase-polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE). Total RNA extracted from mature turnip roots was used as a template for RT-PCR, using a degenerated primer designed to amplify the highly conserved distal motif of plant peroxidases. The resulting partial sequence was used to design the rest of the specific primers for 5' and 3' RACE. Two cDNA fragments were purified, sequenced, and aligned with the partial sequence from RT-PCR, and a complete overlapping sequence was obtained and labeled as BbPA (Genbank Accession No. AY423440, named as podC). The full length cDNA is 1167bp long and contains a 1077bp open reading frame (ORF) encoding a 358 deduced amino acid peroxidase polypeptide. The putative peroxidase (BnPA) showed a calculated Mr of 34kDa, and isoelectric point (pI) of 4.5, with no significant identity with other reported turnip peroxidases. Sequence alignment showed that only three peroxidases have a significant identity with BnPA namely AtP29a (84%), and AtPA2 (81%) from Arabidopsis thaliana, and HRPA2 (82%) from horseradish (Armoracia rusticana). Work is in progress to clone this gene into an adequate host to study the specific role and possible biotechnological applications of this alternative peroxidase source.

  17. Isolation and characterization of human cDNA clones encoding the α and the α' subunits of casein kinase II

    International Nuclear Information System (INIS)

    Lozeman, F.J.; Litchfield, D.W.; Piening, C.; Takio, Koji; Walsh, K.A.; Krebs, E.G.

    1990-01-01

    Casein kinase II is a widely distributed protein serine/threonine kinase. The holoenzyme appears to be a tetramer, containing two α or α' subunits (or one of each) and two β subunits. Complementary DNA clones encoding the subunits of casein kinase II were isolated from a human T-cell λgt 10 library using cDNA clones isolated from Drosophila melanogasten. One of the human cDNA clones (hT4.1) was 2.2 kb long, including a coding region of 1176 bp preceded by 156 bp (5' untranslated region) and followed by 871 bp (3' untranslated region). The hT4.1 close was nearly identical in size and sequence with a cDNA clone from HepG2 human hepatoma cultured cells. Another of the human T-cell cDNA clones (hT9.1) was 1.8 kb long, containing a coding region of 1053 bp preceded by 171 by (5' untranslated region) and followed by 550 bp (3' untranslated region). Amino acid sequences deduced from these two cDNA clones were about 85% identical. Most of the difference between the two encoded polypeptides was in the carboxy-terminal region, but heterogeneity was distributed throughout the molecules. Partial amino acid sequence was determined in a mixture of α and α' subunits from bovine lung casein kinase II. The bovine sequences aligned with the 2 human cDNA-encoded polypeptides with only 2 discrepancies out of 535 amino acid positions. This confirmed that the two human T-cell cDNA clones encoded the α and α' subunits of casein kinase II. These studies show that there are two distinct catalytic subunits for casein II (α and α') and that the sequence of these subunits is largely conserved between the bovine and the human

  18. cDNA, genomic cloning and sequence analysis of ribosomal protein ...

    African Journals Online (AJOL)

    enoh

    2012-03-13

    Mar 13, 2012 ... cDNA and the genomic sequence of RPS4X were cloned successfully from ... S4 genes plays a role in Turner syndrome; however, this ..... Project of Educational Committee of Sichuan Province ... Molecular biology of the cell.

  19. cDNA, genomic sequence cloning and analysis of the ribosomal ...

    African Journals Online (AJOL)

    Ribosomal protein L37A (RPL37A) is a component of 60S large ribosomal subunit encoded by the RPL37A gene, which belongs to the family of ribosomal L37AE proteins, located in the cytoplasm. The complementary deoxyribonucleic acid (cDNA) and the genomic sequence of RPL37A were cloned successfully from giant ...

  20. Detection of reverse transcriptase termination sites using cDNA ligation and massive parallel sequencing

    DEFF Research Database (Denmark)

    Kielpinski, Lukasz J; Boyd, Mette; Sandelin, Albin

    2013-01-01

    Detection of reverse transcriptase termination sites is important in many different applications, such as structural probing of RNAs, rapid amplification of cDNA 5' ends (5' RACE), cap analysis of gene expression, and detection of RNA modifications and protein-RNA cross-links. The throughput...... of these methods can be increased by applying massive parallel sequencing technologies.Here, we describe a versatile method for detection of reverse transcriptase termination sites based on ligation of an adapter to the 3' end of cDNA with bacteriophage TS2126 RNA ligase (CircLigase™). In the following PCR...

  1. Cost-effective sequencing of full-length cDNA clones powered by a de novo-reference hybrid assembly.

    Science.gov (United States)

    Kuroshu, Reginaldo M; Watanabe, Junichi; Sugano, Sumio; Morishita, Shinichi; Suzuki, Yutaka; Kasahara, Masahiro

    2010-05-07

    Sequencing full-length cDNA clones is important to determine gene structures including alternative splice forms, and provides valuable resources for experimental analyses to reveal the biological functions of coded proteins. However, previous approaches for sequencing cDNA clones were expensive or time-consuming, and therefore, a fast and efficient sequencing approach was demanded. We developed a program, MuSICA 2, that assembles millions of short (36-nucleotide) reads collected from a single flow cell lane of Illumina Genome Analyzer to shotgun-sequence approximately 800 human full-length cDNA clones. MuSICA 2 performs a hybrid assembly in which an external de novo assembler is run first and the result is then improved by reference alignment of shotgun reads. We compared the MuSICA 2 assembly with 200 pooled full-length cDNA clones finished independently by the conventional primer-walking using Sanger sequencers. The exon-intron structure of the coding sequence was correct for more than 95% of the clones with coding sequence annotation when we excluded cDNA clones insufficiently represented in the shotgun library due to PCR failure (42 out of 200 clones excluded), and the nucleotide-level accuracy of coding sequences of those correct clones was over 99.99%. We also applied MuSICA 2 to full-length cDNA clones from Toxoplasma gondii, to confirm that its ability was competent even for non-human species. The entire sequencing and shotgun assembly takes less than 1 week and the consumables cost only approximately US$3 per clone, demonstrating a significant advantage over previous approaches.

  2. Cloning and Sequencing of Protein Kinase cDNA from Harbor Seal (Phoca vitulina Lymphocytes

    Directory of Open Access Journals (Sweden)

    Jennifer C. C. Neale

    2004-01-01

    Full Text Available Protein kinases (PKs play critical roles in signal transduction and activation of lymphocytes. The identification of PK genes provides a tool for understanding mechanisms of immunotoxic xenobiotics. As part of a larger study investigating persistent organic pollutants in the harbor seal and their possible immunomodulatory actions, we sequenced harbor seal cDNA fragments encoding PKs. The procedure, using degenerate primers based on conserved motifs of human protein tyrosine kinases (PTKs, successfully amplified nine phocid PK gene fragments with high homology to human and rodent orthologs. We identified eight PTKs and one dual (serine/threonine and tyrosine kinase. Among these were several PKs important in early signaling events through the B- and T-cell receptors (FYN, LYN, ITK and SYK and a MAP kinase involved in downstream signal transduction. V-FGR, RET and DDR2 were also expressed. Sequential activation of protein kinases ultimately induces gene transcription leading to the proliferation and differentiation of lymphocytes critical to adaptive immunity. PKs are potential targets of bioactive xenobiotics, including persistent organic pollutants of the marine environment; characterization of these molecules in the harbor seal provides a foundation for further research illuminating mechanisms of action of contaminants speculated to contribute to large-scale die-offs of marine mammals via immunosuppression.

  3. Isolation of an insulin-like growth factor II cDNA with a unique 5' untranslated region from human placenta

    International Nuclear Information System (INIS)

    Shen, Shujane; Daimon, Makoto; Wang, Chunyeh; Ilan, J.; Jansen, M.

    1988-01-01

    Human insulin-like growth factor II (IGF-II) cDNA from a placental library was isolated and sequenced. The 5' untranslated region (5'-UTR) sequence of this cDNA differs completely from that of adult human liver and has considerable base sequence identity to the same region of an IGF-II cDNA of a rat liver cell line, BRL-3A. Human placental poly(A) + RNA was probed with either the 5'-UTR of the isolated human placental IGF-II cDNA or the 5'-UTR of the IGF-II cDNA obtained from adult human liver. No transcripts were detected by using the 5'-UTR of the adult liver IGF-II as the probe. In contrast, three transcripts of 6.0, 3.2, and 2.2 kilobases were detected by using the 5'-UTR of the placental IGF-II cDNA as the probe or the probe from the coding sequence. A fourth IGF-II transcript of 4.9 kilobases presumably containing a 5'-UTR consisting of a base sequence dissimilar to that of either IGF-II 5'-UTR was apparent. Therefore, IGF-II transcripts detected may be products of alternative splicing as their 5'-UTR sequence is contained within the human IGF-II gene or they may be a consequence of alternative promoter utilization in placenta

  4. Cloning of the human carnitine-acylcarnitine carrier cDNA and identification of the molecular defect in a patient

    NARCIS (Netherlands)

    Huizing, M.; Iacobazzi, V.; IJlst, L.; Savelkoul, P.; Ruitenbeek, W.; van den Heuvel, L.; Indiveri, C.; Smeitink, J.; Trijbels, F.; Wanders, R.; Palmieri, F.

    1997-01-01

    The carnitine-acylcarnitine carrier (CAC) catalyzes the translocation of long-chain fatty acids across the inner mitochondrial membrane. We cloned and sequenced the human CAC cDNA, which has an open reading frame of 903 nucleotides. Northern blot studies revealed different expression levels of CAC

  5. Nucleotide sequence of a cDNA for branched chain acyltransferase with analysis of the deduced protein structure

    International Nuclear Information System (INIS)

    Hummel, K.B.; Litwer, S.; Bradford, A.P.; Aitken, A.; Danner, D.J.; Yeaman, S.J.

    1988-01-01

    Nucleotide sequence was determined for a 1.6-kilobase human cDNA putative for the branched chain acyltransferase protein of the branched chain α-ketoacid dehydrogenase complex. Translation of the sequence reveals an open reading frame encoding a 315-amino acid protein of molecular weight 35,759 followed by 560 bases of 3'-untranslated sequence. Three repeats of the polyadenylation signal hexamer ATTAAA are present prior to the polyadenylate tail. Within the open reading frame is a 10-amino acid fragment which matches exactly the amino acid sequence around the lipoate-lysine residue in bovine kidney branched chain acyltransferase, thus confirming the identity of the cDNA. Analysis of the deduced protein structure for the human branched chain acyltransferase revealed an organization into domains similar to that reported for the acyltransferase proteins of the pyruvate and α-ketoglutarate dehydrogenase complexes. This similarity in organization suggests that a more detailed analysis of the proteins will be required to explain the individual substrate and multienzyme complex specificity shown by these acyltransferases

  6. Cloning and expression of a cDNA coding for a human monocyte-derived plasminogen activator inhibitor.

    Science.gov (United States)

    Antalis, T M; Clark, M A; Barnes, T; Lehrbach, P R; Devine, P L; Schevzov, G; Goss, N H; Stephens, R W; Tolstoshev, P

    1988-02-01

    Human monocyte-derived plasminogen activator inhibitor (mPAI-2) was purified to homogeneity from the U937 cell line and partially sequenced. Oligonucleotide probes derived from this sequence were used to screen a cDNA library prepared from U937 cells. One positive clone was sequenced and contained most of the coding sequence as well as a long incomplete 3' untranslated region (1112 base pairs). This cDNA sequence was shown to encode mPAI-2 by hybrid-select translation. A cDNA clone encoding the remainder of the mPAI-2 mRNA was obtained by primer extension of U937 poly(A)+ RNA using a probe complementary to the mPAI-2 coding region. The coding sequence for mPAI-2 was placed under the control of the lambda PL promoter, and the protein expressed in Escherichia coli formed a complex with urokinase that could be detected immunologically. By nucleotide sequence analysis, mPAI-2 cDNA encodes a protein containing 415 amino acids with a predicted unglycosylated Mr of 46,543. The predicted amino acid sequence of mPAI-2 is very similar to placental PAI-2 (3 amino acid differences) and shows extensive homology with members of the serine protease inhibitor (serpin) superfamily. mPAI-2 was found to be more homologous to ovalbumin (37%) than the endothelial plasminogen activator inhibitor, PAI-1 (26%). Like ovalbumin, mPAI-2 appears to have no typical amino-terminal signal sequence. The 3' untranslated region of the mPAI-2 cDNA contains a putative regulatory sequence that has been associated with the inflammatory mediators.

  7. Complete cDNA sequence and amino acid analysis of a bovine ribonuclease K6 gene.

    Science.gov (United States)

    Pietrowski, D; Förster, M

    2000-01-01

    The complete cDNA sequence of a ribonuclease k6 gene of Bos Taurus has been determined. It codes for a protein with 154 amino acids and contains the invariant cysteine, histidine and lysine residues as well as the characteristic motifs specific to ribonuclease active sites. The deduced protein sequence is 27 residues longer than other known ribonucleases k6 and shows amino acids exchanges which could reflect a strain specificity or polymorphism within the bovine genome. Based on sequence similarity we have termed the identified gene bovine ribonuclease k6 b (brk6b).

  8. Characterization of full-length sequenced cDNA inserts (FLIcs from Atlantic salmon (Salmo salar

    Directory of Open Access Journals (Sweden)

    Lunner Sigbjørn

    2009-10-01

    Full Text Available Abstract Background Sequencing of the Atlantic salmon genome is now being planned by an international research consortium. Full-length sequenced inserts from cDNAs (FLIcs are an important tool for correct annotation and clustering of the genomic sequence in any species. The large amount of highly similar duplicate sequences caused by the relatively recent genome duplication in the salmonid ancestor represents a particular challenge for the genome project. FLIcs will therefore be an extremely useful resource for the Atlantic salmon sequencing project. In addition to be helpful in order to distinguish between duplicate genome regions and in determining correct gene structures, FLIcs are an important resource for functional genomic studies and for investigation of regulatory elements controlling gene expression. In contrast to the large number of ESTs available, including the ESTs from 23 developmental and tissue specific cDNA libraries contributed by the Salmon Genome Project (SGP, the number of sequences where the full-length of the cDNA insert has been determined has been small. Results High quality full-length insert sequences from 560 pre-smolt white muscle tissue specific cDNAs were generated, accession numbers [GenBank: BT043497 - BT044056]. Five hundred and ten (91% of the transcripts were annotated using Gene Ontology (GO terms and 440 of the FLIcs are likely to contain a complete coding sequence (cCDS. The sequence information was used to identify putative paralogs, characterize salmon Kozak motifs, polyadenylation signal variation and to identify motifs likely to be involved in the regulation of particular genes. Finally, conserved 7-mers in the 3'UTRs were identified, of which some were identical to miRNA target sequences. Conclusion This paper describes the first Atlantic salmon FLIcs from a tissue and developmental stage specific cDNA library. We have demonstrated that many FLIcs contained a complete coding sequence (cCDS. This

  9. Characterization of full-length sequenced cDNA inserts (FLIcs) from Atlantic salmon (Salmo salar)

    Science.gov (United States)

    Andreassen, Rune; Lunner, Sigbjørn; Høyheim, Bjørn

    2009-01-01

    Background Sequencing of the Atlantic salmon genome is now being planned by an international research consortium. Full-length sequenced inserts from cDNAs (FLIcs) are an important tool for correct annotation and clustering of the genomic sequence in any species. The large amount of highly similar duplicate sequences caused by the relatively recent genome duplication in the salmonid ancestor represents a particular challenge for the genome project. FLIcs will therefore be an extremely useful resource for the Atlantic salmon sequencing project. In addition to be helpful in order to distinguish between duplicate genome regions and in determining correct gene structures, FLIcs are an important resource for functional genomic studies and for investigation of regulatory elements controlling gene expression. In contrast to the large number of ESTs available, including the ESTs from 23 developmental and tissue specific cDNA libraries contributed by the Salmon Genome Project (SGP), the number of sequences where the full-length of the cDNA insert has been determined has been small. Results High quality full-length insert sequences from 560 pre-smolt white muscle tissue specific cDNAs were generated, accession numbers [GenBank: BT043497 - BT044056]. Five hundred and ten (91%) of the transcripts were annotated using Gene Ontology (GO) terms and 440 of the FLIcs are likely to contain a complete coding sequence (cCDS). The sequence information was used to identify putative paralogs, characterize salmon Kozak motifs, polyadenylation signal variation and to identify motifs likely to be involved in the regulation of particular genes. Finally, conserved 7-mers in the 3'UTRs were identified, of which some were identical to miRNA target sequences. Conclusion This paper describes the first Atlantic salmon FLIcs from a tissue and developmental stage specific cDNA library. We have demonstrated that many FLIcs contained a complete coding sequence (cCDS). This suggests that the remaining cDNA

  10. Cloning and expression of a cDNA coding for a human monocyte-derived plasminogen activator inhibitor

    International Nuclear Information System (INIS)

    Antalis, T.M.; Clark, M.A.; Barnes, T.; Lehrbach, P.R.; Devine, P.L.; Schevzov, G.; Goss, N.H.; Stephens, R.W.; Tolstoshev, P.

    1988-01-01

    Human monocyte-derived plasminogen activator inhibitor (mPAI-2) was purified to homogeneity from the U937 cell line and partially sequenced. Oligonucleotide probes derived from this sequence were used to screen a cDNA library prepared from U937 cells. One positive clone was sequenced and contained most of the coding sequence as well as a long incomplete 3' untranslated region (1112 base pairs). This cDNA sequence was shown to encode mPAI-2 by hybrid-select translation. A cDNA clone encoding the remainder of the mPAI-2 mRNA was obtained by primer extension of U937 poly(A) + RNA using a probe complementary to the mPAI-2 coding region. The coding sequence for mPAI-2 was placed under the control of the λ P/sub L/ promoter, and the protein expressed in Escherichia coli formed a complex with urokinase that could be detected immunologically. By nucleotide sequence analysis, mPAI-2 cDNA encodes a protein containing 415 amino acids with a predicted unglycosylated M/sub r/ of 46,543. The predicted amino acid sequence of mPAI-2 is very similar to placental PAI-2 and shows extensive homology with members of the serine protease inhibitor (serpin) superfamily. mPAI-2 was found to be more homologous to ovalbumin (37%) than the endothelial plasminogen activator inhibitor, PAI-1 (26%). The 3' untranslated region of the mPAI-2 cDNA contains a putative regulatory sequence that has been associated with the inflammatory mediators

  11. Characterization of cDNA encoding human placental anticoagulant protein (PP4): Homology with the lipocortin family

    International Nuclear Information System (INIS)

    Grundmann, U.; Abel, K.J.; Bohn, H.; Loebermann, H.; Lottspeich, F.; Kuepper, H.

    1988-01-01

    A cDNA library prepared from human placenta was screened for sequences encoding the placental protein 4 (PP4). PP4 is an anticoagulant protein that acts as an indirect inhibitor of the thromboplastin-specific complex, which is involved in the blood coagulation cascade. Partial amino acid sequence information from PP4-derived cyanogen bromide fragments was used to design three oligonucleotide probes for screening the library. From 10 6 independent recombinants, 18 clones were identified that hybridized to all three probes. These 18 recombinants contained cDNA inserts encoding a protein of 320 amino acid residues. In addition to the PP4 cDNA the authors identified 9 other recombinants encoding a protein with considerable similarity (74%) to PP4, which was termed PP4-X. PP4 and PP4-X belong to the lipocortin family, as judged by their homology to lipocortin I and calpactin I

  12. cDNA encoding a polypeptide including a hev ein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, Natasha V. (Okemos, MI); Broekaert, Willem F. (Dilbeek, BE); Chua, Nam-Hai (Scarsdale, NY); Kush, Anil (New York, NY)

    2000-07-04

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

  13. Construction of cDNA library and preliminary analysis of expressed sequence tags from Siberian tiger

    Science.gov (United States)

    Liu, Chang-Qing; Lu, Tao-Feng; Feng, Bao-Gang; Liu, Dan; Guan, Wei-Jun; Ma, Yue-Hui

    2010-01-01

    In this study we successfully constructed a full-length cDNA library from Siberian tiger, Panthera tigris altaica, the most well-known wild Animal. Total RNA was extracted from cultured Siberian tiger fibroblasts in vitro. The titers of primary and amplified libraries were 1.30×106 pfu/ml and 1.62×109 pfu/ml respectively. The proportion of recombinants from unamplified library was 90.5% and average length of exogenous inserts was 1.13 kb. A total of 282 individual ESTs with sizes ranging from 328 to 1,142bps were then analyzed the BLASTX score revealed that 53.9% of the sequences were classified as strong match, 38.6% as nominal and 7.4% as weak match. 28.0% of them were found to be related to enzyme/catalytic protein, 20.9% ESTs to metabolism, 13.1% ESTs to transport, 12.1% ESTs to signal transducer/cell communication, 9.9% ESTs to structure protein, 3.9% ESTs to immunity protein/defense metabolism, 3.2% ESTs to cell cycle, and 8.9 ESTs classified as novel genes. These results demonstrated that the reliability and representativeness of the cDNA library attained to the requirements of a standard cDNA library. This library provided a useful platform for the functional genomic research of Siberian tigers. PMID:20941376

  14. Isolation and characterization of full-length cDNA clones coding for cholinesterase from fetal human tissues

    International Nuclear Information System (INIS)

    Prody, C.A.; Zevin-Sonkin, D.; Gnatt, A.; Goldberg, O.; Soreq, H.

    1987-01-01

    To study the primary structure and regulation of human cholinesterases, oligodeoxynucleotide probes were prepared according to a consensus peptide sequence present in the active site of both human serum pseudocholinesterase and Torpedo electric organ true acetylcholinesterase. Using these probes, the authors isolated several cDNA clones from λgt10 libraries of fetal brain and liver origins. These include 2.4-kilobase cDNA clones that code for a polypeptide containing a putative signal peptide and the N-terminal, active site, and C-terminal peptides of human BtChoEase, suggesting that they code either for BtChoEase itself or for a very similar but distinct fetal form of cholinesterase. In RNA blots of poly(A) + RNA from the cholinesterase-producing fetal brain and liver, these cDNAs hybridized with a single 2.5-kilobase band. Blot hybridization to human genomic DNA revealed that these fetal BtChoEase cDNA clones hybridize with DNA fragments of the total length of 17.5 kilobases, and signal intensities indicated that these sequences are not present in many copies. Both the cDNA-encoded protein and its nucleotide sequence display striking homology to parallel sequences published for Torpedo AcChoEase. These finding demonstrate extensive homologies between the fetal BtChoEase encoded by these clones and other cholinesterases of various forms and species

  15. License - Budding yeast cDNA sequencing project | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available List Contact us Budding yeast cDNA sequencing project License to Use This Database Last updated : 2010/02/15 You may use this databas...ional License described below. The Standard License specifies the license terms regarding the use of this database... and the requirements you must follow in using this database. The Additiona...n the Standard License. Standard License The Standard License for this database is the license specified in ...the Creative Commons Attribution-Share Alike 2.1 Japan . If you use data from this database

  16. Cloning the human lysozyme cDNA: Inverted Alu repeat in the mRNA and in situ hybridization for macrophages and Paneth cells

    International Nuclear Information System (INIS)

    Chung, L.P.; Keshav, S.; Gordon, S.

    1988-01-01

    Lysozyme is a major secretory product of human and rodent macrophages and a useful marker for myelomonocytic cells. Based on the known human lysozyme amino acid sequence, oligonucleotides were synthesized and used as probes to screen a phorbol 12-myristate 13-acetate-treated U937 cDNA library. A full-length human lysozyme cDNA clone, pHL-2, was obtained and characterized. Sequence analysis shows that human lysozyme, like chicken lysozyme, has in 18-amino-acid-long signal peptide, but unlike the chicken lysozyme cDNA, the human lysozyme cDNA has a >1-kilobase-long 3' nontranslated sequence. Interestingly, within this 3' region, an inverted repeat of the Alu family of repetitive sequences was discovered. In RNA blot analyses, DNA probes prepared from pHL-2 can be used to detect lysozyme mRNA not only from human but also from mouse and rat. Moreover, by in situ hybridization, complementary RNA transcripts have been used as probes to detect lysozyme mRNA in mouse macrophages and Paneth cells. This human lysozyme cDNA clone is therefore likely to be a useful molecular probe for studying macrophage distribution and gene expression

  17. Human cDNA mapping using fluorescence in situ hybridization

    Energy Technology Data Exchange (ETDEWEB)

    Korenberg, J.R.

    1993-03-04

    Genetic mapping is approached using the techniques of high resolution fluorescence in situ hybridization (FISH). This technology and the results of its application are designed to rapidly generate whole genome as tool box of expressed sequence to speed the identification of human disease genes. The results of this study are intended to dovetail with and to link the results of existing technologies for creating backbone YAC and genetic maps. In the first eight months, this approach generated 60--80% of the expressed sequence map, the remainder expected to be derived through more long-term, labor-intensive, regional chromosomal gene searches or sequencing. The laboratory has made significant progress in the set-up phase, in mapping fetal and adult brain and other cDNAs, in testing a model system for directly linking genetic and physical maps using FISH with small fragments, in setting up a database, and in establishing the validity and throughput of the system.

  18. Serine Protease Variants Encoded by Echis ocellatus Venom Gland cDNA: Cloning and Sequencing Analysis

    Directory of Open Access Journals (Sweden)

    S. S. Hasson

    2010-01-01

    Full Text Available Envenoming by Echis saw-scaled viper is the leading cause of death and morbidity in Africa due to snake bite. Despite its medical importance, there have been few investigations into the toxin composition of the venom of this viper. Here, we report the cloning of cDNA sequences encoding four groups or isoforms of the haemostasis-disruptive Serine protease proteins (SPs from the venom glands of Echis ocellatus. All these SP sequences encoded the cysteine residues scaffold that form the 6-disulphide bonds responsible for the characteristic tertiary structure of venom serine proteases. All the Echis ocellatus EoSP groups showed varying degrees of sequence similarity to published viper venom SPs. However, these groups also showed marked intercluster sequence conservation across them which were significantly different from that of previously published viper SPs. Because viper venom SPs exhibit a high degree of sequence similarity and yet exert profoundly different effects on the mammalian haemostatic system, no attempt was made to assign functionality to the new Echis ocellatus EoSPs on the basis of sequence alone. The extraordinary level of interspecific and intergeneric sequence conservation exhibited by the Echis ocellatus EoSPs and analogous serine proteases from other viper species leads us to speculate that antibodies to representative molecules should neutralise (that we will exploit, by epidermal DNA immunization the biological function of this important group of venom toxins in vipers that are distributed throughout Africa, the Middle East, and the Indian subcontinent.

  19. Fiscal 1998 achievement report. Industrial technology research and development project. (Strategic human cDNA genome application technology development); 1998 nendo senryakuteki hito cDNA genome oyo gijutsu kaihatsu seika hokokusho

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2000-03-01

    A human genome related project named above was started, and studies were conducted for base sequence determination and function analysis for approximately 10,000 kinds of full-length or long-chain human cDNA clones owned by research organizations in this country. The Institute of Medical Science of University of Tokyo and Helix Research Institute dealt with a full-length human cDNA library constructed by oligo-capping, and determined the base sequences of all specimens in the library. The Kazusa DNA Research Institute determined partial sequences for long-chain clones which are not shorter than 4-5kbp, and determined entire sequences for some bases. The obtained base sequence data were subjected to homology analysis, the base sequences were converted into amino acid sequences, and functions of proteins were predicted. In the analysis of gene functions, ATAC-PCR (adaptor tagged competitive-polymerase chain reaction) was applied to the clones covered by this project, and a database was prepared by use of the results of analyses of frequency-related information. For the preparation of a comprehensive gene expression profile, technologies for cDNA microarray construction were established. (NEDO)

  20. Molecular cloning and sequence analysis of growth hormone cDNA of Neotropical freshwater fish Pacu (Piaractus mesopotamicus

    Directory of Open Access Journals (Sweden)

    Janeth Silva Pinheiro

    2008-01-01

    Full Text Available RT-PCR was used for amplifying Piaractus mesopotamicus growth hormone (GH cDNA obtained from mRNA extracted from pituitary cells. The amplified fragment was cloned and the complete cDNA sequence was determined. The cloned cDNA encompassed a sequence of 543 nucleotides that encoded a polypeptide of 178 amino acids corresponding to mature P. mesopotamicus GH. Comparison with other GH sequences showed a gap of 10 amino acids localized in the N terminus of the putative polypeptide of P. mesopotamicus. This same gap was also observed in other members of the family. Neighbor-joining tree analysis with GH sequences from fishes belonging to different taxonomic groups placed the P. mesopotamicus GH within the Otophysi group. To our knowledge, this is the first GH sequence of a Neotropical characiform fish deposited in GenBank.

  1. Human cDNA clones for an α subunit of G/sub i/ signal-transduction protein

    International Nuclear Information System (INIS)

    Bray, P.; Carter, A.; Guo, V.; Puckett, C.; Kamholz, J.; Spiegel, A.; Nirenberg, M.

    1987-01-01

    Two cDNA clones were obtained from a λgt11 cDNA human brain library that correspond to α/sub i/ subunits of G signal-transduction proteins (where α/sub i/ subunits refer to the α subunits of G proteins that inhibit adenylate cyclase). The nucleotide sequence of human brain α/sub i/ is highly homologous to that of bovine brain α/sub i/ and the predicted amino acid sequences are identical. However, human and bovine brain α/sub i/ cDNAs differ significantly from α/sub i/ cDNAs from human monocytes, rat glioma, and mouse macrophages in amino acid (88% homology) and nucleotide (71-75% homology) sequences. In addition, the nucleotide sequences of the 3' untranslated regions of human and bovine brain α/sub i/ cDNAs differ markedly from the sequences of human monocyte, rat glioma, and mouse macrophage α/sub i/ cDNAs. These results suggest there are at least two classes of α/sub i/ mRNA

  2. PMS2 gene mutational analysis: direct cDNA sequencing to circumvent pseudogene interference.

    Science.gov (United States)

    Wimmer, Katharina; Wernstedt, Annekatrin

    2014-01-01

    The presence of highly homologous pseudocopies can compromise the mutation analysis of a gene of interest. In particular, when using PCR-based strategies, pseudogene co-amplification has to be effectively prevented. This is often achieved by using primers designed to be parental gene specific according to the reference sequence and by applying stringent PCR conditions. However, there are cases in which this approach is of limited utility. For example, it has been shown that the PMS2 gene exchanges sequences with one of its pseudogenes, named PMS2CL. This results in functional PMS2 alleles containing pseudogene-derived sequences at their 3'-end and in nonfunctional PMS2CL pseudogene alleles that contain gene-derived sequences. Hence, the paralogues cannot be distinguished according to the reference sequence. This shortcoming can be effectively circumvented by using direct cDNA sequencing. This approach is based on the selective amplification of PMS2 transcripts in two overlapping 1.6-kb RT-PCR products. In addition to avoiding pseudogene co-amplification and allele dropout, this method has also the advantage that it allows to effectively identify deletions, splice mutations, and de novo retrotransposon insertions that escape the detection of most DNA-based mutation analysis protocols.

  3. Molecular characterization of a Leishmania donovani cDNA clone with similarity to human 20S proteasome a-type subunit

    DEFF Research Database (Denmark)

    Christensen, C B; Jørgensen, L; Jensen, A T

    2000-01-01

    Using plasma from patients infected or previously infected with Leishmania donovanii, we isolated a L. donovanii cDNA clone with similarity to the proteasome a-type subunit from humans and other eukaryotes. The cDNA clone, designated LePa, was DNA sequenced and Northern blot analysis of L....... donovanii poly(A(+))mRNA indicated the isolation of a full length cDNA clone with a transcript size of 1.9 kb. The expressed recombinant LePa fusion protein induced proliferation of peripheral blood mononuclear cells in one out of seven patients who had suffered from visceral leishmaniasis. Plasma from 16...

  4. Isolation and structure of a cDNA encoding the B1 (CD20) cell-surface antigen of human B lymphocytes

    International Nuclear Information System (INIS)

    Tender, T.F.; Streuli, M.; Schlossman, S.F.; Saito, H.

    1988-01-01

    The B1 (CD20) molecule is a M/sub r/ 33,000 phosphoprotein on the surface of human B lymphocytes that may serve a central role in the homoral immune response by regulating B-cell proliferation and differentiation. In this report, a cDNA clone that encodes the B1 molecule was isolated and the amino acid sequence of B1 was determined. B-cell-specific cDNA clones were selected from a human tonsillar cDNA library by differential hybridization with labeled cDNA derived from either size-fractionated B-cell mRNA or size-fractionated T-cell mRNA. Of the 261 cDNA clones isolated, 3 cross-hybridizing cDNA clones were chosen as potential candidates for encoding B1 based on their selective hybridization to RNA from B1-positive cell lines. The longest clone, pB1-21, contained a 2.8-kilobase insert with an 891-base-pair open reading frame that encodes a protein of 33 kDa. mRNA synthesized from the pB1-21 cDNA clone in vitro was translated into a protein of the same apparent molecular weight as B1. Limited proteinase digestion of the pB1-21 translation product and B1 generated peptides of the same sizes, indicating that the pB1-21 cDNA encodes the B1 molecule. Gel blot analysis indicated that pB1-21 hybridized with two mRNA species of 2.8 and 3.4 kilobases only in B1-positive cell lines. The amino acid sequence deduced from the pB1-21 nucleotide sequence apparently lacks a signal sequence and contains three extensive hydrophobic regions. The deduced B1 amino acid sequence shows no significant homology with other known patients

  5. Determination of cDNA and genomic DNA sequences of hevamine, a chitinase from the rubber tree Hevea brasiliensis

    NARCIS (Netherlands)

    Bokma, E; Spiering, M; Chow, KS; Mulder, PPMFA; Subroto, T; Beintema, JJ

    Hevamine is a chitinase from the rubber tree Hevea brasiliensis and belongs to the family 18 glycosyl hydrolases. This paper describes the cloning of hevamine DNA and cDNA sequences. Hevamine contains a signal peptide at the N-terminus and a putative vacuolar targeting sequence at the C-terminus

  6. Differential representation of sunflower ESTs in enriched organ-specific cDNA libraries in a small scale sequencing project

    Directory of Open Access Journals (Sweden)

    Heinz Ruth A

    2003-09-01

    Full Text Available Abstract Background Subtractive hybridization methods are valuable tools for identifying differentially regulated genes in a given tissue avoiding redundant sequencing of clones representing the same expressed genes, maximizing detection of low abundant transcripts and thus, affecting the efficiency and cost effectiveness of small scale cDNA sequencing projects aimed to the specific identification of useful genes for breeding purposes. The objective of this work is to evaluate alternative strategies to high-throughput sequencing projects for the identification of novel genes differentially expressed in sunflower as a source of organ-specific genetic markers that can be functionally associated to important traits. Results Differential organ-specific ESTs were generated from leaf, stem, root and flower bud at two developmental stages (R1 and R4. The use of different sources of RNA as tester and driver cDNA for the construction of differential libraries was evaluated as a tool for detection of rare or low abundant transcripts. Organ-specificity ranged from 75 to 100% of non-redundant sequences in the different cDNA libraries. Sequence redundancy varied according to the target and driver cDNA used in each case. The R4 flower cDNA library was the less redundant library with 62% of unique sequences. Out of a total of 919 sequences that were edited and annotated, 318 were non-redundant sequences. Comparison against sequences in public databases showed that 60% of non-redundant sequences showed significant similarity to known sequences. The number of predicted novel genes varied among the different cDNA libraries, ranging from 56% in the R4 flower to 16 % in the R1 flower bud library. Comparison with sunflower ESTs on public databases showed that 197 of non-redundant sequences (60% did not exhibit significant similarity to previously reported sunflower ESTs. This approach helped to successfully isolate a significant number of new reported sequences

  7. Full-Length Venom Protein cDNA Sequences from Venom-Derived mRNA: Exploring Compositional Variation and Adaptive Multigene Evolution.

    Science.gov (United States)

    Modahl, Cassandra M; Mackessy, Stephen P

    2016-06-01

    Envenomation of humans by snakes is a complex and continuously evolving medical emergency, and treatment is made that much more difficult by the diverse biochemical composition of many venoms. Venomous snakes and their venoms also provide models for the study of molecular evolutionary processes leading to adaptation and genotype-phenotype relationships. To compare venom complexity and protein sequences, venom gland transcriptomes are assembled, which usually requires the sacrifice of snakes for tissue. However, toxin transcripts are also present in venoms, offering the possibility of obtaining cDNA sequences directly from venom. This study provides evidence that unknown full-length venom protein transcripts can be obtained from the venoms of multiple species from all major venomous snake families. These unknown venom protein cDNAs are obtained by the use of primers designed from conserved signal peptide sequences within each venom protein superfamily. This technique was used to assemble a partial venom gland transcriptome for the Middle American Rattlesnake (Crotalus simus tzabcan) by amplifying sequences for phospholipases A2, serine proteases, C-lectins, and metalloproteinases from within venom. Phospholipase A2 sequences were also recovered from the venoms of several rattlesnakes and an elapid snake (Pseudechis porphyriacus), and three-finger toxin sequences were recovered from multiple rear-fanged snake species, demonstrating that the three major clades of advanced snakes (Elapidae, Viperidae, Colubridae) have stable mRNA present in their venoms. These cDNA sequences from venom were then used to explore potential activities derived from protein sequence similarities and evolutionary histories within these large multigene superfamilies. Venom-derived sequences can also be used to aid in characterizing venoms that lack proteomic profiles and identify sequence characteristics indicating specific envenomation profiles. This approach, requiring only venom, provides

  8. cDNA cloning and nucleotide sequence comparison of Chinese hamster metallothionein I and II mRNAs

    Energy Technology Data Exchange (ETDEWEB)

    Griffith, B B; Walters, R A; Enger, M D; Hildebrand, C E; Griffith, J K

    1983-01-01

    Polyadenylated RNA was extracted from a cadmium resistant Chinese hamster (CHO) cell line, enriched for metal-induced, abundant RNA sequences and cloned as double-stranded cDNA in the plasmid pBR322. Two cDNA clones, pCHMT1 and pCHMT2, encoding two Chinese hamster isometallothioneins were identified, and the nucleotide sequence of each insert was determined. The two Chinese hamster metallothioneins show nucleotide sequence homologies of 80% in the protein coding region and approximately 35% in both the 5' and 3' untranslated regions. Interestingly, an 8 nucleotide sequence (TGTAAATA) has been conserved in sequence and position in the 3' untranslated regions of each metallothionein mRNA sequenced thus far. Estimated nucleotide substitution rates derived from interspecies comparisons were used to calculate a metallothionein gene duplication time of 45 to 120 million years ago. 39 references, 1 figure, 1 table.

  9. Characterization of cDNA for human tripeptidyl peptidase II: The N-terminal part of the enzyme is similar to subtilisin

    International Nuclear Information System (INIS)

    Tomkinson, B.; Jonsson, A-K

    1991-01-01

    Tripeptidyl peptidase II is a high molecular weight serine exopeptidase, which has been purified from rat liver and human erythrocytes. Four clones, representing 4453 bp, or 90% of the mRNA of the human enzyme, have been isolated from two different cDNA libraries. One clone, designated A2, was obtained after screening a human B-lymphocyte cDNA library with a degenerated oligonucleotide mixture. The B-lymphocyte cDNA library, obtained from human fibroblasts, were rescreened with a 147 bp fragment from the 5' part of the A2 clone, whereby three different overlapping cDNA clones could be isolated. The deduced amino acid sequence, 1196 amino acid residues, corresponding to the longest open rading frame of the assembled nucleotide sequence, was compared to sequences of current databases. This revealed a 56% similarity between the bacterial enzyme subtilisin and the N-terminal part of tripeptidyl peptidase II. The enzyme was found to be represented by two different mRNAs of 4.2 and 5.0 kilobases, respectively, which probably result from the utilziation of two different polyadenylation sites. Futhermore, cDNA corresponding to both the N-terminal and C-terminal part of tripeptidyl peptidase II hybridized with genomic DNA from mouse, horse, calf, and hen, even under fairly high stringency conditions, indicating that tripeptidyl peptidase II is highly conserved

  10. Cloning and expression of a human kidney cDNA for an α2-adrenergic receptor subtype

    International Nuclear Information System (INIS)

    Regan, J.W.; Kobilka, T.S.; Yang-Feng, T.L.; Caron, M.G.; Lefkowitz, R.J.; Kobilka, B.K.

    1988-01-01

    An α 2 -adrenergic receptor subtype has been cloned from a human kidney cDNA library using the gene for the human platelet α 2 -adrenergic receptor as a probe. The deduced amino acid sequence resembles the human platelet α 2 -adrenergic receptor and is consistent with the structure of other members of he family of guanine nucleotide-binding protein-coupled receptors. The cDNA was expressed in a mammalian cell line (COS-7), and the α 2 -adrenergic ligand [ 3 H]rauwolscine was bound. Competition curve analysis with a variety of adrenergic ligands suggests that this cDNA clone represents the α 2 B-adrenergic receptor. The gene for this receptor is on human chromosome 4, whereas the gene for the human platelet α 2 -adrenergic receptor (α 2 A) lies on chromosome 10. This ability to express the receptor in mammalian cells, free of other adrenergic receptor subtypes, should help in developing more selective α-adrenergic ligands

  11. Construction of a T7 Human Lung Cancer cDNA Library

    Directory of Open Access Journals (Sweden)

    Wentao YUE

    2008-10-01

    Full Text Available Background and objective Currently, only a limited numbers of tumor markers for non small lung cancer (NSCLC diagnosis, new biomarker, such as serum autoantibody may improve the early detection of lung cancer. Our objective is construction human lung squamous carcinoma and adenocarcinoma T7 phage display cDNA library from the tissues of NSCLC patients. Methods mRNA was isolated from a pool of total RNA extract from NSCLC tissues obtained from 5 adenocarcinomas and 5 squamous carcinomas, and then mRNA was reverse transcribed into double stranded cDNA. After digestion, the cDNA was inserted into T7Select 10-3 vector. The phage display cDNA library was constructed by package reaction in vitro and plate proliferation. Plaque assay and PCR were used to evaluate the library.Results Two T7 phage display cDNA library were established. Plaque assay show the titer of lung squamas carcinoma library was 1.8×106 pfu, and the adenocarcinoma library was 5×106 pfu. The phage titer of the amplified library were 3.2×1010 pfu/mL and 2.5×1010 pfu/mL. PCR amplification of random plaque show insert ratio were 100% (24/24 in adenocarcinoma library and 95.8% in human lung squamas carcinoma library (23/24. Insert range from 300 bp to 1 500 bp. Conclusion Two phage display cDNA library from NSCLC were constructed.

  12. Cloning and sequencing of the cDNA encoding a core protein of the paired helical filament of Alzheimer's disease: Identification as the microtubule-associated protein tau

    International Nuclear Information System (INIS)

    Goedert, M.; Wischik, C.M.; Crowther, R.A.; Walker, J.E.; Klug, A.

    1988-01-01

    Screening of cDNA libraries prepared from the frontal cortex of an Alzheimer's disease patient and from fetal human brain has led to isolation of the cDNA for a core protein of the paired helical filament of Alzheimer's disease. The partial amino acid sequence of this core protein was used to design synthetic oligonucleotide probes. The cDNA encodes a protein of 352 amino acids that contains a characteristic amino acid repeat in its carboxyl-terminal half. This protein is highly homologous to the sequence of the mouse microtubule-associated protein tau and thus constitutes the human equivalent of mouse tau. RNA blot analysis indicates the presence of two major transcripts, 6 and 2 kilobases long, with a wide distribution in normal human brain. Tau protein mRNAs were found in normal amounts in the frontal cortex from patients with Alzheimer's disease. The proof that at least part of tau protein forms a component of the paired helical filament core opens the way to understanding the mode of formation of paired helical filaments and thus, ultimately, the pathogenesis of Alzheimer's disease

  13. Development of polymorphic genic-SSR markers by cDNA library sequencing in boxwood, Buxus spp. (Buxaceae)

    Science.gov (United States)

    Genic microsatellites or simple sequence repeat (genic-SSR) markers were developed in boxwood (Buxus taxa) for genetic diversity analysis, identification of taxa, and to facilitate breeding. cDNA libraries were developed from mRNA extracted from leaves of Buxus sempervirens ‘Vardar Valley’ and seque...

  14. Isolation and sequence analysis of a cDNA clone encoding the fifth complement component

    DEFF Research Database (Denmark)

    Lundwall, Åke B; Wetsel, Rick A; Kristensen, Torsten

    1985-01-01

    DNA clone of 1.85 kilobase pairs was isolated. Hybridization of the mixed-sequence probe to the complementary strand of the plasmid insert and sequence analysis by the dideoxy method predicted the expected protein sequence of C5a (positions 1-12), amino-terminal to the anticipated priming site. The sequence......, subcloned into M13 mp8, and sequenced at random by the dideoxy technique, thereby generating a contiguous sequence of 1703 base pairs. This clone contained coding sequence for the C-terminal 262 amino acid residues of the beta-chain, the entire C5a fragment, and the N-terminal 98 residues of the alpha......'-chain. The 3' end of the clone had a polyadenylated tail preceded by a polyadenylation recognition site, a 3'-untranslated region, and base pairs homologous to the human Alu concensus sequence. Comparison of the derived partial human C5 protein sequence with that previously determined for murine C3 and human...

  15. New Approaches to Attenuated Hepatitis a Vaccine Development: Cloning and Sequencing of Cell-Culture Adapted Viral cDNA.

    Science.gov (United States)

    1987-10-13

    after multiple passages in vivo and in vitro. J. Gen. Virol. 67, 1741- 1744. Sabin , A.B. (1985). Oral poliovirus vaccine : history of its development...IN (N NEW APPROACHES TO ATTENUATED HEPATITIS A VACCINE DEVELOPMENT: Q) CLONING AND SEQUENCING OF CELL-CULTURE ADAPTED VIRAL cDNA I ANNUAL REPORT...6ll02Bsl0 A 055 11. TITLE (Include Security Classification) New Approaches to Attenuated Hepatitis A Vaccine Development: Cloning and Sequencing of Cell

  16. Molecular cloning of a cDNA encoding human calumenin, expression in Escherichia coli and analysis of its Ca2+-binding activity

    DEFF Research Database (Denmark)

    Vorum, H; Liu, X; Madsen, Peder

    1998-01-01

    By microsequencing and cDNA cloning we have identified the transformation-sensitive protein No. IEF SSP 9302 as the human homologue of calumenin. The nucleotide sequence predicts a 315 amino acid protein with high identity to murine and rat calumenin. The deduced protein contains a 19 amino acid N...

  17. Cloning and chromosomal assignment of a human cDNA encoding a T cell- and natural killer cell-specific trypsin-like serine protease

    International Nuclear Information System (INIS)

    Gershenfeld, H.K.; Hershberger, R.J.; Shows, T.B.; Weissman, I.L.

    1988-01-01

    A cDNA clone encoding a human T cell- and natural killer cell-specific serine protease was obtained by screening a phage λgt10 cDNA library from phytohemagglutinin-stimulated human peripheral blood lymphocytes with the mouse Hanukah factor cDNA clone. In an RNA blot-hybridization analysis, this human Hanukah factor cDNA hybridized with a 1.3-kilobase band in allogeneic-stimulated cytotoxic T cells and the Jurkat cell line, but this transcript was not detectable in normal muscle, liver, tonsil, or thymus. By dot-blot hybridization, this cDNA hybridized with RNA from three cytolytic T-cell clones and three noncytolytic T-cell clones grown in vitro as well as with purified CD16 + natural killer cells and CD3 + , CD16 - T-cell large granular lymphocytes from peripheral blood lymphocytes (CD = cluster designation). The nucleotide sequence of this cDNA clone encodes a predicted serine protease of 262 amino acids. The active enzyme is 71% and 77% similar to the mouse sequence at the amino acid and DNA level, respectively. The human and mouse sequences conserve the active site residues of serine proteases--the trypsin-specific Asp-189 and all 10 cysteine residues. The gene for the human Hanukah factor serine protease is located on human chromosome 5. The authors propose that this trypsin-like serine protease may function as a common component necessary for lysis of target cells by cytotoxic T lymphocytes and natural killer cells

  18. An analysis of expressed sequence tags of developing castor endosperm using a full-length cDNA library

    Directory of Open Access Journals (Sweden)

    Wallis James G

    2007-07-01

    Full Text Available Abstract Background Castor seeds are a major source for ricinoleate, an important industrial raw material. Genomics studies of castor plant will provide critical information for understanding seed metabolism, for effectively engineering ricinoleate production in transgenic oilseeds, or for genetically improving castor plants by eliminating toxic and allergic proteins in seeds. Results Full-length cDNAs are useful resources in annotating genes and in providing functional analysis of genes and their products. We constructed a full-length cDNA library from developing castor endosperm, and obtained 4,720 ESTs from 5'-ends of the cDNA clones representing 1,908 unique sequences. The most abundant transcripts are genes encoding storage proteins, ricin, agglutinin and oleosins. Several other sequences are also very numerous, including two acidic triacylglycerol lipases, and the oleate hydroxylase (FAH12 gene that is responsible for ricinoleate biosynthesis. The role(s of the lipases in developing castor seeds are not clear, and co-expressing of a lipase and the FAH12 did not result in significant changes in hydroxy fatty acid accumulation in transgenic Arabidopsis seeds. Only one oleate desaturase (FAD2 gene was identified in our cDNA sequences. Sequence and functional analyses of the castor FAD2 were carried out since it had not been characterized previously. Overexpression of castor FAD2 in a FAH12-expressing Arabidopsis line resulted in decreased accumulation of hydroxy fatty acids in transgenic seeds. Conclusion Our results suggest that transcriptional regulation of FAD2 and FAH12 genes maybe one of the mechanisms that contribute to a high level of ricinoleate accumulation in castor endosperm. The full-length cDNA library will be used to search for additional genes that affect ricinoleate accumulation in seed oils. Our EST sequences will also be useful to annotate the castor genome, which whole sequence is being generated by shotgun sequencing at

  19. Styl RFLP recognized by a human IRBP cDNA localized to chromosome 10

    Energy Technology Data Exchange (ETDEWEB)

    Chin, K S; Mathew, C G.P.; Fong, S L; Bridges, C D; Ponder, B A.J.

    1988-02-25

    A 2184 bp cDNA (H.4 IRBP) encoding human interstitial retinol-biding protein isolated from a human retina cDNA library in lambdagt10 by screening with a bovine IRBP cDNA probe. Styl identifies a 2-allele polymorphism with bands at 2.3 kb (Cl) and 1.95 kb (C2) and invariant bands at 1.1, 1.0 and 0.8kb. Codominant segregation was observed in two informative families. The RFLP was mapped to chromosome 10 using somatic cell hybrids. In situ hybridization suggests regional assignments near p11.2 -q11.2 with a secondary site of hybridization at q24-25.

  20. Assignment of casein kinase 2 alpha sequences to two different human chromosomes

    DEFF Research Database (Denmark)

    Boldyreff, B; Klett, C; Göttert, E

    1992-01-01

    Human casein kinase 2 alpha gene (CK-2-alpha) sequences have been localized within the human genome by in situ hybridization and somatic cell hybrid analysis using a CK-2 alpha cDNA as a probe. By in situ hybridization, the CK-2 alpha cDNA could be assigned to two different loci, one on 11p15.1-ter...

  1. Interferon-gamma up-regulates a unique set of proteins in human keratinocytes. Molecular cloning and expression of the cDNA encoding the RGD-sequence-containing protein IGUP I-5111

    DEFF Research Database (Denmark)

    Honoré, B; Leffers, H; Madsen, Peder

    1993-01-01

    AMP (Bt2cAMP), dibutyryl cGMP (Bt2cGMP)] and compounds known to affect keratinocytes [4 beta-phorbol 12-myristate 13-acetate (PMA), retinoic acid, Ca2+, dexamethasone, lipopolysaccharides, foetal calf serum]. Protein IGUP I-5111 was selected for further studies as its level is affected by simian-virus-40......, which migrated with the AMA variant of keratinocyte protein IEF SSP 5111, is novel although it exhibits weak similarity to cytoskeletal proteins. IGUP I-5111 contains the RGD sequence found in many extracellular glycoprotein ligands of the integrin receptor family and it is found at least partially...... in the culture supernatant. Considering the presence of IFN-gamma in psoriatic plaques as well as its putative involvement in the pathophysiology of the disease it was of interest to determine whether the set of proteins was upregulated in these cells. Two-dimensional gel analysis of the protein phenotype of non-cultured...

  2. Large-scale Identification of Expressed Sequence Tags (ESTs from Nicotianatabacum by Normalized cDNA Library Sequencing

    Directory of Open Access Journals (Sweden)

    Alvarez S Perez

    2014-12-01

    Full Text Available An expressed sequence tags (EST resource for tobacco plants (Nicotianatabacum was established using high-throughput sequencing of randomly selected clones from one cDNA library representing a range of plant organs (leaf, stem, root and root base. Over 5000 ESTs were generated from the 3’ ends of 8000 clones, analyzed by BLAST searches and categorized functionally. All annotated ESTs were classified into 18 functional categories, unique transcripts involved in energy were the largest group accounting for 831 (32.32% of the annotated ESTs. After excluding 2450 non-significant tentative unique transcripts (TUTs, 100 unique sequences (1.67% of total TUTs were identified from the N. tabacum database. In the array result two genes strongly related to the tobacco mosaic virus (TMV were obtained, one basic form of pathogenesis-related protein 1 precursor (TBT012G08 and ubiquitin (TBT087G01. Both of them were found in the variety Hongda, some other important genes were classified into two groups, one of these implicated in plant development like those genes related to a photosynthetic process (chlorophyll a-b binding protein, photosystem I, ferredoxin I and III, ATP synthase and a further group including genes related to plant stress response (ubiquitin, ubiquitin-like protein SMT3, glycine-rich RNA binding protein, histones and methallothionein. The interesting finding in this study is that two of these genes have never been reported before in N. tabacum (ubiquitin-like protein SMT3 and methallothionein. The array results were confirmed using quantitative PCR.

  3. Cloning and expression of a cDNA coding for the human platelet-derived growth factor receptor: Evidence for more than one receptor class

    International Nuclear Information System (INIS)

    Gronwald, R.G.K.; Grant, F.J.; Haldeman, B.A.; Hart, C.E.; O'Hara, P.J.; Hagen, F.S.; Ross, R.; Bowen-Pope, D.F.; Murray, M.J.

    1988-01-01

    The complete nucleotide sequence of a cDNA encoding the human platelet-derived growth factor (PDGF) receptor is presented. The cDNA contains an open reading frame that codes for a protein of 1106 amino acids. Comparison to the mouse PDGF receptor reveals an overall amino acid sequence identity of 86%. This sequence identity rises to 98% in the cytoplasmic split tyrosine kinase domain. RNA blot hybridization analysis of poly(A) + RNA from human dermal fibroblasts detects a major and a minor transcript using the cDNA as a probe. Baby hamster kidney cells, transfected with an expression vector containing the receptor cDNA, express an ∼ 190-kDa cell surface protein that is recognized by an anti-human PDGF receptor antibody. The recombinant PDGF receptor is functional in the transfected baby hamster kidney cells as demonstrated by ligand-induced phosphorylation of the receptor. Binding properties of the recombinant PDGF receptor were also assessed with pure preparations of BB and AB isoforms of PDGF. Unlike human dermal fibroblasts, which bind both isoforms with high affinity, the transfected baby hamster kidney cells bind only the BB isoform of PDGF with high affinity. This observation is consistent with the existence of more than one PDGF receptor class

  4. cDNA cloning of rat and human medium chain acyl-CoA dehydrogenase (MCAD)

    International Nuclear Information System (INIS)

    Matsubara, Y.; Kraus, J.P.; Rosenberg, L.E.; Tanaka, K.

    1986-01-01

    MCAD is one of three mitochondrial flavoenzymes which catalyze the first step in the β-oxidation of straight chain fatty acids. It is a tetramer with a subunit Mr of 45 kDa. MCAD is synthesized in the cytosol as a 49 kDa precursor polypeptide (pMCAD), imported into mitochondria, and cleaved to the mature form. Genetic deficiency of MCAD causes recurrent episodes of hypoglycemic coma accompanied by medium chain dicarboxylic aciduria. Employing a novel approach, the authors now report isolation of partial rat and human cDNA clones encoding pMCAD. mRNA encoding pMCAD was purified to near homogeneity by polysome immunoadsorption using polyclonal monospecific antibody. Single-stranded [ 32 P]labeled cDNA probe was synthesized using the enriched mRNA as template, and was used to screen directly 16,000 colonies from a total rat liver cDNA library constructed in pBR322. One clone (600 bp) was detected by in situ hybridization. Hybrid-selected translation with this cDNA yielded a 49 kDa polypeptide indistinguishable in size from rat pMCAD and immunoprecipitable with anti-MCAD antibody. Using the rat cDNA as probe, 43,000 colonies from a human liver cDNA library were screened. Four identical positive clones (400 bp) were isolated and positively identified by hybrid-selected translation and immunoprecipitation. The sizes of rat and human mRNAs encoding pMCAD were 2.2 kb and 2.4 kb, respectively, as determined by Northern blotting

  5. Construction and characterization of a cDNA library from human ...

    African Journals Online (AJOL)

    The tumor-suppressor gene p53 and its downstream genes consist of a complicated gene network, and the challenge to understand the network is to identify p53 downstream genes. In order to isolate and identify new p53 regulated genes, we constructed and characterized a normalized cDNA library from human brain ...

  6. GENE EXPRESSION IN THE TESTES OF NORMOSPERMIC VERSUS TERATOSPERMIC DOMESTIC CATS USING HUMAN CDNA MICROARRAY ANALYSES

    Science.gov (United States)

    GENE EXPRESSION IN THE TESTES OF NORMOSPERMIC VERSUS TERATOSPERMIC DOMESTIC CATS USING HUMAN cDNA MICROARRAY ANALYSESB.S. Pukazhenthi1, J. C. Rockett2, M. Ouyang3, D.J. Dix2, J.G. Howard1, P. Georgopoulos4, W.J. J. Welsh3 and D. E. Wildt11Department of Reproductiv...

  7. Radioactive cDNA microarray (II): Gene expression profiling of antidepressant treatment by human cDNA microarray

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Ji Hye; Kang, Rhee Hun; Ham, Byung Joo; Lee, Min Su; Shin, Kyung Ho; Choe, Jae Gol; Kim, Meyoung Kon [College of Medicine, Univ. of Korea, Seoul (Korea, Republic of)

    2003-07-01

    Major depressive disorder is a prevalent psychiatric disorder in primary care, associated with impaired patient functioning and well-being. Fluoxetine is a selective serotonin-reuptake inhibitors (SSRIs) and is a commonly prescribed antidepressant compound. Its action is primarily attributed to selective inhibition of the reuptake of serotonin (5-hydroxytryptamine) in the central nervous system. Objectives ; the aims of this study were two-fold: (1) to determine the usefulness for investigation of the transcription profiles in depression patients, and (2) to assess the differences in gene expression profiles between positive response group and negative response groups by fluoxetine treatment. This study included 53 patients with major depression (26 in positive response group with antidepressant treatment, 27 in negative response group with antidepressant treatment), and 53 healthy controls. To examine the difference of gene expression profile in depression patients, radioactive complementary DNA microarrays were used to evaluate changes in the expression of 1,152 genes in total. Using 33p-labeled probes, this method provided highly sensitive gene expression profiles including brain receptors, drug metabolism, and cellular signaling. Gene transcription profiles were classified into several categories in accordance with the antidepressant gene-regulation. The gene profiles were significantly up-(22 genes) and down-(16 genes) regulated in the positive response group when compared to the control group. Also, in the negative response group, 35 genes were up-regulated and 8 genes were down-regulated when compared to the control group. Consequently, we demonstrated that radioactive human cDNA microarray is highly likely to be an efficient technology for evaluating the gene regulation of antidepressants, such as selective serotonin-reuptake inhibitors (SSRIs), by using high-throughput biotechnology.

  8. Radioactive cDNA microarray (II): Gene expression profiling of antidepressant treatment by human cDNA microarray

    International Nuclear Information System (INIS)

    Lee, Ji Hye; Kang, Rhee Hun; Ham, Byung Joo; Lee, Min Su; Shin, Kyung Ho; Choe, Jae Gol; Kim, Meyoung Kon

    2003-01-01

    Major depressive disorder is a prevalent psychiatric disorder in primary care, associated with impaired patient functioning and well-being. Fluoxetine is a selective serotonin-reuptake inhibitors (SSRIs) and is a commonly prescribed antidepressant compound. Its action is primarily attributed to selective inhibition of the reuptake of serotonin (5-hydroxytryptamine) in the central nervous system. Objectives ; the aims of this study were two-fold: (1) to determine the usefulness for investigation of the transcription profiles in depression patients, and (2) to assess the differences in gene expression profiles between positive response group and negative response groups by fluoxetine treatment. This study included 53 patients with major depression (26 in positive response group with antidepressant treatment, 27 in negative response group with antidepressant treatment), and 53 healthy controls. To examine the difference of gene expression profile in depression patients, radioactive complementary DNA microarrays were used to evaluate changes in the expression of 1,152 genes in total. Using 33p-labeled probes, this method provided highly sensitive gene expression profiles including brain receptors, drug metabolism, and cellular signaling. Gene transcription profiles were classified into several categories in accordance with the antidepressant gene-regulation. The gene profiles were significantly up-(22 genes) and down-(16 genes) regulated in the positive response group when compared to the control group. Also, in the negative response group, 35 genes were up-regulated and 8 genes were down-regulated when compared to the control group. Consequently, we demonstrated that radioactive human cDNA microarray is highly likely to be an efficient technology for evaluating the gene regulation of antidepressants, such as selective serotonin-reuptake inhibitors (SSRIs), by using high-throughput biotechnology

  9. Production of glycosylated physiologically normal human α1-antitrypsin by mouse fibroblasts modified by insertion of a human α1-antitrypsin cDNA using a retroviral vector

    International Nuclear Information System (INIS)

    Garver, R.I. Jr.; Chytil, A.; Karlsson, S.

    1987-01-01

    α 2 -Antitrypsin (α 1 AT) deficiency is a hereditary disorder characterized by reduced serum levels of α 1 AT, resulting in destruction of the lower respiratory tract by neutrophil elastase. As an approach to augment α 1 AT levels in this disorder with physiologically normal human α 1 AT, the authors have integrated a full-length normal human α 1 AT cDNA into the genome of mouse fibroblasts. To accomplish this, the retroviral vector N2 was modified by inserting the simian virus 40 early promoter followed by the α 1 AT cDNA. Southern analysis demonstrated that the intact cDNA was present in the genome of selected clones of the transfected murine fibroblasts psi2 and infected NIH 3T3. The clones produced three mRNA transcripts containing human α 1 AT sequences, secreted an α 1 AT molecule recognized by an anti-human α 1 AT antibody, with the same molecular mass as normal human α 1 AT and that complexed with and inhibited human neutrophil elastase. The psi2 produced α 1 AT was glycosylated, and when infused intravenously into mice, it had a serum half-life similar to normal α 1 AT purified from human plasma and markedly longer than that of nonglycosylated human α 1 AT cDNA-directed yeast-produced α 1 AT. These studies demonstrate the feasibility of using a retroviral vector to insert the normal human α 1 AT cDNA into non-α 1 AT-producing cells, resulting in the synthesis and secretion of physiologically normal α 1 AT

  10. Complete coding sequence of the human raf oncogene and the corresponding structure of the c-raf-1 gene

    Energy Technology Data Exchange (ETDEWEB)

    Bonner, T I; Oppermann, H; Seeburg, P; Kerby, S B; Gunnell, M A; Young, A C; Rapp, U R

    1986-01-24

    The complete 648 amino acid sequence of the human raf oncogene was deduced from the 2977 nucleotide sequence of a fetal liver cDNA. The cDNA has been used to obtain clones which extend the human c-raf-1 locus by an additional 18.9 kb at the 5' end and contain all the remaining coding exons.

  11. Assessing the utility of the Oxford Nanopore MinION for snake venom gland cDNA sequencing

    Directory of Open Access Journals (Sweden)

    Adam D. Hargreaves

    2015-11-01

    Full Text Available Portable DNA sequencers such as the Oxford Nanopore MinION device have the potential to be truly disruptive technologies, facilitating new approaches and analyses and, in some cases, taking sequencing out of the lab and into the field. However, the capabilities of these technologies are still being revealed. Here we show that single-molecule cDNA sequencing using the MinION accurately characterises venom toxin-encoding genes in the painted saw-scaled viper, Echis coloratus. We find the raw sequencing error rate to be around 12%, improved to 0–2% with hybrid error correction and 3% with de novo error correction. Our corrected data provides full coding sequences and 5′ and 3′ UTRs for 29 of 33 candidate venom toxins detected, far superior to Illumina data (13/40 complete and Sanger-based ESTs (15/29. We suggest that, should the current pace of improvement continue, the MinION will become the default approach for cDNA sequencing in a variety of species.

