WorldWideScience

Sample records for hospitalized myopathy translating

  1. Genetics Home Reference: Miyoshi myopathy

    Science.gov (United States)

    ... links) Centers for Disease Control and Prevention: Muscular Dystrophy Cincinnati Children's Hospital: Molkentin Lab: Mechanisms of Duchenne and Miyoshi Myopathy Disease InfoSearch: Miyoshi myopathy Jain ...

  2. DISTAL MYOPATHIES

    Science.gov (United States)

    Dimachkie, Mazen M.; Barohn, Richard J.

    2014-01-01

    Over a century ago, Gowers described two young patients in whom distal muscles weakness involved the hand, foot, sternocleidomastoid, and facial muscles in the other case the shoulder and distal leg musculature. Soon after, , similar distal myopathy cases were reported whereby the absence of sensory symptoms and of pathologic changes in the peripheral nerves and spinal cord at postmortem examination allowed differentiation from Charcot-Marie-Tooth disease. In 1951, Welander described autosomal dominant (AD) distal arm myopathy in a large Scandanavian cohort. Since then the number of well-characterized distal myopathies has continued to grow such that the distal myopathies have formed a clinically and genetically heterogeneous group of disorders. Affected kindred commonly manifest weakness that is limited to foot and toe muscles even in advanced stages of the disease, with variable mild proximal leg, distal arm, neck and laryngeal muscle involvement in selected individuals. An interesting consequence of the molecular characterization of the distal myopathies has been the recognition that mutation in a single gene can lead to more than one clinical disorder. For example, Myoshi myopathy (MM) and limb girdle muscular dystrophy (LGMD) type 2B are allelic disorders due to defects in the gene that encodes dysferlin. The six well described distal myopathy syndromes are shown in Table 1. Table 2 lists advances in our understanding of the myofibrillar myopathy group and Table 3 includes more recently delineated and less common distal myopathies. In the same manner, the first section of this review pertains to the more traditional six distal myopathies followed by discussion of the myofibrillar myopathies. In the third section, we review other clinically and genetically distinctive distal myopathy syndromes usually based upon single or smaller family cohorts. The fourth section considers other neuromuscular disorders that are important to recognize as they display prominent

  3. Myopathies

    Science.gov (United States)

    ... find appropri- ate therapists, and to locate and purchase important assistive devices. And today, people with disabilities ... in inheritable myopathies • Anesthesia: People with myopathies can experience a range of adverse reactions to certain anesthetic ...

  4. Metabolic Myopathies.

    Science.gov (United States)

    Tarnopolsky, Mark A

    2016-12-01

    Metabolic myopathies are genetic disorders that impair intermediary metabolism in skeletal muscle. Impairments in glycolysis/glycogenolysis (glycogen-storage disease), fatty acid transport and oxidation (fatty acid oxidation defects), and the mitochondrial respiratory chain (mitochondrial myopathies) represent the majority of known defects. The purpose of this review is to develop a diagnostic and treatment algorithm for the metabolic myopathies. The metabolic myopathies can present in the neonatal and infant period as part of more systemic involvement with hypotonia, hypoglycemia, and encephalopathy; however, most cases present in childhood or in adulthood with exercise intolerance (often with rhabdomyolysis) and weakness. The glycogen-storage diseases present during brief bouts of high-intensity exercise, whereas fatty acid oxidation defects and mitochondrial myopathies present during a long-duration/low-intensity endurance-type activity or during fasting or another metabolically stressful event (eg, surgery, fever). The clinical examination is often normal between acute events, and evaluation involves exercise testing, blood testing (creatine kinase, acylcarnitine profile, lactate, amino acids), urine organic acids (ketones, dicarboxylic acids, 3-methylglutaconic acid), muscle biopsy (histology, ultrastructure, enzyme testing), MRI/spectroscopy, and targeted or untargeted genetic testing. Accurate and early identification of metabolic myopathies can lead to therapeutic interventions with lifestyle and nutritional modification, cofactor treatment, and rapid treatment of rhabdomyolysis.

  5. Axial myopathy

    DEFF Research Database (Denmark)

    Witting, Nanna; Andersen, Linda K; Vissing, John

    2016-01-01

    Classically, myopathies are categorized according to limb or cranial nerve muscle affection, but with the growing use of magnetic resonance imaging it has become evident that many well-known myopathies have significant involvement of the axial musculature. New disease entities with selective axial...

  6. Mitochondrial disorders in congenital myopathies

    Directory of Open Access Journals (Sweden)

    D. A. Kharlamov

    2014-01-01

    Full Text Available The literature review gives data on the role of mitochondrial disorders in the pathogenesis of congenital myopathies: congenital muscular dystrophies and congenital structural myopathies. It describes changes in congenital muscular dystrophies with type VI collagen, in myodystrophy with giant mitochondria, in congenital central core myopathies, myotubular myopathy, etc. Clinical and experimental findings are presented. Approaches to therapy for energy disorders in congenital myopathies are depicted.

  7. Molecular and Genetic Studies of Congenital Myopathies

    Science.gov (United States)

    2018-03-21

    Central Core Disease; Centronuclear Myopathy; Congenital Fiber Type Disproportion; Multiminicore Disease; Myotubular Myopathy; Nemaline Myopathy; Rigid Spine Muscular Dystrophy; Undefined Congenital Myopathy

  8. Endocrine myopathy: Case-based review

    Directory of Open Access Journals (Sweden)

    Babul Reddy Hanmayyagari

    2016-01-01

    Full Text Available Endocrine myopathy means muscle weakness in the presence of an abnormal endocrine state. Most of the endocrine disorders are associated with myopathy and it is usually reversible with correction of the underlying disturbance, though, there is an increasing knowledge of the metabolic effects of hormones, endocrine myopathy is a less recognized and often overlooked entity in clinical practice. Here, we describe this association in three of our patients, then, we discuss systematically about endocrine myopathy.

  9. Myopathy in acute hypothyroidism

    OpenAIRE

    Ma, JTC; Yu, YL; Kung, AWC

    1987-01-01

    Hypothyroid myopathy has so far been reported in long standing cases of hypothyroidism. We describe two adult patients with myopathy associated with acute transient hypothyroidism. Both presented with severe muscle aches and cramps, stiffness and spasms. Muscle enzymes were markedly elevated and electromyography in one patient showed myopathic features. Histological changes were absent in muscle biopsy, probably because of the short duration of metabolic disturbance. The myopathy subsided pro...

  10. Myopathy in acute hypothyroidism.

    OpenAIRE

    Kung, A. W.; Ma, J. T.; Yu, Y. L.; Wang, C. C.; Woo, E. K.; Lam, K. S.; Huang, C. Y.; Yeung, R. T.

    1987-01-01

    Hypothyroid myopathy has so far been reported in long standing cases of hypothyroidism. We describe two adult patients with myopathy associated with acute transient hypothyroidism. Both presented with severe muscle aches and cramps, stiffness and spasms. Muscle enzymes were markedly elevated and electromyography in one patient showed myopathic features. Histological changes were absent in muscle biopsy, probably because of the short duration of metabolic disturbance. The myopathy subsided pro...

  11. Muscle regeneration in mitochondrial myopathies

    DEFF Research Database (Denmark)

    Krag, T O; Hauerslev, S; Jeppesen, T D

    2013-01-01

    Mitochondrial myopathies cover a diverse group of disorders in which ragged red and COX-negative fibers are common findings on muscle morphology. In contrast, muscle degeneration and regeneration, typically found in muscular dystrophies, are not considered characteristic features of mitochondrial...... myopathies. We investigated regeneration in muscle biopsies from 61 genetically well-defined patients affected by mitochondrial myopathy. Our results show that the perturbed energy metabolism in mitochondrial myopathies causes ongoing muscle regeneration in a majority of patients, and some were even affected...

  12. Establishment of research-oriented hospital: an important way for translational medicine development in China

    Directory of Open Access Journals (Sweden)

    MEINA LI

    2015-06-01

    Full Text Available Globally, one of the major trends is the development of translational medicine. The traditional hospital structure could not meet the demands of translational medicine development any longer and to explore a novel hospital structure is imperative. Following the times, China proposed and implemented a development strategy for a first-class modern research-oriented hospital. To establish a research-oriented hospital has become an important strategy to guide the scientific development of high-quality medical institutions and to advance translational medicine development. To facilitate translational medicine by developing research-oriented hospital, the Chinese Research Hospital Association (CRHA has been established, which provides service of medicine, talents cultivation, scientific research and clinical teaching and covers areas of theoretical research, academic exchange, translational medicine, talents training and practice guiding. On the whole, research-oriented hospital facilitated translational medicine by developing interdisciplinary platform, training core competencies in clinical and translational research, providing financial support of translational research, and hosting journals on translational medicine, etc.

  13. ColVI myopathies: where do we stand, where do we go?

    Directory of Open Access Journals (Sweden)

    Allamand Valérie

    2011-09-01

    Full Text Available Abstract Collagen VI myopathies, caused by mutations in the genes encoding collagen type VI (ColVI, represent a clinical continuum with Ullrich congenital muscular dystrophy (UCMD and Bethlem myopathy (BM at each end of the spectrum, and less well-defined intermediate phenotypes in between. ColVI myopathies also share common features with other disorders associated with prominent muscle contractures, making differential diagnosis difficult. This group of disorders, under-recognized for a long time, has aroused much interest over the past decade, with important advances made in understanding its molecular pathogenesis. Indeed, numerous mutations have now been reported in the COL6A1, COL6A2 and COL6A3 genes, a large proportion of which are de novo and exert dominant-negative effects. Genotype-phenotype correlations have also started to emerge, which reflect the various pathogenic mechanisms at play in these disorders: dominant de novo exon splicing that enables the synthesis and secretion of mutant tetramers and homozygous nonsense mutations that lead to premature termination of translation and complete loss of function are associated with early-onset, severe phenotypes. In this review, we present the current state of diagnosis and research in the field of ColVI myopathies. The past decade has provided significant advances, with the identification of altered cellular functions in animal models of ColVI myopathies and in patient samples. In particular, mitochondrial dysfunction and a defect in the autophagic clearance system of skeletal muscle have recently been reported, thereby opening potential therapeutic avenues.

  14. Evidence-based treatment of metabolic myopathy

    Directory of Open Access Journals (Sweden)

    Yan LIN

    2014-05-01

    Full Text Available Objective To evaluate the current treatments and possible adverse reactions of metabolic myopathy, and to develop the best solution for evidence-based treatment.  Methods Taking metabolic myopathy, mitochondrial myopathy, lipid storage myopathy, glycogen storage diseases, endocrine myopathy, drug toxicity myopathy and treatment as search terms, retrieve in databases such as PubMed, Cochrane Library, ClinicalKey database, National Science and Technology Library (NSTL, in order to collect the relevant literature database including clinical guidelines, systematic reviews (SR, randomized controlled trials (RCT, controlled clinical trials, retrospective case analysis and case study. Jadad Scale was used to evaluate the quality of literature.  Results Twenty-eight related articles were selected, including 6 clinical guidelines, 5 systematic reviews, 10 randomized controlled trials and 7 clinical controlled trials. According to Jadad Scale, 23 articles were evaluated as high-quality literature (≥ 4, and the remaining 5 were evaluated as low-quality literature (< 4. Treatment principles of these clinical trials, efficacy of different therapies and drug safety evaluation suggest that: 1 Acid α-glycosidase (GAA enzyme replacement therapy (ERT is the main treatment for glycogen storage diseases, with taking a high-protein diet, exercising before taking a small amount of fructose orally and reducing the patient's physical activity gradually. 2 Carnitine supplementation is used in the treatment of lipid storage myopathy, with carbohydrate and low fat diet provided before exercise or sports. 3 Patients with mitochondrial myopathy can take coenzyme Q10, vitamin B, vitamin K, vitamin C, etc. Proper aerobic exercise combined with strength training is safe, and it can also enhance the exercise tolerance of patients effectively. 4 The first choice to treat the endocrine myopathy is treating primary affection. 5 Myopathies due to drugs and toxins should

  15. Stepwise approach to myopathy in systemic disease.

    Science.gov (United States)

    Chawla, Jasvinder

    2011-01-01

    Muscle diseases can constitute a large variety of both acquired and hereditary disorders. Myopathies in systemic disease results from several different disease processes including endocrine, inflammatory, paraneoplastic, infectious, drug- and toxin-induced, critical illness myopathy, metabolic, and myopathies with other systemic disorders. Patients with systemic myopathies often present acutely or sub acutely. On the other hand, familial myopathies or dystrophies generally present in a chronic fashion with exceptions of metabolic myopathies where symptoms on occasion can be precipitated acutely. Most of the inflammatory myopathies can have a chance association with malignant lesions; the incidence appears to be specifically increased only in patients with dermatomyositis. In dealing with myopathies associated with systemic illnesses, the focus will be on the acquired causes. Management is beyond the scope of this chapter. Prognosis is based upon the underlying cause and, most of the time, carries a good prognosis. In order to approach a patient with suspected myopathy from systemic disease, a stepwise approach is utilized.

  16. STATINS AND MYOPATHY: MOLECULAR MECHANISMS

    Directory of Open Access Journals (Sweden)

    O. M. Drapkina

    2012-01-01

    Full Text Available The safety of statin therapy is considered. In particular the reasons of a complication such as myopathy are discussed in detail. The molecular mechanisms of statin myopathy , as well as its risk factors are presented. The role of coenzyme Q10 in the myopathy development and coenzyme Q10 application for the prevention of this complication are considered. 

  17. [Descending ocular myopathy].

    Science.gov (United States)

    de Freitas, M R; Nascimento, O J

    1975-06-01

    The case of a 23 years old female patient, with primary involvement of the extraocular and faringeal muscles without familiar history is reported. Electromyographic and muscular biopsy studies proved the myogenic nature of the process. A clinical comparison between the ocular myopathy and the descending ocular myopathy is made, the authors thinking that both of them would be variants of the same muscle disease.

  18. Flaccid quadriplegia due to thyrotoxic myopathy.

    Science.gov (United States)

    Couillard, Philippe; Wijdicks, Eelco F M

    2014-04-01

    Acute flaccid paralysis is an important clinical problem in neurological critical care. After implementing life-supporting measures, it is imperative to identify the correct diagnosis to provide timely appropriate care. Thyrotoxicosis is a recognized cause of myopathy, but rarely of quadriplegia. Here, we report a case of hyperthyroidism with severe weakness. Case report and video demonstration of clinical examination. We describe a case of a 59-year-old woman with Grave's disease who presented to the hospital with progressive shortness of breath secondary to atrial fibrillation with rapid ventricular response. Following contrast administration, she had a pulseless electrical activity arrest from which she recovered without cognitive sequelae, but with flaccid quadriplegia, facial diplegia, and hypophonia. CK was mildly elevated and electrolytes were essentially normal. Nerve conduction studies and electromyography demonstrated features supporting an acute myopathy without evidence of neuromuscular junction conduction abnormality. Normalization of thyroid hormones resulted in slow, but steady improvement over months after which she regained ambulation. Acute flaccid quadriplegia can result from thyrotoxicosis. With normalization of thyroid function, recovery can be expected.

  19. A diagnostic algorithm for metabolic myopathies.

    Science.gov (United States)

    Berardo, Andres; DiMauro, Salvatore; Hirano, Michio

    2010-03-01

    Metabolic myopathies comprise a clinically and etiologically diverse group of disorders caused by defects in cellular energy metabolism, including the breakdown of carbohydrates and fatty acids to generate adenosine triphosphate, predominantly through mitochondrial oxidative phosphorylation. Accordingly, the three main categories of metabolic myopathies are glycogen storage diseases, fatty acid oxidation defects, and mitochondrial disorders due to respiratory chain impairment. The wide clinical spectrum of metabolic myopathies ranges from severe infantile-onset multisystemic diseases to adult-onset isolated myopathies with exertional cramps. Diagnosing these diverse disorders often is challenging because clinical features such as recurrent myoglobinuria and exercise intolerance are common to all three types of metabolic myopathy. Nevertheless, distinct clinical manifestations are important to recognize as they can guide diagnostic testing and lead to the correct diagnosis. This article briefly reviews general clinical aspects of metabolic myopathies and highlights approaches to diagnosing the relatively more frequent subtypes (Fig. 1). Fig. 1 Clinical algorithm for patients with exercise intolerance in whom a metabolic myopathy is suspected. CK-creatine kinase; COX-cytochrome c oxidase; CPT-carnitine palmitoyl transferase; cyt b-cytochrome b; mtDNA-mitochondrial DNA; nDNA-nuclear DNA; PFK-phosphofructokinase; PGAM-phosphoglycerate mutase; PGK-phosphoglycerate kinase; PPL-myophosphorylase; RRF-ragged red fibers; TFP-trifunctional protein deficiency; VLCAD-very long-chain acyl-coenzyme A dehydrogenase.

  20. Zidovudine-induced myopathy: A study in Indian patients.

    Science.gov (United States)

    Sagar, Amitabh; Mohanty, Ambika P; Bahal, Ashish

    2010-07-01

    Literature is replete with studies on zidovudine-induced myopathy after prolonged use (use beyond 270 days on an average). However, all these studies have been done on patients of Caucasian, American and African ethnic origin. No such study has been carried out in Indian patients to our knowledge. To determine the correlation of zidovudine usage with serum creatine phosphokinase (CK) levels, clinical muscular weakness and muscle histology in Indian patients, we studied 147 physically active, Human Immunodeficiency Virus infected men on prolonged zidovudine-based antiretroviral therapy (ART). Cross-sectional study on hospital follow-up patients of HIV infection. All cases on ART who reported to our canter during a period of 18 months were evaluated for symptoms (muscle fatigue, myalgia), objective muscle strength (testing clinically) and serum CK levels, and a select group was evaluated by muscle biopsy. These patients were on zidovudine for 1 to 7 years. None of the patients studied had significant symptoms or objective muscle weakness and only a small fraction (10.8% of cases) had marginally raised serum CK levels. All muscle biopsies were normal on light microscopy. Zidovudine myopathy may be a constraint for use of the drug in the western population; however, it is a well-tolerated drug as regards myopathy in our study on Indian patients.

  1. Hereditary myopathies with early respiratory insufficiency in adults.

    Science.gov (United States)

    Naddaf, Elie; Milone, Margherita

    2017-11-01

    Hereditary myopathies with early respiratory insufficiency as a predominant feature of the clinical phenotype are uncommon and underestimated in adults. We reviewed the clinical and laboratory data of patients with hereditary myopathies who demonstrated early respiratory insufficiency before the need for ambulatory assistance. Only patients with disease-causing mutations or a specific histopathological diagnosis were included. Patients with cardiomyopathy were excluded. We identified 22 patients; half had isolated respiratory symptoms at onset. The diagnosis of the myopathy was often delayed, resulting in delayed ventilatory support. The most common myopathies were adult-onset Pompe disease, myofibrillar myopathy, multi-minicore disease, and myotonic dystrophy type 1. Single cases of laminopathy, MELAS (mitochondrial encephalomyopathy with lactic acidosis and strokelike events), centronuclear myopathy, and cytoplasmic body myopathy were identified. We highlighted the most common hereditary myopathies associated with early respiratory insufficiency as the predominant clinical feature, and underscored the importance of a timely diagnosis for patient care. Muscle Nerve 56: 881-886, 2017. © 2017 Wiley Periodicals, Inc.

  2. A novel mutation in PNPLA2 leading to neutral lipid storage disease with myopathy.

    Science.gov (United States)

    Ash, Daniel B; Papadimitriou, Dimitra; Hays, Arthur P; Dimauro, Salvatore; Hirano, Michio

    2012-09-01

    Mutations in PNPLA2, a gene encoding adipose triglyceride lipase, lead to neutral lipid storage disease with myopathy. To report the clinical and molecular features of a case of neutral lipid storage disease with myopathy resulting from a novel mutation in PNPLA2. Case report. University hospital. A 65-year-old man with progressive muscle weakness and high serum creatine kinase levels. Direct sequencing of the PNPLA2 gene. Identification of a novel homozygous mutation in the patient's PNPLA2 gene confirmed the suspected diagnosis of neutral lipid storage disease with myopathy. Screening of the PNPLA2 gene should be considered for patients presenting with high levels of creatine kinase, progressive muscle weakness, and systemic lipid accumulation. The presence of Jordans anomaly can be a strong diagnostic clue.

  3. Localized scleroderma and regional inflammatory myopathy.

    Science.gov (United States)

    Zivković, Saša A; Freiberg, William; Lacomis, David; Domsic, Robyn T; Medsger, Thomas A

    2014-05-01

    Inflammatory myopathy is rare in localized scleroderma. We report 2 new cases of regional inflammatory myopathy associated with localized scleroderma and review 10 reported cases of localized scleroderma associated with an inflammatory myopathy with regional muscle involvement, more often in the upper extremities. Serum creatine kinase was mildly elevated or normal. Histopathology often showed perimysial inflammation and plasma cell infiltration. These cases demonstrate that inflammatory myopathy should be considered in patients with localized scleroderma and regional muscle weakness, pain or atrophy. Muscle biopsy can confirm the diagnosis of myositis, which if identified, will require anti-inflammatory and/or immunosuppressive therapy. Published by Elsevier B.V.

  4. Exercise training in metabolic myopathies

    DEFF Research Database (Denmark)

    Vissing, J

    2016-01-01

    metabolic adaptations, such as increased dependence on glycogen use and a reduced capacity for fatty acid oxidation, which is detrimental in GSDs. Training has not been studied systematically in any FAODs and in just a few GSDs. However, studies on single bouts of exercise in most metabolic myopathies show......Metabolic myopathies encompass muscle glycogenoses (GSD) and disorders of muscle fat oxidation (FAOD). FAODs and GSDs can be divided into two main clinical phenotypes; those with static symptoms related to fixed muscle weakness and atrophy, and those with dynamic, exercise-related symptoms...... that are brought about by a deficient supply of ATP. Together with mitochondrial myopathies, metabolic myopathies are unique among muscle diseases, as the limitation in exercise performance is not solely caused by structural damage of muscle, but also or exclusively related to energy deficiency. ATP consumption...

  5. Mitochondrial myopathies.

    Science.gov (United States)

    DiMauro, Salvatore

    2006-11-01

    Our understanding of mitochondrial diseases (defined restrictively as defects of the mitochondrial respiratory chain) is expanding rapidly. In this review, I will give the latest information on disorders affecting predominantly or exclusively skeletal muscle. The most recently described mitochondrial myopathies are due to defects in nuclear DNA, including coenzyme Q10 deficiency and mutations in genes controlling mitochondrial DNA abundance and structure, such as POLG, TK2, and MPV17. Barth syndrome, an X-linked recessive mitochondrial myopathy/cardiopathy, is associated with decreased amount and altered structure of cardiolipin, the main phospholipid of the inner mitochondrial membrane, but a secondary impairment of respiratory chain function is plausible. The role of mutations in protein-coding genes of mitochondrial DNA in causing isolated myopathies has been confirmed. Mutations in tRNA genes of mitochondrial DNA can also cause predominantly myopathic syndromes and--contrary to conventional wisdom--these mutations can be homoplasmic. Defects in the mitochondrial respiratory chain impair energy production and almost invariably involve skeletal muscle, causing exercise intolerance, cramps, recurrent myoglobinuria, or fixed weakness, which often affects extraocular muscles and results in droopy eyelids (ptosis) and progressive external ophthalmoplegia.

  6. Applying hospital evidence to paramedicine: issues of indirectness, validity and knowledge translation.

    Science.gov (United States)

    Bigham, Blair; Welsford, Michelle

    2015-05-01

    The practice of emergency medicine (EM) has been intertwined with emergency medical services (EMS) for more than 40 years. In this commentary, we explore the practice of translating hospital based evidence into the prehospital setting. We will challenge both EMS and EM dogma-bringing hospital care to patients in the field is not always better. In providing examples of therapies championed in hospitals that have failed to translate into the field, we will discuss the unique prehospital environment, and why evidence from the hospital setting cannot necessarily be translated to the prehospital field. Paramedicine is maturing so that the capability now exists to conduct practice-specific research that can inform best practices. Before translation from the hospital environment is implemented, evidence must be evaluated by people with expertise in three domains: critical appraisal, EM, and EMS. Scientific evidence should be assessed for: quality and bias; directness, generalizability, and validity to the EMS population; effect size and anticipated benefit from prehospital application; feasibility (including economic evaluation, human resource availability in the mobile environment); and patient and provider safety.

  7. Inherited myopathies and muscular dystrophies

    NARCIS (Netherlands)

    Cardamone, Michael; Darras, Basil T.; Ryan, Monique M.

    The inherited myopathies and muscular dystrophies are a diverse group of muscle diseases presenting with common complaints and physical signs: weakness, motor delay, and respiratory and bulbar dysfunction. The myopathies are caused by genetic defects in the contractile apparatus of muscle, and

  8. Lipid myopathy associated with renal tubular acidosis and spastic diplegia in two brothers.

    Science.gov (United States)

    Tung, Y C; Tsau, Y K; Chu, L W; Young, C; Shen, Y Z

    2001-07-01

    Lipid myopathy is a group of disorders involving mitochondrial fatty acid oxidation. We describe two brothers, 3 years 8 months old and 2 years 9 months old, respectively, with progressive spastic diplegia, developmental delay, failure to thrive, and chronic metabolic acidosis who had lipid myopathy and renal tubular acidosis. Brain magnetic resonance imaging revealed demyelinating changes in the periventricular white matter, which was compatible with spastic diplegia. These symptoms may be related to errors in fatty acid metabolism. Cerebral palsy had been misdiagnosed in both of these patients at another hospital. Therefore, for patients with late-onset and progressive spastic diplegia, detailed investigations for underlying diseases are warranted.

  9. Myopathy

    Science.gov (United States)

    ... alternating episodes of twitching and stiffness; and stiff-man syndrome: characterized by episodes of rigidity and reflex spasms common muscle cramps and stiffness, and tetany: characterized by prolonged spasms of the arms and legs × Definition The myopathies are neuromuscular disorders in which the ...

  10. Adult-onset nemaline myopathy presenting as respiratory failure.

    LENUS (Irish Health Repository)

    Kelly, Emer

    2008-11-01

    Nemaline myopathy is a rare congenital myopathy that generally presents in childhood. We report a case of a 44-year-old man who presented with severe hypoxic hypercapnic respiratory failure as the initial manifestation of nemaline myopathy. After starting noninvasive ventilation, his pulmonary function test results improved substantially, and over the 4 years since diagnosis his respiratory function remained stable. There are few reported cases of respiratory failure in patients with adult-onset nemaline myopathy, and the insidious onset in this case is even more unusual. This case highlights the varied presenting features of adult-onset nemaline myopathy and that noninvasive ventilation improves respiratory function.

  11. Amyloid myopathy: a diagnostic challenge

    Directory of Open Access Journals (Sweden)

    Heli Tuomaala

    2009-08-01

    Full Text Available Amyloid myopathy (AM is a rare manifestation of primary systemic amyloidosis (AL. Like inflammatory myopathies, it presents with proximal muscle weakness and an increased creatine kinase level. We describe a case of AL with severe, rapidly progressive myopathy as the initial symptom. The clinical manifestation and muscle biopsy were suggestive of inclusion body myositis. AM was not suspected until amyloidosis was seen in the gastric mucosal biopsy. The muscle biopsy was then re-examined more specifically, and Congo red staining eventually showed vascular and interstitial amyloid accumulation, which led to a diagnosis of AM. The present case illustrates the fact that the clinical picture of AM can mimic that of inclusion body myositis.

  12. Bethlem myopathy: An autosomal dominant myopathy with flexion contractures, keloids, and follicular hyperkeratosis.

    Science.gov (United States)

    Saroja, Aralikatte Onkarappa; Naik, Karkal Ravishankar; Nalini, Atcharayam; Gayathri, Narayanappa

    2013-10-01

    Bethlem myopathy and Ullrich congenital muscular dystrophy form a spectrum of collagenopathies caused by genetic mutations encoding for any of the three subunits of collagen VI. Bethlem phenotype is relatively benign and is characterized by proximal dominant myopathy, keloids, contractures, distal hyperextensibility, and follicular hyperkeratosis. Three patients from a single family were diagnosed to have Bethlem myopathy based on European Neuromuscular Centre Bethlem Consortium criteria. Affected father and his both sons had slowly progressive proximal dominant weakness and recurrent falls from the first decade. Both children aged 18 and 20 years were ambulant at presentation. All had flexion contractures, keloids, and follicular hyperkeratosis without muscle hypertrophy. Creatinine kinase was mildly elevated and electromyography revealed myopathic features. Muscle imaging revealed severe involvement of glutei and vasti with "central shadow" in rectus femoris. Muscle biopsy in the father showed dystrophic changes with normal immmunostaining for collagen VI, sarcoglycans, and dysferlin.

  13. Bethlem myopathy: An autosomal dominant myopathy with flexion contractures, keloids, and follicular hyperkeratosis

    Directory of Open Access Journals (Sweden)

    Aralikatte Onkarappa Saroja

    2013-01-01

    Full Text Available Bethlem myopathy and Ullrich congenital muscular dystrophy form a spectrum of collagenopathies caused by genetic mutations encoding for any of the three subunits of collagen VI. Bethlem phenotype is relatively benign and is characterized by proximal dominant myopathy, keloids, contractures, distal hyperextensibility, and follicular hyperkeratosis. Three patients from a single family were diagnosed to have Bethlem myopathy based on European Neuromuscular Centre Bethlem Consortium criteria. Affected father and his both sons had slowly progressive proximal dominant weakness and recurrent falls from the first decade. Both children aged 18 and 20 years were ambulant at presentation. All had flexion contractures, keloids, and follicular hyperkeratosis without muscle hypertrophy. Creatinine kinase was mildly elevated and electromyography revealed myopathic features. Muscle imaging revealed severe involvement of glutei and vasti with "central shadow" in rectus femoris. Muscle biopsy in the father showed dystrophic changes with normal immmunostaining for collagen VI, sarcoglycans, and dysferlin.

  14. Myopathies of endocrine disorders: A prospective clinical and biochemical study

    Directory of Open Access Journals (Sweden)

    Vikas Sharma

    2014-01-01

    Full Text Available Introduction: Major categories of endocrine myopathy include those associated with: Adrenal dysfunction (as in Cushing′s disease or steroid myopathy; thyroid dysfunction (as in myxedema coma or thyrotoxic myopathy; vitamin D deficiency; parathyroid dysfunction; and pituitary dysfunction. Steroid myopathy is the most common endocrine myopathy. Objective: To study the etiology, varied presentations, and outcome after therapy of patients with endocrine myopathies. Materials and Methods: Myopathy was evaluated by the standard clinical procedures: Detailed clinical history, manual muscle strength testing, and creatine phosphokinase (CPK. Endocrine disorders were diagnosed as per clinical features and biochemical parameters. The treatment was given to patients as per underlying endocrine disease. Myopathy was assessed before and after treatment. Results: Out of the 37 patients who were diagnosed with endocrine myopathies, thyroid dysfunction was the most common cause (17 cases, followed by vitamin D deficiency in nine, adrenal dysfunction in six, parathyroid dysfunction in three, and pituitary dysfunction in two. Some patients had atypical presentation (repeated falls in one, tongue fasciculations in one, neck weakness in five, one with ptosis and facial weakness, asymmetrical onset in one, and calf hypertrophy in one. The serum creatine kinase (CK concentration did not correlate with muscle weakness. Following the treatment regimen which was specific for a given myopathy, 26 patients recovered fully. Conclusion: We found varied clinical presentations of endocrine myopathies. All the patients with neuromuscular complaints should be investigated for endocrine causes because significant number of them recovers fully with specific treatment.

  15. Systemic calciphylaxis presenting as a painful, proximal myopathy.

    OpenAIRE

    Edelstein, C. L.; Wickham, M. K.; Kirby, P. A.

    1992-01-01

    A renal transplant patient who presented with a painful, proximal myopathy due to systemic calciphylaxis is described. The myopathy preceded the characteristic skin and soft tissue necrosis. Systemic calciphylaxis should be considered in a dialysis or a renal transplant patient presenting with a painful proximal myopathy even in the absence of necrotic skin lesions.

  16. Idiopathic Inflammatory Myopathies: An update

    Directory of Open Access Journals (Sweden)

    Bulent KURT

    2016-06-01

    Full Text Available Idiopathic inflammatory myopathies (IIM are a heterogeneous group of disease with complex clinical features. It has been sub-classified as: (1 Dermatomyositis, (2 Polymyositis, and (3 Inclusion body myositis (IBM. Nowadays, there are some studies in literature suggest necrotizing autoimmune myopathy and immune-mediated necrotizing myopathy should also be added to this group of disease. There is a debate in the diagnosis of IIMs and up until now, about 12 criteria systems have been proposed. Some of the criteria systems have been used widely such as Griggs et al.'s proposal for IBM. Clinical findings, autoantibodies, enzymes, electrophysiological, and muscle biopsy findings are diagnostic tools. Because of diseases' complexity, none of the findings are diagnostic alone. In this study, we discussed the diagnostic criteria of IMMs and described detailed morphological features. [J Interdiscipl Histopathol 2016; 4(2.000: 41-45

  17. Spectrum of metabolic myopathies.

    Science.gov (United States)

    Angelini, Corrado

    2015-04-01

    Metabolic myopathies are disorders of utilization of carbohydrates or fat in muscles. The acute nature of energy failure is manifested either by a metabolic crisis with weakness, sometimes associated with respiratory failure, or by myoglobinuria. A typical disorder where permanent weakness occurs is glycogenosis type II (GSDII or Pompe disease) both in infantile and late-onset forms, where respiratory insufficiency is manifested by a large number of cases. In GSDII the pathogenetic mechanism is still poorly understood, and has to be attributed more to structural muscle alterations, possibly in correlation to macro-autophagy, rather than to energetic failure. This review is focused on recent advances about GSDII and its treatment, and the most recent notions about the management and treatment of other metabolic myopathies will be briefly reviewed, including glycogenosis type V (McArdle disease), glycogenosis type III (debrancher enzyme deficiency or Cori disease), CPT-II deficiency, and ETF-dehydrogenase deficiency (also known as riboflavin-responsive multiple acyl-CoA dehydrogenase deficiency or RR-MADD). The discovery of the genetic defect in ETF dehydrogenase confirms the etiology of this syndrome. Other metabolic myopathies with massive lipid storage and weakness are carnitine deficiency, neutral lipid storage-myopathy (NLSD-M), besides RR-MADD. Enzyme replacement therapy is presented with critical consideration and for each of the lipid storage disorders, representative cases and their response to therapy is included. This article is part of a Special Issue entitled: Neuromuscular Diseases: Pathology and Molecular Pathogenesis. Copyright © 2014. Published by Elsevier B.V.

  18. Mitochondrial myopathy presenting as fibromyalgia: a case report

    Directory of Open Access Journals (Sweden)

    Abdullah Mishal

    2012-02-01

    Full Text Available Abstract Introduction To the best of our knowledge, we describe for the first time the case of a woman who met the diagnostic criteria for fibromyalgia, did not respond to therapy for that disorder, and was subsequently diagnosed by biochemical and genetic studies with a mitochondrial myopathy. Treatment of the mitochondrial myopathy resulted in resolution of symptoms. This case demonstrates that mitochondrial myopathy may present in an adult with a symptom complex consistent with fibromyalgia. Case presentation Our patient was a 41-year-old Caucasian woman with symptoms of fatigue, exercise intolerance, headache, and multiple trigger points. Treatment for fibromyalgia with a wide spectrum of medications including non-steroidal anti-inflammatory drugs, antidepressants, gabapentin and pregabalin had no impact on her symptoms. A six-minute walk study demonstrated an elevated lactic acid level (5 mmol/L; normal Conclusions This case demonstrates that adults diagnosed with fibromyalgia may have their symptom complex related to an adult onset mitochondrial myopathy. This is an important finding since treatment of mitochondrial myopathy resulted in resolution of symptoms.

  19. Statin-associated immune-mediated myopathy: biology and clinical implications.

    Science.gov (United States)

    Christopher-Stine, Lisa; Basharat, Pari

    2017-04-01

    In the last 6 years, our understanding of statin-associated myopathy expanded to include not only a toxic myopathy with limited and reversible side-effects but also an autoimmune variety in which statins likely induce an autoimmune myopathy that is both associated with a specific autoantibody and responsive to immunosuppression and immune modulation. This review widens the reader's understanding of statin myopathy to include an autoimmune process. Statin-associated immune-mediated myopathy provides an example of an environmental trigger (statins) directly implicated in an autoimmune disease associated with a genetic predisposition as well as potential risk factors including concomitant diseases and specific statins. Given a median exposure to statins of 38 months, providers should be aware that anti-3-hydroxy-3-methyl-glutaryl-coenzyme A reductase (HMGCR) myopathy may occur even after several years of statin exposure. It is important for the reader to understand the clinical presentation of statin-associated immune-mediated myopathy and the difference in its clinical presentation to that of statins as direct myotoxins. Prompt recognition of such an entity allows the clinician to immediately stop the offending agent if it has not already been discontinued as well as to recognize that statin rechallenge is not a likely option, and that prompt treatment with immunosuppression and/or immunomodulation is usually of enormous benefit to the patient in restoring muscle strength and physical function. VIDEO ABSTRACT.

  20. Mitochondrial Myopathy: A Rare Cause of Early-Onset Vocal Fold Atrophy

    Science.gov (United States)

    Kelly, Elizabeth A.; Bock, Jonathan M.; Peltier, Amanda C.; Oh, Shin J.; Garrett, C. Gaelyn

    2014-01-01

    Objectives We present the second published case of laryngeal involvement in mitochondrial myopathy. Methods A patient with laryngeal involvement of mitochondrial myopathy is presented, together with a literature review. Results A 41-year-old man presented with progressive breathy dysphonia. His brother had mitochondrial myopathy. Biopsy of the biceps muscle demonstrated cytochrome C oxidase–negative ragged blue fibers confirming mitochondrial myopathy. Videostroboscopy showed marked vocal fold atrophy, but subsequent injection laryngoplasty did not significantly improve the patient’s voice, despite improved postoperative glottic closure. Conclusions Mitochondrial myopathy should be considered in the differential diagnosis of severe early-onset vocal fold atrophy. PMID:23577570

  1. An integrated diagnosis strategy for congenital myopathies.

    Directory of Open Access Journals (Sweden)

    Johann Böhm

    Full Text Available Congenital myopathies are severe muscle disorders affecting adults as well as children in all populations. The diagnosis of congenital myopathies is constrained by strong clinical and genetic heterogeneity. Moreover, the majority of patients present with unspecific histological features, precluding purposive molecular diagnosis and demonstrating the need for an alternative and more efficient diagnostic approach. We used exome sequencing complemented by histological and ultrastructural analysis of muscle biopsies to identify the causative mutations in eight patients with clinically different skeletal muscle pathologies, ranging from a fatal neonatal myopathy to a mild and slowly progressive myopathy with adult onset. We identified RYR1 (ryanodine receptor mutations in six patients and NEB (nebulin mutations in two patients. We found novel missense and nonsense mutations, unraveled small insertions/deletions and confirmed their impact on splicing and mRNA/protein stability. Histological and ultrastructural findings of the muscle biopsies of the patients validated the exome sequencing results. We provide the evidence that an integrated strategy combining exome sequencing with clinical and histopathological investigations overcomes the limitations of the individual approaches to allow a fast and efficient diagnosis, accelerating the patient's access to a better healthcare and disease management. This is of particular interest for the diagnosis of congenital myopathies, which involve very large genes like RYR1 and NEB as well as genetic and phenotypic heterogeneity.

  2. Acute steroid myopathy: a highly overlooked entity.

    Science.gov (United States)

    Haran, Michal; Schattner, Ami; Kozak, Natasha; Mate, Andras; Berrebi, Alain; Shvidel, Lev

    2018-02-15

    Myopathy in patients being treated with corticosteroids is known primarily among chronically-treated patients or in critically ill and mechanically-ventilated patients receiving corticosteroids, often in high doses. To highlight the entity of acute, early-onset corticosteroid-treatment-associated myopathy and its characteristics. Reporting our experience with four patients and reviewing all published reports of myopathy developing ≤14 days of initiating corticosteroid-treatment. Acute corticosteroid myopathy (ASM) exists, though the syndrome appears to be rare. It is characterized by unpredictability and heterogeneity, sometimes developing within 1-3 days, after a single dose, which may not be high and administered by varied routes. Proximal limb muscle weakness is the most common form, but distal limb, bulbar and respiratory muscles may be involved. Steroid cessation often leads to improvement/resolution, but irreversibility may occur. A high index of suspicion for the possibility of ASM is necessary, to ensure drug discontinuation and recovery. This is particularly true since the entity is not widely recognized and its symptoms are often erroneously interpreted as due to the patient's underlying disease.

  3. Statin Induced Myopathy a Patient with Multiple Systemic Diseases

    Directory of Open Access Journals (Sweden)

    Özgül Uçar

    2011-04-01

    Full Text Available Hydroxymethylglutaryl-coenzyme A reductase inhibitors (statins are the most successful class of drugs for the treatment of hypercholesterolaemia and dyslipidaemia. However, the popular profile of statins in terms of efficacy has been maligned by theiradverse effects. Statin induced myopathy, which can be seen at any time during the course of therapy, is a clinically important cause of statin intolerance and discontinuation. When a patient with multiple systemic diseases who use numerous medications represent with myalgia and muscle cramps, statin induced myopathy may not be remembered at first. We present a patient with multiple systemic diseases, alcohol and morphine abuse in whom myopathy developed. After exclusion of other etiologies, we concluded that myopathy was related to statin therapy.

  4. [Rhabdomyolysis - may it be a metabolic myopathy? Case report and diagnostic algorithm].

    Science.gov (United States)

    Sebők, Ágnes; Pál, Endre; Molnár, Gergő Attila; Wittmann, István; Berenténé Bene, Judit; Melegh, Béla; Komoly, Sámuel; Hidvégi, Tibor; Balogh, Lídia; Szabó, Attila; Zsidegh, Petra

    2017-11-01

    We report the case of a 46-year-old female patient with recurrent rhabdomyolysis. In the background of her metabolic myopathy an inherited metabolic disorder of the fatty acid oxidation, very long-chain acyl-coenzyme A-dehydrogenase deficiency was diagnosed. The diagnosis was based on abnormal acyl-carnitine- and urine organic-acid profile in addition to low residual enzyme activity, and was confirmed by genetic testing. After introduction of dietotherapy metabolic crisis necessitating hospital admission has not occurred neither have fixed myopathic changes developed. We present here the differential diagnosis of rhabdomyolysis and exertional muscle complaints, with the metabolic myopathies in focus. The main features of fatty acid oxidation disorders are highlighted, acute and chronic managements of very long-chain acyl-coenzyme A-dehydrogenase deficiency are discussed. Metabolic myopathies respond well to treatment, so good quality of life can be achieved. However, especially in fatty acid oxidation disorders, a metabolic crisis may develop quickly and can be fatal, albeit rarely. Some of these disorders can be identified by newborn screening, but occasionally the symptoms may manifest only in adulthood. With the presentation of this case we would like to point out that in the differential diagnosis of recurrent rhabdomyolysis inherited metabolic disorders should be considered regardless of the patient's age. Orv Hetil. 2017; 158(46): 1873-1882.

  5. Genuine myotubular myopathy

    International Nuclear Information System (INIS)

    Edstroem, L.; Wroblewski, R.; Mair, W.G.

    1982-01-01

    Two patients, a father and his 14-year-old son, were suffering from a facioperoneal syndrome, and muscle biopsy findings were consistent with a myotubular myopathy. The father exhibited central nuclei in most muscle fibers, but his son had typical changes exclusively in hypotrophic type I fibers. The cytochemical and ultrastructural analysis revealed a spectrum of pathological changes typical of myotubular myopathy. Energy-dispersive electron probe x-ray microanalysis was performed on 6- to 12-microns thick freeze-dried cryosections visualized in the scanning or scanning transmission mode of electron microscopy. We found a high intracellular sodium and chlorine concentration and a low potassium concentration in comparison with control muscles. These changes pointed in the direction similar to results from human fetal muscle. The changes in the intracellular elemental composition may indicate a membrane pump dysfunction, which might be caused by a partial arrest in muscle fiber maturation

  6. Is Vitamin D Deficiency a Confounder in Alcoholic Skeletal Muscle Myopathy?

    NARCIS (Netherlands)

    Wijnia, J.W.; Wielders, J.P.M.; Lips, P.T.A.M.; van der Wiel, A.; Mulder, C.L.; Nieuwenhuis, K.G.A.

    2013-01-01

    Background: Excessive intake of alcohol is often associated with low or subnormal levels of vitamin D even in the absence of active liver disease. As vitamin D deficiency is a well-recognized cause of myopathy, alcoholic myopathy might be related to vitamin D deficiency. Chronic alcoholic myopathy

  7. Immune-mediated statin myopathy.

    Science.gov (United States)

    Loganathan, Priyadarshini; Oddis, Chester V; Aggarwal, Rohit

    2016-01-01

    Statin-induced necrotizing autoimmune myopathy (SINAM) is associated with a unique clinical 5 phenotype of severe proximal muscle weakness during or after exposure to statins in patients with high creatine kinase (CK) levels. Electromyography (EMG) and muscle biopsy reveal features of a necrotizing myopathy and the anti-HMGCR autoantibody is frequently detected. Treatment requires a combination of statin discontinuation as well as immunomodulatory or immunosuppressive therapy. HLA typing (HLADRB1*1101) is strongly associated with anti-10 HMGCR autoantibody positivity in statin-exposed patients. It is well documented that statin triggers autoimmune disease in those with a genetic susceptibility. With the commercial availability of an accurate ELISA test, the natural history of the disease and its phenotypic features are becoming increasingly understood.

  8. Bethlem myopathy is not allelic to limb-girdle muscular dystrophy type 1A

    Energy Technology Data Exchange (ETDEWEB)

    Speer, M.C.; Yamaoka, L.H.; Stajich, J.; Lewis, K. [and others

    1995-08-28

    The Bethlem myopathy, an autosomal-dominant myopathy, shows a distribution of proximal muscle weakness similar to that observed in dominant limb-girdle muscular dystrophy (LGMD). Yet the Bethlem myopathy differs from most limb-girdle dystrophies in two important regards. First, the Bethlem myopathy presents with joint contractures most commonly observed at the elbows, ankles, and neck. Secondly, disease onset in the Bethlem myopathy is in early childhood, while most dominant LGMDs present with adult onset. 6 refs., 1 fig.

  9. Evidence for marsh mallow (Malva parviflora) toxicosis causing myocardial disease and myopathy in four horses.

    Science.gov (United States)

    Bauquier, J; Stent, A; Gibney, J; Jerrett, I; White, J; Tennent-Brown, B; Pearce, A; Pitt, J

    2017-05-01

    Investigation of toxicosis caused by Malva parviflora was required after 4 horses from the same farm developed severe muscle fasciculations, tachycardia, sweating and periods of recumbency leading to death or euthanasia after ingesting the plant. To describe historical, clinical, clinicopathological and pathological findings of 4 horses with suspected M. parviflora toxicosis. The role of cyclopropene fatty acids (found in M. parviflora) and mechanism for toxicosis are proposed. Case series. Historical, physical examination, clinicopathological and pathological findings are reported. Due to similarities with atypical myopathy or seasonal pasture myopathy acyl carnitine profiles were performed on sera from 2 cases and equine controls. Presence of cyclopropene fatty acids was also examined in sera of 2 cases. M. parviflora had been heavily grazed by the horses with little other feed available. Horse 1 deteriorated rapidly and was subjected to euthanasia. Horse 2 was referred to hospital where severe myocardial disease and generalised myopathy was determined; this horse was subjected to euthanasia 36 h after admission. Horse 3 died rapidly and Horse 4 was subjected to euthanasia at onset of clinical signs. Post-mortem examinations performed on 3 horses revealed acute, multifocal cardiac and skeletal myonecrosis. Myocyte glycogen accumulation was absent when examined in Horse 2. Acyl carnitine profiles revealed increased C14-C18 acyl carnitine concentrations in cases relative to controls. Cyclopropene fatty acids were detected in sera of cases but not controls. These findings suggest aetiology different to that of atypical myopathy or seasonal pasture myopathy. We hypothesise that cyclopropene fatty acids in M. parviflora interfere with fatty acid β-oxidation in horses in negative energy balance, causing the clinical signs and abnormal acyl carnitine profiles. These equine cases suggest a pathophysiological course that closely mimics the human genetic condition very

  10. Association between statin-associated myopathy and skeletal muscle damage.

    Science.gov (United States)

    Mohaupt, Markus G; Karas, Richard H; Babiychuk, Eduard B; Sanchez-Freire, Verónica; Monastyrskaya, Katia; Iyer, Lakshmanan; Hoppeler, Hans; Breil, Fabio; Draeger, Annette

    2009-07-07

    Many patients taking statins often complain of muscle pain and weakness. The extent to which muscle pain reflects muscle injury is unknown. We obtained biopsy samples from the vastus lateralis muscle of 83 patients. Of the 44 patients with clinically diagnosed statin-associated myopathy, 29 were currently taking a statin, and 15 had discontinued statin therapy before the biopsy (minimal duration of discontinuation 3 weeks). We also included 19 patients who were taking statins and had no myopathy, and 20 patients who had never taken statins and had no myopathy. We classified the muscles as injured if 2% or more of the muscle fibres in a biopsy sample showed damage. Using reverse transcriptase polymerase chain reaction, we evaluated the expression levels of candidate genes potentially related to myocyte injury. Muscle injury was observed in 25 (of 44) patients with myopathy and in 1 patient without myopathy. Only 1 patient with structural injury had a circulating level of creatine phosphokinase that was elevated more than 1950 U/L (10x the upper limit of normal). Expression of ryanodine receptor 3 was significantly upregulated in patients with biopsy evidence of structural damage (1.7, standard error of the mean 0.3). Persistent myopathy in patients taking statins reflects structural muscle damage. A lack of elevated levels of circulating creatine phosphokinase does not rule out structural muscle injury. Upregulation of the expression of ryanodine receptor 3 is suggestive of an intracellular calcium leak.

  11. Meeting the challenges in the diagnosis of inflammatory myopathies ...

    African Journals Online (AJOL)

    Conditions that mimic IM include other causes of myopathy such as endocrine disorders, adverse effects of medication, metabolic myopathies and muscle dystrophies. Atypical features suggesting an alternative diagnosis are acute onset, severe pain, assymmetrical involvement, distal weakness and wasting. Appropriate ...

  12. Atypical presentation of GNE myopathy with asymmetric hand weakness

    Science.gov (United States)

    de Dios, John Karl L.; Shrader, Joseph A.; Joe, Galen O.; McClean, Jeffrey C.; Williams, Kayla; Evers, Robert; Malicdan, May Christine V.; Ciccone, Carla; Mankodi, Ami; Huizing, Marjan; McKew, John C.; Bluemke, David A.; Gahl, William A.; Carrillo-Carrasco, Nuria

    2014-01-01

    GNE myopathy is a rare autosomal recessive muscle disease caused by mutations in GNE, the gene encoding the rate-limiting enzyme in sialic acid biosynthesis. GNE myopathy usually manifests in early adulthood with distal myopathy that progresses slowly and symmetrically, first involving distal muscles of the lower extremities, followed by proximal muscles with relative sparing of the quadriceps. Upper extremities are typically affected later in the disease. We report a patient with GNE myopathy who presented with asymmetric hand weakness. He had considerably decreased left grip strength, atrophy of the left anterior forearm and fibro-fatty tissue replacement of left forearm flexor muscles on T1-weighted magnetic resonance imaging. The patient was an endoscopist and thus the asymmetric hand involvement may be associated with left hand overuse in daily repetitive pinching and gripping movements, highlighting the possible impact of environmental factors on the progression of genetic muscle conditions. PMID:25182749

  13. Congenital myopathy is caused by mutation of HACD1.

    Science.gov (United States)

    Muhammad, Emad; Reish, Orit; Ohno, Yusuke; Scheetz, Todd; Deluca, Adam; Searby, Charles; Regev, Miriam; Benyamini, Lilach; Fellig, Yakov; Kihara, Akio; Sheffield, Val C; Parvari, Ruti

    2013-12-20

    Congenital myopathies are heterogeneous inherited diseases of muscle characterized by a range of distinctive histologic abnormalities. We have studied a consanguineous family with congenital myopathy. Genome-wide linkage analysis and whole-exome sequencing identified a homozygous non-sense mutation in 3-hydroxyacyl-CoA dehydratase 1 (HACD1) in affected individuals. The mutation results in non-sense mediated decay of the HACD1 mRNA to 31% of control levels in patient muscle and completely abrogates the enzymatic activity of dehydration of 3-hydroxyacyl-CoA, the third step in the elongation of very long-chain fatty acids (VLCFAs). We describe clinical findings correlated with a deleterious mutation in a gene not previously known to be associated with congenital myopathy in humans. We suggest that the mutation in the HACD1 gene causes a reduction in the synthesis of VLCFAs, which are components of membrane lipids and participants in physiological processes, leading to congenital myopathy. These data indicate that HACD1 is necessary for muscle function.

  14. Lost in translation: a case-study of the travel of lean thinking in a hospital.

    Science.gov (United States)

    Andersen, Hege; Røvik, Kjell Arne

    2015-09-21

    Lean thinking as a quality improvement approach is introduced in hospitals worldwide, although evidence for its impact is scarce. Lean initiatives are social, complex and context-dependent. This calls for a shift from cause-effect to conditional attributions to understand how lean works. In this study, we bring attention to the transformative power of local translation, which creates different versions of lean in different contexts, and thereby affect the evidence for lean as well as the success of lean initiatives within and among hospitals. We explored the travel of lean within a hospital in Norway by identifying local actors' perceptions of lean through their images of enablers for successful interventions. These attributions describe the characteristics of lean in use, i.e. the prevailing version of lean. Local actors' perceptions of enablers for lean interventions were collected through focus group interviews with three groups of stakeholders: managers, internal consultants and staff. A questionnaire was used to reveal the enablers relative importance. The enablers known from the literature were retrieved at the case hospital. The only exception was that external expert change agents were not believed to promote lean. In addition, the stakeholders added a number of new and supplementary enablers. Two-thirds of the most important enablers for success were novel, local ones. Among these were a problem, not method focus, a bottom-up approach, the need of internal consultants, credibility, realism and patience. The local actors told different stories about local enablers and had different images of lean depending on their hierarchical level. By comparing and analyzing the findings from the literature review, the focus groups and the survey, we deduced that the travel of lean within the hospital was affected by three principles of translation: the practical, the pragmatic, and the sceptical. Further, three logics of translation were in play: translation as a funnel

  15. Autosomal dominant distal myopathy: Linkage to chromosome 14

    Energy Technology Data Exchange (ETDEWEB)

    Laing, N.G.; Laing, B.A.; Wilton, S.D.; Dorosz, S.; Mastaglia, F.L.; Kakulas, B.A. [Australian Neuromuscular Research Institute, Perth (Australia); Robbins, P.; Meredith, C.; Honeyman, K.; Kozman, H.

    1995-02-01

    We have studied a family segregating a form of autosomal dominant distal myopathy (MIM 160500) and containing nine living affected individuals. The myopathy in this family is closest in clinical phenotype to that first described by Gowers in 1902. A search for linkage was conducted using microsatellite, VNTR, and RFLP markers. In total, 92 markers on all 22 autosomes were run. Positive linkage was obtained with 14 of 15 markers tested on chromosome 14, with little indication of linkage elsewhere in the genome. Maximum two-point LOD scores of 2.60 at recombination fraction .00 were obtained for the markers MYH7 and D14S64 - the family structure precludes a two-point LOD score {ge} 3. Recombinations with D14S72 and D14S49 indicate that this distal myopathy locus, MPD1, should lie between these markers. A multipoint analysis assuming 100% penetrance and using the markers D14S72, D14S50, MYH7, D14S64, D14S54, and D14S49 gave a LOD score of exactly 3 at MYH7. Analysis at a penetrance of 80% gave a LOD score of 2.8 at this marker. This probable localization of a gene for distal myopathy, MPD1, on chromosome 14 should allow other investigators studying distal myopathy families to test this region for linkage in other types of the disease, to confirm linkage or to demonstrate the likely genetic heterogeneity. 24 refs., 3 figs., 1 tab.

  16. [The Contribution of GMP-grade Hospital Preparation to Translational Research].

    Science.gov (United States)

    Yonezawa, Atsushi; Kajiwara, Moto; Minami, Ikuko; Omura, Tomohiro; Nakagawa, Shunsaku; Matsubara, Kazuo

    2015-01-01

    Translational research is important for applying the outcomes of basic research studies to practical medical treatments. In exploratory early-phase clinical trials for an innovative therapy, researchers should generally manufacture investigational agents by themselves. To provide investigational agents with safety and high quality in clinical studies, appropriate production management and quality control are essential. In the Department of Pharmacy of Kyoto University Hospital, a manufacturing facility for sterile drugs was established, independent of existing manufacturing facilities. Manuals on production management and quality control were developed according to Good Manufacturing Practices (GMP) for Investigational New Drugs (INDs). Advanced clinical research has been carried out using investigational agents manufactured in our facility. These achievements contribute to both the safety of patients and the reliability of clinical studies. In addition, we are able to do licensing-out of our technique for the manufacture of investigational drugs. In this symposium, we will introduce our GMP grade manufacturing facility for sterile drugs and discuss the role of GMP grade hospital preparation in translational research.

  17. The expanding phenotype of mitochondrial myopathy.

    Science.gov (United States)

    DiMauro, Salvatore; Gurgel-Giannetti, Juliana

    2005-10-01

    Our understanding of mitochondrial diseases (defined restrictively as defects in the mitochondrial respiratory chain) continues to progress apace. In this review we provide an update of information regarding disorders that predominantly or exclusively affect skeletal muscle. Most recently described mitochondrial myopathies are due to defects in nuclear DNA, including coenzyme Q10 deficiency, and mutations in genes that control mitochondrial DNA (mtDNA) abundance and structure such as POLG and TK2. Barth syndrome, an X-linked recessive mitochondrial myopathy/cardiopathy, is associated with altered lipid composition of the inner mitochondrial membrane, but a putative secondary impairment of the respiratory chain remains to be documented. Concerning the 'other genome', the role played by mutations in protein encoding genes of mtDNA in causing isolated myopathies has been confirmed. It has also been confirmed that mutations in tRNA genes of mtDNA can cause predominantly myopathic syndromes and - contrary to conventional wisdom - these mutations can be homoplasmic. Defects in the mitochondrial respiratory chain impair energy production and almost invariably involve skeletal muscle, causing exercise intolerance, myalgia, cramps, or fixed weakness, which often affects extraocular muscles and results in droopy eyelids (ptosis) and progressive external ophthalmoplegia.

  18. Refractory Hyperlactatemia with Organ Insufficiency in Lipid Storage Myopathy.

    Science.gov (United States)

    Xu, Yuanda; Zhou, Li; Liang, Weibo; He, Weiqun; Liu, Xiaoqing; Liang, Xiuling; Zhong, Nanshan; Li, Yimin

    2015-08-01

    Lipid storage myopathy is a metabolic disorder characterized by abnormal lipid accumulation in muscle fibers and progressive muscle weakness. Here, we report the case of a 17-year-old woman with progressive muscle weakness, refractory hyperlactatemia, and multiple organ insufficiency. Severe pneumonia was the initial diagnosis. After anti-infective treatment, fluid resuscitation, and mechanical ventilation, the patient's symptoms improved but hyperlactatemia and muscle weakness persisted. She was empirically treated with carnitine. Biochemical tests, electromyography, and muscle biopsy confirmed lipid storage myopathy. After 7 weeks of treatment, the patient resumed normal daily life. An empirical treatment with carnitine may be beneficial for patients before an accurate diagnosis of lipid storage myopathy is made.

  19. A Case Report of Inflammatory Myopathy and Sideroblastic Anemia

    Directory of Open Access Journals (Sweden)

    F Binesh

    2007-01-01

    Full Text Available Mitochondrial myopathy, lactic acidosis, and siderobastic anemia (MLA SA syndrome is one of the newly reported mitochondrial diseases, seven cases of which have been reported. We report a child with inflammatory myopathy, sideroblastic anemia and lactic acidosis .The patient is a 8.5 year old boy with normal cognitive function suffering from chronic progressive weakness in lower extremities, inability to walk since four months and pallor. In paraclinical evaluation, sideroblastic anemia, mild lactic acidosis and elevated muscle enzymes were seen. Inflammatory myopathy (myositis in muscle biopsy was detected as well .The patient was administered oral prednisolone, folic acid, B6 and underwent regular physiotherapy. He ambulated after four months and resumed education and schooling.

  20. Elevated risk of venous thromboembolic events in patients with inflammatory myopathies

    Directory of Open Access Journals (Sweden)

    Nowak M

    2016-06-01

    Full Text Available Michał Nowak, Katarzyna Królak-Nowak, Aleksandra Sobolewska-Włodarczyk, Jakub Fichna, Marcin Włodarczyk Department of Biochemistry, Faculty of Medicine, Medical University of Lodz, Lodz, Poland Abstract: Venous thromboembolism (VTE is a multifactorial disease manifesting as either deep vein thrombosis or pulmonary embolism. Its prevalence makes VTE a significant issue for both the individual – as a negative factor influencing the quality of life and prognosis – and the society due to economic burden. VTE is the third most common vascular disorder in Western countries, after myocardial infarction and stroke, making it a major cause of in-hospital mortality, responsible for 5%–10% of hospital deaths. Despite many studies conducted, only 50%–60% provoking factors have been identified, while the remaining 40%–50% have been classified as idiopathic or unprovoked. Chronic inflammatory disorders, with their underlying prothrombotic state, reveal an increased risk of VTE (six to eight times compared with the general population. Among the inflammatory disorders, we can identify inflammatory myopathies – a group of rare, chronic diseases featuring weakness and inflammation of muscles with periods of exacerbation and remission; their main classes are polymyositis and dermatomyositis. The objective of this review is to emphasize the need of VTE prophylaxis in individuals with inflammatory myopathies in order to reduce morbidity and mortality rates among those patients and improve their quality of life and prognosis. Keywords: deep vein thrombosis, pulmonary embolism, inflammation, polymyositis, dermatomyositis, prothrombotic state

  1. Mutation Spectrum of GNE Myopathy in the Indian Sub-Continent.

    Science.gov (United States)

    Bhattacharya, Sudha; Khadilkar, Satish V; Nalini, Atchayaram; Ganapathy, Aparna; Mannan, Ashraf U; Majumder, Partha P; Bhattacharya, Alok

    GNE myopathy is an adult onset recessive genetic disorder that affects distal muscles sparing the quadriceps. GNE gene mutations have been identified in GNE myopathy patients all over the world. Homozygosity is a common feature in GNE myopathy patients worldwide. The major objective of this study was to investigate the mutation spectrum of GNE myopathy in India in relation to the population diversity in the country. We have collated GNE mutation data of Indian GNE myopathy patients from published literature and from recently identified patients. We also used data of people of Indian subcontinent from 1000 genomes database, South Asian Genome database and Strand Life Science database to determine frequency of GNE mutations in the general population. A total of 67 GNE myopathy patients were studied, of whom 21% were homozygous for GNE variants, while the rest were compound heterozygous. Thirty-five different mutations in the GNE gene were recorded, of which 5 have not been reported earlier. The most frequent mutation was p.Val727Met (65%) found mainly in the heterozygous form. Another mutation, p.Ile618Thr was also common (16%) but was found mainly in patients from Rajasthan, while p.Val727Met was more widely distributed. The latter was also seen at a high frequency in general population of Indian subcontinent in all the databases. It was also present in Thailand but was absent in general population elsewhere in the world. p.Val727Met is likely to be a founder mutation of Indian subcontinent.

  2. Cerebrovascular Accidents In Myopathies

    Directory of Open Access Journals (Sweden)

    Farzad Fatehi

    2017-02-01

    Full Text Available Several types of stroke in myopathies are described: ischemic, metabolic, or cryptogenic. Ischemic stroke may be categorized as cardioembolic, angiopathic, hemodynamic, or thrombophilic. Cardiac involvement in the form of atrial fibrillation/flutter, dilated cardiomyopathy, or non-compaction Cardioembolic could ensue in stroke. Angiopathic stroke occurs provided that there is atherosclerosis or mitochondrial disorders. Thrombophilic stroke may happen in polymyositis or dermatomyositis along with anti-phospholipid syndrome. Metabolic stroke usually manifests as stroke-like episode and is a distinct feature of various mitochondrial disorders, principally MELAS syndrome. The clinical manifestations are as a result of a vasogenic edema, demonstrating as hyperintensity on T2, DWI, and apparent diffusion coefficient mapping. Differentiation between ischemic and metabolic stroke is essential in terms of diagnosis, therapy, and prognosis. In conclusion, ischemic stroke attributable to cardioembolism, arteriopathy, or thrombophilia are occasional events in myopathies, but metabolic stroke is a frequent feature of mitochondrial disorders.

  3. Genetics Home Reference: nemaline myopathy

    Science.gov (United States)

    ... deformities, abnormal curvature of the spine ( scoliosis ), and joint deformities (contractures). Most people with nemaline myopathy are ... Centre for Rare Diseases Washington University, St. Louis: Neuromuscular Disease Center Patient Support and Advocacy Resources (3 ...

  4. Myopathy With SQSTM1 and TIA1 Variants: Clinical and Pathological Features

    Directory of Open Access Journals (Sweden)

    Zhiyv Niu

    2018-03-01

    Full Text Available ObjectiveThe aim of this study is to identify the molecular defect of three unrelated individuals with late-onset predominant distal myopathy; to describe the spectrum of phenotype resulting from the contributing role of two variants in genes located on two different chromosomes; and to highlight the underappreciated complex forms of genetic myopathies.Patients and methodsClinical and laboratory data of three unrelated probands with predominantly distal weakness manifesting in the sixth-seventh decade of life, and available affected and unaffected family members were reviewed. Next-generation sequencing panel, whole exome sequencing, and targeted analyses of family members were performed to elucidate the genetic etiology of the myopathy.ResultsGenetic analyses detected two contributing variants located on different chromosomes in three unrelated probands: a heterozygous pathogenic mutation in SQSTM1 (c.1175C>T, p.Pro392Leu and a heterozygous variant in TIA1 (c.1070A>G, p.Asn357Ser. The affected fraternal twin of one proband also carries both variants, while the unaffected family members harbor one or none. Two unrelated probands (family 1, II.3, and family 3, II.1 have a distal myopathy with rimmed vacuoles that manifested with index extensor weakness; the other proband (family 2, I.1 has myofibrillar myopathy manifesting with hypercapnic respiratory insufficiency and distal weakness.ConclusionThe findings indicate that all the affected individuals have a myopathy associated with both variants in SQSTM1 and TIA1, respectively, suggesting that the two variants determine the phenotype and likely functionally interact. We speculate that the TIA1 variant is a modifier of the SQSTM1 mutation. We identify the combination of SQSTM1 and TIA1 variants as a novel genetic defect associated with myofibrillar myopathy and suggest to consider sequencing both genes in the molecular investigation of myopathy with rimmed vacuoles and myofibrillar myopathy

  5. Myopathy With SQSTM1 and TIA1 Variants: Clinical and Pathological Features.

    Science.gov (United States)

    Niu, Zhiyv; Pontifex, Carly Sabine; Berini, Sarah; Hamilton, Leslie E; Naddaf, Elie; Wieben, Eric; Aleff, Ross A; Martens, Kristina; Gruber, Angela; Engel, Andrew G; Pfeffer, Gerald; Milone, Margherita

    2018-01-01

    The aim of this study is to identify the molecular defect of three unrelated individuals with late-onset predominant distal myopathy; to describe the spectrum of phenotype resulting from the contributing role of two variants in genes located on two different chromosomes; and to highlight the underappreciated complex forms of genetic myopathies. Clinical and laboratory data of three unrelated probands with predominantly distal weakness manifesting in the sixth-seventh decade of life, and available affected and unaffected family members were reviewed. Next-generation sequencing panel, whole exome sequencing, and targeted analyses of family members were performed to elucidate the genetic etiology of the myopathy. Genetic analyses detected two contributing variants located on different chromosomes in three unrelated probands: a heterozygous pathogenic mutation in SQSTM1 (c.1175C>T, p.Pro392Leu) and a heterozygous variant in TIA1 (c.1070A>G, p.Asn357Ser). The affected fraternal twin of one proband also carries both variants, while the unaffected family members harbor one or none. Two unrelated probands (family 1, II.3, and family 3, II.1) have a distal myopathy with rimmed vacuoles that manifested with index extensor weakness; the other proband (family 2, I.1) has myofibrillar myopathy manifesting with hypercapnic respiratory insufficiency and distal weakness. The findings indicate that all the affected individuals have a myopathy associated with both variants in SQSTM1 and TIA1 , respectively, suggesting that the two variants determine the phenotype and likely functionally interact. We speculate that the TIA1 variant is a modifier of the SQSTM1 mutation. We identify the combination of SQSTM1 and TIA1 variants as a novel genetic defect associated with myofibrillar myopathy and suggest to consider sequencing both genes in the molecular investigation of myopathy with rimmed vacuoles and myofibrillar myopathy although additional studies are needed to investigate the

  6. The myositis autoantibody phenotypes of the juvenile idiopathic inflammatory myopathies.

    Science.gov (United States)

    Rider, Lisa G; Shah, Mona; Mamyrova, Gulnara; Huber, Adam M; Rice, Madeline Murguia; Targoff, Ira N; Miller, Frederick W

    2013-07-01

    The juvenile idiopathic inflammatory myopathies (JIIM) are systemic autoimmune diseases characterized by skeletal muscle weakness, characteristic rashes, and other systemic features. In follow-up to our study defining the major clinical subgroup phenotypes of JIIM, we compared demographics, clinical features, laboratory measures, and outcomes among myositis-specific autoantibody (MSA) subgroups, as well as with published data on adult idiopathic inflammatory myopathy patients enrolled in a separate natural history study. In the present study, of 430 patients enrolled in a nationwide registry study who had serum tested for myositis autoantibodies, 374 had either a single specific MSA (n = 253) or no identified MSA (n = 121) and were the subject of the present report. Following univariate analysis, we used random forest classification and exact logistic regression modeling to compare autoantibody subgroups. Anti-p155/140 autoantibodies were the most frequent subgroup, present in 32% of patients with juvenile dermatomyositis (JDM) or overlap myositis with JDM, followed by anti-MJ autoantibodies, which were seen in 20% of JIIM patients, primarily in JDM. Other MSAs, including anti-synthetase, anti-signal recognition particle (SRP), and anti-Mi-2, were present in only 10% of JIIM patients. Features that characterized the anti-p155/140 autoantibody subgroup included Gottron papules, malar rash, "shawl-sign" rash, photosensitivity, cuticular overgrowth, lowest creatine kinase (CK) levels, and a predominantly chronic illness course. The features that differed for patients with anti-MJ antibodies included muscle cramps, dysphonia, intermediate CK levels, a high frequency of hospitalization, and a monocyclic disease course. Patients with anti-synthetase antibodies had higher frequencies of interstitial lung disease, arthralgia, and "mechanic's hands," and had an older age at diagnosis. The anti-SRP group, which had exclusively juvenile polymyositis, was characterized by high

  7. Statin-Associated Autoimmune Myopathy: A Systematic Review of 100 Cases.

    Science.gov (United States)

    Nazir, Salik; Lohani, Saroj; Tachamo, Niranjan; Poudel, Dilliram; Donato, Anthony

    2017-04-01

    Statins are a group of drugs that reduce the levels of triglycerides and cholesterol in blood by inhibiting HMG-CoA reductase, an enzyme involved in rate limiting step in cholesterol synthesis. About 2-20% patients on statins develop toxic myopathies, which usually resolve on discontinuation of statin. More recently, an immune-mediated necrotizing myopathy has been found to be associated with statin use which in most cases requires treatment with immunosuppressants. To perform a systematic review on published case reports and case series of statin-associated autoimmune myopathy. A comprehensive search of PUBMED, EMBASE, Cochrane library and ClinicalTrials.gov databases was performed for relevant articles from inception until March 19, 2016 to identify cases of statin-associated necrotizing myopathy and characterize their symptoms, evaluation and response to treatment. A total of 16 articles describing 100 patients with statin-associated autoimmune myopathy were identified. The mean age of presentation was 64.72 years, and 54.44% were males. The main presenting clinical feature was proximal muscle weakness, which was symmetric in 83.33% of patients. The mean creatine kinase (CK) was 6853 IU/l. Anti-HMG-CoA reductase antibody was positive in all cases tested (n = 57/57, 100%). In patients with no anti-HMG-CoA antibody results, diagnosis was established by findings of necrotizing myopathy on biopsy. Among the 83 cases where muscle biopsy information was available, 81.48% had necrosis, while 18.51% had combination of necrosis and inflammation. Most (83.82%) patients received two or more immunosuppressants to induce remission. Ninety-one percent had resolution of symptoms after treatment. Statin-associated necrotizing myopathy is a symmetric proximal muscle weakness associated with extreme elevations of CK. It is common in males and can occur after months of statin use. It is associated with necrosis on muscle biopsy and the presence of anti-HMG-CoA reductase antibodies

  8. White striping and woody breast myopathies in the modern poultry industry: a review.

    Science.gov (United States)

    Kuttappan, V A; Hargis, B M; Owens, C M

    2016-11-01

    Myopathies are gaining the attention of poultry meat producers globally. White Striping (WS) is a condition characterized by the occurrence of white striations parallel to muscle fibers on breast, thigh, and tender muscles of broilers, while Woody Breast (WB) imparts tougher consistency to raw breast fillets. Histologically, both conditions have been characterized with myodegeneration and necrosis, fibrosis, lipidosis, and regenerative changes. The occurrence of these modern myopathies has been associated with increased growth rate in birds. The severity of the myopathies can adversely affect consumer acceptance of raw cut up parts and/or quality of further processed poultry meat products, resulting in huge economic loss to the industry. Even though gross and/or histologic characteristics of modern myopathies are similar to some of the known conditions, such as hereditary muscular dystrophy, nutritional myopathy, toxic myopathies, and marbling, WS and WB could have a different etiology. As a result, there is a need for future studies to identify markers for WS and WB in live birds and genetic, nutritional, and/or management strategies to alleviate the condition. © 2016 Poultry Science Association Inc.

