WorldWideScience

Sample records for homologue sch9 promotes

  1. Lipid Signaling via Pkh1/2 Regulates Fungal CO2 Sensing through the Kinase Sch9

    Directory of Open Access Journals (Sweden)

    Susann Pohlers

    2017-01-01

    Full Text Available Adaptation to alternating CO2 concentrations is crucial for all organisms. Carbonic anhydrases—metalloenzymes that have been found in all domains of life—enable fixation of scarce CO2 by accelerating its conversion to bicarbonate and ensure maintenance of cellular metabolism. In fungi and other eukaryotes, the carbonic anhydrase Nce103 has been shown to be essential for growth in air (~0.04% CO2. Expression of NCE103 is regulated in response to CO2 availability. In Saccharomyces cerevisiae, NCE103 is activated by the transcription factor ScCst6, and in Candida albicans and Candida glabrata, it is activated by its homologues CaRca1 and CgRca1, respectively. To identify the kinase controlling Cst6/Rca1, we screened an S. cerevisiae kinase/phosphatase mutant library for the ability to regulate NCE103 in a CO2-dependent manner. We identified ScSch9 as a potential ScCst6-specific kinase, as the sch9Δ mutant strain showed deregulated NCE103 expression on the RNA and protein levels. Immunoprecipitation revealed the binding capabilities of both proteins, and detection of ScCst6 phosphorylation by ScSch9 in vitro confirmed Sch9 as the Cst6 kinase. We could show that CO2-dependent activation of Sch9, which is part of a kinase cascade, is mediated by lipid/Pkh1/2 signaling but not TORC1. Finally, we tested conservation of the identified regulatory cascade in the pathogenic yeast species C. albicans and C. glabrata. Deletion of SCH9 homologues of both species impaired CO2-dependent regulation of NCE103 expression, which indicates a conservation of the CO2 adaptation mechanism among yeasts. Thus, Sch9 is a Cst6/Rca1 kinase that links CO2 adaptation to lipid signaling via Pkh1/2 in fungi.

  2. Lipid Signaling via Pkh1/2 Regulates Fungal CO2 Sensing through the Kinase Sch9.

    Science.gov (United States)

    Pohlers, Susann; Martin, Ronny; Krüger, Thomas; Hellwig, Daniela; Hänel, Frank; Kniemeyer, Olaf; Saluz, Hans Peter; Van Dijck, Patrick; Ernst, Joachim F; Brakhage, Axel; Mühlschlegel, Fritz A; Kurzai, Oliver

    2017-01-31

    Adaptation to alternating CO 2 concentrations is crucial for all organisms. Carbonic anhydrases-metalloenzymes that have been found in all domains of life-enable fixation of scarce CO 2 by accelerating its conversion to bicarbonate and ensure maintenance of cellular metabolism. In fungi and other eukaryotes, the carbonic anhydrase Nce103 has been shown to be essential for growth in air (~0.04% CO 2 ). Expression of NCE103 is regulated in response to CO 2 availability. In Saccharomyces cerevisiae, NCE103 is activated by the transcription factor ScCst6, and in Candida albicans and Candida glabrata, it is activated by its homologues CaRca1 and CgRca1, respectively. To identify the kinase controlling Cst6/Rca1, we screened an S. cerevisiae kinase/phosphatase mutant library for the ability to regulate NCE103 in a CO 2 -dependent manner. We identified ScSch9 as a potential ScCst6-specific kinase, as the sch9Δ mutant strain showed deregulated NCE103 expression on the RNA and protein levels. Immunoprecipitation revealed the binding capabilities of both proteins, and detection of ScCst6 phosphorylation by ScSch9 in vitro confirmed Sch9 as the Cst6 kinase. We could show that CO 2 -dependent activation of Sch9, which is part of a kinase cascade, is mediated by lipid/Pkh1/2 signaling but not TORC1. Finally, we tested conservation of the identified regulatory cascade in the pathogenic yeast species C. albicans and C. glabrata Deletion of SCH9 homologues of both species impaired CO 2 -dependent regulation of NCE103 expression, which indicates a conservation of the CO 2 adaptation mechanism among yeasts. Thus, Sch9 is a Cst6/Rca1 kinase that links CO 2 adaptation to lipid signaling via Pkh1/2 in fungi. All living organisms have to cope with alternating CO 2 concentrations as CO 2 levels range from very low in the atmosphere (0.04%) to high (5% and more) in other niches, including the human body. In fungi, CO 2 is sensed via two pathways. The first regulates virulence in

  3. Experimental Evolution Reveals Interplay between Sch9 and Polyploid Stability in Yeast.

    Directory of Open Access Journals (Sweden)

    Yi-Jin Lu

    2016-11-01

    Full Text Available Polyploidization has crucial impacts on the evolution of different eukaryotic lineages including fungi, plants and animals. Recent genome data suggest that, for many polyploidization events, all duplicated chromosomes are maintained and genome reorganizations occur much later during evolution. However, newly-formed polyploid genomes are intrinsically unstable and often quickly degenerate into aneuploidy or diploidy. The transition between these two states remains enigmatic. In this study, laboratory evolution experiments were conducted to investigate this phenomenon. We show that robust tetraploidy is achieved in evolved yeast cells by increasing the abundance of Sch9-a protein kinase activated by the TORC1 (Target of Rapamycin Complex 1 and other signaling pathways. Overexpressing SCH9, but not TOR1, allows newly-formed tetraploids to exhibit evolved phenotypes and knocking out SCH9 diminishes the evolved phenotypes. Furthermore, when cells were challenged with conditions causing ancestral cells to evolve aneuploidy, tetraploidy was maintained in the evolved lines. Our results reveal a determinant role for Sch9 during the early stage of polyploid evolution.

  4. Mitochondrial genomic dysfunction causes dephosphorylation of Sch9 in the yeast Saccharomyces cerevisiae.

    Science.gov (United States)

    Kawai, Shigeyuki; Urban, Jörg; Piccolis, Manuele; Panchaud, Nicolas; De Virgilio, Claudio; Loewith, Robbie

    2011-10-01

    TORC1-dependent phosphorylation of Saccharomyces cerevisiae Sch9 was dramatically reduced upon exposure to a protonophore or in respiration-incompetent ρ(0) cells but not in respiration-incompetent pet mutants, providing important insight into the molecular mechanisms governing interorganellar signaling in general and retrograde signaling in particular.

  5. Tor1/Sch9-regulated carbon source substitution is as effective as calorie restriction in life span extension.

    Directory of Open Access Journals (Sweden)

    Min Wei

    2009-05-01

    Full Text Available The effect of calorie restriction (CR on life span extension, demonstrated in organisms ranging from yeast to mice, may involve the down-regulation of pathways, including Tor, Akt, and Ras. Here, we present data suggesting that yeast Tor1 and Sch9 (a homolog of the mammalian kinases Akt and S6K is a central component of a network that controls a common set of genes implicated in a metabolic switch from the TCA cycle and respiration to glycolysis and glycerol biosynthesis. During chronological survival, mutants lacking SCH9 depleted extracellular ethanol and reduced stored lipids, but synthesized and released glycerol. Deletion of the glycerol biosynthesis genes GPD1, GPD2, or RHR2, among the most up-regulated in long-lived sch9Delta, tor1Delta, and ras2Delta mutants, was sufficient to reverse chronological life span extension in sch9Delta mutants, suggesting that glycerol production, in addition to the regulation of stress resistance systems, optimizes life span extension. Glycerol, unlike glucose or ethanol, did not adversely affect the life span extension induced by calorie restriction or starvation, suggesting that carbon source substitution may represent an alternative to calorie restriction as a strategy to delay aging.

  6. The yeast protein kinase Sch9 adjusts V-ATPase assembly/disassembly to control pH homeostasis and longevity in response to glucose availability.

    Directory of Open Access Journals (Sweden)

    Tobias Wilms

    2017-06-01

    Full Text Available The conserved protein kinase Sch9 is a central player in the nutrient-induced signaling network in yeast, although only few of its direct substrates are known. We now provide evidence that Sch9 controls the vacuolar proton pump (V-ATPase to maintain cellular pH homeostasis and ageing. A synthetic sick phenotype arises when deletion of SCH9 is combined with a dysfunctional V-ATPase, and the lack of Sch9 has a significant impact on cytosolic pH (pHc homeostasis. Sch9 physically interacts with, and influences glucose-dependent assembly/disassembly of the V-ATPase, thereby integrating input from TORC1. Moreover, we show that the role of Sch9 in regulating ageing is tightly connected with V-ATPase activity and vacuolar acidity. As both Sch9 and the V-ATPase are highly conserved in higher eukaryotes, it will be interesting to further clarify their cooperative action on the cellular processes that influence growth and ageing.

  7. Interplay among Gcn5, Sch9 and mitochondria during chronological aging of wine yeast is dependent on growth conditions.

    Directory of Open Access Journals (Sweden)

    Cecilia Picazo

    Full Text Available Saccharomyces cerevisiae chronological life span (CLS is determined by a wide variety of environmental and genetic factors. Nutrient limitation without malnutrition, i.e. dietary restriction, expands CLS through the control of nutrient signaling pathways, of which TOR/Sch9 has proven to be the most relevant, particularly under nitrogen deprivation. The use of prototrophic wine yeast allows a better understanding of the role of nitrogen in longevity in natural and more demanding environments, such as grape juice fermentation. We previously showed that acetyltransferase Gcn5, a member of the SAGA complex, has opposite effects on CLS under laboratory and winemaking conditions, and is detrimental under the latter. Here we demonstrate that integrity of the SAGA complex is necessary for prolonged longevity, as its dismantling by SPT20 deletion causes a drop in CLS under both laboratory and winemaking conditions. The sch9Δ mutant is long-lived in synthetic SC medium, as expected, and the combined deletion of GCN5 partially suppresses this phenotype. However it is short-lived in grape juice, likely due to its low nitrogen/carbon ratio. Therefore, unbalance of nutrients can be more relevant for life span than total amounts of them. Deletion of RTG2, which codes for a protein associated with Gcn5 and is a component of the mitochondrial retrograde signal, and which communicates mitochondrial dysfunction to the nucleus, is detrimental under laboratory, but not under winemaking conditions, where respiration seems not so relevant for longevity. Transcription factor Rgm1 was found to be a novel CLS regulator Sch9-dependently.

  8. The FOX transcription factor Hcm1 regulates oxidative metabolism in response to early nutrient limitation in yeast. Role of Snf1 and Tor1/Sch9 kinases.

    Science.gov (United States)

    Rodríguez-Colman, María José; Sorolla, M Alba; Vall-Llaura, Núria; Tamarit, Jordi; Ros, Joaquim; Cabiscol, Elisa

    2013-08-01

    Within Saccharomyces cerevisiae, Hcm1is a member of the forkhead transcription factor family with a role in chromosome organization. Our group recently described its involvement in mitochondrial biogenesis and stress resistance, and reports here that Hcm1 played a role in adaptation to respiratory metabolism when glucose or nitrogen was decreased. Regulation of Hcm1 activity occurs in at least three ways: i) protein quantity, ii) subcellular localization, and iii) transcriptional activity. Transcriptional activity was measured using a reporter gene fused to a promoter that contains a binding site for Hcm1. We also analyzed the levels of several genes whose expression is known to be regulated by Hcm1 levels and the role of the main kinases known to respond to nutrients. Lack of sucrose-nonfermenting (Snf1) kinase increases cytoplasmic localization of Hcm1, whereas Δtor1 cells showed a mild increase in nuclear Hcm1. In vitro experiments showed that Snf1 clearly phosphorylates Hcm1 while Sch9 exerts a milder phosphorylation. Although in vitroTor1 does not directly phosphorylate Hcm1, in vivo rapamycin treatment increases nuclear Hcm1. We conclude that Hcm1 participates in the adaptation of cells from fermentation to respiratory metabolism during nutrient scarcity. According to our hypothesis, when nutrient levels decrease, Snf1 phosphorylates Hcm1. This results in a shift from the cytoplasm to the nucleus and increased transcriptional activity of genes involved in respiration, use of alternative energy sources, NAD synthesis and oxidative stress resistance. Copyright © 2013 Elsevier B.V. All rights reserved.

  9. Protein kinase FgSch9 serves as a mediator of the target of rapamycin and high osmolarity glycerol pathways and regulates multiple stress responses and secondary metabolism in Fusarium graminearum.

    Science.gov (United States)

    Gu, Qin; Zhang, Chengqi; Yu, Fangwei; Yin, Yanni; Shim, Won-Bo; Ma, Zhonghua

    2015-08-01

    Saccharomyces cerevisiae protein kinase Sch9 is one of the downstream effectors of the target of rapamycin (TOR) complex 1 and plays multiple roles in stress resistance, longevity and nutrient sensing. However, the functions of Sch9 orthologs in filamentous fungi, particularly in pathogenic species, have not been characterized to date. Here, we investigated biological and genetic functions of FgSch9 in Fusarium graminearum. The FgSCH9 deletion mutant (ΔFgSch9) was defective in aerial hyphal growth, hyphal branching and conidial germination. The mutant exhibited increased sensitivity to osmotic and oxidative stresses, cell wall-damaging agents, and to rapamycin, while showing increased thermal tolerance. We identified FgMaf1 as one of the FgSch9-interacting proteins that plays an important role in regulating mycotoxin biosynthesis and virulence of F. graminearum. Co-immunoprecipitation and affinity capture-mass spectrometry assays showed that FgSch9 also interacts with FgTor and FgHog1. More importantly, both ΔFgSch9 and FgHog1 null mutant (ΔFgHog1) exhibited increased sensitivity to osmotic and oxidative stresses. This defect was more severe in the FgSch9/FgHog1 double mutant. Taken together, we propose that FgSch9 serves as a mediator of the TOR and high osmolarity glycerol pathways, and regulates vegetative differentiation, multiple stress responses and secondary metabolism in F. graminearum. © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.

  10. pH homeostasis links the nutrient sensing PKA/TORC1/Sch9 ménage-à-trois to stress tolerance and longevity

    Directory of Open Access Journals (Sweden)

    Marie-Anne Deprez

    2018-01-01

    Full Text Available The plasma membrane H+-ATPase Pma1 and the vacuolar V-ATPase act in close harmony to tightly control pH homeostasis, which is essential for a vast number of physiological processes. As these main two regulators of pH are responsive to the nutritional status of the cell, it seems evident that pH homeostasis acts in conjunction with nutrient-induced signalling pathways. Indeed, both PKA and the TORC1-Sch9 axis influence the proton pumping activity of the V-ATPase and possibly also of Pma1. In addition, it recently became clear that the proton acts as a second messenger to signal glucose availability via the V-ATPase to PKA and TORC1-Sch9. Given the prominent role of nutrient signalling in longevity, it is not surprising that pH homeostasis has been linked to ageing and longevity as well. A first indication is provided by acetic acid, whose uptake by the cell induces toxicity and affects longevity. Secondly, vacuolar acidity has been linked to autophagic processes, including mitophagy. In agreement with this, a decline in vacuolar acidity was shown to induce mitochondrial dysfunction and shorten lifespan. In addition, the asymmetric inheritance of Pma1 has been associated with replicative ageing and this again links to repercussions on vacuolar pH. Taken together, accumulating evidence indicates that pH homeostasis plays a prominent role in the determination of ageing and longevity, thereby providing new perspectives and avenues to explore the underlying molecular mechanisms.

  11. pH homeostasis links the nutrient sensing PKA/TORC1/Sch9 ménage-à-trois to stress tolerance and longevity.

    Science.gov (United States)

    Deprez, Marie-Anne; Eskes, Elja; Wilms, Tobias; Ludovico, Paula; Winderickx, Joris

    2018-01-12

    The plasma membrane H + -ATPase Pma1 and the vacuolar V-ATPase act in close harmony to tightly control pH homeostasis, which is essential for a vast number of physiological processes. As these main two regulators of pH are responsive to the nutritional status of the cell, it seems evident that pH homeostasis acts in conjunction with nutrient-induced signalling pathways. Indeed, both PKA and the TORC1-Sch9 axis influence the proton pumping activity of the V-ATPase and possibly also of Pma1. In addition, it recently became clear that the proton acts as a second messenger to signal glucose availability via the V-ATPase to PKA and TORC1-Sch9. Given the prominent role of nutrient signalling in longevity, it is not surprising that pH homeostasis has been linked to ageing and longevity as well. A first indication is provided by acetic acid, whose uptake by the cell induces toxicity and affects longevity. Secondly, vacuolar acidity has been linked to autophagic processes, including mitophagy. In agreement with this, a decline in vacuolar acidity was shown to induce mitochondrial dysfunction and shorten lifespan. In addition, the asymmetric inheritance of Pma1 has been associated with replicative ageing and this again links to repercussions on vacuolar pH. Taken together, accumulating evidence indicates that pH homeostasis plays a prominent role in the determination of ageing and longevity, thereby providing new perspectives and avenues to explore the underlying molecular mechanisms.

  12. Pepsin homologues in bacteria

    Directory of Open Access Journals (Sweden)

    Bateman Alex

    2009-09-01

    Full Text Available Abstract Background Peptidase family A1, to which pepsin belongs, had been assumed to be restricted to eukaryotes. The tertiary structure of pepsin shows two lobes with similar folds and it has been suggested that the gene has arisen from an ancient duplication and fusion event. The only sequence similarity between the lobes is restricted to the motif around the active site aspartate and a hydrophobic-hydrophobic-Gly motif. Together, these contribute to an essential structural feature known as a psi-loop. There is one such psi-loop in each lobe, and so each lobe presents an active Asp. The human immunodeficiency virus peptidase, retropepsin, from peptidase family A2 also has a similar fold but consists of one lobe only and has to dimerize to be active. All known members of family A1 show the bilobed structure, but it is unclear if the ancestor of family A1 was similar to an A2 peptidase, or if the ancestral retropepsin was derived from a half-pepsin gene. The presence of a pepsin homologue in a prokaryote might give insights into the evolution of the pepsin family. Results Homologues of the aspartic peptidase pepsin have been found in the completed genomic sequences from seven species of bacteria. The bacterial homologues, unlike those from eukaryotes, do not possess signal peptides, and would therefore be intracellular acting at neutral pH. The bacterial homologues have Thr218 replaced by Asp, a change which in renin has been shown to confer activity at neutral pH. No pepsin homologues could be detected in any archaean genome. Conclusion The peptidase family A1 is found in some species of bacteria as well as eukaryotes. The bacterial homologues fall into two groups, one from oceanic bacteria and one from plant symbionts. The bacterial homologues are all predicted to be intracellular proteins, unlike the eukaryotic enzymes. The bacterial homologues are bilobed like pepsin, implying that if no horizontal gene transfer has occurred the duplication

  13. The Mycobacterium tuberculosis homologue of the Mycobacterium ...

    African Journals Online (AJOL)

    With the completion of genome sequencing of Mycobacterium tuberculosis and upsurge in the incidence of M. tuberculosis infection worldwide partly as a result of HIV pandemic, there is need for rationale approach to vaccine and chemotherapy discoveries for M. tuberculosis. The homologue of mig gene of. Mycobacterium ...

  14. Is the Prosthetic Homologue Necessary for Embodiment?

    Science.gov (United States)

    Dornfeld, Chelsea; Swanston, Michelle; Cassella, Joseph; Beasley, Casey; Green, Jacob; Moshayev, Yonatan; Wininger, Michael

    2016-01-01

    Embodiment is the process by which patients with limb loss come to accept their peripheral device as a natural extension of self. However, there is little guidance as to how exacting the prosthesis must be in order for embodiment to take place: is it necessary for the prosthetic hand to look just like the absent hand? Here, we describe a protocol for testing whether an individual would select a hand that looks like their own from among a selection of five hands, and whether the hand selection (regardless of homology) is consistent across multiple exposures to the same (but reordered) set of candidate hands. Pilot results using healthy volunteers reveals that hand selection is only modestly consistent, and that selection of the prosthetic homologue is atypical (61 of 192 total exposures). Our protocol can be executed in minutes, and makes use of readily available equipment and softwares. We present both a face-to-face and a virtual protocol, for maximum flexibility of implementation.

  15. Monolayer structures of alkyl aldehydes: Odd-membered homologues

    International Nuclear Information System (INIS)

    Phillips, T.K.; Clarke, S.M.; Bhinde, T.; Castro, M.A.; Millan, C.; Medina, S.

    2011-01-01

    Crystalline monolayers of three aldehydes with an odd number of carbon atoms in the alkyl chain (C 7 , C 9 and C 11 ) at low coverages are observed by a combination of X-ray and neutron diffraction. Analysis of the diffraction data is discussed and possible monolayer crystal structures are proposed; although unique structures could not be ascertained for all molecules. We conclude that the structures are flat on the surface, with the molecules lying in the plane of the layer. The C 11 homologue is determined to have a plane group of either p2, pgb or pgg, and for the C 7 homologue the p2 plane group is preferred.

  16. Detection of a Yersinia pestis gene homologue in rodent samples

    Directory of Open Access Journals (Sweden)

    Timothy A. Giles

    2016-08-01

    Full Text Available A homologue to a widely used genetic marker, pla, for Yersinia pestis has been identified in tissue samples of two species of rat (Rattus rattus and Rattus norvegicus and of mice (Mus musculus and Apodemus sylvaticus using a microarray based platform to screen for zoonotic pathogens of interest. Samples were from urban locations in the UK (Liverpool and Canada (Vancouver. The results indicate the presence of an unknown bacterium that shares a homologue for the pla gene of Yersinia pestis, so caution should be taken when using this gene as a diagnostic marker.

  17. Phosphatase and tensin homologue deleted on chromosome 10 ...

    African Journals Online (AJOL)

    Phosphatase and tensin homologue deleted on chromosome 10 (PTEN) is a tumor suppressor gene deleted or mutated in many human cancers such as glioblastoma, spinal tumors, prostate, bladder, adrenals, thyroid, breast, endometrium, and colon cancers. They result from loss of heterozygosity (LOH) for the PTEN ...

  18. Isolation and characterization of an AGAMOUS homologue from cocoa

    NARCIS (Netherlands)

    Chaidamsari, T.; Sugiarit, H.; Santoso, D.; Angenent, G.C.; Maagd, de R.A.

    2006-01-01

    We report the cloning of a cDNA from TcAG, an AG (Arabidopsis thaliana MADS-box C-type transcription factor gene AGAMOUS) homologue from cocoa (Theobroma cacao L.). TcAG was in the cocoa flower expressed primarily in stamens and ovaries, comparable to AG in Arabidopsis. Additionally, we found that

  19. Characterization and cloning of TMV resistance gene N homologues ...

    African Journals Online (AJOL)

    Tobacco cultivars Nicotiana tabacum cv. Samsun NN plants carrying the N gene contain a multitude of N-related genes. We cloned a few N homologues and isolated two full-length cDNAs of NL-C26 and NL-B69 genes from N. tabacum cv. Samsun NN. Nucleotide sequence analysis showed that the coding regions of ...

  20. Structural characterization and expression analysis of a beta-thymosin homologue (Tβ) in disk abalone, Haliotis discus discus.

    Science.gov (United States)

    Kasthuri, Saranya Revathy; Premachandra, H K A; Umasuthan, Navaneethaiyer; Whang, Ilson; Lee, Jehee

    2013-09-15

    Repertoires of proteins and small peptides play numerous physiological roles as hormones, antimicrobial peptides, and cellular signaling factors. The beta-thymosins are a group of small acidic peptides involved in processes such as actin sequestration, neuronal development, wound healing, tissue repair, and angiogenesis. Recent characterization of the beta thymosins as immunological regulators in invertebrates led to our identification and characterization of a beta-thymosin homologue (Tβ) from Haliotis discus discus. The cDNA possessed an ORF of 132 bp encoding a protein of 44 amino acids with a molecular mass of 4977 Da. The amino acid sequence shows high identity with another molluskan beta-thymosin and has a characteristic actin binding motif (LKKTET) and glutamyl donors. Phylogenetic analysis showed a close relationship with molluskan homologues, as well as its distinct identity and common ancestral origin. Genomic analysis revealed a 3 exon-2 intron structure similar to the other homologues. In silico promoter analysis also revealed significant transcription factor binding sites, providing evidence for the expression of this gene under different cellular conditions, including stress or pathogenic attack. Tissue distribution profiling revealed a ubiquitous presence in all the examined tissues, but with the highest expression in mantle and hemocyte. Immune challenge with lipopolysaccharide, poly I:C and Vibrio parahemolyticus induced beta-thymosin expression in gill and hemocytes, affirming an immune-related role in invertebrates. Copyright © 2013 Elsevier B.V. All rights reserved.

  1. Homologue Pairing in Flies and Mammals: Gene Regulation When Two Are Involved

    OpenAIRE

    Apte, Manasi S.; Meller, Victoria H.

    2011-01-01

    Chromosome pairing is usually discussed in the context of meiosis. Association of homologues in germ cells enables chromosome segregation and is necessary for fertility. A few organisms, such as flies, also pair their entire genomes in somatic cells. Most others, including mammals, display little homologue pairing outside of the germline. Experimental evidence from both flies and mammals suggests that communication between homologues contributes to normal genome regulation. This paper will co...

  2. Toxicities of emamectin benzoate homologues and photodegradates to Lepidoptera.

    Science.gov (United States)

    Argentine, Joseph A; Jansson, Richard K; Starner, Van R; Halliday, W Ross

    2002-12-01

    The toxicity of a number of emamectin benzoate homologues and photodegradates to five species of Lepidoptera was investigated using diet and foliar bioassays. The emamectin benzoate homologues B1a and B1b were equally toxic in the diet and foliar assays to Spodoptera exigua (Hübner), Heliothis virescens (F.), Tricoplusia ni (Hübner), and Spodoptera frugiperda (J. E. Smith), within each of these species. Plutella xylostella (L.) was the most sensitive species to emamectin benzoate. The AB1a photodegradate of emamectin benzoate was as toxic as the parent compound in the diet assay. However, in the foliage assay AB1a was 4.4-fold less toxic to S. exigua than the parent compound. The MFB1a photodegradate of emamectin benzoate was as toxic as the parent compound to P. xylostella, and 3.1 to 6.2 times as toxic as the parent compound to the other species in the diet assay. The order of toxicity of the photodegradates were AB1a > MFB1a > FAB1a > 8,9-Z-MAB1a > PAB1a.

  3. Homologue Pairing in Flies and Mammals: Gene Regulation When Two Are Involved

    Directory of Open Access Journals (Sweden)

    Manasi S. Apte

    2012-01-01

    Full Text Available Chromosome pairing is usually discussed in the context of meiosis. Association of homologues in germ cells enables chromosome segregation and is necessary for fertility. A few organisms, such as flies, also pair their entire genomes in somatic cells. Most others, including mammals, display little homologue pairing outside of the germline. Experimental evidence from both flies and mammals suggests that communication between homologues contributes to normal genome regulation. This paper will contrast the role of pairing in transmitting information between homologues in flies and mammals. In mammals, somatic homologue pairing is tightly regulated, occurring at specific loci and in a developmentally regulated fashion. Inappropriate pairing, or loss of normal pairing, is associated with gene misregulation in some disease states. While homologue pairing in flies is capable of influencing gene expression, the significance of this for normal expression remains unknown. The sex chromosomes pose a particularly interesting situation, as females are able to pair X chromosomes, but males cannot. The contribution of homologue pairing to the biology of the X chromosome will also be discussed.

  4. Targeting the Enhancer of Zeste Homologue 2 in Medulloblastoma

    Science.gov (United States)

    Alimova, Irina; Venkataraman, Sujatha; Harris, Peter; Marquez, Victor E.; Northcott, Paul A; Dubuc, Adrian; Taylor, Michael D; Foreman, Nicholas K; Vibhakar, Rajeev

    2012-01-01

    Enhancer of zeste homologue 2 (EZH2) is the catalytic subunit of Polycomb repressive complex 2 that catalyzes the trimethylation of histone H3 on Lys 27, and represses gene transcription. EZH2 enhances cancer-cell proliferation and regulates stem cell maintenance and differentiation. Here, we demonstrate that EZH2 is highly expressed in medulloblastoma, a highly malignant brain tumor of childhood, and this altered expression is correlated with genomic gain of chromosome 7 in a subset of medulloblastoma. Inhibition of EZH2 by RNAi suppresses medulloblastoma tumor cell growth. We show that 3-deazaneplanocin A, a chemical inhibitor of EZH2, can suppress medulloblastoma cell growth partially by inducing apoptosis. Suppression of EZH2 expression diminishes the ability of tumor cells to form spheres in culture and strongly represses the ability of known oncogenes to transform neural stem cells. These findings establish a role of EZH2 in medulloblastoma and identify EZH2 as a potential therapeutic target especially in high-risk tumors. PMID:22287205

  5. Contribution of polycomb homologues Bmi-1 and Mel-18 to medulloblastoma pathogenesis.

    Science.gov (United States)

    Wiederschain, Dmitri; Chen, Lin; Johnson, Brett; Bettano, Kimberly; Jackson, Dowdy; Taraszka, John; Wang, Y Karen; Jones, Michael D; Morrissey, Michael; Deeds, James; Mosher, Rebecca; Fordjour, Paul; Lengauer, Christoph; Benson, John D

    2007-07-01

    Bmi-1 and Mel-18 are structural homologues that belong to the Polycomb group of transcriptional regulators and are believed to stably maintain repression of gene expression by altering the state of chromatin at specific promoters. While a number of clinical and experimental observations have implicated Bmi-1 in human tumorigenesis, the role of Mel-18 in cancer cell growth has not been investigated. We report here that short hairpin RNA-mediated knockdown of either Bmi-1 or Mel-18 in human medulloblastoma DAOY cells results in the inhibition of proliferation, loss of clonogenic survival, anchorage-independent growth, and suppression of tumor formation in nude mice. Furthermore, overexpression of both Bmi-1 and Mel-18 significantly increases the clonogenic survival of Rat1 fibroblasts. In contrast, stable downregulation of Bmi-1 or Mel-18 alone does not affect the growth of normal human WI38 fibroblasts. Proteomics-based characterization of Bmi-1 and Mel-18 protein complexes isolated from cancer cells revealed substantial similarities in their respective compositions. Finally, gene expression analysis identified a number of cancer-relevant pathways that may be controlled by Bmi-1 and Mel-18 and also showed that these Polycomb proteins regulate a set of common gene targets. Taken together, these results suggest that Bmi-1 and Mel-18 may have overlapping functions in cancer cell growth.

  6. Antidepressant Binding Site in a Bacterial Homologue of Neurotransmitter Transporters

    Energy Technology Data Exchange (ETDEWEB)

    Singh,S.; Yamashita, A.; Gouaux, E.

    2007-01-01

    Sodium-coupled transporters are ubiquitous pumps that harness pre-existing sodium gradients to catalyse the thermodynamically unfavourable uptake of essential nutrients, neurotransmitters and inorganic ions across the lipid bilayer. Dysfunction of these integral membrane proteins has been implicated in glucose/galactose malabsorption, congenital hypothyroidism, Bartter's syndrome, epilepsy, depression, autism and obsessive-compulsive disorder. Sodium-coupled transporters are blocked by a number of therapeutically important compounds, including diuretics, anticonvulsants and antidepressants, many of which have also become indispensable tools in biochemical experiments designed to probe antagonist binding sites and to elucidate transport mechanisms. Steady-state kinetic data have revealed that both competitive and noncompetitive modes of inhibition exist. Antagonist dissociation experiments on the serotonin transporter (SERT) have also unveiled the existence of a low-affinity allosteric site that slows the dissociation of inhibitors from a separate high-affinity site. Despite these strides, atomic-level insights into inhibitor action have remained elusive. Here we screen a panel of molecules for their ability to inhibit LeuT, a prokaryotic homologue of mammalian neurotransmitter sodium symporters, and show that the tricyclic antidepressant (TCA) clomipramine noncompetitively inhibits substrate uptake. Cocrystal structures show that clomipramine, along with two other TCAs, binds in an extracellular-facing vestibule about 11 {angstrom} above the substrate and two sodium ions, apparently stabilizing the extracellular gate in a closed conformation. Off-rate assays establish that clomipramine reduces the rate at which leucine dissociates from LeuT and reinforce our contention that this TCA inhibits LeuT by slowing substrate release. Our results represent a molecular view into noncompetitive inhibition of a sodium-coupled transporter and define principles for the

  7. Antidepressant Binding Site in a Bacterial Homologue of Neurotransmitter Transporters

    International Nuclear Information System (INIS)

    Singh, S.; Yamashita, A.; Gouaux, E.

    2007-01-01

    Sodium-coupled transporters are ubiquitous pumps that harness pre-existing sodium gradients to catalyse the thermodynamically unfavourable uptake of essential nutrients, neurotransmitters and inorganic ions across the lipid bilayer. Dysfunction of these integral membrane proteins has been implicated in glucose/galactose malabsorption, congenital hypothyroidism, Bartter's syndrome, epilepsy, depression, autism and obsessive-compulsive disorder. Sodium-coupled transporters are blocked by a number of therapeutically important compounds, including diuretics, anticonvulsants and antidepressants, many of which have also become indispensable tools in biochemical experiments designed to probe antagonist binding sites and to elucidate transport mechanisms. Steady-state kinetic data have revealed that both competitive and noncompetitive modes of inhibition exist. Antagonist dissociation experiments on the serotonin transporter (SERT) have also unveiled the existence of a low-affinity allosteric site that slows the dissociation of inhibitors from a separate high-affinity site. Despite these strides, atomic-level insights into inhibitor action have remained elusive. Here we screen a panel of molecules for their ability to inhibit LeuT, a prokaryotic homologue of mammalian neurotransmitter sodium symporters, and show that the tricyclic antidepressant (TCA) clomipramine noncompetitively inhibits substrate uptake. Cocrystal structures show that clomipramine, along with two other TCAs, binds in an extracellular-facing vestibule about 11 (angstrom) above the substrate and two sodium ions, apparently stabilizing the extracellular gate in a closed conformation. Off-rate assays establish that clomipramine reduces the rate at which leucine dissociates from LeuT and reinforce our contention that this TCA inhibits LeuT by slowing substrate release. Our results represent a molecular view into noncompetitive inhibition of a sodium-coupled transporter and define principles for the rational

  8. The effect of delta-like 1 homologue on the proliferation and odontoblastic differentiation in human dental pulp stem cells.

    Science.gov (United States)

    Qi, Shengcai; Yan, Yanhong; Wen, Yue; Li, Jialiang; Wang, Jing; Chen, Fubo; Tang, Xiaoshan; Shang, Guangwei; Xu, Yuanzhi; Wang, Raorao

    2017-06-01

    This study aimed to investigate the functions of delta-like homologue 1 (DLK1) in the proliferation and differentiation of human dental pulp stem cells (hDPSCs). Immunohistochemical analysis was used to determine the expression of alkaline phosphatase (ALP), dentin sialophosphoprotein (DSPP), DLK1, NOTCH1 and p-ERK1/2 in the mouse first maxillary molar. Recombinant lentivirus was constructed to overexpress DLK1 stably in hDPSCs. The cell viability and proliferation of hDPSCs were examined by CCK8 and EdU incorporation assay respectively. The odontoblastic differentiation of hDPSCs was determined by detection of ALPase activity assay, ALP and alizarin red staining and the expression of mineralization-related genes including ALP, DSPP and dental matrix protein. The mRNA and protein levels of DLK1 and p-ERK1/2 protein expression were detected. ERK inhibitor was used to test the differentiation effect of DLK1 on hDPSCs. Delta-like homologue 1 was highly expressed on the odontoblasts and dental pulp cells on the first maxillary molar; the expression of p-ERK1/2 is similar with the DLK1 in the same process. The expression level of DLK1 increased significantly after the odontoblastic induction of hDPSCs. DLK1 overexpression increased the proliferation ability of hDPSCs and inhibited odontoblastic differentiation of hDPSCs. The protein level of p-ERK1/2 significantly increased in hDPSCs/dlk1-oe group. ERK signalling pathway inhibitor reversed the odontoblastic differentiation effects of DLK1 on hDPSCs. The proliferation of hDPSCs was promoted after DLK1 overexpression. DLK1 inhibited the odontoblastic differentiation of hDPSCs, which maybe through ERK signalling pathway. © 2017 John Wiley & Sons Ltd.

  9. From Cell Death to Metabolism: Holin-Antiholin Homologues with New Functions

    DEFF Research Database (Denmark)

    van den Esker, Marielle H.; Kovács, Ákos T.; Kuipers, Oscar P.

    2017-01-01

    , but their functions can be different, depending on the species. Using a series of biochemical and genetic approaches, in a recent article in mBio, Charbonnier et al. (mBio 8:e00976-17, 2017, https://doi.org/10.1128/mBio.00976-17) demonstrate that the antiholin homologue in Bacillus subtilis transports pyruvate...

  10. Behaviour of the homologues of Rf and Db in complexing media

    International Nuclear Information System (INIS)

    Trubert, D.; Monroy Guzman, F.; Hussonnois, M.; Brillard, L.; Le Naour, C.; Servajean, V.; Constantinescu, O.; Constantinescu, M.; Ardisson, G.; Barci, V.; Weiss, B.

    1999-01-01

    In order to study the chemical behaviour of the trans-actinide elements, the chemical properties of their most probable homologues have been investigated by ion exchange methods in various complexing media. A new chromatographic method allowing the determination of distribution coefficients in the case o short-lived isotopes has been developed and successfully tested with the RACHEL device. (authors)

  11. Partial functional complementation between human and mouse cytomegalovirus chemokine receptor homologues

    DEFF Research Database (Denmark)

    Farrell, Helen E; Abraham, Alexander M; Cardin, Rhonda D

    2011-01-01

    The human cytomegalovirus (CMV) proteins US28 and UL33 are homologous to chemokine receptors (CKRs). Knockout of the mouse CMV M33 protein (UL33 homologue) results in substantial attenuation of salivary gland infection/replication and reduced efficiency of reactivation from tissue explants. M33-m...

  12. A lesion mimic phenotype in tomato obtained by isolating and silencing an Lls1 homologue

    NARCIS (Netherlands)

    Spassieva, S; Hille, J

    Lesion mimic phenotypes serve as a tool to study the regulation of cell death in plants. In order to obtain a tomato lesion mimic phenotype, we used the conservation of the lethal leaf spot 1 (Lls1) genes between plant species. The tomato Lls1 homologue was cloned, sequenced and analyzed. It showed

  13. The actin homologue MreB organizes the bacterial cell membrane

    NARCIS (Netherlands)

    Strahl, H.; Burmann, F.; Hamoen, L.W.

    2014-01-01

    The eukaryotic cortical actin cytoskeleton creates specific lipid domains, including lipid rafts, which determine the distribution of many membrane proteins. Here we show that the bacterial actin homologue MreB displays a comparable activity. MreB forms membrane-associated filaments that coordinate

  14. Cloning and characterization of maize ZmSPK1, a homologue to ...

    African Journals Online (AJOL)

    hope&shola

    2006-03-15

    Mar 15, 2006 ... homologue to nonfermenting1-related protein kinase2 ... RT-PCR analysis showed that the ZmSPK1 expression was induced by mannitol, salt and ... MAPKKK in which each component is activated by .... It has been one of the main ... Protein kinase ATP-binding region signature is shown in gray box.

