WorldWideScience

Sample records for hormone gene promoter

  1. [Divergence of paralogous growth-hormone-encoding genes and their promoters in Salmonidae].

    Science.gov (United States)

    Kamenskaya, D N; Pankova, M V; Atopkin, D M; Brykov, V A

    2017-01-01

    In many fish species, including salmonids, the growth-hormone is encoded by two duplicated paralogous genes, gh1 and gh2. Both genes were already in place at the time of divergence of species in this group. A comparison of the entire sequence of these genes of salmonids has shown that their conserved regions are associated with exons, while their most variable regions correspond to introns. Introns C and D include putative regulatory elements (sites Pit-1, CRE, and ERE), that are also conserved. In chars, the degree of polymorphism of gh2 gene is 2-3 times as large as that in gh1 gene. However, a comparison across all Salmonidae species would not extent this observation to other species. In both these chars' genes, the promoters are conserved mainly because they correspond to putative regulatory sequences (TATA box, binding sites for the pituitary transcription factor Pit-1 (F1-F4), CRE, GRE and RAR/RXR elements). The promoter of gh2 gene has a greater degree of polymorphism compared with gh1 gene promoter in all investigated species of salmonids. The observed differences in the rates of accumulation of changes in growth hormone encoding paralogs could be explained by differences in the intensity of selection.

  2. Human sex hormone-binding globulin gene expression- multiple promoters and complex alternative splicing

    Directory of Open Access Journals (Sweden)

    Rosner William

    2009-05-01

    Full Text Available Abstract Background Human sex hormone-binding globulin (SHBG regulates free sex steroid concentrations in plasma and modulates rapid, membrane based steroid signaling. SHBG is encoded by an eight exon-long transcript whose expression is regulated by a downstream promoter (PL. The SHBG gene was previously shown to express a second major transcript of unknown function, derived from an upstream promoter (PT, and two minor transcripts. Results We report that transcriptional expression of the human SHBG gene is far more complex than previously described. PL and PT direct the expression of at least six independent transcripts each, resulting from alternative splicing of exons 4, 5, 6, and/or 7. We mapped two transcriptional start sites downstream of PL and PT, and present evidence for a third SHBG gene promoter (PN within the neighboring FXR2 gene; PN regulates the expression of at least seven independent SHBG gene transcripts, each possessing a novel, 164-nt first exon (1N. Transcriptional expression patterns were generated for human prostate, breast, testis, liver, and brain, and the LNCaP, MCF-7, and HepG2 cell lines. Each expresses the SHBG transcript, albeit in varying abundance. Alternative splicing was more pronounced in the cancer cell lines. PL- PT- and PN-derived transcripts were most abundant in liver, testis, and prostate, respectively. Initial findings reveal the existence of a smaller immunoreactive SHBG species in LNCaP, MCF-7, and HepG2 cells. Conclusion These results extend our understanding of human SHBG gene transcription, and raise new and important questions regarding the role of novel alternatively spliced transcripts, their function in hormonally responsive tissues including the breast and prostate, and the role that aberrant SHBG gene expression may play in cancer.

  3. Negative regulation of human parathyroid hormone gene promoter by vitamin D3 through nuclear factor Y

    International Nuclear Information System (INIS)

    Jaeaeskelaeinen, T.; Huhtakangas, J.; Maeenpaeae, P.H.

    2005-01-01

    The negative regulation of the human parathyroid hormone (PTH) gene by biologically active vitamin D 3 (1,25-dihydroxyvitamin D 3 ; 1,25(OH) 2 D 3 ) was studied in rat pituitary GH4C1 cells, which express factors needed for the negative regulation. We report here that NF-Y binds to sequences downstream of the site previously reported to bind the vitamin D receptor (VDR). Additional binding sites for NF-Y reside in the near vicinity and were shown to be important for full activity of the PTH gene promoter. VDR and NF-Y were shown to exhibit mutually exclusive binding to the VDRE region. According to our results, sequestration of binding partners for NF-Y by VDR also affects transcription through a NF-Y consensus binding element in GH4C1 but not in ROS17/2.8 cells. These results indicate that 1,25(OH) 2 D 3 may affect transcription of the human PTH gene both by competitive binding of VDR and NF-Y, and by modulating transcriptional activity of NF-Y

  4. Interaction between the thyroid hormone receptor and co-factors on the promoter of the gene encoding phospho enol pyruvate carboxykinase

    NARCIS (Netherlands)

    Schmidt, E. D.; van Beeren, M.; Glass, C. K.; Wiersinga, W. M.; Lamers, W. H.

    1993-01-01

    Using transient transfection studies we localized a thyroid hormone-responsive element on the promoter of the rat phospho-enol pyruvate carboxykinase gene between 355 and 174 bp upstream of the transcription start site. DNAse 1 footprinting analysis within this region showed that a 28 bp fragment at

  5. Functional analysis of the promoter of the molt-inhibiting hormone (mih) gene in mud crab Scylla paramamosain.

    Science.gov (United States)

    Zhang, Xin; Huang, Danping; Jia, Xiwei; Zou, Zhihua; Wang, Yilei; Zhang, Ziping

    2018-04-01

    In this study, the 5'-flanking region of molt-inhibiting hormone (MIH) gene was cloned by Tail-PCR. It is 2024 bp starting from the translation initiation site, and 1818 bp starting from the predicted transcription start site. Forecast analysis results by the bioinformatics software showed that the transcription start site is located at 207 bp upstream of the start codon ATG, and TATA box is located at 240 bp upstream of the start codon ATG. Potential transcription factor binding sites include Sp1, NF-1, Oct-1, Sox-2, RAP1, and so on. There are two CpG islands, located at -25- +183 bp and -1451- -1316 bp respectively. The transfection results of luciferase reporter constructs showed that the core promoter region was located in the fragment -308 bp to -26 bp. NF-kappaB and RAP1 were essential for mih basal transcriptional activity. There are three kinds of polymorphism CA in the 5'-flanking sequence, and they can influence mih promoter activity. These findings provide a genetic foundation of the further research of mih transcription regulation. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. Auxin synthesis gene tms1 driven by tuber-specific promoter alters hormonal status of transgenic potato plants and their responses to exogenous phytohormones.

    Science.gov (United States)

    Kolachevskaya, Oksana O; Sergeeva, Lidiya I; Floková, Kristyna; Getman, Irina A; Lomin, Sergey N; Alekseeva, Valeriya V; Rukavtsova, Elena B; Buryanov, Yaroslav I; Romanov, Georgy A

    2017-03-01

    Ectopic auxin overproduction in transgenic potato leads to enhanced productivity accompanied with concerted and occasional changes in hormonal status, and causing altered response of transformants to exogenous auxin or cytokinin. Previously, we generated potato transformants expressing Agrobacterium-derived auxin synthesis gene tms1 driven by tuber-specific patatin gene promoter (B33-promoter). Here, we studied the endogenous hormonal status and the response to exogenous phytohormones in tms1 transformants cultured in vitro. Adding indole-3-acetic acid (IAA) or kinetin to culture medium affected differently tuberization of tms1-transformed and control plants, depending also on sucrose content in the medium. Exogenous phytohormones ceased to stimulate the tuber initiation in transformants at high (5-8%) sucrose concentration, while in control plants the stimulation was observed in all experimental settings. Furthermore, exogenous auxin partly inhibited the tuber initiation, and exogenous cytokinin reduced the average tuber weight in most transformants at high sucrose content. The elevated auxin level in tubers of the transformants was accompanied with a decrease in content of cytokinin bases and their ribosides in tubers and most shoots. No concerted changes in contents of abscisic, jasmonic, salicylic acids and gibberellins in tubers were detected. The data on hormonal status indicated that the enhanced productivity of tms1 transformants was due to auxin and not mediated by other phytohormones. In addition, exogenous cytokinin was shown to upregulate the expression of genes encoding orthologs of auxin receptors. Overall, the results showed that tms1 expression and local increase in IAA level in transformants affect both the balance of endogenous cytokinins and the dynamics of tuberization in response to exogenous hormones (auxin, cytokinin), the latter reaction depending also on the carbohydrate supply. We introduce a basic model for the hormonal network

  7. The human luteinizing hormone receptor gene promoter: activation by Sp1 and Sp3 and inhibitory regulation.

    Science.gov (United States)

    Geng, Y; Tsai-Morris, C H; Zhang, Y; Dufau, M L

    1999-09-24

    To understand the transcriptional mechanism(s) of human LH receptor (LHR) gene expression, we have identified the dominant functional cis-elements that regulate the activity of the promoter domain (-1 to -176 bp from ATG). Mutagenesis demonstrated that the promoter activity was dependent on two Sp1 domains (-79 bp, -120 bp) in a transformed normal placental cell (PLC) and the choriocarcinoma JAR cell. Both elements interacted with endogenous Sp1 and Sp3 factors but not with Sp2 or Sp4. In Drosophila SL2 cells, the promoter was activated by either Sp1 or Sp3. An ERE half-site (EREhs) at -174 bp was inhibitory (by 100%), but was unresponsive to estradiol and did not bind the estrogen receptor or orphan receptors ERR1 and SF-1. The 5' upstream sequence (-177 to -2056 bp) inhibited promoter activity in PLC by 60%, but only minimally in JAR cells. Activation of the human LHR promoter through Sp1/3 factors is negatively regulated through EREhs and upstream sequences to exert control of gene expression. Copyright 1999 Academic Press.

  8. Ha-ras oncogene expression directed by a milk protein gene promoter: tissue specificity, hormonal regulation, and tumor induction in transgenic mice

    International Nuclear Information System (INIS)

    Andres, A.C.; Schoenenberger, C.A.; Groner, B.; Henninghausen, L.; LeMeur, M.; Gelinger, P.

    1987-01-01

    The activated human Ha-ras oncogene was subjected to the control of the promoter region of the murine whey acidic protein (Wap) gene, which is expressed in mammary epithelial cells in response to lactogenic hormones. The Wap-ras gene was stably introduced into the mouse germ line of five transgenic mice (one male and four females). Wap-ras expression was observed in the mammary glands of lactating females in two lines derived from female founders. The tissue-directed and hormone-dependent Wap expression was conferred on the Ha-ras oncogene. The signals governing Wap expression are located within 2.5 kilobases of 5' flanking sequence. The other two lines derived from female founders did not express the chimeric gene. In the line derived from the male founder the Wap-ras gene is integrated into the Y chromosome. Expression was found in the salivary gland of male animals only. After a long latency, Wap-ras-expressing mice developed tumors. The tumors arose in tissues expressing Wap-ras - i.e., mammary or salivary glands. Compared to the corresponding nonmalignant tissues, Wap-ras expression was enhanced in the tumors

  9. Reciprocal occupancy of BCL6 and STAT5 on Growth Hormone target genes: contrasting transcriptional outcomes and promoter-specific roles of p300 and HDAC3.

    Science.gov (United States)

    Lin, Grace; LaPensee, Christopher R; Qin, Zhaohui S; Schwartz, Jessica

    2014-09-01

    Expression of the Growth Hormone (GH)-stimulated gene Socs2 (Suppressor of Cytokine Signaling 2) is mediated by the transcription activator STAT5 (Signal Transducer and Activator of Transcription 5) and the transcription repressor BCL6 (B-Cell Lymphoma 6). ChIP-Sequencing identified Cish (Cytokine-Inducible SH2-containing protein) and Bcl6 as having similar patterns of reciprocal occupancy by BCL6 and STAT5 in response to GH, though GH stimulates Cish and inhibits Bcl6 expression. The co-activator p300 occupied Socs2, Cish and Bcl6 promoters, and enhanced STAT5-mediated activation of Socs2 and Cish. In contrast, on Bcl6, p300 functioned as a repressor and inhibited in conjunction with STAT5 or BCL6. The co-repressor HDAC3 (Histone deacetylase 3) inhibited the Socs2, Cish and Bcl6 promoters in the presence of STAT5. Thus transcriptional outcomes on GH-regulated genes occupied by BCL6 and STAT5 are determined in a promoter-specific fashion by co-regulatory proteins which mediate the distinction between activating and repressive transcription factors. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  10. Thyroid hormone receptor-β1 signaling is critically involved in regulating secondary ossification via promoting transcription of the Ihh gene in the epiphysis.

    Science.gov (United States)

    Xing, Weirong; Aghajanian, Patrick; Goodluck, Helen; Kesavan, Chandrasekhar; Cheng, Shaohong; Pourteymoor, Sheila; Watt, Heather; Alarcon, Catrina; Mohan, Subburaman

    2016-05-15

    Thyroid hormone (TH) action is mediated through two nuclear TH receptors, THRα and THRβ. Although the role of THRα is well established in bone, less is known about the relevance of THRβ-mediated signaling in bone development. On ther basis of our recent finding that TH signaling is essential for initiation and formation of secondary ossification center, we evaluated the role of THRs in mediating TH effects on epiphysial bone formation. Two-day treatment of TH-deficient Tshr(-/-) mice with TH increased THRβ1 mRNA level 3.4-fold at day 7 but had no effect on THRα1 mRNA level at the proximal tibia epiphysis. Treatment of serum-free cultures of tibias from 3-day-old mice with T3 increased THRβ1 expression 2.1- and 13-fold, respectively, at 24 and 72 h. Ten-day treatment of Tshr(-/-) newborns (days 5-14) with THRβ1 agonist GC1 at 0.2 or 2.0 μg/day increased BV/TV at day 21 by 225 and 263%, respectively, compared with vehicle treatment. Two-day treatment with GC1 (0.2 μg/day) increased expression levels of Indian hedgehog (Ihh) 100-fold, osterix 15-fold, and osteocalcin 59-fold compared with vehicle at day 7 in the proximal tibia epiphysis. Gel mobility shift assay demonstrated that a putative TH response element in the distal promoter of mouse Ihh gene interacted with THRβ1. GC1 treatment (1 nM) increased Ihh distal promoter activity 20-fold after 48 h in chondroctyes. Our data suggest a novel role for THRβ1 in secondary ossification at the epiphysis that involves transcriptional upregulation of Ihh gene.

  11. Thyroid hormone receptor binds to a site in the rat growth hormone promoter required for induction by thyroid hormone

    International Nuclear Information System (INIS)

    Koenig, R.J.; Brent, G.A.; Warne, R.L.; Larsen, P.R.; Moore, D.D.

    1987-01-01

    Transcription of the rat growth hormone (rGH) gene in pituitary cells is increased by addition of thyroid hormone (T3). This induction is dependent on the presence of specific sequences just upstream of the rGH promoter. The authors have partially purified T3 receptor from rat liver and examined its interaction with these rGH sequences. They show here that T3 receptor binds specifically to a site just upstream of the basal rGH promoter. This binding site includes two copies of a 7-base-pair direct repeat, the centers of which are separated by 10 base pairs. Deletions that specifically remove the T3 receptor binding site drastically reduce response to T3 in transient transfection experiments. These results demonstrate that T3 receptor can recognize specific DNA sequences and suggest that it can act directly as a positive transcriptional regulatory factor

  12. Expression of the human growth hormone variant gene in cultured fibroblasts and transgenic mice

    International Nuclear Information System (INIS)

    Selden, R.F.; Wagner, T.E.; Blethen, S.; Yun, J.S.; Rowe, M.E.; Goodman, H.M.

    1988-01-01

    The nucleotide sequence of the human growth hormone variant gene, one of the five members of the growth hormone gene family, predicts that it encodes a growth hormone-like protein. As a first step in determining whether this gene is functional in humans, the authors have expressed a mouse methallothionein I/human growth hormone variant fusion gene in mouse L cells and in transgenic mice. The growth hormone variant protein expressed in transiently transfected L cells is distinct from growth hormone itself with respect to reactivity with anti-growth hormone monoclonal antibodies, behavior during column chromatography, and isoelectric point. Transgenic mice expressing the growth hormone variant protein are 1.4- to 1.9-fold larger than nontransgenic controls, suggesting that the protein has growth-promoting properties

  13. Gene Linked to Excess Male Hormones in Female Infertility Disorder

    Science.gov (United States)

    ... April 15, 2014 Gene linked to excess male hormones in female infertility disorder Discovery by NIH-supported ... may lead to the overproduction of androgens — male hormones similar to testosterone — occurring in women with polycystic ...

  14. Meta-analysis of Arabidopsis KANADI1 direct target genes identifies basic growth-promoting module acting upstream of hormonal signaling pathways

    DEFF Research Database (Denmark)

    Xie, Yakun; Straub, Daniel; Eguen, Teinai Ebimienere

    2015-01-01

    An intricate network of antagonistically acting transcription factors mediates formation of a flat leaf lamina of Arabidopsis thaliana plants. In this context, members of the class III homeodomain leucine zipper (HD-ZIPIII) transcription factor family specify the adaxial domain (future upper side......) of the leaf, while antagonistically acting KANADI transcription factors determine the abaxial domain (future lower side). Here we used an mRNA-seq approach to identify genes regulated by KANADI1 (KAN1) and subsequently performed a meta-analysis approach combining our datasets with published genome......-wide datasets. Our analysis revealed that KAN1 acts upstream of several genes encoding auxin biosynthetic enzymes. When exposed to shade, we find three YUCCA genes, YUC2, YUC5 and YUC8 to be transcriptionally upregulated, which correlates with an increase in the levels of free auxin. When ectopically expressed...

  15. Thyroid hormones upregulate apolipoprotein E gene expression in astrocytes

    Energy Technology Data Exchange (ETDEWEB)

    Roman, Corina; Fuior, Elena V.; Trusca, Violeta G. [Institute of Cellular Biology and Pathology “Nicolae Simionescu”, Bucharest (Romania); Kardassis, Dimitris [University of Crete Medical School and Institute of Molecular Biology and Biotechnology, Foundation for Research and Technology of Hellas, Heraklion, Crete (Greece); Simionescu, Maya [Institute of Cellular Biology and Pathology “Nicolae Simionescu”, Bucharest (Romania); Gafencu, Anca V., E-mail: anca.gafencu@icbp.ro [Institute of Cellular Biology and Pathology “Nicolae Simionescu”, Bucharest (Romania)

    2015-12-04

    Apolipoprotein E (apoE), a protein mainly involved in lipid metabolism, is associated with several neurodegenerative disorders including Alzheimer's disease. Despite numerous attempts to elucidate apoE gene regulation in the brain, the exact mechanism is still uncovered. The mechanism of apoE gene regulation in the brain involves the proximal promoter and multienhancers ME.1 and ME.2, which evolved by gene duplication. Herein we questioned whether thyroid hormones and their nuclear receptors have a role in apoE gene regulation in astrocytes. Our data showed that thyroid hormones increase apoE gene expression in HTB14 astrocytes in a dose-dependent manner. This effect can be intermediated by the thyroid receptor β (TRβ) which is expressed in these cells. In the presence of triiodothyronine (T3) and 9-cis retinoic acid, in astrocytes transfected to overexpress TRβ and retinoid X receptor α (RXRα), apoE promoter was indirectly activated through the interaction with ME.2. To determine the location of TRβ/RXRα binding site on ME.2, we performed DNA pull down assays and found that TRβ/RXRα complex bound to the region 341–488 of ME.2. This result was confirmed by transient transfection experiments in which a series of 5′- and 3′-deletion mutants of ME.2 were used. These data support the existence of a biologically active TRβ binding site starting at 409 in ME.2. In conclusion, our data revealed that ligand-activated TRβ/RXRα heterodimers bind with high efficiency on tissue-specific distal regulatory element ME.2 and thus modulate apoE gene expression in the brain. - Highlights: • T3 induce a dose-dependent increase of apoE expression in astrocytes. • Thyroid hormones activate apoE promoter in a cell specific manner. • Ligand activated TRβ/RXRα bind on the distal regulatory element ME.2 to modulate apoE. • The binding site of TRβ/RXRα heterodimer is located at 409 bp on ME.2.

  16. Thyroid hormones upregulate apolipoprotein E gene expression in astrocytes

    International Nuclear Information System (INIS)

    Roman, Corina; Fuior, Elena V.; Trusca, Violeta G.; Kardassis, Dimitris; Simionescu, Maya; Gafencu, Anca V.

    2015-01-01

    Apolipoprotein E (apoE), a protein mainly involved in lipid metabolism, is associated with several neurodegenerative disorders including Alzheimer's disease. Despite numerous attempts to elucidate apoE gene regulation in the brain, the exact mechanism is still uncovered. The mechanism of apoE gene regulation in the brain involves the proximal promoter and multienhancers ME.1 and ME.2, which evolved by gene duplication. Herein we questioned whether thyroid hormones and their nuclear receptors have a role in apoE gene regulation in astrocytes. Our data showed that thyroid hormones increase apoE gene expression in HTB14 astrocytes in a dose-dependent manner. This effect can be intermediated by the thyroid receptor β (TRβ) which is expressed in these cells. In the presence of triiodothyronine (T3) and 9-cis retinoic acid, in astrocytes transfected to overexpress TRβ and retinoid X receptor α (RXRα), apoE promoter was indirectly activated through the interaction with ME.2. To determine the location of TRβ/RXRα binding site on ME.2, we performed DNA pull down assays and found that TRβ/RXRα complex bound to the region 341–488 of ME.2. This result was confirmed by transient transfection experiments in which a series of 5′- and 3′-deletion mutants of ME.2 were used. These data support the existence of a biologically active TRβ binding site starting at 409 in ME.2. In conclusion, our data revealed that ligand-activated TRβ/RXRα heterodimers bind with high efficiency on tissue-specific distal regulatory element ME.2 and thus modulate apoE gene expression in the brain. - Highlights: • T3 induce a dose-dependent increase of apoE expression in astrocytes. • Thyroid hormones activate apoE promoter in a cell specific manner. • Ligand activated TRβ/RXRα bind on the distal regulatory element ME.2 to modulate apoE. • The binding site of TRβ/RXRα heterodimer is located at 409 bp on ME.2.

  17. Ultradian hormone stimulation induces glucocorticoid receptor-mediated pulses of gene transcription.

    Science.gov (United States)

    Stavreva, Diana A; Wiench, Malgorzata; John, Sam; Conway-Campbell, Becky L; McKenna, Mervyn A; Pooley, John R; Johnson, Thomas A; Voss, Ty C; Lightman, Stafford L; Hager, Gordon L

    2009-09-01

    Studies on glucocorticoid receptor (GR) action typically assess gene responses by long-term stimulation with synthetic hormones. As corticosteroids are released from adrenal glands in a circadian and high-frequency (ultradian) mode, such treatments may not provide an accurate assessment of physiological hormone action. Here we demonstrate that ultradian hormone stimulation induces cyclic GR-mediated transcriptional regulation, or gene pulsing, both in cultured cells and in animal models. Equilibrium receptor-occupancy of regulatory elements precisely tracks the ligand pulses. Nascent RNA transcripts from GR-regulated genes are released in distinct quanta, demonstrating a profound difference between the transcriptional programs induced by ultradian and constant stimulation. Gene pulsing is driven by rapid GR exchange with response elements and by GR recycling through the chaperone machinery, which promotes GR activation and reactivation in response to the ultradian hormone release, thus coupling promoter activity to the naturally occurring fluctuations in hormone levels. The GR signalling pathway has been optimized for a prompt and timely response to fluctuations in hormone levels, indicating that biologically accurate regulation of gene targets by GR requires an ultradian mode of hormone stimulation.

  18. Hormonal growth promoting agents in food producing animals.

    Science.gov (United States)

    Stephany, Rainer W

    2010-01-01

    In contrast to the use of hormonal doping agents in sports to enhance the performance of athletes, in the livestock industry hormonal growth promoters ("anabolics") are used to increase the production of muscle meat. This leads to international disputes about the safety of meat originating from animals treated with such anabolics.As a consequence of the total ban in the EU of all hormonal active growth promoters ("hormones") in livestock production, in contrast to their legal use [e.g. of five such hormones (17beta-estradiol, testosterone, progesterone, trenbolone and zeranol) as small solid ear implants and two hormones as feed additives for feedlot heifers (melengestrol acetate) and for swine (ractopamine) in the USA], the regulatory controls also differ sharply between the EU and the USA.In the EU the treatment of slaughter animals is the regulatory offence that has to be controlled in inspection programs. In the USA testing for compliance of a regulatory maximum residue level in the edible product (muscle, fat, liver or kidney) is the purpose of the inspection program (if any).The EU inspection programs focus on sample materials that are more suitable for testing for banned substances, especially if the animals are still on the farm, such as urine and feces or hair. In the case of slaughtered animals, the more favored sample materials are bile, blood, eyes and sometimes liver. Only in rare occasions is muscle meat sampled. This happens only in the case of import controls or in monitoring programs of meat sampled in butcher shops or supermarkets.As a result, data on hormone concentrations in muscle meat samples from the EU market are very rare and are obtained in most cases from small programs on an ad hoc basis. EU data for natural hormones in meat are even rarer because of the absence of "legal natural levels" for these hormones in compliance testing. With the exception of samples from the application sites - in the EU the site of injection of liquid hormone

  19. The Somatic Reproductive Tissues of C. elegans Promote Longevity through Steroid Hormone Signaling

    Science.gov (United States)

    Yamawaki, Tracy M.; Berman, Jennifer R.; Suchanek-Kavipurapu, Monika; McCormick, Mark; Gaglia, Marta Maria; Lee, Seung-Jae; Kenyon, Cynthia

    2010-01-01

    In Caenorhabditis elegans and Drosophila melanogaster, removing the germline precursor cells increases lifespan. In worms, and possibly also in flies, this lifespan extension requires the presence of somatic reproductive tissues. How the somatic gonad signals other tissues to increase lifespan is not known. The lifespan increase triggered by loss of the germ cells is known to require sterol hormone signaling, as reducing the activity of the nuclear hormone receptor DAF-12, or genes required for synthesis of the DAF-12 ligand dafachronic acid, prevents germline loss from extending lifespan. In addition to sterol signaling, the FOXO transcription factor DAF-16 is required to extend lifespan in animals that lack germ cells. DAF-12/NHR is known to assist with the nuclear accumulation of DAF-16/FOXO in these animals, yet we find that loss of DAF-12/NHR has little or no effect on the expression of at least some DAF-16/FOXO target genes. In this study, we show that the DAF-12-sterol signaling pathway has a second function to activate a distinct set of genes and extend lifespan in response to the somatic reproductive tissues. When germline-deficient animals lacking somatic reproductive tissues are given dafachronic acid, their expression of DAF-12/NHR-dependent target genes is restored and their lifespan is increased. Together, our findings indicate that in C. elegans lacking germ cells, the somatic reproductive tissues promote longevity via steroid hormone signaling to DAF-12. PMID:20824162

  20. The somatic reproductive tissues of C. elegans promote longevity through steroid hormone signaling.

    Directory of Open Access Journals (Sweden)

    Tracy M Yamawaki

    2010-08-01

    Full Text Available In Caenorhabditis elegans and Drosophila melanogaster, removing the germline precursor cells increases lifespan. In worms, and possibly also in flies, this lifespan extension requires the presence of somatic reproductive tissues. How the somatic gonad signals other tissues to increase lifespan is not known. The lifespan increase triggered by loss of the germ cells is known to require sterol hormone signaling, as reducing the activity of the nuclear hormone receptor DAF-12, or genes required for synthesis of the DAF-12 ligand dafachronic acid, prevents germline loss from extending lifespan. In addition to sterol signaling, the FOXO transcription factor DAF-16 is required to extend lifespan in animals that lack germ cells. DAF-12/NHR is known to assist with the nuclear accumulation of DAF-16/FOXO in these animals, yet we find that loss of DAF-12/NHR has little or no effect on the expression of at least some DAF-16/FOXO target genes. In this study, we show that the DAF-12-sterol signaling pathway has a second function to activate a distinct set of genes and extend lifespan in response to the somatic reproductive tissues. When germline-deficient animals lacking somatic reproductive tissues are given dafachronic acid, their expression of DAF-12/NHR-dependent target genes is restored and their lifespan is increased. Together, our findings indicate that in C. elegans lacking germ cells, the somatic reproductive tissues promote longevity via steroid hormone signaling to DAF-12.

  1. Gene expression studies on human keratinocytes transduced with human growth hormone gene for a possible utilization in gene therapy

    International Nuclear Information System (INIS)

    Mathor, Monica Beatriz.

    1994-01-01

    Taking advantage of the recent progress in the DNA-recombinant techniques and of the potentiality of normal human keratinocytes primary culture to reconstitute the epidermis, it was decided to genetically transform these keratinocytes to produce human growth hormone under controllable conditions that would be used in gene therapy at this hormone deficient patients. The first step to achieve this goal was to standardize infection of keratinocytes with retrovirus producer cells containing a construct which included the gene of bacterial b-galactosidase. The best result was obtained cultivating the keratinocytes for 3 days in a 2:1 mixture of retrovirus producer cells and 3T3-J2 fibroblasts irradiated with 60 Gy, and splitting these infected keratinocytes on 3T3-J2 fibroblasts feeder layer. Another preliminary experiment was to infect normal human keratinocytes with interleukin-6 gene (hIL-6) that, in pathologic conditions, could be reproduced by keratinocytes and secreted to the blood stream. Thus, we verify that infected keratinocytes secrete an average amount of 500 ng/10 6 cell/day of cytokin during the in vitro life time, that certify the stable character of the injection. These keratinocytes, when grafted in mice, secrete hIL-6 to the blood stream reaching levels of 40 pg/ml of serum. After these preliminary experiments, we construct a retroviral vector with the human growth hormone gene (h GH) driven by human metallothionein promoter (h PMT), designated DChPMTGH. Normal human keratinocytes were infected with DChPMTGH producer cells, following previously standardized protocol, obtaining infected keratinocytes secreting to the culture media 340 ng h GH/10 6 cell/day without promoter activation. This is the highest level of h GH secreted in human keratinocytes primary culture described in literature. The h GH value increases approximately 10 times after activation with 100 μM Zn +2 for 8-12 hours. (author). 158 refs., 42 figs., 6 tabs

  2. Isolation and characterization of the human parathyroid hormone-like peptide gene

    International Nuclear Information System (INIS)

    Mangin, M.; Ikeda, K.; Dreyer, B.E.; Broadus, A.E.

    1989-01-01

    A parathyroid hormone-like peptide (PTH-LP) has recently been identified in human tumors associated with the syndrome of humoral hypercalcemia of malignancy. The peptide appears to be encoded by a single-copy gene that gives rise to multiple mRNAs that are heterogeneous at both their 5' and their 3' ends. Alternative RNA splicing is responsible for the 3' heterogeneity and results in mRNAs encoding three different peptides, each with a unique C terminus. The authors have isolated and characterized the human PTHLP gene. The gene is a complex transcriptional unit spanning more than 12 kilobases of DNA and containing six exons. Two 5' exons encode distinct 5' untranslated regions and are separated by a putative promoter element, indicating that the gene either has two promoters or is alternatively spliced from a single promoter upstream of the first exon. The middle portion of the PTHLP gene, comprising exons 2-4, has an organizational pattern of introns and exons identical to that of the parathyroid hormone gene, consistent with a common ancestral origin of these two genes. Exon 4 of the PTHLP gene encodes the region common to all three peptides and the C terminus of the shortest peptide, and exons 5 and 6 encode the unique C termini of the other two peptides. Northern analysis of mRNAs from four human tumors of different histological types reveals the preferential use of 3' splicing patterns of individual tumors

  3. Polymorphism of growth hormone gene and its association with ...

    African Journals Online (AJOL)

    sunny t

    2016-04-06

    Apr 6, 2016 ... recorded to be more frequent (83.3, 92.86 and 90%) than pattern II (16.7, 7.14 and 10%) in Barki,. Rahmani ... Key words: Sheep, wool, growth hormone (GH) gene, polymorphism, single strand conformation polymorphism. (SSCP). ... electrophoresis and chemical and ribonuclease cleavage,. SSCP has ...

  4. Gene specific actions of thyroid hormone receptor subtypes.

    Directory of Open Access Journals (Sweden)

    Jean Z Lin

    Full Text Available There are two homologous thyroid hormone (TH receptors (TRs α and β, which are members of the nuclear hormone receptor (NR family. While TRs regulate different processes in vivo and other highly related NRs regulate distinct gene sets, initial studies of TR action revealed near complete overlaps in their actions at the level of individual genes. Here, we assessed the extent that TRα and TRβ differ in target gene regulation by comparing effects of equal levels of stably expressed exogenous TRs +/- T(3 in two cell backgrounds (HepG2 and HeLa. We find that hundreds of genes respond to T(3 or to unliganded TRs in both cell types, but were not able to detect verifiable examples of completely TR subtype-specific gene regulation. TR actions are, however, far from identical and we detect TR subtype-specific effects on global T(3 response kinetics in HepG2 cells and many examples of TR subtype specificity at the level of individual genes, including effects on magnitude of response to TR +/- T(3, TR regulation patterns and T(3 dose response. Cycloheximide (CHX treatment confirms that at least some differential effects involve verifiable direct TR target genes. TR subtype/gene-specific effects emerge in the context of widespread variation in target gene response and we suggest that gene-selective effects on mechanism of TR action highlight differences in TR subtype function that emerge in the environment of specific genes. We propose that differential TR actions could influence physiologic and pharmacologic responses to THs and selective TR modulators (STRMs.

  5. Thyroid hormone promotes remodeling of coronary resistance vessels.

    Directory of Open Access Journals (Sweden)

    Olga V Savinova

    Full Text Available Low thyroid hormone (TH function has been linked to impaired coronary blood flow, reduced density of small arterioles, and heart failure. Nonetheless, little is known about the mechanisms by which THs regulate coronary microvascular remodeling. The current study examined the initial cellular events associated with coronary remodeling induced by triiodothyronine (T3 in hypothyroid rats. Rats with established hypothyroidism, eight weeks after surgical thyroidectomy (TX, were treated with T3 for 36 or 72 hours. The early effects of T3 treatment on coronary microvasculature were examined morphometrically. Gene expression changes in the heart were assessed by quantitative PCR Array. Hypothyroidism resulted in arteriolar atrophy in the left ventricle. T3 treatment rapidly induced small arteriolar muscularization and, within 72 hours, restored arteriolar density to control levels. Total length of the capillary network was not affected by TX or T3 treatment. T3 treatment resulted in the coordinate regulation of Angiopoietin 1 and 2 expression. The response of Angiopoietins was consistent with vessel enlargement. In addition to the well known effects of THs on vasoreactivity, these results suggest that THs may affect function of small resistance arteries by phenotypic remodeling of vascular smooth muscle cells (VSMC.

  6. POLYMORPHISMS OF GROWTH HORMONE GENE IN HARINGHATA BLACK CHICKEN

    Directory of Open Access Journals (Sweden)

    R. Saikhom

    2017-06-01

    Full Text Available The present study was carried out with an aim to investigate the genetic variability of growth hormone gene in Haringhata Black chicken. Blood samples were collected from 82 experimental birds and genomic DNA was extracted using the modified high salt method. Amplification of specific DNA fragment of intron 4 of growth hormone gene yielded a product size of 713 bp and was analyzed for polymorphism using PCR-SSCP technique. The banding pattern of present investigation revealed two SSCP variants AA and BB genotype in all experimental birds. In the analysed flock of Haringhata Black Chicken, the genotype frequencies were found to be 0.915 for AA and 0.085 for BB genotype. The frequencies of A and B alleles were 0.915 and 0.085 respectively which indicated A allele was predominant in the studied Haringhata Black Chicken population of the farm. The Chi Square Test revealed that studied population was not in accordance with Hardy Weinberg equilibrium with respect to intron 4 of Growth hormone gene.

  7. The human oxytocin gene promoter is regulated by estrogens.

    Science.gov (United States)

    Richard, S; Zingg, H H

    1990-04-15

    Gonadal steroids affect brain function primarily by altering the expression of specific genes, yet the specific mechanisms by which neuronal target genes undergo such regulation are unknown. Recent evidence suggests that the expression of the neuropeptide gene for oxytocin (OT) is modulated by estrogens. We therefore examined the possibility that this regulation occurred via a direct interaction of the estrogen-receptor complex with cis-acting elements flanking the OT gene. DNA-mediated gene transfer experiments were performed using Neuro-2a neuroblastoma cells and chimeric plasmids containing portions of the human OT gene 5'-glanking region linked to the chloramphenicol acetyltransferase gene. We identified a 19-base pair region located at -164 to -146 upstream of the transcription start site which is capable of conferring estrogen responsiveness to the homologous as well as to a heterologous promoter. The hormonal response is strictly dependent on the presence of intracellular estrogen receptors, since estrogen induced stimulation occurred only in Neuro-2a cells co-transfected with an expression vector for the human estrogen receptor. The identified region contains a novel imperfect palindrome (GGTGACCTTGACC) with sequence similarity to other estrogen response elements (EREs). To define cis-acting elements that function in synergism with the ERE, sequences 3' to the ERE were deleted, including the CCAAT box, two additional motifs corresponding to the right half of the ERE palindrome (TGACC), as well as a CTGCTAA heptamer similar to the "elegans box" found in Caenorhabditis elegans. Interestingly, optimal function of the identified ERE was fully independent of these elements and only required a short promoter region (-49 to +36). Our studies define a molecular mechanism by which estrogens can directly modulate OT gene expression. However, only a subset of OT neurons are capable of binding estrogens, therefore, direct action of estrogens on the OT gene may be

  8. GSHR, a Web-Based Platform Provides Gene Set-Level Analyses of Hormone Responses in Arabidopsis

    Directory of Open Access Journals (Sweden)

    Xiaojuan Ran

    2018-01-01

    Full Text Available Phytohormones regulate diverse aspects of plant growth and environmental responses. Recent high-throughput technologies have promoted a more comprehensive profiling of genes regulated by different hormones. However, these omics data generally result in large gene lists that make it challenging to interpret the data and extract insights into biological significance. With the rapid accumulation of theses large-scale experiments, especially the transcriptomic data available in public databases, a means of using this information to explore the transcriptional networks is needed. Different platforms have different architectures and designs, and even similar studies using the same platform may obtain data with large variances because of the highly dynamic and flexible effects of plant hormones; this makes it difficult to make comparisons across different studies and platforms. Here, we present a web server providing gene set-level analyses of Arabidopsis thaliana hormone responses. GSHR collected 333 RNA-seq and 1,205 microarray datasets from the Gene Expression Omnibus, characterizing transcriptomic changes in Arabidopsis in response to phytohormones including abscisic acid, auxin, brassinosteroids, cytokinins, ethylene, gibberellins, jasmonic acid, salicylic acid, and strigolactones. These data were further processed and organized into 1,368 gene sets regulated by different hormones or hormone-related factors. By comparing input gene lists to these gene sets, GSHR helped to identify gene sets from the input gene list regulated by different phytohormones or related factors. Together, GSHR links prior information regarding transcriptomic changes induced by hormones and related factors to newly generated data and facilities cross-study and cross-platform comparisons; this helps facilitate the mining of biologically significant information from large-scale datasets. The GSHR is freely available at http://bioinfo.sibs.ac.cn/GSHR/.

  9. Diverse growth hormone receptor gene mutations in Laron syndrome.

    Science.gov (United States)

    Berg, M A; Argente, J; Chernausek, S; Gracia, R; Guevara-Aguirre, J; Hopp, M; Pérez-Jurado, L; Rosenbloom, A; Toledo, S P; Francke, U

    1993-01-01

    To better understand the molecular genetic basis and genetic epidemiology of Laron syndrome (growth-hormone insensitivity syndrome), we analyzed the growth-hormone receptor (GHR) genes of seven unrelated affected individuals from the United States, South America, Europe, and Africa. We amplified all nine GHR gene exons and splice junctions from these individuals by PCR and screened the products for mutations by using denaturing gradient gel electrophoresis (DGGE). We identified a single GHR gene fragment with abnormal DGGE results for each affected individual, sequenced this fragment, and, in each case, identified a mutation likely to cause Laron syndrome, including two nonsense mutations (R43X and R217X), two splice-junction mutations, (189-1 G to T and 71 + 1 G to A), and two frameshift mutations (46 del TT and 230 del TA or AT). Only one of these mutations, R43X, has been previously reported. Using haplotype analysis, we determined that this mutation, which involves a CpG dinucleotide hot spot, likely arose as a separate event in this case, relative to the two prior reports of R43X. Aside from R43X, the mutations we identified are unique to patients from particular geographic regions. Ten GHR gene mutations have now been described in this disorder. We conclude that Laron syndrome is caused by diverse GHR gene mutations, including deletions, RNA processing defects, translational stop codons, and missense codons. All the identified mutations involve the extracellular domain of the receptor, and most are unique to particular families or geographic areas. Images Figure 1 Figure 2 PMID:8488849

  10. Gene study within the 5' flanking regions of growth hormone gene of ...

    African Journals Online (AJOL)

    user

    2011-01-17

    Jan 17, 2011 ... Expression of more than one gene for GH has been reported, indicating ..... hormone levels of palsmáticos IGF-1 and carcass traits in beef cattle. Dissertation ... Structure-function relation of somatotropin with reference to ...

  11. Genetic variation in hormone metabolizing genes and risk of testicular germ cell tumors.

    Science.gov (United States)

    Figueroa, Jonine D; Sakoda, Lori C; Graubard, Barry I; Chanock, Stephen; Rubertone, Mark V; Erickson, R Loren; McGlynn, Katherine A

    2008-11-01

    Testicular germ cell tumors (TGCT) that arise in young men are composed of two histologic types, seminomas and nonseminomas. Risk patterns for the two types appear to be similar and may be related to either endogenous or exogenous hormonal exposures in utero. Why similar risk patterns would result in different histologic types is unclear, but could be related to varying genetic susceptibility profiles. Genetic variation in hormone metabolizing genes could potentially modify hormonal exposures, and thereby affect which histologic type a man develops. To examine this hypothesis, 33 single nucleotide polymorphisms (SNPs) in four hormone metabolism candidate genes (CYP1A1, CYP17A1, HSD17B1, HSD17B4) and the androgen receptor gene (AR) were genotyped. Associations with TGCT were evaluated among 577 TGCT cases (254 seminoma, 323 nonseminoma) and 707 controls from the US Servicemen's Testicular Tumor Environmental and Endocrine Determinants (STEED) study. There were no significant associations with TGCT overall based on a test using an additive model. However, compared to homozygotes of the most common allele, two nonredundant SNPs in CYP1A1 were inversely associated with nonseminoma: CYP1A1 promoter SNP rs4886605 OR = 0.75 (95% CI = 0.54-1.04) among the heterozygotes and OR = 0.37, 95% CI = 0.12-1.11 among the homozygotes with a p-value for trend = 0.02; rs2606345 intron 1 SNP, OR = 0.69 (95% CI = 0.51-0.93) among heterozygotes and OR = 0.70 (95% CI = 0.42-1.17) among homozygotes, with a p-value for trend = 0.02. Caution in interpretation is warranted until findings are replicated in other studies; however, the results suggest that genetic variation in CYP1A1 may be associated with nonseminoma.

  12. Gender in childhood obesity: family environment, hormones, and genes.

    Science.gov (United States)

    Wisniewski, Amy B; Chernausek, Steven D

    2009-01-01

    The prevalence of obesity among children in the United States represents a pool of latent morbidity. Though the prevalence of obesity has increased in both boys and girls, the causes and consequences differ between the sexes. Thus, interventions proposed to treat and prevent childhood obesity will need to account for these differences. This review examines gender differences in the presentation of obesity in children and describes environmental, hormonal, and genetic factors that contribute to observed gender differences. A search of peer-reviewed, published literature was performed with PubMed for articles published from January 1974 through October 2008. Search terms used were obesity, sex, gender, hormones, family environment, body composition, adiposity, and genes. Studies of children aged 0 to 18 years were included, and only articles published in English were reviewed for consideration. Articles that illustrated gender differences in either the presentation or underlying mechanisms of obesity in children were reviewed for content, and their bibliographies were used to identify other relevant literature. Gender differences in childhood obesity have been understudied partially because of how we define the categories of overweight and obesity. Close examination of studies revealed that gender differences were common, both before and during puberty. Boys and girls differ in body composition, patterns of weight gain, hormone biology, and the susceptibility to certain social, ethnic, genetic, and environmental factors. Our understanding of how gender differences in pediatric populations relate to the pathogenesis of obesity and the subsequent development of associated comorbid states is critical to developing and implementing both therapeutic and preventive interventions.

  13. Sex hormones and gene expression signatures in peripheral blood from postmenopausal women - the NOWAC postgenome study

    Directory of Open Access Journals (Sweden)

    Rylander Charlotta

    2011-03-01

    Full Text Available Abstract Background Postmenopausal hormone therapy (HT influences endogenous hormone concentrations and increases the risk of breast cancer. Gene expression profiling may reveal the mechanisms behind this relationship. Our objective was to explore potential associations between sex hormones and gene expression in whole blood from a population-based, random sample of postmenopausal women Methods Gene expression, as measured by the Applied Biosystems microarray platform, was compared between hormone therapy (HT users and non-users and between high and low hormone plasma concentrations using both gene-wise analysis and gene set analysis. Gene sets found to be associated with HT use were further analysed for enrichment in functional clusters and network predictions. The gene expression matrix included 285 samples and 16185 probes and was adjusted for significant technical variables. Results Gene-wise analysis revealed several genes significantly associated with different types of HT use. The functional cluster analyses provided limited information on these genes. Gene set analysis revealed 22 gene sets that were enriched between high and low estradiol concentration (HT-users excluded. Among these were seven oestrogen related gene sets, including our gene list associated with systemic estradiol use, which thereby represents a novel oestrogen signature. Seven gene sets were related to immune response. Among the 15 gene sets enriched for progesterone, 11 overlapped with estradiol. No significant gene expression patterns were found for testosterone, follicle stimulating hormone (FSH or sex hormone binding globulin (SHBG. Conclusions Distinct gene expression patterns associated with sex hormones are detectable in a random group of postmenopausal women, as demonstrated by the finding of a novel oestrogen signature.

  14. Genes, Gender, Hormones, and Doping in Sport: A Convoluted Tale

    Directory of Open Access Journals (Sweden)

    Alan D. Rogol

    2017-10-01

    Full Text Available We are writing this piece in the aftermath of the 2016 Olympic Games in Rio de Janeiro, Brazil. Each of the words in the title plays a role(s in deciding who may compete, especially who may compete as a woman. We shall be careful to disentangle the issues of genes and gender from hormonal levels of the potent androgen testosterone, and very clearly demarcate these natural occurrences from those of doping, for which the World Anti-Doping Agency has established strict guidelines. These elements became conflated in the aftermath of the Court of Arbitration of Sport’s decision, now more than 2 years ago, concerning the teenage Indian sprinter, Dutee Chand. Although many people associate hyperandrogenism with doping and gender determination, each is different and has a distinct function.

  15. Characterization of the neurohypophysial hormone gene loci in elephant shark and the Japanese lamprey: origin of the vertebrate neurohypophysial hormone genes

    Directory of Open Access Journals (Sweden)

    Brenner Sydney

    2009-02-01

    Full Text Available Abstract Background Vasopressin and oxytocin are mammalian neurohypophysial hormones with distinct functions. Vasopressin is involved mainly in osmoregulation and oxytocin is involved primarily in parturition and lactation. Jawed vertebrates contain at least one homolog each of vasopressin and oxytocin, whereas only a vasopressin-family hormone, vasotocin, has been identified in jawless vertebrates. The genes encoding vasopressin and oxytocin are closely linked tail-to-tail in eutherian mammals whereas their homologs in chicken, Xenopus and coelacanth (vasotocin and mesotocin are linked tail-to-head. In contrast, their pufferfish homologs, vasotocin and isotocin, are located on the same strand of DNA with isotocin located upstream of vasotocin and separated by five genes. These differences in the arrangement of the two genes in different bony vertebrate lineages raise questions about their origin and ancestral arrangement. To trace the origin of these genes, we have sequenced BAC clones from the neurohypophysial gene loci in a cartilaginous fish, the elephant shark (Callorhinchus milii, and in a jawless vertebrate, the Japanese lamprey (Lethenteron japonicum. We have also analyzed the neurohypophysial hormone gene locus in an invertebrate chordate, the amphioxus (Branchiostoma floridae. Results The elephant shark neurohypophysial hormone genes encode vasotocin and oxytocin, and are linked tail-to-head like their homologs in coelacanth and non-eutherian tetrapods. Besides the hypothalamus, the two genes are also expressed in the ovary. In addition, the vasotocin gene is expressed in the kidney, rectal gland and intestine. These expression profiles indicate a paracrine role for the two hormones. The lamprey locus contains a single neurohypophysial hormone gene, the vasotocin. The synteny of genes in the lamprey locus is conserved in elephant shark, coelacanth and tetrapods but disrupted in teleost fishes. The amphioxus locus encodes a single

  16. Molecular mechanisms of regulation of growth hormone gene expression in cultured rat pituitary cells by thyroid and glucocorticoid hormones

    International Nuclear Information System (INIS)

    Yaffe, B.M.

    1989-01-01

    In cultured GC cells, a rat pituitary tumor cell line, growth hormone [GH] is induced in a synergistic fashion by physiologic concentrations of thyroid and glucocorticoid hormones. Abundant evidence indicates that these hormones mediate this response via their specific receptors. The purpose of this thesis is to explore the mechanisms by which these hormones affect GH production. When poly (A) + RNA was isolated from cells grown both with and without hormones and translated in a cell-free wheat germ system, the preGH translation products were shown to be proportional to immunoassayable GH production under all combinations of hormonal milieux, indicating that changes in GH production is modulated at a pretranslational level. A cDNA library was constructed from poly (A) + RNA and one clone containing GH cDNA sequences was isolated. This was used to confirm the above results by Northern dot blot analysis. This probe was also used to assess hormonal effects on GH mRNA half-life and synthetic rates as well as GH gene transcription rates in isolated nuclei. Using a pulse-chase protocol in which cellular RNA was labeled in vivo with [ 3 H]uridine, and quantitating [ 3 H]GHmRNA directly by hybridization to GH cDNA bound to nitrocellulose filters, GHmRNA was found to have a half-life of approximately 50 hours, and was not significantly altered by the presence of inducing hormones

  17. Hormones

    Science.gov (United States)

    Hormones are your body's chemical messengers. They travel in your bloodstream to tissues or organs. They work ... glands, which are special groups of cells, make hormones. The major endocrine glands are the pituitary, pineal, ...

  18. Duodenal ulcer promoting gene of Helicobacter pylori.

    Science.gov (United States)

    Lu, Hong; Hsu, Ping-I; Graham, David Y; Yamaoka, Yoshio

    2005-04-01

    Identification of a disease-specific H pylori virulence factors predictive of the outcome of infection remains unachieved. We used the polymerase chain reaction and Southern blot to compare the presence of 14 vir homologue genes with clinical presentation of H pylori infection, mucosal histology, and mucosal interleukin (IL)-8 levels. We examined 500 H pylori strains from East Asia and South America, including 120 with gastritis, 140 with duodenal ulcer (DU), 110 with gastric ulcer (GU), and 130 with gastric cancer. Only 1 gene that encompassed both jhp0917 and jhp0918 called dupA (duodenal ulcer promoting gene) was associated with a specific clinical outcome. dupA was present in 42% of DU vs. 21% of gastritis (adjusted odds ratio [OR] = 3.1, 95% confidence interval [CI]: 1.7-5.7). Its presence was also associated with more intense antral neutrophil infiltration and IL-8 levels and was a marker for protection against gastric atrophy, intestinal metaplasia, and gastric cancer (OR for gastric cancer = 0.42, 95% CI: 0.2-0.9 compared with gastritis). In vitro studies in gastric epithelial cells using dupA -deleted and -complemented mutants showed that the dupA plays roles in IL-8 production, in activation of transcription factors responsible for IL-8 promoter activity, and in increased survivability at low pH. dupA is a novel marker associated with an increased risk for DU and reduced risk for gastric atrophy and cancer. Its association with DU-promoting and -protective effects against atrophy/cancer was evident in both Asian and Western countries.

  19. Necdin, a Prader-Willi syndrome candidate gene, regulates gonadotropin-releasing hormone neurons during development.

    Science.gov (United States)

    Miller, Nichol L G; Wevrick, Rachel; Mellon, Pamela L

    2009-01-15

    Prader-Willi syndrome (PWS) is a complex genetic disorder characterized by hyperphagia, obesity and hypogonadotrophic hypogonadism, all highly suggestive of hypothalamic dysfunction. The NDN gene, encoding the MAGE family protein, necdin, maps to the PWS chromosome region and is highly expressed in mature hypothalamic neurons. Adult mice lacking necdin have reduced numbers of gonadotropin-releasing hormone (GnRH) neurons, but the mechanism for this reduction is unknown. Herein, we show that, although necdin is not expressed in an immature, migratory GnRH neuronal cell line (GN11), high levels are present in a mature GnRH neuronal cell line (GT1-7). Furthermore, overexpression of necdin activates GnRH transcription through cis elements bound by the homeodomain repressor Msx that are located in the enhancer and promoter of the GnRH gene, and knock-down of necdin expression reduces GnRH gene expression. In fact, overexpression of Necdin relieves Msx repression of GnRH transcription through these elements and necdin co-immunoprecipitates with Msx from GnRH neuronal cells, indicating that necdin may activate GnRH gene expression by preventing repression of GnRH gene expression by Msx. Finally, necdin is necessary for generation of the full complement of GnRH neurons during mouse development and extension of GnRH axons to the median eminence. Together, these results indicate that lack of necdin during development likely contributes to the hypogonadotrophic hypogonadal phenotype in individuals with PWS.

  20. Necdin, a Prader–Willi syndrome candidate gene, regulates gonadotropin-releasing hormone neurons during development

    Science.gov (United States)

    Miller, Nichol L.G.; Wevrick, Rachel; Mellon, Pamela L.

    2009-01-01

    Prader–Willi syndrome (PWS) is a complex genetic disorder characterized by hyperphagia, obesity and hypogonadotrophic hypogonadism, all highly suggestive of hypothalamic dysfunction. The NDN gene, encoding the MAGE family protein, necdin, maps to the PWS chromosome region and is highly expressed in mature hypothalamic neurons. Adult mice lacking necdin have reduced numbers of gonadotropin-releasing hormone (GnRH) neurons, but the mechanism for this reduction is unknown. Herein, we show that, although necdin is not expressed in an immature, migratory GnRH neuronal cell line (GN11), high levels are present in a mature GnRH neuronal cell line (GT1-7). Furthermore, overexpression of necdin activates GnRH transcription through cis elements bound by the homeodomain repressor Msx that are located in the enhancer and promoter of the GnRH gene, and knock-down of necdin expression reduces GnRH gene expression. In fact, overexpression of Necdin relieves Msx repression of GnRH transcription through these elements and necdin co-immunoprecipitates with Msx from GnRH neuronal cells, indicating that necdin may activate GnRH gene expression by preventing repression of GnRH gene expression by Msx. Finally, necdin is necessary for generation of the full complement of GnRH neurons during mouse development and extension of GnRH axons to the median eminence. Together, these results indicate that lack of necdin during development likely contributes to the hypogonadotrophic hypogonadal phenotype in individuals with PWS. PMID:18930956

  1. The sheep growth hormone gene polymorphism and its effects on milk traits.

    Science.gov (United States)

    Dettori, Maria Luisa; Pazzola, Michele; Pira, Emanuela; Paschino, Pietro; Vacca, Giuseppe Massimo

    2015-05-01

    Growth hormone (GH) is encoded by the GH gene, which may be single copy or duplicate in sheep. The two copies of the sheep GH gene (GH1/GH2-N and GH2-Z) were entirely sequenced in one 106 ewes of Sarda breed, in order to highlight sequence polymorphisms and investigate possible association between genetic variants and milk traits. Milk traits included milk yield, fat, protein, casein and lactose percentage. We evidenced 75 nucleotide changes. Transcription factor binding site prediction revealed two sequences potentially recognised by the pituitary-specific transcription factor POU1FI at the GH1/GH2-N gene, which were lost at the promoter of GH2-Z, which might explain the different tissues of expression of GH1/GH2-N (pituitary) and GH2-Z (placenta). Significant differences in milk traits were observed among genotypes at polymorphic loci only for the GH2-Z gene. Sheep with homozygote genotype ss748770547 CC had higher fat percentage (P < 0.01) than TT. SNP ss748770547 was part of a potential transcription factor binding site for C/EBP alpha (CCAAT/Enhancer Binding Protein), which is involved in the regulation of adipogenesis and adipoblast differentiation. SNP ss748770547, located in the GH2-Z gene 5' flanking region, may be a causal mutation affecting milk fat content. These findings might contribute to the knowledge of the sheep GH locus and might be useful in selection processes in sheep.

  2. Promotion and marketing of bioidentical hormone therapy on the internet: a content analysis of websites.

    Science.gov (United States)

    Yuksel, Nese; Treseng, Laetitia; Malik, Bushra; Ogbogu, Ubaka

    2017-10-01

    To evaluate the quality of information presented and claims made on websites offering bioidentical hormone therapy (BHT) products or services. A quantitative content analysis was completed on 100 websites promoting or offering BHT products or services. Websites were identified through Google search engine from September to October 2013. Search terms included "bioidentical hormone therapy" or "bioidentical progesterone," accompanied by "purchase or buy," "service," or "doctors." The Brief DISCERN instrument was used to determine the quality of the health information. Websites were from Canada (59%), United States (38%), and other countries (3%). Almost half of the websites originated from medical clinics (47%), and healthcare professionals offering BHT services included physicians (50%), pharmacists (19%), and naturopaths (16%). Majority of websites promoted BHT as custom-compounded formulations (62%), with only 27% indicating that BHT is also commercially available. Websites overall claimed that BHT had less risk compared with conventional hormone therapy (62%). BHT was described as having less breast cancer risk (40%), whereas over a quarter of websites described BHT as "protective" for breast cancer. Websites mainly targeted women (99%), with males mentioned in 62% of websites. Product descriptors used to promote BHT included individualization (77%), natural (70%), hormone imbalance (56%), and antiaging (50%). The mean Brief DISCERN score was 15, indicating lower quality of information. Claims made about BHT on the internet are misleading and not consistent with current professional organizations' recommendations. Understanding how BHT may be promoted on the internet can help healthcare professionals when educating patients.

  3. Isolating Barley ( Hordeum vulgare L.) B1 Hordein Gene Promoter ...

    African Journals Online (AJOL)

    Promoters play the most important role in determining the temporal and spatial expression pattern and transcript level of a gene. Some strong constitutive promoters, such as cauliflower mosaic virus 35s promoter, are widely used in plant genetic engineering research. However, the expression levels of the foreign genes in ...

  4. THYROID HORMONE RECEPTOR BETA GENE MUTATION (P453A) IN A TURKISH FAMILY PRODUCING RESISTANCE TO THYROID HORMONE

    Science.gov (United States)

    Bayraktaroglu, Taner; Noel, Janet; Mukaddes, Nahit Motavalli; Refetoff, Samuel

    2018-01-01

    Two members of a Turkish family, a mother and son, had thyroid function tests suggestive of resistance to thyroid hormone (RTH). The clinical presentation was, however, different. The mother (proposita) had palpitation, weakness, tiredness, nervousness, dry mouth and was misdiagnosed as having multinodular toxic goiter which was treated with antithyroid drugs and partial thyroidectomy. Her younger son had attention deficit hyperactivity disorder and primary encopresis, but normal intellectual quotient. Both had elevated serum iodothyronine levels with nonsuppressed thyrotropin. A mutation in one allele of the thyroid hormone receptor beta gene (P453A) was identified, providing a genetic confirmation for the diagnosis of RTH. PMID:18561095

  5. A growth hormone receptor SNP promotes lung cancer by impairment of SOCS2-mediated degradation

    DEFF Research Database (Denmark)

    Chhabra, Y.; Wong, H. Y.; Nikolajsen, Louise Fletcher

    2018-01-01

    Both humans and mice lacking functional growth hormone (GH) receptors are known to be resistant to cancer. Further, autocrine GH has been reported to act as a cancer promoter. Here we present the first example of a variant of the GH receptor (GHR) associated with cancer promotion, in this case lu......-mesenchymal transition and metastases (TWIST1, SNAI2, EGFR, MYC and CCND1) at 2 h after a GH pulse. This is consistent with prolonged GH signalling acting to promote cancer progression in lung cancer.Oncogene advance online publication, 2 October 2017; doi:10.1038/onc.2017.352....

  6. Hormonal control of spermatogenesis: expression of FSJH receptor and androgen receptor genes

    NARCIS (Netherlands)

    L.J. Blok (Leen)

    1992-01-01

    textabstractFSH and testosterone are the main hormonal regulators of spermatogenesis. The actions of androgens and FSH are mediated by their respective receptors. Receptor gene expression (mRNA and protein). is an important determinant of hormone action. Biochemical aspects of the regulation of

  7. Polymorphisms in the pituitary growth hormone gene and its ...

    Indian Academy of Sciences (India)

    2010-12-06

    Dec 6, 2010 ... GHR variant showed significant association of the GHRd3 deletion allele with CAD (OR 0.48, ...... against scarcity of food supply in this population (Millar et ..... hormone treatment reduces hypertension and obesity induced by.

  8. Identification of cis-acting regulatory elements in the human oxytocin gene promoter.

    Science.gov (United States)

    Richard, S; Zingg, H H

    1991-12-01

    The expression of hormone-inducible genes is determined by the interaction of trans-acting factors with hormone-inducible elements and elements mediating basal and cell-specific expression. We have shown earlier that the gene encoding the hypothalamic nonapeptide oxytocin (OT) is under the control of an estrogen response element (ERE). The present study was aimed at identifying cis-acting elements mediating basal expression of the OT gene. A construct containing sequences -381 to +36 of the human OT gene was linked to a reporter gene and transiently transfected into a series of neuronal and nonneuronal cell lines. Expression of this construct was cell specific: it was highest in the neuroblastoma-derived cell line, Neuro-2a, and lowest in NIH 3T3 and JEG-3 cells. By 5' deletion analysis, we determined that a segment from -49 to +36 was capable of mediating cells-pecific promoter activity. Within this segment, we identified three proximal promoter elements (PPE-1, PPE-2, and PPE-3) that are each required for promoter activity. Most notably, mutation of a conserved purine-rich element (GAGAGA) contained within PPE-2 leads to a 10-fold decrease in promoter strength. Gel mobility shift analysis with three different double-stranded oligonucleotides demonstrated that each proximal promoter element binds distinct nuclear factors. In each case, only the homologous oligonucleotide, but neither of the oligonucleotides corresponding to adjacent elements, was able to act as a competitor. Thus, a different set of factors appears to bind independently to each element. By reinserting the homologous ERE or a heterologous glucocorticoid response element upstream of intact or altered proximal promoter segments we determined that removal or mutation of proximal promoter elements decreases basal expression, but does not abrogate the hormone responsiveness of the promoter. In conclusion, these results indicate that an important component of the transcriptional activity of the OT

  9. Insulators form gene loops by interacting with promoters in Drosophila.

    Science.gov (United States)

    Erokhin, Maksim; Davydova, Anna; Kyrchanova, Olga; Parshikov, Alexander; Georgiev, Pavel; Chetverina, Darya

    2011-09-01

    Chromatin insulators are regulatory elements involved in the modulation of enhancer-promoter communication. The 1A2 and Wari insulators are located immediately downstream of the Drosophila yellow and white genes, respectively. Using an assay based on the yeast GAL4 activator, we have found that both insulators are able to interact with their target promoters in transgenic lines, forming gene loops. The existence of an insulator-promoter loop is confirmed by the fact that insulator proteins could be detected on the promoter only in the presence of an insulator in the transgene. The upstream promoter regions, which are required for long-distance stimulation by enhancers, are not essential for promoter-insulator interactions. Both insulators support basal activity of the yellow and white promoters in eyes. Thus, the ability of insulators to interact with promoters might play an important role in the regulation of basal gene transcription.

  10. Precise regulation of gene expression dynamics favors complex promoter architectures.

    Directory of Open Access Journals (Sweden)

    Dirk Müller

    2009-01-01

    Full Text Available Promoters process signals through recruitment of transcription factors and RNA polymerase, and dynamic changes in promoter activity constitute a major noise source in gene expression. However, it is barely understood how complex promoter architectures determine key features of promoter dynamics. Here, we employ prototypical promoters of yeast ribosomal protein genes as well as simplified versions thereof to analyze the relations among promoter design, complexity, and function. These promoters combine the action of a general regulatory factor with that of specific transcription factors, a common motif of many eukaryotic promoters. By comprehensively analyzing stationary and dynamic promoter properties, this model-based approach enables us to pinpoint the structural characteristics underlying the observed behavior. Functional tradeoffs impose constraints on the promoter architecture of ribosomal protein genes. We find that a stable scaffold in the natural design results in low transcriptional noise and strong co-regulation of target genes in the presence of gene silencing. This configuration also exhibits superior shut-off properties, and it can serve as a tunable switch in living cells. Model validation with independent experimental data suggests that the models are sufficiently realistic. When combined, our results offer a mechanistic explanation for why specific factors are associated with low protein noise in vivo. Many of these findings hold for a broad range of model parameters and likely apply to other eukaryotic promoters of similar structure.

  11. Archaeal promoter architecture and mechanism of gene activation

    DEFF Research Database (Denmark)

    Peng, Nan; Ao, Xiang; Liang, Yun Xiang

    2011-01-01

    element named ara box directing arabinose-inducible expression and the basal promoter element TATA, serving as the binding site for the TATA-binding protein. Strikingly, these promoters possess a modular structure that allows an essentially inactive basal promoter to be strongly activated. The invoked...... mechanisms include TFB (transcription factor B) recruitment by the ara-box-binding factor to activate gene expression and modulation of TFB recruitment efficiency to yield differential gene expression....

  12. The role of thyroid hormone calorigenesis in the redox regulation of gene expression

    Directory of Open Access Journals (Sweden)

    PATRICIA VARELA

    2006-01-01

    Full Text Available Thyroid hormone (TH; 3,3',5-triiodothyronine, T3 is required for the normal function of most tissues, with major effects on 0(2 consumption and metabolic rate. These are due to transcriptional activation of respiratory genes through the interaction of T3-liganded TH receptors with TH response elements or the activation of intermediate factors, with the consequent higher production of reactive 0(2 species (ROS and antioxidant depletion. T3-induced oxidative stress in the liver triggers the redox upregulation of the expression of cytokines (tumor necrosis factor-á [TNF-á], interleukin-10, enzymes (inducible nitric oxide synthase, manganese superoxide dismutase, and anti-apoptotic proteins (Bcl-2, via a cascade initiated by TNF-á produced by Kupffer cells, involving inhibitor of κB phosphorylation and nuclear factor-κB activation. Thus, TH calorigenesis triggers an expression pattern that may represent an adaptive mechanism to re-establish redox homeostasis and promote cell survival under conditions of ROS toxicity secondary to TH-induced oxidative stress. Mechanisms of expression of respiratory and redox-sensitive genes may be functionally integrated, which could be of importance to understand the complexities of TH action and the outcome of thyroid gland dysfunction

  13. Promotional tone in reviews of menopausal hormone therapy after the Women's Health Initiative: an analysis of published articles.

    Directory of Open Access Journals (Sweden)

    Adriane Fugh-Berman

    2011-03-01

    Full Text Available BACKGROUND: Even after the Women's Health Initiative (WHI found that the risks of menopausal hormone therapy (hormone therapy outweighed benefit for asymptomatic women, about half of gynecologists in the United States continued to believe that hormones benefited women's health. The pharmaceutical industry has supported publication of articles in medical journals for marketing purposes. It is unknown whether author relationships with industry affect promotional tone in articles on hormone therapy. The goal of this study was to determine whether promotional tone could be identified in narrative review articles regarding menopausal hormone therapy and whether articles identified as promotional were more likely to have been authored by those with conflicts of interest with manufacturers of menopausal hormone therapy. METHODS AND FINDINGS: We analyzed tone in opinion pieces on hormone therapy published in the four years after the estrogen-progestin arm of the WHI was stopped. First, we identified the ten authors with four or more MEDLINE-indexed reviews, editorials, comments, or letters on hormone replacement therapy or menopausal hormone therapy published between July 2002 and June 2006. Next, we conducted an additional search using the names of these authors to identify other relevant articles. Finally, after author names and affiliations were removed, 50 articles were evaluated by three readers for scientific accuracy and for tone. Scientific accuracy was assessed based on whether or not the findings of the WHI were accurately reported using two criteria: (1 Acknowledgment or lack of denial of the risk of breast cancer diagnosis associated with hormone therapy, and (2 acknowledgment that hormone therapy did not benefit cardiovascular disease endpoints. Determination of promotional tone was based on the assessment by each reader of whether the article appeared to promote hormone therapy. Analysis of inter-rater consistency found moderate agreement

  14. Promotional tone in reviews of menopausal hormone therapy after the Women's Health Initiative: an analysis of published articles.

    Science.gov (United States)

    Fugh-Berman, Adriane; McDonald, Christina Pike; Bell, Alicia M; Bethards, Emily Catherine; Scialli, Anthony R

    2011-03-01

    Even after the Women's Health Initiative (WHI) found that the risks of menopausal hormone therapy (hormone therapy) outweighed benefit for asymptomatic women, about half of gynecologists in the United States continued to believe that hormones benefited women's health. The pharmaceutical industry has supported publication of articles in medical journals for marketing purposes. It is unknown whether author relationships with industry affect promotional tone in articles on hormone therapy. The goal of this study was to determine whether promotional tone could be identified in narrative review articles regarding menopausal hormone therapy and whether articles identified as promotional were more likely to have been authored by those with conflicts of interest with manufacturers of menopausal hormone therapy. We analyzed tone in opinion pieces on hormone therapy published in the four years after the estrogen-progestin arm of the WHI was stopped. First, we identified the ten authors with four or more MEDLINE-indexed reviews, editorials, comments, or letters on hormone replacement therapy or menopausal hormone therapy published between July 2002 and June 2006. Next, we conducted an additional search using the names of these authors to identify other relevant articles. Finally, after author names and affiliations were removed, 50 articles were evaluated by three readers for scientific accuracy and for tone. Scientific accuracy was assessed based on whether or not the findings of the WHI were accurately reported using two criteria: (1) Acknowledgment or lack of denial of the risk of breast cancer diagnosis associated with hormone therapy, and (2) acknowledgment that hormone therapy did not benefit cardiovascular disease endpoints. Determination of promotional tone was based on the assessment by each reader of whether the article appeared to promote hormone therapy. Analysis of inter-rater consistency found moderate agreement for scientific accuracy (κ=0.57) and substantial

  15. Gene expression and plant hormone levels in two contrasting rice genotypes responding to brown planthopper infestation.

    Science.gov (United States)

    Li, Changyan; Luo, Chao; Zhou, Zaihui; Wang, Rui; Ling, Fei; Xiao, Langtao; Lin, Yongjun; Chen, Hao

    2017-02-28

    The brown planthopper (BPH; Nilaparvata lugens Stål) is a destructive piercing-sucking insect pest of rice. The plant hormones salicylic acid (SA) and jasmonic acid (JA) play important roles in plant-pest interactions. Many isolated rice genes that modulate BPH resistance are involved in the metabolism or signaling pathways of SA, JA and ethylene. 'Rathu Heenati' (RH) is a rice cultivar with a high-level, broad-spectrum resistance to all BPH biotypes. Here, RH was used as the research material, while a BPH-susceptible rice cultivar 'Taichung Native 1' (TN1) was the control. A cDNA microarray analysis illuminated the resistance response at the genome level of RH under BPH infestation. The levels of SA and JA in RH and TN1 seedlings after BPH infestation were also determined. The expression pattern clustering indicated that 1467 differential probe sets may be associated with constitutive resistance and 67 with the BPH infestation-responsive resistance of RH. A Venn diagram analysis revealed 192 RH-specific and BPH-inducible probe sets. Finally, 23 BPH resistance-related gene candidates were selected based on the expression pattern clustering and Venn diagram analysis. In RH, the SA content significantly increased and the JA content significantly decreased after BPH infestation, with the former occurring prior to the latter. In RH, the differential genes in the SA pathway were synthesis-related and were up-regulated after BPH infestation. The differential genes in the JA pathway were also up-regulated. They were jasmonate ZIM-domain transcription factors, which are important negative regulators of the JA pathway. Comparatively, genes involved in the ET pathway were less affected by a BPH infestation in RH. DNA sequence analysis revealed that most BPH infestation-inducible genes may be regulated by the genetic background in a trans-acting manner, instead of by their promoters. We profiled the analysis of the global gene expression in RH and TN1 under BPH infestation

  16. Synthetic promoter libraries- tuning of gene expression

    DEFF Research Database (Denmark)

    Hammer, Karin; Mijakovic, Ivan; Jensen, Peter Ruhdal

    2006-01-01

    knockout and strong overexpression. However, applications such as metabolic optimization and control analysis necessitate a continuous set of expression levels with only slight increments in strength to cover a specific window around the wildtype expression level of the studied gene; this requirement can......The study of gene function often requires changing the expression of a gene and evaluating the consequences. In principle, the expression of any given gene can be modulated in a quasi-continuum of discrete expression levels but the traditional approaches are usually limited to two extremes: gene...

  17. Novel growth hormone receptor gene mutation in a patient with Laron syndrome.

    Science.gov (United States)

    Arman, Ahmet; Yüksel, Bilgin; Coker, Ajda; Sarioz, Ozlem; Temiz, Fatih; Topaloglu, Ali Kemal

    2010-04-01

    Growth Hormone (GH) is a 22 kDa protein that has effects on growth and glucose and fat metabolisms. These effects are initiated by binding of growth hormone (GH) to growth hormone receptors (GHR) expressed in target cells. Mutations or deletions in the growth hormone receptor cause an autosomal disorder called Laron-type dwarfism (LS) characterized by high circulating levels of serum GH and low levels of insulin like growth factor-1 (IGF-1). We analyzed the GHR gene for genetic defect in seven patients identified as Laron type dwarfism. We identified two missense mutations (S40L and W104R), and four polymorphisms (S473S, L526I, G168G and exon 3 deletion). We are reporting a mutation (W104R) at exon 5 of GHR gene that is not previously reported, and it is a novel mutation.

  18. Genetic variants in hormone-related genes and risk of breast cancer.

    Directory of Open Access Journals (Sweden)

    Tess Clendenen

    Full Text Available Sex hormones play a key role in the development of breast cancer. Certain polymorphic variants (SNPs and repeat polymorphisms in hormone-related genes are associated with sex hormone levels. However, the relationship observed between these genetic variants and breast cancer risk has been inconsistent. We conducted a case-control study nested within two prospective cohorts to assess the relationship between specific genetic variants in hormone-related genes and breast cancer risk. In total, 1164 cases and 2111 individually-matched controls were included in the study. We did not observe an association between potential functional genetic polymorphisms in the estrogen pathway, SHBG rs6259, ESR1 rs2234693, CYP19 rs10046 and rs4775936, and UGT1A1 rs8175347, or the progesterone pathway, PGR rs1042838, with the risk of breast cancer. Our results suggest that these genetic variants do not have a strong effect on breast cancer risk.

  19. Disruption of growth hormone receptor gene causes diminished pancreatic islet size and increased insulin sensitivity in mice.

    Science.gov (United States)

    Liu, Jun-Li; Coschigano, Karen T; Robertson, Katie; Lipsett, Mark; Guo, Yubin; Kopchick, John J; Kumar, Ujendra; Liu, Ye Lauren

    2004-09-01

    Growth hormone, acting through its receptor (GHR), plays an important role in carbohydrate metabolism and in promoting postnatal growth. GHR gene-deficient (GHR(-/-)) mice exhibit severe growth retardation and proportionate dwarfism. To assess the physiological relevance of growth hormone actions, GHR(-/-) mice were used to investigate their phenotype in glucose metabolism and pancreatic islet function. Adult GHR(-/-) mice exhibited significant reductions in the levels of blood glucose and insulin, as well as insulin mRNA accumulation. Immunohistochemical analysis of pancreatic sections revealed normal distribution of the islets despite a significantly smaller size. The average size of the islets found in GHR(-/-) mice was only one-third of that in wild-type littermates. Total beta-cell mass was reduced 4.5-fold in GHR(-/-) mice, significantly more than their body size reduction. This reduction in pancreatic islet mass appears to be related to decreases in proliferation and cell growth. GHR(-/-) mice were different from the human Laron syndrome in serum insulin level, insulin responsiveness, and obesity. We conclude that growth hormone signaling is essential for maintaining pancreatic islet size, stimulating islet hormone production, and maintaining normal insulin sensitivity and glucose homeostasis.

  20. Discovering potential Streptomyces hormone producers by using disruptants of essential biosynthetic genes as indicator strains.

    Science.gov (United States)

    Thao, Nguyen B; Kitani, Shigeru; Nitta, Hiroko; Tomioka, Toshiya; Nihira, Takuya

    2017-10-01

    Autoregulators are low-molecular-weight signaling compounds that control the production of many secondary metabolites in actinomycetes and have been referred to as 'Streptomyces hormones'. Here, potential producers of Streptomyces hormones were investigated in 40 Streptomyces and 11 endophytic actinomycetes. Production of γ-butyrolactone-type (IM-2, VB) and butenolide-type (avenolide) Streptomyces hormones was screened using Streptomyces lavendulae FRI-5 (ΔfarX), Streptomyces virginiae (ΔbarX) and Streptomyces avermitilis (Δaco), respectively. In these strains, essential biosynthetic genes for Streptomyces hormones were disrupted, enabling them to respond solely to the externally added hormones. The results showed that 20% of each of the investigated strains produced IM-2 and VB, confirming that γ-butyrolactone-type Streptomyces hormones are the most common in actinomycetes. Unlike the γ-butyrolactone type, butenolide-type Streptomyces hormones have been discovered in recent years, but their distribution has been unclear. Our finding that 24% of actinomycetes (12 of 51 strains) showed avenolide activity revealed for the first time that the butenolide-type Streptomyces hormone is also common in actinomycetes.