  12. Assessing the utility of the Oxford Nanopore MinION for snake venom gland cDNA sequencing.

    Science.gov (United States)

    Hargreaves, Adam D; Mulley, John F

    2015-01-01

    Portable DNA sequencers such as the Oxford Nanopore MinION device have the potential to be truly disruptive technologies, facilitating new approaches and analyses and, in some cases, taking sequencing out of the lab and into the field. However, the capabilities of these technologies are still being revealed. Here we show that single-molecule cDNA sequencing using the MinION accurately characterises venom toxin-encoding genes in the painted saw-scaled viper, Echis coloratus. We find the raw sequencing error rate to be around 12%, improved to 0-2% with hybrid error correction and 3% with de novo error correction. Our corrected data provides full coding sequences and 5' and 3' UTRs for 29 of 33 candidate venom toxins detected, far superior to Illumina data (13/40 complete) and Sanger-based ESTs (15/29). We suggest that, should the current pace of improvement continue, the MinION will become the default approach for cDNA sequencing in a variety of species.

  13. [Cloning and sequencing of KIR2DL1 framework gene cDNA and identification of a novel allele].

    Science.gov (United States)

    Sun, Ge; Wang, Chang; Zhen, Jianxin; Zhang, Guobin; Xu, Yunping; Deng, Zhihui

    2016-10-01

    To develop an assay for cDNA cloning and haplotype sequencing of KIR2DL1 framework gene and determine the genotype of an ethnic Han from southern China. Total RNA was isolated from peripheral blood sample, and complementary DNA (cDNA) transcript was synthesized by RT-PCR. The entire coding sequence of the KIR2DL1 framework gene was amplified with a pair of KIR2DL1-specific PCR primers. The PCR products with a length of approximately 1.2 kb were then subjected to cloning and haplotype sequencing. A specific target fragment of the KIR2DL1 framework gene was obtained. Following allele separation, a wild-type KIR2DL1*00302 allele and a novel variant allele, KIR2DL1*031, were identified. Sequence alignment with KIR2DL1 alleles from the IPD-KIR Database showed that the novel allele KIR2DL1*031 has differed from the closest allele KIR2DL1*00302 by a non-synonymous mutation at CDS nt 188A>G (codon 42 GAG>GGG) in exon 4, which has caused an amino acid change Glu42Gly. The sequence of the novel allele KIR2DL1*031 was submitted to GenBank under the accession number KP025960 and to the IPD-KIR Database under the submission number IWS40001982. A name KIR2DL1*031 has been officially assigned by the World Health Organization (WHO) Nomenclature Committee. An assay for cDNA cloning and haplotype sequencing of KIR2DL1 has been established, which has a broad applications in KIR studies at allelic level.

  14. Opsin cDNA sequences of a UV and green rhodopsin of the satyrine butterfly Bicyclus anynana.

    Science.gov (United States)

    Vanhoutte, K J A; Eggen, B J L; Janssen, J J M; Stavenga, D G

    2002-11-01

    The cDNAs of an ultraviolet (UV) and long-wavelength (LW) (green) absorbing rhodopsin of the bush brown Bicyclus anynana were partially identified. The UV sequence, encoding 377 amino acids, is 76-79% identical to the UV sequences of the papilionids Papilio glaucus and Papilio xuthus and the moth Manduca sexta. A dendrogram derived from aligning the amino acid sequences reveals an equidistant position of Bicyclus between Papilio and Manduca. The sequence of the green opsin cDNA fragment, which encodes 242 amino acids, represents six of the seven transmembrane regions. At the amino acid level, this fragment is more than 80% identical to the corresponding LW opsin sequences of Dryas, Heliconius, Papilio (rhodopsin 2) and Manduca. Whereas three LW absorbing rhodopsins were identified in the papilionid butterflies, only one green opsin was found in B. anynana.

  15. cDNA sequence and tissue expression analysis of glucokinase from ...

    African Journals Online (AJOL)

    Yomi

    2012-01-10

    Jan 10, 2012 ... distribution of GK mRNA in brain, mesenteric adipose tissue, spleen, white muscle and liver of grass ... expression profile of GK mRNA in liver normalized with β-actin level was 31, 454 and 649-fold compared .... Primers and expected products used for GK gene cDNA RT-PCR, RACE and real-time PCR.

  16. Isolation of a cDNA for a Growth Factor of Vascular Endothelial Cells from Human Lung Cancer Cells: Its Identity with Insulin‐like Growth Factor II

    Science.gov (United States)

    Hagiwara, Koichi; Kobayashi, Tatsuo; Tobita, Masato; Kikyo, Nobuaki; Yazaki, Yoshio

    1995-01-01

    We have found growth‐promoting activity for vascular endothelial cells in the conditioned medium of a human lung cancer cell line, T3M‐11. Purification and characterization of the growth‐promoting activity have been carried out using ammonium sulfate precipitation and gel‐exclusion chromatography. The activity migrated as a single peak just after ribonuclease. It did not bind to a heparin affinity column. These results suggest that the activity is not a heparin‐binding growth factor (including fibroblast growth factors) or a vascular endothelial growth factor. To identify the molecule exhibiting the growth‐promoting activity, a cDNA encoding the growth factor was isolated through functional expression cloning in COS‐1 cells from a cDNA library prepared from T3M‐11 cells. The nucleotide sequence encoded by the cDNA proved to be identical with that of insulin‐like growth factor II. PMID:7730145

  17. cDNA cloning, mRNA distribution and heterogeneity, chromosomal location, and RFLP analysis of human osteopontin (OPN)

    DEFF Research Database (Denmark)

    Young, M F; Kerr, J M; Termine, J D

    1990-01-01

    A human osteopontin (OP) cDNA was isolated from a library made from primary cultures of human bone cells. The distribution of osteopontin mRNA in human tissues was investigated by Northern analysis and showed that the human message was predominant in cultures of bone cells and in decidua cells...... osteopontin cDNA indicated that the gene is a single copy with an approximate length of 5.4-8.2 kb....

  18. cDNA sequence analysis of a 29-kDa cysteine-rich surface antigen of pathogenic Entamoeba histolytica

    International Nuclear Information System (INIS)

    Torian, B.E.; Stroeher, V.L.; Stamm, W.E.; Flores, B.M.; Hagen, F.S.

    1990-01-01

    A λgt11 cDNA library was constructed from poly(U)-Spharose-selected Entamoeba histolytica trophozoite RNA in order to clone and identify surface antigens. The library was screened with rabbit polyclonal anti-E. histolytica serum. A 700-base-pair cDNA insert was isolated and the nucleotide sequence was determined. The deduced amino acid sequence of the cDNA revealed a cysteine-rich protein. DNA hybridizations showed that the gene was specific to E. histolytica since the cDNA probe reacted with DNA from four axenic strains of E. histolytica but did not react with DNA from Entamoeba invadens, Acanthamoeba castellanii, or Trichomonas vaginalis. The insert was subcloned into the expression vector pGEX-1 and the protein was expressed as a fusion with the C terminus of glutathione S-transferase. Purified fusion protein was used to generate 22 monoclonal antibodies (mAbs) and a mouse polyclonal antiserum specific for the E. histolytica portion of the fusion protein. A 29-kDa protein was identified as a surface antigen when mAbs were used to immunoprecipitate the antigen from metabolically 35 S-labeled live trophozoites. The surface location of the antigen was corroborated by mAb immunoprecipitation of a 29-kDa protein from surface- 125 I-labeled whole trophozoites as well as by the reaction of mAbs with live trophozoites in an indirect immunofluorescence assay performed at 4 degree C. Immunoblotting with mAbs demonstrated that the antigen was present on four axenic isolates tested. mAbs recognized epitopes on the 29-kDa native antigen on some but not all clinical isolates tested

  19. cDNA sequence analysis of a 29-kDa cysteine-rich surface antigen of pathogenic Entamoeba histolytica

    Energy Technology Data Exchange (ETDEWEB)

    Torian, B.E.; Stroeher, V.L.; Stamm, W.E. (Univ. of Washington, Seattle (USA)); Flores, B.M. (Louisiana State Univ. Medical Center, New Orleans (USA)); Hagen, F.S. (Zymogenetics Incorporated, Seattle, WA (USA))

    1990-08-01

    A {lambda}gt11 cDNA library was constructed from poly(U)-Spharose-selected Entamoeba histolytica trophozoite RNA in order to clone and identify surface antigens. The library was screened with rabbit polyclonal anti-E. histolytica serum. A 700-base-pair cDNA insert was isolated and the nucleotide sequence was determined. The deduced amino acid sequence of the cDNA revealed a cysteine-rich protein. DNA hybridizations showed that the gene was specific to E. histolytica since the cDNA probe reacted with DNA from four axenic strains of E. histolytica but did not react with DNA from Entamoeba invadens, Acanthamoeba castellanii, or Trichomonas vaginalis. The insert was subcloned into the expression vector pGEX-1 and the protein was expressed as a fusion with the C terminus of glutathione S-transferase. Purified fusion protein was used to generate 22 monoclonal antibodies (mAbs) and a mouse polyclonal antiserum specific for the E. histolytica portion of the fusion protein. A 29-kDa protein was identified as a surface antigen when mAbs were used to immunoprecipitate the antigen from metabolically {sup 35}S-labeled live trophozoites. The surface location of the antigen was corroborated by mAb immunoprecipitation of a 29-kDa protein from surface-{sup 125}I-labeled whole trophozoites as well as by the reaction of mAbs with live trophozoites in an indirect immunofluorescence assay performed at 4{degree}C. Immunoblotting with mAbs demonstrated that the antigen was present on four axenic isolates tested. mAbs recognized epitopes on the 29-kDa native antigen on some but not all clinical isolates tested.

  20. Human beta 2 chain of laminin (formerly S chain): cDNA cloning, chromosomal localization, and expression in carcinomas

    DEFF Research Database (Denmark)

    Wewer, U M; Gerecke, D R; Durkin, M E

    1994-01-01

    or other known laminin genes. Immunostaining showed that the beta 2 chain is localized to the smooth muscle basement membranes of the arteries, while the homologous beta 1 chain is confined to the subendothelial basement membranes. The beta 2 chain was found in the basement membranes of ovarian carcinomas......Overlapping cDNA clones that encode the full-length human laminin beta 2 chain, formerly called the S chain, were isolated. The cDNA of 5680 nt contains a 5391-nt open reading frame encoding 1797 amino acids. At the amino terminus is a 32-amino-acid signal peptide that is followed by the mature...... beta 2 chain polypeptide of 1765 amino acids with a calculated molecular mass of 192,389 Da. The human beta 2 chain is predicted to have all of the seven structural domains typical of the beta chains of laminin, including the short cysteine-rich alpha region. The amino acid sequence of human beta 2...

  1. Molecular cloning of a cDNA and chromosomal localization of a human theta-class glutathione S-transferase gene (GSTT2) to chromosome 22

    Energy Technology Data Exchange (ETDEWEB)

    Tan, K.L.; Baker, R.T.; Board, P.G. [Australian National Univ., Canberra (Australia)] [and others

    1995-01-20

    Until recently the Theta-class glutathione S-transferases (GSTs) were largely overlooked due to their low activity with the model substrate 1-chloro-2,4-dinitrobenzene (CDNB) and their failure to bind to immobilized glutathione affinity matrices. Little is known about the number of genes in this class. Recently, Pemble et al. reported the cDNA cloning of a human Theta-class GST, termed GSTT1. In this study, we describe the molecular cloning of a cDNA encoding a second human Theta-class GST (GSTT2) from a {lambda}gt11 human liver 5{prime}-stretch cDNA library. The encoded protein contains 244 amino acids and has 78.3% sequence identity with the rat subunit 12 and only 55.0% identity with human GSTT1. GSTT2 has been mapped to chromosome 22 by somatic cell hybrid analysis. The precise position of the gene was localized to subband 22q11.2 by in situ hybridization. The absence of other regions of hybridization suggests that there are no closely related sequences (e.g., reverse transcribed pseudogenes) scattered throughout the genome and that if there are closely related genes, they must be clustered near GSTT2. Southern blot analysis of human DNA digested with BamHI shows that the size of the GSTT2 gene is relatively small, as the coding sequence falls within a 3.6-kb BamHI fragment. 35 refs., 6 figs.

  2. Identification of a cDNA encoding a parathyroid hormone-like peptide from a human tumor associated with humoral hypercalcemia of malignancy

    International Nuclear Information System (INIS)

    Mangin, M.; Webb, A.C.; Dreyer, B.E.

    1988-01-01

    Humoral hypercalcemia of malignancy is a common paraneoplastic syndrome that appears to be mediated in many instances by a parathyroid hormone-like peptide. Poly(A) + RNA from a human renal carcinoma associated with this syndrome was enriched by preparative electrophoresis and used to construct an enriched cDNA library in phage λgt10. The library was screened with a codon-preference oligonucleotide synthesized on the basis of a partial N-terminal amino acid sequence from a human tumor-derived peptide, and a 2.0 kilo-base cDNA was identified. The cDNA encodes a 177 amino acid protein consisting of a 36 amino acid leader sequence and a 141 amino acid mature peptide. The first 13 amino acids of the deduced sequence of the mature peptide display strong homology to human PTH, with complete divergence thereafter. RNA blot-hybridization analysis revealed multiple transcripts in mRNA from tumors associated with the humor syndrome and also in mRNA from normal human keratinocytes. Southern blot analysis of genomic DNA from humans and rodents revealed a simple pattern compatible with a single-copy gene. The gene has been mapped to chromosome 12

  3. Characterization of the porcine carboxypeptidase E cDNA

    DEFF Research Database (Denmark)

    Hreidarsdôttir, G.E.; Cirera, Susanna; Fredholm, Merete

    2007-01-01

    the sequence of the cDNA for the porcine CPE gene including all the coding region and the 3'-UTR region was generated. Comparisons with bovine, human, mouse, and rat CPE cDNA sequences showed that the coding regions of the gene are highly conserved both at the nucleotide and at the amino acid level. A very low...

  4. Isolation and characterization of cDNA clones for human erythrocyte β-spectrin

    International Nuclear Information System (INIS)

    Prchal, J.T.; Morley, B.J.; Yoon, S.H.; Coetzer, T.L.; Palek, J.; Conboy, J.G.; Kan, Y.W.

    1987-01-01

    Spectrin is an important structural component of the membrane skeleton that underlies and supports the erythrocyte plasma membrane. It is composed of nonidentical α (M/sub r/ 240,000) and β (M/sub r/ 220,000) subunits, each of which contains multiple homologous 106-amino acid segments. The authors report here the isolation and characterization of a human erythroid-specific β-spectrin cDNA clone that encodes parts of the β-9 through β-12 repeat segments. This cDNA was used as a hybridization probe to assign the β-spectrin gene to human chromosome 14 and to begin molecular analysis of the gene and its mRNA transcripts. RNA transfer blot analysis showed that the reticulocyte β-spectrin mRNA is 7.8 kilobases in length. Southern blot analysis of genomic DNA revealed the presence of restriction fragment length polymorphisms (RFLPs) within the β-spectrin gene locus. The isolation of human spectrin cDNA probes and the identification of closely linked RFLPs will facilitate analysis of mutant spectrin genes causing congenital hemolytic anemias associated with quantitative and qualitative spectrin abnormalities

  5. cDNA cloning of human DNA topoisomerase I. Catalytic activity of a 67.7-kDa carboxyl-terminal fragment

    International Nuclear Information System (INIS)

    D'Arpa, P.; Machlin, P.S.; Ratrie, H. III; Rothfield, N.F.; Cleveland, D.W.; Earnshaw, W.C.

    1988-01-01

    cDNA clones encoding human topoisomerase I were isolated from an expression vector library (λgt11) screened with autoimmune anti-topoisomerase I serum. One of these clones has been expressed as a fusion protein comprised of a 32-kDa fragment of the bacterial TrpE protein linked to 67.7 kDa of protein encoded by the cDNA. Three lines of evidence indicate that the cloned cDNA encodes topoisomerase I. (i) Proteolysis maps of the fusion protein and human nuclear topoisomerase I are essentially identical. (ii) The fusion protein relaxes supercoiled DNA, an activity that can be immunoprecipitated by anti-topoisomerase I serum. (iii) Sequence analysis has revealed that the longest cDNA clone (3645 base pairs) encodes a protein of 765 amino acids that shares 42% identity with Saccharomyces cerevisiae topoisomerase I. The sequence data also show that the catalytically active 67.7-kDa fragment is comprised of the carboxyl terminus

  6. Analysis of expressed sequence tags generated from full-length enriched cDNA libraries of melon

    Directory of Open Access Journals (Sweden)

    Bendahmane Abdelhafid

    2011-05-01

    Full Text Available Abstract Background Melon (Cucumis melo, an economically important vegetable crop, belongs to the Cucurbitaceae family which includes several other important crops such as watermelon, cucumber, and pumpkin. It has served as a model system for sex determination and vascular biology studies. However, genomic resources currently available for melon are limited. Result We constructed eleven full-length enriched and four standard cDNA libraries from fruits, flowers, leaves, roots, cotyledons, and calluses of four different melon genotypes, and generated 71,577 and 22,179 ESTs from full-length enriched and standard cDNA libraries, respectively. These ESTs, together with ~35,000 ESTs available in public domains, were assembled into 24,444 unigenes, which were extensively annotated by comparing their sequences to different protein and functional domain databases, assigning them Gene Ontology (GO terms, and mapping them onto metabolic pathways. Comparative analysis of melon unigenes and other plant genomes revealed that 75% to 85% of melon unigenes had homologs in other dicot plants, while approximately 70% had homologs in monocot plants. The analysis also identified 6,972 gene families that were conserved across dicot and monocot plants, and 181, 1,192, and 220 gene families specific to fleshy fruit-bearing plants, the Cucurbitaceae family, and melon, respectively. Digital expression analysis identified a total of 175 tissue-specific genes, which provides a valuable gene sequence resource for future genomics and functional studies. Furthermore, we identified 4,068 simple sequence repeats (SSRs and 3,073 single nucleotide polymorphisms (SNPs in the melon EST collection. Finally, we obtained a total of 1,382 melon full-length transcripts through the analysis of full-length enriched cDNA clones that were sequenced from both ends. Analysis of these full-length transcripts indicated that sizes of melon 5' and 3' UTRs were similar to those of tomato, but

  7. Cloning, sequencing and expression of a novel xylanase cDNA from ...

    African Journals Online (AJOL)

    STORAGESEVER

    2008-12-03

    Dec 3, 2008 ... First strand cDNA was synthesized by RT-PCR with Oligo(dT)15 using mRNA isolated ... 4°C. Single colonies were picked into 5 mL BMGY medium for preculture, and incubated ... to fold properly into a native conformation. Without the .... polymorphism is often used in taxonomy, but now, it is being well ...

  8. Primary structure of bovine pituitary secretory protein I (chromogranin A) deduced from the cDNA sequence

    International Nuclear Information System (INIS)

    Ahn, T.G.; Cohn, D.V.; Gorr, S.U.; Ornstein, D.L.; Kashdan, M.A.; Levine, M.A.

    1987-01-01

    Secretory protein I (SP-I), also referred to as chromogranin A, is an acidic glycoprotein that has been found in every tissue of endocrine and neuroendocrine origin examined but never in exocrine or epithelial cells. Its co-storage and co-secretion with peptide hormones and neurotransmitters suggest that it has an important endocrine or secretory function. The authors have isolated cDNA clones from a bovine pituitary λgt11 expression library using an antiserum to parathyroid SP-I. The largest clone (SP4B) hybridized to a transcript of 2.1 kilobases in RNA from parathyroid, pituitary, and adrenal medulla. Immunoblots of bacterial lysates derived from SP4B lysognes demonstrated specific antibody binding to an SP4B/β-galactosidase fusion protein (160 kDa) with a cDNA-derived component of 46 kDa. Radioimmunoassay of the bacterial lystates with SP-I antiserum yielded parallel displacement curves of 125 I-labeled SP-I by the SP4B lysate and authentic SP-I. SP4B contains a cDNA of 1614 nucleotides that encodes a 449-amino acid protein (calculated mass, 50 kDa). The nucleotide sequences of the pituitary SP-I cDNA and adrenal medullary SP-I cDNAs are nearly identical. Analysis of genomic DNA suggests that pituitary, adrenal, and parathyroid SP-I are products of the same gene

  9. Primary structure of bovine pituitary secretory protein I (chromogranin A) deduced from the cDNA sequence

    Energy Technology Data Exchange (ETDEWEB)

    Ahn, T.G.; Cohn, D.V.; Gorr, S.U.; Ornstein, D.L.; Kashdan, M.A.; Levine, M.A.

    1987-07-01

    Secretory protein I (SP-I), also referred to as chromogranin A, is an acidic glycoprotein that has been found in every tissue of endocrine and neuroendocrine origin examined but never in exocrine or epithelial cells. Its co-storage and co-secretion with peptide hormones and neurotransmitters suggest that it has an important endocrine or secretory function. The authors have isolated cDNA clones from a bovine pituitary lambdagt11 expression library using an antiserum to parathyroid SP-I. The largest clone (SP4B) hybridized to a transcript of 2.1 kilobases in RNA from parathyroid, pituitary, and adrenal medulla. Immunoblots of bacterial lysates derived from SP4B lysognes demonstrated specific antibody binding to an SP4B/..beta..-galactosidase fusion protein (160 kDa) with a cDNA-derived component of 46 kDa. Radioimmunoassay of the bacterial lystates with SP-I antiserum yielded parallel displacement curves of /sup 125/I-labeled SP-I by the SP4B lysate and authentic SP-I. SP4B contains a cDNA of 1614 nucleotides that encodes a 449-amino acid protein (calculated mass, 50 kDa). The nucleotide sequences of the pituitary SP-I cDNA and adrenal medullary SP-I cDNAs are nearly identical. Analysis of genomic DNA suggests that pituitary, adrenal, and parathyroid SP-I are products of the same gene.

  10. cDNA, deduced polypeptide structure and chromosomal assignment of human pulmonary surfactant proteolipid, SPL(pVal)

    International Nuclear Information System (INIS)

    Glasser, S.W.; Korfhagen, T.R.; Weaver, T.E.; Clark, J.C.; Pilot-Matias, T.; Meuth, J.; Fox, J.L.; Whitsett, J.A.

    1988-01-01

    In hyaline membrane disease of premature infants, lack of surfactant leads to pulmonary atelectasis and respiratory distress. Hydrophobic surfactant proteins of M/sub r/ = 5000-14,000 have been isolated from mammalian surfactants which enhance the rate of spreading and the surface tension lowering properties of phospholipids during dynamic compression. The authors have characterized the amino-terminal amino acid sequence of pulmonary proteolipids from ether/ethanol extracts of bovine, canine, and human surfactant. Two distinct peptides were identified and termed SPL(pVal) and SPL(Phe). An oligonucleotide probe based on the valine-rich amino-terminal amino acid sequence of SPL(pVal) was utilized to isolate cDNA and genomic DNA encoding the human protein, termed surfactant proteolipid SPL(pVal) on the basis of its unique polyvaline domain. The primary structure of a precursor protein of 20,870 daltons, containing the SPL(pVal) peptide, was deduced from the nucleotide sequence of the cDNAs. Hybrid-arrested translation and immunoprecipitation of labeled translation products of human mRNA demonstrated a precursor protein, the active hydrophobic peptide being produced by proteolytic processing. Two classes of cDNAs encoding SPL(pVal) were identified. Human SPL(pVal) mRNA was more abundant in the adult than in fetal lung. The SPL(pVal) gene locus was assigned to chromosome 8

  11. Cloning of a cDNA encoding the human cation-dependent mannose 6-phosphate-specific receptor

    International Nuclear Information System (INIS)

    Pohlmann, R.; Nagel, G.; Schmidt, B.

    1987-01-01

    Complementary DNA clones for the human cation-dependent mannose 6-phosphate-specific receptor have been isolated from a human placenta library in λgt11. The nucleotide sequence of the 2463-base-pair cDNA insert includes a 145-base-pair 5' untranslated region, an open reading frame of 831 base pairs corresponding to 277 amino acids, and a 1487-base-pair 3' untranslated region. The deduced amino acid sequence is colinear with that determined by amino acid sequencing of the N-terminus peptide (41 residues) and nine tryptic peptides (93 additional residues). The receptor is synthesized as a precursor with a signal peptide of 20 amino acids. The hydrophobicity profile of the receptor indicates a single membrane-spanning domain, which separates an N-terminal region containing five potential N-glycosylation sites from a C-terminal region lacking N-glycosylation sites. Thus the N-terminal (M/sub r/ = 18,299) and C-terminal (M/sub r/ ≤ 7648) segments of the mature receptor are assumed to be exposed to the extracytosolic and cytosolic sides of the membrane, respectively. Analysis of a panel of somatic cell (mouse-human) hybrids shows that the gene for the receptor is located on human chromosome 12

  12. Use of Non-Normalized, Non-Amplified cDNA for 454-Based RNA Sequencing of Fleshy Melon Fruit

    Directory of Open Access Journals (Sweden)

    Vitaly Portnoy

    2011-03-01

    Full Text Available The melon ( L. fruit is an important crop and model system for the genomic study of both fleshy fruit development and the Cucurbitaceae family. To obtain an accurate representation of the melon fruit transcriptome based on expressed sequence tag (EST abundance in 454-pyrosequencing data, we prepared double-stranded complementary DNA (cDNA of melon without the usual amplification and normalization steps. A purification step was also included to eliminate small fragments. Complementary DNAs were obtained from 14 individual fruit libraries derived from two genotypes, separated into flesh and peel tissues, and sampled throughout fruit development. Pyrosequencing was performed using Genome Sequencer FLX (GS FLX technology, resulting in 1,215,359 reads, with mean length of >200 nucleotides. The global digital expression data was validated by comparative reverse transcription quantitative real-time polymerase chain reaction (RT-qPCR of 40 selected genes and expression patterns were similar for the two methods. The results indicate that high-quality, nonbiased cDNA for next-generation sequencing can be prepared from mature, fleshy fruit, which are notorious for difficulties in ribonucleic acid (RNA preparation.

  13. Hybridization-based antibody cDNA recovery for the production of recombinant antibodies identified by repertoire sequencing.

    Science.gov (United States)

    Valdés-Alemán, Javier; Téllez-Sosa, Juan; Ovilla-Muñoz, Marbella; Godoy-Lozano, Elizabeth; Velázquez-Ramírez, Daniel; Valdovinos-Torres, Humberto; Gómez-Barreto, Rosa E; Martinez-Barnetche, Jesús

    2014-01-01

    High-throughput sequencing of the antibody repertoire is enabling a thorough analysis of B cell diversity and clonal selection, which may improve the novel antibody discovery process. Theoretically, an adequate bioinformatic analysis could allow identification of candidate antigen-specific antibodies, requiring their recombinant production for experimental validation of their specificity. Gene synthesis is commonly used for the generation of recombinant antibodies identified in silico. Novel strategies that bypass gene synthesis could offer more accessible antibody identification and validation alternatives. We developed a hybridization-based recovery strategy that targets the complementarity-determining region 3 (CDRH3) for the enrichment of cDNA of candidate antigen-specific antibody sequences. Ten clonal groups of interest were identified through bioinformatic analysis of the heavy chain antibody repertoire of mice immunized with hen egg white lysozyme (HEL). cDNA from eight of the targeted clonal groups was recovered efficiently, leading to the generation of recombinant antibodies. One representative heavy chain sequence from each clonal group recovered was paired with previously reported anti-HEL light chains to generate full antibodies, later tested for HEL-binding capacity. The recovery process proposed represents a simple and scalable molecular strategy that could enhance antibody identification and specificity assessment, enabling a more cost-efficient generation of recombinant antibodies.

  14. Molecular cloning and functional expression of a human cDNA encoding the antimutator enzyme 8-hydroxyguanine-DNA glycosylase

    Science.gov (United States)

    Roldán-Arjona, Teresa; Wei, Ying-Fei; Carter, Kenneth C.; Klungland, Arne; Anselmino, Catherine; Wang, Rui-Ping; Augustus, Meena; Lindahl, Tomas

    1997-01-01

    The major mutagenic base lesion in DNA caused by exposure to reactive oxygen species is 8-hydroxyguanine (8-oxo-7,8-dihydroguanine). In bacteria and Saccharomyces cerevisiae, this damaged base is excised by a DNA glycosylase with an associated lyase activity for chain cleavage. We have cloned, sequenced, and expressed a human cDNA with partial sequence homology to the relevant yeast gene. The encoded 47-kDa human enzyme releases free 8-hydroxyguanine from oxidized DNA and introduces a chain break in a double-stranded oligonucleotide specifically at an 8-hydroxyguanine residue base paired with cytosine. Expression of the human protein in a DNA repair-deficient E. coli mutM mutY strain partly suppresses its spontaneous mutator phenotype. The gene encoding the human enzyme maps to chromosome 3p25. These results show that human cells have an enzyme that can initiate base excision repair at mutagenic DNA lesions caused by active oxygen. PMID:9223306

  15. cDNA cloning and expression of a human platelet-derived growth factor (PDGF) receptor specific for B-chain-containing PDGF molecules

    International Nuclear Information System (INIS)

    Claesson-Welsh, L.; Eriksson, A.; Moren, A.; Severinsson, L.; Ek, B.; Ostman, A.; Betsholtz, C.; Heldin, C.H.

    1988-01-01

    The structure of the human receptor for platelet-derived growth factor (PDGF) has been deduced through cDNA cloning. A 5.45-kilobase-pair cDNA clone predicts a 1,106-amino-acid polypeptide, including the cleavable signal sequence. The overall amino acid sequence similarity with the murine PDGFR receptor is 85%. After transcription of the cDNA and translation in vitro, a PDGR receptor antiserum was used to immunoprecipitate a product of predicted size, which also could be phosphorylated in vitro. Stable introduction of the cDNA into Chinese hamster ovary (CHO) cells led to the expression of a 190-kilodalton component, which was immunoprecipitated by the PDGF receptor antiserum; this most probably represents the mature PDGF receptor. Binding assays with different /sup 125/I-labeled dimeric forms of PDGF A and B chains showed that the PDGFR receptor expressed in CHO cells bound PDGF-BB and, to a lesser extent, PDGF-AB, but not PDGF-AA

  16. Cloning and characterization of a novel human zinc finger gene, hKid3, from a C2H2-ZNF enriched human embryonic cDNA library

    International Nuclear Information System (INIS)

    Gao Li; Sun Chong; Qiu Hongling; Liu Hui; Shao Huanjie; Wang Jun; Li Wenxin

    2004-01-01

    To investigate the zinc finger genes involved in human embryonic development, we constructed a C 2 H 2 -ZNF enriched human embryonic cDNA library, from which a novel human gene named hKid3 was identified. The hKid3 cDNA encodes a 554 amino acid protein with an amino-terminal KRAB domain and 11 carboxyl-terminal C 2 H 2 zinc finger motifs. Northern blot analysis indicates that two hKid3 transcripts of 6 and 8.5 kb express in human fetal brain and kidney. The 6 kb transcript can also be detected in human adult brain, heart, and skeletal muscle while the 8.5 kb transcript appears to be embryo-specific. GFP-fused hKid3 protein is localized to nuclei and the ZF domain is necessary and sufficient for nuclear localization. To explore the DNA-binding specificity of hKid3, an oligonucleotide library was selected by GST fusion protein of hKid3 ZF domain, and the consensus core sequence 5'-CCAC-3' was evaluated by competitive electrophoretic mobility shift assay. Moreover, The KRAB domain of hKid3 exhibits transcription repressor activity when tested in GAL4 fusion protein assay. These results indicate that hKid3 may function as a transcription repressor with regulated expression pattern during human development of brain and kidney

  17. Integrative annotation of 21,037 human genes validated by full-length cDNA clones.

    Directory of Open Access Journals (Sweden)

    Tadashi Imanishi

    2004-06-01

    Full Text Available The human genome sequence defines our inherent biological potential; the realization of the biology encoded therein requires knowledge of the function of each gene. Currently, our knowledge in this area is still limited. Several lines of investigation have been used to elucidate the structure and function of the genes in the human genome. Even so, gene prediction remains a difficult task, as the varieties of transcripts of a gene may vary to a great extent. We thus performed an exhaustive integrative characterization of 41,118 full-length cDNAs that capture the gene transcripts as complete functional cassettes, providing an unequivocal report of structural and functional diversity at the gene level. Our international collaboration has validated 21,037 human gene candidates by analysis of high-quality full-length cDNA clones through curation using unified criteria. This led to the identification of 5,155 new gene candidates. It also manifested the most reliable way to control the quality of the cDNA clones. We have developed a human gene database, called the H-Invitational Database (H-InvDB; http://www.h-invitational.jp/. It provides the following: integrative annotation of human genes, description of gene structures, details of novel alternative splicing isoforms, non-protein-coding RNAs, functional domains, subcellular localizations, metabolic pathways, predictions of protein three-dimensional structure, mapping of known single nucleotide polymorphisms (SNPs, identification of polymorphic microsatellite repeats within human genes, and comparative results with mouse full-length cDNAs. The H-InvDB analysis has shown that up to 4% of the human genome sequence (National Center for Biotechnology Information build 34 assembly may contain misassembled or missing regions. We found that 6.5% of the human gene candidates (1,377 loci did not have a good protein-coding open reading frame, of which 296 loci are strong candidates for non-protein-coding RNA

  18. cDNA, genomic sequence cloning and overexpression of ribosomal protein S25 gene (RPS25) from the Giant Panda.

    Science.gov (United States)

    Hao, Yan-Zhe; Hou, Wan-Ru; Hou, Yi-Ling; Du, Yu-Jie; Zhang, Tian; Peng, Zheng-Song

    2009-11-01

    RPS25 is a component of the 40S small ribosomal subunit encoded by RPS25 gene, which is specific to eukaryotes. Studies in reference to RPS25 gene from animals were handful. The Giant Panda (Ailuropoda melanoleuca), known as a "living fossil", are increasingly concerned by the world community. Studies on RPS25 of the Giant Panda could provide scientific data for inquiring into the hereditary traits of the gene and formulating the protective strategy for the Giant Panda. The cDNA of the RPS25 cloned from Giant Panda is 436 bp in size, containing an open reading frame of 378 bp encoding 125 amino acids. The length of the genomic sequence is 1,992 bp, which was found to possess four exons and three introns. Alignment analysis indicated that the nucleotide sequence of the coding sequence shows a high homology to those of Homo sapiens, Bos taurus, Mus musculus and Rattus norvegicus as determined by Blast analysis, 92.6, 94.4, 89.2 and 91.5%, respectively. Primary structure analysis revealed that the molecular weight of the putative RPS25 protein is 13.7421 kDa with a theoretical pI 10.12. Topology prediction showed there is one N-glycosylation site, one cAMP and cGMP-dependent protein kinase phosphorylation site, two Protein kinase C phosphorylation sites and one Tyrosine kinase phosphorylation site in the RPS25 protein of the Giant Panda. The RPS25 gene was overexpressed in E. coli BL21 and Western Blotting of the RPS25 protein was also done. The results indicated that the RPS25 gene can be really expressed in E. coli and the RPS25 protein fusioned with the N-terminally his-tagged form gave rise to the accumulation of an expected 17.4 kDa polypeptide. The cDNA and the genomic sequence of RPS25 were cloned successfully for the first time from the Giant Panda using RT-PCR technology and Touchdown-PCR, respectively, which were both sequenced and analyzed preliminarily; then the cDNA of the RPS25 gene was overexpressed in E. coli BL21 and immunoblotted, which is the first

  19. Human placental Na+, K+-ATPase α subunit: cDNA cloning, tissue expression, DNA polymorphism, and chromosomal localization

    International Nuclear Information System (INIS)

    Chehab, F.F.; Kan, Y.W.; Law, M.L.; Hartz, J.; Kao, F.T.; Blostein, R.

    1987-01-01

    A 2.2-kilobase clone comprising a major portion of the coding sequence of the Na + , K + -ATPase α subunit was cloned from human placenta and its sequence was identical to that encoding the α subunit of human kidney and HeLa cells. Transfer blot analysis of the mRNA products of the Na + , K + -ATPase gene from various human tissues and cell lines revealed only one band (≅ 4.7 kilobases) under low and high stringency washing conditions. The levels of expression in the tissues were intestine > placenta > liver > pancreas, and in the cell lines the levels were human erythroleukemia > butyrate-induced colon > colon > brain > HeLa cells. mRNA was undetectable in reticulocytes, consistent with the authors failure to detect positive clones in a size-selected ( > 2 kilobases) λgt11 reticulocyte cDNA library. DNA analysis revealed by a polymorphic EcoRI band and chromosome localization by flow sorting and in situ hybridization showed that the α subunit is on the short is on the short arm (band p11-p13) of chromosome 1

  20. Human cDNA mapping using fluorescence in situ hybridization. Progress report, April 1--December 31, 1992

    Energy Technology Data Exchange (ETDEWEB)

    Korenberg, J.R.

    1993-12-31

    The ultimate goal of this proposal is to create a cDNA map of the human genome. Mapping is approached using the techniques of high resolution fluorescence in situ hybridization (FISH). This technology and the results of its application are designed to rapidly generate whole genome as tool box of expressed sequence to speed the identification of human disease genes. The results of this study are intended to dovetail with and to link the results of existing technologies for creating backbone YAC and genetic maps. In the first eight months, this approach will generate 60--80% of the expressed sequence map, the remainder expected to be derived through more long-term, labor-intensive, regional chromosomal gene searches or sequencing. The laboratory has made significant progress in the set-up phase, in mapping fetal and adult brain and other cDNAs, in testing a model system for directly linking genetic and physical maps using FISH with small fragments, in setting up a database, and in establishing the validity and throughput of the system.

  1. An integrated PCR colony hybridization approach to screen cDNA libraries for full-length coding sequences.

    Science.gov (United States)

    Pollier, Jacob; González-Guzmán, Miguel; Ardiles-Diaz, Wilson; Geelen, Danny; Goossens, Alain

    2011-01-01

    cDNA-Amplified Fragment Length Polymorphism (cDNA-AFLP) is a commonly used technique for genome-wide expression analysis that does not require prior sequence knowledge. Typically, quantitative expression data and sequence information are obtained for a large number of differentially expressed gene tags. However, most of the gene tags do not correspond to full-length (FL) coding sequences, which is a prerequisite for subsequent functional analysis. A medium-throughput screening strategy, based on integration of polymerase chain reaction (PCR) and colony hybridization, was developed that allows in parallel screening of a cDNA library for FL clones corresponding to incomplete cDNAs. The method was applied to screen for the FL open reading frames of a selection of 163 cDNA-AFLP tags from three different medicinal plants, leading to the identification of 109 (67%) FL clones. Furthermore, the protocol allows for the use of multiple probes in a single hybridization event, thus significantly increasing the throughput when screening for rare transcripts. The presented strategy offers an efficient method for the conversion of incomplete expressed sequence tags (ESTs), such as cDNA-AFLP tags, to FL-coding sequences.

  2. Molecular cloning of cDNA for the human tumor-associated antigen CO-029 and identification of related transmembrane antigens

    International Nuclear Information System (INIS)

    Szala, S.; Kasai, Yasushi; Steplewski, Z.; Rodeck, U.; Koprowski, H.; Linnenbach, A.J.

    1990-01-01

    The human tumor-associated antigen CO-029 is a monoclonal antibody-defined cell surface glycoprotein of 27-34 kDa. By using the high-efficiency COS cell expression system, a full-length cDNA clone for CO-029 was isolated. When transiently expressed in COS cells, the cDNA clone directed the synthesis of an antigen reactive to monoclonal antibody CO-029 in mixed hemadsorption and immunoblot assays. Sequence analysis revealed that CO-029 belongs to a family of cell surface antigens that includes the melanoma-associated antigen ME491, the leukocyte cell surface antigen CD37, and the Sm23 antigen of the parasitic helminth Schistosoma mansoni. CO-029 and ME491 antigen expression and the effect of their corresponding monoclonal antibodies on cell growth were compared in human tumor cell lines of various histologic origins

  3. Analysis of xylem formation in pine by cDNA sequencing

    Science.gov (United States)

    Allona, I.; Quinn, M.; Shoop, E.; Swope, K.; St Cyr, S.; Carlis, J.; Riedl, J.; Retzel, E.; Campbell, M. M.; Sederoff, R.; hide

    1998-01-01

    Secondary xylem (wood) formation is likely to involve some genes expressed rarely or not at all in herbaceous plants. Moreover, environmental and developmental stimuli influence secondary xylem differentiation, producing morphological and chemical changes in wood. To increase our understanding of xylem formation, and to provide material for comparative analysis of gymnosperm and angiosperm sequences, ESTs were obtained from immature xylem of loblolly pine (Pinus taeda L.). A total of 1,097 single-pass sequences were obtained from 5' ends of cDNAs made from gravistimulated tissue from bent trees. Cluster analysis detected 107 groups of similar sequences, ranging in size from 2 to 20 sequences. A total of 361 sequences fell into these groups, whereas 736 sequences were unique. About 55% of the pine EST sequences show similarity to previously described sequences in public databases. About 10% of the recognized genes encode factors involved in cell wall formation. Sequences similar to cell wall proteins, most known lignin biosynthetic enzymes, and several enzymes of carbohydrate metabolism were found. A number of putative regulatory proteins also are represented. Expression patterns of several of these genes were studied in various tissues and organs of pine. Sequencing novel genes expressed during xylem formation will provide a powerful means of identifying mechanisms controlling this important differentiation pathway.

  4. Sequencing and characterization of asclepain f: the first cysteine peptidase cDNA cloned and expressed from Asclepias fruticosa latex.

    Science.gov (United States)

    Trejo, Sebastián A; López, Laura M I; Caffini, Néstor O; Natalucci, Claudia L; Canals, Francesc; Avilés, Francesc X

    2009-07-01

    Asclepain f is a papain-like protease previously isolated and characterized from latex of Asclepias fruticosa. This enzyme is a member of the C1 family of cysteine proteases that are synthesized as preproenzymes. The enzyme belongs to the alpha + beta class of proteins, with two disulfide bridges (Cys22-Cys63 and Cys56-Cys95) in the alpha domain, and another one (Cys150-Cys201) in the beta domain, as was determined by molecular modeling. A full-length 1,152 bp cDNA was cloned by RT-RACE-PCR from latex mRNA. The sequence was predicted as an open reading frame of 340 amino acid residues, of which 16 residues belong to the signal peptide, 113 to the propeptide and 211 to the mature enzyme. The full-length cDNA was ligated to pPICZalpha vector and expressed in Pichia pastoris. Recombinant asclepain f showed endopeptidase activity on pGlu-Phe-Leu-p-nitroanilide and was identified by PMF-MALDI-TOF MS. Asclepain f is the first peptidase cloned and expressed from mRNA isolated from plant latex, confirming the presence of the preprocysteine peptidase in the latex.

  5. Cloning, sequencing and expression of a novel xylanase cDNA from ...

    African Journals Online (AJOL)

    A strain SH 2016, capable of producing xylanase, was isolated and identified as Aspergillus awamori, based on its physiological and biochemical characteristics as well as its ITS rDNA gene sequence analysis. A xylanase gene of 591 bp was cloned from this newly isolated A. awamori and the ORF sequence predicted a ...

  6. Molecular cloning and sequence of cDNA encoding the plasma membrane proton pump (H+-ATPase) of Arabidopsis thaliana

    International Nuclear Information System (INIS)

    Harper, J.F.; Surowy, T.K.; Sussman, M.R.

    1989-01-01

    In plants, the transport of solutes across the plasma membrane is driven by a proton pump (H + -ATPase) that produces an electric potential and pH gradient. The authors isolated and sequenced a full-length cDNA clone that encodes this enzyme in Arabidopsis thaliana. The protein predicted from its nucleotide sequence encodes 959 amino acids and has a molecular mass of 104,207 Da. The plant protein shows structural features common to a family of cation-translocating ATPases found in the plasma membrane of prokaryotic and eukaryotic cells, with the greatest overall identity in amino acid sequence (36%) to the H + -ATPase observed in the plasma membrane of fungi. The structure predicted from a hydropathy plant contains at least eight transmembrane segments, with most of the protein (73%) extending into the cytoplasm and only 5% of the residues exposed on the external surface. Unique features of the plant enzyme include diverged sequences at the amino and carboxyl termini as well as greater hydrophilic character in three extracellular loops

  7. Identification of human chromosome 22 transcribed sequences with ORF expressed sequence tags

    Science.gov (United States)

    de Souza, Sandro J.; Camargo, Anamaria A.; Briones, Marcelo R. S.; Costa, Fernando F.; Nagai, Maria Aparecida; Verjovski-Almeida, Sergio; Zago, Marco A.; Andrade, Luis Eduardo C.; Carrer, Helaine; El-Dorry, Hamza F. A.; Espreafico, Enilza M.; Habr-Gama, Angelita; Giannella-Neto, Daniel; Goldman, Gustavo H.; Gruber, Arthur; Hackel, Christine; Kimura, Edna T.; Maciel, Rui M. B.; Marie, Suely K. N.; Martins, Elizabeth A. L.; Nóbrega, Marina P.; Paçó-Larson, Maria Luisa; Pardini, Maria Inês M. C.; Pereira, Gonçalo G.; Pesquero, João Bosco; Rodrigues, Vanderlei; Rogatto, Silvia R.; da Silva, Ismael D. C. G.; Sogayar, Mari C.; de Fátima Sonati, Maria; Tajara, Eloiza H.; Valentini, Sandro R.; Acencio, Marcio; Alberto, Fernando L.; Amaral, Maria Elisabete J.; Aneas, Ivy; Bengtson, Mário Henrique; Carraro, Dirce M.; Carvalho, Alex F.; Carvalho, Lúcia Helena; Cerutti, Janete M.; Corrêa, Maria Lucia C.; Costa, Maria Cristina R.; Curcio, Cyntia; Gushiken, Tsieko; Ho, Paulo L.; Kimura, Elza; Leite, Luciana C. C.; Maia, Gustavo; Majumder, Paromita; Marins, Mozart; Matsukuma, Adriana; Melo, Analy S. A.; Mestriner, Carlos Alberto; Miracca, Elisabete C.; Miranda, Daniela C.; Nascimento, Ana Lucia T. O.; Nóbrega, Francisco G.; Ojopi, Élida P. B.; Pandolfi, José Rodrigo C.; Pessoa, Luciana Gilbert; Rahal, Paula; Rainho, Claudia A.; da Ro's, Nancy; de Sá, Renata G.; Sales, Magaly M.; da Silva, Neusa P.; Silva, Tereza C.; da Silva, Wilson; Simão, Daniel F.; Sousa, Josane F.; Stecconi, Daniella; Tsukumo, Fernando; Valente, Valéria; Zalcberg, Heloisa; Brentani, Ricardo R.; Reis, Luis F. L.; Dias-Neto, Emmanuel; Simpson, Andrew J. G.

    2000-01-01

    Transcribed sequences in the human genome can be identified with confidence only by alignment with sequences derived from cDNAs synthesized from naturally occurring mRNAs. We constructed a set of 250,000 cDNAs that represent partial expressed gene sequences and that are biased toward the central coding regions of the resulting transcripts. They are termed ORF expressed sequence tags (ORESTES). The 250,000 ORESTES were assembled into 81,429 contigs. Of these, 1,181 (1.45%) were found to match sequences in chromosome 22 with at least one ORESTES contig for 162 (65.6%) of the 247 known genes, for 67 (44.6%) of the 150 related genes, and for 45 of the 148 (30.4%) EST-predicted genes on this chromosome. Using a set of stringent criteria to validate our sequences, we identified a further 219 previously unannotated transcribed sequences on chromosome 22. Of these, 171 were in fact also defined by EST or full length cDNA sequences available in GenBank but not utilized in the initial annotation of the first human chromosome sequence. Thus despite representing less than 15% of all expressed human sequences in the public databases at the time of the present analysis, ORESTES sequences defined 48 transcribed sequences on chromosome 22 not defined by other sequences. All of the transcribed sequences defined by ORESTES coincided with DNA regions predicted as encoding exons by genscan. (http://genes.mit.edu/GENSCAN.html). PMID:11070084

  8. Molecular cloning of chicken metallothionein. Deduction of the complete amino acid sequence and analysis of expression using cloned cDNA

    Energy Technology Data Exchange (ETDEWEB)

    Wei, D; Andrews, G K

    1988-01-25

    A cDNA library was constructed using RNA isolated from the livers of chickens which had been treated with zinc. This library was screened with a RNA probe complementary to mouse metallothionein-I (MT), and eight chicken MT cDNA clones were obtained. All of the cDNA clones contained nucleotide sequences homologous to regions of the longest (375 bp) cDNA clone. The latter contained an open reading frame of 189 bp, and the deduced amino acid sequence indicates a protein of 63 amino acids of which 20 are cysteine residues. Amino acid composition and partial amino acid sequence analyses of purified chicken MT protein agreed with the amino acid composition and sequence deduced from the cloned cDNA. Amino acid sequence comparison establish that chicken MT shares extensive homology with mammalian MTs. Southern blot analysis of chicken DNA indicates that the chicken MT gene is not a part of a large family of related sequences, but rather is likely to be a unique gene sequence. In the chicken liver, levels of chicken MT mRNA were rapidly induced by metals (Cd/sup 2 +/, Zn/sup 2 +/, Cu/sup 2 +/), glucocorticoids and lipopolysaccharide. MT mRNA was present in low levels in embryonic liver and increased to high levels during the first week after hatching before decreasing again to the basal levels found in adult liver. The results of this study establish that MT is highly conserved between birds and mammals and is regulated in the chicken by agents which also regulate expression of mammalian MT genes. However, in contrast to the mammals, the results suggest the existence of a single isoform of MT in the chicken.

  9. Generation and Analysis of Full-length cDNA Sequences from Elephant Shark (Callorhinchus milii)

    KAUST Repository

    Kodzius, Rimantas; Tay, Boon-Hui; Tan, Yue Ying; Brenner, Sydney; Venkatesh, Byrappa

    2009-01-01

    Cartilaginous fishes are the oldest living group of jawed vertebrates and therefore is an important group for understanding the evolution of vertebrate genomes including the human genome. Our laboratory has proposed elephant shark (C. milii) as a

  10. Amino acid sequence of bovine muzzle epithelial desmocollin derived from cloned cDNA: a novel subtype of desmosomal cadherins.

    Science.gov (United States)

    Koch, P J; Goldschmidt, M D; Walsh, M J; Zimbelmann, R; Schmelz, M; Franke, W W

    1991-05-01

    Desmosomes are cell-type-specific intercellular junctions found in epithelium, myocardium and certain other tissues. They consist of assemblies of molecules involved in the adhesion of specific cell types and in the anchorage of cell-type-specific cytoskeletal elements, the intermediate-size filaments, to the plasma membrane. To explore the individual desmosomal components and their functions we have isolated DNA clones encoding the desmosomal glycoprotein, desmocollin, using antibodies and a cDNA expression library from bovine muzzle epithelium. The cDNA-deduced amino-acid sequence of desmocollin (presently we cannot decide to which of the two desmocollins, DC I or DC II, this clone relates) defines a polypeptide with a calculated molecular weight of 85,000, with a single candidate sequence of 24 amino acids sufficiently long for a transmembrane arrangement, and an extracellular aminoterminal portion of 561 amino acid residues, compared to a cytoplasmic part of only 176 amino acids. Amino acid sequence comparisons have revealed that desmocollin is highly homologous to members of the cadherin family of cell adhesion molecules, including the previously sequenced desmoglein, another desmosome-specific cadherin. Using riboprobes derived from cDNAs for Northern-blot analyses, we have identified an mRNA of approximately 6 kb in stratified epithelia such as muzzle epithelium and tongue mucosa but not in two epithelial cell culture lines containing desmosomes and desmoplakins. The difference may indicate drastic differences in mRNA concentration or the existence of cell-type-specific desmocollin subforms. The molecular topology of desmocollin(s) is discussed in relation to possible functions of the individual molecular domains.

  11. Cloning, characterization and heterologous expression of epoxide hydrolase-encoding cDNA sequences from yeasts belonging to the genera Rhodotorula and Rhodosporidium

    NARCIS (Netherlands)

    Visser, H.; Weijers, C.A.G.M.; Ooyen, van A.J.J.; Verdoes, J.C.

    2002-01-01

    Epoxide hydrolase-encoding cDNA sequences were isolated from the basidiomycetous yeast species Rhodosporidium toruloides CBS 349, Rhodosporidium toruloides CBS 14 and Rhodotorula araucariae CBS 6031 in order to evaluate the molecular data and potential application of this type of enzymes. The

  12. Cloning of human tumor necrosis factor (TNF) receptor cDNA and expression of recombinant soluble TNF-binding protein

    International Nuclear Information System (INIS)

    Gray, P.W.; Barrett, K.; Chantry, D.; Turner, M.; Feldmann, M.

    1990-01-01

    The cDNA for one of the receptors for human tumor necrosis factor (TNF) has been isolated. This cDNA encodes a protein of 455 amino acids that is divided into an extracellular domain of 171 residues and a cytoplasmic domain of 221 residues. The extracellular domain has been engineered for expression in mammalian cells, and this recombinant derivative binds TNFα with high affinity and inhibits its cytotoxic activity in vitro. The TNF receptor exhibits similarity with a family of cell surface proteins that includes the nerve growth factor receptor, the human B-cell surface antigen CD40, and the rat T-cell surface antigen OX40. The TNF receptor contains four cysteine-rich subdomains in the extracellular portion. Mammalian cells transfected with the entire TNF receptor cDNA bind radiolabeled TNFα with an affinity of 2.5 x 10 -9 M. This binding can be competitively inhibited with unlabeled TNFα or lymphotoxin (TNFβ)

  13. 5'-end sequences of budding yeast full-length cDNA clones and quality scores - Budding yeast cDNA sequencing project | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available east_seq_qual.zip File URL: ftp://ftp.biosciencedbc.jp/archive/yeast_cdna/LATEST/...yeast_seq_qual.zip File size: 59.9MB Simple search URL http://togodb.biosciencedbc.jp/togodb/view/budding_yeast_cdna

  14. An Ambystoma mexicanum EST sequencing project: analysis of 17,352 expressed sequence tags from embryonic and regenerating blastema cDNA libraries

    Science.gov (United States)

    Habermann, Bianca; Bebin, Anne-Gaelle; Herklotz, Stephan; Volkmer, Michael; Eckelt, Kay; Pehlke, Kerstin; Epperlein, Hans Henning; Schackert, Hans Konrad; Wiebe, Glenis; Tanaka, Elly M

    2004-01-01

    Background The ambystomatid salamander, Ambystoma mexicanum (axolotl), is an important model organism in evolutionary and regeneration research but relatively little sequence information has so far been available. This is a major limitation for molecular studies on caudate development, regeneration and evolution. To address this lack of sequence information we have generated an expressed sequence tag (EST) database for A. mexicanum. Results Two cDNA libraries, one made from stage 18-22 embryos and the other from day-6 regenerating tail blastemas, generated 17,352 sequences. From the sequenced ESTs, 6,377 contigs were assembled that probably represent 25% of the expressed genes in this organism. Sequence comparison revealed significant homology to entries in the NCBI non-redundant database. Further examination of this gene set revealed the presence of genes involved in important cell and developmental processes, including cell proliferation, cell differentiation and cell-cell communication. On the basis of these data, we have performed phylogenetic analysis of key cell-cycle regulators. Interestingly, while cell-cycle proteins such as the cyclin B family display expected evolutionary relationships, the cyclin-dependent kinase inhibitor 1 gene family shows an unusual evolutionary behavior among the amphibians. Conclusions Our analysis reveals the importance of a comprehensive sequence set from a representative of the Caudata and illustrates that the EST sequence database is a rich source of molecular, developmental and regeneration studies. To aid in data mining, the ESTs have been organized into an easily searchable database that is freely available online. PMID:15345051

  15. Isolation of a cDNA clone complementary to sequences for a 34-kilodalton protein which is a pp60v-src substrate.

    OpenAIRE

    Tomasiewicz, H G; Cook-Deegan, R; Chikaraishi, D M

    1984-01-01

    We have isolated a partial cDNA clone containing sequences complementary to a mRNA encoding a 34- to 36-kilodalton normal chicken cell protein which is a substrate for pp60v-src kinase activity. Using this 34-kilodalton cDNA clone as a probe, we determined that the size of the 34-kilodalton mRNA was 1,100 nucleotides and the level of the 34-kilodalton RNA was the same in various tissues of mature chickens but was significantly higher in chicken embryo fibroblast cells.

  16. Isolation and sequence of cDNA encoding a cytochrome P-450 from an insecticide-resistant strain of the house fly, Musca domestica.

    OpenAIRE

    Feyereisen, R; Koener, J F; Farnsworth, D E; Nebert, D W

    1989-01-01

    A cDNA expression library from phenobarbital-treated house fly (Musca domestica) was screened with rabbit antisera directed against partially purified house fly cytochrome P-450. Two overlapping clones with insert lengths of 1.3 and 1.5 kilobases were isolated. The sequence of a 1629-base-pair (bp) cDNA was obtained, with an open reading frame (nucleotides 81-1610) encoding a P-450 protein of 509 residues (Mr = 58,738). The insect P-450 protein contains a hydrophobic NH2 terminus and a 22-res...

  17. Gene expression of panaxydol-treated human melanoma cells using radioactive cDNA microarrays

    Energy Technology Data Exchange (ETDEWEB)

    Cho, Joong Youn; Yu, Su Jin; Soh, Jeong Won; Kim, Meyoung Kon [College of Medicine, Korea Univ., Seoul (Korea, Republic of)

    2001-07-01

    Polyacetylenic alcohols derived from Panax ginseng have been studied to be an anticancer reagent previously. One of the Panax ginseng polyacetylenic alcohols, i.e., panaxydol, has been studied to possess an antiproliferative effect on human melanoma cell line (SK-MEL-1). In ths study, radioactive cDNA microarrays enabled an efficient approach to analyze the pattern of gene expression (3.194 genes in a total) simultaneously. The bioinformatics selection of human cDNAs, which is specifically designed for immunology, apoptosis and signal transduction, were arrayed on nylon membranes. Using with {sup 33}P labeled probes, this method provided highly sensitive gene expression profiles of our interest including apoptosis, cell proliferation, cell cycle, and signal transduction. Gene expression profiles were also classified into several categories in accordance with the duration of panaxydol treatment. Consequently, the gene profiles of our interest were significantly up (199 genes, > 2.0 of Z-ratio) or down-(196 genes, < 2.0 of Z-ratio) regulated in panaxydol-treated human melanoma cells.

  18. Gene expression of panaxydol-treated human melanoma cells using radioactive cDNA microarrays

    International Nuclear Information System (INIS)

    Cho, Joong Youn; Yu, Su Jin; Soh, Jeong Won; Kim, Meyoung Kon

    2001-01-01

    Polyacetylenic alcohols derived from Panax ginseng have been studied to be an anticancer reagent previously. One of the Panax ginseng polyacetylenic alcohols, i.e., panaxydol, has been studied to possess an antiproliferative effect on human melanoma cell line (SK-MEL-1). In ths study, radioactive cDNA microarrays enabled an efficient approach to analyze the pattern of gene expression (3.194 genes in a total) simultaneously. The bioinformatics selection of human cDNAs, which is specifically designed for immunology, apoptosis and signal transduction, were arrayed on nylon membranes. Using with 33 P labeled probes, this method provided highly sensitive gene expression profiles of our interest including apoptosis, cell proliferation, cell cycle, and signal transduction. Gene expression profiles were also classified into several categories in accordance with the duration of panaxydol treatment. Consequently, the gene profiles of our interest were significantly up (199 genes, > 2.0 of Z-ratio) or down-(196 genes, < 2.0 of Z-ratio) regulated in panaxydol-treated human melanoma cells

  19. Nucleotide sequence of Phaseolus vulgaris L. alcohol dehydrogenase encoding cDNA and three-dimensional structure prediction of the deduced protein.

    Science.gov (United States)

    Amelia, Kassim; Khor, Chin Yin; Shah, Farida Habib; Bhore, Subhash J

    2015-01-01

    Common beans (Phaseolus vulgaris L.) are widely consumed as a source of proteins and natural products. However, its yield needs to be increased. In line with the agenda of Phaseomics (an international consortium), work of expressed sequence tags (ESTs) generation from bean pods was initiated. Altogether, 5972 ESTs have been isolated. Alcohol dehydrogenase (AD) encoding gene cDNA was a noticeable transcript among the generated ESTs. This AD is an important enzyme; therefore, to understand more about it this study was undertaken. The objective of this study was to elucidate P. vulgaris L. AD (PvAD) gene cDNA sequence and to predict the three-dimensional (3D) structure of deduced protein. positive and negative strands of the PvAD cDNA clone were sequenced using M13 forward and M13 reverse primers to elucidate the nucleotide sequence. Deduced PvAD cDNA and protein sequence was analyzed for their basic features using online bioinformatics tools. Sequence comparison was carried out using bl2seq program, and tree-view program was used to construct a phylogenetic tree. The secondary structures and 3D structure of PvAD protein were predicted by using the PHYRE automatic fold recognition server. The sequencing results analysis showed that PvAD cDNA is 1294 bp in length. It's open reading frame encodes for a protein that contains 371 amino acids. Deduced protein sequence analysis showed the presence of putative substrate binding, catalytic Zn binding, and NAD binding sites. Results indicate that the predicted 3D structure of PvAD protein is analogous to the experimentally determined crystal structure of s-nitrosoglutathione reductase from an Arabidopsis species. The 1294 bp long PvAD cDNA encodes for 371 amino acid long protein that contains conserved domains required for biological functions of AD. The predicted deduced PvAD protein's 3D structure reflects the analogy with the crystal structure of Arabidopsis thaliana s-nitrosoglutathione reductase. Further study is required

  20. Construction of a cDNA library and preliminary analysis of expressed sequence tags in Piper hainanense.

    Science.gov (United States)

    Fan, R; Ling, P; Hao, C Y; Li, F P; Huang, L F; Wu, B D; Wu, H S

    2015-10-19

    Black pepper is a perennial climbing vine. It is widely cultivated because its berries can be utilized not only as a spice in food but also for medicinal use. This study aimed to construct a standardized, high-quality cDNA library to facilitated identification of new Piper hainanense transcripts. For this, 262 unigenes were used to generate raw reads. The average length of these 262 unigenes was 774.8 bp. Of these, 94 genes (35.9%) were newly identified, according to the NCBI protein database. Thus, identification of new genes may broaden the molecular knowledge of P. hainanense on the basis of Clusters of Orthologous Groups and Gene Ontology categories. In addition, certain basic genes linked to physiological processes, which can contribute to disease resistance and thereby to the breeding of black pepper. A total of 26 unigenes were found to be SSR markers. Dinucleotide SSR was the main repeat motif, accounting for 61.54%, followed by trinucleotide SSR (23.07%). Eight primer pairs successfully amplified DNA fragments and detected significant amounts of polymorphism among twenty-one piper germplasm. These results present a novel sequence information of P. hainanense, which can serve as the foundation for further genetic research on this species.

  1. Ferritin from the Pacific abalone Haliotis discus hannai: Analysis of cDNA sequence, expression, and activity.

    Science.gov (United States)

    Qiu, Reng; Kan, Yunchao; Li, Dandan

    2016-02-01

    Ferritin plays an important role in iron homeostasis due to its ability to bind and sequester large amounts of iron. In this study, the gene encoding a ferritin (HdhFer2) was cloned from Pacific abalone (Haliotis discus hannai). The full-length cDNA of HdhFer2 contains a 5'-UTR of 121 bp, an ORF of 516 bp, and a 3'-UTR of 252 bp with a polyadenylation signal sequence of AATAAA and a poly(A) tail. It also contains a 31 bp iron-responsive element (IRE) in the 5'-UTR position, which is conserved in many ferritins. HdhFer2 consists of 171 amino acid residues with a predicted molecular weight (MW) ∼19.8 kDa and a theoretical isoelectric point (PI) of 4.84. The deduced amino acid sequence of HdhFer2 contains two ferritin iron-binding region signatures (IBRSs). HdhFer2 mRNA was detected in a wide range of tissues and was dominantly expressed in the gill. Infection with the bacterial pathogen Vibrio anguillarum significantly upregulated HdhFer2 expression in a time-dependent manner. Recombinant HdhFer2 (rHdhFer2) purified from Escherichia coli was able to bind ferrous iron in a concentration-dependent manner. In summary, these results suggest that HdhFer2 is a crucial protein in the iron-withholding defense system, and plays an important role in the innate immune response of abalone. Copyright © 2016 Elsevier Ltd. All rights reserved.

  2. Isolation and expression of human cytokine synthesis inhibitory factor cDNA clones: Homology to Epstein-Barr virus open reading frame BCRFI

    International Nuclear Information System (INIS)

    Vieira, P.; De Waal-Malefyt, R.; Dang, M.N.; Johnson, K.E.; Kastelein, R.; Fiorentino, D.F.; DeVries, J.E.; Roncarolo, M.G.; Mosmann, T.R.; Moore, K.W.