  15. A Hexose Transporter Homologue Controls Glucose Repression in the Methylotrophic Yeast Hansenula polymorpha

    NARCIS (Netherlands)

    Stasyk, Oleh V.; Stasyk, Olena G.; Komduur, Janet; Veenhuis, Marten; Cregg, James M.; Sibirny, Andrei A.

    2004-01-01

    Peroxisome biogenesis and synthesis of peroxisomal enzymes in the methylotrophic yeast Hansenula polymorpha are under the strict control of glucose repression. We identified an H. polymorpha glucose catabolite repression gene (HpGCR1) that encodes a hexose transporter homologue. Deficiency in GCR1

  16. Structure of HLA-A*1101 in complex with a hepatitis B peptide homologue

    DEFF Research Database (Denmark)

    Blicher, Thomas; Kastrup, Jette Sandholm; Pedersen, Lars Østergaard

    2006-01-01

    A high-resolution structure of the human MHC-I molecule HLA-A*1101 is presented in which it forms a complex with a sequence homologue of a peptide that occurs naturally in hepatitis B virus DNA polymerase. The sequence of the bound peptide is AIMPARFYPK, while that of the corresponding natural...

  17. Structural studies on a non-toxic homologue of type II RIPs from ...

    Indian Academy of Sciences (India)

    Structural studies on a non-toxic homologue of type II RIPs from bitter gourd: Molecular basis of non-toxicity, conformational selection and glycan structure. MS accepted http://www.ias.ac.in/jbiosci. THYAGESHWAR CHANDRAN, ALOK SHARMA and M VIJAYAN. J. Biosci. 40(5), October 2015, 929–941, © Indian Academy of ...

  18. Characterization of four RecQ homologues from rice (Oryza sativa L. cv. Nipponbare)

    International Nuclear Information System (INIS)

    Saotome, Ai; Kimura, Seisuke; Mori, Yoko; Uchiyama, Yukinobu; Morohashi, Kengo; Sakaguchi, Kengo

    2006-01-01

    The RecQ family of DNA helicases is conserved throughout the biological kingdoms. In this report, we have characterized four RecQ homologues clearly expressed in rice. OsRecQ1, OsRecQ886, and OsRecQsim expressions were strongly detected in meristematic tissues. Transcription of the OsRecQ homologues was differentially induced by several types of DNA-damaging agents. The expression of four OsRecQ homologues was induced by MMS and bleomycin. OsRecQ1 and OsRecQ886 were induced by H 2 O 2 , and MitomycinC strongly induced the expression of OsRecQ1. Transient expression of OsRecQ/GFP fusion proteins demonstrated that OsRecQ2 and OsRecQ886 are found in nuclei, whereas OsRecQ1 and OsRecQsim are found in plastids. Neither OsRecQ1 nor OsRecQsim are induced by light. These results indicate that four of the RecQ homologues have different and specific functions in DNA repair pathways, and that OsRecQ1 and OsRecQsim may not involve in plastid differentiation but different aspects of a plastid-specific DNA repair system

  19. The role of the leukemia-associated ETO homologue repressors in hematopoiesis

    OpenAIRE

    Olsson, André

    2006-01-01

    The fusion protein AML1-ETO is observed in acute myeloid patients with the chromosomal translocation t(8;21). Cells with this chimeric protein have impaired granulocytic and erythroid differentiation with accumulation of myeloblasts. The transcriptional co-repressor ETO (Eight Twenty One) was identified from the cloning of AML1-ETO. Subsequently, MTGR1 (Myeloid Translocation Gene-Related protein 1) and MTG16 (Myeloid Translocation Gene on chromosome 16) were found to be homologues to ETO, all...

  20. Periodontal status of teeth restored with crowns and its contralateral homologue, Valdivia- Chile.

    OpenAIRE

    Israel Antonio Juárez; Sofía Larroulet; Makarena Ojeda; Cristian Rosas

    2015-01-01

    ABSTRACT Aim: To determine periodontal status of fixes single prostheses (FSP) made during the year 2013 in Austral University of Chile, and its contralateral homologue (CH).Methods: All patients with FSP made during 2013, that met the selection criteria and agreed to participate were evaluated. During the year 2014 was measured: probing depth, attachment level; bleeding on probing and dental plaque index for each FSP and CH; and consigned biological width invasion. Were measured one FSP...

  1. The actin homologue MreB organizes the bacterial cell membrane

    OpenAIRE

    Strahl, Henrik; Bürmann, Frank; Hamoen, Leendert W.

    2014-01-01

    The eukaryotic cortical actin cytoskeleton creates specific lipid domains, including lipid rafts, which determine the distribution of many membrane proteins. Here we show that the bacterial actin homologue MreB displays a comparable activity. MreB forms membrane-associated filaments that coordinate bacterial cell wall synthesis. We noticed that the MreB cytoskeleton influences fluorescent staining of the cytoplasmic membrane. Detailed analyses combining an array of mutants, using specific lip...

  2. Crystal structure of myotoxin-II: a myotoxic phospholipase A2 - homologue from Bothrops moojeni venom

    International Nuclear Information System (INIS)

    Azevedo, W.F.; Ward, R.J.; Lombardi, F.R.; Arni, R.K.; Soares, A.M.; Giglio, J.R.; Fontes, M.R.M.

    1997-01-01

    Full text. Phospho lipases A2 (PLA 2 ; E C 3.1.1.4, phosphatides s n-2 acyl hydrolases) hydrolysis the s n-2 ester bond of phospholipids showing enhanced activity at lamellar or membrane surfaces. Intracellular PLA 2 s are involved at phospholipid metabolism and signal transduction, whereas extracellular PLA 2 s are found in mammalian pancreatic juices, the venoms of snakes, lizards and insects. Based on their high primary sequence similarity, extracellular PLA 2 s are separated into Classes I, II and III. Class II PLA 2 s are found in snake venoms of Crotalidae an Viperidae species, and include the sub-family of Lys PLA 2 s homologue. he coordination of the Ca 2+ ion in the PLA 2 calcium-binding loop includes and aspartate at position 49. In the catalytically active PLA 2 s, this calcium ion plays a critical role in the stabilization of the tetrahedral transition state intermediate in the catalytic mechanism. The conservative substitution Asp49-Lys results in a decreased calcium affinity with a concomitant loss of catalytic activity, and naturally occurring PLA 2 s-homologues showing the same substitution are catalytically inactive. However, the Lys PLA 2 s possess cytolytic and myotoxic activities and furthermore retain the ability to disrupt the integrity of both plasma membranes and model lipid layers by a ca 2+ -independent mechanism for which there is no evidence of lipid hydrolysis. Lys 49 PLA 2 homologues have been isolated from several Bothrops spp. venoms including B. moojeni. Therefore, in order to improve our understanding of the molecular basis of the myotoxic and Ca 2+ independent membrane damaging activities we have determined the crystal structure of MjTX-II, a Lys 49 homologue from the venom of B. moojeni. The model presented has been determined at 2.0 A resolution and refined to a crystallographic residual of 19.7% (R f ree=28.1%). (author)

  3. Three TFL1 homologues regulate floral initiation in the biofuel plant Jatropha curcas

    Science.gov (United States)

    Li, Chaoqiong; Fu, Qiantang; Niu, Longjian; Luo, Li; Chen, Jianghua; Xu, Zeng-Fu

    2017-01-01

    Recent research revealed that TERMINAL FLOWER 1 (TFL1) homologues are involved in the critical developmental process of floral initiation in several plant species. In this study, the functions of three putative TFL1 homologues (JcTFL1a, JcTFL1b and JcTFL1c) in the biofuel plant Jatropha curcas were analysed using the transgenic approach. JcTFL1b and JcTFL1c, but not JcTFL1a, could complement the TFL1 function and rescue early flowering and determinate inflorescence phenotype in tfl1-14 Arabidopsis mutant, thus suggesting that JcTFL1b and JcTFL1c may be homologues of TFL1. Transgenic Jatropha overexpressing JcTFL1a, JcTFL1b or JcTFL1c showed late flowering, whereas only JcTFL1b and JcTFL1c overexpression delayed flowering in transgenic Arabidopsis. JcTFL1b-RNAi transgenic Jatropha consistently exhibited moderately early flowering phenotype. JcFT and JcAP1 were significantly downregulated in transgenic Jatropha overexpressing JcTFL1a, JcTFL1b or JcTFL1c, which suggested that the late flowering phenotype of these transgenic Jatropha may result from the repressed expression of JcFT and JcAP1. Our results indicate that these three JcTFL1 genes play redundant roles in repressing flowering in Jatropha. PMID:28225036

  4. Identification and characterisation of the angiotensin converting enzyme-3 (ACE3) gene: a novel mammalian homologue of ACE

    OpenAIRE

    Rella, Monika; Elliot, Joann L; Revett, Timothy J; Lanfear, Jerry; Phelan, Anne; Jackson, Richard M; Turner, Anthony J; Hooper, Nigel M

    2007-01-01

    Abstract Background Mammalian angiotensin converting enzyme (ACE) plays a key role in blood pressure regulation. Although multiple ACE-like proteins exist in non-mammalian organisms, to date only one other ACE homologue, ACE2, has been identified in mammals. Results Here we report the identification and characterisation of the gene encoding a third homologue of ACE, termed ACE3, in several mammalian genomes. The ACE3 gene is located on the same chromosome downstream of the ACE gene. Multiple ...

  5. Drosophila homologues of adenomatous polyposis coli (APC) and the formin diaphanous collaborate by a conserved mechanism to stimulate actin filament assembly.

    Science.gov (United States)

    Jaiswal, Richa; Stepanik, Vince; Rankova, Aneliya; Molinar, Olivia; Goode, Bruce L; McCartney, Brooke M

    2013-05-10

    Vertebrate APC collaborates with Dia through its Basic domain to assemble actin filaments. Despite limited sequence homology between the vertebrate and Drosophila APC Basic domains, Drosophila APC1 collaborates with Dia to stimulate actin assembly in vitro. The mechanism of actin assembly is highly conserved over evolution. APC-Dia collaborations may be crucial in a wide range of animal cells. Adenomatous polyposis coli (APC) is a large multidomain protein that regulates the cytoskeleton. Recently, it was shown that vertebrate APC through its Basic domain directly collaborates with the formin mDia1 to stimulate actin filament assembly in the presence of nucleation barriers. However, it has been unclear whether these activities extend to homologues of APC and Dia in other organisms. Drosophila APC and Dia are each required to promote actin furrow formation in the syncytial embryo, suggesting a potential collaboration in actin assembly, but low sequence homology between the Basic domains of Drosophila and vertebrate APC has left their functional and mechanistic parallels uncertain. To address this question, we purified Drosophila APC1 and Dia and determined their individual and combined effects on actin assembly using both bulk fluorescence assays and total internal reflection fluorescence microscopy. Our data show that APC1, similar to its vertebrate homologue, bound to actin monomers and nucleated and bundled filaments. Further, Drosophila Dia nucleated actin assembly and protected growing filament barbed ends from capping protein. Drosophila APC1 and Dia directly interacted and collaborated to promote actin assembly in the combined presence of profilin and capping protein. Thus, despite limited sequence homology, Drosophila and vertebrate APCs exhibit highly related activities and mechanisms and directly collaborate with formins. These results suggest that APC-Dia interactions in actin assembly are conserved and may underlie important in vivo functions in a broad

  6. The role of the Saccharomyces cerevisiae lipoate protein ligase homologue, Lip3, in lipoic acid synthesis.

    Science.gov (United States)

    Hermes, Fatemah A; Cronan, John E

    2013-10-01

    The covalent attachment of lipoate to the lipoyl domains (LDs) of the central metabolism enzymes pyruvate dehydrogenase (PDH) and oxoglutarate dehydrogenase (OGDH) is essential for their activation and thus for respiratory growth in Saccharomyces cerevisiae. A third lipoate-dependent enzyme system, the glycine cleavage system (GCV), is required for utilization of glycine as a nitrogen source. Lipoate is synthesized by extraction of its precursor, octanoyl-acyl carrier protein (ACP), from the pool of fatty acid biosynthetic intermediates. Alternatively, lipoate is salvaged from previously modified proteins or from growth medium by lipoate protein ligases (Lpls). The first Lpl to be characterized, LplA of Escherichia coli, catalyses two partial reactions: activation of the acyl chain by formation of acyl-AMP, followed by transfer of the acyl chain to lipoyl domains (LDs). There is a surprising diversity within the Lpl family of enzymes, several of which catalyse reactions other than ligation reactions. For example, the Bacillus subtilis Lpl homologue LipM is an octanoyltransferase that transfers the octanoyl moiety from octanoyl-ACP to GCV. Another B. subtilis Lpl homologue, LipL, transfers octanoate from octanoyl-GCV to other LDs in an amido-transfer reaction. Study of eukaryotic Lpls has lagged behind studies of the bacterial enzymes. We report that the Lip3 Lpl homologue of the yeast S. cerevisiae has octanoyl-CoA-protein transferase activity, and discuss implications of this activity on the physiological role of Lip3 in lipoate synthesis. Published 2013. This article is a U.S. Government work and is in the public domain in the USA.

  7. OVO homologue-like 1 (Ovol1) transcription factor: a novel target of neurogenin-3 in rodent pancreas.

    Science.gov (United States)

    Vetere, A; Li, W-C; Paroni, F; Juhl, K; Guo, L; Nishimura, W; Dai, X; Bonner-Weir, S; Sharma, A

    2010-01-01

    The basic helix-loop-helix transcription factor neurogenin-3 (NGN3) commits the fates of pancreatic progenitors to endocrine cell types, but knowledge of the mechanisms regulating the choice between proliferation and differentiation of these progenitors is limited. Using a chromatin immunoprecipitation cloning approach, we searched for direct targets of NGN3 and identified a zinc-finger transcription factor, OVO homologue-like 1 (OVOL1). Transactivation experiments were carried out to elucidate the functional role of NGN3 in Ovol1 gene expression. Embryonic and adult rodents pancreases were immunostained for OVOL1, Ki67 and NGN3. We showed that NGN3 negatively regulates transcription of Ovol1 in an E-box-dependent fashion. The presence of either NGN3 or NEUROD1, but not MYOD, reduced endogenous Ovol1 mRNA. OVOL1 was detected in pancreatic tissue around embryonic day 15.5, after which OVOL1 levels dramatically increased. In embryonic pancreas, OVOL1 protein levels were low in NGN3(+) or Ki67(+) cells, but high in quiescent differentiated cells. OVOL1 presence was maintained in adult pancreas, where it was detected in islets, pancreatic ducts and some acinar cells. Additionally OVOL1 presence was lacking in proliferating ductules in regenerating pancreas and induced in cells as they began to acquire their differentiated phenotype. The timing of OVOL1 appearance in pancreas and its increased levels in differentiated cells suggest that OVOL1 promotes the transition of cells from a proliferating, less-differentiated state to a quiescent more-differentiated state. We conclude that OVOL1, a downstream target of NGN3, may play an important role in regulating the balance between proliferation and differentiation of pancreatic cells.

  8. Crystal structure of a bacterial homologue of glucose transporters GLUT1-4.

    Science.gov (United States)

    Sun, Linfeng; Zeng, Xin; Yan, Chuangye; Sun, Xiuyun; Gong, Xinqi; Rao, Yu; Yan, Nieng

    2012-10-18

    Glucose transporters are essential for metabolism of glucose in cells of diverse organisms from microbes to humans, exemplified by the disease-related human proteins GLUT1, 2, 3 and 4. Despite rigorous efforts, the structural information for GLUT1-4 or their homologues remains largely unknown. Here we report three related crystal structures of XylE, an Escherichia coli homologue of GLUT1-4, in complex with d-xylose, d-glucose and 6-bromo-6-deoxy-D-glucose, at resolutions of 2.8, 2.9 and 2.6 Å, respectively. The structure consists of a typical major facilitator superfamily fold of 12 transmembrane segments and a unique intracellular four-helix domain. XylE was captured in an outward-facing, partly occluded conformation. Most of the important amino acids responsible for recognition of D-xylose or d-glucose are invariant in GLUT1-4, suggesting functional and mechanistic conservations. Structure-based modelling of GLUT1-4 allows mapping and interpretation of disease-related mutations. The structural and biochemical information reported here constitutes an important framework for mechanistic understanding of glucose transporters and sugar porters in general.

  9. Self-assembly of diphenylalanine backbone homologues and their combination with functionalized carbon nanotubes.

    Science.gov (United States)

    Dinesh, Bhimareddy; Squillaci, Marco A; Ménard-Moyon, Cécilia; Samorì, Paolo; Bianco, Alberto

    2015-10-14

    The integration of carbon nanotubes (CNTs) into organized nanostructures is of great interest for applications in materials science and biomedicine. In this work we studied the self-assembly of β and γ homologues of diphenylalanine peptides under different solvent and pH conditions. We aimed to investigate the role of peptide backbone in tuning the formation of different types of nanostructures alone or in combination with carbon nanotubes. In spite of having the same side chain, β and γ peptides formed distinctively different nanofibers, a clear indication of the role played by the backbone homologation on the self-assembly. The variation of the pH allowed to transform the nanofibers into spherical structures. Moreover, the co-assembly of β and γ peptides with carbon nanotubes covalently functionalized with the same peptide generated unique dendritic assemblies. This comparative study on self-assembly using diphenylalanine backbone homologues and of the co-assembly with CNT covalent conjugates is the first example exploring the capacity of β and γ peptides to adopt precise nanostructures, particularly in combination with carbon nanotubes. The dendritic organization obtained by mixing carbon nanotubes and peptides might find interesting applications in tissue engineering and neuronal interfacing.

  10. Inhibition of hydroxyapatite growth by casein, a potential salivary phosphoprotein homologue.

    Science.gov (United States)

    Romero, Maria J R H; Nakashima, Syozi; Nikaido, Toru; Ichinose, Shizuko; Sadr, Alireza; Tagami, Junji

    2015-08-01

    Salivary phosphoproteins are essential in tooth mineral regulation but are often overlooked in vitro. This study aimed to evaluate the effect of casein, as a salivary phosphoprotein homologue, on the deposition and growth of hydroxyapatite (HA) on tooth surfaces. Hydroxyapatite growth was quantified using seeded crystal systems. Artificial saliva (AS) containing HA powder and 0, 10, 20, 50, or 100 μg ml(-1) of casein, or 100 μg ml(-1) of dephosphorylated casein (Dcasein), was incubated for 0-8 h at 37°C, pH 7.2. Calcium concentrations were measured using atomic absorption spectroscopy (AAS). Surface precipitation of HA on bovine enamel and dentine blocks, incubated in similar conditions for 7 d, was examined using field emission scanning electron microscopy (FE-SEM) and transmission electron microscopy (TEM) with selected area electron diffraction (SAED). Casein adsorption was assessed using modified Lowry assays and zeta-potential measurements. The AAS results revealed a concentration-dependent inhibition of calcium consumption. Hydroxyapatite precipitation occurred when no casein was present, whereas precipitation of HA was apparently completely inhibited in casein-containing groups. Adsorption data demonstrated increasingly negative zeta-potential with increased casein concentration and an affinity constant similar to proline-rich proteins with Langmuir modelling. Casein inhibited the deposition and growth of HA primarily through the binding of esterized phosphate to HA active sites, indicating its potential as a mineral-regulating salivary phosphoprotein homologue in vitro. © 2015 Eur J Oral Sci.

  11. Identification of a candidate CD5 homologue in the amphibian Xenopus laevis.

    Science.gov (United States)

    Jürgens, J B; Gartland, L A; Du Pasquier, L; Horton, J D; Göbel, T W; Cooper, M D

    1995-11-01

    We identified a novel T cell Ag in the South African clawed toad (Xenopus laevis) by a mAb designated 2B1. This Ag is present in relatively high levels on most thymocytes, approximately 65% of splenocytes, 55% of PBL, and 65% of intestinal lymphocytes, but is rarely seen on IgM+ B cells in any of these tissues. Lymphocytes bearing the 2B1 Ag proliferate in response to stimulation with Con A or PHA, whereas the 2B1- lymphocytes are reactive to LPS. Biochemical analysis indicates that this Ag is a differentially phosphorylated glycoprotein of 71 to 82 kDa. The protein core of 64 kDa bears both N- and O-linked carbohydrate side chains. The amino-terminal protein sequence of the 2B1 Ag shares significant homology with both the macrophage scavenger receptor type 1 motif and the mammalian CD5/CD6 family. The biochemical characteristics and cellular distribution of the 2B1 Ag suggest that it represents the CD5 homologue in X. laevis. While T cells constitutively express this highly conserved molecule, Xenopus B cells acquire the CD5 homologue only when they are stimulated in the presence of T cells.

  12. The use of polynuclear aromatic hydrocarbon (PAH) alkyl homologues in determining petroleum source identification and weathering

    International Nuclear Information System (INIS)

    Brown, J.S.; Boehm, P.D.; Sauer, T.C.; Wong, W.M.C.

    1993-01-01

    Techniques utilizing double ratio plots of selected polynuclear aromatic hydrocarbon (PAH) alkyl homologues were used to identify and distinguish crude oils and refined petroleum products from each other and to distinguish petroleum sources in complex pollutant regimes. Petroleum samples were fractionated by high performance liquid chromatography (HPLC) into saturated and aromatic (PAH) hydrocarbon fractions. The saturated hydrocarbon fractions were then analyzed by gas chromatography/flame ionization detection (GC/FID) to obtain a resolved/unresolved alkane fingerprint of each oil. The aromatic fractions of the oils were analyzed by gas chromatography/mass spectrometry (GC/MS) for PAH and selected alkyl homologues. Comparisons of the saturated hydrocarbon fingerprints indicated that some oils were indistinguishable based on the alkane fingerprint alone. Another double ratio plot of the alkyl chrysenes and alkyl dibenzothiophenes was effective in establishing the weathering of oil in environmental samples which were processed using the same analytical techniques, since the dibenzothiophenes are degraded more rapidly than the chrysenes. The application of selected ratios in oil spill source identification in complex environmental samples from Suisin Bay California and Boston Harbor are discussed. The use of ratios to measure the extent of weathering in oil spill samples from Prince William Sound and the Gulf of Alaska is examined

  13. The monomeric orphan nuclear receptor Schistosoma mansoni Ftz-F1 dimerizes specifically and functionally with the schistosome RXR homologue, SmRXR1

    International Nuclear Information System (INIS)

    Bertin, Benjamin; Caby, Stephanie; Oger, Frederik; Sasorith, Souphatta; Wurtz, Jean-Marie; Pierce, Raymond J.

    2005-01-01

    In an attempt to understand development and differentiation processes of the parasitic blood fluke Schistosoma mansoni, several members of the nuclear receptor superfamily were cloned, including SmFtz-F1 (S. mansoni Fushi Tarazu-factor 1). The Ftz-F1 nuclear receptor subfamily only contains orphan receptors that bind to their response element as monomers. Whereas SmFtz-F1 displays these basic functional properties, we have identified an original and specific interaction between SmFtz-F1 and the schistosome RXR homologue, SmRXR1. The mammalian two-hybrid assay showed that the D, E, and F domains of SmFtz-F1 were capable of interacting specifically with the E domain of SmRXR1 but not with that of mouse RXRα. Using three-dimensional LBD homology modelling and structure-guided mutagenesis, we were able to demonstrate the essential role of exposed residues located in the dimerization interfaces of both receptors in the maintenance of the interaction. Cotransfection experiments with constructions encoding full-length nuclear receptors show that SmRXR1 potentiates the transcriptional activity of SmFtz-F1 from various promoters. Nevertheless, the lack of identification of a dimeric response element for this SmFtz-F1/SmRXR1 heterodimer seems to indicate a 'tethering' mechanism. Thus, our results suggest for the first time that a member of the Ftz-F1 family could heterodimerize functionally with a homologue of the universal heterodimerization partner of nuclear receptors. This unique property confirms that SmFtz-F1 may be involved in the development and differentiation of schistosome-specific structures

  14. Biodegradation of diesel fuel by a microbial consortium in the presence of 1-alkoxymethyl-2-methyl-5-hydroxypyridinium chloride homologues

    DEFF Research Database (Denmark)

    Chrzanowski, L; Stasiewicz, M; Owsianiak, Mikolaj

    2009-01-01

    hypothesize that in the presence of diesel fuel low-water-soluble ionic liquids may become more toxic to hydrocarbon-degrading microorganisms. In this study the influence of 1-alkoxymethyl-2-methyl-5-hydroxypyridinium chloride homologues (side-chain length from C-3 to C-18) on biodegradation of diesel fuel...... by a bacterial consortium was investigated. Whereas test performed for the consortium cultivated on disodium succinate showed that toxicity of the investigated ionic liquids decreased with increase in side-chain length, only higher homologues (C-8-C-18) caused a decrease in diesel fuel biodegradation......, respectively. We conclude that in the presence of hydrocarbons acting as a solvent, the increased bioavailability of hydrophobic homologues is responsible for the decrease in biodegradation efficiency of diesel fuel....

  15. TOR1 and TOR2 are structurally and functionally similar but not identical phosphatidylinositol kinase homologues in yeast

    OpenAIRE

    Helliwell, S. B.; Wagner, P.; Kunz, J.; Deuter-Reinhard, M.; Henriquez, R.; Hall, M. N.

    1994-01-01

    The Saccharomyces cerevisiae genes TOR1 and TOR2 were originally identified by mutations that confer resistance to the immunosuppressant rapamycin. TOR2 was previously shown to encode an essential 282-kDa phosphatidylinositol kinase (PI kinase) homologue. The TOR1 gene product is also a large (281 kDa) PI kinase homologue, with 67% identity to TOR2. TOR1 is not essential, but a TOR1 TOR2 double disruption uniquely confers a cell cycle (G1) arrest as does exposure to rapamycin; disruption of T...

  16. Homologue Structure of the SLAC1 Anion Channel for Closing Stomata in Leaves

    Energy Technology Data Exchange (ETDEWEB)

    Y Chen; L Hu; M Punta; R Bruni; B Hillerich; B Kloss; B Rost; J Love; S Siegelbaum; W Hendrickson

    2011-12-31

    The plant SLAC1 anion channel controls turgor pressure in the aperture-defining guard cells of plant stomata, thereby regulating the exchange of water vapour and photosynthetic gases in response to environmental signals such as drought or high levels of carbon dioxide. Here we determine the crystal structure of a bacterial homologue (Haemophilus influenzae) of SLAC1 at 1.20 {angstrom} resolution, and use structure-inspired mutagenesis to analyse the conductance properties of SLAC1 channels. SLAC1 is a symmetrical trimer composed from quasi-symmetrical subunits, each having ten transmembrane helices arranged from helical hairpin pairs to form a central five-helix transmembrane pore that is gated by an extremely conserved phenylalanine residue. Conformational features indicate a mechanism for control of gating by kinase activation, and electrostatic features of the pore coupled with electrophysiological characteristics indicate that selectivity among different anions is largely a function of the energetic cost of ion dehydration.

  17. The actin homologue MreB organizes the bacterial cell membrane.

    Science.gov (United States)

    Strahl, Henrik; Bürmann, Frank; Hamoen, Leendert W

    2014-03-07

    The eukaryotic cortical actin cytoskeleton creates specific lipid domains, including lipid rafts, which determine the distribution of many membrane proteins. Here we show that the bacterial actin homologue MreB displays a comparable activity. MreB forms membrane-associated filaments that coordinate bacterial cell wall synthesis. We noticed that the MreB cytoskeleton influences fluorescent staining of the cytoplasmic membrane. Detailed analyses combining an array of mutants, using specific lipid staining techniques and spectroscopic methods, revealed that MreB filaments create specific membrane regions with increased fluidity (RIFs). Interference with these fluid lipid domains (RIFs) perturbs overall lipid homeostasis and affects membrane protein localization. The influence of MreB on membrane organization and fluidity may explain why the active movement of MreB stimulates membrane protein diffusion. These novel MreB activities add additional complexity to bacterial cell membrane organization and have implications for many membrane-associated processes.

  18. Isolation of a cotton NADP(H oxidase homologue induced by drought stress

    Directory of Open Access Journals (Sweden)

    NEPOMUCENO ALEXANDRE LIMA

    2000-01-01

    Full Text Available The aim of this study was to identify and isolate genes that are differentially expressed in four selected cotton (Gossypium hirsutum L. genotypes contrasting according to their tolerance to water deficit. The genotypes studied were Siokra L-23, Stoneville 506, CS 50 and T-1521. Physiological, morphological and developmental changes that confer drought tolerance in plants must have a molecular genetic basis. To identify and isolate the genes, the mRNA Differential Display (DD technique was used. Messenger RNAs differentially expressed during water deficit were identified, isolated, cloned and sequenced. The cloned transcript A12B15-5, a NADP(H oxidase homologue, was up regulated only during the water deficit stress and only in Siokra L-23, a drought tolerant genotype. Ribonuclease protection assay confirmed that transcription.

  19. The urokinase receptor and its structural homologue C4.4A in human cancer

    DEFF Research Database (Denmark)

    Jacobsen, B; Ploug, M

    2008-01-01

    The urokinase-type plasminogen activator receptor (uPAR) and its structural homologue C4.4A are multidomain members of the Ly6/uPAR/alpha-neurotoxin protein domain family. Both are glycosylphosphatidylinositol-anchored membrane glycoproteins encoded by neighbouring genes located on chromosome 19q13...... that high protein expression in tumour cells of non-small cell pulmonary adenocarcinomas is associated with a particularly severe disease progression. This review will evaluate structural-functional and disease-related aspects of uPAR and C4.4A with a view to possible pharmacological targeting strategies...... in the human genome. The structural relationship between the two proteins is, however, not reflected at the functional level. Whereas uPAR has a well-established role in regulating and focalizing uPA-mediated plasminogen activation to the surface of those cells expressing the receptor, the biological function...

  20. Conservation of Oxidative Protein Stabilization in an Insect Homologue of Parkinsonism-Associated Protein DJ-1

    Energy Technology Data Exchange (ETDEWEB)

    Lin, Jiusheng; Prahlad, Janani; Wilson, Mark A. (UNL)

    2012-08-21

    DJ-1 is a conserved, disease-associated protein that protects against oxidative stress and mitochondrial damage in multiple organisms. Human DJ-1 contains a functionally essential cysteine residue (Cys106) whose oxidation is important for regulating protein function by an unknown mechanism. This residue is well-conserved in other DJ-1 homologues, including two (DJ-1{alpha} and DJ-1{beta}) in Drosophila melanogaster. Because D. melanogaster is a powerful model system for studying DJ-1 function, we have determined the crystal structure and impact of cysteine oxidation on Drosophila DJ-1{beta}. The structure of D. melanogaster DJ-1{beta} is similar to that of human DJ-1, although two important residues in the human protein, Met26 and His126, are not conserved in DJ-1{beta}. His126 in human DJ-1 is substituted with a tyrosine in DJ-1{beta}, and this residue is not able to compose a putative catalytic dyad with Cys106 that was proposed to be important in the human protein. The reactive cysteine in DJ-1 is oxidized readily to the cysteine-sulfinic acid in both flies and humans, and this may regulate the cytoprotective function of the protein. We show that the oxidation of this conserved cysteine residue to its sulfinate form (Cys-SO{sub 2{sup -}}) results in considerable thermal stabilization of both Drosophila DJ-1{beta} and human DJ-1. Therefore, protein stabilization is one potential mechanism by which cysteine oxidation may regulate DJ-1 function in vivo. More generally, most close DJ-1 homologues are likely stabilized by cysteine-sulfinic acid formation but destabilized by further oxidation, suggesting that they are biphasically regulated by oxidative modification.

  1. 4-Oxalocrotonate tautomerase, its homologue YwhB, and active vinylpyruvate hydratase : Synthesis and evaluation of 2-fluoro substrate analogues

    NARCIS (Netherlands)

    Johnson, William H; Wang, Susan C; Stanley, Thanuja M; Czerwinski, Robert M; Almrud, Jeffrey J; Poelarends, Gerrit J; Murzin, Alexey G; Whitman, Christian P

    2004-01-01

    A series of 2-fluoro-4-alkene and 2-fluoro-4-alkyne substrate analogues were synthesized and examined as potential inhibitors of three enzymes: 4-oxalocrotonate tautomerase (4-OT) and vinylpyruvate hydratase (VPH) from the catechol meta-fission pathway and a closely related 4-OT homologue found in

  2. Towards structural studies of the old yellow enzyme homologue SYE4 from Shewanella oneidensis and its complexes at atomic resolution

    International Nuclear Information System (INIS)

    Elegheert, Jonathan; Hemel, Debbie van den; Dix, Ina; Stout, Jan; Van Beeumen, Jozef; Brigé, Ann; Savvides, Savvas N.

    2009-01-01

    Of the four old yellow enzyme homologues found in S. oneidensis, SYE4 is the homologue most implicated in resistance to oxidative stress. SYE4 was recombinantly expressed in Escherichia coli, purified and crystallized using the hanging-drop vapour-diffusion method. Shewanella oneidensis is an environmentally versatile Gram-negative γ-proteobacterium that is endowed with an unusually large proteome of redox proteins. Of the four old yellow enzyme (OYE) homologues found in S. oneidensis, SYE4 is the homologue most implicated in resistance to oxidative stress. SYE4 was recombinantly expressed in Escherichia coli, purified and crystallized using the hanging-drop vapour-diffusion method. The crystals belonged to the orthorhombic space group P2 1 2 1 2 1 and were moderately pseudo-merohedrally twinned, emulating a P422 metric symmetry. The native crystals of SYE4 were of exceptional diffraction quality and provided complete data to 1.10 Å resolution using synchrotron radiation, while crystals of the reduced enzyme and of the enzyme in complex with a wide range of ligands typically led to high-quality complete data sets to 1.30–1.60 Å resolution, thus providing a rare opportunity to dissect the structure–function relationships of a good-sized enzyme (40 kDa) at true atomic resolution. Here, the attainment of a number of experimental milestones in the crystallographic studies of SYE4 and its complexes are reported, including isolation of the elusive hydride–Meisenheimer complex

  3. An exploration of Glb1 Homologue AntibodyLevels in Children at Increased Risk for Type 1 Diabetes mellitus

    Science.gov (United States)

    Simpson, M.; Mojibian, M.; Barriga, K.; Scott, F.W.; Fasano, A.; Rewers, M.; Norris, J.M.

    2010-01-01

    Aims To determine whether Glb1 homologue antibodies are associated with islet autoimmunity (IA) in children at increased risk for type 1 diabetes (T1D), and to investigate their relation with putative environmental correlates of T1D. Methods We selected a sample from the Diabetes Autoimmunity Study in the Young (DAISY), a prospective study of children at increased risk for T1D. Cases were those who were positive for insulin, glutamic acid decarboxylase (GAD), or insulinoma-associated antigen-2 (IA-2) autoantibodies on two consecutive visits and either diagnosed with diabetes mellitus or still autoantibody positive when selected. Controls were from the same increased risk group, of similar age as the cases but negative for autoantibodies. Sera from 91 IA cases and 82 controls were analyzed in a blinded manner for immunoglobulin G (IgG) antibodies to Glb1 homologue by ELISA. Results Adjusting for family history of T1D and HLA-DR4 positivity, Glb1 homologue antibodies were not associated with IA case status (OR: 1.01, 95% CI: 0.99 – 1.03). Adjusting for age, family history of T1D, and HLA-DR4 positivity, Glb1 homologue antibody levels were inversely associated with breast-feeding duration (beta = −0.08, p = 0.001) and directly associated with current intake of foods containing gluten (beta = 0.24, p = 0.007) in IA cases but not in controls. Zonulin, a biomarker of gut permeability, was directly associated with Glb1 homologue antibody levels in cases (beta = 0.73, p = 0.003) but not in controls. Conclusion Differences in correlates of Glb1 antibodies in IA cases and controls suggest an underlying difference in mucosal immune response. PMID:19622083

  4. Identification of possible targets of the Aspergillus fumigatus CRZ1 homologue, CrzA

    Directory of Open Access Journals (Sweden)

    Goldman Gustavo H

    2010-01-01

    Full Text Available Abstract Background Calcineurin, a serine/threonine-specific protein phosphatase, plays an important role in the control of cell morphology and virulence in fungi. Calcineurin regulates localization and activity of a transcription factor called CRZ1. Recently, we characterize Aspergillus fumigatus CRZ1 homologue, AfCrzA. Here, we investigate which pathways are influenced by A. fumigatus AfCrzA during a short pulse of calcium by comparatively determining the transcriptional profile of A. fumigatus wild type and ΔAfcrzA mutant strains. Results We were able to observe 3,622 genes modulated in at least one timepoint in the mutant when compared to the wild type strain (3,211 and 411 at 10 and 30 minutes, respectively. Decreased mRNA abundance in the ΔcrzA was seen for genes encoding calcium transporters, transcription factors and genes that could be directly or indirectly involved in calcium metabolism. Increased mRNA accumulation was observed for some genes encoding proteins involved in stress response. AfCrzA overexpression in A. fumigatus increases the expression of several of these genes. The deleted strain of one of these genes, AfRcnA, belonging to a class of endogenous calcineurin regulators, calcipressins, had more calcineurin activity after exposure to calcium and was less sensitive to menadione 30 μM, hydrogen peroxide 2.5 mM, EGTA 25 mM, and MnCl2 25 mM. We constructed deletion, overexpression, and GFP fusion protein for the closely related A. nidulans AnRcnA. GFP::RcnA was mostly detected along the germling, did not accumulate in the nuclei and its location is not affected by the cellular response to calcium chloride. Conclusion We have performed a transcriptional profiling analysis of the A. fumigatus ΔAfcrzA mutant strain exposed to calcium stress. This provided an excellent opportunity to identify genes and pathways that are under the influence of AfCrzA. AfRcnA, one of these selected genes, encodes a modulator of calcineurin

  5. Expression of cinnamyl alcohol dehydrogenases and their putative homologues during Arabidopsis thaliana growth and development: lessons for database annotations?