  1. Reconstructing Dynamic Promoter Activity Profiles from Reporter Gene Data

    DEFF Research Database (Denmark)

    Kannan, Soumya; Sams, Thomas; Maury, Jérôme

    2018-01-01

    activity despite the fact that the observed output may be dynamic and is a number of steps away from the transcription process. In fact, some promoters that are often thought of as constitutive can show changes in activity when growth conditions change. For these reasons, we have developed a system......Accurate characterization of promoter activity is important when designing expression systems for systems biology and metabolic engineering applications. Promoters that respond to changes in the environment enable the dynamic control of gene expression without the necessity of inducer compounds......, for example. However, the dynamic nature of these processes poses challenges for estimating promoter activity. Most experimental approaches utilize reporter gene expression to estimate promoter activity. Typically the reporter gene encodes a fluorescent protein that is used to infer a constant promoter...

  2. Response of induced bone defects in horses to collagen matrix containing the human parathyroid hormone gene.

    Science.gov (United States)

    Backstrom, Kristin C; Bertone, Alicia L; Wisner, Erik R; Weisbrode, Stephen E

    2004-09-01

    To determine whether human parathyroid hormone (hPTH) gene in collagen matrix could safely promote bone formation in diaphyseal or subchondral bones of horses. 8 clinically normal adult horses. Amount, rate, and quality of bone healing for 13 weeks were determined by use of radiography, quantitative computed tomography, and histomorphometric analysis. Diaphyseal cortex and subchondral bone defects of metacarpi were filled with hPTH(1-34) gene-activated matrix (GAM) or remained untreated. Joints were assessed on the basis of circumference, synovial fluid analysis, pain on flexion, lameness, and gross and histologic examination. Bone volume index was greater for cortical defects treated with hPTH(1-34) GAM, compared with untreated defects. Bone production in cortical defects treated with hPTH(1-34) GAM positively correlated with native bone formation in untreated defects. In contrast, less bone was detected in hPTH(1-34) GAM-treated subchondral bone defects, compared with untreated defects, and histology confirmed poorer healing and residual collagen sponge. Use of hPTH(1-34) GAM induced greater total bone, specifically periosteal bone, after 13 weeks of healing in cortical defects of horses. The hPTH(1-34) GAM impeded healing of subchondral bone but was biocompatible with joint tissues. Promotion of periosteal bone formation may be beneficial for healing of cortical fractures in horses, but the delay in onset of bone formation may negate benefits. The hPTH(1-34) GAM used in this study should not be placed in articular subchondral bone defects, but contact with articular surfaces is unlikely to cause short-term adverse effects.

  3. Mediator subunit MED1 is a T3-dependent and T3-independent coactivator on the thyrotropin β gene promoter

    Energy Technology Data Exchange (ETDEWEB)

    Matsui, Keiji; Oda, Kasumi; Mizuta, Shumpei; Ishino, Ruri; Urahama, Norinaga; Hasegawa, Natsumi [Laboratory of Hematology, Division of Medical Biophysics, Kobe University Graduate School of Health Sciences, 7-10-2 Tomogaoka, Suma-ku, Kobe 654-0142 (Japan); Roeder, Robert G. [Laboratory of Biochemistry and Molecular Biology, The Rockefeller University, 1230 York Avenue, New York, NY 10065 (United States); Ito, Mitsuhiro, E-mail: itomi@med.kobe-u.ac.jp [Laboratory of Hematology, Division of Medical Biophysics, Kobe University Graduate School of Health Sciences, 7-10-2 Tomogaoka, Suma-ku, Kobe 654-0142 (Japan); Laboratory of Biochemistry and Molecular Biology, The Rockefeller University, 1230 York Avenue, New York, NY 10065 (United States); Department of Family and Community Medicine, Kobe University Graduate School of Medicine, 7-5-1 Kusunoki-cho, Chuo-ku, Kobe 654-0142 (Japan); Consolidated Research Institute for Advanced Science and Medical Care, Waseda University, 3-4-1 Okubo, Shinjuku-ku, Tokyo 159-8555 (Japan)

    2013-10-11

    Highlights: •MED1 is a bona fide T3-dependent coactivator on TSHB promoter. •Mice with LxxLL-mutant MED1 have attenuated TSHβ mRNA and thyroid hormone levels. •MED1 activates TSHB promoter T3-dependently in cultured cells. •T3-dependent MED1 action is enhanced when SRC1/SRC2 or HDAC2 is downregulated. •MED1 is also a T3-independent GATA2/Pit1 coactivator on TSHB promoter. -- Abstract: The MED1 subunit of the Mediator transcriptional coregulator complex is a nuclear receptor-specific coactivator. A negative feedback mechanism of thyroid-stimulating hormone (TSH, or thyrotropin) expression in the thyrotroph in the presence of triiodothyronine (T3) is employed by liganded thyroid hormone receptor β (TRβ) on the TSHβ gene promoter, where conventional histone-modifying coactivators act as corepressors. We now provide evidence that MED1 is a ligand-dependent positive cofactor on this promoter. TSHβ gene transcription was attenuated in MED1 mutant mice in which the nuclear receptor-binding ability of MED1 was specifically disrupted. MED1 stimulated GATA2- and Pit1-mediated TSHβ gene promoter activity in a ligand-independent manner in cultured cells. MED1 also stimulated transcription from the TSHβ gene promoter in a T3-dependent manner. The transcription was further enhanced when the T3-dependent corepressors SRC1, SRC2, and HDAC2 were downregulated. Hence, MED1 is a T3-dependent and -independent coactivator on the TSHβ gene promoter.

  4. Reconstructing Dynamic Promoter Activity Profiles from Reporter Gene Data.

    Science.gov (United States)

    Kannan, Soumya; Sams, Thomas; Maury, Jérôme; Workman, Christopher T

    2018-03-16

    Accurate characterization of promoter activity is important when designing expression systems for systems biology and metabolic engineering applications. Promoters that respond to changes in the environment enable the dynamic control of gene expression without the necessity of inducer compounds, for example. However, the dynamic nature of these processes poses challenges for estimating promoter activity. Most experimental approaches utilize reporter gene expression to estimate promoter activity. Typically the reporter gene encodes a fluorescent protein that is used to infer a constant promoter activity despite the fact that the observed output may be dynamic and is a number of steps away from the transcription process. In fact, some promoters that are often thought of as constitutive can show changes in activity when growth conditions change. For these reasons, we have developed a system of ordinary differential equations for estimating dynamic promoter activity for promoters that change their activity in response to the environment that is robust to noise and changes in growth rate. Our approach, inference of dynamic promoter activity (PromAct), improves on existing methods by more accurately inferring known promoter activity profiles. This method is also capable of estimating the correct scale of promoter activity and can be applied to quantitative data sets to estimate quantitative rates.

  5. Gene-environment interaction: Does fluoride influence the reproductive hormones in male farmers modified by ERα gene polymorphisms?

    Science.gov (United States)

    Ma, Qiang; Huang, Hui; Sun, Long; Zhou, Tong; Zhu, Jingyuan; Cheng, Xuemin; Duan, Lijv; Li, Zhiyuan; Cui, Liuxin; Ba, Yue

    2017-12-01

    The occurrence of endemic fluorosis is derived from high fluoride levels in drinking water and industrial fumes or dust. Reproductive disruption is also a major harm caused by fluoride exposure besides dental and skeletal lesions. However, few studies focus on the mechanism of fluoride exposure on male reproductive function, especially the possible interaction of fluoride exposure and gene polymorphism on male reproductive hormones. Therefore, we conducted a cross-sectional study in rural areas of Henan province in China to explore the interaction between the estrogen receptor alpha (ERα) gene and fluoride exposure on reproductive hormone levels in male farmers living in the endemic fluorosis villages. The results showed that fluoride exposure significantly increased the serum level of estradiol in the hypothalamic-pituitary-testicular (HPT) axis in male farmers. Moreover, the observations indicated that fluoride exposure and genetic markers had an interaction on serum concentration of follicle-stimulating hormone and estradiol, and the interaction among different loci of the ERα gene could impact the serum testosterone level. Findings in the present work suggest that chronic fluoride exposure in drinking water could modulate the levels of reproductive hormones in males living in endemic fluorosis areas, and the interaction between fluoride exposure and ERα polymorphisms might affect the serum levels of hormones in the HPT axis in male farmers. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. Crosstalk between thyroid hormone receptor and liver X receptor in the regulation of selective Alzheimer's disease indicator-1 gene expression.

    Directory of Open Access Journals (Sweden)

    Emi Ishida

    Full Text Available Selective Alzheimer's disease (AD indicator 1 (Seladin-1 has been identified as a gene down-regulated in the degenerated lesions of AD brain. Up-regulation of Seladin-1 reduces the accumulation of β-amyloid and neuronal death. Thyroid hormone (TH exerts an important effect on the development and maintenance of central nervous systems. In the current study, we demonstrated that Seladin-1 gene and protein expression in the forebrain was increased in thyrotoxic mice compared with that of euthyroid mice. However, unexpectedly, no significant decrease in the gene and protein expression was observed in hypothyroid mice. Interestingly, an agonist of liver X receptor (LXR, TO901317 (TO administration in vivo increased Seladin-1 gene and protein expression in the mouse forebrain only in a hypothyroid state and in the presence of mutant TR-β, suggesting that LXR-α would compensate for TR-β function to maintain Seladin-1 gene expression in hypothyroidism and resistance to TH. TH activated the mouse Seladin-1 gene promoter (-1936/+21 bp and site 2 including canonical TH response element (TRE half-site in the region between -159 and -154 bp is responsible for the positive regulation. RXR-α/TR-β heterodimerization was identified on site 2 by gel-shift assay, and chromatin immunoprecipitation assay revealed the recruitment of TR-β to site 2 and the recruitment was increased upon TH administration. On the other hand, LXR-α utilizes a distinct region from site 2 (-120 to -102 bp to activate the mouse Seladin-1 gene promoter. Taking these findings together, we concluded that TH up-regulates Seladin-1 gene expression at the transcriptional level and LXR-α maintains the gene expression.

  7. Growth hormone dose in growth hormone-deficient adults is not associated with IGF-1 gene polymorphisms

    NARCIS (Netherlands)

    S. Meyer (Silke); S. Schaefer (Stephan); D. Ivan (Diana); L. Stolk (Lisette); P.P. Arp (Pascal); A.G. Uitterlinden (André); P.P. Nawroth (Peter); U. Plöckinger (Ursula); G.K. Stalla (Günter); U. Tuschy (Ulrich); M.M. Weber (Matthias); W.J. Weise (Wolfgang); A. Pfützner (Andreas); P. Kann (Peter)

    2009-01-01

    textabstractAims: Several SNPs and a microsatellite cytosine-adenine repeat promoter polymorphisms of the IGF-1 gene have been reported to be associated with circulating IGF-1 serum concentrations. Variance in IGF-1 concentrations due to genetic variations may affect different response to growth

  8. Suitable Reference Genes for Accurate Gene Expression Analysis in Parsley (Petroselinum crispum) for Abiotic Stresses and Hormone Stimuli.

    Science.gov (United States)

    Li, Meng-Yao; Song, Xiong; Wang, Feng; Xiong, Ai-Sheng

    2016-01-01

    Parsley, one of the most important vegetables in the Apiaceae family, is widely used in the food, medicinal, and cosmetic industries. Recent studies on parsley mainly focus on its chemical composition, and further research involving the analysis of the plant's gene functions and expressions is required. qPCR is a powerful method for detecting very low quantities of target transcript levels and is widely used to study gene expression. To ensure the accuracy of results, a suitable reference gene is necessary for expression normalization. In this study, four software, namely geNorm, NormFinder, BestKeeper, and RefFinder were used to evaluate the expression stabilities of eight candidate reference genes of parsley ( GAPDH, ACTIN, eIF-4 α, SAND, UBC, TIP41, EF-1 α, and TUB ) under various conditions, including abiotic stresses (heat, cold, salt, and drought) and hormone stimuli treatments (GA, SA, MeJA, and ABA). Results showed that EF-1 α and TUB were the most stable genes for abiotic stresses, whereas EF-1 α, GAPDH , and TUB were the top three choices for hormone stimuli treatments. Moreover, EF-1 α and TUB were the most stable reference genes among all tested samples, and UBC was the least stable one. Expression analysis of PcDREB1 and PcDREB2 further verified that the selected stable reference genes were suitable for gene expression normalization. This study can guide the selection of suitable reference genes in gene expression in parsley.

  9. Suitable reference genes for accurate gene expression analysis in parsley (Petroselinum crispum for abiotic stresses and hormone stimuli

    Directory of Open Access Journals (Sweden)

    Meng-Yao Li

    2016-09-01

    Full Text Available Parsley is one of the most important vegetable in Apiaceae family and widely used in food industry, medicinal and cosmetic. The recent studies in parsley are mainly focus on chemical composition, further research involving the analysis of the gene functions and expressions will be required. qPCR is a powerful method for detecting very low quantities of target transcript levels and widely used for gene expression studies. To ensure the accuracy of results, a suitable reference gene is necessary for expression normalization. In this study, three software geNorm, NormFinder, and BestKeeper were used to evaluate the expression stabilities of eight candidate reference genes (GAPDH, ACTIN, eIF-4α, SAND, UBC, TIP41, EF-1α, and TUB under various conditions including abiotic stresses (heat, cold, salt, and drought and hormone stimuli treatments (GA, SA, MeJA, and ABA. The results showed that EF-1α and TUB were identified as the most stable genes for abiotic stresses, while EF-1α, GAPDH, and TUB were the top three choices for hormone stimuli treatments. Moreover, EF-1α and TUB were the most stable reference genes across all the tested samples, while UBC was the least stable one. The expression analysis of PcDREB1 and PcDREB2 further verified that the selected stable reference genes were suitable for gene expression normalization. This study provides a guideline for selection the suitable reference genes in gene expression in parsley.

  10. NR4A1 (Nur77 mediates thyrotropin-releasing hormone-induced stimulation of transcription of the thyrotropin β gene: analysis of TRH knockout mice.

    Directory of Open Access Journals (Sweden)

    Yasuyo Nakajima

    Full Text Available Thyrotropin-releasing hormone (TRH is a major stimulator of thyrotropin-stimulating hormone (TSH synthesis in the anterior pituitary, though precisely how TRH stimulates the TSHβ gene remains unclear. Analysis of TRH-deficient mice differing in thyroid hormone status demonstrated that TRH was critical for the basal activity and responsiveness to thyroid hormone of the TSHβ gene. cDNA microarray and K-means cluster analyses with pituitaries from wild-type mice, TRH-deficient mice and TRH-deficient mice with thyroid hormone replacement revealed that the largest and most consistent decrease in expression in the absence of TRH and on supplementation with thyroid hormone was shown by the TSHβ gene, and the NR4A1 gene belonged to the same cluster as and showed a similar expression profile to the TSHβ gene. Immunohistochemical analysis demonstrated that NR4A1 was expressed not only in ACTH- and FSH- producing cells but also in thyrotrophs and the expression was remarkably reduced in TRH-deficient pituitary. Furthermore, experiments in vitro demonstrated that incubation with TRH in GH4C1 cells increased the endogenous NR4A1 mRNA level by approximately 50-fold within one hour, and this stimulation was inhibited by inhibitors for PKC and ERK1/2. Western blot analysis confirmed that TRH increased NR4A1 expression within 2 h. A series of deletions of the promoter demonstrated that the region between bp -138 and +37 of the TSHβ gene was responsible for the TRH-induced stimulation, and Chip analysis revealed that NR4A1 was recruited to this region. Conversely, knockdown of NR4A1 by siRNA led to a significant reduction in TRH-induced TSHβ promoter activity. Furthermore, TRH stimulated NR4A1 promoter activity through the TRH receptor. These findings demonstrated that 1 TRH is a highly specific regulator of the TSHβ gene, and 2 TRH mediated induction of the TSHβ gene, at least in part by sequential stimulation of the NR4A1-TSHβ genes through a PKC and

  11. A Bacterial Receptor PcrK Senses the Plant Hormone Cytokinin to Promote Adaptation to Oxidative Stress

    Directory of Open Access Journals (Sweden)

    Fang-Fang Wang

    2017-12-01

    Full Text Available Summary: Recognition of the host plant is a prerequisite for infection by pathogenic bacteria. However, how bacterial cells sense plant-derived stimuli, especially chemicals that function in regulating plant development, remains completely unknown. Here, we have identified a membrane-bound histidine kinase of the phytopathogenic bacterium Xanthomonas campestris, PcrK, as a bacterial receptor that specifically detects the plant cytokinin 2-isopentenyladenine (2iP. 2iP binds to the extracytoplasmic region of PcrK to decrease its autokinase activity. Through a four-step phosphorelay, 2iP stimulation decreased the phosphorylation level of PcrR, the cognate response regulator of PcrK, to activate the phosphodiesterase activity of PcrR in degrading the second messenger 3′,5′-cyclic diguanylic acid. 2iP perception by the PcrK-PcrR remarkably improves bacterial tolerance to oxidative stress by regulating the transcription of 56 genes, including the virulence-associated TonB-dependent receptor gene ctrA. Our results reveal an evolutionarily conserved, inter-kingdom signaling by which phytopathogenic bacteria intercept a plant hormone signal to promote adaptation to oxidative stress. : How pathogenic bacteria use receptors to recognize the signals of the host plant is unknown. Wang et al. have identified a bacterial receptor histidine kinase that specifically senses the plant hormone cytokinin. Through a four-step phosphorelay, cytokinin perception triggers degradation of a second messenger, c-di-GMP, to activate the bacterial response to oxidative stress. Keywords: histidine kinase, ligand, cytokinin, autokinase activity, phosphorelay, response regulator, two-component signal transduction system, Xanthomonas campestris pv. campestris, virulence, oxidative stress

  12. Hyperactivity and Learning Deficits in Transgenic Mice Bearing a Human Mutant Thyroid Hormone β1 Receptor Gene

    OpenAIRE

    McDonald, Michael P.; Wong, Rosemary; Goldstein, Gregory; Weintraub, Bruce; Cheng, Sheue-yann; Crawley, Jacqueline N.

    1998-01-01

    Resistance to thyroid hormone (RTH) is a human syndrome mapped to the thyroid receptor β (TRβ) gene on chromosome 3, representing a mutation of the ligandbinding domain of the TRβ gene. The syndrome is characterized by reduced tissue responsiveness to thyroid hormone and elevated serum levels of thyroid hormones. A common behavioral phenotype associated with RTH is attention deficit hyperactivity disorder (ADHD). To test the hypothesis that RTH produces attention deficits and/or hyperactivity...

  13. Identification and functional characterisation of the promoter of the calcium sensor gene CBL1 from the xerophyte Ammopiptanthus mongolicus

    Directory of Open Access Journals (Sweden)

    Yin Weilun

    2010-01-01

    Full Text Available Abstract Background CBL1 is a calcium sensor that regulates drought, cold and salt signals in Arabidopsis. Overexpression of CBL1 gene in Arabidopsis and in Ammopiptanthus mongolicus showed different tolerant activities. We are interested in understanding the molecular mechanism of the upstream region of the CBL1 gene of A. mongolicus (AmCBL1. We investigated and characterized the promoter of the AmCBL1 gene, for promoters play a very important role in regulating gene expression in eukaryotes. Results A 1683-bp 5' flanking region was isolated from A. mongolicus. The sequence was identified as AmCBL1 promoter. Analysis of the promoter sequence indicated a 690-bp intron and some basic cis-acting elements were related to various environmental stresses and plant hormones. To identify the functional region of the AmCBL1 promoter, five plant expression vectors fused with the GUS (β-glucuronidase gene, driven by series deleted fragments of AmCBL1 promoter at different lengths from -1659, -1414, -1048, -296 to -167 bp relative to the transcriptional start site were constructed and transformed into Nicotiana tabacum L. cv. 89. Functional properties of each promoter segment were examined by GUS staining and fluorescence quantitative analyses using at least three single-copy PCR-positive plants of transgenic tobacco, treated with various environmental stresses and plant hormones for different times. We demonstrated that the AmCBL1 promoter was a vascular-specific and multiple-stress-inducible promoter. Our results further imply that the promoter fragment B1S3 possessed sufficient essential cis-acting elements, accounting for vascular-specific and stress-induced expression patterns. It may also indicate that for response to some stresses certain cis-elements are required in tissues outside the region of the B1S3 construct. Conclusions To help resolve uncertainties about the upstream regulatory mechanism of the CBL1 gene in desert plants, we suggest that

  14. A novel growth hormone receptor gene deletion mutation in a patient with primary growth hormone insensitivity syndrome (Laron syndrome).

    Science.gov (United States)

    Yamamoto, Hiroyasu; Kouhara, Haruhiko; Iida, Keiji; Chihara, Kazuo; Kasayama, Soji

    2008-04-01

    Growth hormone (GH) insensitivity syndrome (Laron syndrome) is known to be caused by genetic disorders of the GH-IGF-1 axis. Although many mutations in the GH receptor have been identified, there have been only a few reports of deletions of the GH receptor gene. A Japanese adult female patient with Laron syndrome was subjected to chromosome analysis with basic G-banding and also with a high accuracy technique. Each exon of the GH receptor gene was amplified by means of PCR. Since this patient was diagnosed with osteoporosis, the effects of alendronate on bone mineral density (BMD) were also examined. The chromosome analysis with the high accuracy technique demonstrated a large deletion of the short arm in one allele of chromosome 5 from p11 to p13.1 [46, XX, del (5) (p11-p13.1)]. PCR amplification of exons of the GH receptor gene showed that only exons 2 and 3 were amplified. Low-dose IGF-1 administration (30microg/kg body weight) failed to increase her BMD, whereas alendronate administration resulted in an increase associated with a decrease in urinary deoxypyridinoline (DPD) and serum osteocalcin concentrations. The GH receptor gene of the patient was shown to lack exons 4-10. To the best of our knowledge, this is the third case report of Laron syndrome with large GH receptor deletion. Alendronate was effective for the enhancement of BMD.

  15. Firefly luciferase gene contains a cryptic promoter

    Czech Academy of Sciences Publication Activity Database

    Vopálenský, V.; Mašek, T.; Horváth, Ondřej; Vicenová, B.; Mokrejš, M.; Pospíšek, M.

    2008-01-01

    Roč. 14, č. 9 (2008), s. 1720-1729 ISSN 1355-8382 Grant - others:GAČR(CZ) GA204/03/1487; GAČR(CZ) GA301/07/0607; Mšk(CZ) LC06066 Program:LC Institutional research plan: CEZ:AV0Z50520514 Keywords : luciferase * cryptic promoter * hepatitis C virus Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.018, year: 2008

  16. Activation of vitellogenin II gene expression by steroid hormones in the old Japanese quail.

    Science.gov (United States)

    Gupta, S; Upadhyay, R; Kanungo, M S

    1998-11-01

    Alterations in the basal transcription rates of eukaryotic genes are believed to involve the binding of trans-acting factor(s) with specific DNA sequences in the promoter. We show here two interrelated events for the VTGII gene of the old, non-egg laying Japanese quail: alterations in the structure of the chromatin encompassing the gene, and binding of trans-acting factors to the promoter of the gene. Estradiol/progesterone alone or together cause alterations in the conformation of the chromatin of the promoter region of the gene. This may allow free access of nuclear protein(s) to the cis-acting elements, ERE, PRE and NF1, in the promoter of the gene and cause activation of transcription.

  17. Transactivation of a cellular promoter by the NS1 protein of the parvovirus minute virus of mice through a putative hormone-responsive element.

    Science.gov (United States)

    Vanacker, J M; Corbau, R; Adelmant, G; Perros, M; Laudet, V; Rommelaere, J

    1996-01-01

    The promoter of the thyroid hormone receptor alpha gene (c-erbA-1) is activated by the nonstructural protein 1 (NS1) of parvovirus minute virus of mice (prototype strain [MVMp]) in ras-transformed FREJ4 cells that are permissive for lytic MVMp replication. This stimulation may be related to the sensitivity of host cells to MVMp, as it does not take place in parental FR3T3 cells, which are resistant to the parvovirus killing effect. The analysis of a series of deletion and point mutants of the c-erbA-1 promoter led to the identification of an upstream region that is necessary for NS1-driven transactivation. This sequence harbors a putative hormone-responsive element and is sufficient to render a minimal promoter NS1 inducible in FREJ4 but not in FR3T3 cells, and it is involved in distinct interactions with proteins from the respective cell lines. The NS1-responsive element of the c-erbA-1 promoter bears no homology with sequences that were previously reported to be necessary for NS1 DNA binding and transactivation. Altogether, our data point to a novel, cell-specific mechanism of promoter activation by NS1. PMID:8642664

  18. Cloning and functional analysis of promoters of three GnRH genes in a cichlid

    International Nuclear Information System (INIS)

    Kitahashi, Takashi; Sato, Hideki; Sakuma, Yasuo; Parhar, Ishwar S.

    2005-01-01

    Mechanisms regulating gonadotropin-releasing hormone (GnRH) types, a key molecule for reproductive physiology, remain unclear. In the present study, we cloned the promoters of GnRH1, GnRH2, and GnRH3 genes in the tilapia, Oreochromis niloticus; and found putative binding sites for glucocorticoid receptors, Sp1, C/EBP, GATA, and Oct-1, but not for androgen receptors in all three GnRH promoters using computer analysis. The presence of binding sites for progesterone receptors in GnRH1, estrogen receptors in GnRH1 and GnRH2, and thyroid hormone receptors in GnRH1 and GnRH3 suggests direct action of steroid hormones on GnRH types. Our observation of SOX and LINE-like sequences exclusively in GnRH1, COUP in GnRH2, and retinoid X receptors in GnRH3 suggests their role in sexual differentiation, midbrain segmentation, and visual cue integration, respectively. Thus, the characteristic binding sites for nuclear receptors and transcription factors support the notion that each GnRH type is regulated differently and has distinct physiological roles

  19. How Did Arthropod Sesquiterpenoids and Ecdysteroids Arise? Comparison of Hormonal Pathway Genes in Noninsect Arthropod Genomes.

    Science.gov (United States)

    Qu, Zhe; Kenny, Nathan James; Lam, Hon Ming; Chan, Ting Fung; Chu, Ka Hou; Bendena, William G; Tobe, Stephen S; Hui, Jerome Ho Lam

    2015-06-25

    The phylum Arthropoda contains the largest number of described living animal species, with insects and crustaceans dominating the terrestrial and aquatic environments, respectively. Their successful radiations have long been linked to their rigid exoskeleton in conjunction with their specialized endocrine systems. In order to understand how hormones can contribute to the evolution of these animals, here, we have categorized the sesquiterpenoid and ecdysteroid pathway genes in the noninsect arthropod genomes, which are known to play important roles in the regulation of molting and metamorphosis in insects. In our analyses, the majority of gene homologs involved in the biosynthetic, degradative, and signaling pathways of sesquiterpenoids and ecdysteroids can be identified, implying these two hormonal systems were present in the last common ancestor of arthropods. Moreover, we found that the "Broad-Complex" was specifically gained in the Pancrustacea, and the innovation of juvenile hormone (JH) in the insect linage correlates with the gain of the JH epoxidase (CYP15A1/C1) and the key residue changes in the binding domain of JH receptor ("Methoprene-tolerant"). Furthermore, the gain of "Phantom" differentiates chelicerates from the other arthropods in using ponasterone A rather than 20-hydroxyecdysone as molting hormone. This study establishes a comprehensive framework for interpreting the evolution of these vital hormonal pathways in these most successful animals, the arthropods, for the first time. © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  20. How Did Arthropod Sesquiterpenoids and Ecdysteroids Arise? Comparison of Hormonal Pathway Genes in Noninsect Arthropod Genomes

    Science.gov (United States)

    Qu, Zhe; Kenny, Nathan James; Lam, Hon Ming; Chan, Ting Fung; Chu, Ka Hou; Bendena, William G.; Tobe, Stephen S.; Hui, Jerome Ho Lam

    2015-01-01

    The phylum Arthropoda contains the largest number of described living animal species, with insects and crustaceans dominating the terrestrial and aquatic environments, respectively. Their successful radiations have long been linked to their rigid exoskeleton in conjunction with their specialized endocrine systems. In order to understand how hormones can contribute to the evolution of these animals, here, we have categorized the sesquiterpenoid and ecdysteroid pathway genes in the noninsect arthropod genomes, which are known to play important roles in the regulation of molting and metamorphosis in insects. In our analyses, the majority of gene homologs involved in the biosynthetic, degradative, and signaling pathways of sesquiterpenoids and ecdysteroids can be identified, implying these two hormonal systems were present in the last common ancestor of arthropods. Moreover, we found that the “Broad-Complex” was specifically gained in the Pancrustacea, and the innovation of juvenile hormone (JH) in the insect linage correlates with the gain of the JH epoxidase (CYP15A1/C1) and the key residue changes in the binding domain of JH receptor (“Methoprene-tolerant”). Furthermore, the gain of “Phantom” differentiates chelicerates from the other arthropods in using ponasterone A rather than 20-hydroxyecdysone as molting hormone. This study establishes a comprehensive framework for interpreting the evolution of these vital hormonal pathways in these most successful animals, the arthropods, for the first time. PMID:26112967

  1. Gene expression and hormone autonomy in radiation-induced tumors of Arabidopsis thaliana

    International Nuclear Information System (INIS)

    Persinger, S.M.; Town, C.D.

    1989-01-01

    In order to study the molecular genetics of factor controlling plant cell growth, we have isolated a group of radiation-induced tumors from Arabidopsis thaliana. Tumors appeared on plants derived from 60 Co gamma-irradiated seed or seedlings, and are capable of hormone-autonomous growth in culture. We have used vertebrate oncogene probes to explore the hypothesis that the tumors arose by the radiation-induced activation of growth-regulating plant oncogenes. One probe, int-2, was used to isolate cDNA clones representing an mRNA differentially expressed between tumors and hormone-dependent callus tissue. The genomic organization and function of this and other differentially expressed Arabidopsis sequences are being further characterized. A second area of study concerns the hormonal status of individual tumors. Tumor tissue varies in color, texture, and degree of differentiation: while some tumors appear undifferentiated, one consistently produces roots, and others occasionally develop shoots or leaflets. The tumors have characteristic growth rates on hormone-free medium, and growth in response to exogenous hormones differs among the tumors themselves and from wild-type. Characterization of the relationships between hormonal status, morphogenesis, and gene expression should yield valuable insights into the mechanisms regulating plant growth and development

  2. Altered gene synchrony suggests a combined hormone-mediated dysregulated state in major depression.

    Directory of Open Access Journals (Sweden)

    Chris Gaiteri

    2010-04-01

    Full Text Available Coordinated gene transcript levels across tissues (denoted "gene synchrony" reflect converging influences of genetic, biochemical and environmental factors; hence they are informative of the biological state of an individual. So could brain gene synchrony also integrate the multiple factors engaged in neuropsychiatric disorders and reveal underlying pathologies? Using bootstrapped Pearson correlation for transcript levels for the same genes across distinct brain areas, we report robust gene transcript synchrony between the amygdala and cingulate cortex in the human postmortem brain of normal control subjects (n = 14; Control/Permutated data, p<0.000001. Coordinated expression was confirmed across distinct prefrontal cortex areas in a separate cohort (n = 19 subjects and affected different gene sets, potentially reflecting regional network- and function-dependent transcriptional programs. Genewise regional transcript coordination was independent of age-related changes and array technical parameters. Robust shifts in amygdala-cingulate gene synchrony were observed in subjects with major depressive disorder (MDD, denoted here "depression" (n = 14; MDD/Permutated data, p<0.000001, significantly affecting between 100 and 250 individual genes (10-30% false discovery rate. Biological networks and signal transduction pathways corresponding to the identified gene set suggested putative dysregulated functions for several hormone-type factors previously implicated in depression (insulin, interleukin-1, thyroid hormone, estradiol and glucocorticoids; p<0.01 for association with depression-related networks. In summary, we showed that coordinated gene expression across brain areas may represent a novel molecular probe for brain structure/function that is sensitive to disease condition, suggesting the presence of a distinct and integrated hormone-mediated corticolimbic homeostatic, although maladaptive and pathological, state in major depression.

  3. Transactivation of a cellular promoter by the NS1 protein of the parvovirus minute virus of mice through a putative hormone-responsive element.

    OpenAIRE

    Vanacker, J M; Corbau, R; Adelmant, G; Perros, M; Laudet, V; Rommelaere, J

    1996-01-01

    The promoter of the thyroid hormone receptor alpha gene (c-erbA-1) is activated by the nonstructural protein 1 (NS1) of parvovirus minute virus of mice (prototype strain [MVMp]) in ras-transformed FREJ4 cells that are permissive for lytic MVMp replication. This stimulation may be related to the sensitivity of host cells to MVMp, as it does not take place in parental FR3T3 cells, which are resistant to the parvovirus killing effect. The analysis of a series of deletion and point mutants of the...

  4. Glucocorticoid stimulates expression of corticotropin-releasing hormone gene in human placenta

    International Nuclear Information System (INIS)

    Robinson, B.G.; Emanuel, R.L.; Frim, D.M.; Majzoub, J.A.

    1988-01-01

    Primary cultures of purified human cytotrophoblasts have been used to examine the expression of the corticotropin-releasing hormone (CRH) gene in placenta. The authors report here that glucocorticoids stimulate placental CRH synthesis and secretion in primary cultures of human placenta. This stimulation is in contrast to the glucocorticoid suppression of CRH expression in hypothalamus. The positive regulation of CRH by glucocorticoids suggests that the rise in CRH preceding parturition could result from the previously described rise in fetal glucocorticoids. Furthermore, this increase in placental CRH could stimulate, via adrenocorticotropic hormone, a further rise in fetal glucocorticoids, completing a positive feedback loop that would be terminated by delivery

  5. Thyrotropin-releasing hormone (TRH promotes wound re-epithelialisation in frog and human skin.

    Directory of Open Access Journals (Sweden)

    Natalia T Meier

    Full Text Available There remains a critical need for new therapeutics that promote wound healing in patients suffering from chronic skin wounds. This is, in part, due to a shortage of simple, physiologically and clinically relevant test systems for investigating candidate agents. The skin of amphibians possesses a remarkable regenerative capacity, which remains insufficiently explored for clinical purposes. Combining comparative biology with a translational medicine approach, we report the development and application of a simple ex vivo frog (Xenopus tropicalis skin organ culture system that permits exploration of the effects of amphibian skin-derived agents on re-epithelialisation in both frog and human skin. Using this amphibian model, we identify thyrotropin-releasing hormone (TRH as a novel stimulant of epidermal regeneration. Moving to a complementary human ex vivo wounded skin assay, we demonstrate that the effects of TRH are conserved across the amphibian-mammalian divide: TRH stimulates wound closure and formation of neo-epidermis in organ-cultured human skin, accompanied by increased keratinocyte proliferation and wound healing-associated differentiation (cytokeratin 6 expression. Thus, TRH represents a novel, clinically relevant neuroendocrine wound repair promoter that deserves further exploration. These complementary frog and human skin ex vivo assays encourage a comparative biology approach in future wound healing research so as to facilitate the rapid identification and preclinical testing of novel, evolutionarily conserved, and clinically relevant wound healing promoters.

  6. Thyrotropin-Releasing Hormone (TRH) Promotes Wound Re-Epithelialisation in Frog and Human Skin

    Science.gov (United States)

    Zhang, Guo-You; Emelianov, Vladimir; Paredes, Roberto; Debus, Sebastian; Augustin, Matthias; Funk, Wolfgang; Amaya, Enrique; Kloepper, Jennifer E.; Hardman, Matthew J.; Paus, Ralf

    2013-01-01

    There remains a critical need for new therapeutics that promote wound healing in patients suffering from chronic skin wounds. This is, in part, due to a shortage of simple, physiologically and clinically relevant test systems for investigating candidate agents. The skin of amphibians possesses a remarkable regenerative capacity, which remains insufficiently explored for clinical purposes. Combining comparative biology with a translational medicine approach, we report the development and application of a simple ex vivo frog (Xenopus tropicalis) skin organ culture system that permits exploration of the effects of amphibian skin-derived agents on re-epithelialisation in both frog and human skin. Using this amphibian model, we identify thyrotropin-releasing hormone (TRH) as a novel stimulant of epidermal regeneration. Moving to a complementary human ex vivo wounded skin assay, we demonstrate that the effects of TRH are conserved across the amphibian-mammalian divide: TRH stimulates wound closure and formation of neo-epidermis in organ-cultured human skin, accompanied by increased keratinocyte proliferation and wound healing-associated differentiation (cytokeratin 6 expression). Thus, TRH represents a novel, clinically relevant neuroendocrine wound repair promoter that deserves further exploration. These complementary frog and human skin ex vivo assays encourage a comparative biology approach in future wound healing research so as to facilitate the rapid identification and preclinical testing of novel, evolutionarily conserved, and clinically relevant wound healing promoters. PMID:24023889

  7. Gene expression of placental hormones regulating energy balance in small for gestational age neonates.

    Science.gov (United States)

    Struwe, Ellen; Berzl, Gabriele M; Schild, Ralf L; Dötsch, Jörg

    2009-01-01

    Fetal growth restriction is associated with an increased risk for metabolic and cardiovascular disease in later life. To further elucidate mechanisms that might be involved in the process of prenatal programming, we measured the adipokines leptin, resistin, and adiponectin and the GH-releasing hormone ghrelin in the placenta of small for gestational age (SGA) neonates. The control group included 24 placentas of appropriate for gestational age (AGA) newborns, in the study group were 16 placentas of SGA neonates. Gene expression of leptin, resistin, adiponectin, and ghrelin was examined. For hormones showing alterations in gene regulation placental protein expression was measured by Western blot. Placental mRNA expression of leptin was significantly increased in SGA placentas (p=0.0035, related to beta-actin). Protein concentration was increased, as well. There were no differences in placental resistin, adiponectin, or ghrelin gene expressions between SGA neonates and controls. Leptin was the only hormone to demonstrate a significant inverse correlation with birth weight (r=-0.44, p=0.01). Adiponectin correlated significantly with leptin (r=0.53, p=0.0023) and ghrelin (r=0.50, p=0.0045). Placental leptin gene expression and protein concentration showed the expected increase in the SGA group. Leptin was inversely correlated with birth weight. Positive correlation of adiponectin with leptin and ghrelin expression suggests an interaction between these hormones in the placenta. However, the unchanged expression of resistin, adiponectin, and ghrelin in SGA placentas and the absence of correlation with birth weight cast doubt whether these hormones produced in the placenta play a key role in fetal programming.

  8. Developmental Regulation of Gonadotropin-releasing Hormone Gene Expression by the MSX and DLX Homeodomain Protein Families*

    Science.gov (United States)

    Givens, Marjory L.; Rave-Harel, Naama; Goonewardena, Vinodha D.; Kurotani, Reiko; Berdy, Sara E.; Swan, Christo H.; Rubenstein, John L. R.; Robert, Benoit; Mellon, Pamela L.

    2010-01-01

    Gonadotropin-releasing hormone (GnRH) is the central regulator of the hypothalamic-pituitary-gonadal axis, controlling sexual maturation and fertility in diverse species from fish to humans. GnRH gene expression is limited to a discrete population of neurons that migrate through the nasal region into the hypothalamus during embryonic development. The GnRH regulatory region contains four conserved homeodomain binding sites (ATTA) that are essential for basal promoter activity and cell-specific expression of the GnRH gene. MSX and DLX are members of the Antennapedia class of non-Hox homeodomain transcription factors that regulate gene expression and influence development of the craniofacial structures and anterior forebrain. Here, we report that expression patterns of the Msx and Dlx families of homeodomain transcription factors largely coincide with the migratory route of GnRH neurons and co-express with GnRH in neurons during embryonic development. In addition, MSX and DLX family members bind directly to the ATTA consensus sequences and regulate transcriptional activity of the GnRH promoter. Finally, mice lacking MSX1 or DLX1 and 2 show altered numbers of GnRH-expressing cells in regions where these factors likely function. These findings strongly support a role for MSX and DLX in contributing to spatiotemporal regulation of GnRH transcription during development. PMID:15743757

  9. Developmental regulation of gonadotropin-releasing hormone gene expression by the MSX and DLX homeodomain protein families.

    Science.gov (United States)

    Givens, Marjory L; Rave-Harel, Naama; Goonewardena, Vinodha D; Kurotani, Reiko; Berdy, Sara E; Swan, Christo H; Rubenstein, John L R; Robert, Benoit; Mellon, Pamela L

    2005-05-13

    Gonadotropin-releasing hormone (GnRH) is the central regulator of the hypothalamic-pituitary-gonadal axis, controlling sexual maturation and fertility in diverse species from fish to humans. GnRH gene expression is limited to a discrete population of neurons that migrate through the nasal region into the hypothalamus during embryonic development. The GnRH regulatory region contains four conserved homeodomain binding sites (ATTA) that are essential for basal promoter activity and cell-specific expression of the GnRH gene. MSX and DLX are members of the Antennapedia class of non-Hox homeodomain transcription factors that regulate gene expression and influence development of the craniofacial structures and anterior forebrain. Here, we report that expression patterns of the Msx and Dlx families of homeodomain transcription factors largely coincide with the migratory route of GnRH neurons and co-express with GnRH in neurons during embryonic development. In addition, MSX and DLX family members bind directly to the ATTA consensus sequences and regulate transcriptional activity of the GnRH promoter. Finally, mice lacking MSX1 or DLX1 and 2 show altered numbers of GnRH-expressing cells in regions where these factors likely function. These findings strongly support a role for MSX and DLX in contributing to spatiotemporal regulation of GnRH transcription during development.

  10. The bactericidal agent triclosan modulates thyroid hormone-associated gene expression and disrupts postembryonic anuran development

    International Nuclear Information System (INIS)

    Veldhoen, Nik; Skirrow, Rachel C.; Osachoff, Heather; Wigmore, Heidi; Clapson, David J.; Gunderson, Mark P.; Van Aggelen, Graham; Helbing, Caren C.

    2006-01-01

    We investigated whether exposure to environmentally relevant concentrations of the bactericidal agent, triclosan, induces changes in the thyroid hormone-mediated process of metamorphosis of the North American bullfrog, Rana catesbeiana and alters the expression profile of thyroid hormone receptor (TR) α and β, basic transcription element binding protein (BTEB) and proliferating nuclear cell antigen (PCNA) gene transcripts. Premetamorphic tadpoles were immersed in environmentally relevant concentrations of triclosan and injected with 1 x 10 -11 mol/g body weight 3,5,3'-triiodothyronine (T 3 ) or vehicle control. Morphometric measurements and steady-state mRNA levels obtained by quantitative polymerase chain reaction were determined. mRNA abundance was also examined in Xenopus laevis XTC-2 cells treated with triclosan and/or 10 nM T 3 . Tadpoles pretreated with triclosan concentrations as low as 0.15 ± 0.03 μg/L for 4 days showed increased hindlimb development and a decrease in total body weight following T 3 administration. Triclosan exposure also resulted in decreased T 3 -mediated TRβ mRNA expression in the tadpole tail fin and increased levels of PCNA transcript in the brain within 48 h of T 3 treatment whereas TRα and BTEB were unaffected. Triclosan alone altered thyroid hormone receptor α transcript levels in the brain of premetamorphic tadpoles and induced a transient weight loss. In XTC-2 cells, exposure to T 3 plus nominal concentrations of triclosan as low as 0.03 μg/L for 24 h resulted in altered thyroid hormone receptor mRNA expression. Exposure to low levels of triclosan disrupts thyroid hormone-associated gene expression and can alter the rate of thyroid hormone-mediated postembryonic anuran development

  11. The bactericidal agent triclosan modulates thyroid hormone-associated gene expression and disrupts postembryonic anuran development

    Energy Technology Data Exchange (ETDEWEB)

    Veldhoen, Nik [Department of Biochemistry and Microbiology, P.O. Box 3055, Stn. CSC, University of Victoria, Victoria, British Columbia V8W 3P6 (Canada); Skirrow, Rachel C. [Pacific Environmental Science Centre, 2645 Dollarton Highway, North Vancouver, British Columbia V7H 1V2 (Canada); Osachoff, Heather [Pacific Environmental Science Centre, 2645 Dollarton Highway, North Vancouver, British Columbia V7H 1V2 (Canada); Wigmore, Heidi [Pacific Environmental Science Centre, 2645 Dollarton Highway, North Vancouver, British Columbia V7H 1V2 (Canada); Clapson, David J. [Department of Biochemistry and Microbiology, P.O. Box 3055, Stn. CSC, University of Victoria, Victoria, British Columbia V8W 3P6 (Canada); Gunderson, Mark P. [Department of Biochemistry and Microbiology, P.O. Box 3055, Stn. CSC, University of Victoria, Victoria, British Columbia V8W 3P6 (Canada); Van Aggelen, Graham [Pacific Environmental Science Centre, 2645 Dollarton Highway, North Vancouver, British Columbia V7H 1V2 (Canada); Helbing, Caren C. [Department of Biochemistry and Microbiology, P.O. Box 3055, Stn. CSC, University of Victoria, Victoria, British Columbia V8W 3P6 (Canada)]. E-mail: chelbing@uvic.ca

    2006-12-01

    We investigated whether exposure to environmentally relevant concentrations of the bactericidal agent, triclosan, induces changes in the thyroid hormone-mediated process of metamorphosis of the North American bullfrog, Rana catesbeiana and alters the expression profile of thyroid hormone receptor (TR) {alpha} and {beta}, basic transcription element binding protein (BTEB) and proliferating nuclear cell antigen (PCNA) gene transcripts. Premetamorphic tadpoles were immersed in environmentally relevant concentrations of triclosan and injected with 1 x 10{sup -11} mol/g body weight 3,5,3'-triiodothyronine (T{sub 3}) or vehicle control. Morphometric measurements and steady-state mRNA levels obtained by quantitative polymerase chain reaction were determined. mRNA abundance was also examined in Xenopus laevis XTC-2 cells treated with triclosan and/or 10 nM T{sub 3}. Tadpoles pretreated with triclosan concentrations as low as 0.15 {+-} 0.03 {mu}g/L for 4 days showed increased hindlimb development and a decrease in total body weight following T{sub 3} administration. Triclosan exposure also resulted in decreased T{sub 3}-mediated TR{beta} mRNA expression in the tadpole tail fin and increased levels of PCNA transcript in the brain within 48 h of T{sub 3} treatment whereas TR{alpha} and BTEB were unaffected. Triclosan alone altered thyroid hormone receptor {alpha} transcript levels in the brain of premetamorphic tadpoles and induced a transient weight loss. In XTC-2 cells, exposure to T{sub 3} plus nominal concentrations of triclosan as low as 0.03 {mu}g/L for 24 h resulted in altered thyroid hormone receptor mRNA expression. Exposure to low levels of triclosan disrupts thyroid hormone-associated gene expression and can alter the rate of thyroid hormone-mediated postembryonic anuran development.

  12. Dietary TiO2 particles modulate expression of hormone-related genes in Bombyx mori.

    Science.gov (United States)

    Shi, Guofang; Zhan, Pengfei; Jin, Weiming; Fei, JianMing; Zhao, Lihua

    2017-08-01

    Silkworm (Bombyx mori) is an economically beneficial insect. Its growth and development are regulated by endogenous hormones. In the present study, we found that feeding titanium dioxide nanoparticles (TiO 2 NP) caused a significant increase of body size. TiO 2 NP stimulated the transcription of several genes, including the insulin-related hormone bombyxin, PI3K/Akt/TOR (where PI3K is phosphatidylinositol 3-kinase and TOR is target of rapamycin), and the adenosine 5'-monophosphateactivated protein kinase (AMPK)/target of rapamycin (TOR) pathways. Differentially expressed gene (DEG) analysis documented 26 developmental hormone signaling related genes that were differentially expressed following dietary TiO 2 NP treatment. qPCR analysis confirmed the upregulation of insulin/ecdysteroid signaling genes, such as bombyxin B-1, bombyxin B-4, bombyxin B-7, MAPK, P70S6K, PI3k, eIF4E, E75, ecdysteroid receptor (EcR), and insulin-related peptide binding protein precursor 2 (IBP2). We infer from the upregulated expression of bombyxins and the signaling network that they act in bombyxin-stimulated ecdysteroidogenesis. © 2017 Wiley Periodicals, Inc.

  13. A novel BDNF gene promoter directs expression to skeletal muscle

    Directory of Open Access Journals (Sweden)

    Heinrich Gerhard

    2003-06-01

    Full Text Available Abstract Background Cell-specific expression of the gene that encodes brain-derived neurotrophic factor (BDNF is required for the normal development of peripheral sensory neurons and efficient synaptic transmission in the mature central and peripheral nervous system. The control of BDNF gene expression involves multiple tissue and cell-specific promoters that are differentially regulated. The molecular mechanisms that are responsible for tissue and cell-specific expression of these promoters are still incompletely understood. Results The cloning and analysis of three additional zebrafish (Danio rerio BDNF gene exons and two associated promoters, is reported. Among them are two exons that generate a novel tripartite mature transcript. The exons were located on the transcription unit, whose overall organization was determined by cloning, Southern blot hybridization and sequence analysis, and compared with the pufferfish (Fugu rubripes and mammalian BDNF loci, revealing a conserved but more compact organization. Structural and functional analysis of the exons, their adjacent promoters and 5' flanks, showed that they are expressed cell-specifically. The promoter associated with the 5' exon of the tripartite transcript is GC-rich, TATA-less and the 5' flank adjacent to it contains multiple Sp1, Mef2, and AP1 elements. A fusion gene containing the promoter and 1.5 KB of 5' flank is directed exclusively to skeletal muscle of transiently transfected embryos. The second promoter, whose associated 5' exon contains a 25-nucleotide segment of identity with a mammalian BDNF gene exon, was transiently expressed in yolk of the early embryo. RT-PCR analysis of total RNA from whole juvenile fish and adult female skeletal muscle revealed tissue-specific expression of the 5' exons but the novel exon could not be detected even after two rounds of nested PCR. Conclusion The zebrafish BDNF gene is as complex as the mammalian gene yet much more compact. Its exons are

  14. Polymorphism of growth hormone receptor (GHR gene in Holstein Friesian dairy cattle

    Directory of Open Access Journals (Sweden)

    Restu Misrianti

    2011-12-01

    Full Text Available Growth hormone gene have a critical role in the regulation of lactation, mammary gland development and growth process through its interaction with a specific receptor. Growth hormone (GH is an anabolic hormone which is synthesized and secreted by somatotrop cell in pituitary anterior lobe, and interacts with a specific receptor on the surface of the target cells. Growth hormone receptor (GHR has been suggested as candidate gene for traits related to milk production in Bovidae. The purpose of this study was to identify genetic polymorphism of the Growth Hormone Receptor (GHR genes in Holstein Friesian (HF cattle. Total of 353 blood samples were collected from five populations belonging to Cikole Dairy Cattle Breeding Station (BPPT-SP Cikole (88 samples, Pasir Kemis (95 samples, Cilumber (98 samples, Cipelang Livestock Embryo Center (BET Cipelang (40 samples, Singosari National Artificial Insemination Centre (BBIB Singosari (32 samples and 17 frozen semen samples from Lembang Artificial Insemination Center (BIB Lembang. Genomic DNAs were extracted by a standard phenol-chloroform protocol and amplified by a polymerase chain reaction (PCR techniques then PCR products were genotyped by the Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP methods. There were two allele dan three genotypes were found namely: allele A and G, Genotype AA, AG and GG repectively. Allele A frequency (0.70-0.82 relatively higher than allele G frequency (0.18-0.30. Chi square test show that on group of BET Cipelang, BIB Lembang and BBIB Singosari population were not significantly different (0.00-0.93, while on group of BET Cipelang, BIB Lembang dan BBIB Singosari population were significantly different (6.02-11.13. Degree of observed heterozygosity (Ho ranged from 0.13-0.42 and expected heterozygosity (He ranged from 0.29-0.42.

  15. Epigenetic involvement of Alien/ESET complex in thyroid hormone-mediated repression of E2F1 gene expression and cell proliferation

    International Nuclear Information System (INIS)

    Hong, Wei; Li, Jinru; Wang, Bo; Chen, Linfeng; Niu, Wenyan; Yao, Zhi; Baniahmad, Aria

    2011-01-01

    Highlights: ► Corepressor Alien interacts with histone methyltransferase ESET in vivo. ► Alien/ESET complex is recruited to nTRE of T3-responsive gene by liganded TRβ1. ► ESET-mediated H3K9 methylation is required for liganded TRβ1-repressed transcription. ► ESET is involved in T3-repressed G1/S phase transition and proliferation. -- Abstract: The ligand-bound thyroid hormone receptor (TR) is known to repress via a negative TRE (nTRE) the expression of E2F1, a key transcription factor that controls the G1/S phase transition. Alien has been identified as a novel interacting factor of E2F1 and acts as a corepressor of E2F1. The detailed molecular mechanism by which Alien inhibits E2F1 gene expression remains unclear. Here, we report that the histone H3 lysine 9 (H3K9) methyltransferase (HMT) ESET is an integral component of the corepressor Alien complex and the Alien/ESET complex is recruited to both sites, the E2F1 and the nTRE site of the E2F1 gene while the recruitment to the negative thyroid hormone response element (nTRE) is induced by the ligand-bound TRβ1 within the E2F1 gene promoter. We show that, overexpression of ESET promotes, whereas knockdown of ESET releases, the inhibition of TRβ1-regulated gene transcription upon T3 stimulation; and H3K9 methylation is required for TRβ1-repressed transcription. Furthermore, depletion of ESET impairs thyroid hormone-repressed proliferation as well as the G1/S transition of the cell cycle. Taken together, our data indicate that ESET is involved in TRβ1-mediated transcription repression and provide a molecular basis of thyroid hormone-induced repression of proliferation.

  16. Paired hormone response elements predict caveolin-1 as a glucocorticoid target gene.

    Directory of Open Access Journals (Sweden)

    Marinus F van Batenburg

    2010-01-01

    Full Text Available Glucocorticoids act in part via glucocorticoid receptor binding to hormone response elements (HREs, but their direct target genes in vivo are still largely unknown. We developed the criterion that genomic occurrence of paired HREs at an inter-HRE distance less than 200 bp predicts hormone responsiveness, based on synergy of multiple HREs, and HRE information from known target genes. This criterion predicts a substantial number of novel responsive genes, when applied to genomic regions 10 kb upstream of genes. Multiple-tissue in situ hybridization showed that mRNA expression of 6 out of 10 selected genes was induced in a tissue-specific manner in mice treated with a single dose of corticosterone, with the spleen being the most responsive organ. Caveolin-1 was strongly responsive in several organs, and the HRE pair in its upstream region showed increased occupancy by glucocorticoid receptor in response to corticosterone. Our approach allowed for discovery of novel tissue specific glucocorticoid target genes, which may exemplify responses underlying the permissive actions of glucocorticoids.

  17. Evidence of a bigenomic regulation of mitochondrial gene expression by thyroid hormone during rat brain development

    International Nuclear Information System (INIS)

    Sinha, Rohit Anthony; Pathak, Amrita; Mohan, Vishwa; Babu, Satish; Pal, Amit; Khare, Drirh; Godbole, Madan M.

    2010-01-01

    Hypothyroidism during early mammalian brain development is associated with decreased expression of various mitochondrial encoded genes along with evidence for mitochondrial dysfunction. However, in-spite of the similarities between neurological disorders caused by perinatal hypothyroidism and those caused by various genetic mitochondrial defects we still do not know as to how thyroid hormone (TH) regulates mitochondrial transcription during development and whether this regulation by TH is nuclear mediated or through mitochondrial TH receptors? We here in rat cerebellum show that hypothyroidism causes reduction in expression of nuclear encoded genes controlling mitochondrial biogenesis like PGC-1α, NRF-1α and Tfam. Also, we for the first time demonstrate a mitochondrial localization of thyroid hormone receptor (mTR) isoform in developing brain capable of binding a TH response element (DR2) present in D-loop region of mitochondrial DNA. These results thus indicate an integrated nuclear-mitochondrial cross talk in regulation of mitochondrial transcription by TH during brain development.

  18. Evidence of a bigenomic regulation of mitochondrial gene expression by thyroid hormone during rat brain development

    Energy Technology Data Exchange (ETDEWEB)

    Sinha, Rohit Anthony; Pathak, Amrita; Mohan, Vishwa; Babu, Satish; Pal, Amit; Khare, Drirh [Department of Endocrinology, Sanjay Gandhi Postgraduate Institute of Medical Sciences, Lucknow 226014 (India); Godbole, Madan M., E-mail: madangodbole@yahoo.co.in [Department of Endocrinology, Sanjay Gandhi Postgraduate Institute of Medical Sciences, Lucknow 226014 (India)

    2010-07-02

    Hypothyroidism during early mammalian brain development is associated with decreased expression of various mitochondrial encoded genes along with evidence for mitochondrial dysfunction. However, in-spite of the similarities between neurological disorders caused by perinatal hypothyroidism and those caused by various genetic mitochondrial defects we still do not know as to how thyroid hormone (TH) regulates mitochondrial transcription during development and whether this regulation by TH is nuclear mediated or through mitochondrial TH receptors? We here in rat cerebellum show that hypothyroidism causes reduction in expression of nuclear encoded genes controlling mitochondrial biogenesis like PGC-1{alpha}, NRF-1{alpha} and Tfam. Also, we for the first time demonstrate a mitochondrial localization of thyroid hormone receptor (mTR) isoform in developing brain capable of binding a TH response element (DR2) present in D-loop region of mitochondrial DNA. These results thus indicate an integrated nuclear-mitochondrial cross talk in regulation of mitochondrial transcription by TH during brain development.

  19. Mechanosensitive promoter region in the human HB-GAM gene

    DEFF Research Database (Denmark)

    Liedert, Astrid; Kassem, Moustapha; Claes, Lutz

    2009-01-01

    Mechanical loading is essential for maintaining bone mass in the adult skeleton. However, the underlying process of the transfer of the physical stimulus into a biochemical response, which is termed mechanotransduction is poorly understood. Mechanotransduction results in the modulation of gene...... cells. Analysis of the human HB-GAM gene upstream regulatory region with luciferase reporter gene assays revealed that the upregulation of HB-GAM expression occurred at the transcriptional level and was mainly dependent on the HB-GAM promoter region most upstream containing three potential AP-1 binding...

  20. Ancient origin of placental expression in the growth hormone genes of anthropoid primates.

    Science.gov (United States)

    Papper, Zack; Jameson, Natalie M; Romero, Roberto; Weckle, Amy L; Mittal, Pooja; Benirschke, Kurt; Santolaya-Forgas, Joaquin; Uddin, Monica; Haig, David; Goodman, Morris; Wildman, Derek E

    2009-10-06

    In anthropoid primates, growth hormone (GH) genes have undergone at least 2 independent locus expansions, one in platyrrhines (New World monkeys) and another in catarrhines (Old World monkeys and apes). In catarrhines, the GH cluster has a pituitary-expressed gene called GH1; the remaining GH genes include placental GHs and placental lactogens. Here, we provide cDNA sequence evidence that the platyrrhine GH cluster also includes at least 3 placenta expressed genes and phylogenetic evidence that placenta expressed anthropoid GH genes have undergone strong adaptive evolution, whereas pituitary-expressed GH genes have faced strict functional constraint. Our phylogenetic evidence also points to lineage-specific gene gain and loss in early placental mammalian evolution, with at least three copies of the GH gene present at the time of the last common ancestor (LCA) of primates, rodents, and laurasiatherians. Anthropoid primates and laurasiatherians share gene descendants of one of these three copies, whereas rodents and strepsirrhine primates each maintain a separate copy. Eight of the amino-acid replacements that occurred on the lineage leading to the LCA of extant anthropoids have been implicated in GH signaling at the maternal-fetal interface. Thus, placental expression of GH may have preceded the separate series of GH gene duplications that occurred in catarrhines and platyrrhines (i.e., the roles played by placenta-expressed GHs in human pregnancy may have a longer evolutionary history than previously appreciated).

  1. DNA methylation of PTEN gene promoter region is not correlated ...

    African Journals Online (AJOL)

    Tumor suppressor gene PTEN plays an important role in cell cycle. Disorder of PTEN protein can cause cell growth and division in an uncontrolled way, which can lead to the formation of tumors. It has been proven that epigenetic mechanisms, such as promoter hypermethylation, may account for inactivation of PTEN in a ...

  2. Interleukin-10 gene promoter polymorphism as a potential host ...

    African Journals Online (AJOL)

    10) gene have been associated with altered levels of circulating IL-10, a Th2 cytokine that plays a key role in the pathogenesis of TB. We analyzed the frequencies of IL-10 promoter polymorphisms in 82 TB patients and 99 healthy Pakistani ...

  3. Interleukin 10 gene promoter polymorphism and risk of diffuse large ...

    African Journals Online (AJOL)

    Purpose: Given the importance of understanding the genetic variations involved in the pathogenesis of non-Hodgkin's lymphoma (NHL), this work was designed to study the impact of IL-10 (1082 G/A; rs1800896 and 819 C/T; rs1800871) gene promoter polymorphism on susceptibility of Egyptians to diffuse large B cell ...

  4. Specific DNA-binding proteins and DNA sequences involved in steroid hormone regulation of gene expression

    International Nuclear Information System (INIS)

    Spelsberg, T.; Hora, J.; Horton, M.; Goldberger, A.; Littlefield, B.; Seelke, R.; Toyoda, H.

    1987-01-01

    Steroid hormones circulate in the blood and are taken by target cells via complexes with intracellular binding proteins termed receptors, that are hormone and tissue specific. Each receptor binds it specific steroid with very high affinity, having an equilibrium dissociation constant (K/sub d/) in the range of 10 -9 to 10 -10 M. Once bound by their specific steroid hormones, the steroid receptors undergo a conformational change which allows them to bind with high affinity to sites on chromatin, termed nuclear acceptor sites. There are estimated 5,000 to 10,000 of these sites expressed with an equal number not expressed (''masked'') in intact chromatin. The result of the binding to nuclear acceptor sites is an alteration of gene transcription or, in some cases, gene expression as measured by the changing levels of specific RNAs and proteins in that target tissue. Each steroid regulates specific effects on the RNA and protein profiles. The chronology of the above mechanism of action after injection of radiolabelled steroid as is follows: Steroid-receptor complex formation (1 minute), nuclear acceptor sites (2 minutes), effects on RNA synthesis (10 to 30 minutes), and finally the changing protein profiles via changes in protein synthesis and protein turnover (1 to 6 hours). Thus steroid receptors represent one of the first identified intracellular gene regulation proteins. The receptor molecules themselves are regulated by the presence or absence of the steroid molecule

  5. Effects of 2G on Gene Expression of Stress-Related Hormones in Rat Placenta

    Science.gov (United States)

    Benson, S.; Talyansky, Y.; Moyer, E. L.; Lowe, M.; Baer, L. A.; Ronca, A. E.

    2017-01-01

    Understanding the effects of spaceflight on mammalian reproductive and developmental physiology is important to future human space exploration and permanent settlement beyond Earth orbit. Fetal developmental programming, including modulation of the HPA axis, is thought to originate at the placental-uterine interface, where both transfer of maternal hormones to the fetus and synthesis of endogenous hormones occurs. In healthy rats, fetal corticosterone levels are kept significantly lower by 11BetaHSD-2, which inactivates corticosterone by conversion into cortisone. Placental tissues express endogenous HPA axis-associated hormones including corticotropin-releasing hormone (CRH), pre-opiomelanocortin (POMC), and vasopressin, which may contribute to fetal programming alongside maternal hormones. DNA methylase 3A, 11BetaHSD-2, and 11BetaHSD-1, which are involved in the regulation of maternal cortisol transfer and modulation of the HPA axis, are also expressed in placental tissues along with glucocorticoid receptor and may be affected by differential gravity exposure during pregnancy. Fetuses may respond differently to maternal glucocorticoid exposure during gestation through sexually dimorphic expression of corticosterone-modulating hormones. To elucidate effects of altered gravity on placental gene expression, here we present a ground-based analogue study involving continuous centrifugation to produce 2g hypergravity. We hypothesized that exposure to 2g would induce a decrease in 11BetaHSD-2 expression through the downregulation of DNA methylase 3a and GC receptor, along with concurrent upregulation in endogenous CRH, POMC, and vasopressin expression. Timed pregnant female rats were exposed to 2G from Gestational day 6 to Gestational day 20, and comparisons made with Stationary Control (SC) and Vivarium Control (VC) dams at 1G. Dams were euthanized and placentas harvested on G20. We homogenized placental tissues, extracted and purified RNA, synthesized cDNA, and

  6. Halophytes: Potential Resources for Salt Stress Tolerance Genes and Promoters.

    Science.gov (United States)

    Mishra, Avinash; Tanna, Bhakti

    2017-01-01

    Halophytes have demonstrated their capability to thrive under extremely saline conditions and thus considered as one of the best germplasm for saline agriculture. Salinity is a worldwide problem, and the salt-affected areas are increasing day-by-day because of scanty rainfall, poor irrigation system, salt ingression, water contamination, and other environmental factors. The salinity stress tolerance mechanism is a very complex phenomenon, and some pathways are coordinately linked for imparting salinity tolerance. Though a number of salt responsive genes have been reported from the halophytes, there is always a quest for promising stress-responsive genes that can modulate plant physiology according to the salt stress. Halophytes such as Aeluropus, Mesembryanthemum, Suaeda, Atriplex, Thellungiella, Cakile , and Salicornia serve as a potential candidate for the salt-responsive genes and promoters. Several known genes like antiporters ( NHX, SOS, HKT, VTPase ), ion channels (Cl - , Ca 2+ , aquaporins), antioxidant encoding genes ( APX, CAT, GST, BADH, SOD ) and some novel genes such as USP, SDR1, SRP etc. were isolated from halophytes and explored for developing stress tolerance in the crop plants (glycophytes). It is evidenced that stress triggers salt sensors that lead to the activation of stress tolerance mechanisms which involve multiple signaling proteins, up- or down-regulation of several genes, and finally the distinctive or collective effects of stress-responsive genes. In this review, halophytes are discussed as an excellent platform for salt responsive genes which can be utilized for developing salinity tolerance in crop plants through genetic engineering.

  7. Halophytes: Potential Resources for Salt Stress Tolerance Genes and Promoters

    Directory of Open Access Journals (Sweden)

    Avinash Mishra

    2017-05-01

    Full Text Available Halophytes have demonstrated their capability to thrive under extremely saline conditions and thus considered as one of the best germplasm for saline agriculture. Salinity is a worldwide problem, and the salt-affected areas are increasing day-by-day because of scanty rainfall, poor irrigation system, salt ingression, water contamination, and other environmental factors. The salinity stress tolerance mechanism is a very complex phenomenon, and some pathways are coordinately linked for imparting salinity tolerance. Though a number of salt responsive genes have been reported from the halophytes, there is always a quest for promising stress-responsive genes that can modulate plant physiology according to the salt stress. Halophytes such as Aeluropus, Mesembryanthemum, Suaeda, Atriplex, Thellungiella, Cakile, and Salicornia serve as a potential candidate for the salt-responsive genes and promoters. Several known genes like antiporters (NHX, SOS, HKT, VTPase, ion channels (Cl−, Ca2+, aquaporins, antioxidant encoding genes (APX, CAT, GST, BADH, SOD and some novel genes such as USP, SDR1, SRP etc. were isolated from halophytes and explored for developing stress tolerance in the crop plants (glycophytes. It is evidenced that stress triggers salt sensors that lead to the activation of stress tolerance mechanisms which involve multiple signaling proteins, up- or down-regulation of several genes, and finally the distinctive or collective effects of stress-responsive genes. In this review, halophytes are discussed as an excellent platform for salt responsive genes which can be utilized for developing salinity tolerance in crop plants through genetic engineering.

  8. The role of feeding rhythm, adrenal hormones and neuronal inputs in synchronizing daily clock gene rhythms in the liver.

    Science.gov (United States)

    Su, Yan; Cailotto, Cathy; Foppen, Ewout; Jansen, Remi; Zhang, Zhi; Buijs, Ruud; Fliers, Eric; Kalsbeek, Andries

    2016-02-15

    The master clock in the hypothalamic suprachiasmatic nucleus (SCN) is assumed to distribute rhythmic information to the periphery via neural, humoral and/or behavioral connections. Until now, feeding, corticosterone and neural inputs are considered important signals for synchronizing daily rhythms in the liver. In this study, we investigated the necessity of neural inputs as well as of the feeding and adrenal hormone rhythms for maintaining daily hepatic clock gene rhythms. Clock genes kept their daily rhythm when only one of these three signals was disrupted, or when we disrupted hepatic neuronal inputs together with the adrenal hormone rhythm or with the daily feeding rhythm. However, all clock genes studied lost their daily expression rhythm after simultaneous disruption of the feeding and adrenal hormone rhythm. These data indicate that either a daily rhythm of feeding or adrenal hormones should be present to synchronize clock gene rhythms in the liver with the SCN. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  9. Promoter DNA hypermethylation and gene repression in undifferentiated Arabidopsis cells.

    Directory of Open Access Journals (Sweden)

    María Berdasco

    Full Text Available Maintaining and acquiring the pluripotent cell state in plants is critical to tissue regeneration and vegetative multiplication. Histone-based epigenetic mechanisms are important for regulating this undifferentiated state. Here we report the use of genetic and pharmacological experimental approaches to show that Arabidopsis cell suspensions and calluses specifically repress some genes as a result of promoter DNA hypermethylation. We found that promoters of the MAPK12, GSTU10 and BXL1 genes become hypermethylated in callus cells and that hypermethylation also affects the TTG1, GSTF5, SUVH8, fimbrin and CCD7 genes in cell suspensions. Promoter hypermethylation in undifferentiated cells was associated with histone hypoacetylation and primarily occurred at CpG sites. Accordingly, we found that the process specifically depends on MET1 and DRM2 methyltransferases, as demonstrated with DNA methyltransferase mutants. Our results suggest that promoter DNA methylation may be another important epigenetic mechanism for the establishment and/or maintenance of the undifferentiated state in plant cells.

  10. Hormonal modulation of breast cancer gene expression: implications for intrinsic subtyping in pre-menopausal women

    Directory of Open Access Journals (Sweden)

    Sarah M Bernhardt

    2016-11-01

    Full Text Available Clinics are increasingly adopting gene expression profiling to diagnose breast cancer subtype, providing an intrinsic, molecular portrait of the tumour. For example, the PAM50-based Prosigna test quantifies expression of 50 key genes to classify breast cancer subtype, and this method of classification has been demonstrated to be superior over traditional immunohistochemical methods that detect proteins, to predict risk of disease recurrence. However, these tests were largely developed and validated using breast cancer samples from post-menopausal women. Thus, the accuracy of such tests has not been explored in the context of the hormonal fluctuations in estrogen and progesterone that occur during the menstrual cycle in pre-menopausal women. Concordance between traditional methods of subtyping and the new tests in pre-menopausal women is likely to depend on the stage of the menstrual cycle at which the tissue sample is taken, and the relative effect of hormones on expression of genes versus proteins. The lack of knowledge around the effect of fluctuating estrogen and progesterone on gene expression in breast cancer patients raises serious concerns for intrinsic subtyping in pre-menopausal women, which comprise about 25% of breast cancer diagnoses. Further research on the impact of the menstrual cycle on intrinsic breast cancer profiling is required if pre-menopausal women are to benefit from the new technology of intrinsic subtyping.

  11. Loss of the NKX3.1 tumorsuppressor promotes the TMPRSS2-ERG fusion gene expression in prostate cancer

    International Nuclear Information System (INIS)

    Thangapazham, Rajesh; Saenz, Francisco; Katta, Shilpa; Mohamed, Ahmed A; Tan, Shyh-Han; Petrovics, Gyorgy; Srivastava, Shiv; Dobi, Albert

    2014-01-01

    In normal prostate epithelium the TMPRSS2 gene encoding a type II serine protease is directly regulated by male hormones through the androgen receptor. In prostate cancer ERG protooncogene frequently gains hormonal control by seizing gene regulatory elements of TMPRSS2 through genomic fusion events. Although, the androgenic activation of TMPRSS2 gene has been established, little is known about other elements that may interact with TMPRSS2 promoter sequences to modulate ERG expression in TMPRSS2-ERG gene fusion context. Comparative genomic analyses of the TMPRSS2 promoter upstream sequences and pathway analyses were performed by the Genomatix Software. NKX3.1 and ERG genes expressions were evaluated by immunoblot or by quantitative Real-Time PCR (qRT-PCR) assays in response to siRNA knockdown or heterologous expression. QRT-PCR assay was used for monitoring the gene expression levels of NKX3.1-regulated genes. Transcriptional regulatory function of NKX3.1 was assessed by luciferase assay. Recruitment of NKX3.1 to its cognate elements was monitored by Chromatin Immunoprecipitation assay. Comparative analysis of the TMPRSS2 promoter upstream sequences among different species revealed the conservation of binding sites for the androgen inducible NKX3.1 tumor suppressor. Defects of NKX3.1, such as, allelic loss, haploinsufficiency, attenuated expression or decreased protein stability represent established pathways in prostate tumorigenesis. We found that NKX3.1 directly binds to TMPRSS2 upstream sequences and negatively regulates the expression of the ERG protooncogene through the TMPRSS2-ERG gene fusion. These observations imply that the frequently noted loss-of-function of NKX3.1 cooperates with the activation of TMPRSS2-ERG fusions in prostate tumorigenesis

  12. Genes that cooperate with tumor promoters in transformation

    International Nuclear Information System (INIS)

    Colburn, N.H.; Smith, B.M.

    1988-01-01

    Tumor-promoting phorbol esters, like growth factors, elicit pleiotropic responses involving biochemical pathways that lead to different biological responses. Genetic variant cell lines that are resistant to mitogenic, differentiation, or transformation responses to tumor promoters have been valuable tools for understanding the molecular bases of these responses. Studies using the mouse epidermal JB6 cell lines that are sensitive or resistant to tumor promoter-induced transformation have yielded new understanding of genetic and signal transduction events involved in neoplastic transformation. The isolation and characterization of cloned mouse promotion sensitivity genes pro-1 and pro-2 is reviewed. A new activity of pro-1 has been identified: when transfected into human cancer prone basal cell nevus syndrome fibroblasts but not normal fibroblasts mouse pro-1 confers lifespan extension of these cells. Recently, we have found tat a pro-1 homolog from a library of nasopharyngeal carcinoma, but not the homolog from a normal human library, is activated for transferring promotion sensitivity. The many genetic variants for responses to tumor promoters have also proved valuable for signal transduction studies. JPB P- cells fail to show the 12-O-tetradecanoyl-phorbol-13-acetate (TPA)-induced syntheses of two proteins of 15 and 16 kD seen in P+ cells. P-, P+, and TPA transformed cells show a progressive decrease in both basal and TPA-inducible levels of a protein kinase C substrate of 80 kD. P- cells are relatively resistant both to anchorage-independent transformation and to a protein band shift induced by the calcium analog lanthanum. It appears that one or more calcium-binding proteins and one or more pro genes may be critical determinants of tumor promoter-induced neoplastic transformation

  13. Effects of Growth Hormone Gene Polymorphism on Lipogenic Gene Expression Levels in Diaphragm Tissues of Japanese Black Heifers

    Directory of Open Access Journals (Sweden)

    Astrid Ardiyanti

    2012-08-01

    Full Text Available Two SNPs, i.e. L127V and T172M, of bovine growth hormone (GH causing the presence of GH gene haplotypes A, B, and C was previously shown to alter intramuscular fatty acid (FA composition in Japanese Black (JB heifers. To determine the SNP effect on somatotropic hormone concentration and lipogenesis, we measured plasma GH, insulin, and insulin-like growth factor-1 (IGF-1 concentrations. We also measured mRNA levels of fatty acid synthase (FASN, stearoyl-coA desaturase (SCD, and sterol regulatory element binding proteins-1 (SREBP-1 and FA composition in diaphragm tissues. Heifers with genotype CC had the lowest plasma insulin concentration and FASN and SCD mRNA levels among genotypes. FASN mRNA levels in haplotype A tended to positively correlate with saturated FA (SFA content and negatively correlated with C18:2 and unsaturated FA (USFA contents. SCD mRNA levels in haplotype A positively correlated with monounsaturated FA (MUFA contents and negatively correlated with C18:0 content. They also tended to positively correlate with C16:1, C18:1, and USFA contents and USFA/SFA ratio and negatively correlate with SFA content. Taken together, GH gene polymorphism affects the lipogenic genes expression levels and their relationships with fatty acid compositions in diaphragm tissues of JB heifers at 31 months of age.