  9. Absence of anti-HMG-CoA reductase autoantibodies in severe self-limited statin-related myopathy.

    Science.gov (United States)

    Floyd, James S; Brody, Jennifer A; Tiniakou, Eleni; Psaty, Bruce M; Mammen, Andrew

    2016-06-01

    Patients with self-limited statin-related myopathy improve spontaneously when statins are stopped. In contrast, patients with statin-associated autoimmune myopathy have autoantibodies recognizing 3-hydroxy-3-methyl-glutaryl-coenzyme A reductase (HMGCR) and usually require immunosuppressive therapy to control their disease. On initial presentation, it can sometimes be difficult to distinguish between these 2 diseases, as both present with muscle pain, weakness, and elevated serum creatine kinase (CK) levels. The goal of this study was to determine whether patients with severe self-limited statin-related myopathy also make anti-HMGCR autoantibodies. We screened 101 subjects with severe self-limited cerivastatin-related myopathy for anti-HMGCR autoantibodies. No patient with severe self-limited cerivastatin-related myopathy had anti-HMGCR autoantibodies. Anti-HMGCR autoantibody testing can be used to help differentiate whether a patient has self-limited myopathy due to cerivastatin or autoimmune statin-associated myopathy; these findings may apply to other statins as well. Muscle Nerve 54: 142-144, 2016. © 2016 Wiley Periodicals, Inc.

  10. REV-ERB and ROR: therapeutic targets for treating myopathies

    Science.gov (United States)

    Welch, Ryan D.; Flaveny, Colin A.

    2017-08-01

    Muscle is primarily known for its mechanical roles in locomotion, maintenance of posture, and regulation of cardiac and respiratory function. There are numerous medical conditions that adversely affect muscle, myopathies that disrupt muscle development, regeneration and protein turnover to detrimental effect. Skeletal muscle is also a vital secretory organ that regulates thermogenesis, inflammatory signaling and directs context specific global metabolic changes in energy substrate preference on a daily basis. Myopathies differ in the causative factors that drive them but share common features including severe reduction in quality of life and significantly increased mortality all due irrefutably to the loss of muscle mass. Thus far clinically viable approaches for preserving muscle proteins and stimulating new muscle growth without unwanted side effects or limited efficacy has been elusive. Over the last few decades, evidence has emerged through in vitro and in vivo studies that suggest the nuclear receptors REV-ERB and ROR might modulate pathways involved in myogenesis and mitochondrial biogenesis. Hinting that REV-ERB and ROR might be targeted to treat myopathies. However there is still a need for substantial investigation into the roles of these nuclear receptors in in vivo rodent models of degenerative muscle diseases and acute injury. Although exciting, REV-ERB and ROR have somewhat confounding roles in muscle physiology and therefore more studies utilizing in vivo models of skeletal muscle myopathies are needed. In this review we highlight the molecular forces driving some of the major degenerative muscular diseases and showcase two promising molecular targets that may have the potential to treat myopathies: ROR and REV-ERB.

  11. [Metabolic myopathies].

    Science.gov (United States)

    Papazian, Óscar; Rivas-Chacón, Rafael

    2013-09-06

    To review the metabolic myopathies manifested only by crisis of myalgias, cramps and rigidity of the muscles with decreased voluntary contractions and normal inter crisis neurologic examination in children and adolescents. These metabolic myopathies are autosomic recessive inherited enzymatic deficiencies of the carbohydrates and lipids metabolisms. The end result is a reduction of intra muscle adenosine triphosphate, mainly through mitochondrial oxidative phosphorylation, with decrease of available energy for muscle contraction. The one secondary to carbohydrates intra muscle metabolism disorders are triggered by high intensity brief (fatty acids metabolism disorders are triggered by low intensity prolonged (> 10 min) exercises. The conditions in the first group in order of decreasing frequency are the deficiencies of myophosforilase (GSD V), muscle phosphofructokinase (GSD VII), phosphoglycerate mutase 1 (GSD X) and beta enolase (GSD XIII). The conditions in the second group in order of decreasing frequency are the deficiencies of carnitine palmitoyl transferase II and very long chain acyl CoA dehydrogenase. The differential characteristics of patients in each group and within each group will allow to make the initial presumptive clinical diagnosis in the majority and then to order only the necessary tests to achieve the final diagnosis. Treatment during the crisis includes hydration, glucose and alkalinization of urine if myoglobin in blood and urine are elevated. Prevention includes avoiding exercise which may induce the crisis and fasting. The prognosis is good with the exception of rare cases of acute renal failure due to hipermyoglobinemia because of severe rabdomyolisis.

  12. Myofibrillar myopathies: State of the art, present and future challenges.

    Science.gov (United States)

    Béhin, A; Salort-Campana, E; Wahbi, K; Richard, P; Carlier, R-Y; Carlier, P; Laforêt, P; Stojkovic, T; Maisonobe, T; Verschueren, A; Franques, J; Attarian, S; Maues de Paula, A; Figarella-Branger, D; Bécane, H-M; Nelson, I; Duboc, D; Bonne, G; Vicart, P; Udd, B; Romero, N; Pouget, J; Eymard, B

    2015-10-01

    Myofibrillar myopathies (MFM) have been described in the mid-1990s as a group of diseases sharing common histological features, including an abnormal accumulation of intrasarcoplasmic proteins, the presence of vacuoles and a disorganization of the intermyofibrillar network beginning at the Z-disk. The boundaries of this concept are still uncertain, and whereas six genes (DES, CRYAB, LDB3/ZASP, MYOT, FLNC and BAG3) are now classically considered as responsible for MFM, other entities such as FHL1 myopathy or Hereditary Myopathy with Early Respiratory Failure linked to mutations of titin can now as well be included in this group. The diagnosis of MFM is not always easy; as histological lesions can be focal, and muscle biopsy may be disappointing; this has led to a growing importance of muscle imaging, and the selectivity of muscle involvement has now been described in several disorders. Due to the rarity of these myopathies, if some clinical patterns (such as distal myopathy associated with cardiomyopathy due to desmin mutations) are now well known, surprises remain possible and should lead to systematic testing of the known genes in case of a typical histological presentation. In this paper, we aim at reviewing the data acquired on the six main genes listed above as well as presenting the experience from two French reference centres, Paris and Marseilles. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  13. Prevalence and phenotypes of congenital myopathy due to α-actin 1 gene mutations

    DEFF Research Database (Denmark)

    Witting, Nanna; Werlauff, Ulla; Duno, Morten

    2016-01-01

    airway pressure. Limb flexor/extensor muscles and upper and lower extremities were affected equally. Pronounced neck flexor weakness was noted. CONCLUSIONS: Congenital myopathy caused by ACTA1 mutations is fatal in infancy in most cases. This study shows that the prevalence of α-actin myopathy in older...... patients with congenital myopathy is not negligible and that phenotypes can be quite mild....

  14. Morphologic imaging in muscular dystrophies and inflammatory myopathies

    International Nuclear Information System (INIS)

    Degardin, Adrian; Lacour, Arnaud; Vermersch, Patrick; Morillon, David; Cotten, Anne; Stojkovic, Tanya

    2010-01-01

    To determine if magnetic resonance imaging (MR imaging) is useful in the diagnostic workup of muscular dystrophies and idiopathic inflammatory myopathies for describing the topography of muscle involvement. MR imaging was performed in 31 patients: 8 with dystrophic myotony types 1 (n = 4) or 2 (n = 4); 11 with limb-girdle muscular dystrophy, including dysferlinopathy, calpainopathy, sarcoglycanopathy, and dystrophy associated with fukutin-related protein mutation; 3 with Becker muscular dystrophy; and 9 with idiopathic inflammatory myopathies, including polymyositis, dermatomyositis, and sporadic inclusion body myositis. Analysis of T1 images enabled us to describe the most affected muscles and the muscles usually spared for each muscular disease. In particular, examination of pelvis, thigh, and leg muscles demonstrated significant differences between the muscular diseases. On STIR images, hyperintensities were present in 62% of our patients with muscular dystrophies. A specific pattern of muscular involvement was established for each muscular disease. Hyperintensities observed on STIR images precede fatty degeneration and are not specific for inflammatory myopathies. (orig.)

  15. Morphologic imaging in muscular dystrophies and inflammatory myopathies

    Energy Technology Data Exchange (ETDEWEB)

    Degardin, Adrian; Lacour, Arnaud; Vermersch, Patrick [CHU de Lille, Clinique neurologique, Lille (France); Morillon, David; Cotten, Anne [CHRU de Lille, Service de Radiologie Osteoarticulaire, Hopital Roger Salengro, Lille (France); Stojkovic, Tanya [G-H Pitie-Salpetriere, Institut de Myologie, Paris (France)

    2010-12-15

    To determine if magnetic resonance imaging (MR imaging) is useful in the diagnostic workup of muscular dystrophies and idiopathic inflammatory myopathies for describing the topography of muscle involvement. MR imaging was performed in 31 patients: 8 with dystrophic myotony types 1 (n = 4) or 2 (n = 4); 11 with limb-girdle muscular dystrophy, including dysferlinopathy, calpainopathy, sarcoglycanopathy, and dystrophy associated with fukutin-related protein mutation; 3 with Becker muscular dystrophy; and 9 with idiopathic inflammatory myopathies, including polymyositis, dermatomyositis, and sporadic inclusion body myositis. Analysis of T1 images enabled us to describe the most affected muscles and the muscles usually spared for each muscular disease. In particular, examination of pelvis, thigh, and leg muscles demonstrated significant differences between the muscular diseases. On STIR images, hyperintensities were present in 62% of our patients with muscular dystrophies. A specific pattern of muscular involvement was established for each muscular disease. Hyperintensities observed on STIR images precede fatty degeneration and are not specific for inflammatory myopathies. (orig.)

  16. A Rare Manifestation of Hypothyroid Myopathy: Hoffmann's Syndrome

    Directory of Open Access Journals (Sweden)

    Kang Won Lee

    2015-12-01

    Full Text Available Hypothyroid myopathy is observed frequently and the resolution of the clinical manifestations of myopathy following thyroid hormone replacement is well known. However, a specific subtype of hypothyroid myopathy, Hoffmann's syndrome, characterized by increased muscular mass (pseudohypertrophy, proximal muscle weakness, muscle stiffness and cramps, is rarely reported. Herein, we describe a 34-year-old male who presented with proximal muscle weakness and non-pitting edema of the lower extremities. He initially visited the neurology department where he was suspected of having polymyositis. Additional laboratory evaluation revealed profound autoimmune hypothyroidism and elevated muscle enzymes including creatine kinase. The patient was started on levothyroxine treatment and, subsequently, clinical symptoms and biochemical parameters resolved with the treatment. The present case highlights that hypothyroidism should be considered in the differential diagnosis of musculoskeletal symptoms even in the absence of overt manifestations of hypothyroidism. To our knowledge, this is the first case reported in Korea.

  17. Study of cognitive sphere in children and adolescents with congenital myopathy (theoretical review

    Directory of Open Access Journals (Sweden)

    V. A. Erokhina

    2013-08-01

    Full Text Available This paper presents an analysis of current approaches to the study of states of higher mental functions in children and adolescents suffering from various forms of hereditary myopathies. The aim of this work is to study the theoretical rationale and the possibility of specific disorders of mental function in children and adolescents with congenital myopathies. To achieve this objective during the study it was necessary to solve the following problems: give a description of the various groups and forms of congenital myopathies, their clinical characteristics; justify the possibility of considering the hereditary myopathies as a factor in the formation of changes in visual-spatial activities and thinking; evaluate the possibility to use complex neuropsychological psycho-diagnostic techniques for investigating the state of the higher mental functions of children with congenital myopathies. The possibility of neuropsychological correction for this category of patients is discussed also.

  18. Glucocorticoid-induced myopathy in the intensive care unit

    DEFF Research Database (Denmark)

    Eddelien, Heidi Shil; Hoffmeyer, Henrik Westy; Lund, Eva Charlotte Løbner

    2015-01-01

    Glucocorticoids (GC) are used for intensive care unit (ICU) patients on several indications. We present a patient who was admitted to the ICU due to severe respiratory failure caused by bronchospasm requiring mechanical ventilation and treated with methylprednisolone 240 mg/day in addition...... to antibiotics and bronchiolytics. When the sedation was lifted on day 10, the patient was awake but quadriplegic. Blood samples revealed elevated muscle enzymes, electromyography showed myopathy, and a muscle biopsy was performed. Glucocorticoid-induced myopathy was suspected, GC treatment was tapered...

  19. Genetics Home Reference: myopathy with deficiency of iron-sulfur cluster assembly enzyme

    Science.gov (United States)

    ... Myopathy with deficiency of iron-sulfur cluster assembly enzyme Printable PDF Open All Close All Enable Javascript ... Myopathy with deficiency of iron-sulfur cluster assembly enzyme is an inherited disorder that primarily affects muscles ...

  20. Whole-body muscle MRI to detect myopathies in non-extrapyramidal bent spine syndrome

    International Nuclear Information System (INIS)

    Ohana, Mickael; Durand, Marie-Christine; Marty, Catherine; Lazareth, Jean-Philippe; Maisonobe, Thierry; Mompoint, Dominique; Carlier, Robert-Yves

    2014-01-01

    Bent spine syndrome (BSS), defined as an abnormal forward flexion of the trunk resolving in supine position, is usually related to parkinsonism, but can also be encountered in myopathies. This study evaluates whole-body muscle MRI (WB-mMRI) as a tool for detecting underlying myopathy in non-extrapyramidal BSS. Forty-three patients (90 % women; 53-86 years old) with a non-extrapyramidal BSS were prospectively included. All underwent a 1.5-T WB-mMRI and a nerve conduction study. Muscle biopsy was performed if a myopathy could not be eliminated based on clinical examination and all tests. Systematic MRI interpretation focused on peripheral and axial muscle injury; spinal posture and incidental findings were also reported. WB-mMRI was completed for all patients, with 13 muscle biopsies ultimately needed and myopathy revealed as the final etiological diagnosis in five cases (12 %). All biopsy-proven myopathies were detected by the WB-mMRI. Relevant incidental MRI findings were made in seven patients. This study supports WB-mMRI as a sensitive and feasible tool for detecting myopathy in BSS patients. Associated with electroneuromyography, it can better indicate when a muscle biopsy is needed and guide it when required. Rigorous radiological interpretation is mandatory, so as not to miss incidental findings of clinical consequence. (orig.)

  1. Whole-body muscle MRI to detect myopathies in non-extrapyramidal bent spine syndrome

    Energy Technology Data Exchange (ETDEWEB)

    Ohana, Mickael [Nouvel Hopital Civil - Hopitaux Universitaires de Strasbourg, Service de Radiologie B, Strasbourg (France); Durand, Marie-Christine [AP-HP - Hopital Raymond Poincare, Service de Neurologie, Garches (France); Marty, Catherine; Lazareth, Jean-Philippe [AP-HP - Hopital Raymond Poincare, Service de Rhumatologie, Garches (France); Maisonobe, Thierry [APH-HP - Hopital de la Pitie-Salpetriere, Service de Neuropathologie, Paris (France); Mompoint, Dominique; Carlier, Robert-Yves [AP-HP - Hopital Raymond Poincare, Service de Radiologie, Garches (France)

    2014-08-15

    Bent spine syndrome (BSS), defined as an abnormal forward flexion of the trunk resolving in supine position, is usually related to parkinsonism, but can also be encountered in myopathies. This study evaluates whole-body muscle MRI (WB-mMRI) as a tool for detecting underlying myopathy in non-extrapyramidal BSS. Forty-three patients (90 % women; 53-86 years old) with a non-extrapyramidal BSS were prospectively included. All underwent a 1.5-T WB-mMRI and a nerve conduction study. Muscle biopsy was performed if a myopathy could not be eliminated based on clinical examination and all tests. Systematic MRI interpretation focused on peripheral and axial muscle injury; spinal posture and incidental findings were also reported. WB-mMRI was completed for all patients, with 13 muscle biopsies ultimately needed and myopathy revealed as the final etiological diagnosis in five cases (12 %). All biopsy-proven myopathies were detected by the WB-mMRI. Relevant incidental MRI findings were made in seven patients. This study supports WB-mMRI as a sensitive and feasible tool for detecting myopathy in BSS patients. Associated with electroneuromyography, it can better indicate when a muscle biopsy is needed and guide it when required. Rigorous radiological interpretation is mandatory, so as not to miss incidental findings of clinical consequence. (orig.)

  2. Genetics Home Reference: idiopathic inflammatory myopathy

    Science.gov (United States)

    ... stumble while walking and find it difficult to grasp items. As in dermatomyositis and polymyositis, swallowing can ... and development? More about Mutations and Health Inheritance Pattern Most cases of idiopathic inflammatory myopathy are sporadic, ...

  3. Acute liver failure after recommended doses of acetaminophen in patients with myopathies

    NARCIS (Netherlands)

    I. Ceelie (Ilse); L.P. James (Laura); V.M.G.J. Gijsen (Violette); R.A.A. Mathôt (Ron); S. Ito (Shinya); C.D. Tesselaar (Coranne); D. Tibboel (Dick); G. Koren (Gideon); S.N. de Wildt (Saskia)

    2011-01-01

    textabstractObjective: To determine the likelihood that recommended doses of acetaminophen are associated with acute liver failure in patients with myopathies. Design: Retrospective analysis. Setting: Level III pediatric intensive care unit. Patients: Two pediatric patients with myopathies and acute

  4. Acute liver failure after recommended doses of acetaminophen in patients with myopathies

    NARCIS (Netherlands)

    Ceelie, Ilse; James, Laura P.; Gijsen, Violette; Mathot, Ron A. A.; Ito, Shinya; Tesselaar, Coranne D.; Tibboel, Dick; Koren, Gideon; de Wildt, Saskia N.

    2011-01-01

    To determine the likelihood that recommended doses of acetaminophen are associated with acute liver failure in patients with myopathies. Retrospective analysis. Level III pediatric intensive care unit. Two pediatric patients with myopathies and acute liver failure. CLINICAL INVESTIGATIONS: We

  5. Congenital myopathy is caused by mutation of HACD1

    OpenAIRE

    Muhammad, Emad; Reish, Orit; Ohno, Yusuke; Scheetz, Todd; DeLuca, Adam; Searby, Charles; Regev, Miriam; Benyamini, Lilach; Fellig, Yakov; Kihara, Akio; Sheffield, Val C.; Parvari, Ruti

    2013-01-01

    Congenital myopathies are heterogeneous inherited diseases of muscle characterized by a range of distinctive histologic abnormalities. We have studied a consanguineous family with congenital myopathy. Genome-wide linkage analysis and whole-exome sequencing identified a homozygous non-sense mutation in 3-hydroxyacyl-CoA dehydratase 1 (HACD1) in affected individuals. The mutation results in non-sense mediated decay of the HACD1 mRNA to 31% of control levels in patient muscle and completely abro...

  6. Fulminant lipid storage myopathy due to multiple acyl-coenzyme a dehydrogenase deficiency.

    Science.gov (United States)

    Whitaker, Charles H; Felice, Kevin J; Silvers, David; Wu, Qian

    2015-08-01

    The lipid storage myopathies, primary carnitine deficiency, neutral lipid storage disease, and multiple acyl coenzyme A dehydrogenase deficiency (MADD), are progressive disorders that cause permanent weakness. These disorders of fatty acid metabolism and intracellular triglyceride degradation cause marked fat deposition and damage to muscle cells. We describe a rapidly progressive myopathy in a previously healthy 33-year-old woman. Over 4 months, she developed a proximal and axial myopathy associated with diffuse myalgia and dysphagia, ultimately leading to respiratory failure and death. Muscle biopsy showed massive accumulation of lipid. Plasma acylcarnitine and urine organic acid analysis was consistent with MADD. This was confirmed by molecular genetic testing, which revealed 2 pathogenic mutations in the ETFDH gene. This report illustrates a late-onset case of MADD and reviews the differential diagnosis and evaluation of patients with proximal myopathy and excessive accumulation of lipid on muscle biopsy. © 2014 Wiley Periodicals, Inc.

  7. CT and the diagnosis of myopathies. Preliminary findings in 42 cases

    Energy Technology Data Exchange (ETDEWEB)

    Calgo, M; Crisi, G; Martinelli, C; Colombo, A; Schoenhuber, R; Gibertoni, M

    1986-01-01

    A total of 42 patients with myopathies underwent CT scans in order to study the relationship between CT images and clinical findings. CT is a valuable diagnostic aid to distinguish primary from neurogenic myopathies, to facilitate directed biopsy and finally to classify the disease according to the degree and extent of the muscular lesion. (orig.).

  8. Autosomal dominant distal myopathy due to a novel ACTA1 mutation.

    Science.gov (United States)

    Liewluck, Teerin; Sorenson, Eric J; Walkiewicz, Magdalena A; Rumilla, Kandelaria M; Milone, Margherita

    2017-08-01

    Mutations in skeletal muscle α-actin 1-encoding gene (ACTA1) cause autosomal dominant or recessive myopathies with marked clinical and pathological heterogeneity. Patients typically develop generalized or limb-girdle pattern of weakness, but recently a family with scapuloperoneal myopathy was reported. We describe a father and 2 children with childhood-to-juvenile onset distal myopathy, carrying a novel dominant ACTA1 variant, c.757G>C (p.Gly253Arg). Father had delayed motor development and developed significant proximal weakness later in life; he was initially misdiagnosed as having spinal muscular atrophy based on electromyographic findings. His children had predominant anterior distal leg and finger extensor involvement. Nemaline rods were abundant on the daughter's biopsy, absent on the father's initial biopsy, and extremely rare on the father's subsequent biopsy a decade later. The father's second biopsy also showed myofibrillar pathology and rare fibers with actin filament aggregates. The present family expands the spectrum of actinopathy to include a distal myopathy. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Genetics Home Reference: hereditary fibrosing poikiloderma with tendon contractures, myopathy, and pulmonary fibrosis

    Science.gov (United States)

    ... Hereditary fibrosing poikiloderma with tendon contractures, myopathy, and pulmonary fibrosis Printable PDF Open All Close All Enable Javascript ... Fibrosing Poikiloderma with Tendon Contractures, Myopathy, and Pulmonary ... Lung, and Blood Institute (NHLBI): Pulmonary Function Tests National ...

  10. GNE Myopathy in Turkish Sisters with a Novel Homozygous Mutation

    Science.gov (United States)

    Diniz, Gulden; Secil, Yaprak; Ceylaner, Serdar; Tokucoglu, Figen; Türe, Sabiha; Celebisoy, Mehmet; İncesu, Tülay Kurt; Akhan, Galip

    2016-01-01

    Background. Hereditary inclusion body myopathy is caused by biallelic defects in the GNE gene located on chromosome 9p13. It generally affects adults older than 20 years of age. Methods and Results. In this study, we present two Turkish sisters with progressive myopathy and describe a novel mutation in the GNE gene. Both sisters had slightly higher levels of creatine kinase (CK) and muscle weakness. The older sister presented at 38 years of age with an inability to climb steps, weakness, and a steppage gait. Her younger sister was 36 years old and had similar symptoms. The first symptoms of the disorder were seen when the sisters were 30 and 34 years old, respectively. The muscle biopsy showed primary myopathic features and presence of rimmed vacuoles. DNA analysis demonstrated the presence of previously unknown homozygous mutations [c.2152 G>A (p.A718T)] in the GNE genes. Conclusion. Based on our literature survey, we believe that ours is the first confirmed case of primary GNE myopathy with a novel missense mutation in Turkey. These patients illustrate that the muscle biopsy is still an important method for the differential diagnosis of vacuolar myopathies in that the detection of inclusions is required for the definitive diagnosis. PMID:27298745

  11. Centronuclear myopathy in a Border collie dog.

    Science.gov (United States)

    Eminaga, S; Cherubini, G B; Shelton, G D

    2012-10-01

    A two-year old, male entire Border collie was presented with a one-year history of exercise-induced collapsing on the pelvic limbs. Physical examination revealed generalised muscle atrophy. Neurological examination supported a generalised neuromuscular disorder. Electromyography revealed spontaneous electrical activity in almost all muscles. Unfixed and formaldehyde-fixed biopsy samples were collected from the triceps brachii, longissimus and vastus lateralis muscles. Histopathological, histochemical and ultrastructural examinations of biopsy specimens were consistent with either centronuclear or myotubular myopathy. The dog clinically improved with supportive treatment with L-carnitine, co-enzyme Q10 and vitamin B compound. To the authors' knowledge, this is the first report of centronuclear/myotubular myopathy in a Border collie. © 2012 British Small Animal Veterinary Association.

  12. Fibrous Myopathy as a Complication of Repeated Intramuscular Injections for Chronic Headache

    Directory of Open Access Journals (Sweden)

    R Burnham

    2006-01-01

    Full Text Available Two cases of fibrous myopathy associated with repeated, long-term intramuscular injections for treatment of chronic temporomandibular joint pain and chronic headache, respectively, are described. Both patients developed severe, function-limiting contractures in upper and lower extremity muscles used as injection sites. In one of the cases, the contractures were painful. Electrophysiological testing, magnetic resonance imaging and muscle biopsy results were all consistent with myopathy and replacement of skeletal muscle with noncontractile fibrous tissue. These cases are presented to increase awareness of fibrous myopathy and to promote surveillance for this serious potential complication of long-term intramuscular injections in chronic headache and other pain patients.

  13. Myopathy and hepatic lipidosis in weaned lambs due to vitamin E deficiency.

    Science.gov (United States)

    Menzies, Paula; Langs, Lisa; Boermans, Herman; Martin, John; McNally, John

    2004-03-01

    A sheep flock experienced losses in weaned lambs from myopathy and hepatic lipidosis. Investigation revealed painful ambulation, illthrift, and unexpected death in lambs with normal selenium levels, deficient vitamin E levels, and elevated muscle and liver enzyme levels. Vitamin E deficiency should be considered when investigating myopathy and illthrift in lambs.

  14. Myopathy and hepatic lipidosis in weaned lambs due to vitamin E deficiency

    OpenAIRE

    Menzies, Paula; Langs, Lisa; Boermans, Herman; Martin, John; McNally, John

    2004-01-01

    A sheep flock experienced losses in weaned lambs from myopathy and hepatic lipidosis. Investigation revealed painful ambulation, illthrift, and unexpected death in lambs with normal selenium levels, deficient vitamin E levels, and elevated muscle and liver enzyme levels. Vitamin E deficiency should be considered when investigating myopathy and illthrift in lambs.

  15. Skeletal muscle repair in a mouse model of nemaline myopathy

    OpenAIRE

    Sanoudou, Despina; Corbett, Mark A.; Han, Mei; Ghoddusi, Majid; Nguyen, Mai-Anh T.; Vlahovich, Nicole; Hardeman, Edna C.; Beggs, Alan H.

    2006-01-01

    Nemaline myopathy (NM), the most common non-dystrophic congenital myopathy, is a variably severe neuromuscular disorder for which no effective treatment is available. Although a number of genes have been identified in which mutations can cause NM, the pathogenetic mechanisms leading to the phenotypes are poorly understood. To address this question, we examined gene expression patterns in an NM mouse model carrying the human Met9Arg mutation of alpha-tropomyosin slow (Tpm3). We assessed five d...

  16. Genetics Home Reference: inclusion body myopathy with early-onset Paget disease and frontotemporal dementia

    Science.gov (United States)

    ... Share: Email Facebook Twitter Home Health Conditions IBMPFD Inclusion body myopathy with early-onset Paget disease and ... Javascript to view the expand/collapse boxes. Description Inclusion body myopathy with early-onset Paget disease and ...

  17. The Impact of Exercise on Statin-Associated Skeletal Muscle Myopathy

    Science.gov (United States)

    Chung, Hae R.; Vakil, Mayand; Munroe, Michael; Parikh, Alay; Meador, Benjamin M.; Wu, Pei T.; Jeong, Jin H.; Woods, Jeffrey A.; Wilund, Kenneth R.; Boppart, Marni D.

    2016-01-01

    HMG-CoA reductase inhibitors (statins) are the most effective pharmacological means of reducing cardiovascular disease risk. The most common side effect of statin use is skeletal muscle myopathy, which may be exacerbated by exercise. Hypercholesterolemia and training status are factors that are rarely considered in the progression of myopathy. The purpose of this study was to determine the extent to which acute and chronic exercise can influence statin-induced myopathy in hypercholesterolemic (ApoE-/-) mice. Mice either received daily injections of saline or simvastatin (20 mg/kg) while: 1) remaining sedentary (Sed), 2) engaging in daily exercise for two weeks (novel, Nov), or 3) engaging in daily exercise for two weeks after a brief period of training (accustomed, Acct) (2x3 design, n = 60). Cholesterol, activity, strength, and indices of myofiber damage and atrophy were assessed. Running wheel activity declined in both exercise groups receiving statins (statin x time interaction, pstatin treatment (statin main effect, pstatin x exercise interaction, pstatin treatment. Exercise (Acct and Nov) increased atrogin-1 mRNA in combination with statin treatment, yet enhanced fiber damage or atrophy was not observed. The results from this study suggest that exercise (Nov, Acct) does not exacerbate statin-induced myopathy in ApoE-/- mice, yet statin treatment reduces activity in a manner that prevents muscle from mounting a beneficial adaptive response to training. PMID:27936249

  18. Severe polysaccharide storage myopathy in Belgian and Percheron draught horses.

    Science.gov (United States)

    Valentine, B A; Credille, K M; Lavoie, J P; Fatone, S; Guard, C; Cummings, J F; Cooper, B J

    1997-05-01

    A severe myopathy leading to death or euthanasia was identified in 4 Belgian and 4 Percheron draught horses age 2-21 years. Clinical signs ranged from overt weakness and muscle atrophy in 2 horses age 2 and 3 years, to recumbency with inability to rise in 6 horses age 4-21 years. In 5 horses there was mild to severe increases in muscle enzyme levels. Clinical diagnoses included equine motor neuron disease (2 horses), post anaesthetic myopathy (2 horses), exertional myopathy (2 horses), myopathy due to unknown (one horse), and equine protozoal myelitis (one horse). Characteristic histopathology of muscle from affected horses was the presence of excessive complex polysaccharide and/or glycogen, revealed by periodic acid-Schiff staining in all cases and by electron microscopy in one case. Evaluation of frozen section histochemistry performed on 2 cases indicated that affected fibres were Type 2 glycolytic fibres. Subsarcolemmal and intracytoplasmic vacuoles were most prominent in 3 horses age 2-4 years, and excessive glycogen, with little or no complex polysaccharide, was the primary compound stored in affected muscle in these young horses. Myopathic changes, including fibre size variation, fibre hypertrophy, internal nuclei, and interstitial fat infiltration, were most prominent in 5 horses age 6-21 years, and the accumulation of complex polysaccharide appeared to increase with age. Mild to moderate segmental myofibre necrosis was present in all cases.

  19. Search for Pompe disease among patients with undetermined myopathies.

    Science.gov (United States)

    Lindberg, C; Anderson, B; Engvall, M; Hult, M; Oldfors, A

    2015-07-20

    Pompe disease is a rare treatable glycogen storage disease with in adults - a limb-girdle muscle weakness. Muscle biopsy may fail to show the typical vacuolar myopathy. We asked if we had un-diagnosed patients with Pompe disease in western Sweden. We searched the muscle biopsy registry during the time period 1986 until 2006 including 3665 biopsies and included patients at our Neuromuscular Center with unspecified myopathy or limb-girdle muscular dystrophy. The dry blood spot test was used to identify patients with Pompe disease. A total of 82 patients (46 from the biopsy register and 36 from our center) were seen and dry blood spot test was obtained. No patient with Pompe disease was found. The dry blood spot test was low in three cases (11, 16, and 18% of normal) but a second blood sample showed a normal result based on GAA enzyme activity in lymphocytes in all three patients. In one patient with low normal result of the analysis in lymphocytes a genetic test showed no pathogenic mutations. Further investigation gave a definite diagnose of another myopathy in 12 patients. The prevalence of Pompe disease in western Sweden (3 in 1.27 million or 0.24 per 100.000 inhabitants) is lower than in the Netherlands and New York. Re-evaluation of patients with myopathies but without definite diagnosis is rewarding since 12 of 82 patients in our study had a definite molecular diagnosis after workup. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  20. [Biologic therapy in idiopathic inflammatory myopathy].

    Science.gov (United States)

    Selva-O'Callaghan, Albert; Ramos Casals, Manel; Grau Junyent, Josep M

    2014-09-15

    The aim of this article is to study the evidence-based knowledge related to the use of biological therapies in patients diagnosed with idiopathic inflammatory myopathy (dermatomyositis, polymyositis and inclusion body myositis). In this review the leading published studies related to the use of biological therapy in patients with myositis are analysed; mainly those with high methodological standards, that means randomized and controlled studies. Methodological drawbacks due to the rarity and heterogeneity of these complex diseases are also addressed. Up to now is not possible to ascertain the biologics as a recommended therapy in patients with myositis, at least based in the current evidence-based knowledge, although it can not be neglected as a therapeutic option in some clinical situations, taking into account the scarce of effective treatments in those patients, especially in refractory myositis. Future studies probably will help to better define the role of biological therapies in patients with idiopathic inflammatory myopathy. Copyright © 2013 Elsevier España, S.L.U. All rights reserved.

  1. Hoffmann's disease: MR imaging of hypothyroid myopathy

    Energy Technology Data Exchange (ETDEWEB)

    Chung, Jeewon; Ahn, Kyung-Sik; Kang, Chang Ho [Korea University Anam Hospital, Korea University College of Medicine, Department of Radiology, Seoul (Korea, Republic of); Hong, Suk-Joo [Korea University Guro Hospital, Korea University College of Medicine, Department of Radiology, Seoul (Korea, Republic of); Kim, Beak Hyun [Korea University Ansan Hospital, Korea University College of Medicine, Department of Radiology, Gyeonggi-do (Korea, Republic of)

    2015-11-15

    Hoffmann's syndrome is a hypothyroid myopathy presenting as muscle stiffness and hypertrophy. It is a rare complication of hypothyroidism. MRI features of this syndrome have seldom been described in the literature. We present a case of Hoffmann's syndrome in a 34-year-old man who underwent lower extremity contrast-enhanced MRI. MRI can demonstrate the hypertrophic configuration, T2 hyperintensity, and enhancement of the involved muscles in Hoffmann's syndrome. Along with clinical, laboratory, and electromyography findings, MRI may be helpful in distinguishing between inflammatory myopathy, myonecrosis, subacute muscle denervation, and infectious myositis. (orig.)

  2. Hoffmann's disease: MR imaging of hypothyroid myopathy

    International Nuclear Information System (INIS)

    Chung, Jeewon; Ahn, Kyung-Sik; Kang, Chang Ho; Hong, Suk-Joo; Kim, Beak Hyun

    2015-01-01

    Hoffmann's syndrome is a hypothyroid myopathy presenting as muscle stiffness and hypertrophy. It is a rare complication of hypothyroidism. MRI features of this syndrome have seldom been described in the literature. We present a case of Hoffmann's syndrome in a 34-year-old man who underwent lower extremity contrast-enhanced MRI. MRI can demonstrate the hypertrophic configuration, T2 hyperintensity, and enhancement of the involved muscles in Hoffmann's syndrome. Along with clinical, laboratory, and electromyography findings, MRI may be helpful in distinguishing between inflammatory myopathy, myonecrosis, subacute muscle denervation, and infectious myositis. (orig.)

  3. A study of acute muscle dysfunction with particular reference to dengue myopathy

    Directory of Open Access Journals (Sweden)

    Rajesh Verma

    2017-01-01

    Full Text Available Background: Acute myopathy is a common cause of acute motor quadriparesis which has various etiologies with different courses of illness and prognosis depending on the cause. Understanding this diversity helps us in proper approach toward diagnosis, predicting the prognosis, and possible complications and in improving the treatments that are being provided. This study was planned to study the clinical, electrophysiological, and etiological profile of patients presenting with acute myopathy. We also studied how dengue-related acute myopathy differs from other causes and also difference between myopathy due to myositis and hypokalemia in cases of dengue. Materials and Methods: This was a prospective, observational study involving all clinically suspected cases of acute myopathy of not more than 4 weeks duration with raised serum creatine kinase (CK level. They were subjected to detailed clinical evaluation along with hematological, biochemical, microbiological, and electrophysiological studies and followed-up for outcome at 1 and 3 months. Muscle biopsy and histopathological examination were done in selected patients after taking informed consent. Statistical analysis was performed by appropriate methods using SPSS version 16.0 (Chicago, IL, USA. Results: We evaluated thirty patients of acute myopathy with raised CK level. Seventeen patients had fever, 11 had myalgia, and 5 had skin lesions. All presented with symmetric weakness, 17 (56.7% patients having predominantly proximal weakness, neck or truncal weakness in 6 (20%, hyporeflexia in 12 (40%, with mean Medical Research Council (MRC sum score of 46.67 ± 6.0. Eight (mean modified Barthel index [MBI] at presentation - 15 ± 3.7 patients had poor functional status according to MBI and 15 according to modified Rankin scale (MRS (mean MRS score - 2.5 ± 1.2. Etiology was dengue viral infection in 14 patients; hypokalemia due to various causes other than dengue in 8; pyomyositis in 3

  4. Leiomodin-3-deficient mice display nemaline myopathy with fast-myofiber atrophy

    Directory of Open Access Journals (Sweden)

    Lei Tian

    2015-06-01

    Full Text Available Nemaline myopathy (NM is one of the most common forms of congenital myopathy, and affects either fast myofibers, slow myofibers, or both. However, an animal model for congenital myopathy with fast-myofiber-specific atrophy is not available. Furthermore, mutations in the leiomodin-3 (LMOD3 gene have recently been identified in a group of individuals with NM. However, it is not clear how loss of LMOD3 leads to NM. Here, we report a mouse mutant in which the piggyBac (PB transposon is inserted into the Lmod3 gene and disrupts its expression. Lmod3PB/PB mice show severe muscle weakness and postnatal growth retardation. Electron microscopy and immunofluorescence studies of the mutant skeletal muscles revealed the presence of nemaline bodies, a hallmark of NM, and disorganized sarcomeric structures. Interestingly, Lmod3 deficiency caused muscle atrophy specific to the fast fibers. Together, our results show that Lmod3 is required in the fast fibers for sarcomere integrity, and this study offers the first NM mouse model with muscle atrophy that is specific to fast fibers. This model could be a valuable resource for interrogating myopathy pathogenesis and developing therapeutics for NM as well as other pathophysiological conditions with preferential atrophy of fast fibers, including cancer cachexia and sarcopenia.

  5. Identification of methylenecyclopropyl acetic acid in serum of European horses with atypical myopathy.

    Science.gov (United States)

    Votion, D-M; van Galen, G; Sweetman, L; Boemer, F; de Tullio, P; Dopagne, C; Lefère, L; Mouithys-Mickalad, A; Patarin, F; Rouxhet, S; van Loon, G; Serteyn, D; Sponseller, B T; Valberg, S J

    2014-03-01

    It is hypothesised that European atypical myopathy (AM) has a similar basis as seasonal pasture myopathy in North America, which is now known to be caused by ingestion of hypoglycin A contained in seeds from the tree Acer negundo. Serum from horses with seasonal pasture myopathy contained the conjugated toxic metabolite of hypoglycin A, methylenecyclopropyl acetic acid (MCPA). Retrospective study on archived samples. 1) To determine whether MCPA-carnitine was present in serum of European horses confirmed to have AM; 2) to determine whether Acer negundo or related Acer species were present on AM pastures in Europe. Concentrations of MCPA-carnitine were analysed in banked serum samples of 17 AM horses from Europe and 3 diseased controls (tetanus, neoplasia and exertional rhabdomyolysis) using tandem mass spectrometry. Atypical myopathy was diagnosed by characteristic serum acylcarnitine profiles. Pastures of 12 AM farms were visited by experienced botanists and plant species were documented. Methylenecyclopropyl acetic acid-carnitine at high concentrations (20.39 ± 17.24 nmol/l; range 0.95-57.63 nmol/l; reference: <0.01 nmol/l) was identified in serum of AM but not disease controls (0.00 ± 0.00 nmol/l). Acer pseudoplatanus but not Acer negundo was present on all AM farms. Atypical myopathy in Europe, like seasonal pasture myopathy in North America, is highly associated with the toxic metabolite of hypoglycin A, MCPA-carnitine. This finding coupled with the presence of a tree of which seeds are known to also contain hypoglycin A indicates that ingestion of Acer pseudoplatanus is the probable cause of AM. This finding has major implications for the prevention of AM. © 2013 EVJ Ltd.

  6. Myopathy in hyperthyroidism as a consequence of rapid reduction of thyroid hormone

    Science.gov (United States)

    Li, Qianrui; Liu, Yuping; Zhang, Qianying; Tian, Haoming; Li, Jianwei; Li, Sheyu

    2017-01-01

    Abstract Rationale: Myalgia and elevated creatine kinase (CK) are occasionally observed during the treatment of hyperthyroid patients. Relative hypothyroidism resulted from rapid thyroid hormone reduction had been promoted as a plausible cause of these myopathic changes, however rarely reported. Patient concerns: We hereby presented a 20-year-old female with Grave's disease, who developed myopathy and elevated CK during rapid correction of thyroid hormone. Diagnoses: Relative hypothyroidism-induced myopathy. Interventions: Antithyroid drug (ATD) dosage was reduced without levothyroxine replacement. Outcomes: The muscular symptoms were recovered with CK level returned to normal after adoption of the euthyroid status. Lessons: Differentiation of relative hypothyroidism from other causes of myopathy, especially with the effect of ATD, is important for clinical practice, although difficult in many cases. PMID:28746208

  7. Role of Autophagy in Glycogen Breakdown and Its Relevance to Chloroquine Myopathy

    Science.gov (United States)

    Zirin, Jonathan; Nieuwenhuis, Joppe; Perrimon, Norbert

    2013-01-01

    Several myopathies are associated with defects in autophagic and lysosomal degradation of glycogen, but it remains unclear how glycogen is targeted to the lysosome and what significance this process has for muscle cells. We have established a Drosophila melanogaster model to study glycogen autophagy in skeletal muscles, using chloroquine (CQ) to simulate a vacuolar myopathy that is completely dependent on the core autophagy genes. We show that autophagy is required for the most efficient degradation of glycogen in response to starvation. Furthermore, we show that CQ-induced myopathy can be improved by reduction of either autophagy or glycogen synthesis, the latter possibly due to a direct role of Glycogen Synthase in regulating autophagy through its interaction with Atg8. PMID:24265594

  8. Elucidation of the mechanism of atorvastatin-induced myopathy in a rat model.

    Science.gov (United States)

    El-Ganainy, Samar O; El-Mallah, Ahmed; Abdallah, Dina; Khattab, Mahmoud M; Mohy El-Din, Mahmoud M; El-Khatib, Aiman S

    2016-06-01

    Myopathy is among the well documented and the most disturbing adverse effects of statins. The underlying mechanism is still unknown. Mitochondrial dysfunction related to coenzyme Q10 decline is one of the proposed theories. The present study aimed to investigate the mechanism of atorvastatin-induced myopathy in rats. In addition, the mechanism of the coenzyme Q10 protection was investigated with special focus of mitochondrial alterations. Sprague-Dawely rats were treated orally either with atorvastatin (100mg/kg) or atorvastatin and coenzyme Q10 (100mg/kg). Myopathy was assessed by measuring serum creatine kinase (CK) and myoglobin levels together with examination of necrosis in type IIB fiber muscles. Mitochondrial dysfunction was evaluated by measuring muscle lactate/pyruvate ratio, ATP level, pAkt as well as mitochondrial ultrastructure examination. Atorvastatin treatment resulted in a rise in both CK (2X) and myoglobin (6X) level with graded degrees of muscle necrosis. Biochemical determinations showed prominent increase in lactate/pyruvate ratio and a decline in both ATP (>80%) and pAkt (>50%) levels. Ultrastructure examination showed mitochondrial swelling with disrupted organelle membrane. Co-treatment with coenzyme Q10 induced reduction in muscle necrosis as well as in CK and myoglobin levels. In addition, coenzyme Q10 improved all mitochondrial dysfunction parameters including mitochondrial swelling and disruption. These results presented a model for atorvastatin-induced myopathy in rats and proved that mitochondrial dysfunction is the main contributor in statin-myopathy pathophysiology. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  9. Analysis of lipid profile in lipid storage myopathy.

    Science.gov (United States)

    Aguennouz, M'hammed; Beccaria, Marco; Purcaro, Giorgia; Oteri, Marianna; Micalizzi, Giuseppe; Musumesci, Olimpia; Ciranni, Annmaria; Di Giorgio, Rosa Maria; Toscano, Antonio; Dugo, Paola; Mondello, Luigi

    2016-09-01

    Lipid dysmetabolism disease is a condition in which lipids are stored abnormally in organs and tissues throughout the body, causing muscle weakness (myopathy). Usually, the diagnosis of this disease and its characterization goes through dosage of Acyl CoA in plasma accompanied with evidence of droplets of intra-fibrils lipids in the patient muscle biopsy. However, to understand the pathophysiological mechanisms of lipid storage diseases, it is useful to identify the nature of lipids deposited in muscle fiber. In this work fatty acids and triglycerides profile of lipid accumulated in the muscle of people suffering from myopathies syndromes was characterized. In particular, the analyses were carried out on the muscle biopsy of people afflicted by lipid storage myopathy, such as multiple acyl-coenzyme A dehydrogenase deficiency, and neutral lipid storage disease with myopathy, and by the intramitochondrial lipid storage dysfunctions, such as deficiencies of carnitine palmitoyltransferase II enzyme. A single step extraction and derivatization procedure was applied to analyze fatty acids from muscle tissues by gas chromatography with a flame ionization detector and with an electronic impact mass spectrometer. Triglycerides, extracted by using n-hexane, were analyzed by high performance liquid chromatography coupled to mass spectrometer equipped with an atmospheric pressure chemical ionization interface. The most representative fatty acids in all samples were: C16:0 in the 13-24% range, C18:1n9 in the 20-52% range, and C18:2n6 in the 10-25% range. These fatty acids were part of the most representative triglycerides in all samples. The data obtained was statistically elaborated performing a principal component analysis. A satisfactory discrimination was obtained among the different diseases. Using component 1 vs component 3 a 43.3% of total variance was explained. Such results suggest the important role that lipid profile characterization can have in supporting a correct

  10. Technological quality, mineral profile, and sensory attributes of broiler chicken breasts affected by White Striping and Wooden Breast myopathies.

    Science.gov (United States)

    Tasoniero, G; Cullere, M; Cecchinato, M; Puolanne, E; Dalle Zotte, A

    2016-11-01

    The aim of the research was to study the impact of white striping and wooden breast myopathies on the technological quality, mineral, and sensory profile of poultry meat. With this purpose, a total of 138 breasts were selected for a control group with normal breasts (N), a group of breasts characterised by white striping (WS) myopathy, and a group of breasts having both white striping and wooden breast myopathies (WSWB). Data revealed that the simultaneous presence of the two myopathies, with respect to the WS lesion individually considered, had a further detrimental effect on pH (6.04 vs. 5.96; P white striping and wooden breast myopathies. © 2016 Poultry Science Association Inc.

  11. Sarcoidosis Presenting as Löfgren’s Syndrome with Myopathy

    Directory of Open Access Journals (Sweden)

    Şenol Kobak

    2013-01-01

    Full Text Available A 34-year-old female patient, who had proximal muscle weakness for 8 months, presented with erythema nodosum lesions on the pretibial region in addition to pain, swelling, and movement restriction in both ankles for the last one month. Thoracic CT demonstrated hilar and mediastinal lymphadenopathy. She underwent mediastinoscopic lymph node biopsy; biopsy result was consistent with noncaseating granuloma. Serum angiotensin converting enzyme level and muscle enzymes have been elevated. Muscular MRI and EMG findings were consistent with myositis. Muscle biopsy was done, and myopathy was found. The patient was diagnosed with sarcoidosis, Löfgren's syndrome, and sarcoid myopathy. The patient displayed remarkable clinical and radiological regression after 6-month corticosteroid and MTX therapy.

  12. Implementation of multidimensional knowledge translation strategies to improve procedural pain in hospitalized children

    OpenAIRE

    Stevens, Bonnie J; Yamada, Janet; Promislow, Sara; Stinson, Jennifer; Harrison, Denise; Victor, J Charles

    2014-01-01

    Background Despite extensive research, institutional policies, and practice guidelines, procedural pain remains undertreated in hospitalized children. Knowledge translation (KT) strategies have been employed to bridge the research to practice gap with varying success. The most effective single or combination of KT strategies has not been found. A multifaceted KT intervention, Evidence-based Practice for Improving Quality (EPIQ), that included tailored KT strategies was effective in improving ...

  13. Ileocolonic transfer of solid chyme in small intestinal neuropathies and myopathies

    Energy Technology Data Exchange (ETDEWEB)

    Greydanus, M.P.; Camilleri, M.; Colemont, L.J.; Phillips, S.F.; Brown, M.L.; Thomforde, G.M. (Mayo Clinic and Foundation, Rochester, MN (USA))

    1990-07-01

    The aims of this study were to assess gastric emptying, small bowel transit and colonic filling in patients with motility disorders, with particular attention to the patterns of colonic filling. Gastrointestinal transit was assessed using a previously validated radiolabeled mixed meal. Fourteen patients with clinical and manometric features of chronic intestinal pseudoobstruction classified as intestinal neuropathy and 6 as intestinal myopathy, were studied. The results were compared with those from 10 healthy controls studied similarly. Gastric emptying and small bowel transit of solids were significantly slower in both groups of patients than in healthy controls (P less than 0.05). In health, the ileocolonic transit of solid chyme was characterized by intermittent bolus transfers. The mean size of boluses transferred to the colon (expressed as a percentage of ingested radiolabel) was significantly less (P less than 0.05) in patients with intestinal myopathy (10% +/- 4% (SEM)) than in healthy controls (25% +/- 4%) or in patients with intestinal neuropathy (25% +/- 4%). The intervals between bolus transfer of solids (plateaus in the colonic filling curve) were longer (P less than 0.05) in myopathies (212 +/- 89 minutes) than in health (45 +/- 7 minutes) or neuropathies (53 +/- 11 minutes). Thus, gastric emptying and small bowel transit were delayed in small bowel neuropathies and myopathies. Bolus filling of the colon was less frequent and less effective in patients with myopathic intestinal pseudoobstruction, whereas bolus transfer was preserved in patients with neuropathic intestinal pseudoobstruction.

  14. ARABIC TRANSLATION AND ADAPTATION OF THE HOSPITAL CONSUMER ASSESSMENT OF HEALTHCARE PROVIDERS AND SYSTEMS (HCAHPS) PATIENT SATISFACTION SURVEY INSTRUMENT.

    Science.gov (United States)

    Dockins, James; Abuzahrieh, Ramzi; Stack, Martin

    2015-01-01

    To translate and adapt an effective, validated, benchmarked, and widely used patient satisfaction measurement tool for use with an Arabic-speaking population. Translation of survey's items, survey administration process development, evaluation of reliability, and international benchmarking Three hundred-bed tertiary care hospital in Jeddah, Saudi Arabia. 645 patients discharged during 2011 from the hospital's inpatient care units. INTERVENTIONS; The Hospital Consumer Assessment of Healthcare Providers and Systems (HCAHPS) instrument was translated into Arabic, a randomized weekly sample of patients was selected, and the survey was administered via telephone during 2011 to patients or their relatives. Scores were compiled for each of the HCAHPS questions and then for each of the six HCAHPS clinical composites, two non-clinical items, and two global items. Clinical composite scores, as well as the two non-clinical and two global items were analyzed for the 645 respondents. Clinical composites were analyzed using Spearman's correlation coefficient and Cronbach's alpha to demonstrate acceptable internal consistency for these items and scales demonstrated acceptable internal consistency for the clinical composites. (Spearman's correlation coefficient = 0.327 - 0.750, P quarterly to US national averages with results that closely paralleled the US benchmarks. . The Arabic translation and adaptation of the HCAHPS is a valid, reliable, and feasible tool for evaluation and benchmarking of inpatient satisfaction in Arabic speaking populations.

  15. Treatment of critical illness polyneuropathy and/or myopathy - a systematic review

    DEFF Research Database (Denmark)

    Ydemann, Mogens; Eddelien, Heidi Shil; Lauritsen, Anne Øberg

    2012-01-01

    The objective was to search the literature with a view to providing a general description of critical illness myopathy/polyneuropathy (CIM/CIP), including its genesis and prevention. Furthermore, it was our aim to determine whether new treatments have occurred in the past five years.......The objective was to search the literature with a view to providing a general description of critical illness myopathy/polyneuropathy (CIM/CIP), including its genesis and prevention. Furthermore, it was our aim to determine whether new treatments have occurred in the past five years....

  16. Myopathy in Childhood Muscle-Specific Kinase Myasthenia Gravis.

    Science.gov (United States)

    Kirzinger, Lukas; Khomenko, Andrei; Schulte-Mattler, Wilhelm; Backhaus, Roland; Platen, Sabine; Schalke, Berthold

    2016-12-01

    Adult and pediatric patients suffering from MuSK (muscle-specific kinase) -antibody positive myasthenia gravis exhibit similar features to individuals with acetylcholine receptor (AChR) antibodies, but they differ in several characteristics such as a predominant bulbar, respiratory and neck weakness, a generally worse disease severity and a tendency to develop muscle atrophy. Muscle atrophy is a rare phenomenon that is usually restricted to the facial muscles. We describe a girl with MuSK-antibody positive myasthenia gravis who developed a myopathy with severe generalized muscular weakness, muscle atrophy, and myopathic changes on electromyography. This is the first published example of a generalized myopathic syndrome in myasthenia gravis. We review the relevant literature and discuss the hypothesis of a mitochondrial myopathy as a pathogenic mechanism in MuSK-antibody positive myasthenia gravis. Copyright © 2016 Elsevier Inc. All rights reserved.

  17. The genetic basis of pectoralis major myopathies in modern broiler chicken lines

    OpenAIRE

    Bailey, Richard A.; Watson, Kellie A.; Bilgili, S. F.; Avendano, Santiago

    2015-01-01

    This is the first report providing estimates of the genetic basis of breast muscle myopathies (BMM) and their relationship with growth and yield in broiler chickens. In addition, this paper addresses the hypothesis that genetic selection for increase breast yield has contributed to the onset of BMM. Data were analyzed from ongoing recording of BMM within the Aviagen breeding program. This study focused on three BMM: deep pectoral myopathy (DPM; binary trait), white striping (WS; 4 categories)...

  18. Evaluation of ubiquinone concentration and mitochondrial function relative to cerivastatin-induced skeletal myopathy in rats

    International Nuclear Information System (INIS)

    Schaefer, William H.; Lawrence, Jeffery W.; Loughlin, Amy F.; Stoffregen, Dana A.; Mixson, Lori A.; Dean, Dennis C.; Raab, Conrad E.; Yu, Nathan X.; Lankas, George R.; Frederick, Clay B.

    2004-01-01

    As a class, hydroxymethylglutaryl-coenzyme A (HMG-CoA) reductase inhibitors can potentially cause skeletal myopathy. One statin, cerivastatin, has recently been withdrawn from the market due to an unacceptably high incidence of rhabdomyolysis. The mechanism underlying statin-induced myopathy is unknown. This paper sought to investigate the relationship among statin-induced myopathy, mitochondrial function, and muscle ubiquinone levels. Rats were administered cerivastatin at 0.1, 0.5, and 1.0 (mg/kg)/day or dose vehicle (controls) by oral gavage for 15 days. Samples of type I-predominant skeletal muscle (soleus) and type II-predominant skeletal muscle [quadriceps and extensor digitorum longus (EDL)], and blood were collected on study days 5, 10, and 15 for morphological evaluation, clinical chemistry, mitochondrial function tests, and analysis of ubiquinone levels. No histological changes were observed in any of the animals on study days 5 or 10, but on study day 15, mid- and high-dose animals had necrosis and inflammation in type II skeletal muscle. Elevated creatine kinase (CK) levels in blood (a clinical marker of myopathy) correlated with the histopathological diagnosis of myopathy. Ultrastructural characterization of skeletal muscle revealed disruption of the sarcomere and altered mitochondria only in myofibers with degeneration, while adjacent myofibers were unaffected and had normal mitochondria. Thus, mitochondrial effects appeared not to precede myofiber degeneration. Mean coenzyme Q9 (CoQ9) levels in all dose groups were slightly decreased relative to controls in type II skeletal muscle, although the difference was not significantly different in most cases. Mitochondrial function in skeletal muscle was not affected by the changes in ubiquinone levels. The ubiquinone levels in high-dose-treated animals exhibiting myopathy were not significantly different from low-dose animals with no observable toxic effects. Furthermore, ubiquinone levels did not correlate

  19. Suspected myofibrillar myopathy in Arabian horses with a history of exertional rhabdomyolysis.

    Science.gov (United States)

    Valberg, S J; McKenzie, E C; Eyrich, L V; Shivers, J; Barnes, N E; Finno, C J

    2016-09-01

    Although exertional rhabdomyolysis (ER) is common in Arabian horses, there are no dedicated studies describing histopathological characteristics of muscle from Arabian horses with ER. To prospectively identify distinctive histopathological features of muscle from Arabian endurance horses with a history of ER (pro-ER) and to retrospectively determine their prevalence in archived samples from Arabian horses with exertional myopathies (retro-ER). Prospective and retrospective histopathological description. Middle gluteal muscle biopsies obtained from Arabian controls (n = 14), pro-ER (n = 13) as well as archived retro-ER (n = 25) muscle samples previously classified with type 2 polysaccharide storage myopathy (15/25), recurrent exertional rhabdomyolysis (7/25) and no pathology (3/25) were scored for histopathology and immunohistochemical staining of cytoskeletal proteins. Glutaraldehyde-fixed samples (2 pro-ER, one control) were processed for electron microscopy. Pro-ER and retro-ER groups were compared with controls using Mann-Whitney U and Fisher's exact tests. Centrally located myonuclei in mature myofibres were found in significantly more (Prhabdomyolysis, ectopic accumulation of cytoskeletal proteins and Z-disc degeneration bear a strong resemblance to a myofibrillar myopathy. While many of these horses were previously diagnosed with type 2 polysaccharide storage myopathy, pools of glycogen forming within disrupted myofibrils appeared to give the false appearance of a glycogen storage disorder. © 2015 EVJ Ltd.

  20. Mutation update and genotype-phenotype correlations of novel and previously described mutations in TPM2 and TPM3 causing congenital myopathies

    NARCIS (Netherlands)

    Marttila, Minttu; Lehtokari, Vilma-Lotta; Marston, Steven; Nyman, Tuula A.; Barnerias, Christine; Beggs, Alan H.; Bertini, Enrico; Ceyhan-Birsoy, Ozge; Cintas, Pascal; Gerard, Marion; Gilbert-Dussardier, Brigitte; Hogue, Jacob S.; Longman, Cheryl; Eymard, Bruno; Frydman, Moshe; Kang, Peter B.; Klinge, Lars; Kolski, Hanna; Lochmüller, Hans; Magy, Laurent; Manel, Véronique; Mayer, Michèle; Mercuri, Eugenio; North, Kathryn N.; Peudenier-Robert, Sylviane; Pihko, Helena; Probst, Frank J.; Reisin, Ricardo; Stewart, Willie; Taratuto, Ana Lia; de Visser, Marianne; Wilichowski, Ekkehard; Winer, John; Nowak, Kristen; Laing, Nigel G.; Winder, Tom L.; Monnier, Nicole; Clarke, Nigel F.; Pelin, Katarina; Grönholm, Mikaela; Wallgren-Pettersson, Carina

    2014-01-01

    Mutations affecting skeletal muscle isoforms of the tropomyosin genes may cause nemaline myopathy, cap myopathy, core-rod myopathy, congenital fiber-type disproportion, distal arthrogryposes, and Escobar syndrome. We correlate the clinical picture of these diseases with novel (19) and previously

  1. Mutation-specific effects on thin filament length in thin filament myopathy.

    Science.gov (United States)

    Winter, Josine M de; Joureau, Barbara; Lee, Eun-Jeong; Kiss, Balázs; Yuen, Michaela; Gupta, Vandana A; Pappas, Christopher T; Gregorio, Carol C; Stienen, Ger J M; Edvardson, Simon; Wallgren-Pettersson, Carina; Lehtokari, Vilma-Lotta; Pelin, Katarina; Malfatti, Edoardo; Romero, Norma B; Engelen, Baziel G van; Voermans, Nicol C; Donkervoort, Sandra; Bönnemann, C G; Clarke, Nigel F; Beggs, Alan H; Granzier, Henk; Ottenheijm, Coen A C

    2016-06-01

    Thin filament myopathies are among the most common nondystrophic congenital muscular disorders, and are caused by mutations in genes encoding proteins that are associated with the skeletal muscle thin filament. Mechanisms underlying muscle weakness are poorly understood, but might involve the length of the thin filament, an important determinant of force generation. We investigated the sarcomere length-dependence of force, a functional assay that provides insights into the contractile strength of muscle fibers as well as the length of the thin filaments, in muscle fibers from 51 patients with thin filament myopathy caused by mutations in NEB, ACTA1, TPM2, TPM3, TNNT1, KBTBD13, KLHL40, and KLHL41. Lower force generation was observed in muscle fibers from patients of all genotypes. In a subset of patients who harbor mutations in NEB and ACTA1, the lower force was associated with downward shifted force-sarcomere length relations, indicative of shorter thin filaments. Confocal microscopy confirmed shorter thin filaments in muscle fibers of these patients. A conditional Neb knockout mouse model, which recapitulates thin filament myopathy, revealed a compensatory mechanism; the lower force generation that was associated with shorter thin filaments was compensated for by increasing the number of sarcomeres in series. This allowed muscle fibers to operate at a shorter sarcomere length and maintain optimal thin-thick filament overlap. These findings might provide a novel direction for the development of therapeutic strategies for thin filament myopathy patients with shortened thin filament lengths. Ann Neurol 2016;79:959-969. © 2016 American Neurological Association.

  2. Unfolded protein response and activated degradative pathways regulation in GNE myopathy.

    Directory of Open Access Journals (Sweden)

    Honghao Li

    Full Text Available Although intracellular beta amyloid (Aβ accumulation is known as an early upstream event in the degenerative course of UDP-N-acetylglucosamine 2-epimerase/N-acetylmannosamine kinase (GNE myopathy, the process by which Aβdeposits initiate various degradative pathways, and their relationship have not been fully clarified. We studied the possible secondary responses after amyloid beta precursor protein (AβPP deposition including unfolded protein response (UPR, ubiquitin proteasome system (UPS activation and its correlation with autophagy system. Eight GNE myopathy patients and five individuals with normal muscle morphology were included in this study. We performed immunofluorescence and immunoblotting to investigate the expression of AβPP, phosphorylated tau (p-tau and endoplasmic reticulum molecular chaperones. Proteasome activities were measured by cleavage of fluorogenic substrates. The expression of proteasome subunits and linkers between proteasomal and autophagy systems were also evaluated by immunoblotting and relative quantitative real-time RT-PCR. Four molecular chaperones, glucose-regulated protein 94 (GRP94, glucose-regulated protein 78 (GRP78, calreticulin and calnexin and valosin containing protein (VCP were highly expressed in GNE myopathy. 20S proteasome subunits, three main proteasome proteolytic activities, and the factors linking UPS and autophagy system were also increased. Our study suggests that AβPP deposition results in endoplasmic reticulum stress (ERS and highly expressed VCP deliver unfolded proteins from endoplasmic reticulum to proteosomal system which is activated in endoplasmic reticulum associated degradation (ERAD in GNE myopathy. Excessive ubiquitinated unfolded proteins are exported by proteins that connect UPS and autophagy to autophagy system, which is activated as an alternative pathway for degradation.

  3. Lipid storage myopathy with clinical markers of Marfan syndrome: A rare association

    Directory of Open Access Journals (Sweden)

    Subasree Ramakrishnan

    2012-01-01

    Full Text Available Disorders of lipid metabolism can cause variable clinical presentations, often involving skeletal muscle, alone or together with other tissues. A 19-year-old boy presented with a 2-year history of muscle pain, cramps, exercise intolerance and progressive weakness of proximal lower limbs. Examination revealed skeletal markers of Marfan syndrome in the form of increased arm span compared with height, Kyphoscoliois, moderate pectus excavatum, high arched palate and wrist sign. He also had mild neck flexor weakness and proximal lower limb weakness with areflexia. Pathologic findings revealed lipid-laden fine vacuoles in the muscle fibers. Possibility of carnitine deficiency myopathy was considered and the patient was started on carnitine and Co Q. The patient made remarkable clinical improvement over the next 2 months. This case is reported for rarity of the association of clinical markers of Marfan syndrome and lipid storage myopathy and sparse literature on lipid storage myopathy in the Indian context.

  4. Hypothyroid myopathy. A clinical and pathologaical study.

    Science.gov (United States)

    McKeran, R O; Slavin, G; Ward, P; Paul, E; Mair, W G

    1980-09-01

    Ten patients with varying degrees of hypothroid myopathy were studied clinically and by serial percutaneous needle muscle biopsies before and during treatment with L-thyroxine. The biochemical evidence of hypothyroidism was related to the severity of the myopathic and signs before treatment. The severity of myopathic symptoms before and during treatment correlated with the biochemical evidence of hypothyrodism, a type II fibre atrophy and increased central nuclear counts. Likewise, the clinical evidence of a myopathy before and during treatment was correlated with both a type II fibre atrophy and loss and increased central nuclear counts but was not related to the biochemical parameters of hypothyroidism, except the level of thyroid stimulating hormone. In the muscle, before and during treatment, of the two most severely affected patients, intracellular glycogen inclusions were seen in scattered muscle fibres. On light microscopy and on electronmicroscopy, numerous mitochondria were seen responding to L-thyroxine with accumulations of subsarcolemmal honey-combing. Vesicular abnormalities, an electron dense matrix or occasional crystalline deposits were seen in muscle mitochondria from less severely azffected patients. Severely myopathic muscle contained excessive glycogen, membrane bound glycogen and excess lipid in a mainly perinuclear distribution. Occasional myelin and membranous bodies were seen and satellite cells during the recovery phase. A group of patients with hypothyroid myopathy who are likely to have a delayed recovery of full muscle strength on L-thyroxine may be recognised by the presence of severe proximal muscle weakness and characteristic changes on histochemical and electronmicroscopic examination of muscle. The spectrum of histochemical and electronmicroscopic abnormalities of muscle revealed with increasing degree of hypothyrodism, suggests that a generally reversible acquired glycogen storage and mictochondrial disorder is an important feature

  5. Genetics Home Reference: early-onset myopathy with fatal cardiomyopathy

    Science.gov (United States)

    ... in childhood, people with EOMFC may also develop joint deformities called contractures that restrict the movement of ... Home Edition for Patients and Caregivers: Dilated Cardiomyopathy Neuromuscular Disease Center, Washington University Orphanet: Early-onset myopathy ...