    1991-01-01

    The authors demonstrated the existence of human cytokine synthesis inhibitory factor (DSIF) [interleukin 10 (IL-10)]. cDNA clones encoding human IL-10 (hIL-10) were isolated from a tetanus toxin-specific human T-cell clone. Like mouse IL-10, hIL-10 exhibits strong DNA and amino acid sequence homology to an open reading frame in the Epstein-Barr virus, BDRFL. hIL-10 and the BCRFI product inhibit cytokine synthesis by activated human peripheral blood mononuclear cells and by a mouse Th1 clone. Both hIL-10 and mouse IL-10 sustain the viability of a mouse mast cell line in culture, but BCRFI lacks comparable activity in this way, suggesting that BCRFI may have conserved only a subset of hIL-10 activities

  3. Isolation and expression of human cytokine synthesis inhibitory factor cDNA clones: Homology to Epstein-Barr virus open reading frame BCRFI

    Energy Technology Data Exchange (ETDEWEB)

    Vieira, P.; De Waal-Malefyt, R.; Dang, M.N.; Johnson, K.E.; Kastelein, R.; Fiorentino, D.F.; DeVries, J.E.; Roncarolo, M.G.; Mosmann, T.R.; Moore, K.W. (DNAX Research Inst. of Molecular and Cellular Biology, Palo Alto, CA (United States))

    1991-02-15

    The authors demonstrated the existence of human cytokine synthesis inhibitory factor (DSIF) (interleukin 10 (IL-10)). cDNA clones encoding human IL-10 (hIL-10) were isolated from a tetanus toxin-specific human T-cell clone. Like mouse IL-10, hIL-10 exhibits strong DNA and amino acid sequence homology to an open reading frame in the Epstein-Barr virus, BDRFL. hIL-10 and the BCRFI product inhibit cytokine synthesis by activated human peripheral blood mononuclear cells and by a mouse Th1 clone. Both hIL-10 and mouse IL-10 sustain the viability of a mouse mast cell line in culture, but BCRFI lacks comparable activity in this way, suggesting that BCRFI may have conserved only a subset of hIL-10 activities.

  4. Construction of a cDNA library from human retinal pigment epithelial cells challenged with rod outer segments.

    Science.gov (United States)

    Cavaney, D M; Rakoczy, P E; Constable, I J

    1995-05-01

    To study genes expressed by retinal pigment epithelial (RPE) cells during phagocytosis and digestion of rod outer segments (ROS), a complementary (c)DNA library was produced using an in-vitro model. The cDNA library can be used to study molecular changes which contribute to the development of diseases due to a failure in outer segment phagocytosis and digestion by RPE cells. Here we demonstrate a way to study genes and their functions using a molecular biological approach and describing the first step involved in this process, the construction of a cDNA library. Human RPE cells obtained from the eyes of a seven-year-old donor were cultured and challenged with bovine ROS. The culture was harvested and total RNA was extracted. Complementary DNA was transcribed from the messenger (m)RNA and was directionally cloned into the LambdaGEM-4 bacteriophage vector successfully. Some clones were picked and the DNA extracted, to determine the size of the inserts as a measure of the quality of the library. Molecular biology and cell culture are important tools to be used in eye research, especially in areas where tissue is limiting and animal models are not available. We now have a ROS challenged RPE cDNA library which will be used to identify genes responsible for degrading phagocytosed debris within the retinal pigment epithelium.

  5. Norrie disease: linkage analysis using a 4.2-kb RFLP detected by a human ornithine aminotransferase cDNA probe.

    Science.gov (United States)

    Ngo, J T; Bateman, J B; Cortessis, V; Sparkes, R S; Mohandas, T; Inana, G; Spence, M A

    1989-05-01

    Previous study has shown that the usual DNA marker for Norrie disease, the L1.28 probe which identifies the DXS7 locus, can recombine with the disease locus. In this study, we used a human ornithine aminotransferase (OAT) cDNA which detects OAT-related DNA sequences mapped to the same region on the X chromosome as that of the L1.28 probe to investigate the family with Norrie disease who exhibited the recombinational event. When genomic DNA from this family was digested with the PvuII restriction endonuclease, we found a restriction fragment length polymorphism (RFLP) of 4.2 kb in size. This fragment was absent in the affected males and cosegregated with the disease locus; we calculated a lod score of 0.602, at theta = 0.00. No deletion could be detected by chromosomal analysis or on Southern blots with other enzymes. These results suggest that one of the OAT-related sequences on the X chromosome may be in close proximity to the Norrie disease locus and represent the first report which indicates that the OAT cDNA may be useful for the identification of carrier status and/or prenatal diagnosis.

  6. Generation and analysis of large-scale expressed sequence tags (ESTs from a full-length enriched cDNA library of porcine backfat tissue

    Directory of Open Access Journals (Sweden)

    Lee Hae-Young

    2006-02-01

    Full Text Available Abstract Background Genome research in farm animals will expand our basic knowledge of the genetic control of complex traits, and the results will be applied in the livestock industry to improve meat quality and productivity, as well as to reduce the incidence of disease. A combination of quantitative trait locus mapping and microarray analysis is a useful approach to reduce the overall effort needed to identify genes associated with quantitative traits of interest. Results We constructed a full-length enriched cDNA library from porcine backfat tissue. The estimated average size of the cDNA inserts was 1.7 kb, and the cDNA fullness ratio was 70%. In total, we deposited 16,110 high-quality sequences in the dbEST division of GenBank (accession numbers: DT319652-DT335761. For all the expressed sequence tags (ESTs, approximately 10.9 Mb of porcine sequence were generated with an average length of 674 bp per EST (range: 200–952 bp. Clustering and assembly of these ESTs resulted in a total of 5,008 unique sequences with 1,776 contigs (35.46% and 3,232 singleton (65.54% ESTs. From a total of 5,008 unique sequences, 3,154 (62.98% were similar to other sequences, and 1,854 (37.02% were identified as having no hit or low identity (Sus scrofa. Gene ontology (GO annotation of unique sequences showed that approximately 31.7, 32.3, and 30.8% were assigned molecular function, biological process, and cellular component GO terms, respectively. A total of 1,854 putative novel transcripts resulted after comparison and filtering with the TIGR SsGI; these included a large percentage of singletons (80.64% and a small proportion of contigs (13.36%. Conclusion The sequence data generated in this study will provide valuable information for studying expression profiles using EST-based microarrays and assist in the condensation of current pig TCs into clusters representing longer stretches of cDNA sequences. The isolation of genes expressed in backfat tissue is the

  7. Isolation, nucleotide sequence and expression of a cDNA encoding feline granulocyte colony-stimulating factor.

    Science.gov (United States)

    Dunham, S P; Onions, D E

    2001-06-21

    A cDNA encoding feline granulocyte colony stimulating factor (fG-CSF) was cloned from alveolar macrophages using the reverse transcriptase-polymerase chain reaction. The cDNA is 949 bp in length and encodes a predicted mature protein of 174 amino acids. Recombinant fG-CSF was expressed as a glutathione S-transferase fusion and purified by affinity chromatography. Biological activity of the recombinant protein was demonstrated using the murine myeloblastic cell line GNFS-60, which showed an ED50 for fG-CSF of approximately 2 ng/ml. Copyright 2001 Academic Press.

  8. Frameshift mutations in infectious cDNA clones of Citrus tristeza virus: a strategy to minimize the toxicity of viral sequences to Escherichia coli

    International Nuclear Information System (INIS)

    Satyanarayana, Tatineni; Gowda, Siddarame; Ayllon, Maria A.; Dawson, William O.

    2003-01-01

    The advent of reverse genetics revolutionized the study of positive-stranded RNA viruses that were amenable for cloning as cDNAs into high-copy-number plasmids of Escherichia coli. However, some viruses are inherently refractory to cloning in high-copy-number plasmids due to toxicity of viral sequences to E. coli. We report a strategy that is a compromise between infectivity of the RNA transcripts and toxicity to E. coli effected by introducing frameshift mutations into 'slippery sequences' near the viral 'toxicity sequences' in the viral cDNA. Citrus tristeza virus (CTV) has cDNA sequences that are toxic to E. coli. The original full-length infectious cDNA of CTV and a derivative replicon, CTV-ΔCla, cloned into pUC119, resulted in unusually limited E. coli growth. However, upon sequencing of these cDNAs, an additional uridinylate (U) was found in a stretch of U's between nts 3726 and 3731 that resulted in a change to a reading frame with a stop codon at nt 3734. Yet, in vitro produced RNA transcripts from these clones infected protoplasts, and the resulting progeny virus was repaired. Correction of the frameshift mutation in the CTV cDNA constructs resulted in increased infectivity of in vitro produced RNA transcripts, but also caused a substantial increase of toxicity to E. coli, now requiring 3 days to develop visible colonies. Frameshift mutations created in sequences not suspected to facilitate reading frame shifting and silent mutations introduced into oligo(U) regions resulted in complete loss of infectivity, suggesting that the oligo(U) region facilitated the repair of the frameshift mutation. Additional frameshift mutations introduced into other oligo(U) regions also resulted in transcripts with reduced infectivity similarly to the original clones with the +1 insertion. However, only the frameshift mutations introduced into oligo(U) regions that were near and before the toxicity region improved growth and stability in E. coli. These data demonstrate that

  9. Sequence of interleukin-2 isolated from human placental poly A+ RNA: possible role in maintenance of fetal allograft.

    Science.gov (United States)

    Chernicky, C L; Tan, H; Burfeind, P; Ilan, J; Ilan, J

    1996-02-01

    There are several cell types within the placenta that produce cytokines which can contribute to the regulatory mechanisms that ensure normal pregnancy. The immunological milieu at the maternofetal interface is considered to be crucial for survival of the fetus. Interleukin-2 (IL-2) is expressed by the syncytiotrophoblast, the cell layer between the mother and the fetus. IL-2 appears to be a key factor in maintenance of pregnancy. Therefore, it was important to determine the sequence of human placental interleukin-2. Direct sequencing of human placental IL-2 cDNA was determined for the coding region. Subclone sequencing was carried out for the 5'- and 3'-untranslated regions (5'-UTR and 3'-UTR). The 5'-UTR for human placental IL-2 cDNA is 294 bp, which is 247 nucleotides longer than that reported for cDNA IL-2 derived from T cells. The sequence of the coding region is identical to that reported for T cell IL-2, while sequence analysis of the polymerase chain reaction (PCR) product showed that the cDNA from the 3' end was the same as that reported for cDNA from T cells. Human placental IL-2 cDNA is 1,028 base pairs (excluding the poly A tail), which is 247 bp longer at the 5' end than that reported for IL-2 T cell cDNA. Therefore, the extended 5'-UTR of the placental IL-2 cDNA may be a consequence of alternative promoter utilization in the placenta.

  10. Mass spectrometry-based cDNA profiling as a potential tool for human body fluid identification.

    Science.gov (United States)

    Donfack, Joseph; Wiley, Anissa

    2015-05-01

    Several mRNA markers have been exhaustively evaluated for the identification of human venous blood, saliva, and semen in forensic genetics. As new candidate human body fluid specific markers are discovered, evaluated, and reported in the scientific literature, there is an increasing trend toward determining the ideal markers for cDNA profiling of body fluids of forensic interest. However, it has not been determined which molecular genetics-based technique(s) should be utilized to assess the performance of these markers. In recent years, only a few confirmatory, mRNA/cDNA-based methods have been evaluated for applications in body fluid identification. The most frequently described methods tested to date include quantitative polymerase chain reaction (qPCR) and capillary electrophoresis (CE). However these methods, in particular qPCR, often favor narrow multiplex PCR due to the availability of a limited number of fluorescent dyes/tags. In an attempt to address this technological constraint, this study explored matrix-assisted laser desorption/ionization-time of flight mass spectrometry (MALDI-TOF MS) for human body fluid identification via cDNA profiling of venous blood, saliva, and semen. Using cDNA samples at 20pg input phosphoglycerate kinase 1 (PGK1) amounts, body fluid specific markers for the candidate genes were amplified in their corresponding body fluid (i.e., venous blood, saliva, or semen) and absent in the remaining two (100% specificity). The results of this study provide an initial indication that MALDI-TOF MS is a potential fluorescent dye-free alternative method for body fluid identification in forensic casework. However, the inherent issues of low amounts of mRNA, and the damage caused to mRNA by environmental exposures, extraction processes, and storage conditions are important factors that significantly hinder the implementation of cDNA profiling into forensic casework. Published by Elsevier Ireland Ltd.

  11. Amplification of a transcriptionally active DNA sequence in the human brain

    International Nuclear Information System (INIS)

    Yakovlev, A.G.; Sazonov, A.E.; Spunde, A.Ya.; Gindilis, V.M.

    1986-01-01

    The authors present their findings of tissue-specific amplification of a DNA fragment actively transcribed in the human brain. This genome fragment was found in the library complement of cDNA of the human brain and evidently belongs to a new class of moderate repetitions of DNA with an unstable copying capacity in the human genome. The authors isolated total cell RNA from various human tissues (brain, placenta), and rat tissues (brain, liver), by the method of hot phenol extraction with guanidine thiocynate. The poly(A + ) RNA fraction was isolated by chromatography. Synthesis of cDNA was done on a matrix of poly(A + ) RNA of human brain. The cDNA obtained was cloned in plasmid pBR322 for the PstI site using (dC/dG) sequences synthesized on the 3' ends of the vector molecule and cDNA respectively. In cloning 75 ng cDNA, the authors obtained approximately 10 5 recombinant. This library was analyzed by the hybridization method on columns with two radioactive ( 32 P) probes: the total cDNA preparation and the total nuclear DNA from the human brain. The number of copies of the cloned DNA fragment in the genome was determined by dot hybridization. Restricting fragments of human and rat DNA genomes homologous to the cloned cDNA were identified on radio-autographs. In each case, 10 micrograms of EcoRI DNA hydrolyzate was fractionated in 1% agarose gel. The probe was also readied with RNA samples fractionated in agarose gel with formaldehyde and transferred to a nitrocellulose filter under weak vacuum. The filter was hybridized with 0.1 micrograms DNA pAG 02, labeled with ( 32 P) to a specific activity of 0.5-1 x 10 9 counts/min x microgram. The autograph was exposed with amplifying screens at -70 0 C for 2 days

  12. Nucleotide sequence of a cDNA coding for the barley seed protein CMa: an inhibitor of insect α-amylase

    DEFF Research Database (Denmark)

    Rasmussen, Søren Kjærsgård; Johansson, A.

    1992-01-01

    The primary structure of the insect alpha-amylase inhibitor CMa of barley seeds was deduced from a full-length cDNA clone pc43F6. Analysis of RNA from barley endosperm shows high levels 15 and 20 days after flowering. The cDNA predicts an amino acid sequence of 119 residues preceded by a signal...... peptide of 25 amino acids. Ala and Leu account for 55% of the signal peptide. CMa is 60-85% identical with alpha-amylase inhibitors of wheat, but shows less than 50% identity to trypsin inhibitors of barley and wheat. The 10 Cys residues are located in identical positions compared to the cereal inhibitor...

  13. Cloning of Human Tumor Necrosis Factor (TNF) Receptor cDNA and Expression of Recombinant Soluble TNF-Binding Protein

    Science.gov (United States)

    Gray, Patrick W.; Barrett, Kathy; Chantry, David; Turner, Martin; Feldmann, Marc

    1990-10-01

    The cDNA for one of the receptors for human tumor necrosis factor (TNF) has been isolated. This cDNA encodes a protein of 455 amino acids that is divided into an extracellular domain of 171 residues and a cytoplasmic domain of 221 residues. The extracellular domain has been engineered for expression in mammalian cells, and this recombinant derivative binds TNFα with high affinity and inhibits its cytotoxic activity in vitro. The TNF receptor exhibits similarity with a family of cell surface proteins that includes the nerve growth factor receptor, the human B-cell surface antigen CD40, and the rat T-cell surface antigen OX40. The TNF receptor contains four cysteine-rich subdomains in the extra-cellular portion. Mammalian cells transfected with the entire TNF receptor cDNA bind radiolabeled TNFα with an affinity of 2.5 x 10-9 M. This binding can be competitively inhibited with unlabeled TNFα or lymphotoxin (TNFβ).

  14. A large scale analysis of cDNA in Arabidopsis thaliana: generation of 12,028 non-redundant expressed sequence tags from normalized and size-selected cDNA libraries.

    Science.gov (United States)

    Asamizu, E; Nakamura, Y; Sato, S; Tabata, S

    2000-06-30

    For comprehensive analysis of genes expressed in the model dicotyledonous plant, Arabidopsis thaliana, expressed sequence tags (ESTs) were accumulated. Normalized and size-selected cDNA libraries were constructed from aboveground organs, flower buds, roots, green siliques and liquid-cultured seedlings, respectively, and a total of 14,026 5'-end ESTs and 39,207 3'-end ESTs were obtained. The 3'-end ESTs could be clustered into 12,028 non-redundant groups. Similarity search of the non-redundant ESTs against the public non-redundant protein database indicated that 4816 groups show similarity to genes of known function, 1864 to hypothetical genes, and the remaining 5348 are novel sequences. Gene coverage by the non-redundant ESTs was analyzed using the annotated genomic sequences of approximately 10 Mb on chromosomes 3 and 5. A total of 923 regions were hit by at least one EST, among which only 499 regions were hit by the ESTs deposited in the public database. The result indicates that the EST source generated in this project complements the EST data in the public database and facilitates new gene discovery.

  15. Isolation of CYP3A5P cDNA from human liver: a reflection of a novel cytochrome P-450 pseudogene.

    Science.gov (United States)

    Schuetz, J D; Guzelian, P S

    1995-03-14

    We have isolated, from a human liver cDNA library, a 1627 bp CYP3A5 cDNA variant (CYP3A5P) that contains several large insertions, deletions, and in-frame termination codons. By comparison with the genomic structure of other CYP3A genes, the major insertions in CYP3A5P cDNA demarcate the inferred sites of several CYP3A5 exons. The segments inserted in CYP3A5P have no homology with splice donor acceptor sites. It is unlikely that CYP3A5P cDNA represents an artifact of the cloning procedures since Southern blot analysis of human genomic DNA disclosed that CYP3A5P cDNA hybridized with a DNA fragment distinct from fragments that hybridized with either CYP3A5, CYP3A3 or CYP3A4. Moreover, analysis of adult human liver RNA on Northern blots hybridized with a CYP3A5P cDNA fragment revealed the presence of an mRNA with the predicted size of CYP3A5P. We conclude that CYP3A5P cDNA was derived from a separate gene, CYP3A5P, most likely a pseudogene evolved from CYP3A5.

  16. Recovery of human metapneumovirus from cDNA: optimization of growth in vitro and expression of additional genes

    International Nuclear Information System (INIS)

    Biacchesi, Stephane; Skiadopoulos, Mario H.; Tran, Kim C.; Murphy, Brian R.; Collins, Peter L.; Buchholz, Ursula J.

    2004-01-01

    Human metapneumovirus (HMPV) is a recently recognized causative agent of respiratory tract disease in individuals of all ages and especially young infants. HMPV remains poorly characterized and has been reported to replicate inefficiently in vitro. Complete consensus sequences were recently determined for two isolates representing the two proposed HMPV genetic subgroups (Biacchesi et al., Virology 315 (1) (2003) 1). We have developed a reverse genetic system to produce one of these isolates, CAN97-83, entirely from cDNA. We also recovered a version, rHMPV-GFP, in which the enhanced green fluorescent protein (GFP) was expressed from a transcription cassette inserted as the first gene, leaving the 41-nt leader region and first 16 nt of the N gene undisturbed. The ability to monitor GFP expression in living cells greatly facilitated the initial recovery of this slow-growing virus. In addition, the ability to express a foreign gene from an engineered transcription cassette confirmed the identification of the HMPV transcription signals and identified the F gene-end signal as being highly efficient for transcription termination. The ability to recover virus containing a foreign insert in this position indicated that the viral promoter is contained within the 3'-terminal 57 nt of the genome. Recombinant HMPV replicated in vitro as efficiently as biologically derived HMPV, whereas the kinetics and final yield of rHMPV-GFP were reduced several-fold. Conditions for trypsin treatment were investigated, providing for improved virus yields. Another version of HMPV, rHMPV+G1F23, was recovered that contained a second copy of the G gene and two extra copies of F in promoter-proximal positions in the order G1-F2-F3. Thus, this recombinant genome would encode 11 mRNAs rather than eight and would be 17.3 kb long, 30% longer than that of the natural virus. Nonetheless, the rHMPV+G1F23 virus replicated in vitro with an efficiency that was only modestly reduced compared to rHMPV and was

  17. Full-length cDNA sequence cloning and analysis of Ghrelin in Cervus nippon%梅花鹿Ghrelin全长cDNA克隆及其序列分析

    Institute of Scientific and Technical Information of China (English)

    张曼; 金鑫; 田巧珍; 刘骄; 王云鹤; 杨银凤

    2017-01-01

    为获得梅花鹿Ghrelin eDNA全序列,以梅花鹿皱胃黏膜上皮组织提取的总RNA为模板,通过RT-PCR和RACE法克隆了梅花鹿皱胃中Ghrelin基因eDNA的全序列.结果表明梅花鹿Ghrelin eDNA序列全长为539 bp,其中5’非翻译区(5'UTR)为46 bp,3'UTR为128 bp,开放阅读框(ORF)为351 bp,该ORF编码116个氨基酸残基.将梅花鹿Ghrelin基因的eDNA与人和其他动物的Ghrelin相比,发现:梅花鹿Ghrelin与驯鹿、山羊、绵羊和牛的同源性达90.4%~99.1%;与恒河猴、人、猪、犬的同源性达76.6%~66.9%;与鸡和野鸽的同源性分别为36.4%和35.4%.研究表明Ghrelin的结构具有明显的种属特异性,因此Ghrelin在反刍动物体内可能有着重要的生理功能.%In order to obtain the full-length cDNA of Ghrelin in Cervus nippon,RT-PCR and RACE methods were used by using total RNA of abomasus tissue in C.nippon as template.The results of sequence analysis revealed a 539 bp length cDNA containing 46 bp 5'-untranslated region (5'UTR),128 bp 3'-untranslated region (3'UTR) and 351 bp open reading frame (ORF) encoding 116 amino acids.The cDNA sequence alignments of C.nippon Ghrelin gene with human and other animals showed that the cDNA sequence homology of C.nippon Ghrelin was 90.4%-99.1% to reindeer,goat,sheep and cattle,66.9%-76.6% with rhesus monkey,human,pig and dog,only 36.4% with chicken and C.livia.These results indicated that the structure of Ghrelin displayed an obvious varietal specificity,suggesting that Ghrelin might play an important physiological function role in ruminants.

  18. Human placental Na/sup +/, K/sup +/-ATPase. cap alpha. subunit: cDNA cloning, tissue expression, DNA polymorphism, and chromosomal localization

    Energy Technology Data Exchange (ETDEWEB)

    Chehab, F.F.; Kan, Y.W.; Law, M.L.; Hartz, J.; Kao, F.T.; Blostein, R.

    1987-11-01

    A 2.2-kilobase clone comprising a major portion of the coding sequence of the Na/sup +/, K/sup +/-ATPase ..cap alpha.. subunit was cloned from human placenta and its sequence was identical to that encoding the ..cap alpha.. subunit of human kidney and HeLa cells. Transfer blot analysis of the mRNA products of the Na/sup +/, K/sup +/-ATPase gene from various human tissues and cell lines revealed only one band (approx. = 4.7 kilobases) under low and high stringency washing conditions. The levels of expression in the tissues were intestine > placenta > liver > pancreas, and in the cell lines the levels were human erythroleukemia > butyrate-induced colon > colon > brain > HeLa cells. mRNA was undetectable in reticulocytes, consistent with the authors failure to detect positive clones in a size-selected ( > 2 kilobases) lambdagt11 reticulocyte cDNA library. DNA analysis revealed by a polymorphic EcoRI band and chromosome localization by flow sorting and in situ hybridization showed that the ..cap alpha.. subunit is on the short is on the short arm (band p11-p13) of chromosome 1.

  19. Identification of "pathologs" (disease-related genes from the RIKEN mouse cDNA dataset using human curation plus FACTS, a new biological information extraction system

    Directory of Open Access Journals (Sweden)

    Socha Luis A

    2004-04-01

    Full Text Available Abstract Background A major goal in the post-genomic era is to identify and characterise disease susceptibility genes and to apply this knowledge to disease prevention and treatment. Rodents and humans have remarkably similar genomes and share closely related biochemical, physiological and pathological pathways. In this work we utilised the latest information on the mouse transcriptome as revealed by the RIKEN FANTOM2 project to identify novel human disease-related candidate genes. We define a new term "patholog" to mean a homolog of a human disease-related gene encoding a product (transcript, anti-sense or protein potentially relevant to disease. Rather than just focus on Mendelian inheritance, we applied the analysis to all potential pathologs regardless of their inheritance pattern. Results Bioinformatic analysis and human curation of 60,770 RIKEN full-length mouse cDNA clones produced 2,578 sequences that showed similarity (70–85% identity to known human-disease genes. Using a newly developed biological information extraction and annotation tool (FACTS in parallel with human expert analysis of 17,051 MEDLINE scientific abstracts we identified 182 novel potential pathologs. Of these, 36 were identified by computational tools only, 49 by human expert analysis only and 97 by both methods. These pathologs were related to neoplastic (53%, hereditary (24%, immunological (5%, cardio-vascular (4%, or other (14%, disorders. Conclusions Large scale genome projects continue to produce a vast amount of data with potential application to the study of human disease. For this potential to be realised we need intelligent strategies for data categorisation and the ability to link sequence data with relevant literature. This paper demonstrates the power of combining human expert annotation with FACTS, a newly developed bioinformatics tool, to identify novel pathologs from within large-scale mouse transcript datasets.

  20. Construction of a Full-Length Enriched cDNA Library and Preliminary Analysis of Expressed Sequence Tags from Bengal Tiger Panthera tigris tigris

    Science.gov (United States)

    Liu, Changqing; Liu, Dan; Guo, Yu; Lu, Taofeng; Li, Xiangchen; Zhang, Minghai; Ma, Jianzhang; Ma, Yuehui; Guan, Weijun

    2013-01-01

    In this study, a full-length enriched cDNA library was successfully constructed from Bengal tiger, Panthera tigris tigris, the most well-known wild Animal. Total RNA was extracted from cultured Bengal tiger fibroblasts in vitro. The titers of primary and amplified libraries were 1.28 × 106 pfu/mL and 1.56 × 109 pfu/mL respectively. The percentage of recombinants from unamplified library was 90.2% and average length of exogenous inserts was 0.98 kb. A total of 212 individual ESTs with sizes ranging from 356 to 1108 bps were then analyzed. The BLASTX score revealed that 48.1% of the sequences were classified as a strong match, 45.3% as nominal and 6.6% as a weak match. Among the ESTs with known putative function, 26.4% ESTs were found to be related to all kinds of metabolisms, 19.3% ESTs to information storage and processing, 11.3% ESTs to posttranslational modification, protein turnover, chaperones, 11.3% ESTs to transport, 9.9% ESTs to signal transducer/cell communication, 9.0% ESTs to structure protein, 3.8% ESTs to cell cycle, and only 6.6% ESTs classified as novel genes. By EST sequencing, a full-length gene coding ferritin was identified and characterized. The recombinant plasmid pET32a-TAT-Ferritin was constructed, coded for the TAT-Ferritin fusion protein with two 6× His-tags in N and C-terminal. After BCA assay, the concentration of soluble Trx-TAT-Ferritin recombinant protein was 2.32 ± 0.12 mg/mL. These results demonstrated that the reliability and representativeness of the cDNA library attained to the requirements of a standard cDNA library. This library provided a useful platform for the functional genome and transcriptome research of Bengal tigers. PMID:23708105

  1. Construction of a Full-Length Enriched cDNA Library and Preliminary Analysis of Expressed Sequence Tags from Bengal Tiger Panthera tigris tigris

    Directory of Open Access Journals (Sweden)

    Changqing Liu

    2013-05-01

    Full Text Available In this study, a full-length enriched cDNA library was successfully constructed from Bengal tiger, Panthera tigris tigris, the most well-known wild Animal. Total RNA was extracted from cultured Bengal tiger fibroblasts in vitro. The titers of primary and amplified libraries were 1.28 × 106 pfu/mL and 1.56 × 109 pfu/mL respectively. The percentage of recombinants from unamplified library was 90.2% and average length of exogenous inserts was 0.98 kb. A total of 212 individual ESTs with sizes ranging from 356 to 1108 bps were then analyzed. The BLASTX score revealed that 48.1% of the sequences were classified as a strong match, 45.3% as nominal and 6.6% as a weak match. Among the ESTs with known putative function, 26.4% ESTs were found to be related to all kinds of metabolisms, 19.3% ESTs to information storage and processing, 11.3% ESTs to posttranslational modification, protein turnover, chaperones, 11.3% ESTs to transport, 9.9% ESTs to signal transducer/cell communication, 9.0% ESTs to structure protein, 3.8% ESTs to cell cycle, and only 6.6% ESTs classified as novel genes. By EST sequencing, a full-length gene coding ferritin was identified and characterized. The recombinant plasmid pET32a-TAT-Ferritin was constructed, coded for the TAT-Ferritin fusion protein with two 6× His-tags in N and C-terminal. After BCA assay, the concentration of soluble Trx-TAT-Ferritin recombinant protein was 2.32 ± 0.12 mg/mL. These results demonstrated that the reliability and representativeness of the cDNA library attained to the requirements of a standard cDNA library. This library provided a useful platform for the functional genome and transcriptome research of Bengal tigers.

  2. Genomic sequence and organization of two members of a human lectin gene family

    International Nuclear Information System (INIS)

    Gitt, M.A.; Barondes, S.H.

    1991-01-01

    The authors have isolated and sequenced the genomic DNA encoding a human dimeric soluble lactose-binding lectin. The gene has four exons, and its upstream region contains sequences that suggest control by glucocorticoids, heat (environmental) shock, metals, and other factors. They have also isolated and sequenced three exons of the gene encoding another human putative lectin, the existence of which was first indicated by isolation of its cDNA. Comparisons suggest a general pattern of genomic organization of members of this lectin gene family

  3. Transcription profiling of the model cyanobacterium Synechococcus sp. strain PCC 7002 by NextGen (SOLiD™ Sequencing of cDNA

    Directory of Open Access Journals (Sweden)

    Marcus eLudwig

    2011-03-01

    Full Text Available The genome of the unicellular, euryhaline cyanobacterium Synechococcus sp. PCC 7002 encodes about 3200 proteins. Transcripts were detected for nearly all annotated open reading frames by a global transcriptomic analysis by Next-Generation (SOLiDTM sequencing of cDNA. In the cDNA samples sequenced, ~90% of the mapped sequences were derived from the 16S and 23S ribosomal RNAs and ~10% of the sequences were derived from mRNAs. In cells grown photoautotrophically under standard conditions (38 °C, 1% (v/v CO2 in air, 250 µmol photons m-2 s-1, the highest transcript levels (up to 2% of the total mRNA for the most abundantly transcribed genes (e. g., cpcAB, psbA, psaA were generally derived from genes encoding structural components of the photosynthetic apparatus. High light exposure for one hour caused changes in transcript levels for genes encoding proteins of the photosynthetic apparatus, Type-1 NADH dehydrogenase complex and ATP synthase, whereas dark incubation for one hour resulted in a global decrease in transcript levels for photosynthesis-related genes and an increase in transcript levels for genes involved in carbohydrate degradation. Transcript levels for pyruvate kinase and the pyruvate dehydrogenase complex decreased sharply in cells incubated in the dark. Under dark anoxic (fermentative conditions, transcript changes indicated a global decrease in transcripts for respiratory proteins and suggested that cells employ an alternative phosphoenolpyruvate degradation pathway via phosphoenolpyruvate synthase (ppsA and the pyruvate:ferredoxin oxidoreductase (nifJ. Finally, the data suggested that an apparent operon involved in tetrapyrrole biosynthesis and fatty acid desaturation, acsF2-ho2-hemN2-desF, may be regulated by oxygen concentration.

  4. Recovery of avian metapneumovirus subgroup C from cDNA: cross-recognition of avian and human metapneumovirus support proteins.

    Science.gov (United States)

    Govindarajan, Dhanasekaran; Buchholz, Ursula J; Samal, Siba K

    2006-06-01

    Avian metapneumovirus (AMPV) causes an acute respiratory disease in turkeys and is associated with "swollen head syndrome" in chickens, contributing to significant economic losses for the U.S. poultry industry. With a long-term goal of developing a better vaccine for controlling AMPV in the United States, we established a reverse genetics system to produce infectious AMPV of subgroup C entirely from cDNA. A cDNA clone encoding the entire 14,150-nucleotide genome of AMPV subgroup C strain Colorado (AMPV/CO) was generated by assembling five cDNA fragments between the T7 RNA polymerase promoter and the autocatalytic hepatitis delta virus ribozyme of a transcription plasmid, pBR 322. Transfection of this plasmid, along with the expression plasmids encoding the N, P, M2-1, and L proteins of AMPV/CO, into cells stably expressing T7 RNA polymerase resulted in the recovery of infectious AMPV/CO. Characterization of the recombinant AMPV/CO showed that its growth properties in tissue culture were similar to those of the parental virus. The potential of AMPV/CO to serve as a viral vector was also assessed by generating another recombinant virus, rAMPV/CO-GFP, that expressed the enhanced green fluorescent protein (GFP) as a foreign protein. Interestingly, GFP-expressing AMPV and GFP-expressing human metapneumovirus (HMPV) could be recovered using the support plasmids of either virus, denoting that the genome promoters are conserved between the two metapneumoviruses and can be cross-recognized by the polymerase complex proteins of either virus. These results indicate a close functional relationship between AMPV/CO and HMPV.

  5. Isolation and characterization of cDNA encoding the 80-kDa subunit protein of the human autoantigen Ku (p70/p80) recognized by autoantibodies from patients with scleroderma-polymyositis overlap syndrome

    International Nuclear Information System (INIS)

    Mimori, Tsuneyo; Ohosone, Yasuo; Hama, Nobuaki; Suwa, Akira; Akizuki, Masashi; Homma, Mitsuo; Griffith, A.J.; Hardin, J.A.

    1990-01-01

    Anti-Ku (p70/p80) autoantibodies in patients with scleroderma-polymyositis overlap syndrome recognize a 70-kDa/80-kDa protein heterodimer which binds to terminal regions of double-stranded DNA. In the present study, the authors isolated full-length cDNAs that encode the 80-kDa Ku subunit. Initial screening of a human spleen cDNA library with anti-Ku antibodies yielded a cDNA of 1.0 kilobase (kb) (termed K71) encoding a portion of the 80-kDa Ku polypeptide (identification based on immunological criteria). In RNA blots, this cDNA hybridized with two mRNAs of 3.4 and 2.6 kb. In vitro transcription and translation experiments produced an immunoprecipitable polypeptide which comigrated with the 80-kDa Ku subunit. The Ku80-6 cDNA proved to be 3304 nucleotides in length, with an additional poly(A) tail, closely approximating the size of the larger mRNA. It contains a single long open reading frame encoding 732 amino acids. The putative polypeptide has a high content of acidic amino acids and a region with periodic repeat of leucine in every seventh position which may form the leucine zipper structure. In genomic DNA blots, probes derived from the opposite ends of cDNA Ku80-6 hybridized with several nonoverlapping restriction fragments from human leukocyte DNA, indicating that the gene encoding the 80-kDa Ku polypeptide is divided into several exons by intervening sequences

  6. Assessment of adaptive evolution between wheat and rice as deduced from full-length common wheat cDNA sequence data and expression patterns

    Directory of Open Access Journals (Sweden)

    Hayashizaki Yoshihide

    2009-06-01

    Full Text Available Abstract Background Wheat is an allopolyploid plant that harbors a huge, complex genome. Therefore, accumulation of expressed sequence tags (ESTs for wheat is becoming particularly important for functional genomics and molecular breeding. We prepared a comprehensive collection of ESTs from the various tissues that develop during the wheat life cycle and from tissues subjected to stress. We also examined their expression profiles in silico. As full-length cDNAs are indispensable to certify the collected ESTs and annotate the genes in the wheat genome, we performed a systematic survey and sequencing of the full-length cDNA clones. This sequence information is a valuable genetic resource for functional genomics and will enable carrying out comparative genomics in cereals. Results As part of the functional genomics and development of genomic wheat resources, we have generated a collection of full-length cDNAs from common wheat. By grouping the ESTs of recombinant clones randomly selected from the full-length cDNA library, we were able to sequence 6,162 independent clones with high accuracy. About 10% of the clones were wheat-unique genes, without any counterparts within the DNA database. Wheat clones that showed high homology to those of rice were selected in order to investigate their expression patterns in various tissues throughout the wheat life cycle and in response to abiotic-stress treatments. To assess the variability of genes that have evolved differently in wheat and rice, we calculated the substitution rate (Ka/Ks of the counterparts in wheat and rice. Genes that were preferentially expressed in certain tissues or treatments had higher Ka/Ks values than those in other tissues and treatments, which suggests that the genes with the higher variability expressed in these tissues is under adaptive selection. Conclusion We have generated a high-quality full-length cDNA resource for common wheat, which is essential for continuation of the

  7. Fiscal 2000 report on result of the full-length cDNA structure analysis; 2000 nendo kanzen cho cDNA kozo kaiseki seika hokokusho

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2001-03-01

    This paper explains the results of research on full-length cDNA structure analysis for the period from April, 2000 to March, 2001. The outline of human genome sequence was published in June, 2000. In Japan, human gene analysis was such that, as the basic technology of the bio industry, a millennium project was decided in the budget of fiscal 2000. The full-length cDNA structure analysis is the core of the project. The libraries of cDNA were prepared using full-length and more than 4-5kbp-long cDNAs by oligo-capping method. It began from determining partial sequence data at end cDNA, and then, with new clones selected therefrom, full-length human cDNA sequence data were determined. The partial sequence data determined by fiscal 2000 were 1,035,000 clones while the full-length sequence data were 12,144 clones. The sequence data obtained were analyzed by homology search and translated into amino acid coding sequences, with predictions conducted on protein functions. A clustering method was examined that selects new clones from partial sequences. Database was constructed on gene expression profiles and disease-related gene sequence data. (NEDO)

  8. cDNA cloning and sequence determination of the pheromone biosynthesis activating neuropeptide from the seabuckthorn carpenterworm, Holcocerus hippophaecolus (Lepidoptera: Cossidae).

    Science.gov (United States)

    Li, Juan; Zhou, Jiao; Sun, Rongbo; Zhang, Haolin; Zong, Shixiang; Luo, Youqing; Sheng, Xia; Weng, Qiang

    2013-04-01

    The PBAN (pheromone biosynthesis activating neuropeptide)/pyrokinin peptides comprise a major neuropeptide family characterized by a common FXPRL amide at the C-terminus. These peptides are actively involved in many essential endocrine functions. For the first time, we reported the cDNA cloning and sequence determination of the PBAN from the seabuckthorn carpenterworm, Holcocerus hippophaecolus, by using rapid amplification of cDNA ends. The full-length cDNA of Hh-DH-PBAN contained five peptides: diapause hormone (DH) homolog, α-neuropeptide (NP), β-NP, PBAN, and γ-NP. All of the peptides were amidated at their C-terminus and shared a conserved motif, FXPR (or K) L. Moreover, Hh-DH-PBAN had high homology to the other members of the PBAN peptide family: 56% with Manduca sexta, 66% with Bombyx mori, 77% with Helicoverpa zea, and 47% with Plutella xylostella. Phylogenetic analysis revealed that Hh-DH-PBAN was closely related to PBANs from Noctuidae, demonstrated by the relatively higher similarity compared with H. zea. In addition, real-time quantitative PCR (qRT-PCR) analysis showed that Hh-DH-PBAN mRNA expression peaked in the brain-subesophageal ganglion (Br-SOG) complex, and was also detected at high levels during larval and adult stages. The expression decreased significantly after pupation. These results provided information concerning molecular structure characteristics of Hh-DH-PBAN, whose expression profile suggested that the Hh-DH-PBAN gene might be correlated with larval development and sex pheromone biosynthesis in females of the H. hippophaecolus. 2013 Wiley Periodicals, Inc

  9. Cloning of the cDNA for a human homologue of the Drosophila white gene and mapping to chromosome 21q22.3.

    OpenAIRE

    Chen, H.; Rossier, C.; Lalioti, M. D.; Lynn, A.; Chakravarti, A.; Perrin, G.; Antonarakis, S. E.

    1996-01-01

    In an effort to contribute to the transcript map of human chromosome 21 and the understanding of the pathophysiology of trisomy 21, we have used exon trapping to identify fragments of chromosome 21 genes. Two trapped exons, from pools of chromosome 21-specific cosmids, showed homology to the Drosophila white (w) gene. We subsequently cloned the corresponding cDNA for a human homologue of the Drosophila w gene (hW) from human retina and fetal brain cDNA libraries. The gene belongs to the ATP-b...

  10. cDNA microarray analysis of human keratinocytes cells of patients submitted to chemoradiotherapy and oral photobiomodulation therapy: pilot study.

    Science.gov (United States)

    Antunes, Heliton S; Wajnberg, Gabriel; Pinho, Marcos B; Jorge, Natasha Andressa Nogueira; de Moraes, Joyce Luana Melo; Stefanoff, Claudio Gustavo; Herchenhorn, Daniel; Araújo, Carlos M M; Viégas, Celia Maria Pais; Rampini, Mariana P; Dias, Fernando L; de Araujo-Souza, Patricia Savio; Passetti, Fabio; Ferreira, Carlos G

    2018-01-01

    Oral mucositis is an acute toxicity that occurs in patients submitted to chemoradiotherapy to treat head and neck squamous cell carcinoma. In this study, we evaluated differences in gene expression in the keratinocytes of the oral mucosa of patients treated with photobiomodulation therapy and tried to associate the molecular mechanisms with clinical findings. From June 2009 to December 2010, 27 patients were included in a randomized double-blind pilot study. Buccal smears from 13 patients were obtained at days 1 and 10 of chemoradiotherapy, and overall gene expression of samples from both dates were analyzed by complementary DNA (cDNA) microarray. In addition, samples from other 14 patients were also collected at D1 and D10 of chemoradiotherapy for subsequent validation of cDNA microarray findings by qPCR. The expression array analysis identified 105 upregulated and 60 downregulated genes in our post-treatment samples when compared with controls. Among the upregulated genes with the highest fold change, it was interesting to observe the presence of genes related to keratinocyte differentiation. Among downregulated genes were observed genes related to cytotoxicity and immune response. The results indicate that genes known to be induced during differentiation of human epidermal keratinocytes were upregulated while genes associated with cytotoxicity and immune response were downregulated in the laser group. These results support previous clinical findings indicating that the lower incidence of oral mucositis associated with photobiomodulation therapy might be correlated to the activation of genes involved in keratinocyte differentiation.

  11. Preparation of Proper Immunogen by Cloning and Stable Expression of cDNA coding for Human Hematopoietic Stem Cell Marker CD34 in NIH-3T3 Mouse Fibroblast Cell Line

    Science.gov (United States)

    Shafaghat, Farzaneh; Abbasi-Kenarsari, Hajar; Majidi, Jafar; Movassaghpour, Ali Akbar; Shanehbandi, Dariush; Kazemi, Tohid

    2015-01-01

    Purpose: Transmembrane CD34 glycoprotein is the most important marker for identification, isolation and enumeration of hematopoietic stem cells (HSCs). We aimed in this study to clone the cDNA coding for human CD34 from KG1a cell line and stably express in mouse fibroblast cell line NIH-3T3. Such artificial cell line could be useful as proper immunogen for production of mouse monoclonal antibodies. Methods: CD34 cDNA was cloned from KG1a cell line after total RNA extraction and cDNA synthesis. Pfu DNA polymerase-amplified specific band was ligated to pGEMT-easy TA-cloning vector and sub-cloned in pCMV6-Neo expression vector. After transfection of NIH-3T3 cells using 3 μg of recombinant construct and 6 μl of JetPEI transfection reagent, stable expression was obtained by selection of cells by G418 antibiotic and confirmed by surface flow cytometry. Results: 1158 bp specific band was aligned completely to reference sequence in NCBI database corresponding to long isoform of human CD34. Transient and stable expression of human CD34 on transfected NIH-3T3 mouse fibroblast cells was achieved (25% and 95%, respectively) as shown by flow cytometry. Conclusion: Cloning and stable expression of human CD34 cDNA was successfully performed and validated by standard flow cytometric analysis. Due to murine origin of NIH-3T3 cell line, CD34-expressing NIH-3T3 cells could be useful as immunogen in production of diagnostic monoclonal antibodies against human CD34. This approach could bypass the need for purification of recombinant proteins produced in eukaryotic expression systems. PMID:25789221

  12. Gene discovery from Jatropha curcas by sequencing of ESTs from normalized and full-length enriched cDNA library from developing seeds

    Directory of Open Access Journals (Sweden)

    Sugantham Priyanka Annabel

    2010-10-01

    Full Text Available Abstract Background Jatropha curcas L. is promoted as an important non-edible biodiesel crop worldwide. Jatropha oil, which is a triacylglycerol, can be directly blended with petro-diesel or transesterified with methanol and used as biodiesel. Genetic improvement in jatropha is needed to increase the seed yield, oil content, drought and pest resistance, and to modify oil composition so that it becomes a technically and economically preferred source for biodiesel production. However, genetic improvement efforts in jatropha could not take advantage of genetic engineering methods due to lack of cloned genes from this species. To overcome this hurdle, the current gene discovery project was initiated with an objective of isolating as many functional genes as possible from J. curcas by large scale sequencing of expressed sequence tags (ESTs. Results A normalized and full-length enriched cDNA library was constructed from developing seeds of J. curcas. The cDNA library contained about 1 × 106 clones and average insert size of the clones was 2.1 kb. Totally 12,084 ESTs were sequenced to average high quality read length of 576 bp. Contig analysis revealed 2258 contigs and 4751 singletons. Contig size ranged from 2-23 and there were 7333 ESTs in the contigs. This resulted in 7009 unigenes which were annotated by BLASTX. It showed 3982 unigenes with significant similarity to known genes and 2836 unigenes with significant similarity to genes of unknown, hypothetical and putative proteins. The remaining 191 unigenes which did not show similarity with any genes in the public database may encode for unique genes. Functional classification revealed unigenes related to broad range of cellular, molecular and biological functions. Among the 7009 unigenes, 6233 unigenes were identified to be potential full-length genes. Conclusions The high quality normalized cDNA library was constructed from developing seeds of J. curcas for the first time and 7009 unigenes coding

  13. Human α2-HS-glycoprotein: the A and B chains with a connecting sequence are encoded by a single mRNA transcript

    International Nuclear Information System (INIS)

    Lee, C.C.; Bowman, B.H.; Yang, F.

    1987-01-01

    The α 2 -HS-glycoprotein (AHSG) is a plasma protein reported to play roles in bone mineralization and in the immune response. It is composed of two subunits, the A and B chains. Recombinant plasmids containing human cDNA AHSG have been isolated by screening an adult human liver library with a mixed oligonucleotide probe. The cDNA clones containing AHSG inserts span approximately 1.5 kilobase pairs and include the entire AHSG coding sequence, demonstrating that the A and B chains are encoded by a single mRNA transcript. The cDNA sequence predicts an 18-amino-acid signal peptide, followed by the A-chain sequence of AHSG. A heretofore unseen connecting sequence of 40 amino acids was deduced between the A- and B-chain sequences. The connecting sequence demonstrates the unique amino acid doublets and collagen triplets found in the A and B chains; it is not homologous with other reported amino acid sequences. The connecting sequence may be cleaved in a posttranslational step by limited proteolysis before mature AHSG is released into the circulation or may vary in its presence because of alternative processing. The AHSG cDNA was utilized for mapping the AHSG gene to the 3q21→qter region of human chromosome 3. The availability of the AHSG cDNA clone will facilitate the analysis of its genetic control and gene expression during development and bone formation

  14. Nucleotide sequences of cDNAs for human papillomavirus type 18 transcripts in HeLa cells

    International Nuclear Information System (INIS)

    Inagaki, Yutaka; Tsunokawa, Youko; Takebe, Naoko; Terada, Masaaki; Sugimura, Takashi; Nawa, Hiroyuki; Nakanishi, Shigetada

    1988-01-01

    HeLa cells expressed 3.4- and 1.6-kilobase (kb) transcripts of the integrated human papillomavirus (HPV) type 18 genome. Two types of cDNA clones representing each size of HPV type 18 transcript were isolated. Sequence analysis of these two types of cDNA clones revealed that the 3.4-kb transcript contained E6, E7, the 5' portion of E1, and human sequence and that the 1.6-kb transcript contained spliced and frameshifted E6 (E6 * ), E7, and human sequence. There was a common human sequence containing a poly(A) addition signal in the 3' end portions of both transcripts, indicating that they were transcribed from the HPV genome at the same integration site with different splicing. Furthermore, the 1.6-kb transcript contained both of the two viral TATA boxes upstream of E6, strongly indicating that a cellular promoter was used for its transcription

  15. Opsin cDNA sequences of a UV and green rhodopsin of the satyrine butterfly Bicyclus anynana.

    NARCIS (Netherlands)

    Vanhoutte, K.J.A.; Eggen, B.J.L.; Janssen, J.J.M.; Stavenga, D.G.

    2002-01-01

    The cDNAs of an ultraviolet (UV) and long-wavelength (LW) (green) absorbing rhodopsin of the bush brown Bicyclus anynana were partially identified. The UV sequence, encoding 377 amino acids, is 76-79% identical to the UV sequences of the papilionids Papilio glaucus and Papilio xuthus and the moth

  16. Opsin cDNA sequences of a UV and green rhodopsin of the satyrine butterfly Bicyclus anynana

    NARCIS (Netherlands)

    Vanhoutte, Kürt; Eggen, BJL; Janssen, JJM; Stavenga, DG

    The cDNAs of an ultraviolet (UV) and long-wavelength (LW) (green) absorbing rhodopsin of the bush brown Bicyclus anynana were partially identified. The UV sequence, encoding 377 amino acids, is 76-79% identical to the UV sequences of the papilionids Papilio glaucus and Papilio xuthus and the moth

  17. The Construction of cDNA Libraries from Human Single Preimplantation Embryos and Their Use in the Study of Gene Expression During Development

    OpenAIRE

    Adjaye, James; Daniels, Rob; Monk, Marilyn

    1998-01-01

    Purpose:The construction and application of polymerase chain reaction (PCR)-based cDNA libraries from unfertilized human oocytes and single preimplantation-stage embryos are described. The purpose of these studies is to provide a readily available resource for the study of gene expression during human preimplantation development.

  18. Normalized cDNA libraries

    Science.gov (United States)

    Soares, Marcelo B.; Efstratiadis, Argiris

    1997-01-01

    This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3' noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library.

  19. Complementation of the UV-sensitive phenotype of a xeroderma pigmentosum human cell line by transfection with a cDNA clone library

    International Nuclear Information System (INIS)

    Teitz, T.; Naiman, T.; Avissar, S.S.; Bar, S.; Okayama, H.; Canaani, D.

    1987-01-01

    In previous work, a xeroderma pigmentosum cell line belonging to complementation group C was established by transformation with origin-defective simian virus 40. We now report the complementation of the UV sensitivity of this cell line by gene transfer. A human cDNA clone library constructed in a mammalian expression vector, and itself incorporated in a lambda phage vector, was introduced into the cells as a calcium phosphate precipitate. Following selection to G418 resistance, provided by the neo gene of the vector, transformants were selected for UV resistance. Twenty-one cell clones were obtained with UV-resistance levels typical of normal human fibroblasts. All transformants contained vector DNA sequences in their nuclei. Upon further propagation in the absence of selection for G418 resistance, about half of the primary transformants remained UV-resistant. Secondary transformants were generated by transfection with a partial digest of total chromosomal DNA from one of these stable transformants. This resulted in 15 G418-resistant clones, 2 of which exhibited a UV-resistant phenotype. The other primary clones lost UV resistance rapidly when subcultured in the absence of G418. Importantly, several retained UV resistance under G418 selection pressure. The acquisition of UV resistance by secondary transformants derived by transfection of DNA from a stable primary transformant, and the linkage between G418 and UV resistances in the unstable primary transformants, strongly suggests that the transformants acquired UV resistance through DNA-mediated gene transfer and not by reversion

  20. Identification and characterization of a novel Cut family cDNA that encodes human copper transporter protein CutC

    International Nuclear Information System (INIS)

    Li Jixi; Ji Chaoneng; Chen Jinzhong; Yang Zhenxing; Wang Yijing; Fei, Xiangwei; Zheng Mei; Gu Xing; Wen Ge; Xie Yi; Mao Yumin

    2005-01-01

    Copper is an essential heavy metal trace element that plays important roles in cell physiology. The Cut family was associated with the copper homeostasis and involved in several important metabolisms, such as uptake, storage, delivery, and efflux of copper. In this study, a novel Cut family cDNA was isolated from the human fetal brain library, which encodes a 273 amino acid protein with a molecular mass of about 29.3 kDa and a calculated pI of 8.17. It was named hCutC (human copper transporter protein CutC). The ORF of hCutC gene was cloned into pQE30 vector and expressed in Escherichia coli M15. The secreted hCutC protein was purified to a homogenicity of 95% by using the Ni-NTA affinity chromatography. RT-PCR analysis showed that the hCutC gene expressed extensively in human tissues. Subcellular location analysis of hCutC-EGFP fusion protein revealed that hCutC was distributed to cytoplasm of COS-7 cells, and both cytoplasm and nucleus of AD293 cells. The results suggest that hCutC may be one shuttle protein and play important roles in intracellular copper trafficking

  1. PCR amplification and sequences of cDNA clones for the small and large subunits of ADP-glucose pyrophosphorylase from barley tissues.

    Science.gov (United States)

    Villand, P; Aalen, R; Olsen, O A; Lüthi, E; Lönneborg, A; Kleczkowski, L A

    1992-06-01

    Several cDNAs encoding the small and large subunit of ADP-glucose pyrophosphorylase (AGP) were isolated from total RNA of the starchy endosperm, roots and leaves of barley by polymerase chain reaction (PCR). Sets of degenerate oligonucleotide primers, based on previously published conserved amino acid sequences of plant AGP, were used for synthesis and amplification of the cDNAs. For either the endosperm, roots and leaves, the restriction analysis of PCR products (ca. 550 nucleotides each) has revealed heterogeneity, suggesting presence of three transcripts for AGP in the endosperm and roots, and up to two AGP transcripts in the leaf tissue. Based on the derived amino acid sequences, two clones from the endosperm, beps and bepl, were identified as coding for the small and large subunit of AGP, respectively, while a leaf transcript (blpl) encoded the putative large subunit of AGP. There was about 50% identity between the endosperm clones, and both of them were about 60% identical to the leaf cDNA. Northern blot analysis has indicated that beps and bepl are expressed in both the endosperm and roots, while blpl is detectable only in leaves. Application of the PCR technique in studies on gene structure and gene expression of plant AGP is discussed.

  2. cDNA, genomic sequence cloning, and overexpression of EIF1 from the giant panda (Ailuropoda Melanoleuca) and the black bear (Ursus Thibetanus Mupinensis).

    Science.gov (United States)

    Hou, Wan-ru; Tang, Yun; Hou, Yi-ling; Song, Yan; Zhang, Tian; Wu, Guang-fu

    2010-07-01

    Eukaryotic initiation factor (eIF) EIF1 is a universally conserved translation factor that is involved in translation initiation site selection. The cDNA and the genomic sequences of EIF1 were cloned successfully from the giant panda (Ailuropoda melanoleuca) and the black bear (Ursus thibetanus mupinensis) using reverse transcription polymerase chain reaction (RT-PCR) technology and touchdown-polymerase chain reaction, respectively. The cDNAs of the EIF1 cloned from the giant panda and the black bear are 418 bp in size, containing an open reading frame (ORF) of 342 bp encoding 113 amino acids. The length of the genomic sequence of the giant panda is 1909 bp, which contains four exons and three introns. The length of the genomic sequence of the black bear is 1897 bp, which also contains four exons and three introns. Sequence alignment indicates a high degree of homology to those of Homo sapiens, Mus musculus, Rattus norvegicus, and Bos Taurus at both amino acid and DNA levels. Topology prediction shows there are one N-glycosylation site, two Casein kinase II phosphorylation sites, and a Amidation site in the EIF1 protein of the giant panda and black bear. In addition, there is a protein kinase C phosphorylation site in EIF1 of the giant panda. The giant panda and the black bear EIF1 genes were overexpressed in E. coli BL21. The results indicated that the both EIF1 fusion proteins with the N-terminally His-tagged form gave rise to the accumulation of two expected 19 kDa polypeptide. The expression products obtained could be used to purify the proteins and study their function further.

  3. cDNA sequence and tissue distribution of the mRNA for bovine and murine p11, the S100-related light chain of the protein-tyrosine kinase substrate p36 (calpactin I)

    DEFF Research Database (Denmark)

    Saris, Chris J M; Kristensen, Torsten; D’Eustachio, Peter

    1987-01-01

    We have isolated and sequenced cDNA clones of bovine nd murine pl 1 mRNAs. The nonpolyadenylated mRNAs are predicted to be 614 and 600 nucleotides, respectively. The p l l mRNAs both contain a 291 nucleotide open reading frame, preceded by a 5”untranslated region of 73 nucleotides in bovine p l l m...

  4. Hybrid Sequencing of Full-Length cDNA Transcripts of Stems and Leaves in Dendrobium officinale

    Directory of Open Access Journals (Sweden)

    Liu He

    2017-10-01

    Full Text Available Dendrobium officinale is an extremely valuable orchid used in traditional Chinese medicine, so sought after that it has a higher market value than gold. Although the expression profiles of some genes involved in the polysaccharide synthesis have previously been investigated, little research has been carried out on their alternatively spliced isoforms in D. officinale. In addition, information regarding the translocation of sugars from leaves to stems in D. officinale also remains limited. We analyzed the polysaccharide content of D. officinale leaves and stems, and completed in-depth transcriptome sequencing of these two diverse tissue types using second-generation sequencing (SGS and single-molecule real-time (SMRT sequencing technology. The results of this study yielded a digital inventory of gene and mRNA isoform expressions. A comparative analysis of both transcriptomes uncovered a total of 1414 differentially expressed genes, including 844 that were up-regulated and 570 that were down-regulated in stems. Of these genes, one sugars will eventually be exported transporter (SWEET and one sucrose transporter (SUT are expressed to a greater extent in D. officinale stems than in leaves. Two glycosyltransferase (GT and four cellulose synthase (Ces genes undergo a distinct degree of alternative splicing. In the stems, the content of polysaccharides is twice as much as that in the leaves. The differentially expressed GT and transcription factor (TF genes will be the focus of further study. The genes DoSWEET4 and DoSUT1 are significantly expressed in the stem, and are likely to be involved in sugar loading in the phloem.

  5. Cloning and sequence of cDNA encoding 1-aminocyclo- propane-1-carboxylate oxidase in Vanda flowers

    Directory of Open Access Journals (Sweden)

    Pattana Srifah Huehne

    2013-08-01

    Full Text Available The 1-aminocyclopropane-1-carboxylate oxidase (ACO gene in the final step of ethylene biosynthesis was isolated from ethylene-sensitive Vanda Miss Joaquim flowers. This consists of 1,242 base pairs (bp encoding for 326 amino acid residues. To investigate the specific divergence in orchid ACO sequences, the deduced Vanda ACO was aligned with five other orchid ACOs. The results reveal that the ACO sequences within Doritaenopsis, Phalaenopsis and Vanda show highly conserved and almost 95% identical homology, while the ACOs isolated from Cymbidium, Dendrobium and Cattleya are 8788% identical to Vanda ACO. In addition, the 2-oxoglutarate- Fe(II_oxygenase (Oxy domain of orchid ACOs consists of a higher degree of amino acid conservation than that of the non-haem dioxygenase (DIOX_N domain. The overall homology regions of Vanda ACO are commonly folded into 12 α-helices and 12 β-sheets similar to the three dimensional template-structure of Petunia ACO. This Vanda ACO cloned gene is highly expressed in flower tissue compared with root and leaf tissues. In particular, there is an abundance of ACO transcript accumulation in the column followed by the lip and the perianth of Vanda Miss Joaquim flowers at the fully-open stage.

  6. Nucleotide sequence preservation of human mitochondrial DNA

    International Nuclear Information System (INIS)

    Monnat, R.J. Jr.; Loeb, L.A.

    1985-01-01

    Recombinant DNA techniques have been used to quantitate the amount of nucleotide sequence divergence in the mitochondrial DNA population of individual normal humans. Mitochondrial DNA was isolated from the peripheral blood lymphocytes of five normal humans and cloned in M13 mp11; 49 kilobases of nucleotide sequence information was obtained from 248 independently isolated clones from the five normal donors. Both between- and within-individual differences were identified. Between-individual differences were identified in approximately = to 1/200 nucleotides. In contrast, only one within-individual difference was identified in 49 kilobases of nucleotide sequence information. This high degree of mitochondrial nucleotide sequence homogeneity in human somatic cells is in marked contrast to the rapid evolutionary divergence of human mitochondrial DNA and suggests the existence of mechanisms for the concerted preservation of mammalian mitochondrial DNA sequences in single organisms

  7. Cloning of a cDNA encoding chitotriosidase, a human chitinase produced by macrophages

    NARCIS (Netherlands)

    Boot, R. G.; Renkema, G. H.; Strijland, A.; van Zonneveld, A. J.; Aerts, J. M.

    1995-01-01

    We have recently observed that chitotriosidase, a chitinolytic enzyme, is secreted by activated human macrophages and is markedly elevated in plasma of Gaucher disease patients (Hollak, C. E. M., van Weely, S., van Oers, M. H. J., and Aerts, J. M. F. G. (1994) J. Clin. Invest. 93, 1288-1292). Here,

  8. Human cDNA mapping using fluorescence in situ hybridization. Final progress report, April 1, 1994--July 31, 1997

    Energy Technology Data Exchange (ETDEWEB)

    Korenberg, J.R.

    1997-12-31

    The ultimate goal of this research is to generate and apply novel technologies to speed completion and integration of the human genome map and sequence with biomedical problems. To do this, techniques were developed and genome-wide resources generated. This includes a genome-wide Mapped and Integrated BAC/PAC Resource that has been used for gene finding, map completion and anchoring, breakpoint definition and sequencing. In the last period of the grant, the Human Mapped BAC/PAC Resource was also applied to determine regions of human variation and to develop a novel paradigm of primate evolution through to humans. Further, in order to more rapidly evaluate animal models of human disease, a BAC Map of the mouse was generated in collaboration with the MTI Genome Center, Dr. Bruce Birren.

  9. Whitefly (Bemisia tabaci genome project: analysis of sequenced clones from egg, instar, and adult (viruliferous and non-viruliferous cDNA libraries

    Directory of Open Access Journals (Sweden)

    Czosnek Henryk

    2006-04-01

    Full Text Available Abstract Background The past three decades have witnessed a dramatic increase in interest in the whitefly Bemisia tabaci, owing to its nature as a taxonomically cryptic species, the damage it causes to a large number of herbaceous plants because of its specialized feeding in the phloem, and to its ability to serve as a vector of plant viruses. Among the most important plant viruses to be transmitted by B. tabaci are those in the genus Begomovirus (family, Geminiviridae. Surprisingly, little is known about the genome of this whitefly. The haploid genome size for male B. tabaci has been estimated to be approximately one billion bp by flow cytometry analysis, about five times the size of the fruitfly Drosophila melanogaster. The genes involved in whitefly development, in host range plasticity, and in begomovirus vector specificity and competency, are unknown. Results To address this general shortage of genomic sequence information, we have constructed three cDNA libraries from non-viruliferous whiteflies (eggs, immature instars, and adults and two from adult insects that fed on tomato plants infected by two geminiviruses: Tomato yellow leaf curl virus (TYLCV and Tomato mottle virus (ToMoV. In total, the sequence of 18,976 clones was determined. After quality control, and removal of 5,542 clones of mitochondrial origin 9,110 sequences remained which included 3,843 singletons and 1,017 contigs. Comparisons with public databases indicated that the libraries contained genes involved in cellular and developmental processes. In addition, approximately 1,000 bases aligned with the genome of the B. tabaci endosymbiotic bacterium Candidatus Portiera aleyrodidarum, originating primarily from the egg and instar libraries. Apart from the mitochondrial sequences, the longest and most abundant sequence encodes vitellogenin, which originated from whitefly adult libraries, indicating that much of the gene expression in this insect is directed toward the production

  10. Comparative analysis of protein coding sequences from human, mouse and the domesticated pig

    DEFF Research Database (Denmark)

    Jørgensen, Frank Grønlund; Hobolth, Asger; Hornshøj, Henrik

    2005-01-01

    Background: The availability of abundant sequence data from key model organisms has made large scale studies of mulecular evolution an exciting possibility. Here we use full length cDNA alignments comprising more than 700,000 nucleotides from human, mouse, pig and the Japanese pufferfish Fugu rub...... rubrices in order to investigate 1) the relationships between three major lineages of mammals: rodents, artiodactys and primates, and 2) the rate of evolution and the occurrence of positive Darwinian selection using codon based models of sequence evolution. Results: We provide evidence...

  11. Isolation and sequence of complementary DNA encoding human extracellular superoxide dismutase

    International Nuclear Information System (INIS)

    Hjalmarsson, K.; Marklund, S.L.; Engstroem, A.; Edlund, T.