  14. Specific expression of bioluminescence reporter gene in cardiomyocyte regulated by tissue specific promoter

    Energy Technology Data Exchange (ETDEWEB)

    Nguyen, Vu Hong; Tae, Seong Ho; Le, Nguyen Uyen Chi; Min, Jung Joon [Chonnam National University Medical School, Gwangju (Korea, Republic of)

    2007-07-01

    As the human heart is not capable of regenerating the great numbers of cardiac cells that are lost after myocardial infarction, impaired cardiac function is the inevitable result of ischemic disease. Recently, human embryonic stem cells (hESCs) have gained popularity as a potentially ideal cell candidate for tissue regeneration. In particular, hESCs are capable of cardiac lineage-specific differentiation and confer improvement of cardiac function following transplantation into animal models. Although such data are encouraging, the specific strategy for in vivo and non-invasive detection of differentiated cardiac lineage is still limited. Therefore, in the present study, we established the gene construction in which the optical reporter gene Firefly luciferase was controlled by Myosin Heavy Chain promoter for specific expressing in heart cells. The vector consisting of - MHC promoter and a firefly luciferase coding sequence flanked by full-length bovine growth hormone (BGH) 3'-polyadenylation sequence based on pcDNA3.1- vector backbone. To test the specific transcription of this promoter in g of MHC-Fluc or CMV-Flue (for control) plasmid DNA in myocardial tissue, 20 phosphate-buffered saline was directly injected into mouse myocardium through a midline sternotomy and liver. After 1 week of injection, MHC-Fluc expression was detected from heart region which was observed under cooled CCD camera of in vivo imaging system but not from liver. In control group injected with CMV-Flue, the bioluminescence was detected from all these organs. The expression of Flue under control of Myosin Heavy Chain promoter may become a suitable optical reporter gene for stem cell-derived cardiac lineage differentiation study.

  15. The Dwarfs of Sindh: severe growth hormone (GH) deficiency caused by a mutation in the GH-releasing hormone receptor gene.

    Science.gov (United States)

    Baumann, G; Maheshwari, H

    1997-11-01

    We report the discovery of a cluster of severe familial dwarfism in two villages in the Province of Sindh in Pakistan. Dwarfism is proportionate and occurs in members of a kindred with a high degree of consanguinity. Only the last generation is affected, with the oldest dwarf being 28 years old. The mode of inheritance is autosomal recessive. Phenotype analysis and endocrine testing revealed isolated growth hormone deficiency (GHD) as the reason for growth failure. Linkage analysis for the loci of several candidate genes yielded a high lod score for the growth hormone-releasing hormone receptor (GHRH-R) locus on chromosome 7. Amplification and sequencing of the GHRH-R gene in affected subjects demonstrated an amber nonsense mutation (GAG-->TAG; Glu50-->Stop) in exon 3. The mutation, in its homozygous form, segregated 100% with the dwarf phenotype. It predicts a truncation of the GHRH-R in its extracellular domain, which is likely to result in a severely disabled or non-existent receptor protein. Subjects who are heterozygous for the mutation show mild biochemical abnormalities in the growth hormone-releasing hormone (GHRH)--growth hormone--insulin-like growth factor axis, but have only minimal or no growth retardation. The occurrence of an offspring of two dwarfed parents indicates that the GHRH-R is not necessary for fertility in either sex. We conclude that Sindh dwarfism is caused by an inactivating mutation in the GHRH-R gene, resulting in the inability to transmit a GHRH signal and consequent severe isolated GHD.

  16. Gene activation regresses atherosclerosis, promotes health, and enhances longevity

    Directory of Open Access Journals (Sweden)

    Luoma Pauli V

    2010-07-01

    Full Text Available Abstract Background Lifestyle factors and pharmacological compounds activate genetic mechanisms that influence the development of atherosclerotic and other diseases. This article reviews studies on natural and pharmacological gene activation that promotes health and enhances longevity. Results Living habits including healthy diet and regular physical activity, and pharmacotherapy, upregulate genes encoding enzymes and apolipoprotein and ATP-binding cassette transporters, acting in metabolic processes that promote health and increase survival. Cytochrome P450-enzymes, physiological factors in maintaining cholesterol homeostasis, generate oxysterols for the elimination of surplus cholesterol. Hepatic CTP:phosphocholine cytidylyltransferase-α is an important regulator of plasma HDL-C level. Gene-activators produce plasma lipoprotein profile, high HDL-C, HDL2-C and HDL-C/cholesterol ratio, which is typical of low risk of atherosclerotic disease, and also of exceptional longevity together with reduced prevalence of cardiovascular, metabolic and other diseases. High HDL contributes to protection against inflammation, oxidation and thrombosis, and associates with good cognitive function in very old people. Avoiding unhealthy stress and managing it properly promotes health and increases life expectancy. Conclusions Healthy living habits and gene-activating xenobiotics upregulate mechanisms that produce lipoprotein pattern typical of very old people and enhance longevity. Lipoprotein metabolism and large HDL2 associate with the process of living a very long life. Major future goals for health promotion are the improving of commitment to both wise lifestyle choices and drug therapy, and further the developing of new and more effective and well tolerated drugs and treatments.

  17. Selective AR Modulators that Distinguish Proliferative from Differentiative Gene Promoters

    Science.gov (United States)

    2016-08-01

    levels, and in some cases be useful in early stage disease or watchful waiting, and in other cases castration resistant prostate cancer (CRPC...dependent kinase inhibitor p21 gene through an androgen response element in the proximal promoter. Molecular endocrinology 13, 376 (Mar, 1999). 9...analyses and in mouse xenograft experiments, as planned. We will also continue to probe the molecular mechanism by which dox elicits these differential

  18. The altered promoter methylation of oxytocin receptor gene in autism.

    Science.gov (United States)

    Elagoz Yuksel, Mine; Yuceturk, Betul; Karatas, Omer Faruk; Ozen, Mustafa; Dogangun, Burak

    Autism spectrum disorder (ASD) is one of the lifelong existing disorders. Abnormal methylation status of gene promoters of oxytonergic system has been implicated as among the etiologic factors of ASDs. We, therefore, investigated the methylation frequency of oxytocin receptor gene (OXTR) promoter from peripheral blood samples of children with autistic features. Our sample includes 66 children in total (22-94 months); 27 children with ASDs according to the DSM-IV-TR and the Childhood Autism Rating Scale (CARS) and 39 children who do not have any autistic like symptoms as the healthy control group. We investigated the DNA methylation status of OXTR promoter by methylation specific enzymatic digestion of genomic DNA and polymerase chain reaction. A significant relationship has been found between ASDs and healthy controls for the reduction of methylation frequency of the regions MT1 and MT3 of OXTR. We could not find any association in the methylation frequency of MT2 and MT4 regions of OXTR. Although our findings indicate high frequency of OXTR promoter hypomethylation in ASDs, there is need for independent replication of the results for a bigger sample set. We expect that future studies with the inclusion of larger, more homogeneous samples will attempt to disentangle the causes of ASDs.

  19. Promoter-wide hypermethylation of the ribosomal RNA gene promoter in the suicide brain.

    Directory of Open Access Journals (Sweden)

    Patrick O McGowan

    Full Text Available BACKGROUND: Alterations in gene expression in the suicide brain have been reported and for several genes DNA methylation as an epigenetic regulator is thought to play a role. rRNA genes, that encode ribosomal RNA, are the backbone of the protein synthesis machinery and levels of rRNA gene promoter methylation determine rRNA transcription. METHODOLOGY/PRINCIPAL FINDINGS: We test here by sodium bisulfite mapping of the rRNA promoter and quantitative real-time PCR of rRNA expression the hypothesis that epigenetic differences in critical loci in the brain are involved in the pathophysiology of suicide. Suicide subjects in this study were selected for a history of early childhood neglect/abuse, which is associated with decreased hippocampal volume and cognitive impairments. rRNA was significantly hypermethylated throughout the promoter and 5' regulatory region in the brain of suicide subjects, consistent with reduced rRNA expression in the hippocampus. This difference in rRNA methylation was not evident in the cerebellum and occurred in the absence of genome-wide changes in methylation, as assessed by nearest neighbor. CONCLUSIONS/SIGNIFICANCE: This is the first study to show aberrant regulation of the protein synthesis machinery in the suicide brain. The data implicate the epigenetic modulation of rRNA in the pathophysiology of suicide.

  20. Effects of octacosanol extracted from rice bran on blood hormone levels and gene expressions of glucose transporter protein-4 and adenosine monophosphate protein kinase in weaning piglets

    Directory of Open Access Journals (Sweden)

    Lei Long

    2015-12-01

    Full Text Available The object of this study was to explore the regulatory mechanism of octacosanol to the body of animals and the effects of octacosanol on blood hormone levels and gene expressions of glucose transporter protein (GLUT-4 and adenosine monophosphate protein kinase (AMPK in liver and muscle tissue of weaning piglets. A total of 105 crossbred piglets ([Yorkshire × Landrace] × Duroc with an initial BW of 5.70 ± 1.41 kg (21 d of age were used in a 6-wk trial to evaluate the effects of octacosanol and tiamulin supplementation on contents of triiodothyronine (T3, thyroxine (T4, growth hormone (GH, glucagon (GU and adrenaline (AD in blood and gene expressions of GLUT-4 and AMPK in liver and muscle. Piglets were randomly distributed into 3 dietary treatments on the basis of BW and sex. Each treatment had 7 replicate pens with 5 piglets per pen. Treatments were as followed: control group, tiamulin group and octacosanol group. The results showed that compared with control group and tiamulin group, octacosanol greatly promoted the secretion of T3, GH, GU and AD (P  0.05. Results of the present study has confirmed that octacosanol affects energy metabolism of body by regulating secretion of blood hormones and related gene expression in tissue of weaning piglets, which can reduce stress response and has an impact on performance.

  1. Growth Hormone Gene Polymorphism in Two Iranian Native Fowls (Short Communication

    Directory of Open Access Journals (Sweden)

    Jafari A

    1999-11-01

    Full Text Available Biochemical polymorphism study is a method of determination of genetic variation. This variability could be a basis for selection and subsequent genetic improvement in farm animals. The polymorphism in the intron 1 of chicken growth hormone (cGH gene was investigated in the Iranian native fowls by using polymerase chain reaction (PCR-restriction fragment length polymorphism (RFLP method. The genomic DNA was extracted from 217 samples (129 samples from the native fowls of Isfahan province and 88 samples from the native fowls of Mazandaran province by using modified salting out technique. The DNA fragment of the growth hormone gene with 776 bp was amplified by PCR using specific primers. Then the PCR products were digested with MspI restriction enzyme and analyzed on 2.5% agarose gel. The allelic frequency of intron 1 locus for A1, A2 and A3 alleles in  Isfahan native fowls were 0.60, 0.21 and 0.19 and those in Mazandaran native  fowls were 0.28, 0.05 and 0.67, respectively. The results of current study indicated that the intron 1 of cGH is polymorphic in Iranian native fowls and could be exploited as a candidate gene for marker-assisted selection for growth-related traits.

  2. Aberrant gene promoter methylation associated with sporadic multiple colorectal cancer.

    Directory of Open Access Journals (Sweden)

    Victoria Gonzalo

    Full Text Available BACKGROUND: Colorectal cancer (CRC multiplicity has been mainly related to polyposis and non-polyposis hereditary syndromes. In sporadic CRC, aberrant gene promoter methylation has been shown to play a key role in carcinogenesis, although little is known about its involvement in multiplicity. To assess the effect of methylation in tumor multiplicity in sporadic CRC, hypermethylation of key tumor suppressor genes was evaluated in patients with both multiple and solitary tumors, as a proof-of-concept of an underlying epigenetic defect. METHODOLOGY/PRINCIPAL FINDINGS: We examined a total of 47 synchronous/metachronous primary CRC from 41 patients, and 41 gender, age (5-year intervals and tumor location-paired patients with solitary tumors. Exclusion criteria were polyposis syndromes, Lynch syndrome and inflammatory bowel disease. DNA methylation at the promoter region of the MGMT, CDKN2A, SFRP1, TMEFF2, HS3ST2 (3OST2, RASSF1A and GATA4 genes was evaluated by quantitative methylation specific PCR in both tumor and corresponding normal appearing colorectal mucosa samples. Overall, patients with multiple lesions exhibited a higher degree of methylation in tumor samples than those with solitary tumors regarding all evaluated genes. After adjusting for age and gender, binomial logistic regression analysis identified methylation of MGMT2 (OR, 1.48; 95% CI, 1.10 to 1.97; p = 0.008 and RASSF1A (OR, 2.04; 95% CI, 1.01 to 4.13; p = 0.047 as variables independently associated with tumor multiplicity, being the risk related to methylation of any of these two genes 4.57 (95% CI, 1.53 to 13.61; p = 0.006. Moreover, in six patients in whom both tumors were available, we found a correlation in the methylation levels of MGMT2 (r = 0.64, p = 0.17, SFRP1 (r = 0.83, 0.06, HPP1 (r = 0.64, p = 0.17, 3OST2 (r = 0.83, p = 0.06 and GATA4 (r = 0.6, p = 0.24. Methylation in normal appearing colorectal mucosa from patients with multiple and solitary CRC showed no relevant

  3. The study of the patient and his parents' gene with thyroid hormone resistance syndrome with review of literature

    International Nuclear Information System (INIS)

    Yang Chenwei; Zhang Xi

    2012-01-01

    Objective: To study the genoty of a family of the thyroid hormone receptor β (TRβ) gene and the clinical representation in a patient with thyroid hormone resistance syndrome (THRS). Methods : The peripheral blood samples of the patient and her parents were collected, then DNA was isolated. PCR and direct sequencing techniques were performed to determine if there were mutations in their THRβ gene. Results: There was a point mutation in exon 3d TRβ of the patient and her father, there was a base inserting in the third exon of the third chromosome. Her mother was normal. Conclusion: THRS is a disease related to thyroid hormone receptor gene mutation. The final diagnosis of this disease depends on gene analysis. (authors)

  4. Promoter Methylation Analysis of IDH Genes in Human Gliomas

    International Nuclear Information System (INIS)

    Flanagan, Simon; Lee, Maggie; Li, Cheryl C. Y.; Suter, Catherine M.; Buckland, Michael E.

    2012-01-01

    Mutations in isocitrate dehydrogenase (IDH)-1 or -2 are found in the majority of WHO grade II and III astrocytomas and oligodendrogliomas, and secondary glioblastomas. Almost all described mutations are heterozygous missense mutations affecting a conserved arginine residue in the substrate binding site of IDH1 (R132) or IDH2 (R172). But the exact mechanism of IDH mutations in neoplasia is not understood. It has been proposed that IDH mutations impart a “toxic gain-of-function” to the mutant protein, however a dominant-negative effect of mutant IDH has also been described, implying that IDH may function as a tumor suppressor gene. As most, if not all, tumor suppressor genes are inactivated by epigenetic silencing, in a wide variety of tumors, we asked if IDH1 or IDH2 carry the epigenetic signature of a tumor suppressor by assessing cytosine methylation at their promoters. Methylation was quantified in 68 human brain tumors, including both IDH-mutant and IDH wildtype, by bisulfite pyrosequencing. In all tumors examined, CpG methylation levels were less than 8%. Our data demonstrate that inactivation of IDH function through promoter hypermethylation is not common in human gliomas and other brain tumors. These findings do not support a tumor suppressor role for IDH genes in human gliomas.

  5. Leptin promoter gene polymorphism on -2549 position decreases plasma leptin and increases appetite in normal weight volunteers

    Directory of Open Access Journals (Sweden)

    Sandra Bragança Coelho

    2014-05-01

    Full Text Available Introduction: Investigate whether polymorphism in the promoter region encoding leptin and leptin receptor gene, in normal weight individuals, affects hormonal and appetite responses to peanuts.Materials and methods: Appetite, anthropometric indices, body composition, physical activity, dietary intake and leptin, ghrelin and insulin levels were monitored. Polymorphism analyses were also carried out.Results: None of the treatments led to statistical differences in the analyzed hormones. No polymorphism was found for leptin receptor gene, while for leptin gene, 50% of the volunteers presented one polymorphic allele and 13% presented both polymorphic alleles. These last ones presented lower body fat mass, leptin and ghrelin plasma concentrations, and fullness rates. They also presented higher hunger, desire to eat, and desire to eat sweet and salty foods.Conclusions: Peanut did not affect appetite and presented no different hormonal responses, compared to other foods studied. Polymorphic allele carriers in both alleles presented higher probability to develop obesity. However, the magnitude of this probability could not be measured.

  6. Growth hormone regulation of metabolic gene expression in muscle: a microarray study in hypopituitary men.

    Science.gov (United States)

    Sjögren, Klara; Leung, Kin-Chuen; Kaplan, Warren; Gardiner-Garden, Margaret; Gibney, James; Ho, Ken K Y

    2007-07-01

    Muscle is a target of growth hormone (GH) action and a major contributor to whole body metabolism. Little is known about how GH regulates metabolic processes in muscle or the extent to which muscle contributes to changes in whole body substrate metabolism during GH treatment. To identify GH-responsive genes that regulate substrate metabolism in muscle, we studied six hypopituitary men who underwent whole body metabolic measurement and skeletal muscle biopsies before and after 2 wk of GH treatment (0.5 mg/day). Transcript profiles of four subjects were analyzed using Affymetrix GeneChips. Serum insulin-like growth factor I (IGF-I) and procollagens I and III were measured by RIA. GH increased serum IGF-I and procollagens I and III, enhanced whole body lipid oxidation, reduced carbohydrate oxidation, and stimulated protein synthesis. It induced gene expression of IGF-I and collagens in muscle. GH reduced expression of several enzymes regulating lipid oxidation and energy production. It reduced calpain 3, increased ribosomal protein L38 expression, and displayed mixed effects on genes encoding myofibrillar proteins. It increased expression of circadian gene CLOCK, and reduced that of PERIOD. In summary, GH exerted concordant effects on muscle expression and blood levels of IGF-I and collagens. It induced changes in genes regulating protein metabolism in parallel with a whole body anabolic effect. The discordance between muscle gene expression profiles and metabolic responses suggests that muscle is unlikely to contribute to GH-induced stimulation of whole body energy and lipid metabolism. GH may regulate circadian function in skeletal muscle by modulating circadian gene expression with possible metabolic consequences.

  7. Expression of human placental lactogen and variant growth hormone genes in placentas.

    Science.gov (United States)

    Martinez-Rodriguez, H G; Guerra-Rodriguez, N E; Iturbe-Cantu, M A; Martinez-Torres, A; Barrera-Saldaña, H A

    1997-01-01

    Previous studies comparing the expression levels of human placental lactogen (hPL) genes have shown varying results, due to, perhaps, the fact that in all of them only one placenta was being analyzed. Here, the expression of hPL and growth hormone variant (hGH-V) genes in fifteen term placentas was comparatively analyzed at the RNA level, using reverse transcription coupled to polymerase chain reaction (RT-PCR). The abundance of the combined RNA transcripts derived from these genes varied from one placenta to another. The authors found that hPL-4 transcripts were more abundant than those of hPL-3 in most samples (ratios from 1:1 to 6:1), transcripts from the putative hPL-1 pseudogene were more abundant at the unprocessed stage while those of the hGH-V gene were mostly processed. Again, the authors of this study observed wide variation from placenta to placenta in the abundance of both of these types of transcripts. The same was observed when a group of six placentas from abortuses and nine from pregnancies complicated by preclampsia, diabetes and hypertension was studied. The authors conclude that the disagreeing results reported in the literature which are not in agreement concerning the expression levels of hPL genes could be explained by normal variations of their expression levels among the different placentas analyzed.

  8. Atrazine affects kidney and adrenal hormones (AHs) related genes expressions of rare minnow (Gobiocypris rarus).

    Science.gov (United States)

    Yang, Lihua; Zha, Jinmiao; Li, Wei; Li, Zhaoli; Wang, Zijian

    2010-05-05

    Atrazine, one of the most widely used herbicides, has been proved to interfere with sexual hormones. However few studies have considered the effects of atrazine on adrenal hormones (AH). In this study, rare minnow (Gobiocypris rarus) was exposed to 0, 3, 10, 33, 100 and 333microg/l atrazine for 28 days. The histopathology of kidney and gill was examined and the expressions of AHs-related genes including Na(+),K(+)-ATPase, glucocorticoid receptor (gr), heat shock protein 70 (hsp70), and heat shock protein 90 (hsp90) in kidney and gill were quantitatively determined. Histopathological observation revealed obvious lesions in gill including hyperplasia, necrosis in epithelium region, aneurysm and lamellar fusion at concentrations as low as 10microg/l. The observed lesions in kidney included extensive expansion in the lumen, degenerative and necrotic changes of the tubular epithelia, shrinkage of the glomerulus as well as increase of the Bowman's space at concentrations as low as 10microg/l. The expressions of Na(+),K(+)-ATPase, gr, hsp70 and hsp90 in the kidney of females were significantly decreased at all concentrations. For males, the expressions of hsp90 in the kidney of all treated groups were significantly down-regulated, while gr at all concentrations and hsp70 at 10, 33, 100microg/l were significantly up-regulated. However in the gill, the expressions of these genes were not significantly different from the control. These results indicated that exposure to atrazine caused impairments of kidney and gill of fish at environmental related concentrations. Histopathological lesions could partly attribute to the changes of the expressions of AHs-related genes in kidney. We concluded also that atrazine is a potential AHs-disruptor and AHs-related genes in kidney of fish could be used as sensitive molecular biomarkers.

  9. Atrazine affects kidney and adrenal hormones (AHs) related genes expressions of rare minnow (Gobiocypris rarus)

    Energy Technology Data Exchange (ETDEWEB)

    Yang Lihua; Zha Jinmiao; Li Wei; Li Zhaoli [State Key Laboratory of Environmental Aquatic Chemistry, Research Center for Eco-Environmental Sciences, Chinese Academy of Sciences, Shuangqing Road 18, P.O. Box 2871, Beijing 100085 (China); Wang Zijian, E-mail: wangzj@rcees.ac.cn [State Key Laboratory of Environmental Aquatic Chemistry, Research Center for Eco-Environmental Sciences, Chinese Academy of Sciences, Shuangqing Road 18, P.O. Box 2871, Beijing 100085 (China)

    2010-05-05

    Atrazine, one of the most widely used herbicides, has been proved to interfere with sexual hormones. However few studies have considered the effects of atrazine on adrenal hormones (AH). In this study, rare minnow (Gobiocypris rarus) was exposed to 0, 3, 10, 33, 100 and 333 {mu}g/l atrazine for 28 days. The histopathology of kidney and gill was examined and the expressions of AHs-related genes including Na{sup +},K{sup +}-ATPase, glucocorticoid receptor (gr), heat shock protein 70 (hsp70), and heat shock protein 90 (hsp90) in kidney and gill were quantitatively determined. Histopathological observation revealed obvious lesions in gill including hyperplasia, necrosis in epithelium region, aneurysm and lamellar fusion at concentrations as low as 10 {mu}g/l. The observed lesions in kidney included extensive expansion in the lumen, degenerative and necrotic changes of the tubular epithelia, shrinkage of the glomerulus as well as increase of the Bowman's space at concentrations as low as 10 {mu}g/l. The expressions of Na{sup +},K{sup +}-ATPase, gr, hsp70 and hsp90 in the kidney of females were significantly decreased at all concentrations. For males, the expressions of hsp90 in the kidney of all treated groups were significantly down-regulated, while gr at all concentrations and hsp70 at 10, 33, 100 {mu}g/l were significantly up-regulated. However in the gill, the expressions of these genes were not significantly different from the control. These results indicated that exposure to atrazine caused impairments of kidney and gill of fish at environmental related concentrations. Histopathological lesions could partly attribute to the changes of the expressions of AHs-related genes in kidney. We concluded also that atrazine is a potential AHs-disruptor and AHs-related genes in kidney of fish could be used as sensitive molecular biomarkers.

  10. Atrazine affects kidney and adrenal hormones (AHs) related genes expressions of rare minnow (Gobiocypris rarus)

    International Nuclear Information System (INIS)

    Yang Lihua; Zha Jinmiao; Li Wei; Li Zhaoli; Wang Zijian

    2010-01-01

    Atrazine, one of the most widely used herbicides, has been proved to interfere with sexual hormones. However few studies have considered the effects of atrazine on adrenal hormones (AH). In this study, rare minnow (Gobiocypris rarus) was exposed to 0, 3, 10, 33, 100 and 333 μg/l atrazine for 28 days. The histopathology of kidney and gill was examined and the expressions of AHs-related genes including Na + ,K + -ATPase, glucocorticoid receptor (gr), heat shock protein 70 (hsp70), and heat shock protein 90 (hsp90) in kidney and gill were quantitatively determined. Histopathological observation revealed obvious lesions in gill including hyperplasia, necrosis in epithelium region, aneurysm and lamellar fusion at concentrations as low as 10 μg/l. The observed lesions in kidney included extensive expansion in the lumen, degenerative and necrotic changes of the tubular epithelia, shrinkage of the glomerulus as well as increase of the Bowman's space at concentrations as low as 10 μg/l. The expressions of Na + ,K + -ATPase, gr, hsp70 and hsp90 in the kidney of females were significantly decreased at all concentrations. For males, the expressions of hsp90 in the kidney of all treated groups were significantly down-regulated, while gr at all concentrations and hsp70 at 10, 33, 100 μg/l were significantly up-regulated. However in the gill, the expressions of these genes were not significantly different from the control. These results indicated that exposure to atrazine caused impairments of kidney and gill of fish at environmental related concentrations. Histopathological lesions could partly attribute to the changes of the expressions of AHs-related genes in kidney. We concluded also that atrazine is a potential AHs-disruptor and AHs-related genes in kidney of fish could be used as sensitive molecular biomarkers.

  11. Growth hormone-releasing hormone promotes survival of cardiac myocytes in vitro and protects against ischaemia-reperfusion injury in rat heart.

    Science.gov (United States)

    Granata, Riccarda; Trovato, Letizia; Gallo, Maria Pia; Destefanis, Silvia; Settanni, Fabio; Scarlatti, Francesca; Brero, Alessia; Ramella, Roberta; Volante, Marco; Isgaard, Jorgen; Levi, Renzo; Papotti, Mauro; Alloatti, Giuseppe; Ghigo, Ezio

    2009-07-15

    The hypothalamic neuropeptide growth hormone-releasing hormone (GHRH) stimulates GH synthesis and release in the pituitary. GHRH also exerts proliferative effects in extrapituitary cells, whereas GHRH antagonists have been shown to suppress cancer cell proliferation. We investigated GHRH effects on cardiac myocyte cell survival and the underlying signalling mechanisms. Reverse transcriptase-polymerase chain reaction analysis showed GHRH receptor (GHRH-R) mRNA in adult rat ventricular myocytes (ARVMs) and in rat heart H9c2 cells. In ARVMs, GHRH prevented cell death and caspase-3 activation induced by serum starvation and by the beta-adrenergic receptor agonist isoproterenol. The GHRH-R antagonist JV-1-36 abolished GHRH survival action under both experimental conditions. GHRH-induced cardiac cell protection required extracellular signal-regulated kinase (ERK)1/2 and phosphoinositide-3 kinase (PI3K)/Akt activation and adenylyl cyclase/cAMP/protein kinase A signalling. Isoproterenol strongly upregulated the mRNA and protein of the pro-apoptotic inducible cAMP early repressor, whereas GHRH completely blocked this effect. Similar to ARVMs, in H9c2 cardiac cells, GHRH inhibited serum starvation- and isoproterenol-induced cell death and apoptosis through the same signalling pathways. Finally, GHRH improved left ventricular recovery during reperfusion and reduced infarct size in Langendorff-perfused rat hearts, subjected to ischaemia-reperfusion (I/R) injury. These effects involved PI3K/Akt signalling and were inhibited by JV-1-36. Our findings suggest that GHRH promotes cardiac myocyte survival through multiple signalling mechanisms and protects against I/R injury in isolated rat heart, indicating a novel cardioprotective role of this hormone.

  12. Intrinsically bent DNA in replication origins and gene promoters.

    Science.gov (United States)

    Gimenes, F; Takeda, K I; Fiorini, A; Gouveia, F S; Fernandez, M A

    2008-06-24

    Intrinsically bent DNA is an alternative conformation of the DNA molecule caused by the presence of dA/dT tracts, 2 to 6 bp long, in a helical turn phase DNA or with multiple intervals of 10 to 11 bp. Other than flexibility, intrinsic bending sites induce DNA curvature in particular chromosome regions such as replication origins and promoters. Intrinsically bent DNA sites are important in initiating DNA replication, and are sometimes found near to regions associated with the nuclear matrix. Many methods have been developed to localize bent sites, for example, circular permutation, computational analysis, and atomic force microscopy. This review discusses intrinsically bent DNA sites associated with replication origins and gene promoter regions in prokaryote and eukaryote cells. We also describe methods for identifying bent DNA sites for circular permutation and computational analysis.

  13. Characterization of carotenoid hydroxylase gene promoter in Haematococcus pluvialis.

    Science.gov (United States)

    Meng, C X; Wei, W; Su, Z- L; Qin, S

    2006-10-01

    Astaxanthin, a high-value ketocarotenoid is mainly used in fish aquaculture. It also has potential in human health due to its higher antioxidant capacity than beta-carotene and vitamin E. The unicellular green alga Haematococcus pluvialis is known to accumulate astaxanthin in response to environmental stresses, such as high light intensity and salt stress. Carotenoid hydroxylase plays a key role in astaxanthin biosynthesis in H. pluvialis. In this paper, we report the characterization of a promoter-like region (-378 to -22 bp) of carotenoid hydroxylase gene by cloning, sequence analysis and functional verification of its 919 bp 5'-flanking region in H. pluvialis. The 5'-flanking region was characterized using micro-particle bombardment method and transient expression of LacZ reporter gene. Results of sequence analysis showed that the 5'-flanking region might have putative cis-acting elements, such as ABA (abscisic acid)-responsive element (ABRE), C-repeat/dehydration responsive element (C-repeat/DRE), ethylene-responsive element (ERE), heat-shock element (HSE), wound-responsive element (WUN-motif), gibberellin-responsive element (P-box), MYB-binding site (MBS) etc., except for typical TATA and CCAAT boxes. Results of 5' deletions construct and beta-galactosidase assays revealed that a highest promoter-like region might exist from -378 to -22 bp and some negative regulatory elements might lie in the region from -919 to -378 bp. Results of site-directed mutagenesis of a putative C-repeat/DRE and an ABRE-like motif in the promoter-like region (-378 to -22 bp) indicated that the putative C-repeat/DRE and ABRE-like motif might be important for expression of carotenoid hydroxylase gene.

  14. Plasticity in neurons synthesizing wake/arousal promoting hormone hypocretin/orexin.

    Science.gov (United States)

    Gao, Xiao-Bing

    2012-01-01

    The hypothalamus is a critical brain structure regulating physiological functions essential to the survival of individuals and species. One of the striking characteristics of this brain region is the abundance of nerve cells (neurons) expressing a great numbers of neurotransmitters and neuromodulators, among which are hormones released into the blood stream through brain neuroendocrinological routes. The neurons in the lateral hypothalamus take part in intra- and extrahypothalamic circuits controlling basic physiological functions essential for the well being of animal bodies (such as cardiovascular function, respiratory function, immune responses, etc.), animal behaviors required for the maintenance of the survival of individuals (food foraging, flight, fight, etc.) and species (reproductive function), and higher brain functions (learning and memory, mental state, etc.). Hypocretin (also called orexin) comprises of two neuropeptides exclusively synthesized by neurons in the perifornical/lateral hypothalamus. Although hypocretin/orexin was initially found to enhance food intake, it is now clear that the functions mediated by hypocretin/orexin are well beyond what were originally proposed. Specifically, hypocretin/orexin is a crucial promoter of wakefulness; deficiency in the hypocretin/orexin system leads to diseases and disorders such as narcolepsy. It is clear that neurons synthesizing hypocretin/orexin are consistently under regulation originating from various parts of the brain and that the status of activity in hypocretin/orexin neurons is closely related with the nutritional and behavioral state of animals. Therefore, the demand to make adaptive changes in hypocretin/orexin neurons to accommodate the changes in the external environment and behavioral state of animals is expected. The latest developments in the studies of plasticity in hypocretin/orexin neurons under the challenges from environmental and behavioral factors have dramatically shaped the

  15. The immediate and late effects of thyroid hormone (triiodothyronine) on murine coagulation gene transcription.

    Science.gov (United States)

    Salloum-Asfar, Salam; Boelen, Anita; Reitsma, Pieter H; van Vlijmen, Bart J M

    2015-01-01

    Thyroid dysfunction is associated with changes in coagulation. The aim of our study was to gain more insight into the role of thyroid hormone in coagulation control. C57Black/6J mice received a low-iodine diet and drinking water supplemented with perchlorate to suppress endogenous triiodothyronine (T3) and thyroxine (T4) production. Under these conditions, the impact of exogenous T3 on plasma coagulation, and hepatic and vessel-wall-associated coagulation gene transcription was studied in a short- (4 hours) and long-term (14 days) setting. Comparing euthyroid conditions (normal mice), with hypothyroidism (conditions of a shortage of thyroid hormone) and those with replacement by incremental doses of T3, dosages of 0 and 0.5 μg T3/mouse/day were selected to study the impact of T3 on coagulation gene transcription. Under these conditions, a single injection of T3 injection increased strongly hepatic transcript levels of the well-characterized T3-responsive genes deiodinase type 1 (Dio1) and Spot14 within 4 hours. This coincided with significantly reduced mRNA levels of Fgg, Serpinc1, Proc, Proz, and Serpin10, and the reduction of the latter three persisted upon daily treatment with T3 for 14 days. Prolonged T3 treatment induced a significant down-regulation in factor (F) 2, F9 and F10 transcript levels, while F11 and F12 levels increased. Activity levels in plasma largely paralleled these mRNA changes. Thbd transcript levels in the lung (vessel-wall-associated coagulation) were significantly up-regulated after a single T3 injection, and persisted upon prolonged T3 exposure. Two-week T3 administration also resulted in increased Vwf and Tfpi mRNA levels, whereas Tf levels decreased. These data showed that T3 has specific effects on coagulation, with Fgg, Serpinc1, Proc, Proz, Serpin10 and Thbd responding rapidly, making these likely direct thyroid hormone receptor targets. F2, F9, F10, F11, F12, Vwf, Tf and Tfpi are late responding genes and probably indirectly

  16. Alcohol dysregulates corticotropin-releasing-hormone (CRH promoter activity by interfering with the negative glucocorticoid response element (nGRE.

    Directory of Open Access Journals (Sweden)

    Magdalena M Przybycien-Szymanska

    Full Text Available EtOH exposure in male rats increases corticotropin-releasing hormone (CRH mRNA in the paraventricular nucleus of the hypothalamus (PVN, a brain region responsible for coordinating stress and anxiety responses. In this study we identified the molecular mechanisms involved in mediating these effects by examining the direct effects of EtOH on CRH promoter activity in a neuronal cell line derived from the PVN (IVB. In addition, we investigated the potential interactions of EtOH and glucocorticoids on the CRH promoter by concomitantly treating cells with EtOH and the glucocorticoid receptor (GR antagonist RU486, and by sequentially deleting GR binding sites within glucocorticoid response element (GRE on the CRH promoter. Cells were transiently transfected with a firefly luciferase reporter construct containing 2.5 kb of the rat wild type (WT or mutated CRH promoter. Our results showed that EtOH treatment induced a biphasic response in CRH promoter activity. EtOH exposure for 0.5 h significantly decreased promoter activity compared to vehicle treated controls, whereas promoter activity was significantly increased after 2.0 h of EtOH exposure. Treatment with RU486, or deletion of the GR binding sites 1 and 2 within the GRE, abolished the EtOH-induced increase in the promoter activity, however did not affect EtOH-induced decrease in CRH promoter activity at an earlier time point. Overall, our data suggest that alcohol exposure directly regulates CRH promoter activity by interfering with the normal feedback mechanisms of glucocorticoids mediated by GR signaling at the GRE site of the CRH promoter.

  17. Transcriptome Analysis of Calcium- and Hormone-Related Gene Expressions during Different Stages of Peanut Pod Development

    Science.gov (United States)

    Li, Yan; Meng, Jingjing; Yang, Sha; Guo, Feng; Zhang, Jialei; Geng, Yun; Cui, Li; Wan, Shubo; Li, Xinguo

    2017-01-01

    Peanut is one of the calciphilous plants. Calcium serves as a ubiquitous central hub in a large number of signaling pathways. In the field, free calcium ion (Ca2+)-deficient soil can result in unfilled pods. Four pod stages were analyzed to determine the relationship between Ca2+ excretion and pod development. Peanut shells showed Ca2+ excretion at all four stages; however, both the embryo of Stage 4 (S4) and the red skin of Stage 3 (S3) showed Ca2+ absorbance. These results showed that embryo and red skin of peanut need Ca2+ during development. In order to survey the relationship among calcium, hormone and seed development from gene perspective, we further analyzed the seed transcriptome at Stage 2 (S2), S3, and S4. About 70 million high quality clean reads were generated, which were assembled into 58,147 unigenes. By comparing these three stages, total 4,457 differentially expressed genes were identified. In these genes, 53 Ca2+ related genes, 40 auxin related genes, 15 gibberellin genes, 20 ethylene related genes, 2 abscisic acid related genes, and 7 cytokinin related genes were identified. Additionally, a part of them were validated by qRT-PCR. Most of their expressions changed during the pod development. Since some reports showed that Ca2+ signal transduction pathway is involved in hormone regulation pathway, these results implied that peanut seed development might be regulated by the collaboration of Ca2+ signal transduction pathway and hormone regulation pathway. PMID:28769950

  18. Transcriptome Analysis of Calcium- and Hormone-Related Gene Expressions during Different Stages of Peanut Pod Development

    Directory of Open Access Journals (Sweden)

    Yan Li

    2017-07-01

    Full Text Available Peanut is one of the calciphilous plants. Calcium serves as a ubiquitous central hub in a large number of signaling pathways. In the field, free calcium ion (Ca2+-deficient soil can result in unfilled pods. Four pod stages were analyzed to determine the relationship between Ca2+ excretion and pod development. Peanut shells showed Ca2+ excretion at all four stages; however, both the embryo of Stage 4 (S4 and the red skin of Stage 3 (S3 showed Ca2+ absorbance. These results showed that embryo and red skin of peanut need Ca2+ during development. In order to survey the relationship among calcium, hormone and seed development from gene perspective, we further analyzed the seed transcriptome at Stage 2 (S2, S3, and S4. About 70 million high quality clean reads were generated, which were assembled into 58,147 unigenes. By comparing these three stages, total 4,457 differentially expressed genes were identified. In these genes, 53 Ca2+ related genes, 40 auxin related genes, 15 gibberellin genes, 20 ethylene related genes, 2 abscisic acid related genes, and 7 cytokinin related genes were identified. Additionally, a part of them were validated by qRT-PCR. Most of their expressions changed during the pod development. Since some reports showed that Ca2+ signal transduction pathway is involved in hormone regulation pathway, these results implied that peanut seed development might be regulated by the collaboration of Ca2+ signal transduction pathway and hormone regulation pathway.

  19. Clinical and molecuar characterization of Brazilian patients with growth hormone gene deletions

    Directory of Open Access Journals (Sweden)

    I.J.P. Arnhold

    1998-04-01

    Full Text Available Genomic DNA from 23 patients with isolated growth hormone (GH deficiency (12 males and 11 females: heights -4.9 ± 1.4 SDS was screened for GH gene deletions by restriction endonuclease analysis of polymerase chain reaction amplification products. Three unrelated patients had typical features of severe GH deficiency and deletions (6.7 kb in two and 7.6 kb in one of the GH gene. The two patients with 6.7-kb deletions developed growth-attenuating anti-GH antibodies whereas the patient with the 7.6-kb deletion continued to grow with GH replacement therapy. Our finding that 3/23 (~13% Brazilian subjects had GH gene deletions agrees with previous studies of severe isolated GH deficiency subjects in other populations. Two of three subjects (67% with deletions developed blocking antibodies despite administration of exogenous GH at low doses. Interestingly, only 1/10 of cases with affected relatives or parental consanguinity had GH-1 gene deletions

  20. Gene structure and functional characterization of growth hormone in dogfish, Squalus acanthias.

    Science.gov (United States)

    Moriyama, Shunsuke; Oda, Mayumi; Yamazaki, Tomohide; Yamaguchi, Kiyoko; Amiya, Noriko; Takahashi, Akiyoshi; Amano, Masafumi; Goto, Tomoaki; Nozaki, Masumi; Meguro, Hiroshi; Kawauchi, Hiroshi

    2008-06-01

    Dogfish (Squalus acanthias) growth hormone (GH) was identified by cDNA cloning and protein purification from the pituitary gland. Dogfish GH cDNA encoded a prehormone of 210 amino acids (aa). Sequence analysis of purified GH revealed that the prehormone is composed of a signal peptide of 27 aa and a mature protein of 183 aa. Dogfish GH showed 94% sequence identity with blue shark GH, and also showed 37-66%, 26%, and 48-67% sequence identity with GH from osteichtyes, an agnathan, and tetrapods. The site of production was identified through immunocytochemistry to be cells of the proximal pars distalis of the pituitary gland. Dogfish GH stimulates both insulin-like growth factor-I and II mRNA levels in dogfish liver in vitro. The dogfish GH gene consisted of five exons and four introns, the same as in lamprey, teleosts such as cypriniforms and siluriforms, and tetrapods. The 5'-flanking region within 1082 bp of the transcription start site contained consensus sequences for the TATA box, Pit-1/GHF-1, CRE, TRE, and ERE. These results show that the endocrine mechanism for growth stimulation by the GH-IGF axis was established at an early stage of vertebrate evolution, and that the 5-exon-type gene organization might reflect the structure of the ancestral gene for the GH gene family.

  1. Skeletal response of male mice to anabolic hormone therapy in the absence of the Igfals gene.

    Science.gov (United States)

    Kennedy, Oran D; Sun, Hui; Wu, Yingjie; Courtland, Hayden-William; Williams, Garry A; Cardoso, Luis; Basta-Pljakic, Jelena; Schaffler, Mitchell B; Yakar, Shoshana

    2014-03-01

    IGF-I is a critical regulator of skeletal acquisition, which acts in endocrine and autocrine/paracrine modes. In serum, IGF-I is carried by the IGF-binding proteins in binary complexes. Further stabilization of these complexes is achieved by binding to the acid labile subunit (ALS) in a ternary complex (of IGF-I-IGF-binding protein 3/5-ALS). Ablation of the Igfals gene in humans (ALS deficiency) and mice (ALS knockout [ALSKO]) leads to markedly decreased serum IGF-I levels, growth retardation, and impaired skeletal acquisition. To investigate whether hormonal replacement therapy would improve the skeletal phenotype in cases of Igfals gene ablation, we treated male ALSKO mice with GH, IGF-I, or a combination of both. Treatments were administered to animals between 4 and 16 weeks of age or from 8 to 16 weeks of age. Although all treatment groups showed an increase (20%) in serum IGF-I levels, there was no increase in body weight, weight gain, or bone length in either age group. Despite the blunted linear growth in response to hormone therapy, ALSKO mice treated with GH showed radial bone growth, which contributed to bone strength tested by 4-point bending. We found that ALSKO mice treated with GH showed increased total cross-sectional area, cortical bone area, and cortical thickness by microtomography. Dynamic histomorphometry showed that although GH and double treatment groups resulted in trends towards increased bone formation parameters, these did not reach significance. However, bone resorption parameters were significantly increased in all treatment groups. ALSKO mice treated between 4 and 16 weeks of age showed minor differences in bone traits compared with vehicle-treated mice. In conclusion, treatment with GH and IGF-I do not work synergistically to rescue the stunted growth found in mice lacking the Igfals gene. Although GH alone appears to increase bone parameters slightly, it does not affect body weight or linear growth.

  2. Senataxin Mutation Reveals How R-Loops Promote Transcription by Blocking DNA Methylation at Gene Promoters.

    Science.gov (United States)

    Grunseich, Christopher; Wang, Isabel X; Watts, Jason A; Burdick, Joshua T; Guber, Robert D; Zhu, Zhengwei; Bruzel, Alan; Lanman, Tyler; Chen, Kelian; Schindler, Alice B; Edwards, Nancy; Ray-Chaudhury, Abhik; Yao, Jianhua; Lehky, Tanya; Piszczek, Grzegorz; Crain, Barbara; Fischbeck, Kenneth H; Cheung, Vivian G

    2018-02-01

    R-loops are three-stranded nucleic acid structures found abundantly and yet often viewed as by-products of transcription. Studying cells from patients with a motor neuron disease (amyotrophic lateral sclerosis 4 [ALS4]) caused by a mutation in senataxin, we uncovered how R-loops promote transcription. In ALS4 patients, the senataxin mutation depletes R-loops with a consequent effect on gene expression. With fewer R-loops in ALS4 cells, the expression of BAMBI, a negative regulator of transforming growth factor β (TGF-β), is reduced; that then leads to the activation of the TGF-β pathway. We uncovered that genome-wide R-loops influence promoter methylation of over 1,200 human genes. DNA methyl-transferase 1 favors binding to double-stranded DNA over R-loops. Thus, in forming R-loops, nascent RNA blocks DNA methylation and promotes further transcription. Hence, our results show that nucleic acid structures, in addition to sequences, influence the binding and activity of regulatory proteins. Copyright © 2017 Elsevier Inc. All rights reserved.

  3. Effects of sex and pregnancy hormones on growth hormone and prolactin receptor gene expression in insulin-producing cells

    DEFF Research Database (Denmark)

    Møldrup, Annette; Petersen, Elisabeth D.; Nielsen, Jens Høiriis

    1993-01-01

    During pregnancy, marked hyperplasia of the pancreatic islet cells has been observed. This effect may be mediated by the pregnancy-associated peptide hormones, placental lactogen, PRL, and GH, which were previously shown to be mitogenic to beta-cells in vitro. To study whether the responsiveness ...

  4. Differential Gene Expression in Gonadotropin-Releasing Hormone Neurons of Male and Metestrous Female Mice.

    Science.gov (United States)

    Vastagh, Csaba; Rodolosse, Annie; Solymosi, Norbert; Farkas, Imre; Auer, Herbert; Sárvári, Miklós; Liposits, Zsolt

    2015-01-01

    Gonadotropin-releasing hormone (GnRH) neurons play a pivotal role in the regulation of the hypothalamic-pituitary gonadal axis in a sex-specific manner. We hypothesized that the differences seen in reproductive functions of males and females are associated with a sexually dimorphic gene expression profile of GnRH neurons. We compared the transcriptome of GnRH neurons obtained from intact metestrous female and male GnRH-green fluorescent protein transgenic mice. About 1,500 individual GnRH neurons from each sex were sampled with laser capture microdissection followed by whole-transcriptome amplification for gene expression profiling. Under stringent selection criteria (fold change >1.6, adjusted p value 0.01), Affymetrix Mouse Genome 430 PM array analysis identified 543 differentially expressed genes. Sexual dimorphism was most apparent in gene clusters associated with synaptic communication, signal transduction, cell adhesion, vesicular transport and cell metabolism. To validate microarray results, 57 genes were selected, and 91% of their differential expression was confirmed by real-time PCR. Similarly, 88% of microarray results were confirmed with PCR from independent samples obtained by patch pipette harvesting and pooling of 30 GnRH neurons from each sex. We found significant differences in the expression of genes involved in vesicle priming and docking (Syt1, Cplx1), GABAergic (Gabra3, Gabrb3, Gabrg2) and glutamatergic (Gria1, Grin1, Slc17a6) neurotransmission, peptide signaling (Sstr3, Npr2, Cxcr4) and the regulation of intracellular ion homeostasis (Cacna1, Cacnb1, Cacng5, Kcnq2, Kcnc1). The striking sexual dimorphism of the GnRH neuron transcriptome we report here contributes to a better understanding of the differences in cellular mechanisms of GnRH neurons in the two sexes. © 2015 S. Karger AG, Basel.

  5. Identification of a novel mutation in the human growth hormone receptor gene (GHR) in a patient with Laron syndrome.

    Science.gov (United States)

    Gennero, Isabelle; Edouard, Thomas; Rashad, Mona; Bieth, Eric; Conte-Aurio, Françoise; Marin, Françoise; Tauber, Maithé; Salles, Jean Pierre; El Kholy, Mohamed

    2007-07-01

    Deletions and mutations in the growth hormone receptor (GHR) gene are the underlying etiology of Laron syndrome (LS) or growth hormone (GH) insensitivity syndrome (GHIS), an autosomal recessive disease. Most patients are distributed in or originate from Mediterranean and Middle-Eastern countries. Sixty mutations have been described so far. We report a novel mutation in the GHR gene in a patient with LS. Genomic DNA sequencing of exon 5 revealed a TT insertion at nucleotide 422 after codon 122. The insertion resulted in a frameshift introducing a premature termination codon that led to a truncated receptor. We present clinical, biochemical and molecular evidence of LS as the result of this homozygous insertion.

  6. Epigenetic involvement of Alien/ESET complex in thyroid hormone-mediated repression of E2F1 gene expression and cell proliferation

    Energy Technology Data Exchange (ETDEWEB)

    Hong, Wei, E-mail: hongwei@tijmu.edu.cn [Department of Immunology, Tianjin Medical University, 300070 Tianjin (China); College of Basic Medicine, Tianjin Medical University, 300070 Tianjin (China); Li, Jinru; Wang, Bo [College of Basic Medicine, Tianjin Medical University, 300070 Tianjin (China); Chen, Linfeng [Department of Medical Oncology, Harvard Medical School, Dana Farber Cancer Institute, Boston, 02115 MA (United States); Niu, Wenyan; Yao, Zhi [Department of Immunology, Tianjin Medical University, 300070 Tianjin (China); Baniahmad, Aria, E-mail: aban@mti.uni-jena.de [Institute for Human Genetics, Jena University Hospital, 07740 Jena (Germany)

    2011-12-02

    Highlights: Black-Right-Pointing-Pointer Corepressor Alien interacts with histone methyltransferase ESET in vivo. Black-Right-Pointing-Pointer Alien/ESET complex is recruited to nTRE of T3-responsive gene by liganded TR{beta}1. Black-Right-Pointing-Pointer ESET-mediated H3K9 methylation is required for liganded TR{beta}1-repressed transcription. Black-Right-Pointing-Pointer ESET is involved in T3-repressed G1/S phase transition and proliferation. -- Abstract: The ligand-bound thyroid hormone receptor (TR) is known to repress via a negative TRE (nTRE) the expression of E2F1, a key transcription factor that controls the G1/S phase transition. Alien has been identified as a novel interacting factor of E2F1 and acts as a corepressor of E2F1. The detailed molecular mechanism by which Alien inhibits E2F1 gene expression remains unclear. Here, we report that the histone H3 lysine 9 (H3K9) methyltransferase (HMT) ESET is an integral component of the corepressor Alien complex and the Alien/ESET complex is recruited to both sites, the E2F1 and the nTRE site of the E2F1 gene while the recruitment to the negative thyroid hormone response element (nTRE) is induced by the ligand-bound TR{beta}1 within the E2F1 gene promoter. We show that, overexpression of ESET promotes, whereas knockdown of ESET releases, the inhibition of TR{beta}1-regulated gene transcription upon T3 stimulation; and H3K9 methylation is required for TR{beta}1-repressed transcription. Furthermore, depletion of ESET impairs thyroid hormone-repressed proliferation as well as the G1/S transition of the cell cycle. Taken together, our data indicate that ESET is involved in TR{beta}1-mediated transcription repression and provide a molecular basis of thyroid hormone-induced repression of proliferation.

  7. Growth hormone receptor (GHR) gene polymorphism and scoliosis in Prader-Willi syndrome.

    Science.gov (United States)

    Butler, Merlin G; Hossain, Waheeda; Hassan, Maaz; Manzardo, Ann M

    2018-04-01

    A growth hormone receptor (GHR) gene polymorphism impacts sensitivity to endogenous and exogenous growth hormone (GH) to moderate growth and development. Increased sensitivity may accelerate spinal growth and contribute to scoliosis, particularly in GH-deficient and treated populations such as Prader-Willi syndrome (PWS). Therefore, we examined the relationship between GHR genotype and scoliosis (case and control) in PWS cohorts. We utilized a case-control design in a study of 73 subjects (34M; 39F) with genetically confirmed PWS in 32 individuals previously diagnosed with moderate to severe scoliosis (mean age=16.9±10.2years; age range of 1 to 41years) and 41 adults with no evidence of scoliosis (mean age=30.8±9.7years; age range of 18 to 56years). The GHR gene polymorphism was determined using PCR specific primers to capture the two recognized GHR gene fragment sizes [i.e., full length (fl) or exon 3 deletions (d3)]. Twenty-three (72%) of the 32 case subjects with scoliosis required surgical correction with an approximately equal balance for gender and PWS genetic subtype among cases and 41 control subjects without scoliosis. The GHR d3/d3 genotype was identified in N=2 of 8 (25%) cases with scoliosis and the d3/fl genotype was identified in N=11 of 25 (44%) cases with scoliosis but the distribution difference did not statistically differ. The GHR fl/fl genotype was correlated with a significantly faster rate and heavier weight gain among case subjects. Our examination of demographic and genetic markers associated with scoliosis and surgical repair in PWS found no evidence to support differences in gender, PWS genetic subtype or GHR d3 allele distributions among the case vs control groups. Those with fl/fl alleles were heavier than those with d3/d3 or d3/fl genotypes and warrant further study with a larger sample size and possibly to include other vulnerable populations requiring growth hormone treatment. Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. Gene by Environment Interaction and Resilience: Effects of Child Maltreatment and Serotonin, Corticotropin Releasing Hormone, Dopamine, and Oxytocin Genes

    Science.gov (United States)

    Cicchetti, Dante; Rogosch, Fred A.

    2013-01-01

    In this investigation, gene-environment interaction effects in predicting resilience in adaptive functioning among maltreated and nonmaltreated low-income children (N = 595) were examined. A multi-component index of resilient functioning was derived and levels of resilient functioning were identified. Variants in four genes, 5-HTTLPR, CRHR1, DRD4 -521C/T, and OXTR, were investigated. In a series of ANCOVAs, child maltreatment demonstrated a strong negative main effect on children’s resilient functioning, whereas no main effects for any of the genotypes of the respective genes were found. However, gene-environment interactions involving genotypes of each of the respective genes and maltreatment status were obtained. For each respective gene, among children with a specific genotype, the relative advantage in resilient functioning of nonmaltreated compared to maltreated children was stronger than was the case for nonmaltreated and maltreated children with other genotypes of the respective gene. Across the four genes, a composite of the genotypes that more strongly differentiated resilient functioning between nonmaltreated and maltreated children provided further evidence of genetic variations influencing resilient functioning in nonmaltreated children, whereas genetic variation had a negligible effect on promoting resilience among maltreated children. Additional effects were observed for children based on the number of subtypes of maltreatment children experienced, as well as for abuse and neglect subgroups. Finally, maltreated and nonmaltreated children with high levels of resilience differed in their average number of differentiating genotypes. These results suggest that differential resilient outcomes are based on the interaction between genes and developmental experiences. PMID:22559122

  9. Association of luteinizing hormone chorionic gonadotropin receptor gene polymorphism (rs2293275) with polycystic ovarian syndrome.

    Science.gov (United States)

    Thathapudi, Sujatha; Kodati, Vijayalakshmi; Erukkambattu, Jayashankar; Addepally, Uma; Qurratulain, Hasan

    2015-03-01

    Polycystic ovaries and irregular menstruation/anovulation are important diagnostic criteria along with hyperandrogenism as per the Androgen Excess Society-2006 criteria for polycystic ovarian syndrome (PCOS). In the etiopathogenesis of PCOS, one of the candidate genes causing ovarian failure is the luteinizing hormone (LH) chorionic gonadotropin hormone receptor (LHCGR). Our aim was to study the association of LHCGR polymorphism (rs2293275) with PCOS in our study population. Genetic case-control study from multiple gynecological centers from Hyderabad, a cosmopolitan city in South India. The study involved 204 women with PCOS and 204 healthy, sex-, and age-matched controls. Anthropometric and biochemical profiles were taken in a well-designed pro forma. Isolation of deoxyribonucleic acid (DNA) and genotype analysis were done for the entire study population using the polymerase chain reaction-restriction fragment length polymorphism method followed by 12% polyacrylamide gel electrophoresis. In this study, we have demonstrated an association between LHCGR (rs2293275) polymorphism and PCOS. The frequency of the G allele was 0.60 in PCOS and 0.49 in controls (odds ratio [OR] 1.531, confidence interval [CI] 1.16-2.01, and p-value=0.0026), which indicates that the G allele is associated with PCOS in our population. The GG genotype conferred a significant risk of developing PCOS (OR 3.36, CI 1.96-5.75, and p-value<0.0001). We found a significant association of the GG allele with body-mass index, waist to hip ratio, insulin resistance, LH, and LH/follicle-stimulating hormone (FSH) ratio in PCOS when compared with controls. The AA allele showed high basal FSH levels. This study suggests that LHCGR (rs2293275) polymorphism is associated with PCOS and could be used as a relevant molecular marker to identify women with the risk of developing PCOS in our population and may provide an understanding about the etiology of PCOS.

  10. Genetic architecture of a hormonal response to gene knockdown in honey bees.

    Science.gov (United States)

    Ihle, Kate E; Rueppell, Olav; Huang, Zachary Y; Wang, Ying; Fondrk, M Kim; Page, Robert E; Amdam, Gro V

    2015-01-01

    Variation in endocrine signaling is proposed to underlie the evolution and regulation of social life histories, but the genetic architecture of endocrine signaling is still poorly understood. An excellent example of a hormonally influenced set of social traits is found in the honey bee (Apis mellifera): a dynamic and mutually suppressive relationship between juvenile hormone (JH) and the yolk precursor protein vitellogenin (Vg) regulates behavioral maturation and foraging of workers. Several other traits cosegregate with these behavioral phenotypes, comprising the pollen hoarding syndrome (PHS) one of the best-described animal behavioral syndromes. Genotype differences in responsiveness of JH to Vg are a potential mechanistic basis for the PHS. Here, we reduced Vg expression via RNA interference in progeny from a backcross between 2 selected lines of honey bees that differ in JH responsiveness to Vg reduction and measured JH response and ovary size, which represents another key aspect of the PHS. Genetic mapping based on restriction site-associated DNA tag sequencing identified suggestive quantitative trait loci (QTL) for ovary size and JH responsiveness. We confirmed genetic effects on both traits near many QTL that had been identified previously for their effect on various PHS traits. Thus, our results support a role for endocrine control of complex traits at a genetic level. Furthermore, this first example of a genetic map of a hormonal response to gene knockdown in a social insect helps to refine the genetic understanding of complex behaviors and the physiology that may underlie behavioral control in general. © The American Genetic Association. 2015.

  11. Genetic recombination is targeted towards gene promoter regions in dogs.

    Science.gov (United States)

    Auton, Adam; Rui Li, Ying; Kidd, Jeffrey; Oliveira, Kyle; Nadel, Julie; Holloway, J Kim; Hayward, Jessica J; Cohen, Paula E; Greally, John M; Wang, Jun; Bustamante, Carlos D; Boyko, Adam R

    2013-01-01

    The identification of the H3K4 trimethylase, PRDM9, as the gene responsible for recombination hotspot localization has provided considerable insight into the mechanisms by which recombination is initiated in mammals. However, uniquely amongst mammals, canids appear to lack a functional version of PRDM9 and may therefore provide a model for understanding recombination that occurs in the absence of PRDM9, and thus how PRDM9 functions to shape the recombination landscape. We have constructed a fine-scale genetic map from patterns of linkage disequilibrium assessed using high-throughput sequence data from 51 free-ranging dogs, Canis lupus familiaris. While broad-scale properties of recombination appear similar to other mammalian species, our fine-scale estimates indicate that canine highly elevated recombination rates are observed in the vicinity of CpG rich regions including gene promoter regions, but show little association with H3K4 trimethylation marks identified in spermatocytes. By comparison to genomic data from the Andean fox, Lycalopex culpaeus, we show that biased gene conversion is a plausible mechanism by which the high CpG content of the dog genome could have occurred.

  12. The interaction of corticotropin-releasing hormone receptor gene and early life stress on emotional empathy.

    Science.gov (United States)

    Grimm, Simone; Wirth, Katharina; Fan, Yan; Weigand, Anne; Gärtner, Matti; Feeser, Melanie; Dziobek, Isabel; Bajbouj, Malek; Aust, Sabine

    2017-06-30

    Early life stress (ELS) is associated with increased vulnerability for depression, changes to the corticotropin-releasing hormone (CRH) system and structural and functional changes in hippocampus. Single nucleotide polymorphisms in the CRH receptor 1 (CRHR1) gene interact with ELS to predict depression, cognitive functions and hippocampal activity. Social cognition has been related to hippocampal function and might be crucial for maintaining mental health. However, the interaction of CRHR1 gene variation and ELS on social cognition has not been investigated yet. We assessed social cognition in 502 healthy subjects to test effects of ELS and the CRHR1 gene. Participants were genotyped for rs110402 and rs242924. ELS was assessed by Childhood Trauma Questionnaire, social cognition was measured via Multifaceted Empathy Test and Empathy Quotient. Severity of ELS was associated with decreased emotional, but not cognitive empathy. Subjects with the common homozygous GG GG genotype showed decreased implicit emotional empathy after ELS exposure regardless of its severity. The results reveal that specific CRHR1 polymorphisms moderate the effect of ELS on emotional empathy. Exposure to ELS in combination with a vulnerable genotype results in impaired emotional empathy in adulthood, which might represent an early marker of increased vulnerability after ELS. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Tissue-Specific Upregulation of MDS/EVI Gene Transcripts in the Intestine by Thyroid Hormone during Xenopus Metamorphosis

    Science.gov (United States)

    Hasebe, Takashi; Fu, Liezhen; Heimeier, Rachel A.; Das, Biswajit; Ishizuya-Oka, Atsuko; Shi, Yun-Bo

    2013-01-01

    Background Intestinal remodeling during amphibian metamorphosis resembles the maturation of the adult intestine during mammalian postembryonic development when the adult epithelial self-renewing system is established under the influence of high concentrations of plasma thyroid hormone (T3). This process involves de novo formation and subsequent proliferation and differentiation of the adult stem cells. Methodology/Principal Findings The T3-dependence of the formation of adult intestinal stem cell during Xenopus laevis metamorphosis offers a unique opportunity to identify genes likely important for adult organ-specific stem cell development. We have cloned and characterized the ectopic viral integration site 1 (EVI) and its variant myelodysplastic syndrome 1 (MDS)/EVI generated via transcription from the upstream MDS promoter and alternative splicing. EVI and MDS/EVI have been implicated in a number of cancers including breast, leukemia, ovarian, and intestinal cancers. We show that EVI and MDS/EVI transcripts are upregulated by T3 in the epithelium but not the rest of the intestine in Xenopus laevis when adult stem cells are forming in the epithelium. Conclusions/Significance Our results suggest that EVI and MDS/EVI are likely involved in the development and/or proliferation of newly forming adult intestinal epithelial cells. PMID:23383234

  14. The α-Helical Structure of Prodomains Promotes Translocation of Intrinsically Disordered Neuropeptide Hormones into the Endoplasmic Reticulum*

    Science.gov (United States)

    Dirndorfer, Daniela; Seidel, Ralf P.; Nimrod, Guy; Miesbauer, Margit; Ben-Tal, Nir; Engelhard, Martin; Zimmermann, Richard; Winklhofer, Konstanze F.; Tatzelt, Jörg

    2013-01-01

    Different neuropeptide hormones, which are either too small to adopt a stable conformation or are predicted to be intrinsically disordered, are synthesized as larger precursors containing a prodomain in addition to an N-terminal signal peptide. We analyzed the biogenesis of three unstructured neuropeptide hormones and observed that translocation of these precursors into the lumen of the endoplasmic reticulum (ER) is critically dependent on the presence of the prodomain. The hormone domains could be deleted from the precursors without interfering with ER import and secretion, whereas constructs lacking the prodomain remained in the cytosol. Domain-swapping experiments revealed that the activity of the prodomains to promote productive ER import resides in their ability to adopt an α-helical structure. Removal of the prodomain from the precursor did not interfere with co-translational targeting of the nascent chain to the Sec61 translocon but with its subsequent productive translocation into the ER lumen. Our study reveals a novel function of prodomains to enable import of small or intrinsically disordered secretory proteins into the ER based on their ability to adopt an α-helical conformation. PMID:23532840

  15. Heterologous gene expression driven by carbonic anhydrase gene promoter in Dunaliella salina

    Science.gov (United States)

    Yurong, Chai; Yumin, Lu; Tianyun, Wang; Weihong, Hou; Lexun, Xue

    2006-12-01

    Dunaliella salina, a halotolerant unicellular green alga without a rigid cell wall, can live in salinities ranging from 0.05 to 5 mol/L NaCl. These features of D. salina make it an ideal host for the production of antibodies, oral vaccine, and commercially valuable polypeptides. To produce high level of heterologous proteins from D. salina, highly efficient promoters are required to drive expression of target genes under controlled condition. In the present study, we cloned a 5' franking region of 1.4 kb from the carbonic anhydrase ( CAH) gene of D. salina by genomic walking and PCR. The fragment was ligated to the pMD18-T vector and characterized. Sequence analysis indicated that this region contained conserved motifs, including a TATA- like box and CAAT-box. Tandem (GT)n repeats that had a potential role of transcriptional control, were also found in this region. The transcription start site (TSS) of the CAH gene was determined by 5' RACE and nested PCR method. Transformation assays showed that the 1.4 kb fragment was able to drive expression of the selectable bar (bialaphos resistance) gene when the fusion was transformed into D. salina by biolistics. Northern blotting hybridizations showed that the bar transcript was most abundant in cells grown in 2 mol/L NaCl, and less abundant in 0.5 mol/L NaCl, indicating that expression of the bar gene was induced at high salinity. These results suggest the potential use of the CAH gene promoter to induce the expression of heterologous genes in D. salina under varied salt condition.

  16. IL6 gene promoter polymorphisms and type 2 diabetes

    DEFF Research Database (Denmark)

    Huth, Cornelia; Heid, Iris M; Vollmert, Caren

    2006-01-01

    Several lines of evidence indicate a causal role of the cytokine interleukin (IL)-6 in the development of type 2 diabetes in humans. Two common polymorphisms in the promoter of the IL-6 encoding gene IL6, -174G>C (rs1800795) and -573G>C (rs1800796), have been investigated for association with type...... 2 diabetes in numerous studies but with results that have been largely equivocal. To clarify the relationship between the two IL6 variants and type 2 diabetes, we analyzed individual data on >20,000 participants from 21 published and unpublished studies. Collected data represent eight different...... countries, making this the largest association analysis for type 2 diabetes reported to date. The GC and CC genotypes of IL6 -174G>C were associated with a decreased risk of type 2 diabetes (odds ratio 0.91, P = 0.037), corresponding to a risk modification of nearly 9%. No evidence for association was found...

  17. C/EBPβ Mediates Growth Hormone-Regulated Expression of Multiple Target Genes

    Science.gov (United States)

    Cui, Tracy X.; Lin, Grace; LaPensee, Christopher R.; Calinescu, Anda-Alexandra; Rathore, Maanjot; Streeter, Cale; Piwien-Pilipuk, Graciela; Lanning, Nathan; Jin, Hui; Carter-Su, Christin; Qin, Zhaohui S.

    2011-01-01

    Regulation of c-Fos transcription by GH is mediated by CCAAT/enhancer binding protein β (C/EBPβ). This study examines the role of C/EBPβ in mediating GH activation of other early response genes, including Cyr61, Btg2, Socs3, Zfp36, and Socs1. C/EBPβ depletion using short hairpin RNA impaired responsiveness of these genes to GH, as seen for c-Fos. Rescue with wild-type C/EBPβ led to GH-dependent recruitment of the coactivator p300 to the c-Fos promoter. In contrast, rescue with C/EBPβ mutated at the ERK phosphorylation site at T188 failed to induce GH-dependent recruitment of p300, indicating that ERK-mediated phosphorylation of C/EBPβ at T188 is required for GH-induced recruitment of p300 to c-Fos. GH also induced the occupancy of phosphorylated C/EBPβ and p300 on Cyr61, Btg2, and Socs3 at predicted C/EBP-cAMP response element-binding protein motifs in their promoters. Consistent with a role for ERKs in GH-induced expression of these genes, treatment with U0126 to block ERK phosphorylation inhibited their GH-induced expression. In contrast, GH-dependent expression of Zfp36 and Socs1 was not inhibited by U0126. Thus, induction of multiple early response genes by GH in 3T3-F442A cells is mediated by C/EBPβ. A subset of these genes is regulated similarly to c-Fos, through a mechanism involving GH-stimulated ERK 1/2 activation, phosphorylation of C/EBPβ, and recruitment of p300. Overall, these studies suggest that C/EBPβ, like the signal transducer and activator of transcription proteins, regulates multiple genes in response to GH. PMID:21292824

  18. Thyroid hormone and adrenergic signaling interact to control pineal expression of the dopamine receptor D4 gene (Drd4)

    DEFF Research Database (Denmark)

    Kim, Jong-So; Bailey, Michael J; Weller, Joan L

    2009-01-01

    is circadian in nature and under photoneural control. Whereas most rhythmically expressed genes in the pineal are controlled by adrenergic/cAMP signaling, Drd4 expression also requires thyroid hormone. This advance raises the questions of whether Drd4 expression is regulated by this mechanism in other systems...

  19. Effect of amiodarone and dronedarone administration in rats on thyroid hormone-dependent gene expression in different cardiac components

    NARCIS (Netherlands)

    Stoykov, I.; van Beeren, H. C.; Moorman, A. F. M.; Christoffels, V. M.; Wiersinga, W. M.; Bakker, O.

    2007-01-01

    OBJECTIVE: In view of their different actions on thyroid hormone receptor (TR) isoforms we set out to investigate whether amiodarone (AM) and dronedarone (Dron) have different and/or component-specific effects on cardiac gene expression. DESIGN: Rats were treated with AM or Dron and the expression

  20. Genome-wide analysis of regions similar to promoters of histone genes

    KAUST Repository

    Chowdhary, Rajesh

    2010-05-28

    Background: The purpose of this study is to: i) develop a computational model of promoters of human histone-encoding genes (shortly histone genes), an important class of genes that participate in various critical cellular processes, ii) use the model so developed to identify regions across the human genome that have similar structure as promoters of histone genes; such regions could represent potential genomic regulatory regions, e.g. promoters, of genes that may be coregulated with histone genes, and iii/ identify in this way genes that have high likelihood of being coregulated with the histone genes.Results: We successfully developed a histone promoter model using a comprehensive collection of histone genes. Based on leave-one-out cross-validation test, the model produced good prediction accuracy (94.1% sensitivity, 92.6% specificity, and 92.8% positive predictive value). We used this model to predict across the genome a number of genes that shared similar promoter structures with the histone gene promoters. We thus hypothesize that these predicted genes could be coregulated with histone genes. This hypothesis matches well with the available gene expression, gene ontology, and pathways data. Jointly with promoters of the above-mentioned genes, we found a large number of intergenic regions with similar structure as histone promoters.Conclusions: This study represents one of the most comprehensive computational analyses conducted thus far on a genome-wide scale of promoters of human histone genes. Our analysis suggests a number of other human genes that share a high similarity of promoter structure with the histone genes and thus are highly likely to be coregulated, and consequently coexpressed, with the histone genes. We also found that there are a large number of intergenic regions across the genome with their structures similar to promoters of histone genes. These regions may be promoters of yet unidentified genes, or may represent remote control regions that

  1. Vinclozolin alters the expression of hormonal and stress genes in the midge Chironomus riparius.

    Science.gov (United States)

    Aquilino, Mónica; Sánchez-Argüello, Paloma; Martínez-Guitarte, José-Luis

    2016-05-01

    Vinclozolin is a fungicide used in agriculture that can reach aquatic ecosystems and affect the organisms living there. Its effects have been intensively studied in vertebrates, where it acts as an antiandrogen, but there is a lack of information about its mechanistic effects on invertebrates. In this work, we analyzed the response of genes related to the endocrine system, the stress response, and the detoxification mechanisms of Chironomus riparius fourth instar larvae after 24h and 48h exposures to 20 (69.9nM), 200 (699nM), and 2000μg/L (6.99μM) of Vinclozolin. Survival analysis showed that this compound has low toxicity, as it was not lethal for this organism at the concentrations used. However, this fungicide was shown to modify the transcriptional activity of the ecdysone response pathway genes EcR, E74, and Kr-h1 by increasing their mRNA levels. While no changes were observed in disembodied, a gene related with the ecdysone synthesis metabolic pathway, Cyp18A1, which is involved in the inactivation of the active form of ecdysone, was upregulated. Additionally, the expression of two genes related to other hormones, FOXO and MAPR, did not show any changes when Vinclozolin was present. The analysis of stress response genes showed significant changes in the mRNA levels of Hsp70, Hsp24, and Gp93, indicating that Vinclozolin activates the cellular stress mechanisms. Finally, the expressions of the genes Cyp4G and GstD3, which encode enzymes involved in phase I and phase II detoxification, respectively, were analyzed. It was found that their mRNA levels were altered by Vinclozolin, suggesting their involvement in the degradation of this compound. For the first time, these results show evidence that Vinclozolin can modulate gene expression, leading to possible significant endocrine alterations of the insect endocrine system. These results also offer new clues about the mode of action of this compound in invertebrates. Copyright © 2016 Elsevier B.V. All rights

  2. Cooperative binding of transcription factors promotes bimodal gene expression response.

    Directory of Open Access Journals (Sweden)

    Pablo S Gutierrez

    Full Text Available In the present work we extend and analyze the scope of our recently proposed stochastic model for transcriptional regulation, which considers an arbitrarily complex cis-regulatory system using only elementary reactions. Previously, we determined the role of cooperativity on the intrinsic fluctuations of gene expression for activating transcriptional switches, by means of master equation formalism and computer simulation. This model allowed us to distinguish between two cooperative binding mechanisms and, even though the mean expression levels were not affected differently by the acting mechanism, we showed that the associated fluctuations were different. In the present generalized model we include other regulatory functions in addition to those associated to an activator switch. Namely, we introduce repressive regulatory functions and two theoretical mechanisms that account for the biphasic response that some cis-regulatory systems show to the transcription factor concentration. We have also extended our previous master equation formalism in order to include protein production by stochastic translation of mRNA. Furthermore, we examine the graded/binary scenarios in the context of the interaction energy between transcription factors. In this sense, this is the first report to show that the cooperative binding of transcription factors to DNA promotes the "all-or-none" phenomenon observed in eukaryotic systems. In addition, we confirm that gene expression fluctuation levels associated with one of two cooperative binding mechanism never exceed the fluctuation levels of the other.

  3. The origin of the p.E180 growth hormone receptor gene mutation.

    Science.gov (United States)

    Ostrer, Harry

    2016-06-01

    Laron syndrome, an autosomal recessive condition of extreme short stature, is caused by the absence or dysfunction of the growth hormone receptor. A recurrent mutation in the GHR gene, p.E180, did not alter the encoded amino acid, but activated a cryptic splice acceptor resulting in a receptor protein with an 8-amino acid deletion in the extracellular domain. This mutation has been observed among Sephardic Jews and among individuals in Ecuador, Brazil and Chile, most notably in a large genetic isolate in Loja, Ecuador. A common origin has been postulated based on a shared genetic background of markers flanking this mutation, suggesting that the Lojanos (and others) may have Sephardic (Converso) Jewish ancestry. Analysis of the population structure of Lojanos based on genome-wide analysis demonstrated European, Sephardic Jewish and Native American ancestry in this group. X-autosomal comparison and monoallelic Y chromosomal and mitochondrial genetic analysis demonstrated gender-biased admixture between Native American women and European and Sephardic Jewish men. These findings are compatible with the co-occurrence of the Inquisition and the colonization of the Americas, including Converso Jews escaping the Inquisition in the Iberian Peninsula. Although not found among Lojanos, Converso Jews also brought founder mutations to contemporary Hispanic and Latino populations in the BRCA1 (c.68_69delAG) and BLM (c.2207_2212delATCTGAinsTAGATTC) genes. Copyright © 2015 Elsevier Ltd. All rights reserved.

  4. Altered gene-expression profile in rat plasma and promoted body ...

    African Journals Online (AJOL)

    Altered gene-expression profile in rat plasma and promoted body and brain development ... The study was aimed to explore how the prenatal EE impacts affect the ... positively promote the body and nervous system development of offspring, ...