  6. Statin induced myopathy presenting as mechanical musculoskeletal pain observed in two chiropractic patients

    OpenAIRE

    Rodine, Robert J; Tibbles, Anthony C; Kim, Peter SY; Alikhan, Neetan

    2010-01-01

    Lipid lowering drugs, such as statins, are commonly used to treat approximately 10 million Canadians affected by hypercholesterolemia. The most commonly experienced side-effect of statin medication is muscle pain. Statin induced myopathy consists of a spectrum of myopathic disorders ranging from mild myalgia to fatal rhabdomyolysis. The following is a presentation of 2 cases of statin induced myopathy in patients presenting in a chiropractic setting. In addition, discussion will surround the ...

  7. Eosinophilic fasciitis in a child mimicking a myopathy.

    NARCIS (Netherlands)

    Pillen, S.; Engelen, B.G.M. van; Hoogen, F.H.J. van den; Fiselier, T.J.W.; Vossen, P. van der; Drost, G.

    2006-01-01

    A 14-year-old boy was suspected of having a myopathy with joint contractures. He presented with progressive painless joint contractures of his right wrist and fingers, and reduced muscle strength of his right arm, without obvious skin changes. Laboratory investigation showed a normal CK,

  8. Genetics Home Reference: CAV3-related distal myopathy

    Science.gov (United States)

    ... gene causes a peculiar form of distal myopathy. Neurology. 2002 Jan 22;58(2):323-5. Erratum in: Neurology 2002 Mar 12;58(5):839. Itoyoma Y [ ... 3 cause four distinct autosomal dominant muscle diseases. Neurology. 2004 Feb 24;62(4):538-43. Review. ...

  9. Myopathy in hyperthyroidism as a consequence of rapid reduction of thyroid hormone: A case report.

    Science.gov (United States)

    Li, Qianrui; Liu, Yuping; Zhang, Qianying; Tian, Haoming; Li, Jianwei; Li, Sheyu

    2017-07-01

    Myalgia and elevated creatine kinase (CK) are occasionally observed during the treatment of hyperthyroid patients. Relative hypothyroidism resulted from rapid thyroid hormone reduction had been promoted as a plausible cause of these myopathic changes, however rarely reported. We hereby presented a 20-year-old female with Grave's disease, who developed myopathy and elevated CK during rapid correction of thyroid hormone. Relative hypothyroidism-induced myopathy. Antithyroid drug (ATD) dosage was reduced without levothyroxine replacement. The muscular symptoms were recovered with CK level returned to normal after adoption of the euthyroid status. Differentiation of relative hypothyroidism from other causes of myopathy, especially with the effect of ATD, is important for clinical practice, although difficult in many cases.

  10. Delirium assessment in hospitalized elderly patients: Italian translation and validation of the nursing delirium screening scale.

    Science.gov (United States)

    Spedale, Valentina; Di Mauro, Stefania; Del Giorno, Giulia; Barilaro, Monica; Villa, Candida E; Gaudreau, Jean D; Ausili, Davide

    2017-08-01

    Delirium has a high incidence pathology associated with negative outcomes. Although highly preventable, half the cases are not recognized. One major cause of delirium misdiagnosis is the absence of a versatile instrument to measure it. Our objective was to translate the nursing delirium screening scale (Nu-DESC) and evaluate its performance in Italian settings. This was a methodological study conducted in two sequential phases. The first was the Italian translation of Nu-DESC through a translation and back-translation process. The second aimed to test the inter-rater reliability, the sensibility and specificity of the instrument on a convenience sample of 101 hospitalized elderly people admitted to relevant wards of the San Gerardo Hospital in Monza. To evaluate the inter-rater reliability, two examiners tested Nu-DESC on 20 patients concurrently without comparison. To measure the sensibility and specificity of Nu-DESC, the confusion assessment method was used as a gold standard measure. The inter-rater reliability (Cohen Kappa) was 0.87-an excellent agreement between examiners. The study of the ROC curve showed an AUC value of 0.9461 suggesting high test accuracy. Using 3 as a cut-off value, Nu-DESC showed 100 % sensibility and 76 % specificity. Further research is needed to test Nu-DESC on a larger sample. However, based on our results, Nu-DESC can be used in research and clinical practice in Italian settings because of its very good and similar performances to previous validation studies. The value of 3 appears to be the optimal cut-off in the Italian context.

  11. [Value of MRI in the treatment of Grave's disease orbital myopathy].

    Science.gov (United States)

    Oğuz, V; Yolar, M; Yetik, H; Cakirer, D; Uysal, O; Pazarli, H

    2001-10-01

    In order to evaluate the predictability of the results in the treatment of myopathy in cases with the clinical signs of muscle involvement, 177 extraocular muscles of 27 cases whose oedematous status was detected by MRI and who were given antiinflammatory treatment according to the data of this method, were studied. The nature of involvement was detected in respect with the signal intensity and thickness of each rectus muscle prior to the treatment and at the end of the sixth month following a three months' application of combined treatment of steroids and irradiation of 2000 rads. When the initial and final results were compared, the signal intensities of four involved recti showed significant decrease at the end of the treatment, as they were evaluated separately or together. Besides the thicknesses of these groups of involved recti which were evaluated separately showed significant decrease. The evaluation of the signal intensities by MRI is a way that enables noninvasive detection of the edema and prediction of the anti-inflammatory treatment's results of dysthyroid myopathy. Therefore a systematic follow up by MRI is recommended for the treatment choice in dysthyroid myopathy.

  12. Miopatia ocular descendente Descending ocular myopathy: a case report

    Directory of Open Access Journals (Sweden)

    Marcos R. G. de Freitas

    1975-06-01

    Full Text Available Os autores apresentam caso de paciente jovem, do sexo feminino, com afecção muscular primária ocular e faríngea sem caráter familial. Foram feitos estudos eletromiográficos e histopatológicos musculares que confirmam o caráter miogênico do processo. É feita comparação entre a miopatia ocular e a miopatia ocular descendente, acreditando os autores que seriam variantesThe case of a 23 years old female patient, with primary involvement of the extraocular and faringeal muscles without familiar history is reported. Electromyographic and muscular biopsy studies proved the myogenic nature of the process. A clinical comparison between the ocular myopathy and the descending ocular myopathy is made, the authors thinking that both of them would be variants of the same muscle disease.

  13. Novel duplication mutation of the DYSF gene in a Pakistani family with Miyoshi Myopathy

    Directory of Open Access Journals (Sweden)

    Muhammad I. Ullah

    2017-12-01

    Full Text Available Objectives: To identify the underlying gene mutation in a large consanguineous Pakistani family. Methods: This is an observational descriptive study carried out at the Department of Biochemistry, Shifa International Hospital, Quaid-i-Azam University, and Atta-ur-Rahman School of Applied Biosciences, National University of Sciences and Technology, Islamabad, Pakistan from 2013-2016. Genomic DNA of all recruited family members was extracted and the Trusight one sequencing panel was used to assess genes associated with a neuro-muscular phenotype. Comparative modeling of mutated and wild-type protein was carried out by PyMOL tool. Results: Clinical investigations of an affected individual showed typical features of Miyoshi myopathy (MM like elevated serum creatine kinase (CK levels, distal muscle weakness, myopathic changes in electromyography (EMG and muscle histopathology. Sequencing with the Ilumina Trusight one sequencing panel revealed a novel 22 nucleotide duplication (CTTCAACTTGTTTGACTCTCCT in the DYSF gene (NM_001130987.1_c.897-918dup; p.Gly307Leufs5X, which results in a truncating frameshift mutation and perfectly segregated with the disease in this family. Protein modeling studies suggested a disruption in spatial configuration of the putative mutant protein. Conclusion: A novel duplication of 22 bases (c.897_918dup; p.Gly307Leufs5X in the DYSF gene was identified in a family suffering from Miyoshi myopathy. Protein homology analysis proposes a disruptive impact of this mutation on protein function.

  14. Enhancing the quality of oral nutrition support for hospitalized patients: a mixed methods knowledge translation study (The EQONS study).

    Science.gov (United States)

    Gerrish, Kate; Laker, Sara; Taylor, Carolyn; Kennedy, Fiona; McDonnell, Ann

    2016-12-01

    The aim of this study was to report a multifaceted knowledge translation intervention to facilitate use of the Malnutrition Universal Screening Tool and innovation in nutritional care for patients at risk of malnutrition. Malnutrition among hospitalized patients is a widespread problem leading to adverse health outcomes. Despite evidence of the benefits of malnutrition screening and recommendations for achieving good nutrition, shortfalls in practice continue. A mixed method integrated knowledge translation study. The knowledge translation intervention comprised nutrition champions supported by knowledge translation facilitators and an action planning process. Data collection was undertaken over 18 months between 2011-2012 in a hospital in England. Data comprised observation of mealtimes, audit of patient records, survey of nurses and semi-structured interviews with nutrition champions, knowledge translation facilitators, senior ward nurses and nurse managers. Statistically significant relationships (Chi Square) were observed between self-reported confidence of nurses (a) to assess patients using the Malnutrition Universal Screening Tool, (b) to teach colleagues how to use the Malnutrition Universal Screening Tool and (c) to ensure that patients were assessed within 24 hours of admission. Ward-based nutrition champions facilitated successful innovation in nutrition support. Contextual factors operating at micro (ward), meso (organization) and macro (healthcare system) levels acted as barriers and enablers for change. Nutrition champions were successful in increasing the timely assessment of patients at risk of malnutrition and promoting innovation in nutritional care. Support from knowledge translation facilitators helped nutrition champions develop their role and work collaboratively with senior ward nurses to implement action plans for improving nutrition. © 2016 John Wiley & Sons Ltd.

  15. Opposed-phase MR imaging of lipid storage myopathy in a case of Chanarin-Dorfman disease

    International Nuclear Information System (INIS)

    Gaeta, Michele; Celona, Antonio; Racchiusa, Sergio; Mazziotti, Silvio; Minutoli, Fabio; Toscano, Antonio; Musumeci, Olimpia

    2008-01-01

    Chanarin-Dorfman disease (CDD) is a rare genetic disorder characterized by ichthyosis, myopathy, central nervous system disturbances, and intracellular lipid storage in muscle fibers, hepatocytes, and granulocytes. We describe skeletal muscle magnetic resonance imaging findings in a case of CDD, outlining the potential role of GE T1-weighted opposed-phase sequence (chemical shift imaging) in the evaluation of lipid storage myopathies. (orig.)

  16. Opposed-phase MR imaging of lipid storage myopathy in a case of Chanarin-Dorfman disease

    Energy Technology Data Exchange (ETDEWEB)

    Gaeta, Michele; Celona, Antonio; Racchiusa, Sergio; Mazziotti, Silvio [University of Messina, Department of Radiological Sciences, Messina (Italy); Minutoli, Fabio [University of Messina, Department of Radiological Sciences, Messina (Italy); A.O.U. ' ' Policlinico G. Martino' ' , Dipartimento di Scienze Radiologiche, Messina (Italy); Toscano, Antonio; Musumeci, Olimpia [University of Messina, Department of Neurosciences, Psychiatry and Anaesthesiology, Messina (Italy)

    2008-11-15

    Chanarin-Dorfman disease (CDD) is a rare genetic disorder characterized by ichthyosis, myopathy, central nervous system disturbances, and intracellular lipid storage in muscle fibers, hepatocytes, and granulocytes. We describe skeletal muscle magnetic resonance imaging findings in a case of CDD, outlining the potential role of GE T1-weighted opposed-phase sequence (chemical shift imaging) in the evaluation of lipid storage myopathies. (orig.)

  17. Whole-body MRI for full assessment and characterization of diffuse inflammatory myopathy

    Directory of Open Access Journals (Sweden)

    Saleh Saleh Elessawy

    2016-09-01

    Full Text Available Background Conventional magnetic resonance imaging (MRI is a highly valuable tool for full assessment of the extent of bilateral symmetrical diffuse inflammatory myopathy, owing to its high sensitivity in the detection of edema which correlates with, and sometimes precedes, clinical findings. Purpose To evaluate the use of whole-body (WB-MRI in characterization and full assessment of the extent and distribution of diffuse inflammatory myopathy. Material and Methods A prospective study on 15 patients presenting with clinical evidence of inflammatory myopathy. It included 4 boys/men and 11 girls/women (age range, 6–44 years; mean age, 25.5 years. 1.5 T WB-MRI was performed and the distribution and extent of disease severity was assessed according to muscle edema on STIR images. Results Four cases of dermatomyositis showed lower limb disease predilection with edema in gluteal, thigh, and calf muscles. The same finding was seen in one case with recurrent polymyositis and three cases with overlap myositis with systemic lupus erythematosus (SLE. Bilateral upper and lower limb myositis was demonstrated in three cases of polymyositis and one case of overlap myositis with scleroderma. Bilateral edema involving all scanned muscle groups was detected in three cases of polymyositis with paraneoplastic syndrome, SLE, and severe active dermatomyositis (including the neck muscles. Conclusion WB-MRI is the diagnostic modality of choice for cases of inflammatory myopathy. It accurately detects the most severely affected muscles candidate for biopsy and provides a reliable baseline study for follow-up of disease progression as well as response to treatment.

  18. The effect of coenzyme Q10 in statin myopathy.

    Science.gov (United States)

    Zlatohlavek, Lukas; Vrablik, Michal; Grauova, Barbora; Motykova, Eva; Ceska, Richard

    2012-01-01

    Statins significantly reduce CV morbidity and mortality. Unfortunately, one of the side effects of statins is myopathy, for which statins cannot be administered in sufficient doses or administered at all. The aim of this study was to demonstrate the effect of coenzyme Q10 in patients with statin myopathy. Twenty eight patients aged 60.6±10.7 years were monitored (18 women and 10 men) and treated with different types and doses of statin. Muscle weakness and pain was monitored using a scale of one to ten, on which patients expressed the degree of their inconvenience. Examination of muscle problems was performed prior to administration of CQ10 and after 3 and 6 months of dosing. Statistical analysis was performed using Friedman test, Annova and Students t-test. Pain decreased on average by 53.8% (pmuscle weakness by 44.4% (pmuscle pain and sensitivity statistically significantly decreased.

  19. Mutations in the collagen XII gene define a new form of extracellular matrix-related myopathy.

    Science.gov (United States)

    Hicks, Debbie; Farsani, Golara Torabi; Laval, Steven; Collins, James; Sarkozy, Anna; Martoni, Elena; Shah, Ashoke; Zou, Yaqun; Koch, Manuel; Bönnemann, Carsten G; Roberts, Mark; Lochmüller, Hanns; Bushby, Kate; Straub, Volker

    2014-05-01

    Bethlem myopathy (BM) [MIM 158810] is a slowly progressive muscle disease characterized by contractures and proximal weakness, which can be caused by mutations in one of the collagen VI genes (COL6A1, COL6A2 and COL6A3). However, there may be additional causal genes to identify as in ∼50% of BM cases no mutations in the COL6 genes are identified. In a cohort of -24 patients with a BM-like phenotype, we first sequenced 12 candidate genes based on their function, including genes for known binding partners of collagen VI, and those enzymes involved in its correct post-translational modification, assembly and secretion. Proceeding to whole-exome sequencing (WES), we identified mutations in the COL12A1 gene, a member of the FACIT collagens (fibril-associated collagens with interrupted triple helices) in five individuals from two families. Both families showed dominant inheritance with a clinical phenotype resembling classical BM. Family 1 had a single-base substitution that led to the replacement of one glycine residue in the triple-helical domain, breaking the Gly-X-Y repeating pattern, and Family 2 had a missense mutation, which created a mutant protein with an unpaired cysteine residue. Abnormality at the protein level was confirmed in both families by the intracellular retention of collagen XII in patient dermal fibroblasts. The mutation in Family 2 leads to the up-regulation of genes associated with the unfolded protein response (UPR) pathway and swollen, dysmorphic rough-ER. We conclude that the spectrum of causative genes in extracellular matrix (ECM)-related myopathies be extended to include COL12A1.

  20. Aerobic Training in Patients with Congenital Myopathy

    DEFF Research Database (Denmark)

    Hedermann, Gitte; Vissing, Christoffer Rasmus; Jensen, Karen

    2016-01-01

    INTRODUCTION: Congenital myopathies (CM) often affect contractile proteins of the sarcomere, which could render patients susceptible to exercise-induced muscle damage. We investigated if exercise is safe and beneficial in patients with CM. METHODS: Patients exercised on a stationary bike for 30......: The Regional Committee on Health Research Ethics of the Capital Region of Denmark H-2-2013-066 and ClinicalTrials.gov H2-2013-066....

  1. Muscle imaging in patients with tubular aggregate myopathy caused by mutations in STIM1

    DEFF Research Database (Denmark)

    Tasca, Giorgio; D'Amico, Adele; Monforte, Mauro

    2015-01-01

    Tubular aggregate myopathy is a genetically heterogeneous disease characterized by tubular aggregates as the hallmark on muscle biopsy. Mutations in STIM1 have recently been identified as one genetic cause in a number of tubular aggregate myopathy cases. To characterize the pattern of muscle...... involvement in this disease, upper and lower girdles and lower limbs were imaged in five patients with mutations in STIM1, and the scans were compared with two patients with tubular aggregate myopathy not caused by mutations in STIM1. A common pattern of involvement was found in STIM1-mutated patients...... of thigh and posterior leg with sparing of gracilis, tibialis anterior and, to a lesser extent, short head of biceps femoris. Mutations in STIM1 are associated with a homogeneous involvement on imaging despite variable clinical features. Muscle imaging can be useful in identifying STIM1-mutated patients...

  2. Radiological features of Paget disease of bone associated with VCP myopathy

    Energy Technology Data Exchange (ETDEWEB)

    Farpour, Farzin [University of California, Department of Radiology, VA Long Beach Health Care, Irvine, CA (United States); Queens Hospital Center, Mount Sinai School of Medicine, New York, NY (United States); Tehranzadeh, Jamshid [University of California, Department of Radiology, VA Long Beach Health Care, Irvine, CA (United States); Donkervoort, Sandra; Vanjara, Pari [University of California, Division of Genetics and Metabolism, Department of Pediatrics, Irvine, CA (United States); Smith, Charles [University of Kentucky, Department of Neurology and Sanders-Brown Center on Aging, Lexington, KY (United States); Martin, Barbara [University of Kentucky, Lexington, KY (United States); Osann, Kathryn [University of California, Department of Medicine, Division of Hematology/Oncology, Irvine, CA (United States); Kimonis, Virginia E. [University of California, Division of Genetics and Metabolism, Department of Pediatrics, Irvine, CA (United States); UC Irvine Medical Center, Division of Genetics and Metabolism, Orange, CA (United States)

    2012-03-15

    Mutations in the Valosin-containing protein (VCP) gene cause a unique disorder characterized by classic Paget disease of bone (PDB), inclusion body myopathy, and frontotemporal dementia (IBMPFD). Our objective was to analyze the radiographic features of PDB associated with VCP mutations since there is a dearth of literature on the PDB component of VCP disease. Radiographic bone surveys were examined in 23 individuals with VCP mutation and compared with their unaffected relatives. Laboratory testing relevant for VCP disease was performed in all individuals. Of the 17 affected individuals with clinical manifestations of VCP disease, 16 of whom had myopathy, radiographic analysis revealed classic PDB in 11 individuals (65%). The mean age of diagnosis for myopathy was 43.8 years and for PDB was 38.1 years of age. Radiological evidence of PDB was seen in one individual (16%) amongst six clinically asymptomatic VCP mutation carriers. Alkaline phosphatase was a useful marker for diagnosing PDB in VCP disease. Radiographic findings of classic PDB are seen in 52% of individuals carrying VCP mutations at a significantly younger age than conventional PDB. Screening for PDB is warranted in at-risk individuals because of the benefit of early treatment with the new powerful bisphosphonates that hold the potential for prevention of disease. (orig.)

  3. Hereditary vacuolar internal anal sphincter myopathy causing proctalgia fugax and constipation: a new case contribution.

    Science.gov (United States)

    de la Portilla, Fernando; Borrero, Juan José; Rafel, Enrique

    2005-03-01

    Hereditary anal sphincter myopathy is rare. We present a family with one affected member with proctalgia fugax, constipation and internal anal sphincter hypertrophy. Ultrastructural findings show vacuolization of smooth muscle cells without the characteristic polyglucosan inclusion. Further relief of symptoms was obtained using an oral calcium antagonist. Based on clinical presentation, endosonography and morphological findings, we consider our case is a histological variant of the vacuolar myopathy originally described.

  4. Whole-body MRI in adult inflammatory myopathies: Do we need imaging of the trunk?

    International Nuclear Information System (INIS)

    Filli, Lukas; Manoliu, Andrei; Andreisek, Gustav; Guggenberger, Roman; Maurer, Britta

    2015-01-01

    To evaluate whether imaging of the trunk could be omitted in patients with inflammatory myopathies without losing diagnostic accuracy using a restricted whole-body magnetic resonance imaging (rWB-MRI) protocol. After approval by the institutional review board, this study was performed in 63 patients (male/female, 13/50; median age, 52 years; range, 20-81 years) with new-onset myopathic symptoms (group 1, n = 41) or previously diagnosed inflammatory myopathy (group 2, n = 22). After performing whole-body MRI (WB-MRI) at 3.0 Tesla, myositis and fatty atrophy were evaluated in different muscles by two independent radiologists. The intra-class correlation coefficient (ICC) was calculated to evaluate inter-observer reliability. Acquisition time was 56:01 minutes for WB-MRI and 37:37 minutes (32.8 % shorter) for rWB-MRI. In group 1, 14 patients were diagnosed with inflammatory myopathy based on muscle biopsy. rWB-MRI and WB-MRI showed equal sensitivity (42.9 %) and specificity (100 %) for myositis, and showed equal sensitivity (71.4 %) and similar specificity (63.0 % and 48.1 %, respectively) for fatty atrophy. No myositis was found in the body trunk in any patient. Inter-observer reliability was between substantial and perfect (ICC, 0.77-1.00). rWB-MRI showed diagnostic accuracy similar to WB-MRI for inflammatory myopathy at markedly reduced overall acquisition time. (orig.)

  5. Whole-body MRI in adult inflammatory myopathies: Do we need imaging of the trunk?

    Energy Technology Data Exchange (ETDEWEB)

    Filli, Lukas; Manoliu, Andrei; Andreisek, Gustav; Guggenberger, Roman [University Hospital Zurich, University of Zurich, Institute of Diagnostic and Interventional Radiology, Zurich (Switzerland); Maurer, Britta [University Hospital Zurich, University of Zurich, Division of Rheumatology, Zurich (Switzerland)

    2015-12-15

    To evaluate whether imaging of the trunk could be omitted in patients with inflammatory myopathies without losing diagnostic accuracy using a restricted whole-body magnetic resonance imaging (rWB-MRI) protocol. After approval by the institutional review board, this study was performed in 63 patients (male/female, 13/50; median age, 52 years; range, 20-81 years) with new-onset myopathic symptoms (group 1, n = 41) or previously diagnosed inflammatory myopathy (group 2, n = 22). After performing whole-body MRI (WB-MRI) at 3.0 Tesla, myositis and fatty atrophy were evaluated in different muscles by two independent radiologists. The intra-class correlation coefficient (ICC) was calculated to evaluate inter-observer reliability. Acquisition time was 56:01 minutes for WB-MRI and 37:37 minutes (32.8 % shorter) for rWB-MRI. In group 1, 14 patients were diagnosed with inflammatory myopathy based on muscle biopsy. rWB-MRI and WB-MRI showed equal sensitivity (42.9 %) and specificity (100 %) for myositis, and showed equal sensitivity (71.4 %) and similar specificity (63.0 % and 48.1 %, respectively) for fatty atrophy. No myositis was found in the body trunk in any patient. Inter-observer reliability was between substantial and perfect (ICC, 0.77-1.00). rWB-MRI showed diagnostic accuracy similar to WB-MRI for inflammatory myopathy at markedly reduced overall acquisition time. (orig.)

  6. Statin myopathy: the fly in the ointment for the prevention of cardiovascular disease in the 21st century?

    Science.gov (United States)

    Keen, Helen I; Krishnarajah, Janakan; Bates, Timothy R; Watts, Gerald F

    2014-09-01

    Cardiovascular disease (CVD) remains the leading cause of death in industrialized nations. Despite clear evidence of CVD risk reduction with HMG-CoA reductase inhibitors (statins), the side effects of these medications, particularly myopathy, limit their effectiveness. Studies into the mechanisms, aetiology and management of statin myopathy are limited by lack of an internationally agreed clinical definition and tools for assessing outcomes. Currently there is a paucity of evidence to guide the management of patients affected by statin myopathy; with the exception of dose reduction, there is little evidence that other strategies can improve statin tolerance, and even less evidence to suggest these alternate dosing strategies reduce cardiovascular risk. This review will cover current definitions, clinical presentations, risk factors, pathogenesis and management. PubMed was searched (English language, to 2014) for key articles pertaining to statin myopathy. This review then briefly describes our experience of managing this condition in a tertiary lipid disorders clinic, in the setting of limited guiding evidence. Knowledge gaps in the field of statin myopathy are identified and future research directions are suggested. We urge the need for international attention to address this important, but largely neglected clinical problem, that if unresolved will remain an impediment to the effective prevention and treatment of CVD.

  7. Actin Nemaline Myopathy Mouse Reproduces Disease, Suggests Other Actin Disease Phenotypes and Provides Cautionary Note on Muscle Transgene Expression

    Science.gov (United States)

    Ravenscroft, Gianina; Jackaman, Connie; Sewry, Caroline A.; McNamara, Elyshia; Squire, Sarah E.; Potter, Allyson C.; Papadimitriou, John; Griffiths, Lisa M.; Bakker, Anthony J.; Davies, Kay E.; Laing, Nigel G.; Nowak, Kristen J.

    2011-01-01

    Mutations in the skeletal muscle α-actin gene (ACTA1) cause congenital myopathies including nemaline myopathy, actin aggregate myopathy and rod-core disease. The majority of patients with ACTA1 mutations have severe hypotonia and do not survive beyond the age of one. A transgenic mouse model was generated expressing an autosomal dominant mutant (D286G) of ACTA1 (identified in a severe nemaline myopathy patient) fused with EGFP. Nemaline bodies were observed in multiple skeletal muscles, with serial sections showing these correlated to aggregates of the mutant skeletal muscle α-actin-EGFP. Isolated extensor digitorum longus and soleus muscles were significantly weaker than wild-type (WT) muscle at 4 weeks of age, coinciding with the peak in structural lesions. These 4 week-old mice were ∼30% less active on voluntary running wheels than WT mice. The α-actin-EGFP protein clearly demonstrated that the transgene was expressed equally in all myosin heavy chain (MHC) fibre types during the early postnatal period, but subsequently became largely confined to MHCIIB fibres. Ringbinden fibres, internal nuclei and myofibrillar myopathy pathologies, not typical features in nemaline myopathy or patients with ACTA1 mutations, were frequently observed. Ringbinden were found in fast fibre predominant muscles of adult mice and were exclusively MHCIIB-positive fibres. Thus, this mouse model presents a reliable model for the investigation of the pathobiology of nemaline body formation and muscle weakness and for evaluation of potential therapeutic interventions. The occurrence of core-like regions, internal nuclei and ringbinden will allow analysis of the mechanisms underlying these lesions. The occurrence of ringbinden and features of myofibrillar myopathy in this mouse model of ACTA1 disease suggests that patients with these pathologies and no genetic explanation should be screened for ACTA1 mutations. PMID:22174871

  8. Nemaline myopathy and heart failure: role of ivabradine; a case report.

    Science.gov (United States)

    Sarullo, Filippo M; Vitale, Giuseppe; Di Franco, Antonino; Sarullo, Silvia; Salerno, Ylenia; Vassallo, Laura; Baviera, Emanuela Petrona; Marazia, Stefania; Mandalà, Giorgio; Lanza, Gaetano A

    2015-01-19

    Nemaline myopathy (NM) is a rare congenital myopathy characterized by muscle weakness, hypotonia and the presence in muscle fibers of inclusions known as nemaline bodies and a wide spectrum of clinical phenotypes, ranging from severe forms with neonatal onset to asymptomatic forms. The adult-onset form is heterogeneous in terms of clinical presentation and disease progression. Cardiac involvement occurs in the minority of cases and little is known about medical management in this subgroup of NM patients. We report a rare case of heart failure (HF) in a patient with adult-onset NM in whom ivabradine proved to be able to dramatically improve the clinical picture. We report a case of a 37-year-old man with adult-onset NM, presenting with weakness and hypotonia of the proximal limb muscles and shoulder girdle, severely limiting daily activities. He developed progressive HF over a period of 6 months while attending a rehabilitation program, with reduced left ventricular ejection fraction (LVEF = 20%), manifested by dyspnea and signs of systemic congestion. The patient was started HF therapy with enalapril, carvedilol, spironolactone and loop diuretics. Target HF doses of these drugs (including carvedilol) were not reached because of symptomatic hypotension causing a high resting heart rate (HR) ≥70 beats per minute (bpm). Further deterioration of the clinical picture occurred with several life-threatening arrhythmic episodes requiring external defibrillation. An implantable cardioverter defibrillator (ICD) was then implanted. Persistent high resting HR was successfully treated with ivabradine with HR lowering from 90 bpm to 55 bpm at 1 month follow up, LVEF rising to 50% at 3 month follow up and to 54% at 2,5 year follow up. To date no more hospitalizations for heart failure occurred. A single hospitalization due to aspiration pneumonia required insertion of a tracheostomy tube to protect airways from further aspiration. At present, the patient is attending

  9. Evaluating the Atrial Myopathy Underlying Atrial Fibrillation: Identifying the Arrhythmogenic and Thrombogenic Substrate

    Science.gov (United States)

    Goldberger, Jeffrey J.; Arora, Rishi; Green, David; Greenland, Philip; Lee, Daniel C.; Lloyd-Jones, Donald M.; Markl, Michael; Ng, Jason; Shah, Sanjiv J.

    2015-01-01

    Atrial disease or myopathy forms the substrate for atrial fibrillation (AF) and underlies the potential for atrial thrombus formation and subsequent stroke. Current diagnostic approaches in patients with AF focus on identifying clinical predictors with evaluation of left atrial size by echocardiography serving as the sole measure specifically evaluating the atrium. Although the atrial substrate underlying AF is likely developing for years prior to the onset of AF, there is no current evaluation to identify the pre-clinical atrial myopathy. Atrial fibrosis is one component of the atrial substrate that has garnered recent attention based on newer MRI techniques that have been applied to visualize atrial fibrosis in humans with prognostic implications regarding success of treatment. Advanced ECG signal processing, echocardiographic techniques, and MRI imaging of fibrosis and flow provide up-to-date approaches to evaluate the atrial myopathy underlying AF. While thromboembolic risk is currently defined by clinical scores, their predictive value is mediocre. Evaluation of stasis via imaging and biomarkers associated with thrombogenesis may provide enhanced approaches to assess risk for stroke in patients with AF. Better delineation of the atrial myopathy that serves as the substrate for AF and thromboembolic complications might improve treatment outcomes. Furthermore, better delineation of the pathophysiologic mechanisms underlying the development of the atrial substrate for AF, particularly in its earlier stages, could help identify blood and imaging biomarkers that could be useful to assess risk for developing new onset AF and suggest specific pathways that could be targeted for prevention. PMID:26216085

  10. Phenotypes, genotypes, and prevalence of congenital myopathies older than 5 years in Denmark

    DEFF Research Database (Denmark)

    Witting, Nanna; Werlauff, Ulla; Duno, Morten

    2017-01-01

    .3% NEB mutations. Less than 5% had mutations in ACTA1, TPM2/3, MTM1, TTN, SEPN1, or SC4NA. A genetic cause was established in 83% with specific histology (cores/rods/centronuclear myopathy) vs 29% with unspecific histology. The detailed clinical examination found gene-dependent discrepancies...... in the pattern of muscle affection and walking ability. Although walking ability was delayed in patients with ACTA1, TPM2/3, and RYR1 mutations, it was within normal limits in patients with NEB and DNM2 mutations. CONCLUSIONS: We found that overall, genetic and histologic prevalence of congenital myopathy...

  11. Rapid diagnosis of hypoglycin A intoxication in atypical myopathy of horses.

    Science.gov (United States)

    Sander, Johannes; Cavalleri, Jessika-M V; Terhardt, Michael; Bochnia, Mandy; Zeyner, Annette; Zuraw, Aleksandra; Sander, Stefanie; Peter, Michael; Janzen, Nils

    2016-03-01

    Hypoglycin A (2-amino-3-(2-methylidenecyclopropyl)propanoic acid) is the plant toxin shown to cause atypical myopathy in horses. It is converted in vivo to methylenecyclopropyl acetic acid, which is transformed to a coenzyme A ester that subsequently blocks beta oxidation of fatty acids. Methylenecyclopropyl acetic acid is also conjugated with carnitine and glycine. Acute atypical myopathy may be diagnosed by quantifying the conjugates of methylenecyclopropyl acetic acid plus a selection of acyl conjugates in urine and serum. We describe a new mass spectrometric method for sample volumes of acid in urine, the coefficients of variation for intraday quantification were 2.9% and 3.0%, respectively. The respective values for interday were 9.3% and 8.0%. Methylenecyclopropyl acetyl carnitine was detected as high as 1.18 µmol/L in serum (median: 0.46 µmol/L) and 1.98 mmol/mol creatinine in urine (median: 0.79 mmol/mol creatinine) of diseased horses, while the glycine derivative accumulated up to 1.97 mmol/mol creatinine in urine but was undetectable in most serum samples. In serum samples from horses with atypical myopathy, the intraday coefficients of variation for C4-C8 carnitines and glycines were ≤4.5%. Measured concentrations exceeded those in healthy horses by ~10 to 1,400 times. © 2015 The Author(s).

  12. Improvements in Pain Outcomes in a Canadian Pediatric Teaching Hospital Following Implementation of a Multifaceted, Knowledge Translation Initiative

    Directory of Open Access Journals (Sweden)

    Lisa M Zhu

    2012-01-01

    Full Text Available BACKGROUND: A previous audit performed at a tertiary/quaternary pediatric hospital in Toronto, Ontario, demonstrated suboptimal assessment and treatment of children’s pain. Knowledge translation (KT initiatives (education, reminders, audit and feedback were implemented to address identified care gaps; however, the impact is unknown.

  13. Differential effect of the rs4149056 variant in SLCO1B1 on myopathy associated with simvastatin and atorvastatin

    NARCIS (Netherlands)

    Brunham, L. R.; Lansberg, P. J.; Zhang, L.; Miao, F.; Carter, C.; Hovingh, G. K.; Visscher, H.; Jukema, J. W.; Stalenhoef, A. F.; Ross, C. J. D.; Carleton, B. C.; Kastelein, J. J. P.; Hayden, M. R.

    2012-01-01

    Statins reduce cardiovascular morbidity and mortality in appropriately selected patients. However, statin-associated myopathy is a significant risk associated with these agents. Recently, variation in the SLCO1B1 gene was reported to predict simvastatin-associated myopathy. The aim of this study was

  14. Free radicals in alcoholic myopathy: indices of damage and preventive studies.

    Science.gov (United States)

    Preedy, Victor R; Adachi, Junko; Asano, Migiwa; Koll, Michael; Mantle, David; Niemela, Onni; Parkkila, Seppo; Paice, Alistair G; Peters, Timothy; Rajendram, Rajkumar; Seitz, Helmut; Ueno, Yasuhiro; Worrall, Simon

    2002-04-15

    Chronic alcoholic myopathy affects up to two-thirds of all alcohol misusers and is characterized by selective atrophy of Type II (glycolytic, fast-twitch, anaerobic) fibers. In contrast, the Type I fibers (oxidative, slow-twitch, aerobic) are relatively protected. Alcohol increases the concentration of cholesterol hydroperoxides and malondialdehyde-protein adducts, though protein-carbonyl concentration levels do not appear to be overtly increased and may actually decrease in some studies. In alcoholics, plasma concentrations of alpha-tocopherol may be reduced in myopathic patients. However, alpha-tocopherol supplementation has failed to prevent either the loss of skeletal muscle protein or the reductions in protein synthesis in alcohol-dosed animals. The evidence for increased oxidative stress in alcohol-exposed skeletal muscle is thus inconsistent. Further work into the role of ROS in alcoholic myopathy is clearly warranted.

  15. Insulin resistance and increased muscle cytokine levels in patients with mitochondrial myopathy.

    Science.gov (United States)

    Rue, Nana; Vissing, John; Galbo, Henrik

    2014-10-01

    Mitochondrial dysfunction has been proposed to cause insulin resistance and that might stimulate cytokine production. The objective of the study was to elucidate the association between mitochondrial myopathy, insulin sensitivity, and cytokine levels in muscle. This was an experimental, controlled study in outpatients. Eight overnight-fasted patients (P) with various inherited mitochondrial myopathies and eight healthy subjects (C) matched for sex, age, weight, height, and physical activity participated in the study. The intervention included a 120-minute hyperinsulinemic, euglycemic clamp. Another morning, microdialysis of both vastus lateralis muscles for 4 hours, including one-legged, knee extension exercise for 30 minutes, was performed. Glucose infusion rate during 90-120 minutes of insulin infusion was measured. Cytokine concentrations in dialysate were also measured. Muscle strength, percentage fat mass, and creatine kinase in plasma did not differ between groups. The maximal oxygen uptake was 21 ± 3 (SE) (P) and 36 ± 3(C) mL/kg·min (2P fatty acids and glycerol at 120 minutes were higher in P vs C (2P myopathies, insulin sensitivity of muscle, adipose tissue, and pancreatic A cells is reduced, supporting that mitochondrial function influences insulin action. Furthermore, a local, low-grade inflammation of potential clinical importance exists in the muscle of these patients.

  16. Diagnosis of myocardial involvement in patients with systemic myopathies with 15-(p-[I-123]iodophenyl) pentadecanoic acid (IPPA) SPECT

    Energy Technology Data Exchange (ETDEWEB)

    Kropp, J.; Briele, B.; Smekal, A.V.; Hotze, A.L.; Biersack, H.J.; Koehler, U.; Zierz, St. [Bonn Univ. (Germany); Knapp, F.F. [Oak Ridge National Lab., TN (United States)

    1992-03-01

    Involvement of the myocardium in non-infectious myopathies presents in most cases as systolic dysfunction or a disturbed cardiac rhythm. We are interested in exploring how often cardiac involvement can be evaluated with various diagnostic techniques in patients with proven myopathy. We investigated 41 patients with myopathies of various etiology, including mitochondrial and congenital myopathies, Curshmann-Steinert disease, muscular dystrophy, and others. Myopathy was proven by muscular biopsy usually from the bicep. Fatty acid imaging was performed with 15-(p-[I-123]iodophenyl)pentadecanoic acid (IP-PA) and sequential SPECT-scintigraphy with a 180 deg. rotation starting at the 45 deg. RAO position. 190 MBq were injected at the maximal stage of a submaximal exercise. Filtered backprojection and reorientation of the slices were achieved by standard techniques. The quantitative comparison of the oblique slices (bulls-eye technique) of the SPECT-studies revealed turnover-rates as a qualitative measure of {beta}-oxidation. Serum levels of lactate (L), pyruvate (P), glucose (G) and triglycerides (TG) were measured at rest and stress. Ventricular function was investigated by radionuclide ventriculography (MUGA) at rest and under stress with Tc-99m labeled red blood cells. In addition, ECG, 24 hour-ECG, and echocardiography were also performed with standard techniques.

  17. Diagnosis of myocardial involvement in patients with systemic myopathies with 15-(p-(I-123)iodophenyl) pentadecanoic acid (IPPA) SPECT

    Energy Technology Data Exchange (ETDEWEB)

    Kropp, J.; Briele, B.; Smekal, A.V.; Hotze, A.L.; Biersack, H.J.; Koehler, U.; Zierz, St. (Bonn Univ. (Germany)); Knapp, F.F. (Oak Ridge National Lab., TN (United States))

    1992-01-01

    Involvement of the myocardium in non-infectious myopathies presents in most cases as systolic dysfunction or a disturbed cardiac rhythm. We are interested in exploring how often cardiac involvement can be evaluated with various diagnostic techniques in patients with proven myopathy. We investigated 41 patients with myopathies of various etiology, including mitochondrial and congenital myopathies, Curshmann-Steinert disease, muscular dystrophy, and others. Myopathy was proven by muscular biopsy usually from the bicep. Fatty acid imaging was performed with 15-(p-(I-123)iodophenyl)pentadecanoic acid (IP-PA) and sequential SPECT-scintigraphy with a 180 deg. rotation starting at the 45 deg. RAO position. 190 MBq were injected at the maximal stage of a submaximal exercise. Filtered backprojection and reorientation of the slices were achieved by standard techniques. The quantitative comparison of the oblique slices (bulls-eye technique) of the SPECT-studies revealed turnover-rates as a qualitative measure of {beta}-oxidation. Serum levels of lactate (L), pyruvate (P), glucose (G) and triglycerides (TG) were measured at rest and stress. Ventricular function was investigated by radionuclide ventriculography (MUGA) at rest and under stress with Tc-99m labeled red blood cells. In addition, ECG, 24 hour-ECG, and echocardiography were also performed with standard techniques.

  18. Diagnosis of myocardial involvement in patients with systemic myopathies with 15-(p-[I-123]iodophenyl) pentadecanoic acid (IPPA) SPECT

    International Nuclear Information System (INIS)

    Kropp, J.; Briele, B.; Smekal, A.V.; Hotze, A.L.; Biersack, H.J.; Koehler, U.; Zierz, St.; Knapp, F.F.

    1992-01-01

    Involvement of the myocardium in non-infectious myopathies presents in most cases as systolic dysfunction or a disturbed cardiac rhythm. We are interested in exploring how often cardiac involvement can be evaluated with various diagnostic techniques in patients with proven myopathy. We investigated 41 patients with myopathies of various etiology, including mitochondrial and congenital myopathies, Curshmann-Steinert disease, muscular dystrophy, and others. Myopathy was proven by muscular biopsy usually from the bicep. Fatty acid imaging was performed with 15-(p-[I-123]iodophenyl)pentadecanoic acid (IP-PA) and sequential SPECT-scintigraphy with a 180 deg. rotation starting at the 45 deg. RAO position. 190 MBq were injected at the maximal stage of a submaximal exercise. Filtered backprojection and reorientation of the slices were achieved by standard techniques. The quantitative comparison of the oblique slices (bulls-eye technique) of the SPECT-studies revealed turnover-rates as a qualitative measure of β-oxidation. Serum levels of lactate (L), pyruvate (P), glucose (G) and triglycerides (TG) were measured at rest and stress. Ventricular function was investigated by radionuclide ventriculography (MUGA) at rest and under stress with Tc-99m labeled red blood cells. In addition, ECG, 24 hour-ECG, and echocardiography were also performed with standard techniques

  19. Muscle spindles exhibit core lesions and extensive degeneration of intrafusal fibers in the Ryr1I4895T/wt mouse model of core myopathy

    International Nuclear Information System (INIS)

    Zvaritch, Elena; MacLennan, David H.

    2015-01-01

    Muscle spindles from the hind limb muscles of adult Ryr1 I4895T/wt (IT/+) mice exhibit severe structural abnormalities. Up to 85% of the spindles are separated from skeletal muscle fascicles by a thick layer of connective tissue. Many intrafusal fibers exhibit degeneration, with Z-line streaming, compaction and collapse of myofibrillar bundles, mitochondrial clumping, nuclear shrinkage and pyknosis. The lesions resemble cores observed in the extrafusal myofibers of this animal model and of core myopathy patients. Spindle abnormalities precede those in extrafusal fibers, indicating that they are a primary pathological feature in this murine Ryr1-related core myopathy. Muscle spindle involvement, if confirmed for human core myopathy patients, would provide an explanation for an array of devastating clinical features characteristic of these diseases and provide novel insights into the pathology of RYR1-related myopathies. - Highlights: • Muscle spindles exhibit structural abnormalities in a mouse model of core myopathy. • Myofibrillar collapse and mitochondrial clumping is observed in intrafusal fibers. • Myofibrillar degeneration follows a pattern similar to core formation in extrafusal myofibers. • Muscle spindle abnormalities are a part of the pathological phenotype in the mouse model of core myopathy. • Direct involvement of muscle spindles in the pathology of human RYR1-related myopathies is proposed

  20. c-Kit-positive cardiac stem cells nested in hypoxic niches are activated by stem cell factor reversing the aging myopathy.

    Science.gov (United States)

    Sanada, Fumihiro; Kim, Junghyun; Czarna, Anna; Chan, Noel Yan-Ki; Signore, Sergio; Ogórek, Barbara; Isobe, Kazuya; Wybieralska, Ewa; Borghetti, Giulia; Pesapane, Ada; Sorrentino, Andrea; Mangano, Emily; Cappetta, Donato; Mangiaracina, Chiara; Ricciardi, Mario; Cimini, Maria; Ifedigbo, Emeka; Perrella, Mark A; Goichberg, Polina; Choi, Augustine M; Kajstura, Jan; Hosoda, Toru; Rota, Marcello; Anversa, Piero; Leri, Annarosa

    2014-01-03

    Hypoxia favors stem cell quiescence, whereas normoxia is required for stem cell activation, but whether cardiac stem cell (CSC) function is regulated by the hypoxic/normoxic state of the cell is currently unknown. A balance between hypoxic and normoxic CSCs may be present in the young heart, although this homeostatic control may be disrupted with aging. Defects in tissue oxygenation occur in the old myocardium, and this phenomenon may expand the pool of hypoxic CSCs, which are no longer involved in myocyte renewal. Here, we show that the senescent heart is characterized by an increased number of quiescent CSCs with intact telomeres that cannot re-enter the cell cycle and form a differentiated progeny. Conversely, myocyte replacement is controlled only by frequently dividing CSCs with shortened telomeres; these CSCs generate a myocyte population that is chronologically young but phenotypically old. Telomere dysfunction dictates their actual age and mechanical behavior. However, the residual subset of quiescent young CSCs can be stimulated in situ by stem cell factor reversing the aging myopathy. Our findings support the notion that strategies targeting CSC activation and growth interfere with the manifestations of myocardial aging in an animal model. Although caution has to be exercised in the translation of animal studies to human beings, our data strongly suggest that a pool of functionally competent CSCs persists in the senescent heart and that this stem cell compartment can promote myocyte regeneration effectively, partly correcting the aging myopathy.

  1. Clinical, serologic, and immunogenetic features of familial idiopathic inflammatory myopathy

    NARCIS (Netherlands)

    Rider, L. G.; Gurley, R. C.; Pandey, J. P.; Garcia de la Torre, I.; Kalovidouris, A. E.; O'Hanlon, T. P.; Love, L. A.; Hennekam, R. C.; Baumbach, L. L.; Neville, H. E.; Garcia, C. A.; Klingman, J.; Gibbs, M.; Weisman, M. H.; Targoff, I. N.; Miller, F. W.

    1998-01-01

    OBJECTIVE: To describe the clinical, serologic, and immunogenetic features of familial idiopathic inflammatory myopathy (IIM) and to compare these with the features of sporadic IIM. METHODS: Clinical signs and symptoms, autoantibodies, HLA-DRB1 and DQA1 alleles, and GM/KM phenotypes were compared

  2. Collagen XII myopathy with rectus femoris atrophy and collagen XII retention in fibroblasts

    DEFF Research Database (Denmark)

    Witting, Nanna; Krag, Thomas; Werlauff, Ulla

    2018-01-01

    INTRODUCTION: Mutation in the collagen XII gene (COL12A1) was recently reported to induce Bethlem myopathy. We describe a family affected by collagen XII-related myopathy in 3 generations. METHODS: Systematic interview, clinical examination, skin biopsies, and MRI of muscle were used. RESULTS...... affection and abnormal collagen XII retention in fibroblasts. MRI disclosed a selective wasting of the rectus femoris muscle. DISCUSSION: COL12A1 mutations should be considered in patients with a mild Bethlem phenotype who present with selective wasting of the rectus femoris, absence of the outside......-in phenomenon on MRI, and abnormal collagen XII retention in fibroblasts. Muscle Nerve, 2018....

  3. DNAJB6 myopathies: Focused review on an emerging and expanding group of myopathies

    Directory of Open Access Journals (Sweden)

    Alessandra Ruggieri

    2016-09-01

    Full Text Available Mutations in the DNAJB6 gene have been associated with the autosomal dominant limb girdle muscular dystrophy type 1D (LGMD1D, a disorder characterized by abnormal protein aggregates and rimmed vacuoles in muscle fibers. DNAJB6 is a ubiquitously expressed Hsp40 co-chaperone characterized by a J domain that specifies Hsp70 functions in the cellular environment. DNAJB6 is also a potent inhibitor of expanded polyglutamine (polyQ aggregation preventing aggregate toxicity in cells. In DNAJB6-mutated patients this anti-aggregation property is significantly reduced, albeit not completely lost. To elucidate the pathogenetic mechanisms underlying the DNAJB6-related myopathy, animal models have been created showing that, indeed, conditional muscular expression of a DNAJB6 mutant in the mouse causes a LGMD1D myofibrillary muscle tissue phenotype. Both mutations and phenotypes reported until recently were rather homogeneous, being exclusively missense mutations of a few amino acids of the protein G/F domain, and with a phenotype characterized by adult-onset slowly progressive muscular dystrophy predominantly affecting proximal muscles. Lately, several novel mutations and new phenotypes of DNAJB6 have been described. These mutations once more affect the G/F domain of DNAJB6 with missense changes and a splice site mutation; and the phenotypes include childhood onset and distal involvement of muscles, or childhood-onset LGMD1D with loss of ambulation in early adulthood and respiratory involvement. Thus, the spectrum of DNAJB6-related phenotypes is widening. Although our knowledge about the role of DNAJB6 in the pathogenesis of muscle diseases has made great progression, several questions remain unsolved, including why a ubiquitous protein affects only, or predominantly, skeletal muscle; why only the G/F domain is involved; and what is the possible role of the DNAJB6a isoform. Clarification of these issues will provide clues to implement possible therapeutic

  4. Knowledge Translation Strategy to Reduce the Use of Potentially Inappropriate Medications in Hospitalized Elderly Adults.

    Science.gov (United States)

    Cossette, Benoit; Bergeron, Josée; Ricard, Geneviève; Éthier, Jean-François; Joly-Mischlich, Thomas; Levine, Mitchell; Sene, Modou; Mallet, Louise; Lanthier, Luc; Payette, Hélène; Rodrigue, Marie-Claude; Brazeau, Serge

    2016-12-01

    To evaluate the effect of a knowledge translation (KT) strategy to reduce potentially inappropriate medication (PIM) use in hospitalized elderly adults. Segmented regression analysis of an interrupted time series. Teaching hospital. Individuals aged 75 and older discharged from the hospital in 2013/14 (mean age 83.3, 54.5% female). The KT strategy comprises the distribution of educational materials, presentations by geriatricians, pharmacist-physician interventions based on alerts from a computerized alert system, and comprehensive geriatric assessments. Rate of PIM use (number of patient-days with use of at least one PIM/number of patient-days of hospitalization for individuals aged ≥75). For 8,622 patients with 14,071 admissions, a total of 145,061 patient-days were analyzed. One or more PIMs were prescribed on 28,776 (19.8%) patient-days; a higher rate was found for individuals aged 75 to 84 (24.0%) than for those aged 85 and older (14.4%) (P patient-days with at least one PIM was observed immediately after the intervention. A KT strategy resulted in decreased use of PIM in elderly adults in the hospital. Additional interventions will be implemented to maintain or further reduce PIM use. © 2016, Copyright the Authors Journal compilation © 2016, The American Geriatrics Society.

  5. Evaluation of inflammatory biomarkers associated with oxidative stress and histological assessment of magnetic therapy on experimental myopathy in rats.

    Science.gov (United States)

    Vignola, María Belén; Dávila, Soledad; Cremonezzi, David; Simes, Juan C; Palma, José A; Campana, Vilma R

    2012-12-01

    The effect of pulsed electromagnetic field (PEMF) therapy, also called magnetic therapy, upon inflammatory biomarkers associated with oxidative stress plasma fibrinogen, nitric oxide (NO), L-citrulline, carbonyl groups, and superoxide dismutase (SOD) was evaluated through histological assessment, in rats with experimental myopathy. The groups studied were: (A) control (intact rats that received PEMF sham exposures); (B) rats with myopathy and sacrificed 24 h later; (C) rats with myopathy; (D) rats with myopathy and treated with PEMF; and (E) intact rats treated with PEMF. Groups A, C, D, and E were sacrificed 8 days later. Myopathy was induced by injecting 50 μl of 1% carrageenan λ (type IV) once sub-plantar. Treatment was carried out with PEMF emitting equipment with two flat solenoid disks for 8 consecutive days in groups D and E, at 20 mT and 50 Hz for 30 min/day/rat. The biomarkers were determined by spectrophotometry. The muscles (5/8) were stained with Hematoxylin-Eosin and examined by optic microscopy. Quantitative variables were statistically analyzed by the Fisher test, and categorical applying Pearson's Chi Squared test at p < 0.05 for all cases. In Groups B and C, the biomarkers were significantly increased compared to A, D, and E groups: fibrinogen (p < 0.001); NO, L-citrulline and carbonyl groups (p < 0.05); SOD (p < 0.01) as well as the percentage of area with inflammatory infiltration (p < 0.001). PEMF caused decreased levels of fibrinogen, L-citrulline, NO, SOD, and carbonyl groups and significant muscle recovery in rats with experimental myopathies.

  6. Novel duplication mutation in the patatin domain of adipose triglyceride lipase (PNPLA2) in neutral lipid storage disease with severe myopathy.

    Science.gov (United States)

    Akiyama, Masashi; Sakai, Kaori; Ogawa, Masaya; McMillan, James R; Sawamura, Daisuke; Shimizu, Hiroshi

    2007-12-01

    Recently, mutations in PNPLA2 encoding adipose triglyceride lipase (ATGL) were reported to underlie a neutral lipid storage disease (NLSD) subgroup characterized by mild myopathy and the absence of ichthyosis. In the present study a novel homozygous PNPLA2 mutation c.475_478dupCTCC (p.Gln160ProfsX19) in the patatin domain, the ATGL active site, was detected in a woman with NLSD and severe myopathy. The present results suggest that a premature truncation mutation in the patatin domain causes NLSD with severe myopathy.

  7. Treatment Opportunities in Patients With Metabolic Myopathies

    DEFF Research Database (Denmark)

    Ørngreen, Mette Cathrine; Vissing, John

    2017-01-01

    the development of new therapeutic options. Enzyme replacement therapy with rGAA has revolutionized treatment of early onset Pompe disease. Supplements of riboflavin, carnitine, and sucrose show promise in patients with respectively riboflavin-responsive multiple acyl-CoA dehydrogenase deficiency, primary...... carnitine deficiency, and McArdle disease. Treatment with citric acid cycle intermediates supply by triheptanoin seems promising in patients with glucogenoses, and studies are ongoing in patients with McArdle disease. Summary Treatment of metabolic myopathies primarily relies on avoiding precipitating...

  8. Diagnostic value of MHC class I staining in idiopathic inflammatory myopathies.

    NARCIS (Netherlands)

    Pas, J. van der; Hengstman, G.J.D.; Laak, H.J. ter; Borm, G.F.; Engelen, B.G.M. van

    2004-01-01

    BACKGROUND: Identification of mononuclear cellular infiltrates in skeletal muscle tissue is the histological cornerstone of the diagnosis of idiopathic inflammatory myopathy (IIM). However, these infiltrates are not always present. OBJECTIVE: To determine whether MHC class I antigen expression on

  9. Diagnosis and treatment of the idiopathic inflammatory myopathies

    OpenAIRE

    Gazeley, David J.; Cronin, Mary E.

    2011-01-01

    The idiopathic inflammatory myopathies (IIMs) are rare disorders with the unifying feature of proximal muscle weakness. These diseases include polymyositis(PM), dermatomyositis (DM) and inclusion body myositis (IBM) as the most common. The diagnosis is based on the finding of weakness on exam, elevated muscles enzymes, characteristic histopathology of muscle biopsies, electromyography abnormalities and rash in DM. Myositis-specific antibodies have been helpful in defining subsets of patients ...

  10. Cardiovascular magnetic resonance imaging (CMR) reveals characteristic pattern of myocardial damage in patients with mitochondrial myopathy.

    Science.gov (United States)

    Yilmaz, Ali; Gdynia, Hans-Jürgen; Ponfick, Matthias; Rösch, Sabine; Lindner, Alfred; Ludolph, Albert C; Sechtem, Udo

    2012-04-01

    Mitochondrial myopathy comprises various clinical subforms of neuromuscular disorders that are characterised by impaired mitochondrial energy metabolism due to dysfunction of the mitochondrial respiratory chain. No comprehensive and targeted cardiovascular magnetic resonance (CMR) studies have been performed so far in patients with mitochondrial disorders. The present study aimed at characterising cardiac disease manifestations in patients with mitochondrial myopathy and elucidating the in vivo cardiac damage pattern of patients with different subforms of mitochondrial disease by CMR studies. In a prospective study, 37 patients with mitochondrial myopathy underwent comprehensive neurological and cardiac evaluations including physical examination, resting ECG and CMR. The CMR studies comprised cine-CMR, T2-weighted "edema" imaging and T1-weighted late-gadolinium-enhancement (LGE) imaging. Various patterns and degrees of skeletal myopathy were present in the participants of this study, whereas clinical symptoms such as chest pain symptoms (in eight (22%) patients) and various degrees of dyspnea (in 16 (43%) patients) were less frequent. Pathological ECG findings were documented in eight (22%) patients. T2-weighted "edema" imaging was positive in one (3%) patient with MELAS (mitochondrial encephalomyopathy with lactic acidosis and stroke-like episodes) only. LGE imaging demonstrated the presence of non-ischemic LGE in 12 (32%) patients: 10 out of 24 (42%) patients with CPEO (chronic progressive external ophthalmoplegia) or KSS (Kearns-Sayre syndrome) and 2 of 3 (67%) patients with MELAS were LGE positive. All 10 LGE-positive patients with CPEO or KSS demonstrated a potentially typical pattern of diffuse intramural LGE in the left-ventricular (LV) inferolateral segments. Cardiac involvement is a frequent finding in patients with mitochondrial myopathy. A potentially characteristic pattern of diffuse intramural LGE in the LV inferolateral segments was identified in

  11. Atypical myopathy in Denmark confirmed with the aTRAQ assay

    DEFF Research Database (Denmark)

    Høffer, Sofie Esbjørn; Votion, Dominique-Marie; Anderberg, Marie

    2016-01-01

    Atypical myopathy is a severe form of rhabdomyolysis that occurs in grazing horses. Over the past decades, the disease has been emerging in Europe. The disease is widespread in Europe and has been suspected in Denmark since 2000, yet no cases have been confirmed. The objective of this study...

  12. RYR1-related myopathies: a wide spectrum of phenotypes throughout life

    NARCIS (Netherlands)

    Snoeck, M.; Engelen, B.G.M. van; Kusters, B.; Lammens, M.M.; Meijer, R.; Molenaar, J.P.F.; Raaphorst, J.; Verschuuren-Bemelmans, C.C.; Straathof, C.S.; Sie, L.T.L.; Coo, I.F.M. de; Pol, W.L. van der; Visser, M de; Scheffer, H.; Treves, S.; Jungbluth, H.; Voermans, N.C.; Kamsteeg, E.J.

    2015-01-01

    BACKGROUND AND PURPOSE: Although several recent studies have implicated RYR1 mutations as a common cause of various myopathies and the malignant hyperthermia susceptibility (MHS) trait, many of these studies have been limited to certain age groups, confined geographical regions or specific

  13. Empowering Parents of Australian Infants and Children in Hospital: Translation, Cultural Adaptation, and Validation of the EMpowerment of PArents in The Intensive Care-30-AUS Questionnaire.

    Science.gov (United States)

    Gill, Fenella J; Wilson, Sally; Aydon, Laurene; Leslie, Gavin D; Latour, Jos M

    2017-11-01

    To translate, culturally adapt, and psychometrically test the EMpowerment of PArents in The Intensive Care-30 questionnaire in Australian pediatric critical care, neonatal, and pediatric ward settings. Cross-sectional, descriptive, multicenter study conducted in two phases; 1) translation and cultural adaptation and 2) validation of the EMpowerment of PArents in The Intensive Care-30 questionnaire. Two Western Australian sites, the PICU and two pediatric wards of a children's hospital and the neonatal unit of a women's and newborn hospital. Parents whose baby or child was admitted to the participating wards or units with a length of hospital stay greater than 24 hours. None. Phase 1: A structured 10-step translation process adhered to international principles of good practice for translation and cultural adaptation of patient-reported outcomes. Thirty parents participated in cognitive debriefing. Phase 2: A total of 328 parents responded to the EMpowerment of PArents in The Intensive Care-30-AUS questionnaire. Reliability was sufficient (Cronbach α at domain level 0.70 -0.82, for each clinical area 0.56-0.86). Congruent validity was adequate between the domains and three general satisfaction items (rs 0.38-0.69). Nondifferential validity showed no significant effect size between three patient or parent demographic characteristics and the domains (Cohen's d PArents in The Intensive Care-30-AUS is a reliable and valid questionnaire to measure parent-reported outcomes in pediatric critical care, pediatric ward, and neonatal hospital settings. Using this questionnaire can provide a framework for a standardized quality improvement approach and identification of best practices across specialties, hospital services and for benchmarking similar health services worldwide.

  14. Statin-associated myopathy: from genetic predisposition to clinical management.

    Science.gov (United States)

    Vrablik, M; Zlatohlavek, L; Stulc, T; Adamkova, V; Prusikova, M; Schwarzova, L; Hubacek, J A; Ceska, R

    2014-01-01

    Statin-associated myopathy (SAM) represents a broad spectrum of disorders from insignificant myalgia to fatal rhabdomyolysis. Its frequency ranges from 1-5 % in clinical trials to 15-20 % in everyday clinical practice. To a large extent, these variations can be explained by the definition used. Thus, we propose a scoring system to classify statin-induced myopathy according to clinical and biochemical criteria as 1) possible, 2) probable or 3) definite. The etiology of this disorder remains poorly understood. Most probably, an underlying genetic cause is necessary for overt SAM to develop. Variants in a few gene groups that encode proteins involved in: i) statin metabolism and distribution (e.g. membrane transporters and enzymes; OATP1B1, ABCA1, MRP, CYP3A4), ii) coenzyme Q10 production (e.g. COQ10A and B), iii) energy metabolism of muscle tissue (e.g. PYGM, GAA, CPT2) and several others have been proposed as candidates which can predispose to SAM. Pharmacological properties of individual statin molecules (e.g. lipophilicity, excretion pathways) and patients´ characteristics influence the likelihood of SAM development. This review summarizes current data as well as our own results.

  15. Effects of ubiquinone (coenzyme Q10) on myopathy in statin users.

    NARCIS (Netherlands)

    Schaars, C.F.; Stalenhoef, A.F.H.

    2008-01-01

    PURPOSE OF REVIEW: Statins are associated with muscle complaints, including myositis. The mechanism through which statin use causes muscle toxicity is unknown. One of the theories is that statin therapy reduces coenzyme Q10 levels in muscle mitochondria, which leads to muscle injury and myopathy.

  16. Skeletal muscle-specific HMG-CoA reductase knockout mice exhibit rhabdomyolysis: A model for statin-induced myopathy.

    Science.gov (United States)

    Osaki, Yoshinori; Nakagawa, Yoshimi; Miyahara, Shoko; Iwasaki, Hitoshi; Ishii, Akiko; Matsuzaka, Takashi; Kobayashi, Kazuto; Yatoh, Shigeru; Takahashi, Akimitsu; Yahagi, Naoya; Suzuki, Hiroaki; Sone, Hirohito; Ohashi, Ken; Ishibashi, Shun; Yamada, Nobuhiro; Shimano, Hitoshi

    2015-10-23

    HMG-CoA reductase (HMGCR) catalyzes the conversion of HMG-CoA to mevalonic acid (MVA); this is the rate-limiting enzyme of the mevalonate pathway that synthesizes cholesterol. Statins, HMGCR inhibitors, are widely used as cholesterol-reducing drugs. However, statin-induced myopathy is the most adverse side effect of statins. To eludicate the mechanisms underlying statin the myotoxicity and HMGCR function in the skeletal muscle, we developed the skeletal muscle-specific HMGCR knockout mice. Knockout mice exhibited postnatal myopathy with elevated serum creatine kinase levels and necrosis. Myopathy in knockout mice was completely rescued by the oral administration of MVA. These results suggest that skeletal muscle toxicity caused by statins is dependent on the deficiencies of HMGCR enzyme activity and downstream metabolites of the mevalonate pathway in skeletal muscles rather than the liver or other organs. Copyright © 2015 Elsevier Inc. All rights reserved.

  17. [Cardiac myopathy due to overt hypothyroidism].

    Science.gov (United States)

    Harbeck, B; Berndt, M J; Lehnert, H

    2014-03-01

    A 51-year-old man presented with progressive tiredness, proximal muscle weakness, hair loss and weight gain for months. The patient showed mild pretibial myxedema and dry skin. Laboratory findings revealed strongly elevated cardiac enzymes as well as marked hypothyroidism. The electrocardiogram, echocardiography, abdominal sonography and chest X-ray were unremarkable. Thyroid ultrasound demonstrated features of Hashimoto thyroiditis. The findings supported the diagnosis of an overt hypothyroidism with myxedema and rhabdomyolysis. After starting levothyroxine and volume substitution laboratory parameters and clinical condition slowly normalized. Severe overt hypothyroidism may rarely present primarily as myopathy with myositis and cardiac involvement. © Georg Thieme Verlag KG Stuttgart · New York.

  18. [Insight into the training of patients with idiopathic inflammatory myopathy].

    Science.gov (United States)

    Váncsa, Andrea

    2016-09-01

    Using current recommended treatment, a majority of patients with idiopathic inflammatory myopathy develop muscle impairment and poor health. Beneficial effects of exercise have been reported on muscle performance, aerobic capacity and health in chronic polymyositis and dermatomyositis, as well as in active disease and inclusion body myositis to some extent. Importantly, randomized controlled trials indicate that improved health and decreased clinical disease activity could be mediated through increased aerobic capacity. Recently, reports seeking pathomechanisms of the underlying effects of exercise on skeletal muscle indicate increased aerobic capacity (i.e. increased mitochondrial capacity and capillary density, reduced lactate levels), activation of genes of aerobic phenotype and muscle growth programs and down regulation of genes related to inflammation. Exercise contributes to both systemic and within-muscle adaptations demonstrating that it is fundamental for improving muscle performance and health in patients with idiopathic inflammatory myopathy. There is a need for randomized controlled trials to study the effects of exercise in patients with active disease and inclusion body myositis. Orv. Hetil., 2016, 157(39), 1557-1562.

  19. The genetic basis of pectoralis major myopathies in modern broiler chicken lines.

    Science.gov (United States)

    Bailey, Richard A; Watson, Kellie A; Bilgili, S F; Avendano, Santiago

    2015-12-01

    This is the first report providing estimates of the genetic basis of breast muscle myopathies (BMM) and their relationship with growth and yield in broiler chickens. In addition, this paper addresses the hypothesis that genetic selection for increase breast yield has contributed to the onset of BMM. Data were analyzed from ongoing recording of BMM within the Aviagen breeding program. This study focused on three BMM: deep pectoral myopathy (DPM; binary trait), white striping (WS; 4 categories) and wooden breast (WB; 3 categories). Data from two purebred commercial broiler lines (A and B) were utilized providing greater than 40,000 meat quality records per line. The difference in selection history between these two lines has resulted in contrasting breast yield (BY): 29% for Line A and 21% for Line B. Data were analyzed to estimate genetic parameters using a multivariate animal model including six traits: body weight (BW), processing body weight (PW), BY, DPM, WB, and WS, in addition to the appropriate fixed effects and permanent environmental effect of the dam. Results indicate similar patterns of heritability and genetic correlations for the two lines. Heritabilities (h2) of BW, PW and BY ranged from 0.271-0.418; for DPM and WB h2white striping of breast muscle and more than 90% of the variance of the incidence of wooden breast and deep pectoral myopathy in broiler chickens. © The Author 2015. Published by Oxford University Press on behalf of Poultry Science Association.

  20. The heart in Becker muscular dystrophy, facioscapulohumeral dystrophy, and Bethlem myopathy

    NARCIS (Netherlands)

    de Visser, M.; de Voogt, W. G.; la Rivière, G. V.

    1992-01-01

    We report a study, assessing involvement of the heart in 33 familial cases of Becker muscular dystrophy (BMD), 31 familiar cases of facioscapulohumeral (FSH) dystrophy, and 27 familial cases of Bethlem myopathy. In the patients with BMD, correlations of myocardial involvement with age and extent of

  1. Fatal hepatic hemorrhage by peliosis hepatis in X-linked myotubular myopathy: a case report.

    Science.gov (United States)

    Motoki, T; Fukuda, M; Nakano, T; Matsukage, S; Fukui, A; Akiyoshi, S; Hayashi, Y K; Ishii, E; Nishino, I

    2013-11-01

    We report a 5-year-old boy with X-linked myotubular myopathy complicated by peliosis hepatis. At birth, he was affected with marked generalized muscle hypotonia and weakness, which required permanent ventilatory support, and was bedridden for life. He died of acute fatal hepatic hemorrhage after using a mechanical in-exsufflator. Peliosis hepatis, defined as multiple, variable-sized, cystic blood-filled spaces through the liver parenchyma, was confirmed by autopsy. To avoid fatal hepatic hemorrhage by peliosis hepatis, routine hepatic function tests and abdominal imaging tests should be performed for patients with X-linked myotubular myopathy, especially at the time of using artificial respiration. Copyright © 2013 Elsevier B.V. All rights reserved.