    Science.gov (United States)

    Kim, Sung-Jin; Kim, Kye-Won; Cho, Man-Ho; Franceschi, Vincent R; Davin, Laurence B; Lewis, Norman G

    2007-07-01

    A major goal currently in Arabidopsis research is determination of the (biochemical) function of each of its approximately 27,000 genes. To date, however, 12% of its genes actually have known biochemical roles. In this study, we considered it instructive to identify the gene expression patterns of nine (so-called AtCAD1-9) of 17 genes originally annotated by The Arabidopsis Information Resource (TAIR) as cinnamyl alcohol dehydrogenase (CAD, EC 1.1.1.195) homologues [see Costa, M.A., Collins, R.E., Anterola, A.M., Cochrane, F.C., Davin, L.B., Lewis N.G., 2003. An in silico assessment of gene function and organization of the phenylpropanoid pathway metabolic networks in Arabidopsis thaliana and limitations thereof. Phytochemistry 64, 1097-1112.]. In agreement with our biochemical studies in vitro [Kim, S.-J., Kim, M.-R., Bedgar, D.L., Moinuddin, S.G.A., Cardenas, C.L., Davin, L.B., Kang, C.-H., Lewis, N.G., 2004. Functional reclassification of the putative cinnamyl alcohol dehydrogenase multigene family in Arabidopsis. Proc. Natl. Acad. Sci. USA 101, 1455-1460.], and analysis of a double mutant [Sibout, R., Eudes, A., Mouille, G., Pollet, B., Lapierre, C., Jouanin, L., Séguin A., 2005. Cinnamyl Alcohol Dehydrogenase-C and -D are the primary genes involved in lignin biosynthesis in the floral stem of Arabidopsis. Plant Cell 17, 2059-2076.], both AtCAD5 (At4g34230) and AtCAD4 (At3g19450) were found to have expression patterns consistent with development/formation of different forms of the lignified vascular apparatus, e.g. lignifying stem tissues, bases of trichomes, hydathodes, abscission zones of siliques, etc. Expression was also observed in various non-lignifying zones (e.g. root caps) indicative of, perhaps, a role in plant defense. In addition, expression patterns of the four CAD-like homologues were investigated, i.e. AtCAD2 (At2g21730), AtCAD3 (At2g21890), AtCAD7 (At4g37980) and AtCAD8 (At4g37990), each of which previously had been demonstrated to have low CAD

  6. Identification of aldehyde oxidase 1 and aldehyde oxidase homologue 1 as dioxin-inducible genes

    International Nuclear Information System (INIS)

    Rivera, Steven P.; Choi, Hyun Ho; Chapman, Brett; Whitekus, Michael J.; Terao, Mineko; Garattini, Enrico; Hankinson, Oliver

    2005-01-01

    Aldehyde oxidases are a family of highly related molybdo-flavoenzymes acting upon a variety of compounds of industrial and medical importance. We have identified aldehyde oxidase 1 (AOX1) as a 2,3,7,8-tetrachlorodibenzo-p-dioxin (dioxin) inducible gene in the mouse hepatoma cell line Hepa-1. AOX1 mRNA levels were not increased by dioxin in mutant derivatives of the Hepa-1 cell line lacking either functional aryl hydrocarbon receptor (AHR) or aryl hydrocarbon receptor nuclear translocator (ARNT) proteins, thus demonstrating that transcriptional induction of AOX1 in response to dioxin occurs through the AHR pathway. Dioxin induction of AOX1 mRNA was also observed in mouse liver. In addition, levels of AOX1 protein as well as those of aldehyde oxidase homologue 1 (AOH1), a recently identified homolog of AOX1, were elevated in mouse liver in response to dioxin. Employing an aldehyde oxidase specific substrate, AOX1/AOH1 activity was shown to be induced by dioxin in mouse liver. This activity was inhibited by a known inhibitor of aldehyde oxidases, and eliminated by including tungstate in the mouse diet, which is known to lead to inactivation of molybdoflavoenzymes, thus confirming that the enzymatic activity was attributable to AOX1/AOH1. Our observations thus identify two additional xenobiotic metabolizing enzymes induced by dioxin

  7. A Potato cDNA Encoding a Homologue of Mammalian Multidrug Resistant P-Glycoprotein

    Science.gov (United States)

    Wang, W.; Takezawa, D.; Poovaiah, B. W.

    1996-01-01

    A homologue of the multidrug resistance (MDR) gene was obtained while screening a potato stolon tip cDNA expression library with S-15-labeled calmodulin. The mammalian MDR gene codes for a membrane-bound P-glycoprotein (170-180 kDa) which imparts multidrug resistance to cancerous cells. The potato cDNA (PMDR1) codes for a polypeptide of 1313 amino acid residues (ca. 144 kDa) and its structural features are very similar to the MDR P-glycoprotein. The N-terminal half of the PMDR1-encoded protein shares striking homology with its C-terminal half, and each half contains a conserved ATP-binding site and six putative transmembrane domains. Southern blot analysis indicated that potato has one or two MDR-like genes. PMDR1 mRNA is constitutively expressed in all organs studied with higher expression in the stem and stolon tip. The PMDR1 expression was highest during tuber initiation and decreased during tuber development.

  8. Equilibrium evaporation behavior of polonium and its homologue tellurium in liquid lead-bismuth eutectic

    International Nuclear Information System (INIS)

    Ohno, Shuji; Miyahara, Shinya; Kurata, Yuji; Katsura, Ryoei; Yoshida, Shigeru

    2006-01-01

    Experimental study using the transpiration method investigates equilibrium evaporation behavior of radionuclide polonium ( 210 Po) generated and accumulated in liquid lead-bismuth eutectic (LBE) cooled nuclear systems. The experiment consists of two series of tests: preliminary evaporation tests for homologue element tellurium (Te) in LBE, and evaporation tests for 210 Po-accumulated LBE in which test specimens are prepared by neutron irradiation. The evaporation tests of Te in LBE provide the suggestion that Te exists in a chemical form of PbTe as well as the information for confirming the validity of technique and conditions of Po test. From the evaporation tests of 210 Po in LBE, we obtain fundamental data and empirical equations such as 210 Po vapor concentration in the gas phase, 210 Po partial vapor pressure, thermodynamic activity coefficients, and gas-liquid equilibrium partition coefficient of 210 Po in LBE in the temperature range from 450 to 750degC. Additionally, radioactivity concentration of 210 Po and 210m Bi vapor in a cover gas region of a typical LBE-cooled nuclear system is specifically estimated based on the obtained experimental results, and the importance of 210 Po evaporation behavior is quantitatively demonstrated. (author)

  9. Crystal structure of a bacterial homologue of the bile acid sodium symporter ASBT

    Science.gov (United States)

    Hu, Nien-Jen; Iwata, So; Cameron, Alexander D.; Drew, David

    2011-01-01

    High cholesterol levels greatly increase the risk of cardiovascular disease. By its conversion into bile acids, about 50% of cholesterol is eliminated from the body. However bile acids released from the bile duct are constantly recycled, being reabsorbed in the intestine via the Apical Sodium dependent Bile acid Transporter (ASBT). It has been shown in animal models that plasma cholesterol levels are significantly lowered by specific inhibitors of ASBT1,2, thus ASBT is a target for hypercholesterolemia drugs. Here, we describe the crystal structure of a bacterial homologue of ASBT from Neisseria meningitidis (ASBTNM) at 2.2Å. ASBTNM contains two inverted structural repeats of five transmembrane helices. A Core domain of six helices harbours two sodium ions while the remaining helices form a Panel-like domain. Overall the architecture of the protein is remarkably similar to the sodium-proton antiporter NhaA3 despite no detectable sequence homology. A bile acid molecule is situated between the Core and Panel domains in a large hydrophobic cavity. Residues near to this cavity have been shown to affect the binding of specific inhibitors of human ASBT4. The position of the bile acid together with the molecular architecture suggests the rudiments of a possible transport mechanism. PMID:21976025

  10. Edge profiles in K shell photoabsorption spectra of gaseous hydrides of 3p elements and homologues

    Science.gov (United States)

    Hauko, R.; Gomilšek, J. Padežnik; Kodre, A.; Arčon, I.; Aquilanti, G.

    2017-10-01

    Photoabsorption spectra of gaseous hydrides of 3p elements (PH3, H2S, HCl) are measured in the energy region of photoexcitations pertaining to K edge. The analysis of the edge profile is extended to hydrides of 4p series (GeH4, AsH3, H2Se, HBr) from an earlier experiment, and to published spectra of 2p hydrides (CH4, NH3, H2O, HF) and noble gases Ar, Kr and Ne and SiH4. The edge profiles are modelled with a linear combination of lorentzian components, describing excitations to individual bound states and to continuum. Transition energies and probabilities are also calculated in the non-relativistic molecular model of the ORCA code, in good agreement with the experiment. Edge profiles in the heavier homologues are closely similar, the symmetry of the molecule governs the transitions to the lowest unoccupied orbitals. In 2p series the effect of the strong nuclear potential prevails. Transitions to higher, atomic-like levels remain very much the same as in free atoms.

  11. The human homologue of Dictyostelium discoideum phg1A is expressed by human metastatic melanoma cells.

    Science.gov (United States)

    Lozupone, Francesco; Perdicchio, Maurizio; Brambilla, Daria; Borghi, Martina; Meschini, Stefania; Barca, Stefano; Marino, Maria Lucia; Logozzi, Mariantonia; Federici, Cristina; Iessi, Elisabetta; de Milito, Angelo; Fais, Stefano

    2009-12-01

    Tumour cannibalism is a characteristic of malignancy and metastatic behaviour. This atypical phagocytic activity is a crucial survival option for tumours in conditions of low nutrient supply, and has some similarities to the phagocytic activity of unicellular microorganisms. In fact, Dictyostelium discoideum has been used widely as a model to study phagocytosis. Recently, phg1A has been described as a protein that is primarily involved in the phagocytic process of this microorganism. The closest human homologue to phg1A is transmembrane 9 superfamily protein member 4 (TM9SF4). Here, we report that TM9SF4 is highly expressed in human malignant melanoma cells deriving from metastatic lesions, whereas it is undetectable in healthy human tissues and cells. TM9SF4 is predominantly expressed in acidic vesicles of melanoma cells, in which it co-localizes with the early endosome antigens Rab5 and early endosome antigen 1. TM9SF4 silencing induced marked inhibition of cannibal activity, which is consistent with a derangement of intracellular pH gradients, with alkalinization of acidic vesicles and acidification of the cell cytosol. We propose TM9SF4 as a new marker of malignancy, representing a potential new target for anti-tumour strategies with a specific role in tumour cannibalism and in the establishment of a metastatic phenotype.

  12. The oil palm Shell gene controls oil yield and encodes a homologue of SEEDSTICK

    Science.gov (United States)

    Singh, Rajinder; Leslie Low, Eng-Ti; Ooi, Leslie Cheng-Li; Ong-Abdullah, Meilina; Chin, Ting Ngoot; Nagappan, Jayanthi; Nookiah, Rajanaidu; Amiruddin, Mohd Din; Rosli, Rozana; Abdul Manaf, Mohamad Arif; Chan, Kuang-Lim; Halim, Mohd Amin; Azizi, Norazah; Lakey, Nathan; Smith, Steven W; Budiman, Muhammad A; Hogan, Michael; Bacher, Blaire; Van Brunt, Andrew; Wang, Chunyan; Ordway, Jared M; Sambanthamurthi, Ravigadevi; Martienssen, Robert A

    2014-01-01

    A key event in the domestication and breeding of the oil palm, Elaeis guineensis, was loss of the thick coconut-like shell surrounding the kernel. Modern E. guineensis has three fruit forms, dura (thick-shelled), pisifera (shell-less) and tenera (thin-shelled), a hybrid between dura and pisifera1–4. The pisifera palm is usually female-sterile but the tenera yields far more oil than dura, and is the basis for commercial palm oil production in all of Southeast Asia5. Here, we describe the mapping and identification of the Shell gene responsible for the different fruit forms. Using homozygosity mapping by sequencing we found two independent mutations in the DNA binding domain of a homologue of the MADS-box gene SEEDSTICK (STK) which controls ovule identity and seed development in Arabidopsis. The Shell gene is responsible for the tenera phenotype in both cultivated and wild palms from sub-Saharan Africa, and our findings provide a genetic explanation for the single gene heterosis attributed to Shell, via heterodimerization. This gene mutation explains the single most important economic trait in oil palm, and has implications for the competing interests of global edible oil production, biofuels and rainforest conservation6. PMID:23883930

  13. Crystallization and preliminary diffraction analysis of a DsbA homologue from Wolbachia pipientis

    Energy Technology Data Exchange (ETDEWEB)

    Kurz, M. [Institute for Molecular Bioscience and ARC Special Research Centre for Functional and Applied Genomics, University of Queensland, St Lucia, QLD 4072 (Australia); Iturbe-Ormaetxe, I. [School of Integrative Biology, The University of Queensland, St Lucia, QLD 4072 (Australia); Jarrott, R. [Institute for Molecular Bioscience and ARC Special Research Centre for Functional and Applied Genomics, University of Queensland, St Lucia, QLD 4072 (Australia); O’Neill, S. L. [School of Integrative Biology, The University of Queensland, St Lucia, QLD 4072 (Australia); Byriel, K. A.; Martin, J. L., E-mail: j.martin@imb.uq.edu.au; Heras, B., E-mail: j.martin@imb.uq.edu.au [Institute for Molecular Bioscience and ARC Special Research Centre for Functional and Applied Genomics, University of Queensland, St Lucia, QLD 4072 (Australia)

    2008-02-01

    The first crystallization of a W. pipientis protein, α-DsbA1, was achieved using hanging-drop and sitting-drop vapour diffusion. α-DsbA1 is one of two DsbA homologues encoded by the Gram-negative α-proteobacterium Wolbachia pipientis, an endosymbiont that can behave as a reproductive parasite in insects and as a mutualist in medically important filarial nematodes. The α-DsbA1 protein is thought to be important for the folding and secretion of Wolbachia proteins involved in the induction of reproductive distortions. Crystals of native and SeMet α-DsbA1 were grown by vapour diffusion and belong to the monoclinic space group C2, with unit-cell parameters a = 71.4, b = 49.5, c = 69.3 Å, β = 107.0° and one molecule in the asymmetric unit (44% solvent content). X-ray data were recorded from native crystals to a resolution of 2.01 Å using a copper anode and data from SeMet α-DsbA1 crystals were recorded to 2.45 Å resolution using a chromium anode.

  14. Stereoselectivity of the demethylation of nicotine piperidine homologues by Nicotiana plumbaginifolia cell suspension cultures.

    Science.gov (United States)

    Bartholomeusz, Trixie Ann; Molinié, Roland; Roscher, Albrecht; Felpin, François-Xavier; Gillet, Françoise; Lebreton, Jacques; Mesnard, François; Robins, Richard J

    2005-08-01

    The metabolism of (R,S)-N-methylanabasine and (R,S)-N-methylanatabine has been studied in a cell suspension culture of Nicotiana plumbaginifolia. Both substrates are effectively demethylated, anabasine or anatabine, respectively, accumulating in the medium. Similarly, there is strong stereoselectivity for the (R)-isomers of both substrates. The kinetics of metabolism of (R,S)-N-methylanabasine differ significantly from those of nicotine in that no further degradation of the initial demethylation product occurs. (R,S)-N-Methylanatabine, however, shows kinetics closer to those of nicotine, with loss of alkaloid from the system. Further more, (R,S)-N-methylanabasine does not diminish (S)-nicotine demethylation, indicating a lack of competition. However, the metabolism of (S)-nicotine is affected by the presence of (R,S)-N-methylanabasine. Hence, the demethylation of the piperidine homologues of nicotine is seen to be similar but not identical to that of the pyridine analogues. The implications of these different metabolic profiles in relation to the demethylation activity are discussed.

  15. Validating tyrosinase homologue MelA as a photoacoustic reporter gene for imaging Escherichia coli

    Science.gov (United States)

    Paproski, Robert J.; Li, Yan; Barber, Quinn; Lewis, John D.; Campbell, Robert; Zemp, Roger

    2015-03-01

    Antibiotic drug resistance is a major worldwide issue. Development of new therapies against pathogenic bacteria requires appropriate research tools for replicating and characterizing infections. Previously fluorescence and bioluminescence modalities have been used to image infectious burden in animal models but scattering significantly limits imaging depth and resolution. We hypothesize that photoacoustic imaging, which has improved depth-toresolution ratio, could be useful for visualizing MelA-expressing bacteria since MelA is a bacterial tyrosinase homologue involved in melanin production. Using an inducible expression system, E. coli expressing MelA were visibly black in liquid culture. Phosphate buffered saline (PBS), MelA-expressing bacteria (at different dilutions in PBS), and chicken embryo blood were injected in plastic tubes which were imaged using a VisualSonics Vevo LAZR system. Photoacoustic imaging at 6 different wavelengths (680, 700, 750, 800, 850 and 900nm) enabled spectral de-mixing to distinguish melanin signals from blood. The signal to noise ratio of 9x diluted MelA bacteria was 55, suggesting that ~20 bacteria cells could be detected with our system. When MelA bacteria were injected as a 100 μL bolus into a chicken embryo, photoacoustic signals from deoxy- and oxy- hemoglobin as well as MelA-expressing bacteria could be separated and overlaid on an ultrasound image, allowing visualization of the bacterial location. Photoacoustic imaging may be a useful tool for visualizing bacterial infections and further work incorporating photoacoustic reporters into infectious bacterial strains is warranted.

  16. DNA methyltransferase homologue TRDMT1 in Plasmodium falciparum specifically methylates endogenous aspartic acid tRNA.

    Science.gov (United States)

    Govindaraju, Gayathri; Jabeena, C A; Sethumadhavan, Devadathan Valiyamangalath; Rajaram, Nivethika; Rajavelu, Arumugam

    2017-10-01

    In eukaryotes, cytosine methylation regulates diverse biological processes such as gene expression, development and maintenance of genomic integrity. However, cytosine methylation and its functions in pathogenic apicomplexan protozoans remain enigmatic. To address this, here we investigated the presence of cytosine methylation in the nucleic acids of the protozoan Plasmodium falciparum. Interestingly, P. falciparum has TRDMT1, a conserved homologue of DNA methyltransferase DNMT2. However, we found that TRDMT1 did not methylate DNA, in vitro. We demonstrate that TRDMT1 methylates cytosine in the endogenous aspartic acid tRNA of P. falciparum. Through RNA bisulfite sequencing, we mapped the position of 5-methyl cytosine in aspartic acid tRNA and found methylation only at C38 position. P. falciparum proteome has significantly higher aspartic acid content and a higher proportion of proteins with poly aspartic acid repeats than other apicomplexan pathogenic protozoans. Proteins with such repeats are functionally important, with significant roles in host-pathogen interactions. Therefore, TRDMT1 mediated C38 methylation of aspartic acid tRNA might play a critical role by translational regulation of important proteins and modulate the pathogenicity of the malarial parasite. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. The ontogeny of nanos homologue expression in the oligochaete annelid Tubifex tubifex.

    Science.gov (United States)

    Mohri, Ki-Ichi; Nakamoto, Ayaki; Shimizu, Takashi

    2016-01-01

    We have cloned and characterized the expression of a nanos homologue (designated Ttu-nos) from the oligochaete annelid Tubifex tubifex. Ttu-nos mRNA is distributed broadly throughout the early cleavage stages. Ttu-nos is expressed in most if not all of the early blastomeres, in which Ttu-nos RNA associates with pole plasms. Ttu-nos transcripts are concentrated to 2d and 4d cells. Shortly after 2d(111) (derived from 2d cell) divides into a bilateral pair of NOPQ proteloblasts, Ttu-nos RNA vanishes from the embryo, which is soon followed by the resumption of Ttu-nos expression in nascent primary blast cells produced by teloblasts. The resumption of Ttu-nos expression occurs only in a subset of teloblast lineages (viz., M, N and Q). After Ttu-nos expression is retained in the germ band for a while, it disappears in anterior-to-posterior progression. At the end of embryogenesis, there is no trace of Ttu-nos expression. Thereafter, growing juveniles do not show any sign of Ttu-nos expression, either. The first sign of Ttu-nos expression is detected in oocytes in the ovary of young adults (ca 40 days after hatching), and its expression continues in growing oocytes that undergo yolk deposition and maturation in the ovisac. Copyright © 2015 Elsevier B.V. All rights reserved.

  18. TRBP and eIF6 homologue in Marsupenaeus japonicus play crucial roles in antiviral response.

    Directory of Open Access Journals (Sweden)

    Shuai Wang

    Full Text Available Plants and invertebrates can suppress viral infection through RNA silencing, mediated by RNA-induced silencing complex (RISC. Trans-activation response RNA-binding protein (TRBP, consisting of three double-stranded RNA-binding domains, is a component of the RISC. In our previous paper, a TRBP homologue in Fenneropenaeus chinensis (Fc-TRBP was reported to directly bind to eukaryotic initiation factor 6 (Fc-eIF6. In this study, we further characterized the function of TRBP and the involvement of TRBP and eIF6 in antiviral RNA interference (RNAi pathway of shrimp. The double-stranded RNA binding domains (dsRBDs B and C of the TRBP from Marsupenaeus japonicus (Mj-TRBP were found to mediate the interaction of TRBP and eIF6. Gel-shift assays revealed that the N-terminal of Mj-TRBP dsRBD strongly binds to double-stranded RNA (dsRNA and that the homodimer of the TRBP mediated by the C-terminal dsRBD increases the affinity to dsRNA. RNAi against either Mj-TRBP or Mj-eIF6 impairs the dsRNA-induced sequence-specific RNAi pathway and facilitates the proliferation of white spot syndrome virus (WSSV. These results further proved the important roles of TRBP and eIF6 in the antiviral response of shrimp.

  19. Short- and medium-chain chlorinated paraffins in biota from the European Arctic -- differences in homologue group patterns.

    Science.gov (United States)

    Reth, Margot; Ciric, Anita; Christensen, Guttorm N; Heimstad, Eldbjørg S; Oehme, Michael

    2006-08-15

    Congener and homologue group patterns of chlorinated paraffins (CPs) in biota can be influenced by different processes, but these are not well studied yet. Short- (SCCPs) and medium-chain chlorinated paraffins (MCCPs) were quantified in liver from Arctic char and seabirds (little auk and kittiwake) collected at Bear Island (European Arctic) as well as in cod from Iceland and Norway. CP concentrations were between 5 and 88 ng/g wet weight (ww) for SCCPs and between 5 and 55 ng/g ww for MCCPs with one exception of 370 ng/g measured in a liver sample from little auk. The SCCP homologue group patterns were compared with those of technical mixtures and of SCCPs present in cod liver from the Baltic Sea. The latter showed a more common SCCP homologue distribution (sum of C(11) and C(12)>60%) in contrast to cod liver from the Northwest of Europe, which had a high abundance of C(10) and C(12) congeners. Seabirds from Bear Island contained an equally distributed SCCP homologue group pattern. In Arctic char, the SCCP distribution was closer to technical products, but with a high proportion (average of 18.9%) of C(10) congeners. A comparison of C(10)/C(12) ratios confirmed the higher abundance of C(10) congeners in samples from higher latitudes. For the first time, MCCPs could be detected in Arctic samples. The average proportion of C(14) congeners was 65.8%. The C(14)/C(15) abundance ratio was similar to technical mixtures. High-chlorinated CPs (Cl(>7)) were also detectable. The average chlorine content of the SCCPs was 61.9% (59.0-63.3%), and that of the MCCPs 55.8% (54.5-57.4%).

  20. Species-specific flight styles of flies are reflected in the response dynamics of a homologue motion sensitive neuron

    Directory of Open Access Journals (Sweden)

    Bart eGeurten

    2012-03-01

    Full Text Available Hoverflies and blowflies have distinctly different flight styles. Yet, both species have been shown to structure their flight behaviour in a way that facilitates extraction of 3D information from the image flow on the retina (optic flow. Neuronal candidates to analyse the optic flow are the tangential cells in the third optical ganglion – the lobula complex. These neurons are directionally selective and integrate the optic flow over large parts of the visual field. Homologue tangential cells in hoverflies and blowflies have a similar morphology. Because blowflies and hoverflies have similar neuronal layout but distinctly different flight behaviours, they are an ideal substrate to pinpoint potential neuronal adaptations to the different flight styles.In this article we describe the relationship between locomotion behaviour and motion vision on three different levels:1.We compare the different flight styles based on the categorisation of flight behaviour into prototypical movements.2.We measure the species specific dynamics of the optic flow under naturalistic flight conditions. We found the translational optic flow of both species to be very different.3.We describe possible adaptations of a homologue motion sensitive neuron. We stimulate this cell in blowflies (Calliphora and hoverflies (Eristalis with naturalistic optic flow generated by both species during free flight. The characterized hoverfly tangential cell responds faster to transient changes in the optic flow than its blowfly homologue. It is discussed whether and how the different dynamical response properties aid optic flow analysis.

  1. Identification of NoxD/Pro41 as the homologue of the p22phox NADPH oxidase subunit in fungi.

    Science.gov (United States)

    Lacaze, Isabelle; Lalucque, Hervé; Siegmund, Ulrike; Silar, Philippe; Brun, Sylvain

    2015-03-01

    NADPH oxidases (Nox) are membrane complexes that produce O2(-). Researches in mammals, plants and fungi highlight the involvement of Nox-generated ROS in cell proliferation, differentiation and defense. In mammals, the core enzyme gp91(phox)/Nox2 is associated with p22(phox) forming the flavocytochrome b558 ready for activation by a cytosolic complex. Intriguingly, no homologue of the p22(phox) gene has been found in fungal genomes, questioning how the flavoenzyme forms. Using whole genome sequencing combined with phylogenetic analysis and structural studies, we identify the fungal p22(phox) homologue as being mutated in the Podospora anserina mutant IDC(509). Functional studies show that the fungal p22(phox), PaNoxD, acts along PaNox1, but not PaNox2, a second fungal gp91(phox) homologue. Finally, cytological analysis of functional tagged versions of PaNox1, PaNoxD and PaNoxR shows clear co-localization of PaNoxD and PaNox1 and unravel a dynamic assembly of the complex in the endoplasmic reticulum and in the vacuolar system. © 2014 John Wiley & Sons Ltd.

  2. Mono-, di- and trimethylated homologues of isoprenoid tetraether lipid cores in archaea and environmental samples: mass spectrometric identification and significance.

    Science.gov (United States)

    Knappy, Chris; Barillà, Daniela; Chong, James; Hodgson, Dominic; Morgan, Hugh; Suleman, Muhammad; Tan, Christine; Yao, Peng; Keely, Brendan

    2015-12-01

    Higher homologues of widely reported C(86) isoprenoid diglycerol tetraether lipid cores, containing 0-6 cyclopentyl rings, have been identified in (hyper)thermophilic archaea, representing up to 21% of total tetraether lipids in the cells. Liquid chromatography-tandem mass spectrometry confirms that the additional carbon atoms in the C(87-88) homologues are located in the etherified chains. Structures identified include dialkyl and monoalkyl ('H-shaped') tetraethers containing C(40-42) or C(81-82) hydrocarbons, respectively, many representing novel compounds. Gas chromatography-mass spectrometric analysis of hydrocarbons released from the lipid cores by ether cleavage suggests that the C(40) chains are biphytanes and the C(41) chains 13-methylbiphytanes. Multiple isomers, having different chain combinations, were recognised among the dialkyl lipids. Methylated tetraethers are produced by Methanothermobacter thermautotrophicus in varying proportions depending on growth conditions, suggesting that methylation may be an adaptive mechanism to regulate cellular function. The detection of methylated lipids in Pyrobaculum sp. AQ1.S2 and Sulfolobus acidocaldarius represents the first reported occurrences in Crenarchaeota. Soils and aquatic sediments from geographically distinct mesotemperate environments that were screened for homologues contained monomethylated tetraethers, with di- and trimethylated structures being detected occasionally. The structural diversity and range of occurrences of the C(87-89) tetraethers highlight their potential as complementary biomarkers for archaea in natural environments. Copyright © 2015 John Wiley & Sons, Ltd.

  3. Crystal structure of pira toxin-I: a calcium-independent, myotoxic phospholipase A2 - homologue from Bothrops pirajai venom

    International Nuclear Information System (INIS)

    Canduri, R.J.; Ward, R.J.; Azevedo Junior, G.W.F. de; Arni, R.K.; Soares, A.M.; Giglio, J.R.

    1997-01-01

    Full text. Phospho lipases A2 (PLA 2 ) are small enzymes that specifically hydrolysed the sn-2 ester bond of phospholipids, preferentially in lamellar or micellar aggregates at membrane surfaces. These enzymes are widely distributed in nature and have been extensively studied. Toxic proteins from venoms from Bothrops species include catalytically active PLA 2 s and calcium independent PLA 2L ys 49 homologues. The substitution of Asp49 by Lys greatly diminishes the ability of these PLA 2 to bind calcium, an ion that plays a critical role in the stabilization of the tetrahedral transition state intermediate in the catalytic mechanism. The Lys 49 PLA 2 homologues and therefore catalytically inactive yet maintain cytolytic and myotoxic activities and furthermore retain the ability to disrupt the integrity of both plasma membranes and model lipid bilayers by a poorly understood Ca 2+ independente mechanism. Lys49 PLA 2 homologues demonstrate a specific toxic activity against skeletal muscle, affecting only muscle fibers and leaving other tissue structure such as connective tissue, nerves and vessels essentially unharmed. In order to improve our understanding of the molecular basis of the myotoxic and Ca 2+ -independent membrane damaging activities, we have determined the crystal structure of Pr TX-I, a Lys49 variant from the venom of B. pirajai. The model presented has been determined at 2.8 angstrom resolution and refined to a crystallographic residual of 19.7% (R free =29.7%). (author)

  4. Characterization of Two 20kDa-Cement Protein (cp20k) Homologues in Amphibalanus amphitrite

    KAUST Repository

    He, Li-Sheng; Zhang, Gen; Qian, Pei-Yuan

    2013-01-01

    The barnacle, Amphibalanus amphitrite, is a common marine fouling organism. Understanding the mechanism of barnacle adhesion will be helpful in resolving the fouling problem. Barnacle cement is thought to play a key role in barnacle attachment. Although several adult barnacle cement proteins have been identified in Megabalanus rosa, little is known about their function in barnacle settlement. In this study, two homologous 20k-cement proteins (cp20k) in Amphibalanus amphitrite, named Bamcp20k-1 and Bamcp20k-2, were characterized. The two homologues share primary sequence structure with proteins from other species including Megabalanus rosa and Fistulobalanus albicostatus. The conserved structure included repeated Cys domains and abundant charged amino acids, such as histidine. In this study we demonstrated that Bamcp20k-1 localized at the α secretory cells in the cyprid cement gland, while Bamcp20k-2 localized to the β secretory cells. The differential localizations suggest differential regulation for secretion from the secretory cells. Both Bamcp20k-1 and Bamcp20k-2 from cyprids dissolved in PBS. However, adult Bamcp20k-2, which was dominant in the basal shell of adult barnacles, was largely insoluble in PBS. Solubility increased in the presence of the reducing reagent Dithiothreitol (DTT), suggesting that the formation of disulfide bonds plays a role in Bamcp20k-2 function. In comparison, Bamcp20k-1, which was enriched in soft tissue, could not be easily detected in the shell and base by Western blot and easily dissolved in PBS. These differential solubilities and localizations indicate that Bamcp20k-1 and Bamcp20k-2 have distinct functions in barnacle cementing. © 2013 He et al.

  5. A La autoantigen homologue is required for the internal ribosome entry site mediated translation of giardiavirus.

    Directory of Open Access Journals (Sweden)

    Srinivas Garlapati

    2011-03-01

    Full Text Available Translation of Giardiavirus (GLV mRNA is initiated at an internal ribosome entry site (IRES in the viral transcript. The IRES localizes to a downstream portion of 5' untranslated region (UTR and a part of the early downstream coding region of the transcript. Recent studies indicated that the IRES does not require a pre-initiation complex to initiate translation but may directly recruit the small ribosome subunit with the help of a number of trans-activating protein factors. A La autoantigen homologue in the viral host Giardia lamblia, GlLa, was proposed as one of the potential trans-activating factors based on its specific binding to GLV-IRES in vitro. In this study, we further elucidated the functional role of GlLa in GLV-IRES mediated translation in Giardia by knocking down GlLa with antisense morpholino oligo, which resulted in a reduction of GLV-IRES activity by 40%. An over-expression of GlLa in Giardia moderately stimulated GLV-IRES activity by 20%. A yeast inhibitory RNA (IRNA, known to bind mammalian and yeast La autoantigen and inhibit Poliovirus and Hepatitis C virus IRES activities in vitro and in vivo, was also found to bind to GlLa protein in vitro and inhibited GLV-IRES function in vivo. The C-terminal domain of La autoantigen interferes with the dimerization of La and inhibits its function. An over-expression of the C-terminal domain (200-348aa of GlLa in Giardia showed a dominant-negative effect on GLV-IRES activity, suggesting a potential inhibition of GlLa dimerization. HA tagged GlLa protein was detected mainly in the cytoplasm of Giardia, thus supporting a primary role of GlLa in translation initiation in Giardiavirus.

  6. Phagosome maturation in unicellular eukaryote Paramecium: the presence of RILP, Rab7 and LAMP-2 homologues

    Directory of Open Access Journals (Sweden)

    E Wyroba

    2009-08-01

    Full Text Available Phagosome maturation is a complex process enabling degradation of internalised particles. Our data obtained at the gene, protein and cellular level indicate that the set of components involved in this process and known up to now in mammalian cells is functioning in unicellular eukaryote. Rab7-interacting partners: homologues of its effector RILP (Rab-interacting lysosomal protein and LAMP-2 (lysosomal membrane protein 2 as well as a7 subunit of the 26S proteasome were revealed in Paramecium phagolysosomal compartment. We identified the gene/transcript fragments encoding RILP-related proteins (RILP1 and RILP2 in Paramecium by PCR/RT-PCR and sequencing. The deduced amino acid sequences of RILP1 and RILP2 show 60.5% and 58.3% similarity, respectively, to the region involved in regulating of lysosomal morphology and dynein-dynactin recruitment of human RILP. RILP colocalised with Rab7 in Paramecium lysosomes and at phagolysosomal membrane during phagocytosis of both the latex beads and bacteria. In the same compartment LAMP-2 was present and its expression during latex internalisation was 2.5-fold higher than in the control when P2 protein fractions (100 000 x g of equal load were quantified by immunoblotting. LAMP-2 crossreacting polypeptide of ~106 kDa was glycosylated as shown by fluorescent and Western analysis of the same blot preceded by PNGase F treatment. The a7 subunit of 26S proteasome was detected close to the phagosomal membrane in the small vesicles, in some of which it colocalised with Rab7. Immunoblotting confirmed presence of RILPrelated polypeptide and a7 subunit of 26S proteasome in Paramecium protein fractions. These results suggest that Rab7, RILP and LAMP-2 may be involved in phagosome maturation in Paramecium.

  7. Characterization of Two 20kDa-Cement Protein (cp20k) Homologues in Amphibalanus amphitrite

    KAUST Repository

    He, Li-Sheng

    2013-05-22

    The barnacle, Amphibalanus amphitrite, is a common marine fouling organism. Understanding the mechanism of barnacle adhesion will be helpful in resolving the fouling problem. Barnacle cement is thought to play a key role in barnacle attachment. Although several adult barnacle cement proteins have been identified in Megabalanus rosa, little is known about their function in barnacle settlement. In this study, two homologous 20k-cement proteins (cp20k) in Amphibalanus amphitrite, named Bamcp20k-1 and Bamcp20k-2, were characterized. The two homologues share primary sequence structure with proteins from other species including Megabalanus rosa and Fistulobalanus albicostatus. The conserved structure included repeated Cys domains and abundant charged amino acids, such as histidine. In this study we demonstrated that Bamcp20k-1 localized at the α secretory cells in the cyprid cement gland, while Bamcp20k-2 localized to the β secretory cells. The differential localizations suggest differential regulation for secretion from the secretory cells. Both Bamcp20k-1 and Bamcp20k-2 from cyprids dissolved in PBS. However, adult Bamcp20k-2, which was dominant in the basal shell of adult barnacles, was largely insoluble in PBS. Solubility increased in the presence of the reducing reagent Dithiothreitol (DTT), suggesting that the formation of disulfide bonds plays a role in Bamcp20k-2 function. In comparison, Bamcp20k-1, which was enriched in soft tissue, could not be easily detected in the shell and base by Western blot and easily dissolved in PBS. These differential solubilities and localizations indicate that Bamcp20k-1 and Bamcp20k-2 have distinct functions in barnacle cementing. © 2013 He et al.

  8. Synthesis, electrochemistry, and electrogenerated chemiluminescence of two BODIPY-appended bipyridine homologues.

    Science.gov (United States)

    Qi, Honglan; Teesdale, Justin J; Pupillo, Rachel C; Rosenthal, Joel; Bard, Allen J

    2013-09-11

    Two new 2,2'-bipyridine (bpy) derivatives containing ancillary BODIPY chromophores attached at the 5- and 5'-positions (BB3) or 6- and 6'-positions (BB4) were prepared and characterized. In this work, the basic photophysics, electrochemistry, and electrogenerated chemiluminescence (ECL) of BB3 and BB4 are compared with those previously reported for a related bpy-BODIPY derivative (BB2) (J. Phys. Chem. C 2011, 115, 17993-18001). Cyclic voltammetry revealed that BB3 and BB4 display reversible 2e(-) oxidation and reduction waves, which consist of two closely spaced (50-70 mV) 1e(-) events. This redox behavior is consistent with the frontier molecular orbitals calculated for BB3 and BB4 and indicates that the 2,2'-bipyridine spacer of each bpy-BODIPY homologue does not facilitate efficient electronic communication between the tethered indacene units. In the presence of a coreactant such as tri-n-propylamine (TPA) or benzoyl peroxide (BPO), BB3 and BB4 exhibit strong ECL and produce spectra that are very similar to their corresponding photoluminescence profiles. The ECL signal obtained under annihilation conditions, however, is significantly different and is characterized by two distinct bands. One of these bands is centered at ∼570 nm and is attributed to emission via an S- or T-route. The second band occurs at longer wavelengths and is centered around ∼740 nm. The shape and concentration dependence of this long-wavelength ECL signal is not indicative of emission from an excimer or aggregate, but rather it suggests that a new emissive species is formed from the bpy-BODIPY luminophores during the annihilation process.

  9. Characterization of a novel organic solute transporter homologue from Clonorchis sinensis.

    Directory of Open Access Journals (Sweden)

    Yanyan Lu

    2018-04-01

    Full Text Available Clonorchis sinensis is a liver fluke that can dwell in the bile ducts of mammals. Bile acid transporters function to maintain the homeostasis of bile acids in C. sinensis, as they induce physiological changes or have harmful effects on C. sinensis survival. The organic solute transporter (OST transports mainly bile acid and belongs to the SLC51 subfamily of solute carrier transporters. OST plays a critical role in the recirculation of bile acids in higher animals. In this study, we cloned full-length cDNA of the 480-amino acid OST from C. sinensis (CsOST. Genomic analysis revealed 11 exons and nine introns. The CsOST protein had a 'Solute_trans_a' domain with 67% homology to Schistosoma japonicum OST. For further analysis, the CsOST protein sequence was split into the ordered domain (CsOST-N at the N-terminus and disordered domain (CsOST-C at the C-terminus. The tertiary structure of each domain was built using a threading-based method and determined by manual comparison. In a phylogenetic tree, the CsOST-N domain belonged to the OSTα and CsOST-C to the OSTβ clade. These two domains were more highly conserved with the OST α- and β-subunits at the structure level than at sequence level. These findings suggested that CsOST comprised the OST α- and β-subunits. CsOST was localized in the oral and ventral suckers and in the mesenchymal tissues abundant around the intestine, vitelline glands, uterus, and testes. This study provides fundamental data for the further understanding of homologues in other flukes.