  5. Single nucleotide polymorphism of the growth hormone (GH encoding gene in inbred and outbred domestic rabbits

    Directory of Open Access Journals (Sweden)

    Deyana Gencheva Hristova

    2018-03-01

    Full Text Available Taking into consideration that the growth hormone (GH gene in rabbits is a candidate for meat production, understanding the genetic diversity and variation in this locus is of particular relevance. The present study comprised 86 rabbits (Oryctolagus cuniculus divided into 3 groups: New Zealand White (NZW outbred rabbits; first-generation inbred rabbits (F1 and second-generation inbred rabbits (F2. They were analysed by polymerase chain reaction-based restriction fragment length polymorphism method. A 231 bp fragment of the polymorphic site of the GH gene was digested with Bsh1236 restriction enzyme. Single nucleotide polymorphisms for the studied GH locus corresponding to 3 genotypes were detected in the studied rabbit populations: CC, CT and TT. In the synthetic inbred F1 and F2 populations, the frequency of the heterozygous genotype CT was 0.696 and 0.609, respectively, while for the homozygous CC genotype the frequency was lower (0.043 and 0.000, and respective values for the homozygous TT genotype were 0.261 and 0.391. This presumed a preponderance of the T allele (0.609 and 0.696 over the C allele (0.391 and 0.304 in these groups. In outbred rabbits, the allele frequencies were 0.613 (allele C and 0.387 (allele Т; consequently, the frequency of the homozygous CC genotype was higher than that of the homozygous TT genotype (0.300 vs. 0.075. Observed heterozygosity for the GH gene was higher than expected, and the result was therefore a negative inbreeding coefficient (Fis=–0.317 for outbred NZW rabbits; –0.460 for inbred F1 and –0.438 for inbred F2, indicating a sufficient number of heterozygous forms in all studied groups of rabbits. The application of narrow inbreeding by breeding full sibs in the synthetic population did not cause a rapid increase in homozygosity.

  6. Myocardium of patients with dilated cardiomyopathy presents altered expression of genes involved in thyroid hormone biosynthesis.

    Directory of Open Access Journals (Sweden)

    Carolina Gil-Cayuela

    Full Text Available The association between dilated cardiomyopathy (DCM and low thyroid hormone (TH levels has been previously described. In these patients abnormal thyroid function is significantly related to impaired left ventricular (LV function and increased risk of death. Although TH was originally thought to be produced exclusively by the thyroid gland, we recently reported TH biosynthesis in the human ischemic heart.Based on these findings, we evaluated whether the genes required for TH production are also altered in patients with DCM.Twenty-three LV tissue samples were obtained from patients with DCM (n = 13 undergoing heart transplantation and control donors (n = 10, and used for RNA sequencing analysis. The number of LV DCM samples was increased to 23 to determine total T4 and T3 tissue levels by ELISA.We found that all components of TH biosynthesis are expressed in human dilated heart tissue. Expression of genes encoding thyroperoxidase (-2.57-fold, P < 0.05 and dual oxidase 2 (2.64-fold, P < 0.01, the main enzymatic system of TH production, was significantly altered in patients with DCM and significantly associated with LV remodeling parameters. Thyroxine (T4 cardiac tissue levels were significantly increased (P < 0.01, whilst triiodothyronine (T3 levels were significantly diminished (P < 0.05 in the patients.Expression of TH biosynthesis machinery in the heart and total tissue levels of T4 and T3, are altered in patients with DCM. Given the relevance of TH in cardiac pathology, our results provide a basis for new gene-based therapeutic strategies for treating DCM.

  7. The effect of thyroid hormones on the white adipose tissue gene expression of PAI-1 and its serum concentration

    Directory of Open Access Journals (Sweden)

    C. Biz

    2009-12-01

    Full Text Available Metabolic syndrome is associated with an increased risk of developing cardiovascular diseases and Plasminogen activator inhibitor 1 (PAI-1 overexpression may play a significant role in this process. A positive correlation between adipose tissue gene expression of PAI-1 and its serum concentration has been reported. Furthermore, high serum levels of thyroid hormones (T3 and T4 and PAI-1 have been observed in obese children. The present study evaluates the impact of thyroid hormone treatment on white adipose tissue PAI-1 gene expression and its serum concentration. Male Wistar rats (60 days old were treated for three weeks with T4 (50 µg/day, Hyper or with saline (control. Additionally, 3T3-L1 adipocytes were treated for 24 h with T4 (100 nM or T3 (100 nM. PAI-1 gene expression was determined by real-time PCR, while the serum concentration of PAI-1 was measured by ELISA using a commercial kit (Innovative Research, USA. Both the serum concentration of PAI-1 and mRNA levels were similar between groups in retroperitoneal and epididymal white adipose tissue. Using 3T3-L1 adipocytes, in vitro treatment with T4 and T3 increased the gene expression of PAI-1, suggesting non-genomic and genomic effects, respectively. These results demonstrate that thyroid hormones have different effects in vitro and in vivo on PAI-1 gene expression in adipocytes.

  8. Hyperactivity and learning deficits in transgenic mice bearing a human mutant thyroid hormone beta1 receptor gene.

    Science.gov (United States)

    McDonald, M P; Wong, R; Goldstein, G; Weintraub, B; Cheng, S Y; Crawley, J N

    1998-01-01

    Resistance to thyroid hormone (RTH) is a human syndrome mapped to the thyroid receptor beta (TRbeta) gene on chromosome 3, representing a mutation of the ligand-binding domain of the TRbeta gene. The syndrome is characterized by reduced tissue responsiveness to thyroid hormone and elevated serum levels of thyroid hormones. A common behavioral phenotype associated with RTH is attention deficit hyperactivity disorder (ADHD). To test the hypothesis that RTH produces attention deficits and/or hyperactivity, transgenic mice expressing a mutant TRbeta gene were generated. The present experiment tested RTH transgenic mice from the PV kindred on behavioral tasks relevant to the primary features of ADHD: hyperactivity, sustained attention (vigilance), learning, and impulsivity. Male transgenic mice showed elevated locomotor activity in an open field compared to male wild-type littermate controls. Both male and female transgenic mice exhibited impaired learning of an autoshaping task, compared to wild-type controls. On a vigilance task in an operant chamber, there were no differences between transgenics and controls on the proportion of hits, response latency, or duration of stimulus tolerated. On an operant go/no-go task measuring sustained attention and impulsivity, there were no differences between controls and transgenics. These results indicate that transgenic mice bearing a mutant human TRbeta gene demonstrate several behavioral characteristics of ADHD and may serve a valuable heuristic role in elucidating possible candidate genes in converging pathways for other causes of ADHD.

  9. Hyperactivity and Learning Deficits in Transgenic Mice Bearing a Human Mutant Thyroid Hormone β1 Receptor Gene

    Science.gov (United States)

    McDonald, Michael P.; Wong, Rosemary; Goldstein, Gregory; Weintraub, Bruce; Cheng, Sheue-yann; Crawley, Jacqueline N.

    1998-01-01

    Resistance to thyroid hormone (RTH) is a human syndrome mapped to the thyroid receptor β (TRβ) gene on chromosome 3, representing a mutation of the ligandbinding domain of the TRβ gene. The syndrome is characterized by reduced tissue responsiveness to thyroid hormone and elevated serum levels of thyroid hormones. A common behavioral phenotype associated with RTH is attention deficit hyperactivity disorder (ADHD). To test the hypothesis that RTH produces attention deficits and/or hyperactivity, transgenic mice expressing a mutant TRβ gene were generated. The present experiment tested RTH transgenic mice from the PV kindred on behavioral tasks relevant to the primary features of ADHD: hyperactivity, sustained attention (vigilance), learning, and impulsivity. Male transgenic mice showed elevated locomotor activity in an open field compared to male wild-type littermate controls. Both male and female transgenic mice exhibited impaired learning of an autoshaping task, compared to wild-type controls. On a vigilance task in an operant chamber, there were no differences between transgenics and controls on the proportion of hits, response latency, or duration of stimulus tolerated. On an operant go/no-go task measuring sustained attention and impulsivity, there were no differences between controls and transgenics. These results indicate that transgenic mice bearing a mutant human TRβ gene demonstrate several behavioral characteristics of ADHD and may serve a valuable heuristic role in elucidating possible candidate genes in converging pathways for other causes of ADHD. PMID:10454355

  10. Validation of potential reference genes for qPCR in maize across abiotic stresses, hormone treatments, and tissue types.

    Directory of Open Access Journals (Sweden)

    Yueai Lin

    Full Text Available The reverse transcription quantitative polymerase chain reaction (RT-qPCR is a powerful and widely used technique for the measurement of gene expression. Reference genes, which serve as endogenous controls ensure that the results are accurate and reproducible, are vital for data normalization. To bolster the literature on reference gene selection in maize, ten candidate reference genes, including eight traditionally used internal control genes and two potential candidate genes from our microarray datasets, were evaluated for expression level in maize across abiotic stresses (cold, heat, salinity, and PEG, phytohormone treatments (abscisic acid, salicylic acid, jasmonic acid, ethylene, and gibberellins, and different tissue types. Three analytical software packages, geNorm, NormFinder, and Bestkeeper, were used to assess the stability of reference gene expression. The results revealed that elongation factor 1 alpha (EF1α, tubulin beta (β-TUB, cyclophilin (CYP, and eukaryotic initiation factor 4A (EIF4A were the most reliable reference genes for overall gene expression normalization in maize, while GRP (Glycine-rich RNA-binding protein, GLU1(beta-glucosidase, and UBQ9 (ubiquitin 9 were the least stable and most unsuitable genes. In addition, the suitability of EF1α, β-TUB, and their combination as reference genes was confirmed by validating the expression of WRKY50 in various samples. The current study indicates the appropriate reference genes for the urgent requirement of gene expression normalization in maize across certain abiotic stresses, hormones, and tissue types.

  11. Development of chimeric gene promoters responsive to hypoxia and ionizing radiation

    International Nuclear Information System (INIS)

    Zheng Aiqing; Yu Jinming

    2004-01-01

    The authors describe two systems that make use of gene-directed enzyme prodrug therapy, regulated by radiation or hypoxic-responsive promoters. The use of treatment-, condition- or tumor-specific promoters to control gene-directed enzyme prodrug therapy is one such method for targeting gene expression to the tumor. The development of such strategies that achieve tumor targeted expression of genes via selective promoters will enable improved specificity and targeting thereby addressing one of the major limitations of cancer gene therapy

  12. Gene expression studies on human keratinocytes transduced with human growth hormone gene for a possible utilization in gene therapy; Estudos da expressao genica mediante utilizacao de queratinocitos humanos normais transduzidos com o gene do hormonio de crscimento humano. Possivel utilizacao em terapia genica

    Energy Technology Data Exchange (ETDEWEB)

    Mathor, Monica Beatriz

    1994-12-31

    Taking advantage of the recent progress in the DNA-recombinant techniques and of the potentiality of normal human keratinocytes primary culture to reconstitute the epidermis, it was decided to genetically transform these keratinocytes to produce human growth hormone under controllable conditions that would be used in gene therapy at this hormone deficient patients. The first step to achieve this goal was to standardize infection of keratinocytes with retrovirus producer cells containing a construct which included the gene of bacterial b-galactosidase. The best result was obtained cultivating the keratinocytes for 3 days in a 2:1 mixture of retrovirus producer cells and 3T3-J2 fibroblasts irradiated with 60 Gy, and splitting these infected keratinocytes on 3T3-J2 fibroblasts feeder layer. Another preliminary experiment was to infect normal human keratinocytes with interleukin-6 gene (hIL-6) that, in pathologic conditions, could be reproduced by keratinocytes and secreted to the blood stream. Thus, we verify that infected keratinocytes secrete an average amount of 500 ng/10{sup 6} cell/day of cytokin during the in vitro life time, that certify the stable character of the injection. These keratinocytes, when grafted in mice, secrete hIL-6 to the blood stream reaching levels of 40 pg/ml of serum. After these preliminary experiments, we construct a retroviral vector with the human growth hormone gene (h GH) driven by human metallothionein promoter (h PMT), designated DChPMTGH. Normal human keratinocytes were infected with DChPMTGH producer cells, following previously standardized protocol, obtaining infected keratinocytes secreting to the culture media 340 ng h GH/10{sup 6} cell/day without promoter activation. This is the highest level of h GH secreted in human keratinocytes primary culture described in literature. The h GH value increases approximately 10 times after activation with 100 {mu}M Zn{sup +2} for 8-12 hours. (author). 158 refs., 42 figs., 6 tabs.

  13. ABERRANT METHYLATION OF THE PROMOTER OF APC, CDH13 AND MGMT GENES IN COLORECTAL CANCER PATIENTS

    Directory of Open Access Journals (Sweden)

    O. I. Kit

    2016-01-01

    Full Text Available Aberrant methylation of gene promoter regions is the main epigenetic change characterizing colorectal cancer. Methylation levels of 42 CpG-sites of promoter regions of the MGMT, APC and CDH13 genes in colorectal cancer were studied in comparison with methylation levels of the adjacent normal tissue in 25 patients. Pyrosequencing showed an increase in methylation levels of promoter regions of the MGMT, APC and CDH13 genes in tumor samples by 3 to 5 times. These tumor samples were screened for activating SNP-mutations in the KRAS (40 %, NRAS (0 % and BRAF (0 % oncogenes. SNP-mutations in the KRAS gene were accompanied by hypermethylation of one or more promoters of the studied genes. Association of this epigenetic index with tumor metastasis was proved. The data on an increase in methylation of the promoter regions of oncosupressor genes can be used as sensitive prognostic markers of progression and metastasis of colorectal cancer.

  14. Molecular characterization of a genetic variant of the steroid hormone-binding globulin gene in heterozygous subjects

    Energy Technology Data Exchange (ETDEWEB)

    Hardy, D.O.; Catterall, J.F. [Population Council, New York, NY (United States); Carino, C. [Instituto National de la Nutricion, Mexico City, MX (United States)] [and others

    1995-04-01

    Steroid hormone-binding globulin in human serum displays different isoelectric focusing (IEF) patterns among individuals, suggesting genetic variation in the gene for this extracellular steroid carrier protein. Analysis of allele frequencies and family studies suggested the existence of two codominant alleles of the gene. Subsequent determination of the molecular basis of a variant of the gene was carried out using DNA from homozygous individuals from a single Belgian family. It was of interest to characterize other variant individuals to determine whether all variants identified by IEF phenotyping were caused by the same mutation or whether other mutations occurred in the gene in different populations. Previous studies identified Mexican subjects who were heterozygous for the variant IEF phenotype. Denaturing gradient gel electrophoresis was used to localize the mutation in these subjects and to purify the variant allele for DNA sequence analysis. The results show that the mutation in this population is identical to that identified in the Belgian family, and no other mutations were detected in the gene. These data represent the first analysis of steroid hormone-binding globulin gene variation in heterozygous subjects and further support the conclusion of biallelism of the gene worldwide. 11 refs., 2 figs., 1 tab.

  15. Viral promoters can initiate expression of toxin genes introduced into Escherichia coli

    Directory of Open Access Journals (Sweden)

    Jacob Daniela

    2005-06-01

    Full Text Available Abstract Background The expression of recombinant proteins in eukaryotic cells requires the fusion of the coding region to a promoter functional in the eukaryotic cell line. Viral promoters are very often used for this purpose. The preceding cloning procedures are usually performed in Escherichia coli and it is therefore of interest if the foreign promoter results in an expression of the gene in bacteria. In the case molecules toxic for humans are to be expressed, this knowledge is indispensable for the specification of safety measures. Results We selected five frequently used viral promoters and quantified their activity in E. coli with a reporter system. Only the promoter from the thymidine kinase gene from HSV1 showed no activity, while the polyhedrin promoter from baculovirus, the early immediate CMV promoter, the early SV40 promoter and the 5' LTR promoter from HIV-1 directed gene expression in E. coli. The determination of transcription start sites in the immediate early CMV promoter and the polyhedrin promoter confirmed the existence of bacterial -10 and -35 consensus sequences. The importance of this heterologous gene expression for safety considerations was further supported by analysing fusions between the aforementioned promoters and a promoter-less cytotoxin gene. Conclusion According to our results a high percentage of viral promoters have the ability of initiating gene expression in E. coli. The degree of such heterologous gene expression can be sufficient for the expression of toxin genes and must therefore be considered when defining safety measures for the handling of corresponding genetically modified organisms.

  16. Prognostic Significance of Promoter DNA Hypermethylation of cysteine dioxygenase 1 (CDO1 Gene in Primary Breast Cancer.

    Directory of Open Access Journals (Sweden)

    Naoko Minatani

    Full Text Available Using pharmacological unmasking microarray, we identified promoter DNA methylation of cysteine dioxygenase 1 (CDO1 gene in human cancer. In this study, we assessed the clinicopathological significance of CDO1 methylation in primary breast cancer (BC with no prior chemotherapy. The CDO1 DNA methylation was quantified by TaqMan methylation specific PCR (Q-MSP in 7 BC cell lines and 172 primary BC patients with no prior chemotherapy. Promoter DNA of the CDO1 gene was hypermethylated in 6 BC cell lines except SK-BR3, and CDO1 gene expression was all silenced at mRNA level in the 7 BC cell lines. Quantification of CDO1 methylation was developed using Q-MSP, and assessed in primary BC. Among the clinicopathologic factors, CDO1 methylation level was not statistically significantly associated with any prognostic factors. The log-rank plot analysis elucidated that the higher methylation the tumors harbored, the poorer prognosis the patients exhibited. Using the median value of 58.0 as a cut-off one, disease specific survival in BC patients with CDO1 hypermethylation showed significantly poorer prognosis than those with hypomethylation (p = 0.004. Multivariate Cox proportional hazards model identified that CDO1 hypermethylation was prognostic factor as well as Ki-67 and hormone receptor status. The most intriguingly, CDO1 hypermethylation was of robust prognostic relevance in triple negative BC (p = 0.007. Promoter DNA methylation of CDO1 gene was robust prognostic indicator in primary BC patients with no prior chemotherapy. Prognostic relevance of the CDO1 promoter DNA methylation is worthy of being paid attention in triple negative BC cancer.

  17. Mono-(2-Ethylhexyl Phthalate Promotes Pro-Labor Gene Expression in the Human Placenta.

    Directory of Open Access Journals (Sweden)

    Ximi K Wang

    Full Text Available Women exposed to phthalates during pregnancy are at increased risk for delivering preterm, but the mechanism behind this relationship is unknown. Placental corticotropin-releasing hormone (CRH and cyclooxygenase-2 (COX-2 are key mediators of parturition and are regulated by the non-canonical NF-kB (RelB/p52 signaling pathway. In this study, we demonstrate that one of the major phthalate metabolites, mono-(2-ethylhexyl-phthalate (MEHP, increased CRH and COX-2 mRNA and protein abundance in a dose-dependent manner in primary cultures of cytotrophoblast. This was coupled with an increase in nuclear import of RelB/p52 and its association with the CRH and COX-2 promoters. Silencing of NF-kB inducing kinase, a central signaling component of the non-canonical NF-kB pathway, blocked MEHP-induced upregulation of CRH and COX-2. These results suggest a potential mechanism mediated by RelB/p52 by which phthalates could prematurely induce pro-labor gene activity and lead to preterm birth.

  18. Corticotropin-Releasing Hormone Receptor 2 Gene Variants in Irritable Bowel Syndrome.

    Directory of Open Access Journals (Sweden)

    Hazuki Komuro

    Full Text Available Corticotropin-releasing hormone (CRH plays an important role in the pathophysiology of irritable bowel syndrome (IBS and regulates the stress response through two CRH receptors (R1 and R2. Previously, we reported that a CRHR1 gene polymorphism (rs110402, rs242924, and rs7209436 and haplotypes were associated with IBS. However, the association between the CRHR2 gene and IBS was not investigated. We tested the hypothesis that genetic polymorphisms and haplotypes of CRHR2 are associated with IBS pathophysiology and negative emotion in IBS patients.A total of 142 IBS patients and 142 healthy controls participated in this study. Seven single nucleotide polymorphisms (SNPs of the CRHR2 gene (rs4722999, rs3779250, rs2240403, rs2267710, rs2190242, rs2284217, and rs2284220 were genotyped. Subjects' psychological states were evaluated using the Perceived-Stress Scale, the State-Trait Anxiety Inventory, and the Self-Rating Depression Scale.We found that rs4722999 and rs3779250, located in intronic region, were associated with IBS in terms of genotype frequency (rs4722999: P = 0.037; rs3779250: P = 0.017 and that the distribution of the major allele was significantly different between patients and controls. There was a significant group effect (controls vs. IBS, and a CRHR2 genotype effect was observed for three psychological scores, but the interaction was not significant. We found a haplotype of four SNPs (rs4722999, rs3779250, rs2240403, and rs2267710 and two SNPs (rs2284217 and rs2284220 in strong linkage disequilibrium (D' > 0.90. We also found that haplotypes of the CRHR2 gene were significantly different between IBS patients and controls and that they were associated with negative emotion.Our findings support the hypothesis that genetic polymorphisms and haplotypes of CRHR2 are related to IBS. In addition, we found associations between CRHR2 genotypes and haplotypes and negative emotion in IBS patients and controls. Further studies on IBS and the CRH

  19. Common and distinct roles of juvenile hormone signaling genes in metamorphosis of holometabolous and hemimetabolous insects.

    Directory of Open Access Journals (Sweden)

    Barbora Konopova

    Full Text Available Insect larvae metamorphose to winged and reproductive adults either directly (hemimetaboly or through an intermediary pupal stage (holometaboly. In either case juvenile hormone (JH prevents metamorphosis until a larva has attained an appropriate phase of development. In holometabolous insects, JH acts through its putative receptor Methoprene-tolerant (Met to regulate Krüppel-homolog 1 (Kr-h1 and Broad-Complex (BR-C genes. While Met and Kr-h1 prevent precocious metamorphosis in pre-final larval instars, BR-C specifies the pupal stage. How JH signaling operates in hemimetabolous insects is poorly understood. Here, we compare the function of Met, Kr-h1 and BR-C genes in the two types of insects. Using systemic RNAi in the hemimetabolous true bug, Pyrrhocoris apterus, we show that Met conveys the JH signal to prevent premature metamorphosis by maintaining high expression of Kr-h1. Knockdown of either Met or Kr-h1 (but not of BR-C in penultimate-instar Pyrrhocoris larvae causes precocious development of adult color pattern, wings and genitalia. A natural fall of Kr-h1 expression in the last larval instar normally permits adult development, and treatment with an exogenous JH mimic methoprene at this time requires both Met and Kr-h1 to block the adult program and induce an extra larval instar. Met and Kr-h1 therefore serve as JH-dependent repressors of deleterious precocious metamorphic changes in both hemimetabolous and holometabolous juveniles, whereas BR-C has been recruited for a new role in specifying the holometabolous pupa. These results show that despite considerable evolutionary distance, insects with diverse developmental strategies employ a common-core JH signaling pathway to commit to adult morphogenesis.

  20. Gonadotropin-Releasing Hormone Regulates Expression of the DNA Damage Repair Gene, Fanconi anemia A, in Pituitary Gonadotroph Cells1

    Science.gov (United States)

    Larder, Rachel; Chang, Lynda; Clinton, Michael; Brown, Pamela

    2007-01-01

    Gonadal function is critically dependant on regulated secretion of the gonadotropin hormones from anterior pituitary gonadotroph cells. Gonadotropin biosynthesis and release is triggered by the binding of hypothalamic GnRH to GnRH receptor expressed on the gonadotroph cell surface. The repertoire of regulatory molecules involved in this process are still being defined. We used the mouse LβT2 gonadotroph cell line, which expresses both gonadotropin hormones, as a model to investigate GnRH regulation of gene expression and differential display reverse transcription-polymerase chain reaction (RT-PCR) to identify and isolate hormonally induced changes. This approach identified Fanconi anemia a (Fanca), a gene implicated in DNA damage repair, as a differentially expressed transcript. Mutations in Fanca account for the majority of cases of Fanconi anemia (FA), a recessively inherited disease identified by congenital defects, bone marrow failure, infertility, and cancer susceptibility. We confirmed expression and hormonal regulation of Fanca mRNA by quantitative RT-PCR, which showed that GnRH induced a rapid, transient increase in Fanca mRNA. Fanca protein was also acutely upregulated after GnRH treatment of LβT2 cells. In addition, Fanca gene expression was confined to mature pituitary gonadotrophs and adult mouse pituitary and was not expressed in the immature αT3-1 gonadotroph cell line. Thus, this study extends the expression profile of Fanca into a highly specialized endocrine cell and demonstrates hormonal regulation of expression of the Fanca locus. We suggest that this regulatory mechanism may have a crucial role in the GnRH-response mechanism of mature gonadotrophs and perhaps the etiology of FA. PMID:15128600

  1. Gonadotropin-releasing hormone regulates expression of the DNA damage repair gene, Fanconi anemia A, in pituitary gonadotroph cells.

    Science.gov (United States)

    Larder, Rachel; Chang, Lynda; Clinton, Michael; Brown, Pamela

    2004-09-01

    Gonadal function is critically dependant on regulated secretion of the gonadotropin hormones from anterior pituitary gonadotroph cells. Gonadotropin biosynthesis and release is triggered by the binding of hypothalamic GnRH to GnRH receptor expressed on the gonadotroph cell surface. The repertoire of regulatory molecules involved in this process are still being defined. We used the mouse L beta T2 gonadotroph cell line, which expresses both gonadotropin hormones, as a model to investigate GnRH regulation of gene expression and differential display reverse transcription-polymerase chain reaction (RT-PCR) to identify and isolate hormonally induced changes. This approach identified Fanconi anemia a (Fanca), a gene implicated in DNA damage repair, as a differentially expressed transcript. Mutations in Fanca account for the majority of cases of Fanconi anemia (FA), a recessively inherited disease identified by congenital defects, bone marrow failure, infertility, and cancer susceptibility. We confirmed expression and hormonal regulation of Fanca mRNA by quantitative RT-PCR, which showed that GnRH induced a rapid, transient increase in Fanca mRNA. Fanca protein was also acutely upregulated after GnRH treatment of L beta T2 cells. In addition, Fanca gene expression was confined to mature pituitary gonadotrophs and adult mouse pituitary and was not expressed in the immature alpha T3-1 gonadotroph cell line. Thus, this study extends the expression profile of Fanca into a highly specialized endocrine cell and demonstrates hormonal regulation of expression of the Fanca locus. We suggest that this regulatory mechanism may have a crucial role in the GnRH-response mechanism of mature gonadotrophs and perhaps the etiology of FA.

  2. Gene expression of thyrotropin- and corticotrophin-releasing hormones is regulated by environmental salinity in the euryhaline teleost Sparus aurata.

    Science.gov (United States)

    Ruiz-Jarabo, Ignacio; Martos-Sitcha, J A; Barragán-Méndez, C; Martínez-Rodríguez, G; Mancera, J M; Arjona, F J

    2018-04-01

    In euryhaline teleosts, the hypothalamus-pituitary-thyroid and hypothalamus-pituitary-interrenal axes (HPT and HPI, respectively) are regulated in response to environmental stimuli such as salinity changes. However, the molecular players participating in this physiological process in the gilthead seabream (Sparus aurata), a species of high value for aquaculture, are still not identified and/or fully characterized in terms of gene expression regulation. In this sense, this study identifies and isolates the thyrotropin-releasing hormone (trh) mRNA sequence from S. aurata, encoding prepro-Trh, the putative factor initiating the HPT cascade. In addition, the regulation of trh expression and of key brain genes in the HPI axis, i.e., corticotrophin-releasing hormone (crh) and corticotrophin-releasing hormone-binding protein (crhbp), was studied when the osmoregulatory status of S. aurata was challenged by exposure to different salinities. The deduced amino acid structure of trh showed 65-81% identity with its teleostean orthologs. Analysis of the tissue distribution of gene expression showed that trh mRNA is, though ubiquitously expressed, mainly found in brain. Subsequently, regulation of gene expression of trh, crh, and crhbp was characterized in fish acclimated to 5-, 15-, 40-, and 55-ppt salinities. In this regard, the brain gene expression pattern of trh mRNA was similar to that found for the crh gene, showing an upregulation of gene expression in seabream acclimated to the highest salinity tested. Conversely, crhbp did not change in any of the groups tested. Our results suggest that Trh and Crh play an important role in the acclimation of S. aurata to hypersaline environments.

  3. Stress hormones promote growth of B16-F10 melanoma metastases: an interleukin 6- and glutathione-dependent mechanism.

    Science.gov (United States)

    Valles, Soraya L; Benlloch, María; Rodriguez, María L; Mena, Salvador; Pellicer, José A; Asensi, Miguel; Obrador, Elena; Estrela, José M

    2013-03-22

    Interleukin (IL)-6 (mainly of tumor origin) activates glutathione (GSH) release from hepatocytes and its interorgan transport to B16-F10 melanoma metastatic foci. We studied if this capacity to overproduce IL-6 is regulated by cancer cell-independent mechanisms. Murine B16-F10 melanoma cells were cultured, transfected with red fluorescent protein, injected i.v. into syngenic C57BL/6J mice to generate lung and liver metastases, and isolated from metastatic foci using high-performance cell sorting. Stress hormones and IL-6 levels were measured by ELISA, and CRH expression in the brain by in situ hybridization. DNA binding activity of NF-κB, CREB, AP-1, and NF-IL-6 was measured using specific transcription factor assay kits. IL-6 expression was measured by RT-PCR, and silencing was achieved by transfection of anti-IL-6 small interfering RNA. GSH was determined by HPLC. Cell death analysis was distinguished using fluorescence microscopy, TUNEL labeling, and flow cytometry techniques. Statistical analyses were performed using Student's t test. Plasma levels of stress-related hormones (adrenocorticotropin hormone, corticosterone, and noradrenaline) increased, following a circadian pattern and as compared to non-tumor controls, in mice bearing B16-F10 lung or liver metastases. Corticosterone and noradrenaline, at pathophysiological levels, increased expression and secretion of IL-6 in B16-F10 cells in vitro. Corticosterone- and noradrenaline-induced transcriptional up-regulation of IL-6 gene involves changes in the DNA binding activity of nuclear factor-κB, cAMP response element-binding protein, activator protein-1, and nuclear factor for IL-6. In vivo inoculation of B16-F10 cells transfected with anti-IL-6-siRNA, treatment with a glucocorticoid receptor blocker (RU-486) or with a β-adrenoceptor blocker (propranolol), increased hepatic GSH whereas decreased plasma IL-6 levels and metastatic growth. Corticosterone, but not NORA, also induced apoptotic cell death in

  4. Eukaryotic genomes may exhibit up to 10 generic classes of gene promoters

    Directory of Open Access Journals (Sweden)

    Gagniuc Paul

    2012-09-01

    Full Text Available Abstract Background The main function of gene promoters appears to be the integration of different gene products in their biological pathways in order to maintain homeostasis. Generally, promoters have been classified in two major classes, namely TATA and CpG. Nevertheless, many genes using the same combinatorial formation of transcription factors have different gene expression patterns. Accordingly, we tried to ask ourselves some fundamental questions: Why certain genes have an overall predisposition for higher gene expression levels than others? What causes such a predisposition? Is there a structural relationship of these sequences in different tissues? Is there a strong phylogenetic relationship between promoters of closely related species? Results In order to gain valuable insights into different promoter regions, we obtained a series of image-based patterns which allowed us to identify 10 generic classes of promoters. A comprehensive analysis was undertaken for promoter sequences from Arabidopsis thaliana, Drosophila melanogaster, Homo sapiens and Oryza sativa, and a more extensive analysis of tissue-specific promoters in humans. We observed a clear preference for these species to use certain classes of promoters for specific biological processes. Moreover, in humans, we found that different tissues use distinct classes of promoters, reflecting an emerging promoter network. Depending on the tissue type, comparisons made between these classes of promoters reveal a complementarity between their patterns whereas some other classes of promoters have been observed to occur in competition. Furthermore, we also noticed the existence of some transitional states between these classes of promoters that may explain certain evolutionary mechanisms, which suggest a possible predisposition for specific levels of gene expression and perhaps for a different number of factors responsible for triggering gene expression. Our conclusions are based on

  5. Effects of triiodothyronine and amiodarone on the promoter of the human LDL receptor gene

    NARCIS (Netherlands)

    Bakker, O.; Hudig, F.; Meijssen, S.; Wiersinga, W. M.

    1998-01-01

    Treatment of patients with amiodarone, a potent anti arrhythmic drug, increases plasma LDL cholesterol levels, similar to that seen during hypothyroidism. This increase is the result of a decreased expression of the hepatic LDL receptor gene. We investigated the effects of thyroid hormone,

  6. IDENTIFIKASI IKAN CUPANG (Betta imbelis TRANSGENIK FOUNDER MEMBAWA GEN PENYANDI HORMON PERTUMBUHAN; Identification of Transgenic Founder Betta Fish (Betta imbelis Carry Growth Hormone Gene.

    Directory of Open Access Journals (Sweden)

    Eni Kusrini

    2017-01-01

    Full Text Available Penelitian dilakukan untuk mengidentifikasi keberhasilan introduksi gen penyandi hormon pertumbuhan (Growth Hormone, GH pada induk F-0 ikan Betta imbellis. Ikan transgenik F-0 dibuat dengan menggunakan metode transfeksi. Identifikasi dilakukan menggunakan metode RT-PCR. RNA total diekstraksi dari embrio pooled sample hasil persilangan induk transgenik dan non-transgenik. Berdasarkan analisis ekspresi gen pada embrio juga menunjukkan adanya aktivitas ekspresi gen GH pada semua perlakuan dibandingkan dengan kontrol (embrio hasil persilangan non-transgenik x non-transgenik. Jumlah individu induk F-0 yang membawa gen GH eksogen berdasarkan analisis PCR dengan DNA template dari sirip ekor adalah sebanyak 16%. Individu positif membawa gen GH eksogen tersebut dibesarkan lebih lanjut untuk memproduksi Betta imbellis transgenik F-1. Kandidat ikan transgenik jantan F-0 dikawinkan dengan ikan non-transgenik betina, sedangkan transgenik F-0 betina dikawinkan dengan non-transgenik jantan. Sebanyak 30-50 butir embrio hasil pemijahan F-0 digabung, kemudian DNA genom diekstrak. Sebagian embrio digunakan untuk ekstraksi RNA total untuk analisis ekspresi mRNA GH eksogen. Hasil analisis PCR menunjukkan bahwa semua sampel embrio dari induk transgenik F-0 dapat terdeteksi gen GH eksogen, sedangkan untuk kontrol (non-transgenik tidak terdeteksi. Ekspresi mRNA juga terdeteksi pada embrio F-1. Dengan demikian, metode transfeksi embrio Betta imbellis efektif digunakan untuk menghasilkan ikan transgenik, dan sangat berpotensi menghasilkan individu F-1 Betta imbellis dengan pertumbuhan lebih cepat. The study was conducted to identify the successful introduction of the growth hormone gene (Growth Hormone, GH on the F-0 Betta imbellis broodstock. The F-0 transgenic fish was made through transfection methods. Identification was done using RT-PCR method. Total RNA was extracted from pooled embryos sample. Based on the analysis of gene expression in embryos also showed

  7. Cloning and sequencing of growth hormone gene of Iranian Lori Bakhtiari sheep

    Directory of Open Access Journals (Sweden)

    M Dayani-Nia

    2010-05-01

    Full Text Available Growth hormone (GH is a peptide hormone that stimulates growth and cell reproduction in humans and animals. It is a 191-amino acid, single chain polypeptide hormone which is synthesized, stored, and secreted by the somatotroph cells within the lateral wings of the anterior pituitary gland. The goal of this research was to clone and sequence sheep growth hormone of Lori Bakhtiary breed in Iran. For this purpose, RNA was extracted from the pituitary gland of freshly slaughtered sheep and cDNA of growth hormone produced. The T/A cloning technique was used to clone the cDNA of growth hormone and then the synthesized construct was transferred into E. coli as the host. Once the correct recombinants were further confirmed by colony PCR or restriction enzyme digestion, sequencing was done. The sequencing results showed that, the length of sheep growth hormone cDNA was 690 bp fragments. Comparison of sequence of growth hormone inside the synthesized construct with those recorded in Genebank (NCBI, Blast indicated high degrees of similarity between Iranian native sheep and other sheep breeds of the world.

  8. Co-Targeting Prostate Cancer Epithelium and Bone Stroma by Human Osteonectin-Promoter-Mediated Suicide Gene Therapy Effectively Inhibits Androgen-Independent Prostate Cancer Growth.

    Directory of Open Access Journals (Sweden)

    Shian-Ying Sung

    Full Text Available Stromal-epithelial interaction has been shown to promote local tumor growth and distant metastasis. We sought to create a promising gene therapy approach that co-targets cancer and its supporting stromal cells for combating castration-resistant prostate tumors. Herein, we demonstrated that human osteonectin is overexpressed in the prostate cancer epithelium and tumor stroma in comparison with their normal counterpart. We designed a novel human osteonectin promoter (hON-522E containing positive transcriptional regulatory elements identified in both the promoter and exon 1 region of the human osteonectin gene. In vitro reporter assays revealed that the hON-522E promoter is highly active in androgen receptor negative and metastatic prostate cancer and bone stromal cells compared to androgen receptor-positive prostate cancer cells. Moreover, in vivo prostate-tumor-promoting activity of the hON-522E promoter was confirmed by intravenous administration of an adenoviral vector containing the hON-522E promoter-driven luciferase gene (Ad-522E-Luc into mice bearing orthotopic human prostate tumor xenografts. In addition, an adenoviral vector with the hON-522E-promoter-driven herpes simplex virus thymidine kinase gene (Ad-522E-TK was highly effective against the growth of androgen-independent human prostate cancer PC3M and bone stromal cell line in vitro and in pre-established PC3M tumors in vivo upon addition of the prodrug ganciclovir. Because of the heterogeneity of human prostate tumors, hON-522E promoter-mediated gene therapy has the potential for the treatment of hormone refractory and bone metastatic prostate cancers.

  9. DNA entropy reveals a significant difference in complexity between housekeeping and tissue specific gene promoters.

    Science.gov (United States)

    Thomas, David; Finan, Chris; Newport, Melanie J; Jones, Susan

    2015-10-01

    The complexity of DNA can be quantified using estimates of entropy. Variation in DNA complexity is expected between the promoters of genes with different transcriptional mechanisms; namely housekeeping (HK) and tissue specific (TS). The former are transcribed constitutively to maintain general cellular functions, and the latter are transcribed in restricted tissue and cells types for specific molecular events. It is known that promoter features in the human genome are related to tissue specificity, but this has been difficult to quantify on a genomic scale. If entropy effectively quantifies DNA complexity, calculating the entropies of HK and TS gene promoters as profiles may reveal significant differences. Entropy profiles were calculated for a total dataset of 12,003 human gene promoters and for 501 housekeeping (HK) and 587 tissue specific (TS) human gene promoters. The mean profiles show the TS promoters have a significantly lower entropy (pentropy distributions for the 3 datasets show that promoter entropies could be used to identify novel HK genes. Functional features comprise DNA sequence patterns that are non-random and hence they have lower entropies. The lower entropy of TS gene promoters can be explained by a higher density of positive and negative regulatory elements, required for genes with complex spatial and temporary expression. Copyright © 2015 Elsevier Ltd. All rights reserved.

  10. HOX Gene Promoter Prediction and Inter-genomic Comparison: An Evo-Devo Study

    Directory of Open Access Journals (Sweden)

    Marla A. Endriga

    2010-10-01

    Full Text Available Homeobox genes direct the anterior-posterior axis of the body plan in eukaryotic organisms. Promoter regions upstream of the Hox genes jumpstart the transcription process. CpG islands found within the promoter regions can cause silencing of these promoters. The locations of the promoter regions and the CpG islands of Homeo sapiens sapiens (human, Pan troglodytes (chimpanzee, Mus musculus (mouse, and Rattus norvegicus (brown rat are compared and related to the possible influence on the specification of the mammalian body plan. The sequence of each gene in Hox clusters A-D of the mammals considered were retrieved from Ensembl and locations of promoter regions and CpG islands predicted using Exon Finder. The predicted promoter sequences were confirmed via BLAST and verified against the Eukaryotic Promoter Database. The significance of the locations was determined using the Kruskal-Wallis test. Among the four clusters, only promoter locations in cluster B showed significant difference. HOX B genes have been linked with the control of genes that direct the development of axial morphology, particularly of the vertebral column bones. The magnitude of variation among the body plans of closely-related species can thus be partially attributed to the promoter kind, location and number, and gene inactivation via CpG methylation.

  11. Tumor Restrictive Suicide Gene Therapy for Glioma Controlled by the FOS Promoter.

    Directory of Open Access Journals (Sweden)

    Jianqing Pan

    Full Text Available Effective suicide gene delivery and expression are crucial to achieving successful effects in gene therapy. An ideal tumor-specific promoter expresses therapeutic genes in tumor cells with minimal normal tissue expression. We compared the activity of the FOS (FBJ murine osteosarcoma viral oncogene homolog promoter with five alternative tumor-specific promoters in glioma cells and non-malignant astrocytes. The FOS promoter caused significantly higher transcriptional activity in glioma cell lines than all alternative promoters with the exception of CMV. The FOS promoter showed 13.9%, 32.4%, and 70.8% of the transcriptional activity of CMV in three glioma cell lines (U87, U251, and U373. Importantly, however, the FOS promoter showed only 1.6% of the transcriptional activity of CMV in normal astrocytes. We also tested the biologic activity of recombinant adenovirus containing the suicide gene herpes simplex virus thymidine kinase (HSV-tk driven by the FOS promoter, including selective killing efficacy in vitro and tumor inhibition rate in vivo. Adenoviral-mediated delivery of the HSV-tk gene controlled by the FOS promoter conferred a cytotoxic effect on human glioma cells in vitro and in vivo. This study suggests that use of the FOS-tk adenovirus system is a promising strategy for glioma-specific gene therapy but still much left for improvement.

  12. Positional bias of general and tissue-specific regulatory motifs in mouse gene promoters

    Directory of Open Access Journals (Sweden)

    Farré Domènec

    2007-12-01

    Full Text Available Abstract Background The arrangement of regulatory motifs in gene promoters, or promoter architecture, is the result of mutation and selection processes that have operated over many millions of years. In mammals, tissue-specific transcriptional regulation is related to the presence of specific protein-interacting DNA motifs in gene promoters. However, little is known about the relative location and spacing of these motifs. To fill this gap, we have performed a systematic search for motifs that show significant bias at specific promoter locations in a large collection of housekeeping and tissue-specific genes. Results We observe that promoters driving housekeeping gene expression are enriched in particular motifs with strong positional bias, such as YY1, which are of little relevance in promoters driving tissue-specific expression. We also identify a large number of motifs that show positional bias in genes expressed in a highly tissue-specific manner. They include well-known tissue-specific motifs, such as HNF1 and HNF4 motifs in liver, kidney and small intestine, or RFX motifs in testis, as well as many potentially novel regulatory motifs. Based on this analysis, we provide predictions for 559 tissue-specific motifs in mouse gene promoters. Conclusion The study shows that motif positional bias is an important feature of mammalian proximal promoters and that it affects both general and tissue-specific motifs. Motif positional constraints define very distinct promoter architectures depending on breadth of expression and type of tissue.

  13. Effects of phyto-oestrogen quercetin on productive performance, hormones, reproductive organs and apoptotic genes in laying hens.

    Science.gov (United States)

    Yang, J X; Chaudhry, M T; Yao, J Y; Wang, S N; Zhou, B; Wang, M; Han, C Y; You, Y; Li, Y

    2018-04-01

    Quercetin, a polyphenolic flavonoid with diverse biological activities including anti-inflammatory and antiviral, inhibits lipid peroxidation, prevents oxidative injury and cell death. The purpose of the research was to investigate the effect of quercetin on productive performance, reproductive organs, hormones and apoptotic genes in laying hens between 37 and 45 weeks of age, because of the structure and oestrogenic activities similar to 17β-oestradiol. The trial was conducted using 240 Hessian laying hens (37 weeks old), housed in wire cages with two hens in each cage. These hens were randomly allotted to four treatments with six replicates, 10 hens in each replicate and fed with diets containing quercetin as 0, 0.2, 0.4 and 0.6 g/kg feed for 8 weeks. The results showed that dietary quercetin significantly increased (p feed-egg ratio was decreased (p  .05) on average egg weight and average daily feed intake. Compared with control, secretion of hormones, oestradiol (E 2 ) , progesterone (P4), follicle-stimulating hormone (FSH), luteinizing hormone (LH), insulin-like growth factors-1 (IGF-1) and growth hormone (GH), was found to be significantly higher (p  .05) by quercetin, whereas magnum index, isthmus index, magnum length, isthmus length and follicle numbers were significantly increased (p < .05) with quercetin supplementation. Additionally, expression of apoptotic genes was significantly (p < .05) up-regulated or down-regulated by quercetin. These results indicated that quercetin improved productive performance, and its mechanism may be due to the oestrogen-like activities of quercetin. © 2017 Blackwell Verlag GmbH.

  14. Transcriptional regulation of receptor-like protein genes by environmental stresses and hormones and their overexpression activities in Arabidopsis thaliana.

    Science.gov (United States)

    Wu, Jinbin; Liu, Zhijun; Zhang, Zhao; Lv, Yanting; Yang, Nan; Zhang, Guohua; Wu, Menyao; Lv, Shuo; Pan, Lixia; Joosten, Matthieu H A J; Wang, Guodong

    2016-05-01

    Receptor-like proteins (RLPs) have been implicated in multiple biological processes, including plant development and immunity to microbial infection. Fifty-seven AtRLP genes have been identified in Arabidopsis, whereas only a few have been functionally characterized. This is due to the lack of suitable physiological screening conditions and the high degree of functional redundancy among AtRLP genes. To overcome the functional redundancy and further understand the role of AtRLP genes, we studied the evolution of AtRLP genes and compiled a comprehensive profile of the transcriptional regulation of AtRLP genes upon exposure to a range of environmental stresses and different hormones. These results indicate that the majority of AtRLP genes are differentially expressed under various conditions that were tested, an observation that will help to select certain AtRLP genes involved in a specific biological process for further experimental studies to eventually dissect their function. A large number of AtRLP genes were found to respond to more than one treatment, suggesting that one single AtRLP gene may be involved in multiple physiological processes. In addition, we performed a genome-wide cloning of the AtRLP genes, and generated and characterized transgenic Arabidopsis plants overexpressing the individual AtRLP genes, presenting new insight into the roles of AtRLP genes, as exemplified by AtRLP3, AtRLP11 and AtRLP28 Our study provides an overview of biological processes in which AtRLP genes may be involved, and presents valuable resources for future investigations into the function of these genes. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  15. Cloning the uteroglobin gene promoter from the relic volcano rabbit (Romerolagus diazi) reveals an ancient estrogen-response element.

    Science.gov (United States)

    Acosta-MontesdeOca, Adriana; Zariñán, Teresa; Macías, Héctor; Pérez-Solís, Marco A; Ulloa-Aguirre, Alfredo; Gutiérrez-Sagal, Rubén

    2012-05-01

    To gain further insight on the estrogen-dependent transcriptional regulation of the uteroglobin (UG) gene, we cloned the 5'-flanking region of the UG gene from the phylogenetically ancient volcano rabbit (Romerolagus diazi; Rd). The cloned region spans 812 base pairs (bp; -812/-1) and contains a noncanonical TATA box (TACA). The translation start site is 48 bp downstream from the putative transcription initiation site (AGA), and is preceded by a consensus Kozak box. Comparison of the Rd-UG gene with that previously isolated from rabbits (Oryctolagus cuniculus) showed 93% in sequence identity as well as a number of conserved cis-acting elements, including the estrogen-response element (ERE; -265/-251), which differs from the consensus by two nucleotides. In MCF-7 cells, 17β-estradiol (E(2)) induced transcription of a luciferase reporter driven by the Rd-UG promoter in a similar manner as in an equivalent rabbit UG reporter; the Rd-UG promoter was 30% more responsive to E(2) than the rabbit promoter. Mutagenesis studies on the Rd-ERE confirmed this cis-element as a target of E(2) as two luciferase mutant reporters of the Rd-promoter, one with the rabbit and the other with the consensus ERE, were more responsive to the hormone than the wild-type reporter. Gel shift and super-shift assays showed that estrogen receptor-α indeed binds to the imperfect palindromic sequence of the Rd-ERE. Copyright © 2012 Wiley Periodicals, Inc.

  16. Synergistic regulation of the mouse orphan nuclear receptor SHP gene promoter by CLOCK-BMAL1 and LRH-1

    International Nuclear Information System (INIS)

    Oiwa, Ako; Kakizawa, Tomoko; Miyamoto, Takahide; Yamashita, Koh; Jiang, Wei; Takeda, Teiji; Suzuki, Satoru; Hashizume, Kiyoshi

    2007-01-01

    Small heterodimer partner (SHP; NR0B2) is an orphan nuclear receptor and acts as a repressor for wide variety of nuclear hormone receptors. We demonstrated here that mouse SHP mRNA showed a circadian expression pattern in the liver. Transient transfection of the mSHP promoter demonstrated that CLOCK-BMAL1, core circadian clock components, bound to E-box (CACGTG), and stimulated the promoter activity by 4-fold. Liver receptor homologue-1 (LRH-1; NR5A2) stimulated the mSHP promoter, and CLOCK-BMAL1 synergistically enhanced the LRH-1-mediated transactivation. Interestingly, SHP did not affect the CLOCK-BMAL1-mediated promoter activity, but strongly repressed the synergistic activation of CLOCK-BMAL1 and LRH-1. Furthermore, in vitro pull-down assays revealed the existence of direct protein-protein interaction between LRH-1 and CLOCK. In summary, this study shows that CLOCK-BMAL1, LRH-1 and SHP coordinately regulate the mSHP gene to generate the circadian oscillation. The cyclic expression of mSHP may affect daily activity of other nuclear receptors and contribute to circadian liver functions

  17. The progress of tumor gene-radiotherapy induced by Egr-1 promoter

    International Nuclear Information System (INIS)

    Guo Rui; Li Biao

    2010-01-01

    The promoter of early growth response gene-1 (Egr-1) is a cis-acting element of Egr-1, and its activity is regulated by inducers such as ionizing radiation, free radical. In designated gene-radiotherapy system, radiation combined with therapeutic gene (such as tumor necrosis factor-α gene, suicide gene) can spatially and temporally regulate therapeutic gene expression in the irradiated field, produced a marked effect, while little systemic toxicities were observed. The combination of radiotherapy and gene therapy is promising in tumor therapy. (authors)

  18. Cancer risk and clinicopathological characteristics of thyroid nodules harboring thyroid-stimulating hormone receptor gene mutations.

    Science.gov (United States)

    Mon, Sann Y; Riedlinger, Gregory; Abbott, Collette E; Seethala, Raja; Ohori, N Paul; Nikiforova, Marina N; Nikiforov, Yuri E; Hodak, Steven P

    2018-05-01

    Thyroid-stimulating hormone receptor (TSHR) gene mutations play a critical role in thyroid cell proliferation and function. They are found in 20%-82% of hyperfunctioning nodules, hyperfunctioning follicular thyroid cancers (FTC), and papillary thyroid cancers (PTC). The diagnostic importance of TSHR mutation testing in fine needle aspiration (FNA) specimens remains unstudied. To examine the association of TSHR mutations with the functional status and surgical outcomes of thyroid nodules, we evaluated 703 consecutive thyroid FNA samples with indeterminate cytology for TSHR mutations using next-generation sequencing. Testing for EZH1 mutations was performed in selected cases. The molecular diagnostic testing was done as part of standard of care treatment, and did not require informed consent. TSHR mutations were detected in 31 (4.4%) nodules and were located in exons 281-640, with codon 486 being the most common. Allelic frequency ranged from 3% to 45%. Of 16 cases (12 benign, 3 FTC, 1 PTC) with surgical correlation, 15 had solitary TSHR mutations and 1 PTC had comutation with BRAF V600E. Hyperthyroidism was confirmed in all 3 FTC (2 overt, 1 subclinical). Of 5 nodules with solitary TSHR mutations detected at high allelic frequency, 3 (60%) were FTC. Those at low allelic frequency (3%-22%) were benign. EZH1 mutations were detected in 2 of 4 TSHR-mutant malignant nodules and neither of 2 benign nodules. We report that TSHR mutations occur in ∼5% thyroid nodules in a large consecutive series with indeterminate cytology. TSHR mutations may be associated with an increased cancer risk when present at high allelic frequency, even when the nodule is hyperfunctioning. Benign nodules were however most strongly correlated with TSHR mutations at low allelic frequency. © 2018 Wiley Periodicals, Inc.

  19. Single Nucleotide Polymorphisms in Growth Hormone Gene and Their Association with Growth Traits in Siniperca chuatsi (Basilewsky

    Directory of Open Access Journals (Sweden)

    Changxu Tian

    2014-04-01

    Full Text Available Growth hormone (GH has been considered as a candidate gene for growth traits in fish. In this study, polymorphisms of the GH gene were evaluated for associations with growth traits in 282 Siniperca chuatsi individuals. Using directly sequencing, four single nucleotide polymorphisms (SNPs were identified in GH gene, with two mutations in intron 4 (g.4940A>C, g.4948A>T, one mutation in exon 5 (g.5045T>C and one in intron 5 (g.5234T>G. Notably, three of them were significantly associated with growth performance, particularly for g.4940A>C which was highly correlated with all the four growth traits. In conclusion, our results demonstrated that these SNPs in GH gene could influence growth performance of S.chuatsi and could be used for marker-assisted selection (MAS in this species.

  20. Growth hormone-promoted tyrosyl phosphorylation of SHC proteins and SHC association with Grb2

    DEFF Research Database (Denmark)

    VanderKuur, J; Allevato, G; Billestrup, Nils

    1995-01-01

    . To gain insight into pathways coupling GH receptor (GHR) to MAP kinase activation and signaling molecules that might interact with GHR and its associated tyrosine kinase JAK2, we examined whether SHC and Grb2 proteins serve as signaling molecules for GH. Human GH was shown to promote the rapid tyrosyl...... phosphorylation of 66-, 52-, and 46-kDa SHC proteins in 3T3-F442A fibroblasts. GH also promoted binding of GHR and JAK2 to the SH2 domain of 46/52-kDa SHC protein fused to glutathione S-transferase (GST). Constitutively phosphorylated JAK2, from COS-7 cells transiently transfected with murine JAK2 cDNA, bound......-638 and GHR1-638(Y333,338F), GH stimulated phosphorylation of all 3 SHC proteins whereas GH stimulated phosphorylation of only the 66- and 52-kDa SHC proteins in cells expressing GHR1-454. GH had no effect on SHC phosphorylation in cells expressing GHR1-294 or GHR delta P, the latter lacking amino acids 297...

  1. New auxin analogs with growth-promoting effects in intact plants reveal a chemical strategy to improve hormone delivery.

    Science.gov (United States)

    Savaldi-Goldstein, Sigal; Baiga, Thomas J; Pojer, Florence; Dabi, Tsegeye; Butterfield, Cristina; Parry, Geraint; Santner, Aaron; Dharmasiri, Nihal; Tao, Yi; Estelle, Mark; Noel, Joseph P; Chory, Joanne

    2008-09-30

    Plant growth depends on the integration of environmental cues and phytohormone-signaling pathways. During seedling emergence, elongation of the embryonic stem (hypocotyl) serves as a readout for light and hormone-dependent responses. We screened 10,000 chemicals provided exogenously to light-grown seedlings and identified 100 compounds that promote hypocotyl elongation. Notably, one subset of these chemicals shares structural characteristics with the synthetic auxins, 2,4-dichlorophenoxyacetic acid (2,4-D), and 1-naphthaleneacetic acid (1-NAA); however, traditional auxins (e.g., indole-3-acetic acid [IAA], 2,4-D, 1-NAA) have no effect on hypocotyl elongation. We show that the new compounds act as "proauxins" akin to prodrugs. Our data suggest that these compounds diffuse efficiently to the hypocotyls, where they undergo cleavage at varying rates, releasing functional auxins. To investigate this principle, we applied a masking strategy and designed a pro-2,4-D. Unlike 2,4-D alone, this pro-2,4-D enhanced hypocotyl elongation. We further demonstrated the utility of the proauxins by characterizing auxin responses in light-grown hypocotyls of several auxin receptor mutants. These new compounds thus provide experimental access to a tissue previously inaccessible to exogenous application of auxins. Our studies exemplify the combined power of chemical genetics and biochemical analyses for discovering and refining prohormone analogs with selective activity in specific plant tissues. In addition to the utility of these compounds for addressing questions related to auxin and light-signaling interactions, one can envision using these simple principles to study other plant hormone and small molecule responses in temporally and spatially controlled ways.

  2. Promoter analysis of the Chilo iridescent virus DNA polymerase and major capsid protein genes

    International Nuclear Information System (INIS)

    Nalcacioglu, Remziye; Marks, Hendrik; Vlak, Just M.; Demirbag, Zihni; Oers, Monique M. van

    2003-01-01

    The DNA polymerase (DNApol) and major capsid protein (MCP) genes were used as models to study promoter activity in Chilo iridescent virus (CIV). Infection of Bombyx mori SPC-BM-36 cells in the presence of inhibitors of DNA or protein synthesis showed that DNApol, as well as helicase, is an immediate-early gene and confirmed that the major capsid protein (MCP) is a late gene. Transcription of DNApol initiated 35 nt upstream and that of MCP 14 nt upstream of the translational start site. In a luciferase reporter gene assay both promoters were active only when cells were infected with CIV. For DNApol sequences between position -27 and -6, relative to the transcriptional start site, were essential for promoter activity. Furthermore, mutation of a G within the sequence TTGTTTT located just upstream of the DNApol transcription initiation site reduced the promoter activity by 25%. Sequences crucial for MCP promoter activity are located between positions -53 and -29

  3. Thylakoids promote release of the satiety hormone cholecystokinin while reducing insulin in healthy humans

    DEFF Research Database (Denmark)

    Köhnke, Rickard; Lindbo, Agnes; Larsson, Therese

    2009-01-01

    (CCK, leptin and ghrelin), insulin and blood metabolites (glucose and free fatty acids). RESULTS: The CCK level increased, in particular between the 120 min time-point and onwards, the ghrelin level was reduced at 120 min and leptin level increased at 360 min after intake of the thylakoid-enriched meal....... The insulin level was reduced, whereas glucose concentrations were unchanged. Free fatty acids were reduced between time-point 120 min and onwards after the thylakoid meal. CONCLUSIONS: The addition of thylakoids to energy-dense food promotes satiety signals and reduces insulin response during a single meal......OBJECTIVE: The effects of a promising new appetite suppressor named "thylakoids" (membrane proteins derived from spinach leaves) were examined in a single meal in man. Thylakoids inhibit the lipase/colipase hydrolysis of triacylglycerols in vitro and suppress food intake, decrease body-weight gain...

  4. Hormone-replacement therapy influences gene expression profiles and is associated with breast-cancer prognosis: a cohort study

    Directory of Open Access Journals (Sweden)

    Skoog Lambert

    2006-06-01

    Full Text Available Abstract Background Postmenopausal hormone-replacement therapy (HRT increases breast-cancer risk. The influence of HRT on the biology of the primary tumor, however, is not well understood. Methods We obtained breast-cancer gene expression profiles using Affymetrix human genome U133A arrays. We examined the relationship between HRT-regulated gene profiles, tumor characteristics, and recurrence-free survival in 72 postmenopausal women. Results HRT use in patients with estrogen receptor (ER protein positive tumors (n = 72 was associated with an altered regulation of 276 genes. Expression profiles based on these genes clustered ER-positive tumors into two molecular subclasses, one of which was associated with HRT use and had significantly better recurrence free survival despite lower ER levels. A comparison with external data suggested that gene regulation in tumors associated with HRT was negatively correlated with gene regulation induced by short-term estrogen exposure, but positively correlated with the effect of tamoxifen. Conclusion Our findings suggest that post-menopausal HRT use is associated with a distinct gene expression profile related to better recurrence-free survival and lower ER protein levels. Tentatively, HRT-associated gene expression in tumors resembles the effect of tamoxifen exposure on MCF-7 cells.

  5. Effect of TNFα on activities of different promoters of human apolipoprotein A-I gene

    International Nuclear Information System (INIS)

    Orlov, Sergey V.; Mogilenko, Denis A.; Shavva, Vladimir S.; Dizhe, Ella B.; Ignatovich, Irina A.; Perevozchikov, Andrej P.

    2010-01-01

    Research highlights: → TNFα stimulates the distal alternative promoter of human apoA-I gene. → TNFα acts by weakening of promoter competition within apoA-I gene (promoter switching). → MEK1/2 and nuclear receptors PPARα and LXRs take part in apoA-I promoter switching. -- Abstract: Human apolipoprotein A-I (ApoA-I) is a major structural and functional protein component of high-density lipoproteins. The expression of the apolipoprotein A-I gene (apoA-I) in hepatocytes is repressed by pro-inflammatory cytokines such as IL-1β and TNFα. Recently, two novel additional (alternative) promoters for human apoA-I gene have been identified. Nothing is known about the role of alternative promoters in TNFα-mediated downregulation of apoA-I gene. In this article we report for the first time about the different effects of TNFα on two alternative promoters of human apoA-I gene. Stimulation of HepG2 cells by TNFα leads to activation of the distal alternative apoA-I promoter and downregulation of the proximal alternative and the canonical apoA-I promoters. This effect is mediated by weakening of the promoter competition within human apoA-I 5'-regulatory region (apoA-I promoter switching) in the cells treated by TNFα. The MEK1/2-ERK1/2 cascade and nuclear receptors PPARα and LXRs are important for TNFα-mediated apoA-I promoter switching.

  6. Evolutionary Transition of Promoter and Gene Body DNA Methylation across Invertebrate-Vertebrate Boundary.

    Science.gov (United States)

    Keller, Thomas E; Han, Priscilla; Yi, Soojin V

    2016-04-01

    Genomes of invertebrates and vertebrates exhibit highly divergent patterns of DNA methylation. Invertebrate genomes tend to be sparsely methylated, and DNA methylation is mostly targeted to a subset of transcription units (gene bodies). In a drastic contrast, vertebrate genomes are generally globally and heavily methylated, punctuated by the limited local hypo-methylation of putative regulatory regions such as promoters. These genomic differences also translate into functional differences in DNA methylation and gene regulation. Although promoter DNA methylation is an important regulatory component of vertebrate gene expression, its role in invertebrate gene regulation has been little explored. Instead, gene body DNA methylation is associated with expression of invertebrate genes. However, the evolutionary steps leading to the differentiation of invertebrate and vertebrate genomic DNA methylation remain unresolved. Here we analyzed experimentally determined DNA methylation maps of several species across the invertebrate-vertebrate boundary, to elucidate how vertebrate gene methylation has evolved. We show that, in contrast to the prevailing idea, a substantial number of promoters in an invertebrate basal chordate Ciona intestinalis are methylated. Moreover, gene expression data indicate significant, epigenomic context-dependent associations between promoter methylation and expression in C. intestinalis. However, there is no evidence that promoter methylation in invertebrate chordate has been evolutionarily maintained across the invertebrate-vertebrate boundary. Rather, body-methylated invertebrate genes preferentially obtain hypo-methylated promoters among vertebrates. Conversely, promoter methylation is preferentially found in lineage- and tissue-specific vertebrate genes. These results provide important insights into the evolutionary origin of epigenetic regulation of vertebrate gene expression. © The Author(s) 2015. Published by Oxford University Press on behalf

  7. Evaluation of the hormonal state of columnar apple trees (Malus x domestica) based on high throughput gene expression studies.

    Science.gov (United States)

    Krost, Clemens; Petersen, Romina; Lokan, Stefanie; Brauksiepe, Bastienne; Braun, Peter; Schmidt, Erwin R

    2013-02-01

    The columnar phenotype of apple trees (Malus x domestica) is characterized by a compact growth habit with fruit spurs instead of lateral branches. These properties provide significant economic advantages by enabling high density plantings. The columnar growth results from the presence of a dominant allele of the gene Columnar (Co) located on chromosome 10 which can appear in a heterozygous (Co/co) or homozygous (Co/Co) state. Although two deep sequencing approaches could shed some light on the transcriptome of columnar shoot apical meristems (SAMs), the molecular mechanisms of columnar growth are not yet elaborated. Since the influence of phytohormones is believed to have a pivotal role in the establishment of the phenotype, we performed RNA-Seq experiments to study genes associated with hormone homeostasis and clearly affected by the presence of Co. Our results provide a molecular explanation for earlier findings on the hormonal state of columnar apple trees. Additionally, they allow hypotheses on how the columnar phenotype might develop. Furthermore, we show a statistically approved enrichment of differentially regulated genes on chromosome 10 in the course of validating RNA-Seq results using additional gene expression studies.

  8. Peri-pubertal gonadotropin-releasing hormone agonist treatment affects sex biased gene expression of amygdala in sheep.

    Science.gov (United States)

    Nuruddin, Syed; Krogenæs, Anette; Brynildsrud, Ola Brønstad; Verhaegen, Steven; Evans, Neil P; Robinson, Jane E; Haraldsen, Ira Ronit Hebold; Ropstad, Erik

    2013-12-01

    The nature of hormonal involvement in pubertal brain development has attracted wide interest. Structural changes within the brain that occur during pubertal development appear mainly in regions closely linked with emotion, motivation and cognitive functions. Using a sheep model, we have previously shown that peri-pubertal pharmacological blockade of gonadotropin releasing hormone (GnRH) receptors, results in exaggerated sex-differences in cognitive executive function and emotional control, as well as sex and hemisphere specific patterns of expression of hippocampal genes associated with synaptic plasticity and endocrine signaling. In this study, we explored effects of this treatment regime on the gene expression profile of the ovine amygdala. The study was conducted with 30 same-sex twin lambs (14 female and 16 male), half of which were treated with the GnRH agonist (GnRHa) goserelin acetate every 4th week, beginning before puberty, until approximately 50 weeks of age. Gene expression profiles of the left and right amygdala were measured using 8×15 K Agilent ovine microarrays. Differential expression of selected genes was confirmed by qRT-PCR (Quantitative real time PCR). Networking analyses and Gene Ontology (GO) Term analyses were performed with Ingenuity Pathway Analysis (IPA), version 7.5 and DAVID (Database for Annotation, Visualization and integrated Discovery) version 6.7 software packages, respectively. GnRHa treatment was associated with significant sex- and hemisphere-specific differential patterns of gene expression. GnRHa treatment was associated with differential expression of 432 (|logFC|>0.3, adj. p value expressed as a result of GnRHa treatment in the male animals. The results indicated that GnRH may, directly and/or indirectly, be involved in the regulation of sex- and hemisphere-specific differential expression of genes in the amygdala. This finding should be considered when long-term peri-pubertal GnRHa treatment is used in children. Copyright

  9. The ageing phenome: caloric restriction and hormones promote neural cell survival, growth, and de-differentiation.

    Science.gov (United States)

    Timiras, Paola S; Yaghmaie, Farzin; Saeed, Omar; Thung, Elaine; Chinn, Garrett

    2005-01-01

    The phenome represents the observable properties of an organism that have developed under the continued influences of both genome and environmental factors. Phenotypic properties are expressed through the functions of cells, organs and body systems that operate optimally, close to equilibrium. In complex organisms, maintenance of the equilibrium is achieved by the interplay of several regulatory mechanisms. In the elderly, dynamic instability may lead to progressive loss of normal function, failure of adaptation and increased pathology. Extensive research (reported elsewhere in this journal) has demonstrated that genetic manipulations of endocrine signaling in flies, worms and mice increase longevity. Another effective strategy for prolonging the lifespan is caloric restriction: in data presented here, the persistence of estrogen-sensitive cells in the hypothalamus of caloric restricted 22-month-old female mice, may explain the persistence of reproductive function at an age, when reproductive function has long ceased in ad libitum fed controls. Still another strategy utilizes the effects of epidermal growth factor (EGF) to promote in vitro proliferation of neuroglia, astrocytes and oligodendrocytes. Their subsequent de-differentiation generates immature precursor cells potentially capable of differentiating into neuroblasts and neurons. These and other examples suggest that, in terms of functional outcomes, "the genome proposes but the phenome disposes".

  10. Effect of exercise on photoperiod-regulated hypothalamic gene expression and peripheral hormones in the seasonal Dwarf Hamster Phodopus sungorus.

    Directory of Open Access Journals (Sweden)

    Ines Petri

    Full Text Available The Siberian hamster (Phodopus sungorus is a seasonal mammal responding to the annual cycle in photoperiod with anticipatory physiological adaptations. This includes a reduction in food intake and body weight during the autumn in anticipation of seasonally reduced food availability. In the laboratory, short-day induction of body weight loss can be reversed or prevented by voluntary exercise undertaken when a running wheel is introduced into the home cage. The mechanism by which exercise prevents or reverses body weight reduction is unknown, but one hypothesis is a reversal of short-day photoperiod induced gene expression changes in the hypothalamus that underpin body weight regulation. Alternatively, we postulate an exercise-related anabolic effect involving the growth hormone axis. To test these hypotheses we established photoperiod-running wheel experiments of 8 to 16 weeks duration assessing body weight, food intake, organ mass, lean and fat mass by magnetic resonance, circulating hormones FGF21 and insulin and hypothalamic gene expression. In response to running wheel activity, short-day housed hamsters increased body weight. Compared to short-day housed sedentary hamsters the body weight increase was accompanied by higher food intake, maintenance of tissue mass of key organs such as the liver, maintenance of lean and fat mass and hormonal profiles indicative of long day housed hamsters but there was no overall reversal of hypothalamic gene expression regulated by photoperiod. Therefore the mechanism by which activity induces body weight gain is likely to act largely independently of photoperiod regulated gene expression in the hypothalamus.

  11. Clinical features and growth hormone receptor gene mutations of patients with Laron syndrome from a Chinese family.

    Science.gov (United States)

    Ying, Yan-Qin; Wei, Hong; Cao, Li-Zhi; Lu, Juan-Juan; Luo, Xiao-Ping

    2007-08-01

    Laron syndrome is an autosomal recessive disorder caused by defects of growth hormone receptor (GHR) gene. It is characterized by severe postnatal growth retardation and characteristic facial features as well as high circulating levels of growth hormone (GH) and low levels of insulin-like growth factor I (IGF-I) and insulin-like growth factor binding protein-3 (IGFBP-3). This report described the clinical features and GHR gene mutations in 2 siblings with Laron syndrome in a Chinese family. Their heights and weights were in the normal range at birth, but the growth was retarded after birth. When they presented to the clinic, the heights of the boy (8 years old) and his sister (11 years old) were 80.0 cm (-8.2 SDS) and 96.6 cm (-6.8 SDS) respectively. They had typical appearance features of Laron syndrome such as short stature and obesity, with protruding forehead, saddle nose, large eyes, sparse and thin silky hair and high-pitched voice. They had higher basal serum GH levels and lower serum levels of IGF-I, IGFBP-3 and growth hormone binding protein (GHBP) than normal controls. The peak serum GH level after colonidine and insulin stimulations in the boy was over 350 ng/mL. After one-year rhGH treatment, the boy's height increased from 80.0 cm to 83.3 cm. The gene mutation analysis revealed that two patients had same homozygous mutation of S65H (TCA -->CCA) in exon 4, which is a novel gene mutation. It was concluded that a definite diagnosis of Laron syndrome can be made based on characteristic appearance features and serum levels of GH, IGF-I, IGFBP-3 and GHBP. The S65H mutation might be the cause of Laron syndrome in the two patients.

  12. Multiple endocrine neoplasia (MEN) - like syndrome and other hormonal factors of promotion and progression of thyroid gland cancer in males-liquidators of Chernobyl accident consequences

    International Nuclear Information System (INIS)

    Strukov, E.L.; Dryguina, L.B.; Nikiforova, I.D.

    1997-01-01

    The clinical and laboratory endocrinological screening performed in 1,000 males - liquidators of Chernobyl accident consequences revealed hormonal factors leading to node formation and having unfavourable influence on progression and promotion of thyroid gland cancer. The factors include syndrome of low thriiodothyronine, hyperprolactinemia, latent hypothyrosis and increased production of thyroglobulin. Peculiarities of hormonal status in liquidators allow us to suggest the presence of MEN-like syndrome among the liquidators population. Possible mechanisms of expression of RET oncogene in adults that may result in MEN- like syndrome have been discussed. (author)

  13. Comparative analysis of ADS gene promoter in seven Artemisia ...

    Indian Academy of Sciences (India)

    2014-12-23

    Dec 23, 2014 ... antimalarial drugs from plants that were used in traditional. Chinese medicine ...... ogy of eukaryotic promoter prediction-a review. Comput. Chem. ... Main J. J. 2006 Antiviral effect of artemisinin from Artemisia annua against a ...

  14. Isolation, Expression, and Promoter Analysis of GbWRKY2: A Novel Transcription Factor Gene from Ginkgo biloba

    Directory of Open Access Journals (Sweden)

    Yong-Ling Liao

    2015-01-01

    Full Text Available WRKY transcription factor is involved in multiple life activities including plant growth and development as well as biotic and abiotic responses. We identified 28 WRKY genes from transcriptome data of Ginkgo biloba according to conserved WRKY domains and zinc finger structure and selected three WRKY genes, which are GbWRKY2, GbWRKY16, and GbWRKY21, for expression pattern analysis. GbWRKY2 was preferentially expressed in flowers and strongly induced by methyl jasmonate. Here, we cloned the full-length cDNA and genomic DNA of GbWRKY2. The full-length cDNA of GbWRKY2 was 1,713 bp containing a 1,014 bp open reading frame encoding a polypeptide of 337 amino acids. The GbWRKY2 genomic DNA had one intron and two exons. The deduced GbWRKY2 contained one WRKY domain and one zinc finger motif. GbWRKY2 was classified into Group II WRKYs. Southern blot analysis revealed that GbWRKY2 was a single copy gene in G. biloba. Many cis-acting elements related to hormone and stress responses were identified in the 1,363 bp-length 5′-flanking sequence of GbWRKY2, including W-box, ABRE-motif, MYBCOREs, and PYRIMIDINE-boxes, revealing the molecular mechanism of upregulated expression of GbWRKY2 by hormone and stress treatments. Further functional characterizations in transiently transformed tobacco leaves allowed us to identify the region that can be considered as the minimal promoter.

  15. A novel binary T-vector with the GFP reporter gene for promoter characterization.

    Directory of Open Access Journals (Sweden)

    Shu-Ye Jiang

    Full Text Available Several strategies have been developed to clone PCR fragments into desired vectors. However, most of commercially available T-vectors are not binary vectors and cannot be directly used for Agrobacterium-mediated plant genetic transformation. In this study, a novel binary T-vector was constructed by integrating two AhdI restriction sites into the backbone vector pCAMBIA 1300. The T-vector also contains a GFP reporter gene and thus, can be used to analyze promoter activity by monitoring the reporter gene. On the other hand, identification and characterization of various promoters not only benefit the functional annotation of their genes but also provide alternative candidates to be used to drive interesting genes for plant genetic improvement by transgenesis. More than 1,000 putative pollen-specific rice genes have been identified in a genome-wide level. Among them, 67 highly expressed genes were further characterized. One of the pollen-specific genes LOC_Os10g35930 was further surveyed in its expression patterns with more details by quantitative real-time reverse-transcription PCR (qRT-PCR analysis. Finally, its promoter activity was further investigated by analyzing transgenic rice plants carrying the promoter::GFP cassette, which was constructed from the newly developed T-vector. The reporter GFP gene expression in these transgenic plants showed that the promoter was active only in mature but not in germinated pollens.

  16. Application of heteroduplex analysis for detecting variation within the growth hormone 2 gene in Salmo trutta L. (brown trout).

    Science.gov (United States)

    Gross, R; Nilsson, J

    1995-03-01

    A new method to detect variation at a single copy nuclear gene in brown trout, Salmo trutta L., is provided. The technique entails (i) selective gene amplification by the polymerase chain reaction (PCR), (ii) digestion of amplification products by restriction endonucleases to obtain fragments of suitable size, (iii) hybridization with heterologous DNA followed by denaturation and reannealing to obtain heteroduplex molecules, and (iv) screening for variation in polyacrylamide gels. Variation was studied within a growth hormone 2 gene 1489 bp segment and polymorphism was detected in two HinfI-digested fragments. Formation of different heteroduplex patterns in experimental mixtures of digested amplification products from brown trout and Atlantic salmon, Salmo salar L., allowed us to determine the genotype of the brown trout. Polymorphism was observed in four out of six studied populations.

  17. Transcriptional analysis of heterologous gene expression using the endogenous sD promoter from Bacillus halodurans

    CSIR Research Space (South Africa)

    Crampton, Michael C

    2010-07-01

    Full Text Available This presentation focused on the transcriptional analysis of heterologous gene expression using the endogenous sD promoter from Bacillus halodurans. It concludes to a successful implementation of a high throughput mRNA sandwich hybridisation...