  2. BAG3-related myopathy, polyneuropathy and cardiomyopathy with long QT syndrome.

    Science.gov (United States)

    Kostera-Pruszczyk, Anna; Suszek, Małgorzata; Płoski, Rafał; Franaszczyk, Maria; Potulska-Chromik, Anna; Pruszczyk, Piotr; Sadurska, Elżbieta; Karolczak, Justyna; Kamińska, Anna M; Rędowicz, Maria Jolanta

    2015-12-01

    BAG3 belongs to BAG family of molecular chaperone regulators interacting with HSP70 and anti-apoptotic protein Bcl-2. It is ubiquitously expressed with strong expression in skeletal and cardiac muscle, and is involved in a panoply of cellular processes. Mutations in BAG3 and aberrations in its expression cause fulminant myopathies, presenting with progressive limb and axial muscle weakness, and respiratory insufficiency and neuropathy. Herein, we report a sporadic case of a 15-years old girl with symptoms of myopathy, demyelinating polyneuropathy and asymptomatic long QT syndrome. Genetic testing demonstrated heterozygous mutation Pro209Leu (c.626C > T) in exon 3 of BAG3 gene causing severe myopathy and neuropathy, often associated with restrictive cardiomyopathy. We did not find a mutation in any known LQT syndrome genes. Analysis of muscle biopsy revealed profound disintegration of Z-discs with extensive accumulation of granular debris and large inclusions within fibers. We demonstrated profound alterations in BAG3 distribution as the protein localized to long filamentous structures present across the fibers that were positively stained not only for α-actinin but also for desmin and filamin indicating that those disintegrated Z-disc regions contained also other sarcomeric proteins. The mutation caused a decrease in the content of BAG3 and HSP70, and also of α-actinin desmin, filamin and fast myosin heavy chain, confirming its severe effect on the muscle fiber morphology and thus function. We provide further evidence that BAG3 is associated with Z-disc maintenance, and the Pro209Leu mutation may occur worldwide. We also provide a summary of cases associated with this mutation reported so far.

  3. Resveratrol and Myopathy

    Science.gov (United States)

    Bastin, Jean; Djouadi, Fatima

    2016-01-01

    Resveratrol is a natural polyphenolic compound produced by plants under various stress conditions. Resveratrol has been reported to exhibit antioxidant, anti-inflammatory, and anti-proliferative properties in mammalian cells and animal models, and might therefore exert pleiotropic beneficial effects in different pathophysiological states. More recently, resveratrol has also been shown to potentially target many mitochondrial metabolic pathways, including fatty acid β-oxidation or oxidative phosphorylation, leading to the up-regulation of the energy metabolism via signaling pathways involving PGC-1α, SIRT1, and/or AMP-kinase, which are not yet fully delineated. Some of resveratrol beneficial effects likely arise from its cellular effects in the skeletal muscle, which, surprisingly, has been given relatively little attention, compared to other target tissues. Here, we review the potential for resveratrol to ameliorate or correct mitochondrial metabolic deficiencies responsible for myopathies, due to inherited fatty acid β-oxidation or to respiratory chain defects, for which no treatment exists to date. We also review recent data supporting therapeutic effects of resveratrol in the Duchenne Muscular Dystrophy, a fatal genetic disease affecting the production of muscle dystrophin, associated to a variety of mitochondrial dysfunctions, which likely contribute to disease pathogenesis. PMID:27136581

  4. A Case of Myopathy, Encephalopathy, Lactic Acidosis and Stroke-Like Episodes (MELAS) Syndrome with Intracardiac Thrombus [corrected].

    Science.gov (United States)

    Joo, Jung-Chul; Seol, Myung Do; Yoon, Jin Won; Lee, Young Soo; Kim, Dong-Keun; Choi, Yong Hoon; Ahn, Hyo Seong; Cho, Wook Hyun

    2013-03-01

    Myopathy, encephalopathy, lactic acidosis and stroke-like episodes (MELAS) is a multisystem clinical syndrome manifested by mitochondrial myopathy, encephalopathy, lactic acidosis and recurrent stroke-like episodes. A 27-year-old female with MELAS syndrome presented with cerebral infarction. Echocardiography revealed a thrombus attached to the apex of the hypertrophied left ventricle, with decreased systolic function. The embolism of the intracardiac thrombus might have been the cause of stroke. There should be more consideration given to the increased possibility of intracardiac thrombus formation when a MELAS patient with cardiac involvement is encountered.

  5. Genetic factors affecting statin concentrations and subsequent myopathy: a HuGENet systematic review

    Science.gov (United States)

    Canestaro, William J.; Austin, Melissa A.; Thummel, Kenneth E.

    2015-01-01

    Statins, 3-hydroxy-3-methyl-glutaryl-coenzyme A reductase inhibitors, have proven efficacy in both lowering low-density-lipoprotein levels and preventing major coronary events, making them one of the most commonly prescribed drugs in the United States. Statins exhibit a class-wide side effect of muscle toxicity and weakness, which has led regulators to impose both dosage limitations and a recall. This review focuses on the best-characterized genetic factors associated with increased statin muscle concentrations, including the genes encoding cytochrome P450 enzymes (CYP2D6, CYP3A4, and CYP3A5), a mitochondrial enzyme (GATM), an influx transporter (SLCO1B1), and efflux transporters (ABCB1 and ABCG2). A systematic literature review was conducted to identify relevant research evaluating the significance of genetic variants predictive of altered statin concentrations and subsequent statin-related myopathy. Studies eligible for inclusion must have incorporated genotype information and must have associated it with some measure of myopathy, either creatine kinase levels or self-reported muscle aches and pains. After an initial review, focus was placed on seven genes that were adequately characterized to provide a substantive review: CYP2D6, CYP3A4, CYP3A5, GATM, SLCO1B1, ABCB1, and ABCG2. All statins were included in this review. Among the genetic factors evaluated, statin-related myopathy appears to be most strongly associated with variants in SLCO1B1. PMID:24810685

  6. Nuclear actin aggregation is a hallmark of anti-synthetase syndrome-induced dysimmune myopathy

    NARCIS (Netherlands)

    Stenzel, Werner; Preuße, Corinna; Allenbach, Yves; Pehl, Debora; Junckerstorff, Reimar; Heppner, Frank L.; Nolte, Kay; Aronica, Eleonora; Kana, Veronika; Rushing, Elisabeth; Schneider, Udo; Claeys, Kristl G.; Benveniste, Olivier; Weis, Joachim; Goebel, Hans H.

    2015-01-01

    To analyze antisynthetase syndrome-associated myositis by modern myopathologic methods and to define its place in the spectrum of idiopathic inflammatory myopathies (IIMs). Skeletal muscle biopsies from antisynthetase syndrome-associated myositis and other IIMs from different institutions worldwide

  7. Apparent diffusion coefficient (ADC) does not correlate with different serological parameters in myositis and myopathy.

    Science.gov (United States)

    Meyer, Hans-Jonas; Ziemann, Oliver; Kornhuber, Malte; Emmer, Alexander; Quäschling, Ulf; Schob, Stefan; Surov, Alexey

    2018-06-01

    Background Magnetic resonance imaging (MRI) is widely used in several muscle disorders. Diffusion-weighted imaging (DWI) is an imaging modality, which can reflect microstructural tissue composition. The apparent diffusion coefficient (ADC) is used to quantify the random motion of water molecules in tissue. Purpose To investigate ADC values in patients with myositis and non-inflammatory myopathy and to analyze possible associations between ADC and laboratory parameters in these patients. Material and Methods Overall, 17 patients with several myositis entities, eight patients with non-inflammatory myopathies, and nine patients without muscle disorder as a control group were included in the study (mean age = 55.3 ± 14.3 years). The diagnosis was confirmed by histopathology in every case. DWI was obtained in a 1.5-T scanner using two b-values: 0 and 1000 s/mm 2 . In all patients, the blood sample was acquired within three days to the MRI. The following serological parameters were estimated: C-reactive protein, lactate dehydrogenase, alanine aminotransferase, aspartate aminotransferase, creatine kinase, and myoglobine. Results The estimated mean ADC value for the myositis group was 1.89 ± 0.37 × 10 -3  mm 2 /s and for the non-inflammatory myopathy group was 1.79 ± 0.33 × 10 -3  mm 2 /s, respectively. The mean ADC values (1.15 ± 0.37 × 10 -3  mm 2 /s) were significantly higher to unaffected muscles (vs. myositis P = 0.0002 and vs. myopathy P = 0.0021). There were no significant correlations between serological parameters and ADC values. Conclusion Affected muscles showed statistically significantly higher ADC values than normal muscles. No linear correlations between ADC and serological parameters were identified.

  8. Knowledge translation lessons from an audit of Aboriginal Australians with acute coronary syndrome presenting to a regional hospital.

    Science.gov (United States)

    Haynes, Emma; Hohnen, Harry; Katzenellenbogen, Judith M; Scalley, Benjamin D; Thompson, Sandra C

    2016-01-01

    Translation of evidence into practice by health systems can be slow and incomplete and may disproportionately impact disadvantaged populations. Coronary heart disease is the leading cause of death among Aboriginal Australians. Timely access to effective medical care for acute coronary syndrome substantially improves survival. A quality-of-care audit conducted at a regional Western Australian hospital in 2011-2012 compared the Emergency Department management of Aboriginal and non-Aboriginal acute coronary syndrome patients. This audit is used as a case study of translating knowledge processes in order to identify the factors that support equity-oriented knowledge translation. In-depth interviews were conducted with a purposive sample of the audit team and further key stakeholders with interest/experience in knowledge translation in the context of Aboriginal health. Interviews were analysed for alignment of the knowledge translation process with the thematic steps outlined in Tugwell's cascade for equity-oriented knowledge translation framework. In preparing the audit, groundwork helped shape management support to ensure receptivity to targeting Aboriginal cardiovascular outcomes. Reporting of audit findings and resulting advocacy were undertaken by the audit team with awareness of the institutional hierarchy, appropriate timing, personal relationships and recognising the importance of tailoring messages to specific audiences. These strategies were also acknowledged as important in the key stakeholder interviews. A follow-up audit documented a general improvement in treatment guideline adherence and a reduction in treatment inequalities for Aboriginal presentations. As well as identifying outcomes such as practice changes, a useful evaluation increases understanding of why and how an intervention worked. Case studies such as this enrich our understanding of the complex human factors, including individual attributes, experiences and relationships and systemic factors

  9. Knowledge translation lessons from an audit of Aboriginal Australians with acute coronary syndrome presenting to a regional hospital

    Directory of Open Access Journals (Sweden)

    Emma Haynes

    2016-07-01

    Full Text Available Objective: Translation of evidence into practice by health systems can be slow and incomplete and may disproportionately impact disadvantaged populations. Coronary heart disease is the leading cause of death among Aboriginal Australians. Timely access to effective medical care for acute coronary syndrome substantially improves survival. A quality-of-care audit conducted at a regional Western Australian hospital in 2011–2012 compared the Emergency Department management of Aboriginal and non-Aboriginal acute coronary syndrome patients. This audit is used as a case study of translating knowledge processes in order to identify the factors that support equity-oriented knowledge translation. Methods: In-depth interviews were conducted with a purposive sample of the audit team and further key stakeholders with interest/experience in knowledge translation in the context of Aboriginal health. Interviews were analysed for alignment of the knowledge translation process with the thematic steps outlined in Tugwell’s cascade for equity-oriented knowledge translation framework. Results: In preparing the audit, groundwork helped shape management support to ensure receptivity to targeting Aboriginal cardiovascular outcomes. Reporting of audit findings and resulting advocacy were undertaken by the audit team with awareness of the institutional hierarchy, appropriate timing, personal relationships and recognising the importance of tailoring messages to specific audiences. These strategies were also acknowledged as important in the key stakeholder interviews. A follow-up audit documented a general improvement in treatment guideline adherence and a reduction in treatment inequalities for Aboriginal presentations. Conclusion: As well as identifying outcomes such as practice changes, a useful evaluation increases understanding of why and how an intervention worked. Case studies such as this enrich our understanding of the complex human factors, including

  10. Elevated Cardiac Troponin T in Patients With Skeletal Myopathies.

    Science.gov (United States)

    Schmid, Johannes; Liesinger, Laura; Birner-Gruenberger, Ruth; Stojakovic, Tatjana; Scharnagl, Hubert; Dieplinger, Benjamin; Asslaber, Martin; Radl, Roman; Beer, Meinrad; Polacin, Malgorzata; Mair, Johannes; Szolar, Dieter; Berghold, Andrea; Quasthoff, Stefan; Binder, Josepha S; Rainer, Peter P

    2018-04-10

    Cardiac troponins are often elevated in patients with skeletal muscle disease who have no evidence of cardiac disease. The goal of this study was to characterize cardiac troponin concentrations in patients with myopathies and derive insights regarding the source of elevated troponin T measurements. Cardiac troponin T (cTnT) and cardiac troponin I (cTnI) concentrations were determined by using high sensitivity assays in 74 patients with hereditary and acquired skeletal myopathies. Patients underwent comprehensive cardiac evaluation, including 12-lead electrocardiogram, 24-h electrocardiogram, cardiac magnetic resonance imaging, and coronary artery computed tomography. cTnT and cTnI protein expression was determined in skeletal muscle samples of 9 patients and in control tissues derived from autopsy using antibodies that are used in commercial assays. Relevant Western blot bands were subjected to liquid chromatography tandem mass spectrometry for protein identification. Levels of cTnT (median: 24 ng/l; interquartile range: 11 to 54 ng/l) were elevated (>14 ng/l) in 68.9% of patients; cTnI was elevated (>26 ng/l) in 4.1% of patients. Serum cTnT levels significantly correlated with creatine kinase and myoglobin (r = 0.679 and 0.786, respectively; both p < 0.001). Based on cTnT serial testing, 30.1% would have fulfilled current rule-in criteria for myocardial infarction. Noncoronary cardiac disease was present in 23%. Using cTnT antibodies, positive bands were found in both diseased and healthy skeletal muscle at molecular weights approximately 5 kDa below cTnT. Liquid chromatography tandem mass spectrometry identified the presence of skeletal troponin T isoforms in these bands. Measured cTnT concentrations were chronically elevated in the majority of patients with skeletal myopathies, whereas cTnI elevation was rare. Our data indicate that cross-reaction of the cTnT immunoassay with skeletal muscle troponin isoforms was the likely cause. Copyright © 2018 The

  11. Aerobic Training in Patients with Congenital Myopathy.

    Directory of Open Access Journals (Sweden)

    Gitte Hedermann

    Full Text Available Congenital myopathies (CM often affect contractile proteins of the sarcomere, which could render patients susceptible to exercise-induced muscle damage. We investigated if exercise is safe and beneficial in patients with CM.Patients exercised on a stationary bike for 30 minutes, three times weekly, for 10 weeks at 70% of their maximal oxygen uptake (VO2max. Creatine kinase (CK was monitored as a marker of muscle damage. VO2max, functional tests, and questionnaires evaluated efficacy.Sixteen patients with CM were included in a controlled study. VO2max increased by 14% (range, 6-25%; 95% CI 7-20; p < 0.001 in the seven patients who completed training, and tended to decrease in a non-intervention group (n = 7; change -3.5%; range, -11-3%, p = 0.083. CK levels were normal and remained stable during training. Baseline Fatigue Severity Scale scores were high, 4.9 (SE 1.9, and tended to decrease (to 4.4 (SE 1.7; p = 0.08 with training. Nine patients dropped out of the training program. Fatigue was the major single reason.Ten weeks of endurance training is safe and improves fitness in patients with congenital myopathies. The training did not cause sarcomeric injury, even though sarcomeric function is affected by the genetic abnormalities in most patients with CM. Severe fatigue, which characterizes patients with CM, is a limiting factor for initiating training in CM, but tends to improve in those who train.The Regional Committee on Health Research Ethics of the Capital Region of Denmark H-2-2013-066 and ClinicalTrials.gov H2-2013-066.

  12. Association between statin-associated myopathy and skeletal muscle damage.

    OpenAIRE

    Mohaupt Markus G; Karas Richard H; Babiychuk Eduard B; Sanchez-Freire Verónica; Monastyrskaya Katia; Iyer Lakshmanan; Hoppeler Hans; Breil Fabio; Draeger Annette

    2009-01-01

    BACKGROUND Many patients taking statins often complain of muscle pain and weakness. The extent to which muscle pain reflects muscle injury is unknown. METHODS We obtained biopsy samples from the vastus lateralis muscle of 83 patients. Of the 44 patients with clinically diagnosed statin associated myopathy 29 were currently taking a statin and 15 had discontinued statin therapy before the biopsy (minimal duration of discontinuation 3 weeks). We also included 19 patients who were taking stat...

  13. Cardiac involvement in adult and juvenile idiopathic inflammatory myopathies

    DEFF Research Database (Denmark)

    Schwartz, TThomas W; Diederichsen, L. P.; Lundberg, Ingrid E.

    2016-01-01

    Idiopathic inflammatory myopathies (IIM) include the main subgroups polymyositis (PM), dermatomyositis (DM), inclusion body myositis (IBM) and juvenile DM ( JDM). The mentioned subgroups are characterised by inflammation of skeletal muscles leading to muscle weakness and other organs can also...... that statins might worsen muscle symptoms mimicking myositis relapse. On the basis of recent studies, we recommend a low threshold for cardiac workup and follow-up in patients with IIM. © 2016 Published by the BMJ Publishing Group Limited....

  14. Congenital myotonic myopathy in the miniature schnauzer: an autosomal recessive trait.

    Science.gov (United States)

    Vite, C H; Melniczek, J; Patterson, D; Giger, U

    1999-01-01

    Myotonia is a clinical sign characterized by a delay in skeletal muscle relaxation following electrical or mechanical stimulation. A series of related miniature schnauzer dogs with congenital myotonic myopathy were studied. A composite pedigree of six affected litters and the results of a planned breeding between two affected animals are consistent with an autosomal recessive mode of inheritance.

  15. Miopatia por corpos esferóides: relato de caso Spheroid body myopathy: case report

    Directory of Open Access Journals (Sweden)

    Rosana Hermínia Scola

    2005-06-01

    Full Text Available A miopatia por corpos esferóides é doença rara, classificada no grupo das miopatias congênitas relacionadas aos distúrbios da desmina; apresenta, em geral, origem autossômica dominante e com início dos sintomas na fase adulta. Relatamos o caso de menina de sete anos, com diparesia facial, hipotrofia e hipotonia muscular generalizadas, arreflexia profunda generalizada, força muscular proximal nos membros superiores e inferiores e distal dos membros superiores grau 3 e distal nos membros inferiores grau 1. A eletromiografia de agulha evidenciou recrutamento aumentado e potenciais de unidade motora de curta duração e baixa amplitude, caracterizando um padrão miopático. A biópsia muscular revelou padrão misto para miopatia e desinervação e presença de corpos esferóides intracitoplasmáticos compatíveis com a miopatia por corpos esferóides. No presente caso, a paciente apresentou precocemente o início dos sintomas e não há relatos de casos semelhantes na família.Spheroid body myopathy is a rare illness classified in the group of the congenital myopathies as a desmin-related neuromuscular disorder, presenting dominant autosomical origin with the beginning of the symptoms in the adult phase. We report on a seven years old girl with facial paresia, generalized muscular hypotrophy and hypotony, generalized deep areflexia, proximal upper and lower limbs muscular strengh and distal upper limbs grade 3 and distal lower limbs grade 1. Needle electromyography evidenced increased conscription and potentials of motor unit of short duration and low amplitude, characterizing a myopathic standard. The muscle biopsy disclosed mixed standard to myopathy, denervation and inclusion bodies that are consistent to spheroid body myopathy. In this case, the patient presented, in advance, early beginning of the symptoms and there are no similar cases in the family.

  16. Acute quadriplegia caused by necrotizing myopathy in a renal transplant recipient with severe pneumonia: acute onset and complete recovery.

    Science.gov (United States)

    Tu, Guo-Wei; Song, Jie-Qiong; Ting, Simon Kang Seng; Ju, Min-Jie; He, Hong-Yu; Dong, Ji-Hong; Luo, Zhe

    2015-02-03

    Critical illness polyneuropathy and myopathy are multifaceted complications that follow severe illnesses involving the sensorimotor axons and proximal skeletal muscles. These syndromes have rarely been reported among renal transplant recipients. In this paper, we report a case of acute quadriplegia caused by necrotizing myopathy in a renal transplant recipient with severe pneumonia. The muscle strength in the patient's extremities improved gradually after four weeks of comprehensive treatment, and his daily life activities were normal a year after being discharged.

  17. Fatigue in patients with spinal muscular atrophy type II and congenital myopathies

    DEFF Research Database (Denmark)

    Werlauff, Ulla; Højberg, A; Firla-Holme, R

    2014-01-01

    PURPOSE: The aim of this study was to evaluate whether the fatigue severity scale (FSS) is an appropriate instrument to assess fatigue in patients with spinal muscular atrophy type II (SMA II) and congenital myopathies (CM). METHODS: FSS and visual analog scale (VAS) were administered to 33 SMA II...

  18. Serum and tissue markers of myopathy in patients with colorectal cancer

    Directory of Open Access Journals (Sweden)

    Nicoletta Adami

    2012-09-01

    Full Text Available Skeletal muscles in patients with cancer undergo many changes due to immuno-inflammatory factors of tumor origin, or to chemotherapy and irradiation. Aim of the present study is to identify serological biomarkers and early myopathic features in skeletal muscle biopsies from weight stable patients bearing colorectal cancer at the onset of disease. Morphometric analyses by histochemistry and immunohistochemistry were performed on intraoperative muscle biopsies from patients with early colorectal cancer and from weight stable patients undergoing surgery for benign non-inflammatory conditions. Serological analyses for testing markers of inflammation (C Reactive Protein, CRP, muscle enzymes, (Creatin Kinase, CK, soluble isoforms of adhesion molecules (Neural Cell Adhesion Molecule, NCAM, and a marker of protein turnover (prealbumin, a typical indicator of caloric and protein malnutrition were also performed. Fifty oncologic patients (28 male/22 female and 25 non oncologic patients (18 male/7 female (p=N.S. were studied. In muscles from cancer patients we observed a subclinical myopathy characterized by an abnormal distribution of myonuclei. The percentage of myofibers with internalized nuclei was significantly higher in oncologic (median= 13.1%, IQR= 6.0-20.3 than in non oncologic patients (median= 3%, IQR= 2.5-6.1 (p<0.0001. The frequency of these internally nucleated myofibers is even higher in a subgroup of oncologic patients taking myotoxic drugs. In cancer patients, we observed an inverse correlation between the number of internally nucleated fibers and the presence of node metastasis (N+ (ρ=-0.30 (p=0.03. Moreover, in patients with colorectal cancer, low serum levels of preoperative prealbumin (median= 167,7 mg/L, normal range 200-400 mg/L, were detected. The link between the observed early myopathy and long-term cachexia is supported also by the altered expression of sarcolemma associated proteins, in particular laminin and dystrophin

  19. Characterization of sarcoplasmic reticulum Ca(2+) ATPase pumps in muscle of patients with myotonic dystrophy and with hypothyroid myopathy.

    Science.gov (United States)

    Guglielmi, V; Oosterhof, A; Voermans, N C; Cardani, R; Molenaar, J P; van Kuppevelt, T H; Meola, G; van Engelen, B G; Tomelleri, G; Vattemi, G

    2016-06-01

    Sarcoplasmic/endoplasmic reticulum Ca(2+) ATPase (SERCA) pumps play the major role in lowering cytoplasmic calcium concentration in skeletal muscle by catalyzing the ATP-dependent transport of Ca(2+) from the cytosol to the lumen of the sarcoplasmic reticulum (SR). Although SERCA abnormalities have been hypothesized to contribute to the dysregulation of intracellular Ca(2+) homeostasis and signaling in muscle of patients with myotonic dystrophy (DM) and hypothyroid myopathy, the characterization of SERCA pumps remains elusive and their impairment is still unclear. We assessed the activity of SR Ca(2+)-ATPase, expression levels and fiber distribution of SERCA1 and SERCA2, and oligomerization of SERCA1 protein in muscle of patients with DM type 1 and 2, and with hypothyroid myopathy. Our data provide evidence that SR Ca(2+) ATPase activity, protein levels and muscle fiber distribution of total SERCA1 and SERCA2, and SERCA1 oligomerization pattern are similar in patients with both DM1 and DM2, hypothyroid myopathy and in control subjects. We prove that SERCA1b, the neonatal isoform of SERCA1, is expressed at protein level in muscle of patients with DM2 and, in lower amount, of patients with DM1. Our present study demonstrates that SERCA function is not altered in muscle of patients with DM and with hypothyroid myopathy. Copyright © 2016 Elsevier B.V. All rights reserved.

  20. Quantitative nailfold video capillaroscopy in patients with idiopathic inflammatory myopathy

    OpenAIRE

    Mercer, Louise K.; Moore, Tonia L.; Chinoy, Hector; Murray, Andrea K.; Vail, Andy; Cooper, Robert G.; Herrick, Ariane L.

    2010-01-01

    Objectives. To quantify nailfold capillary density and dimensions in patients with idiopathic inflammatory myopathy (IIM) and compare them with those in healthy controls; to look for associations with microvascular disease in IIM; and to determine whether nailfold capillary density and dimensions change over time. Methods. Nailfold video microscopy (×300 magnification) was performed on 24 patients with IIM and 35 healthy controls. Capillary density and dimensions (total width and apical width...

  1. Lipid storage myopathies.

    Science.gov (United States)

    Bruno, Claudio; Dimauro, Salvatore

    2008-10-01

    The aim of this review is to provide an update on disorders of lipid metabolism affecting skeletal muscle exclusively or predominantly and to summarize recent clinical, genetic, and therapeutic studies in this field. Over the past 5 years, new clinical phenotypes and genetic loci have been described, unusual pathogenic mechanisms have been elucidated, and novel pharmacological approaches have been developed. At least one genetic defect responsible for the myopathic form of CoQ10 deficiency has been identified, causing a disorder that is allelic with the late-onset riboflavine-responsive form of multiple acyl-coenzyme A dehydrogenation deficiency. Novel mechanisms involved in the lipolytic breakdown of cellular lipid depots have been described and have led to the identification of genes and mutations responsible for multisystemic neutral lipid storage disorders, characterized by accumulation of triglyceride in multiple tissues, including muscle. Defects in lipid metabolism can affect either the mitochondrial transport and oxidation of exogenous fatty acid or the catabolism of endogenous triglycerides. These disorders impair energy production and almost invariably involve skeletal muscle, causing progressive myopathy with muscle weakness, or recurrent acute episodes of rhabdomyolysis triggered by exercise, fasting, or infections. Clinical and genetic characterization of these disorders has important implications both for accurate diagnostic approach and for development of therapeutic strategies.

  2. Acquired multiple Acyl-CoA dehydrogenase deficiency in 10 horses with atypical myopathy

    NARCIS (Netherlands)

    Westermann, C. M.; Dorland, L.; Votion, D. M.; de Sain-van der Velden, M. G. M.; Wijnberg, I. D.; Wanders, R. J. A.; Spliet, W. G. M.; Testerink, N.; Berger, R.; Ruiter, J. P. N.; van der Kolk, J. H.

    2008-01-01

    The aim of the current study was to assess lipid metabolism in horses with atypical myopathy. Urine samples from 10 cases were subjected to analysis of organic acids, glycine conjugates, and acylcarnitines revealing increased mean excretion of lactic acid, ethylmalonic acid, 2-methylsuccinic acid,

  3. Making the most of a translator.

    Science.gov (United States)

    Dannenfeldt, D

    1994-01-01

    Anaheim Memorial Hospital in California is a trailblazer. It's one of the first hospitals in the nation to use translation software for both supply procurement and claims-related transactions. Initially, it acquired the software to streamline the ordering of supplies by shifting to standard electronic formats. Today, the hospital is using the software to receive electronic remittance advice, and it has plans for other labor-saving applications.

  4. A novel mutation in PNPLA2 causes neutral lipid storage disease with myopathy and triglyceride deposit cardiomyovasculopathy: a case report and literature review.

    Science.gov (United States)

    Kaneko, Kimihiko; Kuroda, Hiroshi; Izumi, Rumiko; Tateyama, Maki; Kato, Masaaki; Sugimura, Koichiro; Sakata, Yasuhiko; Ikeda, Yoshihiko; Hirano, Ken-Ichi; Aoki, Masashi

    2014-07-01

    Mutations in PNPLA2 cause neutral lipid storage disease with myopathy (NLSDM) or triglyceride deposit cardiomyovasculopathy (TGCV). We report a 59-year-old patient with NLSDM/TGCV presenting marked asymmetric skeletal myopathy and cardiomyovasculopathy. Skeletal muscle and endomyocardial biopsies showed cytoplasmic vacuoles containing neutral lipid. Gene analysis revealed a novel homozygous mutation (c.576delC) in PNPLA2. We reviewed 37 genetically-proven NLSDM/TGCV cases; median age was 30 years; distribution of myopathy was proximal (69%) and distal predominant (16%); asymmetric myopathy (right>left) was reported in 41% of the patients. Frequently-affected muscles were posterior compartment of leg (75%), shoulder girdle to upper arm (50%), and paraspinal (33%). Skeletal muscle biopsies showed lipid accumulation in 100% and rimmed vacuoles in 22%. Frequent comorbidities were cardiomyopathy (44%), hyperlipidemia (23%), diabetes mellitus (24%), and pancreatitis (14%). PNPLA2 mutations concentrated in Exon 4-7 without apparent genotype-phenotype correlations. To know the characteristic features is essential for the early diagnosis of NLSDM/TGCV. Copyright © 2014 Elsevier B.V. All rights reserved.

  5. Schistosomiasis and nutritional myopathy in a Brazilian tapir (Tapirus terrestris).

    Science.gov (United States)

    Yamini, B; Schillhorn van Veen, T W

    1988-10-01

    Gross lesions suggestive of severe hepatoenteropathy and myopathy were noted in a 4.5-yr-old Brazilian tapir (Tapirus terrestris) from a zoo in Michigan (USA). The major microscopic lesions were granulomatous hepatitis and hemorrhagic enteritis associated with non-operculated eggs compatible with those of the Schistosomatidae (Digenea). Skeletal muscle and tongue contained foci of severe acute myodegeneration and necrosis. The hepatic vitamin E value of 1.3 ppm dry weight was considered critically low.

  6. Exertional Myopathy in a Juvenile Green Sea Turtle (Chelonia mydas Entangled in a Large Mesh Gillnet

    Directory of Open Access Journals (Sweden)

    Brianne E. Phillips

    2015-01-01

    Full Text Available A juvenile female green sea turtle (Chelonia mydas was found entangled in a large mesh gillnet in Pamlico Sound, NC, and was weak upon presentation for treatment. Blood gas analysis revealed severe metabolic acidosis and hyperlactatemia. Plasma biochemistry analysis showed elevated aspartate aminotransferase and creatine kinase, marked hypercalcemia, hyperphosphatemia, and hyperkalemia. Death occurred within 24 hours of presentation despite treatment with intravenous and subcutaneous fluids and sodium bicarbonate. Necropsy revealed multifocal to diffuse pallor of the superficial and deep pectoral muscles. Mild, multifocal, and acute myofiber necrosis was identified by histopathological examination. While histological changes in the examined muscle were modest, the acid-base, mineral, and electrolyte abnormalities were sufficiently severe to contribute to this animal’s mortality. Exertional myopathy in reptiles has not been well characterized. Sea turtle mortality resulting from forced submergence has been attributed to blood gas derangements and seawater aspiration; however, exertional myopathy may also be an important contributing factor. If possible, sea turtles subjected to incidental capture and entanglement that exhibit weakness or dull mentation should be clinically evaluated prior to release to minimize the risk of delayed mortality. Treatment with appropriate fluid therapy and supportive care may mitigate the effects of exertional myopathy in some cases.

  7. The Effect of the Wooden Breast Myopathy on Sarcomere Structure and Organization.

    Science.gov (United States)

    Velleman, Sandra G; Clark, Daniel L; Tonniges, Jeffrey R

    2018-03-01

    The wooden breast (WB) has been classically identified by the phenotypic presence of a wood-like pectoralis major (p. major) muscle. The WB-affected p. major muscle is characterized by necrotic muscle fibers and the replacement of muscle with connective tissue, water, and fat. The objective of the current study was to determine the effect of the WB myopathy on sarcomere organization by transmission electron microscopy. Sarcomere structure and organization were examined in two broiler lines with a high incidence of WB (Lines A and B) and another broiler line without WB (Line C). Affected muscle had an increase in smaller myofibers with diameters of 20 μm or less. Sarcomere organization decreased with fiber diameter in both Lines A and B. The structure and organization of sarcomeres in Line C were similar to WB-unaffected muscle in Lines A and B. Taken together, these data demonstrate that the WB myopathy detrimentally affects sarcomere organization in a broiler line-specific manner. Disorganization of sarcomere structure will affect the function of the p. major muscle as well as meat quality.

  8. Anaesthetic management of a paediatric patient with congenital fibre type disproportion myopathy.

    Science.gov (United States)

    Buisán, F; de la Varga, O; Flores, M; Sánchez-Ruano, J

    2018-04-23

    Congenital fibre type disproportion (CFTD) is a rare type of myopathy that is characterised by muscle weakness and hypotonia during childhood. Clinical features include motor delay, feeding difficulties, limb weakness, joint contractures, and scoliosis. A report is presented of the anaesthetic management of a 3-year-old girl with CFTD myopathy associated with a mutation of the TPM3 gene, scheduled for adenotonsillectomy because of obstructive sleep apnoea hypopnoea syndrome (OSAHS). The main concerns were the possible susceptibility to malignant hyperthermia, the risk of anaesthesia-induced rhabdomyolysis, a greater sensitivity to non-depolarising muscle relaxants, and the presence of OSAHS. Total intravenous anaesthesia with propofol and the use of rocuronium/sugammadex appear to be safe options. Given the high risk of respiratory compromise and other complications, patients should be closely monitored in the post-operative period. Copyright © 2018 Sociedad Española de Anestesiología, Reanimación y Terapéutica del Dolor. Publicado por Elsevier España, S.L.U. All rights reserved.

  9. Acquired multiple Acyl-CoA dehydrogenase deficiency in 10 horses with atypical myopathy.

    Science.gov (United States)

    Westermann, C M; Dorland, L; Votion, D M; de Sain-van der Velden, M G M; Wijnberg, I D; Wanders, R J A; Spliet, W G M; Testerink, N; Berger, R; Ruiter, J P N; van der Kolk, J H

    2008-05-01

    The aim of the current study was to assess lipid metabolism in horses with atypical myopathy. Urine samples from 10 cases were subjected to analysis of organic acids, glycine conjugates, and acylcarnitines revealing increased mean excretion of lactic acid, ethylmalonic acid, 2-methylsuccinic acid, butyrylglycine, (iso)valerylglycine, hexanoylglycine, free carnitine, C2-, C3-, C4-, C5-, C6-, C8-, C8:1-, C10:1-, and C10:2-carnitine as compared with 15 control horses (12 healthy and three with acute myopathy due to other causes). Analysis of plasma revealed similar results for these predominantly short-chain acylcarnitines. Furthermore, measurement of dehydrogenase activities in lateral vastus muscle from one horse with atypical myopathy indeed showed deficiencies of short-chain acyl-CoA dehydrogenase (0.66 as compared with 2.27 and 2.48 in two controls), medium-chain acyl-CoA dehydrogenase (0.36 as compared with 4.31 and 4.82 in two controls) and isovaleryl-CoA dehydrogenase (0.74 as compared with 1.43 and 1.61 nmol min(-1) mg(-1) in two controls). A deficiency of several mitochondrial dehydrogenases that utilize flavin adenine dinucleotide as cofactor including the acyl-CoA dehydrogenases of fatty acid beta-oxidation, and enzymes that degrade the CoA-esters of glutaric acid, isovaleric acid, 2-methylbutyric acid, isobutyric acid, and sarcosine was suspected in 10 out of 10 cases as the possible etiology for a highly fatal and prevalent toxic equine muscle disease similar to the combined metabolic derangements seen in human multiple acyl-CoA dehydrogenase deficiency also known as glutaric acidemia type II.

  10. Implementation of multidimensional knowledge translation strategies to improve procedural pain in hospitalized children.

    Science.gov (United States)

    Stevens, Bonnie J; Yamada, Janet; Promislow, Sara; Stinson, Jennifer; Harrison, Denise; Victor, J Charles

    2014-11-25

    Despite extensive research, institutional policies, and practice guidelines, procedural pain remains undertreated in hospitalized children. Knowledge translation (KT) strategies have been employed to bridge the research to practice gap with varying success. The most effective single or combination of KT strategies has not been found. A multifaceted KT intervention, Evidence-based Practice for Improving Quality (EPIQ), that included tailored KT strategies was effective in improving pain practices and clinical outcomes at the unit level in a prospective comparative cohort study in 32 hospital units (16 EPIQ intervention and 16 Standard Care), in eight pediatric hospitals in Canada. In a study of the 16 EPIQ units (two at each hospital) only, the objectives were to: determine the effectiveness of evidence-based KT strategies implemented to achieve unit aims; describe the KT strategies implemented and their influence on pain assessment and management across unit types; and identify facilitators and barriers to their implementation. Data were collected from each EPIQ intervention unit on targeted pain practices and KT strategies implemented, through chart review and a process evaluation checklist, following four intervention cycles over a 15-month period. Following the completion of the four cycle intervention, 78% of 23 targeted pain practice aims across units were achieved within 80% of the stated aims. A statistically significant improvement was found in the proportion of children receiving pain assessment and management, regardless of pre-determined aims (p strategies implemented was 35 and included reminders, educational outreach and materials, and audit and feedback. Units successful in achieving their aims implemented more KT strategies than units that did not. No specific type of single or combination of KT strategies was more effective in improving pain assessment and management outcomes. Tailoring KT strategies to unit context, support from unit leadership

  11. Oculopharyngeal Weakness, Hypophrenia, Deafness, and Impaired Vision: A Novel Autosomal Dominant Myopathy with Rimmed Vacuoles

    Directory of Open Access Journals (Sweden)

    Ting Chen

    2016-01-01

    Conclusions: We reported a novel autosomal dominant myopathy with rimmed vacuoles characterized by dysarthria, dysphagia, external ophthalmoplegia, limb weakness, hypophrenia, deafness, and impaired vision, but the causative gene has not been found and needs further study.

  12. Muscle structural changes in mitochondrial myopathy relate to genotype

    DEFF Research Database (Denmark)

    Olsen, David B.; Langkilde, Annika Reynberg; Ørngreen, Mette C.

    2003-01-01

    It is well known that morphological changes at the cellular level occur in muscle of patients with mitochondrial myopathy (MM), but changes in muscle structure with fat infiltration and gross variation of muscle fiber size with giant fibers, normally encountered in the muscular dystrophies, have...... typically not been associated with mitochondrial disease. We investigated gross and microscopic muscle morphology in thigh muscles by muscle biopsy and MRI in 16 patients with MM, and compared findings with those obtained in muscular dystrophy patients and healthy subjects. Changes of muscle architecture...

  13. Reading Right: Korean Translation Manual. English for Special Purposes Series: Nursing Aide.

    Science.gov (United States)

    Park, Yong-Ok

    This Korean translation manual for nursing aides is designed to improve reading skills of U.S. immigrants. After short readings in Korean and English translations of vocabulary/phrases, comprehension, grammar, and language usage exercises are presented. Topical areas include: food, the hospital staff, body language, cleanliness in the hospital,…

  14. Combining training in knowledge translation with quality improvement reduced 30-day heart failure readmissions in a community hospital: a case study.

    Science.gov (United States)

    Wyer, Peter; Stojanovic, Zorica; Shaffer, Jonathan A; Placencia, Mitzy; Klink, Kathleen; Fosina, Michael J; Lin, Susan X; Barron, Beth; Graham, Ian D

    2016-04-01

    Training programmes in evidence-based practice (EBP) frequently fail to translate their content into practice change and care improvement. We linked multidisciplinary training in EBP to an initiative to decrease 30-day readmissions among patients admitted to a community teaching hospital for heart failure (HF). Hospital staff reflecting all services and disciplines relevant to care of patients with HF attended a 3-day innovative capacity building conference in evidence-based health care over a 3-year period beginning in 2009. The team, facilitated by a conference faculty member, applied a knowledge-to-action model taught at the conference. We reviewed published research, profiled our population and practice experience, developed a three-phase protocol and implemented it in late 2010. We tracked readmission rates, adverse clinical outcomes and programme cost. The protocol emphasized patient education, medication reconciliation and transition to community-based care. Senior administration approved a full-time nurse HF coordinator. Thirty-day HF readmissions decreased from 23.1% to 16.4% (adjusted OR = 0.64, 95% CI = 0.42-0.97) during the year following implementation. Corresponding rates in another hospital serving the same population but not part of the programme were 22.3% and 20.2% (adjusted OR = 0.87, 95% CI = 0.71-1.08). Adherence to mandated HF quality measures improved. Following a start-up cost of $15 000 US, programme expenses balanced potential savings from decreased HF readmissions. Training of a multidisciplinary hospital team in use of a knowledge translation model, combined with ongoing facilitation, led to implementation of a budget neutral programme that decreased HF readmissions. © 2015 John Wiley & Sons, Ltd.

  15. Management of cases suffering from atypical myopathy: interpretations of descriptive, epidemiological and pathophysiological findings

    DEFF Research Database (Denmark)

    van Galen Verwilghen, Gaby; Votion, D.-M.

    2013-01-01

    Atypical myopathy is highly fatal, but about a quarter of affected horses survive. This highlights the need for provision of supportive treatment for these cases. This review is a practical guideline for equine practitioners and includes suggestions for close monitoring of involved organ systems ...

  16. Management of cases suffering from atypical myopathy: interpretations of descriptive, epidemiological and pathophysiological findings

    DEFF Research Database (Denmark)

    van Galen Verwilghen, Gaby; Votion, D.-M.

    2013-01-01

    Atypical myopathy is highly fatal, but about a quarter of affected horses survive. This highlights the need for provision of supportive treatment for these patients. This review is a practical guideline for equine practitioners and includes suggestions for close monitoring of involved organ systems...

  17. Mutation in the novel nuclear-encoded mitochondrial protein CHCHD10 in a family with autosomal dominant mitochondrial myopathy.

    Science.gov (United States)

    Ajroud-Driss, Senda; Fecto, Faisal; Ajroud, Kaouther; Lalani, Irfan; Calvo, Sarah E; Mootha, Vamsi K; Deng, Han-Xiang; Siddique, Nailah; Tahmoush, Albert J; Heiman-Patterson, Terry D; Siddique, Teepu

    2015-01-01

    Mitochondrial myopathies belong to a larger group of systemic diseases caused by morphological or biochemical abnormalities of mitochondria. Mitochondrial disorders can be caused by mutations in either the mitochondrial or nuclear genome. Only 5% of all mitochondrial disorders are autosomal dominant. We analyzed DNA from members of the previously reported Puerto Rican kindred with an autosomal dominant mitochondrial myopathy (Heimann-Patterson et al. 1997). Linkage analysis suggested a putative locus on the pericentric region of the long arm of chromosome 22 (22q11). Using the tools of integrative genomics, we established chromosome 22 open reading frame 16 (C22orf16) (later designated as CHCHD10) as the only high-scoring mitochondrial candidate gene in our minimal candidate region. Sequence analysis revealed a double-missense mutation (R15S and G58R) in cis in CHCHD10 which encodes a coiled coil-helix-coiled coil-helix protein of unknown function. These two mutations completely co-segregated with the disease phenotype and were absent in 1,481 Caucasian and 80 Hispanic (including 32 Puerto Rican) controls. Expression profiling showed that CHCHD10 is enriched in skeletal muscle. Mitochondrial localization of the CHCHD10 protein was confirmed using immunofluorescence in cells expressing either wild-type or mutant CHCHD10. We found that the expression of the G58R, but not the R15S, mutation induced mitochondrial fragmentation. Our findings identify a novel gene causing mitochondrial myopathy, thereby expanding the spectrum of mitochondrial myopathies caused by nuclear genes. Our findings also suggest a role for CHCHD10 in the morphologic remodeling of the mitochondria.

  18. Performance, meat quality, and pectoral myopathies of broilers fed either corn or sorghum based diets supplemented with guanidinoacetic acid.

    Science.gov (United States)

    Córdova-Noboa, H A; Oviedo-Rondón, E O; Sarsour, A H; Barnes, J; Ferzola, P; Rademacher-Heilshorn, M; Braun, U

    2018-04-13

    One experiment was conducted to evaluate the effects of guanidinoacetic acid (GAA) supplementation in broilers fed corn or sorghum-based diets on live performance, carcass and cut up yields, meat quality, and pectoral myopathies. The treatments consisted of corn or sorghum-based diets with or without the addition of GAA (600 g/ton). A total of 800 one-d-old male Ross 708 broiler chicks were randomly placed in 40 floor pens with 10 replicates (20 birds per pen) per each of the four treatments. At hatch, 14, 35, and 50 d, BW and feed intake were recorded. BW gain and FCR were calculated at the end of each phase. Four broilers per pen were selected and slaughtered at 51d and 55d of age to determine carcass and cut up yields, meat quality and myopathies (spaghetti muscle, white striping, and wooden breast) severity in the Pectoralis major. Data were analyzed as a randomized complete block design in a 2 × 2 factorial arrangement with grain type and GAA supplementation as main effects. At 50 d, diets containing GAA improved (P broilers fed corn diets with GAA had higher breast meat yield (P 0.05) by GAA supplementation at any slaughter ages. However, GAA decreased (P broilers supplemented with GAA had double (P broilers fed non-supplemented diets, therefore reducing the severity of this myopathy. In conclusion, GAA supplementation improved broiler live performance in broilers raised up to 50 d independently of grain source, increased breast meat yield in corn-based diets and reduced the severity of wooden breast myopathy.

  19. Neutral lipid-storage disease with myopathy and extended phenotype with novel PNPLA2 mutation.

    Science.gov (United States)

    Massa, Roberto; Pozzessere, Simone; Rastelli, Emanuele; Serra, Laura; Terracciano, Chiara; Gibellini, Manuela; Bozzali, Marco; Arca, Marcello

    2016-04-01

    Neutral lipid-storage disease with myopathy is caused by mutations in PNPLA2, which produce skeletal and cardiac myopathy. We report a man with multiorgan neutral lipid storage and unusual multisystem clinical involvement, including cognitive impairment. Quantitative brain MRI with voxel-based morphometry and extended neuropsychological assessment were performed. In parallel, the coding sequences and intron/exon boundaries of the PNPLA2 gene were screened by direct sequencing. Neuropsychological assessment revealed global cognitive impairment, and brain MRI showed reduced gray matter volume in the temporal lobes. Molecular characterization revealed a novel homozygous mutation in exon 5 of PNPLA2 (c.714C>A), resulting in a premature stop codon (p.Cys238*). Some PNPLA2 mutations, such as the one described here, may present with an extended phenotype, including brain involvement. In these cases, complete neuropsychological testing, combined with quantitative brain MRI, may help to characterize and quantify cognitive impairment. © 2016 Wiley Periodicals, Inc.

  20. Craniopharyngioma presenting with severe hyponatremia, hyponatremia-induced myopathy, and panhypopituitarism: a case report.

    Science.gov (United States)

    Dilrukshi, M D S A; Sandakumari, G V N; Abeysundara, P K; Chang, T

    2017-02-05

    Craniopharyngiomas are rare intracranial tumors commonly presenting with neurological symptoms. Reports of severe hyponatremia as a presenting manifestation of a craniopharyngioma and hyponatremia-induced myopathy are rare. We report the case of a patient with craniopharyngioma presenting with severe hyponatremia, panhypopituitarism, and hyponatremia-induced myopathy. A 52-year-old Sri Lankan man presented with anorexia, nausea, fatigue, generalized muscle weakness, and cramps for 1 week. The onset of his illness had been preceded by vomiting and diarrhea for 1 day which he attributed to food poisoning. On examination, he had an apathetic disposition with a generalized "sallow complexion." He was not dehydrated. Apart from reduced muscle power (4/5) and hyporeflexia, the neurological examination was normal. His serum sodium was 102 mmol/l; potassium 4.1 mmol/l; chloride 63 mmol/l; plasma osmolality 272 mosm/KgH 2 O; urine osmolality 642 mosm/KgH 2 O; and urine sodium 79 mmol/l. His creatine phosphokinase was 12,400 U/l, lactate dehydrogenase 628 U/l, aspartate aminotransferase 360 U/l, and alanine aminotransferase 64 U/l. His hormone profile revealed panhypopituitarism. An electromyogram showed nonspecific abnormalities while a muscle biopsy did not show any pathology. Magnetic resonance imaging of his brain demonstrated a well-defined craniopharyngioma with suprasellar extension. His pituitary gland was compressed and the pituitary stalk was displaced by the tumor. He had marked improvement in muscle power and rapid reduction of serum creatine phosphokinase levels paralleling the correction of severe hyponatremia, even before the initiation of hormone replacement. This case illustrates the rare presentation of severe hyponatremia and hyponatremia-induced myopathy in patients with craniopharyngioma, awareness of which would facilitate early appropriate investigations and treatment.

  1. Toxic myopathies: muscle biopsy features Miopatia tóxica: biópsia muscular

    Directory of Open Access Journals (Sweden)

    Rosana Herminia Scola

    2007-03-01

    Full Text Available Several drugs and toxic substances can cause muscular abnormalities and are frequent causes of acquired myopathies. We present a series of 32 patients, predominance of young adult patients, diagnosed with toxic myopathy. The most common substances inducing myopathy were corticosteroids (56.2% followed by the propoxyphene, neuroleptics, zidovudine and drug-induced hypokalemia. The investigation showed normal serum creatine kinase levels in 65.4%, myopathic pattern of the needle electromyography in 40% and the more frequent histological diagnosis of the muscle biopsy was type 2 fiber atrophy (59.3%. Clinical features, etiology, course of the disease, serum levels of muscular enzymes, electromyographic features and, especially, muscle biopsy features are discussed.Diversos medicamentos e substâncias tóxicas podem causar alterações musculares e são causas freqüentes de miopatia adquirida. Apresentamos uma série de 32 pacientes, predomínio de pacientes adulto jovens, com miopatia tóxica. As substâncias mais relacionadas com a miopatia foram os corticosteróides (56,2% seguidos pelo propoxifeno, neurolépticos, zidovudina e drogas indutoras de hipocalemia. A investigação mostrou níveis normais de creatino quinase sérica em 65,4%, eletromiografia de agulha com padrão miopático em 40% e o mais freqüente diagnóstico histológico da biópsia muscular foi atrofia de fibras do tipo 2 (59,3%. As manifestações clínicas, etiologia, tempo de evolução, nível sérico das enzimas musculares, alterações da eletroneuromiografia e, especialmente, da biópsia muscular são discutidos.

  2. Novel autosomal dominant TNNT1 mutation causing nemaline myopathy.

    Science.gov (United States)

    Konersman, Chamindra G; Freyermuth, Fernande; Winder, Thomas L; Lawlor, Michael W; Lagier-Tourenne, Clotilde; Patel, Shailendra B

    2017-11-01

    Nemaline myopathy (NEM) is one of the three major forms of congenital myopathy and is characterized by diffuse muscle weakness, hypotonia, respiratory insufficiency, and the presence of nemaline rod structures on muscle biopsy. Mutations in troponin T1 (TNNT1) is 1 of 10 genes known to cause NEM. To date, only homozygous nonsense mutations or compound heterozygous truncating or internal deletion mutations in TNNT1 gene have been identified in NEM. This extended family is of historical importance as some members were reported in the 1960s as initial evidence that NEM is a hereditary disorder. Proband and extended family underwent Sanger sequencing for TNNT1. We performed RT-PCR and immunoblot on muscle to assess TNNT1 RNA expression and protein levels in proband and father. We report a novel heterozygous missense mutation of TNNT1 c.311A>T (p.E104V) that segregated in an autosomal dominant fashion in a large family residing in the United States. Extensive sequencing of the other known genes for NEM failed to identify any other mutant alleles. Muscle biopsies revealed a characteristic pattern of nemaline rods and severe myofiber hypotrophy that was almost entirely restricted to the type 1 fiber population. This novel mutation alters a residue that is highly conserved among vertebrates. This report highlights not only a family with autosomal dominant inheritance of NEM, but that this novel mutation likely acts via a dominant negative mechanism. © 2017 The Authors. Molecular Genetics & Genomic Medicine published by Wiley Periodicals, Inc.

  3. Triacylglycerol infusion improves exercise endurance in patients with mitochondrial myopathy due to complex I deficiency

    NARCIS (Netherlands)

    Roef, MJ; de Meer, K; Reijngoud, DJ; Straver, HWHC; de Barse, M; Kalhan, SC; Berger, R

    Background: A high-fat diet has been recommended for the treatment of patients with mitochondrial myopathy due to complex I (NADH dehydrogenase) deficiency (CID). Objective: This study evaluated the effects of intravenous infusion of isoenergetic amounts of triacylglycerol or glucose on substrate

  4. Becker muscular dystrophy-like myopathy regarded as so-called "fatty muscular dystrophy" in a pig: a case report and its diagnostic method.

    Science.gov (United States)

    Horiuchi, Noriyuki; Aihara, Naoyuki; Mizutani, Hiroshi; Kousaka, Shinichi; Nagafuchi, Tsuneyuki; Ochiai, Mariko; Ochiai, Kazuhiko; Kobayashi, Yoshiyasu; Furuoka, Hidefumi; Asai, Tetsuo; Oishi, Koji

    2014-03-01

    We describe a case of human Becker muscular dystrophy (BMD)-like myopathy that was characterized by the declined stainability of dystrophin at sarcolemma in a pig and the immunostaining for dystrophin on the formalin-fixed, paraffin-embedded (FFPE) tissue. The present case was found in a meat inspection center. The pig looked appeared healthy at the ante-mortem inspection. Muscular abnormalities were detected after carcass dressing as pale, discolored skeletal muscles with prominent fat infiltrations and considered so-called "fatty muscular dystrophy". Microscopic examination revealed following characteristics: diffused fat infiltration into the skeletal muscle and degeneration and regeneration of the remaining skeletal muscle fibers. Any lesions that were suspected of neurogenic atrophy, traumatic muscular degeneration, glycogen storage disease or other porcine muscular disorders were not observed. The immunostaining for dystrophin was conducted and confirmed to be applicable on FFPE porcine muscular tissues and revealed diminished stainability of dystrophin at the sarcolemma in the present case. Based on the histological observations and immunostaining results, the present case was diagnosed with BMD-like myopathy associated with dystrophin abnormality in a pig. Although the genetic properties were not clear, the present BMD-like myopathy implied the occurrence of dystrophinopathy in pigs. To the best of our knowledge, this is the first report of a natural case of myopathy associated with dystrophin abnormalities in a pig.

  5. Autism in the Son of a Woman with Mitochondrial Myopathy and Dysautonomia: A Case Report.

    Science.gov (United States)

    Brown, Bradley D; Rais, Theodore

    2015-01-01

    The relationship between autism spectrum disorders and mitochondrial dysfunction, including mitochondrial myopathies and other mitochondrial diseases, is an area of ongoing research. All autism spectrum disorders are known to be heritable, via genetic and/or epigenetic mechanisms, but specific modes of inheritance are not well characterized. Nevertheless, autism spectrum disorders have been linked to many specific genes associated with mitochondrial function, especially to genes involved in mitochondrial tRNA and the electron transport chain, both particularly vulnerable to point mutations, and clinical research also supports a relationship between the two pathologies. Although only a small minority of patients with autism have a mitochondrial disease, many patients with mitochondrial myopathies have autism spectrum disorder symptoms, and these symptoms may be the presenting symptoms, which presents a diagnostic challenge for clinicians. The authors report the case of a 15-year-old boy with a history of autism spectrum disorder and neurocardiogenic syncope, admitted to the inpatient unit for self-injury, whose young mother, age 35, was discovered to suffer from mitochondrial myopathy, dysautonomia, neurocardiogenic syncope, Ehler-Danlos syndrome, and other uncommon multisystem pathologies likely related to mitochondrial dysfunction. This case illustrates the need for a high index of suspicion for mitochondrial disease in patients with autism, as they have two orders of magnitude greater risk for such diseases than the general population. The literature shows that mitochondrial disease is underdiagnosed in autism spectrum disorder patients and should not be viewed as a "zebra" (i.e., an obscure diagnosis that is made when a more common explanation is more likely).

  6. Skeletal muscle repair in a mouse model of nemaline myopathy.

    Science.gov (United States)

    Sanoudou, Despina; Corbett, Mark A; Han, Mei; Ghoddusi, Majid; Nguyen, Mai-Anh T; Vlahovich, Nicole; Hardeman, Edna C; Beggs, Alan H

    2006-09-01

    Nemaline myopathy (NM), the most common non-dystrophic congenital myopathy, is a variably severe neuromuscular disorder for which no effective treatment is available. Although a number of genes have been identified in which mutations can cause NM, the pathogenetic mechanisms leading to the phenotypes are poorly understood. To address this question, we examined gene expression patterns in an NM mouse model carrying the human Met9Arg mutation of alpha-tropomyosin slow (Tpm3). We assessed five different skeletal muscles from affected mice, which are representative of muscles with differing fiber-type compositions, different physiological specializations and variable degrees of pathology. Although these same muscles in non-affected mice showed marked variation in patterns of gene expression, with diaphragm being the most dissimilar, the presence of the mutant protein in nemaline muscles resulted in a more similar pattern of gene expression among the muscles. This result suggests a common process or mechanism operating in nemaline muscles independent of the variable degrees of pathology. Transcriptional and protein expression data indicate the presence of a repair process and possibly delayed maturation in nemaline muscles. Markers indicative of satellite cell number, activated satellite cells and immature fibers including M-Cadherin, MyoD, desmin, Pax7 and Myf6 were elevated by western-blot analysis or immunohistochemistry. Evidence suggesting elevated focal repair was observed in nemaline muscle in electron micrographs. This analysis reveals that NM is characterized by a novel repair feature operating in multiple different muscles.

  7. An Ethics Of Discomfort: Supplementing Ricœur On Translation

    Directory of Open Access Journals (Sweden)

    Lisa Foran

    2015-07-01

    Full Text Available This article compares Paul Ricoeur and Jacques Derrida on the theme of translation and in particular the ethical implications of the different ways in which they approach the untranslatable.  While Ricoeur’s account of translation as linguistic hospitality does offer a model for an ethical encounter with the other, I argue that this account does not go far enough. My central claim is that Ricoeur’s treatment of translation overemphasizes the movement of appropriation and integration.  While it may not be his intention, this emphasis could lead to a certain kind of complacency that would challenge the ethical claims Ricoeur makes in favour of translation as a paradigm.  I propose to supplement Ricoeur’s hospitality with Derrida’s untranslatable, in order to create a situation of constant discomfort thereby guarding against ethical complacency.

  8. Tc-99m ECD brain SPECT in MELAS syndrome and mitochondrial myopathy: comparison with MR findings

    International Nuclear Information System (INIS)

    Park, Sang Joon; Ryu, Young Hoon; Jeon, Tae Joo; Kim, Jai Keun; Nam, Ji Eun; Yoon, Pyeong Ho; Yoon, Choon Sik; Lee, Jong Doo

    1998-01-01

    We evaluated brain perfusion SPECT findings of MELAS syndrome and mitochondrial myopathy in correlation with MR imaging in search of specific imaging features. Subjects were five patients (four females and one male; age range, 1 to 25 year) who presented with repeated stroke like episodes, seizures or developmental delay or asymptomatic but had elevated lactic acid in CSF and serum. Conventional non-contrast MR imaging and Tc-99m-ethyl cysteinate dimer (ECD) brain perfusion SPECT were performed and imaging features were analyzed. MRI demonstrated increased T2 signal intensities in the affected areas of gray and white matters mainly in the parietal (4/5) and occipital lobes (4/5) and in the basal ganglia (1/5), which were not restricted to a specific vascular territory. SPECT demonstrated decreased perfusion in the corresponding regions of MRI lesions. In addition, there were perfusion defects in parietal (1 patient), temporal (2), and frontal (1) lobes and basal ganglia (1) and thalami (2). In a patient with mitochondrial myopathy who had normal MRI, decreased perfusion was noted in left parietal area and bilateral thalami. Tc-99m ECD SPECT imaging in patients with MELAS syndrome and mitochondrial myopathy showed hypoperfusion of parieto-occipital cortex, basal ganglia, thalamus and temporal cortex, which were not restricted to a specific vascular territory. There were no specific imaging features on SPECT. The significance of abnormal perfusion on SPECT without corresponding MR abnormalities needs to be evaluated further in larger number of patients

  9. Role of Exercise Therapy in Prevention of Decline in Aging Muscle Function: Glucocorticoid Myopathy and Unloading

    Directory of Open Access Journals (Sweden)

    Teet Seene

    2012-01-01

    Full Text Available Changes in skeletal muscle quantity and quality lead to disability in the aging population. Physiological changes in aging skeletal muscle are associated with a decline in mass, strength, and inability to maintain balance. Glucocorticoids, which are in wide exploitation in various clinical scenarios, lead to the loss of the myofibrillar apparatus, changes in the extracellular matrix, and a decrease in muscle strength and motor activity, particularly in the elderly. Exercise therapy has shown to be a useful tool for the prevention of different diseases, including glucocorticoid myopathy and muscle unloading in the elderly. The purpose of the paper is to discuss the possibilities of using exercise therapy in the prevention of glucocorticoid caused myopathy and unloading in the elderly and to describe relationships between the muscle contractile apparatus and the extracellular matrix in different types of aging muscles.

  10. Myopathy in hyperthyroidism as a consequence of rapid reduction of thyroid hormone

    OpenAIRE

    Li, Qianrui; Liu, Yuping; Zhang, Qianying; Tian, Haoming; Li, Jianwei; Li, Sheyu

    2017-01-01

    Abstract Rationale: Myalgia and elevated creatine kinase (CK) are occasionally observed during the treatment of hyperthyroid patients. Relative hypothyroidism resulted from rapid thyroid hormone reduction had been promoted as a plausible cause of these myopathic changes, however rarely reported. Patient concerns: We hereby presented a 20-year-old female with Grave's disease, who developed myopathy and elevated CK during rapid correction of thyroid hormone. Diagnoses: Relative hypothyroidism-i...

  11. Adaptação transcultural da versão brasileira do Hospital Survey on Patient Safety Culture: etapa inicial Translation and cross-cultural adaptation of the Brazilian version of the Hospital Survey on Patient Safety Culture: initial stage

    Directory of Open Access Journals (Sweden)

    Claudia Tartaglia Reis

    2012-11-01

    Full Text Available A avaliação da cultura de segurança do paciente permite aos hospitais identificar e gerir prospectivamente questões relevantes de segurança em suas rotinas de trabalho. Este artigo descreve a adaptação transcultural do Hospital Survey on Patient Safety Culture (HSOPSC para a Língua Portuguesa e contexto brasileiro. Adotou-se abordagem universalista para avaliar a equivalência conceitual, de itens e semântica. A metodologia incluiu os seguintes estágios: (1 tradução do questionário para o Português; (2 retradução para o Inglês; (3 painel de especialistas para elaboração da versão preliminar; (4 avaliação da compreensão verbal pela população-alvo. O questionário foi traduzido para o Português e sua versão final incluiu 42 itens. A população-alvo avaliou todos os itens como de fácil compreensão. O questionário encontra-se traduzido para o Português e adaptado para o contexto brasileiro, entretanto, faz-se necessário avaliar sua equivalência de mensuração, validade externa e reprodutibilidade.Patient safety culture assessment allows hospitals to identify and prospectively manage safety issues in work routines. This article aimed to describe the cross-cultural adaptation of the Hospital Survey on Patient Safety Culture (HSOPSC into Brazilian Portuguese. A universalist approach was adopted to assess conceptual, item, and semantic equivalence. The methodology involved the following stages: (1 translation of the questionnaire into Portuguese; (2 back-translation into English; (3 an expert panel to prepare a draft version; and (4 assessment of verbal understanding of the draft by a sample of the target population. The questionnaire was translated into Portuguese, and the scale's final version included 42 items. The target population sample assessed all the items as easy to understand. The questionnaire has been translated into Portuguese and adapted to the Brazilian hospital context, but it is necessary to assess

  12. Nuclear actin aggregation is a hallmark of anti-synthetase syndrome-induced dysimmune myopathy

    OpenAIRE

    Stenzel, W; Preusse, C; Allenbach, Y; Pehl, D; Junckerstorff, R; Heppner, F L; Nolte, K; Aronica, E; Kana, V; Rushing, E; Schneider, U; Claeys, K G; Benveniste, O; Weis, J; Goebel, H H

    2015-01-01

    Objective: To analyze antisynthetase syndrome–associated myositis by modern myopathologic methods and to define its place in the spectrum of idiopathic inflammatory myopathies (IIMs). Methods: Skeletal muscle biopsies from antisynthetase syndrome–associated myositis and other IIMs from different institutions worldwide were analyzed by histopathology, quantitative PCR, and electron microscopy. Results: Myonuclear actin filament inclusions were identified as a unique morphologic hallmark of a...

  13. Uremic myopathy: Is oxidative stress implicated in muscle dysfunction in uremia?

    Directory of Open Access Journals (Sweden)

    Antonia eKaltsatou

    2015-03-01

    Full Text Available Renal failure is accompanied by progressive muscle weakness and premature fatigue, in part linked to hypokinesis and in part to uremic toxicity. These changes are associated with various detrimental biochemical and morphological alterations. All of these pathological parameters are collectively termed ureamic myopathy. Various interventions while helpful can’t fully remedy the pathological phenotype. Complex mechanisms that stimulate muscle dysfunction in uremia have been proposed, and oxidative stress could be implicated. Skeletal muscles continuously produce reactive oxygen species (ROS and reactive nitrogen species (RNS at rest and more so during contraction. The aim of this mini review is to provide an update on recent advances in our understanding of how ROS and RNS generation might contribute to muscle dysfunction in uremia. Thus a systematic review was conducted searching PubMed and Scopus by using the Cochrane and PRISMA guidelines. While few studies met our criteria their findings are discussed making reference to other available literature data. Oxidative stress can direct muscle cells into a catabolic state and chronic exposure to it leads to wasting. Moreover, redox disturbances can significantly affect force production per se. We conclude that oxidative stress can be in part responsible for some aspects of uremic myopathy. Further research is needed to discern clear mechanisms and to help efforts to counteract muscle weakness and exercise intolerance in uremic patients.

  14. Loss-of-function mutations in SCN4A> cause severe foetal hypokinesia or 'classical' congenital myopathy

    DEFF Research Database (Denmark)

    Zaharieva, Irina T; Thor, Michael G; Oates, Emily C

    2016-01-01

    Congenital myopathies are a clinically and genetically heterogeneous group of muscle disorders characterized by congenital or early-onset hypotonia and muscle weakness, and specific pathological features on muscle biopsy. The phenotype ranges from foetal akinesia resulting in in utero or neonatal...

  15. MYOPATHY AS A SIDE EFFECT OF STATIN THERAPY: MECHANISMS OF DEVELOPMENT AND PROSPECTS FOR TREATMENT

    Directory of Open Access Journals (Sweden)

    O. M. Drapkina

    2015-01-01

    Full Text Available Statins are lipid-lowering drugs with proven efficacy that reduce cardiovascular risk and are well tolerated by most patients. Myopathy as a side effect of statin therapy is one of the most common reasons for their withdrawal. Its severity can range from asymptomatic increase of serum CPK to life-threatening rhabdomyolysis. Therefore it is necessary to remember about the possibility of its occurrence.The exact molecular mechanisms of muscle damage by statins are still unknown. Various hypotheses are suggested in this respect: fatty acid oxidation disorders, mitochondrial dysfunction, increased protein degradation in myocytes due to changes in atrogin-1 and ubiquitin activity, activation of autoimmune processes, intracellular depletion of essential metabolites, destabilization of cell membranes, impaired expression of genes involved in apoptosis and protein degradation. The theory that the reduction of intramuscular CoQ10 level is the cause of myopathy prevails. Additional intake of CoQ10 seems promising, but is not evidence-based.

  16. MYOPATHY AS A SIDE EFFECT OF STATIN THERAPY: MECHANISMS OF DEVELOPMENT AND PROSPECTS FOR TREATMENT

    Directory of Open Access Journals (Sweden)

    O. M. Drapkina

    2015-09-01

    Full Text Available Statins are lipid-lowering drugs with proven efficacy that reduce cardiovascular risk and are well tolerated by most patients. Myopathy as a side effect of statin therapy is one of the most common reasons for their withdrawal. Its severity can range from asymptomatic increase of serum CPK to life-threatening rhabdomyolysis. Therefore it is necessary to remember about the possibility of its occurrence.The exact molecular mechanisms of muscle damage by statins are still unknown. Various hypotheses are suggested in this respect: fatty acid oxidation disorders, mitochondrial dysfunction, increased protein degradation in myocytes due to changes in atrogin-1 and ubiquitin activity, activation of autoimmune processes, intracellular depletion of essential metabolites, destabilization of cell membranes, impaired expression of genes involved in apoptosis and protein degradation. The theory that the reduction of intramuscular CoQ10 level is the cause of myopathy prevails. Additional intake of CoQ10 seems promising, but is not evidence-based.