    1987-01-01

    A complementary DNA (cDNA) clone from a human placenta cDNA library encoding extracellular superoxide dismutase has been isolated and the nucleotide sequence determined. The cDNA has a very high G + C content. EC-SOD is synthesized with a putative 18-amino acid signal peptide, preceding the 222 amino acids in the mature enzyme, indicating that the enzyme is a secretory protein. The first 95 amino acids of the mature enzyme show no sequence homology with other sequenced proteins and there is one possible N-glycosylation site (Asn-89). The amino acid sequence from residues 96-193 shows strong homology (∼ 50%) with the final two-thirds of the sequences of all know eukaryotic CuZn SODs, whereas the homology with the P. leiognathi CuZn SOD is clearly lower. The ligands to Cu and Zn, the cysteines forming the intrasubunit disulfide bridge in the CuZn SODs, and the arginine found in all CuZn SODs in the entrance to the active site can all be identified in EC-SOD. A comparison with bovine CuZn SOD, the three-dimensional structure of which is known, reveals that the homologies occur in the active site and the divergencies are in the part constituting the subunit contact area in CuZn SOD. Amino acid sequence 194-222 in the carboxyl-terminal end of EC-SOD is strongly hydrophilic and contains nine amino acids with a positive charge. This sequence probably confers the affinity of EC-SOD for heparin and heparan sulfate. An analysis of the amino acid sequence homologies with CuZn SODs from various species indicates that the EC-SODs may have evolved form the CuZn SODs before the evolution of fungi and plants

  12. Cloning of cDNA encoding steroid 11β-hydroxylase (P450c11)

    International Nuclear Information System (INIS)

    Chua, S.C.; Szabo, P.; Vitek, A.; Grzeschik, K.H.; John, M.; White, P.C.

    1987-01-01

    The authors have isolated bovine and human adrenal cDNA clones encoding the adrenal cytochrome P-450 specific for 11β-hydroxylation (P450c11). A bovine adrenal cDNA library constructed in the bacteriophage λ vector gt10 was probed with a previously isolated cDNA clone corresponding to part of the 3' untranslated region of the 4.2-kilobase (kb) mRNA encoding P450c11. Several clones with 3.2-kb cDNA inserts were isolated. Sequence analysis showed that they overlapped the original probe by 300 base pairs (bp). Combined cDNA and RNA sequence data demonstrated a continuous open reading frame of 1509 bases. P450c11 is predicted to contain 479 amino acid residues in the mature protein in addition to a 24-residue amino-terminal mitochondrial signal sequence. A bovine clone was used to isolate a homologous clone with a 3.5-kb insert from a human adrenal cDNA library. A region of 1100 bp was 81% homologous to 769 bp of the coding sequence of the bovine cDNA except for a 400-bp segment presumed to be an unprocessed intron. Hybridization of the human cDNA to DNA from a panel of human-rodent somatic cell hybrid lines and in situ hybridization to metaphase spreads of human chromosomes localized the gene to the middle of the long arm of chromosome 8. These data should be useful in developing reagents for heterozygote detection and prenatal diagnosis of 11β-hydroxylase deficiency, the second most frequent cause of congenital adrenal hyperplasia

  13. Retrovirus-mediated gene transfer of a human c-fos cDNA into mouse bone marrow stromal cells.

    Science.gov (United States)

    Roux, P; Verrier, B; Klein, B; Niccolino, M; Marty, L; Alexandre, C; Piechaczyk, M

    1991-11-01

    A cDNA encoding a complete human c-fos protein was isolated and inserted into two different murine MoMuLV-derived recombinant retroviruses allowing expression of c-fos protein in different cell types. One c-fos-expressing retrovirus, chosen for its ability to express high levels of proteins in fibroblast-like cells, was shown to potentiate long-term cultures of mouse bone marrow stromal cells in vitro and therefore constitutes a potential tool for immortalizing such cells. Moreover, when tested in an in vitro differentiation assay, stromal cells constitutively expressing c-fos favor the granulocyte differentiation of hematopoietic precursors. Interestingly, retroviruses expressing v-src and v-abl oncogenes, included as controls in our experiments, do not produce any detectable effects, whereas those expressing polyoma virus middle T antigen facilitate long-term growth in vitro of stromal cells that favor the macrophage differentiation pathway of bone marrow stem cells. Our observation supports the idea that constitutive expression of some oncogenes, including c-fos and polyoma virus middle T antigen, may influence cytokine production by bone marrow stromal cells.

  14. High-level expression of human insulin receptor cDNA in mouse NIH 3T3 cells

    International Nuclear Information System (INIS)

    Whittaker, J.; Okamoto, A.K.; Thys, R.; Bell, G.I.; Steiner, D.F.; Hofmann, C.A.

    1987-01-01

    In order to develop a simple, efficient system for the high-level expression of human insulin receptors in eukaryotic cells, a full-length human kidney insulin receptor cDNA was inserted into a bovine papilloma virus vector under the control of the mouse metallothionein promoter. After transfection of mouse NIH 3T3 cells with this construct, seven cell lines expressing insulin receptors were isolated; two cell lines had more than 10 6 receptors per cell. The cell line with the highest 125 I-insulin binding (NIH 3T3 HIR3.5) had 6 x 10 6 receptors with a K/sub d/ of 10 -9 M. This level was not dependent on exposure to metals but could be increased further to 2 x 10 7 receptors per cell by addition of sodium butyrate to the culture medium. The α and β subunits had apparent molecular weights of 147,000 and 105,000, respectively (compared to 135,000 and 95,000 in IM-9 human lymphocytes), values identical to those of the α and β subunits of the insulin receptors of nontransformed NIH 3T3 cells. This size difference was due to altered carbohydrate composition, as N-glycanase digestion reduced the apparent receptor subunit size of the transfected cells and IM-9 lymphocytes to identical values. The alteration in N-linked oligosaccharide composition could not be ascribed to differences in the kinetics of posttranslational processing of the insulin receptors, which was comparable to that of other cells studied. The basal rate of glycogen synthesis in the cells overexpressing insulin receptors was increased 4- to 5-fold compared with controls. Low levels of added insulin (0.1 nM) caused a 50% increase in the rate of glycogen synthesis

  15. Cloning of cDNA sequences encoding cowpea (Vigna unguiculata) vicilins: Computational simulations suggest a binding mode of cowpea vicilins to chitin oligomers.

    Science.gov (United States)

    Rocha, Antônio J; Sousa, Bruno L; Girão, Matheus S; Barroso-Neto, Ito L; Monteiro-Júnior, José E; Oliveira, José T A; Nagano, Celso S; Carneiro, Rômulo F; Monteiro-Moreira, Ana C O; Rocha, Bruno A M; Freire, Valder N; Grangeiro, Thalles B

    2018-05-27

    Vicilins are 7S globulins which constitute the major seed storage proteins in leguminous species. Variant vicilins showing differential binding affinities for chitin have been implicated in the resistance and susceptibility of cowpea to the bruchid Callosobruchus maculatus. These proteins are members of the cupin superfamily, which includes a wide variety of enzymes and non-catalytic seed storage proteins. The cupin fold does not share similarity with any known chitin-biding domain. Therefore, it is poorly understood how these storage proteins bind to chitin. In this work, partial cDNA sequences encoding β-vignin, the major component of cowpea vicilins, were obtained from developing seeds. Three-dimensional molecular models of β-vignin showed the characteristic cupin fold and computational simulations revealed that each vicilin trimer contained 3 chitin-binding sites. Interaction models showed that chito-oligosaccharides bound to β-vignin were stabilized mainly by hydrogen bonds, a common structural feature of typical carbohydrate-binding proteins. Furthermore, many of the residues involved in the chitin-binding sites of β-vignin are conserved in other 7S globulins. These results support previous experimental evidences on the ability of vicilin-like proteins from cowpea and other leguminous species to bind in vitro to chitin as well as in vivo to chitinous structures of larval C. maculatus midgut. Copyright © 2018. Published by Elsevier B.V.

  16. Salmo salar and Esox lucius full-length cDNA sequences reveal changes in evolutionary pressures on a post-tetraploidization genome

    Directory of Open Access Journals (Sweden)

    Holt Robert A

    2010-04-01

    Full Text Available Abstract Background Salmonids are one of the most intensely studied fish, in part due to their economic and environmental importance, and in part due to a recent whole genome duplication in the common ancestor of salmonids. This duplication greatly impacts species diversification, functional specialization, and adaptation. Extensive new genomic resources have recently become available for Atlantic salmon (Salmo salar, but documentation of allelic versus duplicate reference genes remains a major uncertainty in the complete characterization of its genome and its evolution. Results From existing expressed sequence tag (EST resources and three new full-length cDNA libraries, 9,057 reference quality full-length gene insert clones were identified for Atlantic salmon. A further 1,365 reference full-length clones were annotated from 29,221 northern pike (Esox lucius ESTs. Pairwise dN/dS comparisons within each of 408 sets of duplicated salmon genes using northern pike as a diploid out-group show asymmetric relaxation of selection on salmon duplicates. Conclusions 9,057 full-length reference genes were characterized in S. salar and can be used to identify alleles and gene family members. Comparisons of duplicated genes show that while purifying selection is the predominant force acting on both duplicates, consistent with retention of functionality in both copies, some relaxation of pressure on gene duplicates can be identified. In addition, there is evidence that evolution has acted asymmetrically on paralogs, allowing one of the pair to diverge at a faster rate.

  17. Cloning and sequencing of the gene for human β-casein

    International Nuclear Information System (INIS)

    Loennerdal, B.; Bergstroem, S.; Andersson, Y.; Hialmarsson, K.; Sundgyist, A.; Hernell, O.

    1990-01-01

    Human β-casein is a major protein in human milk. This protein is part of the casein micelle and has been suggested to have several physiological functions in the newborn. Since there is limited information on βcasein and the factors that affect its concentration in human milk, the authors have isolated and sequenced the gene for this protein. A human mammary gland cDNA library (Clontech) in gt 11 was screened by plaque hy-hybridization using a 42-mer synthetic 32 p-labelled oligo-nucleotide. Positive clones were identified and isolated, DNA was prepared and the gene isolated by cleavage with EcoR1. Following subcloning (PUC18), restriction mapping and Southern blotting, DNA for sequencing was prepared. The gene was sequenced by the dideoxy method. Human β-casein has 212 amino acids and the amino acid sequence deducted from the nucleotide sequence is to 91% identical to the published sequence for human β-casein show a high degree of conservation at the leader peptide and the highly phosphorylated sequences, but also deletions and divergence at several positions. These results provide insight into the structure of the human β-casein gene and will facilitate studies on factors affecting its expression

  18. Understanding human DNA sequence variation.

    Science.gov (United States)

    Kidd, K K; Pakstis, A J; Speed, W C; Kidd, J R

    2004-01-01

    Over the past century researchers have identified normal genetic variation and studied that variation in diverse human populations to determine the amounts and distributions of that variation. That information is being used to develop an understanding of the demographic histories of the different populations and the species as a whole, among other studies. With the advent of DNA-based markers in the last quarter century, these studies have accelerated. One of the challenges for the next century is to understand that variation. One component of that understanding will be population genetics. We present here examples of many of the ways these new data can be analyzed from a population perspective using results from our laboratory on multiple individual DNA-based polymorphisms, many clustered in haplotypes, studied in multiple populations representing all major geographic regions of the world. These data support an "out of Africa" hypothesis for human dispersal around the world and begin to refine the understanding of population structures and genetic relationships. We are also developing baseline information against which we can compare findings at different loci to aid in the identification of loci subject, now and in the past, to selection (directional or balancing). We do not yet have a comprehensive understanding of the extensive variation in the human genome, but some of that understanding is coming from population genetics.

  19. Alternative splicing of human elastin mRNA indicated by sequence analysis of cloned genomic and complementary DNA

    International Nuclear Information System (INIS)

    Indik, Z.; Yeh, H.; Ornstein-goldstein, N.; Sheppard, P.; Anderson, N.; Rosenbloom, J.C.; Peltonen, L.; Rosenbloom, J.

    1987-01-01

    Poly(A) + RNA, isolated from a single 7-mo fetal human aorta, was used to synthesize cDNA by the RNase H method, and the cDNA was inserted into λgt10. Recombinant phage containing elastin sequences were identified by hybridization with cloned, exon-containing fragments of the human elastin gene. Three clones containing inserts of 3.3, 2.7, and 2.3 kilobases were selected for further analysis. Three overlapping clones containing 17.8 kilobases of the human elastin gene were also isolated from genomic libraries. Complete sequence analysis of the six clones demonstrated that: (i) the cDNA encompassed the entire translated portion of the mRNA encoding 786 amino acids, including several unusual hydrophilic amino acid sequences not previously identified in porcine tropoelastin, (ii) exons encoding either hydrophobic or crosslinking domains in the protein alternated in the gene, and (iii) a great abundance of Alu repetitive sequences occurred throughout the introns. The data also indicated substantial alternative splicing of the mRNA. These results suggest the potential for significant variation in the precise molecular structure of the elastic fiber in the human population

  20. Human cDNA mapping using fluorescence in situ hybridization. Progress report, April 1, 1992--December 31, 1992

    Energy Technology Data Exchange (ETDEWEB)

    Korenberg, J.R.

    1993-03-04

    Genetic mapping is approached using the techniques of high resolution fluorescence in situ hybridization (FISH). This technology and the results of its application are designed to rapidly generate whole genome as tool box of expressed sequence to speed the identification of human disease genes. The results of this study are intended to dovetail with and to link the results of existing technologies for creating backbone YAC and genetic maps. In the first eight months, this approach generated 60--80% of the expressed sequence map, the remainder expected to be derived through more long-term, labor-intensive, regional chromosomal gene searches or sequencing. The laboratory has made significant progress in the set-up phase, in mapping fetal and adult brain and other cDNAs, in testing a model system for directly linking genetic and physical maps using FISH with small fragments, in setting up a database, and in establishing the validity and throughput of the system.

  1. Human Genome Sequencing in Health and Disease

    Science.gov (United States)

    Gonzaga-Jauregui, Claudia; Lupski, James R.; Gibbs, Richard A.

    2013-01-01

    Following the “finished,” euchromatic, haploid human reference genome sequence, the rapid development of novel, faster, and cheaper sequencing technologies is making possible the era of personalized human genomics. Personal diploid human genome sequences have been generated, and each has contributed to our better understanding of variation in the human genome. We have consequently begun to appreciate the vastness of individual genetic variation from single nucleotide to structural variants. Translation of genome-scale variation into medically useful information is, however, in its infancy. This review summarizes the initial steps undertaken in clinical implementation of personal genome information, and describes the application of whole-genome and exome sequencing to identify the cause of genetic diseases and to suggest adjuvant therapies. Better analysis tools and a deeper understanding of the biology of our genome are necessary in order to decipher, interpret, and optimize clinical utility of what the variation in the human genome can teach us. Personal genome sequencing may eventually become an instrument of common medical practice, providing information that assists in the formulation of a differential diagnosis. We outline herein some of the remaining challenges. PMID:22248320

  2. Human Chromosome 7: DNA Sequence and Biology

    OpenAIRE

    Scherer, Stephen W.; Cheung, Joseph; MacDonald, Jeffrey R.; Osborne, Lucy R.; Nakabayashi, Kazuhiko; Herbrick, Jo-Anne; Carson, Andrew R.; Parker-Katiraee, Layla; Skaug, Jennifer; Khaja, Razi; Zhang, Junjun; Hudek, Alexander K.; Li, Martin; Haddad, May; Duggan, Gavin E.

    2003-01-01

    DNA sequence and annotation of the entire human chromosome 7, encompassing nearly 158 million nucleotides of DNA and 1917 gene structures, are presented. To generate a higher order description, additional structural features such as imprinted genes, fragile sites, and segmental duplications were integrated at the level of the DNA sequence with medical genetic data, including 440 chromosome rearrangement breakpoints associated with disease. This approach enabled the discovery of candidate gene...

  3. Extended sequence diagram for human system interaction

    International Nuclear Information System (INIS)

    Hwang, Jong Rok; Choi, Sun Woo; Ko, Hee Ran; Kim, Jong Hyun

    2012-01-01

    Unified Modeling Language (UML) is a modeling language in the field of object oriented software engineering. The sequence diagram is a kind of interaction diagram that shows how processes operate with one another and in what order. It is a construct of a message sequence chart. It depicts the objects and classes involved in the scenario and the sequence of messages exchanged between the objects needed to carry out the functionality of the scenario. This paper proposes the Extended Sequence Diagram (ESD), which is capable of depicting human system interaction for nuclear power plants, as well as cognitive process of operators analysis. In the conventional sequence diagram, there is a limit to only identify the activities of human and systems interactions. The ESD is extended to describe operators' cognitive process in more detail. The ESD is expected to be used as a task analysis method for describing human system interaction. The ESD can also present key steps causing abnormal operations or failures and diverse human errors based on cognitive condition

  4. Cloning of a cDNA encoding a novel human nuclear phosphoprotein belonging to the WD-40 family

    DEFF Research Database (Denmark)

    Honoré, B; Leffers, H; Madsen, Peder

    1994-01-01

    We have cloned and expressed in vaccinia virus a cDNA encoding an ubiquitous 501-amino-acid (aa) phosphoprotein that corresponds to protein IEF SSP 9502 (79,400 Da, pI 4.5) in the master 2-D-gel keratinocyte protein database [Celis et al., Electrophoresis 14 (1993) 1091-1198]. The deduced aa...

  5. Improvement of methods for large scale sequencing; application to human Xq28

    Energy Technology Data Exchange (ETDEWEB)

    Gibbs, R.A.; Andersson, B.; Wentland, M.A. [Baylor College of Medicine, Houston, TX (United States)] [and others

    1994-09-01

    Sequencing of a one-metabase region of Xq28, spanning the FRAXA and IDS loci has been undertaken in order to investigate the practicality of the shotgun approach for large scale sequencing and as a platform to develop improved methods. The efficiency of several steps in the shotgun sequencing strategy has been increased using PCR-based approaches. An improved method for preparation of M13 libraries has been developed. This protocol combines a previously described adaptor-based protocol with the uracil DNA glycosylase (UDG)-cloning procedure. The efficiency of this procedure has been found to be up to 100-fold higher than that of previously used protocols. In addition the novel protocol is more reliable and thus easy to establish in a laboratory. The method has also been adapted for the simultaneous shotgun sequencing of multiple short fragments by concentrating them before library construction is presented. This protocol is suitable for rapid characterization of cDNA clones. A library was constructed from 15 PCR-amplified and concentrated human cDNA inserts, and the insert sequences could easily be identified as separate contigs during the assembly process and the sequence coverage was even along each fragment. Using this strategy, the fine structures of the FraxA and IDS loci have been revealed and several EST homologies indicating novel expressed sequences have been identified. Use of PCR to close repetitive regions that are difficult to clone was tested by determination of the sequence of a cosmid mapping DXS455 in Xq28, containing a polymorphic VNTR. The region containing the VNTR was not represented in the shotgun library, but by designing PCR primers in the sequences flanking the gap and by cloning and sequencing the PCR product, the fine structure of the VNTR has been determined. It was found to be an AT-rich VNTR with a repeated 25-mer at the center.

  6. Coding sequence of human rho cDNAs clone 6 and clone 9

    Energy Technology Data Exchange (ETDEWEB)

    Chardin, P; Madaule, P; Tavitian, A

    1988-03-25

    The authors have isolated human cDNAs including the complete coding sequence for two rho proteins corresponding to the incomplete isolates previously described as clone 6 and clone 9. The deduced a.a. sequences, when compared to the a.a. sequence deduced from clone 12 cDNA, show that there are in human at least three highly homologous rho genes. They suggest that clone 12 be named rhoA, clone 6 : rhoB and clone 9 : rhoC. RhoA, B and C proteins display approx. 30% a.a. identity with ras proteins,. mainly clustered in four highly homologous internal regions corresponding to the GTP binding site; however at least one significant difference is found; the 3 rho proteins have an Alanine in position corresponding to ras Glycine 13, suggesting that rho and ras proteins might have slightly different biochemical properties.

  7. Characterization of a human MSX-2 cDNA and its fragment isolated as a transformation suppressor gene against v-Ki-ras oncogene.

    Science.gov (United States)

    Takahashi, C; Akiyama, N; Matsuzaki, T; Takai, S; Kitayama, H; Noda, M

    1996-05-16

    A cDNA (termed CT124) encoding a carboxyl-terminal fragment of the human homeobox protein MSX-2 was found to induce flat reversion when expressed in v-Ki-ras-transformed NIH3T3 cells. Although the expression of endogenous MSX-2 gene is low in most of the normal adult tissues examined, it is frequently activated in carcinoma-derived cell lines. Likewise, the gene is inactive in NIH3T3 cells but is transcriptionally activated after transformation by v-Ki-ras oncogene, suggesting that the intact MSX-2 may play a positive, rather than suppressive, role in cell transformation. To test this possibility, we isolated a near full-length human MSX-2 cDNA and tested its activities in two cell systems, i.e. fibroblast and myoblast. In NIH3T3 fibroblasts, although the gene by itself failed to confer a transformed phenotype, antisense MSX-2 cDNA as well as truncated CT124 cDNA interfered with the transforming activities of v-Ki-ras oncogene. In C2C12 myoblasts, MSX-2 was found to suppress MyoD gene expression, as do activated ras oncogenes, under certain culture conditions, and CT124 was found to inhibit the activities of both MSX-2 and ras in this system as well. Our findings not only suggest that CT124 may act as a dominant suppressor of MSX-2 but also raise the possibility that MSX-2 gene may be an important downstream target for the Ras signaling pathways.

  8. Sequence determinants of human microsatellite variability

    Directory of Open Access Journals (Sweden)

    Jakobsson Mattias

    2009-12-01

    Full Text Available Abstract Background Microsatellite loci are frequently used in genomic studies of DNA sequence repeats and in population studies of genetic variability. To investigate the effect of sequence properties of microsatellites on their level of variability we have analyzed genotypes at 627 microsatellite loci in 1,048 worldwide individuals from the HGDP-CEPH cell line panel together with the DNA sequences of these microsatellites in the human RefSeq database. Results Calibrating PCR fragment lengths in individual genotypes by using the RefSeq sequence enabled us to infer repeat number in the HGDP-CEPH dataset and to calculate the mean number of repeats (as opposed to the mean PCR fragment length, under the assumption that differences in PCR fragment length reflect differences in the numbers of repeats in the embedded repeat sequences. We find the mean and maximum numbers of repeats across individuals to be positively correlated with heterozygosity. The size and composition of the repeat unit of a microsatellite are also important factors in predicting heterozygosity, with tetra-nucleotide repeat units high in G/C content leading to higher heterozygosity. Finally, we find that microsatellites containing more separate sets of repeated motifs generally have higher heterozygosity. Conclusions These results suggest that sequence properties of microsatellites have a significant impact in determining the features of human microsatellite variability.

  9. Construction and evaluation of normalized cDNA libraries enriched with full-length sequences for rapid discovery of new genes from Sisal (Agave sisalana Perr.) different developmental stages.

    Science.gov (United States)

    Zhou, Wen-Zhao; Zhang, Yan-Mei; Lu, Jun-Ying; Li, Jun-Feng

    2012-10-12

    To provide a resource of sisal-specific expressed sequence data and facilitate this powerful approach in new gene research, the preparation of normalized cDNA libraries enriched with full-length sequences is necessary. Four libraries were produced with RNA pooled from Agave sisalana multiple tissues to increase efficiency of normalization and maximize the number of independent genes by SMART™ method and the duplex-specific nuclease (DSN). This procedure kept the proportion of full-length cDNAs in the subtracted/normalized libraries and dramatically enhanced the discovery of new genes. Sequencing of 3875 cDNA clones of libraries revealed 3320 unigenes with an average insert length about 1.2 kb, indicating that the non-redundancy of libraries was about 85.7%. These unigene functions were predicted by comparing their sequences to functional domain databases and extensively annotated with Gene Ontology (GO) terms. Comparative analysis of sisal unigenes and other plant genomes revealed that four putative MADS-box genes and knotted-like homeobox (knox) gene were obtained from a total of 1162 full-length transcripts. Furthermore, real-time PCR showed that the characteristics of their transcripts mainly depended on the tight expression regulation of a number of genes during the leaf and flower development. Analysis of individual library sequence data indicated that the pooled-tissue approach was highly effective in discovering new genes and preparing libraries for efficient deep sequencing.

  10. Porcine transcriptome analysis based on 97 non-normalized cDNA libraries and assembly of 1,021,891 expressed sequence tags

    DEFF Research Database (Denmark)

    Gorodkin, Jan; Cirera, Susanna; Hedegaard, Jacob

    2007-01-01

    public databases. The Sino-Danish ESTs were generated from one normalized and 97 non-normalized cDNA libraries representing 35 different tissues and three developmental stages. RESULTS: Using the Distiller package, the ESTs were assembled to roughly 48,000 contigs and 73,000 singletons, of which...... with the greatest number of different expressed genes, whereas tissues with more specialized function, such as developing liver, have fewer expressed genes. There are at least 65 high confidence housekeeping gene candidates and 876 cDNA library-specific gene candidates. We identified differential expression...

  11. Transcribed sequences in the human genome to be held in San Francisco, November 7 and 8, 1992. Final report, September 1, 1992--August 31, 1993

    Energy Technology Data Exchange (ETDEWEB)

    Gardiner, K.

    1993-11-01

    The Second International Workshop on the Identification of Transcribed Sequences was held in San Francisco on November 7--8, 1992. The purpose of the workshop was to discuss and evaluate techniques for developing a complete transcriptional map of the human genome. Such a map requires the positions, sequences, and expression patterns of all genes. This goal is being approached from two different directions, each with strengths and weaknesses. One method is to identify the transcribed sequences from genomic DNA of a given region; the other is to systematically sequence and map cDNAs. The cDNA approach yields sequence information rapidly, but mapping each cDNA is a technical challenge. In the first approach, the map locations of genomic sequences are known at the outset, and the challenge is to identify exons. The efficient construction of a transcriptional map will require a diverse array of techniques.

  12. Evaluation and Adaptation of a Laboratory-Based cDNA Library Preparation Protocol for Retrospective Sequencing of Archived MicroRNAs from up to 35-Year-Old Clinical FFPE Specimens.

    Science.gov (United States)

    Loudig, Olivier; Wang, Tao; Ye, Kenny; Lin, Juan; Wang, Yihong; Ramnauth, Andrew; Liu, Christina; Stark, Azadeh; Chitale, Dhananjay; Greenlee, Robert; Multerer, Deborah; Honda, Stacey; Daida, Yihe; Spencer Feigelson, Heather; Glass, Andrew; Couch, Fergus J; Rohan, Thomas; Ben-Dov, Iddo Z

    2017-03-14

    Formalin-fixed paraffin-embedded (FFPE) specimens, when used in conjunction with patient clinical data history, represent an invaluable resource for molecular studies of cancer. Even though nucleic acids extracted from archived FFPE tissues are degraded, their molecular analysis has become possible. In this study, we optimized a laboratory-based next-generation sequencing barcoded cDNA library preparation protocol for analysis of small RNAs recovered from archived FFPE tissues. Using matched fresh and FFPE specimens, we evaluated the robustness and reproducibility of our optimized approach, as well as its applicability to archived clinical specimens stored for up to 35 years. We then evaluated this cDNA library preparation protocol by performing a miRNA expression analysis of archived breast ductal carcinoma in situ (DCIS) specimens, selected for their relation to the risk of subsequent breast cancer development and obtained from six different institutions. Our analyses identified six miRNAs (miR-29a, miR-221, miR-375, miR-184, miR-363, miR-455-5p) differentially expressed between DCIS lesions from women who subsequently developed an invasive breast cancer (cases) and women who did not develop invasive breast cancer within the same time interval (control). Our thorough evaluation and application of this laboratory-based miRNA sequencing analysis indicates that the preparation of small RNA cDNA libraries can reliably be performed on older, archived, clinically-classified specimens.

  13. The contribution of 700,000 ORF sequence tags to the definition of the human transcriptome

    Science.gov (United States)

    Camargo, Anamaria A.; Samaia, Helena P. B.; Dias-Neto, Emmanuel; Simão, Daniel F.; Migotto, Italo A.; Briones, Marcelo R. S.; Costa, Fernando F.; Aparecida Nagai, Maria; Verjovski-Almeida, Sergio; Zago, Marco A.; Andrade, Luis Eduardo C.; Carrer, Helaine; El-Dorry, Hamza F. A.; Espreafico, Enilza M.; Habr-Gama, Angelita; Giannella-Neto, Daniel; Goldman, Gustavo H.; Gruber, Arthur; Hackel, Christine; Kimura, Edna T.; Maciel, Rui M. B.; Marie, Suely K. N.; Martins, Elizabeth A. L.; Nóbrega, Marina P.; Paçó-Larson, Maria Luisa; Pardini, Maria Inês M. C.; Pereira, Gonçalo G.; Pesquero, João Bosco; Rodrigues, Vanderlei; Rogatto, Silvia R.; da Silva, Ismael D. C. G.; Sogayar, Mari C.; Sonati, Maria de Fátima; Tajara, Eloiza H.; Valentini, Sandro R.; Alberto, Fernando L.; Amaral, Maria Elisabete J.; Aneas, Ivy; Arnaldi, Liliane A. T.; de Assis, Angela M.; Bengtson, Mário Henrique; Bergamo, Nadia Aparecida; Bombonato, Vanessa; de Camargo, Maria E. R.; Canevari, Renata A.; Carraro, Dirce M.; Cerutti, Janete M.; Corrêa, Maria Lucia C.; Corrêa, Rosana F. R.; Costa, Maria Cristina R.; Curcio, Cyntia; Hokama, Paula O. M.; Ferreira, Ari J. S.; Furuzawa, Gilberto K.; Gushiken, Tsieko; Ho, Paulo L.; Kimura, Elza; Krieger, José E.; Leite, Luciana C. C.; Majumder, Paromita; Marins, Mozart; Marques, Everaldo R.; Melo, Analy S. A.; Melo, Monica; Mestriner, Carlos Alberto; Miracca, Elisabete C.; Miranda, Daniela C.; Nascimento, Ana Lucia T. O.; Nóbrega, Francisco G.; Ojopi, Élida P. B.; Pandolfi, José Rodrigo C.; Pessoa, Luciana G.; Prevedel, Aline C.; Rahal, Paula; Rainho, Claudia A.; Reis, Eduardo M. R.; Ribeiro, Marcelo L.; da Rós, Nancy; de Sá, Renata G.; Sales, Magaly M.; Sant'anna, Simone Cristina; dos Santos, Mariana L.; da Silva, Aline M.; da Silva, Neusa P.; Silva, Wilson A.; da Silveira, Rosana A.; Sousa, Josane F.; Stecconi, Daniella; Tsukumo, Fernando; Valente, Valéria; Soares, Fernando; Moreira, Eloisa S.; Nunes, Diana N.; Correa, Ricardo G.; Zalcberg, Heloisa; Carvalho, Alex F.; Reis, Luis F. L.; Brentani, Ricardo R.; Simpson, Andrew J. G.; de Souza, Sandro J.

    2001-01-01

    Open reading frame expressed sequences tags (ORESTES) differ from conventional ESTs by providing sequence data from the central protein coding portion of transcripts. We generated a total of 696,745 ORESTES sequences from 24 human tissues and used a subset of the data that correspond to a set of 15,095 full-length mRNAs as a means of assessing the efficiency of the strategy and its potential contribution to the definition of the human transcriptome. We estimate that ORESTES sampled over 80% of all highly and moderately expressed, and between 40% and 50% of rarely expressed, human genes. In our most thoroughly sequenced tissue, the breast, the 130,000 ORESTES generated are derived from transcripts from an estimated 70% of all genes expressed in that tissue, with an equally efficient representation of both highly and poorly expressed genes. In this respect, we find that the capacity of the ORESTES strategy both for gene discovery and shotgun transcript sequence generation significantly exceeds that of conventional ESTs. The distribution of ORESTES is such that many human transcripts are now represented by a scaffold of partial sequences distributed along the length of each gene product. The experimental joining of the scaffold components, by reverse transcription–PCR, represents a direct route to transcript finishing that may represent a useful alternative to full-length cDNA cloning. PMID:11593022

  14. The contribution of 700,000 ORF sequence tags to the definition of the human transcriptome.

    Science.gov (United States)

    Camargo, A A; Samaia, H P; Dias-Neto, E; Simão, D F; Migotto, I A; Briones, M R; Costa, F F; Nagai, M A; Verjovski-Almeida, S; Zago, M A; Andrade, L E; Carrer, H; El-Dorry, H F; Espreafico, E M; Habr-Gama, A; Giannella-Neto, D; Goldman, G H; Gruber, A; Hackel, C; Kimura, E T; Maciel, R M; Marie, S K; Martins, E A; Nobrega, M P; Paco-Larson, M L; Pardini, M I; Pereira, G G; Pesquero, J B; Rodrigues, V; Rogatto, S R; da Silva, I D; Sogayar, M C; Sonati, M F; Tajara, E H; Valentini, S R; Alberto, F L; Amaral, M E; Aneas, I; Arnaldi, L A; de Assis, A M; Bengtson, M H; Bergamo, N A; Bombonato, V; de Camargo, M E; Canevari, R A; Carraro, D M; Cerutti, J M; Correa, M L; Correa, R F; Costa, M C; Curcio, C; Hokama, P O; Ferreira, A J; Furuzawa, G K; Gushiken, T; Ho, P L; Kimura, E; Krieger, J E; Leite, L C; Majumder, P; Marins, M; Marques, E R; Melo, A S; Melo, M B; Mestriner, C A; Miracca, E C; Miranda, D C; Nascimento, A L; Nobrega, F G; Ojopi, E P; Pandolfi, J R; Pessoa, L G; Prevedel, A C; Rahal, P; Rainho, C A; Reis, E M; Ribeiro, M L; da Ros, N; de Sa, R G; Sales, M M; Sant'anna, S C; dos Santos, M L; da Silva, A M; da Silva, N P; Silva, W A; da Silveira, R A; Sousa, J F; Stecconi, D; Tsukumo, F; Valente, V; Soares, F; Moreira, E S; Nunes, D N; Correa, R G; Zalcberg, H; Carvalho, A F; Reis, L F; Brentani, R R; Simpson, A J; de Souza, S J; Melo, M

    2001-10-09

    Open reading frame expressed sequences tags (ORESTES) differ from conventional ESTs by providing sequence data from the central protein coding portion of transcripts. We generated a total of 696,745 ORESTES sequences from 24 human tissues and used a subset of the data that correspond to a set of 15,095 full-length mRNAs as a means of assessing the efficiency of the strategy and its potential contribution to the definition of the human transcriptome. We estimate that ORESTES sampled over 80% of all highly and moderately expressed, and between 40% and 50% of rarely expressed, human genes. In our most thoroughly sequenced tissue, the breast, the 130,000 ORESTES generated are derived from transcripts from an estimated 70% of all genes expressed in that tissue, with an equally efficient representation of both highly and poorly expressed genes. In this respect, we find that the capacity of the ORESTES strategy both for gene discovery and shotgun transcript sequence generation significantly exceeds that of conventional ESTs. The distribution of ORESTES is such that many human transcripts are now represented by a scaffold of partial sequences distributed along the length of each gene product. The experimental joining of the scaffold components, by reverse transcription-PCR, represents a direct route to transcript finishing that may represent a useful alternative to full-length cDNA cloning.

  15. cDNA cloning and initial characterization of CYP3A43, a novel human cytochrome P450.

    Science.gov (United States)

    Domanski, T L; Finta, C; Halpert, J R; Zaphiropoulos, P G

    2001-02-01

    The RACE amplification technology was used on a novel CYP3A-like exon 1 sequence detected during the reverse transcriptase/polymerase chain reaction analysis of human CYP3A gene expression. This resulted in the identification of cDNAs encompassing the complete coding sequence of a new member of the CYP3A gene subfamily, CYP3A43. Interestingly, the majority of the cDNAs identified were characterized by alternative splicing events such as exon skipping and complete or partial intron inclusion. CYP3A43 expression was detected in liver, kidney, pancreas, and prostate. The amino acid sequence is 75% identical to that of CYP3A4 and CYP3A5 and 71% identical to CYP3A7. CYP3A43 differs from CYP3A4 at six amino acid residues, found within the putative substrate recognition sites of CYP3A4, that are known to be determinants of substrate selectivity. The N terminus of CYP3A43 was modified for efficient expression of the protein in Escherichia coli, and a 6X histidine tag was added at the C terminus to facilitate purification. CYP3A43 gave a reduced carbon monoxide difference spectra with an absorbance maximum at 450 nm. The level of heterologous expression was significantly lower than that observed for CYP3A4 and CYP3A5. Immunoblot analyses revealed that CYP3A43 comigrates with CYP3A4 in polyacrylamide gel electrophoresis but does separate from CYP3A5. Monooxygenase assays were performed under a variety of conditions, several of which yielded reproducible, albeit low, testosterone hydroxylase activity. The findings from this study demonstrate that there is a novel CYP3A member expressed in human tissues, although its relative contribution to drug metabolism has yet to be ascertained.

  16. Exome sequencing of a multigenerational human pedigree.

    Directory of Open Access Journals (Sweden)

    Dale J Hedges

    2009-12-01

    Full Text Available Over the next few years, the efficient use of next-generation sequencing (NGS in human genetics research will depend heavily upon the effective mechanisms for the selective enrichment of genomic regions of interest. Recently, comprehensive exome capture arrays have become available for targeting approximately 33 Mb or approximately 180,000 coding exons across the human genome. Selective genomic enrichment of the human exome offers an attractive option for new experimental designs aiming to quickly identify potential disease-associated genetic variants, especially in family-based studies. We have evaluated a 2.1 M feature human exome capture array on eight individuals from a three-generation family pedigree. We were able to cover up to 98% of the targeted bases at a long-read sequence read depth of > or = 3, 86% at a read depth of > or = 10, and over 50% of all targets were covered with > or = 20 reads. We identified up to 14,284 SNPs and small indels per individual exome, with up to 1,679 of these representing putative novel polymorphisms. Applying the conservative genotype calling approach HCDiff, the average rate of detection of a variant allele based on Illumina 1 M BeadChips genotypes was 95.2% at > or = 10x sequence. Further, we propose an advantageous genotype calling strategy for low covered targets that empirically determines cut-off thresholds at a given coverage depth based on existing genotype data. Application of this method was able to detect >99% of SNPs covered > or = 8x. Our results offer guidance for "real-world" applications in human genetics and provide further evidence that microarray-based exome capture is an efficient and reliable method to enrich for chromosomal regions of interest in next-generation sequencing experiments.

  17. 5′ Rapid Amplification of cDNA Ends and Illumina MiSeq Reveals B Cell Receptor Features in Healthy Adults, Adults With Chronic HIV-1 Infection, Cord Blood, and Humanized Mice

    Directory of Open Access Journals (Sweden)

    Eric Waltari

    2018-03-01

    Full Text Available Using 5′ rapid amplification of cDNA ends, Illumina MiSeq, and basic flow cytometry, we systematically analyzed the expressed B cell receptor (BCR repertoire in 14 healthy adult PBMCs, 5 HIV-1+ adult PBMCs, 5 cord blood samples, and 3 HIS-CD4/B mice, examining the full-length variable region of μ, γ, α, κ, and λ chains for V-gene usage, somatic hypermutation (SHM, and CDR3 length. Adding to the known repertoire of healthy adults, Illumina MiSeq consistently detected small fractions of reads with high mutation frequencies including hypermutated μ reads, and reads with long CDR3s. Additionally, the less studied IgA repertoire displayed similar characteristics to that of IgG. Compared to healthy adults, the five HIV-1 chronically infected adults displayed elevated mutation frequencies for all μ, γ, α, κ, and λ chains examined and slightly longer CDR3 lengths for γ, α, and λ. To evaluate the reconstituted human BCR sequences in a humanized mouse model, we analyzed cord blood and HIS-CD4/B mice, which all lacked the typical SHM seen in the adult reference. Furthermore, MiSeq revealed identical unmutated IgM sequences derived from separate cell aliquots, thus for the first time demonstrating rare clonal members of unmutated IgM B cells by sequencing.

  18. 5' Rapid Amplification of cDNA Ends and Illumina MiSeq Reveals B Cell Receptor Features in Healthy Adults, Adults With Chronic HIV-1 Infection, Cord Blood, and Humanized Mice.

    Science.gov (United States)

    Waltari, Eric; Jia, Manxue; Jiang, Caroline S; Lu, Hong; Huang, Jing; Fernandez, Cristina; Finzi, Andrés; Kaufmann, Daniel E; Markowitz, Martin; Tsuji, Moriya; Wu, Xueling

    2018-01-01

    Using 5' rapid amplification of cDNA ends, Illumina MiSeq, and basic flow cytometry, we systematically analyzed the expressed B cell receptor (BCR) repertoire in 14 healthy adult PBMCs, 5 HIV-1+ adult PBMCs, 5 cord blood samples, and 3 HIS-CD4/B mice, examining the full-length variable region of μ, γ, α, κ, and λ chains for V-gene usage, somatic hypermutation (SHM), and CDR3 length. Adding to the known repertoire of healthy adults, Illumina MiSeq consistently detected small fractions of reads with high mutation frequencies including hypermutated μ reads, and reads with long CDR3s. Additionally, the less studied IgA repertoire displayed similar characteristics to that of IgG. Compared to healthy adults, the five HIV-1 chronically infected adults displayed elevated mutation frequencies for all μ, γ, α, κ, and λ chains examined and slightly longer CDR3 lengths for γ, α, and λ. To evaluate the reconstituted human BCR sequences in a humanized mouse model, we analyzed cord blood and HIS-CD4/B mice, which all lacked the typical SHM seen in the adult reference. Furthermore, MiSeq revealed identical unmutated IgM sequences derived from separate cell aliquots, thus for the first time demonstrating rare clonal members of unmutated IgM B cells by sequencing.

  19. Molecular cloning, nucleotide sequence, and expression of the gene encoding human eosinophil differentiation factor (interleukin 5)

    International Nuclear Information System (INIS)

    Campbell, H.D.; Tucker, W.Q.J.; Hort, Y.; Martinson, M.E.; Mayo, G.; Clutterbuck, E.J.; Sanderson, C.J.; Young, I.G.

    1987-01-01

    The human eosinophil differentiation factor (EDF) gene was cloned from a genomic library in λ phage EMBL3A by using a murine EDF cDNA clone as a probe. The DNA sequence of a 3.2-kilobase BamHI fragment spanning the gene was determined. The gene contains three introns. The predicted amino acid sequence of 134 amino acids is identical with that recently reported for human interleukin 5 but shows no significant homology with other known hemopoietic growth regulators. The amino acid sequence shows strong homology (∼ 70% identity) with that of murine EDF. Recombinant human EDF, expressed from the human EDF gene after transfection into monkey COS cells, stimulated the production of eosinophils and eosinophil colonies from normal human bone marrow but had no effect on the production of neutrophils or mononuclear cells (monocytes and lymphoid cells). The apparent specificity of human EDF for the eosinophil lineage in myeloid hemopoiesis contrasts with the properties of human interleukin 3 and granulocyte/macrophage and granulocyte colony-stimulating factors but is directly analogous to the biological properties of murine EDF. Human EDF therefore represents a distinct hemopoietic growth factor that could play a central role in the regulation of eosinophilia

  20. Comparison of cDNA-derived protein sequences of the human fibronectin and vitronectin receptor α-subunits and platelet glycoprotein IIb

    International Nuclear Information System (INIS)

    Fitzgerald, L.A.; Poncz, M.; Steiner, B.; Rall, S.C. Jr.; Bennett, J.S.; Phillips, D.R.

    1987-01-01

    The fibronectin receptor (FnR), the vitronectin receptor (VnR), and the platelet membrane glycoprotein (GP) IIb-IIIa complex are members of a family of cell adhesion receptors, which consist of noncovalently associated α- and β-subunits. The present study was designed to compare the cDNA-derived protein sequences of the α-subunits of human FnR, VnR, and platelet GP IIb. cDNA clones for the α-subunit of the FnR (FnR/sub α/) were obtained from a human umbilical vein endothelial (HUVE) cell library by using an oligonucleotide probe designed from a peptide sequence of platelet GP IIb. cDNA clones for platelet GP IIb were isolated from a cDNA expression library of human erythroleukemia cells by using antibodies. cDNA clones of the VnR α-subunit (VnR/sub α/) were obtained from the HUVE cell library by using an oligonucleotide probe from the partial cDNA sequence for the VnR/sub α/. Translation of these sequences showed that the FNR/sub α/, the VnR/sub α/, and GP IIb are composed of disulfide-linked large (858-871 amino acids) and small (137-158 amino acids) chains that are posttranslationally processed from a single mRNA. A single hydrophobic segment located near the carboxyl terminus of each small chain appears to be a transmembrane domain. The large chains appear to be entirely extracellular, and each contains four repeated putative Ca 2+ -binding domains of about 30 amino acids that have sequence similarities to other Ca 2+ -binding proteins. The identity among the protein sequences of the three receptor α-subunits ranges from 36.1% to 44.5%, with the Ca 2+ -binding domains having the greatest homology. These proteins apparently evolved by a process of gene duplication

  1. Amino acid substitutions in genetic variants of human serum albumin and in sequences inferred from molecular cloning

    International Nuclear Information System (INIS)

    Takahashi, N.; Takahashi, Y.; Blumberg, B.S.; Putnam, F.W.

    1987-01-01

    The structural changes in four genetic variants of human serum albumin were analyzed by tandem high-pressure liquid chromatography (HPLC) of the tryptic peptides, HPLC mapping and isoelectric focusing of the CNBr fragments, and amino acid sequence analysis of the purified peptides. Lysine-372 of normal (common) albumin A was changed to glutamic acid both in albumin Naskapi, a widespread polymorphic variant of North American Indians, and in albumin Mersin found in Eti Turks. The two variants also exhibited anomalous migration in NaDodSO 4 /PAGE, which is attributed to a conformational change. The identity of albumins Naskapi and Mersin may have originated through descent from a common mid-Asiatic founder of the two migrating ethnic groups, or it may represent identical but independent mutations of the albumin gene. In albumin Adana, from Eti Turks, the substitution site was not identified but was localized to the region from positions 447 through 548. The substitution of aspartic acid-550 by glycine was found in albumin Mexico-2 from four individuals of the Pima tribe. Although only single-point substitutions have been found in these and in certain other genetic variants of human albumin, five differences exist in the amino acid sequences inferred from cDNA sequences by workers in three other laboratories. However, our results on albumin A and on 14 different genetic variants accord with the amino acid sequence of albumin deduced from the genomic sequence. The apparent amino acid substitutions inferred from comparison of individual cDNA sequences probably reflect artifacts in cloning or in cDNA sequence analysis rather than polymorphism of the coding sections of the albumin gene

  2. Heterogeneity of rat tropoelastin mRNA revealed by cDNA cloning

    International Nuclear Information System (INIS)

    Pierce, R.A.; Deak, S.B.; Stolle, C.A.; Boyd, C.D.

    1990-01-01

    A λgt11 library constructed from poly(A+) RNA isolated from aortic tissue of neonatal rats was screened for rat tropoelastin cDNAs. The first, screen, utilizing a human tropoelastin cDNA clone, provided rat tropoelastin cDNAs spanning 2.3 kb of carboxy-terminal coding sequence and extended into the 3'-untranslated region. A subsequent screen using a 5' rat tropoelastin cDNA clone yielded clones extending into the amino-terminal signal sequence coding region. Sequence analysis of these clones has provided the complete derived amino acid sequence of rat tropoelastin and allowed alignment and comparison with published bovine cDNA sequence. While the overall structure of rat tropoelastin is similar to bovine sequence, numerous substitutions, deletions, and insertions demonstrated considerable heterogeneity between species. In particular, the pentapeptide repeat VPGVG, characteristic of all tropoelastins analyzed to date, is replaced in rat tropoelastin by a repeating pentapeptide, IPGVG. The hexapeptide repeat VGVAPG, the bovine elastin receptor binding peptide, is not encoded by rat tropoelastin cDNAs. Variations in coding sequence between rat tropoelastin CDNA clones were also found which may represent mRNA heterogeneity produced by alternative splicing of the rat tropoelastin pre-mRNA

  3. Isolation of the human anionic glutathione S-transferase cDNA and the relation of its gene expression to estrogen-receptor content in primary breast cancer

    International Nuclear Information System (INIS)

    Moscow, J.A.; Townsend, A.J.; Goldsmith, M.E.; Whang-Peng, J.; Vickers, P.J.; Poisson, R.; Legault-Poisson, S.; Myers, C.E.; Cowan, K.H.

    1988-01-01

    The development of multidrug resistance in MCF7 human breast cancer cells is associated with overexpression of P-glycoprotein, changes in activities of several detoxication enzymes, and loss of hormone sensitivity and estrogen receptors (ERs). The authors have cloned the cDNA for one of the drug-detoxifying enzymes overexpressed in multidrug-resistant MCF7 cells (Adr R MCF7), the anionic isozyme of glutathione S-transferase (GSTπ). Hybridization with this GSTπ cDNA, GSTπ-1, demonstrated that increased GSTπ activity in Adr R MCF7 cells is associated with overexpression but not with amplification of the gene. They mapped the GSTπ gene to human chromosome 11q13 by in situ hybridization. Since multidrug resistance and GSTπ overexpression are associated with the loss of ERs in Adr R MCF7 cells, they examined several other breast cancer cell lines that were not selected for drug resistance. In each of these cell lines they found an inverse association between GSTπ expression and ER content. They also examined RNA from 21 primary breast cancers and found a similar association between GSTπ expression and ER content in vivo. The finding of similar patterns of expression of a drug-detoxifying enzyme and of ERs in vitro as well as in vivo suggests that ER-negative breast cancer cells may have greater protection against antineoplastic agents conferred by GSTπ than ER-positive tumors

  4. The characterization of twenty sequenced human genomes.

    Directory of Open Access Journals (Sweden)

    Kimberly Pelak

    2010-09-01

    Full Text Available We present the analysis of twenty human genomes to evaluate the prospects for identifying rare functional variants that contribute to a phenotype of interest. We sequenced at high coverage ten "case" genomes from individuals with severe hemophilia A and ten "control" genomes. We summarize the number of genetic variants emerging from a study of this magnitude, and provide a proof of concept for the identification of rare and highly-penetrant functional variants by confirming that the cause of hemophilia A is easily recognizable in this data set. We also show that the number of novel single nucleotide variants (SNVs discovered per genome seems to stabilize at about 144,000 new variants per genome, after the first 15 individuals have been sequenced. Finally, we find that, on average, each genome carries 165 homozygous protein-truncating or stop loss variants in genes representing a diverse set of pathways.

  5. Radioactive cDNA microarray in neurospsychiatry

    International Nuclear Information System (INIS)

    Choe, Jae Gol; Shin, Kyung Ho; Lee, Min Soo; Kim, Meyoung Kon

    2003-01-01

    Microarray technology allows the simultaneous analysis of gene expression patterns of thousands of genes, in a systematic fashion, under a similar set of experimental conditions, thus making the data highly comparable. In some cases arrays are used simply as a primary screen leading to downstream molecular characterization of individual gene candidates. In other cases, the goal of expression profiling is to begin to identify complex regulatory networks underlying developmental processes and disease states. Microarrays were originally used with cell lines or other simple model systems. More recently, microarrays have been used in the analysis of more complex biological tissues including neural systems and the brain. The application of cDNA arrays in neuropsychiatry has lagged behind other fields for a number of reasons. These include a requirement for a large amount of input probe RNA in fluorescent-glass based array systems and the cellular complexity introduced by multicellular brain and neural tissues. An additional factor that impacts the general use of microarrays in neuropsychiatry is the lack of availability of sequenced clone sets from model systems. While human cDNA clones have been widely available, high quality rat, mouse, and drosophilae, among others are just becoming widely available. A final factor in the application of cDNA microarrays in neuropsychiatry is cost of commercial arrays. As academic microarray facilitates become more commonplace custom made arrays will become more widely available at a lower cost allowing more widespread applications. In summary, microarray technology is rapidly having an impact on many areas of biomedical research. Radioisotope-nylon based microarrays offer alternatives that may in some cases be more sensitive, flexible, inexpensive, and universal as compared to other array formats, such as fluorescent-glass arrays. In some situations of limited RNA or exotic species, radioactive membrane microarrays may be the most

  6. Radioactive cDNA microarray in neurospsychiatry

    Energy Technology Data Exchange (ETDEWEB)

    Choe, Jae Gol; Shin, Kyung Ho; Lee, Min Soo; Kim, Meyoung Kon [Korea University Medical School, Seoul (Korea, Republic of)

    2003-02-01

    Microarray technology allows the simultaneous analysis of gene expression patterns of thousands of genes, in a systematic fashion, under a similar set of experimental conditions, thus making the data highly comparable. In some cases arrays are used simply as a primary screen leading to downstream molecular characterization of individual gene candidates. In other cases, the goal of expression profiling is to begin to identify complex regulatory networks underlying developmental processes and disease states. Microarrays were originally used with cell lines or other simple model systems. More recently, microarrays have been used in the analysis of more complex biological tissues including neural systems and the brain. The application of cDNA arrays in neuropsychiatry has lagged behind other fields for a number of reasons. These include a requirement for a large amount of input probe RNA in fluorescent-glass based array systems and the cellular complexity introduced by multicellular brain and neural tissues. An additional factor that impacts the general use of microarrays in neuropsychiatry is the lack of availability of sequenced clone sets from model systems. While human cDNA clones have been widely available, high quality rat, mouse, and drosophilae, among others are just becoming widely available. A final factor in the application of cDNA microarrays in neuropsychiatry is cost of commercial arrays. As academic microarray facilitates become more commonplace custom made arrays will become more widely available at a lower cost allowing more widespread applications. In summary, microarray technology is rapidly having an impact on many areas of biomedical research. Radioisotope-nylon based microarrays offer alternatives that may in some cases be more sensitive, flexible, inexpensive, and universal as compared to other array formats, such as fluorescent-glass arrays. In some situations of limited RNA or exotic species, radioactive membrane microarrays may be the most

  7. Cloning of a cDNA encoding the rat high molecular weight neurofilament peptide (NF-H): Developmental and tissue expression in the rat, and mapping of its human homologue to chromosomes 1 and 22

    International Nuclear Information System (INIS)

    Lieberburg, I.; Spinner, N.; Snyder, S.

    1989-01-01

    Neurofilaments (NFs) are the intermediate filaments specific to nervous tissue. Three peptides with apparent molecular masses of approximately 68 (NF-L), 145 (NF-M), and 200 (NF-H) kDa appear to be the major components of NF. The expression of these peptides is specific to nervous tissue and is developmentally regulated. Recently, complete cDNAs encoding NF-L and NF-M, and partial cDNAs encoding NF-H, have been described. To better understand the normal pathophysiology of NFs the authors chose to clone the cDNA encoding the rat NF-H peptide. Using monoclonal antibodies that recognized NF-H, they screened a rat brain λgt11 library and identified a clone that contained a 2,100-nucleotide cDNA insert representing the carboxyl-terminal portion of the NF-H protein. Levels of NF-H mRNA varied 20-fold among brain regions, with highest levels in pons/medulla, spinal cord, and cerebellum, and lowest levels in olfactory bulb and hypothalamus. Based on these results, the authors infer that half of the developmental increase and most of the interregional variation in the levels of the NF-H mRNA are mediated through message stabilization. Sequence information revealed that the carboxyl-terminal region of the NF-H peptide contained a unique serine-, proline-, alanine-, glutamic acid-, and lysine-rich repeat. Genomic blots revealed a single copy of the gene in the rat genome and two copies in the human genome. In situ hybridizations performed on human chromosomes mapped the NF-H gene to chromosomes 1 and 22

  8. Molecular cloning and complete nucleotide sequence of a human ventricular myosin light chain 1

    Energy Technology Data Exchange (ETDEWEB)

    Hoffmann, E; Shi, Q W; Floroff, M; Mickle, D A.G.; Wu, T W; Olley, P M; Jackowski, G

    1988-03-25

    Human ventricular plasmid library was constructed. The library was screened with the oligonucleotide probe (17-mer) corresponding to a conserve region of myosin light chain 1 near the carboxy terminal. Full length cDNA recombinant plasmid containing 1100 bp insert was isolated. RNA blot hybridization with this insert detected a message of approximately 1500 bp corresponding to the size of VLCl and mRNA. Complete nucleotide sequence of the coding region was determined in M13 subclones using dideoxy chain termination method. With the isolation of this clone (pCD HLVCl), the publication of the complete nucleotide sequence of HVLCl and the predicted secondary structure of this protein will aid in understanding of the biochemistry of myosin and its function in contraction, the evolution of myosin light genes and the genetic, developmental and physiological regulation of myosin genes.

  9. Construction of high-quality Caco-2 three-frame cDNA library and its application to yeast two-hybrid for the human astrovirus protein-protein interaction.

    Science.gov (United States)

    Zhao, Wei; Li, Xin; Liu, Wen-Hui; Zhao, Jian; Jin, Yi-Ming; Sui, Ting-Ting

    2014-09-01

    Human epithelial colorectal adenocarcinoma (Caco-2) cells are widely used as an in vitro model of the human small intestinal mucosa. Caco-2 cells are host cells of the human astrovirus (HAstV) and other enteroviruses. High quality cDNA libraries are pertinent resources and critical tools for protein-protein interaction research, but are currently unavailable for Caco-2 cells. To construct a three-open reading frame, full length-expression cDNA library from the Caco-2 cell line for application to HAstV protein-protein interaction screening, total RNA was extracted from Caco-2 cells. The switching mechanism at the 5' end of the RNA transcript technique was used for cDNA synthesis. Double-stranded cDNA was digested by Sfi I and ligated to reconstruct a pGADT7-Sfi I three-frame vector. The ligation mixture was transformed into Escherichia coli HST08 premium electro cells by electroporation to construct the primary cDNA library. The library capacity was 1.0×10(6)clones. Gel electrophoresis results indicated that the fragments ranged from 0.5kb to 4.2kb. Randomly picked clones show that the recombination rate was 100%. The three-frame primary cDNA library plasmid mixture (5×10(5)cfu) was also transformed into E. coli HST08 premium electro cells, and all clones were harvested to amplify the cDNA library. To detect the sufficiency of the cDNA library, HAstV capsid protein as bait was screened and tested against the Caco-2 cDNA library by a yeast two-hybrid (Y2H) system. A total of 20 proteins were found to interact with the capsid protein. These results showed that a high-quality three-frame cDNA library from Caco-2 cells was successfully constructed. This library was efficient for the application to the Y2H system, and could be used for future research. Copyright © 2014 Elsevier B.V. All rights reserved.

  10. End Sequencing and Finger Printing of Human & Mouse BAC Libraries

    Energy Technology Data Exchange (ETDEWEB)

    Fraser, C

    2005-09-27

    This project provided for continued end sequencing of existing and new BAC libraries constructed to support human sequencing as well as to initiate BAC end sequencing from the mouse BAC libraries constructed to support mouse sequencing. The clones, the sequences, and the fingerprints are now an available resource for the community at large. Research and development of new metaodologies for BAC end sequencing have reduced costs and increase throughput.

  11. GenEST, a powerful bidirectional link between cDNA sequence data and gene expression profiles generated by cDNA-AFLP

    NARCIS (Netherlands)

    Qin Ling,; Prins, P.; Jones, J.T.; Popeijus, H.; Smant, G.; Bakker, J.; Helder, J.

    2001-01-01

    The release of vast quantities of DNA sequence data by large-scale genome and expressed sequence tag (EST) projects underlines the necessity for the development of efficient and inexpensive ways to link sequence databases with temporal and spatial expression profiles. Here we demonstrate the power

  12. cDNA for the human β2-adrenergic receptor: a protein with multiple membrane-spanning domains and encoded by a gene whose chromosomal location is shared with that of the receptor for platelet-derived growth factor

    International Nuclear Information System (INIS)

    Kobilka, B.K.; Dixon, R.A.F.; Frielle, T.

    1987-01-01

    The authors have isolated and sequenced a cDNA encoding the human β 2 -adrenergic receptor. The deduced amino acid sequence (413 residues) is that of a protein containing seven clusters of hydrophobic amino acids suggestive of membrane-spanning domains. While the protein is 87% identical overall with the previously cloned hamster β 2 -adrenergic receptor, the most highly conserved regions are the putative transmembrane helices (95% identical) and cytoplasmic loops (93% identical), suggesting that these regions of the molecule harbor important functional domains. Several of the transmembrane helices also share lesser degrees of identity with comparable regions of select members of the opsin family of visual pigments. They have localized the gene for the β 2 -adrenergic receptor to q31-q32 on chromosome 5. This is the same position recently determined for the gene encoding the receptor for platelet-derived growth factor and is adjacent to that for the FMS protooncogene, which encodes the receptor for the macrophage colony-stimulating factor

  13. The complete sequence of human chromosome 5

    Energy Technology Data Exchange (ETDEWEB)

    Schmutz, Jeremy; Martin, Joel; Terry, Astrid; Couronne, Olivier; Grimwood, Jane; Lowry, State; Gordon, Laurie A.; Scott, Duncan; Xie, Gary; Huang, Wayne; Hellsten, Uffe; Tran-Gyamfi, Mary; She, Xinwei; Prabhakar, Shyam; Aerts, Andrea; Altherr, Michael; Bajorek, Eva; Black, Stacey; Branscomb, Elbert; Caoile, Chenier; Challacombe, Jean F.; Chan, Yee Man; Denys, Mirian; Detter, Chris; Escobar, Julio; Flowers, Dave; Fotopulos, Dea; Glavina, Tijana; Gomez, Maria; Gonzales, Eidelyn; Goodstenin, David; Grigoriev, Igor; Groza, Matthew; Hammon, Nancy; Hawkins, Trevor; Haydu, Lauren; Israni, Sanjay; Jett, Jamie; Kadner, Kristen; Kimbal, Heather; Kobayashi, Arthur; Lopez, Frederick; Lou, Yunian; Martinez, Diego; Medina, Catherine; Morgan, Jenna; Nandkeshwar, Richard; Noonan, James P.; Pitluck, Sam; Pollard, Martin; Predki, Paul; Priest, James; Ramirez, Lucia; Rash, Sam; Retterer, James; Rodriguez, Alex; Rogers, Stephanie; Salamov, Asaf; Salazar, Angelica; Thayer, Nina; Tice, Hope; Tsai, Ming; Ustaszewska, Anna; Vo, Nu; Wheeler, Jeremy; Wu, Kevin; Yang, Joan; Dickson, Mark; Cheng, Jan-Fang; Eichler, Evan E.; Olsen, Anne; Pennacchio, Len A.; Rokhsar, Daniel S.; Richardson, Paul; Lucas, Susan M.; Myers, Richard M.; Rubin, Edward M.

    2004-04-15

    Chromosome 5 is one of the largest human chromosomes yet has one of the lowest gene densities. This is partially explained by numerous gene-poor regions that display a remarkable degree of noncoding and syntenic conservation with non-mammalian vertebrates, suggesting they are functionally constrained. In total, we compiled 177.7 million base pairs of highly accurate finished sequence containing 923 manually curated protein-encoding genes including the protocadherin and interleukin gene families and the first complete versions of each of the large chromosome 5 specific internal duplications. These duplications are very recent evolutionary events and play a likely mechanistic role, since deletions of these regions are the cause of debilitating disorders including spinal muscular atrophy (SMA).

  14. Genome-Wide Screening of Genes Showing Altered Expression in Liver Metastases of Human Colorectal Cancers by cDNA Microarray

    Directory of Open Access Journals (Sweden)

    Rempei Yanagawa

    2001-01-01

    Full Text Available In spite of intensive and increasingly successful attempts to determine the multiple steps involved in colorectal carcinogenesis, the mechanisms responsible for metastasis of colorectal tumors to the liver remain to be clarified. To identify genes that are candidates for involvement in the metastatic process, we analyzed genome-wide expression profiles of 10 primary colorectal cancers and their corresponding metastatic lesions by means of a cDNA microarray consisting of 9121 human genes. This analysis identified 40 genes whose expression was commonly upregulated in metastatic lesions, and 7 that were commonly downregulated. The upregulated genes encoded proteins involved in cell adhesion, or remodeling of the actin cytoskeleton. Investigation of the functions of more of the altered genes should improve our understanding of metastasis and may identify diagnostic markers and/or novel molecular targets for prevention or therapy of metastatic lesions.

  15. Sequence-specific activation of the DNA sensor cGAS by Y-form DNA structures as found in primary HIV-1 cDNA.

    Science.gov (United States)

    Herzner, Anna-Maria; Hagmann, Cristina Amparo; Goldeck, Marion; Wolter, Steven; Kübler, Kirsten; Wittmann, Sabine; Gramberg, Thomas; Andreeva, Liudmila; Hopfner, Karl-Peter; Mertens, Christina; Zillinger, Thomas; Jin, Tengchuan; Xiao, Tsan Sam; Bartok, Eva; Coch, Christoph; Ackermann, Damian; Hornung, Veit; Ludwig, Janos; Barchet, Winfried; Hartmann, Gunther; Schlee, Martin

    2015-10-01

    Cytosolic DNA that emerges during infection with a retrovirus or DNA virus triggers antiviral type I interferon responses. So far, only double-stranded DNA (dsDNA) over 40 base pairs (bp) in length has been considered immunostimulatory. Here we found that unpaired DNA nucleotides flanking short base-paired DNA stretches, as in stem-loop structures of single-stranded DNA (ssDNA) derived from human immunodeficiency virus type 1 (HIV-1), activated the type I interferon-inducing DNA sensor cGAS in a sequence-dependent manner. DNA structures containing unpaired guanosines flanking short (12- to 20-bp) dsDNA (Y-form DNA) were highly stimulatory and specifically enhanced the enzymatic activity of cGAS. Furthermore, we found that primary HIV-1 reverse transcripts represented the predominant viral cytosolic DNA species during early infection of macrophages and that these ssDNAs were highly immunostimulatory. Collectively, our study identifies unpaired guanosines in Y-form DNA as a highly active, minimal cGAS recognition motif that enables detection of HIV-1 ssDNA.