  18. Seed storage protein gene promoters contain conserved DNA motifs in Brassicaceae, Fabaceae and Poaceae

    Science.gov (United States)

    Fauteux, François; Strömvik, Martina V

    2009-01-01

    Background Accurate computational identification of cis-regulatory motifs is difficult, particularly in eukaryotic promoters, which typically contain multiple short and degenerate DNA sequences bound by several interacting factors. Enrichment in combinations of rare motifs in the promoter sequence of functionally or evolutionarily related genes among several species is an indicator of conserved transcriptional regulatory mechanisms. This provides a basis for the computational identification of cis-regulatory motifs. Results We have used a discriminative seeding DNA motif discovery algorithm for an in-depth analysis of 54 seed storage protein (SSP) gene promoters from three plant families, namely Brassicaceae (mustards), Fabaceae (legumes) and Poaceae (grasses) using backgrounds based on complete sets of promoters from a representative species in each family, namely Arabidopsis (Arabidopsis thaliana (L.) Heynh.), soybean (Glycine max (L.) Merr.) and rice (Oryza sativa L.) respectively. We have identified three conserved motifs (two RY-like and one ACGT-like) in Brassicaceae and Fabaceae SSP gene promoters that are similar to experimentally characterized seed-specific cis-regulatory elements. Fabaceae SSP gene promoter sequences are also enriched in a novel, seed-specific E2Fb-like motif. Conserved motifs identified in Poaceae SSP gene promoters include a GCN4-like motif, two prolamin-box-like motifs and an Skn-1-like motif. Evidence of the presence of a variant of the TATA-box is found in the SSP gene promoters from the three plant families. Motifs discovered in SSP gene promoters were used to score whole-genome sets of promoters from Arabidopsis, soybean and rice. The highest-scoring promoters are associated with genes coding for different subunits or precursors of seed storage proteins. Conclusion Seed storage protein gene promoter motifs are conserved in diverse species, and different plant families are characterized by a distinct combination of conserved motifs

  19. Seed storage protein gene promoters contain conserved DNA motifs in Brassicaceae, Fabaceae and Poaceae

    Directory of Open Access Journals (Sweden)

    Fauteux François

    2009-10-01

    Full Text Available Abstract Background Accurate computational identification of cis-regulatory motifs is difficult, particularly in eukaryotic promoters, which typically contain multiple short and degenerate DNA sequences bound by several interacting factors. Enrichment in combinations of rare motifs in the promoter sequence of functionally or evolutionarily related genes among several species is an indicator of conserved transcriptional regulatory mechanisms. This provides a basis for the computational identification of cis-regulatory motifs. Results We have used a discriminative seeding DNA motif discovery algorithm for an in-depth analysis of 54 seed storage protein (SSP gene promoters from three plant families, namely Brassicaceae (mustards, Fabaceae (legumes and Poaceae (grasses using backgrounds based on complete sets of promoters from a representative species in each family, namely Arabidopsis (Arabidopsis thaliana (L. Heynh., soybean (Glycine max (L. Merr. and rice (Oryza sativa L. respectively. We have identified three conserved motifs (two RY-like and one ACGT-like in Brassicaceae and Fabaceae SSP gene promoters that are similar to experimentally characterized seed-specific cis-regulatory elements. Fabaceae SSP gene promoter sequences are also enriched in a novel, seed-specific E2Fb-like motif. Conserved motifs identified in Poaceae SSP gene promoters include a GCN4-like motif, two prolamin-box-like motifs and an Skn-1-like motif. Evidence of the presence of a variant of the TATA-box is found in the SSP gene promoters from the three plant families. Motifs discovered in SSP gene promoters were used to score whole-genome sets of promoters from Arabidopsis, soybean and rice. The highest-scoring promoters are associated with genes coding for different subunits or precursors of seed storage proteins. Conclusion Seed storage protein gene promoter motifs are conserved in diverse species, and different plant families are characterized by a distinct combination

  20. Identification of Smad Response Elements in the Promoter of Goldfish FSHβ Gene and Evidence for Their Mediation of Activin and GnRH Stimulation of FSHβ Expression

    Directory of Open Access Journals (Sweden)

    Man-Tat eLau

    2012-03-01

    Full Text Available As an essential hormone regulating gonads in vertebrates, the biosynthesis and secretion of follicle-stimulating hormone (FSH is controlled by a variety of endocrine and paracrine factors in both mammalian and non-mammalian vertebrates. Activin was initially discovered in the ovary for its specific stimulation of FSH secretion by the pituitary cells. Our earlier studies in fish have shown that activin stimulates FSHβ but suppresses LHβ expression in both the goldfish and zebrafish. Further experiments showed that the regulation of FSHβ in fish occurred at the promoter level involving Smads, in particular Smad3. To further understand the mechanisms by which activin/Smad regulates FSHβ transcription, the present study was undertaken to analyze the promoter of goldfish FSHβ gene (fshb with the aim to identify potential cis-regulatory elements responsible for activin/Smad stimulation. Both serial deletion and site-directed mutagenesis were used, and the promoter activity was tested in the LβT2 cells, a murine gonadotroph cell line. The reporter constructs of goldfish FSHβ promoter-SEAP (secreted alkaline phosphatase were co-transfected with an expression plasmid for Smads (2 or 3 followed by measurement of SEAP activity in the medium. Two putative Smad responsive elements (SRE were identified in the promoter at distal and proximal regions, respectively. The distal site contained a consensus Smad binding element (SBE; AGAC, -1675/-1672 whereas the proximal site (GACCTTGA, -212/-205 was identical to an SF-1 binding site reported in humans, which was preceded by a sequence (AACACTGA highly conserved between fish and mammals. The proximal site also seemed to be involved in mediating stimulation of FSHβ expression by gonadotropin-releasing hormone (GnRH and its potential interaction with activin. In conclusion, we have identified two potential cis-regulatory elements in the promoter of goldfish FSHβ that are responsible for activin

  1. 20-Hydroxyecdysone (20E) Primary Response Gene E93 Modulates 20E Signaling to Promote Bombyx Larval-Pupal Metamorphosis.

    Science.gov (United States)

    Liu, Xi; Dai, Fangyin; Guo, Enen; Li, Kang; Ma, Li; Tian, Ling; Cao, Yang; Zhang, Guozheng; Palli, Subba R; Li, Sheng

    2015-11-06

    As revealed in a previous microarray study to identify genes regulated by 20-hydroxyecdysone (20E) and juvenile hormone (JH) in the silkworm, Bombyx mori, E93 expression in the fat body was markedly low prior to the wandering stage but abundant during larval-pupal metamorphosis. Induced by 20E and suppressed by JH, E93 expression follows this developmental profile in multiple silkworm alleles. The reduction of E93 expression by RNAi disrupted 20E signaling and the 20E-induced autophagy, caspase activity, and cell dissociation in the fat body. Reducing E93 expression also decreased the expression of the 20E-induced pupal-specific cuticle protein genes and prevented growth and differentiation of the wing discs. Importantly, the two HTH domains in E93 are critical for inducing the expression of a subset of 20E response genes, including EcR, USP, E74, Br-C, and Atg1. By contrast, the LLQHLL and PLDLSAK motifs in E93 inhibit its transcriptional activity. E93 binds to the EcR-USP complex via a physical association with USP through its LLQHLL motif; and this association is enhanced by 20E-induced EcR-USP interaction, which attenuates the transcriptional activity of E93. E93 acts through the two HTH domains to bind to GAGA-containing motifs present in the Atg1 promoter region for inducing gene expression. In conclusion, E93 transcriptionally modulates 20E signaling to promote Bombyx larval-pupal metamorphosis. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  2. 20-Hydroxyecdysone (20E) Primary Response Gene E93 Modulates 20E Signaling to Promote Bombyx Larval-Pupal Metamorphosis*

    Science.gov (United States)

    Liu, Xi; Dai, Fangyin; Guo, Enen; Li, Kang; Ma, Li; Tian, Ling; Cao, Yang; Zhang, Guozheng; Palli, Subba R.; Li, Sheng

    2015-01-01

    As revealed in a previous microarray study to identify genes regulated by 20-hydroxyecdysone (20E) and juvenile hormone (JH) in the silkworm, Bombyx mori, E93 expression in the fat body was markedly low prior to the wandering stage but abundant during larval-pupal metamorphosis. Induced by 20E and suppressed by JH, E93 expression follows this developmental profile in multiple silkworm alleles. The reduction of E93 expression by RNAi disrupted 20E signaling and the 20E-induced autophagy, caspase activity, and cell dissociation in the fat body. Reducing E93 expression also decreased the expression of the 20E-induced pupal-specific cuticle protein genes and prevented growth and differentiation of the wing discs. Importantly, the two HTH domains in E93 are critical for inducing the expression of a subset of 20E response genes, including EcR, USP, E74, Br-C, and Atg1. By contrast, the LLQHLL and PLDLSAK motifs in E93 inhibit its transcriptional activity. E93 binds to the EcR-USP complex via a physical association with USP through its LLQHLL motif; and this association is enhanced by 20E-induced EcR-USP interaction, which attenuates the transcriptional activity of E93. E93 acts through the two HTH domains to bind to GAGA-containing motifs present in the Atg1 promoter region for inducing gene expression. In conclusion, E93 transcriptionally modulates 20E signaling to promote Bombyx larval-pupal metamorphosis. PMID:26378227

  3. Promoter polymorphisms in genes involved in porcine myogenesis influence their transcriptional activity.

    Science.gov (United States)

    Bongiorni, Silvia; Tilesi, Francesca; Bicorgna, Silvia; Iacoponi, Francesca; Willems, Daniela; Gargani, Maria; D'Andrea, MariaSilvia; Pilla, Fabio; Valentini, Alessio

    2014-11-07

    Success of meat production and selection for improvement of meat quality is among the primary aims in animal production. Meat quality traits are economically important in swine; however, the underlying genetic nature is very complex. Therefore, an improved pork production strongly depends on identifying and studying how genetic variations contribute to modulate gene expression. Promoters are key regions in gene modulation as they harbour several binding motifs to transcription regulatory factors. Therefore, polymorphisms in these regions are likely to deeply affect RNA levels and consequently protein synthesis. In this study, we report the identification of single nucleotide polymorphisms (SNPs) in promoter regions of candidate genes involved in development, cellular differentiation and muscle growth in Sus scrofa. We identified SNPs in the promoter regions of genes belonging to the Myogenic Regulatory Factors (MRF) gene family (the Myogenic Differentiation gene, MYOD1) and to Growth and Differentiation Factors (GDF) gene family (Myostatin gene, MSTN, GDF8), in Casertana and Large White breeds. The purpose of this study was to investigate if polymorphisms in the promoters could affect the transcriptional activity of these genes. With this aim, we evaluated in vitro the functional activity of the luciferase reporter gene luc2 activity, driven by two constructs carrying different promoter haplotypes. We tested the effects of the G302A (U12574) transition on the promoter efficiency in MYOD1 gene. We ascertained a difference in transcription efficiency for the two variants. A stronger activity of the A-carrying construct is more evident in C2C12. The luciferase expression driven by the MYOD1-A allelic variant displayed a 3.8-fold increased transcriptional activity. We investigated the activity of two haplotype variants (AY527152) in the promoter of GDF8 gene. The haploptype-1 (A435-A447-A879) up-regulated the expression of the reporter gene by a two-fold increase, and

  4. Identification, isolation and evaluation of a constitutive sucrose phosphate synthase gene promoter from tomato

    International Nuclear Information System (INIS)

    Naqvi, R.Z.; Mubeen, H.; Maqsood, A.; Khatoon, A.

    2017-01-01

    Sucrose phosphate synthase (SPS) is one of the abundantly expressed genes in plants. The promoters of SPS gene was identified, analyzed and retrieved from high throughput genomic sequence (HTGS) database. The cis-acting regulatory elements and transcription start sites of promoter were identified through different bioinformatics tools. The SPS promoter was isolated from Solanum lycopersicum and was initially cloned in TA vector (pTZ57R/T). Later on this promoter was transferred to a plant expression binary vector, pGR1 (pGRSPS) that was used for the transient GUS expression studies in various tissues of Nicotiana tabacum. SPS promoter was also cloned in plant stable expression vector pGA482 (pGASPS) and was transformed in Nicotiana tabacum through Agrobacterium-mediated transformation method. The histochemical GUS expression analysis of both transient and stable transgenic plants for this promoter indicated its functional importance in regulating gene expression in a constitutive manner. It was concluded that SPS promoter is constitutively expressed with a strength equivalent to CaMV 2X35S promoter. The promoter isolated through these studies may be effectively substituted in plant genetic engineering with other constitutive promoter for transgene expression in economically important agricultural crops. (author)

  5. Fanconi anemia core complex gene promoters harbor conserved transcription regulatory elements.

    Science.gov (United States)

    Meier, Daniel; Schindler, Detlev

    2011-01-01

    The Fanconi anemia (FA) gene family is a recent addition to the complex network of proteins that respond to and repair certain types of DNA damage in the human genome. Since little is known about the regulation of this novel group of genes at the DNA level, we characterized the promoters of the eight genes (FANCA, B, C, E, F, G, L and M) that compose the FA core complex. The promoters of these genes show the characteristic attributes of housekeeping genes, such as a high GC content and CpG islands, a lack of TATA boxes and a low conservation. The promoters functioned in a monodirectional way and were, in their most active regions, comparable in strength to the SV40 promoter in our reporter plasmids. They were also marked by a distinctive transcriptional start site (TSS). In the 5' region of each promoter, we identified a region that was able to negatively regulate the promoter activity in HeLa and HEK 293 cells in isolation. The central and 3' regions of the promoter sequences harbor binding sites for several common and rare transcription factors, including STAT, SMAD, E2F, AP1 and YY1, which indicates that there may be cross-connections to several established regulatory pathways. Electrophoretic mobility shift assays and siRNA experiments confirmed the shared regulatory responses between the prominent members of the TGF-β and JAK/STAT pathways and members of the FA core complex. Although the promoters are not well conserved, they share region and sequence specific regulatory motifs and transcription factor binding sites (TBFs), and we identified a bi-partite nature to these promoters. These results support a hypothesis based on the co-evolution of the FA core complex genes that was expanded to include their promoters.

  6. Fanconi anemia core complex gene promoters harbor conserved transcription regulatory elements.

    Directory of Open Access Journals (Sweden)

    Daniel Meier

    Full Text Available The Fanconi anemia (FA gene family is a recent addition to the complex network of proteins that respond to and repair certain types of DNA damage in the human genome. Since little is known about the regulation of this novel group of genes at the DNA level, we characterized the promoters of the eight genes (FANCA, B, C, E, F, G, L and M that compose the FA core complex. The promoters of these genes show the characteristic attributes of housekeeping genes, such as a high GC content and CpG islands, a lack of TATA boxes and a low conservation. The promoters functioned in a monodirectional way and were, in their most active regions, comparable in strength to the SV40 promoter in our reporter plasmids. They were also marked by a distinctive transcriptional start site (TSS. In the 5' region of each promoter, we identified a region that was able to negatively regulate the promoter activity in HeLa and HEK 293 cells in isolation. The central and 3' regions of the promoter sequences harbor binding sites for several common and rare transcription factors, including STAT, SMAD, E2F, AP1 and YY1, which indicates that there may be cross-connections to several established regulatory pathways. Electrophoretic mobility shift assays and siRNA experiments confirmed the shared regulatory responses between the prominent members of the TGF-β and JAK/STAT pathways and members of the FA core complex. Although the promoters are not well conserved, they share region and sequence specific regulatory motifs and transcription factor binding sites (TBFs, and we identified a bi-partite nature to these promoters. These results support a hypothesis based on the co-evolution of the FA core complex genes that was expanded to include their promoters.

  7. Approach of combined cancer gene therapy and radiation: response of promoters to ionizing radiation

    International Nuclear Information System (INIS)

    Anstett, A.

    2005-09-01

    Gene therapy is an emerging cancer treatment modality. We are interested in developing a radiation-inducible gene therapy system to sensitize the tumor vasculature to the effects of ionizing radiation (IR) treatment. An expression system based on irradiation-inducible promoters will drive the expression of anti-tumor genes in the tumor vasculature. Solid tumors are dependent on angio genesis, a process in which new blood vessels are formed from the pre-existing vasculature. Vascular endothelial cells are un transformed and genetically stable, thus avoiding the problem of resistance to the treatments. Vascular endothelial cells may therefore represent a suitable target for this therapeutic gene therapy strategy.The identification of IR-inducible promoters native to endothelial cells was performed by gene expression profiling using cDNA micro array technology. We describe the genes modified by clinically relevant doses of IR. The extension to high doses aimed at studying the effects of total radiation delivery to the tumor. The radio-inductiveness of the genes selected for promoter study was confirmed by RT-PCR. Analysis of the activity of promoters in response to IR was also assessed in a reporter plasmid. We found that authentic promoters cloned onto a plasmid are not suitable for cancer gene therapy due to their low induction after IR. In contrast, synthetic promoters containing repeated sequence-specific binding sites for IR-activated transcription factors such as NF-κB are potential candidates for gene therapy. The activity of five tandemly repeated TGGGGACTTTCCGC elements for NF-κB binding in a luciferase reporter was increased in a dose-dependent manner. Interestingly, the response to fractionated low doses was improved in comparison to the total single dose. Thus, we put present evidence that a synthetic promoter for NF-κB specific binding may have application in the radio-therapeutic treatment of cancer. (author)

  8. Dissection of cis-regulatory element architecture of the rice oleosin gene promoters to assess abscisic acid responsiveness in suspension-cultured rice cells.

    Science.gov (United States)

    Kim, Sol; Lee, Soo-Bin; Han, Chae-Seong; Lim, Mi-Na; Lee, Sung-Eun; Yoon, In Sun; Hwang, Yong-Sic

    2017-08-01

    Oleosins are the most abundant proteins in the monolipid layer surrounding neutral storage lipids that form oil bodies in plants. Several lines of evidence indicate that they are physiologically important for the maintenance of oil body structure and for mobilization of the lipids stored inside. Rice has six oleosin genes in its genome, the expression of all of which was found to be responsive to abscisic acid (ABA) in our examination of mature embryo and aleurone tissues. The 5'-flanking region of OsOle5 was initially characterized for its responsiveness to ABA through a transient expression assay system using the protoplasts from suspension-cultured rice cells. A series of successive deletions and site-directed mutations identified five regions critical for the hormonal induction of its promoter activity. A search for cis-acting elements in these regions deposited in a public database revealed that they contain various promoter elements previously reported to be involved in the ABA response of various genes. A gain-of-function experiment indicated that multiple copies of all five regions were sufficient to provide the minimal promoter with a distinct ABA responsiveness. Comparative sequence analysis of the short, but still ABA-responsive, promoters of OsOle genes revealed no common modular architecture shared by them, indicating that various distinct promoter elements and independent trans-acting factors are involved in the ABA responsiveness of rice oleosin multigenes. Copyright © 2017 Elsevier GmbH. All rights reserved.

  9. Differential gene expression in response to juvenile hormone analog treatment in the damp-wood termite Hodotermopsis sjostedti (Isoptera, Archotermopsidae).

    Science.gov (United States)

    Cornette, Richard; Hayashi, Yoshinobu; Koshikawa, Shigeyuki; Miura, Toru

    2013-04-01

    Termite societies are characterized by a highly organized division of labor among conspicuous castes, groups of individuals with various morphological specializations. Termite caste differentiation is under control of juvenile hormone (JH), but the molecular mechanism underlying the response to JH and early events triggering caste differentiation are still poorly understood. In order to profile candidate gene expression during early soldier caste differentiation of the damp-wood termite, Hodotermopsis sjostedti, we treated pseudergates (workers) with a juvenile hormone analog (JHA) to induce soldier caste differentiation. We then used Suppressive Subtractive Hybridization to create two cDNA libraries enriched for transcripts that were either up- or downregulated at 24h after treatment. Finally, we used quantitative PCR to confirm temporal expression patterns. Hexamerins represent a large proportion of the genes upregulated following JHA treatment and have an expression pattern that shows roughly an inverse correlation to intrinsic JH titers. This data is consistent with the role of a JH "sink", which was demonstrated for hexamerins in another termite, Reticulitermes flavipes. A putative nuclear protein was also upregulated a few hours after JHA treatment, which suggests a role in the early response to JH and subsequent regulation of transcriptional events associated with soldier caste differentiation. Some digestive enzymes, such as endogenous beta-endoglucanase and chymotrypsin, as well as a protein associated to digestion were identified among genes downregulated after JHA treatment. This suggests that JH may directly influence the pseudergate-specific digestive system. Copyright © 2013 Elsevier Ltd. All rights reserved.

  10. Control of phenylalanine ammonia-lyase gene promoters from pea by UV radiation

    International Nuclear Information System (INIS)

    Pluskota, W.E.; Michalczyk, D.J.; Gorecki, R.J.

    2005-01-01

    The gene fusion system was used to study UV light-control of PS PAL1 and PS PAL2 genes encoding phenylalanine ammonia-lyase of pea. The induction of pea PAL promoters was analysed in transgenic tobacco plants. Binary plasmids (derivatives of pBI101.2 vector) containing 5' regulatory fragments of PS PAL1 and PS PAL2 linked to reporter genes (GUS, LUC) were constructed. The analyses were performed with the use of single constructs (containing one variant of PS PAL promoter and one reporter gene) and dual constructs (containing both PS PAL1 and PS PAL2 promoters connected with different reporter genes). The use of dual constructs enabled the evaluation of both PS PAL promoters activity in the same plant. The analyses of in vitro grown plants have shown that both PAL promoters are strongly induced in leaves subjected to UV radiation. In some cases, the UV-stimulated expression exceeded the exposed areas. This phenomenon was observed more often in the leaves of plants containing the PS PAL1::GUS than PS PAL2::GUS construct. Removal of boxes 2, 4, 5 from PS PAL1 promoter and deletion of its 5' end region (-339 to -1394) decreases the level of gene expression but does not eliminate its responsiveness to UV

  11. Type 1 plaminogen activator inhibitor gene: Functional analysis and glucocorticoid regulation of its promoter

    International Nuclear Information System (INIS)

    Van Zonneveld, A.J.; Curriden, S.A.; Loskutoff, D.J.

    1988-01-01

    Plasminogen activator inhibitor type 1 is an important component of the fibrinolytic system and its biosynthesis is subject to complex regulation. To study this regulation at the level of transcription, the authors have identified and sequenced the promoter of the human plasminogen activator inhibitor type 1 gene. Nuclease protection experiments were performed by using endothelial cell mRNA and the transcription initiation (cap) site was established. Sequence analysis of the 5' flanking region of the gene revealed a perfect TATA box at position -28 to position -23, the conserved distance from the cap site. Comparative functional studies with the firefly luciferase gene as a reporter gene showed that fragments derived from this 5' flanking region exhibited high promoter activity when transfected into bovine aortic endothelial cells and mouse Ltk - fibroblasts but were inactive when introduced into HeLa cells. These studies indicate that the fragments contain the plasminogen activator inhibitor type 1 promoter and that it is expressed in a tissue-specific manner. Although the fragments were also silent in rat FTO2B hepatoma cells, their promoter activity could be induced up to 40-fold with the synthetic glucocorticoid dexamethasone. Promoter deletion mapping experiments and studies involving the fusion of promoter fragments to a heterologous gene indicated that dexamethasone induction is mediated by a glucocorticoid responsive element with enhancer-like properties located within the region between nucleotides -305 and +75 of the plasminogen activator inhibitor type 1 gene

  12. The Mouse Solitary Odorant Receptor Gene Promoters as Models for the Study of Odorant Receptor Gene Choice.

    Directory of Open Access Journals (Sweden)

    Andrea Degl'Innocenti

    Full Text Available In vertebrates, several anatomical regions located within the nasal cavity mediate olfaction. Among these, the main olfactory epithelium detects most conventional odorants. Olfactory sensory neurons, provided with cilia exposed to the air, detect volatile chemicals via an extremely large family of seven-transmembrane chemoreceptors named odorant receptors. Their genes are expressed in a monogenic and monoallelic fashion: a single allele of a single odorant receptor gene is transcribed in a given mature neuron, through a still uncharacterized molecular mechanism known as odorant receptor gene choice.Odorant receptor genes are typically arranged in genomic clusters, but a few are isolated (we call them solitary from the others within a region broader than 1 Mb upstream and downstream with respect to their transcript's coordinates. The study of clustered genes is problematic, because of redundancy and ambiguities in their regulatory elements: we propose to use the solitary genes as simplified models to understand odorant receptor gene choice.Here we define number and identity of the solitary genes in the mouse genome (C57BL/6J, and assess the conservation of the solitary status in some mammalian orthologs. Furthermore, we locate their putative promoters, predict their homeodomain binding sites (commonly present in the promoters of odorant receptor genes and compare candidate promoter sequences with those of wild-caught mice. We also provide expression data from histological sections.In the mouse genome there are eight intact solitary genes: Olfr19 (M12, Olfr49, Olfr266, Olfr267, Olfr370, Olfr371, Olfr466, Olfr1402; five are conserved as solitary in rat. These genes are all expressed in the main olfactory epithelium of three-day-old mice. The C57BL/6J candidate promoter of Olfr370 has considerably varied compared to its wild-type counterpart. Within the putative promoter for Olfr266 a homeodomain binding site is predicted. As a whole, our findings

  13. Engineered promoters enable constant gene expression at any copy number in bacteria.

    Science.gov (United States)

    Segall-Shapiro, Thomas H; Sontag, Eduardo D; Voigt, Christopher A

    2018-04-01

    The internal environment of growing cells is variable and dynamic, making it difficult to introduce reliable parts, such as promoters, for genetic engineering. Here, we applied control-theoretic ideas to design promoters that maintained constant levels of expression at any copy number. Theory predicts that independence to copy number can be achieved by using an incoherent feedforward loop (iFFL) if the negative regulation is perfectly non-cooperative. We engineered iFFLs into Escherichia coli promoters using transcription-activator-like effectors (TALEs). These promoters had near-identical expression in different genome locations and plasmids, even when their copy number was perturbed by genomic mutations or changes in growth medium composition. We applied the stabilized promoters to show that a three-gene metabolic pathway to produce deoxychromoviridans could retain function without re-tuning when the stabilized-promoter-driven genes were moved from a plasmid into the genome.

  14. Key KdSOC1 gene expression profiles during plantlet morphogenesis under hormone, photoperiod, and drought treatments.

    Science.gov (United States)

    Liu, C; Zhu, C; Zeng, H M

    2016-02-11

    Kalanchoe daigremontiana utilizes plantlet formation between its zigzag leaf margins as its method of asexual reproduction. In this study, K. daigremontiana SUPPRESSOR OF OVEREXPRESSION OF CONSTANS 1 (KdSOC1), a key intermediate in the transition from vegetative to asexual growth, was cloned. Furthermore, its expression profiles during plantlet formation under different environmental and hormone induction conditions were analyzed. The full-KdSOC1 cDNA sequence length was 1410 bp with 70% shared homology with Carya cathayensis SOC1. The conserved domain search of KdSOC1 showed the absence of I and C domains, which might indicate novel biological functions in K. daigremontiana. The full-KdSOC1 promoter sequence was 1401 bp long and contained multiple-hormone-responsive cis-acting elements. Hormone induction assays showed that gibberellins and salicylic acid mainly regulated KdSOC1 expression. The swift change from low to high KdSOC1 expression levels during long-day induction was accompanied by the rapid emergence of plantlets. Drought stress stimulated KdSOC1 expression in leaves both with and without plantlet formation. Together, the results suggested that KdSOC1 was closely involved in environmental stimulation signal perception and the transduction of K. daigremontiana plantlet formation. Therefore, future identification of KdSOC1 functions might reveal key information that will help elucidate the transition network between embryogenesis and organogenesis during plantlet formation.

  15. Functional analysis of a novel human serotonin transporter gene promoter in immortalized raphe cells

    DEFF Research Database (Denmark)

    Mortensen, O V; Thomassen, M; Larsen, M B

    1999-01-01

    were found to possess the additional 379 bp fragment. The integrity of the promoter was furthermore confirmed by genomic Southern blotting. The promoter activity was analyzed by reporter gene assays in neuronal and non-neuronal serotonergic cell lines. In immortalized serotonergic raphe neurons, RN46A...

  16. The polymorphic insertion of the luteinizing hormone receptor "insLQ" show a negative association to LHR gene expression and to the follicular fluid hormonal profile in human small antral follicles

    DEFF Research Database (Denmark)

    Borgbo, T; Chrudimska, J; Macek, M

    2018-01-01

    (AMHR2) and LHCGR, respectively, were observed for insLQ/insLQ compared to -/insLQ and the -/- genotypes. Moreover, LHCGR and CYP19a1 together with oestradiol and inhibin-B were significantly increased in -/insLQ compared to the -/- genotype. The homozygous insLQ genotype showed strong significant......The luteinizing hormone receptor (LHCGR) has a little studied polymorphic 6 bp insertion (rs4539842/insLQ). This study has evaluated the insLQ polymorphism in relation to potential associations with hormonal characteristics of human small antral follicles (hSAFs). In total, 310 hSAFs were collected...... from 86 women undergoing fertility preservation. Analysis included hormonal profile of 297 follicular fluid (FF) samples and 148 corresponding granulosa cells samples were evaluated by qPCR for selected genes. Significantly reduced and non-detectable mRNA levels of anti-Müllerian hormone receptor II...

  17. Development of a quantitative competitive reverse transcriptase polymerase chain reaction for the quantification of growth hormone gene expression in pigs

    Directory of Open Access Journals (Sweden)

    Maurício Machaim Franco

    2003-01-01

    Full Text Available After the advent of the genome projects, followed by the discovery of DNA polymorphisms, basic understanding of gene expression is the next focus to explain the association between polymorphisms and the level of gene expression, as well as to demonstrate the interaction among genes. Among the various techniques for the investigation of transcriptional profiling involving patterns of gene expression, quantitative PCR is the simplest analytical laboratory technique. The objective of this work was to analyze two strategies of a competitive PCR technique for the quantification of the pig growth hormone (GH gene expression. A pair of primers was designed targeting exons 3 and 5, and two competitive PCR strategies were performed, one utilizing a specific amplicon as a competitor, and the other utilizing a low-stringency PCR amplicon as a competitor. The latter strategy proved to be easier and more efficient, offering an accessible tool that can be used in any kind of competitive reaction, facilitating the study of gene expression patterns for both genetics and diagnostics of infectious diseases.

  18. A L-type lectin gene is involved in the response to hormonal treatment and water deficit in Volkamer lemon.

    Science.gov (United States)

    Vieira, Dayse Drielly Sousa Santana; Emiliani, Giovanni; Bartolini, Paola; Podda, Alessandra; Centritto, Mauro; Luro, François; Carratore, Renata Del; Morillon, Raphaël; Gesteira, Abelmon; Maserti, Biancaelena

    2017-11-01

    Combination of biotic and abiotic stress is a major challenge for crop and fruit production. Thus, identification of genes involved in cross-response to abiotic and biotic stress is of great importance for breeding superior genotypes. Lectins are glycan-binding proteins with a functions in the developmental processes as well as in the response to biotic and abiotic stress. In this work, a lectin like gene, namely ClLectin1, was characterized in Volkamer lemon and its expression was studied in plants exposed to either water stress, hormonal elicitors (JA, SA, ABA) or wounding to understand whether this gene may have a function in the response to multiple stress combination. Results showed that ClLectin1 has 100% homology with a L-type lectin gene from C. sinensis and the in silico study of the 5'UTR region showed the presence of cis-responsive elements to SA, DRE2 and ABA. ClLectin1 was rapidly induced by hormonal treatments and wounding, at local and systemic levels, suggesting an involvement in defence signalling pathways and a possible role as fast detection biomarker of biotic stress. On the other hand, the induction of ClLectin1 by water stress pointed out a role of the gene in the response to drought. The simultaneous response of ClLectin1 expression to water stress and SA treatment could be further investigated to assess whether a moderate drought stress may be useful to improve citrus performance by stimulating the SA-dependent response to biotic stress. Copyright © 2017 Elsevier GmbH. All rights reserved.

  19. Effects of repeated potassium iodide administration on genes involved in synthesis and secretion of thyroid hormone in adult male rat.

    Science.gov (United States)

    Lebsir, Dalila; Manens, Line; Grison, Stephane; Lestaevel, Philippe; Ebrahimian, Teni; Suhard, David; Phan, Guillaume; Dublineau, Isabelle; Tack, Karine; Benderitter, Marc; Pech, Annick; Jourdain, Jean-Rene; Souidi, Maâmar

    2018-02-26

    A single dose of potassium iodide (KI) is recommended to reduce the risk of thyroid cancer during nuclear accidents. However in case of prolonged radioiodine exposure, more than one dose of KI may be necessary. This work aims to evaluate the potential toxic effect of repeated administration of KI. Adult Wistar rats received an optimal dose of KI 1 mg/kg over a period of 1, 4 or 8 days. hormonal status (TSH, FT4) of treated rats was unaffected. Contrariwise, a sequential Wolff-Chaikoff effect was observed, resulting in a prompt decrease of NIS and MCT8 mRNA expression (-58% and -26% respectively), followed by a delayed decrease of TPO mRNA expression (-33%) in conjunction with a stimulation of PDS mRNA expression (+62%). we show for the first time that repeated administration of KI at 1 mg/kg/24h doesn't cause modification of thyroid hormones level, but leads to a reversible modification of the expression of genes involved in the synthesis and secretion of thyroid hormones. Copyright © 2018 Elsevier B.V. All rights reserved.

  20. Cloning and expression of Icc1 Laccase gene promoter in Aspergillus niger

    Energy Technology Data Exchange (ETDEWEB)

    Marqueda-Galvez, A. P.; Loera Carrol, O.; Xaconostle cazares, B.; Tellez-Jurado, A.; Arana-Cuenca, A.

    2009-07-01

    The white rot fungus Trametes sp. I-62 is a strain with laccase activity and a great potential for biotechnological applications given its ability to detoxify distillery effluents. The Icc1, Icc2 and Icc3 laccase genes of this basidiomycetes have been cloned and sequenced. The promoter region of Icc1 kaccase gene contains a putative site for xenobiotics (XRE). (Author)

  1. Computational design and application of endogenous promoters for transcriptionally targeted gene therapy for rheumatoid arthritis.

    NARCIS (Netherlands)

    Geurts, J.; Joosten, L.A.B.; Takahashi, N.; Arntz, O.J.; Gluck, A.; Bennink, M.B.; Berg, W.B. van den; Loo, F.A.J. van de

    2009-01-01

    The promoter regions of genes that are differentially regulated in the synovial membrane during the course of rheumatoid arthritis (RA) represent attractive candidates for application in transcriptionally targeted gene therapy. In this study, we applied an unbiased computational approach to define

  2. Cloning and expression of Icc1 Laccase gene promoter in Aspergillus niger

    International Nuclear Information System (INIS)

    Marqueda-Galvez, A. P.; Loera Carrol, O.; Xaconostle cazares, B.; Tellez-Jurado, A.; Arana-Cuenca, A.

    2009-01-01

    The white rot fungus Trametes sp. I-62 is a strain with laccase activity and a great potential for biotechnological applications given its ability to detoxify distillery effluents. The Icc1, Icc2 and Icc3 laccase genes of this basidiomycetes have been cloned and sequenced. The promoter region of Icc1 laccase gene contains a putative site for xenobiotics (XRE). (Author)

  3. The promoter for a variant surface glycoprotein gene expression site in Trypanosoma brucei

    NARCIS (Netherlands)

    Zomerdijk, J. C.; Ouellette, M.; ten Asbroek, A. L.; Kieft, R.; Bommer, A. M.; Clayton, C. E.; Borst, P.

    1990-01-01

    The variant-specific surface glycoprotein (VSG) gene 221 of Trypanosoma brucei is transcribed as part of a 60 kb expression site (ES). We have identified the promoter controlling this multigene transcription unit by the use of 221 chromosome-enriched DNA libraries and VSG gene 221 expression site

  4. Identification and expression analysis of ERF transcription factor genes in petunia during flower senescence and in response to hormone treatments.

    Science.gov (United States)

    Liu, Juanxu; Li, Jingyu; Wang, Huinan; Fu, Zhaodi; Liu, Juan; Yu, Yixun

    2011-01-01

    Ethylene-responsive element-binding factor (ERF) genes constitute one of the largest transcription factor gene families in plants. In Arabidopsis and rice, only a few ERF genes have been characterized so far. Flower senescence is associated with increased ethylene production in many flowers. However, the characterization of ERF genes in flower senescence has not been reported. In this study, 13 ERF cDNAs were cloned from petunia. Based on the sequence characterization, these PhERFs could be classified into four of the 12 known ERF families. Their predicted amino acid sequences exhibited similarities to ERFs from other plant species. Expression analyses of PhERF mRNAs were performed in corollas and gynoecia of petunia flower. The 13 PhERF genes displayed differential expression patterns and levels during natural flower senescence. Exogenous ethylene accelerates the transcription of the various PhERF genes, and silver thiosulphate (STS) decreased the transcription of several PhERF genes in corollas and gynoecia. PhERF genes of group VII showed a strong association with the rise in ethylene production in both petals and gynoecia, and might be associated particularly with flower senescence in petunia. The effect of sugar, methyl jasmonate, and the plant hormones abscisic acid, salicylic acid, and 6-benzyladenine in regulating the different PhERF transcripts was investigated. Functional nuclear localization signal analyses of two PhERF proteins (PhERF2 and PhERF3) were carried out using fluorescence microscopy. These results supported a role for petunia PhERF genes in transcriptional regulation of petunia flower senescence processes.

  5. The Common Follicle-Stimulating Hormone Receptor (FSHR Promoter Polymorphism FSHR −29G > A Affects Androgen Production in Normal Human Small Antral Follicles

    Directory of Open Access Journals (Sweden)

    Tanni Borgbo

    2017-06-01

    Full Text Available Follicle-stimulating hormone receptors (FSHRs are almost exclusively expressed on granulosa cells, and FSH action is probably most clearly reflected in intrafollicular hormone milieu of antral follicles. Little is known about the possible effects of the common single nucleotide polymorphism (SNP FSHR −29G > A (rs1394205 on hormonal conditions in humsan small antral follicles (hSAFs obtained from women in the natural menstrual cycle. This study investigated the follicle fluid (FF concentrations of anti-Müllerian hormone, estradiol, progesterone, androstenedione, and testosterone in hSAF in relation to the different genotypes of FSHR −29G > A. FF from 362 follicles was collected in 95 women undergoing fertility preservation, who did not suffer from a disease that directly affected ovarian function. The testosterone levels of the minor A/A genotype were significantly increased compared to the A/G and the G/G genotype. Furthermore, significantly reduced androstenedione levels were observed for the G/G genotype, as compared to the A/G genotype, while the other hormones did not show statistical significant differences. In conclusion, the androgen levels of hSAF were significantly elevated in the minor SNP genotype in the FSHR promoter polymorphism FSHR −29G > A.

  6. Testosterone affects neural gene expression differently in male and female juncos: a role for hormones in mediating sexual dimorphism and conflict.

    Directory of Open Access Journals (Sweden)

    Mark P Peterson

    Full Text Available Despite sharing much of their genomes, males and females are often highly dimorphic, reflecting at least in part the resolution of sexual conflict in response to sexually antagonistic selection. Sexual dimorphism arises owing to sex differences in gene expression, and steroid hormones are often invoked as a proximate cause of sexual dimorphism. Experimental elevation of androgens can modify behavior, physiology, and gene expression, but knowledge of the role of hormones remains incomplete, including how the sexes differ in gene expression in response to hormones. We addressed these questions in a bird species with a long history of behavioral endocrinological and ecological study, the dark-eyed junco (Junco hyemalis, using a custom microarray. Focusing on two brain regions involved in sexually dimorphic behavior and regulation of hormone secretion, we identified 651 genes that differed in expression by sex in medial amygdala and 611 in hypothalamus. Additionally, we treated individuals of each sex with testosterone implants and identified many genes that may be related to previously identified phenotypic effects of testosterone treatment. Some of these genes relate to previously identified effects of testosterone-treatment and suggest that the multiple effects of testosterone may be mediated by modifying the expression of a small number of genes. Notably, testosterone-treatment tended to alter expression of different genes in each sex: only 4 of the 527 genes identified as significant in one sex or the other were significantly differentially expressed in both sexes. Hormonally regulated gene expression is a key mechanism underlying sexual dimorphism, and our study identifies specific genes that may mediate some of these processes.

  7. Comparative analysis of ADS gene promoter in seven Artemisia ...

    Indian Academy of Sciences (India)

    ... were more in the high artemisinin producer species, A. annua, than the other species. We have reported that the light-responsive elements, W-box, CAAT-box, 5′-UTR py-rich stretch, TATA-box sequence and tandem repeat sequences have been identified as important factors in the increased expression of ADS gene.

  8. Expression of sex steroid hormone-related genes in the embryo of the leopard gecko.

    Science.gov (United States)

    Endo, Daisuke; Kanaho, Yoh-Ichiro; Park, Min Kyun

    2008-01-01

    Sex steroid hormones are known to play a central role in vertebrate sex determination and differentiation. However, the tissues in which they are produced or received during development, especially around the period of sex determination of the gonads, have rarely been investigated. In this study, we identified the cDNA sequence, including the full-length of the coding region of cholesterol side-chain cleavage enzyme (P450scc), from the leopard gecko; a lizard with temperature-dependent sex determination. Embryonic expression analysis of two steroidogenic enzymes, P450scc and P450 aromatase (P450arom), and four sex steroid hormone receptors, androgen receptor, estrogen receptor alpha and beta, and progesterone receptor, was subsequently conducted. mRNA expression of both steroidogenic enzymes was observed in the brain and gonads prior to the temperature-sensitive period of sex determination. The mRNAs of the four sex steroid hormone receptors were also detected in the brain and gonads at all stages examined. These results suggest the existence of a gonad-independent sex steroid hormone signaling system in the developing leopard gecko brain.

  9. Expression of the growth hormone receptor gene in insulin producing cells

    DEFF Research Database (Denmark)

    Møldrup, Annette; Billestrup, N; Nielsen, Jens Høiriis

    1990-01-01

    Growth hormone (GH) plays a dual role in glucose homeostasis. On the one hand, it exerts an insulin antagonistic effect on the peripheral tissue, on the other hand, it stimulates insulin biosynthesis and beta-cell proliferation. The expression of GH-receptors on the rat insulinoma cell line RIN-5...

  10. The immediate and late effects of thyroid hormone (triiodothyronine) on murine coagulation gene transcription

    NARCIS (Netherlands)

    Salloum-Asfar, Salam; Boelen, Anita; Reitsma, Pieter H.; van Vlijmen, Bart J. M.

    2015-01-01

    Thyroid dysfunction is associated with changes in coagulation. The aim of our study was to gain more insight into the role of thyroid hormone in coagulation control. C57Black/6J mice received a low-iodine diet and drinking water supplemented with perchlorate to suppress endogenous triiodothyronine

  11. A cII-dependent promoter is located within the Q gene of bacteriophage lambda.

    OpenAIRE

    Hoopes, B C; McClure, W R

    1985-01-01

    We have found a cII-dependent promoter, PaQ, within the Q gene of bacteriophage lambda. Transcription experiments and abortive initiation assays performed in vitro showed that the promoter strength and the cII affinity of PaQ were comparable to the other cII-dependent lambda promoters, PE and PI. The location and leftward direction of PaQ suggests a possible role in the delay of lambda late-gene expression by cII protein, a phenomenon that has been called cII-dependent inhibition. We have con...

  12. Characteristic differences between the promoters of intron-containing and intronless ribosomal protein genes in yeast

    Directory of Open Access Journals (Sweden)

    Vingron Martin

    2008-10-01

    Full Text Available Abstract Background More than two thirds of the highly expressed ribosomal protein (RP genes in Saccharomyces cerevisiae contain introns, which is in sharp contrast to the genome-wide five percent intron-containing genes. It is well established that introns carry regulatory sequences and that the transcription of RP genes is extensively and coordinately regulated. Here we test the hypotheses that introns are innately associated with heavily transcribed genes and that introns of RP genes contribute regulatory TF binding sequences. Moreover, we investigate whether promoter features are significantly different between intron-containing and intronless RP genes. Results We find that directly measured transcription rates tend to be lower for intron-containing compared to intronless RP genes. We do not observe any specifically enriched sequence motifs in the introns of RP genes other than those of the branch point and the two splice sites. Comparing the promoters of intron-containing and intronless RP genes, we detect differences in number and position of Rap1-binding and IFHL motifs. Moreover, the analysis of the length distribution and the folding free energies suggest that, at least in a sub-population of RP genes, the 5' untranslated sequences are optimized for regulatory function. Conclusion Our results argue against the direct involvement of introns in the regulation of transcription of highly expressed genes. Moreover, systematic differences in motif distributions suggest that RP transcription factors may act differently on intron-containing and intronless gene promoters. Thus, our findings contribute to the decoding of the RP promoter architecture and may fuel the discussion on the evolution of introns.

  13. Methylation pattern of the intergenic spacer of rRNA genes in excised cotyledons of Cucurbita pepo L. (Zucchini) after hormone treatment

    International Nuclear Information System (INIS)

    Ananiev, E.; Abdulova, G.; Grozdanov, P.; Karagyozov, L.

    2003-01-01

    High molecular mass genomic DNA was isolated from excised marrow cotyledons (Cucurbita pepo L. zucchini) treated with 6-benzyladenine (BA) of methyl ester of jasmonic acid (MeJA) for 24 h in darkness. DNA purified from contaminating polysaccharides with Celite column was completely digested with the restriction enzyme Eco RI and the changes in the methylation pattern of the intergenic spacer (IGS) of r RNA genes were studied after subsequent digestion with the couple of restriction enzymes-isoschizomers MSP I and Hpa II by the method of 'indirect end labelling'. As rDNA units probe a cloned 32 P-labelled Eco RI 2.1 kb fragment spanning in the most part of 18S r RNA gene from flax rDNA was used. Results showed heavy methylation of the rRNA genes. As judged from the almost total lack of digestion with HPA II, there were no methylation free regions in repeated rDNA units or little if any were observed. A hypo methylated Hps II site was detected near the promoter region in some of the repeats. Digestion with Msp I affected nearly 50% of the repeating units. The Msp digestion fragments of the 6.2 kb Eco RI fragment of r DNA were few in number and large in size (0.5 - 2.5 kb). This suggested that in addition with -CpG- sequences, methylation in -CpNpG- might not be random. Methylation pattern in IGS was not changed upon treatment of the cotyledons in vivo with BA and MeJA. Thus, previously observed hormone-mediated effects on the eactivity of rRNA gene expression were not accompanied by any significant changes of the methylation pattern in IGS. (authors)

  14. Tissue specific promoters improve the localization of radiation-inducible gene expression

    International Nuclear Information System (INIS)

    Hallahan, Dennis; Kataoka, Yasushi; Kuchibhotla, Jaya; Virudachalam, Subbu; Weichselbaum, Ralph

    1996-01-01

    Purpose: Site-specific activation of gene expression can be achieved by the use of a promoter that is induced by physical agents such as x-rays. The purpose of the present study was to determine whether site-specific activation of gene therapy can also be achieved within the vascular endothelium by use of radiation-inducible promoters. We studied induction of promoter-reporter gene constructs using previously identified radiation-promoters from c-jun, c-fos, Egr-1, ICAM-1, ELAM-1 after transfection into in the vascular endothelium. Methods: The following radiation-inducible genetic constructs were created: The ELAM-1 promoter fragment was cloned into pOGH to obtain the pE-sel(-587 +35)GH reporter construct. The ICAM-1 promoter fragment (-1162/+1) was cloned upstream of the CAT coding region of the pCAT-plasmid (Promega) after removal of the SV40 promoter by Bgl2/Stu1 digestion to create the pBS-CAT plasmid. The 132 to +170 bp segment of the 5' untranslated region of the c-jun promoter was cloned to the CAT reporter gene to create the -132/+170 cjun-CAT. The Egr-1 promoter fragment (-425/+75) was cloned upstream of the CAT coding region to create the pE425-CAT plasmid. Tandem repeats of the AP-1 binding site were cloned upstream of the CAT coding region (3 xTRE-CAT). Tandem repeats of the Egr binding site (EBS) were cloned upstream of the CAT coding region (EBS-CAT). Human vascular endothelial cells from both large vessel and small vessel origin (HUVEC and HMEC), as well as human tumor cell lines were transfected with plasmids -132/+170 cjun-CAT, pE425-CAT, 3 xTRE-CAT, EBS-CAT, pE-sel-GH and pBS-CAT by use of liposomes. Humor tumor cell lines included SQ20B (squamous), RIT3 (sarcoma), and HL525 (leukemia). Each plasmid was cotransfected with a plasmid containing a CMV promoter linked to the LacZ gene (1 μg). Transfected cells were treated with mock irradiation or x-rays. Cell extracts were assayed for reporter gene expression. Results: Radiation-induced gene

  15. Role of promoter element in c-mpl gene expression induced by TPO.

    Science.gov (United States)

    Sunohara, Masataka; Morikawa, Shigeru; Fuse, Akira; Sato, Iwao

    2013-01-01

    Thrombopoietin (TPO) and its receptor, c-Mpl, play the crucial role for the development of megakaryocyte and considered to regulate megakaryocytopoiesis. Previously we reported that TPO increased the c-mpl promoter activity determined by a transient expression system using a vector containing the luciferase gene as a reporter and the expression of the c-mpl gene is modulated by transcription through a protein kinase C (PKC)-dependent pathway in the megakaryoblastic cells. In this research, to elucidate the required elements in c-mpl promoter, the promoter activity of the deletion constructs and site-directed mutagenesis were measured by a transient transfection assay system. Destruction of -77GATA in c-mpl promoter decreased the activity by 22.8%. Our study elucidated that -77GATA involved in TPO-induced c-mpl gene expression in a human megakaryoblastic cell line, CMK.

  16. The application of powerful promoters to enhance gene expression in industrial microorganisms.

    Science.gov (United States)

    Zhou, Shenghu; Du, Guocheng; Kang, Zhen; Li, Jianghua; Chen, Jian; Li, Huazhong; Zhou, Jingwen

    2017-02-01

    Production of useful chemicals by industrial microorganisms has been attracting more and more attention. Microorganisms screened from their natural environment usually suffer from low productivity, low stress resistance, and accumulation of by-products. In order to overcome these disadvantages, rational engineering of microorganisms to achieve specific industrial goals has become routine. Rapid development of metabolic engineering and synthetic biology strategies provide novel methods to improve the performance of industrial microorganisms. Rational regulation of gene expression by specific promoters is essential to engineer industrial microorganisms for high-efficiency production of target chemicals. Identification, modification, and application of suitable promoters could provide powerful switches at the transcriptional level for fine-tuning of a single gene or a group of genes, which are essential for the reconstruction of pathways. In this review, the characteristics of promoters from eukaryotic, prokaryotic, and archaea microorganisms are briefly introduced. Identification of promoters based on both traditional biochemical and systems biology routes are summarized. Besides rational modification, de novo design of promoters to achieve gradient, dynamic, and logic gate regulation are also introduced. Furthermore, flexible application of static and dynamic promoters for the rational engineering of industrial microorganisms is highlighted. From the perspective of powerful promoters in industrial microorganisms, this review will provide an extensive description of how to regulate gene expression in industrial microorganisms to achieve more useful goals.

  17. Comprehensive Analysis of Hormone and Genetic Variation in 36 Genes Related to Steroid Hormone Metabolism in Pre- and Postmenopausal Women from the Breast and Prostate Cancer Cohort Consortium (BPC3)

    DEFF Research Database (Denmark)

    Beckmann, L.; Husing, A.; Setiawan, V. W.

    2011-01-01

    Context: Sex steroids play a central role in breast cancer development.Objective: This study aimed to relate polymorphic variants in 36 candidate genes in the sex steroid pathway to serum concentrations of sex steroid hormones and SHBG.Design: Data on 700 genetic polymorphisms were combined...

  18. Novel homozygous nonsense mutations in the luteinizing hormone receptor (LHCGR) gene associated with 46,XY primary amenorrhea.

    Science.gov (United States)

    Ben Hadj Hmida, Imen; Mougou-Zerelli, Soumaya; Hadded, Anis; Dimassi, Sarra; Kammoun, Molka; Bignon-Topalovic, Joelle; Bibi, Mohamed; Saad, Ali; Bashamboo, Anu; McElreavey, Ken

    2016-07-01

    To determine the genetic cause of 46,XY primary amenorrhea in three 46,XY girls. Whole exome sequencing. University cytogenetics center. Three patients with unexplained 46,XY primary amenorrhea were included in the study. Potentially pathogenic variants were confirmed by Sanger sequencing, and familial segregation was determined where parents' DNA was available. Exome sequencing was performed in the three patients, and the data were analyzed for potentially pathogenic mutations. The functional consequences of mutations were predicted. Three novel homozygous nonsense mutations in the luteinizing hormone receptor (LHCGR) gene were identified:c.1573 C→T, p.Gln525Ter, c.1435 C→T p.Arg479Ter, and c.508 C→T, p.Gln170Ter. Inactivating mutations of the LHCGR gene may be a more common cause of 46,XY primary amenorrhea than previously considered. Copyright © 2016 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

  19. Identification of learning and memory genes in canine; promoter investigation and determining the selective pressure.

    Science.gov (United States)

    Seifi Moroudi, Reihane; Masoudi, Ali Akbar; Vaez Torshizi, Rasoul; Zandi, Mohammad

    2014-12-01

    One of the important behaviors of dogs is trainability which is affected by learning and memory genes. These kinds of the genes have not yet been identified in dogs. In the current research, these genes were found in animal models by mining the biological data and scientific literatures. The proteins of these genes were obtained from the UniProt database in dogs and humans. Not all homologous proteins perform similar functions, thus comparison of these proteins was studied in terms of protein families, domains, biological processes, molecular functions, and cellular location of metabolic pathways in Interpro, KEGG, Quick Go and Psort databases. The results showed that some of these proteins have the same performance in the rat or mouse, dog, and human. It is anticipated that the protein of these genes may be effective in learning and memory in dogs. Then, the expression pattern of the recognized genes was investigated in the dog hippocampus using the existing information in the GEO profile. The results showed that BDNF, TAC1 and CCK genes are expressed in the dog hippocampus, therefore, these genes could be strong candidates associated with learning and memory in dogs. Subsequently, due to the importance of the promoter regions in gene function, this region was investigated in the above genes. Analysis of the promoter indicated that the HNF-4 site of BDNF gene and the transcription start site of CCK gene is exposed to methylation. Phylogenetic analysis of protein sequences of these genes showed high similarity in each of these three genes among the studied species. The dN/dS ratio for BDNF, TAC1 and CCK genes indicates a purifying selection during the evolution of the genes.

  20. Gene expression markers in circulating tumor cells may predict bone metastasis and response to hormonal treatment in breast cancer.

    Science.gov (United States)

    Wang, Haiying; Molina, Julian; Jiang, John; Ferber, Matthew; Pruthi, Sandhya; Jatkoe, Timothy; Derecho, Carlo; Rajpurohit, Yashoda; Zheng, Jian; Wang, Yixin

    2013-11-01

    Circulating tumor cells (CTCs) have recently attracted attention due to their potential as prognostic and predictive markers for the clinical management of metastatic breast cancer patients. The isolation of CTCs from patients may enable the molecular characterization of these cells, which may help establish a minimally invasive assay for the prediction of metastasis and further optimization of treatment. Molecular markers of proven clinical value may therefore be useful in predicting disease aggressiveness and response to treatment. In our earlier study, we identified a gene signature in breast cancer that appears to be significantly associated with bone metastasis. Among the genes that constitute this signature, trefoil factor 1 (TFF1) was identified as the most differentially expressed gene associated with bone metastasis. In this study, we investigated 25 candidate gene markers in the CTCs of metastatic breast cancer patients with different metastatic sites. The panel of the 25 markers was investigated in 80 baseline samples (first blood draw of CTCs) and 30 follow-up samples. In addition, 40 healthy blood donors (HBDs) were analyzed as controls. The assay was performed using quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) with RNA extracted from CTCs captured by the CellSearch system. Our study indicated that 12 of the genes were uniquely expressed in CTCs and 10 were highly expressed in the CTCs obtained from patients compared to those obtained from HBDs. Among these genes, the expression of keratin 19 was highly correlated with the CTC count. The TFF1 expression in CTCs was a strong predictor of bone metastasis and the patients with a high expression of estrogen receptor β in CTCs exhibited a better response to hormonal treatment. Molecular characterization of these genes in CTCs may provide a better understanding of the mechanism underlying tumor metastasis and identify gene markers in CTCs for predicting disease progression and

  1. The chicken c-erbA alpha-product induces expression of thyroid hormone-responsive genes in 3,5,3'-triiodothyronine receptor-deficient rat hepatoma cells

    DEFF Research Database (Denmark)

    Muñoz, A; Höppner, W; Sap, J

    1990-01-01

    To determine the capacity of the chicken c-erbA (cTR-alpha) gene product in regulating expression of known thyroid hormone-responsive genes, both the cTR-alpha and the viral v-erbA genes were expressed in FAO cells, a rat hepatoma cell line defective for functional thyroid hormone receptors. Upon...

  2. Juvenile hormone biosynthesis gene expression in the corpora allata of honey bee (Apis mellifera L. female castes.

    Directory of Open Access Journals (Sweden)

    Ana Durvalina Bomtorin

    Full Text Available Juvenile hormone (JH controls key events in the honey bee life cycle, viz. caste development and age polyethism. We quantified transcript abundance of 24 genes involved in the JH biosynthetic pathway in the corpora allata-corpora cardiaca (CA-CC complex. The expression of six of these genes showing relatively high transcript abundance was contrasted with CA size, hemolymph JH titer, as well as JH degradation rates and JH esterase (jhe transcript levels. Gene expression did not match the contrasting JH titers in queen and worker fourth instar larvae, but jhe transcript abundance and JH degradation rates were significantly lower in queen larvae. Consequently, transcriptional control of JHE is of importance in regulating larval JH titers and caste development. In contrast, the same analyses applied to adult worker bees allowed us inferring that the high JH levels in foragers are due to increased JH synthesis. Upon RNAi-mediated silencing of the methyl farnesoate epoxidase gene (mfe encoding the enzyme that catalyzes methyl farnesoate-to-JH conversion, the JH titer was decreased, thus corroborating that JH titer regulation in adult honey bees depends on this final JH biosynthesis step. The molecular pathway differences underlying JH titer regulation in larval caste development versus adult age polyethism lead us to propose that mfe and jhe genes be assayed when addressing questions on the role(s of JH in social evolution.

  3. Juvenile hormone biosynthesis gene expression in the corpora allata of honey bee (Apis mellifera L.) female castes.

    Science.gov (United States)

    Bomtorin, Ana Durvalina; Mackert, Aline; Rosa, Gustavo Conrado Couto; Moda, Livia Maria; Martins, Juliana Ramos; Bitondi, Márcia Maria Gentile; Hartfelder, Klaus; Simões, Zilá Luz Paulino

    2014-01-01

    Juvenile hormone (JH) controls key events in the honey bee life cycle, viz. caste development and age polyethism. We quantified transcript abundance of 24 genes involved in the JH biosynthetic pathway in the corpora allata-corpora cardiaca (CA-CC) complex. The expression of six of these genes showing relatively high transcript abundance was contrasted with CA size, hemolymph JH titer, as well as JH degradation rates and JH esterase (jhe) transcript levels. Gene expression did not match the contrasting JH titers in queen and worker fourth instar larvae, but jhe transcript abundance and JH degradation rates were significantly lower in queen larvae. Consequently, transcriptional control of JHE is of importance in regulating larval JH titers and caste development. In contrast, the same analyses applied to adult worker bees allowed us inferring that the high JH levels in foragers are due to increased JH synthesis. Upon RNAi-mediated silencing of the methyl farnesoate epoxidase gene (mfe) encoding the enzyme that catalyzes methyl farnesoate-to-JH conversion, the JH titer was decreased, thus corroborating that JH titer regulation in adult honey bees depends on this final JH biosynthesis step. The molecular pathway differences underlying JH titer regulation in larval caste development versus adult age polyethism lead us to propose that mfe and jhe genes be assayed when addressing questions on the role(s) of JH in social evolution.

  4. Digital gene expression analysis of male and female bud transition in Metasequoia reveals high activity of MADS-box transcription factors and hormone-mediated sugar pathways

    OpenAIRE

    Zhao, Ying; Liang, Haiying; Li, Lan; Tang, Sha; Han, Xiao; Wang, Congpeng; Xia, Xinli; Yin, Weilun

    2015-01-01

    Metasequoia glyptostroboides is a famous redwood tree of ecological and economic importance, and requires more than 20 years of juvenile-to-adult transition before producing female and male cones. Previously, we induced reproductive buds using a hormone solution in juvenile Metasequoia trees as young as 5-to-7 years old. In the current study, hormone-treated shoots found in female and male buds were used to identify candidate genes involved in reproductive bud transition in Metasequoia. Sampl...

  5. A strategy of gene overexpression based on tandem repetitive promoters in Escherichia coli

    Directory of Open Access Journals (Sweden)

    Li Mingji

    2012-02-01

    Full Text Available Abstract Background For metabolic engineering, many rate-limiting steps may exist in the pathways of accumulating the target metabolites. Increasing copy number of the desired genes in these pathways is a general method to solve the problem, for example, the employment of the multi-copy plasmid-based expression system. However, this method may bring genetic instability, structural instability and metabolic burden to the host, while integrating of the desired gene into the chromosome may cause inadequate transcription or expression. In this study, we developed a strategy for obtaining gene overexpression by engineering promoter clusters consisted of multiple core-tac-promoters (MCPtacs in tandem. Results Through a uniquely designed in vitro assembling process, a series of promoter clusters were constructed. The transcription strength of these promoter clusters showed a stepwise enhancement with the increase of tandem repeats number until it reached the critical value of five. Application of the MCPtacs promoter clusters in polyhydroxybutyrate (PHB production proved that it was efficient. Integration of the phaCAB genes with the 5CPtacs promoter cluster resulted in an engineered E.coli that can accumulate 23.7% PHB of the cell dry weight in batch cultivation. Conclusions The transcription strength of the MCPtacs promoter cluster can be greatly improved by increasing the tandem repeats number of the core-tac-promoter. By integrating the desired gene together with the MCPtacs promoter cluster into the chromosome of E. coli, we can achieve high and stale overexpression with only a small size. This strategy has an application potential in many fields and can be extended to other bacteria.

  6. Analysis of an osmotically regulated pathogenesis-related osmotin gene promoter.

    Science.gov (United States)

    Raghothama, K G; Liu, D; Nelson, D E; Hasegawa, P M; Bressan, R A

    1993-12-01

    Osmotin is a small (24 kDa), basic, pathogenesis-related protein, that accumulates during adaptation of tobacco (Nicotiana tabacum) cells to osmotic stress. There are more than 10 inducers that activate the osmotin gene in various plant tissues. The osmotin promoter contains several sequences bearing a high degree of similarity to ABRE, as-1 and E-8 cis element sequences. Gel retardation studies indicated the presence of at least two regions in the osmotin promoter that show specific interactions with nuclear factors isolated from cultured cells or leaves. The abundance of these binding factors increased in response to salt, ABA and ethylene. Nuclear factors protected a 35 bp sequence of the promoter from DNase I digestion. Different 5' deletions of the osmotin promoter cloned into a promoter-less GUSNOS plasmid (pBI 201) were used in transient expression studies with a Biolistic gun. The transient expression studies revealed the presence of three distinct regions in the osmotin promoter. The promoter sequence from -108 to -248 bp is absolutely required for reporter gene activity, followed by a long stretch (up to -1052) of enhancer-like sequence and then a sequence upstream of -1052, which appears to contain negative elements. The responses to ABA, ethylene, salt, desiccation and wounding appear to be associated with the -248 bp sequence of the promoter. This region also contains a putative ABRE (CACTGTG) core element. Activation of the osmotin gene by various inducers is discussed in view of antifungal activity of the osmotin protein.

  7. Isolation and characterization of an ubiquitin extension protein gene (JcUEP) promoter from Jatropha curcas.

    Science.gov (United States)

    Tao, Yan-Bin; He, Liang-Liang; Niu, Long-Jian; Xu, Zeng-Fu

    2015-04-01

    The JcUEP promoter is active constitutively in the bio-fuel plant Jatropha curcas , and is an alternative to the widely used CaMV35S promoter for driving constitutive overexpression of transgenes in Jatropha. Well-characterized promoters are required for transgenic breeding of Jatropha curcas, a biofuel feedstock with great potential for production of bio-diesel and bio-jet fuel. In this study, an ubiquitin extension protein gene from Jatropha, designated JcUEP, was identified to be ubiquitously expressed. Thus, we isolated a 1.2 kb fragment of the 5' flanking region of JcUEP and evaluated its activity as a constitutive promoter in Arabidopsis and Jatropha using the β-glucuronidase (GUS) reporter gene. As expected, histochemical GUS assay showed that the JcUEP promoter was active in all Arabidopsis and Jatropha tissues tested. We also compared the activity of the JcUEP promoter with that of the cauliflower mosaic virus 35S (CaMV35S) promoter, a well-characterized constitutive promoter conferring strong transgene expression in dicot species, in various tissues of Jatropha. In a fluorometric GUS assay, the two promoters showed similar activities in stems, mature leaves and female flowers; while the CaMV35S promoter was more effective than the JcUEP promoter in other tissues, especially young leaves and inflorescences. In addition, the JcUEP promoter retained its activity under stress conditions in low temperature, high salt, dehydration and exogenous ABA treatments. These results suggest that the plant-derived JcUEP promoter could be an alternative to the CaMV35S promoter for driving constitutive overexpression of transgenes in Jatropha and other plants.

  8. Promoter sequence of 3-phosphoglycerate kinase gene 1 of lactic acid-producing fungus rhizopus oryzae and a method of expressing a gene of interest in fungal species

    Energy Technology Data Exchange (ETDEWEB)

    Gao, Johnway [Richland, WA; Skeen, Rodney S [Pendleton, OR

    2002-10-15

    The present invention provides the promoter clone discovery of phosphoglycerate kinase gene 1 of a lactic acid-producing filamentous fungal strain, Rhizopus oryzae. The isolated promoter can constitutively regulate gene expression under various carbohydrate conditions. In addition, the present invention also provides a design of an integration vector for the transformation of a foreign gene in Rhizopus oryzae.

  9. Promoter sequence of 3-phosphoglycerate kinase gene 2 of lactic acid-producing fungus rhizopus oryzae and a method of expressing a gene of interest in fungal species

    Energy Technology Data Exchange (ETDEWEB)

    Gao, Johnway [Richland, WA; Skeen, Rodney S [Pendleton, OR

    2003-03-04

    The present invention provides the promoter clone discovery of phosphoglycerate kinase gene 2 of a lactic acid-producing filamentous fungal strain, Rhizopus oryzae. The isolated promoter can constitutively regulate gene expression under various carbohydrate conditions. In addition, the present invention also provides a design of an integration vector for the transformation of a foreign gene in Rhizopus oryzae.

  10. Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum

    OpenAIRE

    Xin, Shan; Tao, Chengcheng; Li, Hongbin

    2016-01-01

    Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibite...

  11. Docosahexaenoic acid inhibits the growth of hormone-dependent prostate cancer cells by promoting the degradation of the androgen receptor.

    Science.gov (United States)

    Hu, Zhimei; Qi, Haixia; Zhang, Ruixue; Zhang, Kun; Shi, Zhemin; Chang, Yanan; Chen, Linfeng; Esmaeili, Mohsen; Baniahmad, Aria; Hong, Wei

    2015-09-01

    Epidemiological and preclinical data have demonstrated the preventative effects of ω-3 polyunsaturated fatty acids, including docosahexaenoic acid (DHA), on prostate cancer. However, there are inconsistencies in these previous studies and the underlying mechanisms remain to be elucidated. In the present study, the androgen receptor (AR), which is a transcription factor involved in cell proliferation and prostate carcinogenesis, was identified as a target of DHA. It was revealed that DHA inhibited hormone‑dependent growth of LNCaP prostate cancer cells. Reverse transcription-quantitative polymerase chain reaction analysis revealed that treatment with DHA caused no alteration in the transcribed mRNA expression levels of the AR gene. However, immunoblotting revealed that this treatment reduces the protein expression level of the AR. The androgen‑induced genes were subsequently repressed by treatment with DHA. It was demonstrated that DHA exhibits no effect on the translation process of the AR, however, it promotes the proteasome‑mediated degradation of the AR. Therefore, the present study provided a novel mechanism by which DHA exhibits an inhibitory effect on growth of prostate cancer cells.

  12. Effect of thyroid hormones on the gene expression of calcium transport systems in rat muscles

    Czech Academy of Sciences Publication Activity Database

    Hudecová, S.; Vadászová, Adriana; Soukup, Tomáš; Križanová, O.

    2004-01-01

    Roč. 75, č. 8 (2004), s. 923-931 ISSN 0024-3205 R&D Projects: GA ČR GA309/03/0752 Grant - others:VEGA(SK) 2/3008; NATO(XX) 979876; SAV(SK) APVT-51-013802 Institutional research plan: CEZ:AV0Z5011922 Keywords : thyroid hormones * calcium transport systems Subject RIV: ED - Physiology Impact factor: 2.158, year: 2004

  13. Characterization of brn1.2 and corticotropin-releasing hormone genes in zebrafish

    OpenAIRE

    Chandrasekar, Gayathri

    2007-01-01

    The zebrafish (Danio rerio), a tropical fresh water fish originally found in the rivers of India and Bangladesh has become a popular vertebrate model system over the last decade. The rapid sequencing of the zebrafish genome together with the latest advances in forward and reverse genetics has made this model organism more fascinating as it can be used to decipher the genetic mechanisms involved in the vertebrate development. Corticotropin-releasing hormone (CRH) regulates t...

  14. Common and distinct roles of juvenile hormone signaling genes in metamorphosis of holometabolous and hemimetabolous insect

    Czech Academy of Sciences Publication Activity Database

    Konopová, Barbora; Smýkal, V.; Jindra, Marek

    2011-01-01

    Roč. 6, č. 12 (2011), e28728 E-ISSN 1932-6203 R&D Projects: GA ČR(CZ) GA204/07/1032; GA ČR(CZ) GD204/09/H058; GA AV ČR IAA500960906 Institutional research plan: CEZ:AV0Z50070508 Keywords : juvenile hormone Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.092, year: 2011

  15. A mammalian model for Laron syndrome produced by targeted disruption of the mouse growth hormone receptor/binding protein gene (the Laron mouse)

    OpenAIRE

    Zhou, Yihua; Xu, Bixiong C.; Maheshwari, Hiralal G.; He, Li; Reed, Michael; Lozykowski, Maria; Okada, Shigeru; Cataldo, Lori; Coschigamo, Karen; Wagner, Thomas E.; Baumann, Gerhard; Kopchick, John J.

    1997-01-01

    Laron syndrome [growth hormone (GH) insensitivity syndrome] is a hereditary dwarfism resulting from defects in the GH receptor (GHR) gene. GHR deficiency has not been reported in mammals other than humans. Many aspects of GHR dysfunction remain unknown because of ethical and practical limitations in studying humans. To create a mammalian model for this disease, we generated mice bearing a disrupted GHR/binding protein (GHR/BP) gene through a homologous gene targeting approach. Homozygous GHR/...

  16. Low-Dose Radiation Induces Genes Promoting Cell Survival

    International Nuclear Information System (INIS)

    Liu, Shu-Zheng; Chen, Dong; Mu, Ying

    1999-01-01

    Apoptosis is an important process controlling homeostasis of the body. It is influenced by stimuli constantly arising from the external and internal environment of the organism. It is well known that radiation could induce apoptosis of cells in vitro and in vivo. However, the dose-effect relationship of apoptosis extending to the low-dose range has scarcely been studied. Here, the molecular basis of the phenomenon is explored by examining the changes in expression of some of the proapoptotic and antiapoptotic genes

  17. Regional differences in gene expression and promoter usage in aged human brains

    KAUST Repository

    Pardo, Luba M.

    2013-02-19

    To characterize the promoterome of caudate and putamen regions (striatum), frontal and temporal cortices, and hippocampi from aged human brains, we used high-throughput cap analysis of gene expression to profile the transcription start sites and to quantify the differences in gene expression across the 5 brain regions. We also analyzed the extent to which methylation influenced the observed expression profiles. We sequenced more than 71 million cap analysis of gene expression tags corresponding to 70,202 promoter regions and 16,888 genes. More than 7000 transcripts were differentially expressed, mainly because of differential alternative promoter usage. Unexpectedly, 7% of differentially expressed genes were neurodevelopmental transcription factors. Functional pathway analysis on the differentially expressed genes revealed an overrepresentation of several signaling pathways (e.g., fibroblast growth factor and wnt signaling) in hippocampus and striatum. We also found that although 73% of methylation signals mapped within genes, the influence of methylation on the expression profile was small. Our study underscores alternative promoter usage as an important mechanism for determining the regional differences in gene expression at old age.

  18. Molecular cloning and characterization of the light-regulation and circadian-rhythm of the VDE gene promoter from Zingiber officinale.

    Science.gov (United States)

    Zhao, Wenchao; Wang, Shaohui; Li, Xin; Huang, Hongyu; Sui, Xiaolei; Zhang, Zhenxian

    2012-08-01

    Ginger (Zingiber officinale Rosc.) is prone to photoinhibition under intense sunlight. Excessive light can be dissipated by the xanthophyll cycle, where violaxanthin de-epoxidase (VDE) plays a critical role in protecting the photosynthesis apparatus from the damage of excessive light. We isolated ~2.0 kb of ginger VDE (GVDE) gene promoter, which contained the circadian box, I-box, G-box and GT-1 motif. Histochemical staining of Arabidopsis indicated the GVDE promoter was active in almost all organs, especially green tissues. β-glucuronidase (GUS) activity driven by GVDE promoter was repressed rather than activated by high light. GUS activity was altered by hormones, growth regulators and abiotic stresses, which increased with 2,4-dichlorophenoxyacetic acid and decreased with abscisic acid, salicylic acid, zeatin, salt (sodium chloride) and polyethylene glycol. Interestingly, GUS activities with gibberellin or indole-3-acetic acid increased in the short-term (24 h) and decreased in the long-term (48 and 72 h). Analysis of 5' flank deletion found two crucial functional regions residing in -679 to -833 and -63 to -210. Northern blotting analysis found transcription to be regulated by the endogenous circadian clock. Finally, we found a region necessary for regulating the circadian rhythm and another for the basic promoter activity. Key message A novel promoter, named GVDE promoter, was first isolated and analyzed in this study. We have determined one region crucial for promoter activity and another responsible for keeping circadian rhythms.

  19. Effect of external and internal factors on the expression of reporter genes driven by the N resistance gene promoter.

    Science.gov (United States)

    Kathiria, Palak; Sidler, Corinne; Woycicki, Rafal; Yao, Youli; Kovalchuk, Igor

    2013-07-01

    The role of resistance (R) genes in plant pathogen interaction has been studied extensively due to its economical impact on agriculture. Interaction between tobacco mosaic virus (TMV) and the N protein from tobacco is one of the most widely used models to understand various aspects of pathogen resistance. The transcription activity governed by N gene promoter is one of the least understood elements of the model. In this study, the N gene promoter was cloned and fused with two different reporter genes, one encoding β-glucuronidase (N::GUS) and another, luciferase (N::LUC). Tobacco plants transformed with the N::GUS or N::LUC reporter constructs were screened for homozygosity and stable expression. Histochemical analysis of N::GUS tobacco plants revealed that the expression is organ specific and developmentally regulated. Whereas two week old plants expressed GUS in midveins only, 6-wk-old plants also expressed GUS in leaf lamella. Roots did not show GUS expression at any time during development. Experiments to address effects of external stress were performed using N::LUC tobacco plants. These experiments showed that N gene promoter expression was suppressed when plants were exposed to high but not low temperatures. Expression was also upregulated in response to TMV, but no changes were observed in plants treated with SA.