  17. Hypothyroid myopathy: A peculiar clinical presentation of thyroid failure. Review of the literature.

    Science.gov (United States)

    Sindoni, Alessandro; Rodolico, Carmelo; Pappalardo, Maria Angela; Portaro, Simona; Benvenga, Salvatore

    2016-12-01

    Abnormalities in thyroid function are common endocrine disorders that affect 5-10 % of the general population, with hypothyroidism occurring more frequently than hyperthyroidism. Clinical symptoms and signs are often nonspecific, particularly in hypothyroidism. Muscular symptoms (stiffness, myalgias, cramps, easy fatigability) are mentioned by the majority of patients with frank hypothyroidism. Often underestimated is the fact that muscle symptoms may represent the predominant or the only clinical manifestation of hypothyroidism, raising the issue of a differential diagnosis with other causes of myopathy, which sometimes can be difficult. Elevated serum creatine kinase, which not necessarily correlates with the severity of the myopathic symptoms, is certainly suggestive of muscle impairment, though it does not explain the cause. Rare muscular manifestations, associated with hypothyroidism, are rhabdomyolysis, acute compartment syndrome, Hoffman's syndrome and Kocher-Debré-Sémélaigne syndrome. Though the pathogenesis of hypothyroid myopathy is not entirely known, proposed mechanisms include altered glycogenolytic and oxidative metabolism, altered expression of contractile proteins, and neuro-mediated damage. Correlation studies of haplotype, muscle gene expression and protein characterization, could help understanding the pathophysiological mechanisms of this myopathic presentation of hypothyroidism.

  18. Organophosphate-induced intermediate syndrome: aetiology and relationships with myopathy.

    Science.gov (United States)

    Karalliedde, Lakshman; Baker, David; Marrs, Timothy C

    2006-01-01

    -15 days and even up to 21 days. Weaning from ventilatory care is best carried out in stages, with provision of continuous positive airway pressure prior to complete weaning. Continuous and close monitoring of respiratory function (arterial oxygen saturation, partial pressure of oxygen in arterial blood, partial pressure of carbon dioxide in arterial blood) and acid-base status are an absolute necessity. Prophylactic antibiotics are usually not required unless there has been evidence of aspiration of material into the lungs. Close monitoring of fluid and electrolyte balance is mandatory in view of the profuse offensive diarrhoea that most patients develop. Maintenance of nutrition, physiotherapy, prevention of bed sores and other routine measures to minimise discomfort during ventilatory care are necessary. Recovery from the intermediate syndrome is normally complete and without any sequelae. The usefulness of oximes during the IMS remains uncertain. In animal experiments, very early administration of oximes has prevented the occurrence of myopathy. There are reports from developed countries where administration of oximes at recommended doses and within 2 hours of ingestion of OP insecticide did not prevent the onset of the IMS. Controlled randomised clinical studies are necessary to evaluate the efficacy of oximes in combating the IMS. Electrophysiological studies following OP poisoning have revealed three characteristic phenomena: (i) repetitive firing following a single stimulus; (ii) gradual reduction in twitch height or compound muscle action potential followed by an increase with repetitive stimulation (the 'decrement-increment response'); and (iii) continued reduction in twitch height or compound muscle action potential with repetitive simulation ('decrementing response'). Of these, the decrementing response is the most frequent finding during the IMS, whilst repetitive firing is observed during the acute cholinergic syndrome. The distribution of the weakness in

  19. Clinical study on myocardial imaging with β-methyl-p-(123I)-iodophenyl-pentadecanoic acid in patients with mitochondrial myopathy

    International Nuclear Information System (INIS)

    Kihara, Koichi; Nakajo, Masayuki; Shono, Hirohisa

    1992-01-01

    Myocardial imaging with β-methyl-p-( 123 I)-iodophenyl-pentadecanoic acid ( 123 I-BMIPP), a new radiopharmaceutical designed to evaluate myocardial fatty acid metabolism, was performed in 7 patients with mitochondrial myopathy to detect their myocardial damages in comparison with 201 Tl myocardial imaging. These patients were divided into 4 chronic progressive external ophthalmoplegia (CPEO) cases, 2 mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes (MELAS) cases and 1 myoclonus epilepsy with ragged-red fibers (MERRF). In visual assessment, we observed more myocardial segments with decreased uptake of 123 I-BMIPP compared to 201 Tl in MELAS cases than in CPEO cases. The mean myocardial uptake of 123 I-BMIPP was higher than that of 201 Tl in CPEO cases. On the other hand, in MELAS and MERRF cases, the mean myocardial uptake of 123 I-BMIPP was lower than that of 201 Tl. Abnormal findings suggesting myocardial damages were observed in echocardiogram and/or in electrocardiogram in MELAS and MERRF cases, while no such abnormal findings were observed in CPEO cases. Along with the previously reported experimental result that the impairment of rat myocardial mitochondria decreased myocardial uptake of 123 I-BMIPP, these results suggest that 123 I-BMIPP may be useful to detect myocardial damages in patients with mitochondrial myopathy. (author)

  20. Equine atypical myopathy caused by hypoglycin A intoxication associated with ingestion of sycamore maple tree seeds.

    Science.gov (United States)

    Żuraw, A; Dietert, K; Kühnel, S; Sander, J; Klopfleisch, R

    2016-07-01

    Evidence suggest there is a link between equine atypical myopathy (EAM) and ingestion of sycamore maple tree seeds. To further evaluate the hypothesis that the ingestion of hypoglycin A (HGA) containing sycamore maple tree seeds causes acquired multiple acyl-CoA dehydrogenase deficiency and might be associated with the clinical and pathological signs of EAM. Case report. Necropsy and histopathology, using hematoxylin and eosin and Sudan III stains, were performed on a 2.5-year-old mare that died following the development of clinical signs of progressive muscle stiffness and recumbency. Prior to death, the animal ingested sycamore maple tree seeds (Acer pseudoplatanus). Detection of metabolites in blood and urine obtained post mortem was performed by rapid ultra-performance liquid chromatography-tandem mass spectrometry. Data from this case were compared with 3 geldings with no clinical history of myopathy. Macroscopic examination revealed fragments of maple tree seeds in the stomach and severe myopathy of several muscle groups including Mm. intercostales, deltoidei and trapezii. Histologically, the affected muscles showed severe, acute rhabdomyolysis with extensive accumulation of finely dispersed fat droplets in the cytoplasm of degenerated skeletal muscle cells not present in controls. Urine and serum concentrations of several acyl carnitines and acyl glycines were increased, and both contained metabolites of HGA, a toxic amino acid present in sycamore maple tree seeds. The study supports the hypothesis that ingestion of HGA-containing maple tree seeds may cause EAM due to acquired multiple acyl-CoA dehydrogenase deficiency. © 2015 EVJ Ltd.

  1. [Fenofibrate--induced myopathy in a patient with undiagnosed hypothyroidism--case report and a review of the literature].

    Science.gov (United States)

    Lukjanowicz, Małgorzata; Trzcińska-Butkiewicz, Beata; Brzosko, Marek

    2006-01-01

    Hypothyroidism is one of the common causes of the secondary hypercholesterolemia. The prevalence of hypothyroidism in the general population is estimated to be as high as about 1.5%. Frequency of the hypothyroidism in patients with hyperlipidemia is high, and can be observed in 4.2-10% in different populations. Most commonly, there is no need to treat the hypothyroid patients with the hypolipidemic drugs. Substitution treatment with the thyroid hormones usually results in either normalization or significant decreasing of the lipid levels. Hypothyroidism with symptoms of involvement of skeletal muscles is referred as to hypothyroid myopathy in English literature, and can be present in 30-80% patients with deficiency of the thyroid hormones. Hypothyroidism is a risk factor of developing of toxic injury of muscles, what is thought to be related to hypolipidemic drug intake. We report a case of a patient with undiagnosed hypothyroidism with muscle involvement manifestation, who was treated with fenofibrate due to accidentally diagnosed hypercholesterolemia. Hypolipidemic management resulted in rapid exacerbation of previously moderate myopathy. High concentrations of muscle enzymes and moderate increasing of creatinine concentration were detected. Improvement was observed after discontinuation of fenofibrate administration, but muscle symptoms and elevation of muscle enzymes and creatinine persisted. After administration of levothyroxin, muscle weakness and laboratory abnormalities were observed no longer. After several months of follow-up we believe that treatment with fenofibrate in our patient was complicated with muscle tissue damage and exacerbated symptoms of myopathy originally related to decompensated hypothyroidism.

  2. Pain in hospitalized children: Effect of a multidimensional knowledge translation strategy on pain process and clinical outcomes.

    Science.gov (United States)

    Stevens, Bonnie J; Yamada, Janet; Estabrooks, Carole A; Stinson, Jennifer; Campbell, Fiona; Scott, Shannon D; Cummings, Greta

    2014-01-01

    Hospitalized children frequently receive inadequate pain assessment and management despite substantial evidence to support effective pediatric pain practices. The objective of this study was to determine the effect of a multidimensional knowledge translation intervention, Evidence-based Practice for Improving Quality (EPIQ), on procedural pain practices and clinical outcomes for children hospitalized in medical, surgical and critical care units. A prospective cohort study compared 16 interventions using EPIQ and 16 standard care (SC) units in 8 Canadian pediatric hospitals. Chart reviews at baseline (time 1) and intervention completion (time 2) determined the nature and frequency of painful procedures and of pain assessment and pain management practices. Trained pain experts evaluated pain intensity 6 months post-intervention (time 3) during routine, scheduled painful procedures. Generalized estimating equation models compared changes in outcomes between EPIQ and SC units over time. EPIQ units used significantly more validated pain assessment tools (Ppatients who received analgesics (P=0.03) and physical pain management strategies (P=0.02). Mean pain intensity scores were significantly lower in the EPIQ group (P=0.03). Comparisons of moderate (4-6/10) and severe (7-10/10) pain, controlling for child and unit level factors, indicated that the odds of having severe pain were 51% less for children in the EPIQ group (adjusted OR: 0.49, 95% CI: 0.26-0.83; P=0.009). EPIQ was effective in improving practice and clinical outcomes for hospitalized children. Additional exploration of the influence of contextual factors on research use in hospital settings is required to explain the variability in pain processes and clinical outcomes. Copyright © 2013 International Association for the Study of Pain. Published by Elsevier B.V. All rights reserved.

  3. Internal anal sphincter myopathy causing proctalgia fugax and constipation: further clinical and radiological characterization in a patient.

    Science.gov (United States)

    Guy, R J; Kamm, M A; Martin, J E

    1997-02-01

    We report a case of a distinctive familial internal anal sphincter myopathy with unique histological and radiological features. A 67-year-old woman presented with a 20-year history of proctalgia fugax and outlet obstruction; other family members were similarly affected. Computed tomograpy and magnetic resonance imaging demonstrated a grossly hypertrophied internal anal sphincter. Strip myectomy of the sphincter was carried out with improvement in evacuation but little relief of proctalgia. Further relief of symptoms was obtained using oral and transdermal nitrates and a calcium antagonist. Histological examination of the excised muscle revealed hypertrophy and an abnormal arrangement of fibres in whorls; many fibres contained vacuoles with inclusion bodies positive for periodic acid-Schiff. This description of a specific anal sphincter myopathy illustrates the potential importance of histopathological studies of smooth muscle in functional disorders of the gut.

  4. Stac3 is a component of the excitation-contraction coupling machinery and mutated in Native American myopathy

    Science.gov (United States)

    Horstick, Eric J.; Linsley, Jeremy W.; Dowling, James J.; Hauser, Michael A.; McDonald, Kristin K.; Ashley-Koch, Allison; Saint-Amant, Louis; Satish, Akhila; Cui, Wilson W.; Zhou, Weibin; Sprague, Shawn M.; Stamm, Demetra S.; Powell, Cynthia M.; Speer, Marcy C.; Franzini-Armstrong, Clara; Hirata, Hiromi; Kuwada, John Y.

    2013-01-01

    Excitation-contraction coupling, the process that regulates contractions by skeletal muscles, transduces changes in membrane voltage by activating release of Ca2+ from internal stores to initiate muscle contraction. Defects in EC coupling are associated with muscle diseases. Here we identify Stac3 as a novel component of the EC coupling machinery. Using a zebrafish genetic screen, we generate a locomotor mutation that is mapped to stac3. We provide electrophysiological, Ca2+ imaging, immunocytochemical and biochemical evidence that Stac3 participates in excitation-contraction coupling in muscles. Furthermore, we reveal that a mutation in human STAC3 as the genetic basis of the debilitating Native American myopathy (NAM). Analysis of NAM stac3 in zebrafish shows that the NAM mutation decreases excitation-contraction coupling. These findings enhance our understanding of both excitation-contraction coupling and the pathology of myopathies. PMID:23736855

  5. Hypoglycin A in maple trees in the Netherlands and the risk of equine atypical myopathy

    NARCIS (Netherlands)

    Westermann, C.M.; van Leeuwen, Robbert; Mol, Hans

    2016-01-01

    The Acer (maple) genus of trees comprises over 120 species worldwide. Some of these contain the plant-toxin hypoglycin-A which has been proven to be a cause of the highly fatal condition called atypical myopathy (AM) in horses and ponies. In an earlier study of maple-tree samples (leaves and seeds)

  6. Dietary intervention rescues myopathy associated with neurofibromatosis type 1.

    Science.gov (United States)

    Summers, Matthew A; Rupasinghe, Thusitha; Vasiljevski, Emily R; Evesson, Frances J; Mikulec, Kathy; Peacock, Lauren; Quinlan, Kate GR; Cooper, Sandra T; Roessner, Ute; Stevenson, David A; Little, David G; Schindeler, Aaron

    2018-02-15

    Neurofibromatosis type 1 (NF1) is an autosomal dominant genetic disorder with complex symptomology. In addition to a predisposition to tumors, children with NF1 can present with reduced muscle mass, global muscle weakness, and impaired motor skills, which can have a significant impact on quality of life. Genetic mouse models have shown a lipid storage disease phenotype may underlie muscle weakness in NF1. Herein we confirm that biopsy specimens from six individuals with NF1 similarly manifest features of a lipid storage myopathy, with marked accumulation of intramyocellular lipid, fibrosis, and mononuclear cell infiltrates. Intramyocellular lipid was also correlated with reductions in neurofibromin protein expression by western analysis. An RNASeq profile of Nf1null muscle from a muscle-specific Nf1 knockout mouse (Nf1MyoD-/-) revealed alterations in genes associated with glucose regulation and cell signaling. Comparison by lipid mass spectrometry demonstrated that Nf1null muscle specimens were enriched for long chain fatty acid (LCFA) containing neutral lipids, such as cholesterol esters and triacylglycerides, suggesting fundamentally impaired LCFA metabolism. The subsequent generation of a limb-specific Nf1 knockout mouse (Nf1Prx1-/-) recapitulated all observed features of human NF1 myopathy, including lipid storage, fibrosis, and muscle weakness. Collectively, these insights led to the evaluation of a dietary intervention of reduced LCFAs, and enrichment of medium-chain fatty acids (MCFAs) with L-carnitine. Following 8-weeks of dietary treatment, Nf1Prx1-/- mice showed a 45% increase in maximal grip strength, and a 71% reduction in intramyocellular lipid staining compared with littermates fed standard chow. These data link NF1 deficiency to fundamental shifts in muscle metabolism, and provide strong proof of principal that a dietary intervention can ameliorate symptoms. © The Author(s) 2017. Published by Oxford University Press. All rights reserved. For

  7. Homozygous LIPE Mutation in Siblings with Multiple Symmetric Lipomatosis, Partial Lipodystrophy, and Myopathy

    OpenAIRE

    Zolotov, Sagit; Xing, Chao; Mahamid, Riad; Shalata, Adel; Sheikh-Ahmad, Mohammed; Garg, Abhimanyu

    2016-01-01

    Despite considerable progress in identifying causal genes for lipodystrophy syndromes, the molecular basis of some peculiar adipose tissue disorders remains obscure. In an Israeli–Arab pedigree with a novel autosomal recessive, multiple symmetric lipomatosis (MSL), partial lipodystrophy and myopathy, we conducted exome sequencing of two affected siblings to identify the disease-causingmutation. The 41-year-old female proband and her 36-year-old brother reported marked accumulation of subcutan...

  8. Muscle MRI in neutral lipid storage disease with myopathy carrying mutation c.187+1G>A.

    Science.gov (United States)

    Xu, Chunxiao; Zhao, Yawen; Liu, Jing; Zhang, Wei; Wang, Zhaoxia; Yuan, Yun

    2015-06-01

    We describe the clinical and muscle MRI changes in 2 siblings with neutral lipid storage disease with myopathy (NLSDM) carrying the mutation c.187+1G>A. Peripheral blood smears, genetic tests, and muscle biopsies were performed. Thigh MRI was performed to observe fatty replacement, muscle edema, and muscle bulk from axial sections. Both siblings had similar fatty infiltration and edema. T1-weighted images of the gluteus maximus, adductor magnus, semitendinosus, and semimembranosus revealed marked and diffuse fatty infiltration. There was asymmetric involvement in biceps femoris and quadriceps. There was extensive fatty infiltration in the quadriceps, except for the rectus femoris. Gracilis and sartorius were relatively spared. Thigh muscle volume was decreased, while the gracilis and sartorius appeared to show compensatory hypertrophy. Compared with previous reports in NLSDM, MRI changes in this myopathy tended to be more severe. Asymmetry and relatively selective fatty infiltration were characteristics. © 2014 Wiley Periodicals, Inc.

  9. Psychometric properties of the postgraduate hospital educational environment measure in an Iranian hospital setting.

    Science.gov (United States)

    Shokoohi, Shahrzad; Hossein Emami, Amir; Mohammadi, Aeen; Ahmadi, Soleiman; Mojtahedzadeh, Rita

    2014-01-01

    Students' perceptions of the educational environment are an important construct in assessing and enhancing the quality of medical training programs. Reliable and valid measurement, however, can be problematic - especially as instruments developed and tested in one culture are translated for use in another. This study sought to explore the psychometric properties of the Postgraduate Hospital Educational Environment Measure (PHEEM) for use in an Iranian hospital training setting. We translated the instrument into Persian and ensured its content validity by back translation and expert review prior to administering it to 127 residents of Urmia University of Medical Science. Overall internal consistency of the translated measure was good (a=0.94). Principal components analysis revealed five factors accounting for 52.8% of the variance. The Persian version of the PHEEM appears to be a reliable and potentially valid instrument for use in Iranian medical schools and may find favor in evaluating the educational environments of residency programs nationwide.

  10. Psychometric properties of the Postgraduate Hospital Educational Environment Measure in an Iranian hospital setting

    Directory of Open Access Journals (Sweden)

    Shahrzad Shokoohi

    2014-08-01

    Full Text Available Background: Students’ perceptions of the educational environment are an important construct in assessing and enhancing the quality of medical training programs. Reliable and valid measurement, however, can be problematic – especially as instruments developed and tested in one culture are translated for use in another. Materials and method: This study sought to explore the psychometric properties of the Postgraduate Hospital Educational Environment Measure (PHEEM for use in an Iranian hospital training setting. We translated the instrument into Persian and ensured its content validity by back translation and expert review prior to administering it to 127 residents of Urmia University of Medical Science. Results: Overall internal consistency of the translated measure was good (a=0.94. Principal components analysis revealed five factors accounting for 52.8% of the variance. Conclusion: The Persian version of the PHEEM appears to be a reliable and potentially valid instrument for use in Iranian medical schools and may find favor in evaluating the educational environments of residency programs nationwide.

  11. Restrictive extraocular myopathy: A presenting feature of acromegaly

    Directory of Open Access Journals (Sweden)

    Steven Heireman

    2011-01-01

    Full Text Available A 45-year-old man presented with binocular diplopia in primary gaze for 1 year. Orthoptic evaluation showed 10-prism diopter right eye hypotropia and 6-prism diopter right eye esotropia. The elevation and abduction of the right eye were mechanically restricted. This was associated with systemic features suggestive of acromegaly. Magnetic resonance imaging (MRI of the brain demonstrated a pituitary macroadenoma. An elevated serum insulin-like growth factor I level and the failure of growth hormone suppression after an oral glucose load biochemically confirmed the diagnosis of acromegaly. Computed tomography (CT of the orbit demonstrated bilateral symmetrical enlargement of the medial rectus and inferior rectus muscle bellies. All tests regarding Graves-Basedow disease were negative. Although rare, diplopia due to a restrictive extraocular myopathy could be the presenting symptom of acromegaly.

  12. Subclinical myopathy in patients with colorectal cancer: clinical-pathological characterization and search for tissue markers

    Directory of Open Access Journals (Sweden)

    Massimo Vecchiato

    2012-03-01

    Full Text Available Skeletal muscle in patients with cancer undergoes many morphological changes due to immuno-inflammatory factors of tumor origin or treatment.T he latest event of these changes is cancer cachexia. Aim of the study is to identify myopathic features in skeletal muscle biopsies from weight stable patients with colorectal cancer and without cachexia or asthenia / weakness, that could possibly provide new diagnostic and prognostic cancer biomarkers. Morphometric analyses and immunohistochemical studies were performed on intraoperative muscle biopsies from patients with colorectal cancer and from weight stable patients undergoing surgery for benign non-inflammatory conditions. A rectus abdominis biopsy was taken in all patients and controls.A correlation between histopathologic findings and clinical characteristics, circulating inflammatory biomarkers and markers of muscle necrosis,surgery data and cancer phenotype were investigated.. Forty four patients (21male/23 female and 17 controls (6 male/11 female (p=NS were studied. In cancer patients’biopsies we observed asubclinical myopathy characterized by an abnormal distribution of myonuclei, which are localized inside the myofiber rather than at the periphery, and by the presence of regenerating muscle fibers. The percentage of myofibers with internalized nuclei is significantly higher in patients (median= 9%, IQR= 3.7-18.8 than in controls (median= 2.7%, IQR= 1.7-3.2 ( p=0.0002. In patients we observed an inverse correlation between the number of centronucleated fibers and the presence of node metastasis (N+(ρ=-0.64 (p=0.002. Patients affected with colorectal cancer display early sign of a myopathy, characterized by centronucleated and regenerating myofibers. This myopathy appears to be associated with an early stage of neoplasia and it could be an adaptive response of muscle to cancer. We hope a future application of these findings as a possible early diagnostic and prognostic biomarker of

  13. Effects of aerobic training on exercise-related oxidative stress in mitochondrial myopathies.

    Science.gov (United States)

    Siciliano, Gabriele; Simoncini, Costanza; Lo Gerfo, Annalisa; Orsucci, Daniele; Ricci, Giulia; Mancuso, Michelangelo

    2012-12-01

    In mitochondrial myopathies with respiratory chain deficiency impairment of energy cell production may lead to in excess reactive oxygen species generation with consequent oxidative stress and cell damage. Aerobic training has been showed to increase muscle performance in patients with mitochondrial myopathies. Aim of this study has been to evaluate, in 7 patients (6 F e 1M, mean age 44.9 ± 12.1 years) affected by mitochondrial disease, concomitantly to lactate exercise curve, the occurrence of oxidative stress, as indicated by circulating levels of lipoperoxides, in rest condition and as effect of exercise, and also, to verify if an aerobic training program is able to modify, in these patients, ox-redox balance efficiency. At rest and before training blood level of lipoperoxides was 382.4 ± 37.8 AU, compared to controls (318.7 ± 63.8; Pstress degree according to the adopted scale. During incremental exercise blood level of lipoperoxides did not increase, but maintained significantly higher compared to controls. After an aerobic training of 10 weeks the blood level of lipoperoxides decreased by 13.7% at rest (Pexercise test (P=0.06). These data indicate that, in mitochondrial patients, oxidative stress occurs and that an aerobic training is useful in partially reverting this condition. Copyright © 2012 Elsevier B.V. All rights reserved.

  14. Mutation spectrum in the large GTPase dynamin 2, and genotype-phenotype correlation in autosomal dominant centronuclear myopathy

    DEFF Research Database (Denmark)

    Böhm, Johann; Biancalana, Valérie; Dechene, Elizabeth T

    2012-01-01

    Centronuclear myopathy (CNM) is a genetically heterogeneous disorder associated with general skeletal muscle weakness, type I fiber predominance and atrophy, and abnormally centralized nuclei. Autosomal dominant CNM is due to mutations in the large GTPase dynamin 2 (DNM2), a mechanochemical enzym...

  15. Foreign currency-related translation complexities in cross-border healthcare applications.

    Science.gov (United States)

    Kumar, Anand; Rodrigues, Jean M

    2009-01-01

    International cross-border private hospital chains need to apply the standards for foreign currency translation in order to consolidate the balance sheet and income statements. This not only exposes such chains to exchange rate fluctuations in different ways, but also creates added requirements for enterprise-level IT systems especially when they produce parameters which are used to measure the financial and operational performance of the foreign subsidiary or the parent hospital. Such systems would need to come to terms with the complexities involved in such currency-related translations in order to provide the correct data for performance benchmarking.

  16. Muscle-fiber conduction velocity and electromyography as diagnostic tools in patients with suspected inflammatory myopathy: a prospective study.

    NARCIS (Netherlands)

    Blijham, P.J.; Hengstman, G.J.D.; Laak, H.J. ter; Engelen, B.G.M. van; Zwarts, M.J.

    2004-01-01

    Combinations of different techniques can increase the diagnostic yield from neurophysiological examination of muscle. In 25 patients with suspected inflammatory myopathy, we prospectively performed needle electromyography (EMG) and measured muscle-fiber conduction velocity (MFCV) in a single muscle,

  17. Desmin myopathy with severe cardiomyopathy in a Uruguayan family due to a codon deletion in a new location within the desmin 1A rod domain.

    Science.gov (United States)

    Vernengo, Luis; Chourbagi, Oussama; Panuncio, Ana; Lilienbaum, Alain; Batonnet-Pichon, Sabrina; Bruston, Francine; Rodrigues-Lima, Fernando; Mesa, Rosario; Pizzarossa, Carlos; Demay, Laurence; Richard, Pascale; Vicart, Patrick; Rodriguez, Maria-Mirta

    2010-03-01

    Desmin myopathy is a heterogeneous neuromuscular disorder characterized by skeletal myopathy and cardiomyopathy, inherited mostly in an autosomal dominant pattern. We report a five generation Uruguayan family with severe cardiomyopathy and skeletal myopathy. Its most striking features are: atrial dilation, arrhythmia, conduction block and sudden death due to conduction impairment. Affected skeletal muscle shows alteration of mitochondria with paracrystallin inclusions and granulofilamentous material scattered in the muscle fibres. This family carries an unusual deletion p.E114del within the 1A rod domain of desmin. Transfected cells expressing the mutated desmin show punctuated and speckled cytoplasmic aggregates. The mutation causes a local conformational change in heptads a/d residues and charge positions. These findings lead to the hypothesis that coiled-coil interactions may be impaired, resulting in severe alterations in the desmin network. This is the first time that a mutation affecting this domain in the desmin molecule is described in a desminopathy. Copyright 2010. Published by Elsevier B.V.

  18. Melanocytes from patients affected by Ullrich congenital muscular dystrophy and Bethlem myopathy have dysfunctional mitochondria that can be rescued with cyclophilin inhibitors

    Directory of Open Access Journals (Sweden)

    Alessandra eZulian

    2014-11-01

    Full Text Available Ullrich congenital muscular dystrophy and Bethlem myopathy are caused by mutations in collagen VI genes, which encode an extracellular matrix protein; yet mitochondria play a major role in disease pathogenesis through a short circuit caused by inappropriate opening of the permeability transition pore, a high conductance channel which causes a shortage in ATP production. We find that melanocytes do not produce collagen VI yet they bind it at the cell surface, suggesting that this protein may play a trophic role and that its absence may cause lesions similar to those seen in skeletal muscle. We show that mitochondria in melanocytes of Ullrich congenital muscular dystrophy and Bethlem myooathy patients display increased size, reduced matrix density and disrupted cristae, findings that suggest a functional impairment. In keeping with this hypothesis, mitochondria (i underwent anomalous depolarization after inhibition of the F-ATP synthase with oligomycin, and (ii displayed decreased respiratory reserve capacity. The non-immunosuppressive cyclophilin inhibitor NIM811 prevented mitochondrial depolarization in response to oligomycin in melanocytes from both Ullrich congenital muscular dystrophy and Bethlem myopathy patients, and partially restored the respiratory reserve of melanocytes from one Bethlem myopathy patient. These results match our recent findings on melanocytes from patients affected by Duchenne muscular dystrophy (Pellegrini et al., 2013 Melanocytes--a novel tool to study mitochondrial dysfunction in Duchenne muscular dystrophy. J Cell Physiol 228, 1323-1331, and suggest that skin biopsies may represent a minimally invasive tool to investigate mitochondrial dysfunction and to evaluate drug efficacy in collagen VI-related myopathies and possibly in other muscle wasting conditions like aging sarcopenia.

  19. EULAR/ACR classification criteria for adult and juvenile idiopathic inflammatory myopathies and their major subgroups: a methodology report

    NARCIS (Netherlands)

    Bottai, Matteo; Tjärnlund, Anna; Santoni, Giola; Werth, Victoria P.; Pilkington, Clarissa; de Visser, Marianne; Alfredsson, Lars; Amato, Anthony A.; Barohn, Richard J.; Liang, Matthew H.; Singh, Jasvinder A.; Aggarwal, Rohit; Arnardottir, Snjolaug; Chinoy, Hector; Cooper, Robert G.; Danko, Katalin; Dimachkie, Mazen M.; Feldman, Brian M.; García-de la Torre, Ignacio; Gordon, Patrick; Hayashi, Taichi; Katz, James D.; Kohsaka, Hitoshi; Lachenbruch, Peter A.; Lang, Bianca A.; Li, Yuhui; Oddis, Chester V.; Olesinka, Marzena; Reed, Ann M.; Rutkowska-Sak, Lidia; Sanner, Helga; Selva-O'Callaghan, Albert; Wook Song, Yeong; Vencovsky, Jiri; Ytterberg, Steven R.; Miller, Frederick W.; Rider, Lisa G.; Lundberg, Ingrid E.; Amoruso, Maria; Andersson, Helena; Bayat, Nastaran; Bhansing, Kavish J.; Bucher, Sara; Champbell, Richard; Charles-Schoeman, Christina; Chaudhry, Vinay; Christopher-Stine, Lisa; Chung, Lorinda; Cronin, Mary; Curry, Theresa; Dahlbom, Kathe; Distler, Oliver; Efthimiou, Petros; van Engelen, Baziel G. M.; Faiq, Abdullah; Farhadi, Payam Noroozi; Fiorentino, David; Hengstman, Gerald; Hoogendijk, Jessica; Huber, Adam; Kataoka, Hiroshi; Katsumata, Yasuhiro; Kim, Susan; Kong-Rosario, Michelle; Kontzias, Apostolos; Krol, Petra; Kurita, Takashi; Li, Zhan-Guo; Lindvall, Björn; Linklater, Helen; Maillard, Sue; Mamyrova, Gulnara; Mantegazza, Renato; Marder, Galina S.; Nagahashi Marie, Suely Kazue; Mathiesen, Pernille; Mavragani, Clio P.; McHugh, Neil J.; Michaels, Mimi; Mohammed, Reem; Morgan, Gabrielle; Moser, David W.; Moutsopoulos, Haralampos M.

    2017-01-01

    To describe the methodology used to develop new classification criteria for adult and juvenile idiopathic inflammatory myopathies (IIMs) and their major subgroups. An international, multidisciplinary group of myositis experts produced a set of 93 potentially relevant variables to be tested for

  20. Specific binding of Ulex europaeus agglutinin I lectin to sarcolemma of distal myopathy with rimmed vacuole formation.

    Science.gov (United States)

    Yatabe, K; Kawai, M

    1997-08-01

    Ulex europaeus agglutinin I (UEA I) binding was studied in 83 patients with various neuromuscular disorders. UEA I labelled endomysial capillaries and endothelial cells of perimysial blood vessels in all the examined muscles. There was no UEA I binding to muscle fibres except for all (9) cases of distal myopathy with rimmed vacuole formation (DMRV), 1 of 5 cases of inclusion body myositis and 1 of 36 cases of inflammatory myopathies. The UEA I binding was completely eliminated by preincubation of UEA I solution with L-fucose. Using electron microscopy, the UEA I binding was localized to sarcolemma and intrasarco-plasmic membranous organelles other than mitochondria. Myosatellite cells were not labelled. These findings revealed the existence of fucosylated proteins or lipids in a subset of skeletal muscles suffering from DMRV. Biochemical identification of the fucosylated substance and further detailed study on subcellular localization of UEA I binding may yield important clues to the unknown pathogenesis of DMRV.

  1. Computed tomography and angiography in MELAS (mitochondrial myopathy, encephalopathy, lactic acidosis and stroke-like episodes)

    International Nuclear Information System (INIS)

    Hasuo, K.; Tamura, S.; Yasumori, K.; Uchino, A.; Masuda, K.; Goda, S.; Ishimoto, S.; Kamikaseda, K.; Wakuta, Y.; Kishi, M.

    1987-01-01

    Among mitochondrial encephalomyopathies, MELAS (mitochondrial myopathy, encephalopathy, lactic acidosis and stroke-like episodes, Pavlakis et al., 1983) is recognized as a distinct syndrome characterized by generalized convulsions and recurrrent stroke-like episodes. The neuroradiological findings of three patients with MELAS are reported here. Retrospective review shows that MELAS should be included in the differential diagnosis of infarct-like lesions of the cerebrum. (orig.)

  2. Characterization of DLK1+ cells emerging during skeletal muscle remodeling in response to myositis, myopathies, and acute injury

    DEFF Research Database (Denmark)

    Andersen, Ditte C; Petersson, Stine J; Jørgensen, Louise H

    2009-01-01

    , DLK1 was upregulated in all human myopathies analyzed, including Duchenne- and Becker muscular dystrophies. Substantial numbers of DLK1(+) satellite cells were observed in normal neonatal and Duchenne muscle, and furthermore, myogenic DLK1(+) cells were identified during muscle regeneration in animal...

  3. Hereditary internal anal sphincter myopathy causing proctalgia fugax and constipation: further clinical and histological characterization in a patient.

    Science.gov (United States)

    König, P; Ambrose, N S; Scott, N

    2000-01-01

    Hereditary internal anal sphincter myopathy is a very rare condition, only three families have so far been described in the literature. In this case report further clinical and histological findings of one affected member of one of the above families are presented.

  4. Clinical study on myocardial imaging with. beta. -methyl-p-( sup 123 I)-iodophenyl-pentadecanoic acid in patients with mitochondrial myopathy

    Energy Technology Data Exchange (ETDEWEB)

    Kihara, Koichi; Nakajo, Masayuki; Shono, Hirohisa (Kagoshima Univ. (Japan). Faculty of Medicine) (and others)

    1992-04-01

    Myocardial imaging with {beta}-methyl-p-({sup 123}I)-iodophenyl-pentadecanoic acid ({sup 123}I-BMIPP), a new radiopharmaceutical designed to evaluate myocardial fatty acid metabolism, was performed in 7 patients with mitochondrial myopathy to detect their myocardial damages in comparison with {sup 201}Tl myocardial imaging. These patients were divided into 4 chronic progressive external ophthalmoplegia (CPEO) cases, 2 mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes (MELAS) cases and 1 myoclonus epilepsy with ragged-red fibers (MERRF). In visual assessment, we observed more myocardial segments with decreased uptake of {sup 123}I-BMIPP compared to {sup 201}Tl in MELAS cases than in CPEO cases. The mean myocardial uptake of {sup 123}I-BMIPP was higher than that of {sup 201}Tl in CPEO cases. On the other hand, in MELAS and MERRF cases, the mean myocardial uptake of {sup 123}I-BMIPP was lower than that of {sup 201}Tl. Abnormal findings suggesting myocardial damages were observed in echocardiogram and/or in electrocardiogram in MELAS and MERRF cases, while no such abnormal findings were observed in CPEO cases. Along with the previously reported experimental result that the impairment of rat myocardial mitochondria decreased myocardial uptake of {sup 123}I-BMIPP, these results suggest that {sup 123}I-BMIPP may be useful to detect myocardial damages in patients with mitochondrial myopathy. (author)

  5. Mutation in TWINKLE in a Large Iranian Family with Progressive External Ophthalmoplegia, Myopathy, Dysphagia and Dysphonia, and Behavior Change.

    Science.gov (United States)

    Tafakhori, Abbas; Yu Jin Ng, Alvin; Tohari, Sumanty; Venkatesh, Byrappa; Lee, Hane; Eskin, Ascia; Nelson, Stanley F; Bonnard, Carine; Reversade, Bruno; Kariminejad, Ariana

    2016-02-01

    TWINKLE (c10orf2) gene is responsible for autosomal dominant progressive external ophthalmoplegia (PEO). In rare cases, additional features such as muscle weakness, peripheral neuropathy, ataxia, cardiomyopathy, dysphagia, dysphonia, cataracts, depression, dementia, parkinsonism, and hearing loss have been reported in association with heterozygous mutations of the TWINKLE gene. We have studied a large Iranian family with myopathy, dysphonia, dysphagia, and behavior change in addition to PEO in affected members. We identified a missense mutation c.1121G > A in the c10orf2 gene in all affected members. Early death is a novel feature seen in affected members of this family that has not been reported to date. The association of PEO, myopathy, dysphonia, dysphagia, behavior change and early death has not been previously reported in the literature or other patients with this mutation.

  6. Nutritional status evaluation in patients affected by bethlem myopathy and ullrich congenital muscular dystrophy.

    Science.gov (United States)

    Toni, Silvia; Morandi, Riccardo; Busacchi, Marcello; Tardini, Lucia; Merlini, Luciano; Battistini, Nino Carlo; Pellegrini, Massimo

    2014-01-01

    Collagen VI mutations lead to disabling myopathies like Bethlem myopathy (BM) and Ullrich congenital muscular dystrophy (UCMD). We have investigated the nutritional and metabolic status of one UCMD and seven BM patients (five female, three male, mean age 31 ± 9 years) in order to find a potential metabolic target for nutritional intervention. For this study, we used standard anthropometric tools, such as BMI evaluation and body circumference measurements. All results were compared to dual-energy X-ray absorptiometry (DXA), considered the "gold standard" method. Energy intake of each patient was evaluated through longitudinal methods (7-day food diary) while resting energy expenditure (REE) was predicted using specific equations and measured by indirect calorimetry. Clinical evaluation included general and nutritional blood and urine laboratory analyses and quantitative muscle strength measurement by hand-held dynamometry. BM and UCMD patients showed an altered body composition, characterized by low free fat mass (FFM) and high fat mass (FM), allowing us to classify them as sarcopenic, and all but one as sarcopenic-obese. Another main result was the negative correlation between REE/FFM ratio (basal energy expenditure per kilograms of fat-free mass) and the severity of the disease, as defined by the muscle megascore (correlation coefficient -0.955, P-value nutritional intervention in these patients.

  7. Cardiac abnormalities assessed by non-invasive techniques in patients with newly diagnosed idiopathic inflammatory myopathies

    DEFF Research Database (Denmark)

    Diederichsen, Louise Pyndt; Simonsen, Jane Angel; Diederichsen, Axel Cosmus Pyndt

    2015-01-01

    inflammatory myopathies (IIM) by means of non-invasive techniques. METHODS: Fourteen patients with IIM (8 polymyositis, 4 dermatomyositis, 2 cancer-associated dermatomyositis) and 14 gender- and age- matched healthy control subjects were investigated. Participant assessments included a cardiac questionnaire...... in 8 (57%) of the patients compared to none of the controls (pgroup (p=0.01). Two patients had systolic dysfunction, and one diastolic dysfunction...

  8. Toxic myopathy in a dog associated with the presence of monensin in dry food.

    Science.gov (United States)

    Wilson, J S

    1980-01-01

    This report describes a case of toxic myopathy in a two year old sheltie dog with clinical signs of profound weakness, myoglobinuria, and muscle enzyme elevations. The clinical signs were likely related to the accidental inclusion of monensin sodium in the dog's food. This food was prepared by a small feed milling company that also prepares cattle and chicken rations. A change of dog food resulted in remission of the clinical signs.

  9. Toxic Myopathy in a Dog Associated with the Presence of Monensin in Dry Food

    OpenAIRE

    Wilson, J. S.

    1980-01-01

    This report describes a case of toxic myopathy in a two year old sheltie dog with clinical signs of profound weakness, myoglobinuria, and muscle enzyme elevations. The clinical signs were likely related to the accidental inclusion of monensin sodium in the dog's food. This food was prepared by a small feed milling company that also prepares cattle and chicken rations. A change of dog food resulted in remission of the clinical signs.

  10. A Comprehensive Overview on Myositis-Specific Antibodies: New and Old Biomarkers in Idiopathic Inflammatory Myopathy

    Science.gov (United States)

    Satoh, Minoru; Tanaka, Shin; Ceribelli, Angela; Calise, S. John; Chan, Edward K. L.

    2018-01-01

    Autoantibodies specific for idiopathic inflammatory myopathy (myositis-specific autoantibodies (MSAs)) are clinically useful biomarkers to help the diagnosis of polymyositis/dermatomyositis (PM/DM). Many of these are also associated with a unique clinical subset of PM/DM, making them useful in predicting and monitoring certain clinical manifestations. Classic MSAs known for over 30 years include antibodies to Jo-1 (histidyl transfer RNA (tRNA) synthetase) and other aminoacyl tRNA synthetases (ARS), anti-Mi-2, and anti-signal recognition particle (SRP). Anti-Jo-1 is the first autoantibodies to ARS detected in 15–25 % of patients. In addition to anti-Jo-1, antibodies to seven other aminoacyl tRNA synthetases (ARS) have been reported with prevalence, usually 1–5 % or lower. Patients with any antiARS antibodies are associated with anti-synthetase syndrome characterized by myositis, interstitial lung disease (ILD), arthritis, Raynaud’s phenomenon, and others. Several recent studies suggested heterogeneity in clinical features among different anti-ARS antibody-positive patients and anti-ARS may also be found in idiopathic ILD without myositis. Anti-Mi-2 is a classic marker for DM and associated with good response to steroid treatment and good prognosis. Anti-SRP is specific for PM and associated with treatment-resistant myopathy histologically characterized as necrotizing myopathy. In addition to classic MSAs, several new autoantibodies with strong clinical significance have been described in DM. Antibodies to transcription intermediary factor 1γ/α (TIF1γ/α, p155/140) are frequently found in DM associated with malignancy while anti-melanoma differentiation-associated gene 5 (MDA5; CADM140) are associated with clinically amyopathic DM (CADM) complicated by rapidly progressive ILD. Also, anti-MJ/nuclear matrix protein 2 (NXP-2) and anti-small ubiquitin-like modifier-1 (SUMO-1) activating enzyme (SAE) are recognized as new DM-specific autoantibodies. Addition of

  11. The Impact of Machine Translation and Computer-aided Translation on Translators

    Science.gov (United States)

    Peng, Hao

    2018-03-01

    Under the context of globalization, communications between countries and cultures are becoming increasingly frequent, which make it imperative to use some techniques to help translate. This paper is to explore the influence of computer-aided translation on translators, which is derived from the field of the computer-aided translation (CAT) and machine translation (MT). Followed by an introduction to the development of machine and computer-aided translation, it then depicts the technologies practicable to translators, which are trying to analyze the demand of designing the computer-aided translation so far in translation practice, and optimize the designation of computer-aided translation techniques, and analyze its operability in translation. The findings underline the advantages and disadvantages of MT and CAT tools, and the serviceability and future development of MT and CAT technologies. Finally, this thesis probes into the impact of these new technologies on translators in hope that more translators and translation researchers can learn to use such tools to improve their productivity.

  12. Understanding mitochondrial myopathies: a review

    Directory of Open Access Journals (Sweden)

    Abhimanyu S. Ahuja

    2018-05-01

    Full Text Available Mitochondria are small, energy-producing structures vital to the energy needs of the body. Genetic mutations cause mitochondria to fail to produce the energy needed by cells and organs which can cause severe disease and death. These genetic mutations are likely to be in the mitochondrial DNA (mtDNA, or possibly in the nuclear DNA (nDNA. The goal of this review is to assess the current understanding of mitochondrial diseases. This review focuses on the pathology, causes, risk factors, symptoms, prevalence data, symptomatic treatments, and new research aimed at possible preventions and/or treatments of mitochondrial diseases. Mitochondrial myopathies are mitochondrial diseases that cause prominent muscular symptoms such as muscle weakness and usually present with a multitude of symptoms and can affect virtually all organ systems. There is no cure for these diseases as of today. Treatment is generally supportive and emphasizes symptom management. Mitochondrial diseases occur infrequently and hence research funding levels tend to be low in comparison with more common diseases. On the positive side, quite a few genetic defects responsible for mitochondrial diseases have been identified, which are in turn being used to investigate potential treatments. Speech therapy, physical therapy, and respiratory therapy have been used in mitochondrial diseases with variable results. These therapies are not curative and at best help with maintaining a patient’s current abilities to move and function.

  13. Translating Health Services Research into Practice in the Safety Net.

    Science.gov (United States)

    Moore, Susan L; Fischer, Ilana; Havranek, Edward P

    2016-02-01

    To summarize research relating to health services research translation in the safety net through analysis of the literature and case study of a safety net system. Literature review and key informant interviews at an integrated safety net hospital. This paper describes the results of a comprehensive literature review of translational science literature as applied to health care paired with qualitative analysis of five key informant interviews conducted with senior-level management at Denver Health and Hospital Authority. Results from the literature suggest that implementing innovation may be more difficult in the safety net due to multiple factors, including financial and organizational constraints. Results from key informant interviews confirmed the reality of financial barriers to innovation implementation but also implied that factors, including institutional respect for data, organizational attitudes, and leadership support, could compensate for disadvantages. Translating research into practice is of critical importance to safety net providers, which are under increased pressure to improve patient care and satisfaction. Results suggest that translational research done in the safety net can better illuminate the special challenges of this setting; more such research is needed. © Health Research and Educational Trust.

  14. Lactate disposal via gluconeogenesis is increased during exercise in patients with mitochondrial myopathy due to complex I deficiency

    NARCIS (Netherlands)

    Roef, MJ; Kalhan, SC; Reijngoud, DJ; De Meer, K; Berger, Ruud

    This study evaluated lactate disposal via gluconeogenesis as well as effects of FFA availability on gluconeogenesis via pyruvate (GNG(PYR)) in patients with mitochondrial myopathy due to complex I deficiency (CID). The rates of GNG(PYR) were measured in three CID patients and six healthy controls at

  15. Hypoglycin A Concentrations in Maple Tree Species in the Netherlands and the Occurrence of Atypical Myopathy in Horses

    NARCIS (Netherlands)

    Westermann, C.M.; Van Leeuwen, Robbert; Van Raamsdonk, L.W.D.; Mol, H.G.J.

    BACKGROUND: Atypical myopathy (AM) in horses is caused by the plant toxin hypoglycin A, which in Europe typically is found in the sycamore maple tree (Acer pseudoplatanus). Owners are concerned about whether their horses are in danger if they graze near maple trees. HYPOTHESIS/OBJECTIVES: To measure

  16. Hypoglycin A Concentrations in Maple Tree Species in the Netherlands and the Occurrence of Atypical Myopathy in Horses

    NARCIS (Netherlands)

    Westermann, C.M.; Leeuwen, van R.; Raamsdonk, van L.W.D.; Mol, H.G.J.

    2016-01-01

    Background: Atypical myopathy (AM) in horses is caused by the plant toxin hypoglycin A, which in Europe typically is found in the sycamore maple tree (Acer pseudoplatanus). Owners are concerned about whether their horses are in danger if they graze near maple trees. Hypothesis/Objectives: To

  17. A novel Ile1455Thr variant in the skeletal muscle sodium channel alpha-subunit in a patient with a severe adult-onset proximal myopathy with electrical myotonia and a patient with mild paramyotonia phenotype

    NARCIS (Netherlands)

    Bednarz, M.; Stunnenberg, B.C.; Kusters, B.; Kamsteeg, E.J.; Saris, C.G.J.; Groome, J.; Winston, V.; Meola, G.; Jurkat-Rott, K.; Voermans, N.C.

    2017-01-01

    In sodium channelopathies, a severe fixed myopathy caused by a dominant mutation is rare. We describe two unrelated patients with a novel variant, p.Ile1455Thr, with phenotypes of paramyotonia in one case and fixed proximal myopathy with latent myotonia in another. In-vitro whole cell patch-clamp

  18. Dietary nitrate does not reduce oxygen cost of exercise or improve muscle mitochondrial function in patients with mitochondrial myopathy

    NARCIS (Netherlands)

    Nabben, M.; Schmitz, J.P.J.; Ciapaite, J.; le Clercq, C.M.P.; van Riel, N.A.; Haak, H.R.; Nicolay, K.; de Coo, I.F.M.; Smeets, H.; Praet, S.F.; van Loon, L.J.; Prompers, J.J.

    2017-01-01

    Muscle weakness and exercise intol erance negatively affect the quality of life of patients with mitochondrial myopathy. Short-term dietary nitrate supplementation has been shown to improve exercise performance and reduce oxygen cost of exercise in healthy humans and trained athletes. We

  19. Detection of hypoglycin A in the seeds of sycamore (Acer pseudoplatanus) and box elder (A. negundo) in New Zealand; the toxin associated with cases of equine atypical myopathy.

    Science.gov (United States)

    McKenzie, R K; Hill, F I; Habyarimana, J A; Boemer, F; Votion, D M

    2016-05-01

    During April and May 2014 four horses aged between 5 months and 9 years, located in the Canterbury, Marlborough and Southland regions, presented with a variety of clinical signs including recumbency, stiffness, lethargy, dehydration, depression, and myoglobinuria suggestive of acute muscle damage. Two horses were subjected to euthanasia and two recovered. In all cases seeds of sycamore maple (Acer pseudoplatanus) or box elder (A. negundo) were present in the area where the horse had been grazing. The samaras (seeds) of some Acer spp. may contain hypoglycin A, that has been associated with cases of atypical myopathy in Europe and North America. To determine if hypoglycin A is present in the samaras of Acer spp. in New Zealand, samples were collected from trees throughout the country that were associated with historical and/or current cases of atypical myopathy, and analysed for hypoglycin A. Serum samples from the four cases and four unaffected horses were analysed for the presence of hypoglycin A, profiles of acylcarnitines (the definitive diagnosis for atypical myopathy) and activities of creatine kinase and aspartate aminotransferase.Markedly elevated serum activities of creatine kinase and aspartate aminotransferase, and increased concentrations of selected acylcarnitines were found in the case horses. Hypoglycin A was detected in the serum of those horses but not in the healthy controls. Hypoglycin A was detected in 10/15 samples of samaras from sycamore maple and box elder from throughout New Zealand. Cases of atypical myopathy were diagnosed on properties where samaras containing hypoglycin A were also found. Sycamore and box elder trees in New Zealand are a source of hypoglycin A associated with the development of atypical myopathy. If pastured horses present with clinical and biochemical signs of severe muscle damage then the environment should be checked for the presence of these trees. Horses should be prevented from grazing samaras from Acer spp. in the

  20. BAG3 myofibrillar myopathy presenting with cardiomyopathy.

    Science.gov (United States)

    Konersman, Chamindra G; Bordini, Brett J; Scharer, Gunter; Lawlor, Michael W; Zangwill, Steven; Southern, James F; Amos, Louella; Geddes, Gabrielle C; Kliegman, Robert; Collins, Michael P

    2015-05-01

    Myofibrillar myopathies (MFMs) are a heterogeneous group of neuromuscular disorders distinguished by the pathological hallmark of myofibrillar dissolution. Most patients present in adulthood, but mutations in several genes including BCL2-associated athanogene 3 (BAG3) cause predominantly childhood-onset disease. BAG3-related MFM is particularly severe, featuring weakness, cardiomyopathy, neuropathy, and early lethality. While prior cases reported either neuromuscular weakness or concurrent weakness and cardiomyopathy at onset, we describe the first case in which cardiomyopathy and cardiac transplantation (age eight) preceded neuromuscular weakness by several years (age 12). The phenotype comprised distal weakness and severe sensorimotor neuropathy. Nerve biopsy was primarily axonal with secondary demyelinating/remyelinating changes without "giant axons." Muscle biopsy showed extensive neuropathic changes that made myopathic changes difficult to interpret. Similar to previous cases, a p.Pro209Leu mutation in exon 3 of BAG3 was found. This case underlines the importance of evaluating for MFMs in patients with combined neuromuscular weakness and cardiomyopathy. Copyright © 2015 Elsevier B.V. All rights reserved.

  1. [External progressive ophthalmoplegia secondary to mitochondrial myopathy. Report of a case and review of the literature].

    Science.gov (United States)

    Calderón-Garcidueñas, A L; Pérez-Loria, O; Alberto-Sagástegui, J; Farías-García, R

    2000-01-01

    Progressive limitation of occular motility, accompanied by ptosis but usually without diplopia, occurs in many pathologic states, including mitochondrial diseases. A case with chronic progressive external ophthalmoplegia with onset during childhood, associated with proximal myopathy and dysphasia is presented. The muscle biopsy showed a myopathic pattern and abnormal subsarcolemmal mitochondrial deposits. Muscle biopsy for important in the correct diagnosis of this entity.

  2. Translation Theory 'Translated'

    DEFF Research Database (Denmark)

    Wæraas, Arild; Nielsen, Jeppe

    2016-01-01

    Translation theory has proved to be a versatile analytical lens used by scholars working from different traditions. On the basis of a systematic literature review, this study adds to our understanding of the ‘translations’ of translation theory by identifying the distinguishing features of the most...... common theoretical approaches to translation within the organization and management discipline: actor-network theory, knowledge-based theory, and Scandinavian institutionalism. Although each of these approaches already has borne much fruit in research, the literature is diverse and somewhat fragmented......, but also overlapping. We discuss the ways in which the three versions of translation theory may be combined and enrich each other so as to inform future research, thereby offering a more complete understanding of translation in and across organizational settings....

  3. Binary translation using peephole translation rules

    Science.gov (United States)

    Bansal, Sorav; Aiken, Alex

    2010-05-04

    An efficient binary translator uses peephole translation rules to directly translate executable code from one instruction set to another. In a preferred embodiment, the translation rules are generated using superoptimization techniques that enable the translator to automatically learn translation rules for translating code from the source to target instruction set architecture.

  4. High prevalence of impaired glucose homeostasis and myopathy in asymptomatic and oligosymptomatic 3243A>G mitochondrial DNA mutation-positive subjects

    DEFF Research Database (Denmark)

    Frederiksen, A.L.; Jeppesen, T.D.; Vissing, J.

    2009-01-01

    controls were subjected to an oral glucose tolerance test. Twenty-six adult 3243A>G carriers with unknown myopathy status and 17 healthy controls had a maximal cycle test and a muscle biopsy performed. The mutation loads were quantified in blood and muscle biopsies and correlated to the clinical......INTRODUCTION: The point mutation of 3243A>G mtDNA is the most frequent cause of mitochondrial diabetes, often presenting as the syndrome maternally inherited diabetes and deafness (MIDD). The mutation may also cause myopathy, ataxia, strokes, ophthalmoplegia, epilepsy, and cardiomyopathy in various...... combinations. Consequently, it is difficult to predict the "phenotypic risk profile" of 3243A>G mutation-positive subjects. The 3243A>G mutation coexists in cells with wild-type mtDNA, a phenomenon called heteroplasmy. The marked variability in mutation loads in different tissues is the main explanation...

  5. Implications of compound heterozygous insulin receptor mutations in congenital muscle fibre type disproportion myopathy for the receptor kinase activation

    DEFF Research Database (Denmark)

    Klein, H H; Müller, R; Vestergaard, H

    1999-01-01

    We studied insulin receptor kinase activation in two brothers with congenital muscle fibre type disproportion myopathy and compound heterozygous mutations of the insulin receptor gene, their parents, and their unaffected brother. In the father who has a heterozygote Arg1174-->Gln mutation, in sit...

  6. Alternative splicing of exon 17 and a missense mutation in exon 20 of the insulin receptor gene in two brothers with a novel syndrome of insulin resistance (congenital fiber-type disproportion myopathy)

    DEFF Research Database (Denmark)

    Vorwerk, P; Christoffersen, C T; Müller, J

    1999-01-01

    to be compound heterozygotes for mutations in the IR gene. The maternal allele was alternatively spliced in exon 17 due to a point mutation in the -1 donor splice site of the exon. The abnormal skipping of exon 17 shifts the amino acid reading frame and leads to a truncated IR, missing the entire tyrosine kinase......The insulin receptor (IR) in two brothers with a rare syndrome of congenital muscle fiber type disproportion myopathy (CFTDM) associated with diabetes and severe insulin resistance was studied. By direct sequencing of Epstein-Barr virus-transformed lymphocytes both patients were found...... domain. In the correct spliced variant, the point mutation is silent and results in a normally translated IR. The paternal allele carries a missense mutation in the tyrosine kinase domain. All three cDNA variants were present in the lymphocytes of the patients. Purified IR from 293 cells overexpressing...

  7. Homozygous LIPE mutation in siblings with multiple symmetric lipomatosis, partial lipodystrophy, and myopathy.

    Science.gov (United States)

    Zolotov, Sagit; Xing, Chao; Mahamid, Riad; Shalata, Adel; Sheikh-Ahmad, Mohammed; Garg, Abhimanyu

    2017-01-01

    Despite considerable progress in identifying causal genes for lipodystrophy syndromes, the molecular basis of some peculiar adipose tissue disorders remains obscure. In an Israeli-Arab pedigree with a novel autosomal recessive, multiple symmetric lipomatosis (MSL), partial lipodystrophy and myopathy, we conducted exome sequencing of two affected siblings to identify the disease-causing mutation. The 41-year-old female proband and her 36-year-old brother reported marked accumulation of subcutaneous fat in the face, neck, axillae, and trunk but loss of subcutaneous fat from the lower extremities and progressive distal symmetric myopathy during adulthood. They had increased serum creatine kinase levels, hypertriglyceridemia and low levels of high-density lipoprotein cholesterol. Exome sequencing identified a novel homozygous NC_000019.9:g.42906092C>A variant on chromosome 19, leading to a NM_005357.3:c.3103G>T nucleotide change in coding DNA and corresponding p.(Glu1035*) protein change in hormone sensitive lipase (LIPE) gene as the disease-causing variant. Sanger sequencing further confirmed the segregation of the mutation in the family. Hormone sensitive lipase is the predominant regulator of lipolysis from adipocytes, releasing free fatty acids from stored triglycerides. The homozygous null LIPE mutation could result in marked inhibition of lipolysis from some adipose tissue depots and thus may induce an extremely rare phenotype of MSL and partial lipodystrophy in adulthood associated with complications of insulin resistance, such as diabetes, hypertriglyceridemia and hepatic steatosis. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  8. Machine Translation and Other Translation Technologies.

    Science.gov (United States)

    Melby, Alan

    1996-01-01

    Examines the application of linguistic theory to machine translation and translator tools, discusses the use of machine translation and translator tools in the real world of translation, and addresses the impact of translation technology on conceptions of language and other issues. Findings indicate that the human mind is flexible and linguistic…

  9. Morphology of the mitochondria in heat shock protein 60 deficient fibroblasts from mitochondrial myopathy patients : Effects of stress conditions

    NARCIS (Netherlands)

    Huckriede, A; Heikema, A; Sjollema, K; Briones, P; Agsteribbe, E

    1995-01-01

    We have described two mitochondrial (mt) myopathy patients with reduced activities of various mt enzymes associated with significantly decreased amounts of heat shock protein 60 (hsp60). Experimental evidence suggested that the lack of hsp60 was the primary defect. Since hsp60 is essential for the

  10. Myosin Binding Protein-C Slow Phosphorylation is Altered in Duchenne Dystrophy and Arthrogryposis Myopathy in Fast-Twitch Skeletal Muscles.

    Science.gov (United States)

    Ackermann, Maegen A; Ward, Christopher W; Gurnett, Christina; Kontrogianni-Konstantopoulos, Aikaterini

    2015-08-19

    Myosin Binding Protein-C slow (sMyBP-C), encoded by MYBPC1, comprises a family of regulatory proteins of skeletal muscles that are phosphorylated by PKA and PKC. MYBPC1 missense mutations are linked to the development of Distal Arthrogryposis-1 (DA-1). Although structure-function details for this myopathy are evolving, function is undoubtedly driven by sequence variations and post-translational modifications in sMyBP-C. Herein, we examined the phosphorylation profile of sMyBP-C in mouse and human fast-twitch skeletal muscles. We used Flexor Digitorum Brevis (FDB) isolated from young (~2-months old) and old (~14-months old) wild type and mdx mice, and human Abductor Hallucis (AH) and gastrocnemious muscles carrying the DA-1 mutations. Our results indicate both constitutive and differential phosphorylation of sMyBP-C in aged and diseased muscles. We report a 7-35% reduction in the phosphorylation levels of select sites in old wild type and young or old mdx FDB mouse muscles, compared to young wild type tissue. Similarly, we observe a 30-70% decrease in the phosphorylation levels of all PKA and PKC phospho-sites in the DA-1 AH, but not gastrocnemius, muscle. Overall, our studies show that the phosphorylation pattern of sMyBP-C is differentially regulated in response to age and disease, suggesting that phosphorylation plays important roles in these processes.

  11. TRANSLATION, VALIDATION AND PSYCHOMETRIC EVALUATION OF PROBLEM AREAS IN DIABETES QUESTIONNAIRE: THE URDU VERSION

    OpenAIRE

    Sajjad Haider, Marvi Baloch, Qaiser Iqbal and Fahad Saleem

    2017-01-01

    Objective: The study aims to translate and examine the psychometric properties of the Urdu version of Problem Areas in Diabetes (PAID) questionnaire among Type 2 diabetic patients (T2DM) in Quetta, Pakistan. Method: A standard ‘‘forward–backward’’ procedure of translation was used to translate the English version of PAID into Urdu (official language of Pakistan). The translated version was then validated on a convenience sample of 120 T2DM patients attending a public hospital in Quetta, Pakis...

  12. Professional Culture and Personality Traits of Hospital Pharmacists across Canada: A Fundamental First Step in Developing Effective Knowledge Translation Strategies.

    Science.gov (United States)

    Rosenthal, Meagen; Hall, Kevin W; Bussières, Jean-François; Tsuyuki, Ross T

    2015-01-01

    Evidence for the value of pharmacists' interventions in the care of patients is strong and continues to grow, but the rate at which these new practice opportunities are being integrated into daily practice has not kept pace. The knowledge translation literature suggests that before effective change strategies can be implemented, a better understanding of the current environment must be obtained. Two important factors within the practice environment are the professional culture and personality traits of group members. To gain insight, at a national level, into the culture of hospital pharmacy, using the Organizational Culture Profile, and into hospital pharmacists' personality traits, using the Big Five Inventory. A cross-sectional survey of hospital pharmacists from across Canada was conducted intermittently over the period August 2012 to September 2013. The online survey contained questions about demographic characteristics and practice setting, as well as questions from the Organizational Culture Profile and Big Five Inventory. The survey link was distributed directly to hospital pharmacists or made available through provincial monthly newsletters. All data were analyzed descriptively and inferentially. In total, 401 surveys were returned. Descriptive analyses from the Organizational Culture Profile revealed that most respondents perceived value in the factors of supportiveness, competitiveness, and stability. Descriptive analyses from the Big Five Inventory revealed that respondents may have been more likely to exhibit behaviours in line with the trait of conscientiousness. Several significant subgroup differences were noted in relation to levels of education, regions of practice within Canada, years in practice, and proportion of time spent conducting clinical duties. The results from this survey provide preliminary insight into the professional culture and personality traits of Canadian hospital pharmacists. It will be important to explore these findings in

  13. Diagnostic criteria for idiopathic inflammatory myopathies. Problems of their optimization

    Directory of Open Access Journals (Sweden)

    O. A. Antelava

    2014-01-01

    Full Text Available The paper deals with the problems of optimizing the diagnostic criteria for idiopathic inflammatory myopathies (IIM, a group of heterogeneous rare autoimmune diseases characterized by inflammatory lesion in the skeletal muscles. The representatives of this group are traditionally considered to be polymyositis (PM, dermatomyositis (DM, and inclusion-body myositis. The authors detail the history of classification criteria for IIM from those proposed by T.A. Medsger et al. (1970 relying on its clinical picture, laboratory data and instrumental findings, as well as the criteria (including the first introduced exclusion ones elaborated by A. Bohan and J.B. Peter in 1975, which remain fundamental in both clinical practice and researches. The basis for the clinical and serological criteria proposed by Y. Troyanov et al. (2005 for IIM is the identification of myositis-overlap syndromes. The classificational (subtype identification and therapeutic value of the criteria based on clinical and serological characteristics was supported by the Hungarian investigators A. Vancsa et al. (2010 who investigated the relationship between the clinical and therapeutic characteristics of IIM and positivity for myositis-specific and myositis-associated antibodies. The criteria developed by M.C. Dalakas (1991, 2003 are based on the specific immunopathological features of a histological pattern, which allow the differentiation of DM, PM, and inclusion-body myositis from other myopathic syndromes. The 2004 European Neuromuscular Center (ENMC criteria first identify necrotizing autoimmune myopathy and nonspecific myositis as individual subtypes. The serological classification of IIM, which is based onthe assessment of autoantibodies that play an important role in the pathogenesis of the disease, is of indubitable interest. There is an obvious need for the correct and timely diagnosis of both IIM as a whole and its subtypes in particular, which is complicated by

  14. Two novel MYH7 proline substitutions cause Laing Distal Myopathy-like phenotypes with variable expressivity and neck extensor contracture.

    Science.gov (United States)

    Feinstein-Linial, Miora; Buvoli, Massimo; Buvoli, Ada; Sadeh, Menachem; Dabby, Ron; Straussberg, Rachel; Shelef, Ilan; Dayan, Daniel; Leinwand, Leslie Anne; Birk, Ohad S

    2016-08-12

    Human skeletal muscles express three major myosin heavy chain (MyHC) isoforms: MyHCIIx (MYH1) in fast type 2B muscle fibers, MyHCIIa (MYH2) in fast type 2A fibers and MyHCI/β-cardiac MyHC (MYH7) in slow type I skeletal fibers and cardiac ventricles. In line with its expression pattern, MYH7 mutations have been reported in association with hypertrophic or dilated cardiomyopathy, skeletal myopathies or a combination of both. We analyzed the clinical and molecular phenotype of two unrelated families of Jewish Moroccan ancestry that presented with apparently autosomal dominant inheritance of progressive Laing-like distal myopathy with non-specific myopathic changes, but uncommon marked contractures and wasting of the neck extensors. Clinical phenotyping, whole exome sequencing and restriction analysis, generation of mutants followed by cell culture transfection and imaging. Using whole exome sequencing we identified in both families two novel heterozygous proline substitutions located in exon 31 of MYH7 within its rod domain: c.4309G>C (p.Ala1437Pro) and c.4301G>C (p.Arg1434Pro). Here we show that the phenotype caused by these mutations includes marked cervical muscle contracture, and report that the severity of the phenotype varies significantly, to the extent of non-penetrance in one of the families. Finally, we provide evidence that both proline substitutions impair myosin self-assembly in non-muscle cells transfected with β-myosin constructs carrying the mutations, but do not prevent incorporation of the mutant molecules into the sarcomere. This study expands our clinical and molecular knowledge of MYH7 rod mutations causing skeletal myopathies, and underscores the importance of discussing disease penetrance during genetic counseling.

  15. Severe insulin-resistant diabetes mellitus in patients with congenital muscle fiber type disproportion myopathy

    DEFF Research Database (Denmark)

    Vestergaard, H; Klein, H H; Hansen, T

    1995-01-01

    Congenital muscle fiber type disproportion myopathy (CFTDM) is a chronic, nonprogressive muscle disorder characterized by universal muscle hypotrophy and growth retardation. Histomorphometric examination of muscle shows a preponderance of smaller than normal type 1 fibers and overall fiber size....... Insulin receptor function and glycogen synthase (GS) activity and expression were examined in biopsies of vastus lateralis muscle. Despite a 45-90-fold increase in both fasting and postprandial serum insulin levels, both CFTDM patients had diabetes mellitus. Clamp studies revealed that the oldest boy had...

  16. Case Report: Elevated CPK, an indicator of idiopathic inflammatory myopathy? [version 1; referees: 2 approved

    Directory of Open Access Journals (Sweden)

    Hina N. Khan

    2016-02-01

    Full Text Available Polymyositis is a rare disease with incidence rates at about 1 per 100,000 people annually. In this case report we will review a case of proximal muscle weakness with an elevated creatine phosphokinase that was initially misdiagnosed twice as rhabdomyolysis. Therefore, emphasizing that idiopathic inflammatory myopathy is a potential cause of myasthenia that must be considered in the differential. The case will also describe the current treatment and treatment response in polymyositis.

  17. Validation and clinical significance of the childhood myositis assessment scale for assessment of muscle function in the juvenile idiopathic inflammatory myopathies

    NARCIS (Netherlands)

    Huber, AM; Feldman, BM; Rennebohm, RM; Hicks, JE; Lindsley, CB; Perez, MD; Zemel, LS; Wallace, CA; Ballinger, SH; Passo, MH; Reed, AM; Summers, RM; Katona, IM; Miller, FW; Lachenbruch, PA; Rider, LG; White, P.H.

    Objective. To examine the measurement characteristics of the Childhood Myositis Assessment Scale (CMAS) in children with juvenile idiopathic inflammatory myopathy (juvenile IIM), and to obtain preliminary data on the clinical significance of CMAS scores. Methods. One hundred eight children with

  18. Deficiency of long-chain 3-hydroxyacyl-CoA dehydrogenase: a cause of lethal myopathy and cardiomyopathy in early childhood

    NARCIS (Netherlands)

    Rocchiccioli, F.; Wanders, R. J.; Aubourg, P.; Vianey-Liaud, C.; IJlst, L.; Fabre, M.; Cartier, N.; Bougneres, P. F.