  10. Characterization of a novel organic solute transporter homologue from Clonorchis sinensis

    Science.gov (United States)

    Dai, Fuhong; Lee, Ji-Yun; Pak, Jhang Ho; Sohn, Woon-Mok

    2018-01-01

    Clonorchis sinensis is a liver fluke that can dwell in the bile ducts of mammals. Bile acid transporters function to maintain the homeostasis of bile acids in C. sinensis, as they induce physiological changes or have harmful effects on C. sinensis survival. The organic solute transporter (OST) transports mainly bile acid and belongs to the SLC51 subfamily of solute carrier transporters. OST plays a critical role in the recirculation of bile acids in higher animals. In this study, we cloned full-length cDNA of the 480-amino acid OST from C. sinensis (CsOST). Genomic analysis revealed 11 exons and nine introns. The CsOST protein had a ‘Solute_trans_a’ domain with 67% homology to Schistosoma japonicum OST. For further analysis, the CsOST protein sequence was split into the ordered domain (CsOST-N) at the N-terminus and disordered domain (CsOST-C) at the C-terminus. The tertiary structure of each domain was built using a threading-based method and determined by manual comparison. In a phylogenetic tree, the CsOST-N domain belonged to the OSTα and CsOST-C to the OSTβ clade. These two domains were more highly conserved with the OST α- and β-subunits at the structure level than at sequence level. These findings suggested that CsOST comprised the OST α- and β-subunits. CsOST was localized in the oral and ventral suckers and in the mesenchymal tissues abundant around the intestine, vitelline glands, uterus, and testes. This study provides fundamental data for the further understanding of homologues in other flukes. PMID:29702646

  11. Regulation of Metalloprotease Gene Expression in Vibrio vulnificus by a Vibrio harveyi LuxR Homologue

    Science.gov (United States)

    Shao, Chung-Ping; Hor, Lien-I

    2001-01-01

    Expression of the Vibrio vulnificus metalloprotease gene, vvp, was turned up rapidly when bacterial growth reached the late log phase. A similar pattern of expression has been found in the metalloprotease gene of Vibrio cholerae, and this has been shown to be regulated by a Vibrio harveyi LuxR-like transcriptional activator. To find out whether a LuxR homologue exists in V. vulnificus, a gene library of this organism was screened by colony hybridization using a probe derived from a sequence that is conserved in various luxR-like genes of vibrios. A gene containing a 618-bp open reading frame was identified and found to be identical to the smcR gene of V. vulnificus reported previously. An isogenic SmcR-deficient (RD) mutant was further constructed by an in vivo allelic exchange technique. This mutant exhibited an extremely low level of vvp transcription compared with that of the parent strain. On the other hand, the cytolysin gene, vvhA, was expressed at a higher level in the RD mutant than in the parent strain during the log phase of growth. These data suggested that SmcR might not only be a positive regulator of the protease gene but might also be involved in negative regulation of the cytolysin gene. Virulence of the RD mutant in either normal or iron-overloaded mice challenged by intraperitoneal injection was comparable to that of the parent strain, indicating that SmcR is not required for V. vulnificus virulence in mice. PMID:11157950

  12. Development and mapping of SSR markers linked to resistance-gene homologue clusters in common bean

    Institute of Scientific and Technical Information of China (English)

    Luz; Nayibe; Garzon; Matthew; Wohlgemuth; Blair

    2014-01-01

    Common bean is an important but often a disease-susceptible legume crop of temperate,subtropical and tropical regions worldwide. The crop is affected by bacterial, fungal and viral pathogens. The strategy of resistance-gene homologue(RGH) cloning has proven to be an efficient tool for identifying markers and R(resistance) genes associated with resistances to diseases. Microsatellite or SSR markers can be identified by physical association with RGH clones on large-insert DNA clones such as bacterial artificial chromosomes(BACs). Our objectives in this work were to identify RGH-SSR in a BAC library from the Andean genotype G19833 and to test and map any polymorphic markers to identify associations with known positions of disease resistance genes. We developed a set of specific probes designed for clades of common bean RGH genes and then identified positive BAC clones and developed microsatellites from BACs having SSR loci in their end sequences. A total of 629 new RGH-SSRs were identified and named BMr(bean microsatellite RGH-associated markers). A subset of these markers was screened for detecting polymorphism in the genetic mapping population DOR364 × G19833. A genetic map was constructed with a total of 264 markers,among which were 80 RGH loci anchored to single-copy RFLP and SSR markers. Clusters of RGH-SSRs were observed on most of the linkage groups of common bean and in positions associated with R-genes and QTL. The use of these new markers to select for disease resistance is discussed.

  13. Neurophysiological Evidence That Musical Training Influences the Recruitment of Right Hemispheric Homologues for Speech Perception

    Directory of Open Access Journals (Sweden)

    McNeel Gordon Jantzen

    2014-03-01

    Full Text Available Musicians have a more accurate temporal and tonal representation of auditory stimuli than their non-musician counterparts (Kraus & Chandrasekaran, 2010; Parbery-Clark, Skoe, & Kraus, 2009; Zendel & Alain, 2008; Musacchia, Sams, Skoe, & Kraus, 2007. Musicians who are adept at the production and perception of music are also more sensitive to key acoustic features of speech such as voice onset timing and pitch. Together, these data suggest that musical training may enhance the processing of acoustic information for speech sounds. In the current study, we sought to provide neural evidence that musicians process speech and music in a similar way. We hypothesized that for musicians, right hemisphere areas traditionally associated with music are also engaged for the processing of speech sounds. In contrast we predicted that in non-musicians processing of speech sounds would be localized to traditional left hemisphere language areas. Speech stimuli differing in voice onset time was presented using a dichotic listening paradigm. Subjects either indicated aural location for a specified speech sound or identified a specific speech sound from a directed aural location. Musical training effects and organization of acoustic features were reflected by activity in source generators of the P50. This included greater activation of right middle temporal gyrus (MTG and superior temporal gyrus (STG in musicians. The findings demonstrate recruitment of right hemisphere in musicians for discriminating speech sounds and a putative broadening of their language network. Musicians appear to have an increased sensitivity to acoustic features and enhanced selective attention to temporal features of speech that is facilitated by musical training and supported, in part, by right hemisphere homologues of established speech processing regions of the brain.

  14. Synthesis, Electrochemistry and Electrogenerated Chemiluminesce of two BODIPY-Appended Bipyridine Homologues

    Science.gov (United States)

    Qi, Honglan; Teesdale, Justin J.; Pupillo, Rachel C.

    2014-01-01

    Two new 2,2’-bipyridine (bpy) derivatives containing ancillary BODIPY chromophores attached at the 5- and 5’-positions (BB3) or 6- and 6’-positions (BB4) were prepared and characterized. In this work, the basic photophysics, electrochemistry and electrogenerated chemiluminescence (ECL) of BB3 and BB4 are compared with those previously reported for a related bpy-BODIPY derivative (BB2) (J. Phys. Chem. C 2011, 115, 17993–18001). Cyclic voltammetry revealed that BB3 and BB4 display reversible 2e− oxidation and reduction waves, which consist of two closely spaced (50 – 70 mV) 1e− events. This redox behavior is consistent with the frontier molecular orbitals calculated for BB3 and BB4 and indicates that the 2,2’-bipyridine spacer of each bpy- BODIPY homologue does not facilitate efficient electronic communication between the tethered indacene units. In the presence of a coreactant such as tri-n-propylamine (TPA) or benzoyl peroxide (BPO), BB3 and BB4 exhibit strong ECL and produce spectra that are very similar to their corresponding photoluminescence profiles. The ECL signal obtained under annihilation conditions, however, is significantly different and is characterized by two distinct bands. One of these bands is centered at ~570 nm and is attributed to emission via an S- or T-route. The second band, occurs at longer wavelengths and is centered around ~740 nm. The shape and concentration dependence of this long-wavelength ECL signal is not indicative of emission from an excimer or aggregate, but rather is suggests that a new emissive species is formed from the bpy-BODIPY luminophores during the annihilation process. PMID:23980850

  15. Associations of dietary methyl donor intake with MLH1 promoter hypermethylation and related molecular phenotypes in sporadic colorectal cancer

    NARCIS (Netherlands)

    Vogel, S. de; Bongaerts, B.W.C.; Wouters, K.A.D.; Kester, A.D.M.; Schouten, L.J.; Goeij, A.F.P.M. de; Bruïne, A.P. de; Goldbohm, R.A.; Brandt, P.A. van den; Engeland, M. van; Weijenberg, M.P.

    2008-01-01

    Intake of dietary factors that serve as methyl group donors may influence promoter hypermethylation in colorectal carcinogenesis. We investigated whether dietary folate, vitamin B2 and vitamin B6, methionine and alcohol were associated with mutL homologue 1 (MLH1) hypermethylation and the related

  16. Broad anti-HIV activity of the Oscillatoria agardhii agglutinin homologue lectin family.

    Science.gov (United States)

    Férir, Geoffrey; Huskens, Dana; Noppen, Sam; Koharudin, Leonardus M I; Gronenborn, Angela M; Schols, Dominique

    2014-10-01

    Oscillatoria agardhii agglutinin homologue (OAAH) proteins belong to a recently discovered lectin family. The founding member OAA and a designed hybrid OAAH (OPA) recognize similar but unique carbohydrate structures of Man-9, compared with other antiviral carbohydrate-binding agents (CBAs). These two newly described CBAs were evaluated for their inactivating properties on HIV replication and transmission and for their potential as microbicides. Various cellular assays were used to determine antiviral activity against wild-type and certain CBA-resistant HIV-1 strains: (i) free HIV virion infection in human T lymphoma cell lines and PBMCs; (ii) syncytium formation assay using persistently HIV-infected T cells and non-infected CD4+ T cells; (iii) DC-SIGN-mediated viral capture; and (iv) transmission to uninfected CD4+ T cells. OAA and OPA were also evaluated for their mitogenic properties and potential synergistic effects using other CBAs. OAA and OPA inhibit HIV replication, syncytium formation between HIV-1-infected and uninfected T cells, DC-SIGN-mediated HIV-1 capture and transmission to CD4+ target T cells, thereby rendering a variety of HIV-1 and HIV-2 clinical isolates non-infectious, independent of their coreceptor use. Both CBAs competitively inhibit the binding of the Manα(1-2)Man-specific 2G12 monoclonal antibody (mAb) as shown by flow cytometry and surface plasmon resonance analysis. The HIV-1 NL4.3(2G12res), NL4.3(MVNres) and IIIB(GRFTres) strains were equally inhibited as the wild-type HIV-1 strains by these CBAs. Combination studies indicate that OAA and OPA act synergistically with Hippeastrum hybrid agglutinin, 2G12 mAb and griffithsin (GRFT), with the exception of OPA/GRFT. OAA and OPA are unique CBAs with broad-spectrum anti-HIV activity; however, further optimization will be necessary for microbicidal application. © The Author 2014. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights

  17. Expression patterns of Passiflora edulis APETALA1/FRUITFULL homologues shed light onto tendril and corona identities

    Directory of Open Access Journals (Sweden)

    Livia C. T. Scorza

    2017-02-01

    Full Text Available Abstract Background Passiflora (passionflowers makes an excellent model for studying plant evolutionary development. They are mostly perennial climbers that display axillary tendrils, which are believed to be modifications of the inflorescence. Passionflowers are also recognized by their unique flower features, such as the extra whorls of floral organs composed of corona filaments and membranes enclosing the nectary. Although some work on Passiflora organ ontogeny has been done, the developmental identity of both Passiflora tendrils and the corona is still controversial. Here, we combined ultrastructural analysis and expression patterns of the flower meristem and floral organ identity genes of the MADS-box AP1/FUL clade to reveal a possible role for these genes in the generation of evolutionary novelties in Passiflora. Results We followed the development of structures arising from the axillary meristem from juvenile to adult phase in P. edulis. We further assessed the expression pattern of P. edulis AP1/FUL homologues (PeAP1 and PeFUL, by RT-qPCR and in situ hybridization in several tissues, correlating it with the developmental stages of P. edulis. PeAP1 is expressed only in the reproductive stage, and it is highly expressed in tendrils and in flower meristems from the onset of their development. PeAP1 is also expressed in sepals, petals and in corona filaments, suggesting a novel role for PeAP1 in floral organ diversification. PeFUL presented a broad expression pattern in both vegetative and reproductive tissues, and it is also expressed in fruits. Conclusions Our results provide new molecular insights into the morphological diversity in the genus Passiflora. Here, we bring new evidence that tendrils are part of the Passiflora inflorescence. This points to the convergence of similar developmental processes involving the recruitment of genes related to flower identity in the origin of tendrils in different plant families. The data obtained also

  18. Validating tyrosinase homologue melA as a photoacoustic reporter gene for imaging Escherichia coli

    Science.gov (United States)

    Paproski, Robert J.; Li, Yan; Barber, Quinn; Lewis, John D.; Campbell, Robert E.; Zemp, Roger

    2015-10-01

    To understand the pathogenic processes for infectious bacteria, appropriate research tools are required for replicating and characterizing infections. Fluorescence and bioluminescence imaging have primarily been used to image infections in animal models, but optical scattering in tissue significantly limits imaging depth and resolution. Photoacoustic imaging, which has improved depth-to-resolution ratio compared to conventional optical imaging, could be useful for visualizing melA-expressing bacteria since melA is a bacterial tyrosinase homologue which produces melanin. Escherichia coli-expressing melA was visibly dark in liquid culture. When melA-expressing bacteria in tubes were imaged with a VisualSonics Vevo LAZR system, the signal-to-noise ratio of a 9× dilution sample was 55, suggesting that ˜20 bacteria cells could be detected with our system. Multispectral (680, 700, 750, 800, 850, and 900 nm) analysis of the photoacoustic signal allowed unmixing of melA-expressing bacteria from blood. To compare photoacoustic reporter gene melA (using Vevo system) with luminescent and fluorescent reporter gene Nano-lantern (using Bruker Xtreme In-Vivo system), tubes of bacteria expressing melA or Nano-lantern were submerged 10 mm in 1% Intralipid, spaced between melA-expressing bacteria even when the tubes were less than 1 mm from each other, while bioluminescence and fluorescence imaging could not resolve the two tubes of Nano-lantern-expressing bacteria even when the tubes were spaced 10 mm from each other. After injecting 100-μL of melA-expressing bacteria in the back flank of a chicken embryo, photoacoustic imaging allowed visualization of melA-expressing bacteria up to 10-mm deep into the embryo. Photoacoustic signal from melA could also be separated from deoxy- and oxy-hemoglobin signal observed within the embryo and chorioallantoic membrane. Our results suggest that melA is a useful photoacoustic reporter gene for visualizing bacteria, and further work

  19. Over-expression, purification and characterization of an Asc-1 homologue from Gloeobacter violaceus

    DEFF Research Database (Denmark)

    Wang, Xiaole; Hald, Helle; Ernst, Heidi Asschenfeldt

    2010-01-01

    The human alanine-serine-cysteine transporter 1 (Asc-1) belongs to the slc7a family of solute carrier transporters. Asc-1 mediates the uptake of D-serine in an exchanger-type fashion, coupling the process to the release of alanine and cysteine. Among the bacterial Asc-1 homologues, one transporter...... of auto-induction was crucial for obtaining high yields and purity of the transporter. The transporter was purified with yields in the range of 0.2-0.4 mg per L culture and eluted in a single peak from a size-exclusion column. The circular dichroism spectrum revealed a folded and apparently all...

  20. Purification, crystallization and preliminary X-ray analysis of SGR6054, a Streptomyces homologue of the mycobacterial integration host factor mIHF

    International Nuclear Information System (INIS)

    Nomoto, Ryohei; Tezuka, Takeaki; Miyazono, Ken-ichi; Tanokura, Masaru; Horinouchi, Sueharu; Ohnishi, Yasuo

    2012-01-01

    A Streptomyces homologue of the mycobacterial integration host factor mIHF was heterologously produced, purified and crystallized in the presence of a 16-mer duplex DNA by the sitting-drop vapour-diffusion method. The best crystal diffracted X-rays to 2.22 Å resolution and belonged to space group C2. The mycobacterial integration host factor (mIHF) is a small nonspecific DNA-binding protein that is essential for the growth of Mycobacterium smegmatis. mIHF homologues are widely distributed among Actinobacteria, and a Streptomyces homologue of mIHF is involved in control of sporulation and antibiotic production in S. coelicolor A3(2). Despite their important biological functions, a structure of mIHF or its homologues has not been elucidated to date. Here, the S. griseus mIHF homologue (SGR6054) was expressed and purified from Escherichia coli and crystallized in the presence of a 16-mer duplex DNA by the sitting-drop vapour-diffusion method. The plate-shaped crystal belonged to space group C2, with unit-cell parameters a = 88.53, b = 69.35, c = 77.71 Å, β = 96.63°, and diffracted X-rays to 2.22 Å resolution

  1. Purification, crystallization and preliminary X-ray analysis of SGR6054, a Streptomyces homologue of the mycobacterial integration host factor mIHF

    Energy Technology Data Exchange (ETDEWEB)

    Nomoto, Ryohei; Tezuka, Takeaki; Miyazono, Ken-ichi; Tanokura, Masaru; Horinouchi, Sueharu; Ohnishi, Yasuo [Graduate School of Agricultural and Life Sciences, The University of Tokyo, 1-1-1 Yayoi, Bunkyo-ku, Tokyo 113-8657 (Japan)

    2012-08-31

    A Streptomyces homologue of the mycobacterial integration host factor mIHF was heterologously produced, purified and crystallized in the presence of a 16-mer duplex DNA by the sitting-drop vapour-diffusion method. The best crystal diffracted X-rays to 2.22 Å resolution and belonged to space group C2. The mycobacterial integration host factor (mIHF) is a small nonspecific DNA-binding protein that is essential for the growth of Mycobacterium smegmatis. mIHF homologues are widely distributed among Actinobacteria, and a Streptomyces homologue of mIHF is involved in control of sporulation and antibiotic production in S. coelicolor A3(2). Despite their important biological functions, a structure of mIHF or its homologues has not been elucidated to date. Here, the S. griseus mIHF homologue (SGR6054) was expressed and purified from Escherichia coli and crystallized in the presence of a 16-mer duplex DNA by the sitting-drop vapour-diffusion method. The plate-shaped crystal belonged to space group C2, with unit-cell parameters a = 88.53, b = 69.35, c = 77.71 Å, β = 96.63°, and diffracted X-rays to 2.22 Å resolution.

  2. Activation of pur Gene Expression by a Homologue of the Bacillus subtilis PurR repressor:

    DEFF Research Database (Denmark)

    Kilstrup, Mogens; Martinussen, Jan

    1998-01-01

    R encoded repressor from Bacillus subtilis. The wildtype purR gene complements the purine auxotrophy of a purR::Iss1mutant, and it was shown that the purR::Iss1 mutation lowers transcription from the purine regulated L. lactis purD promoter. In a parallel study on the regulation of purC and purD expression....... We have identified a PurBox sequence overlapping the -35 region of the L. lactis purR promoter and found, by studies of a purR-lacLM fusion plasmid, that purR is autoregulated. Because of the high similarity of the PurR proteins from B. subtilis and L. lactis, we looked for PurBox sequences...... in the promoter regions of the PurR regulated genes in B. subtilis, and identified a perfectly matching PurBox in the purA promoter region, and slightly degenerate PurBox like sequences in the promoter regions for the pur operon and the purR gene....

  3. Effects of the deletion of the Escherichia coli frataxin homologue CyaY on the respiratory NADH:ubiquinone oxidoreductase

    Directory of Open Access Journals (Sweden)

    Grauman Peter L

    2007-07-01

    Full Text Available Abstract Background Frataxin is discussed as involved in the biogenesis of iron-sulfur clusters. Recently it was discovered that a frataxin homologue is a structural component of the respiratory NADH:ubiquinone oxidoreductase (complex I in Thermus thermophilus. It was not clear whether frataxin is in general a component of complex I from bacteria. The Escherichia coli homologue of frataxin is coined CyaY. Results We report that complex I is completely assembled to a stable and active enzyme complex equipped with all known iron-sulfur clusters in a cyaY mutant of E. coli. However, the amount of complex I is reduced by one third compared to the parental strain. Western blot analysis and live cell imaging of CyaY engineered with a GFP demonstrated that CyaY is located in the cytoplasm and not attached to the membrane as to be expected if it were a component of complex I. Conclusion CyaY plays a non-essential role in the assembly of complex I in E. coli. It is not a structural component but may transiently interact with the complex.

  4. Fisetin up-regulates the expression of adiponectin in 3T3-L1 adipocytes via the activation of silent mating type information regulation 2 homologue 1 (SIRT1)-deacetylase and peroxisome proliferator-activated receptors (PPARs).

    Science.gov (United States)

    Jin, Taewon; Kim, Oh Yoen; Shin, Min-Jeong; Choi, Eun Young; Lee, Sung Sook; Han, Ye Sun; Chung, Ji Hyung

    2014-10-29

    Adiponectin, an adipokine, has been described as showing physiological benefits against obesity-related malfunctions and vascular dysfunction. Several natural compounds that promote the expression and secretion of adipokines in adipocytes could be useful for treating metabolic disorders. This study investigated the effect of fisetin, a dietary flavonoid, on the regulation of adiponectin in adipocytes using 3T3-L1 preadipocytes. The expression and secretion of adiponectin increased in 3T3-L1 cells upon treatment with fisetin in a dose-dependent manner. Fisetin-induced adiponectin secretion was inhibited by peroxisome proliferator-activated receptor (PPAR) antagonists. It was also revealed that fisetin increased the activities of PPARs and silent mating type information regulation 2 homologue 1 (SIRT1) in a dose-dependent manner. Furthermore, the up-regulation of adiponectin and the activation of PPARs induced by fisetin were prevented by a SIRT1 inhibitor. Fisetin also promoted deacetylation of PPAR γ coactivator 1 (PGC-1) and its interaction with PPARs. SIRT knockdown by siRNA significantly decreased both adiponectin production and PPARs-PGC-1 interaction. These results provide evidence that fisetin promotes the gene expression of adiponectin through the activation of SIRT1 and PPARs in adipocytes.

  5. A novel role for the Bombyx Slbo homologue, BmC/EBP, in insect choriogenesis.

    Science.gov (United States)

    Sourmeli, S; Papantonis, A; Lecanidou, R

    2005-11-18

    One previously unidentified cDNA clone coding for a C/EBP factor, BmC/EBP, was isolated from Bombyx mori follicular cells. This is the first time that a C/EBP factor has been isolated and characterized in Lepidoptera. We provide information concerning structural features and developmental specificity, as well as in vitro interaction properties with chorion gene promoter modules. BmC/EBP was capable of effectively recognizing homologous binding sites from chorion gene promoters derived from flies and other moths, despite significant diversity of chorion structure, gene organization, and gene expression profiles. We propose that the relative concentration of BmC/EBP, in relation to its differential binding affinity for promoter cis-elements, results in activation or repression of silkmoth chorion gene expression.

  6. [Intersection point rule for the retention value with mobile phase composition and boiling point of the homologues and chlorobenzenes in soil leaching column chromatography].

    Science.gov (United States)

    Xu, F; Liang, X; Lin, B; Su, F

    1999-03-01

    Based on the linear retention equation of the logarithm of the capacity factor (logk') vs. the methanol volume fraction (psi) of aqueous binary mobile phase in soil leaching column chromatography, the intersection point rule for the logk' of homologues and weak polar chlorobenzenes, with psi, as well as with boiling point, has been derived due to existence of the similar interactions among solutes of the same series, stationary phase (soil) and eluent (methanol-water). These rules were testified by experimental data of homologues (n-alkylbenzenes, methylbenzenes) and weak polar chlorobenzenes.

  7. TMBP200, a XMAP215 homologue of tobacco BY-2 cells, has an essential role in plant mitosis.

    Science.gov (United States)

    Yasuhara, Hiroki; Oe, Yuki

    2011-07-01

    TMBP200 from tobacco BY-2 cells is a member of the highly conserved family of microtubule-associated proteins that includes Xenopus XMAP215, human TOGp, and Arabidopsis MOR1/GEM1. XMAP215 homologues have an essential role in spindle assembly and function in animals and yeast, but their role in plant mitosis is not fully clarified. Here, we show by immunoblot analysis that TMBP200 levels in synchronously cultured BY-2 cells increased when the cells entered mitosis, thus indicating that TMBP200 plays an important role in mitosis in tobacco. To investigate the role of TMBP200 in mitosis, we employed inducible RNA interference to silence TMBP200 expression in BY-2 cells. The resulting depletion of TMBP200 caused severe defects in bipolar spindle formation and resulted in the appearance of multinucleated cells with variable-sized nuclei. This finding indicates that TMBP200 has an essential role in bipolar spindle formation and function.

  8. The expression of the rice (Oryza sativa L.) homologue of Snm1 is induced by DNA damages

    International Nuclear Information System (INIS)

    Kimura, Seisuke; Saotome, Ai; Uchiyama, Yukinobu; Mori, Yoko; Tahira, Yasue; Sakaguchi, Kengo

    2005-01-01

    We isolated and characterized the rice homologue of the DNA repair gene Snm1 (OsSnm1). The length of the cDNA was 1862 bp; the open reading frame encoded a predicted product of 485 amino acid residues with a molecular mass of 53.2 kDa. The OsSnm1 protein contained the conserved β-lactamase domain in its internal region. OsSnm1 was expressed in all rice organs. The expression was induced by MMS, H 2 O 2 , and mitomycin C, but not by UV. Transient expression of an OsSnm1/GFP fusion protein in onion epidermal cells revealed the localization of OsSnm1 to the nucleus. These results suggest that OsSnm1 is involved not only in the repair of DNA interstrand crosslinks, but also in various other DNA repair pathways

  9. Investigation of evaporation characteristics of polonium and its lighter homologues selenium and tellurium from liquid Pb-Bi-eutecticum

    CERN Document Server

    Neuhausen, J; Eichler, B

    2004-01-01

    The evaporation behaviour of polonium and its lighter homologues selenium and tellurium dissolved in liquid Pb-Bi-eutecticum (LBE) has been studied at various temperatures in the range from 482 K up to 1330 K under Ar/H2 and Ar/H2O-atmospheres using γ-ray spectroscopy. Polonium release in the temperature range of interest for technical applications is slow. Within short term (1h) experiments measurable amounts of polonium are evaporated only at temperatures above 973 K. Long term experiments reveal that a slow evaporation of polonium occurs at temperatures around 873 K resulting in a fractional polonium loss of the melt around 1% per day. Evaporation rates of selenium and tellurium are smaller than those of polonium. The presence of H2O does not enhance the evaporation within the error limits of our experiments. The thermodynamics and possible reaction pathways involved in polonium release from LBE are discussed.

  10. Snipper, an Eri1 homologue, affects histone mRNA abundance and is crucial for normal Drosophila melanogaster development.

    Science.gov (United States)

    Alexiadis, Anastasios; Delidakis, Christos; Kalantidis, Kriton

    2017-07-01

    The conserved 3'-5' RNA exonuclease ERI1 is implicated in RNA interference inhibition, 5.8S rRNA maturation and histone mRNA maturation and turnover. The single ERI1 homologue in Drosophila melanogaster Snipper (Snp) is a 3'-5' exonuclease, but its in vivo function remains elusive. Here, we report Snp requirement for normal Drosophila development, since its perturbation leads to larval arrest and tissue-specific downregulation results in abnormal tissue development. Additionally, Snp directly interacts with histone mRNA, and its depletion results in drastic reduction in histone transcript levels. We propose that Snp protects the 3'-ends of histone mRNAs and upon its absence, histone transcripts are readily degraded. This in turn may lead to cell cycle delay or arrest, causing growth arrest and developmental perturbations. © 2017 Federation of European Biochemical Societies.

  11. Identification and characterisation of the angiotensin converting enzyme-3 (ACE3 gene: a novel mammalian homologue of ACE

    Directory of Open Access Journals (Sweden)

    Phelan Anne

    2007-06-01

    Full Text Available Abstract Background Mammalian angiotensin converting enzyme (ACE plays a key role in blood pressure regulation. Although multiple ACE-like proteins exist in non-mammalian organisms, to date only one other ACE homologue, ACE2, has been identified in mammals. Results Here we report the identification and characterisation of the gene encoding a third homologue of ACE, termed ACE3, in several mammalian genomes. The ACE3 gene is located on the same chromosome downstream of the ACE gene. Multiple sequence alignment and molecular modelling have been employed to characterise the predicted ACE3 protein. In mouse, rat, cow and dog, the predicted protein has mutations in some of the critical residues involved in catalysis, including the catalytic Glu in the HEXXH zinc binding motif which is Gln, and ESTs or reverse-transcription PCR indicate that the gene is expressed. In humans, the predicted ACE3 protein has an intact HEXXH motif, but there are other deletions and insertions in the gene and no ESTs have been identified. Conclusion In the genomes of several mammalian species there is a gene that encodes a novel, single domain ACE-like protein, ACE3. In mouse, rat, cow and dog ACE3, the catalytic Glu is replaced by Gln in the putative zinc binding motif, indicating that in these species ACE3 would lack catalytic activity as a zinc metalloprotease. In humans, no evidence was found that the ACE3 gene is expressed and the presence of deletions and insertions in the sequence indicate that ACE3 is a pseudogene.

  12. Ensembles generated from crystal structures of single distant homologues solve challenging molecular-replacement cases in AMPLE.

    Science.gov (United States)

    Rigden, Daniel J; Thomas, Jens M H; Simkovic, Felix; Simpkin, Adam; Winn, Martyn D; Mayans, Olga; Keegan, Ronan M

    2018-03-01

    Molecular replacement (MR) is the predominant route to solution of the phase problem in macromolecular crystallography. Although routine in many cases, it becomes more effortful and often impossible when the available experimental structures typically used as search models are only distantly homologous to the target. Nevertheless, with current powerful MR software, relatively small core structures shared between the target and known structure, of 20-40% of the overall structure for example, can succeed as search models where they can be isolated. Manual sculpting of such small structural cores is rarely attempted and is dependent on the crystallographer's expertise and understanding of the protein family in question. Automated search-model editing has previously been performed on the basis of sequence alignment, in order to eliminate, for example, side chains or loops that are not present in the target, or on the basis of structural features (e.g. solvent accessibility) or crystallographic parameters (e.g. B factors). Here, based on recent work demonstrating a correlation between evolutionary conservation and protein rigidity/packing, novel automated ways to derive edited search models from a given distant homologue over a range of sizes are presented. A variety of structure-based metrics, many readily obtained from online webservers, can be fed to the MR pipeline AMPLE to produce search models that succeed with a set of test cases where expertly manually edited comparators, further processed in diverse ways with MrBUMP, fail. Further significant performance gains result when the structure-based distance geometry method CONCOORD is used to generate ensembles from the distant homologue. To our knowledge, this is the first such approach whereby a single structure is meaningfully transformed into an ensemble for the purposes of MR. Additional cases further demonstrate the advantages of the approach. CONCOORD is freely available and computationally inexpensive, so

  13. An initial biochemical and cell biological characterization of the mammalian homologue of a central plant developmental switch, COP1

    Directory of Open Access Journals (Sweden)

    Wang Haiyang

    2002-12-01

    Full Text Available Abstract Background Constitutive photomorphogenic 1 (COP1 has been defined as a central regulator of photomorphogenic development in plants, which targets key transcription factors for proteasome-dependent degradation. Although COP1 mammalian homologue has been previously reported, its function and distribution in animal kingdom are not known. Results Here we report the characterization of full-length human and mouse COP1 cDNAs and the genomic structures of the COP1 genes from several different species. Mammalian COP1 protein binds to ubiquitinated proteins in vivo and is itself ubiquitinated. Furthermore, mammalian COP1 is predominately nuclear localized and exists primarily as a complex of over 700 kDa. Through mutagenesis studies, we have defined a leucine-rich nuclear export signal (NES within the coiled-coil domain of mammalian COP1 and a nuclear localization signal (NLS, which is composed of two clusters of positive-charged amino acids, bridged by the RING finger. Disruption of the RING finger structure abolishes the nuclear import, while deletion of the entire RING finger restores the nuclear import. Conclusions Our data suggest that mammalian COP1, similar to its plant homologue, may play a role in ubiquitination. Mammalian COP1 contains a classic leucine-rich NES and a novel bipartite NLS bridged by a RING finger domain. We propose a working model in which the COP1 RING finger functions as a structural scaffold to bring two clusters of positive-charged residues within spatial proximity to mimic a bipartite NLS. Therefore, in addition to its well-characterized role in ubiquitination, the RING finger domain may also play a structural role in nuclear import.

  14. CORRELATIONS BETWEEN HOMOLOGUE CONCENTRATIONS OF PCDD/FS AND TOXIC EQUIVALENCY VALUES IN LABORATORY-, PACKAGE BOILER-, AND FIELD-SCALE INCINERATORS

    Science.gov (United States)

    The toxic equivalency (TEQ) values of polychlorinated dibenzo-p-dioxins and polychlorinated dibenzofurans (PCDD/Fs) are predicted with a model based on the homologue concentrations measured from a laboratory-scale reactor (124 data points), a package boiler (61 data points), and ...

  15. Identification and characterization of the ESAT-6 homologue of Mycobacterium leprae and T-cell cross-reactivity with Mycobacterium tuberculosis

    NARCIS (Netherlands)

    Geluk, Annemieke; van Meijgaarden, Krista E.; Franken, Kees L. M. C.; Subronto, Yanri W.; Wieles, Brigitte; Arend, Sandra M.; Sampaio, Elizabeth P.; de Boer, Tjitske; Faber, William R.; Naafs, Ben; Ottenhoff, Tom H. M.

    2002-01-01

    In this paper we describe identification and characterization of Mycobacterium leprae ESAT-6 (L-ESAT-6), the homologue of M. tuberculosis ESAT-6 (T-ESAT-6). T-ESAT-6 is expressed by all pathogenic strains belonging to the M. tuberculosis complex but is absent from virtually all other mycobacterial

  16. Mouse Homologue of the Schizophrenia Susceptibility Gene ZNF804A as a Target of Hoxc8

    Directory of Open Access Journals (Sweden)

    Hyun Joo Chung

    2010-01-01

    Full Text Available Using a ChIP-cloning technique, we identified a Zinc finger protein 804a (Zfp804a as one of the putative Hoxc8 downstream target genes. We confirmed binding of Hoxc8 to an intronic region of Zfp804a by ChIP-PCR in F9 cells as well as in mouse embryos. Hoxc8 upregulated Zfp804a mRNA levels and augmented minimal promoter activity in vitro. In E11.5 mouse embryos, Zfp804a and Hoxc8 were coexpressed. Recent genome-wide studies identified Zfp804a (or ZNF804A in humans as a plausible marker for schizophrenia, leading us to hypothesize that this embryogenic regulatory control might also exert influence in development of complex traits such as psychosis.

  17. A plasmid-encoded UmuD homologue regulates expression of Pseudomonas aeruginosa SOS genes.

    Science.gov (United States)

    Díaz-Magaña, Amada; Alva-Murillo, Nayeli; Chávez-Moctezuma, Martha P; López-Meza, Joel E; Ramírez-Díaz, Martha I; Cervantes, Carlos

    2015-07-01

    The Pseudomonas aeruginosa plasmid pUM505 contains the umuDC operon that encodes proteins similar to error-prone repair DNA polymerase V. The umuC gene appears to be truncated and its product is probably not functional. The umuD gene, renamed umuDpR, possesses an SOS box overlapped with a Sigma factor 70 type promoter; accordingly, transcriptional fusions revealed that the umuDpR gene promoter is activated by mitomycin C. The predicted sequence of the UmuDpR protein displays 23 % identity with the Ps. aeruginosa SOS-response LexA repressor. The umuDpR gene caused increased MMC sensitivity when transferred to the Ps. aeruginosa PAO1 strain. As expected, PAO1-derived knockout lexA-  mutant PW6037 showed resistance to MMC; however, when the umuDpR gene was transferred to PW6037, MMC resistance level was reduced. These data suggested that UmuDpR represses the expression of SOS genes, as LexA does. To test whether UmuDpR exerts regulatory functions, expression of PAO1 SOS genes was evaluated by reverse transcription quantitative PCR assays in the lexA-  mutant with or without the pUC_umuD recombinant plasmid. Expression of lexA, imuA and recA genes increased 3.4-5.3 times in the lexA-  mutant, relative to transcription of the corresponding genes in the lexA+ strain, but decreased significantly in the lexA- /umuDpR transformant. These results confirmed that the UmuDpR protein is a repressor of Ps. aeruginosa SOS genes controlled by LexA. Electrophoretic mobility shift assays, however, did not show binding of UmuDpR to 5' regions of SOS genes, suggesting an indirect mechanism of regulation.

  18. Health Promotion

    DEFF Research Database (Denmark)

    Povlsen, Lene; Borup, I.

    2015-01-01

    and Adolescent Health Promotion', Salutogenesis - from theory to practice' and Health, Stress and Coping'. More than half of all doctoral theses undertaken at NHV during these years had health promotion as their theme. As a derivative, the Nordic Health Promotion Research Network (NHPRN) was established in 2007......In 1953 when the Nordic School of Public Health was founded, the aim of public health programmes was disease prevention more than health promotion. This was not unusual, since at this time health usually was seen as the opposite of disease and illness. However, with the Ottawa Charter of 1986......, the World Health Organization made a crucial change to view health not as a goal in itself but as the means to a full life. In this way, health promotion became a first priority and fundamental action for the modern society. This insight eventually reached NHV and in 2002 - 50 years after the foundation...

  19. Molecular cloning, sequence characterization and expression analysis of a CD63 homologue from the coleopteran beetle, Tenebrio molitor.

    Science.gov (United States)

    Patnaik, Bharat Bhusan; Kang, Seong Min; Seo, Gi Won; Lee, Hyo Jeong; Patnaik, Hongray Howrelia; Jo, Yong Hun; Tindwa, Hamisi; Lee, Yong Seok; Lee, Bok Luel; Kim, Nam Jung; Bang, In Seok; Han, Yeon Soo

    2013-10-15

    CD63, a member of the tetraspanin membrane protein family, plays a pivotal role in cell growth, motility, signal transduction, host-pathogen interactions and cancer. In this work, the cDNA encoding CD63 homologue (TmCD63) was cloned from larvae of a coleopteran beetle, Tenebrio molitor. The cDNA is comprised of an open reading frame of 705 bp, encoding putative protein of 235 amino acid residues. In silico analysis shows that the protein has four putative transmembrane domains and one large extracellular loop. The characteristic "Cys-Cys-Gly" motif and "Cys188" residues are highly conserved in the large extracellular loop. Phylogenetic analysis of TmCD63 revealed that they belong to the insect cluster with 50%-56% identity. Analysis of spatial expression patterns demonstrated that TmCD63 mRNA is mainly expressed in gut and Malphigian tubules of larvae and the testis of the adult. Developmental expression patterns of CD63 mRNA showed that TmCD63 transcripts are detected in late larval, pupal and adult stages. Interestingly, TmCD63 transcripts are upregulated to the maximum level of 4.5 fold, in response to DAP-type peptidoglycan during the first 6 h, although other immune elicitors also caused significant increase to the transcript level at later time-points. These results suggest that CD63 might contribute to T. molitor immune response against various microbial pathogens.

  20. Molecular Cloning, Sequence Characterization and Expression Analysis of a CD63 Homologue from the Coleopteran Beetle, Tenebrio molitor

    Directory of Open Access Journals (Sweden)

    Yeon Soo Han

    2013-10-01

    Full Text Available CD63, a member of the tetraspanin membrane protein family, plays a pivotal role in cell growth, motility, signal transduction, host-pathogen interactions and cancer. In this work, the cDNA encoding CD63 homologue (TmCD63 was cloned from larvae of a coleopteran beetle, Tenebrio molitor. The cDNA is comprised of an open reading frame of 705 bp, encoding putative protein of 235 amino acid residues. In silico analysis shows that the protein has four putative transmembrane domains and one large extracellular loop. The characteristic “Cys-Cys-Gly” motif and “Cys188” residues are highly conserved in the large extracellular loop. Phylogenetic analysis of TmCD63 revealed that they belong to the insect cluster with 50%–56% identity. Analysis of spatial expression patterns demonstrated that TmCD63 mRNA is mainly expressed in gut and Malphigian tubules of larvae and the testis of the adult. Developmental expression patterns of CD63 mRNA showed that TmCD63 transcripts are detected in late larval, pupal and adult stages. Interestingly, TmCD63 transcripts are upregulated to the maximum level of 4.5 fold, in response to DAP-type peptidoglycan during the first 6 h, although other immune elicitors also caused significant increase to the transcript level at later time-points. These results suggest that CD63 might contribute to T. molitor immune response against various microbial pathogens.