  20. Promoter Hypermethylation of the ATM Gene as a Novel Biomarker for Breast Cancer

    Science.gov (United States)

    Begam, Nasrin; Jamil, Kaiser; Raju, Suryanarayana G

    2017-11-26

    Background: Breast cancer may be induced by activation of protooncogenes to oncogenes and in many cases inactivation of tumor suppressor genes. Ataxia telangiectasia mutated (ATM) is an important tumor suppressor gene which plays central roles in the maintenance of genomic integrity by activating cell cycle checkpoints and promoting repair of double-strand breaks of DNA. In breast cancer, decrease ATM expression correlates with a poor outcome; however, the molecular mechanisms underlying downregulation are still unclear. Promoter hypermethylation may contribute in downregulation. Hence the present investigation was designed to evaluate promoter methylation and expression of the ATM gene in breast cancer cases, and to determine links with clinical and demographic manifestations, in a South Indian population. Methods: Tumor biopsy samples were collected from 50 pathologically confirmed sporadic breast cancer cases. DNA was isolated from tumor and adjacent non-tumorous regions, and sodium bisulfite conversion and methylation-specific PCR were performed using MS-PCR primers for the ATM promoter region. In addition, ATM mRNA expression was also analyzed for all samples using real-time PCR. Results: Fifty eight percent (58%) of cancer tissue samples showed promoter hypermethylation for the ATM gene, in contrast to only 4.44% of normal tissues (p= 0.0001). Furthermore, ATM promoter methylation was positively associated with age (p = 0.01), tumor size (p=0.045) and advanced stage of disease i.e. stages III and IV (p =0.019). An association between promoter hypermethylation and lower expression of ATM mRNA was also found (p=0.035). Conclusion: We report for the first time that promoter hypermethylation of ATM gene may be useful as a potential new biomarker for breast cancer, especially in the relatively young patients. Creative Commons Attribution License

  1. Cancer cell specific cytotoxic gene expression mediated by ARF tumor suppressor promoter constructs

    International Nuclear Information System (INIS)

    Kurayoshi, Kenta; Ozono, Eiko; Iwanaga, Ritsuko; Bradford, Andrew P.; Komori, Hideyuki; Ohtani, Kiyoshi

    2014-01-01

    Highlights: • ARF promoter showed higher responsiveness to deregulated E2F activity than the E2F1 promoter. • ARF promoter showed higher cancer cell-specificity than E2F1 promoter to drive gene expression. • HSV-TK driven by ARF promoter showed higher cancer cell-specific cytotoxicity than that driven by E2F1 promoter. - Abstract: In current cancer treatment protocols, such as radiation and chemotherapy, side effects on normal cells are major obstacles to radical therapy. To avoid these side effects, a cancer cell-specific approach is needed. One way to specifically target cancer cells is to utilize a cancer specific promoter to express a cytotoxic gene (suicide gene therapy) or a viral gene required for viral replication (oncolytic virotherapy). For this purpose, the selected promoter should have minimal activity in normal cells to avoid side effects, and high activity in a wide variety of cancers to obtain optimal therapeutic efficacy. In contrast to the AFP, CEA and PSA promoters, which have high activity only in a limited spectrum of tumors, the E2F1 promoter exhibits high activity in wide variety of cancers. This is based on the mechanism of carcinogenesis. Defects in the RB pathway and activation of the transcription factor E2F, the main target of the RB pathway, are observed in almost all cancers. Consequently, the E2F1 promoter, which is mainly regulated by E2F, has high activity in wide variety of cancers. However, E2F is also activated by growth stimulation in normal growing cells, suggesting that the E2F1 promoter may also be highly active in normal growing cells. In contrast, we found that the tumor suppressor ARF promoter is activated by deregulated E2F activity, induced by forced inactivation of pRB, but does not respond to physiological E2F activity induced by growth stimulation. We also found that the deregulated E2F activity, which activates the ARF promoter, is detected only in cancer cell lines. These observations suggest that ARF promoter

  2. Cancer cell specific cytotoxic gene expression mediated by ARF tumor suppressor promoter constructs

    Energy Technology Data Exchange (ETDEWEB)

    Kurayoshi, Kenta [Department of Bioscience, School of Science and Technology, Kwansei Gakuin University, 2-1 Gakuen, Sanda, Hyogo 669-1337 (Japan); Ozono, Eiko [Centre for Molecular Oncology, Barts Cancer Institute, Queen Mary, University of London, John Vane Science Centre, Charterhouse Square, London EC1M 6BQ (United Kingdom); Iwanaga, Ritsuko; Bradford, Andrew P. [Department of Obstetrics and Gynecology, University of Colorado School of Medicine, Anschutz Medical Campus, 12800 East 19th Avenue, Aurora, CO 80045 (United States); Komori, Hideyuki [Center for Stem Cell Biology, Life Sciences Institute, University of Michigan, Ann Arbor, MI 48109 (United States); Ohtani, Kiyoshi, E-mail: btm88939@kwansei.ac.jp [Department of Bioscience, School of Science and Technology, Kwansei Gakuin University, 2-1 Gakuen, Sanda, Hyogo 669-1337 (Japan)

    2014-07-18

    Highlights: • ARF promoter showed higher responsiveness to deregulated E2F activity than the E2F1 promoter. • ARF promoter showed higher cancer cell-specificity than E2F1 promoter to drive gene expression. • HSV-TK driven by ARF promoter showed higher cancer cell-specific cytotoxicity than that driven by E2F1 promoter. - Abstract: In current cancer treatment protocols, such as radiation and chemotherapy, side effects on normal cells are major obstacles to radical therapy. To avoid these side effects, a cancer cell-specific approach is needed. One way to specifically target cancer cells is to utilize a cancer specific promoter to express a cytotoxic gene (suicide gene therapy) or a viral gene required for viral replication (oncolytic virotherapy). For this purpose, the selected promoter should have minimal activity in normal cells to avoid side effects, and high activity in a wide variety of cancers to obtain optimal therapeutic efficacy. In contrast to the AFP, CEA and PSA promoters, which have high activity only in a limited spectrum of tumors, the E2F1 promoter exhibits high activity in wide variety of cancers. This is based on the mechanism of carcinogenesis. Defects in the RB pathway and activation of the transcription factor E2F, the main target of the RB pathway, are observed in almost all cancers. Consequently, the E2F1 promoter, which is mainly regulated by E2F, has high activity in wide variety of cancers. However, E2F is also activated by growth stimulation in normal growing cells, suggesting that the E2F1 promoter may also be highly active in normal growing cells. In contrast, we found that the tumor suppressor ARF promoter is activated by deregulated E2F activity, induced by forced inactivation of pRB, but does not respond to physiological E2F activity induced by growth stimulation. We also found that the deregulated E2F activity, which activates the ARF promoter, is detected only in cancer cell lines. These observations suggest that ARF promoter

  3. The expression of gonadotropin releasing hormone receptor gene in ovaries and uterus cells of Iraqi and Damascus goat breed

    Directory of Open Access Journals (Sweden)

    Alaa kamil Abdulla

    2017-07-01

    Full Text Available Iraqi goats have a major economic role in production of meat, milk and leather as well as it considered a financial source for owners as reproduce twice a year, yet the Damascus goats have great importance than Iraqi goats owing to the number of twin births. The gonadotropin releasing hormone (GnRH and its receptors have great importance in the reproduction and eugenics. To make a comparison between the Iraqi and Damascus goats in terms of this receptor gene expression in the ovaries and uterus tissue cells, the study was performed, in which used the (∆Ct Using a Reference Gene method by quintitive -real time PCR technique. Results were found a significant difference (p<0.05, as the gene expression of (GnRH-R higher in the ovaries and uterus tissue cells in Damascus goats compared with the Iraqi goats. In conclusion; the multiple pregnancies of twins in Damascus goats may be due to an increase gene expression of (GnRH-R in the ovaries and uterus tissue

  4. Four inducible promoters for controlled gene expression in the oleaginous yeast Rhodotorula toruloides

    Directory of Open Access Journals (Sweden)

    Alexander Michael Bedford Johns

    2016-10-01

    Full Text Available Rhodotorula (Rhodosporidium toruloides is an oleaginous yeast with great biotechnological potential, capable of accumulating lipid up to 70 % of its dry biomass, and of carotenoid biosynthesis. However, few molecular genetic tools are available for manipulation of this basidiomycete yeast and its high genomic GC content can make routine cloning difficult. We have developed plasmid vectors for transformation of R. toruloides which include elements for Saccharomyces cerevisiae in-yeast assembly; this method is robust to the assembly of GC-rich DNA and of large plasmids. Using such vectors we screened for controllable promoters, and identified inducible promoters from the genes NAR1, ICL1, CTR3 and MET16. These four promoters have independent induction/repression conditions and exhibit different levels and rates of induction in R. toruloides, making them appropriate for controllable transgene expression in different experimental situations. Nested deletions were used to identify regulatory regions in the four promoters, and to delimit the minimal inducible promoters, which are as small as 200 bp for the NAR1 promoter. The NAR1 promoter shows very tight regulation under repressed conditions as determined both by an EGFP reporter gene and by conditional rescue of a leu2 mutant. These new tools facilitate molecular genetic manipulation and controllable gene expression in R. toruloides.

  5. Characterization of promoter sequence of toll-like receptor genes in Vechur cattle

    Directory of Open Access Journals (Sweden)

    R. Lakshmi

    2016-06-01

    Full Text Available Aim: To analyze the promoter sequence of toll-like receptor (TLR genes in Vechur cattle, an indigenous breed of Kerala with the sequence of Bos taurus and access the differences that could be attributed to innate immune responses against bovine mastitis. Materials and Methods: Blood samples were collected from Jugular vein of Vechur cattle, maintained at Vechur cattle conservation center of Kerala Veterinary and Animal Sciences University, using an acid-citrate-dextrose anticoagulant. The genomic DNA was extracted, and polymerase chain reaction was carried out to amplify the promoter region of TLRs. The amplified product of TLR2, 4, and 9 promoter regions was sequenced by Sanger enzymatic DNA sequencing technique. Results: The sequence of promoter region of TLR2 of Vechur cattle with the B. taurus sequence present in GenBank showed 98% similarity and revealed variants for four sequence motifs. The sequence of the promoter region of TLR4 of Vechur cattle revealed 99% similarity with that of B. taurus sequence but not reveals significant variant in motifregions. However, two heterozygous loci were observed from the chromatogram. Promoter sequence of TLR9 gene also showed 99% similarity to B. taurus sequence and revealed variants for four sequence motifs. Conclusion: The results of this study indicate that significant variation in the promoter of TLR2 and 9 genes in Vechur cattle breed and may potentially link the influence the innate immunity response against mastitis diseases.

  6. Individual Polychlorinated Biphenyl (PCB) Congeners Produce Tissue- and Gene-Specific Effects on Thyroid Hormone Signaling during Development

    Science.gov (United States)

    Giera, Stefanie; Bansal, Ruby; Ortiz-Toro, Theresa M.; Taub, Daniel G.

    2011-01-01

    Polychlorinated biphenyls (PCB) are industrial chemicals linked to developmental deficits that may be caused in part by disrupting thyroid hormone (TH) action by either reducing serum TH or interacting directly with the TH receptor (TR). Individual PCB congeners can activate the TR in vitro when the metabolic enzyme cytochrome P4501A1 (CYP1A1) is induced, suggesting that specific PCB metabolites act as TR agonists. To test this hypothesis in vivo, we compared two combinations of PCB congeners that either activate the TR (PCB 105 and 118) or not (PCB 138 and 153) in the presence or absence of a PCB congener (PCB 126) that induces CYP1A1 in vitro. Aroclor 1254 was used as a positive control, and a group treated with propylthiouracil was included to characterize the effects of low serum TH. We monitored the effects on TH signaling in several peripheral tissues by measuring the mRNA expression of well-known TH-response genes in these tissues. Aroclor 1254 and its component PCB 105/118/126 reduced total T4 to the same extent as that of propylthiouracil but increased the expression of some TH target genes in liver. This effect was strongly correlated with CYP1A1 expression supporting the hypothesis that metabolism is necessary. Effects were gene and tissue specific, indicating that tissue-specific metabolism is an important component of PCB disruption of TH action and that PCB metabolites interact in complex ways with the TR. These are essential mechanisms to consider when evaluating the health risks of contaminant exposures, for both PCB and other polycyclic compounds known to interact with nuclear hormone receptors. PMID:21540284

  7. A milk protein gene promoter directs the expression of human tissue plasminogen activator cDNA to the mammary gland in transgenic mice

    International Nuclear Information System (INIS)

    Pittius, C.W.; Hennighausen, L.; Lee, E.; Westphal, H.; Nicols, E.; Vitale, J.; Gordon, K.

    1988-01-01

    Whey acidic protein (WAP) is a major whey protein in mouse milk. Its gene is expressed in the lactating mammary gland and is inducible by steroid and peptide hormones. A series of transgenic mice containing a hybrid gene in which human tissue plasminogen activator (tPA) cDNA is under the control of the murine WAP gene promoter had previously been generated. In this study, 21 tissues from lactating and virgin transgenic female mice containing the WAP-tPA hybrid gene were screened for the distribution of murine WAP and human tPA transcripts. Like the endogenous WAP RNA, WAP-tPA RNA was expressed predominantly in mammary gland tissue and appeared to be inducible by lactation. Whereas WAP transcripts were not detected in 22 tissues of virgin mice, low levels of WAP-tPA RNA, which were not modulated during lactation, were found in tongue, kidney, and sublingual gland. These studies demonstrate that the WAP gene promoter can target the expression of a transgene to the mammary gland and that this expression is inducible during lactation

  8. Differential effects of simple repeating DNA sequences on gene expression from the SV40 early promoter.

    Science.gov (United States)

    Amirhaeri, S; Wohlrab, F; Wells, R D

    1995-02-17

    The influence of simple repeat sequences, cloned into different positions relative to the SV40 early promoter/enhancer, on the transient expression of the chloramphenicol acetyltransferase (CAT) gene was investigated. Insertion of (G)29.(C)29 in either orientation into the 5'-untranslated region of the CAT gene reduced expression in CV-1 cells 50-100 fold when compared with controls with random sequence inserts. Analysis of CAT-specific mRNA levels demonstrated that the effect was due to a reduction of CAT mRNA production rather than to posttranscriptional events. In contrast, insertion of the same insert in either orientation upstream of the promoter-enhancer or downstream of the gene stimulated gene expression 2-3-fold. These effects could be reversed by cotransfection of a competitor plasmid carrying (G)25.(C)25 sequences. The results suggest that a G.C-binding transcription factor modulates gene expression in this system and that promoter strength can be regulated by providing protein-binding sites in trans. Although constructs containing longer tracts of alternating (C-G), (T-G), or (A-T) sequences inhibited CAT expression when inserted in the 5'-untranslated region of the CAT gene, the amount of CAT mRNA was unaffected. Hence, these inhibitions must be due to posttranscriptional events, presumably at the level of translation. These effects of microsatellite sequences on gene expression are discussed with respect to recent data on related simple repeat sequences which cause several human genetic diseases.

  9. Identifying Growth Conditions for Nicotiana benthimiana Resulting in Predictable Gene Expression of Promoter-Gus Fusion

    Science.gov (United States)

    Sandoval, V.; Barton, K.; Longhurst, A.

    2012-12-01

    Revoluta (Rev) is a transcription factor that establishes leaf polarity inArabidopsis thaliana. Through previous work in Dr. Barton's Lab, it is known that Revoluta binds to the ZPR3 promoter, thus activating the ZPR3 gene product inArabidopsis thaliana. Using this knowledge, two separate DNA constructs were made, one carrying revgene and in the other, the ZPR3 promoter fussed with the GUS gene. When inoculated in Nicotiana benthimiana (tobacco), the pMDC32 plasmid produces the Rev protein. Rev binds to the ZPR3 promoter thereby activating the transcription of the GUS gene, which can only be expressed in the presence of Rev. When GUS protein comes in contact with X-Gluc it produce the blue stain seen (See Figure 1). In the past, variability has been seen of GUS expression on tobacco therefore we hypothesized that changing the growing conditions and leaf age might improve how well it's expressed.

  10. Characterization of the distal promoter of the human pyruvate carboxylase gene in pancreatic beta cells.

    Directory of Open Access Journals (Sweden)

    Ansaya Thonpho

    Full Text Available Pyruvate carboxylase (PC is an enzyme that plays a crucial role in many biosynthetic pathways in various tissues including glucose-stimulated insulin secretion. In the present study, we identify promoter usage of the human PC gene in pancreatic beta cells. The data show that in the human, two alternative promoters, proximal and distal, are responsible for the production of multiple mRNA isoforms as in the rat and mouse. RT-PCR analysis performed with cDNA prepared from human liver and islets showed that the distal promoter, but not the proximal promoter, of the human PC gene is active in pancreatic beta cells. A 1108 bp fragment of the human PC distal promoter was cloned and analyzed. It contains no TATA box but possesses two CCAAT boxes, and other putative transcription factor binding sites, similar to those of the distal promoter of rat PC gene. To localize the positive regulatory region in the human PC distal promoter, 5'-truncated and the 25-bp and 15-bp internal deletion mutants of the human PC distal promoter were generated and used in transient transfections in INS-1 832/13 insulinoma and HEK293T (kidney cell lines. The results indicated that positions -340 to -315 of the human PC distal promoter serve as (an activator element(s for cell-specific transcription factor, while the CCAAT box at -71/-67, a binding site for nuclear factor Y (NF-Y, as well as a GC box at -54/-39 of the human PC distal promoter act as activator sequences for basal transcription.

  11. Functional dissection of a napin gene promoter: identification of promoter elements required for embryo and endosperm-specific transcription.

    Science.gov (United States)

    Ellerström, M; Stålberg, K; Ezcurra, I; Rask, L

    1996-12-01

    The promoter region (-309 to +44) of the Brassica napus storage protein gene napA was studied in transgenic tobacco by successive 5' as well as internal deletions fused to the reporter gene GUS (beta-glucuronidase). The expression in the two main tissues of the seed, the endosperm and the embryo, was shown to be differentially regulated. This tissue-specific regulation within the seed was found to affect the developmental expression during seed development. The region between -309 to -152, which has a large effect on quantitative expression, was shown to harbour four elements regulating embryo and one regulating endosperm expression. This region also displayed enhancer activity. Deletion of eight bp from position -152 to position -144 totally abolished the activity of the napA promoter. This deletion disrupted a cis element with similarity to an ABA-responsive element (ABRE) overlapping with an E-box, demonstrating its crucial importance for quantitative expression. An internal deletion of the region -133 to -120, resulted in increased activity in both leaves and endosperm and a decreased activity in the embryo. Within this region, a cis element similar to the (CA)n element, found in other storage protein promoters, was identified. This suggest that the (CA)n element is important for conferring seed specificity by serving both as an activator and a repressor element.

  12. The promoter of the glucoamylase-encoding gene of Aspergillus niger functions in Ustilago maydis

    Energy Technology Data Exchange (ETDEWEB)

    Smith, T.L. (Dept. of Agriculture, Madison, WI (United States) Univ. of Wisconsin, Madison (United States)); Gaskell, J.; Cullen, D. (Dept. of Agriculture, Madison, WI (United States)); Berka, R.M.; Yang, M.; Henner, D.J. (Genentech Inc., San Francisco, CA (United States))

    1990-01-01

    Promoter sequences from the Aspergillus niger glucoamylase-encoding gene (glaA) were linked to the bacterial hygromycin (Hy) phosphotransferase-encoding gene (hph) and this chimeric marker was used to select Hy-resistant (Hy[sup R]) Ustilago maydis transformants. This is an example of an Ascomycete promoter functioning in a Basidiomycete. Hy[sup R] transformants varied with respect to copy number of integrated vector, mitotic stability, and tolerance to Hy. Only 216 bp of glaA promoter sequence is required for expression in U. maydis but this promoter is not induced by starch as it is in Aspergillus spp. The transcription start points are the same in U. maydis and A. niger.

  13. Detection of growth hormone doping by gene expression profiling of peripheral blood.

    Science.gov (United States)

    Mitchell, Christopher J; Nelson, Anne E; Cowley, Mark J; Kaplan, Warren; Stone, Glenn; Sutton, Selina K; Lau, Amie; Lee, Carol M Y; Ho, Ken K Y

    2009-12-01

    GH abuse is a significant problem in many sports, and there is currently no robust test that allows detection of doping beyond a short window after administration. Our objective was to evaluate gene expression profiling in peripheral blood leukocytes in-vivo as a test for GH doping in humans. Seven men and thirteen women were administered GH, 2 mg/d sc for 8 wk. Blood was collected at baseline and at 8 wk. RNA was extracted from the white cell fraction. Microarray analysis was undertaken using Agilent 44K G4112F arrays using a two-color design. Quantitative RT-PCR using TaqMan gene expression assays was performed for validation of selected differentially expressed genes. GH induced an approximately 2-fold increase in circulating IGF-I that was maintained throughout the 8 wk of the study. GH induced significant changes in gene expression with 353 in women and 41 in men detected with a false discovery rate of less than 5%. None of the differentially expressed genes were common between men and women. The maximal changes were a doubling for up-regulated or halving for down-regulated genes, similar in magnitude to the variation between individuals. Quantitative RT-PCR for seven target genes showed good concordance between microarray and quantitative PCR data in women but not in men. Gene expression analysis of peripheral blood leukocytes is unlikely to be a viable approach for the detection of GH doping.

  14. NGX6 gene mediated by promoter methylation as a potential molecular marker in colorectal cancer

    Directory of Open Access Journals (Sweden)

    Shen Shourong

    2010-04-01

    Full Text Available Abstract Background Nasopharyngeal carcinoma associated gene 6 (NGX6 is down-regulated in most colon cancer cell lines and tumor tissues when compared with their normal tissue samples. As a novel suppress tumor gene, it could inhibit colon cancer cell growth and cell cycle progression. However, little is known about the transcriptional mechanisms controlling NGX6 gene expression. Recent findings suggest that epigenetic inactivation of multiple tumor suppressor genes plays an important role in the tumorigenesis of colorectal carcinoma (CRC. In this study, we explored the role of DNA methylation in regulation of NGX6 transcription. Methods In the present study, we cloned the NGX6 promoter with characteristics of a CpG island by luciferase reporter assay. Then, the CpG methylation status around the NGX6 promoter region in colon cancer cell lines and colorectal tumor tissues was examined by methylation-specific PCR and bisulfite DNA sequencing. Finally, 5-Aza-2'-deoxycytidine (5-Aza-dC treatment was used to confirm the correlation between NGX6 promoter methylation and its gene inactivation. Results The sequence spanning positions -157 to +276 was identified as the NGX6 promoter, in which no canonical TATA boxes were found, while two CAAT boxes and GC boxes were discovered. Methylation status was observed more frequently in 40 colorectal cancer samples than in 40 adjacent normal mucosa samples (18/40 versus 7/40; P Conclusions Down-regulation of NGX6 gene is related to the promoter methylation. DNA methylation of NGX6 promoter might be a potential molecular marker for diagnosis or prognosis, or serve as a therapeutic target.

  15. Relationship between promoter methylation & tissue expression of MGMT gene in ovarian cancer

    Directory of Open Access Journals (Sweden)

    V Shilpa

    2014-01-01

    Full Text Available Background & objectives: Epigenetic alterations, in addition to multiple gene abnormalities, are involved in the genesis and progression of human cancers. Aberrant methylation of CpG islands within promoter regions is associated with transcriptional inactivation of various tumour suppressor genes. O 6 -methyguanine-DNA methyltransferase (MGMT is a DNA repair gene that removes mutagenic and cytotoxic adducts from the O 6 -position of guanine induced by alkylating agents. MGMT promoter hypermethylation and reduced expression has been found in some primary human carcinomas. We studied DNA methylation of CpG islands of the MGMT gene and its relation with MGMT protein expression in human epithelial ovarian carcinoma. Methods: A total of 88 epithelial ovarian cancer (EOC tissue samples, 14 low malignant potential (LMP tumours and 20 benign ovarian tissue samples were analysed for MGMT promoter methylation by nested methylation-specific polymerase chain reaction (MSP after bisulphite modification of DNA. A subset of 64 EOC samples, 10 LMP and benign tumours and five normal ovarian tissue samples were analysed for protein expression by immunohistochemistry. Results: The methylation frequencies of the MGMT gene promoter were found to be 29.5, 28.6 and 20 per cent for EOC samples, LMP tumours and benign cases, respectively. Positive protein expression was observed in 93.8 per cent of EOC and 100 per cent in LMP, benign tumours and normal ovarian tissue samples. Promoter hypermethylation with loss of protein expression was seen only in one case of EOC. Interpretation & conclusions: Our results suggest that MGMT promoter hypermethylation does not always reflect gene expression.

  16. Structure and regulated expression of bovine prolactin and bovine growth hormone genes

    International Nuclear Information System (INIS)

    Rottman, F.; Camper, S.; Goodwin, E.; Hampson, R.; Lyons, R.

    1986-01-01

    This paper presents a description of several studies which utilize the transfection of cloned chimeric genes in an attempt to analyze the regulatory signals found in the bPRL and bGH genes. Examination of 5' flanking region of PRL genes reveals a high degree of sequence homology between the bovine, human, and rat species. In order to assess the existence of possible regulatory sequences in a more direct manner, the authors transfected homologous and heterologous cells with chimeric gene constructs containing possible regulatory sequences derived from both the bPRL and bGH genes. An analysis is presented of the polyadenylation signal contained in the bGH 3' flanking sequence

  17. Comparative analysis of myostatin gene and promoter sequences of Qinchuan and Red Angus cattle.

    Science.gov (United States)

    He, Y L; Wu, Y H; Quan, F S; Liu, Y G; Zhang, Y

    2013-09-04

    To better understand the function of the myostatin gene and its promoter region in bovine, we amplified and sequenced the myostatin gene and promoter from the blood of Qinchuan and Red Angus cattle by using polymerase chain reaction. The sequences of Qinchuan and Red Angus cattle were compared with those of other cattle breeds available in GenBank. Exon splice sites were confirmed by mRNA sequencing. Compared to the published sequence (GenBank accession No. AF320998), 69 single nucleotide polymorphisms (SNPs) were identified in the Qinchuan myostatin gene, only one of which was an insertion mutation in Qinchuan cattle. There was a 16-bp insertion in the first 705-bp intron in 3 Qinchuan cattle. A total of 7 SNPs were identified in exon 3, in which the mutation occurred in the third base of the codon and was synonymous. On comparing the Qinchuan myostatin gene sequence to that of Red Angus cattle, a total of 50 SNPs were identified in the first and third exons. In addition, there were 18 SNPs identified in the Qinchuan cattle promoter region compared with those of other cattle compared to the Red Angus cattle myostatin promoter region. breeds (GenBank accession No. AF348479), but only 14 SNPs when compared to the Red Angus cattle myostatin promoter region.

  18. Gene Expression in Class 2 Integrons Is SOS-Independent and Involves Two Pc Promoters.

    Science.gov (United States)

    Jové, Thomas; Da Re, Sandra; Tabesse, Aurore; Gassama-Sow, Amy; Ploy, Marie-Cécile

    2017-01-01

    Integrons are powerful bacterial genetic elements that permit the expression and dissemination of antibiotic-resistance gene cassettes. They contain a promoter Pc that allows the expression of gene cassettes captured through site-specific recombination catalyzed by IntI, the integron-encoded integrase. Class 1 and 2 integrons are found in both clinical and environmental settings. The regulation of intI and of Pc promoters has been extensively studied in class 1 integrons and the regulatory role of the SOS response on intI expression has been shown. Here we investigated class 2 integrons. We characterized the P intI2 promoter and showed that intI2 expression is not regulated via the SOS response. We also showed that, unlike class 1 integrons, class 2 integrons possess not one but two active Pc promoters that are located within the attI2 region that seem to contribute equally to gene cassette expression. Class 2 integrons mostly encode an inactive truncated integrase, but the rare class 2 integrons that encode an active integrase are associated with less efficient Pc2 promoter variants. We propose an evolutionary model for class 2 integrons in which the absence of repression of the integrase gene expression led to mutations resulting in either inactive integrase or Pc variants of weaker activity, thereby reducing the potential fitness cost of these integrons.

  19. Association of polymorphisms of interleukin-18 gene promoter region with polycystic ovary syndrome in chinese population

    Directory of Open Access Journals (Sweden)

    Li Mei-zhi

    2010-10-01

    Full Text Available Abstract Background Recent research shows that polycystic ovary syndrome (PCOS may have an association with low-grade chronic inflammation, and that PCOS may induce an increase in serum interleukin-18 (IL-18 levels. Methods To investigate the polymorphisms of the IL-18 gene promoters with PCOS, two single nucleotide polymorphisms (SNPs in the promoter of the IL-18 gene (at positions -607C/A and -137G/C in 118 Chinese women with PCOS and 79 controls were evaluated using polymerase chain reaction (PCR. Results No significant differences were found in the genotype distribution, allele frequency and haplotype frequency between the PCOS and control groups. Further analysis demonstrated a relationship between IL-18 gene promoter polymorphisms and PCOS insulin resistance (IR. Regarding the -137 allele frequency, G and C allele frequencies were 93.5% and 6.5%, respectively, in the PCOS with IR patients; G and C allele frequencies were 85.4% and 14.6%, respectively, in PCOS patients without IR (chi2 = 3.601, P = 0.048. Conclusions The presence of a polymorphism in the IL-18 gene was found to have no correlation with the occurrence of PCOS. Carriage of the C allele at position -137 in the promoter of the IL-18 gene may play a protective role from the development of PCOS IR.

  20. Genomic structure and promoter functional analysis of GnRH3 gene in large yellow croaker (Larimichthys crocea).

    Science.gov (United States)

    Huang, Wei; Zhang, Jianshe; Liao, Zhi; Lv, Zhenming; Wu, Huifei; Zhu, Aiyi; Wu, Changwen

    2016-01-15

    Gonadotropin-releasing hormone III (GnRH3) is considered to be a key neurohormone in fish reproduction control. In the present study, the cDNA and genomic sequences of GnRH3 were cloned and characterized from large yellow croaker Larimichthys crocea. The cDNA encoded a protein of 99 amino acids with four functional motifs. The full-length genome sequence was composed of 3797 nucleotides, including four exons and three introns. Higher identities of amino acid sequences and conserved exon-intron organizations were found between LcGnRH3 and other GnRH3 genes. In addition, some special features of the sequences were detected in partial species. For example, two specific residues (V and A) were found in the family Sciaenidae, and the unique 75-72 bp type of the open reading frame 2 and 3 existed in the family Cyprinidae. Analysis of the 2576 bp promoter fragment of LcGnRH3 showed a number of transcription factor binding sites, such as AP1, CREB, GATA-1, HSF, FOXA2, and FOXL1. Promoter functional analysis using an EGFP reporter fusion in zebrafish larvae presented positive signals in the brain, including the olfactory region, the terminal nerve ganglion, the telencephalon, and the hypothalamus. The expression pattern was generally consistent with the endogenous GnRH3 GFP-expressing transgenic zebrafish lines, but the details were different. These results indicate that the structure and function of LcGnRH3 are generally similar to the other teleost GnRH3 genes, but there exist some distinctions among them. Copyright © 2015 Elsevier B.V. All rights reserved.

  1. Effect of feed restriction and subsequent re-alimentation on hormones and genes of the somatotropic axis in cattle.

    Science.gov (United States)

    Keogh, Kate; Waters, Sinéad M; Kelly, Alan K; Wylie, Alastair R G; Kenny, David A

    2015-07-01

    The objective of this study was to characterize the effect of feed restriction and compensatory growth during re-alimentation on the functionality of the somatotropic axis. We blocked 60 bulls into one of two groups: 1) restricted feed allowance for 125 days (period 1) (RES, n = 30) followed by ad libitum feeding for 55 days (period 2) or 2) ad libitum access to feed throughout (ADLIB, n = 30). A growth hormone releasing hormone (GHRH) challenge was performed during each period. At the end of each period, 15 animals from each treatment were slaughtered and hepatic tissue collected. Hepatic expression of 13 genes of the somatotropic axis was measured by qRT-PCR. RES displayed a lower growth rate during period 1 (0.6 vs. 1.9 kg/day; P 0.05); however, resultant plasma IGF-1 was lower in period 1 and greater in period 2 in RES animals (P 0.05). Collectively, the results of this study are consistent with uncoupling of the somatotropic axis following feed restriction. However, there is no evidence from this study that the somatotropic axis per se is a significant contributor to compensatory growth. Copyright © 2015 the American Physiological Society.

  2. Modulation of gene expression by nutritional state and hormones in Bombyx larvae in relation to its growth period.

    Science.gov (United States)

    Thounaojam, Bembem; Keshan, Bela

    2017-11-01

    Insect growth and development are mainly regulated via synchronization of many extrinsic and intrinsic factors such as nutrition and hormones. Previously we have demonstrated that larval growth period influences the effect of insulin on the accumulation of glycogen in the fat body of Bombyx larvae. In the present study we demonstrate that Bombyx larvae at the terminal growth period (TGP, after critical weight) had a significantly greater increase in the expression level of Akt in the fat body than at the active growth period (AGP, before critical weight). The larvae at TGP also showed an increase in the expression level of ecdysone receptors (EcRB1 and USP1) and ecdysone-induced early genes (E75A and broad). The treatment of bovine insulin and methoprene to larvae at AGP induced the transcript levels of Akt, irrespective of the nutritional status of the larvae. However, in larvae at TGP, insulin repressed the transcript level of Akt. On contrary, 20-hydroxyecdysone (20E) induced the expression level of Akt in TGP larvae, but at feeding only. Insulin and 20E thus showed an antagonistic action on the Akt expression level in TGP larvae under feeding. The studies thus showed that larval growth period influences the expression level of Akt and ecdysone receptors in Bombyx. Further, the growth period and nutrition modulate the effect of exogenous hormones on Akt expression. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. Investigating the association between polymorphism of follicle-stimulating hormone receptor gene and ovarian response in controlled ovarian hyperstimulation

    Directory of Open Access Journals (Sweden)

    Mohammad Hasan Sheikhha

    2011-01-01

    Full Text Available Aim : The aim of the study was to investigate the association between follicle-stimulating hormone receptor (FSHR gene polymorphism at Position 680 and the outcomes of controlled ovarian hyperstimulation for in vitro fertilization and embryo transfer (IVF-ET in infertile women. Materials and Methods : One hundred and eight patients under 35 years of age who underwent IVF-ET procedures were included in this study. The hormonal profile and treatment of all patients were analyzed and FSHR polymorphism was examined by polymerase chain reaction-restriction fragment length polymorphism. Women from all groups were classified based on polymorphisms at Position 680, occupied either by asparagines (Asn or serine (Ser as Asn/Asn, Asn/Ser, and Ser/Ser genotype. Result : Our study showed that all patients in the Asn/Asn group were normal responders and in the Asn/Ser group 64.8% were normal responders and 21.1% and 14.1% were poor and hyper responders respectively. In the Ser/Ser group we did not have normal responders and 46.7% of these patients were poor responders and 53.3% were hyper responders. Conclusion : FSH receptor polymorphism is correlated with response to ovarian stimulation.

  4. Effects of corticotropin-releasing hormone and its antagonist on the gene expression of gonadotrophin-releasing hormone (GnRH) and GnRH receptor in the hypothalamus and anterior pituitary gland of follicular phase ewes.

    Science.gov (United States)

    Ciechanowska, Magdalena; Łapot, Magdalena; Malewski, Tadeusz; Mateusiak, Krystyna; Misztal, Tomasz; Przekop, Franciszek

    2011-01-01

    There is no information in the literature regarding the effect of corticotropin-releasing hormone (CRH) on genes encoding gonadotrophin-releasing hormone (GnRH) and the GnRH receptor (GnRHR) in the hypothalamus or on GnRHR gene expression in the pituitary gland in vivo. Thus, the aim of the present study was to investigate, in follicular phase ewes, the effects of prolonged, intermittent infusion of small doses of CRH or its antagonist (α-helical CRH 9-41; CRH-A) into the third cerebral ventricle on GnRH mRNA and GnRHR mRNA levels in the hypothalamo-pituitary unit and on LH secretion. Stimulation or inhibition of CRH receptors significantly decreased or increased GnRH gene expression in the hypothalamus, respectively, and led to different responses in GnRHR gene expression in discrete hypothalamic areas. For example, CRH increased GnRHR gene expression in the preoptic area, but decreased it in the hypothalamus/stalk median eminence and in the anterior pituitary gland. In addition, CRH decreased LH secretion. Blockade of CRH receptors had the opposite effect on GnRHR gene expression. The results suggest that activation of CRH receptors in the hypothalamus of follicular phase ewes can modulate the biosynthesis and release of GnRH through complex changes in the expression of GnRH and GnRHR genes in the hypothalamo-anterior pituitary unit. © CSIRO 2011 Open Access

  5. Light-regulated promoters for tunable, temporal, and affordable control of fungal gene expression.

    Science.gov (United States)

    Fuller, Kevin K; Dunlap, Jay C; Loros, Jennifer J

    2018-05-01

    Regulatable promoters are important genetic tools, particularly for assigning function to essential and redundant genes. They can also be used to control the expression of enzymes that influence metabolic flux or protein secretion, thereby optimizing product yield in bioindustry. This review will focus on regulatable systems for use in filamentous fungi, an important group of organisms whose members include key research models, devastating pathogens of plants and animals, and exploitable cell factories. Though we will begin by cataloging those promoters that are controlled by nutritional or chemical means, our primary focus will rest on those who can be controlled by a literal flip-of-the-switch: promoters of light-regulated genes. The vvd promoter of Neurospora will first serve as a paradigm for how light-driven systems can provide tight, robust, tunable, and temporal control of either autologous or heterologous fungal proteins. We will then discuss a theoretical approach to, and practical considerations for, the development of such promoters in other species. To this end, we have compiled genes from six previously published light-regulated transcriptomic studies to guide the search for suitable photoregulatable promoters in your fungus of interest.

  6. Functional characterization of Pol III U6 promoters for gene knockdown and knockout in Plutella xylostella.

    Science.gov (United States)

    Huang, Yuping; Wang, Yajun; Zeng, Baosheng; Liu, Zhaoxia; Xu, Xuejiao; Meng, Qian; Huang, Yongping; Yang, Guang; Vasseur, Liette; Gurr, Geoff M; You, Minsheng

    2017-10-01

    RNA polymerase type III (Pol-III) promoters such as U6 are commonly used to express small RNAs, including short hairpin RNAs (shRNAs) and single guide RNAs (sgRNAs). Functional U6 promoters are widely used in CRISPR systems, and their characterization can facilitate genome editing of non-model organisms. In the present study, six U6 small nuclear RNA (snRNA) promoters containing two conserved elements of a proximal sequence element (PSEA) and a TATA box, were identified and characterized in the diamondback moth (Plutella xylostella) genome. Relative efficiency of the U6 promoters to express shRNA induced EGFP knockdown was tested in a P. xylostella cell line, revealing that the PxU6:3 promoter had the strongest expression effect. Further work with the PxU6:3 promoter showed its efficacy in EGFP knockout using CRISPR/Cas9 system in the cells. The expression plasmids with versatile Pxabd-A gene specific sgRNA driven by the PxU6:3 promoter, combined with Cas9 mRNA, could induce mutagenesis at specific genomic loci in vivo. The phenotypes induced by sgRNA expression plasmids were similar to those done in vitro transcription sgRNAs. A plasmid with two tandem arranged PxU6:3:sgRNA expression cassettes targeting Pxabd-A loci was generated, which caused a 28,856 bp fragment deletion, suggesting that the multi-sgRNA expression plasmid can be used for multi-targeting. Our work indicates that U6 snRNA promoters can be used for functional studies of genes with the approach of reverse genetics in P. xylostella. These essential promoters also provide valuable potential for CRISPR-derived gene drive as a tactic for population control in this globally significant pest. Copyright © 2017 Elsevier Ltd. All rights reserved.

  7. Quantitative Analyses of Core Promoters Enable Precise Engineering of Regulated Gene Expression in Mammalian Cells

    Science.gov (United States)

    Ede, Christopher; Chen, Ximin; Lin, Meng-Yin; Chen, Yvonne Y.

    2016-01-01

    Inducible transcription systems play a crucial role in a wide array of synthetic biology circuits. However, the majority of inducible promoters are constructed from a limited set of tried-and-true promoter parts, which are susceptible to common shortcomings such as high basal expression levels (i.e., leakiness). To expand the toolbox for regulated mammalian gene expression and facilitate the construction of mammalian genetic circuits with precise functionality, we quantitatively characterized a panel of eight core promoters, including sequences with mammalian, viral, and synthetic origins. We demonstrate that this selection of core promoters can provide a wide range of basal gene expression levels and achieve a gradient of fold-inductions spanning two orders of magnitude. Furthermore, commonly used parts such as minimal CMV and minimal SV40 promoters were shown to achieve robust gene expression upon induction, but also suffer from high levels of leakiness. In contrast, a synthetic promoter, YB_TATA, was shown to combine low basal expression with high transcription rate in the induced state to achieve significantly higher fold-induction ratios compared to all other promoters tested. These behaviors remain consistent when the promoters are coupled to different genetic outputs and different response elements, as well as across different host-cell types and DNA copy numbers. We apply this quantitative understanding of core promoter properties to the successful engineering of human T cells that respond to antigen stimulation via chimeric antigen receptor signaling specifically under hypoxic environments. Results presented in this study can facilitate the design and calibration of future mammalian synthetic biology systems capable of precisely programmed functionality. PMID:26883397

  8. Prognostic utility of the 21-gene assay in hormone receptor-positive operable breast cancer compared with classical clinicopathologic features.

    Science.gov (United States)

    Goldstein, Lori J; Gray, Robert; Badve, Sunil; Childs, Barrett H; Yoshizawa, Carl; Rowley, Steve; Shak, Steven; Baehner, Frederick L; Ravdin, Peter M; Davidson, Nancy E; Sledge, George W; Perez, Edith A; Shulman, Lawrence N; Martino, Silvana; Sparano, Joseph A

    2008-09-01

    Adjuvant! is a standardized validated decision aid that projects outcomes in operable breast cancer based on classical clinicopathologic features and therapy. Genomic classifiers offer the potential to more accurately identify individuals who benefit from chemotherapy than clinicopathologic features. A sample of 465 patients with hormone receptor (HR) -positive breast cancer with zero to three positive axillary nodes who did (n = 99) or did not have recurrence after chemohormonal therapy had tumor tissue evaluated using a 21-gene assay. Histologic grade and HR expression were evaluated locally and in a central laboratory. Recurrence Score (RS) was a highly significant predictor of recurrence, including node-negative and node-positive disease (P < .001 for both) and when adjusted for other clinical variables. RS also predicted recurrence more accurately than clinical variables when integrated by an algorithm modeled after Adjuvant! that was adjusted to 5-year outcomes. The 5-year recurrence rate was only 5% or less for the estimated 46% of patients who have a low RS (< 18). The 21-gene assay was a more accurate predictor of relapse than standard clinical features for individual patients with HR-positive operable breast cancer treated with chemohormonal therapy and provides information that is complementary to features typically used in anatomic staging, such as tumor size and lymph node involvement. The 21-gene assay may be used to select low-risk patients for abbreviated chemotherapy regimens similar to those used in our study or high-risk patients for more aggressive regimens or clinical trials evaluating novel treatments.

  9. Sustained long-term immune responses after in situ gene therapy combined with radiotherapy and hormonal therapy in prostate cancer patients

    International Nuclear Information System (INIS)

    Fujita, Tetsuo; Teh, Bin S.; Timme, Terry L.; Mai, W.-Y.; Satoh, Takefumi; Kusaka, Nobuyuki; Naruishi, Koji; Fattah, Elmoataz Abdel; Aguilar-Cordova, Estuardo; Butler, E. Brian; Thompson, Timothy C.

    2006-01-01

    Purpose: To explore long-term immune responses after combined radio-gene-hormonal therapy. Methods and Materials: Thirty-three patients with prostate specific antigen 10 or higher or Gleason score of 7 or higher or clinical stage T2b to T3 were treated with gene therapy that consisted of 3 separate intraprostatic injections of AdHSV-tk on Days 0, 56, and 70. Each injection was followed by 2 weeks of valacyclovir. Intensity-modulated radiation therapy was delivered 2 days after the second AdHSV-tk injection for 7 weeks. Hormonal therapy was initiated on Day 0 and continued for 4 months or 2.3 years. Blood samples were taken before, during, and after treatment. Lymphocytes were analyzed by fluorescent antibody cell sorting (FACS). Results: Median follow-up was 26 months (range, 4-48 months). The mean percentages of DR + CD8 + T cells were increased at all timepoints up to 8 months. The mean percentages of DR + CD4 + T cells were increased later and sustained longer until 12 months. Long-term (2.3 years) use of hormonal therapy did not affect the percentage of any lymphocyte population. Conclusions: Sustained long-term (up to 8 to 12 months) systemic T-cell responses were noted after combined radio-gene-hormonal therapy for prostate cancer. Prolonged use of hormonal therapy does not suppress this response. These results suggest the potential for sustained activation of cell-mediated immune responses against cancer

  10. Methylation of the leukocyte glucocorticoid receptor gene promoter in adults: associations with early adversity and depressive, anxiety and substance-use disorders.

    Science.gov (United States)

    Tyrka, A R; Parade, S H; Welch, E S; Ridout, K K; Price, L H; Marsit, C; Philip, N S; Carpenter, L L

    2016-07-05

    Early adversity increases risk for developing psychopathology. Epigenetic modification of stress reactivity genes is a likely mechanism contributing to this risk. The glucocorticoid receptor (GR) gene is of particular interest because of the regulatory role of the GR in hypothalamic-pituitary-adrenal (HPA) axis function. Mounting evidence suggests that early adversity is associated with GR promoter methylation and gene expression. Few studies have examined links between GR promoter methylation and psychopathology, and findings to date have been mixed. Healthy adult participants (N=340) who were free of psychotropic medications reported on their childhood experiences of maltreatment and parental death and desertion. Lifetime depressive and anxiety disorders and past substance-use disorders were assessed using the Structured Clinical Interview for the Diagnostic and Statistical Manual of Mental Disorders, Fourth Edition. Methylation of exon 1F of the GR gene (NR3C1) was examined in leukocyte DNA via pyrosequencing. On a separate day, a subset of the participants (n=231) completed the dexamethasone/corticotropin-releasing hormone (Dex/CRH) test. Childhood adversity and a history of past substance-use disorder and current or past depressive or anxiety disorders were associated with lower levels of NR3C1 promoter methylation across the region as a whole and at individual CpG sites (Pdisorder. GR promoter methylation was linked to altered cortisol responses to the Dex/CRH test (Pdepressive, anxiety and substance-use disorders in adults. This finding stands in contrast to our prior work, but is consistent with emerging findings, suggesting complexity in the regulation of this gene.

  11. Spermatogenesis-related ring finger gene ZNF230 promoter: identification and functional analysis

    DEFF Research Database (Denmark)

    Xu, Wenming; Zhang, Sizhong; Qiu, Weimin

    2009-01-01

    reporter Plasmids. Overexpression and site-directed mutation test were used to characterize the cis-element. The results showed ZNF230 gene promoter to be GC rich and not contain a TATA box. Deletion analysis of the 5'-flanking region of ZNF230 in HEK293 cells indicated that the sequence encompassing from...... nt -131 to +152 has a basal transcriptional activity. Site-directed mutation test and mithramycin A treatment demonstrated that the ZNF230 promoter contained a functional Sp1 site. Overexpression of the Sox5 protein activated the promoter activity. A 312-bp fragment surrounding the transcription...

  12. Characterization of Soybean WRKY Gene Family and Identification of Soybean WRKY Genes that Promote Resistance to Soybean Cyst Nematode.

    Science.gov (United States)

    Yang, Yan; Zhou, Yuan; Chi, Yingjun; Fan, Baofang; Chen, Zhixiang

    2017-12-19

    WRKY proteins are a superfamily of plant transcription factors with important roles in plants. WRKY proteins have been extensively analyzed in plant species including Arabidopsis and rice. Here we report characterization of soybean WRKY gene family and their functional analysis in resistance to soybean cyst nematode (SCN), the most important soybean pathogen. Through search of the soybean genome, we identified 174 genes encoding WRKY proteins that can be classified into seven groups as established in other plants. WRKY variants including a WRKY-related protein unique to legumes have also been identified. Expression analysis reveals both diverse expression patterns in different soybean tissues and preferential expression of specific WRKY groups in certain tissues. Furthermore, a large number of soybean WRKY genes were responsive to salicylic acid. To identify soybean WRKY genes that promote soybean resistance to SCN, we first screened soybean WRKY genes for enhancing SCN resistance when over-expressed in transgenic soybean hairy roots. To confirm the results, we transformed five WRKY genes into a SCN-susceptible soybean cultivar and generated transgenic soybean lines. Transgenic soybean lines overexpressing three WRKY transgenes displayed increased resistance to SCN. Thus, WRKY genes could be explored to develop new soybean cultivars with enhanced resistance to SCN.

  13. Modulation of steroidogenic gene expression and hormone production of H295R cells by pharmaceuticals and other environmentally active compounds

    International Nuclear Information System (INIS)

    Gracia, Tannia; Hilscherova, Klara; Jones, Paul D.; Newsted, John L.; Higley, Eric B.; Zhang, Xiaowei; Hecker, Markus; Murphy, Margaret B.; Yu, Richard M.K.; Lam, Paul K.S.; Wu, Rudolf S.S.; Giesy, John P.

    2007-01-01

    The H295R cell bioassay was used to evaluate the potential endocrine disrupting effects of 18 of the most commonly used pharmaceuticals in the United States. Exposures for 48 h with single pharmaceuticals and binary mixtures were conducted; the expression of five steroidogenic genes, 3βHSD2, CYP11β1, CYP11β2, CYP17 and CYP19, was quantified by Q-RT-PCR. Production of the steroid hormones estradiol (E2), testosterone (T) and progesterone (P) was also evaluated. Antibiotics were shown to modulate gene expression and hormone production. Amoxicillin up-regulated the expression of CYP11β2 and CYP19 by more than 2-fold and induced estradiol production up to almost 3-fold. Erythromycin significantly increased CYP11β2 expression and the production of P and E2 by 3.5- and 2.4-fold, respectively, while production of T was significantly decreased. The β-blocker salbutamol caused the greatest induction of CYP17, more than 13-fold, and significantly decreased E2 production. The binary mixture of cyproterone and salbutamol significantly down-regulated expression of CYP19, while a mixture of ethynylestradiol and trenbolone, increased E2 production 3.7-fold. Estradiol production was significantly affected by changes in concentrations of trenbolone, cyproterone, and ethynylestradiol. Exposures with individual pharmaceuticals showed the possible secondary effects that drugs may exert on steroid production. Results from binary mixture exposures suggested the possible type of interactions that may occur between drugs and the joint effects product of such interactions. Dose-response results indicated that although two chemicals may share a common mechanism of action the concentration effects observed may be significantly different

  14. Hormonal modulation of breast cancer gene expression: implications for intrinsic subtyping in pre-menopausal women

    OpenAIRE

    Sarah M Bernhardt; Pallave Dasari; David Walsh; Amanda R Townsend; Amanda R Townsend; Timothy J Price; Timothy J Price; Wendy V Ingman

    2016-01-01

    Clinics are increasingly adopting gene expression profiling to diagnose breast cancer subtype, providing an intrinsic, molecular portrait of the tumour. For example, the PAM50-based Prosigna test quantifies expression of 50 key genes to classify breast cancer subtype, and this method of classification has been demonstrated to be superior over traditional immunohistochemical methods that detect proteins, to predict risk of disease recurrence. However, these tests were largely developed and val...

  15. Hormonal Modulation of Breast Cancer Gene Expression: Implications for Intrinsic Subtyping in Premenopausal Women

    OpenAIRE

    Bernhardt, Sarah M.; Dasari, Pallave; Walsh, David; Townsend, Amanda R.; Price, Timothy J.; Ingman, Wendy V.

    2016-01-01

    Clinics are increasingly adopting gene-expression profiling to diagnose breast cancer subtype, providing an intrinsic, molecular portrait of the tumor. For example, the PAM50-based Prosigna test quantifies expression of 50 key genes to classify breast cancer subtype, and this method of classification has been demonstrated to be superior over traditional immunohistochemical methods that detect proteins, to predict risk of disease recurrence. However, these tests were largely developed and vali...

  16. Developmental processes and responses to hormonal stimuli in tea plant (Camellia sinensis) leaves are controlled by GRF and GIF gene families.

    Science.gov (United States)

    Wu, Zhi-Jun; Wang, Wen-Li; Zhuang, Jing

    2017-09-01

    Tea plant (Camellia sinensis (L.) O. Kuntze) is an important leaf-type woody crop used for producing of non-alcoholic beverages worldwide. The GROWTH-REGULATING FACTOR (GRF) transcription factors cooperated with GRF-INTERACTING FACTOR (GIF) transcriptional coactivators positively regulate leaf development. In the present study, six GRF and two GIF genes were identified and characterized in the leaf transcriptome of C. sinensis, respectively. The alignment results showed that the feature structures of the predicted homologous GRF and GIF proteins of C. sinensis hold a high identity with Arabidopsis and rice. The presence of C. sinensis miR396 target sites suggested that these miR396 members are the potential post-transcriptional regulators of CsGRF genes. The expression profiles of CsGRF and CsGIF1 genes were higher in tender leaves and consistently downregulated during tea plant leaf development. Those results suggested that these genes may be actively involved in the early stage leaf tissue formation in tea plant. The divergence of CsGRF and CsGIF genes in response to different hormonal stimuli revealed the possible multiple functions of these genes in hormonal regulation. This study provided the potential molecular basis of the CsGRF and CsGIF family genes for future functional research on leaf development and hormonal stimuli in C. sinensis.

  17. Effect of pollination and fertilization on the expression of genes related to floral transition, hormone synthesis and berry development in grapevine.

    Science.gov (United States)

    Dauelsberg, Patricia; Matus, José Tomás; Poupin, María Josefina; Leiva-Ampuero, Andrés; Godoy, Francisca; Vega, Andrea; Arce-Johnson, Patricio

    2011-09-15

    In the present work, the effect of assisted fertilization on anatomical, morphological and gene expression changes occurring in carpels and during early stages of berry development in Vitis vinifera were studied. Inflorescences were emasculated before capfall, immediately manually pollinated (EP) and fruit development was compared to emasculated but non-pollinated (ENP) and self-pollinated inflorescences (NESP). The diameter of berries derived from pollinated flowers (EP and NESP) was significantly higher than from non-pollinated flowers (ENP) at 21 days after emasculation/pollination (DAE), and a rapid increase in the size of the inner mesocarp, together with the presence of an embryo-like structure, were observed. The expression of gibberellin oxidases (GA20ox and GA2ox), anthranilate synthase (related to auxin synthesis) and cytokinin synthase coding genes was studied to assess the relationship between hormone synthesis and early berry development, while flower patterning genes were analyzed to describe floral transition. Significant expression changes were found for hormone-related genes, suggesting that their expression at early stages of berry development (13 DAE) is related to cell division and differentiation of mesocarp tissue at a later stage (21 DAE). Expression of hormone-related genes also correlates with the expression of VvHB13, a gene related to mesocarp expansion, and with an increased repression of floral patterning genes (PISTILLATA and TM6), which may contribute to prevent floral transition inhibiting fruit growth before fertilization takes place. Copyright © 2011 Elsevier GmbH. All rights reserved.

  18. Novel strong tissue specific promoter for gene expression in human germ cells

    Directory of Open Access Journals (Sweden)

    Kuzmin Denis

    2010-08-01

    Full Text Available Abstract Background Tissue specific promoters may be utilized for a variety of applications, including programmed gene expression in cell types, tissues and organs of interest, for developing different cell culture models or for use in gene therapy. We report a novel, tissue-specific promoter that was identified and engineered from the native upstream regulatory region of the human gene NDUFV1 containing an endogenous retroviral sequence. Results Among seven established human cell lines and five primary cultures, this modified NDUFV1 upstream sequence (mNUS was active only in human undifferentiated germ-derived cells (lines Tera-1 and EP2102, where it demonstrated high promoter activity (~twice greater than that of the SV40 early promoter, and comparable to the routinely used cytomegaloviral promoter. To investigate the potential applicability of the mNUS promoter for biotechnological needs, a construct carrying a recombinant cytosine deaminase (RCD suicide gene under the control of mNUS was tested in cell lines of different tissue origin. High cytotoxic effect of RCD with a cell-death rate ~60% was observed only in germ-derived cells (Tera-1, whereas no effect was seen in a somatic, kidney-derived control cell line (HEK293. In further experiments, we tested mNUS-driven expression of a hyperactive Sleeping Beauty transposase (SB100X. The mNUS-SB100X construct mediated stable transgene insertions exclusively in germ-derived cells, thereby providing further evidence of tissue-specificity of the mNUS promoter. Conclusions We conclude that mNUS may be used as an efficient promoter for tissue-specific gene expression in human germ-derived cells in many applications. Our data also suggest that the 91 bp-long sequence located exactly upstream NDUFV1 transcriptional start site plays a crucial role in the activity of this gene promoter in vitro in the majority of tested cell types (10/12, and an important role - in the rest two cell lines.

  19. Promoter Analysis Reveals Globally Differential Regulation of Human Long Non-Coding RNA and Protein-Coding Genes

    KAUST Repository

    Alam, Tanvir; Medvedeva, Yulia A.; Jia, Hui; Brown, James B.; Lipovich, Leonard; Bajic, Vladimir B.

    2014-01-01

    raise the possibility that, given the historical reliance on protein-coding gene catalogs to define the chromatin states of active promoters, a revision of these chromatin signature profiles to incorporate expressed lncRNA genes is warranted

  20. MGMT DNA repair gene promoter/enhancer haplotypes alter transcription factor binding and gene expression.

    Science.gov (United States)

    Xu, Meixiang; Cross, Courtney E; Speidel, Jordan T; Abdel-Rahman, Sherif Z

    2016-10-01

    The O 6 -methylguanine-DNA methyltransferase (MGMT) protein removes O 6 -alkyl-guanine adducts from DNA. MGMT expression can thus alter the sensitivity of cells and tissues to environmental and chemotherapeutic alkylating agents. Previously, we defined the haplotype structure encompassing single nucleotide polymorphisms (SNPs) in the MGMT promoter/enhancer (P/E) region and found that haplotypes, rather than individual SNPs, alter MGMT promoter activity. The exact mechanism(s) by which these haplotypes exert their effect on MGMT promoter activity is currently unknown, but we noted that many of the SNPs comprising the MGMT P/E haplotypes are located within or in close proximity to putative transcription factor binding sites. Thus, these haplotypes could potentially affect transcription factor binding and, subsequently, alter MGMT promoter activity. In this study, we test the hypothesis that MGMT P/E haplotypes affect MGMT promoter activity by altering transcription factor (TF) binding to the P/E region. We used a promoter binding TF profiling array and a reporter assay to evaluate the effect of different P/E haplotypes on TF binding and MGMT expression, respectively. Our data revealed a significant difference in TF binding profiles between the different haplotypes evaluated. We identified TFs that consistently showed significant haplotype-dependent binding alterations (p ≤ 0.01) and revealed their role in regulating MGMT expression using siRNAs and a dual-luciferase reporter assay system. The data generated support our hypothesis that promoter haplotypes alter the binding of TFs to the MGMT P/E and, subsequently, affect their regulatory function on MGMT promoter activity and expression level.

  1. Influence of promoting blood circulation to remove blood stasis combined with laparoscopy on serum MCP-1, RANTES, oxidative stress and hormones in infertile patients with endometriosis

    Directory of Open Access Journals (Sweden)

    Xiao-Sha Zhang

    2017-11-01

    Full Text Available Objective: To observe the influence of promoting blood circulation to remove blood stasis combined with laparoscopy on serum MCP-1, RANTES, oxidative stress and hormones in infertile patients with endometriosis. Methods: A total of 60 infertile patients with endometriosis were randomly divided into observation group (30 cases and control group (30 cases. Observation group: promoting blood circulation to remove blood stasis combined with laparoscopy; control group: patients were treated only by laparoscopy. Recording and comparing the levels of MCP-1, RANTES, oxidative stress and hormones before and after treatment. Results: (1 Before treatment, there was no statistically significant difference in the serum MCP-1, RANTES, AOPP, MDA, SOD, levels between the two groups. After treatment, compared with the same group before treatment, the serum RANTES, AOPP, MDA levels of the two groups were significantly lower, the serum SOD level of the two groups were significantly higher, and those levels of observation group were significantly better than the control group, there was significant difference between the two groups. (2 Before treatment, there was no statistically significant difference in the serum FSH, LH, E2, P, PRL levels between the two groups. After treatment, compared with the same group before treatment, the serum FSH, LH, P, PRL levels of the two groups were significantly higher, the serum E2 level of the two groups were significantly lower, and those levels of observation group were significantly better than the control group, there was significant difference between the two groups. Conclusion: Promoting blood circulation to remove blood stasis combined with laparoscopy for infertile patients with endometriosis can reduce the levels of serum MCP-1, RANTES, oxidative stress, hormones and be beneficial to protect their uterine function.

  2. A study of the frequency of methylation of gene promoter regions in ...

    Indian Academy of Sciences (India)

    2013-04-02

    Apr 2, 2013 ... colorectal cancer in the Taiwanese population. CHANG-CHIEH WU1 ... hypermethylation of promoter-region CpG islands is an important ... mismatch repair gene MLH1 plays an important role in dele- ..... Asia Pac. J. Clin.

  3. Characterization of the promoter and upstream activating sequence from the Pseudomonas alcaligenes lipase gene

    NARCIS (Netherlands)

    Cox, M; Gerritse, G; Dankmeyer, L; Quax, W.J.

    2001-01-01

    Pseudomonas alcaligenes secretes a lipase with a high pH optimum, which has interesting properties for application in detergents. The expression of the lipase is strongly dependent on the presence of lipids in the growth medium such as soybean oil. The promoter of the gene was characterized and

  4. Promoter analysis of the Chilo iridescent virus DNA polymerase and major capsid protein genes

    NARCIS (Netherlands)

    Nalcacioglu, R.; Marks, H.; Vlak, J.M.; Demirbag, Z.; Oers, van M.M.

    2003-01-01

    The DNA polymerase (DNApol) and major capsid protein (MCP) genes were used as models to study promoter activity in Chilo iridescent virus (CIV). Infection of Bombyx mori SPC-BM-36 cells in the presence of inhibitors of DNA or protein synthesis showed that DNApol, as well as helicase, is an

  5. Isolation and characterization of a copalyl diphosphate synthase gene promoter from Salvia miltiorrhiza

    Directory of Open Access Journals (Sweden)

    Piotr Szymczyk

    2016-09-01

    Full Text Available The promoter, 5' UTR, and 34-nt 5' fragments of protein encoding region of the Salvia miltiorrhiza copalyl diphosphate synthase gene were cloned and characterized. No tandem repeats, miRNA binding sites, or CpNpG islands were observed in the promoter, 5' UTR, or protein encoding fragments. The entire isolated promoter and 5' UTR is 2235 bp long and contains repetitions of many cis-active elements, recognized by homologous transcription factors, found in Arabidopsis thaliana and other plant species. A pyrimidine-rich fragment with only 6 non-pyrimidine bases was localized in the 33-nt stretch from nt 2185 to 2217 in the 5' UTR. The observed cis-active sequences are potential binding sites for trans-factors that could regulate spatio-temporal CPS gene expression in response to biotic and abiotic stress conditions. Obtained results are initially verified by in silico and co-expression studies based on A. thaliana microarray data. The quantitative RT-PCR analysis confirmed that the entire 2269-bp copalyl diphosphate synthase gene fragment has the promoter activity. Quantitative RT-PCR analysis was used to study changes in CPS promoter activity occurring in response to the application of four selected biotic and abiotic regulatory factors; auxin, gibberellin, salicylic acid, and high-salt concentration.

  6. The gene encoding the melanin-concentrating hormone receptor 1 is associated with schizophrenia in a Danish case-control sample

    DEFF Research Database (Denmark)

    Demontis, Ditte; Nyegaard, Mette; Christensen, Jane H

    2012-01-01

    OBJECTIVE: The MCHR1 gene encoding the melanin-concentrating hormone receptor 1 is located on chromosome 22q13.2 and has previously been associated with schizophrenia in a study of cases and controls from the Faroe Islands and Scotland. Herein we report an association between variations in the MCHR...

  7. Cardiac-Specific Gene Expression Facilitated by an Enhanced Myosin Light Chain Promoter

    Directory of Open Access Journals (Sweden)

    Wolfgang Boecker

    2004-04-01

    Full Text Available Background: Adenoviral gene transfer has been shown to be effective in cardiac myocytes in vitro and in vivo. A major limitation of myocardial gene therapy is the extracardiac transgene expression. Methods: To minimize extracardiac gene expression, we have constructed a tissue-specific promoter for cardiac gene transfer, namely, the 250-bp fragment of the myosin light chain-2v (MLC-2v gene, which is known to be expressed in a tissue-specific manner in ventricular myocardium followed by a luciferase (luc reporter gene (Ad.4 × MLC250.Luc. Rat cardiomyocytes, liver and kidney cells were infected with Ad.4 × MLC.Luc or control vectors. For in vivo testing, Ad.4 × MLC250.Luc was injected into the myocardium or in the liver of rats. Kinetics of promoter activity were monitored over 8 days using a cooled CCD camera. Results: In vitro: By infecting hepatic versus cardiomyocyte cells, we found that the promoter specificity ratio (luc activity in cardiomyocytes per liver cells was 20.4 versus 0.9 (Ad.4 × MLC250.Luc vs. Ad.CMV. In vivo: Ad.4 × MLC250.Luc significantly reduced luc activity in liver (38.4-fold, lung (16.1-fold, and kidney (21.8-fold versus Ad.CMV (p = .01; whereas activity in the heart was only 3.8-fold decreased. The gene expression rate of cardiomyocytes versus hepatocytes was 7:1 (Ad.4 × MLC.Luc versus 1:1.4 (Ad.CMV.Luc. Discussion: This new vector may be useful to validate therapeutic approaches in animal disease models and offers the perspective for selective expression of therapeutic genes in the diseased heart.

  8. Medicago truncatula SOC1 Genes Are Up-regulated by Environmental Cues That Promote Flowering

    Directory of Open Access Journals (Sweden)

    Jared B. Fudge

    2018-04-01

    Full Text Available Like Arabidopsis thaliana, the flowering of the legume Medicago truncatula is promoted by long day (LD photoperiod and vernalization. However, there are differences in the molecular mechanisms involved, with orthologs of two key Arabidopsis thaliana regulators, FLOWERING LOCUS C (FLC and CONSTANS (CO, being absent or not having a role in flowering time function in Medicago. In Arabidopsis, the MADS-box transcription factor gene, SUPPRESSOR OF OVEREXPRESSION OF CONSTANS 1 (AtSOC1, plays a key role in integrating the photoperiodic and vernalization pathways. In this study, we set out to investigate whether the Medicago SOC1 genes play a role in regulating flowering time. Three Medicago SOC1 genes were identified and characterized (MtSOC1a–MtSOC1c. All three MtSOC1 genes, when heterologously expressed, were able to promote earlier flowering of the late-flowering Arabidopsis soc1-2 mutant. The three MtSOC1 genes have different patterns of expression. However, consistent with a potential role in flowering time regulation, all three MtSOC1 genes are expressed in the shoot apex and are up-regulated in the shoot apex of plants in response to LD photoperiods and vernalization. The up-regulation of MtSOC1 genes was reduced in Medicago fta1-1 mutants, indicating that they are downstream of MtFTa1. Insertion mutant alleles of Medicago soc1b do not flower late, suggestive of functional redundancy among Medicago SOC1 genes in promoting flowering.

  9. Associations between Single-Nucleotide Polymorphisms in Corticotropin-Releasing Hormone-Related Genes and Irritable Bowel Syndrome.

    Directory of Open Access Journals (Sweden)

    Ayaka Sasaki

    Full Text Available Irritable bowel syndrome (IBS is a common functional disorder with distinct features of stress-related pathophysiology. A key mediator of the stress response is corticotropin-releasing hormone (CRH. Although some candidate genes have been identified in stress-related disorders, few studies have examined CRH-related gene polymorphisms. Therefore, we tested our hypothesis that single-nucleotide polymorphisms (SNPs in CRH-related genes influence the features of IBS.In total, 253 individuals (123 men and 130 women participated in this study. They comprised 111 IBS individuals and 142 healthy controls. The SNP genotypes in CRH (rs28364015 and rs6472258 and CRH-binding protein (CRH-BP (rs10474485 were determined by direct sequencing and real-time polymerase chain reaction. The emotional states of the subjects were evaluated using the State-Trait Anxiety Inventory, Perceived Stress Scale, and the Self-rating Depression Scale.Direct sequencing of the rs28364015 SNP of CRH revealed no genetic variation among the study subjects. There was no difference in the genotype distributions and allele frequencies of rs6472258 and rs10474485 between IBS individuals and controls. However, IBS subjects with diarrhea symptoms without the rs10474485 A allele showed a significantly higher emotional state score than carriers.These results suggest that the CRH and CRH-BP genes have no direct effect on IBS status. However, the CRH-BP SNP rs10474485 has some effect on IBS-related emotional abnormalities and resistance to psychosocial stress.

  10. The artificial zinc finger coding gene 'Jazz' binds the utrophin promoter and activates transcription.

    Science.gov (United States)

    Corbi, N; Libri, V; Fanciulli, M; Tinsley, J M; Davies, K E; Passananti, C

    2000-06-01

    Up-regulation of utrophin gene expression is recognized as a plausible therapeutic approach in the treatment of Duchenne muscular dystrophy (DMD). We have designed and engineered new zinc finger-based transcription factors capable of binding and activating transcription from the promoter of the dystrophin-related gene, utrophin. Using the recognition 'code' that proposes specific rules between zinc finger primary structure and potential DNA binding sites, we engineered a new gene named 'Jazz' that encodes for a three-zinc finger peptide. Jazz belongs to the Cys2-His2 zinc finger type and was engineered to target the nine base pair DNA sequence: 5'-GCT-GCT-GCG-3', present in the promoter region of both the human and mouse utrophin gene. The entire zinc finger alpha-helix region, containing the amino acid positions that are crucial for DNA binding, was specifically chosen on the basis of the contacts more frequently represented in the available list of the 'code'. Here we demonstrate that Jazz protein binds specifically to the double-stranded DNA target, with a dissociation constant of about 32 nM. Band shift and super-shift experiments confirmed the high affinity and specificity of Jazz protein for its DNA target. Moreover, we show that chimeric proteins, named Gal4-Jazz and Sp1-Jazz, are able to drive the transcription of a test gene from the human utrophin promoter.

  11. Chronological gene expression of parathyroid hormone-related protein (PTHrP) in the stellate reticulum of the rat: implications for tooth eruption.

    Science.gov (United States)

    Yao, Shaomian; Pan, Fenghui; Wise, Gary E

    2007-03-01

    Tooth eruption is a localized event that requires the expression of certain molecules at precise times to regulate bone resorption and bone formation. Parathyroid hormone-related protein (PTHrP) may be one of those molecules. Although PTHrP is produced in the stellate reticulum (SR) of the tooth and exerts its effect on the adjacent dental follicle, its expression pattern in the SR is unknown. Thus, it was the objectives of this study to determine the chronology of expression of PTHrP, and then to determine its effect on vascular endothelial growth factor (VEGF) expression for osteoclastogenesis and on bone morphogenetic protein-2 (BMP-2) for bone growth. Laser capture microdissection and RT-PCR were used to determine the chronological expression of PTHrP in vivo. In vitro, dental follicle cells were incubated with PTHrP and RT-PCR was conducted to determine its effect on VEGF and BMP-2 gene expression. PTHrP was maximally expressed at day 7 postnatally in the SR with the level of expression still high at day 9. In vitro, PTHrP upregulated VEGF120 and VEGF164 expression after 4h of incubation with a maximum effect at 6h. PTHrP upregulated BMP-2 gene expression with a maximal effect at 2h. Because the secondary burst of osteoclastogenesis needed for eruption occurs around day 10, it is possible that PTHrP is stimulating this osteoclastogenesis by upregulating VEGF. Concurrently, the upregulation of BMP-2 by PTHrP may stimulate bone growth at the base of the bony crypt to promote eruption.

  12. Highly specific expression of luciferase gene in lungs of naive nude mice directed by prostate-specific antigen promoter

    International Nuclear Information System (INIS)

    Li Hongwei; Li Jinzhong; Helm, Gregory A.; Pan Dongfeng

    2005-01-01

    PSA promoter has been demonstrated the utility for tissue-specific toxic gene therapy in prostate cancer models. Characterization of foreign gene overexpression in normal animals elicited by PSA promoter should help evaluate therapy safety. Here we constructed an adenovirus vector (AdPSA-Luc), containing firefly luciferase gene under the control of the 5837 bp long prostate-specific antigen promoter. A charge coupled device video camera was used to non-invasively image expression of firefly luciferase in nude mice on days 3, 7, 11 after injection of 2 x 10 9 PFU of AdPSA-Luc virus via tail vein. The result showed highly specific expression of the luciferase gene in lungs of mice from day 7. The finding indicates the potential limitations of the suicide gene therapy of prostate cancer based on selectivity of PSA promoter. By contrary, it has encouraging implications for further development of vectors via PSA promoter to enable gene therapy for pulmonary diseases

  13. Diethylstilbestrol (DES)-stimulated hormonal toxicity is mediated by ERα alteration of target gene methylation patterns and epigenetic modifiers (DNMT3A, MBD2, and HDAC2) in the mouse seminal vesicle.

    Science.gov (United States)

    Li, Yin; Hamilton, Katherine J; Lai, Anne Y; Burns, Katherine A; Li, Leping; Wade, Paul A; Korach, Kenneth S

    2014-03-01

    Diethylstilbestrol (DES) is a synthetic estrogen associated with adverse effects on reproductive organs. DES-induced toxicity of the mouse seminal vesicle (SV) is mediated by estrogen receptor α (ERα), which alters expression of seminal vesicle secretory protein IV (Svs4) and lactoferrin (Ltf) genes. We examined a role for nuclear receptor activity in association with DNA methylation and altered gene expression. We used the neonatal DES exposure mouse model to examine DNA methylation patterns via bisulfite conversion sequencing in SVs of wild-type (WT) and ERα-knockout (αERKO) mice. The DNA methylation status at four specific CpGs (-160, -237, -306, and -367) in the Svs4 gene promoter changed during mouse development from methylated to unmethylated, and DES prevented this change at 10 weeks of age in WT SV. At two specific CpGs (-449 and -459) of the Ltf gene promoter, DES altered the methylation status from methylated to unmethylated. Alterations in DNA methylation of Svs4 and Ltf were not observed in αERKO SVs, suggesting that changes of methylation status at these CpGs are ERα dependent. The methylation status was associated with the level of gene expression. In addition, gene expression of three epigenetic modifiers-DNMT3A, MBD2, and HDAC2-increased in the SV of DES-exposed WT mice. DES-induced hormonal toxicity resulted from altered gene expression of Svs4 and Ltf associated with changes in DNA methylation that were mediated by ERα. Alterations in gene expression of DNMT3A, MBD2, and HDAC2 in DES-exposed male mice may be involved in mediating the changes in methylation status in the SV. Li Y, Hamilton KJ, Lai AY, Burns KA, Li L, Wade PA, Korach KS. 2014. Diethylstilbestrol (DES)-stimulated hormonal toxicity is mediated by ERα alteration of target gene methylation patterns and epigenetic modifiers (DNMT3A, MBD2, and HDAC2) in the mouse seminal vesicle. Environ Health Perspect 122:262-268; http://dx.doi.org/10.1289/ehp.1307351.

  14. Identification of distal silencing elements in the murine interferon-A11 gene promoter.

    Science.gov (United States)

    Roffet, P; Lopez, S; Navarro, S; Bandu, M T; Coulombel, C; Vignal, M; Doly, J; Vodjdani, G

    1996-08-01

    The murine interferon-A11 (Mu IFN-A11) gene is a member of the IFN-A multigenic family. In mouse L929 cells, the weak response of the gene's promoter to viral induction is due to a combination of both a point mutation in the virus responsive element (VRE) and the presence of negatively regulating sequences surrounding the VRE. In the distal part of the promoter, the negatively acting E1E2 sequence was delimited. This sequence displays an inhibitory effect in either orientation or position on the inducibility of a virus-responsive heterologous promoter. It selectively represses VRE-dependent transcription but is not able to reduce the transcriptional activity of a VRE-lacking promoter. In a transient transfection assay, an E1E2-containing DNA competitor was able to derepress the native Mu IFN-A11 promoter. Specific nuclear factors bind to this sequence; thus the binding of trans-regulators participates in the repression of the Mu IFN-A11 gene. The E1E2 sequence contains an IFN regulatory factor (IRF)-binding site. Recombinant IRF2 binds this sequence and anti-IRF2 antibodies supershift a major complex formed with nuclear extracts. The protein composing the complex is 50 kDa in size, indicating the presence of IRF2 or antigenically related proteins in the complex. The Mu IFN-A11 gene is the first example within the murine IFN-A family, in which a distal promoter element has been identified that can negatively modulate the transcriptional response to viral induction.

  15. CpG promoter methylation of the ALKBH3 alkylation repair gene in breast cancer.

    Science.gov (United States)

    Stefansson, Olafur Andri; Hermanowicz, Stefan; van der Horst, Jasper; Hilmarsdottir, Holmfridur; Staszczak, Zuzanna; Jonasson, Jon Gunnlaugur; Tryggvadottir, Laufey; Gudjonsson, Thorkell; Sigurdsson, Stefan

    2017-07-05

    DNA repair of alkylation damage is defective in various cancers. This occurs through somatically acquired inactivation of the MGMT gene in various cancer types, including breast cancers. In addition to MGMT, the two E. coli AlkB homologs ALKBH2 and ALKBH3 have also been linked to direct reversal of alkylation damage. However, it is currently unknown whether ALKBH2 or ALKBH3 are found inactivated in cancer. Methylome datasets (GSE52865, GSE20713, GSE69914), available through Omnibus, were used to determine whether ALKBH2 or ALKBH3 are found inactivated by CpG promoter methylation. TCGA dataset enabled us to then assess the impact of CpG promoter methylation on mRNA expression for both ALKBH2 and ALKBH3. DNA methylation analysis for the ALKBH3 promoter region was carried out by pyrosequencing (PyroMark Q24) in 265 primary breast tumours and 30 proximal normal breast tissue samples along with 8 breast-derived cell lines. ALKBH3 mRNA and protein expression were analysed in cell lines using RT-PCR and Western blotting, respectively. DNA alkylation damage assay was carried out in cell lines based on immunofluorescence and confocal imaging. Data on clinical parameters and survival outcomes in patients were obtained and assessed in relation to ALKBH3 promoter methylation. The ALKBH3 gene, but not ALKBH2, undergoes CpG promoter methylation and transcriptional silencing in breast cancer. We developed a quantitative alkylation DNA damage assay based on immunofluorescence and confocal imaging revealing higher levels of alkylation damage in association with epigenetic inactivation of the ALKBH3 gene (P = 0.029). In our cohort of 265 primary breast cancer, we found 72 cases showing aberrantly high CpG promoter methylation over the ALKBH3 promoter (27%; 72 out of 265). We further show that increasingly higher degree of ALKBH3 promoter methylation is associated with reduced breast-cancer specific survival times in patients. In this analysis, ALKBH3 promoter methylation at >20

  16. Lack of death receptor 4 (DR4) expression through gene promoter methylation in gastric carcinoma.

    Science.gov (United States)

    Lee, Kyung Hwa; Lim, Sang Woo; Kim, Ho Gun; Kim, Dong Yi; Ryu, Seong Yeob; Joo, Jae Kyun; Kim, Jung Chul; Lee, Jae Hyuk

    2009-07-01

    To determine the underlying mechanism for the differential expression, the extent of promoter methylation in tumor necrosis factor-related apoptosis-inducing ligand (TRAIL)-related genes acting downstream of TRAIL was examined in early and advanced gastric carcinomas. The extent of promoter methylation in the DR4, DR5, DcR1, DcR2, and CASP8 genes was quantified using bisulfite modification and methylation-specific polymerase chain reaction. The promoters for DcR1, DcR2, and CASP8 were largely unmethylated in early gastric carcinoma, advanced gastric carcinoma, and controls, with no significant difference among them. Protein levels of DR4, DcR1, and DcR2 as revealed by immunohistochemistry correlated with the extent of the respective promoter methylation (P < 0.05 in all cases). Hypomethylation, rather than hypermethylation, of the DR4 promoter was noted in invasive gastric malignancies, with statistical significance (P = 0.003). The promoter methylation status of TRAIL receptors in gastric carcinoma may have clinical implications for improving therapeutic strategies in patients with gastric carcinoma.