  16. Generation and analysis of a large-scale expressed sequence Tag database from a full-length enriched cDNA library of developing leaves of Gossypium hirsutum L.

    Directory of Open Access Journals (Sweden)

    Min Lin

    Full Text Available BACKGROUND: Cotton (Gossypium hirsutum L. is one of the world's most economically-important crops. However, its entire genome has not been sequenced, and limited resources are available in GenBank for understanding the molecular mechanisms underlying leaf development and senescence. METHODOLOGY/PRINCIPAL FINDINGS: In this study, 9,874 high-quality ESTs were generated from a normalized, full-length cDNA library derived from pooled RNA isolated from throughout leaf development during the plant blooming stage. After clustering and assembly of these ESTs, 5,191 unique sequences, representative 1,652 contigs and 3,539 singletons, were obtained. The average unique sequence length was 682 bp. Annotation of these unique sequences revealed that 84.4% showed significant homology to sequences in the NCBI non-redundant protein database, and 57.3% had significant hits to known proteins in the Swiss-Prot database. Comparative analysis indicated that our library added 2,400 ESTs and 991 unique sequences to those known for cotton. The unigenes were functionally characterized by gene ontology annotation. We identified 1,339 and 200 unigenes as potential leaf senescence-related genes and transcription factors, respectively. Moreover, nine genes related to leaf senescence and eleven MYB transcription factors were randomly selected for quantitative real-time PCR (qRT-PCR, which revealed that these genes were regulated differentially during senescence. The qRT-PCR for three GhYLSs revealed that these genes express express preferentially in senescent leaves. CONCLUSIONS/SIGNIFICANCE: These EST resources will provide valuable sequence information for gene expression profiling analyses and functional genomics studies to elucidate their roles, as well as for studying the mechanisms of leaf development and senescence in cotton and discovering candidate genes related to important agronomic traits of cotton. These data will also facilitate future whole-genome sequence

  17. Cloning, sequence analysis, and expression of the large subunit of the human lymphocyte activation antigen 4F2

    International Nuclear Information System (INIS)

    Lumadue, J.A.; Glick, A.B.; Ruddle, F.H.

    1987-01-01

    Among the earliest expressed antigens on the surface of activated human lymphocytes is the surface antigen 4F2. The authors have used DNA-mediated gene transfer and fluorescence-activated cell sorting to obtain cell lines that contain the gene encoding the large subunit of the human 4F2 antigen in a mouse L-cell background. Human DNAs cloned from these cell lines were subsequently used as hybridization probes to isolate a full-length cDNA clone expressing 4F2. Sequence analysis of the coding region has revealed an amino acid sequence of 529 residues. Hydrophobicity plotting has predicted a probable structure for the protein that includes an external carboxyl terminus, an internal leader sequence, a single hydrophobic transmembrane domain, and two possible membrane-associated domains. The 4F2 cDNA detects a single 1.8-kilobase mRNA in T-cell and B-cell lines. RNA gel blot analysis of RNA derived from quiescent and serum-stimulated Swiss 3T3 fibroblasts reveals a cell-cycle modulation of 4F2 gene expression: the mRNA is present in quiescent fibroblasts but increases 8-fold 24-36 hr after stimulation, at the time of maximal DNA synthesis

  18. Cloning, sequence analysis, and expression of the large subunit of the human lymphocyte activation antigen 4F2

    Energy Technology Data Exchange (ETDEWEB)

    Lumadue, J.A.; Glick, A.B.; Ruddle, F.H.

    1987-12-01

    Among the earliest expressed antigens on the surface of activated human lymphocytes is the surface antigen 4F2. The authors have used DNA-mediated gene transfer and fluorescence-activated cell sorting to obtain cell lines that contain the gene encoding the large subunit of the human 4F2 antigen in a mouse L-cell background. Human DNAs cloned from these cell lines were subsequently used as hybridization probes to isolate a full-length cDNA clone expressing 4F2. Sequence analysis of the coding region has revealed an amino acid sequence of 529 residues. Hydrophobicity plotting has predicted a probable structure for the protein that includes an external carboxyl terminus, an internal leader sequence, a single hydrophobic transmembrane domain, and two possible membrane-associated domains. The 4F2 cDNA detects a single 1.8-kilobase mRNA in T-cell and B-cell lines. RNA gel blot analysis of RNA derived from quiescent and serum-stimulated Swiss 3T3 fibroblasts reveals a cell-cycle modulation of 4F2 gene expression: the mRNA is present in quiescent fibroblasts but increases 8-fold 24-36 hr after stimulation, at the time of maximal DNA synthesis.

  19. Molecular cloning of growth hormone encoding cDNA of Indian

    Indian Academy of Sciences (India)

    A modified rapid amplification of cDNA ends (RACE) strategy has been developed for cloning highly conserved cDNA sequences. Using this modified method, the growth hormone (GH) encoding cDNA sequences of Labeo rohita, Cirrhina mrigala and Catla catla have been cloned, characterized and overexpressed in ...

  20. An alternative method for cDNA cloning from surrogate eukaryotic cells transfected with the corresponding genomic DNA.

    Science.gov (United States)

    Hu, Lin-Yong; Cui, Chen-Chen; Song, Yu-Jie; Wang, Xiang-Guo; Jin, Ya-Ping; Wang, Ai-Hua; Zhang, Yong

    2012-07-01

    cDNA is widely used in gene function elucidation and/or transgenics research but often suitable tissues or cells from which to isolate mRNA for reverse transcription are unavailable. Here, an alternative method for cDNA cloning is described and tested by cloning the cDNA of human LALBA (human alpha-lactalbumin) from genomic DNA. First, genomic DNA containing all of the coding exons was cloned from human peripheral blood and inserted into a eukaryotic expression vector. Next, by delivering the plasmids into either 293T or fibroblast cells, surrogate cells were constructed. Finally, the total RNA was extracted from the surrogate cells and cDNA was obtained by RT-PCR. The human LALBA cDNA that was obtained was compared with the corresponding mRNA published in GenBank. The comparison showed that the two sequences were identical. The novel method for cDNA cloning from surrogate eukaryotic cells described here uses well-established techniques that are feasible and simple to use. We anticipate that this alternative method will have widespread applications.

  1. cDNA cloning and immunological characterization of the rye grass allergen Lol p I.

    Science.gov (United States)

    Perez, M; Ishioka, G Y; Walker, L E; Chesnut, R W

    1990-09-25

    The complete amino acid sequence of two "isoallergenic" forms of Lol p I, the major rye grass (Lolium perenne) pollen allergen, was deduced from cDNA sequence analysis. cDNA clones isolated from a Lolium perenne pollen library contained an open reading frame coding for a 240-amino acid protein. Comparison of the nucleotide and deduced amino acid sequence of two of these clones revealed four changes at the amino acid level and numerous nucleotide differences. Both clones contained one possible asparagine-linked glycosylation site. Northern blot analysis shows one RNA species of 1.2 kilobases. Based on the complete amino acid sequence of Lol p I, overlapping peptides covering the entire molecule were synthesized. Utilizing these peptides we have identified a determinant within the Lol p I molecule that is recognized by human leukocyte antigen class II-restricted T cells obtained from persons allergic to rye grass pollen.

  2. Structure and expression of human dihydropteridine reductase

    International Nuclear Information System (INIS)

    Lockyer, J.; Cook, R.G.; Milstien, S.; Kaufman, S.; Woo, S.L.C.; Ledley, F.D.

    1987-01-01

    Dihydropteridine reductase catalyzes the NADH-mediated reduction of quinonoid dihydrobiopterin and is an essential component of the pterindependent aromatic amino acid hydroxylating systems. A cDNA for human DHPR was isolated from a human liver cDNA library in the vector λgt11 using a monospecific antibody against sheep DHPR. The nucleic acid sequence and amino acid sequence of human DHPR were determined from a full-length clone. A 112 amino acid sequence of sheep DHPR was obtained by sequencing purified sheep DHPR. This sequence is highly homologous to the predicted amino acid sequence of the human protein. Gene transfer of the recombinant human DHPR into COS cells leads to expression of DHPR enzymatic activity. These results indicate that the cDNA clone identified by antibody screening is an authentic and full-length cDNA for human DHPR

  3. Molecular cloning of lupin leghemoglobin cDNA

    DEFF Research Database (Denmark)

    Konieczny, A; Jensen, E O; Marcker, K A

    1987-01-01

    Poly(A)+ RNA isolated from root nodules of yellow lupin (Lupinus luteus, var. Ventus) has been used as a template for the construction of a cDNA library. The ds cDNA was synthesized and inserted into the Hind III site of plasmid pBR 322 using synthetic Hind III linkers. Clones containing sequences...... specific for nodules were selected by differential colony hybridization using 32P-labeled cDNA synthesized either from nodule poly(A)+ RNA or from poly(A)+ RNA of uninfected root as probes. Among the recombinant plasmids, the cDNA gene for leghemoglobin was identified. The protein structure derived from...... its nucleotide sequence was consistent with known amino acid sequence of lupin Lb II. The cloned lupin Lb cDNA hybridized to poly(A)+ RNA from nodules only, which is in accordance with the general concept, that leghemoglobin is expressed exclusively in nodules. Udgivelsesdato: 1987-null...

  4. Microfluidic PCR Amplification and MiSeq Amplicon Sequencing Techniques for High-Throughput Detection and Genotyping of Human Pathogenic RNA Viruses in Human Feces, Sewage, and Oysters

    Directory of Open Access Journals (Sweden)

    Mamoru Oshiki

    2018-04-01

    Full Text Available Detection and genotyping of pathogenic RNA viruses in human and environmental samples are useful for monitoring the circulation and prevalence of these pathogens, whereas a conventional PCR assay followed by Sanger sequencing is time-consuming and laborious. The present study aimed to develop a high-throughput detection-and-genotyping tool for 11 human RNA viruses [Aichi virus; astrovirus; enterovirus; norovirus genogroup I (GI, GII, and GIV; hepatitis A virus; hepatitis E virus; rotavirus; sapovirus; and human parechovirus] using a microfluidic device and next-generation sequencer. Microfluidic nested PCR was carried out on a 48.48 Access Array chip, and the amplicons were recovered and used for MiSeq sequencing (Illumina, Tokyo, Japan; genotyping was conducted by homology searching and phylogenetic analysis of the obtained sequence reads. The detection limit of the 11 tested viruses ranged from 100 to 103 copies/μL in cDNA sample, corresponding to 101–104 copies/mL-sewage, 105–108 copies/g-human feces, and 102–105 copies/g-digestive tissues of oyster. The developed assay was successfully applied for simultaneous detection and genotyping of RNA viruses to samples of human feces, sewage, and artificially contaminated oysters. Microfluidic nested PCR followed by MiSeq sequencing enables efficient tracking of the fate of multiple RNA viruses in various environments, which is essential for a better understanding of the circulation of human pathogenic RNA viruses in the human population.

  5. Complete amino acid sequence of the human alpha 5 (IV) collagen chain and identification of a single-base mutation in exon 23 converting glycine 521 in the collagenous domain to cysteine in an Alport syndrome patient

    DEFF Research Database (Denmark)

    Zhou, J; Hertz, Jens Michael; Leinonen, A

    1992-01-01

    We have generated and characterized cDNA clones providing the complete amino acid sequence of the human type IV collagen chain whose gene has been shown to be mutated in X chromosome-linked Alport syndrome. The entire translation product has 1,685 amino acid residues. There is a 26-residue signal...

  6. Identification of human chromosome 22 transcribed sequences with ORF expressed sequence tags

    DEFF Research Database (Denmark)

    de Souza, S J; Camargo, A A; Briones, M R

    2000-01-01

    Transcribed sequences in the human genome can be identified with confidence only by alignment with sequences derived from cDNAs synthesized from naturally occurring mRNAs. We constructed a set of 250,000 cDNAs that represent partial expressed gene sequences and that are biased toward the central ...

  7. Characterization of gonadotrophin-releasing hormone precursor cDNA in the Old World mole-rat Cryptomys hottentotus pretoriae: high degree of identity with the New World guinea pig sequence.

    Science.gov (United States)

    Kalamatianos, T; du Toit, L; Hrabovszky, E; Kalló, I; Marsh, P J; Bennett, N C; Coen, C W

    2005-05-01

    Regulation of pituitary gonadotrophins by the decapeptide gonadotrophin-releasing hormone 1 (GnRH1) is crucial for the development and maintenance of reproductive functions. A common amino acid sequence for this decapeptide, designated as 'mammalian' GnRH, has been identified in all mammals thus far investigated with the exception of the guinea pig, in which there are two amino acid substitutions. Among hystricognath rodents, the members of the family Bathyergidae regulate reproduction in response to diverse cues. Thus, highveld mole-rats (Cryptomys hottentotus pretoriae) are social bathyergids in which breeding is restricted to a particular season in the dominant female, but continuously suppressed in subordinate colony members. Elucidation of reproductive control in these animals will be facilitated by characterization of their GnRH1 gene. A partial sequence of GnRH1 precursor cDNA was isolated and characterized. Comparative analysis revealed the highest degree of identity (86%) to guinea pig GnRH1 precursor mRNA. Nevertheless, the deduced amino acid sequence of the mole-rat decapeptide is identical to the 'mammalian' sequence rather than that of guinea pigs. Successful detection of GnRH1-synthesizing neurones using either a guinea pig GnRH1 riboprobe or an antibody against the 'mammalian' decapeptide is consistent with the guinea pig-like sequence for the precursor and the classic 'mammalian' form for the decapeptide. The high degree of identity in the GnRH1 precursor sequence between this Old World mole-rat and the New World guinea pig is consistent with the theory that caviomorphs and phiomorphs originated from a common ancestral line in the Palaeocene to mid Eocene, some 63-45 million years ago.

  8. A milk protein gene promoter directs the expression of human tissue plasminogen activator cDNA to the mammary gland in transgenic mice

    International Nuclear Information System (INIS)

    Pittius, C.W.; Hennighausen, L.; Lee, E.; Westphal, H.; Nicols, E.; Vitale, J.; Gordon, K.

    1988-01-01

    Whey acidic protein (WAP) is a major whey protein in mouse milk. Its gene is expressed in the lactating mammary gland and is inducible by steroid and peptide hormones. A series of transgenic mice containing a hybrid gene in which human tissue plasminogen activator (tPA) cDNA is under the control of the murine WAP gene promoter had previously been generated. In this study, 21 tissues from lactating and virgin transgenic female mice containing the WAP-tPA hybrid gene were screened for the distribution of murine WAP and human tPA transcripts. Like the endogenous WAP RNA, WAP-tPA RNA was expressed predominantly in mammary gland tissue and appeared to be inducible by lactation. Whereas WAP transcripts were not detected in 22 tissues of virgin mice, low levels of WAP-tPA RNA, which were not modulated during lactation, were found in tongue, kidney, and sublingual gland. These studies demonstrate that the WAP gene promoter can target the expression of a transgene to the mammary gland and that this expression is inducible during lactation

  9. Building the sequence map of the human pan-genome

    DEFF Research Database (Denmark)

    Li, Ruiqiang; Li, Yingrui; Zheng, Hancheng

    2010-01-01

    analysis of predicted genes indicated that the novel sequences contain potentially functional coding regions. We estimate that a complete human pan-genome would contain approximately 19-40 Mb of novel sequence not present in the extant reference genome. The extensive amount of novel sequence contributing...

  10. Cloning and analysis of the mouse Fanconi anemia group A cDNA and an overlapping penta zinc finger cDNA.

    Science.gov (United States)

    Wong, J C; Alon, N; Norga, K; Kruyt, F A; Youssoufian, H; Buchwald, M

    2000-08-01

    Despite the cloning of four disease-associated genes for Fanconi anemia (FA), the molecular pathogenesis of FA remains largely unknown. To study FA complementation group A using the mouse as a model system, we cloned and characterized the mouse homolog of the human FANCA cDNA. The mouse cDNA (Fanca) encodes a 161-kDa protein that shares 65% amino acid sequence identity with human FANCA. Fanca is located at the distal region of mouse chromosome 8 and has a ubiquitous pattern of expression in embryonic and adult tissues. Expression of the mouse cDNA in human FA-A cells restores the cellular drug sensitivity to normal levels. Thus, the expression pattern, protein structure, chromosomal location, and function of FANCA are conserved in the mouse. We also isolated a novel zinc finger protein, Zfp276, which has five C(2)H(2) domains. Interestingly, Zfp276 is situated in the Fanca locus, and the 3'UTR of its cDNA overlaps with the last four exons of Fanca in a tail-to-tail manner. Zfp276 is expressed in the same tissues as Fanca, but does not complement the mitomycin C (MMC)-sensitive phenotype of FA-A cells. The overlapping genomic organization between Zfp276 and Fanca may have relevance to the disease phenotype of FA. Copyright 2000 Academic Press.

  11. Sequencing and analysis of an Irish human genome.

    LENUS (Irish Health Repository)

    Tong, Pin

    2010-01-01

    Recent studies generating complete human sequences from Asian, African and European subgroups have revealed population-specific variation and disease susceptibility loci. Here, choosing a DNA sample from a population of interest due to its relative geographical isolation and genetic impact on further populations, we extend the above studies through the generation of 11-fold coverage of the first Irish human genome sequence.

  12. Complete Genome Sequence of the Human Gut Symbiont Roseburia hominis

    DEFF Research Database (Denmark)

    Travis, Anthony J.; Kelly, Denise; Flint, Harry J

    2015-01-01

    We report here the complete genome sequence of the human gut symbiont Roseburia hominis A2-183(T) (= DSM 16839(T) = NCIMB 14029(T)), isolated from human feces. The genome is represented by a 3,592,125-bp chromosome with 3,405 coding sequences. A number of potential functions contributing to host...

  13. Characteristics of MHC class I genes in house sparrows Passer domesticus as revealed by long cDNA transcripts and amplicon sequencing.

    Science.gov (United States)

    Karlsson, Maria; Westerdahl, Helena

    2013-08-01

    In birds the major histocompatibility complex (MHC) organization differs both among and within orders; chickens Gallus gallus of the order Galliformes have a simple arrangement, while many songbirds of the order Passeriformes have a more complex arrangement with larger numbers of MHC class I and II genes. Chicken MHC genes are found at two independent loci, classical MHC-B and non-classical MHC-Y, whereas non-classical MHC genes are yet to be verified in passerines. Here we characterize MHC class I transcripts (α1 to α3 domain) and perform amplicon sequencing using a next-generation sequencing technique on exon 3 from house sparrow Passer domesticus (a passerine) families. Then we use phylogenetic, selection, and segregation analyses to gain a better understanding of the MHC class I organization. Trees based on the α1 and α2 domain revealed a distinct cluster with short terminal branches for transcripts with a 6-bp deletion. Interestingly, this cluster was not seen in the tree based on the α3 domain. 21 exon 3 sequences were verified in a single individual and the average numbers within an individual were nine and five for sequences with and without a 6-bp deletion, respectively. All individuals had exon 3 sequences with and without a 6-bp deletion. The sequences with a 6-bp deletion have many characteristics in common with non-classical MHC, e.g., highly conserved amino acid positions were substituted compared with the other alleles, low nucleotide diversity and just a single site was subject to positive selection. However, these alleles also have characteristics that suggest they could be classical, e.g., complete linkage and absence of a distinct cluster in a tree based on the α3 domain. Thus, we cannot determine for certain whether or not the alleles with a 6-bp deletion are non-classical based on our present data. Further analyses on segregation patterns of these alleles in combination with dating the 6-bp deletion through MHC characterization across the

  14. Tiamulin inhibits human CYP3A4 activity in an NIH/3T3 cell line stably expressing CYP3A4 cDNA.

    Science.gov (United States)

    De Groene, E M; Nijmeijer, S M; Horbach, G J; Witkamp, R F

    1995-09-07

    Tiamulin is an antibiotic frequently used in veterinary medicine. The drug has been shown to produce clinically important interactions with other compounds that are administered simultaneously. An NIH/3T3 cell line, stably expressing human cytochrome P450 (EC 1.14.14.1) cDNA (CYP3A4), was used to study the effect of tiamulin on CYP3A4 activity. The 6 beta-hydroxylation activity of testosterone, which is increased in CYP3A4-expressing cells compared to vector-transfected cells, showed reduced activity after incubation with 1 microM tiamulin and was completely reduced to background level after incubation with 2, 5 and 10 microM tiamulin. The CYP3A4-expressing cell line was used in combination with a shuttle vector containing the bacterial lacZ' gene to study the effect of tiamulin on CYP3A4-mediated mutagenicity of aflatoxin B1. The mutation frequency of aflatoxin B1 could be completely inhibited by tiamulin in CYP3A4-expressing cells, but no effect was observed on the mutation frequency of the direct mutagen ethylmethanesulphonate. Western blotting of homogenates of the CYP3A4-expressing cell line showed stabilization of CYP3A4 protein after incubation with tiamulin, supporting the hypothesis that the mechanism of inhibition is by binding of tiamulin to the cytochrome.

  15. Anchoring a Defined Sequence to the 55' Ends of mRNAs : The Bolt to Clone Rare Full Length mRNAs and Generate cDNA Libraries porn a Few Cells.

    Science.gov (United States)

    Baptiste, J; Milne Edwards, D; Delort, J; Mallet, J

    1993-01-01

    Among numerous applications, the polymerase chain reaction (PCR) (1,2) provides a convenient means to clone 5' ends of rare mRNAs and to generate cDNA libraries from tissue available in amounts too low to be processed by conventional methods. Basically, the amplification of cDNAs by the PCR requires the availability of the sequences of two stretches of the molecule to be amplified. A sequence can easily be imposed at the 5' end of the first-strand cDNAs (corresponding to the 3' end of the mRNAs) by priming the reverse transcription with a specific primer (for cloning the 5' end of rare messenger) or with an oligonucleotide tailored with a poly (dT) stretch (for cDNA library construction), taking advantage of the poly (A) sequence that is located at the 3' end of mRNAs. Several strategies have been devised to tag the 3' end of the ss-cDNAs (corresponding to the 55' end of the mRNAs). We (3) and others have described strategies based on the addition of a homopolymeric dG (4,5) or dA (6,7) tail using terminal deoxyribonucleotide transferase (TdT) ("anchor-PCR" [4]). However, this strategy has important limitations. The TdT reaction is difficult to control and has a low efficiency (unpublished observations). But most importantly, the return primers containing a homopolymeric (dC or dT) tail generate nonspecific amplifications, a phenomenon that prevents the isolation of low abundance mRNA species and/or interferes with the relative abundance of primary clones in the library. To circumvent these drawbacks, we have used two approaches. First, we devised a strategy based on a cRNA enrichment procedure, which has been useful to eliminate nonspecific-PCR products and to allow detection and cloning of cDNAs of low abundance (3). More recently, to avoid the nonspecific amplification resulting from the annealing of the homopolymeric tail oligonucleotide, we have developed a novel anchoring strategy that is based on the ligation of an oligonucleotide to the 35' end of ss

  16. Primary structure of human pancreatic elastase 2 determined by sequence analysis of the cloned mRNA

    International Nuclear Information System (INIS)

    Fletcher, T.S.; Shen, W.F.; Largman, C.

    1987-01-01

    A cDNA encoding elastase 2 has been cloned from a human pancreatic cDNA library. The cDNA contains a translation initiation site and a poly(A) recognition site and encodes a protein of 269 amino acids, including a proposed 16-residue signal peptide. The amino acid sequence of the deduced mature protein contains a 12-residue activation peptide containing a cysteine at residue 1 similar to that of chymotryspin. The proposed active enzyme contains all of the characteristic active-site amino acids, including His-57, Asp-102, and Ser-195. The S1 binding pocket is bounded by Gly-216 and Ser-226, making this pocket intermediate in size between chymotrypsins and elastase 1 or protease E, consistent with the substrate specificity of elastase 2 for long-chain aliphatic or aromatic amino acids. Computer modeling studies using the amino acid sequence of elastase 2 superimposed on the X-ray structure of porcine elastase 1 suggest that a change of Gln-192 in elastase 1 to Asn-192 in elastase 2 may account for the lower catalytic efficiency of the latter enzyme. Several basic residues appear to be near the ends of the extended binding pocket of elastases which might serve to anchor the enzyme to the elastin substrate. These studies indicate that elastases 2 and elastase 1 both contain an Arg-65A as well as a basic dipeptide at 223/224 which is not present in chymotrypsins. In addition, Arg-217A is present in humaan elastase 2 but absent in rat pancreatic protein which has been proposed to be an elastase 2 on the basis of sequence homology, but which was not isolated during screening of rat pancreatic tissue extracts for elastolytic activity

  17. Amplification and chromosomal dispersion of human endogenous retroviral sequences

    International Nuclear Information System (INIS)

    Steele, P.E.; Martin, M.A.; Rabson, A.B.; Bryan, T.; O'Brien, S.J.

    1986-01-01

    Endogenous retroviral sequences have undergone amplification events involving both viral and flanking cellular sequences. The authors cloned members of an amplified family of full-length endogenous retroviral sequences. Genomic blotting, employing a flanking cellular DNA probe derived from a member of this family, revealed a similar array of reactive bands in both humans and chimpanzees, indicating that an amplification event involving retroviral and associated cellular DNA sequences occurred before the evolutionary separation of these two primates. Southern analyses of restricted somatic cell hybrid DNA preparations suggested that endogenous retroviral segments are widely dispersed in the human genome and that amplification and dispersion events may be linked

  18. Developmental and Subcellular Organization of Single-Cell C₄ Photosynthesis in Bienertia sinuspersici Determined by Large-Scale Proteomics and cDNA Assembly from 454 DNA Sequencing.

    Science.gov (United States)

    Offermann, Sascha; Friso, Giulia; Doroshenk, Kelly A; Sun, Qi; Sharpe, Richard M; Okita, Thomas W; Wimmer, Diana; Edwards, Gerald E; van Wijk, Klaas J

    2015-05-01

    Kranz C4 species strictly depend on separation of primary and secondary carbon fixation reactions in different cell types. In contrast, the single-cell C4 (SCC4) species Bienertia sinuspersici utilizes intracellular compartmentation including two physiologically and biochemically different chloroplast types; however, information on identity, localization, and induction of proteins required for this SCC4 system is currently very limited. In this study, we determined the distribution of photosynthesis-related proteins and the induction of the C4 system during development by label-free proteomics of subcellular fractions and leaves of different developmental stages. This was enabled by inferring a protein sequence database from 454 sequencing of Bienertia cDNAs. Large-scale proteome rearrangements were observed as C4 photosynthesis developed during leaf maturation. The proteomes of the two chloroplasts are different with differential accumulation of linear and cyclic electron transport components, primary and secondary carbon fixation reactions, and a triose-phosphate shuttle that is shared between the two chloroplast types. This differential protein distribution pattern suggests the presence of a mRNA or protein-sorting mechanism for nuclear-encoded, chloroplast-targeted proteins in SCC4 species. The combined information was used to provide a comprehensive model for NAD-ME type carbon fixation in SCC4 species.

  19. Expressed sequence tag analysis of adult human optic nerve for NEIBank: Identification of cell type and tissue markers

    Directory of Open Access Journals (Sweden)

    Peterson Katherine

    2009-09-01

    Full Text Available Abstract Background The optic nerve is a pure white matter central nervous system (CNS tract with an isolated blood supply, and is widely used in physiological studies of white matter response to various insults. We examined the gene expression profile of human optic nerve (ON and, through the NEIBANK online resource, to provide a resource of sequenced verified cDNA clones. An un-normalized cDNA library was constructed from pooled human ON tissues and was used in expressed sequence tag (EST analysis. Location of an abundant oligodendrocyte marker was examined by immunofluorescence. Quantitative real time polymerase chain reaction (qRT-PCR and Western analysis were used to compare levels of expression for key calcium channel protein genes and protein product in primate and rodent ON. Results Our analyses revealed a profile similar in many respects to other white matter related tissues, but significantly different from previously available ON cDNA libraries. The previous libraries were found to include specific markers for other eye tissues, suggesting contamination. Immune/inflammatory markers were abundant in the new ON library. The oligodendrocyte marker QKI was abundant at the EST level. Immunofluorescence revealed that this protein is a useful oligodendrocyte cell-type marker in rodent and primate ONs. L-type calcium channel EST abundance was found to be particularly low. A qRT-PCR-based comparative mammalian species analysis reveals that L-type calcium channel expression levels are significantly lower in primate than in rodent ON, which may help account for the class-specific difference in responsiveness to calcium channel blocking agents. Several known eye disease genes are abundantly expressed in ON. Many genes associated with normal axonal function, mRNAs associated with axonal transport, inflammation and neuroprotection are observed. Conclusion We conclude that the new cDNA library is a faithful representation of human ON and EST data

  20. The complete amino acid sequence of human erythrocyte diphosphoglycerate mutase.

    OpenAIRE

    Haggarty, N W; Dunbar, B; Fothergill, L A

    1983-01-01

    The complete amino acid sequence of human erythrocyte diphosphoglycerate mutase, comprising 239 residues, was determined. The sequence was deduced from the four cyanogen bromide fragments, and from the peptides derived from these fragments after digestion with a number of proteolytic enzymes. Comparison of this sequence with that of the yeast glycolytic enzyme, phosphoglycerate mutase, shows that these enzymes are 47% identical. Most, but not all, of the residues implicated as being important...

  1. [Whole cDNA sequence cloning and expression of chicken L-FABP gene and its relationship with lipid deposition of hybrid chickens].

    Science.gov (United States)

    Yu, Ying; Wang, Dong; Sun, Dong-Xiao; Xu, Gui-Yun; Li, Jun-Ying; Zhang, Yuan

    2011-07-01

    Liver fatty acid-binding protein (L-FABP) is closely related to intracellular transportation and deposition of lipids. A positive differential displayed fragment was found in the liver tissue among Silkie (CC), CAU-brown chicken (CD), and their reciprocal hybrids (CD and DC) at 8 weeks-old using differential display RT-PCR techniques (DDRT-PCR). Through recycling, sequencing, and alignment analysis, the fragment was identified as chicken liver fatty acid-binding protein gene (L-FABP, GenBank accession number AY321365). Reverse Northern dot blot and semi-quantitative RT-PCR revealed that the avian L-FABP gene was over-expressed in the liver tissue of the reciprocal hybrids (CD and DC) compared to their parental lines (CC and DD), which was consistent with the fact that higher abdomen fat weight and wider inter-muscular fat width observed in the reciprocal hybrids. Considering the higher expression of L-FABP may contribute to the increased lipid deposition in the hybrid chickens, the functional study of avian L-FABP is warranted in future.

  2. A human gut microbial gene catalogue established by metagenomic sequencing

    DEFF Research Database (Denmark)

    dos Santos, Marcelo Bertalan Quintanilha; Sicheritz-Pontén, Thomas; Nielsen, Henrik Bjørn

    2010-01-01

    To understand the impact of gut microbes on human health and well-being it is crucial to assess their genetic potential. Here we describe the Illumina-based metagenomic sequencing, assembly and characterization of 3.3 million non-redundant microbial genes, derived from 576.7 gigabases of sequence...

  3. Sequence and expression analysis of gaps in human chromosome 20

    DEFF Research Database (Denmark)

    Minocherhomji, Sheroy; Seemann, Stefan; Mang, Yuan

    2012-01-01

    /or overlap disease-associated loci, including the DLGAP4 locus. In this study, we sequenced ~99% of all three unfinished gaps on human chr 20, determined their complete genomic sizes and assessed epigenetic profiles using a combination of Sanger sequencing, mate pair paired-end high-throughput sequencing......The finished human genome-assemblies comprise several hundred un-sequenced euchromatic gaps, which may be rich in long polypurine/polypyrimidine stretches. Human chromosome 20 (chr 20) currently has three unfinished gaps remaining on its q-arm. All three gaps are within gene-dense regions and...... and chromatin, methylation and expression analyses. We found histone 3 trimethylated at Lysine 27 to be distributed across all three gaps in immortalized B-lymphocytes. In one gap, five novel CpG islands were predominantly hypermethylated in genomic DNA from peripheral blood lymphocytes and human cerebellum...

  4. Identification of cDNA encoding an additional α subunit of a human GTP-binding protein: Expression of three αi subtypes in human tissues and cell lines

    International Nuclear Information System (INIS)

    Kim, S.; Ang, S.L.; Bloch, D.B.; Bloch, K.D.; Kawahara, Y.; Tolman, C.; Lee, R.; Seidman, J.G.; Neer, E.J.

    1988-01-01

    The guanine nucleotide-binding proteins (G proteins), which mediate hormonal regulation of many membrane functions, are composed of α, β, and γ subunits. The authors have cloned and characterized cDNA from a human T-cell library encoding a form of α i that is different from the human α i subtypes previously reported. α i is the α subunit of a class of G proteins that inhibits adenylate cyclase and regulates other enzymes and ion channels. This cDNA encodes a polypeptide of 354 amino acids and is assigned to encode the α i-3 subtype of G proteins on the basis of its similarity to other α i -like cDNAs and the presence of a predicted site for ADP ribosylation by pertussis toxin. They have determined the expression of mRNA for this and two other subtypes of human α i (α i-1 and α i-2 ) in a variety of human fetal tissues and in human cell lines. All three α i subtypes were present in the tissues tested. However, analysis of individual cell types reveals specificity of α i-1 expression. mRNA for α i-1 is absent in T cells, B cells, and monocytes but is present in other cell lines. The finding of differential expression of α i-1 genes may permit characterization of distinct physiological roles for this α i subunit. mRNA for α i-2 and α i-3 was found in all the primary and transformed cell lines tested. Thus, some cells contain all three α i subtypes. This observation raises the question of how cells prevent cross talk among receptors that are coupled to effectors through such similar α proteins

  5. Analysis of cellular responses to aflatoxin B1 in yeast expressing human cytochrome P450 1A2 using cDNA microarrays

    International Nuclear Information System (INIS)

    Guo Yingying; Breeden, Linda L.; Fan, Wenhong; Zhao Lueping; Eaton, David L.; Zarbl, Helmut

    2006-01-01

    Aflatoxin B1 (AFB 1 ) is a potent human hepatotoxin and hepatocarcinogen produced by the mold Aspergillus flavus. In human, AFB 1 is bioactivated by cytochrome P450 (CYP450) enzymes, primarily CYP1A2, to the genotoxic epoxide that forms N 7 -guanine DNA adducts. To characterize the transcriptional responses to genotoxic insults from AFB 1 , a strain of Saccharomyces cerevisiae engineered to express human CYP1A2 was exposed to doses of AFB 1 that resulted in minimal lethality, but substantial genotoxicity. Flow cytometric analysis demonstrated a dose and time dependent S phase delay under the same treatment conditions, indicating a checkpoint response to DNA damage. Replicate cDNA microarray analyses of AFB 1 treated cells showed that about 200 genes were significantly affected by the exposure. The genes activated by AFB 1 -treatment included RAD51, DUN1 and other members of the DNA damage response signature reported in a previous study with methylmethane sulfonate and ionizing radiation [A.P. Gasch, M. Huang, S. Metzner, D. Botstein, S.J. Elledge, P.O. Brown, Genomic expression responses to DNA-damaging agents and the regulatory role of the yeast ATR homolog Mec1p, Mol. Biol. Cell 12 (2001) 2987-3003]. However, unlike previous studies using highly cytotoxic doses, environmental stress response genes [A.P. Gasch, P.T. Spellman, C.M. Kao, O. Carmel-Harel, M.B. Eisen, G. Storz, D. Botstein, P.O. Brown, Genomic expression programs in the response of yeast cells to environmental changes, Mol. Biol. Cell 11 (2000) 4241-4257] were largely unaffected by our dosing regimen. About half of the transcripts affected are also known to be cell cycle regulated. The most strongly repressed transcripts were those encoding the histone genes and a group of genes that are cell cycle regulated and peak in M phase and early G1. These include most of the known daughter-specific genes. The rapid and coordinated repression of histones and M/G1-specific transcripts cannot be explained by

  6. Analysis of cellular responses to aflatoxin B{sub 1} in yeast expressing human cytochrome P450 1A2 using cDNA microarrays

    Energy Technology Data Exchange (ETDEWEB)

    Guo Yingying [Departmental of Environmental and Occupational Health Sciences, University of Washington, Seattle, WA (United States); Fred Hutchinson Cancer Research Center, Seattle, WA (United States); Breeden, Linda L. [Fred Hutchinson Cancer Research Center, Seattle, WA (United States); Fan, Wenhong [Fred Hutchinson Cancer Research Center, Seattle, WA (United States); Zhao Lueping [Fred Hutchinson Cancer Research Center, Seattle, WA (United States); Eaton, David L. [Departmental of Environmental and Occupational Health Sciences, University of Washington, Seattle, WA (United States); Fred Hutchinson Cancer Research Center, Seattle, WA (United States); Zarbl, Helmut [Departmental of Environmental and Occupational Health Sciences, University of Washington, Seattle, WA (United States) and Fred Hutchinson Cancer Research Center, Seattle, WA (United States)]. E-mail: hzarbl@fhcrc.org

    2006-01-29

    Aflatoxin B1 (AFB{sub 1}) is a potent human hepatotoxin and hepatocarcinogen produced by the mold Aspergillus flavus. In human, AFB{sub 1} is bioactivated by cytochrome P450 (CYP450) enzymes, primarily CYP1A2, to the genotoxic epoxide that forms N{sup 7}-guanine DNA adducts. To characterize the transcriptional responses to genotoxic insults from AFB{sub 1}, a strain of Saccharomyces cerevisiae engineered to express human CYP1A2 was exposed to doses of AFB{sub 1} that resulted in minimal lethality, but substantial genotoxicity. Flow cytometric analysis demonstrated a dose and time dependent S phase delay under the same treatment conditions, indicating a checkpoint response to DNA damage. Replicate cDNA microarray analyses of AFB{sub 1} treated cells showed that about 200 genes were significantly affected by the exposure. The genes activated by AFB{sub 1}-treatment included RAD51, DUN1 and other members of the DNA damage response signature reported in a previous study with methylmethane sulfonate and ionizing radiation [A.P. Gasch, M. Huang, S. Metzner, D. Botstein, S.J. Elledge, P.O. Brown, Genomic expression responses to DNA-damaging agents and the regulatory role of the yeast ATR homolog Mec1p, Mol. Biol. Cell 12 (2001) 2987-3003]. However, unlike previous studies using highly cytotoxic doses, environmental stress response genes [A.P. Gasch, P.T. Spellman, C.M. Kao, O. Carmel-Harel, M.B. Eisen, G. Storz, D. Botstein, P.O. Brown, Genomic expression programs in the response of yeast cells to environmental changes, Mol. Biol. Cell 11 (2000) 4241-4257] were largely unaffected by our dosing regimen. About half of the transcripts affected are also known to be cell cycle regulated. The most strongly repressed transcripts were those encoding the histone genes and a group of genes that are cell cycle regulated and peak in M phase and early G1. These include most of the known daughter-specific genes. The rapid and coordinated repression of histones and M/G1-specific

  7. Comparison of Human and Guinea Pig Acetylcholinesterase Sequences and Rates of Oxime-Assisted Reactivation

    Science.gov (United States)

    2010-01-01

    of appropriate animal model systems. For OP poisoning, the guinea pig (Cavia porcellus) is a commonly used animal model because guinea pigs more...endogenous bioscavenger in vivo. Although guinea pigs historically have been used to test OP poisoning therapies, it has been found recently that guinea pig AChE...transcribed mRNA encoding guinea pig AChE, amplified the resulting cDNA, and sequenced this product. The nucleotide and deduced amino acid sequences of

  8. Accident sequence analysis of human-computer interface design

    International Nuclear Information System (INIS)

    Fan, C.-F.; Chen, W.-H.

    2000-01-01

    It is important to predict potential accident sequences of human-computer interaction in a safety-critical computing system so that vulnerable points can be disclosed and removed. We address this issue by proposing a Multi-Context human-computer interaction Model along with its analysis techniques, an Augmented Fault Tree Analysis, and a Concurrent Event Tree Analysis. The proposed augmented fault tree can identify the potential weak points in software design that may induce unintended software functions or erroneous human procedures. The concurrent event tree can enumerate possible accident sequences due to these weak points

  9. Human genome and genetic sequencing research and informed consent

    International Nuclear Information System (INIS)

    Iwakawa, Mayumi

    2003-01-01

    On March 29, 2001, the Ethical Guidelines for Human Genome and Genetic Sequencing Research were established. They have intended to serve as ethical guidelines for all human genome and genetic sequencing research practice, for the purpose of upholding respect for human dignity and rights and enforcing use of proper methods in the pursuit of human genome and genetic sequencing research, with the understanding and cooperation of the public. The RadGenomics Project has prepared a research protocol and informed consent document that follow these ethical guidelines. We have endeavored to protect the privacy of individual information, and have established a procedure for examination of research practices by an ethics committee. Here we report our procedure in order to offer this concept to the patients. (authors)

  10. Pseudogene of dihydrolipoyl succinyltransferase (E2k) found by PCR amplification and direct sequencing of rodent-human cell hybrid DNAs

    Energy Technology Data Exchange (ETDEWEB)

    Cai, X.; Ali, G.; Blass, J.P. [Cornell Univ. Medical College, White Plains, NY (United States); Szabo, P. [Cornell Univ. Medical College, New York, NY (United States); Tanzi, R.E. [Massachusetts General Hospital, Boston, MA (United States)

    1994-07-01

    Previous studies have indicated that the cDNA for the E2k component of the human {alpha}-ketoglutarate dehydrogenase complex (KGDHC) hybridized not only to a major locus on chromosome 14q24.3 in a region associated with familial Alzheimer`s disease and with Joseph-Machado disease, but also to another locus on chromosome 1p31. The authors now report that PCR of genomic DNA and direct sequencing indicated that the chromosome 1 locus is an intronless pseudogene. PCR of genomic DNA amplified E2k fragments from mouse-human cell hybrids containing human chromosome 1 DNA but not from hybrids containing human chromosome 14 DNA. The resulting amplicons were of comparable sizes to those when the cDNA was used to template. The direct sequencing of these amplicons confirmed the lack of introns and indicated a frame shift, which led to the presence of four termination codons early in the coding region. PCR followed by direct sequencing of the amplicons appears to be a convenient method for identifying intronless pseudogenes.

  11. Microbial Community Profiling of Human Saliva Using Shotgun Metagenomic Sequencing

    OpenAIRE

    Hasan, Nur A.; Young, Brian A.; Minard-Smith, Angela T.; Saeed, Kelly; Li, Huai; Heizer, Esley M.; McMillan, Nancy J.; Isom, Richard; Abdullah, Abdul Shakur; Bornman, Daniel M.; Faith, Seth A.; Choi, Seon Young; Dickens, Michael L.; Cebula, Thomas A.; Colwell, Rita R.

    2014-01-01

    Human saliva is clinically informative of both oral and general health. Since next generation shotgun sequencing (NGS) is now widely used to identify and quantify bacteria, we investigated the bacterial flora of saliva microbiomes of two healthy volunteers and five datasets from the Human Microbiome Project, along with a control dataset containing short NGS reads from bacterial species representative of the bacterial flora of human saliva. GENIUS, a system designed to identify and quantify ba...

  12. Complementary DNA and derived amino acid sequence of the α subunit of human complement protein C8: evidence for the existence of a separate α subunit messenger RNA

    International Nuclear Information System (INIS)

    Rao, A.G.; Howard, O.M.Z.; Ng, S.C.; Whitehead, A.S.; Colten, H.R.; Sodetz, J.M.

    1987-01-01

    The entire amino acid sequence of the α subunit (M/sub r/ 64,000) of the eight component of complement (C8) was determined by characterizing cDNA clones isolated from a human liver cDNA library. Two clones with overlapping inserts of net length 2.44 kilobases (kb) were isolated and found to contain the entire α coding region [1659 base pairs (bp)]. The 5' end consists of an untranslated region and a leader sequence of 30 amino acids. This sequence contains an apparent initiation Met, signal peptide, and propeptide which ends with an arginine-rich sequence that is characteristic of proteolytic processing sites found in the pro form of protein precursors. The 3' untranslated region contains two polyadenylation signals and a poly(A)sequence. RNA blot analysis of total cellular RNA from the human hepatoma cell line HepG2 revealed a message size of ∼2.5 kb. Features of the 5' and 3' sequences and the message size suggest that a separate mRNA codes for α and argues against the occurrence of a single-chain precursor form of the disulfide-linked α-λ subunit found in mature C8. Analysis of the derived amino acid sequence revealed several membrane surface seeking domains and a possible transmembrane domain. Analysis of the carbohydrate composition indicates 1 or 2 asparagine-linked but no O-linked oligosaccharide chains, a result consistent with predictions from the amino acid sequence. Most significantly, it exhibits a striking overall homology to human C9, with values of 24% on the basis of identity and 46% when conserved substitutions are allowed. As described in an accompanying report this homology also extends to the β subunit of C8

  13. Sequencing of 50 human exomes reveals adaptation to high altitude

    DEFF Research Database (Denmark)

    Yi, Xin; Liang, Yu; Huerta-Sanchez, Emilia

    2010-01-01

    Residents of the Tibetan Plateau show heritable adaptations to extreme altitude. We sequenced 50 exomes of ethnic Tibetans, encompassing coding sequences of 92% of human genes, with an average coverage of 18x per individual. Genes showing population-specific allele frequency changes, which repres...... in genetic adaptation to high altitude.......Residents of the Tibetan Plateau show heritable adaptations to extreme altitude. We sequenced 50 exomes of ethnic Tibetans, encompassing coding sequences of 92% of human genes, with an average coverage of 18x per individual. Genes showing population-specific allele frequency changes, which...... represent strong candidates for altitude adaptation, were identified. The strongest signal of natural selection came from endothelial Per-Arnt-Sim (PAS) domain protein 1 (EPAS1), a transcription factor involved in response to hypoxia. One single-nucleotide polymorphism (SNP) at EPAS1 shows a 78% frequency...

  14. Cloning of the cDNA for murine von Willebrand factor and identification of orthologous genes reveals the extent of conservation among diverse species.

    Science.gov (United States)

    Chitta, Mohan S; Duhé, Roy J; Kermode, John C

    2007-05-01

    Interaction of von Willebrand factor (VWF) with circulating platelets promotes hemostasis when a blood vessel is injured. The A1 domain of VWF is responsible for the initial interaction with platelets and is well conserved among species. Knowledge of the cDNA and genomic DNA sequences for human VWF allowed us to predict the cDNA sequence for murine VWF in silico and amplify its entire coding region by RT-PCR. The murine VWF cDNA has an open reading frame of 8,442 bp, encoding a protein of 2,813 amino acid residues with 83% identity to human pre-pro-VWF. The same strategy was used to predict in silico the cDNA sequence for the ortholog of VWF in a further six species. Many of these predictions diverged substantially from the putative Reference Sequences derived by ab initio methods. Our predicted sequences indicated that the VWF gene has a conserved structure of 52 exons in all seven mammalian species examined, as well as in the chicken. There is a minor structural variation in the pufferfish Takifugu rubripes insofar as the VWF gene in this species has 53 exons. Comparison of the translated amino acid sequences also revealed a high degree of conservation. In particular, the cysteine residues are conserved precisely throughout both the pro-peptide and the mature VWF sequence in all species, with a minor exception in the pufferfish VWF ortholog where two adjacent cysteine residues are omitted. The marked conservation of cysteine residues emphasizes the importance of the intricate pattern of disulfide bonds in governing the structure of pro-VWF and regulating the function of the mature VWF protein. It should also be emphasized that many of the conserved features of the VWF gene and protein were obscured when the comparison among species was based on the putative Reference Sequences instead of our predicted cDNA sequences.

  15. [cDNA library construction from panicle meristem of finger millet].

    Science.gov (United States)

    Radchuk, V; Pirko, Ia V; Isaenkov, S V; Emets, A I; Blium, Ia B

    2014-01-01

    The protocol for production of full-size cDNA using SuperScript Full-Length cDNA Library Construction Kit II (Invitrogen) was tested and high quality cDNA library from meristematic tissue of finger millet panicle (Eleusine coracana (L.) Gaertn) was created. The titer of obtained cDNA library comprised 3.01 x 10(5) CFU/ml in avarage. In average the length of cDNA insertion consisted about 1070 base pairs, the effectivity of cDNA fragment insertions--99.5%. The selective sequencing of cDNA clones from created library was performed. The sequences of cDNA clones were identified with usage of BLAST-search. The results of cDNA library analysis and selective sequencing represents prove good functionality and full length character of inserted cDNA clones. Obtained cDNA library from meristematic tissue of finger millet panicle represents good and valuable source for isolation and identification of key genes regulating metabolism and meristematic development and for mining of new molecular markers to conduct out high quality genetic investigations and molecular breeding as well.

  16. [Screening of phosphoprotein associated with glycosphingolipid microdomains 1 (PAG1) by cDNA microarray and influence of overexpression of PAG1 on biologic behavior of human metastatic prostatic cancer cell line in vitro].

    Science.gov (United States)

    Yu, Wen-juan; Wang, Yue-wei; Xie, Zhi-gang; You, Jiang-feng; Wang, Jie-liang; Cui, Xiang-lin; Pei, Fei; Zheng, Jie

    2010-02-01

    To screen for novel gene(s) associated with tumor metastasis, and to investigate the effect of overexpression of phosphoprotein associated with glycosphingolipid microdomains 1 (PAG1) on the biological behaviors of human prostatic cancer cell line PC-3M-1E8 in vitro. Four cDNA microarrays were constructed using cDNA library of prostatic cancer cells PC-3M-1E8 (high metastatic potential), PC-3M-2B4 (low metastatic potential), lung cancer cells PG-BE1 (high metastatic potential)and PG-LH7 (low metastatic potential)to screen genes which were differentially expressed according to their different metastatic properties. From a battery of differentially expressed genes, PAG1, which was markedly downregulated in both high metastatic sublines of PC-3M and PG was chosen for further investigation. Real-time PCR and Western blot were used to confirm the gene expression of PAG1 at mRNA and protein levels. Full-length coding sequence of human PAG1 was subcloned into plasmid pcDNA3.0 and the recombinant plasmids were stably transfected into PC-3M-1E8. The cell proliferation ability, anchorage-independent growth, cell cycle distribution, apoptosis rates and invasive ability were detected by MTT, and in addition, soft agar colony formation, flow cytometry analysis and matrigel invasion assay using Boyden chamber were also carried out respectively. All experiments contained pcDNA3.0-PAG1-transfected clones, vector transfected clones and non-transfected parental cells. A total of 327 differentially expressed genes were obtained between the high and low metastatic sublines of PC-3M cells, including 123 upregulated and 204 downregulated genes in PC-3M-1E8. A total of 281 genes, including 167 upregulated and 114 downregulated genes were obtained in PG-BE1 cells. Nine genes were simultaneously downregulated and 8 genes were upregulated in both high metastatic cell lines of PC-3M and PG. The expression of PAG1 at mRNA and protein level were decreased in the high metastatic subline PC-3M-1

  17. A new approach for cloning hLIF cDNA from genomic DNA isolated from the oral mucous membrane.

    Science.gov (United States)

    Cui, Y H; Zhu, G Q; Chen, Q J; Wang, Y F; Yang, M M; Song, Y X; Wang, J G; Cao, B Y

    2011-11-25

    Complementary DNA (cDNA) is valuable for investigating protein structure and function in the study of life science, but it is difficult to obtain by traditional reverse transcription. We employed a novel strategy to clone human leukemia inhibitory factor (hLIF) gene cDNA from genomic DNA, which was directly isolated from the mucous membrane of mouth. The hLIF sequence, which is 609 bp long and is composed of three exons, can be acquired within a few hours by amplifying each exon and splicing all of them using overlap-PCR. This new approach developed is simple, time- and cost-effective, without RNA preparation or cDNA synthesis, and is not limited to the specific tissues for a particular gene and the expression level of the gene.

  18. Molecular cloning of cDNAs of human liver and placenta NADH-cytochrome b5 reductase

    International Nuclear Information System (INIS)

    Yubisui, T.; Naitoh, Y.; Zenno, S.; Tamura, M.; Takeshita, M.; Sakaki, Y.

    1987-01-01

    A cDNA coding for human liver NADH-cytochrome b 5 reductase was cloned from a human liver cDNA library constructed in phage λgt11. The library was screened by using an affinity-purified rabbit antibody against NADH-cytochrome b 5 reductase of human erythrocytes. A cDNA about 1.3 kilobase pairs long was isolated. By using the cDNA as a probe, another cDNA (pb 5 R141) of 1817 base pairs was isolated that hybridized with a synthetic oligonucleotide encoding Pro-Asp-Ile-Lys-Tyr-Pro, derived from the amino acid sequence at the amino-terminal region of the enzyme from human erythrocytes. Furthermore, by using the pb 5 R141 as a probe, cDNA clones having more 5' sequence were isolated from a human placenta cDNA library. The amino acid sequences deduced from the nucleotide sequences of these cDNA clones overlapped each other and consisted of a sequence that completely coincides with that of human erythrocytes and a sequence of 19 amino acid residues extended at the amino-terminal side. The latter sequence closely resembles that of the membrane-binding domain of steer liver microsomal enzyme

  19. Horse cDNA clones encoding two MHC class I genes

    Energy Technology Data Exchange (ETDEWEB)

    Barbis, D.P.; Maher, J.K.; Stanek, J.; Klaunberg, B.A.; Antczak, D.F.

    1994-12-31

    Two full-length clones encoding MHC class I genes were isolated by screening a horse cDNA library, using a probe encoding in human HLA-A2.2Y allele. The library was made in the pcDNA1 vector (Invitrogen, San Diego, CA), using mRNA from peripheral blood lymphocytes obtained from a Thoroughbred stallion (No. 0834) homozygous for a common horse MHC haplotype (ELA-A2, -B2, -D2; Antczak et al. 1984; Donaldson et al. 1988). The clones were sequenced, using SP6 and T7 universal primers and horse-specific oligonucleotides designed to extend previously determined sequences.

  20. The complete amino acid sequence of human erythrocyte diphosphoglycerate mutase.

    Science.gov (United States)

    Haggarty, N W; Dunbar, B; Fothergill, L A

    1983-01-01

    The complete amino acid sequence of human erythrocyte diphosphoglycerate mutase, comprising 239 residues, was determined. The sequence was deduced from the four cyanogen bromide fragments, and from the peptides derived from these fragments after digestion with a number of proteolytic enzymes. Comparison of this sequence with that of the yeast glycolytic enzyme, phosphoglycerate mutase, shows that these enzymes are 47% identical. Most, but not all, of the residues implicated as being important for the activity of the glycolytic mutase are conserved in the erythrocyte diphosphoglycerate mutase. PMID:6313356

  1. cDNA cloning and characterization of the human THRAP2 gene which maps to chromosome 12q24, and its mouse ortholog Thrap2.

    Science.gov (United States)

    Musante, Luciana; Bartsch, Oliver; Ropers, Hans-Hilger; Kalscheuer, Vera M

    2004-05-12

    Characterization of a balanced t(2;12)(q37;q24) translocation in a patient with suspicion of Noonan syndrome revealed that the chromosome 12 breakpoint lies in the vicinity of a novel human gene, thyroid hormone receptor-associated protein 2 (THRAP2). We therefore characterized this gene and its mouse counterpart in more detail. Human and mouse THRAP2/Thrap2 span a genomic region of about 310 and >170 kilobases (kb), and both contain 31 exons. Corresponding transcripts are approximately 9.5 kb long. Their open reading frames code for proteins of 2210 and 2203 amino acids, which are 93% identical. By northern blot analysis, human and mouse THRAP2/Thrap2 genes showed ubiquitous expression. Transcripts were most abundant in human skeletal muscle and in mouse heart. THRAP2 protein is 56% identical to human TRAP240, which belongs to the thyroid hormone receptor associated protein (TRAP) complex and is evolutionary conserved up to yeast. This complex is involved in transcriptional regulation and is believed to serve as adapting interface between regulatory proteins bound to specific DNA sequences and RNA polymerase II.

  2. Cloning and expression of cDNA coding for bouganin.

    Science.gov (United States)

    den Hartog, Marcel T; Lubelli, Chiara; Boon, Louis; Heerkens, Sijmie; Ortiz Buijsse, Antonio P; de Boer, Mark; Stirpe, Fiorenzo

    2002-03-01

    Bouganin is a ribosome-inactivating protein that recently was isolated from Bougainvillea spectabilis Willd. In this work, the cloning and expression of the cDNA encoding for bouganin is described. From the cDNA, the amino-acid sequence was deduced, which correlated with the primary sequence data obtained by amino-acid sequencing on the native protein. Bouganin is synthesized as a pro-peptide consisting of 305 amino acids, the first 26 of which act as a leader signal while the 29 C-terminal amino acids are cleaved during processing of the molecule. The mature protein consists of 250 amino acids. Using the cDNA sequence encoding the mature protein of 250 amino acids, a recombinant protein was expressed, purified and characterized. The recombinant molecule had similar activity in a cell-free protein synthesis assay and had comparable toxicity on living cells as compared to the isolated native bouganin.

  3. Mutation of miRNA target sequences during human evolution

    DEFF Research Database (Denmark)

    Gardner, Paul P; Vinther, Jeppe

    2008-01-01

    It has long-been hypothesized that changes in non-protein-coding genes and the regulatory sequences controlling expression could undergo positive selection. Here we identify 402 putative microRNA (miRNA) target sequences that have been mutated specifically in the human lineage and show that genes...... containing such deletions are more highly expressed than their mouse orthologs. Our findings indicate that some miRNA target mutations are fixed by positive selection and might have been involved in the evolution of human-specific traits....

  4. Ancient Human Genome Sequence of an Extinct Palaeo-Eskimo

    DEFF Research Database (Denmark)

    Rasmussen, Morten; Li, Yingrui; Lindgreen, Stinus

    2010-01-01

    We report here the genome sequence of an ancient human. Obtained from approximately 4,000-year-old permafrost-preserved hair, the genome represents a male individual from the first known culture to settle in Greenland. Sequenced to an average depth of 20x, we recover 79% of the diploid genome...... possible phenotypic characteristics of the individual that belonged to a culture whose location has yielded only trace human remains. We compare the high-confidence SNPs to those of contemporary populations to find the populations most closely related to the individual. This provides evidence...

  5. Constructing and detecting a cDNA library for mites.

    Science.gov (United States)

    Hu, Li; Zhao, YaE; Cheng, Juan; Yang, YuanJun; Li, Chen; Lu, ZhaoHui

    2015-10-01

    RNA extraction and construction of complementary DNA (cDNA) library for mites have been quite challenging due to difficulties in acquiring tiny living mites and breaking their hard chitin. The present study is to explore a better method to construct cDNA library for mites that will lay the foundation on transcriptome and molecular pathogenesis research. We selected Psoroptes cuniculi as an experimental subject and took the following steps to construct and verify cDNA library. First, we combined liquid nitrogen grinding with TRIzol for total RNA extraction. Then, switching mechanism at 5' end of the RNA transcript (SMART) technique was used to construct full-length cDNA library. To evaluate the quality of cDNA library, the library titer and recombination rate were calculated. The reliability of cDNA library was detected by sequencing and analyzing positive clones and genes amplified by specific primers. The results showed that the RNA concentration was 836 ng/μl and the absorbance ratio at 260/280 nm was 1.82. The library titer was 5.31 × 10(5) plaque-forming unit (PFU)/ml and the recombination rate was 98.21%, indicating that the library was of good quality. In the 33 expressed sequence tags (ESTs) of P. cuniculi, two clones of 1656 and 1658 bp were almost identical with only three variable sites detected, which had an identity of 99.63% with that of Psoroptes ovis, indicating that the cDNA library was reliable. Further detection by specific primers demonstrated that the 553-bp Pso c II gene sequences of P. cuniculi had an identity of 98.56% with those of P. ovis, confirming that the cDNA library was not only reliable but also feasible.

  6. Cloning of cDNA for a prolactin-inducible protein (PIP) and studies on the hormonal control of PIP gene expression in T47D human breast cancer cells

    International Nuclear Information System (INIS)

    Murphy, L.; Myal, Y.; Tsuyuki, D.; Shiu, R.

    1986-01-01

    Recently in this laboratory it was shown that in the human breast cancer cell line T47D, human prolactin of human growth hormone in the presence of hydrocortisone induced the synthesis and secretion of PIP's, a family of proteins which differed only in their degree of glycosylation. This finding represented the first demonstration of an inductin of specific proteins by prolactin in human target cells and has provided us with a unique model in which to study the molecular mechanism of multihormonal actions as well as the possible significance of prolactin in human breast cancer. In order to facilitate their studies the authors cloned PIP cDNA. The strategy chosen and the methods used are described in this article

  7. Identification of failure sequences sensitive to human error

    International Nuclear Information System (INIS)

    1987-06-01

    This report prepared by the participants of the technical committee meeting on ''Identification of Failure Sequences Sensitive to Human Error'' addresses the subjects discussed during the meeting and the conclusions reached by the committee. Chapter 1 reviews the INSAG recommendations and the main elements of the IAEA Programme in the area of human element. In Chapter 2 the role of human actions in nuclear power plants safety from insights of operational experience is reviewed. Chapter 3 is concerned with the relationship between probabilistic safety assessment and human performance associated with severe accident sequences. Chapter 4 addresses the role of simulators in view of training for accident conditions. Chapter 5 presents the conclusions and future trends. The seven papers presented by members of this technical committee are also included in this technical document. A separate abstract was prepared for each of these papers

  8. Technique for human-error sequence identification and signification

    International Nuclear Information System (INIS)

    Heslinga, G.

    1988-01-01

    The aim of the present study was to investigate whether the event-tree technique can be used for the analysis of sequences of human errors that could cause initiating events. The scope of the study was limited to a consideration of the performance of procedural actions. The event-tree technique was modified to adapt it for this study and will be referred to as the 'Technique for Human-Error-Sequence Identification and Signification' (THESIS). The event trees used in this manner, i.e. THESIS event trees, appear to present additional problems if they are applied to human performance instead of technical systems. These problems, referred to as the 'Man-Related Features' of THESIS, are: the human capability to choose among several procedures, the ergonomics of the panel layout, human actions of a continuous nature, dependence between human errors, human capability to recover possible errors, the influence of memory during the recovery attempt, variability in human performance and correlations between human;erropr probabilities. The influence of these problems on the applicability of THESIS was assessed by means of mathematical analysis, field studies and laboratory experiments (author). 130 refs.; 51 figs.; 24 tabs

  9. Skeleton-based human action recognition using multiple sequence alignment

    Science.gov (United States)

    Ding, Wenwen; Liu, Kai; Cheng, Fei; Zhang, Jin; Li, YunSong

    2015-05-01

    Human action recognition and analysis is an active research topic in computer vision for many years. This paper presents a method to represent human actions based on trajectories consisting of 3D joint positions. This method first decompose action into a sequence of meaningful atomic actions (actionlets), and then label actionlets with English alphabets according to the Davies-Bouldin index value. Therefore, an action can be represented using a sequence of actionlet symbols, which will preserve the temporal order of occurrence of each of the actionlets. Finally, we employ sequence comparison to classify multiple actions through using string matching algorithms (Needleman-Wunsch). The effectiveness of the proposed method is evaluated on datasets captured by commodity depth cameras. Experiments of the proposed method on three challenging 3D action datasets show promising results.

  10. The DNA sequence, annotation and analysis of human chromosome 3

    DEFF Research Database (Denmark)

    Muzny, D.M.; Bolund, Lars; As part of the Chinese Human Genome Sequencing Consortium, E.T.A.L.

    2006-01-01

    as numerous loci involved in multiple human cancers such as the gene encoding FHIT, which contains the most common constitutive fragile site in the genome, FRA3B. Using genomic sequence from chimpanzee and rhesus macaque, we were able to characterize the breakpoints defining a large pericentric inversion...

  11. Templated sequence insertion polymorphisms in the human genome

    Science.gov (United States)

    Onozawa, Masahiro; Aplan, Peter

    2016-11-01

    Templated Sequence Insertion Polymorphism (TSIP) is a recently described form of polymorphism recognized in the human genome, in which a sequence that is templated from a distant genomic region is inserted into the genome, seemingly at random. TSIPs can be grouped into two classes based on nucleotide sequence features at the insertion junctions; Class 1 TSIPs show features of insertions that are mediated via the LINE-1 ORF2 protein, including 1) target-site duplication (TSD), 2) polyadenylation 10-30 nucleotides downstream of a “cryptic” polyadenylation signal, and 3) preference for insertion at a 5’-TTTT/A-3’ sequence. In contrast, class 2 TSIPs show features consistent with repair of a DNA double-strand break via insertion of a DNA “patch” that is derived from a distant genomic region. Survey of a large number of normal human volunteers demonstrates that most individuals have 25-30 TSIPs, and that these TSIPs track with specific geographic regions. Similar to other forms of human polymorphism, we suspect that these TSIPs may be important for the generation of human diversity and genetic diseases.