  1. Molecular Cloning, Sequence Characterization and Expression Analysis of a CD63 Homologue from the Coleopteran Beetle, Tenebrio molitor

    Science.gov (United States)

    Patnaik, Bharat Bhusan; Kang, Seong Min; Seo, Gi Won; Lee, Hyo Jeong; Patnaik, Hongray Howrelia; Jo, Yong Hun; Tindwa, Hamisi; Lee, Yong Seok; Lee, Bok Luel; Kim, Nam Jung; Bang, In Seok; Han, Yeon Soo

    2013-01-01

    CD63, a member of the tetraspanin membrane protein family, plays a pivotal role in cell growth, motility, signal transduction, host-pathogen interactions and cancer. In this work, the cDNA encoding CD63 homologue (TmCD63) was cloned from larvae of a coleopteran beetle, Tenebrio molitor. The cDNA is comprised of an open reading frame of 705 bp, encoding putative protein of 235 amino acid residues. In silico analysis shows that the protein has four putative transmembrane domains and one large extracellular loop. The characteristic “Cys-Cys-Gly” motif and “Cys188” residues are highly conserved in the large extracellular loop. Phylogenetic analysis of TmCD63 revealed that they belong to the insect cluster with 50%–56% identity. Analysis of spatial expression patterns demonstrated that TmCD63 mRNA is mainly expressed in gut and Malphigian tubules of larvae and the testis of the adult. Developmental expression patterns of CD63 mRNA showed that TmCD63 transcripts are detected in late larval, pupal and adult stages. Interestingly, TmCD63 transcripts are upregulated to the maximum level of 4.5 fold, in response to DAP-type peptidoglycan during the first 6 h, although other immune elicitors also caused significant increase to the transcript level at later time-points. These results suggest that CD63 might contribute to T. molitor immune response against various microbial pathogens. PMID:24132157

  2. Determination of vitamin K homologues by high-performance liquid chromatography with on-line photoreactor and peroxyoxalate chemiluminescence detection

    International Nuclear Information System (INIS)

    Ahmed, Sameh; Kishikawa, Naoya; Nakashima, Kenichiro; Kuroda, Naotaka

    2007-01-01

    A sensitive and highly selective high-performance liquid chromatography (HPLC) method was developed for the determination of vitamin K homologues including phylloquinone (PK), menaquinone-4 (MK-4) and menaquinone-7 (MK-7) in human plasma using post-column peroxyoxalate chemiluminescence (PO-CL) detection following on-line ultraviolet (UV) irradiation. The method was based on ultraviolet irradiation (254 nm, 15 W) of vitamin K to produce hydrogen peroxide and a fluorescent product at the same time, which can be determined with PO-CL detection. The separation of vitamin K by HPLC was accomplished isocratically on an ODS column within 35 min. The method involves the use of 2-methyl-3-pentadecyl-1,4-naphthoquinone as an internal standard. The detection limits (signal-to-noise ratio = 3) were 32, 38 and 85 fmol for PK, MK-4 and MK-7, respectively. The recoveries of PK, MK-4 and MK-7 were greater than 82% and the inter- and intra-assay R.S.D. values were 1.9-5.4%. The sensitivity and selectivity of this method were sufficient for clinical and nutritional applications

  3. Detection and Characterization of Homologues of Human Hepatitis Viruses and Pegiviruses in Rodents and Bats in Vietnam.

    Science.gov (United States)

    Van Nguyen, Dung; Van Nguyen, Cuong; Bonsall, David; Ngo, Tue Tri; Carrique-Mas, Juan; Pham, Anh Hong; Bryant, Juliet E; Thwaites, Guy; Baker, Stephen; Woolhouse, Mark; Simmonds, Peter

    2018-02-28

    Rodents and bats are now widely recognised as important sources of zoonotic virus infections in other mammals, including humans. Numerous surveys have expanded our knowledge of diverse viruses in a range of rodent and bat species, including their origins, evolution, and range of hosts. In this study of pegivirus and human hepatitis-related viruses, liver and serum samples from Vietnamese rodents and bats were examined by PCR and sequencing. Nucleic acids homologous to human hepatitis B, C, E viruses were detected in liver samples of 2 (1.3%) of 157 bats, 38 (8.1%), and 14 (3%) of 470 rodents, respectively. Hepacivirus-like viruses were frequently detected (42.7%) in the bamboo rat, Rhizomys pruinosus , while pegivirus RNA was only evident in 2 (0.3%) of 638 rodent serum samples. Complete or near-complete genome sequences of HBV, HEV and pegivirus homologues closely resembled those previously reported from rodents and bats. However, complete coding region sequences of the rodent hepacivirus-like viruses substantially diverged from all of the currently classified variants and potentially represent a new species in the Hepacivirus genus. Of the viruses identified, their routes of transmission and potential to establish zoonoses remain to be determined.

  4. Functional analysis of three type-2 DGAT homologue genes for triacylglycerol production in the green microalga Chlamydomonas reinhardtii.

    Science.gov (United States)

    La Russa, M; Bogen, C; Uhmeyer, A; Doebbe, A; Filippone, E; Kruse, O; Mussgnug, J H

    2012-11-30

    Photosynthetic organisms like plants and algae can use sunlight to produce lipids as important metabolic compounds. Plant-derived triacylglycerols (TAGs) are valuable for human and animal nutrition because of their high energy content and are becoming increasingly important for the production of renewable biofuels. Acyl-CoA:diacylglycerol acyltransferases (DGATs) have been demonstrated to play an important role in the accumulation of TAG compounds in higher plants. DGAT homologue genes have been identified in the genome of the green alga Chlamydomonas reinhardtii, however their function in vivo is still unknown. In this work, the three most promising type-2 DGAT candidate genes potentially involved in TAG lipid accumulation (CrDGAT2a, b and c) were investigated by constructing overexpression strains. For each of the genes, three strains were identified which showed enhanced mRNA levels of between 1.7 and 29.1 times that of the wild type (wt). Total lipid contents, neutral lipids and fatty acid profiles were determined and showed that an enhanced mRNA expression level of the investigated DGAT genes did not boost the intracellular TAG accumulation or resulted in alterations of the fatty acid profiles compared to wild type during standard growth condition or during nitrogen or sulfur stress conditions. We conclude that biotechnological efforts to enhance cellular TAG amount in microalgae need further insights into the complex network of lipid biosynthesis to identify potential bottlenecks of neutral lipid production. Copyright © 2012 Elsevier B.V. All rights reserved.

  5. PP-O and PP-V, Monascus pigment homologues, production, and phylogenetic analysis in Penicillium purpurogenum.

    Science.gov (United States)

    Arai, Teppei; Kojima, Ryo; Motegi, Yoshiki; Kato, Jun; Kasumi, Takafumi; Ogihara, Jun

    2015-12-01

    The production of pigments as secondary metabolites by microbes is known to vary by species and by physiological conditions within a single strain. The fungus strain Penicillium purpurogenum IAM15392 has been found to produce violet pigment (PP-V) and orange pigment (PP-O),Monascus azaphilone pigment homologues, when grown under specific culture conditions. In this study, we analysed PP-V and PP-O production capability in seven strains of P. purpurogenum in addition to strain IAM15392 under specific culture conditions. The pigment production pattern of five strains cultivated in PP-V production medium was similar to that of strain IAM15392, and all violet pigments produced by these five strains were confirmed to be PP-V. Strains that did not produce pigment were also identified. In addition, two strains cultivated in PP-O production medium produced a violet pigment identified as PP-V. The ribosomal DNA (rDNA) internal transcribed spacer (ITS) region sequences from the eight P. purpurogenum strains were sequenced and used to construct a neighbor-joining phylogenetic tree. PP-O and PP-V production of P. purpurogenum was shown to be related to phylogenetic placement based on rDNA ITS sequence. Based on these results, two hypotheses for the alteration of pigment production of P. purpurogenum in evolution were proposed. Copyright © 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  6. Characterization of Translationally Controlled Tumour Protein from the Sea Anemone Anemonia viridis and Transcriptome Wide Identification of Cnidarian Homologues.

    Science.gov (United States)

    Nicosia, Aldo; Bennici, Carmelo; Biondo, Girolama; Costa, Salvatore; Di Natale, Marilena; Masullo, Tiziana; Monastero, Calogera; Ragusa, Maria Antonietta; Tagliavia, Marcello; Cuttitta, Angela

    2018-01-11

    Gene family encoding translationally controlled tumour protein (TCTP) is defined as highly conserved among organisms; however, there is limited knowledge of non-bilateria. In this study, the first TCTP homologue from anthozoan was characterised in the Mediterranean Sea anemone, Anemonia viridis . The release of the genome sequence of Acropora digitifera , Exaiptasia pallida , Nematostella vectensis and Hydra vulgaris enabled a comprehensive study of the molecular evolution of TCTP family among cnidarians. A comparison among TCTP members from Cnidaria and Bilateria showed conserved intron exon organization, evolutionary conserved TCTP signatures and 3D protein structure. The pattern of mRNA expression profile was also defined in A. viridis . These analyses revealed a constitutive mRNA expression especially in tissues with active proliferation. Additionally, the transcriptional profile of A. viridis TCTP ( AvTCTP ) after challenges with different abiotic/biotic stresses showed induction by extreme temperatures, heavy metals exposure and immune stimulation. These results suggest the involvement of AvTCTP in the sea anemone defensome taking part in environmental stress and immune responses.

  7. Characterization of Translationally Controlled Tumour Protein from the Sea Anemone Anemonia viridis and Transcriptome Wide Identification of Cnidarian Homologues

    Directory of Open Access Journals (Sweden)

    Aldo Nicosia

    2018-01-01

    Full Text Available Gene family encoding translationally controlled tumour protein (TCTP is defined as highly conserved among organisms; however, there is limited knowledge of non-bilateria. In this study, the first TCTP homologue from anthozoan was characterised in the Mediterranean Sea anemone, Anemonia viridis. The release of the genome sequence of Acropora digitifera, Exaiptasia pallida, Nematostella vectensis and Hydra vulgaris enabled a comprehensive study of the molecular evolution of TCTP family among cnidarians. A comparison among TCTP members from Cnidaria and Bilateria showed conserved intron exon organization, evolutionary conserved TCTP signatures and 3D protein structure. The pattern of mRNA expression profile was also defined in A. viridis. These analyses revealed a constitutive mRNA expression especially in tissues with active proliferation. Additionally, the transcriptional profile of A. viridis TCTP (AvTCTP after challenges with different abiotic/biotic stresses showed induction by extreme temperatures, heavy metals exposure and immune stimulation. These results suggest the involvement of AvTCTP in the sea anemone defensome taking part in environmental stress and immune responses.

  8. Immune responses of B. malayi thioredoxin (TRX) and venom allergen homologue (VAH) chimeric multiple antigen for lymphatic filariasis.

    Science.gov (United States)

    Anugraha, Gandhirajan; Jeyaprita, Parasurama Jawaharlal; Madhumathi, Jayaprakasam; Sheeba, Tamilvanan; Kaliraj, Perumal

    2013-12-01

    Although multiple vaccine strategy for lymphatic filariasis has provided tremendous hope, the choice of antigens used in combination has determined its success in the previous studies. Multiple antigens comprising key vaccine candidates from different life cycle stages would provide a promising strategy if the antigenic combination is chosen by careful screening. In order to analyze one such combination, we have used a chimeric construct carrying the well studied B. malayi antigens thioredoxin (BmTRX) and venom allergen homologue (BmVAH) as a fusion protein (TV) and evaluated its immune responses in mice model. The efficacy of fusion protein vaccine was explored in comparison with the single antigen vaccines and their cocktail. In mice, TV induced significantly high antibody titer of 1,28,000 compared to cocktail vaccine TRX+VAH (50,000) and single antigen vaccine TRX (16,000) or VAH (50,000). Furthermore, TV elicited higher level of cellular proliferative response together with elevated levels of IFN-γ, IL-4 and IL-5 indicating a Th1/Th2 balanced response. The isotype antibody profile showed significantly high level of IgG1 and IgG2b confirming the balanced response elicited by TV. Immunization with TV antigen induced high levels of both humoral and cellular immune responses compared to either cocktail or antigen given alone. The result suggests that TV is highly immunogenic in mice and hence the combination needs to be evaluated for its prophylactic potential.

  9. Mouse homologue of yeast Prp19 interacts with mouse SUG1, the regulatory subunit of 26S proteasome

    International Nuclear Information System (INIS)

    Sihn, Choong-Ryoul; Cho, Si Young; Lee, Jeong Ho; Lee, Tae Ryong; Kim, Sang Hoon

    2007-01-01

    Yeast Prp19 has been shown to involve in pre-mRNA splicing and DNA repair as well as being an ubiquitin ligase. Mammalian homologue of yeast Prp19 also plays on similar functional activities in cells. In the present study, we isolated mouse SUG1 (mSUG1) as binding partner of mouse Prp19 (mPrp19) by the yeast two-hybrid system. We confirmed the interaction of mPrp9 with mSUG1 by GST pull-down assay and co-immunoprecipitation assay. The N-terminus of mPrp19 including U-box domain was associated with the C-terminus of mSUG1. Although, mSUG1 is a regulatory subunit of 26S proteasome, mPrp19 was not degraded in the proteasome-dependent pathway. Interestingly, GFP-mPrp19 fusion protein was co-localized with mSUG1 protein in cytoplasm as the formation of the speckle-like structures in the presence of a proteasome inhibitor MG132. In addition, the activity of proteasome was increased in cells transfected with mPrp19. Taken together, these results suggest that mPrp19 involves the regulation of protein turnover and may transport its substrates to 26S proteasome through mSUG1 protein

  10. Cloning, purification, crystallization and preliminary crystallographic analysis of a penicillin-binding protein homologue from Pyrococcus abyssi

    International Nuclear Information System (INIS)

    Delfosse, Vanessa; Hugonnet, Jean-Emmanuel; Sougakoff, Wladimir; Mayer, Claudine

    2005-01-01

    The crystallization of a hypothetical penicillin-binding protein from the archaeon P. abyssi in space group C2 by hanging-drop vapour diffusion is reported. The genome of the hyperthermophilic archaeon Pyrococcus abyssi contains a gene (pab0087) encoding a penicillin-binding protein (PBP) homologue. This sequence consists of 447 residues and shows significant sequence similarity to low-molecular-weight PBPs and class C β-lactamases. The Pab0087 protein was overexpressed, purified and crystallized. Diffraction data from two different crystal forms were collected to 2.7 and 2.0 Å resolution. Both crystals belong to space group C2, with unit-cell parameters a = 160.59, b = 135.74, c = 113.02 Å, β = 117.36° and a = 166.97, b = 131.25, c = 189.39 Å, β = 113.81°, respectively. The asymmetric unit contains four and eight molecules, respectively, with fourfold non-crystallographic symmetry

  11. Molecular cloning and expression of the human homologue of the murine gene encoding myeloid leukemia-inhibitory factor

    International Nuclear Information System (INIS)

    Gough, N.M.; Gearing, D.P.; King, J.A.; Willson, T.A.; Hilton, D.J.; Nicola, N.A.; Metcalf, D.

    1988-01-01

    A human homologue of the recently cloned murine leukemia-inhibitory factor (LIF) gene was isolated from a genomic library by using the marine cDNA as a hybridization probe. The nucleotide sequence of the human gene indicated that human LIF has 78% amino acid sequence identity with murine LIF, with no insertions or deletions, and that the region of the human gene encoding the mature protein has one intervening sequence. After oligonucleotide-mediated mutagenesis, the mature protein-coding region of the LIF gene was introduced into the yeast expression vector YEpsec1. Yeast cells transformed with the resulting recombinant could be induced with galactose to produce high levels of a factor that induced the differentiation of murine M1 leukemic cells in a manner analogous to murine LIF. This factor competed with 125 I-labeled native murine LIF for binding to specific cellular receptors on murine cells, compatible with a high degree of structural similarity between the murine and human factors

  12. Enhancer of rudimentary homologue interacts with scaffold attachment factor B at the nuclear matrix to regulate SR protein phosphorylation.

    Science.gov (United States)

    Drakouli, Sotiria; Lyberopoulou, Aggeliki; Papathanassiou, Maria; Mylonis, Ilias; Georgatsou, Eleni

    2017-08-01

    Scaffold attachment factor B1 (SAFB1) is an integral component of the nuclear matrix of vertebrate cells. It binds to DNA on scaffold/matrix attachment region elements, as well as to RNA and a multitude of different proteins, affecting basic cellular activities such as transcription, splicing and DNA damage repair. In the present study, we show that enhancer of rudimentary homologue (ERH) is a new molecular partner of SAFB1 and its 70% homologous paralogue, scaffold attachment factor B2 (SAFB2). ERH interacts directly in the nucleus with the C-terminal Arg-Gly-rich region of SAFB1/2 and co-localizes with it in the insoluble nuclear fraction. ERH, a small ubiquitous protein with striking homology among species and a unique structure, has also been implicated in fundamental cellular mechanisms. Our functional analyses suggest that the SAFB/ERH interaction does not affect SAFB1/2 function in transcription (e.g. as oestrogen receptor α co-repressors), although it reverses the inhibition exerted by SAFB1/2 on the splicing kinase SR protein kinase 1 (SRPK1), which also binds on the C-terminus of SAFB1/2. Accordingly, ERH silencing decreases lamin B receptor and SR protein phosphorylation, which are major SRPK1 substrates, further substantiating the role of SAFB1 and SAFB2 in the co-ordination of nuclear function. © 2017 Federation of European Biochemical Societies.

  13. Anion exchange behaviour of Zr, Hf, Nb, Ta and Pa as homologues of RF and Db in fluoride medium

    Energy Technology Data Exchange (ETDEWEB)

    Monroy G, F. [ININ, Carretera Mexico-Toluca s/n, 52750 Ocoyoacac, Estado de Mexico (Mexico); Trubert, D.; Brillard, L.; Hussonnois, M.; Constantinescu, O.; Le Naour, C., E-mail: fabiola.monroy@inin.gob.m [Institut de Physique Nucleaire, F-91406 Orsay, France (France)

    2010-07-01

    Studies of the chemical property of trans actinide elements are very difficult due to their short half-lives and extremely small production yields. However it is still possible to obtain considerable information about their chemical properties, such as the most stable oxidation states in aqueous solution, complexing ability, etc., comparing their behaviour with their lighter homologous in the periodic table. In order to obtain a better knowledge of the behaviour of rutherfordium, RF (element 104), dub nium, Db (element 105) in HF medium, the sorption properties of Zr, Hf, Nb, Ta an Pa, homologues of RF and Db, were studied in NH{sub 4}F/HClO{sub 4} medium in this work. Stability constants of the fluoride complexes of these elements were experimentally obtained from K{sub d} obtained at different F{sup -} and H{sup +} concentrations. The anionic complexes: [Zr(Hf)F{sub 5}]{sup -}, [Zr(Hf)F{sub 6}]{sup 2-}, [Zr(Hf)F{sub 7}]{sup 3-}, [Ta(Pa)F{sub 6}]{sup -}, [Ta(Pa)F{sub 7}]{sup 2-}, [Ta(Pa)F{sub 8}]{sup 3-}, [NbOF{sub 4}]{sup -} and [NbOF{sub 5}]{sup 2-} are present as predominant species in the HF range over investigation. (Author)

  14. Temperature-sensitive defects of the GSP1gene, yeast Ran homologue, activate the Tel1-dependent pathway

    International Nuclear Information System (INIS)

    Hayashi, Naoyuki; Murakami, Seishi; Tsurusaki, Susumu; Nagaura, Zen-ichiro; Oki, Masaya; Nishitani, Hideo; Kobayashi, Masahiko; Shimizu, Hiroko; Yamamoto, Ken-ichi; Nishimoto, Takeharu

    2007-01-01

    RanGTPase is involved in many cellular processes. It functions in nuclear-cytosolic transport and centrosome formation. Ran also localizes to chromatin as RCC1 does, its guanine nucleotide exchange factor, but Ran's function on chromatin is not known. We found that gsp1, a temperature-sensitive mutant of GSP1, a Saccharomyces cerevisiae Ran homologue, suppressed the hydroxyurea (HU) and ultra violet (UV) sensitivities of the mec1 mutant. In UV-irradiated mec1 gsp1 cells, Rad53 was phosphorylated despite the lack of Mec1. This suppression depended on the TEL1 gene, given that the triple mutant, mec1 gsp1 tel1, was unable to grow. The gsp1 mutations also suppressed the HU sensitivity of the rad9 mutant in a Tel1-dependent manner, but not the HU sensitivity of the rad53 mutant. These results indicated that Rad53 was activated by the Tel1 pathway in mec1 gsp1 cells, suggesting that Gsp1 helps regulate the role switching the ATM family kinases Mec1 and Tel1

  15. Anion exchange behaviour of Zr, Hf, Nb, Ta and Pa as homologues of RF and Db in fluoride medium

    International Nuclear Information System (INIS)

    Monroy G, F.; Trubert, D.; Brillard, L.; Hussonnois, M.; Constantinescu, O.; Le Naour, C.

    2010-01-01

    Studies of the chemical property of trans actinide elements are very difficult due to their short half-lives and extremely small production yields. However it is still possible to obtain considerable information about their chemical properties, such as the most stable oxidation states in aqueous solution, complexing ability, etc., comparing their behaviour with their lighter homologous in the periodic table. In order to obtain a better knowledge of the behaviour of rutherfordium, RF (element 104), dub nium, Db (element 105) in HF medium, the sorption properties of Zr, Hf, Nb, Ta an Pa, homologues of RF and Db, were studied in NH 4 F/HClO 4 medium in this work. Stability constants of the fluoride complexes of these elements were experimentally obtained from K d obtained at different F - and H + concentrations. The anionic complexes: [Zr(Hf)F 5 ] - , [Zr(Hf)F 6 ] 2- , [Zr(Hf)F 7 ] 3- , [Ta(Pa)F 6 ] - , [Ta(Pa)F 7 ] 2- , [Ta(Pa)F 8 ] 3- , [NbOF 4 ] - and [NbOF 5 ] 2- are present as predominant species in the HF range over investigation. (Author)

  16. Aplasia Ras homologue member Ⅰ overexpression inhibits tumor growth and induces apoptosis through inhibition of PI3K/Akt survival pathways in human osteosarcoma MG-63 cells in culture.

    Science.gov (United States)

    Ye, Kaishan; Wang, Shuanke; Yang, Yong; Kang, Xuewen; Wang, Jing; Han, Hua

    2015-09-01

    Aplasia Ras homologue member Ⅰ (ARHI), an imprinted tumor-suppressor gene, is downregulated in various types of cancer. However, the expression, function and specific mechanisms of ARHI in human osteosarcoma (OS) cells remain unclear. The aim of the present study was to assess the effect of ARHI on OS cell proliferation and apoptosis and its associated mechanism. In the study, ARHI mRNA and protein levels were markedly downregulated in OS cells compared with the human osteoblast precursor cell line hFOB1.19. By generating stable transfectants, ARHI was overexpressed in OS cells that had low levels of ARHI. Overexpression of ARHI inhibited cell viability and proliferation and induced apoptosis. However, caspase‑3 activity was not changed by ARHI overexpression. In addition, phosphorylated Akt protein expression decreased in the ARHI overexpression group compared to that in the control vector group. The knockdown of ARHI also resulted in the promotion of cell proliferation and the attenuation of apoptosis in MG‑63 cells. Additionally, ARHI silencing increased the level of p‑Akt. The present results indicate that ARHI inhibits OS cell proliferation and may have a key role in the development of OS.

  17. Characterization of the cDNA encoding a BPI/LBP homologue in venom gland of the hundred-pace snake Deinagkistrodon acutus

    Directory of Open Access Journals (Sweden)

    Jianrao HU, Mingfu CAO, Jiong Chen

    2009-10-01

    Full Text Available Bactericidal/permeability-increasing protein (BPI and LPS-binding protein (LBP play an important role in host defence. Current evidence shows that BPI/LBP may be widely existed in different cells and tissue types of animals. A full-length cDNA clone encoding a BPI/LBP homologue (dBPI, 1757bp in size, was characterized in venom gland of the hundred-pace snake Deinagkistrodon acutus. Its deduced amino acid sequence of 417 residues had 13.8%–21.5% identity to BPI like 1(BPIL1 and BPI like 3(BPIL3 of other animals. Conserved cysteine residues which are involved in disulfide bond formation between the final strand of the N-terminal beta sheet and the long alpha helix of BPI are identified as Cys146-Cys183 of dBPI. Phylogenetic tree analysis showed that the BPI/LBP homologues formed five large clusters and dBPI was in a large cluster including BPIL1 and BPIL3. dBPI mRNA shows a tissue specific expression in venom gland. This is the first study to identify the cDNA encoding BPI/LBP homologues from reptiles [Current Zoology 55 (5: –2009].

  18. Genetic analysis of the spindle checkpoint genes san-1, mdf-2, bub-3 and the CENP-F homologues hcp-1 and hcp-2 in Caenorhabditis elegans

    Directory of Open Access Journals (Sweden)

    Moore Landon L

    2008-02-01

    Full Text Available Abstract Background The spindle checkpoint delays the onset of anaphase until all sister chromatids are aligned properly at the metaphase plate. To investigate the role san-1, the MAD3 homologue, has in Caenorhabditis elegans embryos we used RNA interference (RNAi to identify genes synthetic lethal with the viable san-1(ok1580 deletion mutant. Results The san-1(ok1580 animal has low penetrating phenotypes including an increased incidence of males, larvae arrest, slow growth, protruding vulva, and defects in vulva morphogenesis. We found that the viability of san-1(ok1580 embryos is significantly reduced when HCP-1 (CENP-F homologue, MDF-1 (MAD-1 homologue, MDF-2 (MAD-2 homologue or BUB-3 (predicted BUB-3 homologue are reduced by RNAi. Interestingly, the viability of san-1(ok1580 embryos is not significantly reduced when the paralog of HCP-1, HCP-2, is reduced. The phenotype of san-1(ok1580;hcp-1(RNAi embryos includes embryonic and larval lethality, abnormal organ development, and an increase in abnormal chromosome segregation (aberrant mitotic nuclei, anaphase bridging. Several of the san-1(ok1580;hcp-1(RNAi animals displayed abnormal kinetochore (detected by MPM-2 and microtubule structure. The survival of mdf-2(RNAi;hcp-1(RNAi embryos but not bub-3(RNAi;hcp-1(RNAi embryos was also compromised. Finally, we found that san-1(ok1580 and bub-3(RNAi, but not hcp-1(RNAi embryos, were sensitive to anoxia, suggesting that like SAN-1, BUB-3 has a functional role as a spindle checkpoint protein. Conclusion Together, these data suggest that in the C. elegans embryo, HCP-1 interacts with a subset of the spindle checkpoint pathway. Furthermore, the fact that san-1(ok1580;hcp-1(RNAi animals had a severe viability defect whereas in the san-1(ok1580;hcp-2(RNAi and san-1(ok1580;hcp-2(ok1757 animals the viability defect was not as severe suggesting that hcp-1 and hcp-2 are not completely redundant.

  19. Cloning, sequencing, disruption and phenotypic analysis of uvsC, an Aspergillus nidulans homologue of yeast RAD51.

    Science.gov (United States)

    van Heemst, D; Swart, K; Holub, E F; van Dijk, R; Offenberg, H H; Goosen, T; van den Broek, H W; Heyting, C

    1997-05-01

    We have cloned the uvsC gene of Aspergillus nidulans by complementation of the A. nidulans uvsC114 mutant. The predicted protein UVSC shows 67.4% sequence identity to the Saccharomyces cerevisiae Rad51 protein and 27.4% sequence identity to the Escherichia coli RecA protein. Transcription of uvsC is induced by methyl-methane sulphonate (MMS), as is transcription of RAD51 of yeast. Similar levels of uvsC transcription were observed after MMS induction in a uvsC+ strain and the uvsC114 mutant. The coding sequence of the uvsC114 allele has a deletion of 6 bp, which results in deletion of two amino acids and replacement of one amino acid in the translation product. In order to gain more insight into the biological function of the uvsC gene, a uvsC null mutant was constructed, in which the entire uvsC coding sequence was replaced by a selectable marker gene. Meiotic and mitotic phenotypes of a uvsC+ strain, the uvsC114 mutant and the uvsC null mutant were compared. The uvsC null mutant was more sensitive to both UV and MMS than the uvsC114 mutant. The uvsC114 mutant arrested in meiotic prophase-I. The uvsC null mutant arrested at an earlier stage, before the onset of meiosis. One possible interpretation of these meiotic phenotypes is that the A. nidulans homologue of Rad51 of yeast has a role both in the specialized processes preceding meiosis and in meiotic prophase I.

  20. The Neurospora crassa UVS-3 epistasis group encodes homologues of the ATR/ATRIP checkpoint control system.

    Science.gov (United States)

    Kazama, Yusuke; Ishii, Chizu; Schroeder, Alice L; Shimada, Hisao; Wakabayashi, Michiyoshi; Inoue, Hirokazu

    2008-02-01

    The mutagen sensitive uvs-3 and mus-9 mutants of Neurospora show mutagen and hydroxyurea sensitivity, mutator effects and duplication instability typical of recombination repair and DNA damage checkpoint defective mutants. To determine the nature of these genes we used cosmids from a genomic library to clone the uvs-3 gene by complementation for MMS sensitivity. Mutation induction by transposon insertion and RIP defined the coding sequence. RFLP analysis confirmed that this sequence maps in the area of uvs-3 at the left telomere of LG IV. Analysis of the cDNA showed that the UVS-3 protein contains an ORF of 969 amino acids with one intron. It is homologous to UvsD of Aspergillus nidulans, a member of the ATRIP family of checkpoint proteins. It retains the N' terminal coiled-coil motif followed by four basic amino acids typical of these proteins and shows the highest homology in this region. The uvsD cDNA partially complements the defects of the uvs-3 mutation. The uvs-3 mutant shows a higher level of micronuclei in conidia and failure to halt germination and nuclear division in the presence of hydroxyurea than wild type, suggesting checkpoint defects. ATRIP proteins bind tightly to ATR PI-3 kinase (phosphatidylinositol 3-kinase) proteins. Therefore, we searched the Neurospora genome sequence for homologues of the Aspergillus nidulans ATR, UvsB. A uvsB homologous sequence was present in the right arm of chromosome I where the mus-9 gene maps. A cosmid containing this genomic DNA complemented the mus-9 mutation. The putative MUS-9 protein is 2484 amino acids long with eight introns. Homology is especially high in the C-terminal 350 amino acids that correspond to the PI-3 kinase domain. In wild type a low level of constitutive mRNA is present for both genes. It is transiently induced upon UV exposure.

  1. The SPF27 homologue Num1 connects splicing and kinesin 1-dependent cytoplasmic trafficking in Ustilago maydis.

    Directory of Open Access Journals (Sweden)

    Nikola Kellner

    2014-01-01

    Full Text Available The conserved NineTeen protein complex (NTC is an integral subunit of the spliceosome and required for intron removal during pre-mRNA splicing. The complex associates with the spliceosome and participates in the regulation of conformational changes of core spliceosomal components, stabilizing RNA-RNA- as well as RNA-protein interactions. In addition, the NTC is involved in cell cycle checkpoint control, response to DNA damage, as well as formation and export of mRNP-particles. We have identified the Num1 protein as the homologue of SPF27, one of NTC core components, in the basidiomycetous fungus Ustilago maydis. Num1 is required for polarized growth of the fungal hyphae, and, in line with the described NTC functions, the num1 mutation affects the cell cycle and cell division. The num1 deletion influences splicing in U. maydis on a global scale, as RNA-Seq analysis revealed increased intron retention rates. Surprisingly, we identified in a screen for Num1 interacting proteins not only NTC core components as Prp19 and Cef1, but several proteins with putative functions during vesicle-mediated transport processes. Among others, Num1 interacts with the motor protein Kin1 in the cytoplasm. Similar phenotypes with respect to filamentous and polar growth, vacuolar morphology, as well as the motility of early endosomes corroborate the genetic interaction between Num1 and Kin1. Our data implicate a previously unidentified connection between a component of the splicing machinery and cytoplasmic transport processes. As the num1 deletion also affects cytoplasmic mRNA transport, the protein may constitute a novel functional interconnection between the two disparate processes of splicing and trafficking.

  2. Enhancer of zeste homologue 2 plays an important role in neuroblastoma cell survival independent of its histone methyltransferase activity.

    Science.gov (United States)

    Bate-Eya, Laurel T; Gierman, Hinco J; Ebus, Marli E; Koster, Jan; Caron, Huib N; Versteeg, Rogier; Dolman, M Emmy M; Molenaar, Jan J

    2017-04-01

    Neuroblastoma is predominantly characterised by chromosomal rearrangements. Next to V-Myc Avian Myelocytomatosis Viral Oncogene Neuroblastoma Derived Homolog (MYCN) amplification, chromosome 7 and 17q gains are frequently observed. We identified a neuroblastoma patient with a regional 7q36 gain, encompassing the enhancer of zeste homologue 2 (EZH2) gene. EZH2 is the histone methyltransferase of lysine 27 of histone H3 (H3K27me3) that forms the catalytic subunit of the polycomb repressive complex 2. H3K27me3 is commonly associated with the silencing of genes involved in cellular processes such as cell cycle regulation, cellular differentiation and cancer. High EZH2 expression correlated with poor prognosis and overall survival independent of MYCN amplification status. Unexpectedly, treatment of 3 EZH2-high expressing neuroblastoma cell lines (IMR32, CHP134 and NMB), with EZH2-specific inhibitors (GSK126 and EPZ6438) resulted in only a slight G1 arrest, despite maximum histone methyltransferase activity inhibition. Furthermore, colony formation in cell lines treated with the inhibitors was reduced only at concentrations much higher than necessary for complete inhibition of EZH2 histone methyltransferase activity. Knockdown of the complete protein with three independent shRNAs resulted in a strong apoptotic response and decreased cyclin D1 levels. This apoptotic response could be rescued by overexpressing EZH2ΔSET, a truncated form of wild-type EZH2 lacking the SET transactivation domain necessary for histone methyltransferase activity. Our findings suggest that high EZH2 expression, at least in neuroblastoma, has a survival function independent of its methyltransferase activity. This important finding highlights the need for studies on EZH2 beyond its methyltransferase function and the requirement for compounds that will target EZH2 as a complete protein. Copyright © 2017 Elsevier Ltd. All rights reserved.

  3. Cloning and Characterization of the Genes Encoding the Murine Homologues of the Human Melanoma Antigens MART1 and gp100

    Science.gov (United States)

    Zhai, Yifan; Yang, James C.; Spiess, Paul; Nishimura, Michael I.; Overwijk, Willem W.; Roberts, Bruce; Restifo, Nicholas P.; Rosenberg, Steven A.

    2008-01-01

    The recent identification of genes encoding melanoma-associated antigens has opened new possibilities for the development of cancer vaccines designed to cause the rejection of established tumors. To develop a syngeneic animal model for evaluating antigen-specific vaccines in cancer therapy, the murine homologues of the human melanoma antigens MART1 and gp 100, which were specifically recognized by tumor-infiltrating lymphocytes from patients with melanoma, were cloned and sequenced from a murine B16 melanoma cDNA library. The open reading frames of murine MART1 and gp 100 encode proteins of 113- and 626-amino acids with 68.8 and 77% identity to the respective human proteins. Comparison of the DNA sequences of the murine MART1 genes, derived from normal melanocytes, the immortalized nontumorgenic melanocyte line Melan-a and the B16 melanoma, showed all to be identical. Northern and Western blot analyses confirmed that both genes encoded products that were melanocyte lineage proteins. Mice immunized with murine MART1 or gp 100 using recombinant vaccinia virus failed to produce any detectable T-cell responses or protective immunity against B16 melanoma. In contrast, immunization of mice with human gp 100 using recombinant adenoviruses elicited T cells specific for hgp100, but these T cells also cross reacted with B16 tumor in vitro and induced significant but weak protection against B16 challenge. Immunization with human and mouse gp100 together [adenovirus type 2 (Ad2)-hep100 plus recombinant vaccinia virus (rVV)-mgp100], or immunization with human gp100 (Ad2-hgp100) and boosting with heterologous vector (rVV-hgp100 or rVV-mgp100) or homologous vector (Ad2-hgp100), did not significantly enhance the protective response against B16 melanoma. These results may suggest that immunization with heterologous tumor antigen, rather than self, may be more effective as an immunotherapeutic reagent in designing antigen-specific cancer vaccines. PMID:9101410

  4. A spinach O-acetylserine(thiollyase homologue, SoCSaseLP, suppresses cysteine biosynthesis catalysed by other enzyme isoforms

    Directory of Open Access Journals (Sweden)

    Miki Noda

    2016-06-01

    Full Text Available An enzyme, O-acetylserine(thiollyase (OASTL, also known as O-acetylserine sulfhydrylase or cysteine synthase (CSase, catalyses the incorporation of sulfide into O-acetylserine and produces cysteine. We previously identified a cDNA encoding an OASTL-like protein from Spinacia oleracea, (SoCSaseLP, but a recombinant SoCSaseLP produced in Escherichia coli did not show OASTL activity. The exon-intron structure of the SoCSaseLP gene shared conserved structures with other spinach OASTL genes. The SoCSaseLP and a Beta vulgaris homologue protein, KMT13462, comprise a unique clade in the phylogenetic tree of the OASTL family. Interestingly, when the SoCSaseLP gene was expressed in tobacco plants, total OASTL activity in tobacco leaves was reduced. This reduction in total OASTL activity was most likely caused by interference by SoCSaseLP with cytosolic OASTL. To investigate the possible interaction of SoCSaseLP with a spinach cytosolic OASTL isoform SoCSaseA, a pull-down assay was carried out. The recombinant glutathione S-transferase (GST-SoCSaseLP fusion protein was expressed in E. coli together with the histidine-tagged SoCSaseA protein, and the protein extract was subjected to glutathione affinity chromatography. The histidine-tagged SoCSaseA was co-purified with the GST-SoCSaseLP fusion protein, indicating the binding of SoCSaseLP to SoCSaseA. Consistent with this interaction, the OASTL activity of the co-purified SoCSaseA was reduced compared with the activity of SoCSaseA that was purified on its own. These results strongly suggest that SoCSaseLP negatively regulates the activity of other cytosolic OASTL family members by direct interaction.

  5. Neuronal SIRT1 (Silent Information Regulator 2 Homologue 1) Regulates Glycolysis and Mediates Resveratrol-Induced Ischemic Tolerance.