  17. Multidrug resistance gene expression is controlled by steroid hormones in the secretory epithelium of the uterus

    NARCIS (Netherlands)

    Arceci, R. J.; Baas, F.; Raponi, R.; Horwitz, S. B.; Housman, D.; Croop, J. M.

    1990-01-01

    The multidrug resistance (mdr) gene family has been shown to encode a membrane glycoprotein, termed the P-glycoprotein, which functions as a drug efflux pump with broad substrate specificity. This multigene family is expressed in a tissue-specific fashion in a wide variety of normal and neoplastic

  18. Gene probes to detect cross-culture contamination in hormone producing cell lines

    DEFF Research Database (Denmark)

    Matsuba, I; Lernmark, A; Madsen, Ole Dragsbæk

    1988-01-01

    hamster insulin gene. Karyotyping confirmed the absence of human chromosomes in the Clone-16 cells while sizes, centromere indices, and banding patterns were identical to Syrian hamster fibroblasts. We conclude that the insulin-producing Clone-16 cells are of Syrian hamster origin and demonstrate...

  19. New in vitro reporter gene bioassays for screening of hormonal active compounds in the environment

    Czech Academy of Sciences Publication Activity Database

    Svobodová, Kateřina; Cajthaml, Tomáš

    2010-01-01

    Roč. 88, č. 4 (2010), s. 839-847 ISSN 0175-7598 R&D Projects: GA ČR GAP503/10/0408 Institutional research plan: CEZ:AV0Z50200510 Keywords : endocrine disruptors * in vitro bioassays * reporter gene assays Subject RIV: EE - Microbiology, Virology Impact factor: 3.280, year: 2010

  20. Gene array and real time PCR analysis of the adrenal sensitivity to adrenocorticotropic hormone in pig

    Directory of Open Access Journals (Sweden)

    SanCristobal Magali

    2008-02-01

    Full Text Available Abstract Background Variability in hypothalamic-pituitary-adrenal (HPA axis activity has been shown to be influenced by genetic factors and related to great metabolic differences such as obesity. The aim of this study was to investigate molecular bases of genetic variability of the adrenal sensitivity to ACTH, a major source of variability, in Meishan (MS and Large White (LW pigs, MS being reported to exhibit higher basal cortisol levels, response to ACTH and fatness than LW. A pig cDNA microarray was used to identify changes in gene expression in basal conditions and in response to ACTH stimulation. Results Genotype and/or ACTH affected the expression of 211 genes related to transcription, cell growth/maintenance, signal transduction, cell structure/adhesion/extra cellular matrix and protein kinase/phosphatase activity. No change in the expression of known key regulator proteins of the ACTH signaling pathway or of steroidogenic enzymes was found. However, Mdh2, Sdha, Suclg2, genes involved in the tricarboxylic acid (TCA pathway, were over-expressed in MS pigs. Higher TCA cycle activity in MS than in LW may thus result in higher steroidogenic activity and thus explain the typically higher cortisol levels in MS compared to LW. Moreover, up-regulation of Star and Ldlr genes in MS and/or in response to ACTH suggest that differences in the adrenal function between MS and LW may also involve mechanisms requisite for cholesterol supply to steroidogenesis. Conclusion The present study provides new potential candidate genes to explain genetic variations in the adrenal sensitivity to ACTH and better understand relationship between HPA axis activity and obesity.

  1. The Growth Hormone Receptor Gene-Disrupted (GHR-KO) Mouse Fails to Respond to an Intermittent Fasting (IF) Diet

    Science.gov (United States)

    Arum, Oge; Bonkowski, Michael S.; Rocha, Juliana S.; Bartke, Andrzej

    2009-01-01

    SUMMARY The interaction of longevity-conferring genes with longevity-conferring diets is poorly understood. The growth hormone receptor gene-disrupted (GHR-KO) mouse is long-lived; and this longevity is not responsive to 30% caloric restriction (CR), in contrast to wild-type animals from the same strain. To determine whether this may have been limited to a particular level of dietary restriction (DR), we subjected GHR-KO mice to a different dietary restriction regimen, an intermittent fasting (IF) diet. The IF diet increased the survivorship and improved insulin sensitivity of normal males, but failed to affect either parameter in GHR-KO mice. From the results of two paradigms of dietary restriction we postulate that GHR-KO mice would be resistant to any manner of DR; potentially due to their inability to further enhance insulin sensitivity. Insulin sensitivity may be a mechanism and/or a marker of the lifespan-extending potential of an intervention. PMID:19747233

  2. Identification of Differentially Expressed Thyroid Hormone Responsive Genes from the Brain of the Mexican Axolotl (Ambystoma mexicanum) ✧

    Science.gov (United States)

    Huggins, P; Johnson, CK; Schoergendorfer, A; Putta, S; Bathke, AC; Stromberg, AJ; Voss, SR

    2011-01-01

    The Mexican axolotl (Ambystoma mexicanum) presents an excellent model to investigate mechanisms of brain development that are conserved among vertebrates. In particular, metamorphic changes of the brain can be induced in free-living aquatic juveniles and adults by simply adding thyroid hormone (T4) to rearing water. Whole brains were sampled from juvenile A. mexicanum that were exposed to 0, 8, and 18 days of 50 nM T4, and these were used to isolate RNA and make normalized cDNA libraries for 454 DNA sequencing. A total of 1,875,732 high quality cDNA reads were assembled with existing ESTs to obtain 5,884 new contigs for human RefSeq protein models, and to develop a custom Affymetrix gene expression array (Amby_002) with approximately 20,000 probe sets. The Amby_002 array was used to identify 303 transcripts that differed statistically (p 1.5) as a function of days of T4 treatment. Further statistical analyses showed that Amby_002 performed concordantly in comparison to an existing, small format expression array. This study introduces a new A. mexicanum microarray resource for the community and the first lists of T4-responsive genes from the brain of a salamander amphibian. PMID:21457787

  3. Identification of differentially expressed thyroid hormone responsive genes from the brain of the Mexican Axolotl (Ambystoma mexicanum).

    Science.gov (United States)

    Huggins, P; Johnson, C K; Schoergendorfer, A; Putta, S; Bathke, A C; Stromberg, A J; Voss, S R

    2012-01-01

    The Mexican axolotl (Ambystoma mexicanum) presents an excellent model to investigate mechanisms of brain development that are conserved among vertebrates. In particular, metamorphic changes of the brain can be induced in free-living aquatic juveniles and adults by simply adding thyroid hormone (T4) to rearing water. Whole brains were sampled from juvenile A. mexicanum that were exposed to 0, 8, and 18 days of 50 nM T4, and these were used to isolate RNA and make normalized cDNA libraries for 454 DNA sequencing. A total of 1,875,732 high quality cDNA reads were assembled with existing ESTs to obtain 5884 new contigs for human RefSeq protein models, and to develop a custom Affymetrix gene expression array (Amby_002) with approximately 20,000 probe sets. The Amby_002 array was used to identify 303 transcripts that differed statistically (p1.5) as a function of days of T4 treatment. Further statistical analyses showed that Amby_002 performed concordantly in comparison to an existing, small format expression array. This study introduces a new A. mexicanum microarray resource for the community and the first lists of T4-responsive genes from the brain of a salamander amphibian. Copyright © 2011 Elsevier Inc. All rights reserved.

  4. Association of the thyroid stimulating hormone receptor gene (TSHR) with Graves' disease

    DEFF Research Database (Denmark)

    Brand, Oliver J; Barrett, Jeffrey C; Simmonds, Matthew J

    2009-01-01

    hormone, causing the characteristic clinical phenotype. Although early studies investigating the TSHR and GD proved inconclusive, more recently we provided convincing evidence for association of the TSHR region with disease. In the current study, we investigated a combined panel of 98 SNPs, including 70...... tag SNPs, across an extended 800 kb region of the TSHR to refine association in a cohort of 768 GD subjects and 768 matched controls. In total, 28 SNPs revealed association with GD (P associations at rs179247 (chi(2) = 32.45, P = 8.90 x 10(-8), OR = 1.53, 95% CI = 1.......32-1.78) and rs12101255 (chi(2) = 30.91, P = 1.95 x 10(-7), OR = 1.55, 95% CI = 1.33-1.81), both located in intron 1 of the TSHR. Association of the most associated SNP, rs179247, was replicated in 303 GD families (P = 7.8 x 10(-4)). In addition, we provide preliminary evidence that the disease-associated...

  5. A database of annotated promoters of genes associated with common respiratory and related diseases

    KAUST Repository

    Chowdhary, Rajesh; Tan, Sinlam; Pavesi, Giulio; Jin, Gg; Dong, Difeng; Mathur, Sameer K.; Burkart, Arthur; Narang, Vipin; Glurich, Ingrid E.; Raby, Benjamin A.; Weiss, Scott T.; Limsoon, Wong; Liu, Jun; Bajic, Vladimir B.

    2012-01-01

    Many genes have been implicated in the pathogenesis of common respiratory and related diseases (RRDs), yet the underlying mechanisms are largely unknown. Differential gene expression patterns in diseased and healthy individuals suggest that RRDs affect or are affected by modified transcription regulation programs. It is thus crucial to characterize implicated genes in terms of transcriptional regulation. For this purpose, we conducted a promoter analysis of genes associated with 11 common RRDs including allergic rhinitis, asthma, bronchiectasis, bronchiolitis, bronchitis, chronic obstructive pulmonary disease, cystic fibrosis, emphysema, eczema, psoriasis, and urticaria, many of which are thought to be genetically related. The objective of the present study was to obtain deeper insight into the transcriptional regulation of these disease-associated genes by annotating their promoter regions with transcription factors (TFs) and TF binding sites (TFBSs). We discovered many TFs that are significantly enriched in the target disease groups including associations that have been documented in the literature. We also identified a number of putative TFs/TFBSs that appear to be novel. The results of our analysis are provided in an online database that is freely accessible to researchers at http://www.respiratorygenomics.com. Promoter-associated TFBS information and related genomic features, such as histone modification sites, microsatellites, CpG islands, and SNPs, are graphically summarized in the database. Users can compare and contrast underlying mechanisms of specific RRDs relative to candidate genes, TFs, gene ontology terms, micro-RNAs, and biological pathways for the conduct of metaanalyses. This database represents a novel, useful resource for RRD researchers. Copyright © 2012 by the American Thoracic Society.

  6. A database of annotated promoters of genes associated with common respiratory and related diseases

    KAUST Repository

    Chowdhary, Rajesh

    2012-07-01

    Many genes have been implicated in the pathogenesis of common respiratory and related diseases (RRDs), yet the underlying mechanisms are largely unknown. Differential gene expression patterns in diseased and healthy individuals suggest that RRDs affect or are affected by modified transcription regulation programs. It is thus crucial to characterize implicated genes in terms of transcriptional regulation. For this purpose, we conducted a promoter analysis of genes associated with 11 common RRDs including allergic rhinitis, asthma, bronchiectasis, bronchiolitis, bronchitis, chronic obstructive pulmonary disease, cystic fibrosis, emphysema, eczema, psoriasis, and urticaria, many of which are thought to be genetically related. The objective of the present study was to obtain deeper insight into the transcriptional regulation of these disease-associated genes by annotating their promoter regions with transcription factors (TFs) and TF binding sites (TFBSs). We discovered many TFs that are significantly enriched in the target disease groups including associations that have been documented in the literature. We also identified a number of putative TFs/TFBSs that appear to be novel. The results of our analysis are provided in an online database that is freely accessible to researchers at http://www.respiratorygenomics.com. Promoter-associated TFBS information and related genomic features, such as histone modification sites, microsatellites, CpG islands, and SNPs, are graphically summarized in the database. Users can compare and contrast underlying mechanisms of specific RRDs relative to candidate genes, TFs, gene ontology terms, micro-RNAs, and biological pathways for the conduct of metaanalyses. This database represents a novel, useful resource for RRD researchers. Copyright © 2012 by the American Thoracic Society.

  7. Analysis of tissue-specific region in sericin 1 gene promoter of Bombyx mori

    Energy Technology Data Exchange (ETDEWEB)

    Yan, Liu [College of Biomedical Engineering and Instrument Science, Zhejiang University, Hangzhou 310027 (China); Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Lian, Yu [College of Biomedical Engineering and Instrument Science, Zhejiang University, Hangzhou 310027 (China); Zhejiang Province Key Laboratory of Preventive Veterinary Medicine, Institute of Preventive Veterinary Medicine, Zhejiang University, Hangzhou 310029 (China); Xiuyang, Guo [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Tingqing, Guo [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Shengpeng, Wang [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Changde, Lu [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China)

    2006-03-31

    The gene encoding sericin 1 (Ser1) of silkworm (Bombyx mori) is specifically expressed in the middle silk gland cells. To identify element involved in this transcription-dependent spatial restriction, truncation of the 5' terminal from the sericin 1 (Ser1) promoter is studied in vivo. A 209 bp DNA sequence upstream of the transcriptional start site (-586 to -378) is found to be responsible for promoting tissue-specific transcription. Analysis of this 209 bp region by overlapping deletion studies showed that a 25 bp region (-500 to -476) suppresses the ectopic expression of the Ser1 promoter. An unknown factor abundant in fat body nuclear extracts is shown to bind to this 25 bp fragment. These results suggest that this 25 bp region and the unknown factor are necessary for determining the tissue-specificity of the Ser1 promoter.

  8. Endocrine Parameters and Phenotypes of the Growth Hormone Receptor Gene Disrupted (GHR−/−) Mouse

    Science.gov (United States)

    List, Edward O.; Sackmann-Sala, Lucila; Berryman, Darlene E.; Funk, Kevin; Kelder, Bruce; Gosney, Elahu S.; Okada, Shigeru; Ding, Juan; Cruz-Topete, Diana

    2011-01-01

    Disruption of the GH receptor (GHR) gene eliminates GH-induced intracellular signaling and, thus, its biological actions. Therefore, the GHR gene disrupted mouse (GHR−/−) has been and is a valuable tool for helping to define various parameters of GH physiology. Since its creation in 1995, this mouse strain has been used by our laboratory and others for numerous studies ranging from growth to aging. Some of the most notable discoveries are their extreme insulin sensitivity in the presence of obesity. Also, the animals have an extended lifespan, which has generated a large number of investigations into the roles of GH and IGF-I in the aging process. This review summarizes the many results derived from the GHR−/− mice. We have attempted to present the findings in the context of current knowledge regarding GH action and, where applicable, to discuss how these mice compare to GH insensitivity syndrome in humans. PMID:21123740

  9. Growth hormone receptor gene mutations in two Italian patients with Laron Syndrome.

    Science.gov (United States)

    Fassone, L; Corneli, G; Bellone, S; Camacho-Hübner, C; Aimaretti, G; Cappa, M; Ubertini, G; Bona, G

    2007-05-01

    Laron Syndrome (LS) represents a condition characterized by GH insensitivity caused by molecular defects in the GH receptor (GHR) gene or in the post-receptor signalling pathway. We report the molecular characterization of two unrelated Italian girls from Sicily diagnosed with LS. The DNA sequencing of the GHR gene revealed the presence of different nonsense mutations, occurring in the same background haplotype. The molecular defects occurred in the extracellular domain of the GHR leading to a premature termination signal and to a truncated non-functional receptor. In one patient, a homozygous G to T transversion, in exon 6, led to the mutation GAA to TAA at codon 180 (E180X), while in the second patient a homozygous C to T transition in exon 7 was detected, causing the CGA to TAA substitution at codon 217 (R217X). Both probands presented the polymorphisms Gly168Gly and Ile544Leu in a homozygous state in exons 6 and 10, respectively. The E180X represents a novel defect of the GHR gene, while the R217X mutation has been previously reported in several patients from different ethnic backgrounds but all from countries located in the Mediterranean and Middle Eastern region.

  10. MITEs in the promoters of effector genes allow prediction of novel virulence genes in Fusarium oxysporum

    NARCIS (Netherlands)

    Schmidt, S.M.; Houterman, P.M.; Schreiver, I.; Ma, L.; Amyotte, S.; Chellappan, B.; Boeren, S.; Takken, F.L.W.; Rep, M.

    2013-01-01

    Background The plant-pathogenic fungus Fusarium oxysporum f.sp.lycopersici (Fol) has accessory, lineage-specific (LS) chromosomes that can be transferred horizontally between strains. A single LS chromosome in the Fol4287 reference strain harbors all known Fol effector genes. Transfer of this

  11. Transactivation of the proximal promoter of human oxytocin gene by TR4 orphan receptor

    International Nuclear Information System (INIS)

    Wang, C.-P.; Lee, Y.-F.; Chang, C.; Lee, H.-J.

    2006-01-01

    The human testicular receptor 4 (TR4) shares structural homology with members of the nuclear receptor superfamily. Some other members of this superfamily were able to regulate the transcriptional activity of the human oxytocin (OXT) promoter by binding to the first DR0 regulatory site. However, little investigation was conducted systematically in the study of the second dDR4 site of OXT proximal promoter, and the relationship between the first and the second sites of OXT promoter. Here, we demonstrated for the first time that TR4 could increase the proximal promoter activity of the human OXT gene via DR0, dDR4, and OXT (both DR0 and dDR4) elements, respectively. TR4 might induce OXT gene expression through the OXT element in a dose-dependent manner. However, there is no synergistic effect between DR0 and dDR4 elements during TR4 transactivation. Taken together, these results suggested that TR4 should be one of important regulators of OXT gene expression

  12. Cloning and characterization of the human integrin β6 gene promoter.

    Directory of Open Access Journals (Sweden)

    Mingyan Xu

    Full Text Available The integrin β6 (ITGB6 gene, which encodes the limiting subunit of the integrin αvβ6 heterodimer, plays an important role in wound healing and carcinogenesis. The mechanism underlying ITGB6 regulation, including the identification of DNA elements and cognate transcription factors responsible for basic transcription of human ITGB6 gene, remains unknown. This report describes the cloning and characterization of the human ITGB6 promoter. Using 5'-RACE (rapid amplification of cDNA ends analysis, the transcriptional initiation site was identified. Promoter deletion analysis identified and functionally validated a TATA box located in the region -24 to -18 base pairs upstream of the ITGB6 promoter. The regulatory elements for transcription of the ITGB6 gene were predominantly located -289 to -150 from the ITGB6 promoter and contained putative binding sites for transcription factors such as STAT3 and C/EBPα. Using chromatin immunoprecipitation assays, this study has demonstrated, for the first time, that transcription factors STAT3 and C/EBPα are involved in the positive regulation of ITGB6 transcription in oral squamous cell carcinoma cells. These findings have important implications for unraveling the mechanism of abnormal ITGB6 activation in tissue remodeling and tumorigenesis.

  13. The enrichment of TATA box and the scarcity of depleted proximal nucleosome in the promoters of duplicated yeast genes.

    Science.gov (United States)

    Kim, Yuseob; Lee, Jang H; Babbitt, Gregory A

    2010-01-01

    Population genetic theory of gene duplication suggests that the preservation of duplicate copies requires functional divergence upon duplication. Genes that can be readily modified to produce new gene expression patterns may thus be duplicated often. In yeast, genes exhibit dichotomous expression patterns based on their promoter architectures. The expression of genes that contain TATA box or occupied proximal nucleosome (OPN) tends to be variable and respond to external signals. On the other hand, genes without TATA box or with depleted proximal nucleosome (DPN) are expressed constitutively. We find that recent duplicates in the yeast genome are heavily biased to be TATA box containing genes and not to be DPN genes. This suggests that variably expressed genes, due to the functional organization in their promoters, have higher duplicability than constitutively expressed genes.

  14. IHH Gene Mutations Causing Short Stature With Nonspecific Skeletal Abnormalities and Response to Growth Hormone Therapy.

    Science.gov (United States)

    Vasques, Gabriela A; Funari, Mariana F A; Ferreira, Frederico M; Aza-Carmona, Miriam; Sentchordi-Montané, Lucia; Barraza-García, Jimena; Lerario, Antonio M; Yamamoto, Guilherme L; Naslavsky, Michel S; Duarte, Yeda A O; Bertola, Debora R; Heath, Karen E; Jorge, Alexander A L

    2018-02-01

    Genetic evaluation has been recognized as an important tool to elucidate the causes of growth disorders. To investigate the cause of short stature and to determine the phenotype of patients with IHH mutations, including the response to recombinant human growth hormone (rhGH) therapy. We studied 17 families with autosomal-dominant short stature by using whole exome sequencing and screened IHH defects in 290 patients with growth disorders. Molecular analyses were performed to evaluate the potential impact of N-terminal IHH variants. We identified 10 pathogenic or possibly pathogenic variants in IHH, an important regulator of endochondral ossification. Molecular analyses revealed a smaller potential energy of mutated IHH molecules. The allele frequency of rare, predicted to be deleterious IHH variants found in short-stature samples (1.6%) was higher than that observed in two control cohorts (0.017% and 0.08%; P IHH variants segregate with short stature in a dominant inheritance pattern. Affected individuals typically manifest mild disproportional short stature with a frequent finding of shortening of the middle phalanx of the fifth finger. None of them have classic features of brachydactyly type A1, which was previously associated with IHH mutations. Five patients heterozygous for IHH variants had a good response to rhGH therapy. The mean change in height standard deviation score in 1 year was 0.6. Our study demonstrated the association of pathogenic variants in IHH with short stature with nonspecific skeletal abnormalities and established a frequent cause of growth disorder, with a preliminary good response to rhGH. Copyright © 2017 Endocrine Society

  15. Chromosomal localization of the gonadotropin-releasing hormone receptor gene to human chromosome 4q13. 1-q21. 1 and mouse chromosome 5

    Energy Technology Data Exchange (ETDEWEB)

    Kaiser, U.B.; Dushkin, H.; Beier, D.R.; Chin, W.W. (Harvard Medical School, Boston, MA (United States)); Altherr, M.R. (Los Alamos National Lab., NM (United States))

    1994-04-01

    The gonadotropin-releasing hormone receptor (GRHR) is a G-protein-coupled receptor on the cell surface of pituitary gonadotropes, where it serves to transduce signals from the extracellular ligand, the hypothalamic factor gonadotropin-releasing hormone, and to modulate the synthesis and secretion of luteinizing hormone and follicle-stimulating hormone. The authors have localized the GRHR gene to the q13.1-q21.1 region of the human chromosome 4 using mapping panels of human/rodent somatic cell hybrids containing different human chromosomes or different regions of human chromosome 4. Furthermore, using linkage analysis of single-strand conformational polymorphisms, the murine GRHR gene was localized to mouse chromosome 5, linked to the endogenous retroviral marker Pmv-11. This is consistent with the evolutionary conservation of homology between these two regions, as has been previously suggested from comparative mapping of several other loci. The localization of the GRHR gene may be useful in the study of disorders of reproduction. 22 refs., 2 figs.

  16. Resistance to thyroid hormone associated with a novel mutation of the thyroid β receptor gene in a four-year-old female

    Directory of Open Access Journals (Sweden)

    Breuer Christopher K

    2011-06-01

    Full Text Available Abstract Resistance to thyroid hormone (RTH is a rare syndrome of reduced responsiveness of target tissues to thyroid hormone and is caused mutation in the thyroid β receptor gene. We report a novel mutation, E445X, causing RTH in a 4-year old girl. The patient exhibited extreme signs and symptoms of RTH at an early age, and had a large compressive goiter. Following total extracapsular thyroidectomy, upper airway compression was relieved and symptoms of hyperthyroidism improved. This case appears to be the youngest child recorded to have undergone total thyroidectomy for RTH. Post-operative TSH elevations were managed with every-other-day triiodothyronine therapy.

  17. Comparative ovarian microarray analysis of juvenile hormone-responsive genes in water flea Daphnia magna: potential targets for toxicity.

    Science.gov (United States)

    Toyota, Kenji; Williams, Timothy D; Sato, Tomomi; Tatarazako, Norihisa; Iguchi, Taisen

    2017-03-01

    The freshwater zooplankton Daphnia magna has been extensively employed in chemical toxicity tests such as OECD Test Guidelines 202 and 211. Previously, it has been demonstrated that the treatment of juvenile hormones (JHs) or their analogues to female daphnids can induce male offspring production. Based on this finding, a rapid screening method for detection of chemicals with JH-activity was recently developed using adult D. magna. This screening system determines whether a chemical has JH-activity by investigating the male offspring inducibility. Although this is an efficient high-throughput short-term screening system, much remains to be discovered about JH-responsive pathways in the ovary, and whether different JH-activators act via the same mechanism. JH-responsive genes in the ovary including developing oocytes are still largely undescribed. Here, we conducted comparative microarray analyses using ovaries from Daphnia magna treated with fenoxycarb (Fx; artificial JH agonist) or methyl farnesoate (MF; a putative innate JH in daphnids) to elucidate responses to JH agonists in the ovary, including developing oocytes, at a JH-sensitive period for male sex determination. We demonstrate that induction of hemoglobin genes is a well-conserved response to JH even in the ovary, and a potential adverse effect of JH agonist is suppression of vitellogenin gene expression, that might cause reduction of offspring number. This is the first report demonstrating different transcriptomics profiles from MF and an artificial JH agonist in D. magna ovary, improving understanding the tissue-specific mode-of-action of JH. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

  18. Prognostic Utility of the 21-Gene Assay in Hormone Receptor–Positive Operable Breast Cancer Compared With Classical Clinicopathologic Features

    Science.gov (United States)

    Goldstein, Lori J.; Gray, Robert; Badve, Sunil; Childs, Barrett H.; Yoshizawa, Carl; Rowley, Steve; Shak, Steven; Baehner, Frederick L.; Ravdin, Peter M.; Davidson, Nancy E.; Sledge, George W.; Perez, Edith A.; Shulman, Lawrence N.; Martino, Silvana; Sparano, Joseph A.

    2008-01-01

    Purpose Adjuvant! is a standardized validated decision aid that projects outcomes in operable breast cancer based on classical clinicopathologic features and therapy. Genomic classifiers offer the potential to more accurately identify individuals who benefit from chemotherapy than clinicopathologic features. Patients and Methods A sample of 465 patients with hormone receptor (HR) –positive breast cancer with zero to three positive axillary nodes who did (n = 99) or did not have recurrence after chemohormonal therapy had tumor tissue evaluated using a 21-gene assay. Histologic grade and HR expression were evaluated locally and in a central laboratory. Results Recurrence Score (RS) was a highly significant predictor of recurrence, including node-negative and node-positive disease (P < .001 for both) and when adjusted for other clinical variables. RS also predicted recurrence more accurately than clinical variables when integrated by an algorithm modeled after Adjuvant! that was adjusted to 5-year outcomes. The 5-year recurrence rate was only 5% or less for the estimated 46% of patients who have a low RS (< 18). Conclusion The 21-gene assay was a more accurate predictor of relapse than standard clinical features for individual patients with HR-positive operable breast cancer treated with chemohormonal therapy and provides information that is complementary to features typically used in anatomic staging, such as tumor size and lymph node involvement. The 21-gene assay may be used to select low-risk patients for abbreviated chemotherapy regimens similar to those used in our study or high-risk patients for more aggressive regimens or clinical trials evaluating novel treatments. PMID:18678838

  19. Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum.

    Directory of Open Access Journals (Sweden)

    Shan Xin

    Full Text Available Apoplastic ascorbate oxidase (AO plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1 gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5'-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5'-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5' truncations were treated with indole-3-acetic acid (IAA. Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome, Gossypium raimondii (Gr, diploid cotton with a DD genome and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence

  20. Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum.

    Science.gov (United States)

    Xin, Shan; Tao, Chengcheng; Li, Hongbin

    2016-01-01

    Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5'-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5'-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element) was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5' truncations were treated with indole-3-acetic acid (IAA). Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element) might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome), Gossypium raimondii (Gr, diploid cotton with a DD genome) and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome) indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh) cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence with a

  1. Characterization and functional analysis of the Paralichthys olivaceus prdm1 gene promoter.

    Science.gov (United States)

    Li, Peizhen; Wang, Bo; Cao, Dandan; Liu, Yuezhong; Zhang, Quanqi; Wang, Xubo

    2017-10-01

    PR domain containing protein 1 (Prdm1) is a transcriptional repressor identified in various species and plays multiple important roles in immune response and embryonic development. However, little is known about the transcriptional regulation of the prdm1 gene. This study aims to characterize the promoter of Paralichthys olivaceus prdm1 (Po-prdm1) gene and determine the regulatory mechanism of Po-prdm1 expression. A 2000bp-long 5'-flanking region (translation initiation site designated as +1) of the Po-prdm1 gene was isolated and characterized. The regulatory elements in this fragment were then investigated and many putative transcription factor (TF) binding sites involved in immunity and multiple tissue development were identified. A 5'-deletion analysis was then conducted, and the ability of the deletion mutants to promote luciferase and green fluorescent protein (GFP) expression in a flounder gill cell line was examined. The results revealed that the minimal promoter is located in the region between -446 and -13bp, and the region between -1415 and -13bp enhanced the promoter activity. Site-directed mutation analysis was subsequently performed on the putative regulatory elements sites, and the results indicated that FOXP1, MSX and BCL6 binding sites play negative functional roles in the regulation of the Po-prdm1 expression in FG cells. In vivo analysis demonstrated that a GFP reporter gene containing 1.4kb-long promoter fragment (-1415/-13) was expressed in the head and trunk muscle fibres of transient transgenic zebrafish embryos. Our study provided the basic information for the exploration of Po-prdm1 regulation and expression. Copyright © 2017 Elsevier Inc. All rights reserved.

  2. Development of radiation-inducible promoters for use in nitric oxide synthase gene therapy of cancer

    International Nuclear Information System (INIS)

    Hirst, D.G.; Worthington, J.; Adams, C.; Robson, T.; Scott, S.D.

    2003-01-01

    Full text: The free radical nitric oxide (NO) at nM concentrations performs multiple signaling roles that are essential for survival. These processes are regulated via the enzymes nNOS and eNOS, but another isoform, inducible nitric oxide synthase (iNOS) is capable of generating much higher concentrations (mM) over longer periods, resulting in the generation of very toxic species such as peroxynitrite. At high concentrations NO has many of the characteristics of an ideal anticancer molecule: it is cytotoxic (pro-apoptotic via peroxynitrite), it is a potent chemical radiosensitizer, it is anti-angiogenic and anti-metastatic. Thus, we see iNOS gene therapy as a strategy for targeting the generation of high concentrations of NO to tumours for therapeutic benefit. iNOS gene therapy should be used in combination with radiotherapy; so it is logical that the use of a radiation-inducible promoter should be part of the targeting strategy. We have tested several candidate promoters in vitro and in vivo. The WAF1 promoter has many of the properties desirable for therapeutic use including: rapid 3-4 fold induction at X-ray doses of 2 and 4Gy and no significant leakiness. WAF1 also has the advantage of being inducible by hypoxia and by the final product, NO. We have also tested the synthetic CArG promoter and demonstrated that, in addition to a high level of radiation inducibility, it is also inducible by NO. We have also been able to demonstrate potent radiosensitization (SER 2.0-2.5) in tumour cells in vitro and in vivo using iNOS gene transfer with constitutive or radiation-inducible promoters. We have also tested the use of iNOS gene therapy in combination with cisplatin and shown significant enhancement

  3. c-Myc activates BRCA1 gene expression through distal promoter elements in breast cancer cells

    International Nuclear Information System (INIS)

    Chen, Yinghua; Xu, Jinhua; Borowicz, Stanley; Collins, Cindy; Huo, Dezheng; Olopade, Olufunmilayo I

    2011-01-01

    The BRCA1 gene plays an important role in the maintenance of genomic stability. BRCA1 inactivation contributes to breast cancer tumorigenesis. An increasing number of transcription factors have been shown to regulate BRCA1 expression. c-Myc can act as a transcriptional activator, regulating up to 15% of all genes in the human genome and results from a high throughput screen suggest that BRCA1 is one of its targets. In this report, we used cultured breast cancer cells to examine the mechanisms of transcriptional activation of BRCA1 by c-Myc. c-Myc was depleted using c-Myc-specific siRNAs in cultured breast cancer cells. BRCA1 mRNA expression and BRCA1 protein expression were determined by quantitative RT-PCR and western blot, respectively and BRCA1 promoter activities were examined under these conditions. DNA sequence analysis was conducted to search for high similarity to E boxes in the BRCA1 promoter region. The association of c-Myc with the BRCA1 promoter in vivo was tested by a chromatin immunoprecipitation assay. We investigated the function of the c-Myc binding site in the BRCA1 promoter region by a promoter assay with nucleotide substitutions in the putative E boxes. BRCA1-dependent DNA repair activities were measured by a GFP-reporter assay. Depletion of c-Myc was found to be correlated with reduced expression levels of BRCA1 mRNA and BRCA1 protein. Depletion of c-Myc decreased BRCA1 promoter activity, while ectopically expressed c-Myc increased BRCA1 promoter activity. In the distal BRCA1 promoter, DNA sequence analysis revealed two tandem clusters with high similarity, and each cluster contained a possible c-Myc binding site. c-Myc bound to these regions in vivo. Nucleotide substitutions in the c-Myc binding sites in these regions abrogated c-Myc-dependent promoter activation. Furthermore, breast cancer cells with reduced BRCA1 expression due to depletion of c-Myc exhibited impaired DNA repair activity. The distal BRCA1 promoter region is associated with c

  4. Mechanism of selective recruitment of RNA polymerases II and III to snRNA gene promoters.

    Science.gov (United States)

    Dergai, Oleksandr; Cousin, Pascal; Gouge, Jerome; Satia, Karishma; Praz, Viviane; Kuhlman, Tracy; Lhôte, Philippe; Vannini, Alessandro; Hernandez, Nouria

    2018-05-01

    RNA polymerase II (Pol II) small nuclear RNA (snRNA) promoters and type 3 Pol III promoters have highly similar structures; both contain an interchangeable enhancer and "proximal sequence element" (PSE), which recruits the SNAP complex (SNAPc). The main distinguishing feature is the presence, in the type 3 promoters only, of a TATA box, which determines Pol III specificity. To understand the mechanism by which the absence or presence of a TATA box results in specific Pol recruitment, we examined how SNAPc and general transcription factors required for Pol II or Pol III transcription of SNAPc-dependent genes (i.e., TATA-box-binding protein [TBP], TFIIB, and TFIIA for Pol II transcription and TBP and BRF2 for Pol III transcription) assemble to ensure specific Pol recruitment. TFIIB and BRF2 could each, in a mutually exclusive fashion, be recruited to SNAPc. In contrast, TBP-TFIIB and TBP-BRF2 complexes were not recruited unless a TATA box was present, which allowed selective and efficient recruitment of the TBP-BRF2 complex. Thus, TBP both prevented BRF2 recruitment to Pol II promoters and enhanced BRF2 recruitment to Pol III promoters. On Pol II promoters, TBP recruitment was separate from TFIIB recruitment and enhanced by TFIIA. Our results provide a model for specific Pol recruitment at SNAPc-dependent promoters. © 2018 Dergai et al.; Published by Cold Spring Harbor Laboratory Press.

  5. Inactivation of promoter 1B of APC causes partial gene silencing: evidence for a significant role of the promoter in regulation and causative of familial adenomatous polyposis

    DEFF Research Database (Denmark)

    Rohlin, A; Engwall, Y; Fritzell, K

    2011-01-01

    inactivation of promoter 1B is disease causing in FAP; (ii) expression of transcripts from promoter 1B is generated at considerable higher levels compared with 1A, demonstrating a hitherto unknown importance of 1B; (iii) adenoma formation in FAP, caused by impaired function of promoter 1B, does not require......Familial adenomatous polyposis (FAP) is caused by germline mutations in the adenomatous polyposis coli (APC) gene. Two promoters, 1A and 1B, have been recognized in APC, and 1B is thought to have a minor role in the regulation of the gene. We have identified a novel deletion encompassing half...... of this promoter in the largest family (Family 1) of the Swedish Polyposis Registry. The mutation leads to an imbalance in allele-specific expression of APC, and transcription from promoter 1B was highly impaired in both normal colorectal mucosa and blood from mutation carriers. To establish the significance...

  6. hTERT promoter mediating gene therapy in laryngeal squamous carcinomas cells in vitro

    International Nuclear Information System (INIS)

    Liao Zhengkai; Zhou Yunfeng; Zhou Fuxiang; Luo Zhiguo; Xiong Jie; Bao Jie; Xie Conghua; Liu Shiquan

    2007-01-01

    Objective: To investigate the relationship among hTERT promoter activity, hTERT mRNA expression, and telomerase activity (TA) in laryngeal squamous carcinomas cell lines, and to evaluate the usefulness of hTERT promoter mediated gene therapy. Methods: After plasmids pGL3-hTERTp were transfected, hTEBT promoter activity, hTERT mRNA expression and TA were determined by luciferase assay, RT-PCR and TRAP-PCR-ELISA, respectively. Plasmid phTERTp-HRP was constructed and transfected, HRP expression was determined by RT-PCR and competent peroxidase activity was confirmed by enzyme activity assay. The cytotoxicity and radiosensitivity of phTERTp-HRP/IAA were determined by clonogenic assay. Results: The relative levels of hTERT promoter activity, hTERT mRNA expression and TA in Hep2R cells were 1.37-fold, 1.43-fold and 1.81-fold compared with Hep2R cells, hTERT promoter activity was closely associated with hTERT mRNA expression and TA levels (P SF 2 ) was 1.24 (Hep2R cells) and 1.20 (Hep 2cells), the parameter a of with or without IAA incubation were 0.090, 0.020 (Hep2R)and 0.099, 0.042 (Hep2). Conclusions: hTERT promoter is applicable in mediating gene therapy in different radiosensitive laryngeal squamous carcinomas cells. hTERTp-HRP/IAA gene therapy may be a promising supplementary method for radiotherapy of laryngeal squamous-cell carcinomas. (authors)

  7. Methylation of class II transactivator gene promoter IV is not associated with susceptibility to Multiple Sclerosis

    Directory of Open Access Journals (Sweden)

    Lincoln Matthew R

    2008-07-01

    Full Text Available Abstract Background Multiple sclerosis (MS is a complex trait in which alleles at or near the class II loci HLA-DRB1 and HLA-DQB1 contribute significantly to genetic risk. The MHC class II transactivator (MHC2TA is the master controller of expression of class II genes, and methylation of the promoter of this gene has been previously been shown to alter its function. In this study we sought to assess whether or not methylation of the MHC2TA promoter pIV could contribute to MS disease aetiology. Methods In DNA from peripheral blood mononuclear cells from a sample of 50 monozygotic disease discordant MS twins the MHC2TA promoter IV was sequenced and analysed by methylation specific PCR. Results No methylation or sequence variation of the MHC2TA promoter pIV was found. Conclusion The results of this study cannot support the notion that methylation of the pIV promoter of MHC2TA contributes to MS disease risk, although tissue and timing specific epigenetic modifications cannot be ruled out.

  8. DNA demethylases target promoter transposable elements to positively regulate stress responsive genes in Arabidopsis.

    Science.gov (United States)

    Le, Tuan-Ngoc; Schumann, Ulrike; Smith, Neil A; Tiwari, Sameer; Au, Phil Chi Khang; Zhu, Qian-Hao; Taylor, Jennifer M; Kazan, Kemal; Llewellyn, Danny J; Zhang, Ren; Dennis, Elizabeth S; Wang, Ming-Bo

    2014-09-17

    DNA demethylases regulate DNA methylation levels in eukaryotes. Arabidopsis encodes four DNA demethylases, DEMETER (DME), REPRESSOR OF SILENCING 1 (ROS1), DEMETER-LIKE 2 (DML2), and DML3. While DME is involved in maternal specific gene expression during seed development, the biological function of the remaining DNA demethylases remains unclear. We show that ROS1, DML2, and DML3 play a role in fungal disease resistance in Arabidopsis. A triple DNA demethylase mutant, rdd (ros1 dml2 dml3), shows increased susceptibility to the fungal pathogen Fusarium oxysporum. We identify 348 genes differentially expressed in rdd relative to wild type, and a significant proportion of these genes are downregulated in rdd and have functions in stress response, suggesting that DNA demethylases maintain or positively regulate the expression of stress response genes required for F. oxysporum resistance. The rdd-downregulated stress response genes are enriched for short transposable element sequences in their promoters. Many of these transposable elements and their surrounding sequences show localized DNA methylation changes in rdd, and a general reduction in CHH methylation, suggesting that RNA-directed DNA methylation (RdDM), responsible for CHH methylation, may participate in DNA demethylase-mediated regulation of stress response genes. Many of the rdd-downregulated stress response genes are downregulated in the RdDM mutants nrpd1 and nrpe1, and the RdDM mutants nrpe1 and ago4 show enhanced susceptibility to F. oxysporum infection. Our results suggest that a primary function of DNA demethylases in plants is to regulate the expression of stress response genes by targeting promoter transposable element sequences.

  9. MGMT, GATA6, CD81, DR4, and CASP8 gene promoter methylation in glioblastoma

    Directory of Open Access Journals (Sweden)

    Skiriute Daina

    2012-06-01

    Full Text Available Abstract Background Methylation of promoter region is the major mechanism affecting gene expression in tumors. Recent methylome studies of brain tumors revealed a list of new epigenetically modified genes. Our aim was to study promoter methylation of newly identified epigenetically silenced genes together with already known epigenetic markers and evaluate its separate and concomitant role in glioblastoma genesis and patient outcome. Methods The methylation status of MGMT, CD81, GATA6, DR4, and CASP8 in 76 patients with primary glioblastomas was investigated. Methylation-specific PCR reaction was performed using bisulfite treated DNA. Evaluating glioblastoma patient survival time after operation, patient data and gene methylation effect on survival was estimated using survival analysis. Results The overwhelming majority (97.3% of tumors were methylated in at least one of five genes tested. In glioblastoma specimens gene methylation was observed as follows: MGMT in 51.3%, GATA6 in 68.4%, CD81 in 46.1%, DR4 in 41.3% and CASP8 in 56.8% of tumors. Methylation of MGMT was associated with younger patient age (p CASP8 with older (p MGMT methylation was significantly more frequent event in patient group who survived longer than 36 months after operation (p CASP8 was more frequent in patients who survived shorter than 36 months (p MGMT, GATA6 and CASP8 as independent predictors for glioblastoma patient outcome (p MGMT and GATA6 were independent predictors for patient survival in younger patients’ group, while there were no significant associations observed in older patients’ group when adjusted for therapy. Conclusions High methylation frequency of tested genes shows heterogeneity of glioblastoma epigenome and the importance of MGMT, GATA6 and CASP8 genes methylation in glioblastoma patient outcome.

  10. Global loss of bmal1 expression alters adipose tissue hormones, gene expression and glucose metabolism.

    Directory of Open Access Journals (Sweden)

    David John Kennaway

    Full Text Available The close relationship between circadian rhythm disruption and poor metabolic status is becoming increasingly evident, but role of adipokines is poorly understood. Here we investigated adipocyte function and the metabolic status of mice with a global loss of the core clock gene Bmal1 fed either a normal or a high fat diet (22% by weight. Bmal1 null mice aged 2 months were killed across 24 hours and plasma adiponectin and leptin, and adipose tissue expression of Adipoq, Lep, Retn and Nampt mRNA measured. Glucose, insulin and pyruvate tolerance tests were conducted and the expression of liver glycolytic and gluconeogenic enzyme mRNA determined. Bmal1 null mice displayed a pattern of increased plasma adiponectin and plasma leptin concentrations on both control and high fat diets. Bmal1 null male and female mice displayed increased adiposity (1.8 fold and 2.3 fold respectively on the normal diet, but the high fat diet did not exaggerate these differences. Despite normal glucose and insulin tolerance, Bmal1 null mice had increased production of glucose from pyruvate, implying increased liver gluconeogenesis. The Bmal1 null mice had arrhythmic clock gene expression in epigonadal fat and liver, and loss of rhythmic transcription of a range of metabolic genes. Furthermore, the expression of epigonadal fat Adipoq, Retn, Nampt, AdipoR1 and AdipoR2 and liver Pfkfb3 mRNA were down-regulated. These results show for the first time that global loss of Bmal1, and the consequent arrhythmicity, results in compensatory changes in adipokines involved in the cellular control of glucose metabolism.

  11. Identification and expression analysis of WRKY transcription factor genes in canola (Brassica napus L. in response to fungal pathogens and hormone treatments

    Directory of Open Access Journals (Sweden)

    Deyholos Michael K

    2009-06-01

    Full Text Available Abstract Background Members of plant WRKY transcription factor families are widely implicated in defense responses and various other physiological processes. For canola (Brassica napus L., no WRKY genes have been described in detail. Because of the economic importance of this crop, and its evolutionary relationship to Arabidopsis thaliana, we sought to characterize a subset of canola WRKY genes in the context of pathogen and hormone responses. Results In this study, we identified 46 WRKY genes from canola by mining the expressed sequence tag (EST database and cloned cDNA sequences of 38 BnWRKYs. A phylogenetic tree was constructed using the conserved WRKY domain amino acid sequences, which demonstrated that BnWRKYs can be divided into three major groups. We further compared BnWRKYs to the 72 WRKY genes from Arabidopsis and 91 WRKY from rice, and we identified 46 presumptive orthologs of AtWRKY genes. We examined the subcellular localization of four BnWRKY proteins using green fluorescent protein (GFP and we observed the fluorescent green signals in the nucleus only. The responses of 16 selected BnWRKY genes to two fungal pathogens, Sclerotinia sclerotiorum and Alternaria brassicae, were analyzed by quantitative real time-PCR (qRT-PCR. Transcript abundance of 13 BnWRKY genes changed significantly following pathogen challenge: transcripts of 10 WRKYs increased in abundance, two WRKY transcripts decreased after infection, and one decreased at 12 h post-infection but increased later on (72 h. We also observed that transcript abundance of 13/16 BnWRKY genes was responsive to one or more hormones, including abscisic acid (ABA, and cytokinin (6-benzylaminopurine, BAP and the defense signaling molecules jasmonic acid (JA, salicylic acid (SA, and ethylene (ET. We compared these transcript expression patterns to those previously described for presumptive orthologs of these genes in Arabidopsis and rice, and observed both similarities and differences in

  12. Two distinct promoters drive transcription of the human D1A dopamine receptor gene.

    Science.gov (United States)

    Lee, S H; Minowa, M T; Mouradian, M M

    1996-10-11

    The human D1A dopamine receptor gene has a GC-rich, TATA-less promoter located upstream of a small, noncoding exon 1, which is separated from the coding exon 2 by a 116-base pair (bp)-long intron. Serial 3'-deletions of the 5'-noncoding region of this gene, including the intron and 5'-end of exon 2, resulted in 80 and 40% decrease in transcriptional activity of the upstream promoter in two D1A-expressing neuroblastoma cell lines, SK-N-MC and NS20Y, respectively. To investigate the function of this region, the intron and 245 bp at the 5'-end of exon 2 were investigated. Transient expression analyses using various chloramphenicol acetyltransferase constructs showed that the transcriptional activity of the intron is higher than that of the upstream promoter by 12-fold in SK-N-MC cells and by 5.5-fold in NS20Y cells in an orientation-dependent manner, indicating that the D1A intron is a strong promoter. Primer extension and ribonuclease protection assays revealed that transcription driven by the intron promoter is initiated at the junction of intron and exon 2 and at a cluster of nucleotides located 50 bp downstream from this junction. The same transcription start sites are utilized by the chloramphenicol acetyltransferase constructs employed in transfections as well as by the D1A gene expressed within the human caudate. The relative abundance of D1A transcripts originating from the upstream promoter compared with those transcribed from the intron promoter is 1.5-2.9 times in SK-N-MC cells and 2 times in the human caudate. Transcript stability studies in SK-N-MC cells revealed that longer D1A mRNA molecules containing exon 1 are degraded 1.8 times faster than shorter transcripts lacking exon 1. Although gel mobility shift assay could not detect DNA-protein interaction at the D1A intron, competitive co-transfection using the intron as competitor confirmed the presence of trans-acting factors at the intron. These data taken together indicate that the human D1A gene has

  13. Nonlinear Dynamics in Gene Regulation Promote Robustness and Evolvability of Gene Expression Levels.

    Science.gov (United States)

    Steinacher, Arno; Bates, Declan G; Akman, Ozgur E; Soyer, Orkun S

    2016-01-01

    Cellular phenotypes underpinned by regulatory networks need to respond to evolutionary pressures to allow adaptation, but at the same time be robust to perturbations. This creates a conflict in which mutations affecting regulatory networks must both generate variance but also be tolerated at the phenotype level. Here, we perform mathematical analyses and simulations of regulatory networks to better understand the potential trade-off between robustness and evolvability. Examining the phenotypic effects of mutations, we find an inverse correlation between robustness and evolvability that breaks only with nonlinearity in the network dynamics, through the creation of regions presenting sudden changes in phenotype with small changes in genotype. For genotypes embedding low levels of nonlinearity, robustness and evolvability correlate negatively and almost perfectly. By contrast, genotypes embedding nonlinear dynamics allow expression levels to be robust to small perturbations, while generating high diversity (evolvability) under larger perturbations. Thus, nonlinearity breaks the robustness-evolvability trade-off in gene expression levels by allowing disparate responses to different mutations. Using analytical derivations of robustness and system sensitivity, we show that these findings extend to a large class of gene regulatory network architectures and also hold for experimentally observed parameter regimes. Further, the effect of nonlinearity on the robustness-evolvability trade-off is ensured as long as key parameters of the system display specific relations irrespective of their absolute values. We find that within this parameter regime genotypes display low and noisy expression levels. Examining the phenotypic effects of mutations, we find an inverse correlation between robustness and evolvability that breaks only with nonlinearity in the network dynamics. Our results provide a possible solution to the robustness-evolvability trade-off, suggest an explanation for

  14. Nonlinear Dynamics in Gene Regulation Promote Robustness and Evolvability of Gene Expression Levels.

    Directory of Open Access Journals (Sweden)

    Arno Steinacher

    Full Text Available Cellular phenotypes underpinned by regulatory networks need to respond to evolutionary pressures to allow adaptation, but at the same time be robust to perturbations. This creates a conflict in which mutations affecting regulatory networks must both generate variance but also be tolerated at the phenotype level. Here, we perform mathematical analyses and simulations of regulatory networks to better understand the potential trade-off between robustness and evolvability. Examining the phenotypic effects of mutations, we find an inverse correlation between robustness and evolvability that breaks only with nonlinearity in the network dynamics, through the creation of regions presenting sudden changes in phenotype with small changes in genotype. For genotypes embedding low levels of nonlinearity, robustness and evolvability correlate negatively and almost perfectly. By contrast, genotypes embedding nonlinear dynamics allow expression levels to be robust to small perturbations, while generating high diversity (evolvability under larger perturbations. Thus, nonlinearity breaks the robustness-evolvability trade-off in gene expression levels by allowing disparate responses to different mutations. Using analytical derivations of robustness and system sensitivity, we show that these findings extend to a large class of gene regulatory network architectures and also hold for experimentally observed parameter regimes. Further, the effect of nonlinearity on the robustness-evolvability trade-off is ensured as long as key parameters of the system display specific relations irrespective of their absolute values. We find that within this parameter regime genotypes display low and noisy expression levels. Examining the phenotypic effects of mutations, we find an inverse correlation between robustness and evolvability that breaks only with nonlinearity in the network dynamics. Our results provide a possible solution to the robustness-evolvability trade-off, suggest

  15. Gastrointestinal hormones and their targets

    DEFF Research Database (Denmark)

    Rehfeld, Jens F.

    2014-01-01

    Gastrointestinal hormones are peptides released from endocrine cells and neurons in the digestive tract. More than 30 hormone genes are currently known to be expressed in the gastrointestinal tract, which makes the gut the largest hormone producing organ in the body. Modern biology makes...... it feasible to conceive the hormones under five headings: The structural homology groups a majority of the hormones into nine families, each of which is assumed to originate from one ancestral gene. The individual hormone gene often has multiple phenotypes due to alternative splicing, tandem organization......, or differentiated maturation of the prohormone. By a combination of these mechanisms, more than 100 different hormonally active peptides are released from the gut. Gut hormone genes are also widely expressed in cells outside the gut, some only in extraintestinal endocrine cells and neurons but others also in other...

  16. Tripeptide amide L-pyroglutamyl-histidyl-L-prolineamide (L-PHP-thyrotropin-releasing hormone, TRH) promotes insulin-producing cell proliferation.

    Science.gov (United States)

    Luo, LuGuang; Luo, John Z Q; Jackson, Ivor

    2013-02-01

    A very small tripeptide amide L-pyroglutamyl-L-histidyl-L-prolineamide (L-PHP, Thyrotropin-Releasing Hormone, TRH), was first identified in the brain hypothalamus area. Further studies found that L-PHP was expressed in pancreas. The biological role of pancreatic L-PHP is still not clear. Growing evidence indicates that L-PHP expression in the pancreas may play a pivotal role for pancreatic development in the early prenatal period. However, the role of L-PHP in adult pancreas still needs to be explored. L-PHP activation of pancreatic β cell Ca2+ flow and stimulation of β-cell insulin synthesis and release suggest that L-PHP involved in glucose metabolism may directly act on the β cell separate from any effects via the central nervous system (CNS). Knockout L-PHP animal models have shown that loss of L-PHP expression causes hyperglycemia, which cannot be reversed by administration of thyroid hormone, suggesting that the absence of L-PHP itself is the cause. L-PHP receptor type-1 has been identified in pancreas which provides a possibility for L-PHP autocrine and paracrine regulation in pancreatic function. During pancreatic damage in adult pancreas, L-PHP may protect beta cell from apoptosis and initiate its regeneration through signal pathways of growth hormone in β cells. L-PHP has recently been discovered to affect a broad array of gene expression in the pancreas including growth factor genes. Signal pathways linked between L-PHP and EGF receptor phosphorylation suggest that L-PHP may be an important factor for adult β-cell regeneration, which could involve adult stem cell differentiation. These effects suggest that L-PHP may benefit pancreatic β cells and diabetic therapy in clinic.

  17. Transcriptional factor DLX3 promotes the gene expression of enamel matrix proteins during amelogenesis.

    Science.gov (United States)

    Zhang, Zhichun; Tian, Hua; Lv, Ping; Wang, Weiping; Jia, Zhuqing; Wang, Sainan; Zhou, Chunyan; Gao, Xuejun

    2015-01-01

    Mutation of distal-less homeobox 3 (DLX3) is responsible for human tricho-dento-osseous syndrome (TDO) with amelogenesis imperfecta, indicating a crucial role of DLX3 in amelogenesis. However, the expression pattern of DLX3 and its specific function in amelogenesis remain largely unknown. The aim of this study was to investigate the effects of DLX3 on enamel matrix protein (EMP) genes. By immunohistochemistry assays of mouse tooth germs, stronger immunostaining of DLX3 protein was identified in ameloblasts in the secretory stage than in the pre-secretory and maturation stages, and the same pattern was found for Dlx3 mRNA using Realtime PCR. In a mouse ameloblast cell lineage, forced expression of DLX3 up-regulated the expression of the EMP genes Amelx, Enam, Klk4, and Odam, whereas knockdown of DLX3 down-regulated these four EMP genes. Further, bioinformatics, chromatin immunoprecipitation, and luciferase assays revealed that DLX3 transactivated Enam, Amelx, and Odam through direct binding to their enhancer regions. Particularly, over-expression of mutant-DLX3 (c.571_574delGGGG, responsible for TDO) inhibited the activation function of DLX3 on expression levels and promoter activities of the Enam, Amelx, and Odam genes. Together, our data show that DLX3 promotes the expression of the EMP genes Amelx, Enam, Klk4, and Odam in amelogenesis, while mutant-DLX3 disrupts this regulatory function, thus providing insights into the molecular mechanisms underlying the enamel defects of TDO disease.

  18. Cloning and characterization of the promoter regions from the parent and paralogous creatine transporter genes.

    Science.gov (United States)

    Ndika, Joseph D T; Lusink, Vera; Beaubrun, Claudine; Kanhai, Warsha; Martinez-Munoz, Cristina; Jakobs, Cornelis; Salomons, Gajja S

    2014-01-10

    Interconversion between phosphocreatine and creatine, catalyzed by creatine kinase is crucial in the supply of ATP to tissues with high energy demand. Creatine's importance has been established by its use as an ergogenic aid in sport, as well as the development of intellectual disability in patients with congenital creatine deficiency. Creatine biosynthesis is complemented by dietary creatine uptake. Intracellular transport of creatine is carried out by a creatine transporter protein (CT1/CRT/CRTR) encoded by the SLC6A8 gene. Most tissues express this gene, with highest levels detected in skeletal muscle and kidney. There are lower levels of the gene detected in colon, brain, heart, testis and prostate. The mechanism(s) by which this regulation occurs is still poorly understood. A duplicated unprocessed pseudogene of SLC6A8-SLC6A10P has been mapped to chromosome 16p11.2 (contains the entire SLC6A8 gene, plus 2293 bp of 5'flanking sequence and its entire 3'UTR). Expression of SLC6A10P has so far only been shown in human testis and brain. It is still unclear as to what is the function of SLC6A10P. In a patient with autism, a chromosomal breakpoint that intersects the 5'flanking region of SLC6A10P was identified; suggesting that SLC6A10P is a non-coding RNA involved in autism. Our aim was to investigate the presence of cis-acting factor(s) that regulate expression of the creatine transporter, as well as to determine if these factors are functionally conserved upstream of the creatine transporter pseudogene. Via gene-specific PCR, cloning and functional luciferase assays we identified a 1104 bp sequence proximal to the mRNA start site of the SLC6A8 gene with promoter activity in five cell types. The corresponding 5'flanking sequence (1050 bp) on the pseudogene also had promoter activity in all 5 cell lines. Surprisingly the pseudogene promoter was stronger than that of its parent gene in 4 of the cell lines tested. To the best of our knowledge, this is the first

  19. CAGE-defined promoter regions of the genes implicated in Rett Syndrome

    DEFF Research Database (Denmark)

    Vitezic, Morana; Bertin, Nicolas; Andersson, Robin

    2014-01-01

    BACKGROUND: Mutations in three functionally diverse genes cause Rett Syndrome. Although the functions of Forkhead box G1 (FOXG1), Methyl CpG binding protein 2 (MECP2) and Cyclin-dependent kinase-like 5 (CDKL5) have been studied individually, not much is known about their relation to each other...... reveal the predominantly used transcription start sites (TSSs) for each gene including novel transcription start sites for FOXG1. We show that FOXG1 expression is poorly correlated with the expression of MECP2 and CDKL5. We identify promoter shapes for each TSS, the predicted location of enhancers...

  20. Absence of mutation at the 5'-upstream promoter region of the TPM4 gene from cardiac mutant axolotl (Ambystoma mexicanum).

    Science.gov (United States)

    Denz, Christopher R; Zhang, Chi; Jia, Pingping; Du, Jianfeng; Huang, Xupei; Dube, Syamalima; Thomas, Anish; Poiesz, Bernard J; Dube, Dipak K

    2011-09-01

    Tropomyosins are a family of actin-binding proteins that show cell-specific diversity by a combination of multiple genes and alternative RNA splicing. Of the 4 different tropomyosin genes, TPM4 plays a pivotal role in myofibrillogenesis as well as cardiac contractility in amphibians. In this study, we amplified and sequenced the upstream regulatory region of the TPM4 gene from both normal and mutant axolotl hearts. To identify the cis-elements that are essential for the expression of the TPM4, we created various deletion mutants of the TPM4 promoter DNA, inserted the deleted segments into PGL3 vector, and performed promoter-reporter assay using luciferase as the reporter gene. Comparison of sequences of the promoter region of the TPM4 gene from normal and mutant axolotl revealed no mutations in the promoter sequence of the mutant TPM4 gene. CArG box elements that are generally involved in controlling the expression of several other muscle-specific gene promoters were not found in the upstream regulatory region of the TPM4 gene. In deletion experiments, loss of activity of the reporter gene was noted upon deletion which was then restored upon further deletion suggesting the presence of both positive and negative cis-elements in the upstream regulatory region of the TPM4 gene. We believe that this is the first axolotl promoter that has ever been cloned and studied with clear evidence that it functions in mammalian cell lines. Although striated muscle-specific cis-acting elements are absent from the promoter region of TPM4 gene, our results suggest the presence of positive and negative cis-elements in the promoter region, which in conjunction with positive and negative trans-elements may be involved in regulating the expression of TPM4 gene in a tissue-specific manner.

  1. Correlation between the methylation of APC gene promoter and colon cancer.

    Science.gov (United States)

    Li, Bing-Qiang; Liu, Peng-Peng; Zhang, Cai-Hua

    2017-08-01

    The present study was planned to explore the correlation between the methylation of APC (adenomatous polyposis coli) and colon carcinogenesis. Colon cancer tissues and tumor-adjacent normal tissues of 60 colon cancer patients (who received surgical operation in our hospital from January 2012 to December 2014) were collected. SW1116 cells in human colon cancer tissues were selected for culturing. 5-aza-2c-deoxycytidine (5-aza-dC) was utilized as an inhibitor of the methylation for APC gene. Methylation specific PCR (MSP) was utilized for detection of APC methylation in SW1116 cells. The MTT and Transwell assays were performed to detect the effect of the methylation of APC gene on the proliferation and invasive abilities of SW1116 cells. The correlation between the methylation of APC gene and pathological parameters of colon cancer patients was analyzed. MSP results revealed that 41 cases (68.33%) showed methylation of APC gene in colon cancer tissues. No methylation of APC gene was found in tumor-adjacent normal tissues. 5-aza-dC was able to inhibit the methylation of APC gene in SW1116 cells. APC gene methylation was correlated with tumor size, differentiation degree, lymph node metastasis and Dukes staging. In conclusion, the levels of the methylation of APC in colon cancer tissues and SW1116 cells are relatively high. The methylation of APC promoted the proliferation and invasion abilities of SW1116 cells. Furthermore, methylation is correlated with a variety of clinicopathological features of colon cancer patients.

  2. Expansion of microsatellite in the thyroid hormone receptor-alpha1 gene linked to increased receptor expression and less aggressive thyroid cancer

    DEFF Research Database (Denmark)

    Onda, Masamitsu; Li, Daisy; Suzuki, Shinichi

    2002-01-01

    PURPOSE: The purpose of this study was to determine whether the length of the THRA1 microsatellite, which resides in a noncoding portion of the thyroid hormone receptor-alpha1 gene, affects receptor expression and is linked to clinicopathological parameters in thyroid cancer. EXPERIMENTAL DESIGN......: In 30 cases of surgically resected sporadic thyroid cancer, the length of the THRA1 microsatellite was determined by DNA sequence analysis, and expression of thyroid hormone receptor-alpha1 was assessed immunohistochemically in thin sections cut from tumor blocks. The length of THRA1 and expression...... of thyroid hormone receptor-alpha1 were also assessed in seven cancer cell lines. Regression analysis was used to gauge the correlation between the size of THRA1 and receptor expression. Multivariate analysis was used to test for links to the clinical parameters of gender, age, histology, stage, nodal...

  3. Expression of Hormonal Carcinogenesis Genes and Related Regulatory microRNAs in Uterus and Ovaries of DDT-Treated Female Rats.

    Science.gov (United States)

    Kalinina, T S; Kononchuk, V V; Gulyaeva, L F

    2017-10-01

    The insecticide dichlorodiphenyltrichloroethane (DDT) is a nonmutagenic xenobiotic compound able to exert estrogen-like effects resulting in activation of estrogen receptor-α (ERα) followed by changed expression of its downstream target genes. In addition, studies performed over recent years suggest that DDT may also influence expression of microRNAs. However, an impact of DDT on expression of ER, microRNAs, and related target genes has not been fully elucidated. Here, using real-time PCR, we assessed changes in expression of key genes involved in hormonal carcinogenesis as well as potentially related regulatory oncogenic/tumor suppressor microRNAs and their target genes in the uterus and ovaries of female Wistar rats during single and chronic multiple-dose DDT exposure. We found that applying DDT results in altered expression of microRNAs-221, -222, -205, -126a, and -429, their target genes (Pten, Dicer1), as well as genes involved in hormonal carcinogenesis (Esr1, Pgr, Ccnd1, Cyp19a1). Notably, Cyp19a1 expression seems to be also regulated by microRNAs-221, -222, and -205. The data suggest that epigenetic effects induced by DDT as a potential carcinogen may be based on at least two mechanisms: (i) activation of ERα followed by altered expression of the target genes encoding receptor Pgr and Ccnd1 as well as impaired expression of Cyp19a1, affecting, thereby, cell hormone balance; and (ii) changed expression of microRNAs resulting in impaired expression of related target genes including reduced level of Cyp19a1 mRNA.

  4. Dissection of a locus on mouse chromosome 5 reveals arthritis promoting and inhibitory genes

    DEFF Research Database (Denmark)

    Lindvall, Therese; Karlsson, Jenny; Holmdahl, Rikard

    2009-01-01

    with Eae39 congenic- and sub-interval congenic mice, carrying RIIIS/J genes on the B10.RIII genetic background, revealed three loci within Eae39 that control disease and anti-collagen antibody titers. Two of the loci promoted disease and the third locus was protecting from collagen induced arthritis...... development. By further breeding of mice with small congenic fragments, we identified a 3.2 Megabasepair (Mbp) interval that regulates disease. CONCLUSIONS: Disease promoting- and protecting genes within the Eae39 locus on mouse chromosome 5, control susceptibility to collagen induced arthritis. A disease......-protecting locus in the telomeric part of Eae39 results in lower anti-collagen antibody responses. The study shows the importance of breeding sub-congenic mouse strains to reveal genetic effects on complex diseases....

  5. Characterization and regulation of the bovine stearoyl-CoA desaturase gene promoter

    International Nuclear Information System (INIS)

    Keating, Aileen F.; Kennelly, John J.; Zhao Fengqi

    2006-01-01

    The bovine stearoyl-CoA desaturase (Scd) gene plays an important role in the bovine mammary gland where substrates such as stearic and vaccenic acids are converted to oleic acid and conjugated linoleic acid (CLA), respectively. Up to 90% of the CLA in bovine milk is formed due to the action of this enzyme in the mammary gland. The areas of the bovine promoter of importance in regulating this key enzyme were examined and an area of 36 bp in length was identified as having a critical role in transcriptional activation and is designated the Scd transcriptional enhancer element (STE). Electrophoretic mobility shift assay detected three binding complexes on this area in Mac-T cell nuclear extracts. Treatment of cells with CLA caused a significant reduction in transcriptional activity, with this effect being mediated through the STE region. The bovine Scd gene promoter was up-regulated by insulin and down-regulated by oleic acid

  6. Digital gene expression analysis of male and female bud transition in Metasequoia reveals high activity of MADS-box transcription factors and hormone-mediated sugar pathways.

    Science.gov (United States)

    Zhao, Ying; Liang, Haiying; Li, Lan; Tang, Sha; Han, Xiao; Wang, Congpeng; Xia, Xinli; Yin, Weilun

    2015-01-01

    Metasequoia glyptostroboides is a famous redwood tree of ecological and economic importance, and requires more than 20 years of juvenile-to-adult transition before producing female and male cones. Previously, we induced reproductive buds using a hormone solution in juvenile Metasequoia trees as young as 5-to-7 years old. In the current study, hormone-treated shoots found in female and male buds were used to identify candidate genes involved in reproductive bud transition in Metasequoia. Samples from hormone-treated cone reproductive shoots and naturally occurring non-cone setting shoots were analyzed using 24 digital gene expression (DGE) tag profiles using Illumina, generating a total of 69,520 putative transcripts. Next, 32 differentially and specifically expressed transcripts were determined using quantitative real-time polymerase chain reaction, including the upregulation of MADS-box transcription factors involved in male bud transition and flowering time control proteins involved in female bud transition. These differentially expressed transcripts were associated with 243 KEGG pathways. Among the significantly changed pathways, sugar pathways were mediated by hormone signals during the vegetative-to-reproductive phase transition, including glycolysis/gluconeogenesis and sucrose and starch metabolism pathways. Key enzymes were identified in these pathways, including alcohol dehydrogenase (NAD) and glutathione dehydrogenase for the glycolysis/gluconeogenesis pathway, and glucanphosphorylase for sucrose and starch metabolism pathways. Our results increase our understanding of the reproductive bud transition in gymnosperms. In addition, these studies on hormone-mediated sugar pathways increase our understanding of the relationship between sugar and hormone signaling during female and male bud initiation in Metasequoia.

  7. Digital gene expression analysis of male and female bud transition in Metasequoia reveals high activity of MADS-box transcription factors and hormone-mediated sugar pathways

    Directory of Open Access Journals (Sweden)

    Ying eZhao

    2015-06-01

    Full Text Available Metasequoiaglyptostroboidies is a famous redwood tree of ecological and economic importance, and requires more than 20 years of juvenile-to-adult transition before producing female and male cones. Previously, we induced reproductive buds using a hormone solution in juvenile Metasequoia trees as young as5-to-7years old. In the current study, hormone-treated shoots found in female and male buds were used to identify candidate genes involved in reproductive bud transition in Metasequoia. Samples from hormone-treated cone reproductive shoots and naturally occurring non-cone setting shoots were analyzed using 24 digital gene expression (DGE tag profiles using Illumina, generating a total of 69,520 putative transcripts. Next, 32 differentially and specifically expressed transcripts were determined using quantitative real-time polymerase chain reaction, including the upregulation of MADS-box transcription factors involved in male bud transition and flowering time control proteins involved in female bud transition. These differentially expressed transcripts were associated with 243 KEGG pathways. Among the significantly changed pathways, sugar pathways were mediated by hormone signals during the vegetative-to-reproductive phase transition, including glycolysis/gluconeogenesis and sucrose and starch metabolism pathways. Key enzymes were identified in these pathways, including alcohol dehydrogenase (NAD and glutathione dehydrogenase for the glycolysis/gluconeogenesis pathway, and glucanphosphorylase for sucrose and starch metabolism pathways. Our results increase our understanding of the reproductive bud transition in gymnosperms. In addition, these studies on hormone-mediated sugar pathways increase our understanding of the relationship between sugar and hormone signaling during female and male bud initiation in Metasequoia.

  8. Pairwise comparisons of ten porcine tissues identify differential transcriptional regulation at the gene, isoform, promoter and transcription start site level

    DEFF Research Database (Denmark)

    Farajzadeh, Leila; Hornshøj, Henrik; Momeni, Jamal

    2013-01-01

    , isoform, and transcription start site (TSS), and promoter level showed that several of the genes differed at all four levels. Interestingly, these genes were mainly annotated to the "electron transport chain" and neuronal differentiation, emphasizing that "tissue important" genes are regulated at several...

  9. Quantitative promoter methylation analysis of multiple cancer-related genes in renal cell tumors

    Directory of Open Access Journals (Sweden)

    Oliveira Jorge

    2007-07-01

    Full Text Available Abstract Background Aberrant promoter hypermethylation of cancer-associated genes occurs frequently during carcinogenesis and may serve as a cancer biomarker. In this study we aimed at defining a quantitative gene promoter methylation panel that might identify the most prevalent types of renal cell tumors. Methods A panel of 18 gene promoters was assessed by quantitative methylation-specific PCR (QMSP in 85 primarily resected renal tumors representing the four major histologic subtypes (52 clear cell (ccRCC, 13 papillary (pRCC, 10 chromophobe (chRCC, and 10 oncocytomas and 62 paired normal tissue samples. After genomic DNA isolation and sodium bisulfite modification, methylation levels were determined and correlated with standard clinicopathological parameters. Results Significant differences in methylation levels among the four subtypes of renal tumors were found for CDH1 (p = 0.0007, PTGS2 (p = 0.002, and RASSF1A (p = 0.0001. CDH1 hypermethylation levels were significantly higher in ccRCC compared to chRCC and oncocytoma (p = 0.00016 and p = 0.0034, respectively, whereas PTGS2 methylation levels were significantly higher in ccRCC compared to pRCC (p = 0.004. RASSF1A methylation levels were significantly higher in pRCC than in normal tissue (p = 0.035. In pRCC, CDH1 and RASSF1A methylation levels were inversely correlated with tumor stage (p = 0.031 and nuclear grade (p = 0.022, respectively. Conclusion The major subtypes of renal epithelial neoplasms display differential aberrant CDH1, PTGS2, and RASSF1A promoter methylation levels. This gene panel might contribute to a more accurate discrimination among common renal tumors, improving preoperative assessment and therapeutic decision-making in patients harboring suspicious renal masses.

  10. Quantitative promoter methylation analysis of multiple cancer-related genes in renal cell tumors

    International Nuclear Information System (INIS)

    Costa, Vera L; Henrique, Rui; Ribeiro, Franclim R; Pinto, Mafalda; Oliveira, Jorge; Lobo, Francisco; Teixeira, Manuel R; Jerónimo, Carmen

    2007-01-01

    Aberrant promoter hypermethylation of cancer-associated genes occurs frequently during carcinogenesis and may serve as a cancer biomarker. In this study we aimed at defining a quantitative gene promoter methylation panel that might identify the most prevalent types of renal cell tumors. A panel of 18 gene promoters was assessed by quantitative methylation-specific PCR (QMSP) in 85 primarily resected renal tumors representing the four major histologic subtypes (52 clear cell (ccRCC), 13 papillary (pRCC), 10 chromophobe (chRCC), and 10 oncocytomas) and 62 paired normal tissue samples. After genomic DNA isolation and sodium bisulfite modification, methylation levels were determined and correlated with standard clinicopathological parameters. Significant differences in methylation levels among the four subtypes of renal tumors were found for CDH1 (p = 0.0007), PTGS2 (p = 0.002), and RASSF1A (p = 0.0001). CDH1 hypermethylation levels were significantly higher in ccRCC compared to chRCC and oncocytoma (p = 0.00016 and p = 0.0034, respectively), whereas PTGS2 methylation levels were significantly higher in ccRCC compared to pRCC (p = 0.004). RASSF1A methylation levels were significantly higher in pRCC than in normal tissue (p = 0.035). In pRCC, CDH1 and RASSF1A methylation levels were inversely correlated with tumor stage (p = 0.031) and nuclear grade (p = 0.022), respectively. The major subtypes of renal epithelial neoplasms display differential aberrant CDH1, PTGS2, and RASSF1A promoter methylation levels. This gene panel might contribute to a more accurate discrimination among common renal tumors, improving preoperative assessment and therapeutic decision-making in patients harboring suspicious renal masses

  11. Finding Combination of Features from Promoter Regions for Ovarian Cancer-related Gene Group Classification

    KAUST Repository

    Olayan, Rawan S.

    2012-12-01

    In classification problems, it is always important to use the suitable combination of features that will be employed by classifiers. Generating the right combination of features usually results in good classifiers. In the situation when the problem is not well understood, data items are usually described by many features in the hope that some of these may be the relevant or most relevant ones. In this study, we focus on one such problem related to genes implicated in ovarian cancer (OC). We try to recognize two important OC-related gene groups: oncogenes, which support the development and progression of OC, and oncosuppressors, which oppose such tendencies. For this, we use the properties of promoters of these genes. We identified potential “regulatory features” that characterize OC-related oncogenes and oncosuppressors promoters. In our study, we used 211 oncogenes and 39 oncosuppressors. For these, we identified 538 characteristic sequence motifs from their promoters. Promoters are annotated by these motifs and derived feature vectors used to develop classification models. We made a comparison of a number of classification models in their ability to distinguish oncogenes from oncosuppressors. Based on 10-fold cross-validation, the resultant model was able to separate the two classes with sensitivity of 96% and specificity of 100% with the complete set of features. Moreover, we developed another recognition model where we attempted to distinguish oncogenes and oncosuppressors as one group from other OC-related genes. That model achieved accuracy of 82%. We believe that the results of this study will help in discovering other OC-related oncogenes and oncosuppressors not identified as yet.