    1990-01-01

    A child presented in early childhood with episodes of coma and hypoglycemia and a rapidly evolutive myopathy and cardiomyopathy leading to death at 9 mo of age. Ketosis was decreased (blood beta-hydroxybutyrate: 0.07 mmol/L) despite normal plasma levels of fatty acids (0.81 mmol/L). The patient's

  19. Performance of an online translation tool when applied to patient educational material.

    Science.gov (United States)

    Khanna, Raman R; Karliner, Leah S; Eck, Matthias; Vittinghoff, Eric; Koenig, Christopher J; Fang, Margaret C

    2011-11-01

    Language barriers may prevent clinicians from tailoring patient educational material to the needs of individuals with limited English proficiency. Online translation tools could fill this gap, but their accuracy is unknown. We evaluated the accuracy of an online translation tool for patient educational material. We selected 45 sentences from a pamphlet available in both English and Spanish, and translated it into Spanish using GoogleTranslate™ (GT). Three bilingual Spanish speakers then performed a blinded evaluation on these 45 sentences, comparing GT-translated sentences to those translated professionally, along four domains: fluency (grammatical correctness), adequacy (information preservation), meaning (connotation maintenance), and severity (perceived dangerousness of an error if present). In addition, evaluators indicated whether they had a preference for either the GT-translated or professionally translated sentences. The GT-translated sentences had significantly lower fluency scores compared to the professional translation (3.4 vs. 4.7, P educational material, GT performed comparably to professional human translation in terms of preserving information and meaning, though it was slightly worse in preserving grammar. In situations where professional human translations are unavailable or impractical, online translation may someday fill an important niche. Copyright © 2011 Society of Hospital Medicine.

  20. Inflammatory myopathies in childhood: correlation between nailfold capillaroscopy findings and clinical and laboratory data.

    Science.gov (United States)

    Nascif, Ana K S; Terreri, Maria T R A; Len, Cláudio A; Andrade, Luis E C; Hilário, Maria O E

    2006-01-01

    Nailfold capillaroscopy is an important tool for the diagnosis and follow-up of patients with rheumatic diseases, in particular dermatomyositis and scleroderma. A relationship has been observed in adults between improved capillaroscopic findings and reduced disease activity. Our aim was to correlate disease activity (clinical and laboratory data) and nailfold capillaroscopy findings in 18 patients with inflammatory myopathies. This prospective study included 13 juvenile dermatomyositis patients (Bohan and Peter criteria) (mean age of 8.8 years) and five patients with overlap syndrome (mean age of 15.7 years). We evaluated disease activity (skin abnormalities and muscle weakness, muscle enzymes and acute phase reactants) and its correlation with nailfold capillaroscopy findings (dilatation of isolated loops, dropout of surrounding vessels and giant capillary loops). We used a microscope with special light and magnification of 10 to 16X. Eighteen patients underwent a total of 26 capillaroscopic examinations, seven of them on two or more occasions (13 were performed during the active disease phase and 13 during remission). Twelve of the 13 examinations performed during the active phase exhibited scleroderma pattern and 8 of the 13 examinations performed during remission were normal. Therefore, in 20 of the 26 examinations clinical and laboratory data and nailfold capillaroscopy findings correlated (p = 0.01). Nailfold capillaroscopy is a non-invasive examination that offers satisfactory correlation with disease activity and could be a useful tool for the diagnosis and follow-up of inflammatory myopathies.

  1. Hereditary internal anal sphincter myopathy causing proctalgia fugax and constipation. A newly identified condition.

    Science.gov (United States)

    Kamm, M A; Hoyle, C H; Burleigh, D E; Law, P J; Swash, M; Martin, J E; Nicholls, R J; Northover, J M

    1991-03-01

    A newly identified myopathy of the internal anal sphincter is described. In the affected family, at least one member from each of five generations had severe proctalgia fugax; onset was usually in the third to fifth decades of life. Three members of the family have been studied in detail. Each had severe pain intermittently during the day and hourly during the night. Constipation was an associated symptom, in particular difficulty with rectal evacuation. Clinically the internal anal sphincter was thickened and of decreased compliance. The maximum anal canal pressure was usually increased with marked ultraslow wave activity. Anal endosonography confirmed a grossly thickened internal anal sphincter. Two patients were treated by internal anal sphincter strip myectomy; one showed marked improvement and one was relieved of the constipation but had only slight improvement of the pain. The hypertrophied muscle in two of the patients showed unique myopathic changes, consisting of vacuolar changes with periodic acid-Schiff-positive polyglycosan bodies in the smooth muscle fibers and increased endomysial fibrosis. In vitro organ-bath studies showed insensitivity of the muscle to noradrenaline, isoprenaline, carbachol, dimethylpiperazinium, and electrical-field stimulation. Immunohistochemical studies for substance P, calcitonin gene-related peptide, galanin, neuropeptide Y, and vasoactive intestinal peptide showed staining in a similar distribution to that in control tissue. A specific autosomal-dominant inherited myopathy of the internal anal sphincter that causes anal pain and constipation has been identified and characterized.

  2. Treatment options for mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes (MELAS) syndrome.

    Science.gov (United States)

    Santa, Kristin M

    2010-11-01

    Mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes (MELAS) syndrome is a rare neurodegenerative disease caused by the decreased ability of cells to produce sufficient energy in the form of adenosine 5'-triphosphate. Although it is one of the most common maternally inherited mitochondrial disorders, its exact incidence is unknown. Caused most frequently by an A-to-G point mutation at the 3243 position in the mitochondrial DNA, MELAS syndrome has a broad range of clinical manifestations and a highly variable course. The classic neurologic characteristics include encephalopathy, seizures, and stroke-like episodes. In addition to its neurologic manifestations, MELAS syndrome exhibits multisystem effects including cardiac conduction defects, diabetes mellitus, short stature, myopathy, and gastrointestinal disturbances. Unfortunately, no consensus guidelines outlining standard drug regimens exist for this syndrome. Many of the accepted therapies used in treating MELAS syndrome have been identified through a small number of clinical trials or isolated case reports. Currently, the drugs most often used include antioxidants and various vitamins aimed at minimizing the demands on the mitochondria and supporting and maximizing their function. Some of the most frequently prescribed agents include coenzyme Q(10), l-arginine, B vitamins, and levocarnitine. Although articles describing MELAS syndrome are available, few specifically target education for clinical pharmacists. This article will provide pharmacists with a practical resource to enhance their understanding of MELAS syndrome in order to provide safe and effective pharmaceutical care.

  3. Gene expression profiling in equine polysaccharide storage myopathy revealed inflammation, glycogenesis inhibition, hypoxia and mitochondrial dysfunctions

    Directory of Open Access Journals (Sweden)

    Benech Philippe

    2009-08-01

    Full Text Available Abstract Background Several cases of myopathies have been observed in the horse Norman Cob breed. Muscle histology examinations revealed that some families suffer from a polysaccharide storage myopathy (PSSM. It is assumed that a gene expression signature related to PSSM should be observed at the transcriptional level because the glycogen storage disease could also be linked to other dysfunctions in gene regulation. Thus, the functional genomic approach could be conducted in order to provide new knowledge about the metabolic disorders related to PSSM. We propose exploring the PSSM muscle fiber metabolic disorders by measuring gene expression in relationship with the histological phenotype. Results Genotypying analysis of GYS1 mutation revealed 2 homozygous (AA and 5 heterozygous (GA PSSM horses. In the PSSM muscles, histological data revealed PAS positive amylase resistant abnormal polysaccharides, inflammation, necrosis, and lipomatosis and active regeneration of fibers. Ultrastructural evaluation revealed a decrease of mitochondrial number and structural disorders. Extensive accumulation of an abnormal polysaccharide displaced and partially replaced mitochondria and myofibrils. The severity of the disease was higher in the two homozygous PSSM horses. Gene expression analysis revealed 129 genes significantly modulated (p Conclusion The main disorders observed in PSSM muscles could be related to mitochondrial dysfunctions, glycogenesis inhibition and the chronic hypoxia of the PSSM muscles.

  4. Idiopathic Inflammatory Myopathies; Association with Overlap Myositis and Syndromes: Classification, Clinical Characteristics, and Associated Autoantibodies

    Directory of Open Access Journals (Sweden)

    Pari Basharat

    2016-07-01

    Full Text Available Idiopathic inflammatory myopathies (IIM are traditionally identified as a group of disorders that target skeletal muscle due to autoimmune dysfunction. The IIM can be divided into subtypes based on certain clinical characteristics, and several classification schemes have been proposed. The predominant diagnostic criteria for IIM is the Bohan and Peter criteria, which subdivides IIM into primary polymyositis (PM, primary dermatomyositis (DM, myositis with another connective tissue disease, and myositis associated with cancer. However, this measure has been criticised for several reasons including lack of specific criteria to help distinguish between muscle biopsy findings of PM, DM, and immune-mediated necrotising myopathy, as well as the lack of identification of cases of overlap myositis (OM. Because of this issue, other classification criteria for IIM have been proposed, which include utilising myositis-associated antibodies and myositis-specific antibodies, as well as overlap features such as Raynaud’s phenomenon, polyarthritis, oesophageal abnormalities, interstitial lung disease, small bowel abnormalities such as hypomotility and malabsorption, and renal crises, amongst others. Indeed, the identification of autoantibodies associated with certain clinical phenotypes of myositis, in particular connective tissue disease-myositis overlap, has further helped divide IIM into distinct clinical subsets, which include OM and overlap syndromes (OS. This paper reviews the concepts of OM and OS as they pertain to IIM, including definitions in the literature, clinical characteristics, and overlap autoantibodies.

  5. [Hot spot mutation screening of RYR1 gene in diagnosis of congenital myopathies].

    Science.gov (United States)

    Chang, Xing-zhi; Jin, Yi-wen; Wang, Jing-min; Yuan, Yun; Xiong, Hui; Wang, Shuang; Qin, Jiong

    2014-10-18

    To detect hot spot mutation of RYR1 gene in 15 cases of congenital myopathy with different subtypes, and to discuss the value of RYR1 gene hot spot mutation detection in the diagnosis of the disease. Clinical data were collected in all the patients, including clinical manifestations and signs, serum creatine kinase, electromyography. Fourteen of the patients accepted the muscle biopsy. Hot spot mutation in the C-terminal of RYR1 gene (extron 96-106) had been detected in all the 15 patients. All the patients presented with motor development delay, and they could walk at the age of 1 to 3.5 years,but were always easy to fall and could not run or jump. There were no progressive deteriorations. Physical examination showed different degrees of muscle weakness and hypotonia.High arched palates were noted in 3 patients. The serum levels of creatine kinase were mildly elevated in 3 cases, and normal in 12 cases. Electromyography showed "myogenic" features in 11 patients, being normal in the other 4 patients. Muscle biopsy pathologic diagnosis was the central core disease in 3 patients, the central nuclei in 2 patients, the congenital fiber type disproportion in 2 patients, the nameline myopathy in 3 patient, the multiminicore disease in 1 patient, and nonspecific minimal changes in the other 3 patients; one patient was diagnosed with central core disease according to positive family history and gene mutation. In the family case (Patient 2) of central core disease, the c.14678G>A (p.Arg4893Gln) mutation in 102 extron of RYR1 was identified in three members of the family, which had been reported to be a pathogenic mutation. The c.14596A>G(p.Lys4866Gln) mutation in 101 extron was found in one patient with central core disease(Patient 1), and the c.14719G>A(p.Gly4907Ser) mutation in 102 extron was found in another case of the central core disease(Patient 3).The same novel mutation was verified in one of the patients' (Patient 3) asymptomatic father. Congenital myopathies in

  6. Adherence to drug label recommendations for avoiding drug interactions causing statin-induced myopathy--a nationwide register study.

    Directory of Open Access Journals (Sweden)

    Jennifer Settergren

    Full Text Available To investigate the extent to which clinicians avoid well-established drug-drug interactions that cause statin-induced myopathy. We hypothesised that clinicians would avoid combining erythromycin or verapamil/diltiazem respectively with atorvastatin or simvastatin. In patients with statin-fibrate combination therapy, we hypothesised that gemfibrozil was avoided to the preference of bezafibrate or fenofibrate. When combined with verapamil/diltiazem or fibrates, we hypothesized that the dispensed doses of atorvastatin/simvastatin would be decreased.Cross-sectional analysis of nationwide dispensing data. Odds ratios of interacting erythromycin, verapamil/diltiazem versus respective prevalence of comparator drugs doxycycline, amlodipine/felodipine in patients co-dispensed interacting statins simvastatin/atorvastatin versus patients unexposed (pravastatin/fluvastatin/rosuvastatin was calculated. For fibrates, OR of gemfibrozil versus fenofibrate/bezafibrate in patients co-dispensed any statin was assessed.OR of interacting erythromycin versus comparator doxycycline did not differ between patients on interacting and comparator statins either in patients dispensed high or low statin doses (adjusted OR 0.87; 95% CI 0.60-1.25 and 0.92; 95% CI 0.69-1.23. Interacting statins were less common among patients dispensed verapamil/diltiazem as compared to patients on amlodipine/felodipine (OR high dose 0.62; CI 0.56-0.68 and low dose 0.63; CI 0.58-0.68. Patients on any statin were to a lesser extent dispensed gemfibrozil compared to patients not dispensed a statin (OR high dose 0.65; CI 0.55-0.76 and low dose 0.70; CI 0.63-0.78. Mean DDD (SD for any statin was substantially higher in patients co-dispensed gemfibrozil 178 (149 compared to patients on statin monotherapy 127 (93, (p<0.001.Prescribers may to some extent avoid co-prescription of statins with calcium blockers and fibrates with an increased risk of myopathy. We found no evidence for avoiding co

  7. Mapping Translation Technology Research in Translation Studies

    DEFF Research Database (Denmark)

    Schjoldager, Anne; Christensen, Tina Paulsen; Flanagan, Marian

    2017-01-01

    section aims to improve this situation by presenting new and innovative research papers that reflect on recent technological advances and their impact on the translation profession and translators from a diversity of perspectives and using a variety of methods. In Section 2, we present translation......Due to the growing uptake of translation technology in the language industry and its documented impact on the translation profession, translation students and scholars need in-depth and empirically founded knowledge of the nature and influences of translation technology (e.g. Christensen....../Schjoldager 2010, 2011; Christensen 2011). Unfortunately, the increasing professional use of translation technology has not been mirrored within translation studies (TS) by a similar increase in research projects on translation technology (Munday 2009: 15; O’Hagan 2013; Doherty 2016: 952). The current thematic...

  8. Academic Hospitality

    Science.gov (United States)

    Phipps, Alison; Barnett, Ronald

    2007-01-01

    Academic hospitality is a feature of academic life. It takes many forms. It takes material form in the hosting of academics giving papers. It takes epistemological form in the welcome of new ideas. It takes linguistic form in the translation of academic work into other languages, and it takes touristic form through the welcome and generosity with…

  9. A case of congenital myopathy masquerading as paroxysmal dyskinesia

    Directory of Open Access Journals (Sweden)

    Harsh Patel

    2014-01-01

    Full Text Available Gastroesophageal reflux (GER disease is a significant comorbidity of neuromuscular disorders. It may present as paroxysmal dyskinesia, an entity known as Sandifer syndrome. A 6-week-old neonate presented with very frequent paroxysms of generalized stiffening and opisthotonic posture since day 22 of life. These were initially diagnosed as seizures and he was started on multiple antiepileptics which did not show any response. After a normal video electroencephalogram (VEEG was documented, possibility of dyskinesia was kept. However, when he did not respond to symptomatic therapy, Sandifer syndrome was thought of and GER scan was done, which revealed severe GER. After his symptoms got reduced to some extent, a detailed clinical examination revealed abnormal facies with flaccid quadriparesis. Muscle biopsy confirmed the diagnosis of a specific congenital myopathy. On antireflux measures, those episodic paroxysms reduced to some extent. Partial response to therapy in GER should prompt search for an underlying secondary etiology.

  10. Becoming Food Aware in Hospital: A Narrative Review to Advance the Culture of Nutrition Care in Hospitals

    OpenAIRE

    Laur, Celia; McCullough, James; Davidson, Bridget; Keller, Heather

    2015-01-01

    The Nutrition Care in Canadian Hospitals (2010–2013) study identified the prevalence of malnutrition on admission to medical and surgical wards as 45%. Nutrition practices in the eighteen hospitals, including diagnosis, treatment and monitoring of malnourished patients, were ad hoc. This lack of a systematic approach has demonstrated the need for the development of improved processes and knowledge translation of practices aimed to advance the culture of nutrition care in hospitals. A narrativ...

  11. Chinese translation of English textbooks on internal medicine from the 1850s to the 1940s.

    Science.gov (United States)

    Hong, Chuang-Ye; Wang, Fu-Mei

    2014-06-01

    During the 100 years from 1850 to 1949, six English textbooks on internal medicine were translated into Chinese and published. Publication of these books was a response to the increased demand for Chinese textbooks after the opening of several Western-style hospitals and medical schools in China where the instruction was in Chinese. Throughout this period, textbooks translated from English were regarded as symbols of mainstream and authority within medical communities in China. There was a shift of translators from British and American medical missionaries to Chinese medical elites. Publishers also changed from missionary hospitals or missionary organizations to the Chinese Medical Association, which was led by ethnic Chinese. After the 1950s, translation activity continued in Taiwan, but it was halted in China until after the Cultural Revolution. This paper provides bibliographic information about these books. The transition of medical authority in China during this 100-year period is also reviewed through the successive publication of translated textbooks on internal medicine. Copyright © 2014. Published by Elsevier B.V.

  12. Assessment of indicators for hospital drug formulary non-adherence

    NARCIS (Netherlands)

    Fijn, R; Lenderink, AW; Egberts, ACG; Brouwers, JRBJ; De Jong-Van DenBerg, LTW

    Background: Translation of rational drug therapy into practice remains an international problem. Although pharmacotherapeutic treatment guidelines (PTGs) as managerial tools are favoured over hospital drug formularies (HDFs), the latter are still applied in most hospitals. HDF enforcement often

  13. Frequency and phenotype of patients carrying TPM2 and TPM3 gene mutations in a cohort of 94 patients with congenital myopathy

    DEFF Research Database (Denmark)

    Citirak, Gülsenay; Witting, Nanna; Duno, Morten

    2014-01-01

    , two related female patients and two sporadic, male patients were found to carry mutations in the tropomyosin 2 (TPM2) and tropomyosin 3 (TPM3) genes, respectively. This indicates a low (4.3%) frequency of TPM2 and TPM3 mutations as a cause of congenital myopathy. Compared to previously described...... patients carrying the same mutations as found in our study (c.503G>A, and c.502C>T in TPM3, and c.415_417delGAG in TPM2), clinical presentation and muscle morphological findings differed in our patients. Differences included variation in distribution of muscle weakness, presence of scoliosis and ptosis...... had nemaline myopathy and fiber size disproportion, while three patients had congenital fiber type disproportion (CFTD) on muscle biopsies. TPM2-related CFTD has only been described in two cases, indicating that mutations in TPM2 are rare causes of CFTD....

  14. A novel PNPLA2 mutation causes neutral lipid storage disease with myopathy (NLSDM) presenting muscular dystrophic features with lipid storage and rimmed vacuoles.

    Science.gov (United States)

    Chen, J; Hong, D; Wang, Z; Yuan, Y

    2010-01-01

    Neutral lipid storage disease with myopathy (NLSDM) is a type of lipid storage myopathy arising due to a mutation in the PNPLA2 gene encoding an adipose triglyceride lipase responsible for the degradation of intracellular triglycerides. Herein, we report the cases of two siblings manifesting slowly progressive proximal and distal limb weakness in adulthood. One of the patients had dilated cardiomyopathy, hearing loss and short stature. Muscle specimens of the 2 patients revealed muscular dystrophic features with massive lipid droplets and numerous rimmed vacuoles in the fibers. A novel homozygous mutation IVS2+1G > A in the PNPLA2 gene was identified in the 2 cases, but not in the healthy familial individuals. The presence of massive lipid droplets with muscular dystrophic changes and rimmed vacuoles in muscle fibers might be one of the characteristic pathological changes of NLSDM.

  15. Understanding Translation

    DEFF Research Database (Denmark)

    Schjoldager, Anne Gram; Gottlieb, Henrik; Klitgård, Ida

    Understanding Translation is designed as a textbook for courses on the theory and practice of translation in general and of particular types of translation - such as interpreting, screen translation and literary translation. The aim of the book is to help you gain an in-depth understanding...... of the phenomenon of translation and to provide you with a conceptual framework for the analysis of various aspects of professional translation. Intended readers are students of translation and languages, but the book will also be relevant for others who are interested in the theory and practice of translation...... - translators, language teachers, translation users and literary, TV and film critics, for instance. Discussions focus on translation between Danish and English....

  16. Multi-dimensional knowledge translation: enabling health informatics capacity audits using patient journey models.

    Science.gov (United States)

    Catley, Christina; McGregor, Carolyn; Percival, Jennifer; Curry, Joanne; James, Andrew

    2008-01-01

    This paper presents a multi-dimensional approach to knowledge translation, enabling results obtained from a survey evaluating the uptake of Information Technology within Neonatal Intensive Care Units to be translated into knowledge, in the form of health informatics capacity audits. Survey data, having multiple roles, patient care scenarios, levels, and hospitals, is translated using a structured data modeling approach, into patient journey models. The data model is defined such that users can develop queries to generate patient journey models based on a pre-defined Patient Journey Model architecture (PaJMa). PaJMa models are then analyzed to build capacity audits. Capacity audits offer a sophisticated view of health informatics usage, providing not only details of what IT solutions a hospital utilizes, but also answering the questions: when, how and why, by determining when the IT solutions are integrated into the patient journey, how they support the patient information flow, and why they improve the patient journey.

  17. Experimental studies on the accumulation of 99mTc-MDP in the bupivacaine hydrochloride induced myopathy

    International Nuclear Information System (INIS)

    Sone, Shinsuke

    1989-01-01

    It has recently been demonstrated that several 99m Tc-labeled phosphate compounds accumulate in skeletal muscle in patients with myopathies including Duchenne muscular dystrophy (DMD). However, the mechanism by which these compounds accumulate in skeletal muscles is unknown. In order to analyze the mechanisms of tracer-localization in skeletal muscles of myopathies, the uptake of 99m Tc-methylendiphosphonate ( 99m Tc-MDP) by muscles examined in rats treated by intramuscular injection of a local anesthetic, bupivacaine. At the same time, the histological and biochemical changes of the injured muscles were studied, and findings obtained were correlated with the procedure of 99m Tc-MDP uptake. Intramuscular injection of bupivacaine resulted in markedly increased uptake of 99m Tc-MDP in the injected muscle at 12 and 24 hours after injection. The plasma creatine phosphokinase (CK) concentration increased 2-3 folds during the period from 3 to 24 hours after bupivacaine injection. Four days following injection, the CK isozyme MB activity in muscle increased. Twenty hours after injection of bupivacaine, changes such as hypercontraction and disruptin of myofibrils, Z-band lysis, and swelling of mitochondria occurred. Four days after the injection, myoblasts and myotubes were found in the damaged areas of the muscle. These results show that the increased muscle uptake of 99m Tc-MDP reflects the early degenerative changes of skeletal muscle. (author)

  18. Sporadic late-onset nemaline myopathy with MGUS: long-term follow-up after melphalan and SCT.

    Science.gov (United States)

    Voermans, Nicol C; Benveniste, Olivier; Minnema, Monique C; Lokhorst, Henk; Lammens, Martin; Meersseman, Wouter; Delforge, Michel; Kuntzer, Thierry; Novy, Jan; Pabst, Thomas; Bouhour, Françoise; Romero, Norma; Leblond, Veronique; Bergh, Peter van den; Vekemans, Marie-Christiane; van Engelen, Baziel G; Eymard, Bruno

    2014-12-02

    Sporadic late-onset nemaline myopathy (SLONM) is a rare, late-onset myopathy that progresses subacutely. If associated with a monoclonal gammopathy of unknown significance (MGUS), the outcome is unfavorable: the majority of these patients die within 1 to 5 years of respiratory failure. This study aims to qualitatively assess the long-term treatment effect of high-dose melphalan (HDM) followed by autologous stem cell transplantation (SCT) in a series of 8 patients with SLONM-MGUS. We performed a retrospective case series study (n = 8) on the long-term (1-8 years) treatment effect of HDM followed by autologous SCT (HDM-SCT) on survival, muscle strength, and functional capacities. Seven patients showed a lasting moderate-good clinical response, 2 of them after the second HDM-SCT. All of them had a complete, a very good partial, or a partial hematologic response. One patient showed no clinical or hematologic response and died. This case series shows the positive effect of HDM-SCT in this rare disorder. Factors that may portend an unfavorable outcome are a long disease course before the hematologic treatment and a poor hematologic response. Age at onset, level and type of M protein (κ vs λ), and severity of muscle weakness were not associated with a specific outcome. This study provides Class IV evidence that for patients with SLONM-MGUS, HDM-SCT increases the probability of survival and functional improvement. © 2014 American Academy of Neurology.

  19. Late onset of neutral lipid storage disease due to novel PNPLA2 mutations causing total loss of lipase activity in a patient with myopathy and slight cardiac involvement.

    Science.gov (United States)

    Missaglia, Sara; Maggi, Lorenzo; Mora, Marina; Gibertini, Sara; Blasevich, Flavia; Agostoni, Piergiuseppe; Moro, Laura; Cassandrini, Denise; Santorelli, Filippo Maria; Gerevini, Simonetta; Tavian, Daniela

    2017-05-01

    Neutral lipid storage disease with myopathy (NLSDM) presents with skeletal muscle myopathy and severe dilated cardiomyopathy in nearly 40% of cases. NLSDM is caused by mutations in the PNPLA2 gene, which encodes the adipose triglyceride lipase (ATGL). Here we report clinical and genetic findings of a patient carrying two novel PNPLA2 mutations (c.696+4A>G and c.553_565delGTCCCCCTTCTCG). She presented at age 39 with right upper limb abduction weakness slowly progressing over the years with asymmetric involvement of proximal upper and lower limb muscles. Cardiological evaluation through ECG and heart echo scan was normal until the age 53, when mild left ventricular diastolic dysfunction was detected. Molecular analysis revealed that only one type of PNPLA2 transcript, with exon 5 skipping, was expressed in patient cells. Such aberrant mRNA causes the production of a shorter ATGL protein, lacking part of the catalytic domain. This is an intriguing case, displaying severe PNPLA2 mutations with clinical presentation characterized by slight cardiac impairment and full expression of severe asymmetric myopathy. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  20. Myopathy Associated with Acute Hypothyroidism following Radioiodine Therapy for Graves Disease in an Adolescent

    Directory of Open Access Journals (Sweden)

    Rivkees ScottA

    2010-08-01

    Full Text Available We describe acute myopathy following I-131 treatment for hyperthyroidism due to Graves Disease (GD in an adolescent. A 15 year-old diagnosed with GD required treatment with radioactive iodine (I-131 therapy. Six weeks post I-131, he developed generalized muscle cramps. The CK was 19.800 U/L, the total thyroxine was 2.3 mcg/dL (29.6 nmol/L SI and the estimated free thyroxine (EFT was 0.5 ng/dL (6.4 pmol/L SI. The ALT was 112 U/L and AST was 364 U/L (normal

  1. X linked neonatal centronuclear/myotubular myopathy: evidence for linkage to Xq28 DNA marker loci.

    OpenAIRE

    Thomas, N S; Williams, H; Cole, G; Roberts, K; Clarke, A; Liechti-Gallati, S; Braga, S; Gerber, A; Meier, C; Moser, H

    1990-01-01

    We have studied the inheritance of several polymorphic Xq27/28 DNA marker loci in two three generation families with the X linked neonatal lethal form of centronuclear/myotubular myopathy (XL MTM). We found complete linkage of XLMTM to all four informative Xq28 markers analysed, with GCP/RCP (Z = 3.876, theta = 0.00), with DXS15 (Z = 3.737, theta = 0.00), with DXS52 (Z = 2.709, theta = 0.00), and with F8C (Z = 1.020, theta = 0.00). In the absence of any observable recombination, we are unable...

  2. Neurogenic myopathies and imaging of muscle denervation; Neurogene Myopathien und Bildgebung der Muskeldenervation

    Energy Technology Data Exchange (ETDEWEB)

    Wolf, M. [Universitaetsklinikum Heidelberg, Abteilung fuer Neuroradiologie, Heidelberg (Germany); Wolf, C. [Reha-Zentrum Gernsbach, Neurologie, Gernsbach (Germany); Weber, M.A. [Universitaetsklinikum Heidelberg, Abteilung fuer Diagnostische und Interventionelle Radiologie, Heidelberg (Germany)

    2017-12-15

    Neurogenic myopathies are primary diseases of the nervous system, which secondarily result in denervation of the target musculature. The spectrum of potential causes is manifold ranging from acute traumatic injuries and chronic compression to neurodegenerative, inflammatory, metabolic and neoplastic processes. The medical history, clinical neurological examination, and electrophysiological tests including electromyography and nerve conduction studies are crucial in diagnosing neuropathic myopathies. Electromyography is the gold standard for diagnosing muscle denervation. Additional imaging methods and magnetic resonance imaging (MRI) in particular, are capable of contributing valuable information. The MRI examination of denervated musculature shows edema, an increase in the apparent diffusion coefficient (ADC) and hyperperfusion. Chronic denervation results in fatty degeneration and atrophy of affected muscles, which are also detectable by MRI. Although the MRI findings in muscle denervation are relatively unspecific, they show a high sensitivity, comparable to electromyography. Dedicated MR neurography may often visualize the underlying lesion(s) of the innervating nerve(s). Besides high sensitivity, comparable to electromyography, MRI is capable of evaluating muscles which are inaccessible for needle electromyography. Due to its non-invasive character, MRI is ideal for follow-up examinations. The use of MRI is often a meaningful addition to the diagnostics of neurogenic myopathies. The extent and distribution pattern of muscular alterations often provide information on the localization of the causative nerve damage. A correct diagnosis or at least a narrowing down of possible differential diagnoses can often be achieved using MRI. (orig.) [German] Neurogene Myopathien sind Erkrankungen des Nervensystems, die sekundaer zur Denervierung der Zielmuskulatur fuehren. Das Spektrum potenzieller Ursachen ist vielfaeltig und umfasst akute traumatische Verletzungen

  3. The Impact of Hospital Size on CMS Hospital Profiling.

    Science.gov (United States)

    Sosunov, Eugene A; Egorova, Natalia N; Lin, Hung-Mo; McCardle, Ken; Sharma, Vansh; Gelijns, Annetine C; Moskowitz, Alan J

    2016-04-01

    The Centers for Medicare & Medicaid Services (CMS) profile hospitals using a set of 30-day risk-standardized mortality and readmission rates as a basis for public reporting. These measures are affected by hospital patient volume, raising concerns about uniformity of standards applied to providers with different volumes. To quantitatively determine whether CMS uniformly profile hospitals that have equal performance levels but different volumes. Retrospective analysis of patient-level and hospital-level data using hierarchical logistic regression models with hospital random effects. Simulation of samples including a subset of hospitals with different volumes but equal poor performance (hospital effects=+3 SD in random-effect logistic model). A total of 1,085,568 Medicare fee-for-service patients undergoing 1,494,993 heart failure admissions in 4930 hospitals between July 1, 2005 and June 30, 2008. CMS methodology was used to determine the rank and proportion (by volume) of hospitals reported to perform "Worse than US National Rate." Percent of hospitals performing "Worse than US National Rate" was ∼40 times higher in the largest (fifth quintile by volume) compared with the smallest hospitals (first quintile). A similar gradient was seen in a cohort of 100 hospitals with simulated equal poor performance (0%, 0%, 5%, 20%, and 85% in quintiles 1 to 5) effectively leaving 78% of poor performers undetected. Our results illustrate the disparity of impact that the current CMS method of hospital profiling has on hospitals with higher volumes, translating into lower thresholds for detection and reporting of poor performance.

  4. Lipid-storage myopathy and respiratory insufficiency due to ETFQO mutations in a patient with late-onset multiple acyl-CoA dehydrogenation deficiency

    DEFF Research Database (Denmark)

    Olsen, Rikke Katrine Jentoft; Pourfarzam, M; Morris, A A M

    2004-01-01

    response to treatment, she developed respiratory insufficiency at age 14 years and has required long-term overnight ventilation. Thus, MADD is one of the few conditions that can cause a myopathy with weakness of the respiratory muscles out of proportion to the limb muscles. Udgivelsesdato: 2004-null...

  5. Mild trifunctional protein deficiency is associated with progressive neuropathy and myopathy and suggests a novel genotype-phenotype correlation.

    OpenAIRE

    Ibdah, J A; Tein, I; Dionisi-Vici, C; Bennett, M J; IJlst, L; Gibson, B; Wanders, R J; Strauss, A W

    1998-01-01

    Human mitochondrial trifunctional protein (TFP) is a heterooctamer of four alpha- and four beta-subunits that catalyzes three steps in the beta-oxidation spiral of long-chain fatty acids. TFP deficiency causes a Reye-like syndrome, cardiomyopathy, or sudden, unexpected death. We delineated the molecular basis for TFP deficiency in two patients with a unique phenotype characterized by chronic progressive polyneuropathy and myopathy without hepatic or cardiac involvement. Single-stranded confor...

  6. Gender Differences in Hospital CEO Compensation: A National Investigation of Not-for-Profit Hospitals.

    Science.gov (United States)

    Song, Paula H; Lee, Shoou-Yih Daniel; Toth, Matthew; Singh, Simone R; Young, Gary J

    2018-01-01

    Gender pay equity is a desirable social value and an important strategy to fill every organizational stratum with gender-diverse talent to fulfill an organization's goals and mission. This study used national, large-sample data to examine gender difference in CEO compensation among not-for-profit hospitals. Results showed the average unadjusted annual compensation for female CEOs in 2009 was $425,085 compared with $581,121 for male CEOs. With few exceptions, the difference existed across all types of not-for-profit hospitals. After controlling for hospital- and area-level characteristics, female CEOs of not-for-profit hospitals earned 22.6% less than male CEOs of not-for-profit hospitals. This translates into an earnings differential of $132,652 associated with gender. Explanations and implications of the results are discussed.

  7. Mapping Translation Technology Research in Translation Studies

    DEFF Research Database (Denmark)

    Schjoldager, Anne; Christensen, Tina Paulsen; Flanagan, Marian

    2017-01-01

    /Schjoldager 2010, 2011; Christensen 2011). Unfortunately, the increasing professional use of translation technology has not been mirrored within translation studies (TS) by a similar increase in research projects on translation technology (Munday 2009: 15; O’Hagan 2013; Doherty 2016: 952). The current thematic...... section aims to improve this situation by presenting new and innovative research papers that reflect on recent technological advances and their impact on the translation profession and translators from a diversity of perspectives and using a variety of methods. In Section 2, we present translation...... technology research as a subdiscipline of TS, and we define and discuss some basic concepts and models of the field that we use in the rest of the paper. Based on a small-scale study of papers published in TS journals between 2006 and 2016, Section 3 attempts to map relevant developments of translation...

  8. Uptake of critical knowledge in nursing practice: lessons learned from a knowledge translation study.

    Science.gov (United States)

    Anderson, Joan M; Browne, Annette J; Reimer-Kirkham, Sheryl; Lynam, M Judith; Rodney, Paddy; Varcoe, Colleen; Wong, Sabrina; Tan, Elsie; Smye, Victoria; McDonald, Heather; Baumbusch, Jennifer; Khan, Koushambhi Basu; Reimer, Joanne; Peltonen, Adrienne; Brar, Anureet

    2010-09-01

    This article is based on a knowledge translation (KT) study of the transition of patients from hospital to home. It focuses on the lessons learned about the challenges of translating research-derived critical knowledge in practice settings. The authors situate the article in current discourses about KT; discuss their understanding of the nature of critical knowledge; and present themes from their body of research, which comprises the knowledge that was translated. The findings have the potential to guide future KT research that focuses on the uptake of critical knowledge in nursing practice.

  9. Acylcarnitines profile best predicts survival in horses with atypical myopathy.

    Directory of Open Access Journals (Sweden)

    François Boemer

    Full Text Available Equine atypical myopathy (AM is caused by hypoglycin A intoxication and is characterized by a high fatality rate. Predictive estimation of survival in AM horses is necessary to prevent unnecessary suffering of animals that are unlikely to survive and to focus supportive therapy on horses with a possible favourable prognosis of survival. We hypothesized that outcome may be predicted early in the course of disease based on the assumption that the acylcarnitine profile reflects the derangement of muscle energetics. We developed a statistical model to prognosticate the risk of death of diseased animals and found that estimation of outcome may be drawn from three acylcarnitines (C2, C10:2 and C18 -carnitines with a high sensitivity and specificity. The calculation of the prognosis of survival makes it possible to distinguish the horses that will survive from those that will die despite severe signs of acute rhabdomyolysis in both groups.

  10. Acylcarnitines profile best predicts survival in horses with atypical myopathy

    Science.gov (United States)

    Detilleux, Johann; Cello, Christophe; Amory, Hélène; Marcillaud-Pitel, Christel; Richard, Eric; van Galen, Gaby; van Loon, Gunther; Lefère, Laurence; Votion, Dominique-Marie

    2017-01-01

    Equine atypical myopathy (AM) is caused by hypoglycin A intoxication and is characterized by a high fatality rate. Predictive estimation of survival in AM horses is necessary to prevent unnecessary suffering of animals that are unlikely to survive and to focus supportive therapy on horses with a possible favourable prognosis of survival. We hypothesized that outcome may be predicted early in the course of disease based on the assumption that the acylcarnitine profile reflects the derangement of muscle energetics. We developed a statistical model to prognosticate the risk of death of diseased animals and found that estimation of outcome may be drawn from three acylcarnitines (C2, C10:2 and C18 -carnitines) with a high sensitivity and specificity. The calculation of the prognosis of survival makes it possible to distinguish the horses that will survive from those that will die despite severe signs of acute rhabdomyolysis in both groups. PMID:28846683

  11. Are Peripheral Blood Mononuclear Cells Derived from Patients with Certain Myopathies Suitable for Personalized Drug Screening?

    Directory of Open Access Journals (Sweden)

    Andriy V. Shatillo

    2014-12-01

    Full Text Available Background: Limb girdle muscular dystrophies (LGMDs and several other disorders which share their specific phenotype are rare, predominantly hereditary conditions with no curative treatment. Differential diagnosis of these myopathies is quite challenging and expensive in many cases. Therefore, a significant proportion of patients remains undiagnosed and untreated for a long time. At the same time there is a huge amount of drugs and supplements potentially able to modify the course of some of these muscular dystrophies. That is why a simple empirical approach able to define a patient’s reaction to a specific compound seems rational. Because most common basic pathogenetic mechanisms for these quite different disorders increase the vulnerability of muscle cells (or decrease ability for reparation during mechanical stress, we propose a simple, noninvasive and inexpensive approach for individualized drug screening based on the drug’s influence on the mechanical vulnerability of peripheral blood mononuclear cells (PBMC. Methods: PBMC derived from 8 patients with Duchenne muscular dystrophy (DMD, 2 patients with LGMD2A, 1 patient with LGMD2B, 1 with MERRF syndrome, 1 with facioscapulohumeral muscular dystrophy (FSHD and 13 matched control subjects were irradiated by ultrasound in the presence of several compounds (lisinopril, vitamin D3, prednisolon, tocopherol, topiramate, glutargin, α-lipoic acid, essentiale, and physiological solution. Then viability indexes of the samples were detected by citotoxic assays based on vital dye (neutral red and resazurin metabolism. Results: In cytotoxicity tests with active transport of neutral red into PBMC derived from DMD patients, the cells showed signs of destruction at 1.06±0.52 minutes of ultrasounding compared to 1.75±0.6 minutes in control. PBMCs from patients with other myopathies have either normal or decreased resistance to ultrasound. The addition of tocopherol significantly changes the PBMC

  12. Experimental studies on the accumulation of /sup 99m/Tc-MDP in the bupivacaine hydrochloride induced myopathy

    Energy Technology Data Exchange (ETDEWEB)

    Sone, Shinsuke

    1989-02-01

    It has recently been demonstrated that several /sup 99m/Tc-labeled phosphate compounds accumulate in skeletal muscle in patients with myopathies including Duchenne muscular dystrophy (DMD). However, the mechanism by which these compounds accumulate in skeletal muscles is unknown. In order to analyze the mechanisms of tracer-localization in skeletal muscles of myopathies, the uptake of /sup 99m/Tc-methylendiphosphonate (/sup 99m/Tc-MDP) by muscles examined in rats treated by intramuscular injection of a local anesthetic, bupivacaine. At the same time, the histological and biochemical changes of the injured muscles were studied, and findings obtained were correlated with the procedure of /sup 99m/Tc-MDP uptake. Intramuscular injection of bupivacaine resulted in markedly increased uptake of /sup 99m/Tc-MDP in the injected muscle at 12 and 24 hours after injection. The plasma creatine phosphokinase (CK) concentration increased 2-3 folds during the period from 3 to 24 hours after bupivacaine injection. Four days following injection, the CK isozyme MB activity in muscle increased. Twenty hours after injection of bupivacaine, changes such as hypercontraction and disruptin of myofibrils, Z-band lysis, and swelling of mitochondria occurred. Four days after the injection, myoblasts and myotubes were found in the damaged areas of the muscle. These results show that the increased muscle uptake of /sup 99m/Tc-MDP reflects the early degenerative changes of skeletal muscle.

  13. Role of Myofibrillar Protein Catabolism in Development of Glucocorticoid Myopathy: Aging and Functional Activity Aspects

    Directory of Open Access Journals (Sweden)

    Teet Seene

    2016-05-01

    Full Text Available Muscle weakness in corticosteroid myopathy is mainly the result of the destruction and atrophy of the myofibrillar compartment of fast-twitch muscle fibers. Decrease of titin and myosin, and the ratio of nebulin and MyHC in myopathic muscle, shows that these changes of contractile and elastic proteins are the result of increased catabolism of the abovementioned proteins in skeletal muscle. Slow regeneration of skeletal muscle is in good correlation with a decreased number of satellite cells under the basal lamina of muscle fibers. Aging causes a reduction of AMP-activated protein kinase (AMPK activity as the result of the reduced function of the mitochondrial compartment. AMPK activity increases as a result of increased functional activity. Resistance exercise causes anabolic and anticatabolic effects in skeletal muscle: muscle fibers experience hypertrophy while higher myofibrillar proteins turn over. These changes are leading to the qualitative remodeling of muscle fibers. As a result of these changes, possible maximal muscle strength is increasing. Endurance exercise improves capillary blood supply, increases mitochondrial biogenesis and muscle oxidative capacity, and causes a faster turnover rate of sarcoplasmic proteins as well as qualitative remodeling of type I and IIA muscle fibers. The combination of resistance and endurance exercise may be the fastest way to prevent or decelerate muscle atrophy due to the anabolic and anticatabolic effects of exercise combined with an increase in oxidative capacity. The aim of the present short review is to assess the role of myofibrillar protein catabolism in the development of glucocorticoid-caused myopathy from aging and physical activity aspects.

  14. Intercultural communication problems relating to translation from English into Sesotho

    Directory of Open Access Journals (Sweden)

    Anastacia Sara Motsei

    2013-12-01

    Full Text Available In this article, certain translative communication problems associated with the linguistic and stylistic differences between English and Sesotho are identified and discussed. With a view to help improve translation between the two languages where inaccurate and stilted communication frequently occurs, issues of equivalence, fidelity/faithfulness and the purpose of translation are delved into. It is furthermore argued that in South African multilingual contexts, like legal courts, criminal cases/hearings and hospitals clinics and similar health establishments, inaccurate translation and/or misinterpreting can lead to serious miscarriages of justice and poor service delivery. The reasons for such unfortunate eventualities sometimes relate to the translator-interpreter’s poor understanding of the cultural factors behind the English or Sesotho message. As such, emphasis is lain on the need for a translator-interpreter’s cultural understanding of the source language/text (SL/T and target language/text (TL/T to deliver an accurate version (in the target language or text – TL/T of the original message. It is furthermore shown that one cause of social and legal injustice is closely related to the translator- interpreter’s insufficient knowledge of both the English and Sesotho culture as it exists in grammatical forms, idiomatic structures, collocation patterns and stylistic patterns of the SL/T and the TL/T.

  15. A Nonsense Variant in the ACADVL Gene in German Hunting Terriers with Exercise Induced Metabolic Myopathy.

    Science.gov (United States)

    Lepori, Vincent; Mühlhause, Franziska; Sewell, Adrian C; Jagannathan, Vidhya; Janzen, Nils; Rosati, Marco; Alves de Sousa, Filipe Miguel Maximiano; Tschopp, Aurélie; Schüpbach, Gertraud; Matiasek, Kaspar; Tipold, Andrea; Leeb, Tosso; Kornberg, Marion

    2018-05-04

    Several enzymes are involved in fatty acid oxidation, which is a key process in mitochondrial energy production. Inherited defects affecting any step of fatty acid oxidation can result in clinical disease. We present here an extended family of German Hunting Terriers with 10 dogs affected by clinical signs of exercise induced weakness, muscle pain, and suspected rhabdomyolysis. The combination of clinical signs, muscle histopathology and acylcarnitine analysis with an elevated tetradecenoylcarnitine (C14:1) peak suggested a possible diagnosis of acyl-CoA dehydrogenase very long chain deficiency (ACADVLD). Whole genome sequence analysis of one affected dog and 191 controls revealed a nonsense variant in the ACADVL gene encoding acyl-CoA dehydrogenase very long chain, c.1728C>A or p.(Tyr576*). The variant showed perfect association with the phenotype in the 10 affected and more than 500 control dogs of various breeds. Pathogenic variants in the ACADVL gene have been reported in humans with similar myopathic phenotypes. We therefore considered the detected variant to be the most likely candidate causative variant for the observed exercise induced myopathy. To our knowledge, this is the first description of this disease in dogs, which we propose to name exercise induced metabolic myopathy (EIMM), and the identification of the first canine pathogenic ACADVL variant. Our findings provide a large animal model for a known human disease and will enable genetic testing to avoid the unintentional breeding of affected offspring. Copyright © 2018 Lepori et al.

  16. A Nonsense Variant in the ACADVL Gene in German Hunting Terriers with Exercise Induced Metabolic Myopathy

    Directory of Open Access Journals (Sweden)

    Vincent Lepori

    2018-05-01

    Full Text Available Several enzymes are involved in fatty acid oxidation, which is a key process in mitochondrial energy production. Inherited defects affecting any step of fatty acid oxidation can result in clinical disease. We present here an extended family of German Hunting Terriers with 10 dogs affected by clinical signs of exercise induced weakness, muscle pain, and suspected rhabdomyolysis. The combination of clinical signs, muscle histopathology and acylcarnitine analysis with an elevated tetradecenoylcarnitine (C14:1 peak suggested a possible diagnosis of acyl-CoA dehydrogenase very long chain deficiency (ACADVLD. Whole genome sequence analysis of one affected dog and 191 controls revealed a nonsense variant in the ACADVL gene encoding acyl-CoA dehydrogenase very long chain, c.1728C>A or p.(Tyr576*. The variant showed perfect association with the phenotype in the 10 affected and more than 500 control dogs of various breeds. Pathogenic variants in the ACADVL gene have been reported in humans with similar myopathic phenotypes. We therefore considered the detected variant to be the most likely candidate causative variant for the observed exercise induced myopathy. To our knowledge, this is the first description of this disease in dogs, which we propose to name exercise induced metabolic myopathy (EIMM, and the identification of the first canine pathogenic ACADVL variant. Our findings provide a large animal model for a known human disease and will enable genetic testing to avoid the unintentional breeding of affected offspring.

  17. Translational Science Research: Towards Better Health

    Directory of Open Access Journals (Sweden)

    Emir Festic

    2009-10-01

    Full Text Available Even though it is considered a 21st century term, translational research has been present for much longer. Idea of translating experimental discovery to its’ clinical application and use is old as research itself. However, it is the understanding of missing links between the basic science research and clinical research that emerged in the past decade and mobilized scientific and clinical communities and organizations worldwide. Hence term, translational research, which represents an “enterprise of harnessing knowledge from basic sciences to produce new drugs, devices, and treatment options for patients” (1. It has been also characterized as “effective translation of the new knowledge, mechanisms, and techniques generated by advances in basic science research into new approaches for prevention, diagnosis, and treatment of disease, which is essential for improving health” (2.This translation is a complex process and involves more than one step for transfer of research knowledge. At least 3 such roadblocks have been identified (Figure 1 ; T1 translation: “The transfer of new understandings of disease mechanisms gained in the laboratory into the development of new methods for diagnosis, therapy, and prevention and their first testing in humans”, T2 translation: “The translation of results from clinical studies into everyday clinical practice and health decision making”, and T3 translation: “Practice-based research, which is often necessary before distilled knowledge (e.g., systematic reviews, guidelines can be implemented in practice” (3-5.The international research community rapidly recognized importance for promotion of translational research and made it their priority(5. In the USA, National Institutes of Health, (NIH expects to fund 60 translational research centers with a budget of $500 million per year by 2012 (6. Besides academic centers, foundations, industry, disease-related organizations, and individual hospitals and

  18. Translation and validation of ICIQ-FLUTS for Tamil-speaking women.

    Science.gov (United States)

    Ekanayake, Chanil D; Pathmeswaran, Arunasalam; Nishad, A A Nilanga; Samaranayake, Kanishka U; Wijesinghe, Prasantha S

    2017-12-01

    Research in to lower urinary tract symptoms (LUTS) in women in South Asia is hampered by lack of validated tools. Our aim was to validate the International Consultation on Incontinence Modular Questionnaire on Female Lower Urinary Tract Symptoms (ICIQ-FLUTS) from English to Tamil. After translation to Tamil, a validation study was carried out among women attending the gynecology clinic at District General Hospital-Mannar. Content validity assessed by the level of missing data was Tamil translation of ICIQ-FLUTS retained the psychometric properties of the original English questionnaire and will be an invaluable tool to detect LUTS among Tamil-speaking women.

  19. Translational Creativity

    DEFF Research Database (Denmark)

    Nielsen, Sandro

    2010-01-01

    A long-established approach to legal translation focuses on terminological equivalence making translators strictly follow the words of source texts. Recent research suggests that there is room for some creativity allowing translators to deviate from the source texts. However, little attention...... is given to genre conventions in source texts and the ways in which they can best be translated. I propose that translators of statutes with an informative function in expert-to-expert communication may be allowed limited translational creativity when translating specific types of genre convention....... This creativity is a result of translators adopting either a source-language or a target-language oriented strategy and is limited by the pragmatic principle of co-operation. Examples of translation options are provided illustrating the different results in target texts. The use of a target-language oriented...

  20. Topical Review: Translating Translational Research in Behavioral Science.

    Science.gov (United States)

    Hommel, Kevin A; Modi, Avani C; Piazza-Waggoner, Carrie; Myers, James D

    2015-01-01

    To present a model of translational research for behavioral science that communicates the role of behavioral research at each phase of translation. A task force identified gaps in knowledge regarding behavioral translational research processes and made recommendations regarding advancement of knowledge. A comprehensive model of translational behavioral research was developed. This model represents T1, T2, and T3 research activities, as well as Phase 1, 2, 3, and 4 clinical trials. Clinical illustrations of translational processes are also offered as support for the model. Behavioral science has struggled with defining a translational research model that effectively articulates each stage of translation and complements biomedical research. Our model defines key activities at each phase of translation from basic discovery to dissemination/implementation. This should be a starting point for communicating the role of behavioral science in translational research and a catalyst for better integration of biomedical and behavioral research. © The Author 2015. Published by Oxford University Press on behalf of the Society of Pediatric Psychology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  1. Proximal myopathy in lacto-vegetarian Asian patients responding to Vitamin D and calcium supplement therapy - two case reports and review of the literature

    LENUS (Irish Health Repository)

    Thabit, Hood

    2011-05-13

    Abstract Introduction Severe proximal myopathy can occasionally be the first presenting complaint of patients with osteomalacia. This may lead to investigations and misdiagnosis of a neuromuscular disease, rather than a metabolic bone disease. Case presentations We present here two cases of severe proximal myopathy in patients who were both of South Asian origin and lacto-vegetarians: a 31-year-old Indian man and a 34-year-old Indian woman. In both cases, their clinical symptoms fully resolved following vitamin D and calcium replacement therapy. These patients were at risk of osteomalacia due to their dietary intake and ethnicity. The role of dietary intake and sunlight exposure in the development of osteomalacia in certain ethnic groups living in Western Europe is reviewed here. Conclusion These two cases emphasize the importance of recognizing osteomalacia in at-risk individuals, as the condition is reversible and easily treated with vitamin D and calcium supplementation. It may also help avoid prolonged and unnecessary investigations of these patients.

  2. Proximal myopathy in lacto-vegetarian Asian patients responding to Vitamin D and calcium supplement therapy - two case reports and review of the literature

    Directory of Open Access Journals (Sweden)

    Sreenan Seamus

    2011-05-01

    Full Text Available Abstract Introduction Severe proximal myopathy can occasionally be the first presenting complaint of patients with osteomalacia. This may lead to investigations and misdiagnosis of a neuromuscular disease, rather than a metabolic bone disease. Case presentations We present here two cases of severe proximal myopathy in patients who were both of South Asian origin and lacto-vegetarians: a 31-year-old Indian man and a 34-year-old Indian woman. In both cases, their clinical symptoms fully resolved following vitamin D and calcium replacement therapy. These patients were at risk of osteomalacia due to their dietary intake and ethnicity. The role of dietary intake and sunlight exposure in the development of osteomalacia in certain ethnic groups living in Western Europe is reviewed here. Conclusion These two cases emphasize the importance of recognizing osteomalacia in at-risk individuals, as the condition is reversible and easily treated with vitamin D and calcium supplementation. It may also help avoid prolonged and unnecessary investigations of these patients.

  3. Proximal myopathy in lacto-vegetarian Asian patients responding to Vitamin D and calcium supplement therapy - two case reports and review of the literature.

    LENUS (Irish Health Repository)

    Thabit, Hood

    2012-02-01

    INTRODUCTION: Severe proximal myopathy can occasionally be the first presenting complaint of patients with osteomalacia. This may lead to investigations and misdiagnosis of a neuromuscular disease, rather than a metabolic bone disease. CASE PRESENTATIONS: We present here two cases of severe proximal myopathy in patients who were both of South Asian origin and lacto-vegetarians: a 31-year-old Indian man and a 34-year-old Indian woman. In both cases, their clinical symptoms fully resolved following vitamin D and calcium replacement therapy. These patients were at risk of osteomalacia due to their dietary intake and ethnicity. The role of dietary intake and sunlight exposure in the development of osteomalacia in certain ethnic groups living in Western Europe is reviewed here. CONCLUSION: These two cases emphasize the importance of recognizing osteomalacia in at-risk individuals, as the condition is reversible and easily treated with vitamin D and calcium supplementation. It may also help avoid prolonged and unnecessary investigations of these patients.

  4. Finite translation surfaces with maximal number of translations

    OpenAIRE

    Schlage-Puchta, Jan-Christoph; Weitze-Schmithuesen, Gabriela

    2013-01-01

    The natural automorphism group of a translation surface is its group of translations. For finite translation surfaces of genus g > 1 the order of this group is naturally bounded in terms of g due to a Riemann-Hurwitz formula argument. In analogy with classical Hurwitz surfaces, we call surfaces which achieve the maximal bound Hurwitz translation surfaces. We study for which g there exist Hurwitz translation surfaces of genus g.

  5. Machine Translation Tools - Tools of The Translator's Trade

    DEFF Research Database (Denmark)

    Kastberg, Peter

    2012-01-01

    In this article three of the more common types of translation tools are presented, discussed and critically evaluated. The types of translation tools dealt with in this article are: Fully Automated Machine Translation (or FAMT), Human Aided Machine Translation (or HAMT) and Machine Aided Human...... Translation (or MAHT). The strengths and weaknesses of the different types of tools are discussed and evaluated by means of a number of examples. The article aims at two things: at presenting a sort of state of the art of what is commonly referred to as “machine translation” as well as at providing the reader...... with a sound basis for considering what translation tool (if any) is the most appropriate in order to meet his or her specific translation needs....

  6. Translation Techniques

    OpenAIRE

    Marcia Pinheiro

    2015-01-01

    In this paper, we discuss three translation techniques: literal, cultural, and artistic. Literal translation is a well-known technique, which means that it is quite easy to find sources on the topic. Cultural and artistic translation may be new terms. Whilst cultural translation focuses on matching contexts, artistic translation focuses on matching reactions. Because literal translation matches only words, it is not hard to find situations in which we should not use this technique.  Because a...

  7. Translation Ambiguity but Not Word Class Predicts Translation Performance

    Science.gov (United States)

    Prior, Anat; Kroll, Judith F.; Macwhinney, Brian

    2013-01-01

    We investigated the influence of word class and translation ambiguity on cross-linguistic representation and processing. Bilingual speakers of English and Spanish performed translation production and translation recognition tasks on nouns and verbs in both languages. Words either had a single translation or more than one translation. Translation…

  8. Examining English-German Translation Ambiguity Using Primed Translation Recognition

    Science.gov (United States)

    Eddington, Chelsea M.; Tokowicz, Natasha

    2013-01-01

    Many words have more than one translation across languages. Such "translation-ambiguous" words are translated more slowly and less accurately than their unambiguous counterparts. We examine the extent to which word context and translation dominance influence the processing of translation-ambiguous words. We further examine how these factors…

  9. A GRAMMATICAL ADJUSTMENT ANALYSIS OF STATISTICAL MACHINE TRANSLATION METHOD USED BY GOOGLE TRANSLATE COMPARED TO HUMAN TRANSLATION IN TRANSLATING ENGLISH TEXT TO INDONESIAN

    Directory of Open Access Journals (Sweden)

    Eko Pujianto

    2017-04-01

    Full Text Available Google translate is a program which provides fast, free and effortless translating service. This service uses a unique method to translate. The system is called ―Statistical Machine Translation‖, the newest method in automatic translation. Machine translation (MT is an area of many kinds of different subjects of study and technique from linguistics, computers science, artificial intelligent (AI, translation theory, and statistics. SMT works by using statistical methods and mathematics to process the training data. The training data is corpus-based. It is a compilation of sentences and words of the languages (SL and TL from translation done by human. By using this method, Google let their machine discovers the rules for themselves. They do this by analyzing millions of documents that have already been translated by human translators and then generate the result based on the corpus/training data. However, questions arise when the results of the automatic translation prove to be unreliable in some extent. This paper questions the dependability of Google translate in comparison with grammatical adjustment that naturally characterizes human translators' specific advantage. The attempt is manifested through the analysis of the TL of some texts translated by the SMT. It is expected that by using the sample of TL produced by SMT we can learn the potential flaws of the translation. If such exists, the partial of more substantial undependability of SMT may open more windows to the debates of whether this service may suffice the users‘ need.

  10. Validation of the PHEEM instrument in a Danish hospital setting

    DEFF Research Database (Denmark)

    Aspegren, Knut; Bastholt, Lars; Bested, K.M.

    2007-01-01

    The Postgraduate Hospital Educational Environment Measure (PHEEM) has been translated into Danish and then validated with good internal consistency by 342 Danish junior and senior hospital doctors. Four of the 40 items are culturally dependent in the Danish hospital setting. Factor analysis...... demonstrated that seven items are interconnected. This information can be used to shorten the instrument by perhaps another three items...

  11. APPLIED ASPECTS OF SLCO1B1 PHARMACOGENETIC TESTING FOR PREDICTING OF STATIN-INDUCED MYOPATHY AND PERSONALIZATION OF STATINS THERAPY

    Directory of Open Access Journals (Sweden)

    D. A. Sychev

    2015-09-01

    Full Text Available The clinical significance of the SLCO1B1 gene polymorphism (encoding an organic anion transport polipeptide in the development of statin induced myopathy is considered. Possible tactics of statin dose determination on the basis of pharmacogenetic testing is discussed. Indications for the use of this approach in clinical practice that should increase the efficacy and safety of the statin therapy are also considered.

  12. Translation-coupling systems

    Science.gov (United States)

    Pfleger, Brian; Mendez-Perez, Daniel

    2013-11-05

    Disclosed are systems and methods for coupling translation of a target gene to a detectable response gene. A version of the invention includes a translation-coupling cassette. The translation-coupling cassette includes a target gene, a response gene, a response-gene translation control element, and a secondary structure-forming sequence that reversibly forms a secondary structure masking the response-gene translation control element. Masking of the response-gene translation control element inhibits translation of the response gene. Full translation of the target gene results in unfolding of the secondary structure and consequent translation of the response gene. Translation of the target gene is determined by detecting presence of the response-gene protein product. The invention further includes RNA transcripts of the translation-coupling cassettes, vectors comprising the translation-coupling cassettes, hosts comprising the translation-coupling cassettes, methods of using the translation-coupling cassettes, and gene products produced with the translation-coupling cassettes.

  13. Genetics Home Reference: TK2-related mitochondrial DNA depletion syndrome, myopathic form

    Science.gov (United States)

    ... Additional NIH Resources (1 link) National Institute of Neurological Disorders and Stroke: Mitochondrial Myopathies Information Page Educational Resources (10 links) Boston Children's Hospital: Muscle Weakness Cincinnati Children's Hospital: Mitochondrial Diseases ...

  14. The Role of Semantics in Translation Recognition: Effects of Number of Translations, Dominance of Translations and Semantic Relatedness of Multiple Translations

    Science.gov (United States)

    Laxen, Jannika; Lavaur, Jean-Marc

    2010-01-01

    This study aims to examine the influence of multiple translations of a word on bilingual processing in three translation recognition experiments during which French-English bilinguals had to decide whether two words were translations of each other or not. In the first experiment, words with only one translation were recognized as translations…

  15. Masseter muscle myofibrillar protein synthesis and degradation in an experimental critical illness myopathy model.

    Directory of Open Access Journals (Sweden)

    Hazem Akkad

    Full Text Available Critical illness myopathy (CIM is a debilitating common consequence of modern intensive care, characterized by severe muscle wasting, weakness and a decreased myosin/actin (M/A ratio. Limb/trunk muscles are primarily affected by this myopathy while cranial nerve innervated muscles are spared or less affected, but the mechanisms underlying these muscle-specific differences remain unknown. In this time-resolved study, the cranial nerve innervated masseter muscle was studied in a unique experimental rat intensive care unit (ICU model, where animals were exposed to sedation, neuromuscular blockade (NMB, mechanical ventilation, and immobilization for durations varying between 6 h and 14d. Gel electrophoresis, immunoblotting, RT-PCR and morphological staining techniques were used to analyze M/A ratios, myofiber size, synthesis and degradation of myofibrillar proteins, and levels of heat shock proteins (HSPs. Results obtained in the masseter muscle were compared with previous observations in experimental and clinical studies of limb muscles. Significant muscle-specific differences were observed, i.e., in the masseter, the decline in M/A ratio and muscle fiber size was small and delayed. Furthermore, transcriptional regulation of myosin and actin synthesis was maintained, and Akt phosphorylation was only briefly reduced. In studied degradation pathways, only mRNA, but not protein levels of MuRF1, atrogin-1 and the autophagy marker LC3b were activated by the ICU condition. The matrix metalloproteinase MMP-2 was inhibited and protective HSPs were up-regulated early. These results confirm that the cranial nerve innervated masticatory muscles is less affected by the ICU-stress response than limb muscles, in accordance with clinical observation in ICU patients with CIM, supporting the model' credibility as a valid CIM model.

  16. X-linked Myotubular Myopathy with a Novel MTM1 Mutation in a Taiwanese Child

    Directory of Open Access Journals (Sweden)

    Chia-Ying Chang

    2008-12-01

    Full Text Available We report a male, preterm newborn infant with X-linked myotubular myopathy, the most severe type of the disease. He presented at birth with generalized hypotonia, difficulty in swallowing, and respiratory distress with frequent episodes of atelectasis. The infant had a long thin face, generalized hypotonia, and arachnodactyly. Diagnosis was based on fetal history, muscle histopathology, electron microscopy and a genetic study. A base pair change was detected in exon 11 of the MTM1 gene: c.1160C > A, which caused an amino acid change, p.S387Y. The father's gene was normal but the mother had the same mutation as her son and was thus a carrier.

  17. PERSONALITY TYPE AND TRANSLATION PERFORMANCE OF PERSIAN TRANSLATOR TRAINEES

    Directory of Open Access Journals (Sweden)

    Reza Shaki

    2017-09-01

    Full Text Available The study investigated the relationship between the personality typology of a sample of Iranian translation students and their translation quality in terms of expressive, appellative, and informative text types. The study also attempted to identify the personality types that can perform better in English to Persian translation of the three text types. For that purpose, the personality type and the translation quality of the participants was assessed using Myers-Briggs Type Indicator (MBTI personality test and translation quality assessment (TQA, respectively. The analysis of the data revealed that the personality type of the participants seemed relevant to the translation quality of all the text types. The translation quality of the participants with intuitive and thinking types was significantly better than the sensing type counterparts in translating expressive texts. The participants with intuitive and feeling types also performed better than their counterparts with sensing type in translation of the informative text. Moreover, the participants with intuitive, feeling, and thinking personality types performed more successfully than the participants with sensing type in translation of the appellative text. The findings of the study are discussed in light of the existing research literature.

  18. Myopathy in CRPS-I: disuse or neurogenic?

    Science.gov (United States)

    Hulsman, Natalie M; Geertzen, Jan H B; Dijkstra, Pieter U; van den Dungen, Jan J A M; den Dunnen, Wilfred F A

    2009-08-01

    The diagnosis Complex Regional Pain Syndrome type I (CRPS-I) is based on clinical symptoms, including motor symptoms. Histological changes in muscle tissue may be present in the chronic phase of CRPS-I. Aim of this study was to analyze skeletal muscle tissue from amputated limbs of patients with CRPS-I, in order to gain more insight in factors that may play a role in changes in muscles in CRPS-I. These changes may be helpful in clarifying the pathophysiology of CRPS-I. Fourteen patients with therapy resistant and longstanding CRPS-I, underwent an amputation of the affected limb. In all patients histological analysis showed extensive changes in muscle tissue, such as fatty degeneration, fibre atrophy and nuclear clumping, which was not related to duration of CRPS-I prior to amputation. In all muscles affected, both type 1 and type 2 fibre atrophy was found, without selective type 2 fibre atrophy. In four patients, type grouping was observed, indicating a sequence of denervation and reinnervation of muscle tissue. In two patients even large group atrophy was present, suggesting new denervation after reinnervation. Comparison between subgroups in arms and legs showed no difference in the number of changes in muscle tissue. Intrinsic and extrinsic muscles were affected equally. Our findings show that in the chronic phase of CRPS-I extensive changes can be seen in muscle tissue, not related to duration of CRPS-I symptoms. Signs of neurogenic myopathy were present in five patients.

  19. Insulin Resistance and Increased Muscle Cytokine Levels in Patients With Mitochondrial Myopathy

    DEFF Research Database (Denmark)

    Rue, Nana; Vissing, John; Galbo, Henrik

    2014-01-01

    CONTEXT: Mitochondrial dysfunction has been proposed to cause insulin resistance and that might stimulate cytokine production. OBJECTIVE: The objective of the study was to elucidate the association between mitochondrial myopathy, insulin sensitivity, and cytokine levels in muscle. DESIGN......: The intervention included a 120-minute hyperinsulinemic, euglycemic clamp. Another morning, microdialysis of both vastus lateralis muscles for 4 hours, including one-legged, knee extension exercise for 30 minutes, was performed. MAIN OUTCOME MEASURES: Glucose infusion rate during 90-120 minutes of insulin infusion...... was measured. Cytokine concentrations in dialysate were also measured. RESULTS: Muscle strength, percentage fat mass, and creatine kinase in plasma did not differ between groups. The maximal oxygen uptake was 21 ± 3 (SE) (P) and 36 ± 3(C) mL/kg·min (2P insulin, C-peptide, and glucagon were higher...

  20. Clinical pathological and genetic analysis of 2 cases of mitochondrial myopathy presented as acute motor axonal neuropathy

    Directory of Open Access Journals (Sweden)

    Hou-min YIN

    2014-06-01

    Full Text Available Background The main clinical manifestations of mitochondrial myopathy are chronic limb weakness and muscular soreness. Subclinical peripheral nerve injury is also reported, but acute axonal neuropathy.like syndrome concurrent with lactic acidosis is rare. In this paper the clinical features of 2 patients presenting as acute lactic acidosis and sudden muscle weakness were analyzed. Pathological changes and genetic mutations were detected.  Methods Electromyography (EMG and muscle biopsy were performed. Modified Gomori trichrome (MGT and succinodehydrogenase (SDH staining were used to identify pathological changes. Changes of ultra microstructure of muscular tissue were observed under electron microscope. Mitochondrial DNA (mtDNA full length sequencing was performed using 24 pairs of partially overlapping primers.  Results EMG showed a coexistence of neurogenic and myogenic changes. Dramatic decrease of motor nerve amplitude and moderately reduced sensory nerve amplitude were observed but nerve conduction velocity was normal in both patients. Impressive ragged red fibers were seen on MGT staining. Electron microscope showed dramatic mitochondrial abnormalities in Case 1 and paracrystaline inclusions in Case 2. mtDNA sequencing showed 3243A > G mutation in Case 1 and 8344A > G mutation in Case 2. Conclusions Mitochondrial myopathy can present as metabolic crisis like acute lactic acidosis, dyspnea and acute motor axonal neuropathy.like syndrome. It is a life.threatening phenotype that needs more attention. doi: 10.3969/j.issn.1672-6731.2014.06.007

  1. Hypoglycin A concentrations in seeds of Acer pseudoplatanus trees growing on atypical myopathy-affected and control pastures.

    Science.gov (United States)

    Unger, L; Nicholson, A; Jewitt, E M; Gerber, V; Hegeman, A; Sweetman, L; Valberg, S

    2014-01-01

    Hypoglycin A, found in seeds of Acer negundo, appears to cause seasonal pasture myopathy (SPM) in North America and is implicated in atypical myopathy (AM) in Europe. Acer negundo is uncommon in Europe. Thus, the potential source of hypoglycin A in Europe is unknown. We hypothesized that seeds of Acer pseudoplatanus were the source of hypoglycin A in Europe. Our objective was to determine the concentration of hypoglycin A in seeds of A. pseudoplatanus trees located in pastures where previous cases of AM had occurred. None. University of Berne records were searched to retrospectively identify 6 farms with 10 AM cases and 11 suspected AM deaths between 2007 and 2011. During October 2012, A. pseudoplatanus seeds were collected from 2 to 6 trees per pasture on 6 AM farms (7 pastures) from trees in or close to 2 pastures on 2 control farms where AM had not been previously reported. Hypoglycin A in seeds was analyzed by GC-MS. Acer pseudoplatanus trees were identified on all AM pastures. Hypoglycin A was detected in all A. pseudoplatanus seeds in highly variable concentrations ranging from 0.04 to 2.81 μg/mg (mean 0.69) on AM farms and 0.10 to 9.12 μg/mg (mean 1.59) on control farms. Preventing horses from grazing pastures containing A. pseudoplatanus seeds during late fall and early spring might be the best means to prevent AM. Copyright © 2014 by the American College of Veterinary Internal Medicine.