  12. Genome Sequence of Novel Human Parechovirus Type 17

    OpenAIRE

    B?ttcher, Sindy; Obermeier, Patrick E.; Diedrich, Sabine; Kabor?, Yolande; D?Alfonso, Rossella; Pfister, Herbert; Kaiser, Rolf; Di Cristanziano, Veronica

    2017-01-01

    ABSTRACT Human parechoviruses (HPeV) circulate worldwide, causing a broad variety of symptoms, preferentially in early childhood. We report here the nearly complete genome sequence of a novel HPeV type, consisting of 7,062 nucleotides and encoding 2,179?amino acids. M36/CI/2014 was taxonomically classified as HPeV-17 by the picornavirus study group.

  13. Method for construction of normalized cDNA libraries

    Science.gov (United States)

    Soares, Marcelo B.; Efstratiadis, Argiris

    1998-01-01

    This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3' noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to appropriate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library. This invention also provides normalized cDNA libraries generated by the above-described method and uses of the generated libraries.

  14. Cloning and sequencing of the casein kinase 2 alpha subunit from Zea mays

    DEFF Research Database (Denmark)

    Dobrowolska, G; Boldyreff, B; Issinger, O G

    1991-01-01

    The nucleotide sequence of the cDNA coding for the alpha subunit of casein kinase 2 of Zea mays has been determined. The cDNA clone contains an open reading frame of 996 nucleotides encoding a polypeptide comprising 332 amino acids. The primary amino acid sequence exhibits 75% identity to the alpha...... subunit and 71% identity to the alpha' subunit of human casein kinase 2....

  15. The Complete Sequence of a Human Parainfluenzavirus 4 Genome

    Science.gov (United States)

    Yea, Carmen; Cheung, Rose; Collins, Carol; Adachi, Dena; Nishikawa, John; Tellier, Raymond

    2009-01-01

    Although the human parainfluenza virus 4 (HPIV4) has been known for a long time, its genome, alone among the human paramyxoviruses, has not been completely sequenced to date. In this study we obtained the first complete genomic sequence of HPIV4 from a clinical isolate named SKPIV4 obtained at the Hospital for Sick Children in Toronto (Ontario, Canada). The coding regions for the N, P/V, M, F and HN proteins show very high identities (95% to 97%) with previously available partial sequences for HPIV4B. The sequence for the L protein and the non-coding regions represent new information. A surprising feature of the genome is its length, more than 17 kb, making it the longest genome within the genus Rubulavirus, although the length is well within the known range of 15 kb to 19 kb for the subfamily Paramyxovirinae. The availability of a complete genomic sequence will facilitate investigations on a respiratory virus that is still not completely characterized. PMID:21994536

  16. The Complete Sequence of a Human Parainfluenzavirus 4 Genome

    Directory of Open Access Journals (Sweden)

    Carmen Yea

    2009-06-01

    Full Text Available Although the human parainfluenza virus 4 (HPIV4 has been known for a long time, its genome, alone among the human paramyxoviruses, has not been completely sequenced to date. In this study we obtained the first complete genomic sequence of HPIV4 from a clinical isolate named SKPIV4 obtained at the Hospital for Sick Children in Toronto (Ontario, Canada. The coding regions for the N, P/V, M, F and HN proteins show very high identities (95% to 97% with previously available partial sequences for HPIV4B. The sequence for the L protein and the non-coding regions represent new information. A surprising feature of the genome is its length, more than 17 kb, making it the longest genome within the genus Rubulavirus, although the length is well within the known range of 15 kb to 19 kb for the subfamily Paramyxovirinae. The availability of a complete genomic sequence will facilitate investigations on a respiratory virus that is still not completely characterized.

  17. Human acid β-glucosidase: isolation and amino acid sequence of a peptide containing the catalytic site

    International Nuclear Information System (INIS)

    Dinur, T.; Osiecki, K.M.; Legler, G.; Gatt, S.; Desnick, R.J.; Grabowski, G.A.

    1986-01-01

    Human acid β-glucosidase (D-glucosyl-N-acylsphingosine glucohydrolase, EC 3.2.1.45) cleaves the glucosidic bonds of glucosylceramide and synthetic β-glucosides. The deficient activity of this hydrolase is the enzymatic defect in the subtypes and variants of Gaucher disease, the most prevalent lysosomal storage disease. To isolate and characterize the catalytic site of the normal enzyme, brominated 3 H-labeled conduritol B epoxide ( 3 H-Br-CBE), which inhibits the enzyme by binding covalently to this site, was used as an affinity label. Under optimal conditions 1 mol of 3 H-Br-CBE bound to 1 mol of pure enzyme protein, indicating the presence of a single catalytic site per enzyme subunit. After V 8 protease digestion of the 3 H-Br-CBE-labeled homogeneous enzyme, three radiolabeled peptides, designated peptide A, B, or C, were resolved by reverse-phase HPLC. The partial amino acid sequence (37 residues) of peptide A (M/sub r/, 5000) was determined. The sequence of this peptide, which contained the catalytic site, had exact homology to the sequence near the carboxyl terminus of the protein, as predicted from the nucleotide sequence of the full-length cDNA encoding acid β-glucosidase

  18. Topology of genes and nontranscribed sequences in human interphase nuclei

    International Nuclear Information System (INIS)

    Scheuermann, Markus O.; Tajbakhsh, Jian; Kurz, Anette; Saracoglu, Kaan; Eils, Roland; Lichter, Peter

    2004-01-01

    Knowledge about the functional impact of the topological organization of DNA sequences within interphase chromosome territories is still sparse. Of the few analyzed single copy genomic DNA sequences, the majority had been found to localize preferentially at the chromosome periphery or to loop out from chromosome territories. By means of dual-color fluorescence in situ hybridization (FISH), immunolabeling, confocal microscopy, and three-dimensional (3D) image analysis, we analyzed the intraterritorial and nuclear localization of 10 genomic fragments of different sequence classes in four different human cell types. The localization of three muscle-specific genes FLNA, NEB, and TTN, the oncogene BCL2, the tumor suppressor gene MADH4, and five putatively nontranscribed genomic sequences was predominantly in the periphery of the respective chromosome territories, independent from transcriptional status and from GC content. In interphase nuclei, the noncoding sequences were only rarely found associated with heterochromatic sites marked by the satellite III DNA D1Z1 or clusters of mammalian heterochromatin proteins (HP1α, HP1β, HP1γ). However, the nontranscribed sequences were found predominantly at the nuclear periphery or at the nucleoli, whereas genes tended to localize on chromosome surfaces exposed to the nuclear interior

  19. Primary structure of human pancreatic protease E determined by sequence analysis of the cloned mRNA

    International Nuclear Information System (INIS)

    Shen, W.; Fletcher, T.S.; Largman, C.

    1987-01-01

    Although protease E was isolated from human pancreas over 10 years ago, its amino acid sequence and relationship to the elastases have not been established. The authors report the isolation of a cDNA clone for human pancreatic protease E and determination of the nucleic acid sequence coding for the protein. The deduced amino acid sequence contains all of the features common to serine proteases. The substrate binding region is highly homologous to those of porcine and rat elastases 1, explaining the similar specificity for alanine reported for protease E and these elastases. However, the amino acid sequence outside the substrate binding region is less than 50% conserved, and there is a striking difference in the overall net charge for protease E (6-) and elastases 1 (8+). These findings confirm that protease E is a new member of the serine protease family. They have attempted to identify amino acid residues important for the interaction between elastases and elastin by examining the amino acid sequence differences between elastases and protease E. In addition to the large number of surface charge changes which are outside the substrate binding region, there are several changes which might be crucial for elastolysis: Leu-73/Arg-73; Arg-217A/Ala-217A; Arg-65A/Gln-65A; and the presence of two new cysteine residues (Cys-98 and Cys-99B) which computer modeling studies predict could form a new disulfide bond, not previously observed for serine proteases. They also present evidence which suggests that human pancreas does not synthesize a basic, alanine-specific elastase similar to porcine elastase 1

  20. Nucleotide sequence of the gene coding for human factor VII, a vitamin K-dependent protein participating in blood coagulation

    International Nuclear Information System (INIS)

    O'Hara, P.J.; Grant, F.J.; Haldeman, B.A.; Gray, C.L.; Insley, M.Y.; Hagen, F.S.; Murray, M.J.

    1987-01-01

    Activated factor VII (factor VIIa) is a vitamin K-dependent plasma serine protease that participates in a cascade of reactions leading to the coagulation of blood. Two overlapping genomic clones containing sequences encoding human factor VII were isolated and characterized. The complete sequence of the gene was determined and found to span about 12.8 kilobases. The mRNA for factor VII as demonstrated by cDNA cloning is polyadenylylated at multiple sites but contains only one AAUAAA poly(A) signal sequence. The mRNA can undergo alternative splicing, forming one transcript containing eight segments as exons and another with an additional exon that encodes a larger prepro leader sequence. The latter transcript has no known counterpart in the other vitamin K-dependent proteins. The positions of the introns with respect to the amino acid sequence encoded by the eight essential exons of factor VII are the same as those present in factor IX, factor X, protein C, and the first three exons of prothrombin. These exons code for domains generally conserved among members of this gene family. The comparable introns in these genes, however, are dissimilar with respect to size and sequence, with the exception of intron C in factor VII and protein C. The gene for factor VII also contains five regions made up of tandem repeats of oligonucleotide monomer elements. More than a quarter of the intron sequences and more than a third of the 3' untranslated portion of the mRNA transcript consist of these minisatellite tandem repeats

  1. Nucleotide sequence of a human tRNA gene heterocluster

    International Nuclear Information System (INIS)

    Chang, Y.N.; Pirtle, I.L.; Pirtle, R.M.

    1986-01-01

    Leucine tRNA from bovine liver was used as a hybridization probe to screen a human gene library harbored in Charon-4A of bacteriophage lambda. The human DNA inserts from plaque-pure clones were characterized by restriction endonuclease mapping and Southern hybridization techniques, using both [3'- 32 P]-labeled bovine liver leucine tRNA and total tRNA as hybridization probes. An 8-kb Hind III fragment of one of these γ-clones was subcloned into the Hind III site of pBR322. Subsequent fine restriction mapping and DNA sequence analysis of this plasmid DNA indicated the presence of four tRNA genes within the 8-kb DNA fragment. A leucine tRNA gene with an anticodon of AAG and a proline tRNA gene with an anticodon of AGG are in a 1.6-kb subfragment. A threonine tRNA gene with an anticodon of UGU and an as yet unidentified tRNA gene are located in a 1.1-kb subfragment. These two different subfragments are separated by 2.8 kb. The coding regions of the three sequenced genes contain characteristic internal split promoter sequences and do not have intervening sequences. The 3'-flanking region of these three genes have typical RNA polymerase III termination sites of at least four consecutive T residues

  2. Cloning and sequence of the human adrenodoxin reductase gene

    International Nuclear Information System (INIS)

    Lin, Dong; Shi, Y.; Miller, W.L.

    1990-01-01

    Adrenodoxin reductase is a flavoprotein mediating electron transport to all mitochondrial forms of cytochrome P450. The authors cloned the human adrenodoxin reductase gene and characterized it by restriction endonuclease mapping and DNA sequencing. The entire gene is approximately 12 kilobases long and consists of 12 exons. The first exon encodes the first 26 of the 32 amino acids of the signal peptide, and the second exon encodes the remainder of signal peptide and the apparent FAD binding site. The remaining 10 exons are clustered in a region of only 4.3 kilobases, separated from the first two exons by a large intron of about 5.6 kilobases. Two forms of human adrenodoxin reductase mRNA, differing by the presence or absence of 18 bases in the middle of the sequence, arise from alternate splicing at the 5' end of exon 7. This alternately spliced region is directly adjacent to the NADPH binding site, which is entirely contained in exon 6. The immediate 5' flanking region lacks TATA and CAAT boxes; however, this region is rich in G+C and contains six copies of the sequence GGGCGGG, resembling promoter sequences of housekeeping genes. RNase protection experiments show that transcription is initiated from multiple sites in the 5' flanking region, located about 21-91 base pairs upstream from the AUG translational initiation codon

  3. The sequence and analysis of duplication rich human chromosome 16

    Energy Technology Data Exchange (ETDEWEB)

    Martin, Joel; Han, Cliff; Gordon, Laurie A.; Terry, Astrid; Prabhakar, Shyam; She, Xinwei; Xie, Gary; Hellsten, Uffe; Man Chan, Yee; Altherr, Michael; Couronne, Olivier; Aerts, Andrea; Bajorek, Eva; Black, Stacey; Blumer, Heather; Branscomb, Elbert; Brown, Nancy C.; Bruno, William J.; Buckingham, Judith M.; Callen, David F.; Campbell, Connie S.; Campbell, Mary L.; Campbell, Evelyn W.; Caoile, Chenier; Challacombe, Jean F.; Chasteen, Leslie A.; Chertkov, Olga; Chi, Han C.; Christensen, Mari; Clark, Lynn M.; Cohn, Judith D.; Denys, Mirian; Detter, John C.; Dickson, Mark; Dimitrijevic-Bussod, Mira; Escobar, Julio; Fawcett, Joseph J.; Flowers, Dave; Fotopulos, Dea; Glavina, Tijana; Gomez, Maria; Gonzales, Eidelyn; Goodstein, David; Goodwin, Lynne A.; Grady, Deborah L.; Grigoriev, Igor; Groza, Matthew; Hammon, Nancy; Hawkins, Trevor; Haydu, Lauren; Hildebrand, Carl E.; Huang, Wayne; Israni, Sanjay; Jett, Jamie; Jewett, Phillip E.; Kadner, Kristen; Kimball, Heather; Kobayashi, Arthur; Krawczyk, Marie-Claude; Leyba, Tina; Longmire, Jonathan L.; Lopez, Frederick; Lou, Yunian; Lowry, Steve; Ludeman, Thom; Mark, Graham A.; Mcmurray, Kimberly L.; Meincke, Linda J.; Morgan, Jenna; Moyzis, Robert K.; Mundt, Mark O.; Munk, A. Christine; Nandkeshwar, Richard D.; Pitluck, Sam; Pollard, Martin; Predki, Paul; Parson-Quintana, Beverly; Ramirez, Lucia; Rash, Sam; Retterer, James; Ricke, Darryl O.; Robinson, Donna L.; Rodriguez, Alex; Salamov, Asaf; Saunders, Elizabeth H.; Scott, Duncan; Shough, Timothy; Stallings, Raymond L.; Stalvey, Malinda; Sutherland, Robert D.; Tapia, Roxanne; Tesmer, Judith G.; Thayer, Nina; Thompson, Linda S.; Tice, Hope; Torney, David C.; Tran-Gyamfi, Mary; Tsai, Ming; Ulanovsky, Levy E.; Ustaszewska, Anna; Vo, Nu; White, P. Scott; Williams, Albert L.; Wills, Patricia L.; Wu, Jung-Rung; Wu, Kevin; Yang, Joan; DeJong, Pieter; Bruce, David; Doggett, Norman; Deaven, Larry; Schmutz, Jeremy; Grimwood, Jane; Richardson, Paul; et al.

    2004-08-01

    We report here the 78,884,754 base pairs of finished human chromosome 16 sequence, representing over 99.9 percent of its euchromatin. Manual annotation revealed 880 protein coding genes confirmed by 1,637 aligned transcripts, 19 tRNA genes, 341 pseudogenes and 3 RNA pseudogenes. These genes include metallothionein, cadherin and iroquois gene families, as well as the disease genes for polycystic kidney disease and acute myelomonocytic leukemia. Several large-scale structural polymorphisms spanning hundreds of kilobasepairs were identified and result in gene content differences across humans. One of the unique features of chromosome 16 is its high level of segmental duplication, ranked among the highest of the human autosomes. While the segmental duplications are enriched in the relatively gene poor pericentromere of the p-arm, some are involved in recent gene duplication and conversion events which are likely to have had an impact on the evolution of primates and human disease susceptibility.

  4. The Sequence and Analysis of Duplication Rich Human Chromosome 16

    Science.gov (United States)

    Martin, Joel; Han, Cliff; Gordon, Laurie A.; Terry, Astrid; Prabhakar, Shyam; She, Xinwei; Xie, Gary; Hellsten, Uffe; Man Chan, Yee; Altherr, Michael; Couronne, Olivier; Aerts, Andrea; Bajorek, Eva; Black, Stacey; Blumer, Heather; Branscomb, Elbert; Brown, Nancy C.; Bruno, William J.; Buckingham, Judith M.; Callen, David F.; Campbell, Connie S.; Campbell, Mary L.; Campbell, Evelyn W.; Caoile, Chenier; Challacombe, Jean F.; Chasteen, Leslie A.; Chertkov, Olga; Chi, Han C.; Christensen, Mari; Clark, Lynn M.; Cohn, Judith D.; Denys, Mirian; Detter, John C.; Dickson, Mark; Dimitrijevic-Bussod, Mira; Escobar, Julio; Fawcett, Joseph J.; Flowers, Dave; Fotopulos, Dea; Glavina, Tijana; Gomez, Maria; Gonzales, Eidelyn; Goodstein, David; Goodwin, Lynne A.; Grady, Deborah L.; Grigoriev, Igor; Groza, Matthew; Hammon, Nancy; Hawkins, Trevor; Haydu, Lauren; Hildebrand, Carl E.; Huang, Wayne; Israni, Sanjay; Jett, Jamie; Jewett, Phillip E.; Kadner, Kristen; Kimball, Heather; Kobayashi, Arthur; Krawczyk, Marie-Claude; Leyba, Tina; Longmire, Jonathan L.; Lopez, Frederick; Lou, Yunian; Lowry, Steve; Ludeman, Thom; Mark, Graham A.; Mcmurray, Kimberly L.; Meincke, Linda J.; Morgan, Jenna; Moyzis, Robert K.; Mundt, Mark O.; Munk, A. Christine; Nandkeshwar, Richard D.; Pitluck, Sam; Pollard, Martin; Predki, Paul; Parson-Quintana, Beverly; Ramirez, Lucia; Rash, Sam; Retterer, James; Ricke, Darryl O.; Robinson, Donna L.; Rodriguez, Alex; Salamov, Asaf; Saunders, Elizabeth H.; Scott, Duncan; Shough, Timothy; Stallings, Raymond L.; Stalvey, Malinda; Sutherland, Robert D.; Tapia, Roxanne; Tesmer, Judith G.; Thayer, Nina; Thompson, Linda S.; Tice, Hope; Torney, David C.; Tran-Gyamfi, Mary; Tsai, Ming; Ulanovsky, Levy E.; Ustaszewska, Anna; Vo, Nu; White, P. Scott; Williams, Albert L.; Wills, Patricia L.; Wu, Jung-Rung; Wu, Kevin; Yang, Joan; DeJong, Pieter; Bruce, David; Doggett, Norman; Deaven, Larry; Schmutz, Jeremy; Grimwood, Jane; Richardson, Paul; et al.

    2004-01-01

    We report here the 78,884,754 base pairs of finished human chromosome 16 sequence, representing over 99.9 percent of its euchromatin. Manual annotation revealed 880 protein coding genes confirmed by 1,637 aligned transcripts, 19 tRNA genes, 341 pseudogenes and 3 RNA pseudogenes. These genes include metallothionein, cadherin and iroquois gene families, as well as the disease genes for polycystic kidney disease and acute myelomonocytic leukemia. Several large-scale structural polymorphisms spanning hundreds of kilobasepairs were identified and result in gene content differences across humans. One of the unique features of chromosome 16 is its high level of segmental duplication, ranked among the highest of the human autosomes. While the segmental duplications are enriched in the relatively gene poor pericentromere of the p-arm, some are involved in recent gene duplication and conversion events which are likely to have had an impact on the evolution of primates and human disease susceptibility.

  5. Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine.

    Directory of Open Access Journals (Sweden)

    Utut Widyastuti Suharsono

    2008-11-01

    Full Text Available Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine. M. affine can grow well in acid soil with high level of soluble aluminum. One of the important proteins in the detoxifying xenobiotic stress including acid and Al stresses is a multidrug resistance associated protein (MRP encoded by mrp gene. The objective of this research is to isolate and clone the cDNA fragment of MaMrp encoding MRP from M. affine. By reverse transcription, total cDNA had been synthesized from the total RNA as template. The fragment of cDNA MaMrp had been successfully isolated by PCR by using total cDNA as template and mrp primer designed from A. thaliana, yeast, and human. This fragment was successfully inserted into pGEM-T Easy and the recombinant plasmid was successfully introduced into E. coli DH5α. Nucleotide sequence analysis showed that the lenght of MaMrp fragment is 633 bp encoding 208 amino acids. Local alignment analysis based on nucleotide of mRNA showed that MaMrp fragment is 69% identical to AtMrp1 and 63% to AtMrp from A. thaliana. Based on deduced amino acid sequence, MaMRP is 84% identical to part of AtMRP13, 77% to AtMRP12, and 73% to AtMRP1 from A. thaliana respectively. Alignment analysis with AtMRP1 showed that MaMRP fragment is located in TM1 and NBF1 domains and has a specific amino acid sequence QCKAQLQNMEEE.

  6. The diploid genome sequence of an individual human.

    Directory of Open Access Journals (Sweden)

    Samuel Levy

    2007-09-01

    Full Text Available Presented here is a genome sequence of an individual human. It was produced from approximately 32 million random DNA fragments, sequenced by Sanger dideoxy technology and assembled into 4,528 scaffolds, comprising 2,810 million bases (Mb of contiguous sequence with approximately 7.5-fold coverage for any given region. We developed a modified version of the Celera assembler to facilitate the identification and comparison of alternate alleles within this individual diploid genome. Comparison of this genome and the National Center for Biotechnology Information human reference assembly revealed more than 4.1 million DNA variants, encompassing 12.3 Mb. These variants (of which 1,288,319 were novel included 3,213,401 single nucleotide polymorphisms (SNPs, 53,823 block substitutions (2-206 bp, 292,102 heterozygous insertion/deletion events (indels(1-571 bp, 559,473 homozygous indels (1-82,711 bp, 90 inversions, as well as numerous segmental duplications and copy number variation regions. Non-SNP DNA variation accounts for 22% of all events identified in the donor, however they involve 74% of all variant bases. This suggests an important role for non-SNP genetic alterations in defining the diploid genome structure. Moreover, 44% of genes were heterozygous for one or more variants. Using a novel haplotype assembly strategy, we were able to span 1.5 Gb of genome sequence in segments >200 kb, providing further precision to the diploid nature of the genome. These data depict a definitive molecular portrait of a diploid human genome that provides a starting point for future genome comparisons and enables an era of individualized genomic information.

  7. Human cyclophilin B: A second cyclophilin gene encodes a peptidyl-prolyl isomerase with a signal sequence

    International Nuclear Information System (INIS)

    Price, E.R.; Zydowsky, L.D.; Jin, Mingjie; Baker, C.H.; McKeon, F.D.; Walsh, C.T.

    1991-01-01

    The authors report the cloning and characterization of a cDNA encoding a second human cyclosporin A-binding protein (hCyPB). Homology analyses reveal that hCyPB is a member of the cyclophilin B (CyPB) family, which includes yeast CyPB, Drosophila nina A, and rat cyclophilin-like protein. This family is distinguished from the cyclophilin A (CyPA) family by the presence of endoplasmic reticulum (ER)-directed signal sequences. hCyPB has a hydrophobic leader sequence not found in hCyPA, and its first 25 amino acids are removed upon expression in Escherichia coli. Moreover, they show that hCyPB is a peptidyl-prolyl cis-trans isomerase which can be inhibited by cyclosporin A. These observations suggest that other members of the CyPB family will have similar enzymatic properties. Sequence comparisons of the CyPB proteins show a central, 165-amino acid peptidyl-prolyl isomerase and cyclosprorin A-binding domain, flanked by variable N-terminal and C-terminal domains. These two variable regions may impart compartmental specificity and regulation to this family of cyclophilin proteins containing the conserved core domain. Northern blot analyses show that hCyPB mRNA is expressed in the Jurkat T-cell line, consistent with its possible target role in cyclosporin A-mediated immunosuppression

  8. Cloning of the cDNA for U1 small nuclear ribonucleoprotein particle 70K protein from Arabidopsis thaliana

    Science.gov (United States)

    Reddy, A. S.; Czernik, A. J.; An, G.; Poovaiah, B. W.

    1992-01-01

    We cloned and sequenced a plant cDNA that encodes U1 small nuclear ribonucleoprotein (snRNP) 70K protein. The plant U1 snRNP 70K protein cDNA is not full length and lacks the coding region for 68 amino acids in the amino-terminal region as compared to human U1 snRNP 70K protein. Comparison of the deduced amino acid sequence of the plant U1 snRNP 70K protein with the amino acid sequence of animal and yeast U1 snRNP 70K protein showed a high degree of homology. The plant U1 snRNP 70K protein is more closely related to the human counter part than to the yeast 70K protein. The carboxy-terminal half is less well conserved but, like the vertebrate 70K proteins, is rich in charged amino acids. Northern analysis with the RNA isolated from different parts of the plant indicates that the snRNP 70K gene is expressed in all of the parts tested. Southern blotting of genomic DNA using the cDNA indicates that the U1 snRNP 70K protein is coded by a single gene.

  9. Transcriptome sequencing from diverse human populations reveals differentiated regulatory architecture.

    Directory of Open Access Journals (Sweden)

    Alicia R Martin

    2014-08-01

    Full Text Available Large-scale sequencing efforts have documented extensive genetic variation within the human genome. However, our understanding of the origins, global distribution, and functional consequences of this variation is far from complete. While regulatory variation influencing gene expression has been studied within a handful of populations, the breadth of transcriptome differences across diverse human populations has not been systematically analyzed. To better understand the spectrum of gene expression variation, alternative splicing, and the population genetics of regulatory variation in humans, we have sequenced the genomes, exomes, and transcriptomes of EBV transformed lymphoblastoid cell lines derived from 45 individuals in the Human Genome Diversity Panel (HGDP. The populations sampled span the geographic breadth of human migration history and include Namibian San, Mbuti Pygmies of the Democratic Republic of Congo, Algerian Mozabites, Pathan of Pakistan, Cambodians of East Asia, Yakut of Siberia, and Mayans of Mexico. We discover that approximately 25.0% of the variation in gene expression found amongst individuals can be attributed to population differences. However, we find few genes that are systematically differentially expressed among populations. Of this population-specific variation, 75.5% is due to expression rather than splicing variability, and we find few genes with strong evidence for differential splicing across populations. Allelic expression analyses indicate that previously mapped common regulatory variants identified in eight populations from the International Haplotype Map Phase 3 project have similar effects in our seven sampled HGDP populations, suggesting that the cellular effects of common variants are shared across diverse populations. Together, these results provide a resource for studies analyzing functional differences across populations by estimating the degree of shared gene expression, alternative splicing, and

  10. Human factors review for Severe Accident Sequence Analysis (SASA)

    International Nuclear Information System (INIS)

    Krois, P.A.; Haas, P.M.; Manning, J.J.; Bovell, C.R.

    1984-01-01

    The paper will discuss work being conducted during this human factors review including: (1) support of the Severe Accident Sequence Analysis (SASA) Program based on an assessment of operator actions, and (2) development of a descriptive model of operator severe accident management. Research by SASA analysts on the Browns Ferry Unit One (BF1) anticipated transient without scram (ATWS) was supported through a concurrent assessment of operator performance to demonstrate contributions to SASA analyses from human factors data and methods. A descriptive model was developed called the Function Oriented Accident Management (FOAM) model, which serves as a structure for bridging human factors, operations, and engineering expertise and which is useful for identifying needs/deficiencies in the area of accident management. The assessment of human factors issues related to ATWS required extensive coordination with SASA analysts. The analysis was consolidated primarily to six operator actions identified in the Emergency Procedure Guidelines (EPGs) as being the most critical to the accident sequence. These actions were assessed through simulator exercises, qualitative reviews, and quantitative human reliability analyses. The FOAM descriptive model assumes as a starting point that multiple operator/system failures exceed the scope of procedures and necessitates a knowledge-based emergency response by the operators. The FOAM model provides a functionally-oriented structure for assembling human factors, operations, and engineering data and expertise into operator guidance for unconventional emergency responses to mitigate severe accident progression and avoid/minimize core degradation. Operators must also respond to potential radiological release beyond plant protective barriers. Research needs in accident management and potential uses of the FOAM model are described. 11 references, 1 figure

  11. Major groove binding track residues of the connection subdomain of human immunodeficiency virus type 1 reverse transcriptase enhance cDNA synthesis at high temperatures.

    Science.gov (United States)

    Matamoros, Tania; Barrioluengo, Verónica; Abia, David; Menéndez-Arias, Luis

    2013-12-23

    At high temperatures, RNA denaturation can improve the efficiency and specificity of reverse transcription. Refined structures and molecular models of HIV-1 reverse transcriptases (RTs) from phylogenetically distant clades (i.e., group M subtype B and group O) revealed a major interaction between the template-primer and the Arg³⁵⁸-Gly³⁵⁹-Ala³⁶⁰ triad in the large subunit of HIV-1M/B RT. However, fewer contacts were predicted for the equivalent Lys³⁵⁸-Ala³⁵⁹-Ser³⁶⁰ triad of HIV-1O RT and the nucleic acid. An engineered HIV-1O K358R/A359G/S360A RT showed increased cDNA synthesis efficiency above 68 °C, as determined by qualitative and quantitative reverse transcription polymerase chain reactions. In comparison with wild-type HIV-1O RT, the mutant enzyme showed higher thermal stability but retained wild-type RNase H activity. Mutations that increased the accuracy of HIV-1M/B RTs were tested in combination with the K358R/A359G/S360A triple mutation. Some of them (e.g., F61A, K65R, K65R/V75I, and V148I) had a negative effect on reverse transcription efficiency above 65 °C. RTs with improved DNA binding affinities also showed higher cDNA synthesis efficiencies at elevated temperatures. Two of the most thermostable RTs (i.e., mutants T69SSG/K358R/A359G/S360A and K358R/A359G/S360A/E478Q) showed moderately increased fidelity in forward mutation assays. Our results demonstrate that the triad of Arg³⁵⁸, Gly³⁵⁹, and Ala³⁶⁰ in the major groove binding track of HIV-1 RT is a major target for RT stabilization, and most relevant for improving reverse transcription efficiency at high temperatures.

  12. Accident Sequence Evaluation Program: Human reliability analysis procedure

    Energy Technology Data Exchange (ETDEWEB)

    Swain, A.D.

    1987-02-01

    This document presents a shortened version of the procedure, models, and data for human reliability analysis (HRA) which are presented in the Handbook of Human Reliability Analysis With emphasis on Nuclear Power Plant Applications (NUREG/CR-1278, August 1983). This shortened version was prepared and tried out as part of the Accident Sequence Evaluation Program (ASEP) funded by the US Nuclear Regulatory Commission and managed by Sandia National Laboratories. The intent of this new HRA procedure, called the ''ASEP HRA Procedure,'' is to enable systems analysts, with minimal support from experts in human reliability analysis, to make estimates of human error probabilities and other human performance characteristics which are sufficiently accurate for many probabilistic risk assessments. The ASEP HRA Procedure consists of a Pre-Accident Screening HRA, a Pre-Accident Nominal HRA, a Post-Accident Screening HRA, and a Post-Accident Nominal HRA. The procedure in this document includes changes made after tryout and evaluation of the procedure in four nuclear power plants by four different systems analysts and related personnel, including human reliability specialists. The changes consist of some additional explanatory material (including examples), and more detailed definitions of some of the terms. 42 refs.

  13. Accident Sequence Evaluation Program: Human reliability analysis procedure

    International Nuclear Information System (INIS)

    Swain, A.D.

    1987-02-01

    This document presents a shortened version of the procedure, models, and data for human reliability analysis (HRA) which are presented in the Handbook of Human Reliability Analysis With emphasis on Nuclear Power Plant Applications (NUREG/CR-1278, August 1983). This shortened version was prepared and tried out as part of the Accident Sequence Evaluation Program (ASEP) funded by the US Nuclear Regulatory Commission and managed by Sandia National Laboratories. The intent of this new HRA procedure, called the ''ASEP HRA Procedure,'' is to enable systems analysts, with minimal support from experts in human reliability analysis, to make estimates of human error probabilities and other human performance characteristics which are sufficiently accurate for many probabilistic risk assessments. The ASEP HRA Procedure consists of a Pre-Accident Screening HRA, a Pre-Accident Nominal HRA, a Post-Accident Screening HRA, and a Post-Accident Nominal HRA. The procedure in this document includes changes made after tryout and evaluation of the procedure in four nuclear power plants by four different systems analysts and related personnel, including human reliability specialists. The changes consist of some additional explanatory material (including examples), and more detailed definitions of some of the terms. 42 refs

  14. Dynamic encoding of speech sequence probability in human temporal cortex.

    Science.gov (United States)

    Leonard, Matthew K; Bouchard, Kristofer E; Tang, Claire; Chang, Edward F

    2015-05-06

    Sensory processing involves identification of stimulus features, but also integration with the surrounding sensory and cognitive context. Previous work in animals and humans has shown fine-scale sensitivity to context in the form of learned knowledge about the statistics of the sensory environment, including relative probabilities of discrete units in a stream of sequential auditory input. These statistics are a defining characteristic of one of the most important sequential signals humans encounter: speech. For speech, extensive exposure to a language tunes listeners to the statistics of sound sequences. To address how speech sequence statistics are neurally encoded, we used high-resolution direct cortical recordings from human lateral superior temporal cortex as subjects listened to words and nonwords with varying transition probabilities between sound segments. In addition to their sensitivity to acoustic features (including contextual features, such as coarticulation), we found that neural responses dynamically encoded the language-level probability of both preceding and upcoming speech sounds. Transition probability first negatively modulated neural responses, followed by positive modulation of neural responses, consistent with coordinated predictive and retrospective recognition processes, respectively. Furthermore, transition probability encoding was different for real English words compared with nonwords, providing evidence for online interactions with high-order linguistic knowledge. These results demonstrate that sensory processing of deeply learned stimuli involves integrating physical stimulus features with their contextual sequential structure. Despite not being consciously aware of phoneme sequence statistics, listeners use this information to process spoken input and to link low-level acoustic representations with linguistic information about word identity and meaning. Copyright © 2015 the authors 0270-6474/15/357203-12$15.00/0.

  15. Microbial community profiling of human saliva using shotgun metagenomic sequencing.

    Directory of Open Access Journals (Sweden)

    Nur A Hasan

    Full Text Available Human saliva is clinically informative of both oral and general health. Since next generation shotgun sequencing (NGS is now widely used to identify and quantify bacteria, we investigated the bacterial flora of saliva microbiomes of two healthy volunteers and five datasets from the Human Microbiome Project, along with a control dataset containing short NGS reads from bacterial species representative of the bacterial flora of human saliva. GENIUS, a system designed to identify and quantify bacterial species using unassembled short NGS reads was used to identify the bacterial species comprising the microbiomes of the saliva samples and datasets. Results, achieved within minutes and at greater than 90% accuracy, showed more than 175 bacterial species comprised the bacterial flora of human saliva, including bacteria known to be commensal human flora but also Haemophilus influenzae, Neisseria meningitidis, Streptococcus pneumoniae, and Gamma proteobacteria. Basic Local Alignment Search Tool (BLASTn analysis in parallel, reported ca. five times more species than those actually comprising the in silico sample. Both GENIUS and BLAST analyses of saliva samples identified major genera comprising the bacterial flora of saliva, but GENIUS provided a more precise description of species composition, identifying to strain in most cases and delivered results at least 10,000 times faster. Therefore, GENIUS offers a facile and accurate system for identification and quantification of bacterial species and/or strains in metagenomic samples.

  16. Medical Sequencing at the extremes of Human Body Mass

    Energy Technology Data Exchange (ETDEWEB)

    Ahituv, Nadav; Kavaslar, Nihan; Schackwitz, Wendy; Ustaszewski,Anna; Martin, Joes; Hebert, Sybil; Doelle, Heather; Ersoy, Baran; Kryukov, Gregory; Schmidt, Steffen; Yosef, Nir; Ruppin, Eytan; Sharan,Roded; Vaisse, Christian; Sunyaev, Shamil; Dent, Robert; Cohen, Jonathan; McPherson, Ruth; Pennacchio, Len A.

    2006-09-01

    Body weight is a quantitative trait with significantheritability in humans. To identify potential genetic contributors tothis phenotype, we resequenced the coding exons and splice junctions of58 genes in 379 obese and 378 lean individuals. Our 96Mb survey included21 genes associated with monogenic forms of obesity in humans or mice, aswell as 37 genes that function in body weight-related pathways. We foundthat the monogenic obesity-associated gene group was enriched for rarenonsynonymous variants unique to the obese (n=46) versus lean (n=26)populations. Computational analysis further predicted a significantlygreater fraction of deleterious variants within the obese cohort.Consistent with the complex inheritance of body weight, we did notobserve obvious familial segregation in the majority of the 28 availablekindreds. Taken together, these data suggest that multiple rare alleleswith variable penetrance contribute to obesity in the population andprovide a deep medical sequencing based approach to detectthem.

  17. The DNA sequence of the human X chromosome

    Science.gov (United States)

    Ross, Mark T.; Grafham, Darren V.; Coffey, Alison J.; Scherer, Steven; McLay, Kirsten; Muzny, Donna; Platzer, Matthias; Howell, Gareth R.; Burrows, Christine; Bird, Christine P.; Frankish, Adam; Lovell, Frances L.; Howe, Kevin L.; Ashurst, Jennifer L.; Fulton, Robert S.; Sudbrak, Ralf; Wen, Gaiping; Jones, Matthew C.; Hurles, Matthew E.; Andrews, T. Daniel; Scott, Carol E.; Searle, Stephen; Ramser, Juliane; Whittaker, Adam; Deadman, Rebecca; Carter, Nigel P.; Hunt, Sarah E.; Chen, Rui; Cree, Andrew; Gunaratne, Preethi; Havlak, Paul; Hodgson, Anne; Metzker, Michael L.; Richards, Stephen; Scott, Graham; Steffen, David; Sodergren, Erica; Wheeler, David A.; Worley, Kim C.; Ainscough, Rachael; Ambrose, Kerrie D.; Ansari-Lari, M. Ali; Aradhya, Swaroop; Ashwell, Robert I. S.; Babbage, Anne K.; Bagguley, Claire L.; Ballabio, Andrea; Banerjee, Ruby; Barker, Gary E.; Barlow, Karen F.; Barrett, Ian P.; Bates, Karen N.; Beare, David M.; Beasley, Helen; Beasley, Oliver; Beck, Alfred; Bethel, Graeme; Blechschmidt, Karin; Brady, Nicola; Bray-Allen, Sarah; Bridgeman, Anne M.; Brown, Andrew J.; Brown, Mary J.; Bonnin, David; Bruford, Elspeth A.; Buhay, Christian; Burch, Paula; Burford, Deborah; Burgess, Joanne; Burrill, Wayne; Burton, John; Bye, Jackie M.; Carder, Carol; Carrel, Laura; Chako, Joseph; Chapman, Joanne C.; Chavez, Dean; Chen, Ellson; Chen, Guan; Chen, Yuan; Chen, Zhijian; Chinault, Craig; Ciccodicola, Alfredo; Clark, Sue Y.; Clarke, Graham; Clee, Chris M.; Clegg, Sheila; Clerc-Blankenburg, Kerstin; Clifford, Karen; Cobley, Vicky; Cole, Charlotte G.; Conquer, Jen S.; Corby, Nicole; Connor, Richard E.; David, Robert; Davies, Joy; Davis, Clay; Davis, John; Delgado, Oliver; DeShazo, Denise; Dhami, Pawandeep; Ding, Yan; Dinh, Huyen; Dodsworth, Steve; Draper, Heather; Dugan-Rocha, Shannon; Dunham, Andrew; Dunn, Matthew; Durbin, K. James; Dutta, Ireena; Eades, Tamsin; Ellwood, Matthew; Emery-Cohen, Alexandra; Errington, Helen; Evans, Kathryn L.; Faulkner, Louisa; Francis, Fiona; Frankland, John; Fraser, Audrey E.; Galgoczy, Petra; Gilbert, James; Gill, Rachel; Glöckner, Gernot; Gregory, Simon G.; Gribble, Susan; Griffiths, Coline; Grocock, Russell; Gu, Yanghong; Gwilliam, Rhian; Hamilton, Cerissa; Hart, Elizabeth A.; Hawes, Alicia; Heath, Paul D.; Heitmann, Katja; Hennig, Steffen; Hernandez, Judith; Hinzmann, Bernd; Ho, Sarah; Hoffs, Michael; Howden, Phillip J.; Huckle, Elizabeth J.; Hume, Jennifer; Hunt, Paul J.; Hunt, Adrienne R.; Isherwood, Judith; Jacob, Leni; Johnson, David; Jones, Sally; de Jong, Pieter J.; Joseph, Shirin S.; Keenan, Stephen; Kelly, Susan; Kershaw, Joanne K.; Khan, Ziad; Kioschis, Petra; Klages, Sven; Knights, Andrew J.; Kosiura, Anna; Kovar-Smith, Christie; Laird, Gavin K.; Langford, Cordelia; Lawlor, Stephanie; Leversha, Margaret; Lewis, Lora; Liu, Wen; Lloyd, Christine; Lloyd, David M.; Loulseged, Hermela; Loveland, Jane E.; Lovell, Jamieson D.; Lozado, Ryan; Lu, Jing; Lyne, Rachael; Ma, Jie; Maheshwari, Manjula; Matthews, Lucy H.; McDowall, Jennifer; McLaren, Stuart; McMurray, Amanda; Meidl, Patrick; Meitinger, Thomas; Milne, Sarah; Miner, George; Mistry, Shailesh L.; Morgan, Margaret; Morris, Sidney; Müller, Ines; Mullikin, James C.; Nguyen, Ngoc; Nordsiek, Gabriele; Nyakatura, Gerald; O’Dell, Christopher N.; Okwuonu, Geoffery; Palmer, Sophie; Pandian, Richard; Parker, David; Parrish, Julia; Pasternak, Shiran; Patel, Dina; Pearce, Alex V.; Pearson, Danita M.; Pelan, Sarah E.; Perez, Lesette; Porter, Keith M.; Ramsey, Yvonne; Reichwald, Kathrin; Rhodes, Susan; Ridler, Kerry A.; Schlessinger, David; Schueler, Mary G.; Sehra, Harminder K.; Shaw-Smith, Charles; Shen, Hua; Sheridan, Elizabeth M.; Shownkeen, Ratna; Skuce, Carl D.; Smith, Michelle L.; Sotheran, Elizabeth C.; Steingruber, Helen E.; Steward, Charles A.; Storey, Roy; Swann, R. Mark; Swarbreck, David; Tabor, Paul E.; Taudien, Stefan; Taylor, Tineace; Teague, Brian; Thomas, Karen; Thorpe, Andrea; Timms, Kirsten; Tracey, Alan; Trevanion, Steve; Tromans, Anthony C.; d’Urso, Michele; Verduzco, Daniel; Villasana, Donna; Waldron, Lenee; Wall, Melanie; Wang, Qiaoyan; Warren, James; Warry, Georgina L.; Wei, Xuehong; West, Anthony; Whitehead, Siobhan L.; Whiteley, Mathew N.; Wilkinson, Jane E.; Willey, David L.; Williams, Gabrielle; Williams, Leanne; Williamson, Angela; Williamson, Helen; Wilming, Laurens; Woodmansey, Rebecca L.; Wray, Paul W.; Yen, Jennifer; Zhang, Jingkun; Zhou, Jianling; Zoghbi, Huda; Zorilla, Sara; Buck, David; Reinhardt, Richard; Poustka, Annemarie; Rosenthal, André; Lehrach, Hans; Meindl, Alfons; Minx, Patrick J.; Hillier, LaDeana W.; Willard, Huntington F.; Wilson, Richard K.; Waterston, Robert H.; Rice, Catherine M.; Vaudin, Mark; Coulson, Alan; Nelson, David L.; Weinstock, George; Sulston, John E.; Durbin, Richard; Hubbard, Tim; Gibbs, Richard A.; Beck, Stephan; Rogers, Jane; Bentley, David R.

    2009-01-01

    The human X chromosome has a unique biology that was shaped by its evolution as the sex chromosome shared by males and females. We have determined 99.3% of the euchromatic sequence of the X chromosome. Our analysis illustrates the autosomal origin of the mammalian sex chromosomes, the stepwise process that led to the progressive loss of recombination between X and Y, and the extent of subsequent degradation of the Y chromosome. LINE1 repeat elements cover one-third of the X chromosome, with a distribution that is consistent with their proposed role as way stations in the process of X-chromosome inactivation. We found 1,098 genes in the sequence, of which 99 encode proteins expressed in testis and in various tumour types. A disproportionately high number of mendelian diseases are documented for the X chromosome. Of this number, 168 have been explained by mutations in 113 X-linked genes, which in many cases were characterized with the aid of the DNA sequence. PMID:15772651

  18. Cloning and analysis of the mouse Fanconi anemia group a cDNA and an overlapping penta zinc finger cDNA

    NARCIS (Netherlands)

    Wong, JCY; Alon, N; Norga, K; Kruyt, FAE; Youssoufian, H; Buchwald, M

    2000-01-01

    Despite the cloning of four disease-associated genes for Fanconi anemia (FA), the molecular pathogenesis of FA remains largely unknown. To study FA complementation group A using the mouse as a mode I system, we cloned and characterized the mouse homolog of the human FANCA cDNA, The mouse cDNA

  19. Human genome sequencing with direct x-ray holographic imaging

    International Nuclear Information System (INIS)

    Rhodes, C.K.

    1993-01-01

    Direct holographic imaging of biological materials is widely applicable to the study of the structure, properties and action of genetic material. This particular application involves the sequencing of the human genome where prospective genomic imaging technology is composed of three subtechnologies, name an x-ray holographic camera, suitable chemistry and enzymology for the preparation of tagged DNA samples, and the illuminator in the form of an x-ray laser. We report appropriate x-ray camera, embodied by the instrument developed by MCR, is available and that suitable chemical and enzymatic procedures exist for the preparation of the necessary tagged DNA strands. Concerning the future development of the x-ray illuminator. We find that a practical small scale x-ray light source is indeed feasible. This outcome requires the use of unconventional physical processes in order to achieve the necessary power-compression in the amplifying medium. The understanding of these new physical mechanisms is developing rapidly. Importantly, although the x-ray source does not currently exist, the understanding of these new physical mechanisms is developing rapidly and the research has established the basic scaling laws that will determine the properties of the x-ray illuminator. When this x-ray source becomes available, an extremely rapid and cost effective instrument for 3-D imaging of biological materials can be applied to a wide range of biological structural assays, including the base-pair sequencing of the human genome and many questions regarding its higher levels of organization

  20. Nucleotide sequence of the human N-myc gene

    International Nuclear Information System (INIS)

    Stanton, L.W.; Schwab, M.; Bishop, J.M.

    1986-01-01

    Human neuroblastomas frequently display amplification and augmented expression of a gene known as N-myc because of its similarity to the protooncogene c-myc. It has therefore been proposed that N-myc is itself a protooncogene, and subsequent tests have shown that N-myc and c-myc have similar biological activities in cell culture. The authors have now detailed the kinship between N-myc and c-myc by determining the nucleotide sequence of human N-myc and deducing the amino acid sequence of the protein encoded by the gene. The topography of N-myc is strikingly similar to that of c-myc: both genes contain three exons of similar lengths; the coding elements of both genes are located in the second and third exons; and both genes have unusually long 5' untranslated regions in their mRNAs, with features that raise the possibility that expression of the genes may be subject to similar controls of translation. The resemblance between the proteins encoded by N-myc and c-myc sustains previous suspicions that the genes encode related functions

  1. Prediction of Human Activity by Discovering Temporal Sequence Patterns.

    Science.gov (United States)

    Li, Kang; Fu, Yun

    2014-08-01

    Early prediction of ongoing human activity has become more valuable in a large variety of time-critical applications. To build an effective representation for prediction, human activities can be characterized by a complex temporal composition of constituent simple actions and interacting objects. Different from early detection on short-duration simple actions, we propose a novel framework for long -duration complex activity prediction by discovering three key aspects of activity: Causality, Context-cue, and Predictability. The major contributions of our work include: (1) a general framework is proposed to systematically address the problem of complex activity prediction by mining temporal sequence patterns; (2) probabilistic suffix tree (PST) is introduced to model causal relationships between constituent actions, where both large and small order Markov dependencies between action units are captured; (3) the context-cue, especially interactive objects information, is modeled through sequential pattern mining (SPM), where a series of action and object co-occurrence are encoded as a complex symbolic sequence; (4) we also present a predictive accumulative function (PAF) to depict the predictability of each kind of activity. The effectiveness of our approach is evaluated on two experimental scenarios with two data sets for each: action-only prediction and context-aware prediction. Our method achieves superior performance for predicting global activity classes and local action units.

  2. Nucleotide sequences of the cDNAs encoding the V-regions of H- and L-chains of a human monoclonal antibody with broad reactivity to malignant tumor cells

    Energy Technology Data Exchange (ETDEWEB)

    Kishimoto, Toshimitsu; Okajima, Hideki; Okumoto, Takeki [Yoshitomi Pharmaceutical Industries, Ltd., Saitama (Japan); Taniguchi, Masaru [Chiba Univ. (Japan)

    1989-06-12

    The human monoclonal antibody secreted from 4G12 hybridoma cells has broad reactivity to malignant tumor cells, especially for lung squamous cell carcinomas, and recognizes a new tumor-associated and differentiation antigen. The antigen detected by 4G12 is a glycoprotein with MW 195,000 and MW 65,000 under nonreducing and reducing conditions, respectively. Screening of a 4G12 {lambda}gt10 cDNA library with constant region probes for human immunoglobulin yielded full length clones for H- and L-chains. Nucleotide sequences revealed that subtypes of the variable regions were V{sub HIII} and {lambda}{sub 1}, respectively.

  3. Studies on the isolation, structural analysis and tissue localization of fetal antigen 1 and its relation to a human adrenal-specific cDNA, pG2

    DEFF Research Database (Denmark)

    Jensen, Charlotte Harken; Teisner, Børge; Højrup, Peter

    1993-01-01

    Fetal antigen 1 was purified from second trimester human amniotic fluid by immunospecific affinity chromatography followed by reversed-phase chromatography. Fetal antigen 1 is a single chain glycoprotein with a M(r) of 32-38 kDa. The amino acid composition revealed a high content of cysteines......, prolines and amino acids (aa) with acidic side-chains indicating that fetal antigen 1 is a compactly folded, strongly hydrophilic molecule. The N-terminal amino acid sequence (37 aa) revealed no homology to other known protein sequences, implying that fetal antigen 1 is a 'novel' human protein. When the aa...... sequence was back-translated into the appropriate degenerate sequence of nucleic acids, fetal antigen 1 could be partially aligned to a 'human adrenal-specific mRNA, pG2'. The indirect immunoperoxidase technique demonstrated fetal antigen 1 in fetal hepatocytes, glandular cells of fetal pancreas...

  4. Sequence conservation between porcine and human LRRK2

    DEFF Research Database (Denmark)

    Larsen, Knud; Madsen, Lone Bruhn

    2009-01-01

     Leucine-rich repeat kinase 2 (LRRK2) is a member of the ROCO protein superfamily (Ras of complex proteins (Roc) with a C-terminal Roc domain). Mutations in the LRRK2 gene lead to autosomal dominant Parkinsonism. We have cloned the porcine LRRK2 cDNA in an attempt to characterize conserved...... and expression patterns are conserved across species. The porcine LRRK2 gene was mapped to chromosome 5q25. The results obtained suggest that the LRRK2 gene might be of particular interest in our attempt to generate a transgenic porcine model for Parkinson's disease...

  5. Human Inferences about Sequences: A Minimal Transition Probability Model.

    Directory of Open Access Journals (Sweden)

    Florent Meyniel

    2016-12-01

    Full Text Available The brain constantly infers the causes of the inputs it receives and uses these inferences to generate statistical expectations about future observations. Experimental evidence for these expectations and their violations include explicit reports, sequential effects on reaction times, and mismatch or surprise signals recorded in electrophysiology and functional MRI. Here, we explore the hypothesis that the brain acts as a near-optimal inference device that constantly attempts to infer the time-varying matrix of transition probabilities between the stimuli it receives, even when those stimuli are in fact fully unpredictable. This parsimonious Bayesian model, with a single free parameter, accounts for a broad range of findings on surprise signals, sequential effects and the perception of randomness. Notably, it explains the pervasive asymmetry between repetitions and alternations encountered in those studies. Our analysis suggests that a neural machinery for inferring transition probabilities lies at the core of human sequence knowledge.

  6. CDNA cloning, characterization and expression of an endosperm-specific barley peroxidase

    DEFF Research Database (Denmark)

    Rasmussen, Søren Kjærsgård; Welinder, K.G.; Hejgaard, J.

    1991-01-01

    A barley peroxidase (BP 1) of pI ca. 8.5 and M(r) 37000 has been purified from mature barley grains. Using antibodies towards peroxidase BP 1, a cDNA clone (pcR7) was isolated from cDNA expression library. The nucleotide sequence of pcR7 gave a derived amino acid sequence identical to the 158 C...

  7. cDNA fingerprinting of osteoprogenitor cells to isolate differentiation stage-specific genes.

    OpenAIRE

    Candeliere, G A; Rao, Y; Floh, A; Sandler, S D; Aubin, J E

    1999-01-01

    A cDNA fingerprinting strategy was developed to identify genes based on their differential expression pattern during osteoblast development. Preliminary biological and molecular staging of cDNA pools prepared by global amplification PCR allowed discrim-inating choices to be made in selection of expressed sequence tags (ESTs) to be isolated. Sequencing of selected ESTs confirmed that both known and novel genes can be isolated from any developmental stage of interest, e.g. from primitive progen...

  8. Isolation of full-length putative rat lysophospholipase cDNA using improved methods for mRNA isolation and cDNA cloning

    International Nuclear Information System (INIS)

    Han, J.H.; Stratowa, C.; Rutter, W.J.

    1987-01-01

    The authors have cloned a full-length putative rat pancreatic lysophospholipase cDNA by an improved mRNA isolation method and cDNA cloning strategy using [ 32 P]-labelled nucleotides. These new methods allow the construction of a cDNA library from the adult rat pancreas in which the majority of recombinant clones contained complete sequences for the corresponding mRNAs. A previously recognized but unidentified long and relatively rare cDNA clone containing the entire sequence from the cap site at the 5' end to the poly(A) tail at the 3' end of the mRNA was isolated by single-step screening of the library. The size, amino acid composition, and the activity of the protein expressed in heterologous cells strongly suggest this mRNA codes for lysophospholipase

  9. Methods to determine the transcriptomes of trypanosomes in mixtures with mammalian cells: the effects of parasite purification and selective cDNA amplification.

    Directory of Open Access Journals (Sweden)

    Julius Mulindwa

    2014-04-01

    Full Text Available Patterns of gene expression in cultured Trypanosoma brucei bloodstream and procyclic forms have been extensively characterized, and some comparisons have been made with trypanosomes grown to high parasitaemias in laboratory rodents. We do not know, however, to what extent these transcriptomes resemble those in infected Tsetse flies - or in humans or cattle, where parasitaemias are substantially lower. For clinical and field samples it is difficult to characterize parasite gene expression because of the large excess of host cell RNA. We have here examined two potential solutions to this problem for bloodstream form trypanosomes, assaying transcriptomes by high throughput cDNA sequencing (RNASeq. We first purified the parasites from blood of infected rats. We found that a red blood cell lysis procedure affected the transcriptome substantially more than purification using a DEAE cellulose column, but that too introduced significant distortions and variability. As an alternative, we specifically amplified parasite sequences from a mixture containing a 1000-fold excess of human RNA. We first purified polyadenylated RNA, then made trypanosome-specific cDNA by priming with a spliced leader primer. Finally, the cDNA was amplified using nested primers. The amplification procedure was able to produce samples in which 20% of sequence reads mapped to the trypanosome genome. Synthesis of the second cDNA strand with a spliced leader primer, followed by amplification, is sufficiently reproducible to allow comparison of different samples so long as they are all treated in the same way. However, SL priming distorted the abundances of the cDNA products and definitely cannot be used, by itself, to measure absolute mRNA levels. The amplification method might be suitable for clinical samples with low parasitaemias, and could also be adapted for other Kinetoplastids and to samples from infected vectors.

  10. Functional cloning using pFB retroviral cDNA expression libraries.

    Science.gov (United States)

    Felts, Katherine A; Chen, Keith; Zaharee, Kim; Sundar, Latha; Limjoco, Jamie; Miller, Anna; Vaillancourt, Peter

    2002-09-01

    Retroviral cDNA expression libraries allow the efficient introduction of complex cDNA libraries into virtually any mitotic cell type for screening based on gene function. The cDNA copy number per cell can be easily controlled by adjusting the multiplicity of infection, thus cell populations may be generated in which >90% of infected cells contain one to three cDNAs. We describe the isolation of two known oncogenes and one cell-surface receptor from a human Burkitt's lymphoma (Daudi) cDNA library inserted into the high-titer retroviral vector pFB.

  11. Computational sequence analysis of predicted long dsRNA transcriptomes of major crops reveals sequence complementarity with human genes.

    Science.gov (United States)

    Jensen, Peter D; Zhang, Yuanji; Wiggins, B Elizabeth; Petrick, Jay S; Zhu, Jin; Kerstetter, Randall A; Heck, Gregory R; Ivashuta, Sergey I

    2013-01-01

    Long double-stranded RNAs (long dsRNAs) are precursors for the effector molecules of sequence-specific RNA-based gene silencing in eukaryotes. Plant cells can contain numerous endogenous long dsRNAs. This study demonstrates that such endogenous long dsRNAs in plants have sequence complementarity to human genes. Many of these complementary long dsRNAs have perfect sequence complementarity of at least 21 nucleotides to human genes; enough complementarity to potentially trigger gene silencing in targeted human cells if delivered in functional form. However, the number and diversity of long dsRNA molecules in plant tissue from crops such as lettuce, tomato, corn, soy and rice with complementarity to human genes that have a long history of safe consumption supports a conclusion that long dsRNAs do not present a significant dietary risk.

  12. Complementary DNA and derived amino acid sequence of the β subunit of human complement protein C8: identification of a close structural and ancestral relationship to the α subunit and C9

    International Nuclear Information System (INIS)

    Howard, O.M.Z.; Rao, A.G.; Sodetz, J.M.

    1987-01-01

    A cDNA clone encoding the β subunit (M/sub r/ 64,000) of the eighth component of complement (C8) has been isolated from a human liver cDNA library. This clone has a cDNA insert of 1.95 kilobases (kb) and contains the entire β sequence [1608 base pairs (bp)]. Analysis of total cellular RNA isolated from the hepatoma cell line HepG2 revealed the mRNA for β to be ∼ 2.5 kb. This is similar to the message size for the α subunit of C8 and confirms the existence of different mRNAs for α and β. This finding supports genetic evidence that α and β are encoded at different loci. Analysis of the derived amino acid sequence revealed several membrane surface seeking segments that may facilitate β interaction with target membranes during complement-mediated cytolysis. Determined of the carbohydrate composition indicated 1 or 2 asparagine-linked but no O-linked oligosaccharide chains. Comparison of the β sequence to that reported earlier and to that of human C9 revealed a striking homology between all three proteins. For β and α, the overall homology is 33% on the basis of identity and 53% when conserved substitutions are allowed. For β and C9, the values are 26% and 47 5 , respectively. All three have a large internal domain that is nearly cysteine free and N- and C-termini that are cysteine-rich and homologous to the low-density lipoprotein receptor repeat and epidermal growth factor type sequences, respectively. The overall homology and similarities in size and structural organization are indicative of a close ancestral relationship. It is concluded that α, β and C9 are members of a family of structurally related proteins that are capable of interacting to produce a hydrophilic to amphiphilic transition and membrane association

  13. Molecular cloning of the human casein kinase II α subunit

    International Nuclear Information System (INIS)

    Meisner, H.; Heller-Harrison, R.; Buxton, J.; Czech, M.P.

    1989-01-01

    A human cDNA encoding the α subunit of casein kinase II and a partial cDNA encoding the rat homologue were isolated by using a Drosophila casein kinase II cDNA probe. The 2.2-kb human cDNA contains a 1.2-kb open reading frame, 150 nucleotides of 5' leader, and 850 nucleotides of 3' noncoding region. Except for the first 7 deduced amino acids that are missing in the rat cDNA, the 328 amino acids beginning with the amino terminus are identical between human and rat. The Drosophila enzyme sequence is 90% identical with the human casein kinase II sequence, and there is only a single amino acid difference between the published partial bovine sequence and the human sequence. In addition, the C-terminus of the human cDNA has an extra 53 amino acids not present in Drosophila. Northern analysis of rat and human RNA showed predominant bands of 5.5, 3.1, and 1.8 kb. In rat tissues, brain and spleen had the highest levels of casein kinase II α subunit specific RNA, while skeletal muscle showed the lowest. Southern analysis of human cultured cell and tissue genomic DNA using the full-length cDNA probe revealed two bands with restriction enzymes that have no recognition sites within the cDNA and three to six bands with enzymes having single internal sites. These results are consistent with the possibility that two genes encode the α subunits

  14. Next Generation Sequencing Analysis of Human Platelet PolyA+ mRNAs and rRNA-Depleted Total RNA

    Science.gov (United States)

    Kissopoulou, Antheia; Jonasson, Jon; Lindahl, Tomas L.; Osman, Abdimajid

    2013-01-01

    Background Platelets are small anucleate cells circulating in the blood vessels where they play a key role in hemostasis and thrombosis. Here, we compared platelet RNA-Seq results obtained from polyA+ mRNA and rRNA-depleted total RNA. Materials and Methods We used purified, CD45 depleted, human blood platelets collected by apheresis from three male and one female healthy blood donors. The Illumina HiSeq 2000 platform was employed to sequence cDNA converted either from oligo(dT) isolated polyA+ RNA or from rRNA-depleted total RNA. The reads were aligned to the GRCh37 reference assembly with the TopHat/Cufflinks alignment package using Ensembl annotations. A de novo assembly of the platelet transcriptome using the Trinity software package and RSEM was also performed. The bioinformatic tools HTSeq and DESeq from Bioconductor were employed for further statistical analyses of read counts. Results Consistent with previous findings our data suggests that mitochondrially expressed genes comprise a substantial fraction of the platelet transcriptome. We also identified high transcript levels for protein coding genes related to the cytoskeleton function, chemokine signaling, cell adhesion, aggregation, as well as receptor interaction between cells. Certain transcripts were particularly abundant in platelets compared with other cell and tissue types represented by RNA-Seq data from the Illumina Human Body Map 2.0 project. Irrespective of the different library preparation and sequencing protocols, there was good agreement between samples from the 4 individuals. Eighteen differentially expressed genes were identified in the two sexes at 10% false discovery rate using DESeq. Conclusion The present data suggests that platelets may have a unique transcriptome profile characterized by a relative over-expression of mitochondrially encoded genes and also of genomic transcripts related to the cytoskeleton function, chemokine signaling and surface components compared with other cell and

  15. Sequence features responsible for intron retention in human

    Directory of Open Access Journals (Sweden)

    Sakabe Noboru

    2007-02-01

    Full Text Available Abstract Background One of the least common types of alternative splicing is the complete retention of an intron in a mature transcript. Intron retention (IR is believed to be the result of intron, rather than exon, definition associated with failure of the recognition of weak splice sites flanking short introns. Although studies on individual retained introns have been published, few systematic surveys of large amounts of data have been conducted on the mechanisms that lead to IR. Results TTo understand how sequence features are associated with or control IR, and to produce a generalized model that could reveal previously unknown signals that regulate this type of alternative splicing, we partitioned intron retention events observed in human cDNAs into two groups based on the relative abundance of both isoforms and compared relevant features. We found that a higher frequency of IR in human is associated with individual introns that have weaker splice sites, genes with shorter intron lengths, higher expression levels and lower density of both a set of exon splicing silencers (ESSs and the intronic splicing enhancer GGG. Both groups of retained introns presented events conserved in mouse, in which the retained introns were also short and presented weaker splice sites. Conclusion Although our results confirmed that weaker splice sites are associated with IR, they showed that this feature alone cannot explain a non-negligible fraction of events. Our analysis suggests that cis-regulatory elements are likely to play a crucial role in regulating IR and also reveals previously unknown features that seem to influence its occurrence. These results highlight the importance of considering the interplay among these features in the regulation of the relative frequency of IR.

  16. The DNA sequence and biology of human chromosome 19

    Energy Technology Data Exchange (ETDEWEB)

    Grimwood, J; Gordon, L A; Olsen, A; Terry, A; Schmutz, J; Lamerdin, J; Hellsten, U; Goodstein, D; Couronne, O; Tran-Gyamfi, M

    2004-04-06

    Chromosome 19 has the highest gene density of all human chromosomes, more than double the genome-wide average. The large clustered gene families, corresponding high GC content, CpG islands and density of repetitive DNA indicate a chromosome rich in biological and evolutionary significance. Here we describe 55.8 million base pairs of highly accurate finished sequence representing 99.9% of the euchromatin portion of the chromosome. Manual curation of gene loci reveals 1,461 protein-coding genes and 321 pseudogenes. Among these are genes directly implicated in Mendelian disorders, including familial hypercholesterolemia and insulin-resistant diabetes. Nearly one quarter of these genes belong to tandemly arranged families, encompassing more than 25% of the chromosome. Comparative analyses show a fascinating picture of conservation and divergence, revealing large blocks of gene orthology with rodents, scattered regions with more recent gene family expansions and deletions, and segments of coding and non-coding conservation with the distant fish species Takifugu.