  12. Finding Combination of Features from Promoter Regions for Ovarian Cancer-related Gene Group Classification

    KAUST Repository

    Olayan, Rawan S.

    2012-01-01

    In classification problems, it is always important to use the suitable combination of features that will be employed by classifiers. Generating the right combination of features usually results in good classifiers. In the situation when the problem is not well understood, data items are usually described by many features in the hope that some of these may be the relevant or most relevant ones. In this study, we focus on one such problem related to genes implicated in ovarian cancer (OC). We try to recognize two important OC-related gene groups: oncogenes, which support the development and progression of OC, and oncosuppressors, which oppose such tendencies. For this, we use the properties of promoters of these genes. We identified potential “regulatory features” that characterize OC-related oncogenes and oncosuppressors promoters. In our study, we used 211 oncogenes and 39 oncosuppressors. For these, we identified 538 characteristic sequence motifs from their promoters. Promoters are annotated by these motifs and derived feature vectors used to develop classification models. We made a comparison of a number of classification models in their ability to distinguish oncogenes from oncosuppressors. Based on 10-fold cross-validation, the resultant model was able to separate the two classes with sensitivity of 96% and specificity of 100% with the complete set of features. Moreover, we developed another recognition model where we attempted to distinguish oncogenes and oncosuppressors as one group from other OC-related genes. That model achieved accuracy of 82%. We believe that the results of this study will help in discovering other OC-related oncogenes and oncosuppressors not identified as yet.

  13. Comparison of the in vitro effects of TCDD, PCB 126 and PCB 153 on thyroid-restricted gene expression and thyroid hormone secretion by the chicken thyroid gland.

    Science.gov (United States)

    Katarzyńska, Dorota; Hrabia, Anna; Kowalik, Kinga; Sechman, Andrzej

    2015-03-01

    The aim of this study was to compare the in vitro effects of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD), 3,3',4,4',5-pentachlorobiphenyl (PCB 126; a coplanar PCB congener) and 2,2'4,4',5,5'-hexachlorobiphenyl (PCB153; non-coplanar PCB) on mRNA expression of thyroid-restricted genes, i.e. sodium iodide symporter (NIS), thyroid peroxidase (TPO) and thyroglobulin (TG), and thyroid hormone secretion from the thyroid gland of the laying chicken. Relative expression levels of NIS, TG and TPO genes and thyroxine (T4) and triiodothyronine (T3) secretion from the thyroidal explants were quantified by the real-time qPCR and RIA methods, respectively. In comparison with the control group, TCDD and PCB 126 significantly increased mRNA expression of TPO and TG genes. TCDD did not affect NIS mRNA levels, but PCB 126 decreased its expression. No effect of PCB 153 on the expression of these genes was observed. TCDD and PCB 126 significantly decreased T4 and T3 secretion. There was no significant effect of PCB 153 on these hormone secretions. In conclusion, the results obtained show that in comparison with non-coplanar PCB 153, TCDD and coplanar PCB 126 can directly affect thyroid hormone synthesis and secretion, and in consequence, they may disrupt the endocrine function of the thyroid gland of the laying chicken. Copyright © 2015 Elsevier B.V. All rights reserved.

  14. Characteristics of lentiviral vectors harboring the proximal promoter of the vav proto-oncogene: a weak and efficient promoter for gene therapy.

    Science.gov (United States)

    Almarza, Elena; Río, Paula; Meza, Nestor W; Aldea, Montserrat; Agirre, Xabier; Guenechea, Guillermo; Segovia, José C; Bueren, Juan A

    2007-08-01

    Recent published data have shown the efficacy of gene therapy treatments of certain monogenic diseases. Risks of insertional oncogenesis, however, indicate the necessity of developing new vectors with weaker or cell-restricted promoters to minimize the trans-activation activity of integrated proviruses. We have inserted the proximal promoter of the vav proto-oncogene into self-inactivating lentiviral vectors (vav-LVs) and investigated the expression pattern and therapeutic efficacy of these vectors. Compared with other LVs frequently used in gene therapy, vav-LVs mediated a weak, though homogeneous and stable, expression in in vitro-cultured cells. Transplantation experiments using transduced mouse bone marrow and human CD34(+) cells confirmed the stable activity of the promoter in vivo. To investigate whether the weak activity of this promoter was compatible with a therapeutic effect, a LV expressing the Fanconi anemia A (FANCA) gene was constructed (vav-FANCA LV). Although this vector induced a low expression of FANCA, compared to the expression induced by a LV harboring the spleen focus-forming virus (SFFV) promoter, the two vectors corrected the phenotype of cells from a patient with FA-A with the same efficacy. We propose that self-inactivating vectors harboring weak promoters, such as the vav promoter, will improve the safety of gene therapy and will be of particular interest for the treatment of diseases where a high expression of the transgene is not required.

  15. Let-7b regulates the expression of the growth hormone receptor gene in deletion-type dwarf chickens.

    Science.gov (United States)

    Lin, Shumao; Li, Hongmei; Mu, Heping; Luo, Wen; Li, Ying; Jia, Xinzheng; Wang, Sibing; Jia, Xiaolu; Nie, Qinghua; Li, Yugu; Zhang, Xiquan

    2012-07-10

    A deletion mutation in the growth hormone receptor (GHR) gene results in the inhibition of skeletal muscle growth and fat deposition in dwarf chickens. We used microarray techniques to determine microRNA (miRNA) and mRNA expression profiles of GHR in the skeletal muscles of 14-day-old embryos as well as 7-week-old deletion-type dwarf and normal-type chickens. Our aim was to elucidate the miRNA regulation of GHR expression with respect to growth inhibition and fat deposition. At the same developmental stages, different expression profiles in skeletal muscles of dwarf and normal chickens occurred for four miRNAs (miR-1623, miR-181b, let-7b, and miR-128). At different developmental stages, there was a significant difference in the expression profiles of a greater number of miRNAs. Eleven miRNAs were up-regulated and 18 down-regulated in the 7-week-old dwarf chickens when compared with profiles in 14-day-old embryos. In 7-week-old normal chickens, seven miRNAs were up-regulated and nine down-regulated compared with those in 14-day-old embryos. In skeletal muscles, 22 genes were up-regulated and 33 down-regulated in 14-day-old embryos compared with 7-week-old dwarf chickens. Sixty-five mRNAs were up-regulated and 108 down-regulated in 14-day-old embryos as compared with 7-week-old normal chickens. Thirty-four differentially expressed miRNAs were grouped into 18 categories based on overlapping seed and target sequences. Only let-7b was found to be complementary to its target in the 3' untranslated region of GHR, and was able to inhibit its expression. Kyoto Encyclopedia of Genes and Genomes pathway analysis and quantitative polymerase chain reactions indicated there were three main signaling pathways regulating skeletal muscle growth and fat deposition of chickens. These were influenced by let-7b-regulated GHR. Suppression of the cytokine signaling 3 (SOCS3) gene was found to be involved in the signaling pathway of adipocytokines. There is a critical miRNA, let-7b

  16. The effects of subchronic acrylamide exposure on gene expression, neurochemistry, hormones, and histopathology in the hypothalamus-pituitary-thyroid axis of male Fischer 344 rats

    International Nuclear Information System (INIS)

    Bowyer, J.F.; Latendresse, J.R.; Delongchamp, R.R.; Muskhelishvili, L.; Warbritton, A.R.; Thomas, M.; Tareke, E.; McDaniel, L.P.; Doerge, D.R.

    2008-01-01

    Acrylamide (AA) is an important industrial chemical that is neurotoxic in rodents and humans and carcinogenic in rodents. The observation of cancer in endocrine-responsive tissues in Fischer 344 rats has prompted hypotheses of hormonal dysregulation, as opposed to DNA damage, as the mechanism for tumor induction by AA. The current investigation examines possible evidence for disruption of the hypothalamic-pituitary-thyroid axis from 14 days of repeated exposure of male Fischer 344 rats to doses of AA that range from one that is carcinogenic after lifetime exposure (2.5 mg/kg/d), an intermediate dose (10 mg/kg/d), and a high dose (50 mg/kg/d) that is neurotoxic for this exposure time. The endpoints selected include: serum levels of thyroid and pituitary hormones; target tissue expression of genes involved in hormone synthesis, release, and receptors; neurotransmitters in the CNS that affect hormone homeostasis; and histopathological evaluation of target tissues. These studies showed virtually no evidence for systematic alteration of the hypothalamic-pituitary-thyroid axis and do not support hormone dysregulation as a plausible mechanism for AA-induced thyroid cancer in the Fischer 344 rat. Specifically, there were no significant changes in: 1) mRNA levels in hypothalamus or pituitary for TRH, TSH, thyroid hormone receptor α and β, as well 10 other hormones or releasing factors; 2) mRNA levels in thyroid for thyroglobulin, thyroid peroxidase, sodium iodide symporter, or type I deiodinases; 3) serum TSH or T3 levels (T4 was decreased at high dose only); 4) dopaminergic tone in the hypothalamus and pituitary or importantly 5) increased cell proliferation (Mki67 mRNA and Ki-67 protein levels were not increased) in thyroid or pituitary. These negative findings are consistent with a genotoxic mechanism of AA carcinogenicity based on metabolism to glycidamide and DNA adduct formation. Clarification of this mechanistic dichotomy may be useful in human cancer risk

  17. Characterization, expression patterns of molt-inhibiting hormone gene of Macrobrachium nipponense and its roles in molting and growth.

    Science.gov (United States)

    Qiao, Hui; Jiang, Fengwei; Xiong, Yiwei; Jiang, Sufei; Fu, Hongtuo; Li, Fei; Zhang, Wenyi; Sun, Shengming; Jin, Shubo; Gong, Yongsheng; Wu, Yan

    2018-01-01

    The oriental river prawn, Macrobrachium nipponense, is an important commercial aquaculture resource in China. In order to overwinter, M. nipponense displays decreased physiological activity and less consumption of energy. Sudden warming would trigger molting and cause an extensive death, resulting in huge economic losses. Therefore, it is of great practical significance to study the molting mechanism of oriental river prawns. Molt-inhibiting hormone gene (MIH) plays a major role in regulating molting in crustaceans. In this study, a full length MIH cDNA of M. nipponense (Mn-MIH) was cloned from the eyestalk. The total length of the Mn-MIH was 925 bp, encoding a protein of 119 amino acids. Tissue distribution analysis showed that Mn-MIH was highly expressed in the eyestalk, and that it had relatively low expression in gill, ovary, and abdominal ganglion. Mn-MIH was detected in all developmental stages, and changed regularly in line with the molting cycle of the embryo and larva. Mn-MIH varied in response to the molting cycle, suggesting that Mn-MIH negatively regulates ecdysteroidogenesis. Mn-MIH inhibition by RNAi resulted in a significant acceleration of molting cycles in both males and females, confirming the inhibitory role of MIH in molting. After long-term RNAi males, but not females had significant weight gain, confirming that Mn-MIH plays an important role in growth of M. nipponense. Our work contributes to a better understanding of the role of Mn-MIH in crustacean molting and growth.

  18. Novel splice site mutation in the growth hormone receptor gene in Turkish patients with Laron-type dwarfism.

    Science.gov (United States)

    Arman, Ahmet; Ozon, Alev; Isguven, Pinar S; Coker, Ajda; Peker, Ismail; Yordam, Nursen

    2008-01-01

    Growth hormone (GH) is involved in growth, and fat and carbohydrate metabolism. Interaction of GH with the GH receptor (GHR) is necessary for systemic and local production of insulin-like growth factor-I (IGF-I) which mediates GH actions. Mutations in the GHR cause severe postnatal growth failure; the disorder is an autosomal recessive genetic disease resulting in GH insensitivity, called Laron syndrome. It is characterized by dwarfism with elevated serum GH and low levels of IGF-I. We analyzed the GHR gene for mutations and polymorphisms in eight patients with Laron-type dwarfism from six families. We found three missense mutations (S40L, V125A, I526L), one nonsense mutation (W157X), and one splice site mutation in the extracellular domain of GHR. Furthermore, G168G and exon 3 deletion polymorphisms were detected in patients with Laron syndrome. The splice site mutation, which is a novel mutation, was located at the donor splice site of exon 2/ intron 2 within GHR. Although this mutation changed the highly conserved donor splice site consensus sequence GT to GGT by insertion of a G residue, the intron splicing between exon 2 and exon 3 was detected in the patient. These results imply that the splicing occurs arthe GT site in intron 2, leaving the extra inserted G residue at the end of exon 2, thus changing the open reading frame of GHR resulting in a premature termination codon in exon 3.

  19. Height outcome of the recombinant human growth hormone treatment in patients with SHOX gene haploinsufficiency: a meta-analysis.

    Science.gov (United States)

    Massart, Francesco; Bizzi, Martina; Baggiani, Angelo; Miccoli, Mario

    2013-04-01

    Patients with mutations or deletions of the SHOX gene present variable growth impairment, with or without mesomelic skeletal dysplasia. If untreated, short patients with SHOX haplodeficiency (SHOXD) remain short into adulthood. Although recombinant human growth hormone (rhGH) treatment improves short-term linear growth, there are episodic data on the final height of treated SHOXD subjects. After a thorough search of the published literature for pertinent studies, we undertook a meta-analysis evaluation of the efficacy and safety of rhGH treatment in SHOXD patients. In SHOXD patients, administration of rhGH progressively improved the height deficit from baseline to 24 months, although the major catch-up growth was detected after 12 months. The rhGH-induced growth appeared constant until final height. Our meta-analysis suggested rhGH therapy improves height outcome of SHOXD patients, though future studies using carefully titrated rhGH protocols are needed. Original submitted 29 October 2012; Revision submitted 22 February 2013.

  20. DETECTION OF MENDELIAN AND GENOTYPE FREQUENCY OF GROWTH HORMONE GENE IN ONGOLE CROSSBRED CATTLE MATED BY THE ARTIFICIAL INSEMINATION TECHNIQUE

    Directory of Open Access Journals (Sweden)

    U. Paputungan

    2012-06-01

    Full Text Available The objectives of this study were to detect the Mendelian mode inheritance of growth hormone (GH and to establish genotype frequency of GH gene in Ongole-crossbred cattle mated by the artificial insemination (AI technique. Total of 76 blood samples were collected from Ongole-crossbred cows and bulls (G0, and their progenies (G1 at the Tumaratas AI service center in North Sulawesi province, Indonesia. All blood samples were screened for the presence of GH locus using a PCR-RFLP method involving restricted enzyme Msp1 on 1.2 % of agarose gel. Data were analyzed using statistical program function in Excel XP. The results showed that GH locus using alleles of Msp1+ and Msp1- enzyme restriction in Ongole-crossbred cows and bulls was inherited to their Ongole-crossbred progenies following the Mendelian mode inheritance. This Mendelian inheritance generated by AI technique was not under genetic equilibrium for the Msp1 genotype frequencies in groups of G0 and G1. The breeding program using genotypes of bulls and cows (G0 for generating the genotype of GH Msp1 enzyme restriction by AI technique should be maintained to increase these various allele dispersion rates for breeding under genetic equilibrium of the Ongole-crossbred cattle population.

  1. Polymorphisms in Th1/Th2 Cytokine Genes, Hormone Replacement Therapy, and Risk of Non-Hodgkin Lymphoma

    International Nuclear Information System (INIS)

    Zhu, Gongjian; Pan, Dongsheng; Zheng, Tongzhang; Lan, Qing; Chen, Xuezhong; Chen, Yingtai; Kim, Christopher; Bi, Xiaofeng; Holford, Theodore; Boyle, Peter; Leaderer, Brian; Chanock, Stephen J.; Rothman, Nathaniel; Zhang, Yawei

    2011-01-01

    We conducted a population-based case–control study in Connecticut women to test the hypothesis that genetic variations in Th1 and Th2 cytokine genes modify the relationship between hormone replacement therapy (HRT) and risk of non-Hodgkin lymphoma (NHL). Compared to women without a history of HRT use, women with a history of HRT use had a significantly decreased risk of NHL if they carried IFNGR2 (rs1059293) CT/TT genotypes (OR = 0.5, 95%CI: 0.3–0.9), IL13 (rs20541) GG genotype (OR = 0.6, 95%CI: 0.4–0.9), and IL13 (rs1295686) CC genotype (OR = 0.6, 95%CI: 0.4–0.8), but not among women who carried IFNGR2 CC, IL13 AG/AA, and IL13CT/TT genotypes. A similar pattern was also observed for B-cell lymphoma but not for T-cell lymphoma. A statistically significant interaction was observed for IFNGR2 (rs1059293 P for interaction = 0.024), IL13(rs20541 P for interaction = 0.005), IL13 (rs1295686 P for interaction = 0.008), and IL15RA (rs2296135 P for interaction = 0.049) for NHL overall; IL13 (rs20541 P for interaction = 0.0009), IL13(rs1295686 P for interaction = 0.0002), and IL15RA (rs2296135 P for interaction = 0.041) for B-cell lymphoma. The results suggest that common genetic variation in Th1/Th pathway genes may modify the association between HRT and NHL risk.

  2. Polymorphisms in Th1/Th2 Cytokine Genes, Hormone Replacement Therapy, and Risk of Non-Hodgkin Lymphoma

    Energy Technology Data Exchange (ETDEWEB)

    Zhu, Gongjian; Pan, Dongsheng [Gansu Provincial Academy of Medical Sciences, Gansu Provincial Tumor Hospital, Lanzhou (China); Yale University School of Public Health, New Haven, CT (United States); Zheng, Tongzhang [Yale University School of Public Health, New Haven, CT (United States); Lan, Qing [Division of Cancer Epidemiology and Genetics, Department of Health and Human Services, National Cancer Institute, National Institutes of Health, Rockville, MD (United States); Chen, Xuezhong [Gansu Provincial Academy of Medical Sciences, Gansu Provincial Tumor Hospital, Lanzhou (China); Chen, Yingtai [Yale University School of Public Health, New Haven, CT (United States); Cancer Institute/Hospital, Chinese Academy of Medical Sciences, Beijing, P.R. (China); Kim, Christopher [Yale University School of Public Health, New Haven, CT (United States); Bi, Xiaofeng [Yale University School of Public Health, New Haven, CT (United States); Cancer Institute/Hospital, Chinese Academy of Medical Sciences, Beijing, P.R. (China); Holford, Theodore [Yale University School of Public Health, New Haven, CT (United States); Boyle, Peter [International Prevention Research Institute, Lyon (France); Leaderer, Brian [Yale University School of Public Health, New Haven, CT (United States); Chanock, Stephen J. [Division of Cancer Epidemiology and Genetics, Department of Health and Human Services, National Cancer Institute, National Institutes of Health, Rockville, MD (United States); Core Genotyping Facility, Department of Health and Human Services, Advanced Technology Center, National Cancer Institute, National Institutes of Health, Gaithersburg, MD (United States); Rothman, Nathaniel [Division of Cancer Epidemiology and Genetics, Department of Health and Human Services, National Cancer Institute, National Institutes of Health, Rockville, MD (United States); Zhang, Yawei, E-mail: yawei.zhang@yale.edu [Yale University School of Public Health, New Haven, CT (United States)

    2011-07-28

    We conducted a population-based case–control study in Connecticut women to test the hypothesis that genetic variations in Th1 and Th2 cytokine genes modify the relationship between hormone replacement therapy (HRT) and risk of non-Hodgkin lymphoma (NHL). Compared to women without a history of HRT use, women with a history of HRT use had a significantly decreased risk of NHL if they carried IFNGR2 (rs1059293) CT/TT genotypes (OR = 0.5, 95%CI: 0.3–0.9), IL13 (rs20541) GG genotype (OR = 0.6, 95%CI: 0.4–0.9), and IL13 (rs1295686) CC genotype (OR = 0.6, 95%CI: 0.4–0.8), but not among women who carried IFNGR2 CC, IL13 AG/AA, and IL13CT/TT genotypes. A similar pattern was also observed for B-cell lymphoma but not for T-cell lymphoma. A statistically significant interaction was observed for IFNGR2 (rs1059293 P{sub for} {sub interaction} = 0.024), IL13(rs20541 P{sub for} {sub interaction} = 0.005), IL13 (rs1295686 P{sub for} {sub interaction} = 0.008), and IL15RA (rs2296135 P{sub for} {sub interaction} = 0.049) for NHL overall; IL13 (rs20541 P{sub for} {sub interaction} = 0.0009), IL13(rs1295686 P{sub for} {sub interaction} = 0.0002), and IL15RA (rs2296135 P{sub for} {sub interaction} = 0.041) for B-cell lymphoma. The results suggest that common genetic variation in Th1/Th pathway genes may modify the association between HRT and NHL risk.

  3. Oleic acid induces specific alterations in the morphology, gene expression and steroid hormone production of cultured bovine granulosa cells.

    Science.gov (United States)

    Yenuganti, Vengala Rao; Viergutz, Torsten; Vanselow, Jens

    2016-06-01

    After parturition, one of the major problems related to nutritional management that is faced by the majority of dairy cows is negative energy balance (NEB). During NEB, excessive lipid mobilization takes place and hence the levels of free fatty acids, among them oleic acid, increase in the blood, but also in the follicular fluid. This accumulation can be associated with serious metabolic and reproductive disorders. In the present study, we analyzed the effects of physiological concentrations of oleic acid on cell morphology, apoptosis, necrosis, proliferation and steroid production, and on the abundance of selected transcripts in cultured bovine granulosa cells. Increasing oleic acid concentrations induced intracellular lipid droplet accumulation, thus resulting in a foam cell-like morphology, but had no effects on apoptosis, necrosis or proliferation. Oleic acid also significantly reduced the transcript abundance of the gonadotropin hormone receptors, FSHR and LHCGR, steroidogenic genes STAR, CYP11A1, HSD3B1 and CYP19A1, the cell cycle regulator CCND2, but not of the proliferation marker PCNA. In addition, treatment increased the transcript levels of the fatty acid transporters CD36 and SLC27A1, and decreased the production of 17-beta-estradiol and progesterone. From these data it can be concluded that oleic acid specifically affects morphological and physiological features and gene expression levels thus altering the functionality of granulosa cells. Suggestively, these effects might be partly due to the reduced expression of FSHR and thus the reduced responsiveness to FSH stimulation. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  4. Transgelin gene is frequently downregulated by promoter DNA hypermethylation in breast cancer.

    Science.gov (United States)

    Sayar, Nilufer; Karahan, Gurbet; Konu, Ozlen; Bozkurt, Betul; Bozdogan, Onder; Yulug, Isik G

    2015-01-01

    CpG hypermethylation in gene promoters is a frequent mechanism of tumor suppressor gene silencing in various types of cancers. It usually occurs at early steps of cancer progression and can be detected easily, giving rise to development of promising biomarkers for both detection and progression of cancer, including breast cancer. 5-aza-2'-deoxycytidine (AZA) is a DNA demethylating and anti-cancer agent resulting in induction of genes suppressed via DNA hypermethylation. Using microarray expression profiling of AZA- or DMSO-treated breast cancer and non-tumorigenic breast (NTB) cells, we identified for the first time TAGLN gene as a target of DNA hypermethylation in breast cancer. TAGLN expression was significantly and frequently downregulated via promoter DNA hypermethylation in breast cancer cells compared to NTB cells, and also in 13/21 (61.9 %) of breast tumors compared to matched normal tissues. Analyses of public microarray methylation data showed that TAGLN was also hypermethylated in 63.02 % of tumors compared to normal tissues; relapse-free survival of patients was worse with higher TAGLN methylation; and methylation levels could discriminate between tumors and healthy tissues with 83.14 % sensitivity and 100 % specificity. Additionally, qRT-PCR and immunohistochemistry experiments showed that TAGLN expression was significantly downregulated in two more independent sets of breast tumors compared to normal tissues and was lower in tumors with poor prognosis. Colony formation was increased in TAGLN silenced NTB cells, while decreased in overexpressing BC cells. TAGLN gene is frequently downregulated by DNA hypermethylation, and TAGLN promoter methylation profiles could serve as a future diagnostic biomarker, with possible clinical impact regarding the prognosis in breast cancer.

  5. Association of Interleukin-10 gene promoter polymorphisms with obstructive sleep apnea.

    Science.gov (United States)

    Özdaş, Sibel; Özdaş, Talih; Acar, Mustafa; Erbek, Selim S; Köseoğlu, Sabri; Göktürk, Gökhan; Izbirak, Afife

    2016-05-01

    Interleukin-10 (IL) is an anti-inflammatory cytokine that regulates normal sleep patterns, and recent studies have reported that it is a potential useful biomarker to identify presence and severity of sleep apnea syndrome (OSAS). Promoter polymorphisms of IL-10 gene have been associated with altered expression levels, which contributes to OSAS. The aim of this study was to determine the prevalence of -1082 G/A, -819 C/T, and -592 C/A promoter polymorphisms of IL-10 gene in individuals with OSAS and controls. An open-label study was performed in the Otorhinolaryngology and Sleep Disorders Outpatient Clinics. One hundred four cases with OSAS were included as the study group, and 78 individuals without OSAS were included as the controls. DNAs were extracted from peripheral blood leukocytes, and the sites that encompassed those polymorphisms were identified by DNA sequencing analyses. Data were analyzed with SNPStats and multifactor dimensionality reduction (MDR) software. The prevalence of OSAS was higher in males in the study group when compared to controls (P = 0.0003). The IL-10-1082 G/A, -819 C/T, and -592 C/A SNPs, and their minor alleles were associated with a significantly increased risk for OSAS compared to the controls (P ˂ 0.05 for all). Furthermore, ATA haplotype frequency was significantly higher in the study group compared to the control group, but the GCC haplotype frequency was lower (P = 0.0001 and P = 0.0001). As indicated in MDR analysis, combinations of IL-10 gene were associated with OSAS in single-, double-, and triple-locus analyses. The prevalences of the IL-10 gene promoter polymorphisms were different in OSAS patients and the controls in Turkish population. IL-10 gene polymorphisms may lead to altered inflammatory cascade, which might contribute to OSAS. Further studies on larger cohorts are needed to validate our findings.

  6. Promotion of growth by Coenzyme Q10 is linked to gene expression in C. elegans.

    Science.gov (United States)

    Fischer, Alexandra; Niklowitz, Petra; Menke, Thomas; Döring, Frank

    2014-10-03

    Coenzyme Q (CoQ, ubiquinone) is an essential component of the respiratory chain, a cofactor of pyrimidine biosynthesis and acts as an antioxidant in extra mitochondrial membranes. More recently CoQ has been identified as a modulator of apoptosis, inflammation and gene expression. CoQ deficient Caenorhabditis elegans clk-1 mutants show several phenotypes including a delayed postembryonic growth. Using wild type and two clk-1 mutants, here we established an experimental set-up to study the consequences of endogenous CoQ deficiency or exogenous CoQ supply on gene expression and growth. We found that a deficiency of endogenous CoQ synthesis down-regulates a cluster of genes that are important for growth (i.e., RNA polymerase II, eukaryotic initiation factor) and up-regulates oxidation reactions (i.e., cytochrome P450, superoxide dismutase) and protein interactions (i.e., F-Box proteins). Exogenous CoQ supply partially restores the expression of these genes as well as the growth retardation of CoQ deficient clk-1 mutants. On the other hand exogenous CoQ supply does not alter the expression of a further sub-set of genes. These genes are involved in metabolism (i.e., succinate dehydrogenase complex), cell signalling or synthesis of lectins. Thus, our work provides a comprehensive overview of genes which can be modulated in their expression by endogenous or exogenous CoQ. As growth retardation in CoQ deficiency is linked to the gene expression profile we suggest that CoQ promotes growth via gene expression. Copyright © 2014 Elsevier Inc. All rights reserved.

  7. Promoter Hypermethylation of the EMP3 Gene in a Series of 229 Human Gliomas

    Directory of Open Access Journals (Sweden)

    Marta Mellai

    2013-01-01

    Full Text Available The epithelial membrane protein 3 (EMP3 is a candidate tumor suppressor gene in the critical region 19q13.3 for several solid tumors, including tumors of the nervous systems. The aim of this study was to investigate the EMP3 promoter hypermethylation status in a series of 229 astrocytic and oligodendroglial tumors and in 16 GBM cell lines. The analysis was performed by methylation-specific PCR and capillary electrophoresis. Furthermore, the EMP3 expression at protein level was evaluated by immunohistochemistry and Western blotting analysis. Associations of EMP3 hypermethylation with total 1p/19q codeletion, MGMT promoter hypermethylation, IDH1/IDH2 and TP53 mutations, and EGFR amplification were studied, as well as its prognostic significance. The EMP3 promoter hypermethylation has been found in 39.5% of gliomas. It prevailed in low-grade tumors, especially in gliomas with an oligodendroglial component, and in sGBMs upon pGBMs. In oligodendroglial tumors, it was strongly associated with both IDH1/IDH2 mutations and total 1p/19q codeletion and inversely with EGFR gene amplification. No association was found with MGMT hypermethylation and TP53 mutations. In the whole series, the EMP3 hypermethylation status correlated with 19q13.3 loss and lack of EMP3 expression at protein level. A favorable prognostic significance on overall survival of the EMP3 promoter hypermethylation was found in patients with oligodendroglial tumors.

  8. The association of the metalloproteinase-3 gene promoter polymorphisms and the middle cerebral artery stenosis.

    Science.gov (United States)

    Fu, Chunli; Xing, Yingqi; Song, Xiaonan

    2011-04-01

    To investigate the association of single nucleotide polymorphism in the matrix metalloproteinase-3 (MMP3) gene promoter with the susceptibility to the middle cerebral artery stenosis. A case-control study was performed by determining the genotype of MMP3 gene promoter region using polymerase chain reaction-restriction fragment length polymorphism in 119 patients with middle cerebral artery stenosis documented by transcranial Doppler compared to 92 control patients. The frequencies of 5A and 6A alleles in MMP3 promoter region were 16.0 and 84.0% respectively in case group compared to 15.8 and 84.2% in control group with no significant difference between the two groups (P > 0.05). No significant difference was also observed in the distribution of genotypes 5A/5A,5A/6A, and 6A/6A between middle cerebral artery stenosis and control groups. Compared to 5A/5A + 5A/6A genotypes,the 6A/6A genotype did not significantly modify the risk of developing the middle cerebral artery stenosis. The MMP3-1171 dupA promoter polymorphisms are not valuable markers of susceptibility of the middle cerebral artery stenosis in this sample of population studied.

  9. Quantitative Methylation Profiles for Multiple Tumor Suppressor Gene Promoters in Salivary Gland Tumors

    Science.gov (United States)

    Durr, Megan L.; Mydlarz, Wojciech K.; Shao, Chunbo; Zahurak, Marianna L.; Chuang, Alice Y.; Hoque, Mohammad O.; Westra, William H.; Liegeois, Nanette J.; Califano, Joseph A.; Sidransky, David; Ha, Patrick K.

    2010-01-01

    Background Methylation profiling of tumor suppressor gene (TSGs) promoters is quickly becoming a powerful diagnostic tool for the early detection, prognosis, and even prediction of clinical response to treatment. Few studies address this in salivary gland tumors (SGTs); hence the promoter methylation profile of various TSGs was quantitatively assessed in primary SGT tissue to determine if tumor-specific alterations could be detected. Methodology DNA isolated from 78 tumor and 17 normal parotid gland specimens was assayed for promoter methylation status of 19 TSGs by fluorescence-based, quantitative methylation-specific PCR (qMSP). The data were utilized in a binary fashion as well as quantitatively (using a methylation quotient) allowing for better profiling and interpretation of results. Principal Findings The average number of methylation events across the studied genes was highest in salivary duct carcinoma (SDC), with a methylation value of 9.6, compared to the normal 4.5 (ptrend for increasing methylation in APC, Mint 1, PGP9.5, RAR-β, and Timp3. Conclusions/Significance Screening promoter methylation profiles in SGTs showed considerable heterogeneity. The methylation status of certain markers was surprisingly high in even normal salivary tissue, confirming the need for such controls. Several TSGs were found to be associated with malignant SGTs, especially SDC. Further study is needed to evaluate the potential use of these associations in the detection, prognosis, and therapeutic outcome of these rare tumors. PMID:20520817

  10. Identification of the MUC2 Promoter as a Strong Promoter for Intestinal Gene Expression through Generation of Transgenic Quail Expressing GFP in Gut Epithelial Cells

    Directory of Open Access Journals (Sweden)

    Rachel M. Woodfint

    2017-01-01

    Full Text Available Identification of tissue- and stage-specific gene promoters is valuable for delineating the functional roles of specific genes in genetically engineered animals. Here, through the comparison of gene expression in different tissues by analysis of a microarray database, the intestinal specificity of mucin 2 (MUC2 expression was identified in mice and humans, and further confirmed in chickens by RT-PCR (reverse transcription-PCR analysis. An analysis of cis-acting elements in avian MUC2 gene promoters revealed conservation of binding sites, within a 2.9 kb proximal promoter region, for transcription factors such as caudal type homeobox 2 (CDX2, GATA binding protein 4 (GATA4, hepatocyte nuclear factor 4 α (HNF4A, and transcription factor 4 (TCF4 that are important for maintaining intestinal homeostasis and functional integrity. By generating transgenic quail, we demonstrated that the 2.9 kb chicken MUC2 promoter could drive green fluorescent protein (GFP reporter expression exclusively in the small intestine, large intestine, and ceca. Fluorescence image analysis further revealed GFP expression in intestine epithelial cells. The GFP expression was barely detectable in the embryonic intestine, but increased during post-hatch development. The spatiotemporal expression pattern of the reporter gene confirmed that the 2.9 kb MUC2 promoter could retain the regulatory element to drive expression of target genes in intestinal tissues after hatching. This new transgene expression system, using the MUC2 promoter, will provide a new method of overexpressing target genes to study gene function in the avian intestine.

  11. The dwarf phenotype in GH240B mice, haploinsufficient for the autism candidate gene Neurobeachin, is caused by ectopic expression of recombinant human growth hormone.

    Science.gov (United States)

    Nuytens, Kim; Tuand, Krizia; Fu, Quili; Stijnen, Pieter; Pruniau, Vincent; Meulemans, Sandra; Vankelecom, Hugo; Creemers, John W M

    2014-01-01

    Two knockout mouse models for the autism candidate gene Neurobeachin (Nbea) have been generated independently. Although both models have similar phenotypes, one striking difference is the dwarf phenotype observed in the heterozygous configuration of the GH240B model that is generated by the serendipitous insertion of a promoterless human growth hormone (hGH) genomic fragment in the Nbea gene. In order to elucidate this discrepancy, the dwarfism present in this Nbea mouse model was investigated in detail. The growth deficiency in Nbea+/- mice coincided with an increased percentage of fat mass and a decrease in bone mineral density. Low but detectable levels of hGH were detected in the pituitary and hypothalamus of Nbea+/- mice but not in liver, hippocampus nor in serum. As a consequence, several members of the mouse growth hormone (mGH) signaling cascade showed altered mRNA levels, including a reduction in growth hormone-releasing hormone mRNA in the hypothalamus. Moreover, somatotrope cells were less numerous in the pituitary of Nbea+/- mice and both contained and secreted significantly less mGH resulting in reduced levels of circulating insulin-like growth factor 1. These findings demonstrate that the random integration of the hGH transgene in this mouse model has not only inactivated Nbea but has also resulted in the tissue-specific expression of hGH causing a negative feedback loop, mGH hyposecretion and dwarfism.

  12. The dwarf phenotype in GH240B mice, haploinsufficient for the autism candidate gene Neurobeachin, is caused by ectopic expression of recombinant human growth hormone.

    Directory of Open Access Journals (Sweden)

    Kim Nuytens

    Full Text Available Two knockout mouse models for the autism candidate gene Neurobeachin (Nbea have been generated independently. Although both models have similar phenotypes, one striking difference is the dwarf phenotype observed in the heterozygous configuration of the GH240B model that is generated by the serendipitous insertion of a promoterless human growth hormone (hGH genomic fragment in the Nbea gene. In order to elucidate this discrepancy, the dwarfism present in this Nbea mouse model was investigated in detail. The growth deficiency in Nbea+/- mice coincided with an increased percentage of fat mass and a decrease in bone mineral density. Low but detectable levels of hGH were detected in the pituitary and hypothalamus of Nbea+/- mice but not in liver, hippocampus nor in serum. As a consequence, several members of the mouse growth hormone (mGH signaling cascade showed altered mRNA levels, including a reduction in growth hormone-releasing hormone mRNA in the hypothalamus. Moreover, somatotrope cells were less numerous in the pituitary of Nbea+/- mice and both contained and secreted significantly less mGH resulting in reduced levels of circulating insulin-like growth factor 1. These findings demonstrate that the random integration of the hGH transgene in this mouse model has not only inactivated Nbea but has also resulted in the tissue-specific expression of hGH causing a negative feedback loop, mGH hyposecretion and dwarfism.

  13. Genomic organization and promoter cloning of the human X11α gene APBA1.

    LENUS (Irish Health Repository)

    Chai, Ka-Ho

    2012-05-01

    X11α is a brain specific multi-modular protein that interacts with the Alzheimer\\'s disease amyloid precursor protein (APP). Aggregation of amyloid-β peptide (Aβ), an APP cleavage product, is believed to be central to the pathogenesis of Alzheimer\\'s disease. Recently, overexpression of X11α has been shown to reduce Aβ generation and to ameliorate memory deficit in a transgenic mouse model of Alzheimer\\'s disease. Therefore, manipulating the expression level of X11α may provide a novel route for the treatment of Alzheimer\\'s disease. Human X11α is encoded by the gene APBA1. As evidence suggests that X11α expression can be regulated at transcription level, we have determined the gene structure and cloned the promoter of APBA1. APBA1 spans over 244 kb on chromosome 9 and is composed of 13 exons and has multiple transcription start sites. A putative APBA1 promoter has been identified upstream of exon 1 and functional analysis revealed that this is highly active in neurons. By deletion analysis, the minimal promoter was found to be located between -224 and +14, a GC-rich region that contains a functional Sp3 binding site. In neurons, overexpression of Sp3 stimulates the APBA1 promoter while an Sp3 inhibitor suppresses the promoter activity. Moreover, inhibition of Sp3 reduces endogenous X11α expression and promotes the generation of Aβ. Our findings reveal that Sp3 play an essential role in APBA1 transcription.

  14. Effect of acute exposure to cadmium on the expression of heat-shock and hormone-nuclear receptor genes in the aquatic midge Chironomus riparius

    International Nuclear Information System (INIS)

    Planello, R.; Martinez-Guitarte, J.L.; Morcillo, G.

    2010-01-01

    Cadmium is a widespread and highly toxic pollutant of particular ecotoxicological relevance for aquatic ecosystems where it accumulates. To identify biomarkers for ecotoxicity monitoring, the effect of cadmium on the expression of different genes related to the stress response as well as to the ecdysone hormone-signalling pathway was studied in the aquatic larvae of Chironomus riparius (Diptera, Chironomidae), a standard test organism in aquatic toxicology testing. Reverse Transcription Polymerase Chain Reaction (RT-PCR) was used to evaluate the effects of acute and short-term cadmium exposures (10 mM CdCl 2 , 12 h and 24 h) on the expression of hsp70, hsc70, hsp90 and hsp40 genes, as well as on that of the ecdysone hormonal-receptor genes (EcR and usp). A significant 3-fold increase in the level of hsp70 gene transcripts was induced by the treatment, whereas neither the other stress genes tested (hsp90 and hsp40) nor the constitutive form of hsp70, hsc70, was affected in the larvae exposed to cadmium. These results show that hsp70 is differentially activated to other environmentally regulated heat-shock genes, and constitutes a biomarker of exposure to this toxic metal. In addition, we also found that cadmium is able to alter the expression of the ecdysone receptor gene (EcR), whose mRNA level is significantly increased whereas usp levels remained unaltered. This finding, evidenced for the first time in invertebrates, supports the view that cadmium has the ability to mimic the effect of the hormone by the activation of the ecdysone nuclear receptor, which may partly explain the endocrine disruption capability that has been previously suggested for this toxic metal. Our research adds to the growing evidence implicating heavy metals, and cadmium in particular, as potential endocrine disruptive agents and may have significant implications for ecological risk assessment of endocrine-disrupting compounds in invertebrates.

  15. Effect of acute exposure to cadmium on the expression of heat-shock and hormone-nuclear receptor genes in the aquatic midge Chironomus riparius

    Energy Technology Data Exchange (ETDEWEB)

    Planello, R.; Martinez-Guitarte, J.L. [Grupo de Biologia y Toxicologia Ambiental, Facultad de Ciencias, Universidad Nacional de Educacion a Distancia, UNED, Senda del Rey 9, 28040 Madrid (Spain); Morcillo, G., E-mail: gmorcillo@ccia.uned.es [Grupo de Biologia y Toxicologia Ambiental, Facultad de Ciencias, Universidad Nacional de Educacion a Distancia, UNED, Senda del Rey 9, 28040 Madrid (Spain)

    2010-03-01

    Cadmium is a widespread and highly toxic pollutant of particular ecotoxicological relevance for aquatic ecosystems where it accumulates. To identify biomarkers for ecotoxicity monitoring, the effect of cadmium on the expression of different genes related to the stress response as well as to the ecdysone hormone-signalling pathway was studied in the aquatic larvae of Chironomus riparius (Diptera, Chironomidae), a standard test organism in aquatic toxicology testing. Reverse Transcription Polymerase Chain Reaction (RT-PCR) was used to evaluate the effects of acute and short-term cadmium exposures (10 mM CdCl{sub 2}, 12 h and 24 h) on the expression of hsp70, hsc70, hsp90 and hsp40 genes, as well as on that of the ecdysone hormonal-receptor genes (EcR and usp). A significant 3-fold increase in the level of hsp70 gene transcripts was induced by the treatment, whereas neither the other stress genes tested (hsp90 and hsp40) nor the constitutive form of hsp70, hsc70, was affected in the larvae exposed to cadmium. These results show that hsp70 is differentially activated to other environmentally regulated heat-shock genes, and constitutes a biomarker of exposure to this toxic metal. In addition, we also found that cadmium is able to alter the expression of the ecdysone receptor gene (EcR), whose mRNA level is significantly increased whereas usp levels remained unaltered. This finding, evidenced for the first time in invertebrates, supports the view that cadmium has the ability to mimic the effect of the hormone by the activation of the ecdysone nuclear receptor, which may partly explain the endocrine disruption capability that has been previously suggested for this toxic metal. Our research adds to the growing evidence implicating heavy metals, and cadmium in particular, as potential endocrine disruptive agents and may have significant implications for ecological risk assessment of endocrine-disrupting compounds in invertebrates.

  16. Over-expression of Gene FaASR Promotes Strawberry Fruit Coloring

    Directory of Open Access Journals (Sweden)

    Liu Zhongjie

    2015-11-01

    Full Text Available Fruit development and ripening is a complicate process. Although much progress has been made on the ripenig process, the molecular mechamism of fruit development is not yet clear. In this study, we used ‘Sweet Charlie’ strawberry as test materials, based on cloning the strawberries ASR homologous gene, we carried out the bioinformatics and temporal expression analysis of FaASR, by manipulating ASR gene expression level in strawberry fruit, we tested the changes of physiological indicators, including sugar, ABA, pigments content, and fruit firmness, as well as phenotypic changes. In addition, we measured the expression changes of some anthocyanin-related gene, such as CHS and UFGT, by which we revealed the regulation mechanisms of ASR gene over strawberry fruit ripening. Strawberry ASR contained a typical domain of ABA/WDS that was related to fruit ripening and stress-resistance, and ASR gene over-expression could promote strawberry fruit coloring, endogenous ABA and sucrose accumulation, fruit softening, and induced the transcription levels of anthocyanin-related genes CHS and UFGT. The present study will further reveal the molecular mechanisms of information transmission in fruit development, and will also play an important foundation for future molecular improvement of strawberries breeding.

  17. Methylation of Promoter Regions of Genes of the Human Intrauterine Renin Angiotensin System and Their Expression

    Directory of Open Access Journals (Sweden)

    Shane D. Sykes

    2015-01-01

    Full Text Available The intrauterine renin angiotensin system (RAS is implicated in placentation and labour onset. Here we investigate whether promoter methylation of RAS genes changes with gestation or labour and if it affects gene expression. Early gestation amnion and placenta were studied, as were term amnion, decidua, and placenta collected before labour (at elective caesarean section or after spontaneous labour and delivery. The expression and degree of methylation of the prorenin receptor (ATP6AP2, angiotensin converting enzyme (ACE, angiotensin II type 1 receptor (AGTR1, and two proteases that can activate prorenin (kallikrein, KLK1, and cathepsin D, CTSD were measured by qPCR and a DNA methylation array. There was no effect of gestation or labour on the methylation of RAS genes and CTSD. Amnion and decidua displayed strong correlations between the percent hypermethylation of RAS genes and CTSD, suggestive of global methylation. There were no correlations between the degree of methylation and mRNA abundance of any genes studied. KLK1 was the most methylated gene and the proportion of hypermethylated KLK1 alleles was lower in placenta than decidua. The presence of intermediate methylated alleles of KLK1 in early gestation placenta and in amnion after labour suggests that KLK1 methylation is uniquely dynamic in these tissues.

  18. Structure of the gene for human β2-adrenergic receptor: expression and promoter characterization

    International Nuclear Information System (INIS)

    Emorine, L.J.; Marullo, S.; Delavier-Klutchko, C.; Kaveri, S.V.; Durieu-Trautmann, O.; Strosberg, A.D.

    1987-01-01

    The genomic gene coding for the human β 2 -adrenergic receptor (β 2 AR) from A431 epidermoid cells has been isolated. Transfection of the gene into eukaryotic cells restores a fully active receptor/GTP-binding protein/adenylate cyclase complex with β 2 AR properties. Southern blot analyses with β 2 AR-specific probes show that a single β 2 AR gene is common to various human tissues and that its flanking sequences are highly conserved among humans and between man and rabbit, mouse, and hamster. Functional significance of these regions is supported by the presence of a promoter region (including mRNA cap sites, two TATA boxes, a CAAT box, and three G + C-rich regions that resemble binding sites for transcription factor Sp1) 200-300 base pairs 5' to the translation initiation codon. In the 3' flanking region, sequences homologous to glucocorticoid-response elements might be responsible for the increased expression of the β 2 AR gene observed after treatment of the transfected cells with hydrocortisone. In addition, 5' to the promoter region, an open reading frame encodes a 251-residue polypeptide that displays striking homologies with protein kinases and other nucleotide-binding proteins

  19. Cloning and characterization of largemouth bass ( Micropterus salmoides) myostatin encoding gene and its promoter

    Science.gov (United States)

    Li, Shengjie; Bai, Junjie; Wang, Lin

    2008-08-01

    Myostatin or GDF-8, a member of the transforming growth factor-β (TGF-β) superfamily, has been demonstrated to be a negative regulator of skeletal muscle mass in mammals. In the present study, we obtained a 5.64 kb sequence of myostatin encoding gene and its promoter from largemouth bass ( Micropterus salmoides). The myostatin encoding gene consisted of three exons (488 bp, 371 bp and 1779 bp, respectively) and two introns (390 bp and 855 bp, respectively). The intron-exon boundaries were conservative in comparison with those of mammalian myostatin encoding genes, whereas the size of introns was smaller than that of mammals. Sequence analysis of 1.569 kb of the largemouth bass myostatin gene promoter region revealed that it contained two TATA boxes, one CAAT box and nine putative E-boxes. Putative muscle growth response elements for myocyte enhancer factor 2 (MEF2), serum response factor (SRF), activator protein 1 (AP1), etc., and muscle-specific Mt binding site (MTBF) were also detected. Some of the transcription factor binding sites were conserved among five teleost species. This information will be useful for studying the transcriptional regulation of myostatin in fish.

  20. Porcine MYF6 gene: sequence, homology analysis, and variation in the promoter region.

    Science.gov (United States)

    Wyszyńska-Koko, J; Kurył, J

    2004-01-01

    MYF6 gene codes for the bHLH transcription factor belonging to MyoD family. Its expression accompanies the processes of differentiation and maturation of myotubes during embriogenesis and continues on a relatively high level after birth, affecting the muscle phenotype. The porcine MYF6 gene was amplified and sequenced and compared with MYF6 gene sequences of other species. The amino acid sequence was deduced and an interspecies homology analysis was performed. Myf-6 protein shows a high conservation among species of 99 and 97% identity when comparing pig with cow and human, respectively, and of 93% when comparing pig with mouse and rat. The single nucleotide polymorphism (SNP) was revealed within the promoter region, which appeared to be T --> C transition recognized by a MspI restriction enzyme.

  1. The Long Intron 1 of Growth Hormone Gene from Reeves’ Turtle (Chinemys reevesii Correlates with Negatively Regulated GH Expression in Four Cell Lines

    Directory of Open Access Journals (Sweden)

    Wen-Sheng Liu

    2016-04-01

    Full Text Available Turtles grow slowly and have a long lifespan. Ultrastructural studies of the pituitary gland in Reeves’ turtle (Chinemys reevesii have revealed that the species possesses a higher nucleoplasmic ratio and fewer secretory granules in growth hormone (GH cells than other animal species in summer and winter. C. reevesii GH gene was cloned and species-specific similarities and differences were investigated. The full GH gene sequence in C. reevesii contains 8517 base pairs (bp, comprising five exons and four introns. Intron 1 was found to be much longer in C. reevesii than in other species. The coding sequence (CDS of the turtle’s GH gene, with and without the inclusion of intron 1, was transfected into four cell lines, including DF-1 chicken embryo fibroblasts, Chinese hamster ovary (CHO cells, human embryonic kidney 293FT cells, and GH4C1 rat pituitary cells; the turtle growth hormone (tGH gene mRNA and protein expression levels decreased significantly in the intron-containing CDS in these cell lines, compared with that of the corresponding intronless CDS. Thus, the long intron 1 of GH gene in Reeves’ turtle might correlate with downregulated gene expression.

  2. Putative DNA G-quadruplex formation within the promoters of Plasmodium falciparum var genes

    Directory of Open Access Journals (Sweden)

    Rowe J

    2009-08-01

    Full Text Available Abstract Background Guanine-rich nucleic acid sequences are capable of folding into an intramolecular four-stranded structure called a G-quadruplex. When found in gene promoter regions, G-quadruplexes can downregulate gene expression, possibly by blocking the transcriptional machinery. Here we have used a genome-wide bioinformatic approach to identify Putative G-Quadruplex Sequences (PQS in the Plasmodium falciparum genome, along with biophysical techniques to examine the physiological stability of P. falciparum PQS in vitro. Results We identified 63 PQS in the non-telomeric regions of the P. falciparum clone 3D7. Interestingly, 16 of these PQS occurred in the upstream region of a subset of the P. falciparum var genes (group B var genes. The var gene family encodes PfEMP1, the parasite's major variant antigen and adhesin expressed at the surface of infected erythrocytes, that plays a key role in malaria pathogenesis and immune evasion. The ability of the PQS found in the upstream regions of group B var genes (UpsB-Q to form stable G-quadruplex structures in vitro was confirmed using 1H NMR, circular dichroism, UV spectroscopy, and thermal denaturation experiments. Moreover, the synthetic compound BOQ1 that shows a higher affinity for DNA forming quadruplex rather than duplex structures was found to bind with high affinity to the UpsB-Q. Conclusion This is the first demonstration of non-telomeric PQS in the genome of P. falciparum that form stable G-quadruplexes under physiological conditions in vitro. These results allow the generation of a novel hypothesis that the G-quadruplex sequences in the upstream regions of var genes have the potential to play a role in the transcriptional control of this major virulence-associated multi-gene family.

  3. Transcriptomics-based identification of WRKY genes and characterization of a salt and hormone-responsive PgWRKY1 gene in Panax ginseng.

    Science.gov (United States)

    Nuruzzaman, Mohammed; Cao, Hongzhe; Xiu, Hao; Luo, Tiao; Li, Jijia; Chen, Xianghui; Luo, Junli; Luo, Zhiyong

    2016-02-01

    WRKY proteins belong to a transcription factor (TF) family and play dynamic roles in many plant processes, including plant responses to abiotic and biotic stresses, as well as secondary metabolism. However, no WRKY gene in Panax ginseng C.A. Meyer has been reported to date. In this study, a number of WRKY unigenes from methyl jasmonate (MeJA)-treated adventitious root transcriptome of this species were identified using next-generation sequencing technology. A total of 48 promising WRKY unigenes encoding WRKY proteins were obtained by eliminating wrong and incomplete open reading frame (ORF). Phylogenetic analysis reveals 48 WRKY TFs, including 11 Group I, 36 Group II, and 1 Group III. Moreover, one MeJA-responsive unigene designated as PgWRKY1 was cloned and characterized. It contains an entire ORF of 1077 bp and encodes a polypeptide of 358 amino acid residues. The PgWRKY1 protein contains a single WRKY domain consisting of a conserved amino acid sequence motif WRKYGQK and a C2H2-type zinc-finger motif belonging to WRKY subgroup II-d. Subcellular localization of PgWRKY1-GFP fusion protein in onion and tobacco epidermis cells revealed that PgWRKY1 was exclusively present in the nucleus. Quantitative real-time polymerase chain reaction analysis demonstrated that the expression of PgWRKY1 was relatively higher in roots and lateral roots compared with leaves, stems, and seeds. Importantly, PgWRKY1 expression was significantly induced by salicylic acid, abscisic acid, and NaCl, but downregulated by MeJA treatment. These results suggested that PgWRKY1 might be a multiple stress-inducible gene responding to hormones and salt stresses. © The Author 2015. Published by ABBS Editorial Office in association with Oxford University Press on behalf of the Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences.

  4. After-ripening induced transcriptional changes of hormonal genes in wheat seeds: the cases of brassinosteroids, ethylene, cytokinin and salicylic acid.

    Directory of Open Access Journals (Sweden)

    Vijaya R Chitnis

    Full Text Available Maintenance and release of seed dormancy is regulated by plant hormones; their levels and seed sensitivity being the critical factors. This study reports transcriptional regulation of brassinosteroids (BR, ethylene (ET, cytokinin (CK and salicylic acid (SA related wheat genes by after-ripening, a period of dry storage that decays dormancy. Changes in the expression of hormonal genes due to seed after-ripening did not occur in the anhydrobiotic state but rather in the hydrated state. After-ripening induced dormancy decay appears to be associated with imbibition mediated increase in the synthesis and signalling of BR, via transcriptional activation of de-etiolated2, dwarf4 and brassinosteroid signaling kinase, and repression of brassinosteroid insensitive 2. Our analysis is also suggestive of the significance of increased ET production, as reflected by enhanced transcription of 1-aminocyclopropane-1-carboxylic acid oxidase in after-ripened seeds, and tight regulation of seed response to ET in regulating dormancy decay. Differential transcriptions of lonely guy, zeatin O-glucosyltransferases and cytokinin oxidases, and pseudo-response regulator between dormant and after-ripened seeds implicate CK in the regulation of seed dormancy in wheat. Our analysis also reflects the association of dormancy decay in wheat with seed SA level and NPR independent SA signaling that appear to be regulated transcriptionally by phenylalanine ammonia lyase, and whirly and suppressor of npr1 inducible1 genes, respectively. Co-expression clustering of the hormonal genes implies the significance of synergistic and antagonistic interaction between the different plant hormones in regulating wheat seed dormancy. These results contribute to further our understanding of the molecular features controlling seed dormancy in wheat.

  5. Identification of a novel first exon in the human dystrophin gene and of a new promoter located more than 500 kb upstream of the nearest known promoter

    Energy Technology Data Exchange (ETDEWEB)

    Yanagawa, H.; Nishio, H.; Takeshima, Y. [Kobe Univ. School of Medicine (Japan)] [and others

    1994-09-01

    The dystrophin gene, which is muted in patients with Duchenne and Becker muscular dystrophies, is the largest known human gene. Five alternative promoters have been characterized until now. Here we show that a novel dystrophin isoform with a different first exon can be produced through transcription initiation at a previously-unidentified alternative promoter. The case study presented is that of patient with Duchenne muscular dystrophy who had a deletion extending from 5{prime} end of the dystrophin gene to exon 2, including all promoters previously mapped in the 5{prime} part of the gene. Transcripts from lymphoblastoid cells were found to contain sequences corresponding to exon 3, indicating the presence of new promoter upstream of this exon. The nucleotide sequence of amplified cDNA corresponding to the 5{prime} end of the new transcript indicated that the 5{prime} end of exon 3 was extended by 9 codons, only the last (most 3{prime}) of which codes for methionine. The genomic nucleotide sequence upstream from the new exon, as determined using inverse polymerase chain reaction, revealed the presence of sequences similar to a TATA box, an octamer motif and an MEF-2 element. The identified promoter/exon did not map to intron 2, as might have been expected, but to a position more than 500 kb upstream of the most 5{prime} of the previously-identified promoters, thereby adding 500 kb to the dystrophin gene. The sequence of part of the new promoter region is very similar to that of certain medium reiteration frequency repetitive sequences. These findings may help us understand the molecular evolution of the dystrophin gene.

  6. Polymorphism and association of growth hormone gene with growth traits in Sirohi and Barbari breeds of goat

    Directory of Open Access Journals (Sweden)

    Praduman Pal Singh

    2015-03-01

    Full Text Available Aim: The aim was to study the polymorphism of exon 2 and exon 3 of growth hormone (GH gene, to test the polymorphic variants for Hardy–Weinberg equilibrium and to investigate association of these polymorphisms with chest girth and paunch girth in Sirohi and Barbari breeds of goat. Materials and Methods: A total of 80 kids involving forty each of Sirohi and Barbari breeds of goat were included in the study. A good quality genomic DNA isolated from the whole blood using standard protocol were used for polymerase chain reaction (PCR amplification and products obtained on restriction digestion of amplicon with enzyme HaeIII were separated on 2% agarose gel, and documented in a gel doc system. The chest girth and paunch girth of kids at birth and weekly intervals up to 4 weeks of age and subsequently at 2 months, 3 months and 6 months of age were recorded. Allele frequency and genotype distribution of polymorphism were tested for Hardy–Weinberg equilibrium by program me Genepop package. Association between different genetic variants on chest girth and paunch girth were analyzed by least squares analysis employing suitable statistical model. Results: The PCR product of genomic DNA isolated from kids of Sirohi and Barbari breeds of goat on digestion with the restriction enzyme HaeIII revealed two genotypic variants viz., AB and BB. None of the two breeds was in Hardy–Weinberg equilibrium for these variants. The least squares analysis of variance revealed non-significant effect of GH genotype and breed × genotype interaction on chest girth and paunch girth from birth to 180 days of age. The effect of breed was highly significant (p<0.01 at all ages. Conclusion: The present study showed that both the breeds were polymorphic at the exon 2 and exon 3 loci of GH gene under study with respect to HaeIII restriction endonuclease. None of the breeds was in Hardy–Weinberg equilibrium for this region of GH gene. In the present study, no significant

  7. Promoter characterization and genomic organization of the human X11β gene APBA2.

    LENUS (Irish Health Repository)

    Hao, Yan

    2012-02-15

    Overexpression of neuronal adaptor protein X11β has been shown to decrease the production of amyloid-β, a toxic peptide deposited in Alzheimer\\'s disease brains. Therefore, manipulation of the X11β level may represent a potential therapeutic strategy for Alzheimer\\'s disease. As X11β expression can be regulated at the transcription level, we determined the genomic organization and the promoter of the human X11β gene, amyloid β A4 precursor protein-binding family A member 2 (APBA2). By RNA ligase-mediated rapid amplification of cDNA ends, a single APBA2 transcription start site and the complete sequence of exon 1 were identified. The APBA2 promoter was located upstream of exon 1 and was more active in neurons. The core promoter contains several CpG dinucleotides, and was strongly suppressed by DNA methylation. In addition, mutagenesis analysis revealed a putative Pax5-binding site within the promoter. Together, APBA2 contains a potent neuronal promoter whose activity may be regulated by DNA methylation and Pax5.

  8. COX-2 gene expression in colon cancer tissue related to regulating factors and promoter methylation status

    International Nuclear Information System (INIS)

    Asting, Annika Gustafsson; Carén, Helena; Andersson, Marianne; Lönnroth, Christina; Lagerstedt, Kristina; Lundholm, Kent

    2011-01-01

    Increased cyclooxygenase activity promotes progression of colorectal cancer, but the mechanisms behind COX-2 induction remain elusive. This study was therefore aimed to define external cell signaling and transcription factors relating to high COX-2 expression in colon cancer tissue. Tumor and normal colon tissue were collected at primary curative operation in 48 unselected patients. COX-2 expression in tumor and normal colon tissue was quantified including microarray analyses on tumor mRNA accounting for high and low tumor COX-2 expression. Cross hybridization was performed between tumor and normal colon tissue. Methylation status of up-stream COX-2 promoter region was evaluated. Tumors with high COX-2 expression displayed large differences in gene expression compared to normal colon. Numerous genes with altered expression appeared in tumors of high COX-2 expression compared to tumors of low COX-2. COX-2 expression in normal colon was increased in patients with tumors of high COX-2 compared to normal colon from patients with tumors of low COX-2. IL1β, IL6 and iNOS transcripts were up-regulated among external cell signaling factors; nine transcription factors (ATF3, C/EBP, c-Fos, Fos-B, JDP2, JunB, c-Maf, NF-κB, TCF4) showed increased expression and 5 (AP-2, CBP, Elk-1, p53, PEA3) were decreased in tumors with high COX-2. The promoter region of COX-2 gene did not show consistent methylation in tumor or normal colon tissue. Transcription and external cell signaling factors are altered as covariates to COX-2 expression in colon cancer tissue, but DNA methylation of the COX-2 promoter region was not a significant factor behind COX-2 expression in tumor and normal colon tissue

  9. COX-2 gene expression in colon cancer tissue related to regulating factors and promoter methylation status

    Directory of Open Access Journals (Sweden)

    Lagerstedt Kristina

    2011-06-01

    Full Text Available Abstract Background Increased cyclooxygenase activity promotes progression of colorectal cancer, but the mechanisms behind COX-2 induction remain elusive. This study was therefore aimed to define external cell signaling and transcription factors relating to high COX-2 expression in colon cancer tissue. Method Tumor and normal colon tissue were collected at primary curative operation in 48 unselected patients. COX-2 expression in tumor and normal colon tissue was quantified including microarray analyses on tumor mRNA accounting for high and low tumor COX-2 expression. Cross hybridization was performed between tumor and normal colon tissue. Methylation status of up-stream COX-2 promoter region was evaluated. Results Tumors with high COX-2 expression displayed large differences in gene expression compared to normal colon. Numerous genes with altered expression appeared in tumors of high COX-2 expression compared to tumors of low COX-2. COX-2 expression in normal colon was increased in patients with tumors of high COX-2 compared to normal colon from patients with tumors of low COX-2. IL1β, IL6 and iNOS transcripts were up-regulated among external cell signaling factors; nine transcription factors (ATF3, C/EBP, c-Fos, Fos-B, JDP2, JunB, c-Maf, NF-κB, TCF4 showed increased expression and 5 (AP-2, CBP, Elk-1, p53, PEA3 were decreased in tumors with high COX-2. The promoter region of COX-2 gene did not show consistent methylation in tumor or normal colon tissue. Conclusions Transcription and external cell signaling factors are altered as covariates to COX-2 expression in colon cancer tissue, but DNA methylation of the COX-2 promoter region was not a significant factor behind COX-2 expression in tumor and normal colon tissue.

  10. Association of a Human FABP1 Gene Promoter Region Polymorphism with Altered Serum Triglyceride Levels.

    Directory of Open Access Journals (Sweden)

    Xian-E Peng

    Full Text Available Liver fatty acid-binding protein (L-FABP, also known as fatty acid-binding protein 1 (FABP1, is a key regulator of hepatic lipid metabolism. Elevated FABP1 levels are associated with an increased risk of cardiovascular disease (CVD and metabolic syndromes. In this study, we examine the association of FABP1 gene promoter variants with serum FABP1 and lipid levels in a Chinese population. Four promoter single-nucleotide polymorphisms (SNPs of FABP1 gene were genotyped in a cross-sectional survey of healthy volunteers (n = 1,182 from Fuzhou city of China. Results showed that only the rs2919872 G>A variant was significantly associated with serum TG concentration(P = 0.032.Compared with the rs2919872 G allele, rs2919872 A allele contributed significantly to reduced serum TG concentration, and this allele dramatically decreased the FABP1 promoter activity(P < 0.05. The rs2919872 A allele carriers had considerably lower serum FABP1 levels than G allele carriers (P < 0.01. In the multivariable linear regression analysis, the rs2919872 A allele was negatively associated with serum FABP1 levels (β = -0.320, P = 0.003, while serum TG levels were positively associated with serum FABP1 levels (β = 0.487, P = 0.014. Our data suggest that compared with the rs2919872 G allele, the rs2919872 A allele reduces the transcriptional activity of FABP1 promoter, and thereby may link FABP1 gene variation to TG level in humans.

  11. Plutella xylostella granulovirus late gene promoter activity in the context of the Autographa californica multiple nucleopolyhedrovirus genome.

    Science.gov (United States)

    Ren, He-Lin; Hu, Yuan; Guo, Ya-Jun; Li, Lu-Lin

    2016-06-01

    Within Baculoviridae, little is known about the molecular mechanisms of replication in betabaculoviruses, despite extensive studies in alphabaculoviruses. In this study, the promoters of nine late genes of the betabaculovirus Plutella xylostella granulovirus (PlxyGV) were cloned into a transient expression vector and the alphabaculovirus Autographa californica multiple nucleopolyhedrovirus (AcMNPV) genome, and compared with homologous late gene promoters of AcMNPV in Sf9 cells. In transient expression assays, all PlxyGV late promoters were activated in cells transfected with the individual reporter plasmids together with an AcMNPV bacmid. In infected cells, reporter gene expression levels with the promoters of PlxyGV e18 and AcMNPV vp39 and gp41 were significantly higher than those of the corresponding AcMNPV or PlxyGV promoters, which had fewer late promoter motifs. Observed expression levels were lower for the PlxyGV p6.9, pk1, gran, p10a, and p10b promoters than for the corresponding AcMNPV promoters, despite equal numbers of late promoter motifs, indicating that species-specific elements contained in some late promoters were favored by the native viral RNA polymerases for optimal transcription. The 8-nt sequence TAAATAAG encompassing the ATAAG motif was conserved in the AcMNPV polh, p10, and pk1 promoters. The 5-nt sequence CAATT located 4 or 5 nt upstream of the T/ATAAG motif was conserved in the promoters of PlxyGV gran, p10c, and pk1. The results of this study demonstrated that PlxyGV late gene promoters could be effectively activated by the RNA polymerase from AcMNPV, implying that late gene expression systems are regulated by similar mechanisms in alphabaculoviruses and betabaculoviruses.

  12. Immunohistochemical localization of anterior pituitary hormones in S-100 protein-positive cells in the rat pituitary gland.

    Science.gov (United States)

    Kikuchi, Motoshi; Yatabe, Megumi; Tando, Yukiko; Yashiro, Takashi

    2011-09-01

    In the anterior and intermediate lobes of the rat pituitary gland, non-hormone-producing cells that express S-100 protein coexist with various types of hormone-producing cells and are believed to function as phagocytes, supporting and paracrine-controlling cells of hormone-producing cells and stem cells, among other functions; however, their cytological characteristics are not yet fully understood. Using a transgenic rat that expresses green fluorescent protein under the promoter of the S100β protein gene, we immunohistochemically detected expression of the luteinizing hormone, thyroid-stimulating hormone, prolactin, growth hormone and proopiomelanocortin by S-100 protein-positive cells located between clusters of hormone-producing cells in the intermediate lobe. These findings lend support to the hypothesis that S-100 protein-positive cells are capable of differentiating into hormone-producing cells in the adult rat pituitary gland.

  13. Association of Exon 10A and 10B inactivating mutation of follicle stimulating hormone receptor gene (FSHR) and Polycystic Ovarian Syndrome in Vellore cohort

    Science.gov (United States)

    Sekar, Nishu; Kulkarni, Rucha; Ozalkar, Sharvari; Prabhu, Yogamaya D.; Renu, Kaviyarasi; Ramgir, Shalaka S.; Abilash, V. G.

    2017-11-01

    Polycystic ovarian syndrome is the most common heterogenous endocrine disorder in women. Follicle stimulating hormone receptor is associated with normal development as well as maturation of follicles and triggers estrogen production in granulosa cells of the ovary. Inactivating mutation in FSHR gene correlated with reduction of ovarian function in women is due to damage to receptor function. This study aims to investigate whether inactivating mutations, in follicle stimulating hormone receptor gene is related to polycystic ovarian morphology in women with PCOS. Genomic DNA isolated from 15 subjects from Sandhya Hospital, Vellore (10 patients with PCOS and 5 healthy controls) was taken for this study. Patient data included a clinical report, hormonal levels, and ovarian morphological details. DNA isolation was followed by DNA amplification by polymerase chain reaction using Exon 10 A and Exon 10 B primers. The PCR-RFLP analysis was performed using Dde1 restriction enzyme. Here we discuss inactivating mutation found in Exon 10 of FSHR gene in patients with PCOS.The absence of inactivating mutation was observed through PCR-RFLP study on Exon 10A and Exon 10B.

  14. Integration of molecular biology tools for identifying promoters and genes abundantly expressed in flowers of Oncidium Gower Ramsey

    Directory of Open Access Journals (Sweden)

    Tung Shu-Yun

    2011-04-01

    Full Text Available Abstract Background Orchids comprise one of the largest families of flowering plants and generate commercially important flowers. However, model plants, such as Arabidopsis thaliana do not contain all plant genes, and agronomic and horticulturally important genera and species must be individually studied. Results Several molecular biology tools were used to isolate flower-specific gene promoters from Oncidium 'Gower Ramsey' (Onc. GR. A cDNA library of reproductive tissues was used to construct a microarray in order to compare gene expression in flowers and leaves. Five genes were highly expressed in flower tissues, and the subcellular locations of the corresponding proteins were identified using lip transient transformation with fluorescent protein-fusion constructs. BAC clones of the 5 genes, together with 7 previously published flower- and reproductive growth-specific genes in Onc. GR, were identified for cloning of their promoter regions. Interestingly, 3 of the 5 novel flower-abundant genes were putative trypsin inhibitor (TI genes (OnTI1, OnTI2 and OnTI3, which were tandemly duplicated in the same BAC clone. Their promoters were identified using transient GUS reporter gene transformation and stable A. thaliana transformation analyses. Conclusions By combining cDNA microarray, BAC library, and bombardment assay techniques, we successfully identified flower-directed orchid genes and promoters.

  15. Identification of a p53-response element in the promoter of the proline oxidase gene

    International Nuclear Information System (INIS)

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-01-01

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site

  16. Distinguishing the Transcription Regulation Patterns in Promoters of Human Genes with Different Function or Evolutionary Age

    KAUST Repository

    Alam, Tanvir

    2012-07-01

    Distinguishing transcription regulatory patterns of different gene groups is a common problem in various bioinformatics studies. In this work we developed a methodology to deal with such a problem based on machine learning techniques. We applied our method to two biologically important problems related to detecting a difference in transcription regulation of: a/ protein-coding and long non-coding RNAs (lncRNAs) in human, as well as b/ a difference between primate-specific and non-primate-specific long non-coding RNAs. Our method is capable to classify RNAs using various regulatory features of genes that transcribe into these RNAs, such as nucleotide frequencies, transcription factor binding sites, de novo sequence motifs, CpG islands, repetitive elements, histone modification marks, and others. Ten-fold cross-validation tests suggest that our model can distinguish protein-coding and non-coding RNAs with accuracy above 80%. Twenty-fold cross-validation tests suggest that our model can distinguish primate-specific from non-primate-specific promoters of lncRNAs with accuracy above 80%. Consequently, we can hypothesize that transcription of the groups of genes mentioned above are regulated by different mechanisms. Feature selection techniques allowed us to reduce the number of features significantly while keeping the accuracy around 80%. Consequently, we can conclude that selected features play significant role in transcription regulation of coding and non-coding genes, as well as primate-specific and non-primate-specific lncRNA genes.

  17. Aquilegia B gene homologs promote petaloidy of the sepals and maintenance of the C domain boundary

    Directory of Open Access Journals (Sweden)

    Bharti Sharma

    2017-11-01

    Full Text Available Abstract The model Aquilegia coerulea x “Origami” possesses several interesting floral features, including petaloid sepals that are morphologically distinct from the true petals and a broad domain containing many whorls of stamens. We undertook the current study in an effort to understand the former trait, but additionally uncovered data that inform on the latter. The Aquilegia B gene homolog AqPI is shown to contribute to the production of anthocyanin in the first whorl sepals, although it has no major role in their morphology. Surprisingly, knockdown of AqPI in Aquilegia coerulea x “Origami” also reveals a role for the B class genes in maintaining the expression of the C gene homolog AqAG1 in the outer whorls of stamens. These findings suggest that the transference of pollinator function to the first whorl sepals included a non-homeotic recruitment of the B class genes to promote aspects of petaloidy. They also confirm results in several other Ranunculales that have revealed an unexpected regulatory connection between the B and C class genes.

  18. Functional evolution in the plant SQUAMOSA-PROMOTER BINDING PROTEIN-LIKE (SPL gene family

    Directory of Open Access Journals (Sweden)

    Jill Christine Preston

    2013-04-01

    Full Text Available The SQUAMOSA-PROMOTER BINDING PROTEIN-LIKE (SPL family of transcription factors is functionally diverse, controlling a number of fundamental aspects of plant growth and development, including vegetative phase change, flowering time, branching, and leaf initiation rate. In natural plant populations, variation in flowering time and shoot architecture have major consequences for fitness. Likewise, in crop species, variation in branching and developmental rate impact biomass and yield. Thus, studies aimed at dissecting how the various functions are partitioned among different SPL genes in diverse plant lineages are key to providing insight into the genetic basis of local adaptation and have already garnered attention by crop breeders. Here we use phylogenetic reconstruction to reveal nine major SPL gene lineages, each of which is described in terms of function and diversification. To assess evidence for ancestral and derived functions within each SPL gene lineage, we use ancestral character state reconstructions. Our analyses suggest an emerging pattern of sub-functionalization, neo-functionalization, and possible convergent evolution following both ancient and recent gene duplication. Based on these analyses we suggest future avenues of research that may prove fruitful for elucidating the importance of SPL gene evolution in plant growth and development.

  19. CELSR2, encoding a planar cell polarity protein, is a putative gene in Joubert syndrome with cortical heterotopia, microophthalmia, and growth hormone deficiency.

    Science.gov (United States)

    Vilboux, Thierry; Malicdan, May Christine V; Roney, Joseph C; Cullinane, Andrew R; Stephen, Joshi; Yildirimli, Deniz; Bryant, Joy; Fischer, Roxanne; Vemulapalli, Meghana; Mullikin, James C; Steinbach, Peter J; Gahl, William A; Gunay-Aygun, Meral

    2017-03-01

    Joubert syndrome is a ciliopathy characterized by a specific constellation of central nervous system malformations that result in the pathognomonic "molar tooth sign" on imaging. More than 27 genes are associated with Joubert syndrome, but some patients do not have mutations in any of these genes. Celsr1, Celsr2, and Celsr3 are the mammalian orthologues of the drosophila planar cell polarity protein, flamingo; they play important roles in neural development, including axon guidance, neuronal migration, and cilium polarity. Here, we report bi-allelic mutations in CELSR2 in a Joubert patient with cortical heterotopia, microophthalmia, and growth hormone deficiency. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  20. Characterization of the bovine pregnancy-associated glycoprotein gene family – analysis of gene sequences, regulatory regions within the promoter and expression of selected genes

    Directory of Open Access Journals (Sweden)

    Walker Angela M

    2009-04-01

    Full Text Available Abstract Background The Pregnancy-associated glycoproteins (PAGs belong to a large family of aspartic peptidases expressed exclusively in the placenta of species in the Artiodactyla order. In cattle, the PAG gene family is comprised of at least 22 transcribed genes, as well as some variants. Phylogenetic analyses have shown that the PAG family segregates into 'ancient' and 'modern' groupings. Along with sequence differences between family members, there are clear distinctions in their spatio-temporal distribution and in their relative level of expression. In this report, 1 we performed an in silico analysis of the bovine genome to further characterize the PAG gene family, 2 we scrutinized proximal promoter sequences of the PAG genes to evaluate the evolution pressures operating on them and to identify putative regulatory regions, 3 we determined relative transcript abundance of selected PAGs during pregnancy and, 4 we performed preliminary characterization of the putative regulatory elements for one of the candidate PAGs, bovine (bo PAG-2. Results From our analysis of the bovine genome, we identified 18 distinct PAG genes and 14 pseudogenes. We observed that the first 500 base pairs upstream of the translational start site contained multiple regions that are conserved among all boPAGs. However, a preponderance of conserved regions, that harbor recognition sites for putative transcriptional factors (TFs, were found to be unique to the modern boPAG grouping, but not the ancient boPAGs. We gathered evidence by means of Q-PCR and screening of EST databases to show that boPAG-2 is the most abundant of all boPAG transcripts. Finally, we provided preliminary evidence for the role of ETS- and DDVL-related TFs in the regulation of the boPAG-2 gene. Conclusion PAGs represent a relatively large gene family in the bovine genome. The proximal promoter regions of these genes display differences in putative TF binding sites, likely contributing to observed