  2. A GYS1 gene mutation is highly associated with polysaccharide storage myopathy in Cob Normand draught horses.

    Science.gov (United States)

    Herszberg, B; McCue, M E; Larcher, T; Mata, X; Vaiman, A; Chaffaux, S; Chérel, Y; Valberg, S J; Mickelson, J R; Guérin, G

    2009-02-01

    Glycogen storage diseases or glycogenoses are inherited diseases caused by abnormalities of enzymes that regulate the synthesis or degradation of glycogen. Deleterious mutations in many genes of the glyco(geno)lytic or the glycogenesis pathways can potentially cause a glycogenosis, and currently mutations in fourteen different genes are known to cause animal or human glycogenoses, resulting in myopathies and/or hepatic disorders. The genetic bases of two forms of glycogenosis are currently known in horses. A fatal neonatal polysystemic type IV glycogenosis, inherited recessively in affected Quarter Horse foals, is due to a mutation in the glycogen branching enzyme gene (GBE1). A second type of glycogenosis, termed polysaccharide storage myopathy (PSSM), is observed in adult Quarter Horses and other breeds. A severe form of PSSM also occurs in draught horses. A mutation in the skeletal muscle glycogen synthase gene (GYS1) was recently reported to be highly associated with PSSM in Quarter Horses and Belgian draught horses. This GYS1 point mutation appears to cause a gain-of-function of the enzyme and to result in the accumulation of a glycogen-like, less-branched polysaccharide in skeletal muscle. It is inherited as a dominant trait. The aim of this work was to test for possible associations between genetic polymorphisms in four candidate genes of the glycogen pathway or the GYS1 mutation in Cob Normand draught horses diagnosed with PSSM by muscle biopsy.

  3. Communication, Translation and the Global Community of Persons

    Directory of Open Access Journals (Sweden)

    Dries Deweer

    2015-07-01

    Full Text Available Paul Ricœur shared Emmanuel Mounier’s personalist and communitarian ideal of a universal community, which ensures that every human being has access to the conditions for self-development as a person. Whereas Mounier talks about communication as the structure of personhood that summons us towards the gradual enlargement of the community, Ricœur’s reflections on translation provide a missing link by referring, not just to the human capacity to communicate, but more specifically, to our capacity to translate and the implied ethics of linguistic hospitality. This allowed him to show that what enables us to enlarge the circle of brotherhood is the capacity to gradually settle in the world of the other and to welcome the other into one’s own world.

  4. Role of TGF-β signaling in inherited and acquired myopathies

    Directory of Open Access Journals (Sweden)

    Burks Tyesha N

    2011-05-01

    Full Text Available Abstract The transforming growth factor-beta (TGF-β superfamily consists of a variety of cytokines expressed in many different cell types including skeletal muscle. Members of this superfamily that are of particular importance in skeletal muscle are TGF-β1, mitogen-activated protein kinases (MAPKs, and myostatin. These signaling molecules play important roles in skeletal muscle homeostasis and in a variety of inherited and acquired neuromuscular disorders. Expression of these molecules is linked to normal processes in skeletal muscle such as growth, differentiation, regeneration, and stress response. However, chronic elevation of TGF-β1, MAPKs, and myostatin is linked to various features of muscle pathology, including impaired regeneration and atrophy. In this review, we focus on the aberrant signaling of TGF-β in various disorders such as Marfan syndrome, muscular dystrophies, sarcopenia, and critical illness myopathy. We also discuss how the inhibition of several members of the TGF-β signaling pathway has been implicated in ameliorating disease phenotypes, opening up novel therapeutic avenues for a large group of neuromuscular disorders.

  5. Quantitative nailfold video capillaroscopy in patients with idiopathic inflammatory myopathy.

    Science.gov (United States)

    Mercer, Louise K; Moore, Tonia L; Chinoy, Hector; Murray, Andrea K; Vail, Andy; Cooper, Robert G; Herrick, Ariane L

    2010-09-01

    To quantify nailfold capillary density and dimensions in patients with idiopathic inflammatory myopathy (IIM) and compare them with those in healthy controls; to look for associations with microvascular disease in IIM; and to determine whether nailfold capillary density and dimensions change over time. Nailfold video microscopy (x300 magnification) was performed on 24 patients with IIM and 35 healthy controls. Capillary density and dimensions (total width and apical width) were quantified. Patients were clinically assessed and disease activity recorded using the Myositis Disease Activity Assessment Tool. Disease severity and physical function were assessed using the myositis damage index and Stanford HAQ, respectively. Findings were analysed using linear and logistic regression, adjusted for age and sex. In a subgroup of 16 patients with IIM and 27 controls, the process was repeated 6-12 months later and the results were analysed using Student's t-test. Capillary density was lower and dimensions were higher in patients with IIM compared with healthy controls (P nailfold capillaroscopy, suggesting that nailfold capillaroscopy may be useful as an outcome measure of microvascular disease in studies of IIM.

  6. Pauses by Student and Professional Translators in Translation Process

    Directory of Open Access Journals (Sweden)

    Rusdi Noor Rosa

    2018-01-01

    Full Text Available Translation as a process of meaning making activity requires a cognitive process one of which is realized in a pause, a temporary stop or a break indicating doing other than typing activities in a certain period of translation process. Scholars agree that pauses are an indicator of cognitive process without which there will never be any translation practices. Despite such agreement, pauses are debatable as well, either in terms of their length or in terms of the activities managed by a translator while taking pauses. This study, in particular, aims at finding out how student translators and professional translators managed the pauses in a translation process. This was a descriptive research taking two student translators and two professional translators as the participants who were asked to translate a text from English into bahasa Indonesia. The source text (ST was a historical recount text entitled ‘Early History of Yellowstone National Park’ downloaded from http://www.nezperce.com/yelpark9.html composed of 230-word long from English into bahasa Indonesia. The data were collected using Translog protocols, think aloud protocols (TAPs and screen recording. Based on the data analysis, it was found that student translators took the longest pauses in the drafting phase spent to solve the problems related to finding out the right equivalent for the ST words or terms and to solve the difficulties encountered in encoding their ST understanding in the TL; meanwhile, professional translators took the longest pauses in the pos-drafting phase spent to ensure whether their TT had been natural and whether their TT had corresponded to the prevailing grammatical rules of the TL.

  7. Machine translation

    Energy Technology Data Exchange (ETDEWEB)

    Nagao, M

    1982-04-01

    Each language has its own structure. In translating one language into another one, language attributes and grammatical interpretation must be defined in an unambiguous form. In order to parse a sentence, it is necessary to recognize its structure. A so-called context-free grammar can help in this respect for machine translation and machine-aided translation. Problems to be solved in studying machine translation are taken up in the paper, which discusses subjects for semantics and for syntactic analysis and translation software. 14 references.

  8. Exertional myopathy in a grizzly bear (Ursus arctos) captured by leghold snare.

    Science.gov (United States)

    Cattet, Marc; Stenhouse, Gordon; Bollinger, Trent

    2008-10-01

    We diagnosed exertional myopathy (EM) in a grizzly bear (Ursus arctos) that died approximately 10 days after capture by leghold snare in west-central Alberta, Canada, in June 2003. The diagnosis was based on history, post-capture movement data, gross necropsy, histopathology, and serum enzyme levels. We were unable to determine whether EM was the primary cause of death because autolysis precluded accurate evaluation of all tissues. Nevertheless, comparison of serum aspartate aminotransferase and creatine kinase concentrations and survival between the affected bear and other grizzly bears captured by leghold snare in the same research project suggests EM also occurred in other bears, but that it is not generally a cause of mortality. We propose, however, occurrence of nonfatal EM in grizzly bears after capture by leghold snare has potential implications for use of this capture method, including negative effects on wildlife welfare and research data.

  9. Rimmed vacuoles in Becker muscular dystrophy have similar features with inclusion myopathies.

    Science.gov (United States)

    Momma, Kazunari; Noguchi, Satoru; Malicdan, May Christine V; Hayashi, Yukiko K; Minami, Narihiro; Kamakura, Keiko; Nonaka, Ikuya; Nishino, Ichizo

    2012-01-01

    Rimmed vacuoles in myofibers are thought to be due to the accumulation of autophagic vacuoles, and can be characteristic in certain myopathies with protein inclusions in myofibers. In this study, we performed a detailed clinical, molecular, and pathological characterization of Becker muscular dystrophy patients who have rimmed vacuoles in muscles. Among 65 Becker muscular dystrophy patients, we identified 12 patients who have rimmed vacuoles and 11 patients who have deletions in exons 45-48 in DMD gene. All patients having rimmed vacuoles showed milder clinical features compared to those without rimmed vacuoles. Interestingly, the rimmed vacuoles in Becker muscular dystrophy muscles seem to represent autophagic vacuoles and are also associated with polyubiquitinated protein aggregates. These findings support the notion that rimmed vacuoles can appear in Becker muscular dystrophy, and may be related to the chronic changes in muscle pathology induced by certain mutations in the DMD gene.

  10. Rimmed vacuoles in Becker muscular dystrophy have similar features with inclusion myopathies.

    Directory of Open Access Journals (Sweden)

    Kazunari Momma

    Full Text Available Rimmed vacuoles in myofibers are thought to be due to the accumulation of autophagic vacuoles, and can be characteristic in certain myopathies with protein inclusions in myofibers. In this study, we performed a detailed clinical, molecular, and pathological characterization of Becker muscular dystrophy patients who have rimmed vacuoles in muscles. Among 65 Becker muscular dystrophy patients, we identified 12 patients who have rimmed vacuoles and 11 patients who have deletions in exons 45-48 in DMD gene. All patients having rimmed vacuoles showed milder clinical features compared to those without rimmed vacuoles. Interestingly, the rimmed vacuoles in Becker muscular dystrophy muscles seem to represent autophagic vacuoles and are also associated with polyubiquitinated protein aggregates. These findings support the notion that rimmed vacuoles can appear in Becker muscular dystrophy, and may be related to the chronic changes in muscle pathology induced by certain mutations in the DMD gene.

  11. Mutations in the satellite cell gene MEGF10 cause a recessive congenital myopathy with minicores.

    Science.gov (United States)

    Boyden, Steven E; Mahoney, Lane J; Kawahara, Genri; Myers, Jennifer A; Mitsuhashi, Satomi; Estrella, Elicia A; Duncan, Anna R; Dey, Friederike; DeChene, Elizabeth T; Blasko-Goehringer, Jessica M; Bönnemann, Carsten G; Darras, Basil T; Mendell, Jerry R; Lidov, Hart G W; Nishino, Ichizo; Beggs, Alan H; Kunkel, Louis M; Kang, Peter B

    2012-05-01

    We ascertained a nuclear family in which three of four siblings were affected with an unclassified autosomal recessive myopathy characterized by severe weakness, respiratory impairment, scoliosis, joint contractures, and an unusual combination of dystrophic and myopathic features on muscle biopsy. Whole genome sequence from one affected subject was filtered using linkage data and variant databases. A single gene, MEGF10, contained nonsynonymous mutations that co-segregated with the phenotype. Affected subjects were compound heterozygous for missense mutations c.976T > C (p.C326R) and c.2320T > C (p.C774R). Screening the MEGF10 open reading frame in 190 patients with genetically unexplained myopathies revealed a heterozygous mutation, c.211C > T (p.R71W), in one additional subject with a similar clinical and histological presentation as the discovery family. All three mutations were absent from at least 645 genotyped unaffected control subjects. MEGF10 contains 17 atypical epidermal growth factor-like domains, each of which contains eight cysteine residues that likely form disulfide bonds. Both the p.C326R and p.C774R mutations alter one of these residues, which are completely conserved in vertebrates. Previous work showed that murine Megf10 is required for preserving the undifferentiated, proliferative potential of satellite cells, myogenic precursors that regenerate skeletal muscle in response to injury or disease. Here, knockdown of megf10 in zebrafish by four different morpholinos resulted in abnormal phenotypes including unhatched eggs, curved tails, impaired motility, and disorganized muscle tissue, corroborating the pathogenicity of the human mutations. Our data establish the importance of MEGF10 in human skeletal muscle and suggest satellite cell dysfunction as a novel myopathic mechanism.

  12. Translating Inclusion

    DEFF Research Database (Denmark)

    Fallov, Mia Arp; Birk, Rasmus

    2018-01-01

    The purpose of this paper is to explore how practices of translation shape particular paths of inclusion for people living in marginalized residential areas in Denmark. Inclusion, we argue, is not an end-state, but rather something which must be constantly performed. Active citizenship, today......, is not merely a question of participation, but of learning to become active in all spheres of life. The paper draws on empirical examples from a multi-sited field work in 6 different sites of local community work in Denmark, to demonstrate how different dimensions of translation are involved in shaping active...... citizenship. We propose the following different dimensions of translation: translating authority, translating language, translating social problems. The paper takes its theoretical point of departure from assemblage urbanism, arguing that cities are heterogeneous assemblages of socio-material interactions...

  13. Measuring the nursing work environment: translation and psychometric evaluation of the Essentials of Magnetism.

    Science.gov (United States)

    de Brouwer, B J M; Kaljouw, M J; Kramer, M; Schmalenberg, C; van Achterberg, T

    2014-03-01

    Translate the Essentials of Magnetism II© (EOMII; Dutch Nurses' Association, Utrecht, The Netherlands) and assess its psychometric properties in a culture different from its origin. The EOMII, developed in the USA, measures the extent to which organizations/units provide healthy, productive and satisfying work environments. As many healthcare organizations are facing difficulties in attracting and retaining staff nurses, the EOMII provides the opportunity to assess the health and effectiveness of work environments. A three-phased (respectively N = 13, N = 74 and N = 2542) combined descriptive and correlational design was undertaken for translation and evaluation validity and psychometric qualities of the EOMII for Dutch hospitals (December 2009-January 2010). We performed forward-backward translation, face and content validation via cross-sectional survey research, and semi-structured interviews on relevance, clarity, and recognizability of instruments' items. Psychometric testing included principal component analysis using varimax rotation, item-total statistics, and reliability in terms of internal consistency (Cronbach's α) for the total scale and its subscales. Face validity was confirmed. Items were recognizable, relevant and clear. Confirmatory factor analysis indicated that five of eight subscales formed clear factors. Three original subscales contained two factors. Item-total correlations ranged from 0.43 to 0.83. One item correlated weakly (0.24) with its subscale. Cronbach's α for the entire scale was 0.92 and ranged from 0.58 to 0.92 for eight subscales. Dutch-translated EOMII (D-EOMII) demonstrated acceptable reliability and validity for assessing hospital staff nurses' work environment. The D-EOMII can be useful and effective in identifying areas in which change is needed for a hospital to pursue an excellent work environment that attracts and retains well-qualified nurses. © 2013 International Council of Nurses.

  14. Mitochondrial aminoacyl-tRNA synthetase single-nucleotide polymorphisms that lead to defects in refolding but not aminoacylation

    DEFF Research Database (Denmark)

    Banerjee, Rajat; Reynolds, Noah M; Yadavalli, Srujana S

    2011-01-01

    Defects in organellar translation are the underlying cause of a number of mitochondrial diseases, including diabetes, deafness, encephalopathy, and other mitochondrial myopathies. The most common causes of these diseases are mutations in mitochondria-encoded tRNAs. It has recently become apparent...

  15. Efficient and reproducible myogenic differentiation from human iPS cells: prospects for modeling Miyoshi Myopathy in vitro.

    Directory of Open Access Journals (Sweden)

    Akihito Tanaka

    Full Text Available The establishment of human induced pluripotent stem cells (hiPSCs has enabled the production of in vitro, patient-specific cell models of human disease. In vitro recreation of disease pathology from patient-derived hiPSCs depends on efficient differentiation protocols producing relevant adult cell types. However, myogenic differentiation of hiPSCs has faced obstacles, namely, low efficiency and/or poor reproducibility. Here, we report the rapid, efficient, and reproducible differentiation of hiPSCs into mature myocytes. We demonstrated that inducible expression of myogenic differentiation1 (MYOD1 in immature hiPSCs for at least 5 days drives cells along the myogenic lineage, with efficiencies reaching 70-90%. Myogenic differentiation driven by MYOD1 occurred even in immature, almost completely undifferentiated hiPSCs, without mesodermal transition. Myocytes induced in this manner reach maturity within 2 weeks of differentiation as assessed by marker gene expression and functional properties, including in vitro and in vivo cell fusion and twitching in response to electrical stimulation. Miyoshi Myopathy (MM is a congenital distal myopathy caused by defective muscle membrane repair due to mutations in DYSFERLIN. Using our induced differentiation technique, we successfully recreated the pathological condition of MM in vitro, demonstrating defective membrane repair in hiPSC-derived myotubes from an MM patient and phenotypic rescue by expression of full-length DYSFERLIN (DYSF. These findings not only facilitate the pathological investigation of MM, but could potentially be applied in modeling of other human muscular diseases by using patient-derived hiPSCs.

  16. Efficient and Reproducible Myogenic Differentiation from Human iPS Cells: Prospects for Modeling Miyoshi Myopathy In Vitro

    Science.gov (United States)

    Tanaka, Akihito; Woltjen, Knut; Miyake, Katsuya; Hotta, Akitsu; Ikeya, Makoto; Yamamoto, Takuya; Nishino, Tokiko; Shoji, Emi; Sehara-Fujisawa, Atsuko; Manabe, Yasuko; Fujii, Nobuharu; Hanaoka, Kazunori; Era, Takumi; Yamashita, Satoshi; Isobe, Ken-ichi; Kimura, En; Sakurai, Hidetoshi

    2013-01-01

    The establishment of human induced pluripotent stem cells (hiPSCs) has enabled the production of in vitro, patient-specific cell models of human disease. In vitro recreation of disease pathology from patient-derived hiPSCs depends on efficient differentiation protocols producing relevant adult cell types. However, myogenic differentiation of hiPSCs has faced obstacles, namely, low efficiency and/or poor reproducibility. Here, we report the rapid, efficient, and reproducible differentiation of hiPSCs into mature myocytes. We demonstrated that inducible expression of myogenic differentiation1 (MYOD1) in immature hiPSCs for at least 5 days drives cells along the myogenic lineage, with efficiencies reaching 70–90%. Myogenic differentiation driven by MYOD1 occurred even in immature, almost completely undifferentiated hiPSCs, without mesodermal transition. Myocytes induced in this manner reach maturity within 2 weeks of differentiation as assessed by marker gene expression and functional properties, including in vitro and in vivo cell fusion and twitching in response to electrical stimulation. Miyoshi Myopathy (MM) is a congenital distal myopathy caused by defective muscle membrane repair due to mutations in DYSFERLIN. Using our induced differentiation technique, we successfully recreated the pathological condition of MM in vitro, demonstrating defective membrane repair in hiPSC-derived myotubes from an MM patient and phenotypic rescue by expression of full-length DYSFERLIN (DYSF). These findings not only facilitate the pathological investigation of MM, but could potentially be applied in modeling of other human muscular diseases by using patient-derived hiPSCs. PMID:23626698

  17. Translation and Culture:Translation as a Cross-cultural Mediation

    Institute of Scientific and Technical Information of China (English)

    叶谋锦

    2013-01-01

    Translation is a complex activity which involves language competence as well as proficiency in multiculturalism. From the perspective of multiculturalism, translation resembles recreation of source text by grasping essential meanings to produce a sub-tle target text which can be clearly perceived by target readers. Ignoring cultural issues can present serious mistranslations in the field of advertising translation. This paper aims to explore the significance of connotation confined by the framework of culture and point out that verbal translation is a dangerous inclination by illustrating three business examples. This paper argues that cross-cultural mediation plays an important role in translation.

  18. Anti-HMGCR antibodies as a biomarker for immune-mediated necrotizing myopathies: A history of statins and experience from a large international multi-center study.

    Science.gov (United States)

    Musset, Lucile; Allenbach, Yves; Benveniste, Olivier; Boyer, Olivier; Bossuyt, Xavier; Bentow, Chelsea; Phillips, Joe; Mammen, Andrew; Van Damme, Philip; Westhovens, René; Ghirardello, Anna; Doria, Andrea; Choi, May Y; Fritzler, Marvin J; Schmeling, Heinrike; Muro, Yoshinao; García-De La Torre, Ignacio; Ortiz-Villalvazo, Miguel A; Bizzaro, Nicola; Infantino, Maria; Imbastaro, Tiziana; Peng, Qinglin; Wang, Guochun; Vencovský, Jiří; Klein, Martin; Krystufkova, Olga; Franceschini, Franco; Fredi, Micaela; Hue, Sophie; Belmondo, Thibaut; Danko, Katalin; Mahler, Michael

    2016-10-01

    In an effort to find naturally occurring substances that reduce cholesterol by inhibiting 3-hydroxy-3-methylglutaryl-coenzyme A reductase (HMGCR), statins were first discovered by Endo in 1972. With the widespread prescription and use of statins to decrease morbidity from myocardial infarction and stroke, it was noted that approximately 5% of all statin users experienced muscle pain and weakness during treatment. In a smaller proportion of patients, the myopathy progressed to severe morbidity marked by proximal weakness and severe muscle wasting. Remarkably, Mammen and colleagues were the first to discover that the molecular target of statins, 3-hydroxy-3-methylglutaryl coenzyme A reductase (HMGCR), is an autoantibody target in patients that develop an immune-mediated necrotizing myopathy (IMNM). These observations have been confirmed in a number of studies but, until today, a multi-center, international study of IMNM, related idiopathic inflammatory myopathies (IIM), other auto-inflammatory conditions and controls has not been published. Accordingly, an international, multi-center study investigated the utility of anti-HMGCR antibodies in the diagnosis of statin-associated IMNM in comparison to different forms of IIM and controls. This study included samples from patients with different forms of IIM (n=1250) and patients with other diseases (n=656) that were collected from twelve sites and tested for anti-HMGCR antibodies by ELISA. This study confirmed that anti-HMGCR autoantibodies, when found in conjunction with statin use, characterize a subset of IIM who are older and have necrosis on muscle biopsy. Taken together, the data to date indicates that testing for anti-HMGCR antibodies is important in the differential diagnosis of IIM and might be considered for future classification criteria. Copyright © 2016. Published by Elsevier B.V.

  19. What language is your doctor speaking? Facing the problems of translating medical documents into English

    Directory of Open Access Journals (Sweden)

    Mićović Dragoslava

    2013-01-01

    Full Text Available What is translation - a craft, an art, a profession or a job? Although one of the oldest human activities, translation has not still been fully defined, and it is still young in terms of an academic discipline. The paper defines the difference between translation and interpreting and then attempts to find the answer to the question what characteristics, knowledge and skills a translator must have, particularly the one involved in court translation, and where his/her place in the communication process (both written and oral communication is. When translating medical documentation, a translator is set within a medical language environment as an intermediary between two doctors (in other words, two professionals in the process of communication which would be impossible without him, since it is conducted in two different languages. The paper also gives an insight into types of medical documentation and who they are intended for. It gives practical examples of the problems faced in the course of translation of certain types of medical documentation (hospital discharge papers, diagnoses, case reports,.... Is it possible to make this kind of communication between professionals (doctors standardized, which would subsequently make their translation easier? Although great efforts are made in Serbia regarding medical language and medical terminology, the conclusion is that specific problems encountered by translators can hardly be overcome using only dictionaries and translation manuals.

  20. The Effect of Translators' Emotional Intelligence on Their Translation Quality

    Science.gov (United States)

    Varzande, Mohsen; Jadidi, Esmaeil

    2015-01-01

    Translators differ from each other in many ways in terms of their knowledge, professional and psychological conditions that may directly influence their translation. The present study aimed at investigating the impact of translators' Emotional Intelligence on their translation quality. Following a "causal-comparative study," a sample of…

  1. The impact of a unique knowledge translation programme implemented in a large multisite paediatric hospital.

    Science.gov (United States)

    Christensen, Catie; Wessells, David; Byars, Michelle; Marrie, James; Coffman, Shaun; Gates, Erin; Selhorst, Mitch

    2017-04-01

    Physical therapists (PTs) display positive attitudes toward evidence-based practice (EBP), and implementing it can improve patient outcomes and reduce costs. However, barriers can lead to inconsistent use of EBP. The objectives of this manuscript are to (i) describe the initiation and revisions to a knowledge translation (KT) programme, (ii) assess staff participation in KT, and (iii) evaluate availability, internal use and external dissemination of evidence-based recommendations and research. The KT programme was implemented in a large paediatric hospital employing 66 PTs who provide services in the inpatient, outpatient developmental and sports and orthopaedics settings in 15 locations. The KT programme was initiated 9 years ago but underwent improvements over the past 3 years. Five key revisions included the subdivision of the EBP and Research Coordinator positions by area of practice, increasing the structure of the KT programme, implementing strategies to encourage use of local recommendations, obtaining leadership support to emphasize KT and providing staff education. With the revisions, staff participation in local recommendation development increased from 16.3-68.2%. Research involvement increased from 4.1-50%. The number of local recommendations increased from 1 to 9, and an overall compliance rate of 79% was achieved for the recommendations presented in an algorithm format. External dissemination increased from 1 to 44 for presentations and 0 to 7 for publications. Revisions to a KT programme improved PT engagement in KT activities, increased the availability of local recommendations, encouraged use of EBP and increased external dissemination of information. © 2016 John Wiley & Sons, Ltd.

  2. Translating India

    CERN Document Server

    Kothari, Rita

    2014-01-01

    The cultural universe of urban, English-speaking middle class in India shows signs of growing inclusiveness as far as English is concerned. This phenomenon manifests itself in increasing forms of bilingualism (combination of English and one Indian language) in everyday forms of speech - advertisement jingles, bilingual movies, signboards, and of course conversations. It is also evident in the startling prominence of Indian Writing in English and somewhat less visibly, but steadily rising, activity of English translation from Indian languages. Since the eighties this has led to a frenetic activity around English translation in India's academic and literary circles. Kothari makes this very current phenomenon her chief concern in Translating India.   The study covers aspects such as the production, reception and marketability of English translation. Through an unusually multi-disciplinary approach, this study situates English translation in India amidst local and global debates on translation, representation an...

  3. The Impact of Translators' Academic Experience on Their Translation Quality

    Science.gov (United States)

    Varzande, Mohsen; Jadidi, Esmaeil

    2015-01-01

    Translators differ from each other in many ways in terms of their knowledge and professional conditions that may directly influence their translation. The present study aimed at investigating the impact of translators' academic experience on their translation quality. Following a "causal-comparative study", a sample of 100 male and…

  4. Translating Legal Collocations in Contract Agreements by Iraqi EFL Students-Translators

    Directory of Open Access Journals (Sweden)

    Muntaha A. Abdulwahid

    2017-01-01

    Full Text Available Legal translation of contract agreements is a challenge to translators as it involves combining the literary translation with the technical terminological precision. In translating legal contract agreements, a legal translator must utilize the lexical or syntactic precision and, more importantly, the pragmatic awareness of the context. This will guarantee an overall communicative process and avoid inconsistency in legal translation. However, the inability of the translator to meet these two functions in translating the contract item not only affects the contractors’ comprehension of the contract item but also affects the parties’ contractual obligations. In light of this, the purpose of this study was to find out how legal collocations used in contract agreements are translated from Arabic into English by student-translators in terms of (1 purely technical, (2 semi-technical, and (3 everyday vocabulary collocations. For the data collection, a multiple-choice collocation test was used to be answered by 35 EFL Iraqi undergraduate translator-students to decide on the aspects of weaknesses and strengths of their translation, thus decide on the aspects of correction. The findings showed that these students had serious problems in translating legal collocations as they lack the linguistic knowledge and pragmatic awareness needed to achieve the legal meaning and effect. They were also unable to make a difference among the three categories of legal collocations, purely technical, semi-technical, and everyday vocabulary collocations. These students should be exposed to more legal translation practices to obtain the required experience needed for their future career.

  5. Translation Analysis on Civil Engineering Text Produced by Machine Translator

    Directory of Open Access Journals (Sweden)

    Sutopo Anam

    2018-01-01

    Full Text Available Translation is extremely needed in communication since people have serious problem in the language used. Translation activity is done by the person in charge for translating the material. Translation activity is also able to be done by machine. It is called machine translation, reflected in the programs developed by programmer. One of them is Transtool. Many people used Transtool for helping them in solving the problem related with translation activities. This paper wants to deliver how important is the Transtool program, how effective is Transtool program and how is the function of Transtool for human business. This study applies qualitative research. The sources of data were document and informant. This study used documentation and in dept-interviewing as the techniques for collecting data. The collected data were analyzed by using interactive analysis. The results of the study show that, first; Transtool program is helpful for people in translating the civil engineering text and it functions as the aid or helper, second; the working of Transtool software program is effective enough and third; the result of translation produced by Transtool is good for short and simple sentences and not readable, not understandable and not accurate for long sentences (compound, complex and compound complex thought the result is informative. The translated material must be edited by the professional translator.

  6. Translation Analysis on Civil Engineering Text Produced by Machine Translator

    Science.gov (United States)

    Sutopo, Anam

    2018-02-01

    Translation is extremely needed in communication since people have serious problem in the language used. Translation activity is done by the person in charge for translating the material. Translation activity is also able to be done by machine. It is called machine translation, reflected in the programs developed by programmer. One of them is Transtool. Many people used Transtool for helping them in solving the problem related with translation activities. This paper wants to deliver how important is the Transtool program, how effective is Transtool program and how is the function of Transtool for human business. This study applies qualitative research. The sources of data were document and informant. This study used documentation and in dept-interviewing as the techniques for collecting data. The collected data were analyzed by using interactive analysis. The results of the study show that, first; Transtool program is helpful for people in translating the civil engineering text and it functions as the aid or helper, second; the working of Transtool software program is effective enough and third; the result of translation produced by Transtool is good for short and simple sentences and not readable, not understandable and not accurate for long sentences (compound, complex and compound complex) thought the result is informative. The translated material must be edited by the professional translator.

  7. OCULAR ASPECTS OF HYPERTHYROIDISM WITH SPECIAL REFERENCE TO OCULAR MYOPATHY

    Directory of Open Access Journals (Sweden)

    Mallika O. U

    2017-04-01

    Full Text Available BACKGROUND Hyperthyroidism can result in ocular manifestations even before systemic signs and symptoms develop. It is seen more in females and severe forms are more common in males. Early detection of ocular involvement can prevent vision threatening complications and troublesome discomforts affecting quality of vision. This clinical study highlights the importance of detailed ocular examination in hyperthyroidism. MATERIALS AND METHODS Fifty consecutive patients with ocular signs of hyperthyroidism were evaluated and followed up for an average period of 1 year. Detailed ocular examination included exophthalmometric measurements, ocular movements and Worth four-dot test. T3, T4, TSH, CT scan and antimicrosomal antibodies and antithyroglobulin antibodies were done along with routine investigations. Study Design- Prospective cohort study. RESULTS Statistical analysis did not reveal any correlation between the level of serum T3 and severity of ocular findings. Majority of the cases were euthyroid with moderate ocular myopathy having multiple muscle involvement. Inferior rectus was affected most. CONCLUSION The ocular signs of hyperthyroidism in the present study seem to be mild. The severe eye changes like corneal involvement and optic nerve changes were less common.

  8. Neuropatia na miopatia miotubular ou centronuclear Neuropathy in myotubular or centronuclear myopathy

    Directory of Open Access Journals (Sweden)

    Roberto E. P. Sica

    1975-06-01

    Full Text Available Un estudio electrofisiológico detallado fué hecho en los músculos extensor corto de los dedos, de la eminencia tenar, de la eminencia hipotenar y soleo en un paciente con el diagnóstico de miopatía miotubular o centronuclear. El hallazgo principal fué una notoria reducción en el número de unidades motoras activas en todos los músculos investigados, en tanto que las unidades remanentes mostraron tamaño conservado. Las observaciones hechas se han interpretado como favoreciéndo la génesis neurógena en el desarrollo de este proceso.A detailed electrophysiological study has been made of the extensor digitorum brevis, thenar, hypothenar and soleus muscles in one patient with myotubular or centronuclear myopathy. The main finding was a noticeable reduction in the population of active motor units in all the investigated muscles. The remainer units showed normal sizes. The experimental observations have been interpreted in terms of a neuropathic process.

  9. A knowledge translation collaborative to improve the use of therapeutic hypothermia in post-cardiac arrest patients: protocol for a stepped wedge randomized trial.

    Science.gov (United States)

    Dainty, Katie N; Scales, Damon C; Brooks, Steve C; Needham, Dale M; Dorian, Paul; Ferguson, Niall; Rubenfeld, Gordon; Wax, Randy; Zwarenstein, Merrick; Thorpe, Kevin; Morrison, Laurie J

    2011-01-14

    Advances in resuscitation science have dramatically improved survival rates following cardiac arrest. However, about 60% of adults that regain spontaneous circulation die before leaving the hospital. Recently it has been shown that inducing hypothermia in cardiac arrest survivors immediately following their arrival in hospital can dramatically improve both overall survival and neurological outcomes. Despite the strong evidence for its efficacy and the apparent simplicity of this intervention, recent surveys show that therapeutic hypothermia is delivered inconsistently, incompletely, and often with delay. This study will evaluate a multi-faceted knowledge translation strategy designed to increase the utilization rate of induced hypothermia in survivors of cardiac arrest across a network of 37 hospitals in Southwestern Ontario, Canada. The study is designed as a stepped wedge randomized trial lasting two years. Individual hospitals will be randomly assigned to four different wedges that will receive the active knowledge translation strategy according to a sequential rollout over a number of time periods. By the end of the study, all hospitals will have received the intervention. The primary aim is to measure the effectiveness of a multifaceted knowledge translation plan involving education, reminders, and audit-feedback for improving the use of induced hypothermia in survivors of cardiac arrest presenting to the emergency department. The primary outcome is the proportion of eligible OHCA patients that are cooled to a body temperature of 32 to 34°C within six hours of arrival in the hospital. Secondary outcomes will include process of care measures and clinical outcomes. Inducing hypothermia in cardiac arrest survivors immediately following their arrival to hospital has been shown to dramatically improve both overall survival and neurological outcomes. However, this lifesaving treatment is frequently not applied in practice. If this trial is positive, our results

  10. Translation: between what can be translated and what must be translated

    Directory of Open Access Journals (Sweden)

    Magda Jeanrenaud

    2016-02-01

    Full Text Available Starting from a disconcerting interpretation of Jacques Derrida, our analysis aims at investigating and also tries to explain the blockage which appears in the English, French and Romanian translations (signed by Maurice de Gandillac, Antoine Berman, Laurent Lamy, Alexis Nouss, Harry Zohn, Steven Rendall, Martine Broda, Catrinel Pleșu etc. of a well-known text of Walter Benjamin, Die Aufgabe des Übersetzers, when translators transpose in their target languages the two quotations given by Benjamin: one of Mallarmé, left untranslated in the source text, and another, signed by Pannwitz. The fact is that both quotations have something in common: a discoursive form which results from an unusual syntax, as if they were already, in a certain sense, „translations”. As if the translators feared—a feature of the translator’s psychology?—not to render their text sufficiently accessible, even when the source text is not intended to be accessible. Hence the painful dilemma of the intentional fallacy (not only of the text to be translated.

  11. The seven common pitfalls of customer service in hospitals.

    Science.gov (United States)

    Domingo, Rene T

    2015-01-01

    Operating simultaneously like a repair shop, prison, and hotel, hospitals are prone to seven common pitfalls in customer service. Patient care is often fragmented, inscrutable, inflexible, insensitive, reactive, myopic, and unsafe. Hospitals are vying to be more high-tech, rather than high-touch even though staff engagement with patients rather than facilities and equipment strongly influence patient satisfaction. Unless processes, policies, and people are made customer-centered, the high quality of the hospital's human and hardware resources will not translate into high patient satisfaction and patient loyalty.

  12. Integrating Automatic Speech Recognition and Machine Translation for Better Translation Outputs

    DEFF Research Database (Denmark)

    Liyanapathirana, Jeevanthi

    translations, combining machine translation with computer assisted translation has drawn attention in current research. This combines two prospects: the opportunity of ensuring high quality translation along with a significant performance gain. Automatic Speech Recognition (ASR) is another important area......, which caters important functionalities in language processing and natural language understanding tasks. In this work we integrate automatic speech recognition and machine translation in parallel. We aim to avoid manual typing of possible translations as dictating the translation would take less time...... to the n-best list rescoring, we also use word graphs with the expectation of arriving at a tighter integration of ASR and MT models. Integration methods include constraining ASR models using language and translation models of MT, and vice versa. We currently develop and experiment different methods...

  13. (Con)figuring gender in Bible translation: Cultural, translational and ...

    African Journals Online (AJOL)

    The gendered intersection of cultural studies and Bible translation is under acknowledged. Accounting for gender criticism in translation work requires, besides responsible theory and practice of translation, also attention to interwoven gender critical aspects. After a brief investigation of the intersections between biblical, ...

  14. Translation and identity: Translation of the Freedom Charter into ...

    African Journals Online (AJOL)

    A comparative analysis of the Afrikaans translations reveals how the respective translators struggled sporadically through certain ideological constraints in order to provide a satisfactory narrative. Their inability to internalise the principles contained in the Freedom Charter resulted in them presenting a 'framed' translation ...

  15. Novel Homozygous Missense Mutation in RYR1 Leads to Severe Congenital Ptosis, Ophthalmoplegia, and Scoliosis in the Absence of Myopathy.

    Science.gov (United States)

    Dilaver, Nafi; Mazaheri, Neda; Maroofian, Reza; Zeighami, Jawaher; Seifi, Tahere; Zamani, Mina; Sedaghat, Alireza; Shariati, Gholam Reza; Galehdari, Hamid

    2017-12-01

    Ryanodine receptor 1 ( RYR1 ) is an intracellular calcium receptor primarily expressed in skeletal muscle with a role in excitation contraction. Both dominant and recessive mutations in the RYR1 gene cause a range of RYR1 -related myopathies and/or susceptibility to malignant hyperthermia (MH). Recently, an atypical manifestation of ptosis, variably presenting with ophthalmoplegia, facial paralysis, and scoliosis but without significant muscle weakness, has been reported in 9 cases from 4 families with bialleic variants in RYR1 . Two affected children from a consanguineous family with severe congenital ptosis, ophthalmoplegia, scoliosis, and distinctive long faces but without skeletal myopathy were studied. To identify the cause of the hereditary condition, DNA from the proband was subjected to whole exome sequencing (WES). WES revealed a novel homozygous missense variant in RYR1 (c.14066T>A; p.IIe4689Asn), which segregated within the family. Although the phenotype of the affected siblings in this study was similar to previously described cases, the clinical features were more severely expressed. Our findings contribute to the expansion of phenotypes related to RYR1 dysfunction. Additionally, it supports a new RYR1 -related clinical presentation without musculoskeletal involvement. It is important that individuals with RYR1 mutations are considered susceptible to MH, as 70% of the MH cases are caused by mutations in the RYR1 gene.

  16. Word translation entropy in translation

    DEFF Research Database (Denmark)

    Schaeffer, Moritz; Dragsted, Barbara; Hvelplund, Kristian Tangsgaard

    2016-01-01

    This study reports on an investigation into the relationship between the number of translation alternatives for a single word and eye movements on the source text. In addition, the effect of word order differences between source and target text on eye movements on the source text is studied....... In particular, the current study investigates the effect of these variables on early and late eye movement measures. Early eye movement measures are indicative of processes that are more automatic while late measures are more indicative of conscious processing. Most studies that found evidence of target...... language activation during source text reading in translation, i.e. co-activation of the two linguistic systems, employed late eye movement measures or reaction times. The current study therefore aims to investigate if and to what extent earlier eye movement measures in reading for translation show...

  17. (Configuring gender in Bible translation: Cultural, translational and gender critical intersections

    Directory of Open Access Journals (Sweden)

    Jeremy Punt

    2014-06-01

    Full Text Available The gendered intersection of cultural studies and Bible translation is under acknowledged. Accounting for gender criticism in translation work requires, besides responsible theory and practice of translation, also attention to interwoven gender critical aspects. After a brief investigation of the intersections between biblical, translation and gender studies, translation in a few Pauline texts with bearing on gender and sexuality are investigated.

  18. 'Inhabiting' the Translator's Habitus – Antjie Krog as Translator ...

    African Journals Online (AJOL)

    Drawing on the Bourdieusian concept of habitus and its applicability in the field of translation, this article discusses Antjie Krog's profile in the practice of translation in. South Africa. Bourdieu's conceptualisation of the relationship between the initiating activities of translators and the structures which constrain and enable ...

  19. Danish version of the Tilburg Frailty Indicator-translation, cross-cultural adaption and validity pretest by cognitive interviewing

    DEFF Research Database (Denmark)

    Andreasen, Jane; Sørensen, Erik E; Gobbens, Robbert J J

    2014-01-01

    The Tilburg Frailty Indicator (TFI) is a self-administered questionnaire with a bio-psycho-social integrated approach that measures the degree of frailty in elderly persons. The TFI was developed in the Netherlands and tested in a population of elderly Dutch men and women. The aim of this study...... was to translate and culturally adapt the TFI to a Danish context, and to test face validity of the Danish version by cognitive interviewing. An internationally recognized procedure was applied as a basis for the translation process. The primary tasks were forward translation, reconciliation, back translation......, harmonization and pretest. Pretest and review of the preliminary version by cognitive interviewing, were performed at a local community center and in an acute medical ward at the University Hospital in Aalborg, Denmark respectively. A large agreement regarding meaning of the items in the forward translation...

  20. X linked neonatal centronuclear/myotubular myopathy: evidence for linkage to Xq28 DNA marker loci.

    Science.gov (United States)

    Thomas, N S; Williams, H; Cole, G; Roberts, K; Clarke, A; Liechti-Gallati, S; Braga, S; Gerber, A; Meier, C; Moser, H

    1990-05-01

    We have studied the inheritance of several polymorphic Xq27/28 DNA marker loci in two three generation families with the X linked neonatal lethal form of centronuclear/myotubular myopathy (XL MTM). We found complete linkage of XLMTM to all four informative Xq28 markers analysed, with GCP/RCP (Z = 3.876, theta = 0.00), with DXS15 (Z = 3.737, theta = 0.00), with DXS52 (Z = 2.709, theta = 0.00), and with F8C (Z = 1.020, theta = 0.00). In the absence of any observable recombination, we are unable to sublocalise the XLMTM locus further within the Xq28 region. This evidence for an Xq28 localisation may allow us to carry out useful genetic counselling within such families.

  1. Literal Translation using Google Translate in Translating the Text from French to English in Digital Tourism Brochure “Bienvenue À Paris”

    Directory of Open Access Journals (Sweden)

    Rila Hilma

    2011-05-01

    Full Text Available Translation is basically change of form. The form from which the translation is made will be called the source language and the form into which it is to be changed will be called the receptor language. Translation consists of transferring the meaning of the source language into the receptor language. Translating is not an easy job to do because many things to be considered to do this activity because translation means determining the meaning of a text, then reconstructing this same meaning using the appropriate structure and form in the receptor language. Translation is basically divided by two types of translation, one is literal and the other is idiomatic. Literal translation is really strict to the structure and form then often can not well express the true meaning of source language. Idiomatic translation makes every effort to communicate the meaning of the source language text in the natural forms of the receptor language. Then the most popular translation machine, Google Translate, in this study shows the results of translation which remain odd, unnatural, and nonsensical because the unsuccessful of message delivery, which is notably the typically error of literal translation.

  2. Idiopathic inflammatory myopathies in adults: A comparative study of Bohan and Peter and European Neuromuscular Center 2004 criteria.

    Science.gov (United States)

    Challa, Sundaram; Jakati, Saumya; Uppin, Megha S; Kannan, Meena A; Liza, Rajasekhar; Murthy Jagarlapudi, M K

    2018-01-01

    Bohan and Peter criteria are widely used for the diagnosis of idiopathic inflammatory myopathies (IIMs). Recently, European Neuromuscular Center (ENMC) formulated criteria to identify subgroups of IIMs. To compare the two diagnostic criteria in adult IIMs. This was a retrospective review of case records of histologically confirmed IIMs in adults between January 2014 and May 2015. Both the Bohan and Peter, and ENMC 2004 criteria were applied in the same group of patients to subgroup the IIMs. Muscle biopsy was evaluated in all the four domains: muscle fiber, inflammatory, connective tissue, and vascular, with the basic panel of histological stains. Sporadic inclusion body myositis (s-IBM) was diagnosed using ENMC IBM diagnostic research criteria 2011. During the study period, 69 patients fulfilled the ENMC criteria for IIMs including 16 patients with s-IBM. The subgrouping as per the ENMC criteria (53) was: dermatomyositis (DM) in 30; polymyositis (PM) in 2; immune-mediated necrotizing myopathy (IMNM) in 9; and nonspecific myositis (NM) in 12 patients, whereas subgrouping by the Bohan and Peter criteria was DM in 9 and PM with and without connective tissue disease (CTD) in 26 patients only. There was underdiagnosis of DM, as perifascicular atrophy is not recognized as a diagnostic histological feature, and overdiagnosis of PM with and without CTD due to poor characterization of histological features in PM by the Bohan and Peter criteria. Systematic evaluation of muscle biopsy according to the ENMC criteria with basic panel of histochemical stains improved the diagnostic yield of IIM significantly when compared to the Bohan and Peter criteria.

  3. The measurement of reversible redox dependent post-translational modifications and their regulation of mitochondrial and skeletal muscle function

    Directory of Open Access Journals (Sweden)

    Philip A Kramer

    2015-11-01

    Full Text Available Mitochondrial oxidative stress is a common feature of skeletal myopathies across multiple conditions; however, the mechanism by which it contributes to skeletal muscle dysfunction remains controversial. Oxidative damage to proteins, lipids, and DNA has received the most attention, yet an important role for reversible redox post-translational modifications (PTMs in pathophysiology is emerging. The possibility that these PTMs can exert dynamic control of muscle function implicates them as a mechanism contributing to skeletal muscle dysfunction in chronic disease. Herein, we discuss the significance of thiol-based redox dependent modifications to mitochondrial, myofibrillar and excitation-contraction (EC coupling proteins with an emphasis on how these changes could alter skeletal muscle performance under chronically stressed conditions. A major barrier to a better mechanistic understanding of the role of reversible redox PTMs in muscle function is the technical challenges associated with accurately measuring the changes of site-specific redox PTMs. Here we will critically review current approaches with an emphasis on sample preparation artifacts, quantitation, and specificity. Despite these challenges, the ability to accurately quantify reversible redox PTMs is critical to understanding the mechanisms by which mitochondrial oxidative stress contributes to skeletal muscle dysfunction in chronic diseases.

  4. The Measurement of Reversible Redox Dependent Post-translational Modifications and Their Regulation of Mitochondrial and Skeletal Muscle Function

    Energy Technology Data Exchange (ETDEWEB)

    Kramer, Philip A.; Duan, Jicheng; Qian, Wei-Jun; Marcinek, David J.

    2015-11-25

    Mitochondrial oxidative stress is a common feature of skeletal myopathies across multiple conditions; however, the mechanism by which it contributes to skeletal muscle dysfunction remains controversial. Oxidative damage to proteins, lipids, and DNA has received the most attention, yet an important role for reversible redox post-translational modifications (PTMs) in pathophysiology is emerging. The possibility that these PTMs can exert dynamic control of muscle function implicates them as a mechanism contributing to skeletal muscle dysfunction in chronic disease. Herein, we discuss the significance of thiol-based redox dependent modifications to mitochondrial, myofibrillar and excitation-contraction (EC) coupling proteins with an emphasis on how these changes could alter skeletal muscle performance under chronically stressed conditions. A major barrier to a better mechanistic understanding of the role of reversible redox PTMs in muscle function is the technical challenges associated with accurately measuring the changes of site-specific redox PTMs. Here we will critically review current approaches with an emphasis on sample preparation artifacts, quantitation, and specificity. Despite these challenges, the ability to accurately quantify reversible redox PTMs is critical to understanding the mechanisms by which mitochondrial oxidative stress contributes to skeletal muscle dysfunction in chronic diseases.

  5. The ICNP BaT - from translation tool to translation web service.

    Science.gov (United States)

    Schrader, Ulrich

    2009-01-01

    The ICNP BaT has been developed as a web application to support the collaborative translation of different versions of the ICNP into different languages. A prototype of a web service is described that could reuse the translations in the database of the ICNP BaT to provide automatic translations of nursing content based on the ICNP terminology globally. The translation web service is based on a service-oriented architecture making it easy to interoperate with different applications. Such a global translation server would free individual institutions from the maintenance costs of realizing their own translation services.

  6. Two families with MYH7 distal myopathy associated with cardiomyopathy and core formations.

    Science.gov (United States)

    Naddaf, Elie; Waclawik, Andrew J

    2015-03-01

    Laing distal myopathy is caused by MYH7 gene mutations. Multiple families have been reported with varying patterns of skeletal and cardiac involvement as well as histopathological findings. We report 2 families with p.Glu1508del mutation with detailed electrophysiological and muscle pathology findings. All patients displayed the classic phenotype with weakness starting in the anterior compartment of the legs with a "hanging great toe." It was followed by finger extensors involvement, relatively sparing the extensor indicis proprius, giving the appearance of a "pointing index" finger. All the affected individuals had a dilated cardiomyopathy and core formations on muscle biopsy. Unexpectedly, neurogenic changes were also observed in some individuals. Both families were initially misdiagnosed with either central core disease or hereditary neuropathy. Recognizing the classic phenotype, screening for cardiac involvement that may be clinically silent, and determining the mode of inheritance help with selecting the appropriate genetic test.

  7. On Various Negative Translations

    Directory of Open Access Journals (Sweden)

    Gilda Ferreira

    2011-01-01

    Full Text Available Several proof translations of classical mathematics into intuitionistic mathematics have been proposed in the literature over the past century. These are normally referred to as negative translations or double-negation translations. Among those, the most commonly cited are translations due to Kolmogorov, Godel, Gentzen, Kuroda and Krivine (in chronological order. In this paper we propose a framework for explaining how these different translations are related to each other. More precisely, we define a notion of a (modular simplification starting from Kolmogorov translation, which leads to a partial order between different negative translations. In this derived ordering, Kuroda and Krivine are minimal elements. Two new minimal translations are introduced, with Godel and Gentzen translations sitting in between Kolmogorov and one of these new translations.

  8. Knowledge Translation and Patient Safety: The Canadian Adverse Events Study

    OpenAIRE

    Baker, G. Ross; Norton, Peter; Flintoft, Virginia

    2006-01-01

    The Canadian Adverse Events Study was the first national study of adverse events in Canadian hospitals. Learning from the controversy surrounding similar studies in other countries, the team engaged in extensive knowledge translation activities throughout the life of the project. Using meetings, Web-based communication and other tools, the team successfully prepared most Canadian stakeholders for the study’s release, allowing them to develop anticipatory patient safety initiatives. However, u...

  9. Lost in translation?

    DEFF Research Database (Denmark)

    Granas, Anne Gerd; Nørgaard, Lotte Stig; Sporrong, Sofia Kälvemark

    2014-01-01

    OBJECTIVE: The "Beliefs about Medicines Questionnaire" (BMQ) assess balance of necessity and concern of medicines. The BMQ has been translated from English to many languages. However, the original meaning of statements, such as "My medicine is a mystery to me", may be lost in translation. The aim...... of this study is to compare three Scandinavian translations of the BMQ. (1) How reliable are the translations? (2) Are they still valid after translation? METHODS: Translated Norwegian, Swedish and Danish versions of the BMQ were scrutinized by three native Scandinavian researchers. Linguistic differences...... and ambiguities in the 5-point Likert scale and the BMQ statements were compared. RESULTS: In the Scandinavian translations, the Likert scale expanded beyond the original version at one endpoint (Swedish) or both endpoints (Danish). In the BMQ statements, discrepancies ranged from smaller inaccuracies toward...

  10. mtDNA depletion myopathy: elucidation of the tissue specificity in the mitochondrial thymidine kinase (TK2) deficiency.

    Science.gov (United States)

    Saada, Ann; Shaag, Avraham; Elpeleg, Orly

    2003-05-01

    Decreased mitochondrial thymidine kinase (TK2) activity is associated with mitochondrial DNA (mtDNA) depletion and respiratory chain dysfunction and is manifested by isolated, fatal skeletal myopathy. Other tissues such as liver, brain, heart, and skin remain unaffected throughout the patients' life. In order to elucidate the mechanism of tissue specificity in the disease we have investigated the expression of the mitochondrial deoxynucleotide carrier, the mtDNA content and the activity of TK2 in mitochondria of various tissues. Our results suggest that low basal TK2 activity combined with a high requirement for mitochondrial encoded proteins in muscle predispose this tissue to the devastating effect of TK2 deficiency.

  11. An Evergreen Challenge for Translators – The Translation of Idioms

    Directory of Open Access Journals (Sweden)

    Kovács Gabriella

    2016-12-01

    Full Text Available Translating idioms has always been a challenging decision-making process for translators mainly because not all idioms have direct equivalents in the target language. Translators usually and ideally have a solid knowledge of the target language and its cultural aspects, but even so they cannot match the ability of a native speaker in deciding when – i.e. in what context and text type – an idiom would or would not be appropriate. This study aims to explore the main characteristics of idioms and the difficulties which might occur when translating them. A needs analysis will also be presented, where the various solutions which a group of translator trainees chose while translating certain idioms from the novel “A Game of Thrones” by George R. R. Martin into Hungarian are examined. Their strategies and the appropriateness of their choices are analysed and compared with the options of the experienced literary translator (Tamás Pétersz. We consider this an important endeavour because, based on our experience, we believe that the topic of the translation of idioms should be included into the curriculum and appropriate materials and tasks should be designed to develop the translator trainees’ knowledge and skills in this domain. Therefore, the aim of this analysis is to obtain a clearer view of the difficulties they are dealing with and bear them in mind when designing teaching materials for them.

  12. Translation in Language Teaching: Insights from Professional Translator Training

    Science.gov (United States)

    Carreres, Angeles; Noriega-Sanchez, Maria

    2011-01-01

    The past three decades have seen vast changes in attitudes towards translation, both as an academic discipline and as a profession. The insights we have gained in recent years, in particular in the area of professional translator training, call for a reassessment of the role of translation in language teaching. Drawing on research and practices in…

  13. Reliability and validity of the Malay translated version of diabetes quality of life for youth questionnaire

    Directory of Open Access Journals (Sweden)

    Jamaiyah H

    2013-05-01

    Full Text Available Introduction: Many studies reported poorer quality of life (QoL in youth with diabetes compared to healthy peers. One of the tools used is the Diabetes Quality of Life for Youth (DQoLY questionnaire in English. A validated instrument in Malay is needed to assess the perception of QoL among youth with diabetes in Malaysia. Objective: To translate the modified version, i.e., the DQoLY questionnaire,into Malay and determine its reliability and validity.Methods: Translation and back-translation were used. An expert panel reviewed the translated version for conceptual and content equivalence. The final version was then administered to youths with type 1 diabetes mellitus from the universities and Ministry of Health hospitals between August 2006 and September 2007. Reliability was analysed using Cronbach’s alpha, while validity was confirmed using concurrent validity (HbA1c and self-rated health score.Results: A total of 82 youths with type 1 diabetes (38 males aged 10-18 years were enrolled from eight hospitals. The reliability of overall questionnaire was 0.917, and the reliabilities of the three domains ranged from 0.832 to 0.867. HbA1c was positively correlated with worry (p=0.03. The self-rated health score was found to have significant negative correlation with the “satisfaction” (p=0.013 and “impact” (p=0.007 domains.Conclusion: The Malay translated version of DQoLY questionnaire was reliable and valid to be used among youths with type 2 diabetes in Malaysia.

  14. Lost in translation

    DEFF Research Database (Denmark)

    Hedegaard, Steffen; Simonsen, Jakob Grue

    2011-01-01

    of translated texts. Our results suggest (i) that frame-based classifiers are usable for author attribution of both translated and untranslated texts; (ii) that framebased classifiers generally perform worse than the baseline classifiers for untranslated texts, but (iii) perform as well as, or superior...... to the baseline classifiers on translated texts; (iv) that—contrary to current belief—naïve classifiers based on lexical markers may perform tolerably on translated texts if the combination of author and translator is present in the training set of a classifier....

  15. From translational research to open technology innovation systems.

    Science.gov (United States)

    Savory, Clive; Fortune, Joyce

    2015-01-01

    The purpose of this paper is to question whether the emphasis placed within translational research on a linear model of innovation provides the most effective model for managing health technology innovation. Several alternative perspectives are presented that have potential to enhance the existing model of translational research. A case study is presented of innovation of a clinical decision support system. The paper concludes from the case study that an extending the triple helix model of technology transfer, to one based on a quadruple helix, present a basis for improving the performance translational research. A case study approach is used to help understand development of an innovative technology within a teaching hospital. The case is then used to develop and refine a model of the health technology innovation system. The paper concludes from the case study that existing models of translational research could be refined further through the development of a quadruple helix model of heath technology innovation that encompasses greater emphasis on user-led and open innovation perspectives. The paper presents several implications for future research based on the need to enhance the model of health technology innovation used to guide policy and practice. The quadruple helix model of innovation that is proposed can potentially guide alterations to the existing model of translational research in the healthcare sector. Several suggestions are made for how innovation activity can be better supported at both a policy and operational level. This paper presents a synthesis of the innovation literature applied to a theoretically important case of open innovation in the UK National Health Service. It draws in perspectives from other industrial sectors and applies them specifically to the management and organisation of innovation activities around health technology and the services in which they are embedded.

  16. Writing Through: Practising Translation

    Directory of Open Access Journals (Sweden)

    Joel Scott

    2010-05-01

    Full Text Available This essay exists as a segment in a line of study and writing practice that moves between a critical theory analysis of translation studies conceptions of language, and the practical questions of what those ideas might mean for contemporary translation and writing practice. Although the underlying preoccupation of this essay, and my more general line of inquiry, is translation studies and practice, in many ways translation is merely a way into a discussion on language. For this essay, translation is the threshold of language. But the two trails of the discussion never manage to elude each other, and these concatenations have informed two experimental translation methods, referred to here as Live Translations and Series Translations. Following the essay are a number of poems in translation, all of which come from Blanco Nuclear by the contemporary Spanish poet, Esteban Pujals Gesalí. The first group, the Live Translations consist of transcriptions I made from audio recordings read in a public setting, in which the texts were translated in situ, either off the page of original Spanish-language poems, or through a process very much like that carried out by simultaneous translators, for which readings of the poems were played back to me through headphones at varying speeds to be translated before the audience. The translations collected are imperfect renderings, attesting to a moment in language practice rather than language objects. The second method involves an iterative translation process, by which three versions of any one poem are rendered, with varying levels of fluency, fidelity and servility. All three translations are presented one after the other as a series, with no version asserting itself as the primary translation. These examples, as well as the translation methods themselves, are intended as preliminary experiments within an endlessly divergent continuum of potential methods and translations, and not as a complete representation of

  17. Implementing 'translational' biomedical research: convergence and divergence among clinical and basic scientists.

    Science.gov (United States)

    Morgan, Myfanwy; Barry, Christine A; Donovan, Jenny L; Sandall, Jane; Wolfe, Charles D A; Boaz, Annette

    2011-10-01

    Universities are increasingly regarded as key actors in the new 'knowledge economy', with requirements to produce market-oriented knowledge and engage in commercialization. This is of particular significance in the biomedical field, reflecting the perceived gap between success in terms of scientific discoveries and its transformation into products. The dominant discourse attributes this situation to 'blocks' in the translational pathway from 'bench to bedside', leading to policies to 'reengineer' the research enterprise. This study examines a pilot initiative established by the UK's Medical Research Council (MRC). This involved employing a change agent (Research Translator) supported by a small amount of translational funding to promote the culture and practice of translational research at a university/hospital site in England. An ethnographically informed case study involving semi-structured and open exploratory interviews, observation and document review, was conducted in 2008. Analysis and interpretation were informed by Bourdieu's logic of practice applied to science. The requirements of translational research promoted by the Research Translator and its sources of capital (authority, prestige etc) were largely congruent with the 'field' of clinical science. In contrast, translational research diverged from perceptions of 'legitimate' science and requirements for capital accumulation held by the majority of basic scientists who often described this research as 'high risk' and were resistant to the Research Translator's advice. However some differences in motivations and practices were identified within groups of scientists associated with career stage, work environment and specialty. We argue that there are convergent and divergent forces that influence scientists' readiness to adopt a market-oriented translational research model and in turn facilitate or constrain the effectiveness of a knowledge broker. We also identify ways in which current structures and

  18. Speaking your Translation

    DEFF Research Database (Denmark)

    Dragsted, Barbara; Mees, Inger M.; Gorm Hansen, Inge

    2011-01-01

    In this article we discuss the translation processes and products of 14 MA students who produced translations from Danish (L1) into English (L2) under different working conditions: (1) written translation, (2) sight translation, and (3) sight translation with a speech recognition (SR) tool. Audio......, since students were dictating in their L2, we looked into the number and types of error that occurred when using the SR software. Items that were misrecognised by the program could be divided into three categories: homophones, hesitations, and incorrectly pronounced words. Well over fifty per cent...

  19. Onset of white striping and progression into wooden breast as defined by myopathic changes underlying Pectoralis major growth. Estimation of growth parameters as predictors for stage of myopathy progression.

    Science.gov (United States)

    Griffin, Jacqueline Reedy; Moraes, Luis; Wick, Macdonald; Lilburn, Michael Snell

    2018-02-01

    The broiler industry has incurred significant economic losses due to two muscle myopathies, white striping (WS) and wooden breast (WB), affecting the Pectoralis major (P. major) of commercial broilers. The present study documented macroscopic changes occurring with age/growth in the P. major and P. minor muscles of commercial broilers from day 2 through day 46 (n = 27/day). Distinct myopathic aberrations observed in both breast muscles corresponded to the onset of WB. These distinct morphological changes were used as determinants in developing a ranking system, defining the ontogeny of WB as the following four stages: (1) WS, (2) petechial epimysium haemorrhages, (3) intramuscular haemorrhages and (4) ischaemia. A cumulative logit proportional odds model was used to relate the rank probabilities with the following growth parameters: body weight, P. major and P. minor weight/yield/length/width/depth. The best-fit model included P. major length/width/depth, P. minor width, P. major and P. minor yield as predictors for rank. Increasing P. major depth, P. minor width and P. major yield increased the odds of falling into higher ranks (more severe myopathy). Conversely, increasing P. major length, P. major width and P. minor yield increased the odds of falling into smaller ranks (less severe myopathy). This study describes the macroscopic changes associated with WB ontogeny in the development of a ranking system and the contribution of growth parameters in the determination of rank (WB severity). Results suggest that physical measurements inherent to selection for high-yielding broiler genotypes are contributing to the occurrence and severity of WS and WB.

  20. Struggling with Translations

    DEFF Research Database (Denmark)

    Obed Madsen, Søren

    This paper shows empirical how actors have difficulties with translating strategy texts. The paper uses four cases as different examples of what happens, and what might be difficult, when actors translate organizational texts. In order to explore this, it draws on a translation training method from...... translation theory. The study shows that for those who have produced the text, it is difficult to translate a strategy where they have to change the words so others who don’t understand the language in the text can understand it. It also shows that for those who haven’t been a part of the production, it very...... challenge the notion that actors understand all texts and that managers per se can translate a text....

  1. A Comparative Study of "Google Translate" Translations: An Error Analysis of English-to-Persian and Persian-to-English Translations

    Science.gov (United States)

    Ghasemi, Hadis; Hashemian, Mahmood

    2016-01-01

    Both lack of time and the need to translate texts for numerous reasons brought about an increase in studying machine translation with a history spanning over 65 years. During the last decades, Google Translate, as a statistical machine translation (SMT), was in the center of attention for supporting 90 languages. Although there are many studies on…

  2. Bean Soup Translation: Flexible, Linguistically-Motivated Syntax for Machine Translation

    Science.gov (United States)

    Mehay, Dennis Nolan

    2012-01-01

    Machine translation (MT) systems attempt to translate texts from one language into another by translating words from a "source language" and rearranging them into fluent utterances in a "target language." When the two languages organize concepts in very different ways, knowledge of their general sentence structure, or…

  3. Improving resource capacity planning in hospitals with business approaches.

    NARCIS (Netherlands)

    van Lent, Wineke Agnes Marieke; van Lent, W.A.M.

    2011-01-01

    This dissertation contributed to the knowledge on the translation of approaches from businesses and services to improve the resource capacity planning on tactical and operational level in (oncologic) hospital care. The following studies were presented: * Chapter 2 surveyed the business approaches

  4. Promised Land No More: Dynamic Shifts in Slovene Translation Market and Translator Education

    Directory of Open Access Journals (Sweden)

    Nike K. Pokorn

    2016-12-01

    Full Text Available The article outlines the changes of the translation market, the development of Higher Education (HE translator training and of the profession of translator in Slovenia. First, three HE translator-training programmes in Slovenia are briefly described. Second, through an analysis of the public database containing information on all business entities in Slovenia, a description of the translation market in 2014 is made and the findings are compared to those of a similar study carried out in 2007. Then two surveys of translation graduates of University of Ljubljana are presented, focusing in particular on graduate employment statistics and average earnings of junior translators. The results show that despite the fact that the Slovene translation market is thriving, this growth is not reflected in the average earnings of individual translators. Finally, in view of the fact that translation rates are constantly falling, it is argued that the role of professional associations becomes vital.

  5. Progressive Structural Defects in Canine Centronuclear Myopathy Indicate a Role for HACD1 in Maintaining Skeletal Muscle Membrane Systems.

    Science.gov (United States)

    Walmsley, Gemma L; Blot, Stéphane; Venner, Kerrie; Sewry, Caroline; Laporte, Jocelyn; Blondelle, Jordan; Barthélémy, Inès; Maurer, Marie; Blanchard-Gutton, Nicolas; Pilot-Storck, Fanny; Tiret, Laurent; Piercy, Richard J

    2017-02-01

    Mutations in HACD1/PTPLA cause recessive congenital myopathies in humans and dogs. Hydroxyacyl-coA dehydratases are required for elongation of very long chain fatty acids, and HACD1 has a role in early myogenesis, but the functions of this striated muscle-specific enzyme in more differentiated skeletal muscle remain unknown. Canine HACD1 deficiency is histopathologically classified as a centronuclear myopathy (CNM). We investigated the hypothesis that muscle from HACD1-deficient dogs has membrane abnormalities in common with CNMs with different genetic causes. We found progressive changes in tubuloreticular and sarcolemmal membranes and mislocalized triads and mitochondria in skeletal muscle from animals deficient in HACD1. Furthermore, comparable membranous abnormalities in cultured HACD1-deficient myotubes provide additional evidence that these defects are a primary consequence of altered HACD1 expression. Our novel findings, including T-tubule dilatation and disorganization, associated with defects in this additional CNM-associated gene provide a definitive pathophysiologic link with these disorders, confirm that dogs deficient in HACD1 are relevant models, and strengthen the evidence for a unifying pathogenesis in CNMs via defective membrane trafficking and excitation-contraction coupling in muscle. These results build on previous work by determining further functional roles of HACD1 in muscle and provide new insight into the pathology and pathogenetic mechanisms of HACD1 CNM. Consequently, alterations in membrane properties associated with HACD1 mutations should be investigated in humans with related phenotypes. Copyright © 2017 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.

  6. Translation in ESL Classes

    Directory of Open Access Journals (Sweden)

    Nagy Imola Katalin

    2015-12-01

    Full Text Available The problem of translation in foreign language classes cannot be dealt with unless we attempt to make an overview of what translation meant for language teaching in different periods of language pedagogy. From the translation-oriented grammar-translation method through the complete ban on translation and mother tongue during the times of the audio-lingual approaches, we have come today to reconsider the role and status of translation in ESL classes. This article attempts to advocate for translation as a useful ESL class activity, which can completely fulfil the requirements of communicativeness. We also attempt to identify some activities and games, which rely on translation in some books published in the 1990s and the 2000s.

  7. Translational study of obesity management using the Diabetes Prevention Program "Group Lifestyle Balance" in primary care clinics and public hospitals from Mexico: study protocol

    Directory of Open Access Journals (Sweden)

    Rolando Giovanni Díaz-Zavala

    2017-12-01

    Full Text Available Introduction: Obesity is the main modifiable risk factor for the development of chronic diseases in Mexico. Several randomized controlled trials have shown that intensive lifestyle programs are efficacious for the management of obesity. These programs include frequent sessions (14 or more contacts in the first 6 months focused on diet and physical activity and use a behavior change protocol. However, most Mexican primary care clinics and public hospitals apply traditional treatments for obesity management with limited results on weight loss. The purpose of the study is to evaluate the effectiveness of the Diabetes Prevention Program (DPP “Group Lifestyle Balance” for weight loss among adults with overweight and obesity from baseline to 6 months and from baseline to 12 months in primary care clinics and public hospitals from Sonora, Mexico. Material and Methods: This is a translational, multi-center, non-controlled, 6 and 12-month follow-up clinical study with a pre-test and post-test design. Healthcare providers from two primary care clinics, two hospitals and one university clinic will be trained with the DPP protocol to implement on their patients with overweight and obesity. Body weight, body mass index, waist circumference, systolic and diastolic blood pressure, depression, quality of life and stress scales will be measured in participants receiving the program at baseline, 6 and 12 months. Biochemical parameters will be measured at baseline and 12 months. The primary outcome is the change in body weight at 6 and 12 months. Discussion: This study will provide scientific evidence of the effectiveness of the DPP protocol as a model for obesity management in real world clinical practice among the adult Mexican population.