    Science.gov (United States)

    Koronowski, Kevin B; Khoury, Nathalie; Saul, Isabel; Loris, Zachary B; Cohan, Charles H; Stradecki-Cohan, Holly M; Dave, Kunjan R; Young, Juan I; Perez-Pinzon, Miguel A

    2017-11-01

    Resveratrol, at least in part via SIRT1 (silent information regulator 2 homologue 1) activation, protects against cerebral ischemia when administered 2 days before injury. However, it remains unclear if SIRT1 activation must occur, and in which brain cell types, for the induction of neuroprotection. We hypothesized that neuronal SIRT1 is essential for resveratrol-induced ischemic tolerance and sought to characterize the metabolic pathways regulated by neuronal Sirt1 at the cellular level in the brain. We assessed infarct size and functional outcome after transient 60 minute middle cerebral artery occlusion in control and inducible, neuronal-specific SIRT1 knockout mice. Nontargeted primary metabolomics analysis identified putative SIRT1-regulated pathways in brain. Glycolytic function was evaluated in acute brain slices from adult mice and primary neuronal-enriched cultures under ischemic penumbra-like conditions. Resveratrol-induced neuroprotection from stroke was lost in neuronal Sirt1 knockout mice. Metabolomics analysis revealed alterations in glucose metabolism on deletion of neuronal Sirt1 , accompanied by transcriptional changes in glucose metabolism machinery. Furthermore, glycolytic ATP production was impaired in acute brain slices from neuronal Sirt1 knockout mice. Conversely, resveratrol increased glycolytic rate in a SIRT1-dependent manner and under ischemic penumbra-like conditions in vitro. Our data demonstrate that resveratrol requires neuronal SIRT1 to elicit ischemic tolerance and identify a novel role for SIRT1 in the regulation of glycolytic function in brain. Identification of robust neuroprotective mechanisms that underlie ischemia tolerance and the metabolic adaptations mediated by SIRT1 in brain are crucial for the translation of therapies in cerebral ischemia and other neurological disorders. © 2017 American Heart Association, Inc.

  6. Genetic link between Cabeza, a Drosophila homologue of Fused in Sarcoma (FUS), and the EGFR signaling pathway

    Energy Technology Data Exchange (ETDEWEB)

    Shimamura, Mai; Kyotani, Akane [Department of Applied Biology, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585 (Japan); Insect Biomedical Research Center, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585 (Japan); Azuma, Yumiko [Department of Neurology, Kyoto Prefectural University of Medicine, 465 Kajii-cho,Kamigyo-ku, Kyoto 602-8566 (Japan); Yoshida, Hideki; Binh Nguyen, Thanh [Department of Applied Biology, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585 (Japan); Insect Biomedical Research Center, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585 (Japan); Mizuta, Ikuko; Yoshida, Tomokatsu; Mizuno, Toshiki [Department of Neurology, Kyoto Prefectural University of Medicine, 465 Kajii-cho,Kamigyo-ku, Kyoto 602-8566 (Japan); Nakagawa, Masanori [North Medical Center, Kyoto Prefectural University of Medicine, 465 Kajii-cho, Kamigyo-ku, Kyoto 602-8566 (Japan); Tokuda, Takahiko, E-mail: ttokuda@koto.kpu-m.ac.jp [Department of Neurology, Kyoto Prefectural University of Medicine, 465 Kajii-cho,Kamigyo-ku, Kyoto 602-8566 (Japan); Department of Molecular Pathobiology of Brain Diseases, Graduate School of Medical Science, Kyoto Prefectural University of Medicine, 465 Kajii-cho, Kamigyo-ku, Kyoto 602-8566 (Japan); Yamaguchi, Masamitsu, E-mail: myamaguc@kit.ac.jp [Department of Applied Biology, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585 (Japan); Insect Biomedical Research Center, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585 (Japan)

    2014-08-01

    Amyotrophic Lateral Sclerosis (ALS) is a fatal neurodegenerative disease that causes progressive muscular weakness. Fused in Sarcoma (FUS) that has been identified in familial ALS is an RNA binding protein that is normally localized in the nucleus. However, its function in vivo is not fully understood. Drosophila has Cabeza (Caz) as a FUS homologue and specific knockdown of Caz in the eye imaginal disc and pupal retina using a GMR-GAL4 driver was here found to induce an abnormal morphology of the adult compound eyes, a rough eye phenotype. This was partially suppressed by expression of the apoptosis inhibitor P35. Knockdown of Caz exerted no apparent effect on differentiation of photoreceptor cells. However, immunostaining with an antibody to Cut that marks cone cells revealed fusion of these and ommatidia of pupal retinae. These results indicate that Caz knockdown induces apoptosis and also inhibits differentiation of cone cells, resulting in abnormal eye morphology in adults. Mutation in EGFR pathway-related genes, such as rhomboid-1, rhomboid-3 and mirror suppressed the rough eye phenotype induced by Caz knockdown. Moreover, the rhomboid-1 mutation rescued the fusion of cone cells and ommatidia observed in Caz knockdown flies. The results suggest that Caz negatively regulates the EGFR signaling pathway required for determination of cone cell fate in Drosophila. - Highlights: • Knockdown of Cabeza induced rough eye phenotype. • Knockdown of Cabeza induced fusion of cone cells in pupal retinae. • Knockdown of Cabeza induced apoptosis in pupal retinae. • Mutation in EGFR pathway-related genes suppressed the rough eye phenotype. • Cabeza may negatively regulate the EGFR pathway.

  7. Health promotion.

    Science.gov (United States)

    Miyake, S; Lucas-Miyake, M

    1989-01-01

    This article will describe a marketing model for the development of a role for occupational therapy in the industrial market. Health promotion activities are used as a means to diversify existing revenue bases by establishing new referral sources in industry. The technique of need satisfaction -selling or marketing one's services to a customer based on needs expressed by the customer - is reviewed, and implementation of this approach is described from two settings, one in psychiatry and the other in rehabilitation.

  8. Enhancer of the rudimentary gene homologue (ERH expression pattern in sporadic human breast cancer and normal breast tissue

    Directory of Open Access Journals (Sweden)

    Knüchel Ruth

    2008-05-01

    Full Text Available Abstract Background The human gene ERH (Enhancer of the Rudimentary gene Homologue has previously been identified by in silico analysis of four million ESTs as a gene differentially expressed in breast cancer. The biological function of ERH protein has not been fully elucidated, however functions in cell cycle progression, pyrimidine metabolism a possible interaction with p21(Cip1/Waf1 via the Ciz1 zinc finger protein have been suggested. The aim of the present study was a systematic characterization of ERH expression in human breast cancer in order to evaluate possible clinical applications of this molecule. Methods The expression pattern of ERH was analyzed using multiple tissue northern blots (MTN on a panel of 16 normal human tissues and two sets of malignant/normal breast and ovarian tissue samples. ERH expression was further analyzed in breast cancer and normal breast tissues and in tumorigenic as well as non-tumorigenic breast cancer cell lines, using quantitative RT-PCR and non-radioisotopic in situ hybridization (ISH. Results Among normal human tissues, ERH expression was most abundant in testis, heart, ovary, prostate, and liver. In the two MTN sets of malignant/normal breast and ovarian tissue,ERH was clearly more abundantly expressed in all tumours than in normal tissue samples. Quantitative RT-PCR analyses showed that ERH expression was significantly more abundant in tumorigenic than in non-tumorigenic breast cancer cell lines (4.5-fold; p = 0.05, two-tailed Mann-Whitney U-test; the same trend was noted in a set of 25 primary invasive breast cancers and 16 normal breast tissue samples (2.5-fold; p = 0.1. These findings were further confirmed by non-radioisotopic ISH in human breast cancer and normal breast tissue. Conclusion ERH expression is clearly up-regulated in malignant as compared with benign breast cells both in primary human breast cancer and in cell models of breast cancer. Since similar results were obtained for ovarian

  9. Characterization of cogon grass (Imperata cylindrica) pollen extract and preliminary analysis of grass group 1, 4 and 5 homologues using monoclonal antibodies to Phleum pratense.

    Science.gov (United States)

    Kumar, L; Sridhara, S; Singh, B P; Gangal, S V

    1998-11-01

    Previous studies have established the role of Imperata cylindrica (Ic) pollen in type I allergic disorders. However, no systematic information is available on the allergen composition of Ic pollen extract. To characterize the IgE-binding proteins of Ic pollen extract and to detect the presence of grass group 1, 4 and 5 allergen homologues, if any. Pollen extract of Ic was analyzed by in vivo and in vitro procedures such as intradermal tests (ID), enzyme-linked immunosorbent assay (ELISA), ELISA-inhibition, thin-layer isoelectric focusing (TLIEF), sodium dodecylsulfate polyacrylamide gel electrophoresis (SDS-PAGE) and immunoblotting. Dot blot assay was carried out to check the presence of well-known group 1, 4, and 5 allergen homologues in Ic pollen extract. Out of 303 respiratory allergies patients skin-tested, 27 showed sensitivity to Ic pollen extract. Specific IgE levels were elevated in all 15 serum samples tested. The extract prepared for this study was found to be highly potent since it required only 400 ng of homologous proteins for 50% inhibition of binding in ELISA inhibition assays. TLIEF of Ic pollen extract showed 44 silver-stained bands (pI 3.5-7.0) while SDS-PAGE resolved it into 24 Coomassie-Brilliant-Blue-stained bands (MW 100-10 kD). Immunoblotting with individual patient sera recognized 7 major IgE-binding bands (MW 85, 62, 57, 43, 40, 28 and 16 kD) in Ic pollen extract. A panel of monoclonal antibodies, specific to group 1, 4 and 5 allergens from Phleum pratense pollen extract identified group 5 and group 4 homologues in Ic pollen extract. Ic pollen extract was characterized for the protein profile by TLIEF and SDS-PAGE. IgE reactivity was determined by ELISA and immunoblot. Monoclonal antibodies to group 5 and group 4 allergens reacted weakly showing that this pollen contains group 5 and group 4 homologous allergens.

  10. Promoting industrialisation

    International Nuclear Information System (INIS)

    Hayfield, F.

    1986-04-01

    When the first nuclear power programme is decided upon, automatically the country has to initiate in parallel a programme to modify or add to its current industrial structure and resources. The extent of this new industrialisation depends upon many factors which both, the Government and the Industries have to consider. The Government has a vital role which includes the setting up of the background against which the industrial promotion should take place and in many cases may have also to play an active role all along this programme. Equally, the existing industries have an important role so as to achieve the most efficient participation in the nuclear programme. Invariably the industrial promotional programme will incur a certain degree of transfer of technology, the extent depending on the policies adopted. For this technology transfer to take place efficiently, both the donor and the receiver have to recognise each other's legitimate ambitions and fears. The transfer of technology is a process having a high human content and both donor and receiver have to take this into account. This can be further complicated when there is a difference in culture between them. Technology transfer is carried out within a contractual and organisational framework which will identify the donor (licensor) and the receiver (licensee). This framework may take various forms from a simple cooperative agreement, through a joint-venture organisation right to a standard contract between two separate entities. Each arrangement has its advantages and drawbacks and requires investment of different degrees. One of the keys to a successful industrial promotion is having it carried out in a timely fashion which will be parallel with the nuclear power programme. Experience in some countries has shown the problems when the industrialisation is out of phase with the programme whilst in other cases this industrialisation was at a level and scale unjustified. (author)

  11. Meticillin-resistant Staphylococcus aureus with a novel mecA homologue in human and bovine populations in the UK and Denmark: a descriptive study.

    Science.gov (United States)

    García-Álvarez, Laura; Holden, Matthew T G; Lindsay, Heather; Webb, Cerian R; Brown, Derek F J; Curran, Martin D; Walpole, Enid; Brooks, Karen; Pickard, Derek J; Teale, Christopher; Parkhill, Julian; Bentley, Stephen D; Edwards, Giles F; Girvan, E Kirsty; Kearns, Angela M; Pichon, Bruno; Hill, Robert L R; Larsen, Anders Rhod; Skov, Robert L; Peacock, Sharon J; Maskell, Duncan J; Holmes, Mark A

    2011-08-01

    Animals can act as a reservoir and source for the emergence of novel meticillin-resistant Staphylococcus aureus (MRSA) clones in human beings. Here, we report the discovery of a strain of S aureus (LGA251) isolated from bulk milk that was phenotypically resistant to meticillin but tested negative for the mecA gene and a preliminary investigation of the extent to which such strains are present in bovine and human populations. Isolates of bovine MRSA were obtained from the Veterinary Laboratories Agency in the UK, and isolates of human MRSA were obtained from diagnostic or reference laboratories (two in the UK and one in Denmark). From these collections, we searched for mecA PCR-negative bovine and human S aureus isolates showing phenotypic meticillin resistance. We used whole-genome sequencing to establish the genetic basis for the observed antibiotic resistance. A divergent mecA homologue (mecA(LGA251)) was discovered in the LGA251 genome located in a novel staphylococcal cassette chromosome mec element, designated type-XI SCCmec. The mecA(LGA251) was 70% identical to S aureus mecA homologues and was initially detected in 15 S aureus isolates from dairy cattle in England. These isolates were from three different multilocus sequence type lineages (CC130, CC705, and ST425); spa type t843 (associated with CC130) was identified in 60% of bovine isolates. When human mecA-negative MRSA isolates were tested, the mecA(LGA251) homologue was identified in 12 of 16 isolates from Scotland, 15 of 26 from England, and 24 of 32 from Denmark. As in cows, t843 was the most common spa type detected in human beings. Although routine culture and antimicrobial susceptibility testing will identify S aureus isolates with this novel mecA homologue as meticillin resistant, present confirmatory methods will not identify them as MRSA. New diagnostic guidelines for the detection of MRSA should consider the inclusion of tests for mecA(LGA251). Department for Environment, Food and Rural Affairs

  12. Analysis of dofA, a fruA-Dependent Developmental Gene, and Its Homologue, dofB, in Myxococcus xanthus

    OpenAIRE

    Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

    2002-01-01

    The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, a...

  13. Cloning of the cDNA for a human homologue of the Drosophila white gene and mapping to chromosome 21q22.3.

    OpenAIRE

    Chen, H.; Rossier, C.; Lalioti, M. D.; Lynn, A.; Chakravarti, A.; Perrin, G.; Antonarakis, S. E.

    1996-01-01

    In an effort to contribute to the transcript map of human chromosome 21 and the understanding of the pathophysiology of trisomy 21, we have used exon trapping to identify fragments of chromosome 21 genes. Two trapped exons, from pools of chromosome 21-specific cosmids, showed homology to the Drosophila white (w) gene. We subsequently cloned the corresponding cDNA for a human homologue of the Drosophila w gene (hW) from human retina and fetal brain cDNA libraries. The gene belongs to the ATP-b...

  14. Genetic and physical mapping of homologues of the virus resistance gene Rx1 and the cyst nematode resistance gene Gpa2 in potato.

    Science.gov (United States)

    Bakker, E; Butterbach, P; Rouppe van der Voort, J; van der Vossen, E; van Vliet, J; Bakker, J; Goverse, A

    2003-05-01

    Nine resistance gene homologues (RGHs) were identified in two diploid potato clones (SH and RH), with a specific primer pair based on conserved motifs in the LRR domain of the potato cyst nematode resistance gene Gpa2 and the potato virus X resistance gene Rx1. A modified AFLP method was used to facilitate the genetic mapping of the RGHs in the four haplotypes under investigation. All nine RGHs appeared to be located in the Gpa2/ Rx1 cluster on chromosome XII. Construction of a physical map using bacterial artificial chromosome (BAC) clones for both the Solanum tuberosum ssp. tuberosum and the S. tuberosum ssp. andigena haplotype of SH showed that the RGHs are located within a stretch of less than 200 kb. Sequence analysis of the RGHs revealed that they are highly similar (93 to 95%) to Gpa2 and Rx1. The sequence identities among all RGHs range from 85 to 100%. Two pairs of RGHs are identical, or nearly so (100 and 99.9%), with each member located in a different genotype. Southern-blot analysis on genomic DNA revealed no evidence for additional homologues outside the Gpa2/ Rx1 cluster on chromosome XII.

  15. Phospholipase C δ-type consists of three isozymes: bovine PLCδ2 is a homologue of human/mouse PLCδ4

    International Nuclear Information System (INIS)

    Irino, Yasuhiro; Cho, Hiroyuki; Nakamura, Yoshikazu; Nakahara, Masamichi; Furutani, Masahiro; Suh, Pann-Ghill; Takenawa, Tadaomi; Fukami, Kiyoko

    2004-01-01

    To date, 12 phospholipase C (PLC) isozymes have been identified in mammals, and they are divided into five classes, β-, γ-, δ-, ε-, and ζ-type. PLCδ-type is reported to be composed of four isozymes, PLCδ1-δ4. Here we report that a screening for mouse PLCδ2 from a BAC library with primers that amplify a specific region of bovine PLCδ2 resulted in isolation of one clone containing the mouse PLCδ4 gene. Furthermore, a database search revealed that there is only one gene corresponding to PLCδ2 and PLCδ4 in the mouse and human genomes, indicating that bovine PLCδ2 is a homologue of human and mouse PLCδ4. However, PLCδ2 Western blot analysis with a widely used commercial anti-PLCδ2 antibody showed an expression pattern distinct from that of PLCδ4 in wild-type mice. In addition, an 80-kDa band, which was recognized by antibody against PLCδ2, was smaller than an 85-kDa band detected by anti-PLCδ4 antibody, and the 80-kDa band was detectable in lysates of brain, testis, and spleen from PLCδ4-deficient mice. We also found that immunoprecipitates from brain lysates with this PLCδ2 antibody contained no PLC activity. From these data, we conclude that bovine PLCδ2 is a homologue of human and mouse PLCδ4, and that three isozymes (δ1, δ3, and δ4) exist in the PLCδ family

  16. Duodenal ulcer promoting gene of Helicobacter pylori.

    Science.gov (United States)

    Lu, Hong; Hsu, Ping-I; Graham, David Y; Yamaoka, Yoshio

    2005-04-01

    Identification of a disease-specific H pylori virulence factors predictive of the outcome of infection remains unachieved. We used the polymerase chain reaction and Southern blot to compare the presence of 14 vir homologue genes with clinical presentation of H pylori infection, mucosal histology, and mucosal interleukin (IL)-8 levels. We examined 500 H pylori strains from East Asia and South America, including 120 with gastritis, 140 with duodenal ulcer (DU), 110 with gastric ulcer (GU), and 130 with gastric cancer. Only 1 gene that encompassed both jhp0917 and jhp0918 called dupA (duodenal ulcer promoting gene) was associated with a specific clinical outcome. dupA was present in 42% of DU vs. 21% of gastritis (adjusted odds ratio [OR] = 3.1, 95% confidence interval [CI]: 1.7-5.7). Its presence was also associated with more intense antral neutrophil infiltration and IL-8 levels and was a marker for protection against gastric atrophy, intestinal metaplasia, and gastric cancer (OR for gastric cancer = 0.42, 95% CI: 0.2-0.9 compared with gastritis). In vitro studies in gastric epithelial cells using dupA -deleted and -complemented mutants showed that the dupA plays roles in IL-8 production, in activation of transcription factors responsible for IL-8 promoter activity, and in increased survivability at low pH. dupA is a novel marker associated with an increased risk for DU and reduced risk for gastric atrophy and cancer. Its association with DU-promoting and -protective effects against atrophy/cancer was evident in both Asian and Western countries.

  17. Interactions of an Arabidopsis RanBPM homologue with LisH-CTLH domain proteins revealed high conservation of CTLH complexes in eukaryotes

    Czech Academy of Sciences Publication Activity Database

    Tomaštíková, Eva; Cenklová, Věra; Kohoutová, Lucie; Petrovská, Beáta; Váchová, Lenka; Halada, Petr; Kočárová, Gabriela; Binarová, Pavla

    2012-01-01

    Roč. 12, č. 83 (2012) ISSN 1471-2229 R&D Projects: GA ČR(CZ) GA204/07/1169; GA ČR GP204/09/P155; GA ČR GAP501/12/2333; GA MŠk(CZ) LC06034; GA MŠk LC545; GA AV ČR IAA500200719 Grant - others:GA MŠk(CZ) ED0007/01/01 Program:ED Institutional research plan: CEZ:AV0Z50380511; CEZ:AV0Z50200510 Keywords : Arabidopsis homologue of RanBPM * CTLH-complex * LisH-CTLH domain proteins Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.354, year: 2012

  18. A density functional theory study of magneto-electric Jones birefringence of noble gases, furan homologues, and mono-substituted benzenes

    International Nuclear Information System (INIS)

    Fahleson, Tobias; Norman, Patrick; Coriani, Sonia; Rizzo, Antonio; Rikken, Geert L. J. A.

    2013-01-01

    We report on the results of a systematic ab initio study of the Jones birefringence of noble gases, of furan homologues, and of monosubstituted benzenes, in the gas phase, with the aim of analyzing the behavior and the trends within a list of systems of varying size and complexity, and of identifying candidates for a combined experimental/theoretical study of the effect. We resort here to analytic linear and nonlinear response functions in the framework of time-dependent density functional theory. A correlation is made between the observable (the Jones constant) and the atomic radius for noble gases, or the permanent electric dipole and a structure/chemical reactivity descriptor as the para Hammett constant for substituted benzenes

  19. The small GTPase Rab5 homologue Ypt5 regulates cell morphology, sexual development, ion-stress response and vacuolar formation in fission yeast

    Energy Technology Data Exchange (ETDEWEB)

    Tsukamoto, Yuta; Katayama, Chisako [Graduate School of Science, Kobe University, 1-1 Rokkodai-cho Nada, Kobe 657-8501 (Japan); Shinohara, Miki; Shinohara, Akira [Institute for Protein Research, Osaka University, 3-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Maekawa, Shohei [Graduate School of Science, Kobe University, 1-1 Rokkodai-cho Nada, Kobe 657-8501 (Japan); Miyamoto, Masaaki, E-mail: miya@kobe-u.ac.jp [Graduate School of Science, Kobe University, 1-1 Rokkodai-cho Nada, Kobe 657-8501 (Japan); Center for Supports to Research and Education Activities, Kobe University, 1-1 Rokkodai-cho Nada, Kobe 657-8501 (Japan)

    2013-11-29

    Highlights: •Multiple functions of Rab5 GTPase in fission yeast were found. •Roles of Rab5 in fission yeast were discussed. •Relation between Rab5 and actin cytoskeleton were discussed. -- Abstract: Inner-membrane transport is critical to cell function. Rab family GTPases play an important role in vesicle transport. In mammalian cells, Rab5 is reported to be involved in the regulation of endosome formation, phagocytosis and chromosome alignment. Here, we examined the role of the fission yeast Rab5 homologue Ypt5 using a point mutant allele. Mutant cells displayed abnormal cell morphology, mating, sporulation, endocytosis, vacuole fusion and responses to ion stress. Our data strongly suggest that fission yeast Rab5 is involved in the regulation of various types of cellular functions.

  20. The small GTPase Rab5 homologue Ypt5 regulates cell morphology, sexual development, ion-stress response and vacuolar formation in fission yeast

    International Nuclear Information System (INIS)

    Tsukamoto, Yuta; Katayama, Chisako; Shinohara, Miki; Shinohara, Akira; Maekawa, Shohei; Miyamoto, Masaaki

    2013-01-01

    Highlights: •Multiple functions of Rab5 GTPase in fission yeast were found. •Roles of Rab5 in fission yeast were discussed. •Relation between Rab5 and actin cytoskeleton were discussed. -- Abstract: Inner-membrane transport is critical to cell function. Rab family GTPases play an important role in vesicle transport. In mammalian cells, Rab5 is reported to be involved in the regulation of endosome formation, phagocytosis and chromosome alignment. Here, we examined the role of the fission yeast Rab5 homologue Ypt5 using a point mutant allele. Mutant cells displayed abnormal cell morphology, mating, sporulation, endocytosis, vacuole fusion and responses to ion stress. Our data strongly suggest that fission yeast Rab5 is involved in the regulation of various types of cellular functions

  1. The Orf virus E3L homologue is able to complement deletion of the vaccinia virus E3L gene in vitro but not in vivo

    International Nuclear Information System (INIS)

    Vijaysri, Sangeetha; Talasela, Latha; Mercer, Andrew A.; Mcinnes, Colin J.; Jacobs, Bertram L.; Langland, Jeffrey O.

    2003-01-01

    Orf virus (OV), the prototypic parapoxvirus, is resistant to the effects of interferon (IFN) and this function of OV has been mapped to the OV20.0L gene. The protein product of this gene shares 31% amino acid identity to the E3L-encoded protein of vaccinia virus (VV) that is required for the broad host range and IFN-resistant phenotype of VV in cells in culture and for virulence of the virus in vivo. In this study we investigated whether the distantly related OV E3L homologue could complement the deletion of E3L in VV. The recombinant VV (VV/ORF-E3L) expressing the OV E3L homologue in place of VV E3L was indistinguishable from wt VV in its cell-culture phenotype. But VV/ORF-E3L was over a 1000-fold less pathogenic than wt VV (LD 50 > 5 x 10 6 PFU, compared to LD 50 of wtVV = 4 x 10 3 PFU) following intranasal infection of mice. While wt VV spread to the lungs and brain and replicated to high titers in the brain of infected mice, VV/ORF-E3L could not be detected in the lungs or brain following intranasal infection. VV/ORF-E3L was at least 100,000-fold less pathogenic than wt VV on intracranial injection. Domain swap experiments demonstrate that the difference in pathogenesis maps to the C-terminal domain of these proteins. This domain has been shown to be required for the dsRNA binding function of the VV E3L

  2. The Ca{sup 2+} channel TRPML3 specifically interacts with the mammalian ATG8 homologue GATE16 to regulate autophagy

    Energy Technology Data Exchange (ETDEWEB)

    Choi, Suzy; Kim, Hyun Jin, E-mail: kimhyunjin@skku.edu

    2014-01-03

    Highlights: •Split-ubiquitin MY2H screen identified GATE16 as an interacting protein of TRPML3. •TRPML3 specifically binds to a mammalian ATG8 homologue GATE16, not to LC3B. •The interaction of TRPML3 with GATE16 facilitates autophagosome formation. •GATE16 is expressed in both autophagosome and extra-autophagosomal compartments. -- Abstract: TRPML3 is a Ca{sup 2+} permeable cation channel expressed in multiple intracellular compartments. Although TRPML3 is implicated in autophagy, how TRPML3 can regulate autophagy is not understood. To search interacting proteins with TRPML3 in autophagy, we performed split-ubiquitin membrane yeast two-hybrid (MY2H) screening with TRPML3-loop as a bait and identified GATE16, a mammalian ATG8 homologue. GST pull-down assay revealed that TRPML3 and TRPML3-loop specifically bind to GATE16, not to LC3B. Co-immunoprecipitation (co-IP) experiments showed that TRPML3 and TRPML3-loop pull down only the lipidated form of GATE16, indicating that the interaction occurs exclusively at the organellar membrane. The interaction of TRPML3 with GATE16 and GATE16-positive vesicle formation were increased in starvation induced autophagy, suggesting that the interaction facilitates the function of GATE16 in autophagosome formation. However, GATE16 was not required for TRPML3 trafficking to autophagosomes. Experiments using dominant-negative (DN) TRPML3(D458K) showed that GATE16 is localized not only in autophagosomes but also in extra-autophagosomal compartments, by contrast with LC3B. Since GATE16 acts at a later stage of the autophagosome biogenesis, our results suggest that TRPML3 plays a role in autophagosome maturation through the interaction with GATE16, by providing Ca{sup 2+} in the fusion process.

  3. In vivo metabolism of the methyl homologues of delta-8-tetrahydrocannabinol, delta-9-tetrahydrocannabinol and abn-delta-8-tetrahydrocannabinol in the mouse.

    Science.gov (United States)

    Brown, N K; Harvey, D J

    1988-04-01

    Methyl-delta-8-tetrahydrocannabinol (methyl-delta-8-THC), methyl-delta-9-THC and abn-methyl-delta-8-THC were synthesized by condensation of orcinol and (1S)-cis-verbenol and were administered to male Charles River CD-1 mice. Extracted hepatic metabolites were isolated by chromatography on Sephadex LH-20 and examined by gas chromatography/mass spectrometry as trimethylsilyl (TMS), (2H9)TMS and methyl ester/TMS derivatives. In addition, metabolic fractions were reduced with lithium aluminium deuteride to convert carboxylic acids to alcohols for structural correlation. Metabolites from methyl-delta-8-THC were similar with respect to the positions substituted to those produced by higher homologues; the major metabolite was methyl-delta-8-THC-11-oic acid. abn-Methyl-delta-8-THC was metabolized in a different manner. The location of the aromatic methyl group at the position adjacent to ring fusion appeared to inhibit metabolism at C(11) to a considerable extent and also to reduce the amount of the resulting alcohol from being oxidized to a carboxylic acid. This caused other metabolic pathways to become dominant, with the result that a compound containing a hydroxy group at the gem-methyl position was the major metabolite. Hydroxylation at this position has not been confirmed with any other cannabinoid, although it is thought to result in trace concentrations of hydroxy metabolites from some compounds. Metabolism of methyl-delta-9-THC was also similar to that of the higher homologues, with the exception that less metabolism occurred at C(8) and a higher percentage of the total metabolic fraction was accounted for by the 11-oic acid metabolite. Minor metabolites were mainly dihydroxy compounds and hydroxylated derivatives of delta-9-THC-11-oic acid.

  4. A gonococcal homologue of meningococcal γ-glutamyl transpeptidase gene is a new type of bacterial pseudogene that is transcriptionally active but phenotypically silent

    Directory of Open Access Journals (Sweden)

    Watanabe Haruo

    2005-10-01

    Full Text Available Abstract Background It has been speculated that the γ-glutamyl transpeptidase (ggt gene is present only in Neisseria meningitidis and not among related species such as Neisseria gonorrhoeae and Neisseria lactamica, because N. meningitidis is the only bacterium with GGT activity. However, nucleotide sequences highly homologous to the meningococcal ggt gene were found in the genomes of N. gonorrhoeae isolates. Results The gonococcal homologue (ggt gonococcal homologue; ggh was analyzed. The nucleotide sequence of the ggh gene was approximately 95 % identical to that of the meningococcal ggt gene. An open reading frame in the ggh gene was disrupted by an ochre mutation and frameshift mutations induced by a 7-base deletion, but the amino acid sequences deduced from the artificially corrected ggh nucleotide sequences were approximately 97 % identical to that of the meningococcal ggt gene. The analyses of the sequences flanking the ggt and ggh genes revealed that both genes were localized in a common DNA region containing the fbp-ggt (or ggh-glyA-opcA-dedA-abcZ gene cluster. The expression of the ggh RNA could be detected by dot blot, RT-PCR and primer extension analyses. Moreover, the truncated form of ggh-translational product was also found in some of the gonococcal isolates. Conclusion This study has shown that the gonococcal ggh gene is a pseudogene of the meningococcal ggt gene, which can also be designated as Ψggt. The gonococcal ggh (Ψggt gene is the first identified bacterial pseudogene that is transcriptionally active but phenotypically silent.

  5. acn-1, a C. elegans homologue of ACE, genetically interacts with the let-7 microRNA and other heterochronic genes.

    Science.gov (United States)

    Metheetrairut, Chanatip; Ahuja, Yuri; Slack, Frank J

    2017-10-02

    The heterochronic pathway in C. elegans controls the relative timing of cell fate decisions during post-embryonic development. It includes a network of microRNAs (miRNAs), such as let-7, and protein-coding genes, such as the stemness factors, LIN-28 and LIN-41. Here we identified the acn-1 gene, a homologue of mammalian angiotensin-converting enzyme (ACE), as a new suppressor of the stem cell developmental defects of let-7 mutants. Since acn-1 null mutants die during early larval development, we used RNAi to characterize the role of acn-1 in C. elegans seam cell development, and determined its interaction with heterochronic factors, including let-7 and its downstream interactors - lin-41, hbl-1, and apl-1. We demonstrate that although RNAi knockdown of acn-1 is insufficient to cause heterochronic defects on its own, loss of acn-1 suppresses the retarded phenotypes of let-7 mutants and enhances the precocious phenotypes of hbl-1, though not lin-41, mutants. Conversely, the pattern of acn-1 expression, which oscillates during larval development, is disrupted by lin-41 mutants but not by hbl-1 mutants. Finally, we show that acn-1(RNAi) enhances the let-7-suppressing phenotypes caused by loss of apl-1, a homologue of the Alzheimer's disease-causing amyloid precursor protein (APP), while significantly disrupting the expression of apl-1 during the L4 larval stage. In conclusion, acn-1 interacts with heterochronic genes and appears to function downstream of let-7 and its target genes, including lin-41 and apl-1.

  6. Initial characterization of a bolA homologue from Pseudomonas fluorescens indicates different roles for BolA-like proteins in P. fluorescens and Escherichia coli

    DEFF Research Database (Denmark)

    Koch, Birgit; Nybroe, Ole

    2006-01-01

    A expression. The mutant grew slower than the wild-type strain in minimal medium with L-serine as the sole nitrogen source, while growth rates were similar on a mixture of L-serine and L-cysteine. Reverse transcriptase polymerase chain reaction analysis indicated that the bolA homologue is the second gene...

  7. Use of isotope ratio mass spectrometry to differentiate between endogenous steroids and synthetic homologues in cattle: a review.

    Science.gov (United States)

    Janssens, Geert; Courtheyn, Dirk; Mangelinckx, Sven; Prévost, Stéphanie; Bichon, Emmanuelle; Monteau, Fabrice; De Poorter, Geert; De Kimpe, Norbert; Le Bizec, Bruno

    2013-04-15

    Although substantial technical advances have been achieved during the past decades to extend and facilitate the analysis of growth promoters in cattle, the detection of abuse of synthetic analogs of naturally occurring hormones has remained a challenging issue. When it became clear that the exogenous origin of steroid hormones could be traced based on the (13)C/(12)C isotope ratio of the substances, GC/C/IRMS has been successfully implemented to this aim since the end of the past century. However, due to the costly character of the instrumental setup, the susceptibility of the equipment to errors and the complex and time consuming sample preparation, this method is up until now only applied by a limited number of laboratories. In this review, the general principles as well as the practical application of GC/C/IRMS to differentiate between endogenous steroids and exogenously synthesized homologous compounds in cattle will be discussed in detail, and will be placed next to other existing and to be developed methods based on isotope ratio mass spectrometry. Finally, the link will be made with the field of sports doping, where GC/C/IRMS has been established within the World Anti-Doping Agency (WADA) approved methods as the official technique to differentiate between exogenous and endogenous steroids over the past few years. Copyright © 2013 Elsevier B.V. All rights reserved.

  8. Evidence for a functional link between Dd-STATa and Dd-PIAS, a Dictyostelium PIAS homologue.

    Science.gov (United States)

    Kawata, Takefumi; Hirano, Tatsunori; Ogasawara, Shun; Aoshima, Ryota; Yachi, Ayako

    2011-09-01

    Several mammalian protein families inhibit the activity of signal transducer and activator of transcription (STAT) proteins. The protein inhibitor of activated STAT (PIAS) was initially identified through its ability to interact with human STAT proteins. We isolated a gene (pisA) encoding a Dictyostelium orthologue of PIAS, Dd-PIAS, which possesses almost all the representative motifs and domains of mammalian PIAS proteins. A Dd-PIAS null mutant strain displays a normal terminal morphology but with accelerated development once cells are aggregated. In contrast, Dd-PIAS overexpressor strains demonstrate delayed aggregation, almost no slug phototaxis, impaired slug motility, and a prolonged slug migration period. This strain is a near phenocopy of the Dd-STATa null mutant, although it eventually forms a fruiting body, albeit inefficiently. The expression of several Dd-STATa-activated genes is upregulated in the Dd-PIAS null mutant and there is ectopic expression of pstAB makers. The concentration of a PIAS-green fluorescent protein (GFP) fusion protein, expressed under the PIAS promoter, is greatest in the pstO cells and gradually decreases with proximity to the tip of the slug and culminant: a pattern diametrically opposite to that of Dd-STATa. Our results suggest a functional interrelationship between Dd-PIAS and Dd-STATa that influences gene expression and development. © 2011 The Authors. Development, Growth & Differentiation © 2011 Japanese Society of Developmental Biologists.

  9. Insertion of a specific fungal 3'-phosphoadenosine-5'-phosphatase motif into a plant homologue improves halotolerance and drought tolerance of plants.

    Science.gov (United States)

    Gašparič, Meti Buh; Lenassi, Metka; Gostinčar, Cene; Rotter, Ana; Plemenitaš, Ana; Gunde-Cimerman, Nina; Gruden, Kristina; Zel, Jana

    2013-01-01

    Soil salinity and drought are among the most serious agricultural and environmental problems of today. Therefore, investigations of plant resistance to abiotic stress have received a lot of attention in recent years. In this study, we identified the complete coding sequence of a 3'-phosphoadenosine-5'-phosphatase protein, ApHal2, from the halotolerant yeast Aureobasidium pullulans. Expression of the ApHAL2 gene in a Saccharomyces cerevisiae hal2 mutant complemented the mutant auxotrophy for methionine, and rescued the growth of the hal2 mutant in media with high NaCl concentrations. A 21-amino-acids-long region of the ApHal2 enzyme was inserted into the Arabidopsis thaliana homologue of Hal2, the SAL1 phosphatase. The inserted sequence included the META motif, which has previously been implicated in increased sodium tolerance of the Hal2 homologue from a related fungal species. Transgenic Arabidopsis plants overexpressing this modified SAL1 (mSAL1) showed improved halotolerance and drought tolerance. In a medium with an elevated salt concentration, mSAL1-expressing plants were twice as likely to have roots in a higher length category in comparison with the wild-type Arabidopsis and with plants overexpressing the native SAL1, and had 5% to 10% larger leaf surface area under moderate and severe salt stress, respectively. Similarly, after moderate drought exposure, the mSAL1-expressing plants showed 14% increased dry weight after revitalisation, with no increase in dry weight of the wild-type plants. With severe drought, plants overexpressing native SAL1 had the worst rehydration success, consistent with the recently proposed role of SAL1 in severe drought. This was not observed for plants expressing mSAL1. Therefore, the presence of this fungal META motif sequence is beneficial under conditions of increased salinity and moderate drought, and shows no drawbacks for plant survival under severe drought. This demonstrates that adaptations of extremotolerant fungi should

  10. What Is a Promotion?

    Science.gov (United States)

    Pergamit, Michael R.; Veum, Jonathan R.