  17. Expression analysis of a ''Cucurbita'' cDNA encoding endonuclease

    International Nuclear Information System (INIS)

    Szopa, J.

    1995-01-01

    The nuclear matrices of plant cell nuclei display intrinsic nuclease activity which consists in nicking supercoiled DNA. A cDNA encoding a 32 kDa endonuclease has been cloned and sequenced. The nucleotide and deduced amino-acid sequences show high homology to known 14-3-3-protein sequences from other sources. The amino-acid sequence shows agreement with consensus sequences for potential phosphorylation by protein kinase A and C and for calcium, lipid and membrane-binding sites. The nucleotide-binding site is also present within the conserved part of the sequence. By Northern blot analysis, the differential expression of the corresponding mRNA was detected; it was the strongest in sink tissues. The endonuclease activity found on DNA-polyacrylamide gel electrophoresis coincided with mRNA content and was the highest in tuber. (author). 22 refs, 6 figs

  18. The monitoring and control of task sequences in human and non-human primates

    Directory of Open Access Journals (Sweden)

    Theresa M Desrochers

    2016-01-01

    Full Text Available Our ability to plan and execute a series of tasks leading to a desired goal requires remarkable coordination between sensory, motor, and decision-related systems. Prefrontal cortex is thought to play a central role in this coordination, especially when actions must be assembled extemporaneously and cannot be programmed as a rote series of movements. A central component of this flexible behavior is the moment-by-moment allocation of working memory and attention. The ubiquity of sequence planning in our everyday lives belies the neural complexity that supports this capacity, and little is known about how frontal cortical regions orchestrate the monitoring and control of sequential behaviors. For example, it remains unclear if and how sensory cortical areas, which provide essential driving inputs for behavior, are modulated by the frontal cortex during these tasks. Here we review what is known about moment-to-moment monitoring as it relates to visually guided, rule-driven behaviors that change over time. We highlight recent human work that shows how the rostrolateral prefrontal cortex (RLPFC participates in monitoring during task sequences. Neurophysiological data from monkeys suggests that monitoring may be accomplished by neurons that respond to items within the sequence and may in turn influence the tuning properties of neurons in posterior sensory areas. Understanding the interplay between proceduralized or habitual acts and supervised control of sequences is key to our understanding of sequential task execution. A crucial bridge will be the use of experimental protocols that allow for the examination of the functional homology between monkeys and humans. We illustrate how task sequences may be parceled into components and examined experimentally, thereby opening future avenues of investigation into the neural basis of sequential monitoring and control.

  19. RICD: A rice indica cDNA database resource for rice functional genomics

    Directory of Open Access Journals (Sweden)

    Zhang Qifa

    2008-11-01

    Full Text Available Abstract Background The Oryza sativa L. indica subspecies is the most widely cultivated rice. During the last few years, we have collected over 20,000 putative full-length cDNAs and over 40,000 ESTs isolated from various cDNA libraries of two indica varieties Guangluai 4 and Minghui 63. A database of the rice indica cDNAs was therefore built to provide a comprehensive web data source for searching and retrieving the indica cDNA clones. Results Rice Indica cDNA Database (RICD is an online MySQL-PHP driven database with a user-friendly web interface. It allows investigators to query the cDNA clones by keyword, genome position, nucleotide or protein sequence, and putative function. It also provides a series of information, including sequences, protein domain annotations, similarity search results, SNPs and InDels information, and hyperlinks to gene annotation in both The Rice Annotation Project Database (RAP-DB and The TIGR Rice Genome Annotation Resource, expression atlas in RiceGE and variation report in Gramene of each cDNA. Conclusion The online rice indica cDNA database provides cDNA resource with comprehensive information to researchers for functional analysis of indica subspecies and for comparative genomics. The RICD database is available through our website http://www.ncgr.ac.cn/ricd.

  20. The effects of radiation on p53-mutated glioma cells using cDNA microarray technique

    International Nuclear Information System (INIS)

    Ngo, F.Q.H.; Hsiao, Y.-Y.H.

    2003-01-01

    Full text: In this study, we investigated the effects of 10-Gy irradiation on cell-cycle arrest, apoptosis and clonogenic death in the p53-mutated human U138MG (malignant glioblastoma) cell line. In order to evaluate time-dependent events in cellular responses to radiation, we did a time course study by incubating cells ranging from 0.5 to 48 hours after irradiation. Cell-cycle distribution and apoptosis were evaluated by flow cytometry using propidium iodide (PI) and annexin-V plus PI staining. Cell viability and proliferative capacity were studied by colony formation assay. Dual fluorescence cDNA microarray technique was used to examine the differential expression patterns of the irradiated cells. The cDNA microarray chips used contained DNA sequences corresponding to 12,814 human genes. From the flow cytometry data, it can be observed that radiation induced G2/M phase arrest and that late apoptosis was more evident following G2/M arrest. After 36 hours, some cells underwent senescence and the remains continued on with the cell cycle. Microarray analyses revealed changes in the expression of a small number of cell-cycle-related genes (p21, cyclin B1, etc.) and cell-death genes (tumor necrosis factors, DDB2, etc.) suggesting their involvement in radiation-induced cell-cycle arrest and apoptosis. In silico interpretations of the molecular mechanisms responsible for these radiation effects are in progress

  1. Complete genome sequence analysis of novel human bocavirus reveals genetic recombination between human bocavirus 2 and human bocavirus 4.

    Science.gov (United States)

    Khamrin, Pattara; Okitsu, Shoko; Ushijima, Hiroshi; Maneekarn, Niwat

    2013-07-01

    Epidemiological surveillance of human bocavirus (HBoV) was conducted on fecal specimens collected from hospitalized children with diarrhea in Chiang Mai, Thailand in 2011. By partial sequence analysis of VP1 gene, an unusual strain of HBoV (CMH-S011-11), was initially identified as HBoV4. The complete genome sequence of CMH-S011-11 was performed and analyzed further to clarify whether it was a recombinant strain or a new HBoV variant. Analysis of complete genome sequence revealed that the coding sequence starting from NS1, NP1 to VP1/VP2 was 4795 nucleotides long. Interestingly, the nucleotide sequence of NS1 gene of CMH-S011-11 was most closely related to the HBoV2 reference strains detected in Pakistan, which contradicted to the initial genotyping result of the partial VP1 region in the previous study. In addition, comparison of NP1 nucleotide sequence of CMH-S011-11 with those of other HBoV1-4 reference strains also revealed a high level of sequence identity with HBoV2. On the other hand, nucleotide sequence of VP1/VP2 gene of CMH-S011-11 was most closely related to those of HBoV4 reference strains detected in Nigeria. The overall full-length sequence analysis revealed that this CMH-S011-11 was grouped within HBoV4 species, but located in a separate branch from other HBoV4 prototype strains. Recombination analysis revealed that CMH-S011-11 was the result of recombination between HBoV2 and HBoV4 strains with the break point located near the start codon of VP2. Copyright © 2013 Elsevier B.V. All rights reserved.

  2. Analysis of the Macaca mulatta transcriptome and the sequence divergence between Macaca and human.

    Science.gov (United States)

    Magness, Charles L; Fellin, P Campion; Thomas, Matthew J; Korth, Marcus J; Agy, Michael B; Proll, Sean C; Fitzgibbon, Matthew; Scherer, Christina A; Miner, Douglas G; Katze, Michael G; Iadonato, Shawn P

    2005-01-01

    We report the initial sequencing and comparative analysis of the Macaca mulatta transcriptome. Cloned sequences from 11 tissues, nine animals, and three species (M. mulatta, M. fascicularis, and M. nemestrina) were sampled, resulting in the generation of 48,642 sequence reads. These data represent an initial sampling of the putative rhesus orthologs for 6,216 human genes. Mean nucleotide diversity within M. mulatta and sequence divergence among M. fascicularis, M. nemestrina, and M. mulatta are also reported.

  3. Human Ro60 (SSA2) genomic organization and sequence alterations, examined in cutaneous lupus erythematosus.

    Science.gov (United States)

    Millard, T P; Ashton, G H S; Kondeatis, E; Vaughan, R W; Hughes, G R V; Khamashta, M A; Hawk, J L M; McGregor, J M; McGrath, J A

    2002-02-01

    The Ro 60 kDa protein (Ro60 or SSA2) is the major component of the Ro ribonucleoprotein (Ro RNP) complex, to which an immune response is a specific feature of several autoimmune diseases. The genomic organization and any sequence variation within the DNA encoding Ro60 are unknown. To characterize the Ro60 gene structure and to assess whether any sequence alterations might be associated with serum anti-Ro antibody in subacute cutaneous lupus erythematosus (SCLE), thus potentially providing new insight into disease pathogenesis. The cDNA sequence for Ro60 was obtained from the NCBI database and used for a BLAST search for a clone containing the entire genomic sequence. The intron-exon borders were confirmed by designing intronic primer pairs to flank each exon, which were then used to amplify genomic DNA for automated sequencing from 36 caucasian patients with SCLE (anti-Ro positive) and 49 with discoid LE (DLE, anti-Ro negative), in addition to 36 healthy caucasian controls. Heteroduplex analysis of polymerase chain reaction (PCR) products from patients and controls spanning all Ro60 exons (1-8) revealed a common bandshift in the PCR products spanning exon 7. Sequencing of the corresponding PCR products demonstrated an A > G substitution at nucleotide position 1318-7, within the consensus acceptor splice site of exon 7 (GenBank XM001901). The allele frequencies were major allele A (0.71) and minor allele G (0.29) in 72 control chromosomes, with no significant differences found between SCLE patients, DLE patients and controls. The genomic organization of the DNA encoding the Ro60 protein is described, including a common polymorphism within the consensus acceptor splice site of exon 7. Our delineation of a strategy for the genomic amplification of Ro60 forms a basis for further examination of the pathological functions of the Ro RNP in autoimmune disease.

  4. Genomic sequences of murine gamma B- and gamma C-crystallin-encoding genes: promoter analysis and complete evolutionary pattern of mouse, rat and human gamma-crystallins.

    Science.gov (United States)

    Graw, J; Liebstein, A; Pietrowski, D; Schmitt-John, T; Werner, T

    1993-12-22

    The murine genes, gamma B-cry and gamma C-cry, encoding the gamma B- and gamma C-crystallins, were isolated from a genomic DNA library. The complete nucleotide (nt) sequences of both genes were determined from 661 and 711 bp, respectively, upstream from the first exon to the corresponding polyadenylation sites, comprising more than 2650 and 2890 bp, respectively. The new sequences were compared to the partial cDNA sequences available for the murine gamma B-cry and gamma C-cry, as well as to the corresponding genomic sequences from rat and man, at both the nt and predicted amino acid (aa) sequence levels. In the gamma B-cry promoter region, a canonical CCAAT-box, a TATA-box, putative NF-I and C/EBP sites were detected. An R-repeat is inserted 366 bp upstream from the transcription start point. In contrast, the gamma C-cry promoter does not contain a CCAAT-box, but some other putative binding sites for transcription factors (AP-2, UBP-1, LBP-1) were located by computer analysis. The promoter regions of all six gamma-cry from mouse, rat and human, except human psi gamma F-cry, were analyzed for common sequence elements. A complex sequence element of about 70-80 bp was found in the proximal promoter, which contains a gamma-cry-specific and almost invariant sequence (crygpel) of 14 nt, and ends with the also invariant TATA-box. Within the complex sequence element, a minimum of three further features specific for the gamma A-, gamma B- and gamma D/E/F-cry genes can be defined, at least two of which were recently shown to be functional. In addition to these four sequence elements, a subtype-specific structure of inverted repeats with different-sized spacers can be deduced from the multiple sequence alignment. A phylogenetic analysis based on the promoter region, as well as the complete exon 3 of all gamma-cry from mouse, rat and man, suggests separation of only five gamma-cry subtypes (gamma A-, gamma B-, gamma C-, gamma D- and gamma E/F-cry) prior to species separation.

  5. [Preparation of the cDNA microarray on the differential expressed cDNA of senescence-accelerated mouse's hippocampus].

    Science.gov (United States)

    Cheng, Xiao-Rui; Zhou, Wen-Xia; Zhang, Yong-Xiang

    2006-05-01

    Alzheimer' s disease (AD) is the most common form of dementia in the elderly. AD is an invariably fatal neurodegenerative disorder with no effective treatment. Senescence-accelerated mouse prone 8 (SAMP8) is a model for studying age-related cognitive impairments and also is a good model to study brain aging and one of mouse model of AD. The technique of cDNA microarray can monitor the expression levels of thousands of genes simultaneously and can be used to study AD with the character of multi-mechanism, multi-targets and multi-pathway. In order to disclose the mechanism of AD and find the drug targets of AD, cDNA microarray containing 3136 cDNAs amplified from the suppression subtracted cDNA library of hippocampus of SAMP8 and SAMR1 was prepared with 16 blocks and 14 x 14 pins, the housekeeping gene beta-actin and G3PDH as inner conference. The background of this microarray was low and unanimous, and dots divided evenly. The conditions of hybridization and washing were optimized during the hybridization of probe and target molecule. After the data of hybridization analysis, the differential expressed cDNAs were sequenced and analyzed by the bioinformatics, and some of genes were quantified by the real time RT-PCR and the reliability of this cDNA microarray were validated. This cDNA microarray may be the good means to select the differential expressed genes and disclose the molecular mechanism of SAMP8's brain aging and AD.

  6. Construction and characterization of cDNA library for IRM-2 mice

    International Nuclear Information System (INIS)

    Wang Qin; Li Jin; Song Li; Liu Qiang; Yue Jingyin; Mu Chuanjie; Tang Weisheng; Fan Feiyue

    2010-01-01

    Objective: To screen and isolate the radioresistance related genes of IRM-2 mice. Methods: cDNA library of IRM-2 mice was constructed by SMART technique. Total RNA was isolated from spleens of IRM-2 male mice. The first-strand cDNA was synthesized by using PowerScript reverse transcriptase, and double-strand cDNA was synthesized and amplified by long PCR. The PCR products were purified, digested with restriction enzyme Sfi I. The ds-cDNA fragment less than 500 bp was fractionated and ligated to the Sfi I-digested pDNR-LIB vector. The ligation mixture was transformed into E. coil DH5 α by electroporation transformation to generate the unamplified cDNA library. The quality of cDNA library was identified by PCR technique. 130 clones from cDNA library were sequenced and compared with GenBank database. Results: The cDNA library contained 2.25 x 10 6 independent clones with an average insert size of 1.2 kb. The ratio of recombination and full-length was 95% and 55%, respectively. 21 pieces of EST sequences from cDNA library were not the same as the known mice genes and registered into GenBank EST database, with registered number DW474856-DW474876. Conclusions: cDNA library of IRM-2 mice has been constructed successfully. 21 pieces of EST implies that radioresistance correlative genes may be in IRM-2 mice, which will lay a foundation for isolating and identifying radioresistance related genes in further study. (authors)

  7. Complementation of radiation-sensitive Ataxia telangiectasia cells after transfection of cDNA expression libraries and cosmid clones from wildtype cells

    International Nuclear Information System (INIS)

    Fritz, E.

    1994-06-01

    In this Ph.D.-thesis, phenotypic complementation of AT-cells (AT5BIVA) by transfection of cDNA-expression-libraries was adressed: After stable transfection of cDNA-expression-libraries G418 resistant clones were selected for enhanced radioresistance by a fractionated X-ray selection. One surviving transfectant clone (clone 514) exhibited enhanced radiation resistance in dose-response experiments and further X-ray selections. Cell cycle analysis revealed complementation of untreated and irradiated 514-cells in cell cycle progression. The rate of DNA synthesis, however, is not diminished after irradiation but shows the reverse effect. A transfected cDNA-fragment (AT500-cDNA) was isolated from the genomic DNA of 514-cells and proved to be an unknown DNA sequence. A homologous sequence could be detected in genomic DNA from human cell lines, but not in DNA from other species. The cDNA-sequence could be localized to human chromosome 11. In human cells the cDNA sequence is part of two large mRNAs. 4 different cosmid clones containing high molecular genomic DNA from normal human cells could be isolated from a library, each hybridizing to the AT500-cDNA. After stable transfection into AT-cells, one cosmid-clone was able to confer enhanced radiation resistance both in X-ray selections and dose-response experiments. The results indicate that the cloned cDNA-fragment is based on an unknown gene from human chromosome 11 which partially complements the radiosensitivity and the defective cell cycle progression in AT5BIVA cells. (orig.) [de

  8. Cloning of the γ-aminobutyric acid (GABA) ρ1 cDNA: A GABA receptor subunit highly expressed in the retina

    International Nuclear Information System (INIS)

    Cutting, G.R.; Lu, Luo; Kasch, L.M.; Montrose-Rafizadeh, C.; Antonarakis, S.E.; Guggino, W.B.; Kazazian, H.H. Jr.; O'Hara, B.F.; Donovan, D.M.; Shimada, Shoichi; Uhl, G.R.

    1991-01-01

    Type A γ-aminobutyric acid (GABA A ) receptors are a family of ligand-gated chloride channels that are the major inhibitory neurotransmitter receptors in the nervous system. Molecular cloning has revealed diversity in the subunits that compose this heterooligomeric receptor, but each previously elucidated subunit displays amino acid similarity in conserved structural elements. The authors have used these highly conserved regions to identify additional members of this family by using the polymerase chain reaction (PCR). One PCR product was used to isolate a full-length cDNA from a human retina cDNA library. The mature protein predicted from this cDNA sequence is 458 amino acids long and displays between 30 and 38% amino acid similarity to the previously identified GABA A subunits. This gene is expressed primarily in the retina but transcripts are also detected in the brain, lung, and thymus. Injection of Xenopus oocytes with RNA transcribed in vitro produces a GABA-responsive chloride conductance and expression of the cDNA in COS cells yields GABA-displaceable muscimol binding. These features are consistent with our identification of a GABA subunit, GABA ρ 1 , with prominent retinal expression that increases the diversity and tissue specificity of this ligand-gated ion-channel receptor family

  9. Discovery of human inversion polymorphisms by comparative analysis of human and chimpanzee DNA sequence assemblies.

    Directory of Open Access Journals (Sweden)

    2005-10-01

    Full Text Available With a draft genome-sequence assembly for the chimpanzee available, it is now possible to perform genome-wide analyses to identify, at a submicroscopic level, structural rearrangements that have occurred between chimpanzees and humans. The goal of this study was to investigate chromosomal regions that are inverted between the chimpanzee and human genomes. Using the net alignments for the builds of the human and chimpanzee genome assemblies, we identified a total of 1,576 putative regions of inverted orientation, covering more than 154 mega-bases of DNA. The DNA segments are distributed throughout the genome and range from 23 base pairs to 62 mega-bases in length. For the 66 inversions more than 25 kilobases (kb in length, 75% were flanked on one or both sides by (often unrelated segmental duplications. Using PCR and fluorescence in situ hybridization we experimentally validated 23 of 27 (85% semi-randomly chosen regions; the largest novel inversion confirmed was 4.3 mega-bases at human Chromosome 7p14. Gorilla was used as an out-group to assign ancestral status to the variants. All experimentally validated inversion regions were then assayed against a panel of human samples and three of the 23 (13% regions were found to be polymorphic in the human genome. These polymorphic inversions include 730 kb (at 7p22, 13 kb (at 7q11, and 1 kb (at 16q24 fragments with a 5%, 30%, and 48% minor allele frequency, respectively. Our results suggest that inversions are an important source of variation in primate genome evolution. The finding of at least three novel inversion polymorphisms in humans indicates this type of structural variation may be a more common feature of our genome than previously realized.

  10. Human genetics and genomics a decade after the release of the draft sequence of the human genome

    Science.gov (United States)

    2011-01-01

    Substantial progress has been made in human genetics and genomics research over the past ten years since the publication of the draft sequence of the human genome in 2001. Findings emanating directly from the Human Genome Project, together with those from follow-on studies, have had an enormous impact on our understanding of the architecture and function of the human genome. Major developments have been made in cataloguing genetic variation, the International HapMap Project, and with respect to advances in genotyping technologies. These developments are vital for the emergence of genome-wide association studies in the investigation of complex diseases and traits. In parallel, the advent of high-throughput sequencing technologies has ushered in the 'personal genome sequencing' era for both normal and cancer genomes, and made possible large-scale genome sequencing studies such as the 1000 Genomes Project and the International Cancer Genome Consortium. The high-throughput sequencing and sequence-capture technologies are also providing new opportunities to study Mendelian disorders through exome sequencing and whole-genome sequencing. This paper reviews these major developments in human genetics and genomics over the past decade. PMID:22155605

  11. Comparative genomics of human and non-human Listeria monocytogenes sequence type 121 strains.

    Directory of Open Access Journals (Sweden)

    Kathrin Rychli

    Full Text Available The food-borne pathogen Listeria (L. monocytogenes is able to survive for months and even years in food production environments. Strains belonging to sequence type (ST121 are particularly found to be abundant and to persist in food and food production environments. To elucidate genetic determinants characteristic for L. monocytogenes ST121, we sequenced the genomes of 14 ST121 strains and compared them with currently available L. monocytogenes ST121 genomes. In total, we analyzed 70 ST121 genomes deriving from 16 different countries, different years of isolation, and different origins-including food, animal and human ST121 isolates. All ST121 genomes show a high degree of conservation sharing at least 99.7% average nucleotide identity. The main differences between the strains were found in prophage content and prophage conservation. We also detected distinct highly conserved subtypes of prophages inserted at the same genomic locus. While some of the prophages showed more than 99.9% similarity between strains from different sources and years, other prophages showed a higher level of diversity. 81.4% of the strains harbored virtually identical plasmids. 97.1% of the ST121 strains contain a truncated internalin A (inlA gene. Only one of the seven human ST121 isolates encodes a full-length inlA gene, illustrating the need of better understanding their survival and virulence mechanisms.

  12. Isolation and characterization of human glycophorin A cDNAs using a synthetic oligonucleotide approach: nucleotide sequence, mRNA structure and regulation by 12-O-tetradecanoylphorbol 13-acetate (TPA)

    International Nuclear Information System (INIS)

    Siebert, P.D.; Fukuda, M.

    1986-01-01

    The authors have previously shown that treatment of human erythroleukemic K562 cells with the tumor-promoting phorbol ester, TPA, results in a diminished expression of glycophorin A at the level of protein biosynthesis and in vitro mRNA translation activity. To further examine the structure, relationships and expression of human glycophorins they have successfully isolated and sequenced several glycophorin A specific cDNA clones derived from K562 cells, by making extensive use of mixed and exact synthetic oligonucleotides as primers and radioactively labeled probes. The nucleotide sequence obtained from the largest glycophorin A cDNA suggests the presence of a hydrophobic leader-like peptide of at least 19 amino acids. Northern gel analysis using both whole cDNA-plasmid and synthetic oligonucleotide probes revealed the existence of multiple mRNAs, three of which they believe to be glycophorin A-specific, whereas a fourth and smaller mRNA appears to be glycophorin B-specific. Furthermore, the abundance of all four glycophorin mRNAs were found to be extensively reduced following treatment of K562 cells with TPA suggesting coordinate regulation, possibly at the level of gene transcription

  13. Response of human epidermal keratinocytes to UV light

    International Nuclear Information System (INIS)

    Kartasova, A.A.

    1987-01-01

    This thesis presents a study on the response of human epidermal keratinocytes to UV light as well as to other agents like 4-NQO and TPA. The effects of ultraviolet (UV) light on the protein synthesis in cultured keratinocytes are presented in ch. III. The next chapter describes the construction of a cDNA library using mRNA isolated from UV irradiated kernatinocytes. This library was differentially screened with cDNA probes synthesized on mRNA from either UV irradiated or nonirradiated cells. Several groups of cDNA clones corresponding to transcripts whose level in the cytoplasm seem to be affected by exposure to UV light have been isolated and characterized by cross-hybridization, sequencing and Northern blot analysis. More detailed analysis of some of the cDNA clones is presented in the two chapters following ch. IV. The complete cDNA sequence of the proteinase inhibitor cystatin A and the modulation of its expression by UV light and the carcinogen 4-nitroquinoline 1-oxide (4-NQO) in keratinocytes are described in ch. V. Two other groups of cDNA clones have been isolated which do not cross-hybridize with each other on Southern blots. However, the primary structures of the proteins deduced from the nucleotide sequences of these two groups of cDNA clones are very similar. 212 refs.; 33 figs.; 2 tabs

  14. α/sub i/-3 cDNA encodes the α subunit of G/sub k/, the stimulatory G protein of receptor-regulated K+ channels

    International Nuclear Information System (INIS)

    Codina, J.; Olate, J.; Abramowitz, J.; Mattera, R.; Cook, R.G.; Birnbaumer, L.

    1988-01-01

    cDNA cloning has identified the presence in the human genome of three genes encoding α subunits of pertussis toxin substrates, generically called G/sub i/. They are named α/sub i/-1, α/sub i/-2 and α/sub i/-3. However, none of these genes has been functionally identified with any of the α subunits of several possible G proteins, including pertussis toxin-sensitive G/sub p/'s, stimulatory to phospholipase C or A 2 , G/sub i/, inhibitory to adenylyl cyclase, or G/sub k/, stimulatory to a type of K + channels. The authors now report the nucleotide sequence and the complete predicted amino acid sequence of human liver α/sub i/-3 and the partial amino acid sequence of proteolytic fragments of the α subunit of human erythrocyte G/sub k/. The amino acid sequence of the proteolytic fragment is uniquely encoded by the cDNA of α/sub i/-3, thus identifying it as α/sub k/. The probable identity of α/sub i/-1 with α/sub p/ and possible roles for α/sub i/-2, as well as additional roles for α/sub i/-1 and α/sub i/-3 (α/sub k/) are discussed

  15. Cloning and characterization of human very-long-chain acyl-CoA dehydrogenase cDNA, chromosomal assignment of the gene and identification in four patients of nine different mutations within the VLCAD gene

    DEFF Research Database (Denmark)

    Andresen, B S; Bross, P; Vianey-Saban, C

    1996-01-01

    Very-long-chain acyl-CoA dehydrogenase (VLCAD) is one of four straight-chain acyl-CoA dehydrogenase (ACD) enzymes, which are all nuclear encoded mitochondrial flavoproteins catalyzing the initial step in fatty acid beta-oxidation. We have used the very fast, Rapid Amplification of cDNA Ends (RACE...

  16. Galectin-3 and Beclin1/Atg6 genes in human cancers: using cDNA tissue panel, qRT-PCR, and logistic regression model to identify cancer cell biomarkers.

    Directory of Open Access Journals (Sweden)

    Halliday A Idikio

    Full Text Available Cancer biomarkers are sought to support cancer diagnosis, predict cancer patient response to treatment and survival. Identifying reliable biomarkers for predicting cancer treatment response needs understanding of all aspects of cancer cell death and survival. Galectin-3 and Beclin1 are involved in two coordinated pathways of programmed cell death, apoptosis and autophagy and are linked to necroptosis/necrosis. The aim of the study was to quantify galectin-3 and Beclin1 mRNA in human cancer tissue cDNA panels and determine their utility as biomarkers of cancer cell survival.A panel of 96 cDNAs from eight (8 different normal and cancer tissue types were used for quantitative real-time polymerase chain reaction (qRT-PCR using ABI7900HT. Miner2.0, a web-based 4- and 3-parameter logistic regression software was used to derive individual well polymerase chain reaction efficiencies (E and cycle threshold (Ct values. Miner software derived formula was used to calculate mRNA levels and then fold changes. The ratios of cancer to normal tissue levels of galectin-3 and Beclin1 were calculated (using the mean for each tissue type. Relative mRNA expressions for galectin-3 were higher than for Beclin1 in all tissue (normal and cancer types. In cancer tissues, breast, kidney, thyroid and prostate had the highest galectin-3 mRNA levels compared to normal tissues. High levels of Beclin1 mRNA levels were in liver and prostate cancers when compared to normal tissues. Breast, kidney and thyroid cancers had high galectin-3 levels and low Beclin1 levels.Galectin-3 expression patterns in normal and cancer tissues support its reported roles in human cancer. Beclin1 expression pattern supports its roles in cancer cell survival and in treatment response. qRT-PCR analysis method used may enable high throughput studies to generate molecular biomarker sets for diagnosis and predicting cancer treatment response.

  17. Construction of Infectious cDNA Clone of a Chrysanthemum stunt viroid Korean Isolate

    Directory of Open Access Journals (Sweden)

    Ju-Yeon Yoon

    2014-03-01

    Full Text Available Chrysanthemum stunt viroid (CSVd, a noncoding infectious RNA molecule, causes seriously economic losses of chrysanthemum for 3 or 4 years after its first infection. Monomeric cDNA clones of CSVd isolate SK1 (CSVd-SK1 were constructed in the plasmids pGEM-T easy vector and pUC19 vector. Linear positive-sense transcripts synthesized in vitro from the full-length monomeric cDNA clones of CSVd-SK1 could infect systemically tomato seedlings and chrysanthemum plants, suggesting that the linear CSVd RNA transcribed from the cDNA clones could be replicated as efficiently as circular CSVd in host species. However, direct inoculation of plasmid cDNA clones containing full-length monomeric cDNA of CSVd-SK1 failed to infect tomato and chrysanthemum and linear negative-sense transcripts from the plasmid DNAs were not infectious in the two plant species. The cDNA sequences of progeny viroid in systemically infected tomato and chrysanthemum showed a few substitutions at a specific nucleotide position, but there were no deletions and insertions in the sequences of the CSVd progeny from tomato and chrysanthemum plants.

  18. Draft genome sequence of the first human isolate of the ruminant pathogen Mycoplasma capricolum subsp. capricolum

    DEFF Research Database (Denmark)

    Seersholm, Frederik Valeur; Fischer, Anne; Heller, Martin

    2015-01-01

    Mycoplasma capricolum subsp. capricolum is a well-known pathogen of small ruminants. A recent human case of septicemia involving this agent raised the question of its potential pathogenicity to humans. We present the first draft genome sequence of a human Mycoplasma capricolum subsp. capricolum...

  19. 3G vector-primer plasmid for constructing full-length-enriched cDNA libraries.

    Science.gov (United States)

    Zheng, Dong; Zhou, Yanna; Zhang, Zidong; Li, Zaiyu; Liu, Xuedong

    2008-09-01

    We designed a 3G vector-primer plasmid for the generation of full-length-enriched complementary DNA (cDNA) libraries. By employing the terminal transferase activity of reverse transcriptase and the modified strand replacement method, this plasmid (assembled with a polydT end and a deoxyguanosine [dG] end) combines priming full-length cDNA strand synthesis and directional cDNA cloning. As a result, the number of steps involved in cDNA library preparation is decreased while simplifying downstream gene manipulation, sequencing, and subcloning. The 3G vector-primer plasmid method yields fully represented plasmid primed libraries that are equivalent to those made by the SMART (switching mechanism at 5' end of RNA transcript) approach.

  20. Nonlinear Synchronization for Automatic Learning of 3D Pose Variability in Human Motion Sequences

    Directory of Open Access Journals (Sweden)

    Mozerov M

    2010-01-01

    Full Text Available A dense matching algorithm that solves the problem of synchronizing prerecorded human motion sequences, which show different speeds and accelerations, is proposed. The approach is based on minimization of MRF energy and solves the problem by using Dynamic Programming. Additionally, an optimal sequence is automatically selected from the input dataset to be a time-scale pattern for all other sequences. The paper utilizes an action specific model which automatically learns the variability of 3D human postures observed in a set of training sequences. The model is trained using the public CMU motion capture dataset for the walking action, and a mean walking performance is automatically learnt. Additionally, statistics about the observed variability of the postures and motion direction are also computed at each time step. The synchronized motion sequences are used to learn a model of human motion for action recognition and full-body tracking purposes.

  1. De novo assembly of human genomes with massively parallel short read sequencing

    DEFF Research Database (Denmark)

    Li, Ruiqiang; Zhu, Hongmei; Ruan, Jue

    2010-01-01

    genomes from short read sequences. We successfully assembled both the Asian and African human genome sequences, achieving an N50 contig size of 7.4 and 5.9 kilobases (kb) and scaffold of 446.3 and 61.9 kb, respectively. The development of this de novo short read assembly method creates new opportunities...... for building reference sequences and carrying out accurate analyses of unexplored genomes in a cost-effective way....

  2. Construction and characterization of the alpha form of a cardiac myosin heavy chain cDNA clone and its developmental expression in the Syrian hamster.

    OpenAIRE

    Liew, C C; Jandreski, M A

    1986-01-01

    A cDNA clone, pVHC1, was isolated from a Syrian hamster heart cDNA library and was compared to the rat alpha (pCMHC21) and beta (pCMHC5) ventricular myosin heavy chain cDNA clones. The DNA sequence and amino acid sequence deducted from the DNA show more homology with pCMHC21 than pCMHC5. This indicates that pVHC1 is an alpha ventricular myosin heavy chain cDNA clone. However, even though pVHC1 shows a high degree of nucleotide and amino acid conservation with the rat myosin heavy chain sequen...

  3. Complete genome sequence of Bifidobacterium breve CECT 7263, a strain isolated from human milk.

    Science.gov (United States)

    Jiménez, Esther; Villar-Tajadura, M Antonia; Marín, María; Fontecha, Javier; Requena, Teresa; Arroyo, Rebeca; Fernández, Leónides; Rodríguez, Juan M

    2012-07-01

    Bifidobacterium breve is an actinobacterium frequently isolated from colonic microbiota of breastfeeding babies. Here, we report the complete and annotated genome sequence of a B. breve strain isolated from human milk, B. breve CECT 7263. The genome sequence will provide new insights into the biology of this potential probiotic organism and will allow the characterization of genes related to beneficial properties.

  4. The first complete genome sequences of clinical isolates of human coronavirus 229E

    NARCIS (Netherlands)

    Farsani, Seyed Mohammad Jazaeri; Dijkman, Ronald; Jebbink, Maarten F.; Goossens, Herman; Ieven, Margareta; Deijs, Martin; Molenkamp, Richard; van der Hoek, Lia

    2012-01-01

    Human coronavirus 229E has been identified in the mid-1960s, yet still only one full-genome sequence is available. This full-length sequence has been determined from the cDNA-clone Inf-1 that is based on the lab-adapted strain VR-740. Lab-adaptation might have resulted in genomic changes, due to

  5. Cloning the interleukin 1 receptor from human T cells

    International Nuclear Information System (INIS)

    Sims, J.E.; Acres, R.B.; Grubin, C.E.; McMahan, C.J.; Wignall, J.M.; March, C.J.; Dower, S.K.

    1989-01-01

    cDNA clones of the interleukin 1 (IL-1) receptor expressed in a human T-cell clone have been isolated by using a murine IL-1 receptor cDNA as a probe. The human and mouse receptors show a high degree of sequence conservation. Both are integral membrane proteins possessing a single membrane-spanning segment. Similar to the mouse receptor, the human IL-1 receptor contains a large cytoplasmic region and an extracellular, IL-1 binding portion composed of three immunoglobulin-like domains. When transfected into COS cells, the human IL-1 receptor cDNA clone leads to expression of two different affinity classes of receptors, with K a values indistinguishable from those determined for IL-1 receptors in the original T-cell clone. An IL-1 receptor expressed in human dermal fibroblasts has also been cloned and sequenced and found to be identical to the IL-1 receptor expressed in T cells

  6. [Whole Genome Sequencing of Human mtDNA Based on Ion Torrent PGM™ Platform].

    Science.gov (United States)

    Cao, Y; Zou, K N; Huang, J P; Ma, K; Ping, Y

    2017-08-01

    To analyze and detect the whole genome sequence of human mitochondrial DNA (mtDNA) by Ion Torrent PGM™ platform and to study the differences of mtDNA sequence in different tissues. Samples were collected from 6 unrelated individuals by forensic postmortem examination, including chest blood, hair, costicartilage, nail, skeletal muscle and oral epithelium. Amplification of whole genome sequence of mtDNA was performed by 4 pairs of primer. Libraries were constructed with Ion Shear™ Plus Reagents kit and Ion Plus Fragment Library kit. Whole genome sequencing of mtDNA was performed using Ion Torrent PGM™ platform. Sanger sequencing was used to determine the heteroplasmy positions and the mutation positions on HVⅠ region. The whole genome sequence of mtDNA from all samples were amplified successfully. Six unrelated individuals belonged to 6 different haplotypes. Different tissues in one individual had heteroplasmy difference. The heteroplasmy positions and the mutation positions on HVⅠ region were verified by Sanger sequencing. After a consistency check by the Kappa method, it was found that the results of mtDNA sequence had a high consistency in different tissues. The testing method used in present study for sequencing the whole genome sequence of human mtDNA can detect the heteroplasmy difference in different tissues, which have good consistency. The results provide guidance for the further applications of mtDNA in forensic science. Copyright© by the Editorial Department of Journal of Forensic Medicine

  7. Recombinant DNA specifying the human amyloid. beta. precursor protein (ABPP) encodes a 95-kDa polypeptide

    Energy Technology Data Exchange (ETDEWEB)

    Mita, S; Sadlock, J; Herbert, J; Schon, E A

    1988-10-11

    Although the ABPP gene give rise to multiple mRNAs, the primary translation product of this gene is unknown. The longest published cDNA sequences predict a 770-aa polypeptide of 87 kDa. However, in immunoblots, ABPP migrated as a single species of >92 kDa in rat brain, and in human, as a species of 95-100 kDa in non-membrane bound form, as multiple species of 110-135 kDa in membrane-associated form and as a 130-kDa species in fibroblasts. The sizes of these larger species relative to the MW of ABPP predicted from the cDNA sequences have been attributed to postranslational modification. However, the authors have isolated a cDNA (lambdaHAP2) from a human fetal muscle lambdagt11 cDNA library encoding an 843-aa polypeptide with a deduced MW of 94,642. This cDNA contains both exons encoding an 843-aa polypeptide with a deduced MW of 94.642. This cDNA contains both exons encoding the protease inhibitor domains. Primer extension analysis indicates that the 5' terminus of this cDNA is 14 nt from a transcriptional start site. This cDNA, encoding the longest ABPP described to date, may explain some of the observations on the sizes of tissue-derived ABPP.

  8. Next generation sequencing analysis of human platelet PolyA+ mRNAs and rRNA-depleted total RNA.

    Directory of Open Access Journals (Sweden)

    Antheia Kissopoulou

    Full Text Available BACKGROUND: Platelets are small anucleate cells circulating in the blood vessels where they play a key role in hemostasis and thrombosis. Here, we compared platelet RNA-Seq results obtained from polyA+ mRNA and rRNA-depleted total RNA. MATERIALS AND METHODS: We used purified, CD45 depleted, human blood platelets collected by apheresis from three male and one female healthy blood donors. The Illumina HiSeq 2000 platform was employed to sequence cDNA converted either from oligo(dT isolated polyA+ RNA or from rRNA-depleted total RNA. The reads were aligned to the GRCh37 reference assembly with the TopHat/Cufflinks alignment package using Ensembl annotations. A de novo assembly of the platelet transcriptome using the Trinity software package and RSEM was also performed. The bioinformatic tools HTSeq and DESeq from Bioconductor were employed for further statistical analyses of read counts. RESULTS: Consistent with previous findings our data suggests that mitochondrially expressed genes comprise a substantial fraction of the platelet transcriptome. We also identified high transcript levels for protein coding genes related to the cytoskeleton function, chemokine signaling, cell adhesion, aggregation, as well as receptor interaction between cells. Certain transcripts were particularly abundant in platelets compared with other cell and tissue types represented by RNA-Seq data from the Illumina Human Body Map 2.0 project. Irrespective of the different library preparation and sequencing protocols, there was good agreement between samples from the 4 individuals. Eighteen differentially expressed genes were identified in the two sexes at 10% false discovery rate using DESeq. CONCLUSION: The present data suggests that platelets may have a unique transcriptome profile characterized by a relative over-expression of mitochondrially encoded genes and also of genomic transcripts related to the cytoskeleton function, chemokine signaling and surface components

  9. Cloning and characterization of cDNAs encoding the complete sequence of decay-accelerating factor of human complement

    International Nuclear Information System (INIS)

    Medof, M.E.; Lublin, D.M.; Holers, V.M.; Ayers, D.J.; Getty, R.R.; Leykam, J.F.; Atkinson, J.P.; Tykocinski, M.L.

    1987-01-01

    cDNAs encoding the complement decay-accelerating factor (DAF) were isolated from HeLa and differentiated HL-60 λgt cDNA libraries by screening with a codon preference oligonucleotide corresponding to DAF NH 2 -terminal amino acids 3-14. The composite cDNA sequence showed a 347-amino acid protein preceded by an NH 2 -terminal leader peptide sequence. The translated sequence beginning at the DAF NH 2 terminus encodes four contiguous ≅ 61-amino acid long repetitive units of internal homology. The repetitive regions contain four conserved cysteines, one proline, one glycine, one glycine/alanine, four leucines/isoleucines/valines, one serine, three tyrosines/phenylalanines, and on tryptophan and show striking homology to similar regions previously identified in factor B, C2, C4 binding protein, factor H, C1r, factor XIII, interleukin 2 receptor, and serum β 2 -glycoprotein I. The consensus repeats are attached to a 70-amino acid long segment rich in serine and threonine (potential O-glycosylation sites), which is in turn followed by a stretch of hydrophobic amino acids. RNA blot analysis of HeLa and HL-60 RNA revealed three DAF mRNA species of 3.1, 2.7, and 2.0 kilobases. The results indicate that portions of the DAF gene may have evolved from a DNA element common to the above proteins, that DAF cDNA predicts a COOH-terminal anchoring polypeptide, and that distinct species of DAF message are elaborated in cells

  10. Avoiding cross hybridization by choosing nonredundant targets on cDNA arrays

    DEFF Research Database (Denmark)

    Nielsen, Henrik Bjørn; Knudsen, Steen

    2002-01-01

    PROBEWIZ designs PCR primers for amplifying probes for cDNA arrays. The probes are designed to have minimal homology to other expressed sequences from a given organism. The primer selection is based on user-defined penalties for homology, primer quality, and proximity to the 3' end.......PROBEWIZ designs PCR primers for amplifying probes for cDNA arrays. The probes are designed to have minimal homology to other expressed sequences from a given organism. The primer selection is based on user-defined penalties for homology, primer quality, and proximity to the 3' end....

  11. Isolation and expression of a pea vicilin cDNA in the yeast Saccharomyces cerevisiae.

    OpenAIRE

    Watson, M D; Lambert, N; Delauney, A; Yarwood, J N; Croy, R R; Gatehouse, J A; Wright, D J; Boulter, D

    1988-01-01

    A cDNA clone containing the complete coding sequence for vicilin from pea (Pisum sativum L.) was isolated. It specifies a 50,000-Mr protein that in pea is neither post-translationally processed nor glycosylated. The cDNA clone was expressed in yeast from a 2 micron plasmid by using the yeast phosphoglycerate kinase promoter and initiator codon. The resultant fusion protein, which contains the first 16 amino acid residues of phosphoglycerate kinase in addition to the vicilin sequence, was puri...

  12. Human catechol-O-methyltransferase: Cloning and expression of the membrane-associated form

    International Nuclear Information System (INIS)

    Bertocci, B.; Miggiano, V.; Da Prada, M.; Dembic, Z.; Lahm, H.W.; Malherbe, P.

    1991-01-01

    A cDNA clone for human catechol-O-methyltransferase was isolated from a human hepatoma cell line (Hep G2) cDNA library by hybridization screening with a porcine cDNA probe. The cDNA clone was sequenced and found to have an insert of 1226 nucleotides. The deduced primary structure of hCOMT is composed of 271 amino acid residues with the predicted molecular mass of 30 kDa. At its N terminus it has a hydrophobic segment of 21 amino acid residues that may be responsible for insertion of hCOMT into the endoplasmic reticulum membrane. The primary structure of hCOMT exhibits high homology to the porcine partial cDNA sequence (93%). The deduced amino acid sequence contains two tryptic peptide sequences (T-22, T-33) found in porcine liver catechol-O-methyltransferase (CEMT). The coding region of hCOMT cDNA was placed under the control of the cytomegalovirus promoter to transfect human kidney 293 cells. The recombinant hCOMT was shown by immunoblot analysis to be mainly associated with the membrane fraction. RNA blot analysis revealed one COMT mRNA transcript of 1.4 kilobases in Hep G2 poly(A) + RNA

  13. Characterization of cDNAs encoding human pyruvate dehydrogenase α subunit

    International Nuclear Information System (INIS)

    Ho, Lap; Wexler, I.D.; Liu, Techung; Thekkumkara, T.J.; Patel, M.S.

    1989-01-01

    A cDNA clone (1,423 base pairs) comprising the entire coding region of the precursor form of the α subunit of pyruvate dehydrogenase (E 1 α) has been isolated from a human liver cDNA library in phage λgt11. The first 29 amino acids deduced from the open reading frame correspond to a typical mitochondrial targeting leader sequence. The remaining 361 amino acids, starting at the N terminus with phenylalanine, represent the mature mitochondrial E 1 α peptide. The cDNA has 43 base pairs in the 5' untranslated region and 210 base pairs in the 3' untranslated region, including a polyadenylylation signal and a short poly(A) tract. The nucleotide sequence of human liver E 1 α cDNA was confirmed by the nucleotide sequences of three overlapping fragments generated from human liver and fibroblast RNA by reverse transcription and DNA amplification by the polymerase chain reaction. This consensus nucleotide sequence of human liver E 1 α cDNA resolves existing discrepancies among three previously reported human E 1 α cDNAs and provides the unambiguous reference sequence needed for the characterization of genetic mutations in pyruvate dehydrogenase-deficient patients

  14. Genetic mutation analysis of human gastric adenocarcinomas using ion torrent sequencing platform.

    Directory of Open Access Journals (Sweden)

    Zhi Xu

    Full Text Available Gastric cancer is the one of the major causes of cancer-related death, especially in Asia. Gastric adenocarcinoma, the most common type of gastric cancer, is heterogeneous and its incidence and cause varies widely with geographical regions, gender, ethnicity, and diet. Since unique mutations have been observed in individual human cancer samples, identification and characterization of the molecular alterations underlying individual gastric adenocarcinomas is a critical step for developing more effective, personalized therapies. Until recently, identifying genetic mutations on an individual basis by DNA sequencing remained a daunting task. Recent advances in new next-generation DNA sequencing technologies, such as the semiconductor-based Ion Torrent sequencing platform, makes DNA sequencing cheaper, faster, and more reliable. In this study, we aim to identify genetic mutations in the genes which are targeted by drugs in clinical use or are under development in individual human gastric adenocarcinoma samples using Ion Torrent sequencing. We sequenced 737 loci from 45 cancer-related genes in 238 human gastric adenocarcinoma samples using the Ion Torrent Ampliseq Cancer Panel. The sequencing analysis revealed a high occurrence of mutations along the TP53 locus (9.7% in our sample set. Thus, this study indicates the utility of a cost and time efficient tool such as Ion Torrent sequencing to screen cancer mutations for the development of personalized cancer therapy.

  15. Accelerated Evolution of Conserved Noncoding Sequences in theHuman Genome

    Energy Technology Data Exchange (ETDEWEB)

    Prambhakar, Shyam; Noonan, James P.; Paabo, Svante; Rubin, EdwardM.

    2006-07-06

    Genomic comparisons between human and distant, non-primatemammals are commonly used to identify cis-regulatory elements based onconstrained sequence evolution. However, these methods fail to detect"cryptic" functional elements, which are too weakly conserved amongmammals to distinguish from nonfunctional DNA. To address this problem,we explored the potential of deep intra-primate sequence comparisons. Wesequenced the orthologs of 558 kb of human genomic sequence, coveringmultiple loci involved in cholesterol homeostasis, in 6 nonhumanprimates. Our analysis identified 6 noncoding DNA elements displayingsignificant conservation among primates, but undetectable in more distantcomparisons. In vitro and in vivo tests revealed that at least three ofthese 6 elements have regulatory function. Notably, the mouse orthologsof these three functional human sequences had regulatory activity despitetheir lack of significant sequence conservation, indicating that they arecryptic ancestral cis-regulatory elements. These regulatory elementscould still be detected in a smaller set of three primate speciesincluding human, rhesus and marmoset. Since the human and rhesus genomesequences are already available, and the marmoset genome is activelybeing sequenced, the primate-specific conservation analysis describedhere can be applied in the near future on a whole-genome scale, tocomplement the annotation provided by more distant speciescomparisons.

  16. The "most wanted" taxa from the human microbiome for whole genome sequencing.

    Directory of Open Access Journals (Sweden)

    Anthony A Fodor

    Full Text Available The goal of the Human Microbiome Project (HMP is to generate a comprehensive catalog of human-associated microorganisms including reference genomes representing the most common species. Toward this goal, the HMP has characterized the microbial communities at 18 body habitats in a cohort of over 200 healthy volunteers using 16S rRNA gene (16S sequencing and has generated nearly 1,000 reference genomes from human-associated microorganisms. To determine how well current reference genome collections capture the diversity observed among the healthy microbiome and to guide isolation and future sequencing of microbiome members, we compared the HMP's 16S data sets to several reference 16S collections to create a 'most wanted' list of taxa for sequencing. Our analysis revealed that the diversity of commonly occurring taxa within the HMP cohort microbiome is relatively modest, few novel taxa are represented by these OTUs and many common taxa among HMP volunteers recur across different populations of healthy humans. Taken together, these results suggest that it should be possible to perform whole-genome sequencing on a large fraction of the human microbiome, including the 'most wanted', and that these sequences should serve to support microbiome studies across multiple cohorts. Also, in stark contrast to other taxa, the 'most wanted' organisms are poorly represented among culture collections suggesting that novel culture- and single-cell-based methods will be required to isolate these organisms for sequencing.

  17. Structural analysis of human complement protein H: homology with C4b binding protein, beta 2-glycoprotein I, and the Ba fragment of B2

    DEFF Research Database (Denmark)

    Kristensen, Torsten; Wetsel, R A; Tack, B F

    1986-01-01

    We report here a partial primary structure for human complement protein H. Tryptic peptides comprising 27% of the H molecule were isolated by conventional techniques and were sequenced (333 amino acid residues). Several mixed-sequence oligonucleotide probes were constructed, based on the peptide...... sequence data, and were used to screen a human liver cDNA library. The largest recombinant plasmid (pH1050), which hybridized with two probes, was further characterized. The cDNA insert of this plasmid contained coding sequence (672 bp) for 224 amino acids of H. The 3' end of this clone had...... a polyadenylated tail preceded by a polyadenylation recognition site (ATTAAA) and a 3'-untranslated region (229 bp). Four regions of internal homology, each about 60 amino acids in length, were observed in the derived protein sequence from this cDNA clone, and a further seven from the tryptic peptide sequences...

  18. Effect of 5'-flanking sequence deletions on expression of the human insulin gene in transgenic mice

    DEFF Research Database (Denmark)

    Fromont-Racine, M; Bucchini, D; Madsen, O

    1990-01-01

    Expression of the human insulin gene was examined in transgenic mouse lines carrying the gene with various lengths of DNA sequences 5' to the transcription start site (+1). Expression of the transgene was demonstrated by 1) the presence of human C-peptide in urine, 2) the presence of specific...... of the transgene was observed in cell types other than beta-islet cells....

  19. LEDGF/p75 Deficiency Increases Deletions at the HIV-1 cDNA Ends.

    Science.gov (United States)

    Bueno, Murilo T D; Reyes, Daniel; Llano, Manuel

    2017-09-15

    Processing of unintegrated linear HIV-1 cDNA by the host DNA repair system results in its degradation and/or circularization. As a consequence, deficient viral cDNA integration generally leads to an increase in the levels of HIV-1 cDNA circles containing one or two long terminal repeats (LTRs). Intriguingly, impaired HIV-1 integration in LEDGF/p75-deficient cells does not result in a correspondent increase in viral cDNA circles. We postulate that increased degradation of unintegrated linear viral cDNA in cells lacking the lens epithelium-derived growth factor (LEDGF/p75) account for this inconsistency. To evaluate this hypothesis, we characterized the nucleotide sequence spanning 2-LTR junctions isolated from LEDGF/p75-deficient and control cells. LEDGF/p75 deficiency resulted in a significant increase in the frequency of 2-LTRs harboring large deletions. Of note, these deletions were dependent on the 3' processing activity of integrase and were not originated by aberrant reverse transcription. Our findings suggest a novel role of LEDGF/p75 in protecting the unintegrated 3' processed linear HIV-1 cDNA from exonucleolytic degradation.

  20. Human platelet glycoprotein IX: An adhesive prototype of leucine-rich glycoproteins with flank-center-flank structures

    International Nuclear Information System (INIS)

    Hickey, M.J.; Williams, S.A.; Roth, G.J.

    1989-01-01

    The glycoprotein (GP) Ib-IX complex on the surface of human platelets functions as the von Willebrand factor receptor and mediates von Willebrand factor-dependent platelet adhesion to blood vessels. GPIX is a relatively small (M r , 17,000) protein that may provide for membrane insertion and orientation of the larger component of the complex. GPIb (M r , 165,000). Using antibody screening, the authors cloned a cDNA encoding GPIX from a human erythroleukemia cell cDNA library constructed in phage λgt11. Lacking a 5' untranslated region and start codon, the cDNA sequence includes 604 nucleotides, beginning with 495 bases at the 5' end coding for 165 amino acids, followed by a stop codon and 106 noncoding bases at the 3' end. By Northern blot analysis, the GPIX cDNA hybridizes with a single 1.0-kilobase species of platelet poly(A) + RNA. Translation of the cDNA sequence gives a predicted protein sequence beginning with a truncated putative signal sequence of 5 amino acids followed by a sequence of 17 amino acids matching that determined directly by Edman degradation of intact GPIX. GPIX contains a leucine-rich glycoprotein (LRG) sequence of 24 amino acids similar to conserved LRG sequences in GPIb and other proteins from humans, Drosophila, and yeast. The role of the flank-LRG center-flank structure in the evolution and function of the LRG proteins remains to be defined

  1. Construction of a cDNA library from female adult of Toxocara canis, and analysis of EST and immune-related genes expressions.

    Science.gov (United States)

    Zhou, Rongqiong; Xia, Qingyou; Huang, Hancheng; Lai, Min; Wang, Zhenxin

    2011-10-01

    Toxocara canis is a widespread intestinal nematode parasite of dogs, which can also cause disease in humans. We employed an expressed sequence tag (EST) strategy in order to study gene-expression including development, digestion and reproduction of T. canis. ESTs provided a rapid way to identify genes, particularly in organisms for which we have very little molecular information. In this study, a cDNA library was constructed from a female adult of T. canis and 215 high-quality ESTs from 5'-ends of the cDNA clones representing 79 unigenes were obtained. The titer of the primary cDNA library was 1.83×10(6)pfu/mL with a recombination rate of 99.33%. Most of the sequences ranged from 300 to 900bp with an average length of 656bp. Cluster analysis of these ESTs allowed identification of 79 unique sequences containing 28 contigs and 51 singletons. BLASTX searches revealed that 18 unigenes (22.78% of the total) or 70 ESTs (32.56% of the total) were novel genes that had no significant matches to any protein sequences in the public databases. The rest of the 61 unigenes (77.22% of the total) or 145 ESTs (67.44% of the total) were closely matched to the known genes or sequences deposited in the public databases. These genes were classified into seven groups based on their known or putative biological functions. We also confirmed the gene expression patterns of several immune-related genes using RT-PCR examination. This work will provide a valuable resource for the further investigations in the stage-, sex- and tissue-specific gene transcription or expression. Copyright © 2011. Published by Elsevier Inc.

  2. Human liver cell trafficking mutants: characterization and whole exome sequencing.

    Directory of Open Access Journals (Sweden)

    Fei Yuan

    Full Text Available The HuH7 liver cell mutant Trf1 is defective in membrane trafficking and is complemented by the casein kinase 2α subunit CK2α''. Here we identify characteristic morphologies, trafficking and mutational changes in six additional HuH7 mutants Trf2-Trf7. Trf1 cells were previously shown to be severely defective in gap junction functions. Using a Lucifer yellow transfer assay, remarkable attenuation of gap junction communication was revealed in each of the mutants Trf2-Trf7. Electron microscopy and light microscopy of thiamine pyrophosphatase showed that several mutants exhibited fragmented Golgi apparatus cisternae compared to parental HuH7 cells. Intracellular trafficking was investigated using assays of transferrin endocytosis and recycling and VSV G secretion. Surface binding of transferrin was reduced in all six Trf2-Trf7 mutants, which generally correlated with the degree of reduced expression of the transferrin receptor at the cell surface. The mutants displayed the same transferrin influx rates as HuH7, and for efflux rate, only Trf6 differed, having a slower transferrin efflux rate than HuH7. The kinetics of VSV G transport along the exocytic pathway were altered in Trf2 and Trf5 mutants. Genetic changes unique to particular Trf mutants were identified by exome sequencing, and one was investigated in depth. The novel mutation Ile34Phe in the GTPase RAB22A was identified in Trf4. RNA interference knockdown of RAB22A or overexpression of RAB22AI34F in HuH7 cells caused phenotypic changes characteristic of the Trf4 mutant. In addition, the Ile34Phe mutation reduced both guanine nucleotide binding and hydrolysis activities of RAB22A. Thus, the RAB22A Ile34Phe mutation appears to contribute to the Trf4 mutant phenotype.

  3. PCR-based cDNA library construction: general cDNA libraries at the level of a few cells.

    OpenAIRE

    Belyavsky, A; Vinogradova, T; Rajewsky, K

    1989-01-01

    A procedure for the construction of general cDNA libraries is described which is based on the amplification of total cDNA in vitro. The first cDNA strand is synthesized from total RNA using an oligo(dT)-containing primer. After oligo(dG) tailing the total cDNA is amplified by PCR using two primers complementary to oligo(dA) and oligo(dG) ends of the cDNA. For insertion of the cDNA into a vector a controlled trimming of the 3' ends of the cDNA by Klenow enzyme was used. Starting from 10 J558L ...

  4. Automation of cDNA Synthesis and Labelling Improves Reproducibility

    Directory of Open Access Journals (Sweden)

    Daniel Klevebring

    2009-01-01

    Full Text Available Background. Several technologies, such as in-depth sequencing and microarrays, enable large-scale interrogation of genomes and transcriptomes. In this study, we asses reproducibility and throughput by moving all laboratory procedures to a robotic workstation, capable of handling superparamagnetic beads. Here, we describe a fully automated procedure for cDNA synthesis and labelling for microarrays, where the purification steps prior to and after labelling are based on precipitation of DNA on carboxylic acid-coated paramagnetic beads. Results. The fully automated procedure allows for samples arrayed on a microtiter plate to be processed in parallel without manual intervention and ensuring high reproducibility. We compare our results to a manual sample preparation procedure and, in addition, use a comprehensive reference dataset to show that the protocol described performs better than similar manual procedures. Conclusions. We demonstrate, in an automated gene expression microarray experiment, a reduced variance between replicates, resulting in an increase in the statistical power to detect differentially expressed genes, thus allowing smaller differences between samples to be identified. This protocol can with minor modifications be used to create cDNA libraries for other applications such as in-depth analysis using next-generation sequencing technologies.

  5. Motion Segments Decomposition of RGB-D Sequences for Human Behavior Understanding

    OpenAIRE

    Devanne , Maxime; Berretti , Stefano; Pala , Pietro; Wannous , Hazem; Daoudi , Mohamed; Bimbo , Alberto ,

    2017-01-01

    International audience; In this paper, we propose a framework for analyzing and understanding human behavior from depth videos. The proposed solution first employs shape analysis of the human pose across time to decompose the full motion into short temporal segments representing elementary motions. Then, each segment is characterized by human motion and depth appearance around hand joints to describe the change in pose of the body and the interaction with objects. Finally , the sequence of te...

  6. Combined sequencing of mRNA and DNA from human embryonic stem cells

    Directory of Open Access Journals (Sweden)

    Florian Mertes

    2016-06-01

    Full Text Available Combined transcriptome and whole genome sequencing of the same ultra-low input sample down to single cells is a rapidly evolving approach for the analysis of rare cells. Besides stem cells, rare cells originating from tissues like tumor or biopsies, circulating tumor cells and cells from early embryonic development are under investigation. Herein we describe a universal method applicable for the analysis of minute amounts of sample material (150 to 200 cells derived from sub-colony structures from human embryonic stem cells. The protocol comprises the combined isolation and separate amplification of poly(A mRNA and whole genome DNA followed by next generation sequencing. Here we present a detailed description of the method developed and an overview of the results obtained for RNA and whole genome sequencing of human embryonic stem cells, sequencing data is available in the Gene Expression Omnibus (GEO database under accession number GSE69471.

  7. Complete genome sequence of Bifidobacterium breve CECT 7263, a strain isolated from human milk

    OpenAIRE

    Jiménez, Esther; Villar-Tajadura, M. Antonia; Marín, María; Fontecha, F. Javier; Requena, Teresa; Arroyo, Rebeca; Fernández, Leónides; Rodríguez, Juan M.

    2012-01-01

    Bifidobacterium breve is an actinobacterium frequently isolated from colonic microbiota of breastfeeding babies. Here, we report the complete and annotated genome sequence of a B. breve strain isolated from human milk, B. breve CECT 7263. The genome sequence will provide new insights into the biology of this potential probiotic organism and will allow the characterization of genes related to beneficial properties. © 2012, American Society for Microbiology.

  8. Application of high-throughput sequencing in understanding human oral microbiome related with health and disease

    OpenAIRE

    Chen, Hui; Jiang, Wen

    2014-01-01

    The oral microbiome is one of most diversity habitat in the human body and they are closely related with oral health and disease. As the technique developing,, high throughput sequencing has become a popular approach applied for oral microbial analysis. Oral bacterial profiles have been studied to explore the relationship between microbial diversity and oral diseases such as caries and periodontal disease. This review describes the application of high-throughput sequencing for characterizati...

  9. cDNA, genomic sequence cloning and overexpression of ribosomal ...

    African Journals Online (AJOL)

    PRECIOUS

    2009-11-02

    Nov 2, 2009 ... basic machinery of protein synthesis and regulation, but also in various ... The genomic DNA was isolated from Giant Panda muscle tissue according to the ... for 45 s, 72°C for 2 min in the first cycle and the anneal temperature deceased 0.2°C ..... edition, Cold Spring Harbor aboratory Press. Cold Spring ...

  10. Isolation and characterization of two cDNA clones encoding for glutamate dehydrogenase in Nicotiana plumbaginifolia.

    Science.gov (United States)

    Ficarelli, A; Tassi, F; Restivo, F M

    1999-03-01

    We have isolated two full length cDNA clones encoding Nicotiana plumbaginifolia NADH-glutamate dehydrogenase. Both clones share amino acid boxes of homology corresponding to conserved GDH catalytic domains and putative mitochondrial targeting sequence. One clone shows a putative EF-hand loop. The level of the two transcripts is affected differently by carbon source.

  11. Human papilloma viruses and cervical tumours: mapping of integration sites and analysis of adjacent cellular sequences

    International Nuclear Information System (INIS)

    Klimov, Eugene; Vinokourova, Svetlana; Moisjak, Elena; Rakhmanaliev, Elian; Kobseva, Vera; Laimins, Laimonis; Kisseljov, Fjodor; Sulimova, Galina

    2002-01-01

    In cervical tumours the integration of human papilloma viruses (HPV) transcripts often results in the generation of transcripts that consist of hybrids of viral and cellular sequences. Mapping data using a variety of techniques has demonstrated that HPV integration occurred without obvious specificity into human genome. However, these techniques could not demonstrate whether integration resulted in the generation of transcripts encoding viral or viral-cellular sequences. The aim of this work was to map the integration sites of HPV DNA and to analyse the adjacent cellular sequences. Amplification of the INTs was done by the APOT technique. The APOT products were sequenced according to standard protocols. The analysis of the sequences was performed using BLASTN program and public databases. To localise the INTs PCR-based screening of GeneBridge4-RH-panel was used. Twelve cellular sequences adjacent to integrated HPV16 (INT markers) expressed in squamous cell cervical carcinomas were isolated. For 11 INT markers homologous human genomic sequences were readily identified and 9 of these showed significant homologies to known genes/ESTs. Using the known locations of homologous cDNAs and the RH-mapping techniques, mapping studies showed that the INTs are distributed among different human chromosomes for each tumour sample and are located in regions with the high levels of expression. Integration of HPV genomes occurs into the different human chromosomes but into regions that contain highly transcribed genes. One interpretation of these studies is that integration of HPV occurs into decondensed regions, which are more accessible for integration of foreign DNA

  12. Non-codingRNA sequence variations in human chronic lymphocytic leukemia and colorectal cancer.

    Science.gov (United States)

    Wojcik, Sylwia E; Rossi, Simona; Shimizu, Masayoshi; Nicoloso, Milena S; Cimmino, Amelia; Alder, Hansjuerg; Herlea, Vlad; Rassenti, Laura Z; Rai, Kanti R; Kipps, Thomas J; Keating, Michael J; Croce, Carlo M; Calin, George A

    2010-02-01

    Cancer is a genetic disease in which the interplay between alterations in protein-coding genes and non-coding RNAs (ncRNAs) plays a fundamental role. In recent years, the full coding component of the human genome was sequenced in various cancers, whereas such attempts related to ncRNAs are still fragmentary. We screened genomic DNAs for sequence variations in 148 microRNAs (miRNAs) and ultraconserved regions (UCRs) loci in patients with chronic lymphocytic leukemia (CLL) or colorectal cancer (CRC) by Sanger technique and further tried to elucidate the functional consequences of some of these variations. We found sequence variations in miRNAs in both sporadic and familial CLL cases, mutations of UCRs in CLLs and CRCs and, in certain instances, detected functional effects of these variations. Furthermore, by integrating our data with previously published data on miRNA sequence variations, we have created a catalog of DNA sequence variations in miRNAs/ultraconserved genes in human cancers. These findings argue that ncRNAs are targeted by both germ line and somatic mutations as well as by single-nucleotide polymorphisms with functional significance for human tumorigenesis. Sequence variations in ncRNA loci are frequent and some have functional and biological significance. Such information can be exploited to further investigate on a genome-wide scale the frequency of genetic variations in ncRNAs and their functional meaning, as well as for the development of new diagnostic and prognostic markers for leukemias and carcinomas.