  8. Rare myositis-specific autoantibody associations among Hungarian patients with idiopathic inflammatory myopathy.

    Science.gov (United States)

    Bodoki, L; Nagy-Vincze, M; Griger, Z; Betteridge, Z; Szöllősi, L; Jobanputra, R; Dankó, K

    2015-01-01

    Idiopathic inflammatory myopathies are systemic, chronic autoimmune diseases characterized by symmetrical, proximal muscle weakness. Homogeneous groups present with similar symptoms. The response to therapy and prognosis could be facilitated by myositis-specific autoantibodies, and in this way, give rise to immunoserological classification. The myositis-specific autoantibodies are directed against specific proteins found in the cytoplasm or in the nucleus of the cells. To date, literature suggests the rarity of the co-existence of two myositis-specific autoantibodies. In this study the authors highlight rare associations of myositis-specific autoantibodies. Three hundred and thirty-seven Hungarian patients with polymyositis or dermatomyositis were studied. Their clinical findings were noted retrospectively. Specific blood tests identified six patients with the rare co-existence of myositis-specific autoantibodies, anti-Jo-1 and anti-SRP, anti-Jo-1 and anti-Mi-2, anti-Mi-2 and anti-PL-12, anti-Mi-2 and anti-SRP, and anti-SRP and anti-PL-7, respectively. This case review aims to identify the clinical importance of these rare associations and their place within the immunoserological classification.

  9. Orthognathic Surgery in Patients With Congenital Myopathies and Congenital Muscular Dystrophies: Case Series and Review of the Literature.

    Science.gov (United States)

    Bezak, Brett J; Arce, Kevin A; Jacob, Adam; Van Ess, James

    2016-03-01

    This case series examined preoperative findings and the surgical, anesthetic, and postoperative management of 6 patients with congenital myopathies (CMs) and congenital muscular dystrophies (CMDs) treated at a tertiary medical institution with orthognathic surgery over 15 years to describe pertinent considerations for performing orthognathic surgery in these complex patients. According to the institutional review board-approved protocol, chart records were reviewed for all orthognathic surgical patients with a clinical, genetic, or muscle biopsy-proved diagnosis of CM or CMD. Six patients (5 male, 1 female) qualified, and they were treated by 4 surgeons in the division of oral and maxillofacial surgery from 1992 through 2007. Average age was 19.5 years at the time of orthognathic surgery. Five patients had Class III malocclusions and 1 patient had Class II malocclusion. All 6 patients had apertognathia with lip incompetence. Nasoendotracheal intubation with a difficulty of 0/3 (0=easiest, 3=most difficult) was performed in all cases. Routine induction and maintenance anesthetics, including halogenated agents and nondepolarizing muscle relaxants, were administered without malignant hyperthermia. All 6 patients underwent Le Fort level osteotomies; 4 also had mandibular setback surgery with or without balancing mandibular inferior border osteotomies. Five patients required planned intensive care unit care postoperatively (average, 18.4 days; range, 4 to 65 days). Postoperative respiratory complications resulting in major blood oxygen desaturations occurred in 5 patients; 4 of these patients required reintubation during emergency code response. Five patients required extended postoperative intubation (average, 4.2 days; range, 3 to 6 days) and ventilatory support. Average hospital length of stay was 21.8 days (range, 6 to 75 days). Average postoperative follow-up interval was 29.8 weeks (range, 6 to 128 weeks). Patients with CMs or CMDs often have characteristic

  10. A Writer's Thoughts on Translation and Always Living in Translation.

    Science.gov (United States)

    Agosin, Marjorie; Jones, Robin

    2000-01-01

    Discusses how it feels to be a poet who writes in Spanish and has her work translated, examining the author's immigration experiences and noting the translator's contributions in making her work accessible across languages, borders, and cultures. Explains that writing in Spanish is a gesture of survival, and translation allows her memories to…

  11. Lost in Translation: The Gap in Scientific Advancements and Clinical Application

    Directory of Open Access Journals (Sweden)

    Joseph eFernandez-Moure

    2016-06-01

    Full Text Available The evolution of medicine and medical technology hinges on the successful translation of basic science research from the bench to clinical implementation at the bedside. Born out of the increasing need to facilitate the transfer of scientific knowledge to patients, translational research has emerged. Significant leaps in improving global health such as antibiotics, vaccinations, and cancer therapies have all seen successes under this paradigm yet today it has become increasingly difficult to realize this ideal scenario. As hospital revenue demand increase, and financial support declines, clinician protected research time has been limited. Researchers, likewise, have been forced to abandon time and resource consuming translational research to focus on publication generating work to maintain funding and professional advancement. Compared to the surge in scientific innovation and new fields of science have surged, realization of transformational scientific findings in device development and materials sciences has significantly lagged behind. Herein, we describe: how the current scientific paradigm struggles in the new health-care landscape; the obstacles met by translational researchers; and solutions, both public and private, to overcoming those obstacles. We must rethink the old dogma of academia and reinvent the traditional pathways of research in order to truly impact the health-care arena and ultimately those that matter most: the patient.

  12. Lost in translation?: Comparing three Scandinavian translations of the Beliefs about Medicines Questionnaire.

    Science.gov (United States)

    Granas, Anne Gerd; Nørgaard, Lotte Stig; Sporrong, Sofia Kälvemark

    2014-08-01

    The "Beliefs about Medicines Questionnaire" (BMQ) assess balance of necessity and concern of medicines. The BMQ has been translated from English to many languages. However, the original meaning of statements, such as "My medicine is a mystery to me", may be lost in translation. The aim of this study is to compare three Scandinavian translations of the BMQ. (1) How reliable are the translations? (2) Are they still valid after translation? Translated Norwegian, Swedish and Danish versions of the BMQ were scrutinized by three native Scandinavian researchers. Linguistic differences and ambiguities in the 5-point Likert scale and the BMQ statements were compared. In the Scandinavian translations, the Likert scale expanded beyond the original version at one endpoint (Swedish) or both endpoints (Danish). In the BMQ statements, discrepancies ranged from smaller inaccuracies toward completely different meaning. Some dissimilarities reflect different cultural beliefs about medicines. When translating questionnaires, bilingual researchers should scrutinize translations across similar languages to address content validity across different countries and languages. Our findings are of relevance to other BMQ translations in non-English countries, as direct comparisons between different translations might not be reliable or valid. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  13. Validation of hindi translation of DSM-5 level 1 cross-cutting symptom measure.

    Science.gov (United States)

    Goel, Ankit; Kataria, Dinesh

    2018-04-01

    The DSM-5 Level 1 Cross-Cutting Symptom Measure is a self- or informant-rated measure that assesses mental health domains which are important across psychiatric diagnoses. The absence of this self- or informant-administered instrument in Hindi, which is a major language in India, is an important limitation in using this scale. To translate the English version of the DSM-5 Level 1 Cross-Cutting Symptom Measure to Hindi and evaluate its psychometric properties. The study was conducted at a tertiary care hospital in Delhi. The DSM-5 Level 1 Cross-Cutting Symptom Measure was translated into Hindi using the World Health Organization's translation methodology. Mean and standard deviation were evaluated for continuous variables while for categorical variables frequency and percentages were calculated. The translated version was evaluated for cross-language equivalence, test-retest reliability, internal consistency, and split half reliability. Hindi version was found to have good cross-language equivalence and test-retest reliability at the level of items and domains. Twenty two of the 23 items and all the 23 items had a significant correlation (ρ Cutting Symptom Measure as translated in this study is a valid instrument. Copyright © 2018 Elsevier B.V. All rights reserved.

  14. Australian Hospital-Based Nurse Educators' Perceptions of Their Role.

    Science.gov (United States)

    Thornton, Karleen

    2018-06-01

    This article presents the findings from a phenomenological study that explored the understandings of Australian hospital-based nurse educators' experiences of their role. Purposive sampling resulted in 11 nurse educators from four large metropolitan hospitals within an Australian jurisdiction. The participants were asked how they understand their role and translate that understanding into practice. Thematic analysis identified four themes representative of nurse educators' understanding of their role: Becoming an Educator, Capability Building, Panacea, and Tension. A coherent picture emerged from subthemes highlighting that nurse educators were undervalued and value is added. Being undervalued and value adding are translated into nurse educator practice as resilience, being educationally literate, investing, and having a presence. This article identifies a gap in knowledge related to understanding the nurse educator role and informs recruitment and subsequent retention of nurses into nurse educator roles at a time when the nursing workforce in Australia and internationally is about to experience a major shortfall. Findings are specific to the Australian context and are not necessarily generalizable to other hospital jurisdictions. J Contin Educ Nurs. 2018;49(6):274-281. Copyright 2018, SLACK Incorporated.

  15. Translation Methods Applied in Translating Quotations in “the Secret” by Rhonda

    OpenAIRE

    FEBRIANTI, VICKY

    2014-01-01

    Keywords: Translation Methods, The Secret, Quotations.Translation helps human to get information written in any language evenwhen it is written in foreign languages. Therefore translation happens in printed media. Books have been popular printed media. The Secret written by Rhonda Byrne is a popular self-help book which has been translated into 50 languages including Indonesian (“The Secret”, n.d., para.5-6).This study is meant to find out the translation methods applied in The Secret. The wr...

  16. From a Viewpoint of Clinical Settings: Pharmacoepidemiology as Reverse Translational Research (rTR).

    Science.gov (United States)

    Kawakami, Junichi

    2017-01-01

    Clinical pharmacology and pharmacoepidemiology research may converge in practise. Pharmacoepidemiology is the study of pharmacotherapy and risk management in patient groups. For many drugs, adverse reaction(s) that were not seen and/or clarified during research and development stages have been reported in the real world. Pharmacoepidemiology can detect and verify adverse drug reactions as reverse translational research. Recently, development and effective use of medical information databases (MID) have been conducted in Japan and elsewhere for the purpose of post-marketing safety of drugs. The Ministry of Health, Labour and Welfare, Japan has been promoting the development of 10-million scale database in 10 hospitals and hospital groups as "the infrastructure project of medical information database (MID-NET)". This project enables estimation of the frequency of adverse reactions, the distinction between drug-induced reactions and basal health-condition changes, and usefulness verification of administrative measures of drug safety. However, because the database information is different from detailed medical records, construction of methodologies for the detection and evaluation of adverse reactions is required. We have been performing database research using medical information system in some hospitals to establish and demonstrate useful methods for post-marketing safety. In this symposium, we aim to discuss the possibility of reverse translational research from clinical settings and provide an introduction to our research.

  17. Why Translation Is Difficult

    DEFF Research Database (Denmark)

    Carl, Michael; Schaeffer, Moritz Jonas

    2017-01-01

    The paper develops a definition of translation literality that is based on the syntactic and semantic similarity of the source and the target texts. We provide theoretical and empirical evidence that absolute literal translations are easy to produce. Based on a multilingual corpus of alternative...... translations we investigate the effects of cross-lingual syntactic and semantic distance on translation production times and find that non-literality makes from-scratch translation and post-editing difficult. We show that statistical machine translation systems encounter even more difficulties with non-literality....

  18. Cultural Context and Translation

    Institute of Scientific and Technical Information of China (English)

    张敏

    2009-01-01

    cultural context plays an important role in translation. Because translation is a cross-culture activity, the culture context that influ-ences translating is consisted of both the culture contexts of source language and target language. This article firstly analyzes the concept of context and cultural context, then according to the procedure of translating classifies cultural context into two stages and talks about how they respectively influence translating.

  19. Gender issues in translation

    OpenAIRE

    ERGASHEVA G.I.

    2015-01-01

    The following research is done regarding gender in translation dealing specifically with the issue of the translators’ gender identity and its effect on their translations, as well as on how gender itself is translated and produced. We will try to clarify what gender is, how gender manifests itself in the system of language, and what problems translators encounter when translating or producing gender-related materials

  20. Impaired Insulin/IGF Signaling in Experimental Alcohol-Related Myopathy

    Directory of Open Access Journals (Sweden)

    Elizabeth Silbermann

    2012-08-01

    Full Text Available Alcohol-related myopathy (Alc-M is highly prevalent among heavy drinkers, although its pathogenesis is not well understood. We hypothesize that Alc-M is mediated by combined effects of insulin/IGF resistance and oxidative stress, similar to the effects of ethanol on liver and brain. We tested this hypothesis using an established model in which adult rats were pair-fed for 8 weeks with isocaloric diets containing 0% (N = 8 or 35.5% (N = 13 ethanol by caloric content. Gastrocnemius muscles were examined by histology, morphometrics, qRT-PCR analysis, and ELISAs. Chronic ethanol feeding reduced myofiber size and mRNA expression of IGF-1 polypeptide, insulin, IGF-1, and IGF-2 receptors, IRS-1, and IRS-2. Multiplex ELISAs demonstrated ethanol-associated inhibition of insulin, IRS-1, Akt, and p70S6K signaling, and increased activation of GSK-3β. In addition, ethanol-exposed muscles had increased 4-hydroxy-2-nonenal immunoreactivity, reflecting lipid peroxidation, and reduced levels of mitochondrial Complex IV, Complex V, and acetylcholinesterase. These results demonstrate that experimental Alc-M is associated with inhibition of insulin/IGF/IRS and downstream signaling that mediates metabolism and cell survival, similar to findings in alcoholic liver and brain degeneration. Moreover, the increased oxidative stress, which could be mediated by mitochondrial dysfunction, may have led to inhibition of acetylcholinesterase, which itself is sufficient to cause myofiber atrophy and degeneration.

  1. Machine Translation

    Indian Academy of Sciences (India)

    Research Mt System Example: The 'Janus' Translating Phone Project. The Janus ... based on laptops, and simultaneous translation of two speakers in a dialogue. For more ..... The current focus in MT research is on using machine learning.

  2. Translation, adaptation and validation of the "Cultural and Psychosocial Influences on Disability (CUPID) Questionnaire" for use in Brazil.

    Science.gov (United States)

    Ferrari, Andrea Lepos; Baptista, Patricia Campos Pavan; Felli, Vanda Elisa Andres; Coggon, David

    2010-01-01

    The paper describes the adaptation and testing of the Cultural and Psychosocial Influences on Disability Questionnaire for use in Portuguese. The cross-cultural adaptation followed the steps of translation, back-translation, evaluation of the translations by a committee of judges, and then piloting of the pre-final version. This was performed in a sample of 40 nursing staff from the Hospital at the University of São Paulo. Adjustments were made after review of the translations by the committee of judges (CVI ≤ 80%). The pilot study was used to test whether questions could be satisfactorily understood and completed (≥ 85% of subjects). The Brazilian version of the Questionnaire is an adequate instrument for the ascertainment of occupational activities, psychosocial aspects of work, musculoskeletal symptoms and associated disabilities in nursing staff.

  3. Translating Proper Nouns: A Case Study on English Translation of Hafez's Lyrics

    Science.gov (United States)

    Shirinzadeh, Seyed Alireza; Mahadi, Tengku Sepora Tengku

    2014-01-01

    Proper nouns are regarded so simple that they might be taken for granted in translation explorations. Some may believe that they should not be translated in transmitting source texts to target texts. But, it is not the case; if one looks at present translations, he will notice that different strategies might be applied for translating proper…

  4. Adding Value by FM and CREM in Dutch hospitals

    NARCIS (Netherlands)

    van der Voordt, D.J.M.; Prevosth, J.; van der Zwart, J.

    2012-01-01

    Purpose: To explore if and how Dutch hospital managers steer on adding value by well-considered Facility Management (FM) and Corporate Real Estate Management (CREM), which values are leading, and how adding value is being translated into concrete interventions. Methodology: In addition to a review

  5. Translation and Quality Management

    DEFF Research Database (Denmark)

    Petersen, Margrethe

    1996-01-01

    theory which would seem likely to be of interest in this connection and section 2. gives a linguist's introduction to the part of the area of quality management which I consider relevant for present purposes. Section 3. is devoted to the case study of a small translation firm which has been certified......The aim of this article is to consider the issue of quality in translation. Specifically, the question under consideration is whether quality assurance in relation to translation is feasible and, if so, what some of the implications for translation theory, translation practice and the teaching...... of translation would be. To provide a backdrop against which the issue may be discussed, I present an overview of the two areas which seem most likely to hold potential answers, viz., that of translation theory and that of quality management. Section 1. gives a brief outline of some contributions to translation...

  6. Translation-Memory (TM) Research

    DEFF Research Database (Denmark)

    Schjoldager, Anne Gram; Christensen, Tina Paulsen

    2010-01-01

    to be representative of the research field as a whole. Our analysis suggests that, while considerable knowledge is available about the technical side of TMs, more research is needed to understand how translators interact with TM technology and how TMs influence translators' cognitive translation processes.......  It is no exaggeration to say that the advent of translation-memory (TM) systems in the translation profession has led to drastic changes in translators' processes and workflow, and yet, though many professional translators nowadays depend on some form of TM system, this has not been the object...... of much research. Our paper attempts to find out what we know about the nature, applications and influences of TM technology, including translators' interaction with TMs, and also how we know it. An essential part of the analysis is based on a selection of empirical TM studies, which we assume...

  7. Translation modalities: an investigation of the translated short story “Dez de dezembro”

    Directory of Open Access Journals (Sweden)

    Clara Peron da Silva Guedes

    2017-05-01

    Full Text Available During the translation process translators adopt linguistic strategies in order to make decisions that help to render a translated text suitable to the target language and culture. The translation modalities proposed by Aubert (105-10 constitute a tool that enables one to identify some of these strategies. In addition, they permit to measure the level of linguistic differentiation between a source text and a target text verifying the distance or the proximity of the target text to the linguistic and cultural issues of the source text. Thus, this paper aims to investigate the translation modalities in the short story “Dez de dezembro” (Saunders 204-38, a translation of the short story “Tenth of December” (Saunders 215-51. For quantifying the translation modalities in the translated text the noun phrases from the source text were selected and their counterparts in the target text were classified and annotated within Notepad++ software. The most recurrent translation modalities in the corpus were Literal Translation and Transposition, categories considered intermediate ones in the rank proposed by Aubert (105-10. Therefore, a relation of equivalence can be established between the target and the source texts.

  8. Discourse Analysis in Translator Training

    OpenAIRE

    Gülfidan Ayvaz

    2015-01-01

    Translator training enables students to gain experience in both linguistic parameters and translation practice. Discourse Analysis is one of the strategies that lead to a better translation process and quality in translation. In that regard, this study aims to present DA as a translation strategy for translation practice and a useful tool for translator training. The relationship between DA and Translator Training is not widely studied. Therefore this study aims to define DA and how it can be...

  9. Translation Competence and Translation Performance: Lexical, Syntactic and Textual Patterns in Student Translations of a Specialized EU Genre

    Science.gov (United States)

    Karoly, Adrienn

    2012-01-01

    This paper reports the findings of a study aiming to reveal the recurring patterns of lexical, syntactic and textual errors in student translations of a specialized EU genre from English into Hungarian. By comparing the student translations to the official translation of the text, this article uncovers the most frequent errors that students made…

  10. How Italian dialect poets translate themselves and how they translate other poets

    Directory of Open Access Journals (Sweden)

    Edoardo Zuccato

    2017-07-01

    Full Text Available Part one of this essay discusses the way most contemporary Italian dialect poets translate themselves into Italian. Part two of the essay examines examples of poetry translation into dialect made by some of the same contemporary authors. A comparison between the style of the self-translations, which is mainly lyrical, and the variety of styles of the translations from other poets, shows that each choice is an intentional strategy rather than a missed opportunity for a more creative self-translation, as some scholars have argued.

  11. Translation Memory and Computer Assisted Translation Tool for Medieval Texts

    Directory of Open Access Journals (Sweden)

    Törcsvári Attila

    2013-05-01

    Full Text Available Translation memories (TMs, as part of Computer Assisted Translation (CAT tools, support translators reusing portions of formerly translated text. Fencing books are good candidates for using TMs due to the high number of repeated terms. Medieval texts suffer a number of drawbacks that make hard even “simple” rewording to the modern version of the same language. The analyzed difficulties are: lack of systematic spelling, unusual word orders and typos in the original. A hypothesis is made and verified that even simple modernization increases legibility and it is feasible, also it is worthwhile to apply translation memories due to the numerous and even extremely long repeated terms. Therefore, methods and algorithms are presented 1. for automated transcription of medieval texts (when a limited training set is available, and 2. collection of repeated patterns. The efficiency of the algorithms is analyzed for recall and precision.

  12. Who translates the translation? (Retraduire les héros marginaux d'Alan Moore

    Directory of Open Access Journals (Sweden)

    Alice RAY

    2016-11-01

    Full Text Available The retranslation phenomenon is essential to the translation process. It is considered as the logical progression of this process which allows the translated literary work to regenerate in a restless cultural and language space. To a lesser extent, we can observe the same phenomenon in the translation of comics. However, this specific translation requires other competencies and a translating approach somehow different from the ones required to translate fiction literature, especially because of the presence of the visual system of drawings which is strongly bound to its own culture and the endless mutations it goes through. The comic book Watchmen (Les Gardiens, in the first French translation by Alan Moore and Dave Gibbons, is known in the whole world as the comic which had not only remodeled the vision we had of super-heroes, but had also given the comic books another voice. Watchmen was published between 1986 and 1987 in the United States and translated in French from 1987 to 1988. Fifteen years after this first translation by Jean-Patrick Manchette, Panini publishing decided to retranslate this famous comic in 2007. However, if the reviews of the first translation were laudatory, the retranslation did not enjoy a great reception from the readers or from the reviewers. This paper proposes a comparative analysis of both these translations and of their original version as well as an experiment on the readers, comic books readers or not, in order to establish why the first translation was a success and the retranslation a failure. Thus, we could withdraw the elements which allow us to understand the reception of comic translation.

  13. Differences in Adipose Tissue and Lean Mass Distribution in Patients with Collagen VI Related Myopathies Are Associated with Disease Severity and Physical Ability.

    Science.gov (United States)

    Rodríguez, M A; Del Rio Barquero, Luís M; Ortez, Carlos I; Jou, Cristina; Vigo, Meritxell; Medina, Julita; Febrer, Anna; Ramon-Krauel, Marta; Diaz-Manera, Jorge; Olive, Montse; González-Mera, Laura; Nascimento, Andres; Jimenez-Mallebrera, Cecilia

    2017-01-01

    Mutations in human collagen VI genes cause a spectrum of musculoskeletal conditions in children and adults collectively termed collagen VI-related myopathies (COL6-RM) characterized by a varying degree of muscle weakness and joint contractures and which include Ullrich Congenital Muscular Dystrophy (UCMD) and Bethlem Myopathy (BM). Given that collagen VI is one of the most abundant extracellular matrix proteins in adipose tissue and its emerging role in energy metabolism we hypothesized that collagen VI deficiency might be associated with alterations in adipose tissue distribution and adipokines serum profile. We analyzed body composition by means of dual-energy X-ray absorptiometry in 30 pediatric and adult COL6-RM myopathy patients representing a range of severities (UCMD, intermediate-COL6-RM, and BM). We found a distinctive pattern of regional adipose tissue accumulation which was more evident in children at the most severe end of the spectrum. In particular, the accumulation of fat in the android region was a distinguishing feature of UCMD patients. In parallel, there was a decrease in lean mass compatible with a state of sarcopenia, particularly in ambulant children with an intermediate phenotype. All children and adult patients that were sarcopenic were also obese. These changes were significantly more pronounced in children with collagen VI deficiency than in children with Duchenne Muscular Dystrophy of the same ambulatory status. High molecular weight adiponectin and leptin were significantly increased in sera from children in the intermediate and BM group. Correlation analysis showed that the parameters of fat mass were negatively associated with motor function according to several validated outcome measures. In contrast, lean mass parameters correlated positively with physical performance and quality of life. Leptin and adiponectin circulating levels correlated positively with fat mass parameters and negatively with lean mass and thus may be relevant to

  14. Differences in Adipose Tissue and Lean Mass Distribution in Patients with Collagen VI Related Myopathies Are Associated with Disease Severity and Physical Ability

    Directory of Open Access Journals (Sweden)

    M. A. Rodríguez

    2017-08-01

    Full Text Available Mutations in human collagen VI genes cause a spectrum of musculoskeletal conditions in children and adults collectively termed collagen VI-related myopathies (COL6-RM characterized by a varying degree of muscle weakness and joint contractures and which include Ullrich Congenital Muscular Dystrophy (UCMD and Bethlem Myopathy (BM. Given that collagen VI is one of the most abundant extracellular matrix proteins in adipose tissue and its emerging role in energy metabolism we hypothesized that collagen VI deficiency might be associated with alterations in adipose tissue distribution and adipokines serum profile. We analyzed body composition by means of dual-energy X-ray absorptiometry in 30 pediatric and adult COL6-RM myopathy patients representing a range of severities (UCMD, intermediate-COL6-RM, and BM. We found a distinctive pattern of regional adipose tissue accumulation which was more evident in children at the most severe end of the spectrum. In particular, the accumulation of fat in the android region was a distinguishing feature of UCMD patients. In parallel, there was a decrease in lean mass compatible with a state of sarcopenia, particularly in ambulant children with an intermediate phenotype. All children and adult patients that were sarcopenic were also obese. These changes were significantly more pronounced in children with collagen VI deficiency than in children with Duchenne Muscular Dystrophy of the same ambulatory status. High molecular weight adiponectin and leptin were significantly increased in sera from children in the intermediate and BM group. Correlation analysis showed that the parameters of fat mass were negatively associated with motor function according to several validated outcome measures. In contrast, lean mass parameters correlated positively with physical performance and quality of life. Leptin and adiponectin circulating levels correlated positively with fat mass parameters and negatively with lean mass and thus may

  15. Determinants of translation ambiguity

    Science.gov (United States)

    Degani, Tamar; Prior, Anat; Eddington, Chelsea M.; Arêas da Luz Fontes, Ana B.; Tokowicz, Natasha

    2016-01-01

    Ambiguity in translation is highly prevalent, and has consequences for second-language learning and for bilingual lexical processing. To better understand this phenomenon, the current study compared the determinants of translation ambiguity across four sets of translation norms from English to Spanish, Dutch, German and Hebrew. The number of translations an English word received was correlated across these different languages, and was also correlated with the number of senses the word has in English, demonstrating that translation ambiguity is partially determined by within-language semantic ambiguity. For semantically-ambiguous English words, the probability of the different translations in Spanish and Hebrew was predicted by the meaning-dominance structure in English, beyond the influence of other lexical and semantic factors, for bilinguals translating from their L1, and translating from their L2. These findings are consistent with models postulating direct access to meaning from L2 words for moderately-proficient bilinguals. PMID:27882188

  16. Adult-onset nemaline myopathy in a dog presenting with persistent atrial standstill and primary hypothyroidism.

    Science.gov (United States)

    Nakamura, R K; Russell, N J; Shelton, G D

    2012-06-01

    A nine-year-old neutered female mixed breed dog presented for evaluation following a five-day history of lethargy, inappetence, weakness, abdominal distension and generalised muscle atrophy. Persistent vatrial standstill with a junctional rhythm was identified on electrocardiogram. Echocardiogram identified moderate dilation of all cardiac chambers and mild thickening of the mitral and tricuspid valves. Serology was negative for Neospora caninum and Toxoplasma gondii. Permanent pacemaker implantation was performed in addition to endomyocardial and skeletal muscle biopsies. Cryosections from the biceps femoris muscle showed numerous nemaline rod bodies while endomyocardial biopsies were possibly consistent with end-stage myocarditis. Rod bodies have rarely been reported in the veterinary literature. To the authors' knowledge, this is the first report of adult-onset nemaline rod myopathy and hypothyroidism with concurrent cardiac disease in a dog. © 2012 British Small Animal Veterinary Association.

  17. Linguistic Levels of Translation: A Generic Exploration of Translation Difficulties in Literary Textual Corpus

    Directory of Open Access Journals (Sweden)

    Magda Madkour

    2016-11-01

    Full Text Available This case study research was based on a generic exploration of the translation problems that graduate students face in literary translation. Literary translation is fundamental to translation programs at higher education due to the upsurge that has occurred in publishing classical and modern literary works from various cultures. However, literary texts have special characteristics that make the process of transferring them from one language into another a daunting task. Translating literary texts is difficult even for professional translators because misinterpreting the messages of the source texts can lead to distorting the aesthetic aspects of the literary work. Students need to learn various linguistic levels of literary translation as well as strategies and methods of translation. Learning the linguistics levels of translation necessitates providing adequate training that is based on enhancing students’ cognitive abilities. Cognitive-based translation training helps students learn the procedures of solving the problems of translating sound and literary devices. Cognitive approaches are relevant to the translation process since cognition implies mental activities that students can use to understand and synthesize the literary text, and reconstruct it creatively. Therefore, the current study aimed at examining the relationship between cognitive teaching methodologies and students’ performance in literary translation. To examine this relationship, qualitative and quantitative data was collected from graduate students at the College of Languages and Translation at Imam Mohammed bin Saud Islamic University (IMAMU University, Riyadh, Saudi Arabia. In addition, corpus data was gathered from authentic literary texts including, novels, short stories, and poetry, to investigate the effect of linguistic analysis and cognitive strategies on the quality of literary translation. Quantitative data was analyzed using the Statistical Package for the

  18. Reversible tetraplegia after percutaneous nephrostolithotomy and septic shock: a case of critical illness polyneuropathy and myopathy with acute onset and complete recovery

    Directory of Open Access Journals (Sweden)

    Li Hai

    2013-02-01

    Full Text Available Abstract Background Critical illness polyneuropathy (CIP and critical illness myopathy (CIM are complications causing weakness of respiratory and limb muscles in critically ill patients. As an important differential diagnosis of Guillain-Barré syndrome (GBS, CIP and CIM should be diagnosed with caution, after a complete clinical and laboratory examination. Although not uncommon in ICU, CIP and CIM as severe complications of percutaneous nephrostolithotomy (PNL have not been documented in literature. Case presentation A 48-year-old Chinese woman was referred to our hospital, complaining of occasional pain in the right lower back for one month. Lithiasis was diagnosed by ultrasonographical and radiological examinations on the urinary system. PNL was indicated and performed. The patient developed CIP and CIM on the fourth day after PNL. Early recognition and treatment of the severe complications contributed to a satisfactory recovery of the patient. Conclusion This case expands our understanding of the complications of PNL and underscores the importance of differentiating CIP/CIM from GBS in case of such patients developing weakness after the treatment. Clinical characteristics and examination results should be carefully evaluated to make the diagnosis of CIP or CIM. Both anti-septic prophylaxis and control of hyperglycemia might be effective for the prevention of CIP or CIM; aggressive treatment on sepsis and multiple organ failure is considered to be the most effective measure to reduce the incidence of CIP/CIM.

  19. An analysis of machine translation and speech synthesis in speech-to-speech translation system

    OpenAIRE

    Hashimoto, K.; Yamagishi, J.; Byrne, W.; King, S.; Tokuda, K.

    2011-01-01

    This paper provides an analysis of the impacts of machine translation and speech synthesis on speech-to-speech translation systems. The speech-to-speech translation system consists of three components: speech recognition, machine translation and speech synthesis. Many techniques for integration of speech recognition and machine translation have been proposed. However, speech synthesis has not yet been considered. Therefore, in this paper, we focus on machine translation and speech synthesis, ...

  20. Effects of coenzyme Q10 on statin-induced myopathy: a meta-analysis of randomized controlled trials.

    Science.gov (United States)

    Banach, Maciej; Serban, Corina; Sahebkar, Amirhossein; Ursoniu, Sorin; Rysz, Jacek; Muntner, Paul; Toth, Peter P; Jones, Steven R; Rizzo, Manfredi; Glasser, Stephen P; Lip, Gregory Y H; Dragan, Simona; Mikhailidis, Dimitri P

    2015-01-01

    To evaluate the efficacy of coenzyme Q10 (CoQ10) supplementation on statin-induced myopathy. We searched the MEDLINE, Cochrane Library, Scopus, and EMBASE databases (November 1, 1987, to May 1, 2014) to identify randomized controlled trials investigating the impact of CoQ10 on muscle pain and plasma creatine kinase (CK) activity as 2 measures of statin-induced myalgia. Two independent reviewers extracted data on study characteristics, methods, and outcomes. We included 6 studies with 302 patients receiving statin therapy: 5 studies with 226 participants evaluated the effect of CoQ10 supplementation on plasma CK activity, and 5 studies (4 used in the CK analysis and 1 other study) with 253 participants were included to assess the effect of CoQ10 supplementation on muscle pain. Compared with the control group, plasma CK activity was increased after CoQ10 supplementation, but this change was not significant (mean difference, 11.69 U/L [to convert to μkat/L, multiply by 0.0167]; 95% CI, -14.25 to 37.63 U/L; P=.38). Likewise, CoQ10 supplementation had no significant effect on muscle pain despite a trend toward a decrease (standardized mean difference, -0.53; 95% CI, -1.33 to 0.28; P=.20). No dose-effect association between changes in plasma CK activity (slope, -0.001; 95% CI, -0.004 to 0.001; P=.33) or in the indices of muscle pain (slope, 0.002; 95% CI, -0.005 to 0.010; P=.67) and administered doses of CoQ10 were observed. The results of this meta-analysis of available randomized controlled trials do not suggest any significant benefit of CoQ10 supplementation in improving statin-induced myopathy. Larger, well-designed trials are necessary to confirm the findings from this meta-analysis. Copyright © 2015 Mayo Foundation for Medical Education and Research. Published by Elsevier Inc. All rights reserved.

  1. From corporate governance to hospital governance. Authority, transparency and accountability of Belgian non-profit hospitals' board and management.

    Science.gov (United States)

    Eeckloo, Kristof; Van Herck, Gustaaf; Van Hulle, Cynthia; Vleugels, Arthur

    2004-04-01

    As a result of multiple developments in health care and health care policy, hospital administrators, policy makers and researchers are increasingly challenged to reflect on the meaning of good hospital governance and how they can implement it in the hospital organisations. The question arises whether and to what extent governance models that have been developed within the corporate world can be valuable for these reflections. Due to the unique societal position of hospitals--which involves a large diversity of stakeholders--the claim for autonomy of various highly professional groups and the lack of clear business objectives, principles of corporate governance cannot be translated into the hospital sector without specific adjustments. However, irrespective of these contextual differences, corporate governance can provide for a comprehensive 'frame of reference', to which the hospital sector will have to give its own interpretation. A multidisciplinary research unit of the university of Leuven has taken the initiative to develop a governance model for Belgian hospitals. As part of the preliminary research work a survey has been performed among 82 hospitals of the Flemish Community on their governance structure, the composition of the governance entities, the partition of competencies and the relationship between management and medical staff.

  2. Translation Meets Cognitive Science: The Imprint of Translation on Cognitive Processing

    Science.gov (United States)

    Rojo, Ana

    2015-01-01

    Translation has long played a role in linguistic and literary studies research. More recently, the theoretical and methodological concerns of process research have given translation an additional role in cognitive science. The interest in the cognitive aspects of translation has led scholars to turn to disciplines such as cognitive linguistics,…

  3. Audiovisual Translation:A Critical Review on Sino-western Perspectives of Film Subtitle Translation

    OpenAIRE

    Junchen Zhang

    2018-01-01

    The paper argues the development of audiovisual translation (mainly focuses on the strand of film subtitle translation) in the West and China. Firstly, the paper discusses film translation from the perspective of the West and critically reviews the achievements produced by western researchers. Secondly, the paper analyzes film translation from Chinese perspective and outlines its change and development in Mainland China. Thirdly, some major issues exited in film translation such as cultural p...

  4. TRANSLATING BLACKNESS: A CHALLENGE TO TRANSLATION STUDIES IN CONTEMPORANEITY

    Directory of Open Access Journals (Sweden)

    Maria Aparecida Andrade Salgueiro

    2014-07-01

    Full Text Available The present article presents aspects of a work in progress about both African-American and Afro-Brazilian Literatures as well as Translation Studies. As it makes observations about how blackness has been translated in different contexts and geographical spaces, it calls the reader’s attention to power relations, processes of colonial and post-colonial identity construction, the rising of literary canons, cultural hegemony and globalization, demystifying spaces and showing translation as an activity that does not take place in a neutral space, but, for sure, inside social and political concrete situations.

  5. Word reading and translation in bilinguals: The impact of formal and informal translation expertise

    Directory of Open Access Journals (Sweden)

    Adolfo M. García

    2014-11-01

    Full Text Available Studies on bilingual word reading and translation have examined the effects of lexical variables (e.g., concreteness, cognate status by comparing groups of non-translators with varying levels of L2 proficiency. However, little attention has been paid to another relevant factor: translation expertise (TI. To explore this issue, we administered word reading and translation tasks to two groups of non-translators possessing different levels of informal TI (Experiment 1, and to three groups of bilinguals possessing different levels of translation training (Experiment 2. Reaction-time recordings showed that in all groups reading was faster than translation and unaffected by concreteness and cognate effects. Conversely, in both experiments, all groups translated concrete and cognate words faster than abstract and non-cognate words, respectively. Notably, an advantage of backward over forward translation was observed only for low-proficiency non-translators (in Experiment 1. Also, in Experiment 2, the modifications induced by translation expertise were more marked in the early than in the late stages of training and practice. The results suggest that TI contributes to modulating inter-equivalent connections in bilingual memory.

  6. Muscle sonography in six patients with hereditary inclusion body myopathy

    International Nuclear Information System (INIS)

    Adler, Ronald S.; Garolfalo, Giovanna; Paget, Stephen; Kagen, Lawrence

    2008-01-01

    To evaluate the morphological changes of muscle with sonography in six patients affected by hereditary inclusion body myopathy (HIBM). We studied a group of six Persian Jews diagnosed with HIBM. All were homozygous for the GNE mutation M712T. Ultrasonographic examinations of the quadriceps femoris and hamstring muscle groups were performed. A follow-up ultrasound examination was performed, after an interval of 3 years, in four of these patients. Muscles were assessed subjectively as to echogenicity, determined by gray-scale assessment, and loss of normal muscle morphology. Power Doppler sonography (PDS) was used to assess vascularity. A sonographic finding of central atrophy and peripheral sparing resulting in a target-like appearance was noted in the hamstring compartment of all six patients. The quadriceps compartment also showed involvement of the rectus femoris of all patients, which, in some cases, was the only muscle involved in the quadriceps. Vascularity was markedly reduced in the affected areas, with blood flow demonstrated in the peripherally spared areas. The severity of atrophy increased with disease duration. In this case series, we describe a new sonographic finding as well as document progression of HIBM disease, which has generally been described as quadriceps sparing. The myopathic target lesion, as well as isolated rectus femoris atrophy, may provide a useful adjunct to disease diagnosis. (orig.)

  7. [Statin associated myopathy in clinical practice. Results of DAMA study].

    Science.gov (United States)

    Millán, Jesús; Pedro-Botet, Juan; Climent, Elisenda; Millán, Joaquín; Rius, Joan

    Muscle symptoms, with or without elevation of creatin kinase are one of the main adverse effects of statin therapy, a fact that sometimes limits their use. The aim of this study was to evaluate the clinical characteristics of patients treated with statins who have complained muscle symptoms and to identify possible predictive factors. A cross-sectional one-visit, non-interventional, national multicenter study including patients of both sexes over 18 years of age referred for past or present muscle symptoms associated with statin therapy was conducted. 3,845 patients were recruited from a one-day record from 2,001 physicians. Myalgia was present in 78.2% of patients included in the study, myositis in 19.3%, and rhabdomyolysis in 2.5%. Patients reported muscle pain in 77.5% of statin-treated individuals, general weakness 42.7%, and cramps 28.1%. Kidney failure, intense physical exercise, alcohol consumption (>30g/d in men and 20g/d in women) and abdominal obesity were the clinical situations associated with statin myopathy. Myalgia followed by myositis are the most frequent statin-related side effects. It should be recommended control environmental factors such as intense exercise and alcohol intake as well as abdominal obesity and renal function of the patient treated with statins. Copyright © 2016 Sociedad Española de Arteriosclerosis. Publicado por Elsevier España, S.L.U. All rights reserved.

  8. What is a translator?

    Directory of Open Access Journals (Sweden)

    Martha Pulido

    2016-08-01

    Full Text Available I copied the title from Foucault’s text, "Qu'est-ce qu'un auteur" in Dits et écrits [1969], Paris, Gallimard, 1994, that I read in French, then in English in Donald F. Bouchard’s and Sherry Simon’s translation, and finally in Spanish in Yturbe Corina’s translation, and applied for the translator some of the analysis that Foucault presents to define the author. Foucault suggests that if we cannot define an author, at least we can see where their function is reflected. My purpose in this paper is to present those surfaces where the function of the translator is reflected or where it can be revealed, and to analyse the categories that could lead us to the elaboration of a suitable definition of a Translator. I dare already give a compound noun for the translator: Translator-Function.

  9. What is a translator?

    Directory of Open Access Journals (Sweden)

    Martha Martha Pulido

    2016-05-01

    Full Text Available I copied the title from Foucault’s text, "Qu'est-ce qu'un auteur" in Dits et écrits [1969], Paris, Gallimard, 1994, that I read in French, then in English in Donald F. Bouchard’s and Sherry Simon’s translation, and finally in Spanish in Yturbe Corina’s translation, and applied for the translator some of the analysis that Foucault presents to define the author. Foucault suggests that if we cannot define an author, at least we can see where their function is reflected. My purpose in this paper is to present those surfaces where the function of the translator is reflected or where it can be revealed, and to analyse the categories that could lead us to the elaboration of a suitable definition of a Translator. I dare already give a compound noun for the translator: Translator-Function.

  10. Learning by Translating: A Contrastive Methodology for ESP Learning and Translation

    Directory of Open Access Journals (Sweden)

    Sara Laviosa

    2015-11-01

    Full Text Available Over the last few years applied linguists have explored the possibility of integrating the insights of second language acquisition theories, contrastive analysis, foreign language teaching methodologies, and translation studies with a view to enhancing current communicative models and techniques for L2 teaching and translator training (see for example Sewell and Higgins 1996; Laviosa-Braithwaite 1997; Campbell 1998; Malmkjær 1998; Laviosa 2000; Colina 2002. We intend to make a contribution to this interdisciplinary orientation by putting forward a translation-based methodology for learning ESP vocabulary and grammar through real life mediating communicative activities. With particular reference to the translation task itself, we endeavour to provide teachers of English for special purposes and translator trainers with a methodology for guiding their students in producing, to the best of their abilities, a target text which meets the quality criteria of terminological accuracy and stylistic fluency, and is also effective in terms of the communicative situation it is intended for. After outlining the rationale and main theoretical approaches underpinning our work, we will illustrate our methodology for learning ESP vocabulary and translation skills from a contrastive perspective, as in our book Learning by Translating (Laviosa and Cleverton 2003.

  11. Translation and Intertextuality

    Directory of Open Access Journals (Sweden)

    Mohammad Rahimi

    2015-09-01

    Full Text Available This study is intends to describe and Presents a new theory of translation based on the "Intertextuality" unlike the Translation theories that presented to date, what all are based on the principle of "Equivalence". Our theory is based on the examples of Arabic poetry translated into Persian poetry. The major findings of this study show that the Intertextuality can serve as a link between the original text and the target. it can also interact with other texts is the translation result in the target language, Whtich is the book of poetic eloquence is addressed and was mentioned Literary robbery.

  12. Compositional translation

    NARCIS (Netherlands)

    Appelo, Lisette; Janssen, Theo; Jong, de F.M.G.; Landsbergen, S.P.J.

    1994-01-01

    This book provides an in-depth review of machine translation by discussing in detail a particular method, called compositional translation, and a particular system, Rosetta, which is based on this method. The Rosetta project is a unique combination of fundamental research and large-scale

  13. Gyrate atrophy of choroid and retina with myopia, cataract and systemic proximal myopathy: A rare case report from rural India

    Directory of Open Access Journals (Sweden)

    Surekha Bangal

    2012-12-01

    Full Text Available AbstractGyrate atrophy is a rare metabolic disease with autosomal recessive inheritance pattern characterised by hyperornithinemia and typical ocular findings. This report presents a 17-year-old intellectually challenged girl consulting for a progressive fall of visual acuity with night blindness. Fundus examination showed patches of chorioretinal atrophy with typical scalloped borders and peri vascular pigmentation in the equatorial region. Fundus fluroscein angiography revealed characteristic staining pattern. Other ocular associations included myopia and posterior sub capsular cataract. Progressive systemic proximal myopathy was one of the associated features. Dietary supplementation of vitamin B6 was advised.

  14. Sound Effects in Translation

    DEFF Research Database (Denmark)

    Mees, Inger M.; Dragsted, Barbara; Gorm Hansen, Inge

    2013-01-01

    On the basis of a pilot study using speech recognition (SR) software, this paper attempts to illustrate the benefits of adopting an interdisciplinary approach in translator training. It shows how the collaboration between phoneticians, translators and interpreters can (1) advance research, (2) have......), Translog was employed to measure task times. The quality of the products was assessed by three experienced translators, and the number and types of misrecognitions were identified by a phonetician. Results indicate that SR translation provides a potentially useful supplement to written translation...

  15. Translation Training in the Jordanian Context: Curriculum Evaluation in Translator Education

    Science.gov (United States)

    Mahasneh, Anjad

    2013-01-01

    This study aims at drawing a clear picture of translator training in Jordan through the evaluation of translation programs at the Master's level. The framework of the Context, Input, Process, and Product components of the CIPP evaluation model developed by Daniel Stufflebeam in 1971 was used to evaluate the three translation Master's programs at…

  16. Measuring Difficulty in English-Chinese Translation: Towards a General Model of Translation Difficulty

    Science.gov (United States)

    Sun, Sanjun

    2012-01-01

    Accurate assessment of a text's level of translation difficulty is critical for translator training and accreditation, translation research, and the language industry as well. Traditionally, people rely on their general impression to gauge a text's translation difficulty level. If the evaluation process is to be more effective and the…

  17. Danish translation and validation of the International Skin Tear Advisory Panel Skin Tear Classification System

    DEFF Research Database (Denmark)

    Skiveren, J; Bermark, S; LeBlanc, K

    2015-01-01

    OBJECTIVE: The aim of this study was to translate, validate and establish reliability of the International Skin Tear Classification System in Danish. METHOD: Phase 1 of the project involved the translation of the International Skin Tear Advisory Panel (ISTAP) Skin Tear Classification System......) and social and health-care assistants (non-RN) from both primary health care and a Danish university hospital in Copenhagen. Thirty photographs, with equal representation of the three types of skin tears, were selected to test validity. The photographs chosen were those originally used for internal...... and external validation by the ISTAP group. The subjects were approached in their place of work and invited to participate in the study and to attend an educational session related to skin tears. RESULTS: The Danish translation of the ISTAP classification system was tested on 270 non-wound specialists...

  18. Translator-computer interaction in action

    DEFF Research Database (Denmark)

    Bundgaard, Kristine; Christensen, Tina Paulsen; Schjoldager, Anne

    2016-01-01

    perspective, this paper investigates the relationship between machines and humans in the field of translation, analysing a CAT process in which machine-translation (MT) technology was integrated into a translation-memory (TM) suite. After a review of empirical research into the impact of CAT tools......Though we lack empirically-based knowledge of the impact of computer-aided translation (CAT) tools on translation processes, it is generally agreed that all professional translators are now involved in some kind of translator-computer interaction (TCI), using O’Brien’s (2012) term. Taking a TCI......, the study indicates that the tool helps the translator conform to project and customer requirements....

  19. Genetics Home Reference: FBXL4-related encephalomyopathic mitochondrial DNA depletion syndrome

    Science.gov (United States)

    ... Additional NIH Resources (1 link) National Institute of Neurological Disorders and Stroke: Mitochondrial Myopathy Information Page Educational Resources (3 links) Cincinnati Children's Hospital: Mitochondrial Diseases Kennedy Krieger Institute: Mitochondrial Disorders ...

  20. Computer-aided translation tools

    DEFF Research Database (Denmark)

    Christensen, Tina Paulsen; Schjoldager, Anne

    2016-01-01

    in Denmark is rather high in general, but limited in the case of machine translation (MT) tools: While most TSPs use translation-memory (TM) software, often in combination with a terminology management system (TMS), only very few have implemented MT, which is criticised for its low quality output, especially......The paper reports on a questionnaire survey from 2013 of the uptake and use of computer-aided translation (CAT) tools by Danish translation service providers (TSPs) and discusses how these tools appear to have impacted on the Danish translation industry. According to our results, the uptake...

  1. The spectrum of myopathies in the city of São Paulo

    Directory of Open Access Journals (Sweden)

    José A. Levy

    1976-12-01

    Full Text Available A review of all myopathic patients treated at the Neurologic Clinic of the Medical School of the University of São Paulo during the past 15 years is reported. A total of 466 cases were examined and distributed as follows: 56% of progressive muscular dystrophy; 31% of myasthenia gravis; 6% of polymyositis; 4% of myotonic dystrophy; and the remainder of several different diseases (central core disease, Kearns-syndrome, myotonia congenita, adynamia episodica hereditaria, diabetic myopathy and Eaton-Lambert syndrome. Enzymatic dosages, electromyography, muscle biopsy, electrocardiography and genetic counselling are also reported.Os autores fazem uma revisão de todos os casos de miopatias tratados na Clínica Neurológica da F.M.U.S.P. durante os últimos 15 anos. Foram examinados 466 casos, assim distribuídos: 56% de distrofia muscular progressiva; 31% de miastenia grave; 6% de polimiosite; 4% de distrofia miotônica e, o restante, de várias outras moléstias (Central core disease, síndrome de Kearns, miotonia congênita, adinamia episódica hereditária, miopatia diabética e síndrome de Eaton-Lambert. São relatadas também as dosagens enzimáticas, eletromiografia, biópsia muscular, eletrocardiografia e aconselhamento genético.

  2. The Community Mentorship Program: Providing Community-Engagement Opportunities for Early-Stage Clinical and Translational Scientists to Facilitate Research Translation.

    Science.gov (United States)

    Patino, Cecilia M; Kubicek, Katrina; Robles, Marisela; Kiger, Holly; Dzekov, Jeanne

    2017-02-01

    A goal of the Southern California Clinical and Translational Science Institute (SC-CTSI) at the University of Southern California and Children's Hospital Los Angeles is to train early-stage clinical and translational scientists (CTSs) to conduct research that improves the health of diverse communities. This goal aligns well with the Institute of Medicine's recommendations emphasizing community engagement in biomedical research that facilitates research translation. The Community Mentorship Program (CMP), created to complement community-engaged research didactics, matches CTSs with community mentors who help them identify and complete community-engaged experiences that inform their research. The CMP was piloted in 2013-2015 by the SC-CTSI Workforce Development and Community Engagement cores. The CMP team matched three CTSs (assistant professors pursuing mentored career development awards) with mentors at community-based organizations (CBOs) aligned with their research interests. Each mentor-mentee pair signed a memorandum of understanding. The CMP team checked in regularly, monitoring progress and addressing challenges in CTSs' completion of their community-engaged experience. Each pair completed at least one community-engaged activity informing the CTS's research. In exit interviews, the CTSs and CBO mentors expressed satisfaction with the program and stated that they would continue to work together. The CTSs reported that the program provided opportunities to develop networks outside academia, build trust within the community, and receive feedback and learn from individuals in communities affected by their research. The CMP will be expanded to include all eligible early-career CTSs and promoted for use in similar settings outside the SC-CTSI.

  3. Myotubular myopathy and the neuromuscular junction: a novel therapeutic approach from mouse models

    Directory of Open Access Journals (Sweden)

    James J. Dowling

    2012-11-01

    Myotubular myopathy (MTM is a severe congenital muscle disease characterized by profound weakness, early respiratory failure and premature lethality. MTM is defined by muscle biopsy findings that include centralized nuclei and disorganization of perinuclear organelles. No treatments currently exist for MTM. We hypothesized that aberrant neuromuscular junction (NMJ transmission is an important and potentially treatable aspect of the disease pathogenesis. We tested this hypothesis in two murine models of MTM. In both models we uncovered evidence of a disorder of NMJ transmission: fatigable weakness, improved strength with neostigmine, and electrodecrement with repetitive nerve stimulation. Histopathological analysis revealed abnormalities in the organization, appearance and size of individual NMJs, abnormalities that correlated with changes in acetylcholine receptor gene expression and subcellular localization. We additionally determined the ability of pyridostigmine, an acetylcholinesterase inhibitor, to ameliorate aspects of the behavioral phenotype related to NMJ dysfunction. Pyridostigmine treatment resulted in significant improvement in fatigable weakness and treadmill endurance. In all, these results describe a newly identified pathological abnormality in MTM, and uncover a potential disease-modifying therapy for this devastating disorder.

  4. Translation goes to the movies

    CERN Document Server

    Cronin, Michael

    2008-01-01

    This highly accessible introduction to translation theory, written by a leading author in the field, uses the genre of film to bring the main themes in translation to life. Through analyzing films as diverse as the Marx Brothers' A Night at the Opera, The Star Wars Trilogies and Lost in Translation, the reader is encouraged to think about both issues and problems of translation as they are played out on the screen and issues of filmic representation through examining the translation dimension of specific films. In highlighting how translation has featured in both mainstream commercial and arthouse films over the years, Cronin shows how translation has been a concern of filmmakers dealing with questions of culture, identity, conflict and representation. This book is a lively and accessible text for translation theory courses and offers a new and largely unexplored approach to topics of identity and representation on screen. Translation Goes to the Movies will be of interest to those on translation studies...

  5. Effects of reduced dietary energy and amino acid density on Pectoralis major myopathies in broiler chickens at 36 and 49 days of age1.

    Science.gov (United States)

    Meloche, K J; Fancher, B I; Emmerson, D A; Bilgili, S F; Dozier, W A

    2018-05-01

    Two experiments (Exp) were conducted to determine if reductions in the incidence and severity of wooden breast (WB) and white striping (WS) may be obtained by reducing dietary nutrient density. In each Exp, Yield Plus × Ross 708 male broiler chicks were placed into 63 pens (22 birds/pen). All birds received an identical prestarter diet until 7 d of age, after which time each pen was randomly assigned to 1 of the following 7 dietary treatments (TRT) for the starter (8 to 14 d), grower (15 to 24 d), finisher 1 (Exp 1: 26 to 35 d; Exp 2: 26 to 42 d), and withdrawal (Exp 2: 43 to 48 d) phases: 1) 100% of primary breeder recommendations for digestible amino acid and metabolizable energy density throughout Exp; 2) 95% of TRT 1 until 14 d of age, then as TRT 1; 3) 95% of TRT 1 until 24 d of age, then as TRT 1; 4) 95% of TRT 1 throughout Exp; 5) 90% of TRT 1 until 14 d of age, then as TRT 1; 6) 90% of TRT 1 until 24 d of age, then as TRT 1; 7) 90% of TRT 1 throughout Exp. At 36 d (Exp 1) and 49 d (Exp 2), 18 birds per pen were processed and evaluated for WS and WB. In Exp 1, reduced dietary density in the starter phase (TRT 2 and TRT 5) resulted in increased (P ≤ 0.05) incidences of severe WB (32.9% and 34.7%) relative to TRT 1 (18.2%). In Exp 2, broilers assigned to TRT 7 had reduced (P 36.5%; WS: 64.5%). In both Exp, plasma creatine kinase and lactate dehydrogenase increased (P ≤ 0.05) with increasing scores for WB and WS. Reducing dietary nutrient density from 8 to 14 d may exacerbate fillet myopathies in broilers reared to 35 d of age. Although reducing dietary energy and amino acid density to 90% of recommendations from 1 to 48 d reduced the severity of myopathies, these reductions occurred with compromises in live performance. Altogether, these results indicated that concurrent manipulation of dietary amino acid and energy density is not a viable practical solution for breast myopathies.

  6. Jungmann's translation of Paradise Lost

    OpenAIRE

    Janů, Karel

    2014-01-01

    This thesis examines Josef Jungmann's translation of John Milton's Paradise Lost. Josef Jungmann was one of the leading figures of the Czech National Revival and translated Milton 's poem between the years 1800 and 1804. The thesis covers Jungmann's theoretical model of translation and presents Jungmann's motives for translation of Milton's epic poem. The paper also describes the aims Jungmann had with his translation and whether he has achieved them. The reception Jungmann's translation rece...

  7. Genetics Home Reference: RRM2B-related mitochondrial DNA depletion syndrome, encephalomyopathic form with renal ...

    Science.gov (United States)

    ... Additional NIH Resources (1 link) National Institute of Neurological Disorders and Stroke: Mitochondrial Myopathy Information Page Educational Resources (7 links) Cincinnati Children's Hospital: Mitochondrial Diseases Disease InfoSearch: Mitochondrial DNA depletion ...

  8. Theory of Test Translation Error

    Science.gov (United States)

    Solano-Flores, Guillermo; Backhoff, Eduardo; Contreras-Nino, Luis Angel

    2009-01-01

    In this article, we present a theory of test translation whose intent is to provide the conceptual foundation for effective, systematic work in the process of test translation and test translation review. According to the theory, translation error is multidimensional; it is not simply the consequence of defective translation but an inevitable fact…

  9. JavaScript DNA translator: DNA-aligned protein translations.

    Science.gov (United States)

    Perry, William L

    2002-12-01

    There are many instances in molecular biology when it is necessary to identify ORFs in a DNA sequence. While programs exist for displaying protein translations in multiple ORFs in alignment with a DNA sequence, they are often expensive, exist as add-ons to software that must be purchased, or are only compatible with a particular operating system. JavaScript DNA Translator is a shareware application written in JavaScript, a scripting language interpreted by the Netscape Communicator and Internet Explorer Web browsers, which makes it compatible with several different operating systems. While the program uses a familiar Web page interface, it requires no connection to the Internet since calculations are performed on the user's own computer. The program analyzes one or multiple DNA sequences and generates translations in up to six reading frames aligned to a DNA sequence, in addition to displaying translations as separate sequences in FASTA format. ORFs within a reading frame can also be displayed as separate sequences. Flexible formatting options are provided, including the ability to hide ORFs below a minimum size specified by the user. The program is available free of charge at the BioTechniques Software Library (www.Biotechniques.com).

  10. [The early medical textbooks in Korea: medical textbooks published at Je Joong Won-Severance Hospital Medical School].

    Science.gov (United States)

    Park, H W

    1998-01-01

    Kwang Hye Won(Je Joong Won), the first western hospital in Korea, was founded in 1885. The first western Medical School in Korea was open in 1886 under the hospital management. Dr. O. R. Avison, who came to Korea in 1893, resumed the medical education there, which was interrupted for some time before his arrival in Korea. He inaugurated translating and publishing medical textbooks with the help of Kim Pil Soon who later became one of the first seven graduates in Severance Hospital Medical School. The first western medical textbook translated into Korean was Henry Gray's Anatomy. However, these twice-translated manuscripts were never to be published on account of being lost and burnt down. The existing early anatomy textbooks, the editions of 1906 and 1909, are not the translation of Gray's Anatomy, but that of Japanese anatomy textbook of Gonda. The remaining oldest medical textbook in Korean is Inorganic Materia Medica published in 1905. This book is unique among its kind that O. R. Avison is the only translator of the book and it contains the prefaces of O. R. Avison and Kim Pil Soon. The publication of medical textbook was animated by the participation of other medical students, such as Hong Suk Hoo and Hong Jong Eun. The list of medical textbooks published includes almost all the field of medicine. The medical textbooks in actual existence are as follows: Inorganic Materia Medica (1905), Inorganic Chemistry (1906), Anatomy I (1906), Physiology (1906), Diagnostics I (1906), Diagnostics II (1907), Obstetrics (1908), Organic Chemistry (1909), Anatomy (1909), and Surgery (1910).

  11. Lost in Translation

    Science.gov (United States)

    Lass, Wiebke; Reusswig, Fritz

    2014-05-01

    Lost in Translation? Introducing Planetary Boundaries into Social Systems. Fritz Reusswig, Wiebke Lass Potsdam Institute for Climate Impact Research, Potsdam, Germany Identifying and quantifying planetary boundaries by interdisciplinary science efforts is a challenging task—and a risky one, as the 1972 Limits to Growth publication has shown. Even if we may be assured that scientific understanding of underlying processes of the Earth system has significantly improved since then, the challenge of translating these findings into the social systems of the planet remains crucial for any kind of action, and in many respects far more challenging. We would like to conceptualize what could also be termed a problem of coupling social and natural systems as a nested set of social translation processes, well aware of the limited applicability of the language-related translation metaphor. Societies must, first, perceive these boundaries, and they have to understand their relevance. This includes, among many other things, the organization of transdisciplinary scientific cooperation. They will then have to translate this understood perception into possible actions, i.e. strategies for different local bodies, actors, and institutional settings. This implies a lot of 'internal' translation processes, e.g. from the scientific subsystem to the mass media, the political and the economic subsystem. And it implies to develop subsystem-specific schemes of evaluation for these alternatives, e.g. convincing narratives, cost-benefit analyses, or ethical legitimacy considerations. And, finally, societies do have to translate chosen action alternatives into monitoring and evaluation schemes, e.g. for agricultural production or renewable energies. This process includes the continuation of observing and re-analyzing the planetary boundary concept itself, as a re-adjustment of these boundaries in the light of new scientific insights cannot be excluded. Taken all together, societies may well

  12. Translation and Creation

    Directory of Open Access Journals (Sweden)

    Paulo Bezerra

    2012-12-01

    Full Text Available The article begins with the differences betweenscientific and fictional translations, and focus on the second.The fictional translation works with meanings, opens itselfto the plurissignification in the purpose to create a similarity of the dissimilarity; in this process, the translator does nottranslate a language, but what a creative individuality makeswith a language. At last there is an approach to the knowledgeand skills necessaries to a translator of literature: theknowledge of the theories of the literature and of thetranslation, the capacity to preserve the national color ofthe original text and at the same time to respect the arrivallanguage, and the sensibility to his national languagevariations present in the daily and in the literary spheres.

  13. Autophagy, inflammation and innate immunity in inflammatory myopathies.

    Directory of Open Access Journals (Sweden)

    Cristina Cappelletti

    Full Text Available Autophagy has a large range of physiological functions and its dysregulation contributes to several human disorders, including autoinflammatory/autoimmune diseases such as inflammatory myopathies (IIMs. In order to better understand the pathogenetic mechanisms of these muscular disorders, we sought to define the role of autophagic processes and their relation with the innate immune system in the three main subtypes of IIM, specifically sporadic inclusion body myositis (sIBM, polymyositis (PM, dermatomyositis (DM and juvenile dermatomyositis (JDM. We found that although the mRNA transcript levels of the autophagy-related genes BECN1, ATG5 and FBXO32 were similar in IIM and controls, autophagy activation in all IIM subgroups was suggested by immunoblotting results and confirmed by immunofluorescence. TLR4 and TLR3, two potent inducers of autophagy, were highly increased in IIM, with TLR4 transcripts significantly more expressed in PM and DM than in JDM, sIBM and controls, and TLR3 transcripts highly up-regulated in all IIM subgroups compared to controls. Co-localization between autophagic marker, LC3, and TLR4 and TLR3 was observed not only in sIBM but also in PM, DM and JDM muscle tissues. Furthermore, a highly association with the autophagic processes was observed in all IIM subgroups also for some TLR4 ligands, endogenous and bacterial HSP60, other than the high-mobility group box 1 (HMGB1. These findings indicate that autophagic processes are active not only in sIBM but also in PM, DM and JDM, probably in response to an exogenous or endogenous 'danger signal'. However, autophagic activation and regulation, and also interaction with the innate immune system, differ in each type of IIM. Better understanding of these differences may lead to new therapies for the different IIM types.

  14. Translating Alcohol Research

    Science.gov (United States)

    Batman, Angela M.; Miles, Michael F.

    2015-01-01

    Alcohol use disorder (AUD) and its sequelae impose a major burden on the public health of the United States, and adequate long-term control of this disorder has not been achieved. Molecular and behavioral basic science research findings are providing the groundwork for understanding the mechanisms underlying AUD and have identified multiple candidate targets for ongoing clinical trials. However, the translation of basic research or clinical findings into improved therapeutic approaches for AUD must become more efficient. Translational research is a multistage process of streamlining the movement of basic biomedical research findings into clinical research and then to the clinical target populations. This process demands efficient bidirectional communication across basic, applied, and clinical science as well as with clinical practitioners. Ongoing work suggests rapid progress is being made with an evolving translational framework within the alcohol research field. This is helped by multiple interdisciplinary collaborative research structures that have been developed to advance translational work on AUD. Moreover, the integration of systems biology approaches with collaborative clinical studies may yield novel insights for future translational success. Finally, appreciation of genetic variation in pharmacological or behavioral treatment responses and optimal communication from bench to bedside and back may strengthen the success of translational research applications to AUD. PMID:26259085

  15. On Literal Translation of English Idioms

    Science.gov (United States)

    Chen, Linli

    2009-01-01

    There are six translation tactics in translating English idioms into Chinese: literal translation, compensatory translation, free translation, explanational translation, borrowing, integrated approach. Each tactic should be reasonably employed in the process of translating, so as to keep the flavor of the original English idioms as well as to…

  16. A Study of Translation Institutional Ethics

    Institute of Scientific and Technical Information of China (English)

    LuoXianfeng; ZhouJin

    2017-01-01

    Traditional translation ethics characterized by translators' ethics cannot provide a strong moral support to the translation practice,or guarantee the moral requirement towards translation activities in the social transformation caused by the market economy,because it does not have the power of punishment.Translation institutional ethics,however,a new form of translation ethics,integrates the translation ethic norm,translation regulations and relative laws together.As an inevitable outcome in the new era,it can escort the orderly and healthy translation activities.Its purpose is to strengthen the translators' moral consciousness,to sublimate their moral notions and to transfer from heteronomy to autonomy.

  17. Translation, adaptation and validation of the diabetes distress scale for Indonesian diabetic outpatients with various types of complications

    NARCIS (Netherlands)

    Arifin, B.; Perwitasari, D.; Atthobari, J.; Cao, Q.; Krabbe, P.F.; Postma, M.J.

    2016-01-01

    Objectives: To translate, adapt and validate the Diabetes Distress Scale (DDS) instrument for Indonesian type 2 diabetes mellitus (T2DM) outpatients with various types of complications. Methods: Participants were recruited from four hospitals and two primary healthcare facilities. The procedure of

  18. Safety climate in Swiss hospital units: Swiss version of the Safety Climate Survey

    Science.gov (United States)

    Gehring, Katrin; Mascherek, Anna C.; Bezzola, Paula

    2015-01-01

    Abstract Rationale, aims and objectives Safety climate measurements are a broadly used element of improvement initiatives. In order to provide a sound and easy‐to‐administer instrument for the use in Swiss hospitals, we translated the Safety Climate Survey into German and French. Methods After translating the Safety Climate Survey into French and German, a cross‐sectional survey study was conducted with health care professionals (HCPs) in operating room (OR) teams and on OR‐related wards in 10 Swiss hospitals. Validity of the instrument was examined by means of Cronbach's alpha and missing rates of the single items. Item‐descriptive statistics group differences and percentage of ‘problematic responses’ (PPR) were calculated. Results 3153 HCPs completed the survey (response rate: 63.4%). 1308 individuals were excluded from the analyses because of a profession other than doctor or nurse or invalid answers (n = 1845; nurses = 1321, doctors = 523). Internal consistency of the translated Safety Climate Survey was good (Cronbach's alpha G erman = 0.86; Cronbach's alpha F rench = 0.84). Missing rates at item level were rather low (0.23–4.3%). We found significant group differences in safety climate values regarding profession, managerial function, work area and time spent in direct patient care. At item level, 14 out of 21 items showed a PPR higher than 10%. Conclusions Results indicate that the French and German translations of the Safety Climate Survey might be a useful measurement instrument for safety climate in Swiss hospital units. Analyses at item level allow for differentiating facets of safety climate into more positive and critical safety climate aspects. PMID:25656302

  19. [Use of pharmacogenetic testing to prevent adverse drug reactions during statin therapy].

    Science.gov (United States)

    Rumyantsev, N A; Kukes, V G; Kazakov, R E; Rumyantsev, A A; Sychev, D A

    The number of patients receiving statins increases every year and due to the fact that they should take statins during their lives, the problem of their safety use comes to the forefront. The paper analyzes the safety of using the medications of this group and discusses the diagnosis of myopathies induced by statins and the occurrence of immune-mediated statin myopathies. It considers a personalized approach to prescribing statins, analyzes Russian and foreign experience in using pharmacogenetics to reduce the risk of myopathies, publishes the results of the authors' experience in clinically introducing pharmacogenetic testing at hospitals, and analyzes the long-term results of determining the polymorphism of the SLCO1B1 gene for the prediction of the risk of adverse events when using statins and estimating patient compliance to prescribed treatment.

  20. Comparison of blood aminotransferase methods for assessment of myopathy and hepatopathy in Florida manatees (Trichechus manatus latirostris).

    Science.gov (United States)

    Harr, Kendal E; Allison, Kathryn; Bonde, Robert K; Murphy, David; Harvey, John W

    2008-06-01

    Muscle injury is common in Florida manatees (Trichechus manatus latirostris). Plasma aspartate aminotransferase (AST) is frequently used to assess muscular damage in capture myopathy and traumatic injury. Therefore, accurate measurement of AST and alanine aminotransferase (ALT) is important in managed, free-ranging animals, as well as in those rehabilitating from injury. Activities of these enzymes, however, are usually not increased in manatees with either acute or chronic muscle damage, despite marked increases in plasma creatine kinase activity. It is hypothesized that this absence of response is due to apoenzymes in the blood not detected by commonly used veterinary assays. Addition of coenzyme pyridoxal-5-phosphate (P5P or vitamin B6) should, therefore, result in higher measured enzyme activities. The objective of this study was to determine the most accurate, precise, and diagnostically useful method for aminotransferase measurement in manatees that can be used in veterinary practices and diagnostic laboratories. Additionally, appropriate collection and storage techniques were assessed. The use of an optimized commercial wet chemical assay with 100 micromol P5P resulted in a positive bias of measured enzyme activities in a healthy population of animals. However, AST and ALT were still much lower than that typically observed in domestic animals and should not be used alone in the assessment of capture myopathy and muscular trauma. Additionally, the dry chemistry analyzer, typically used in clinics, reported significantly higher and less precise AST and ALT activities with poor correlation to those measured with wet chemical methods found in diagnostic laboratories. Therefore, these results cannot be clinically compared. Overall, the optimized wet chemical method was the most precise and diagnostically useful measurement of aminotransferase in samples. Additionally, there was a statistically significant difference between paired serum and plasma measurement