    1999-01-01

    For a sample of young workers, "promotion" involved no change in position or duties; promotion was more likely for males than females and Whites than Blacks or Hispanics. Company training and prior promotions were important predictors. Promotion did not appear to have a direct impact on job satisfaction. (SK)

  11. Use of isotope ratio mass spectrometry to differentiate between endogenous steroids and synthetic homologues in cattle: A review

    Energy Technology Data Exchange (ETDEWEB)

    Janssens, Geert, E-mail: Geert.janssens@favv.be [Federal Agency for the Safety of the Food Chain, Directorate General Laboratories, Kruidtuinlaan 55, 1000 Brussels (Belgium); Department of Sustainable Organic Chemistry and Technology, Faculty of Bioscience Engineering, Ghent University, Coupure Links 653, 9000 Ghent (Belgium); Courtheyn, Dirk [Federal Agency for the Safety of the Food Chain, Directorate General Laboratories, Kruidtuinlaan 55, 1000 Brussels (Belgium); Mangelinckx, Sven [Department of Sustainable Organic Chemistry and Technology, Faculty of Bioscience Engineering, Ghent University, Coupure Links 653, 9000 Ghent (Belgium); Prévost, Stéphanie; Bichon, Emmanuelle; Monteau, Fabrice [LUNAM Université, Oniris, Laboratoire d’Etude des Résidus et Contaminants dans les Aliments (LABERCA), F-44307 Nantes (France); De Poorter, Geert [Federal Agency for the Safety of the Food Chain, Directorate General Laboratories, Kruidtuinlaan 55, 1000 Brussels (Belgium); De Kimpe, Norbert [Department of Sustainable Organic Chemistry and Technology, Faculty of Bioscience Engineering, Ghent University, Coupure Links 653, 9000 Ghent (Belgium); Le Bizec, Bruno [LUNAM Université, Oniris, Laboratoire d’Etude des Résidus et Contaminants dans les Aliments (LABERCA), F-44307 Nantes (France)

    2013-04-15

    Graphical abstract: Scheme: Representation of the observed isotope ratios and the relation to exogenous and endogenous natural steroids. AS stands for “amount of steroid”. Highlights: ► The difference between endogenous and exogenous steroids is thoroughly laid out. ► Factors influencing the carbon ratio and the use of Δ{sup 13}C-values are explained. ► Implementation of GC/C/IRMS to detect steroid abuse in cattle is reviewed. ► Alternative methods and upcoming techniques are discussed. ► The differences and similarities with sports doping control are highlighted. -- Abstract: Although substantial technical advances have been achieved during the past decades to extend and facilitate the analysis of growth promoters in cattle, the detection of abuse of synthetic analogs of naturally occurring hormones has remained a challenging issue. When it became clear that the exogenous origin of steroid hormones could be traced based on the {sup 13}C/{sup 12}C isotope ratio of the substances, GC/C/IRMS has been successfully implemented to this aim since the end of the past century. However, due to the costly character of the instrumental setup, the susceptibility of the equipment to errors and the complex and time consuming sample preparation, this method is up until now only applied by a limited number of laboratories. In this review, the general principles as well as the practical application of GC/C/IRMS to differentiate between endogenous steroids and exogenously synthesized homologous compounds in cattle will be discussed in detail, and will be placed next to other existing and to be developed methods based on isotope ratio mass spectrometry. Finally, the link will be made with the field of sports doping, where GC/C/IRMS has been established within the World Anti-Doping Agency (WADA) approved methods as the official technique to differentiate between exogenous and endogenous steroids over the past few years.

  12. Use of isotope ratio mass spectrometry to differentiate between endogenous steroids and synthetic homologues in cattle: A review

    International Nuclear Information System (INIS)

    Janssens, Geert; Courtheyn, Dirk; Mangelinckx, Sven; Prévost, Stéphanie; Bichon, Emmanuelle; Monteau, Fabrice; De Poorter, Geert; De Kimpe, Norbert; Le Bizec, Bruno

    2013-01-01

    Graphical abstract: Scheme: Representation of the observed isotope ratios and the relation to exogenous and endogenous natural steroids. AS stands for “amount of steroid”. Highlights: ► The difference between endogenous and exogenous steroids is thoroughly laid out. ► Factors influencing the carbon ratio and the use of Δ 13 C-values are explained. ► Implementation of GC/C/IRMS to detect steroid abuse in cattle is reviewed. ► Alternative methods and upcoming techniques are discussed. ► The differences and similarities with sports doping control are highlighted. -- Abstract: Although substantial technical advances have been achieved during the past decades to extend and facilitate the analysis of growth promoters in cattle, the detection of abuse of synthetic analogs of naturally occurring hormones has remained a challenging issue. When it became clear that the exogenous origin of steroid hormones could be traced based on the 13 C/ 12 C isotope ratio of the substances, GC/C/IRMS has been successfully implemented to this aim since the end of the past century. However, due to the costly character of the instrumental setup, the susceptibility of the equipment to errors and the complex and time consuming sample preparation, this method is up until now only applied by a limited number of laboratories. In this review, the general principles as well as the practical application of GC/C/IRMS to differentiate between endogenous steroids and exogenously synthesized homologous compounds in cattle will be discussed in detail, and will be placed next to other existing and to be developed methods based on isotope ratio mass spectrometry. Finally, the link will be made with the field of sports doping, where GC/C/IRMS has been established within the World Anti-Doping Agency (WADA) approved methods as the official technique to differentiate between exogenous and endogenous steroids over the past few years

  13. Cloning of Interleukin-10 from African Clawed Frog (Xenopus tropicalis, with the Finding of IL-19/20 Homologue in the IL-10 Locus

    Directory of Open Access Journals (Sweden)

    Zhitao Qi

    2015-01-01

    Full Text Available Interleukin-10 (IL-10 is a pleiotropic cytokine that plays an important role in immune system. In the present study, the IL-10 gene of African clawed frog (Xenopus tropicalis was first cloned, and its expression pattern and 3D structure were also analyzed. The frog IL-10 mRNA encoded 172 amino acids which possessed several conserved features found in IL-10s from other species, including five-exon/four-intron genomic structure, conserved four cysteine residues, IL-10 family motif, and six α-helices. Real-time PCR showed that frog IL-10 mRNA was ubiquitous expressed in all examined tissues, highly in some immune related tissues including kidney, spleen, and intestine and lowly in heart, stomach, and liver. The frog IL-10 mRNA was upregulated at 24 h after LPS stimulation, indicating that it plays a part in the host immune response to bacterial infection. Another IL, termed as IL-20, was identified from the frog IL-10 locus, which might be the homologue of mammalian IL-19/20 according to the analysis results of the phylogenetic tree and the sequence identities.

  14. The CD11a partner in Sus scrofa lymphocyte function-associated antigen-1 (LFA-1: mRNA cloning, structure analysis and comparison with mammalian homologues

    Directory of Open Access Journals (Sweden)

    Thomas Anne VT

    2005-10-01

    Full Text Available Abstract Background Lymphocyte function-associated antigen-1 (LFA-1, CD11a/CD18, alphaLbeta2, the most abundant and widely expressed beta2-integrin, is required for many cellular adhesive interactions during the immune response. Many studies have shown that LFA-1 is centrally involved in the pathogenesis of several diseases caused by Repeats-in-toxin (RTX -producing bacteria. Results The porcine-LFA-1 CD11a (alpha subunit coding sequence was cloned, sequenced and compared with the available mammalian homologues in this study. Despite some focal differences, it shares all the main characteristics of these latter. Interestingly, as in sheep and humans, an allelic variant with a triplet insertion resulting in an additional Gln-744 was consistently identified, which suggests an allelic polymorphism that might be biologically relevant. Conclusion Together with the pig CD18-encoding cDNA, which has been available for a long time, the sequence data provided here will allow the successful expression of porcine CD11a, thus giving the first opportunity to express the Sus scrofa beta2-integrin LFA-1 in vitro as a tool to examine the specificities of inflammation in the porcine species.

  15. The nematode homologue of Mediator complex subunit 28, F28F8.5, is a critical regulator of C. elegans development

    Directory of Open Access Journals (Sweden)

    Markéta Kostrouchová

    2017-06-01

    Full Text Available The evolutionarily conserved Mediator complex is a critical player in regulating transcription. Comprised of approximately two dozen proteins, the Mediator integrates diverse regulatory signals through direct protein-protein interactions that, in turn, modulate the influence of Mediator on RNA Polymerase II activity. One Mediator subunit, MED28, is known to interact with cytoplasmic structural proteins, providing a potential direct link between cytoplasmic dynamics and the control of gene transcription. Although identified in many animals and plants, MED28 is not present in yeast; no bona fide MED28 has been described previously in Caenorhabditis elegans. Here, we identify bioinformatically F28F8.5, an uncharacterized predicted protein, as the nematode homologue of MED28. As in other Metazoa, F28F8.5 has dual nuclear and cytoplasmic localization and plays critical roles in the regulation of development. F28F8.5 is a vital gene and its null mutants have severely malformed gonads and do not reproduce. F28F8.5 interacts on the protein level with the Mediator subunits MDT-6 and MDT-30. Our results indicate that F28F8.5 is an orthologue of MED28 and suggest that the potential to link cytoplasmic and nuclear events is conserved between MED28 vertebrate and nematode orthologues.

  16. The phocein homologue SmMOB3 is essential for vegetative cell fusion and sexual development in the filamentous ascomycete Sordaria macrospora.

    Science.gov (United States)

    Bernhards, Yasmine; Pöggeler, Stefanie

    2011-04-01

    Members of the striatin family and their highly conserved interacting protein phocein/Mob3 are key components in the regulation of cell differentiation in multicellular eukaryotes. The striatin homologue PRO11 of the filamentous ascomycete Sordaria macrospora has a crucial role in fruiting body development. Here, we functionally characterized the phocein/Mob3 orthologue SmMOB3 of S. macrospora. We isolated the gene and showed that both, pro11 and Smmob3 are expressed during early and late developmental stages. Deletion of Smmob3 resulted in a sexually sterile strain, similar to the previously characterized pro11 mutant. Fusion assays revealed that ∆Smmob3 was unable to undergo self-fusion and fusion with the pro11 strain. The essential function of the SmMOB3 N-terminus containing the conserved mob domain was demonstrated by complementation analysis of the sterile S. macrospora ∆Smmob3 strain. Downregulation of either pro11 in ∆Smmob3, or Smmob3 in pro11 mutants by means of RNA interference (RNAi) resulted in synthetic sexual defects, demonstrating for the first time the importance of a putative PRO11/SmMOB3 complex in fruiting body development.

  17. An Epichloë festucae homologue of MOB3, a component of the STRIPAK complex, is required for the establishment of a mutualistic symbiotic interaction with Lolium perenne

    Science.gov (United States)

    Green, Kimberly A.; Becker, Yvonne; Fitzsimons, Helen L.

    2016-01-01

    Summary In both Sordaria macrospora and Neurospora crassa, components of the conserved STRIPAK (striatin‐interacting phosphatase and kinase) complex regulate cell–cell fusion, hyphal network development and fruiting body formation. Interestingly, a number of Epichloë festucae genes that are required for hyphal cell–cell fusion, such as noxA, noxR, proA, mpkA and mkkA, are also required for the establishment of a mutualistic symbiotic interaction with Lolium perenne. To determine whether MobC, a homologue of the STRIPAK complex component MOB3 in S. macrospora and N. crassa, is required for E. festucae hyphal fusion and symbiosis, a mobC deletion strain was generated. The ΔmobC mutant showed reduced rates of hyphal cell–cell fusion, formed intrahyphal hyphae and exhibited enhanced conidiation. Plants infected with ΔmobC were severely stunted. Hyphae of ΔmobC showed a proliferative pattern of growth within the leaves of Lolium perenne with increased colonization of the intercellular spaces and vascular bundles. Although hyphae were still able to form expressoria, structures allowing the colonization of the leaf surface, the frequency of formation was significantly reduced. Collectively, these results show that the STRIPAK component MobC is required for the establishment of a mutualistic symbiotic association between E. festucae and L. perenne, and plays an accessory role in the regulation of hyphal cell–cell fusion and expressorium development in E. festucae. PMID:27277141

  18. MicroRNA-15a finetunes the level of Delta-like 1 homologue (DLK1) in proliferating 3T3-L1 preadipocytes

    DEFF Research Database (Denmark)

    Andersen, Ditte C; Jensen, Charlotte H; Schneider, Mikael

    2010-01-01

    Delta like 1 homologue (Dlk1) exists in both transmembrane and soluble molecular forms, and is implicated in cellular growth and plays multiple roles in development, tissue regeneration, and cancer. Thus, DLK1 levels are critical for cell function, and abnormal DLK1 expression can be lethal...... increases with cell density, and peaks at the same stage where membrane DLK1(M) and soluble DLK1(S) are found at maximum levels. Remarkably, miR-15a represses the amount of all Dlk1 variants at the mRNA level but also the level of DLK1(M) protein while it increases the amount of DLK1(S) supporting a direct...... while increasing cell numbers, scenarios that were completely rescued by addition of purified DLK1(S). Our data thus imply that miR-15a regulates cell size and proliferation by fine-tuning Dlk1 among others, and further emphasize miR-15a and DLK1 levels to play important roles in growth signaling...

  19. Induction of MAP Kinase Homologues during Growth and Morphogenetic Development of Karnal Bunt (Tilletia indica) under the Influence of Host Factor(s) from Wheat Spikes

    Science.gov (United States)

    Gupta, Atul K.; Seneviratne, J. M.; Joshi, G. K.; Kumar, Anil

    2012-01-01

    Signaling pathways that activate different mitogen-activated protein kinases (MAPKs) in response to certain environmental conditions, play important role in mating type switching (Fus3) and pathogenicity (Pmk1) in many fungi. In order to determine the roles of such regulatory genes in Tilletia indica, the causal pathogen of Karnal bunt (KB) of wheat, semi-quantitative and quantitative RT-PCR was carried out to isolate and determine the expression of MAP kinase homologues during fungal growth and development under in vitro culture. Maximum expression of TiFus3 and TiPmk1 genes were observed at 14th and 21st days of culture and decreased thereafter. To investigate whether the fungus alters the expression levels of same kinases upon interaction with plants, cultures were treated with 1% of host factors (extracted from S-2 stage of wheat spikes). Such treatment induced the expression of MAPks in time dependent manner compared to the absence of host factors. These results suggest that host factor(s) provide certain signal(s) which activate TiFus3 and TiPmk1 during morphogenetic development of T. indica. The results also provides a clue about the role of host factors in enhancing the disease potential due to induction of MAP kinases involved in fungal development and pathogenecity. PMID:22547988

  20. First report of a thioredoxin homologue in jellyfish: molecular cloning, expression and antioxidant activity of CcTrx1 from Cyanea capillata.

    Directory of Open Access Journals (Sweden)

    Zengliang Ruan

    Full Text Available Thioredoxins (Trx proteins are a family of small, highly-conserved and ubiquitous proteins that play significant roles in the resistance of oxidative damage. In this study, a homologue of Trx was identified from the cDNA library of tentacle of the jellyfish Cyanea capillata and named CcTrx1. The full-length cDNA of CcTrx1 was 479 bp with a 312 bp open reading frame encoding 104 amino acids. Bioinformatics analysis revealed that the putative CcTrx1 protein harbored the evolutionarily-conserved Trx active site 31CGPC34 and shared a high similarity with Trx1 proteins from other organisms analyzed, indicating that CcTrx1 is a new member of Trx1 sub-family. CcTrx1 mRNA was found to be constitutively expressed in tentacle, umbrella, oral arm and gonad, indicating a general role of CcTrx1 protein in various physiological processes. The recombinant CcTrx1 (rCcTrx1 protein was expressed in Escherichia coli BL21 (DE3, and then purified by affinity chromatography. The rCcTrx1 protein was demonstrated to possess the expected redox activity in enzymatic analysis and protection against oxidative damage of supercoiled DNA. These results indicate that CcTrx1 may function as an important antioxidant in C. capillata. To our knowledge, this is the first Trx protein characterized from jellyfish species.

  1. SLAH1, a homologue of the slow type anion channel SLAC1, modulates shoot Cl − accumulation and salt tolerance in Arabidopsis thaliana

    KAUST Repository

    Qiu, Jiaen; Henderson, Sam W; Tester, Mark A.; Roy, Stuart J; Gilliham, Mathew

    2016-01-01

    Salinity tolerance is correlated with shoot chloride (Cl–) exclusion in multiple crops, but the molecular mechanisms of long-distance Cl– transport are poorly defined. Here, we characterize the in planta role of AtSLAH1 (a homologue of the slow type anion channel-associated 1 (SLAC1)). This protein, localized to the plasma membrane of root stelar cells, has its expression reduced by salt or ABA, which are key predictions for a protein involved with loading Cl– into the root xylem. Artificial microRNA knockdown mutants of AtSLAH1 had significantly reduced shoot Cl− accumulation when grown under low Cl–, whereas shoot Cl– increased and the shoot nitrate/chloride ratio decreased following AtSLAH1 constitutive or stelar-specific overexpression when grown in high Cl–. In both sets of overexpression lines a significant reduction in shoot biomass over the null segregants was observed under high Cl– supply, but not low Cl– supply. Further in planta data showed AtSLAH3 overexpression increased the shoot nitrate/chloride ratio, consistent with AtSLAH3 favouring nitrate transport. Heterologous expression of AtSLAH1 in Xenopus laevis oocytes led to no detectible transport, suggesting the need for post-translational modifications for AtSLAH1 to be active. Our in planta data are consistent with AtSLAH1 having a role in controlling root-to-shoot Cl– transport.

  2. The nematode homologue of Mediator complex subunit 28, F28F8.5, is a critical regulator of C. elegans development.

    Science.gov (United States)

    Kostrouchová, Markéta; Kostrouch, David; Chughtai, Ahmed A; Kaššák, Filip; Novotný, Jan P; Kostrouchová, Veronika; Benda, Aleš; Krause, Michael W; Saudek, Vladimír; Kostrouchová, Marta; Kostrouch, Zdeněk

    2017-01-01

    The evolutionarily conserved Mediator complex is a critical player in regulating transcription. Comprised of approximately two dozen proteins, the Mediator integrates diverse regulatory signals through direct protein-protein interactions that, in turn, modulate the influence of Mediator on RNA Polymerase II activity. One Mediator subunit, MED28, is known to interact with cytoplasmic structural proteins, providing a potential direct link between cytoplasmic dynamics and the control of gene transcription. Although identified in many animals and plants, MED28 is not present in yeast; no bona fide MED28 has been described previously in Caenorhabditis elegans. Here, we identify bioinformatically F28F8.5, an uncharacterized predicted protein, as the nematode homologue of MED28. As in other Metazoa, F28F8.5 has dual nuclear and cytoplasmic localization and plays critical roles in the regulation of development. F28F8.5 is a vital gene and its null mutants have severely malformed gonads and do not reproduce. F28F8.5 interacts on the protein level with the Mediator subunits MDT-6 and MDT-30. Our results indicate that F28F8.5 is an orthologue of MED28 and suggest that the potential to link cytoplasmic and nuclear events is conserved between MED28 vertebrate and nematode orthologues.

  3. Drosophila homologue of Diaphanous 1 (DIAPH1) controls the metastatic potential of colon cancer cells by regulating microtubule-dependent adhesion.

    Science.gov (United States)

    Lin, Yuan-Na; Bhuwania, Ridhirama; Gromova, Kira; Failla, Antonio Virgilio; Lange, Tobias; Riecken, Kristoffer; Linder, Stefan; Kneussel, Matthias; Izbicki, Jakob R; Windhorst, Sabine

    2015-07-30

    Drosophila homologue of Diaphanous 1 (DIAPH1) regulates actin polymerization and microtubule (MT) stabilization upon stimulation with lysophosphatidic acid (LPA). Recently, we showed strongly reduced lung metastasis of DIAPH1-depleted colon cancer cells but we found accumulations of DIAPH1-depleted cells in bone marrow. Here, we analyzed possible organ- or tissue-specific metastasis of DIAPH1-depleted HCT-116 cells. Our data confirmed that depletion of DIAPH1 strongly inhibited lung metastasis and revealed that, in contrast to control cells, DIAPH1-depleted cells did not form metastases in further organs. Detailed mechanistic analysis on cells that were not stimulated with LPA to activate the cytoskeleton-modulating activity of DIAPH1, revealed that even under basal conditions DIAPH1 was essential for cellular adhesion to collagen. In non-stimulated cells DIAPH1 did not control actin dynamics but, interestingly, was essential for stabilization of microtubules (MTs). Additionally, DIAPH1 controlled directed vesicle trafficking and with this, local clustering of the adhesion protein integrin-β1 at the plasma membrane. Therefore, we conclude that under non-stimulating conditions DIAPH1 controls cellular adhesion by stabilizing MTs required for local clustering of integrin-β1 at the plasma membrane. Thus, blockade of DIAPH1-tubulin interaction may be a promising approach to inhibit one of the earliest steps in the metastatic cascade of colon cancer.

  4. Analysis of dofA, a fruA-dependent developmental gene, and its homologue, dofB, in Myxococcus xanthus.

    Science.gov (United States)

    Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

    2002-12-01

    The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.

  5. Purification of the spliced leader ribonucleoprotein particle from Leptomonas collosoma revealed the existence of an Sm protein in trypanosomes. Cloning the SmE homologue.

    Science.gov (United States)

    Goncharov, I; Palfi, Z; Bindereif, A; Michaeli, S

    1999-04-30

    Trans-splicing in trypanosomes involves the addition of a common spliced leader (SL) sequence, which is derived from a small RNA, the SL RNA, to all mRNA precursors. The SL RNA is present in the cell in the form of a ribonucleoprotein, the SL RNP. Using conventional chromatography and affinity selection with 2'-O-methylated RNA oligonucleotides at high ionic strength, five proteins of 70, 16, 13, 12, and 8 kDa were co-selected with the SL RNA from Leptomonas collosoma, representing the SL RNP core particle. Under conditions of lower ionic strength, additional proteins of 28 and 20 kDa were revealed. On the basis of peptide sequences, the gene coding for a protein with a predicted molecular weight of 11.9 kDa was cloned and identified as homologue of the cis-spliceosomal SmE. The protein carries the Sm motifs 1 and 2 characteristic of Sm antigens that bind to all known cis-spliceosomal uridylic acid-rich small nuclear RNAs (U snRNAs), suggesting the existence of Sm proteins in trypanosomes. This finding is of special interest because trypanosome snRNPs are the only snRNPs examined to date that are not recognized by anti-Sm antibodies. Because of the early divergence of trypanosomes from the eukaryotic lineage, the trypanosome SmE protein represents one of the primordial Sm proteins in nature.

  6. SLAH1, a homologue of the slow type anion channel SLAC1, modulates shoot Cl − accumulation and salt tolerance in Arabidopsis thaliana

    KAUST Repository

    Qiu, Jiaen

    2016-06-23

    Salinity tolerance is correlated with shoot chloride (Cl–) exclusion in multiple crops, but the molecular mechanisms of long-distance Cl– transport are poorly defined. Here, we characterize the in planta role of AtSLAH1 (a homologue of the slow type anion channel-associated 1 (SLAC1)). This protein, localized to the plasma membrane of root stelar cells, has its expression reduced by salt or ABA, which are key predictions for a protein involved with loading Cl– into the root xylem. Artificial microRNA knockdown mutants of AtSLAH1 had significantly reduced shoot Cl− accumulation when grown under low Cl–, whereas shoot Cl– increased and the shoot nitrate/chloride ratio decreased following AtSLAH1 constitutive or stelar-specific overexpression when grown in high Cl–. In both sets of overexpression lines a significant reduction in shoot biomass over the null segregants was observed under high Cl– supply, but not low Cl– supply. Further in planta data showed AtSLAH3 overexpression increased the shoot nitrate/chloride ratio, consistent with AtSLAH3 favouring nitrate transport. Heterologous expression of AtSLAH1 in Xenopus laevis oocytes led to no detectible transport, suggesting the need for post-translational modifications for AtSLAH1 to be active. Our in planta data are consistent with AtSLAH1 having a role in controlling root-to-shoot Cl– transport.

  7. Rasputin, the Drosophila homologue of the RasGAP SH3 binding protein, functions in ras- and Rho-mediated signaling.

    Science.gov (United States)

    Pazman, C; Mayes, C A; Fanto, M; Haynes, S R; Mlodzik, M

    2000-04-01

    The small GTPase Ras plays an important role in many cellular signaling processes. Ras activity is negatively regulated by GTPase activating proteins (GAPs). It has been proposed that RasGAP may also function as an effector of Ras activity. We have identified and characterized the Drosophila homologue of the RasGAP-binding protein G3BP encoded by rasputin (rin). rin mutants are viable and display defects in photoreceptor recruitment and ommatidial polarity in the eye. Mutations in rin/G3BP genetically interact with components of the Ras signaling pathway that function at the level of Ras and above, but not with Raf/MAPK pathway components. These interactions suggest that Rin is required as an effector in Ras signaling during eye development, supporting an effector role for RasGAP. The ommatidial polarity phenotypes of rin are similar to those of RhoA and the polarity genes, e.g. fz and dsh. Although rin/G3BP interacts genetically with RhoA, affecting both photoreceptor differentiation and polarity, it does not interact with the gain-of-function genotypes of fz and dsh. These data suggest that Rin is not a general component of polarity generation, but serves a function specific to Ras and RhoA signaling pathways.

  8. Identification of the Mycobacterium marinum Apa antigen O-mannosylation sites reveals important glycosylation variability with the M. tuberculosis Apa homologue.

    Science.gov (United States)

    Coddeville, Bernadette; Wu, Sz-Wei; Fabre, Emeline; Brassart, Colette; Rombouts, Yoann; Burguière, Adeline; Kremer, Laurent; Khoo, Kay-Hooi; Elass-Rochard, Elisabeth; Guérardel, Yann

    2012-10-22

    The 45/47 kDa Apa, an immuno-dominant antigen secreted by Mycobacterium tuberculosis is O-mannosylated at multiple sites. Glycosylation of Apa plays a key role in colonization and invasion of the host cells by M. tuberculosis through interactions of Apa with the host immune system C-type lectins. Mycobacterium marinum (M.ma) a fish pathogen, phylogenetically close to M. tuberculosis, induces a granulomatous response with features similar to those described for M. tuberculosis in human. Although M.ma possesses an Apa homologue, its glycosylation status is unknown, and whether this represents a crucial element in the pathophysiology induced by M.ma remains to be addressed. To this aim, we have identified two concanavalin A-reactive 45/47 kDa proteins from M.ma, which have been further purified by a two-step anion exchange chromatography process. Advanced liquid chromatography-nanoESI mass spectrometry-based proteomic analyses of peptides, derived from either tryptic digestion alone or in combination with the Asp-N endoproteinase, established that M.ma Apa possesses up to seven distinct O-mannosylated sites with mainly single mannose substitutions, which can be further extended at the Ser/Thr/Pro rich region near the N-terminus. This opens the way to further studies focussing on the involvement and biological functions of Apa O-mannosylation using the M.ma/zebrafish model. Copyright © 2012 Elsevier B.V. All rights reserved.

  9. Co-precipitation of phosphate and iron limits mitochondrial phosphate availability in Saccharomyces cerevisiae lacking the yeast frataxin homologue (YFH1).

    Science.gov (United States)

    Seguin, Alexandra; Santos, Renata; Pain, Debkumar; Dancis, Andrew; Camadro, Jean-Michel; Lesuisse, Emmanuel

    2011-02-25

    Saccharomyces cerevisiae cells lacking the yeast frataxin homologue (Δyfh1) accumulate iron in the mitochondria in the form of nanoparticles of ferric phosphate. The phosphate content of Δyfh1 mitochondria was higher than that of wild-type mitochondria, but the proportion of mitochondrial phosphate that was soluble was much lower in Δyfh1 cells. The rates of phosphate and iron uptake in vitro by isolated mitochondria were higher for Δyfh1 than wild-type mitochondria, and a significant proportion of the phosphate and iron rapidly became insoluble in the mitochondrial matrix, suggesting co-precipitation of these species after oxidation of iron by oxygen. Increasing the amount of phosphate in the medium decreased the amount of iron accumulated by Δyfh1 cells and improved their growth in an iron-dependent manner, and this effect was mostly transcriptional. Overexpressing the major mitochondrial phosphate carrier, MIR1, slightly increased the concentration of soluble mitochondrial phosphate and significantly improved various mitochondrial functions (cytochromes, [Fe-S] clusters, and respiration) in Δyfh1 cells. We conclude that in Δyfh1 cells, soluble phosphate is limiting, due to its co-precipitation with iron.

  10. Rapid detection, differentiation and typing of methicillin-resistant Staphylococcus aureus harbouring either mecA or the new mecA homologue mecA(LGA251).

    Science.gov (United States)

    Stegger, M; Andersen, P S; Kearns, A; Pichon, B; Holmes, M A; Edwards, G; Laurent, F; Teale, C; Skov, R; Larsen, A R

    2012-04-01

    The recent finding of a new mecA homologue, mecA(LGA251) , with only 70% nucleotide homology to the conventional mecA gene has brought the routine testing for mecA as a confirmatory test for methicillin-resistant Staphylococcus aureus (MRSA) into question. A multiplex PCR was designed to differentiate mecA(LGA251) from the known mecA together with detection of lukF-PV and the spa gene fragments, enabling direct spa typing by sequencing of the PCR amplicons. The PCR analysis and subsequent spa typing were validated on a large collection (n=185) of contemporary MRSA and methicillin-sensitive S. aureus isolates, including 127 isolates carrying mecA(LGA251) . The mecA(LGA251) gene was situated in staphylococcal cassette chromosome mec type XI elements, and sequence variation within a 631-bp fragment of mecA(LGA251) in 79 isolates indicated a very conserved gene sequence. Following a successful validation, the multiplex PCR strategy was implemented in the routine testing of MRSA for national surveillance. Over a 2-month period, among 203 samples tested, 12 new MRSA cases caused by isolates carrying mecA(LGA251) were identified, emphasizing the clinical importance of testing for these new MRSA isolates. © 2011 STATENS SERUM INSTITUT. Clinical Microbiology and Infection © 2011 European Society of Clinical Microbiology and Infectious Diseases.

  11. Perceptions of health promoters about health promotion ...

    African Journals Online (AJOL)

    2013-02-11

    Feb 11, 2013 ... regarding a health promotion programme for families with ... to contribute to high rates of not going to school (ibid. ... sector in order, amongst other objectives, to prevent health ... exercise and mental health promotion must be incorporated ..... (2009:141) identified ignorance and misconception about the.

  12. The TFIID components human TAF(II)140 and Drosophila BIP2 (TAF(II)155) are novel metazoan homologues of yeast TAF(II)47 containing a histone fold and a PHD finger.

    Science.gov (United States)

    Gangloff, Y G; Pointud, J C; Thuault, S; Carré, L; Romier, C; Muratoglu, S; Brand, M; Tora, L; Couderc, J L; Davidson, I

    2001-08-01

    The RNA polymerase II transcription factor TFIID comprises the TATA binding protein (TBP) and a set of TBP-associated factors (TAF(II)s). TFIID has been extensively characterized for yeast, Drosophila, and humans, demonstrating a high degree of conservation of both the amino acid sequences of the constituent TAF(II)s and overall molecular organization. In recent years, it has been assumed that all the metazoan TAF(II)s have been identified, yet no metazoan homologues of yeast TAF(II)47 (yTAF(II)47) and yTAF(II)65 are known. Both of these yTAF(II)s contain a histone fold domain (HFD) which selectively heterodimerizes with that of yTAF(II)25. We have cloned a novel mouse protein, TAF(II)140, containing an HFD and a plant homeodomain (PHD) finger, which we demonstrated by immunoprecipitation to be a mammalian TFIID component. TAF(II)140 shows extensive sequence similarity to Drosophila BIP2 (dBIP2) (dTAF(II)155), which we also show to be a component of Drosophila TFIID. These proteins are metazoan homologues of yTAF(II)47 as their HFDs selectively heterodimerize with dTAF(II)24 and human TAF(II)30, metazoan homologues of yTAF(II)25. We further show that yTAF(II)65 shares two domains with the Drosophila Prodos protein, a recently described potential dTAF(II). These conserved domains are critical for yTAF(II)65 function in vivo. Our results therefore identify metazoan homologues of yTAF(II)47 and yTAF(II)65.

  13. Single-Crystal X-Ray Diffraction Studies of Homologues in the Series nBa(Nb,Zr)O 3+3 mNbO with n=2, 3, 4, 5 and m=1

    Science.gov (United States)

    Nilsson, G.; Svensson, G.

    2001-01-01

    Single crystals of four homologues in the series nBa(Nb,Zr)O3+3mNbO, with n:m=2:1, 3:1, 4:1, and 5:1, were found in the reduced Ba-Nb-Zr-O system. Single-crystal X-ray diffraction data were collected for all the crystals. For all homologues the space group was found to be P4/mmm. The structures can be described as intergrowths of Ba(Nb,Zr)O3 perovskite and NbO slabs. The refined cell parameters and compositions of the 2:1, 3:1, and 4:1 homologues are a=4.1768(5) Å and c=12.269(2) Å for Ba2Nb4.5(1)Zr0.5(1)O9, a=4.1769(5) Å and c=16.493(3) Å for Ba3+δNb4.8(2)-δ Zr1.2(2)O12-δ (δ=0.098(4)), and a=4.1747(6) Å and c= 20.619(4) Å for Ba4+δNb5.1(4)-δZr1.9(4)O15-δ (δ=0.270(9)). The refined cell parameters of the 5:1 homologue are a=4.1727(3) Å and c=24.804(3) Å. Zr replaces Nb only in the NbO6 octahedra found in the perovskite slabs.

  14. Short-chain chlorinated paraffins in soil, paddy seeds (Oryza sativa) and snails (Ampullariidae) in an e-waste dismantling area in China: Homologue group pattern, spatial distribution and risk assessment.

    Science.gov (United States)

    Yuan, Bo; Fu, Jianjie; Wang, Yawei; Jiang, Guibin

    2017-01-01

    Short-chain chlorinated paraffins (SCCPs) in multi-environmental matrices are studied in Taizhou, Zhejiang Province, China, which is a notorious e-waste dismantling area. The investigated matrices consist of paddy field soil, paddy seeds (Oryza sativa, separated into hulls and rice unpolished) and apple snails (Ampullariidae, inhabiting the paddy fields). The sampling area covered a 65-km radius around the contamination center. C 10 and C 11 are the two predominant homologue groups in the area, accounting for about 35.7% and 33.0% of total SCCPs, respectively. SCCPs in snails and hulls are generally higher than in soil samples (30.4-530 ng/g dw), and SCCPs in hulls are approximate five times higher than in corresponding rice samples (4.90-55.1 ng/g dw). Homologue pattern analysis indicates that paddy seeds (both hull and rice) tend to accumulate relatively high volatile SCCP homologues, especially the ones with shorter carbon chain length, while snails tend to accumulate relatively high lipophilic homologues, especially the ones with more substituted chlorines. SCCPs in both paddy seeds and snails are linearly related to those in the soil. The e-waste dismantling area, which covers a radius of approximate 20 km, shows higher pollution levels for SCCPs according to their spatial distribution in four matrices. The preliminary assessment indicates that SCCP levels in local soils pose no significant ecological risk for soil dwelling organisms, but higher risks from dietary exposure of SCCPs are suspected for people living in e-waste dismantling area. Copyright © 2016 Elsevier Ltd. All rights reserved.

  15. Two mannose-binding lectin homologues and an MBL-associated serine protease are expressed in the gut epithelia of the urochordate species Ciona intestinalis

    DEFF Research Database (Denmark)

    Skjødt, Mikkel-Ole; Palarasah, Yaseelan; Rasmussen, Karina Juhl

    2010-01-01

    The lectin complement pathway has important functions in vertebrate host defence and accumulating evidence of primordial complement components trace its emergence to invertebrate phyla. We introduce two putative mannose-binding lectin homologues (CioMBLs) from the urochordate species Ciona intest...... protease in the epithelia cells lining the stomach and intestine. In conclusion we present two urochordate MBLs and identify an associated serine protease, which support the concept of an evolutionary ancient origin of the lectin complement pathway....

  16. Health Promotion Education

    DEFF Research Database (Denmark)

    Lehn-Christiansen, Sine

    The paper discusses the implications of health promotion in education. The paper is based on my PhD project entitled “Health promotion education seen through a power/knowledge and subjectification perspective” (in prep). The PhD project explores how professional health promotion skills are concei......The paper discusses the implications of health promotion in education. The paper is based on my PhD project entitled “Health promotion education seen through a power/knowledge and subjectification perspective” (in prep). The PhD project explores how professional health promotion skills...

  17. Unique variability of tocopherol composition in various seed oils recovered from by-products of apple industry: rapid and simple determination of all four homologues (α, β, γ and δ) by RP-HPLC/FLD.

    Science.gov (United States)

    Górnaś, Paweł

    2015-04-01

    The tocochromanol profile was studied in seed oils recovered from by-products of fruit industry, five dessert and seven crab apple varieties grown in Eastern Europe (Latvia). The seed oils obtained from dessert apples were characterized by higher contents of tocopherols (191.05-379.08 mg/100g oil) when compared to seed oils recovered from crab apples (130.55-202.54 mg/100g oil). The predominant homologues of tocopherol in all the studied samples were α and β over γ and δ. However, seed oils recovered from the apple cultivars 'Antej' and 'Beforest' had a unique profile of four tocopherol homologues (α:β:γ:δ) 91.41:80.55:72.46:79.03 and 114.55:112.84:78.69:73.00 mg/100g oil, respectively. A single dilution of seed oils in 2-propanol facilitated the direct use samples in the DPPH assay as well as injection into the RP-HPLC system containing a PFP (pentafluorophenyl) column, which resulted in a rapid separation of all four tocopherol homologues with excellent repeatability and reproducibility. Copyright © 2014 Elsevier Ltd. All rights reserved.

  18. Promoting preschool reading

    OpenAIRE

    Istenič, Vesna

    2013-01-01

    The thesis titled Promoting preschool reading consists of a theoretiral and an empirical part. In the theoretical part I wrote about reading, the importance of reading, types of reading, about reading motivation, promoting reading motivation, internal and external motivation, influence of reading motivation on the child's reading activity, reading and familial literacy, the role of adults in promotion reading literacy, reading to a child and promoting reading in pre-school years, where I ...

  19. What do health-promoting schools promote?

    DEFF Research Database (Denmark)

    Simovska, Venka

    2012-01-01

    -promotion interventions. Directly or indirectly the articles reiterate the idea that health promotion in schools needs to be linked with the core task of the school – education, and to the values inherent to education, such as inclusion, democracy, participation and influence, critical literacy and action competence......Purpose – The editorial aims to provide a brief overview of the individual contributions to the special issue, and a commentary positioning the contributions within research relating to the health-promoting schools initiative in Europe. Design/methodology/approach – The members of the Schools...... for Health in Europe Research Group were invited to submit their work addressing processes and outcomes in school health promotion to this special issue of Health Education. Additionally, an open call for papers was published on the Health Education web site. Following the traditional double blind peer...

  20. Deep mRNA sequencing of the Tritonia diomedea brain transcriptome provides access to gene homologues for neuronal excitability, synaptic transmission and peptidergic signalling.

    Directory of Open Access Journals (Sweden)

    Adriano Senatore

    Full Text Available The sea slug Tritonia diomedea (Mollusca, Gastropoda, Nudibranchia, has a simple and highly accessible nervous system, making it useful for studying neuronal and synaptic mechanisms underlying behavior. Although many important contributions have been made using Tritonia, until now, a lack of genetic information has impeded exploration at the molecular level.We performed Illumina sequencing of central nervous system mRNAs from Tritonia, generating 133.1 million 100 base pair, paired-end reads. De novo reconstruction of the RNA-Seq data yielded a total of 185,546 contigs, which partitioned into 123,154 non-redundant gene clusters (unigenes. BLAST comparison with RefSeq and Swiss-Prot protein databases, as well as mRNA data from other invertebrates (gastropod molluscs: Aplysia californica, Lymnaea stagnalis and Biomphalaria glabrata; cnidarian: Nematostella vectensis revealed that up to 76,292 unigenes in the Tritonia transcriptome have putative homologues in other databases, 18,246 of which are below a more stringent E-value cut-off of 1x10-6. In silico prediction of secreted proteins from the Tritonia transcriptome shotgun assembly (TSA produced a database of 579 unique sequences of secreted proteins, which also exhibited markedly higher expression levels compared to other genes in the TSA.Our efforts greatly expand the availability of gene sequences available for Tritonia diomedea. We were able to extract full length protein sequences for most queried genes, including those involved in electrical excitability, synaptic vesicle release and neurotransmission, thus confirming that the transcriptome will serve as a useful tool for probing the molecular correlates of behavior in this species. We also generated a neurosecretome database that will serve as a useful tool for probing peptidergic signalling systems in the Tritonia brain.