  13. Cracking the Code of Human Diseases Using Next-Generation Sequencing: Applications, Challenges, and Perspectives

    Directory of Open Access Journals (Sweden)

    Vincenza Precone

    2015-01-01

    Full Text Available Next-generation sequencing (NGS technologies have greatly impacted on every field of molecular research mainly because they reduce costs and increase throughput of DNA sequencing. These features, together with the technology’s flexibility, have opened the way to a variety of applications including the study of the molecular basis of human diseases. Several analytical approaches have been developed to selectively enrich regions of interest from the whole genome in order to identify germinal and/or somatic sequence variants and to study DNA methylation. These approaches are now widely used in research, and they are already being used in routine molecular diagnostics. However, some issues are still controversial, namely, standardization of methods, data analysis and storage, and ethical aspects. Besides providing an overview of the NGS-based approaches most frequently used to study the molecular basis of human diseases at DNA level, we discuss the principal challenges and applications of NGS in the field of human genomics.

  14. Murine mammary tumor virus pol-related sequences in human DNA: characterization and sequence comparison with the complete murine mammary tumor virus pol gene

    International Nuclear Information System (INIS)

    Deen, K.C.; Sweet, R.W.

    1986-01-01

    Sequences in the human genome with homology to the murine mammary tumor virus (MMTV) pol gene were isolated from a human phage library. Ten clones with extensive pol homology were shown to define five separate loci. These loci share common sequences immediately adjacent to the pol-like segments and, in addition, contain a related repeat element which bounds this region. This organization is suggestive of a proviral structure. The authors estimate that the human genome contains 30 to 40 copies of these pol-related sequences. The pol region of one of the cloned segments (HM16) and the complete MMTV pol gene were sequenced and compared. The nucleotide homology between these pol sequences is 52% and is concentrated in the terminal regions. The MMTV pol gene contains a single long open reading frame encoding 899 amino acids and is demarcated from the partially overlapping putative gag gene by termination codons and a shift in translational reading frame. The pol sequence of HM16 is multiply terminated but does contain open reading frames which encode 370, 105, and 112 amino acids residues in separate reading frames. The authors deduced a composite pol protein sequence for HM16 by aligning it to the MMTV pol gene and then compared these sequences with other retroviral pol protein sequences. Conserved sequences occur in both the amino and carboxyl regions which lie within the polymerase and endonuclease domains of pol, respectively

  15. Songbirds and humans apply different strategies in a sound sequence discrimination task

    Directory of Open Access Journals (Sweden)

    Yoshimasa eSeki

    2013-07-01

    Full Text Available The abilities of animals and humans to extract rules from sound sequences have previously been compared using observation of spontaneous responses and conditioning techniques. However, the results were inconsistently interpreted across studies possibly due to methodological and/or species differences. Therefore, we examined the strategies for discrimination of sound sequences in Bengalese finches and humans using the same protocol. Birds were trained on a GO/NOGO task to discriminate between two categories of sound stimulus generated based on an AAB or ABB rule. The sound elements used were taken from a variety of male (M and female (F calls, such that the sequences could be represented as MMF and MFF. In test sessions, FFM and FMM sequences, which were never presented in the training sessions but conformed to the rule, were presented as probe stimuli. The results suggested two discriminative strategies were being applied: 1 memorizing sound patterns of either GO or NOGO stimuli and generating the appropriate responses for only those sounds; and 2 using the repeated element as a cue. There was no evidence that the birds successfully extracted the abstract rule (i.e. AAB and ABB; MMF-GO subjects did not produce a GO response for FFM and vice versa. Next we examined whether those strategies were also applicable for human participants on the same task. The results and questionnaires revealed that participants extracted the abstract rule, and most of them employed it to discriminate the sequences. This strategy was never observed in bird subjects, although some participants used strategies similar to the birds when responding to the probe stimuli. Our results showed that the human participants applied the abstract rule in the task even without instruction but Bengalese finches did not, thereby reconfirming that humans have to extract abstract rules from sound sequences that is distinct from non-human animals.

  16. Songbirds and humans apply different strategies in a sound sequence discrimination task.

    Science.gov (United States)

    Seki, Yoshimasa; Suzuki, Kenta; Osawa, Ayumi M; Okanoya, Kazuo

    2013-01-01

    The abilities of animals and humans to extract rules from sound sequences have previously been compared using observation of spontaneous responses and conditioning techniques. However, the results were inconsistently interpreted across studies possibly due to methodological and/or species differences. Therefore, we examined the strategies for discrimination of sound sequences in Bengalese finches and humans using the same protocol. Birds were trained on a GO/NOGO task to discriminate between two categories of sound stimulus generated based on an "AAB" or "ABB" rule. The sound elements used were taken from a variety of male (M) and female (F) calls, such that the sequences could be represented as MMF and MFF. In test sessions, FFM and FMM sequences, which were never presented in the training sessions but conformed to the rule, were presented as probe stimuli. The results suggested two discriminative strategies were being applied: (1) memorizing sound patterns of either GO or NOGO stimuli and generating the appropriate responses for only those sounds; and (2) using the repeated element as a cue. There was no evidence that the birds successfully extracted the abstract rule (i.e., AAB and ABB); MMF-GO subjects did not produce a GO response for FFM and vice versa. Next we examined whether those strategies were also applicable for human participants on the same task. The results and questionnaires revealed that participants extracted the abstract rule, and most of them employed it to discriminate the sequences. This strategy was never observed in bird subjects, although some participants used strategies similar to the birds when responding to the probe stimuli. Our results showed that the human participants applied the abstract rule in the task even without instruction but Bengalese finches did not, thereby reconfirming that humans have to extract abstract rules from sound sequences that is distinct from non-human animals.

  17. Determination of genetic relatedness from low-coverage human genome sequences using pedigree simulations.

    Science.gov (United States)

    Martin, Michael D; Jay, Flora; Castellano, Sergi; Slatkin, Montgomery

    2017-08-01

    We develop and evaluate methods for inferring relatedness among individuals from low-coverage DNA sequences of their genomes, with particular emphasis on sequences obtained from fossil remains. We suggest the major factors complicating the determination of relatedness among ancient individuals are sequencing depth, the number of overlapping sites, the sequencing error rate and the presence of contamination from present-day genetic sources. We develop a theoretical model that facilitates the exploration of these factors and their relative effects, via measurement of pairwise genetic distances, without calling genotypes, and determine the power to infer relatedness under various scenarios of varying sequencing depth, present-day contamination and sequencing error. The model is validated by a simulation study as well as the analysis of aligned sequences from present-day human genomes. We then apply the method to the recently published genome sequences of ancient Europeans, developing a statistical treatment to determine confidence in assigned relatedness that is, in some cases, more precise than previously reported. As the majority of ancient specimens are from animals, this method would be applicable to investigate kinship in nonhuman remains. The developed software grups (Genetic Relatedness Using Pedigree Simulations) is implemented in Python and freely available. © 2017 John Wiley & Sons Ltd.

  18. Genomic divergences among cattle, dog and human estimated from large-scale alignments of genomic sequences

    Directory of Open Access Journals (Sweden)

    Shade Larry L

    2006-06-01

    Full Text Available Abstract Background Approximately 11 Mb of finished high quality genomic sequences were sampled from cattle, dog and human to estimate genomic divergences and their regional variation among these lineages. Results Optimal three-way multi-species global sequence alignments for 84 cattle clones or loci (each >50 kb of genomic sequence were constructed using the human and dog genome assemblies as references. Genomic divergences and substitution rates were examined for each clone and for various sequence classes under different functional constraints. Analysis of these alignments revealed that the overall genomic divergences are relatively constant (0.32–0.37 change/site for pairwise comparisons among cattle, dog and human; however substitution rates vary across genomic regions and among different sequence classes. A neutral mutation rate (2.0–2.2 × 10(-9 change/site/year was derived from ancestral repetitive sequences, whereas the substitution rate in coding sequences (1.1 × 10(-9 change/site/year was approximately half of the overall rate (1.9–2.0 × 10(-9 change/site/year. Relative rate tests also indicated that cattle have a significantly faster rate of substitution as compared to dog and that this difference is about 6%. Conclusion This analysis provides a large-scale and unbiased assessment of genomic divergences and regional variation of substitution rates among cattle, dog and human. It is expected that these data will serve as a baseline for future mammalian molecular evolution studies.

  19. Budding yeast cDNA sequencing project: S03052-78_H01 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available GGTTCAGTC ACCCCAGCTTTAAACNATTGTTAATACAGAAGTGAATGCTTCCGTTTTCCAATTTTTCGC TTCCCTCCGCCGCNCCNNACCGNTTCTTCCGANCATTTAGATATNNATTCATANA...TGCTT ATTTNNGGGTCATANAGGAAANAATTTTCGATTGNAANGACTGAATATANATTGTTNTAT ANTTANATTGAANANGNTANNAN

  20. Budding yeast cDNA sequencing project: S03036-21_O21 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available NANAAGAGNATATGATATANNNNCATANATAN AGATAAATANANNAACAANCACNCACATANATNTAGACAANNANGANGNTNACTATANAN TTTATTCTATTAAA...CTTTTNNNNAAGAATANA AAAAANAAAAACCACCCCCCNTCCCCCTATGAGAGAGGAGGAGGAGANNNNNACNNTNTT TTTATTTANTANATANGNAAANGANAGC

  1. Budding yeast cDNA sequencing project: S03052-01_K20 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available GTCTTTGCTTCTAAA GCTTAACCATANAGTCACGGACTTAAGACTGTACGACCTGAAGGGCGCAAAAGGTGTATG CG Quality >S03052-01_K20.phd 4...C ATATACAATGTTGTCANGAGTAGCTAAACGTGCGTTTTCCTCTACANTTGCCAACCCTTA TAAAGTGACTGTCTTGGGTGCAGGCGGTGGTATTGGACAACCATT

  2. Alternative splicing enriched cDNA libraries identify breast cancer-associated transcripts

    Science.gov (United States)

    2010-01-01

    Background Alternative splicing (AS) is a central mechanism in the generation of genomic complexity and is a major contributor to transcriptome and proteome diversity. Alterations of the splicing process can lead to deregulation of crucial cellular processes and have been associated with a large spectrum of human diseases. Cancer-associated transcripts are potential molecular markers and may contribute to the development of more accurate diagnostic and prognostic methods and also serve as therapeutic targets. Alternative splicing-enriched cDNA libraries have been used to explore the variability generated by alternative splicing. In this study, by combining the use of trapping heteroduplexes and RNA amplification, we developed a powerful approach that enables transcriptome-wide exploration of the AS repertoire for identifying AS variants associated with breast tumor cells modulated by ERBB2 (HER-2/neu) oncogene expression. Results The human breast cell line (C5.2) and a pool of 5 ERBB2 over-expressing breast tumor samples were used independently for the construction of two AS-enriched libraries. In total, 2,048 partial cDNA sequences were obtained, revealing 214 alternative splicing sequence-enriched tags (ASSETs). A subset with 79 multiple exon ASSETs was compared to public databases and reported 138 different AS events. A high success rate of RT-PCR validation (94.5%) was obtained, and 2 novel AS events were identified. The influence of ERBB2-mediated expression on AS regulation was evaluated by capillary electrophoresis and probe-ligation approaches in two mammary cell lines (Hb4a and C5.2) expressing different levels of ERBB2. The relative expression balance between AS variants from 3 genes was differentially modulated by ERBB2 in this model system. Conclusions In this study, we presented a method for exploring AS from any RNA source in a transcriptome-wide format, which can be directly easily adapted to next generation sequencers. We identified AS transcripts

  3. Sequence space coverage, entropy of genomes and the potential to detect non-human DNA in human samples

    Directory of Open Access Journals (Sweden)

    Maley Carlo C

    2008-10-01

    Full Text Available Abstract Background Genomes store information for building and maintaining organisms. Complete sequencing of many genomes provides the opportunity to study and compare global information properties of those genomes. Results We have analyzed aspects of the information content of Homo sapiens, Mus musculus, Drosophila melanogaster, Caenorhabditis elegans, Arabidopsis thaliana, Saccharomyces cerevisiae, and Escherichia coli (K-12 genomes. Virtually all possible (> 98% 12 bp oligomers appear in vertebrate genomes while 98% to D. melanogaster (12–17 bp, C. elegans (11–17 bp, A. thaliana (11–17 bp, S. cerevisiae (10–16 bp and E. coli (9–15 bp. Frequencies of unique oligomers in the genomes follow similar patterns. We identified a set of 2.6 M 15-mers that are more than 1 nucleotide different from all 15-mers in the human genome and so could be used as probes to detect microbes in human samples. In a human sample, these probes would detect 100% of the 433 currently fully sequenced prokaryotes and 75% of the 3065 fully sequenced viruses. The human genome is significantly more compact in sequence space than a random genome. We identified the most frequent 5- to 20-mers in the human genome, which may prove useful as PCR primers. We also identified a bacterium, Anaeromyxobacter dehalogenans, which has an exceptionally low diversity of oligomers given the size of its genome and its GC content. The entropy of coding regions in the human genome is significantly higher than non-coding regions and chromosomes. However chromosomes 1, 2, 9, 12 and 14 have a relatively high proportion of coding DNA without high entropy, and chromosome 20 is the opposite with a low frequency of coding regions but relatively high entropy. Conclusion Measures of the frequency of oligomers are useful for designing PCR assays and for identifying chromosomes and organisms with hidden structure that had not been previously recognized. This information may be used to detect

  4. Sequence space coverage, entropy of genomes and the potential to detect non-human DNA in human samples

    Science.gov (United States)

    Liu, Zhandong; Venkatesh, Santosh S; Maley, Carlo C

    2008-01-01

    Background Genomes store information for building and maintaining organisms. Complete sequencing of many genomes provides the opportunity to study and compare global information properties of those genomes. Results We have analyzed aspects of the information content of Homo sapiens, Mus musculus, Drosophila melanogaster, Caenorhabditis elegans, Arabidopsis thaliana, Saccharomyces cerevisiae, and Escherichia coli (K-12) genomes. Virtually all possible (> 98%) 12 bp oligomers appear in vertebrate genomes while 98% to < 2% of possible oligomers in D. melanogaster (12–17 bp), C. elegans (11–17 bp), A. thaliana (11–17 bp), S. cerevisiae (10–16 bp) and E. coli (9–15 bp). Frequencies of unique oligomers in the genomes follow similar patterns. We identified a set of 2.6 M 15-mers that are more than 1 nucleotide different from all 15-mers in the human genome and so could be used as probes to detect microbes in human samples. In a human sample, these probes would detect 100% of the 433 currently fully sequenced prokaryotes and 75% of the 3065 fully sequenced viruses. The human genome is significantly more compact in sequence space than a random genome. We identified the most frequent 5- to 20-mers in the human genome, which may prove useful as PCR primers. We also identified a bacterium, Anaeromyxobacter dehalogenans, which has an exceptionally low diversity of oligomers given the size of its genome and its GC content. The entropy of coding regions in the human genome is significantly higher than non-coding regions and chromosomes. However chromosomes 1, 2, 9, 12 and 14 have a relatively high proportion of coding DNA without high entropy, and chromosome 20 is the opposite with a low frequency of coding regions but relatively high entropy. Conclusion Measures of the frequency of oligomers are useful for designing PCR assays and for identifying chromosomes and organisms with hidden structure that had not been previously recognized. This information may be used to

  5. Locus Reference Genomic sequences: An improved basis for describing human DNA variants

    KAUST Repository

    Dalgleish, Raymond; Flicek, Paul; Cunningham, Fiona; Astashyn, Alex; Tully, Raymond E; Proctor, Glenn; Chen, Yuan; McLaren, William M; Larsson, Pontus; Vaughan, Brendan W; Bé roud, Christophe; Dobson, Glen; Lehvä slaiho, Heikki; Taschner, Peter EM; den Dunnen, Johan T; Devereau, Andrew; Birney, Ewan; Brookes, Anthony J; Maglott, Donna R

    2010-01-01

    As our knowledge of the complexity of gene architecture grows, and we increase our understanding of the subtleties of gene expression, the process of accurately describing disease-causing gene variants has become increasingly problematic. In part, this is due to current reference DNA sequence formats that do not fully meet present needs. Here we present the Locus Reference Genomic (LRG) sequence format, which has been designed for the specifi c purpose of gene variant reporting. The format builds on the successful National Center for Biotechnology Information (NCBI) RefSeqGene project and provides a single-fi le record containing a uniquely stable reference DNA sequence along with all relevant transcript and protein sequences essential to the description of gene variants. In principle, LRGs can be created for any organism, not just human. In addition, we recognize the need to respect legacy numbering systems for exons and amino acids and the LRG format takes account of these. We hope that widespread adoption of LRGs - which will be created and maintained by the NCBI and the European Bioinformatics Institute (EBI) - along with consistent use of the Human Genome Variation Society (HGVS)- approved variant nomenclature will reduce errors in the reporting of variants in the literature and improve communication about variants aff ecting human health. Further information can be found on the LRG web site (http://www.lrg-sequence.org). 2010 Dalgleish et al.; licensee BioMed Central Ltd.

  6. Locus Reference Genomic sequences: An improved basis for describing human DNA variants

    KAUST Repository

    Dalgleish, Raymond

    2010-04-15

    As our knowledge of the complexity of gene architecture grows, and we increase our understanding of the subtleties of gene expression, the process of accurately describing disease-causing gene variants has become increasingly problematic. In part, this is due to current reference DNA sequence formats that do not fully meet present needs. Here we present the Locus Reference Genomic (LRG) sequence format, which has been designed for the specifi c purpose of gene variant reporting. The format builds on the successful National Center for Biotechnology Information (NCBI) RefSeqGene project and provides a single-fi le record containing a uniquely stable reference DNA sequence along with all relevant transcript and protein sequences essential to the description of gene variants. In principle, LRGs can be created for any organism, not just human. In addition, we recognize the need to respect legacy numbering systems for exons and amino acids and the LRG format takes account of these. We hope that widespread adoption of LRGs - which will be created and maintained by the NCBI and the European Bioinformatics Institute (EBI) - along with consistent use of the Human Genome Variation Society (HGVS)- approved variant nomenclature will reduce errors in the reporting of variants in the literature and improve communication about variants aff ecting human health. Further information can be found on the LRG web site (http://www.lrg-sequence.org). 2010 Dalgleish et al.; licensee BioMed Central Ltd.

  7. Humans can consciously generate random number sequences: a possible test for artificial intelligence.

    Science.gov (United States)

    Persaud, Navindra

    2005-01-01

    Computer algorithms can only produce seemingly random or pseudorandom numbers whereas certain natural phenomena, such as the decay of radioactive particles, can be utilized to produce truly random numbers. In this study, the ability of humans to generate random numbers was tested in healthy adults. Subjects were simply asked to generate and dictate random numbers. Generated numbers were tested for uniformity, independence and information density. The results suggest that humans can generate random numbers that are uniformly distributed, independent of one another and unpredictable. If humans can generate sequences of random numbers then neural networks or forms of artificial intelligence, which are purported to function in ways essentially the same as the human brain, should also be able to generate sequences of random numbers. Elucidating the precise mechanism by which humans generate random number sequences and the underlying neural substrates may have implications in the cognitive science of decision-making. It is possible that humans use their random-generating neural machinery to make difficult decisions in which all expected outcomes are similar. It is also possible that certain people, perhaps those with neurological or psychiatric impairments, are less able or unable to generate random numbers. If the random-generating neural machinery is employed in decision making its impairment would have profound implications in matters of agency and free will.

  8. Workup of Human Blood Samples for Deep Sequencing of HIV-1 Genomes

    NARCIS (Netherlands)

    Cornelissen, Marion; Gall, Astrid; van der Kuyl, Antoinette; Wymant, Chris; Blanquart, François; Fraser, Christophe; Berkhout, Ben

    2018-01-01

    We describe a detailed protocol for the manual workup of blood (plasma/serum) samples from individuals infected with the human immunodeficiency virus type 1 (HIV-1) for deep sequence analysis of the viral genome. The study optimizing the assay was performed in the context of the BEEHIVE (Bridging

  9. Draft Genome Sequences of Historical Listeria monocytogenes from Human Listeriosis, 1933

    Science.gov (United States)

    We report here the draft genome sequences of two Listeria monocytogenes strains from some of the earliest reported cases of human listeriosis in North America. The strains were isolated in 1933 from patients in Massachusetts and Connecticut, USA, and belong to the widely disseminated hypervirulent c...

  10. Draft Genome Sequence of the Animal and Human Pathogen Malassezia pachydermatis Strain CBS 1879

    Science.gov (United States)

    Triana, Sergio; González, Andrés; Ohm, Robin A.; Wösten, Han A. B.; de Cock, Hans; Restrepo, Silvia

    2015-01-01

    Malassezia pachydermatis is a basidiomycetous yeast that causes infections in humans and animals. Here, we report the genome sequence of Malassezia pachydermatis strain CBS 1879, which will facilitate the study of mechanisms underlying pathogenicity of the only non-lipid-dependent Malasezzia species. PMID:26472839

  11. Lectin cDNA and transgenic plants derived therefrom

    Science.gov (United States)

    Raikhel, Natasha V.

    2000-10-03

    Transgenic plants containing cDNA encoding Gramineae lectin are described. The plants preferably contain cDNA coding for barley lectin and store the lectin in the leaves. The transgenic plants, particularly the leaves exhibit insecticidal and fungicidal properties.

  12. Predicting human activities in sequences of actions in RGB-D videos

    Science.gov (United States)

    Jardim, David; Nunes, Luís.; Dias, Miguel

    2017-03-01

    In our daily activities we perform prediction or anticipation when interacting with other humans or with objects. Prediction of human activity made by computers has several potential applications: surveillance systems, human computer interfaces, sports video analysis, human-robot-collaboration, games and health-care. We propose a system capable of recognizing and predicting human actions using supervised classifiers trained with automatically labeled data evaluated in our human activity RGB-D dataset (recorded with a Kinect sensor) and using only the position of the main skeleton joints to extract features. Using conditional random fields (CRFs) to model the sequential nature of actions in a sequence has been used before, but where other approaches try to predict an outcome or anticipate ahead in time (seconds), we try to predict what will be the next action of a subject. Our results show an activity prediction accuracy of 89.9% using an automatically labeled dataset.

  13. Display of a Maize cDNA library on baculovirus infected insect cells

    Directory of Open Access Journals (Sweden)

    Jones Ian M

    2008-08-01

    Full Text Available Abstract Background Maize is a good model system for cereal crop genetics and development because of its rich genetic heritage and well-characterized morphology. The sequencing of its genome is well advanced, and new technologies for efficient proteomic analysis are needed. Baculovirus expression systems have been used for the last twenty years to express in insect cells a wide variety of eukaryotic proteins that require complex folding or extensive posttranslational modification. More recently, baculovirus display technologies based on the expression of foreign sequences on the surface of Autographa californica (AcMNPV have been developed. We investigated the potential of a display methodology for a cDNA library of maize young seedlings. Results We constructed a full-length cDNA library of young maize etiolated seedlings in the transfer vector pAcTMVSVG. The library contained a total of 2.5 × 105 independent clones. Expression of two known maize proteins, calreticulin and auxin binding protein (ABP1, was shown by western blot analysis of protein extracts from insect cells infected with the cDNA library. Display of the two proteins in infected insect cells was shown by selective biopanning using magnetic cell sorting and demonstrated proof of concept that the baculovirus maize cDNA display library could be used to identify and isolate proteins. Conclusion The maize cDNA library constructed in this study relies on the novel technology of baculovirus display and is unique in currently published cDNA libraries. Produced to demonstrate proof of principle, it opens the way for the development of a eukaryotic in vivo display tool which would be ideally suited for rapid screening of the maize proteome for binding partners, such as proteins involved in hormone regulation or defence.

  14. cDNA cloning and transcriptional controlling of a novel low dose radiation-induced gene and its function analysis

    International Nuclear Information System (INIS)

    Zhou Pingkun; Sui Jianli

    2002-01-01

    Objective: To clone a novel low dose radiation-induced gene (LRIGx) and study its function as well as its transcriptional changes after irradiation. Methods: Its cDNA was obtained by DDRT-PCR and RACE techniques. Northern blot hybridization was used to investigate the gene transcription. Bioinformatics was employed to analysis structure and function of this gene. Results: LRIGx cDNA was cloned. The sequence of LRIGx was identical to a DNA clone located in human chromosome 20 q 11.2-12 Bioinformatics analysis predicted an encoded protein with a conserved helicase domain. Northern analysis revealed a ∼8.5 kb transcript which was induced after 0.2 Gy as well as 0.02 Gy irradiation, and the transcript level was increased 5 times at 4 h after 0.2 Gy irradiation. The induced level of LRIGx transcript by 2.0 Gy high dose was lower than by 0.2 Gy. Conclusion: A novel low dose radiation-induced gene has been cloned. It encodes a protein with a conserved helicase domain that could involve in DNA metabolism in the cellular process of radiation response

  15. BRICHOS domain-containing leukocyte cell-derived chemotaxin 1-like cDNA from disk abalone Haliotis discus discus.

    Science.gov (United States)

    Kim, Yucheol; De Zoysa, Mahanama; Lee, Youngdeuk; Whang, Ilson; Lee, Jehee

    2010-11-01

    A BRICHOS domain-containing leukocyte cell-derived chemotaxin 1-like cDNA was cloned from the disk abalone (Haliotis discus discus) and designated as AbLECT-1. A full-length (705 bp) of AbLECT-1 cDNA was composed of a 576 bp open reading frame that translates into a putative peptide of 192 amino acids. Deduced amino acid sequence of AbLECT-1 had 15.5- and 27.8% identity and similarity to human LECT-1, respectively. Quantitative real-time PCR analysis results showed that the mRNA of AbLECT-1 was constitutively expressed in abalone hemocytes, gills, mantle, muscle, digestive tract and hepatopancreas in a tissue-specific manner. Moreover, the AbLECT-1 transcription level was induced in hemocytes after challenge with Vibrio alginolyticus, Vibrio parahemolyticus, and Listeria monocytogenes suggesting that it may be involved in immune response reactions in abalone. Copyright 2010 Elsevier Ltd. All rights reserved.

  16. Cloning and expression of the receptor for human urokinase plasminogen activator, a central molecule in cell surface, plasmin dependent proteolysis

    DEFF Research Database (Denmark)

    Roldan, A.L.; Cubellis, M.V.; Masucci, M.T.

    1990-01-01

    , and therefore the capacity of cells to migrate and invade neighboring tissues. We have isolated a 1.4 kb cDNA clone coding for the entire human uPAR. An oligonucleotide synthesized on the basis of the N-terminal sequence of the purified protein was used to screen a cDNA library made from SV40 transformed human......, a size very close to that of the cloned cDNA. Expression of the uPAR cDNA in mouse cells confirms that the clone is complete and expresses a functional uPA binding protein, located on the cell surface and with properties similar to the human uPAR. Caseinolytic plaque assay, immunofluorescence analysis......The surface receptor for urokinase plasminogen activator (uPAR) has been recognized in recent years as a key molecule in regulating plasminogen mediated extracellular proteolysis. Surface plasminogen activation controls the connections between cells, basement membrane and extracellular matrix...

  17. A functional test of Neandertal and modern human mitochondrial targeting sequences

    Energy Technology Data Exchange (ETDEWEB)

    Gralle, Matthias, E-mail: gralle@bioqmed.ufrj.br [Instituto de Bioquimica Medica, Universidade Federal do Rio de Janeiro, CCS, Ilha do Fundao, 21941-590 Rio de Janeiro (Brazil); Department of Evolutionary Genetics, Max Planck Institute for Evolutionary Anthropology, Deutscher Platz 6, 04103 Leipzig (Germany); Schaefer, Ingo; Seibel, Peter [Department of Molecular Cell Therapy, Leipzig University, Deutscher Platz 5, 04103 Leipzig (Germany); Paeaebo, Svante [Department of Evolutionary Genetics, Max Planck Institute for Evolutionary Anthropology, Deutscher Platz 6, 04103 Leipzig (Germany)

    2010-11-26

    Research highlights: {yields} Two mutations in mitochondrial targeting peptides occurred during human evolution, possibly after Neandertals split off from modern human lineage. {yields} The ancestral and modern human versions of these two targeting peptides were tested functionally for their effects on localization and cleavage rate. {yields} In spite of recent evolution, and to the contrary of other mutations in targeting peptides, these mutations had no visible effects. -- Abstract: Targeting of nuclear-encoded proteins to different organelles, such as mitochondria, is a process that can result in the redeployment of proteins to new intracellular destinations during evolution. With the sequencing of the Neandertal genome, it has become possible to identify amino acid substitutions that occurred on the modern human lineage since its separation from the Neandertal lineage. Here we analyze the function of two substitutions in mitochondrial targeting sequences that occurred and rose to high frequency recently during recent human evolution. The ancestral and modern versions of the two targeting sequences do not differ in the efficiency with which they direct a protein to the mitochondria, an observation compatible with the neutral theory of molecular evolution.

  18. A functional test of Neandertal and modern human mitochondrial targeting sequences

    International Nuclear Information System (INIS)

    Gralle, Matthias; Schaefer, Ingo; Seibel, Peter; Paeaebo, Svante

    2010-01-01

    Research highlights: → Two mutations in mitochondrial targeting peptides occurred during human evolution, possibly after Neandertals split off from modern human lineage. → The ancestral and modern human versions of these two targeting peptides were tested functionally for their effects on localization and cleavage rate. → In spite of recent evolution, and to the contrary of other mutations in targeting peptides, these mutations had no visible effects. -- Abstract: Targeting of nuclear-encoded proteins to different organelles, such as mitochondria, is a process that can result in the redeployment of proteins to new intracellular destinations during evolution. With the sequencing of the Neandertal genome, it has become possible to identify amino acid substitutions that occurred on the modern human lineage since its separation from the Neandertal lineage. Here we analyze the function of two substitutions in mitochondrial targeting sequences that occurred and rose to high frequency recently during recent human evolution. The ancestral and modern versions of the two targeting sequences do not differ in the efficiency with which they direct a protein to the mitochondria, an observation compatible with the neutral theory of molecular evolution.

  19. The zebrafish reference genome sequence and its relationship to the human genome

    Science.gov (United States)

    Howe, Kerstin; Clark, Matthew D.; Torroja, Carlos F.; Torrance, James; Berthelot, Camille; Muffato, Matthieu; Collins, John E.; Humphray, Sean; McLaren, Karen; Matthews, Lucy; McLaren, Stuart; Sealy, Ian; Caccamo, Mario; Churcher, Carol; Scott, Carol; Barrett, Jeffrey C.; Koch, Romke; Rauch, Gerd-Jörg; White, Simon; Chow, William; Kilian, Britt; Quintais, Leonor T.; Guerra-Assunção, José A.; Zhou, Yi; Gu, Yong; Yen, Jennifer; Vogel, Jan-Hinnerk; Eyre, Tina; Redmond, Seth; Banerjee, Ruby; Chi, Jianxiang; Fu, Beiyuan; Langley, Elizabeth; Maguire, Sean F.; Laird, Gavin K.; Lloyd, David; Kenyon, Emma; Donaldson, Sarah; Sehra, Harminder; Almeida-King, Jeff; Loveland, Jane; Trevanion, Stephen; Jones, Matt; Quail, Mike; Willey, Dave; Hunt, Adrienne; Burton, John; Sims, Sarah; McLay, Kirsten; Plumb, Bob; Davis, Joy; Clee, Chris; Oliver, Karen; Clark, Richard; Riddle, Clare; Eliott, David; Threadgold, Glen; Harden, Glenn; Ware, Darren; Mortimer, Beverly; Kerry, Giselle; Heath, Paul; Phillimore, Benjamin; Tracey, Alan; Corby, Nicole; Dunn, Matthew; Johnson, Christopher; Wood, Jonathan; Clark, Susan; Pelan, Sarah; Griffiths, Guy; Smith, Michelle; Glithero, Rebecca; Howden, Philip; Barker, Nicholas; Stevens, Christopher; Harley, Joanna; Holt, Karen; Panagiotidis, Georgios; Lovell, Jamieson; Beasley, Helen; Henderson, Carl; Gordon, Daria; Auger, Katherine; Wright, Deborah; Collins, Joanna; Raisen, Claire; Dyer, Lauren; Leung, Kenric; Robertson, Lauren; Ambridge, Kirsty; Leongamornlert, Daniel; McGuire, Sarah; Gilderthorp, Ruth; Griffiths, Coline; Manthravadi, Deepa; Nichol, Sarah; Barker, Gary; Whitehead, Siobhan; Kay, Michael; Brown, Jacqueline; Murnane, Clare; Gray, Emma; Humphries, Matthew; Sycamore, Neil; Barker, Darren; Saunders, David; Wallis, Justene; Babbage, Anne; Hammond, Sian; Mashreghi-Mohammadi, Maryam; Barr, Lucy; Martin, Sancha; Wray, Paul; Ellington, Andrew; Matthews, Nicholas; Ellwood, Matthew; Woodmansey, Rebecca; Clark, Graham; Cooper, James; Tromans, Anthony; Grafham, Darren; Skuce, Carl; Pandian, Richard; Andrews, Robert; Harrison, Elliot; Kimberley, Andrew; Garnett, Jane; Fosker, Nigel; Hall, Rebekah; Garner, Patrick; Kelly, Daniel; Bird, Christine; Palmer, Sophie; Gehring, Ines; Berger, Andrea; Dooley, Christopher M.; Ersan-Ürün, Zübeyde; Eser, Cigdem; Geiger, Horst; Geisler, Maria; Karotki, Lena; Kirn, Anette; Konantz, Judith; Konantz, Martina; Oberländer, Martina; Rudolph-Geiger, Silke; Teucke, Mathias; Osoegawa, Kazutoyo; Zhu, Baoli; Rapp, Amanda; Widaa, Sara; Langford, Cordelia; Yang, Fengtang; Carter, Nigel P.; Harrow, Jennifer; Ning, Zemin; Herrero, Javier; Searle, Steve M. J.; Enright, Anton; Geisler, Robert; Plasterk, Ronald H. A.; Lee, Charles; Westerfield, Monte; de Jong, Pieter J.; Zon, Leonard I.; Postlethwait, John H.; Nüsslein-Volhard, Christiane; Hubbard, Tim J. P.; Crollius, Hugues Roest; Rogers, Jane; Stemple, Derek L.

    2013-01-01

    Zebrafish have become a popular organism for the study of vertebrate gene function1,2. The virtually transparent embryos of this species, and the ability to accelerate genetic studies by gene knockdown or overexpression, have led to the widespread use of zebrafish in the detailed investigation of vertebrate gene function and increasingly, the study of human genetic disease3–5. However, for effective modelling of human genetic disease it is important to understand the extent to which zebrafish genes and gene structures are related to orthologous human genes. To examine this, we generated a high-quality sequence assembly of the zebrafish genome, made up of an overlapping set of completely sequenced large-insert clones that were ordered and oriented using a high-resolution high-density meiotic map. Detailed automatic and manual annotation provides evidence of more than 26,000 protein-coding genes6, the largest gene set of any vertebrate so far sequenced. Comparison to the human reference genome shows that approximately 70% of human genes have at least one obvious zebrafish orthologue. In addition, the high quality of this genome assembly provides a clearer understanding of key genomic features such as a unique repeat content, a scarcity of pseudogenes, an enrichment of zebrafish-specific genes on chromosome 4 and chromosomal regions that influence sex determination. PMID:23594743

  20. The zebrafish reference genome sequence and its relationship to the human genome.

    Science.gov (United States)

    Howe, Kerstin; Clark, Matthew D; Torroja, Carlos F; Torrance, James; Berthelot, Camille; Muffato, Matthieu; Collins, John E; Humphray, Sean; McLaren, Karen; Matthews, Lucy; McLaren, Stuart; Sealy, Ian; Caccamo, Mario; Churcher, Carol; Scott, Carol; Barrett, Jeffrey C; Koch, Romke; Rauch, Gerd-Jörg; White, Simon; Chow, William; Kilian, Britt; Quintais, Leonor T; Guerra-Assunção, José A; Zhou, Yi; Gu, Yong; Yen, Jennifer; Vogel, Jan-Hinnerk; Eyre, Tina; Redmond, Seth; Banerjee, Ruby; Chi, Jianxiang; Fu, Beiyuan; Langley, Elizabeth; Maguire, Sean F; Laird, Gavin K; Lloyd, David; Kenyon, Emma; Donaldson, Sarah; Sehra, Harminder; Almeida-King, Jeff; Loveland, Jane; Trevanion, Stephen; Jones, Matt; Quail, Mike; Willey, Dave; Hunt, Adrienne; Burton, John; Sims, Sarah; McLay, Kirsten; Plumb, Bob; Davis, Joy; Clee, Chris; Oliver, Karen; Clark, Richard; Riddle, Clare; Elliot, David; Eliott, David; Threadgold, Glen; Harden, Glenn; Ware, Darren; Begum, Sharmin; Mortimore, Beverley; Mortimer, Beverly; Kerry, Giselle; Heath, Paul; Phillimore, Benjamin; Tracey, Alan; Corby, Nicole; Dunn, Matthew; Johnson, Christopher; Wood, Jonathan; Clark, Susan; Pelan, Sarah; Griffiths, Guy; Smith, Michelle; Glithero, Rebecca; Howden, Philip; Barker, Nicholas; Lloyd, Christine; Stevens, Christopher; Harley, Joanna; Holt, Karen; Panagiotidis, Georgios; Lovell, Jamieson; Beasley, Helen; Henderson, Carl; Gordon, Daria; Auger, Katherine; Wright, Deborah; Collins, Joanna; Raisen, Claire; Dyer, Lauren; Leung, Kenric; Robertson, Lauren; Ambridge, Kirsty; Leongamornlert, Daniel; McGuire, Sarah; Gilderthorp, Ruth; Griffiths, Coline; Manthravadi, Deepa; Nichol, Sarah; Barker, Gary; Whitehead, Siobhan; Kay, Michael; Brown, Jacqueline; Murnane, Clare; Gray, Emma; Humphries, Matthew; Sycamore, Neil; Barker, Darren; Saunders, David; Wallis, Justene; Babbage, Anne; Hammond, Sian; Mashreghi-Mohammadi, Maryam; Barr, Lucy; Martin, Sancha; Wray, Paul; Ellington, Andrew; Matthews, Nicholas; Ellwood, Matthew; Woodmansey, Rebecca; Clark, Graham; Cooper, James D; Cooper, James; Tromans, Anthony; Grafham, Darren; Skuce, Carl; Pandian, Richard; Andrews, Robert; Harrison, Elliot; Kimberley, Andrew; Garnett, Jane; Fosker, Nigel; Hall, Rebekah; Garner, Patrick; Kelly, Daniel; Bird, Christine; Palmer, Sophie; Gehring, Ines; Berger, Andrea; Dooley, Christopher M; Ersan-Ürün, Zübeyde; Eser, Cigdem; Geiger, Horst; Geisler, Maria; Karotki, Lena; Kirn, Anette; Konantz, Judith; Konantz, Martina; Oberländer, Martina; Rudolph-Geiger, Silke; Teucke, Mathias; Lanz, Christa; Raddatz, Günter; Osoegawa, Kazutoyo; Zhu, Baoli; Rapp, Amanda; Widaa, Sara; Langford, Cordelia; Yang, Fengtang; Schuster, Stephan C; Carter, Nigel P; Harrow, Jennifer; Ning, Zemin; Herrero, Javier; Searle, Steve M J; Enright, Anton; Geisler, Robert; Plasterk, Ronald H A; Lee, Charles; Westerfield, Monte; de Jong, Pieter J; Zon, Leonard I; Postlethwait, John H; Nüsslein-Volhard, Christiane; Hubbard, Tim J P; Roest Crollius, Hugues; Rogers, Jane; Stemple, Derek L

    2013-04-25

    Zebrafish have become a popular organism for the study of vertebrate gene function. The virtually transparent embryos of this species, and the ability to accelerate genetic studies by gene knockdown or overexpression, have led to the widespread use of zebrafish in the detailed investigation of vertebrate gene function and increasingly, the study of human genetic disease. However, for effective modelling of human genetic disease it is important to understand the extent to which zebrafish genes and gene structures are related to orthologous human genes. To examine this, we generated a high-quality sequence assembly of the zebrafish genome, made up of an overlapping set of completely sequenced large-insert clones that were ordered and oriented using a high-resolution high-density meiotic map. Detailed automatic and manual annotation provides evidence of more than 26,000 protein-coding genes, the largest gene set of any vertebrate so far sequenced. Comparison to the human reference genome shows that approximately 70% of human genes have at least one obvious zebrafish orthologue. In addition, the high quality of this genome assembly provides a clearer understanding of key genomic features such as a unique repeat content, a scarcity of pseudogenes, an enrichment of zebrafish-specific genes on chromosome 4 and chromosomal regions that influence sex determination.

  1. Verification of human actions in SBO sequences with LOCA stamps in Westinghouse PWRs

    International Nuclear Information System (INIS)

    Queral, C.; Mena Rosell, L.; Jimenez Varas, G.

    2013-01-01

    The Fukushima accident has shown the need for tools and methodologies able to analyze human activities and / or capabilities of portable systems that has given the Spanish plants as a result of the stress tests . In this work we have applied the methodology of integrated safety analysis developed by the CSN , to SBO sequences with LOCA stamp. The aim is to show a methodology for testing the performances of the Emergency Operating Procedures and Guides Severe Accident Management. The simulations were performed with the tool SCAIS coupled to MAAP . The results show that there are human activities that may be beneficial in certain sequences but harmful in others. This type of problem is already known and referred to in the GGAS . However, FSR shows a practical way to check human actions cannot be obtained with other methods.

  2. Unique features of a global human ectoparasite identified through sequencing of the bed bug genome.

    Science.gov (United States)

    Benoit, Joshua B; Adelman, Zach N; Reinhardt, Klaus; Dolan, Amanda; Poelchau, Monica; Jennings, Emily C; Szuter, Elise M; Hagan, Richard W; Gujar, Hemant; Shukla, Jayendra Nath; Zhu, Fang; Mohan, M; Nelson, David R; Rosendale, Andrew J; Derst, Christian; Resnik, Valentina; Wernig, Sebastian; Menegazzi, Pamela; Wegener, Christian; Peschel, Nicolai; Hendershot, Jacob M; Blenau, Wolfgang; Predel, Reinhard; Johnston, Paul R; Ioannidis, Panagiotis; Waterhouse, Robert M; Nauen, Ralf; Schorn, Corinna; Ott, Mark-Christoph; Maiwald, Frank; Johnston, J Spencer; Gondhalekar, Ameya D; Scharf, Michael E; Peterson, Brittany F; Raje, Kapil R; Hottel, Benjamin A; Armisén, David; Crumière, Antonin Jean Johan; Refki, Peter Nagui; Santos, Maria Emilia; Sghaier, Essia; Viala, Sèverine; Khila, Abderrahman; Ahn, Seung-Joon; Childers, Christopher; Lee, Chien-Yueh; Lin, Han; Hughes, Daniel S T; Duncan, Elizabeth J; Murali, Shwetha C; Qu, Jiaxin; Dugan, Shannon; Lee, Sandra L; Chao, Hsu; Dinh, Huyen; Han, Yi; Doddapaneni, Harshavardhan; Worley, Kim C; Muzny, Donna M; Wheeler, David; Panfilio, Kristen A; Vargas Jentzsch, Iris M; Vargo, Edward L; Booth, Warren; Friedrich, Markus; Weirauch, Matthew T; Anderson, Michelle A E; Jones, Jeffery W; Mittapalli, Omprakash; Zhao, Chaoyang; Zhou, Jing-Jiang; Evans, Jay D; Attardo, Geoffrey M; Robertson, Hugh M; Zdobnov, Evgeny M; Ribeiro, Jose M C; Gibbs, Richard A; Werren, John H; Palli, Subba R; Schal, Coby; Richards, Stephen

    2016-02-02

    The bed bug, Cimex lectularius, has re-established itself as a ubiquitous human ectoparasite throughout much of the world during the past two decades. This global resurgence is likely linked to increased international travel and commerce in addition to widespread insecticide resistance. Analyses of the C. lectularius sequenced genome (650 Mb) and 14,220 predicted protein-coding genes provide a comprehensive representation of genes that are linked to traumatic insemination, a reduced chemosensory repertoire of genes related to obligate hematophagy, host-symbiont interactions, and several mechanisms of insecticide resistance. In addition, we document the presence of multiple putative lateral gene transfer events. Genome sequencing and annotation establish a solid foundation for future research on mechanisms of insecticide resistance, human-bed bug and symbiont-bed bug associations, and unique features of bed bug biology that contribute to the unprecedented success of C. lectularius as a human ectoparasite.

  3. Construction and application of a bovine immune-endocrine cDNA microarray.

    Science.gov (United States)

    Tao, Wenjing; Mallard, Bonnie; Karrow, Niel; Bridle, Byram

    2004-09-01

    A variety of commercial DNA arrays specific for humans and rodents are widely available; however, microarrays containing well-characterized genes to study pathway-specific gene expression are not as accessible for domestic animals, such as cattle, sheep and pigs. Therefore, a small-scale application-targeted bovine immune-endocrine cDNA array was developed to evaluate genetic pathways involved in the immune-endocrine axis of cattle during periods of altered homeostasis provoked by physiological or environmental stressors, such as infection, vaccination or disease. For this purpose, 167 cDNA sequences corresponding to immune, endocrine and inflammatory response genes were collected and categorized. Positive controls included 5 housekeeping genes (glyceraldehydes-3-phosphate dehydrogenase, hypoxanthine phosphoribosyltransferase, ribosomal protein L19, beta-actin, beta2-microglobulin) and bovine genomic DNA. Negative controls were a bacterial gene (Rhodococcus equi 17-kDa virulence-associated protein) and a partial sequence of the plasmid pACYC177. In addition, RNA extracted from un-stimulated, as well as superantigen (Staphylococcus aureus enterotoxin-A, S. aureus Cowan Pansorbin Cells) and mitogen-stimulated (LPS, ConA) bovine blood leukocytes was mixed, reverse transcribed and PCR amplified using gene-specific primers. The endocrine-associated genes were amplified from cDNA derived from un-stimulated bovine hypothalamus, pituitary, adrenal and thyroid gland tissues. The array was constructed in 4 repeating grids of 180 duplicated spots by coupling the PCR amplified 213-630 bp gene fragments onto poly-l-lysine coated glass slides. The bovine immune-endocrine arrays were standardized and preliminary gene expression profiles generated using Cy3 and Cy5 labelled cDNA from un-stimulated and ConA (5 microg/ml) stimulated PBMC of 4 healthy Holstein cows (2-4 replicate arrays/cow) in a time course study. Mononuclear cell-derived cytokine and chemokine (IL-2, IL-1alpha

  4. Canine adiponectin: cDNA structure, mRNA expression in adipose tissues and reduced plasma levels in obesity.

    Science.gov (United States)

    Ishioka, K; Omachi, A; Sagawa, M; Shibata, H; Honjoh, T; Kimura, K; Saito, M

    2006-04-01

    Adiponectin is a protein synthesized and secreted by adipocytes. Decreased adiponectin is responsible for insulin resistance and atherosclerosis associated with human obesity. We obtained a cDNA clone corresponding to canine adiponectin, whose nucleotide and deduced amino acid sequences were highly identical to those of other species. Adiponectin mRNA was detected in adipose tissues, but not in other tissues, of dogs. When 22 adult beagles were given a high-energy diet for 14 weeks, they became obese, showing heavier body weights, higher plasma leptin concentrations, but lower plasma adiponectin concentrations. The adiponectin concentrations of plasma samples collected from 71 dogs visiting veterinary practices were negatively correlated to plasma leptin concentrations, being lower in obese than non-obese dogs. These results are compatible with those reported in other species, and suggest that adiponectin is an index of adiposity and a target molecule for studies on diseases associated with obesity in dogs.

  5. Deduced amino acid sequence of the small hydrophobic protein of US avian pneumovirus has greater identity with that of human metapneumovirus than those of non-US avian pneumoviruses.

    Science.gov (United States)

    Yunus, Abdul S; Govindarajan, Dhanasekaran; Huang, Zhuhui; Samal, Siba K

    2003-05-01

    We report here the nucleotide and deduced amino acid (aa) sequences of the small hydrophobic (SH) gene of the avian pneumovirus strain Colorado (APV/CO). The SH gene of APV/CO is 628 nucleotides in length from gene-start to gene-end. The longest ORF of the SH gene encoded a protein of 177 aas in length. Comparison of the deduced aa sequence of the SH protein of APV/CO with the corresponding published sequences of other members of genera metapneumovirus showed 28% identity with the newly discovered human metapneumovirus (hMPV), but no discernable identity with the APV subgroup A or B. Collectively, this data supports the hypothesis that: (i) APV/CO is distinct from European APV subgroups and belongs to the novel subgroup APV/C (APV/US); (ii) APV/CO is more closely related to hMPV, a mammalian metapneumovirus, than to either APV subgroup A or B. The SH gene of APV/CO was cloned using a genomic walk strategy which initiated cDNA synthesis from genomic RNA that traversed the genes in the order 3'-M-F-M2-SH-G-5', thus confirming that gene-order of APV/CO conforms in the genus Metapneumovirus. We also provide the sequences of transcription-signals and the M-F, F-M2, M2-SH and SH-G intergenic regions of APV/CO.

  6. Efficient identification of Y chromosome sequences in the human and Drosophila genomes

    Science.gov (United States)

    Carvalho, Antonio Bernardo; Clark, Andrew G.

    2013-01-01

    Notwithstanding their biological importance, Y chromosomes remain poorly known in most species. A major obstacle to their study is the identification of Y chromosome sequences; due to its high content of repetitive DNA, in most genome projects, the Y chromosome sequence is fragmented into a large number of small, unmapped scaffolds. Identification of Y-linked genes among these fragments has yielded important insights about the origin and evolution of Y chromosomes, but the process is labor intensive, restricting studies to a small number of species. Apart from these fragmentary assemblies, in a few mammalian species, the euchromatic sequence of the Y is essentially complete, owing to painstaking BAC mapping and sequencing. Here we use female short-read sequencing and k-mer comparison to identify Y-linked sequences in two very different genomes, Drosophila virilis and human. Using this method, essentially all D. virilis scaffolds were unambiguously classified as Y-linked or not Y-linked. We found 800 new scaffolds (totaling 8.5 Mbp), and four new genes in the Y chromosome of D. virilis, including JYalpha, a gene involved in hybrid male sterility. Our results also strongly support the preponderance of gene gains over gene losses in the evolution of the Drosophila Y. In the intensively studied human genome, used here as a positive control, we recovered all previously known genes or gene families, plus a small amount (283 kb) of new, unfinished sequence. Hence, this method works in large and complex genomes and can be applied to any species with sex chromosomes. PMID:23921660

  7. Efficient identification of Y chromosome sequences in the human and Drosophila genomes.

    Science.gov (United States)

    Carvalho, Antonio Bernardo; Clark, Andrew G

    2013-11-01

    Notwithstanding their biological importance, Y chromosomes remain poorly known in most species. A major obstacle to their study is the identification of Y chromosome sequences; due to its high content of repetitive DNA, in most genome projects, the Y chromosome sequence is fragmented into a large number of small, unmapped scaffolds. Identification of Y-linked genes among these fragments has yielded important insights about the origin and evolution of Y chromosomes, but the process is labor intensive, restricting studies to a small number of species. Apart from these fragmentary assemblies, in a few mammalian species, the euchromatic sequence of the Y is essentially complete, owing to painstaking BAC mapping and sequencing. Here we use female short-read sequencing and k-mer comparison to identify Y-linked sequences in two very different genomes, Drosophila virilis and human. Using this method, essentially all D. virilis scaffolds were unambiguously classified as Y-linked or not Y-linked. We found 800 new scaffolds (totaling 8.5 Mbp), and four new genes in the Y chromosome of D. virilis, including JYalpha, a gene involved in hybrid male sterility. Our results also strongly support the preponderance of gene gains over gene losses in the evolution of the Drosophila Y. In the intensively studied human genome, used here as a positive control, we recovered all previously known genes or gene families, plus a small amount (283 kb) of new, unfinished sequence. Hence, this method works in large and complex genomes and can be applied to any species with sex chromosomes.

  8. Improvements and impacts of GRCh38 human reference on high throughput sequencing data analysis.

    Science.gov (United States)

    Guo, Yan; Dai, Yulin; Yu, Hui; Zhao, Shilin; Samuels, David C; Shyr, Yu

    2017-03-01

    Analyses of high throughput sequencing data starts with alignment against a reference genome, which is the foundation for all re-sequencing data analyses. Each new release of the human reference genome has been augmented with improved accuracy and completeness. It is presumed that the latest release of human reference genome, GRCh38 will contribute more to high throughput sequencing data analysis by providing more accuracy. But the amount of improvement has not yet been quantified. We conducted a study to compare the genomic analysis results between the GRCh38 reference and its predecessor GRCh37. Through analyses of alignment, single nucleotide polymorphisms, small insertion/deletions, copy number and structural variants, we show that GRCh38 offers overall more accurate analysis of human sequencing data. More importantly, GRCh38 produced fewer false positive structural variants. In conclusion, GRCh38 is an improvement over GRCh37 not only from the genome assembly aspect, but also yields more reliable genomic analysis results. Copyright © 2017. Published by Elsevier Inc.

  9. Yleaf: Software for Human Y-Chromosomal Haplogroup Inference from Next-Generation Sequencing Data.

    Science.gov (United States)

    Ralf, Arwin; Montiel González, Diego; Zhong, Kaiyin; Kayser, Manfred

    2018-05-01

    Next-generation sequencing (NGS) technologies offer immense possibilities given the large genomic data they simultaneously deliver. The human Y-chromosome serves as good example how NGS benefits various applications in evolution, anthropology, genealogy, and forensics. Prior to NGS, the Y-chromosome phylogenetic tree consisted of a few hundred branches, based on NGS data, it now contains many thousands. The complexity of both, Y tree and NGS data provide challenges for haplogroup assignment. For effective analysis and interpretation of Y-chromosome NGS data, we present Yleaf, a publically available, automated, user-friendly software for high-resolution Y-chromosome haplogroup inference independently of library and sequencing methods.

  10. Fidelity and mutational spectrum of Pfu DNA polymerase on a human mitochondrial DNA sequence.

    Science.gov (United States)

    André, P; Kim, A; Khrapko, K; Thilly, W G

    1997-08-01

    The study of rare genetic changes in human tissues requires specialized techniques. Point mutations at fractions at or below 10(-6) must be observed to discover even the most prominent features of the point mutational spectrum. PCR permits the increase in number of mutant copies but does so at the expense of creating many additional mutations or "PCR noise". Thus, each DNA sequence studied must be characterized with regard to the DNA polymerase and conditions used to avoid interpreting a PCR-generated mutation as one arising in human tissue. The thermostable DNA polymerase derived from Pyrococcus furiosus designated Pfu has the highest fidelity of any DNA thermostable polymerase studied to date, and this property recommends it for analyses of tissue mutational spectra. Here, we apply constant denaturant capillary electrophoresis (CDCE) to separate and isolate the products of DNA amplification. This new strategy permitted direct enumeration and identification of point mutations created by Pfu DNA polymerase in a 96-bp low melting domain of a human mitochondrial sequence despite the very low mutant fractions generated in the PCR process. This sequence, containing part of the tRNA glycine and NADH dehydrogenase subunit 3 genes, is the target of our studies of mitochondrial mutagenesis in human cells and tissues. Incorrectly synthesized sequences were separated from the wild type as mutant/wild-type heteroduplexes by sequential enrichment on CDCE. An artificially constructed mutant was used as an internal standard to permit calculation of the mutant fraction. Our study found that the average error rate (mutations per base pair duplication) of Pfu was 6.5 x 10(-7), and five of its more frequent mutations (hot spots) consisted of three transversions (GC-->TA, AT-->TA, and AT-->CG), one transition (AT-->GC), and one 1-bp deletion (in an AAAAAA sequence). To achieve an even higher sensitivity, the amount of Pfu-induced mutants must be reduced.

  11. Cloning and characterization of transferrin cDNA and rapid detection of transferrin gene polymorphism in rainbow trout (Oncorhynchus mykiss).

    Science.gov (United States)

    Tange, N; Jong-Young, L; Mikawa, N; Hirono, I; Aoki, T

    1997-12-01

    A cDNA clone of rainbow trout (Oncorhynchus mykiss) transferrin was obtained from a liver cDNA library. The 2537-bp cDNA sequence contained an open reading frame encoding 691 amino acids and the 5' and 3' noncoding regions. The amino acid sequences at the iron-binding sites and the two N-linked glycosylation sites, and the cysteine residues were consistent with known, conserved vertebrate transferrin cDNA sequences. Single N-linked glycosylation sites existed on the N- and C-lobe. The deduced amino acid sequence of the rainbow trout transferrin cDNA had 92.9% identities with transferrin of coho salmon (Oncorhynchus kisutch); 85%, Atlantic salmon (Salmo salar); 67.3%, medaka (Oryzias latipes); 61.3% Atlantic cod (Gadus morhua); and 59.7%, Japanese flounder (Paralichthys olivaceus). The long and accurate polymerase chain reaction (LA-PCR) was used to amplify approximately 6.5 kb of the transferrin gene from rainbow trout genomic DNA. Restriction fragment length polymorphisms (RFLPs) of the LA-PCR products revealed three digestion patterns in 22 samples.

  12. Structure of human milk bile salt activated lipase

    International Nuclear Information System (INIS)

    Baba, T.; Downs, D.; Jackson, K.W.; Tang, J.; Wang, Chi-Sun

    1991-01-01

    The structure and some functional sites of human milk bile salt activated lipase (BAL) were studied by cDNA cloning and chemical analysis of the enzyme. Eighteen cDNA clones of human BAL were identified from lactating human breast cDNA libraries in λgt11 and λgt10 with antibody and synthetic oligonucleotides as probes. The sequence of four clones was sufficient to construct a 3018-bp BAL cDNA structure. This sequence codes for an open reading frame of 742 amino acid residues. There is a putative signal sequence of 20 residues which is followed by the amino-terminal sequence of BAL, and the mature BAL contains 722 amino acid residues. The cDNA sequence also contains a 678-base 5'-untranslated sequence, a 97-base 3'-untranslated region, and a 14-base poly(A) tail. The sequence of a 1.8-kbp insert of clone G10-4A differs from that of the other cDNA in that it contains a deletion of 198 bases (1966-2163) corresponding to 66 amino acid residues. By use of BAL cDAN as probe, it was found that the major molecular species of BAL mRNA in human mammary gland HBL-100 cells had a size of 2.9 kb and two minor species had sizes of 3.8 and 5.1 kb by Northern blot analyses. These chemical studies established that the active site of human milk BAL is located at serine-194, the N-glycosylation site is present at asparagine-187, the O-glycosylation region is in the 16 repeating units near the C-terminus, and the heparin binding domain is in the N-terminal region. The authors have also determined the location of disulfide bridges as Cys64-Cys80 and Cys246-Cys257. The cyanogen bromide cleavage and the partial sequencing of CNBr peptides also confirmed the location of methionines in the polypeptide chain as well as the deduced cDNA sequence of BAL

  13. A unique genomic sequence in the Wolf-Hirschhorn syndrome [WHS] region of humans is conserved in the great apes.

    Science.gov (United States)

    Tarzami, S T; Kringstein, A M; Conte, R A; Verma, R S

    1996-10-01

    The Wolf-Hirschhorn syndrome (WHS) is caused by a partial deletion in the short arm of chromosome 4 band 16.3 (4p 16.3). A unique-sequence human DNA probe (39 kb) localized within this region has been used to search for sequence homology in the apes' equivalent chromosome 3 by FISH-technique. The WHS loci are conserved in higher primates at the expected position. Nevertheless, a control probe, which detects alphoid sequences of the pericentromeric region of humans, is diverged in chimpanzee, gorilla, and orangutan. The conservation of WHS loci and divergence of DNA alphoid sequences have further added to the controversy concerning human descent.

  14. Molecular cloning and characterization of a novel human kinase ...

    Indian Academy of Sciences (India)

    throughput cDNA sequencing. It encodes a protein of 341 amino acids, which shows 69% identity with the human kinase CLIK1 (AAL99353), which was suggested to be the CLP-36 interacting kinase. Bioinformatics analysis suggests that the ...

  15. Packaging of human endogenous retrovirus sequences is undetectable in porcine endogenous retrovirus particles produced from human cells

    International Nuclear Information System (INIS)

    Suling, Kristen; Quinn, Gary; Wood, James; Patience, Clive

    2003-01-01

    The chronic shortage of human donor organs and tissues for allotransplantation could be relieved if clinical xenotransplantation were to become a viable clinical therapy. Balanced against the benefits of xenotransplantation are the possible consequences of zoonotic infections, and in particular, infection by porcine endogenous retrovirus (PERV). An often-proclaimed risk of PERV infection is the possible recombination of PERV with human endogenous retroviruses (HERV) . To address this issue, we examined the potential for HERV sequences to be cross-packaged into PERV particles produced from infected human 293 cells. Although HERV-K, W, E, R, and ERV-9 RNA transcripts are expressed in 293 cells, we did not detect cross-packaging of any of these HERV groups. Quantitative analysis indicated that less than approximately 1 in 10 4 -10 7 PERV particles might contain HERV sequences. In comparison, we found that murine leukemia virus (MLV)-based vector transcripts were cross-packaged at a rate of approximately one copy in 10 4 PERV particles. Our results indicate that the potential for recombination of PERV and HERV sequences is low and that novel viruses generated by this mechanism are unlikely to represent a significant risk for xenotransplantation

  16. Complete genome sequence of the first human parechovirus type 3 isolated in Taiwan

    Directory of Open Access Journals (Sweden)

    Jenn-Tzong Chang

    2017-11-01

    Full Text Available The first human parechovirus 3 (HPeV3 VGHKS-2007 in Taiwan was identified from a clinical specimen from a male infant. The entire genome of the HPeV3 isolate was sequenced and compared to known HPeV3 sequences. Genome alignment data showed that HPeV3 VGHKS-2007 shares the highest nucleotide identity, 99%, with the Japanese strain of HPeV3 1361K-162589-Yamagata-2008. All HPeV3 isolates possess at least 97% amino acid identity. The analysis of the genome sequence of HPeV3 VGHKS-2007 will facilitate future investigations of the epidemiology and pathogenicity of HPeV3 infection.

  17. Genotyping of Giardia lamblia isolates from humans in China and Korea using ribosomal DNA Sequences.

    Science.gov (United States)

    Yong, T S; Park, S J; Hwang, U W; Yang, H W; Lee, K W; Min, D Y; Rim, H J; Wang, Y; Zheng, F

    2000-08-01

    Genetic characterization of a total of 15 Giardia lamblia isolates, 8 from Anhui Province, China (all from purified cysts) and 7 from Seoul, Korea (2 from axenic cultures and 5 from purified cysts), was performed by polymerase chain reaction amplification and sequencing of a 295-bp region near the 5' end of the small subunit ribosomal DNA (eukaryotic 16S rDNA). Phylogenetic analyses were subsequently conducted using sequence data obtained in this study, as well as sequences published from other Giardia isolates. The maximum parsimony method revealed that G. lamblia isolates from humans in China and Korea are divided into 2 major lineages, assemblages A and B. All 7 Korean isolates were grouped into assemblage A, whereas 4 Chinese isolates were grouped into assemblage A and 4 into assemblage B. Two Giardia microti isolates and 2 dog-derived Giardia isolates also grouped into assemblage B, whereas Giardia ardeae and Giardia muris were unique.

  18. Comparison of whole genome amplification techniques for human single cell exome sequencing.

    Science.gov (United States)

    Borgström, Erik; Paterlini, Marta; Mold, Jeff E; Frisen, Jonas; Lundeberg, Joakim

    2017-01-01

    Whole genome amplificat