  1. Regulation of the Src Kinase-associated Phosphoprotein 55 Homologue by the Protein Tyrosine Phosphatase PTP-PEST in the Control of Cell Motility*

    Science.gov (United States)

    Ayoub, Emily; Hall, Anita; Scott, Adam M.; Chagnon, Mélanie J.; Miquel, Géraldine; Hallé, Maxime; Noda, Masaharu; Bikfalvi, Andreas; Tremblay, Michel L.

    2013-01-01

    PTP-PEST is a cytosolic ubiquitous protein tyrosine phosphatase (PTP) that contains, in addition to its catalytic domain, several protein-protein interaction domains that allow it to interface with several signaling pathways. Among others, PTP-PEST is a key regulator of cellular motility and cytoskeleton dynamics. The complexity of the PTP-PEST interactome underscores the necessity to identify its interacting partners and physiological substrates in order to further understand its role in focal adhesion complex turnover and actin organization. Using a modified yeast substrate trapping two-hybrid system, we identified a cytosolic adaptor protein named Src kinase-associated phosphoprotein 55 homologue (SKAP-Hom) as a novel substrate of PTP-PEST. To confirm PTP-PEST interaction with SKAP-Hom, in vitro pull down assays were performed demonstrating that the PTP catalytic domain and Proline-rich 1 (P1) domain are respectively binding to the SKAP-Hom Y260 and Y297 residues and its SH3 domain. Subsequently, we generated and rescued SKAP-Hom-deficient mouse embryonic fibroblasts (MEFs) with WT SKAP-Hom, SKAP-Hom tyrosine mutants (Y260F, Y260F/Y297F), or SKAP-Hom SH3 domain mutant (W335K). Given the role of PTP-PEST, wound-healing and trans-well migration assays were performed using the generated lines. Indeed, SKAP-Hom-deficient MEFs showed a defect in migration compared with WT-rescued MEFs. Interestingly, the SH3 domain mutant-rescued MEFs showed an enhanced cell migration corresponding potentially with higher tyrosine phosphorylation levels of SKAP-Hom. These findings suggest a novel role of SKAP-Hom and its phosphorylation in the regulation of cellular motility. Moreover, these results open new avenues by which PTP-PEST regulates cellular migration, a hallmark of metastasis. PMID:23897807

  2. BmajPLA2-II, a basic Lys49-phospholipase A2 homologue from Bothrops marajoensis snake venom with parasiticidal potential.

    Science.gov (United States)

    Grabner, Amy N; Alfonso, Jorge; Kayano, Anderson M; Moreira-Dill, Leandro S; Dos Santos, Ana Paula de A; Caldeira, Cleópatra A S; Sobrinho, Juliana C; Gómez, Ana; Grabner, Fernando P; Cardoso, Fabio F; Zuliani, Juliana Pavan; Fontes, Marcos R M; Pimenta, Daniel C; Gómez, Celeste Vega; Teles, Carolina B G; Soares, Andreimar M; Calderon, Leonardo A

    2017-09-01

    Snake venoms contain various proteins, especially phospholipases A 2 (PLA 2 s), which present potential applications in diverse areas of health and medicine. In this study, a new basic PLA 2 from Bothrops marajoensis with parasiticidal activity was purified and characterized biochemically and biologically. B. marajoensis venom was fractionated through cation exchange followed by reverse phase chromatographies. The isolated toxin, BmajPLA 2 -II, was structurally characterized with MALDI-TOF (Matrix-assisted laser desorption/ionization-time of flight) mass spectrometry, sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE), followed by two-dimensional electrophoresis, partial amino acid sequencing, an enzymatic activity assay, circular dichroism, and dynamic light scattering assays. These structural characterization tests presented BmajPLA 2 -II as a basic Lys49 PLA 2 homologue, compatible with other basic snake venom PLA 2 s (svPLA 2 ), with a tendency to form aggregations. The in vitro anti-parasitic potential of B. marajoensis venom and of BmajPLA 2 -II was evaluated against Leishmania infantum promastigotes and Trypanosoma cruzi epimastigotes, showing significant activity at a concentration of 100μg/mL. The venom and BmajPLA 2 -II presented IC 50 of 0.14±0.08 and 6.41±0.64μg/mL, respectively, against intraerythrocytic forms of Plasmodium falciparum with CC 50 cytotoxicity values against HepG2 cells of 43.64±7.94 and >150μg/mL, respectively. The biotechnological potential of these substances in relation to leishmaniasis, Chagas disease and malaria should be more deeply investigated. Copyright © 2017. Published by Elsevier B.V.

  3. An Arabidopsis chloroplast-targeted Hsp101 homologue, APG6, has an essential role in chloroplast development as well as heat-stress response.

    Science.gov (United States)

    Myouga, Fumiyoshi; Motohashi, Reiko; Kuromori, Takashi; Nagata, Noriko; Shinozaki, Kazuo

    2006-10-01

    Analysis of albino or pale-green (apg) mutants is important for identifying nuclear genes responsible for chloroplast development and pigment synthesis. We have identified 38 apg mutants by screening 11 000 Arabidopsis Ds-tagged lines. One mutant, apg6, contains a Ds insertion in a gene encoding APG6 (ClpB3), a homologue of the heat-shock protein Hsp101 (ClpB1). We isolated somatic revertants and identified two Ds-tagged and one T-DNA-tagged mutant alleles of apg6. All three alleles gave the same pale-green phenotype. These results suggest that APG6 is important for chloroplast development. The APG6 protein contains a transit peptide and is localized in chloroplasts. The plastids of apg6 pale-green cells were smaller than those of the wild type, and contained undeveloped thylakoid membranes. APG6 mRNA accumulated in response to heat shock in various organs, but not in response to other abiotic stresses. Under normal conditions, APG6 is constitutively expressed in the root tips, the organ boundary region, the reproductive tissues of mature plants where plastids exist as proplastids, and slightly in the stems and leaves. In addition, constitutive overexpression of APG6 in transgenic plants inhibited chloroplast development and resulted in a mild pale-green phenotype. The amounts of chloroplast proteins related to photosynthesis were markedly decreased in apg6 mutants. These results suggest that APG6 functions as a molecular chaperone involved in plastid differentiation mediating internal thylakoid membrane formation and conferring thermotolerance to chloroplasts during heat stress. The APG6 protein is not only involved in heat-stress response in chloroplasts, but is also essential for chloroplast development.

  4. E3B1, a human homologue of the mouse gene product Abi-1, sensitizes activation of Rap1 in response to epidermal growth factor

    International Nuclear Information System (INIS)

    Jenei, Veronika; Andersson, Tommy; Jakus, Judit; Dib, Karim

    2005-01-01

    E3B1, a human homologue of the mouse gene product Abi-1, has been implicated in growth-factor-mediated regulation of the small GTPases p21 Ras and Rac. E3b1 is a regulator of Rac because it can form a complex with Sos-1 and eps8, and such a Sos-1-e3B1-eps8 complex serves as a guanine nucleotide exchange factor for Rac. In the present study, we found that overexpression of e3B1 in NIH3T3/EGFR cells sensitized EGF-induced activation of Rac1, whereas it had no impact on EGF-induced activation of p21 Ras . Remarkably, we found that EGF-induced activation of the p21 Ras -related GTPase Rap1 was also sensitized in NIH3T3/EGFR-e3B1 cells. Thus, in NIH3T3/EGFR-e3B1 cells, maximal EGF-induced activation of Rap1 occurs with a dose of EGF much lower than in NIH3T3/EGFR cells. We also report that overexpression of e3B1 in NIH3T3/EGFR cells renders EGF-induced activation of Rap1 completely dependent on Src tyrosine kinases but not on c-Abl. However, EGF-induced tyrosine phosphorylation of the Rap GEF C3G occurred regardless of whether e3B1 was overexpressed or not, and this did not involve Src tyrosine kinases. Accordingly, we propose that overexpression of e3B1 in NIH3T3/EGFR cells leads to mobilization of Src tyrosine kinases that participate in EGF-induced activation of Rap1 and inhibition of cell proliferation

  5. Effect of Phosphatase and Tensin Homologue on Chromosome 10 on Angiotensin II-Mediated Proliferation, Collagen Synthesis, and Akt/P27 Signaling in Neonatal Rat Cardiac Fibroblasts

    Directory of Open Access Journals (Sweden)

    Ling Nie

    2016-01-01

    Full Text Available Cardiac fibroblasts (CFs play a key role in cardiac fibrosis by regulating the balance between extracellular matrix synthesis and breakdown. Although phosphatase and tensin homologue on chromosome 10 (PTEN has been found to play an important role in cardiovascular disease, it is not clear whether PTEN is involved in functional regulation of CFs. In the present study, PTEN was overexpressed in neonatal rat CFs via recombinant adenovirus-mediated gene transfer. The effects of PTEN overexpression on cell-cycle progression and angiotensin II- (Ang II- mediated regulation of collagen metabolism, synthesis of matrix metalloproteinases, and Akt/P27 signaling were investigated. Compared with uninfected cells and cells infected with green fluorescent protein-expressing adenovirus (Ad-GFP, cells infected with PTEN-expressing adenovirus (Ad-PTEN significantly increased PTEN protein and mRNA levels in CFs (P<0.05. The proportion of CFs in the G1/S cell-cycle phase was significantly higher for PTEN-overexpressing cells. In addition, Ad-PTEN decreased mRNA expression and the protein synthesis rate of collagen types I and III and antagonized Ang II-induced collagen synthesis. Overexpression of PTEN also decreased Ang II-induced matrix metalloproteinase-2 (MMP-2 and tissue inhibitor of metalloproteinase-1 (TIMP-1 production as well as gelatinase activity. Moreover, Ad-PTEN decreased Akt expression and increased P27 expression independent of Ang II stimulation. These results suggest that PTEN could regulate its functional effects in neonatal rat CFs partially via the Akt/P27 signaling pathway.

  6. Human CD4+ T cell responses to the dog major allergen Can f 1 and its human homologue tear lipocalin resemble each other.

    Directory of Open Access Journals (Sweden)

    Aino L K Liukko

    Full Text Available Lipocalin allergens form a notable group of proteins, as they contain most of the significant respiratory allergens from mammals. The basis for the allergenic capacity of allergens in the lipocalin family, that is, the development of T-helper type 2 immunity against them, is still unresolved. As immunogenicity has been proposed to be a decisive feature of allergens, the purpose of this work was to examine human CD4+ T cell responses to the major dog allergen Can f 1 and to compare them with those to its human homologue, tear lipocalin (TL. For this, specific T cell lines were induced in vitro from the peripheral blood mononuclear cells of Can f 1-allergic and healthy dog dust-exposed subjects with peptides containing the immunodominant T cell epitopes of Can f 1 and the corresponding TL peptides. We found that the frequency of Can f 1 and TL-specific T cells in both subject groups was low and close to each other, the difference being about two-fold. Importantly, we found that the proliferative responses of both Can f 1 and TL-specific T cell lines from allergic subjects were stronger than those from healthy subjects, but that the strength of the responses within the subject groups did not differ between these two antigens. Moreover, the phenotype of the Can f 1 and TL-specific T cell lines, determined by cytokine production and expression of cell surface markers, resembled each other. The HLA system appeared to have a minimal role in explaining the allergenicity of Can f 1, as the allergic and healthy subjects' HLA background did not differ, and HLA binding was very similar between Can f 1 and TL peptides. Along with existing data on lipocalin allergens, we conclude that strong antigenicity is not decisive for the allergenicity of Can f 1.

  7. Occurrence, homologue patterns and source apportionment of short- and medium-chain chlorinated paraffins in suburban soils of Shanghai, China.

    Science.gov (United States)

    Wang, Xue-Tong; Xu, Si-Yue; Wang, Xi-Kui; Hu, Bao-Ping; Jia, Hao-Hao

    2017-08-01

    In order to systematically investigate the spatial distribution, homologue profiles, and sources of short- and medium-chain chlorinated paraffins (SCCPs and MCCPs) in suburban soils in Shanghai, SCCPs and MCCPs in soils were analyzed using gas chromatography coupled with low resolution mass spectrometry in electron capture negative ion (ECNI) mode (GC-ECNI-MS). The CP concentrations in soils were between not detected (ND) - 697 ng g -1 with a median value of 3.52 ng g -1 for SCCPs, and ND - 666 ng g -1 with a median value of 15.3 ng g -1 for MCCPs, respectively. The concentrations of MCCPs in most soils were higher than that of SCCPs. The total CP concentrations (sum of SCCPs and MCCPs) in soils varied from ND to 964 ng g -1 with a median value of 20.5 ng g -1 . The concentration of MCCPs was higher than that of SCCPs in most soils. The levels of SCCPs and MCCPs in suburban soils in Shanghai were at the medium level when compared to other areas around the world. No significant correlation was observed between soil CP concentrations and total organic carbon contents (p > 0.05). For different use type of soils, the median concentrations of CPs in soils were found higher in greenland than that in other areas probably due to busy traffic, sewage sludge application and/or wastewater irrigation. All soils were divided into two groups by hierarchical cluster analysis (HCA) both for SCCPs and MCCPs. Three discharge sources of CPs in suburban soil of Shanghai were identified by PMF model. Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. LD-aminopterin in the canine homologue of human atopic dermatitis: a randomized, controlled trial reveals dosing factors affecting optimal therapy.

    Science.gov (United States)

    Zebala, John A; Mundell, Alan; Messinger, Linda; Griffin, Craig E; Schuler, Aaron D; Kahn, Stuart J

    2014-01-01

    Options are limited for patients with atopic dermatitis (AD) who do not respond to topical treatments. Antifolate therapy with systemic methotrexate improves the disease, but is associated with adverse effects. The investigational antifolate LD-aminopterin may offer improved safety. It is not known how antifolate dose and dosing frequency affect efficacy in AD, but a primary mechanism is thought to involve the antifolate-mediated accumulation of 5-aminoimidazole-4-carboxamide ribonucleotide (AICAR). However, recent in vitro studies indicate that AICAR increases then decreases as a function of antifolate concentration. To address this issue and understand how dosing affects antifolate efficacy in AD, we examined the efficacy and safety of different oral doses and schedules of LD-aminopterin in the canine model of AD. This was a multi-center, double-blind trial involving 75 subjects with canine AD randomized to receive up to 12 weeks of placebo, once-weekly (0.007, 0.014, 0.021 mg/kg) or twice-weekly (0.007 mg/kg) LD-aminopterin. The primary efficacy outcome was the Global Score (GS), a composite of validated measures of disease severity and itch. GS improved in all once-weekly cohorts, with 0.014 mg/kg being optimal and significant (43%, P<0.01). The majority of improvement was seen by 8 weeks. In contrast, GS in the twice-weekly cohort was similar to placebo and worse than all once-weekly cohorts. Adverse events were similar across all treated cohorts and placebo. Once-weekly LD-aminopterin was safe and efficacious in canine AD. Twice-weekly dosing negated efficacy despite having the same daily and weekly dose as effective once-weekly regimens. Optimal dosing in this homologue of human AD correlated with the concentration-selective accumulation of AICAR in vitro, consistent with AICAR mediating LD-aminopterin efficacy in AD.

  9. LD-aminopterin in the canine homologue of human atopic dermatitis: a randomized, controlled trial reveals dosing factors affecting optimal therapy.

    Directory of Open Access Journals (Sweden)

    John A Zebala

    Full Text Available Options are limited for patients with atopic dermatitis (AD who do not respond to topical treatments. Antifolate therapy with systemic methotrexate improves the disease, but is associated with adverse effects. The investigational antifolate LD-aminopterin may offer improved safety. It is not known how antifolate dose and dosing frequency affect efficacy in AD, but a primary mechanism is thought to involve the antifolate-mediated accumulation of 5-aminoimidazole-4-carboxamide ribonucleotide (AICAR. However, recent in vitro studies indicate that AICAR increases then decreases as a function of antifolate concentration. To address this issue and understand how dosing affects antifolate efficacy in AD, we examined the efficacy and safety of different oral doses and schedules of LD-aminopterin in the canine model of AD.This was a multi-center, double-blind trial involving 75 subjects with canine AD randomized to receive up to 12 weeks of placebo, once-weekly (0.007, 0.014, 0.021 mg/kg or twice-weekly (0.007 mg/kg LD-aminopterin. The primary efficacy outcome was the Global Score (GS, a composite of validated measures of disease severity and itch. GS improved in all once-weekly cohorts, with 0.014 mg/kg being optimal and significant (43%, P<0.01. The majority of improvement was seen by 8 weeks. In contrast, GS in the twice-weekly cohort was similar to placebo and worse than all once-weekly cohorts. Adverse events were similar across all treated cohorts and placebo.Once-weekly LD-aminopterin was safe and efficacious in canine AD. Twice-weekly dosing negated efficacy despite having the same daily and weekly dose as effective once-weekly regimens. Optimal dosing in this homologue of human AD correlated with the concentration-selective accumulation of AICAR in vitro, consistent with AICAR mediating LD-aminopterin efficacy in AD.

  10. Isolation and characterization of the human homologue of rig and its pseudogenes: The functional gene has features characteristic of housekeeping genes

    International Nuclear Information System (INIS)

    Shiga, Kiyoto; Yamamoto, Hiroshi; Okamoto, Hiroshi

    1990-01-01

    Rig (rat insulinoma gene) was first isolated from a cDNA library of rat insulinomas and has been found to be activated in various human tumors such as insulinomas, esophageal cancers, and colon cancers. Here the authors isolated the human homologue of rig from a genomic DNA library constructed from a human esophageal carcinoma and determined its complete nucleotide sequence. The gene is composed of about 3,000 nucleotides and divided into four exons separated by three introns: exon 3 encodes the nuclear location signal and the DNA-binding domain of the RIG protein. The transcription initiation site was located at -46 base pairs upstream from the first ATG codon. The 5'-flanking region of the gene has no apparent TATA-box or CAAT-box sequence. However, two GC boxes are found at -189 and -30 base pairs upstream from the transcription initiation site and five GC boxes are also found in introns 1 and 2. The gene is bounded in the 5' region by CpG islands, regions of DNA with a high GC content and a high frequency of CpG dinucleotides relative to the bulk genome. Furthermore, the human genome contains at least six copies of RIG pseudogenes, and four of them have the characteristics of processed pseudogenes. From these results together with the finding that RIG is expressed in a wide variety of tissues and cells, they speculate that RIG belongs to the class of housekeeping genes, whose products are necessary for the growth of all cell types

  11. GEI-8, a homologue of vertebrate nuclear receptor corepressor NCoR/SMRT, regulates gonad development and neuronal functions in Caenorhabditis elegans.

    Directory of Open Access Journals (Sweden)

    Pavol Mikoláš

    Full Text Available NCoR and SMRT are two paralogous vertebrate proteins that function as corepressors with unliganded nuclear receptors. Although C. elegans has a large number of nuclear receptors, orthologues of the corepressors NCoR and SMRT have not unambiguously been identified in Drosophila or C. elegans. Here, we identify GEI-8 as the closest homologue of NCoR and SMRT in C. elegans and demonstrate that GEI-8 is expressed as at least two isoforms throughout development in multiple tissues, including neurons, muscle and intestinal cells. We demonstrate that a homozygous deletion within the gei-8 coding region, which is predicted to encode a truncated protein lacking the predicted NR domain, results in severe mutant phenotypes with developmental defects, slow movement and growth, arrested gonadogenesis and defects in cholinergic neurotransmission. Whole genome expression analysis by microarrays identified sets of de-regulated genes consistent with both the observed mutant phenotypes and a role of GEI-8 in regulating transcription. Interestingly, the upregulated transcripts included a predicted mitochondrial sulfide:quinine reductase encoded by Y9C9A.16. This locus also contains non-coding, 21-U RNAs of the piRNA class. Inhibition of the expression of the region coding for 21-U RNAs leads to irregular gonadogenesis in the homozygous gei-8 mutants, but not in an otherwise wild-type background, suggesting that GEI-8 may function in concert with the 21-U RNAs to regulate gonadogenesis. Our results confirm that GEI-8 is the orthologue of the vertebrate NCoR/SMRT corepressors and demonstrate important roles for this putative transcriptional corepressor in development and neuronal function.

  12. MS4a4B, a CD20 homologue in T cells, inhibits T cell propagation by modulation of cell cycle.

    Directory of Open Access Journals (Sweden)

    Hui Xu

    2010-11-01

    Full Text Available MS4a4B, a CD20 homologue in T cells, is a novel member of the MS4A gene family in mice. The MS4A family includes CD20, FcεRIβ, HTm4 and at least 26 novel members that are characterized by their structural features: with four membrane-spanning domains, two extracellular domains and two cytoplasmic regions. CD20, FcεRIβ and HTm4 have been found to function in B cells, mast cells and hematopoietic cells respectively. However, little is known about the function of MS4a4B in T cell regulation. We demonstrate here that MS4a4B negatively regulates mouse T cell proliferation. MS4a4B is highly expressed in primary T cells, natural killer cells (NK and some T cell lines. But its expression in all malignant T cells, including thymoma and T hybridoma tested, was silenced. Interestingly, its expression was regulated during T cell activation. Viral vector-driven overexpression of MS4a4B in primary T cells and EL4 thymoma cells reduced cell proliferation. In contrast, knockdown of MS4a4B accelerated T cell proliferation. Cell cycle analysis showed that MS4a4B regulated T cell proliferation by inhibiting entry of the cells into S-G2/M phase. MS4a4B-mediated inhibition of cell cycle was correlated with upregulation of Cdk inhibitory proteins and decreased levels of Cdk2 activity, subsequently leading to inhibition of cell cycle progression. Our data indicate that MS4a4B negatively regulates T cell proliferation. MS4a4B, therefore, may serve as a modulator in the negative-feedback regulatory loop of activated T cells.

  13. MS4a4B, a CD20 homologue in T cells, inhibits T cell propagation by modulation of cell cycle.

    Science.gov (United States)

    Xu, Hui; Yan, Yaping; Williams, Mark S; Carey, Gregory B; Yang, Jingxian; Li, Hongmei; Zhang, Guang-Xian; Rostami, Abdolmohamad

    2010-11-01

    MS4a4B, a CD20 homologue in T cells, is a novel member of the MS4A gene family in mice. The MS4A family includes CD20, FcεRIβ, HTm4 and at least 26 novel members that are characterized by their structural features: with four membrane-spanning domains, two extracellular domains and two cytoplasmic regions. CD20, FcεRIβ and HTm4 have been found to function in B cells, mast cells and hematopoietic cells respectively. However, little is known about the function of MS4a4B in T cell regulation. We demonstrate here that MS4a4B negatively regulates mouse T cell proliferation. MS4a4B is highly expressed in primary T cells, natural killer cells (NK) and some T cell lines. But its expression in all malignant T cells, including thymoma and T hybridoma tested, was silenced. Interestingly, its expression was regulated during T cell activation. Viral vector-driven overexpression of MS4a4B in primary T cells and EL4 thymoma cells reduced cell proliferation. In contrast, knockdown of MS4a4B accelerated T cell proliferation. Cell cycle analysis showed that MS4a4B regulated T cell proliferation by inhibiting entry of the cells into S-G2/M phase. MS4a4B-mediated inhibition of cell cycle was correlated with upregulation of Cdk inhibitory proteins and decreased levels of Cdk2 activity, subsequently leading to inhibition of cell cycle progression. Our data indicate that MS4a4B negatively regulates T cell proliferation. MS4a4B, therefore, may serve as a modulator in the negative-feedback regulatory loop of activated T cells.

  14. Radiation promotive concept

    International Nuclear Information System (INIS)

    Shebaita, M.K.

    1975-01-01

    The concept of radiation promotion was proposed in this study. The proposal of this concept was dependent upon stimulation in growth weight of survived chicks when fertile eggs were exposed to 60 Co gamma radiation. It was found that female chick (Promotive Sex) responded to this proposal concept rather than the male. Moreover, the dose level of 640 rads was found to be the Promotive Dose. It is important before applying ionizing radiation as a growth promotive to take into consideration whether you want increasing egg or meat production, as meat promotion in layers breed is bound to decrease egg production. (orig.) [de

  15. SPORT PROMOTION STRATEGIES

    Directory of Open Access Journals (Sweden)

    Alexandru Lucian MIHAI

    2013-10-01

    Full Text Available In sport marketing, the word promotion covers a range of interrelated activities. All of these activities are designed to attract attention, stimulate the interest and awareness of consumers, and of course, encourage them to purchase a sport product. Promotion is about communicating with and educating consumers. The purpose of a sport promotional strategy is to build brand loyalty and product credibility, develop image, and position the brand. A promotional strategy is similar to a marketing strategy, but the promotional strategy seeks short-term objectives, both direct and indirect. Promotional objectives usually include increased sales, stimulate impulse buying, raise customer traffic, and present and reinforce image. It also provides information about products and services, publicizes new stores or websites, and creates and enhances customer satisfaction.

  16. Health promotion in globalization

    Directory of Open Access Journals (Sweden)

    Álvaro Franco-Giraldo

    2012-10-01

    Full Text Available Objective: to unravel some theoretical and factual elements required to implement more effective health promotion strategies and practices in the field of health services whilst following the great challenges that globalization has imposed on the health systems, which are inevitably expressed in the local context (glocalization. Methodology: a narrative review taking into account the concepts of globalization and health promotion in relation to health determinants. The authors approach some courses of action and strategies for health promotion based on the social principles and universal values that guide health promotion, health service reorientation and primary healthcare, empowerment, social participation, and inter-sectoral and social mobilization. Discussion: the discussion focuses on the redirection of health promotion services in relation to the wave of health reforms that has spread throughout the world under the neoliberal rule. The author also discusses health promotion, its ineffectiveness, and the quest for renewal. Likewise, the author sets priorities for health promotion in relation to social determinants. Conclusion: the current global order, in terms of international relations, is not consistent with the ethical principles of health promotion. In this paper, the author advocates for the implementation of actions to change the social and physical life conditions of people based on changes in the use of power in society and the appropriate practice of politics in the context of globalization in order to achieve the effectiveness of the actions of health promotion.

  17. The human homologue of unc-93 maps to chromosome 6q27 – characterisation and analysis in sporadic epithelial ovarian cancer

    Directory of Open Access Journals (Sweden)

    Charnock F Mark L

    2002-10-01

    Full Text Available Abstract Background In sporadic ovarian cancer, we have previously reported allele loss at D6S193 (62% on chromosome 6q27, which suggested the presence of a putative tumour suppressor gene. Based on our data and that from another group, the minimal region of allele loss was between D6S264 and D6S149 (7.4 cM. To identify the putative tumour suppressor gene, we established a physical map initially with YACs and subsequently with PACs/BACs from D6S264 to D6S149. To accelerate the identification of genes, we sequenced the entire contig of approximately 1.1 Mb. Seven genes were identified within the region of allele loss between D6S264 and D6S149. Results The human homologue of unc-93 (UNC93A in C. elegans was identified to be within the interval of allele loss centromeric to D6S149. This gene is 24.5 kb and comprises of 8 exons. There are two transcripts with the shorter one due to splicing out of exon 4. It is expressed in testis, small intestine, spleen, prostate, and ovary. In a panel of 8 ovarian cancer cell lines, UNC93A expression was detected by RT-PCR which identified the two transcripts in 2/8 cell lines. The entire coding sequence was examined for mutations in a panel of ovarian tumours and ovarian cancer cell lines. Mutations were identified in exons 1, 3, 4, 5, 6 and 8. Only 3 mutations were identified specifically in the tumour. These included a c.452G>A (W151X mutation in exon 3, c.676C>T (R226X in exon 5 and c.1225G>A(V409I mutation in exon 8. However, the mutations in exon 3 and 5 were also present in 6% and 2% of the normal population respectively. The UNC93A cDNA was shown to express at the cell membrane and encodes for a protein of 60 kDa. Conclusions These results suggest that no evidence for UNC93A as a tumour suppressor gene in sporadic ovarian cancer has been identified and further research is required to evaluate its normal function and role in the pathogenesis of ovarian cancer.

  18. Plant 115-kDa actin-filament bundling protein, P-115-ABP, is a homologue of plant villin and is widely distributed in cells.

    Science.gov (United States)

    Yokota, Etsuo; Vidali, Luis; Tominaga, Motoki; Tahara, Hiroshi; Orii, Hidefumi; Morizane, Yosuke; Hepler, Peter K; Shimmen, Teruo

    2003-10-01

    In many cases, actin filaments are arranged into bundles and serve as tracks for cytoplasmic streaming in plant cells. We have isolated an actin-filament bundling protein, which is composed of 115-kDa polypeptide (P-115-ABP), from the germinating pollen of lily, Lilium longiflorum [Nakayasu et al. (1998) BIOCHEM: Biophys. Res. Commun. 249: 61]. P-115-ABP shared similar antigenicity with a plant 135-kDa actin-filament bundling protein (P-135-ABP), a plant homologue of villin. A full-length cDNA clone (ABP115; accession no. AB097407) was isolated from an expression cDNA library of lily pollen by immuno-screening using antisera against P-115-ABP and P-135-ABP. The amino acid sequence of P-115-ABP deduced from this clone showed high homology with those of P-135-ABP and four villin isoforms of Arabidopsis thaliana (AtVLN1, AtVLN2, AtVLN3 and AtVLN4), especially AtVLN4, indicating that P-115-ABP can also be classified as a plant villin. The P-115-ABP isolated biochemically from the germinating lily pollen was able to arrange F-actin filaments with uniform polarity into bundles and this bundling activity was suppressed by Ca2+-calmodulin (CaM), similar to the actin-filament bundling properties of P-135-ABP. The P-115-ABP type of plant villin was widely distributed in plant cells, from algae to land plants. In root hair cells of Hydrocharis dubia, this type of plant villin was co-localized with actin-filament bundles in the transvacuolar strands and the sub-cortical regions. Microinjection of the antiserum against P-115-ABP into living root hair cells caused the disappearance of transvaculor strands and alteration of the route of cytoplasmic streaming. In internodal cells of Chara corallina in which the P-135-ABP type of plant villin is lacking, the P-115-ABP type showed co-localization with actin-filament cables anchored on the intracellular surface of chloroplasts. These results indicated that plant villins are widely distributed and involved in the organization of actin

  19. Protein 4.1, a component of the erythrocyte membrane skeleton and its related homologue proteins forming the protein 4.1/FERM superfamily.

    Directory of Open Access Journals (Sweden)

    Aleksander F Sikorski

    2007-01-01

    Full Text Available The review is focused on the domain structure and function of protein 4.1, one of the proteins belonging to the membrane skeleton. The protein 4.1 of the red blood cells (4.1R is a multifunctional protein that localizes to the membrane skeleton and stabilizes erythrocyte shape and membrane mechanical properties, such as deformability and stability, via lateral interactions with spectrin, actin, glycophorin C and protein p55. Protein 4.1 binding is modulated through the action of kinases and/or calmodulin-Ca2+. Non-erythroid cells express the 4.1R homologues: 4.1G (general type, 4.1B (brain type, and 4.1N (neuron type, and the whole group belongs to the protein 4.1 superfamily, which is characterized by the presence of a highly conserved FERM domain at the N-terminus of the molecule. Proteins 4.1R, 4.1G, 4.1N and 4.1B are encoded by different genes. Most of the 4.1 superfamily proteins also contain an actin-binding domain. To date, more than 40 members have been identified. They can be divided into five groups: protein 4.1 molecules, ERM proteins, talin-related molecules, protein tyrosine phosphatase (PTPH proteins and NBL4 proteins. We have focused our attention on the main, well known representatives of 4.1 superfamily and tried to choose the proteins which are close to 4.1R or which have distinct functions. 4.1 family proteins are not just linkers between the plasma membrane and membrane skeleton; they also play an important role in various processes. Some, such as focal adhesion kinase (FAK, non-receptor tyrosine kinase that localizes to focal adhesions in adherent cells, play the role in cell adhesion. The other members control or take part in tumor suppression, regulation of cell cycle progression, inhibition of cell proliferation, downstream signaling of the glutamate receptors, and establishment of cell polarity; some are also involved in cell proliferation, cell motility, and/or cell-to-cell communication.

  20. Drug discovery for Duchenne muscular dystrophy via utrophin promoter activation screening.

    Directory of Open Access Journals (Sweden)

    Catherine Moorwood

    Full Text Available Duchenne muscular dystrophy (DMD is a devastating muscle wasting disease caused by mutations in dystrophin, a muscle cytoskeletal protein. Utrophin is a homologue of dystrophin that can functionally compensate for its absence when expressed at increased levels in the myofibre, as shown by studies in dystrophin-deficient mice. Utrophin upregulation is therefore a promising therapeutic approach for DMD. The use of a small, drug-like molecule to achieve utrophin upregulation offers obvious advantages in terms of delivery and bioavailability. Furthermore, much of the time and expense involved in the development of a new drug can be eliminated by screening molecules that are already approved for clinical use.We developed and validated a cell-based, high-throughput screening assay for utrophin promoter activation, and used it to screen the Prestwick Chemical Library of marketed drugs and natural compounds. Initial screening produced 20 hit molecules, 14 of which exhibited dose-dependent activation of the utrophin promoter and were confirmed as hits. Independent validation demonstrated that one of these compounds, nabumetone, is able to upregulate endogenous utrophin mRNA and protein, in C2C12 muscle cells.We have developed a cell-based, high-throughput screening utrophin promoter assay. Using this assay, we identified and validated a utrophin promoter-activating drug, nabumetone, for which pharmacokinetics and safety in humans are already well described, and which represents a lead compound for utrophin upregulation as a therapy for DMD.

  1. A pomegranate (Punica granatum L.) WD40-repeat gene is a functional homologue of Arabidopsis TTG1 and is involved in the regulation of anthocyanin biosynthesis during pomegranate fruit development.

    Science.gov (United States)

    Ben-Simhon, Zohar; Judeinstein, Sylvie; Nadler-Hassar, Talia; Trainin, Taly; Bar-Ya'akov, Irit; Borochov-Neori, Hamutal; Holland, Doron

    2011-11-01

    Anthocyanins are the major pigments responsible for the pomegranate (Punica granatum L.) fruit skin color. The high variability in fruit external color in pomegranate cultivars reflects variations in anthocyanin composition. To identify genes involved in the regulation of anthocyanin biosynthesis pathway in the pomegranate fruit skin we have isolated, expressed and characterized the pomegranate homologue of the Arabidopsis thaliana TRANSPARENT TESTA GLABRA1 (TTG1), encoding a WD40-repeat protein. The TTG1 protein is a regulator of anthocyanins and proanthocyanidins (PAs) biosynthesis in Arabidopsis, and acts by the formation of a transcriptional regulatory complex with two other regulatory proteins: bHLH and MYB. Our results reveal that the pomegranate gene, designated PgWD40, recovered the anthocyanin, PAs, trichome and seed coat mucilage phenotype in Arabidopsis ttg1 mutant. PgWD40 expression and anthocyanin composition in the skin were analyzed during pomegranate fruit development, in two accessions that differ in skin color intensity and timing of appearance. The results indicate high positive correlation between the total cyanidin derivatives quantity (red pigments) and the expression level of PgWD40. Furthermore, strong correlation was found between the steady state levels of PgWD40 transcripts and the transcripts of pomegranate homologues of the structural genes PgDFR and PgLDOX. PgWD40, PgDFR and PgLDOX expression also correlated with the expression of pomegranate homologues of the regulatory genes PgAn1 (bHLH) and PgAn2 (MYB). On the basis of our results we propose that PgWD40 is involved in the regulation of anthocyanin biosynthesis during pomegranate fruit development and that expression of PgWD40, PgAn1 and PgAn2 in the pomegranate fruit skin is required to regulate the expression of downstream structural genes involved in the anthocyanin biosynthesis.

  2. Promoter reuse in prokaryotes

    NARCIS (Netherlands)

    Nijveen, H.; Matus-Garcia, M.; Passel, van M.W.J.

    2012-01-01

    Anecdotal evidence shows promoters being reused separate from their downstream gene, thus providing a mechanism for the efficient and rapid rewiring of a gene’s transcriptional regulation. We have identified over 4000 groups of highly similar promoters using a conservative sequence similarity search

  3. Health promotion in context:

    DEFF Research Database (Denmark)

    Liveng, Anne; Andersen, Heidi Myglegård; Lehn Christiansen, Sine

    2018-01-01

    Health promotion constitutes a complex field of study, as it addresses multifaceted problems and involves a range of methods and theories. Students in the field of health promotion can find this challenging. To raise their level of reflexivity and support learning we have developed the “context m...

  4. Promotion primer. Foerderfibel

    Energy Technology Data Exchange (ETDEWEB)

    1981-01-01

    This revised edition of the promotion primer is to serve as a topical orientation aid for industrial firms, unions, boards and other bodies interested where the actions of governmental R and D and innovation policy are compiled and clearly arranged. It is important for the success of governmental aids that the institutions concerned are informed about all possibilities of the promotion, financing and advisory programme. Beyond the presentation of the research promotion sectors, the fiscal measures and the contractual as well as the joint research this revised edition focussess on the fields of consultative services for innovation and information. For many firms the access to qualified information and guidance is of particular importance. That is why this brochure points out the ways towards governmental research promotion. The BMFT has provided a remarkable contribution to research promotion by establishing information and consultative services for trade and industry.

  5. Health-promoting schools

    DEFF Research Database (Denmark)

    Kwan, Stella Y L; Petersen, Poul Erik; Pine, Cynthia M

    2005-01-01

    Schools provide an important setting for promoting health, as they reach over 1 billion children worldwide and, through them, the school staff, families and the community as a whole. Health promotion messages can be reinforced throughout the most influential stages of children's lives, enabling...... them to develop lifelong sustainable attitudes and skills. Poor oral health can have a detrimental effect on children's quality of life, their performance at school and their success in later life. This paper examines the global need for promoting oral health through schools. The WHO Global School...... Health Initiative and the potential for setting up oral health programmes in schools using the health-promoting school framework are discussed. The challenges faced in promoting oral health in schools in both developed and developing countries are highlighted. The importance of using a validated...

  6. Discovery of practical production processes for arylsulfur pentafluorides and their higher homologues, bis- and tris(sulfur pentafluorides: Beginning of a new era of “super-trifluoromethyl” arene chemistry and its industry

    Directory of Open Access Journals (Sweden)

    Teruo Umemoto

    2012-03-01

    Full Text Available Various arylsulfur pentafluorides, ArSF5, have long been desired in both academic and industrial areas, and ArSF5 compounds have attracted considerable interest in many areas such as medicines, agrochemicals, and other new materials, since the highly stable SF5 group is considered a “super-trifluoromethyl group” due to its significantly higher electronegativity and lipophilicity. This article describes the first practical method for the production of various arylsulfur pentafluorides and their higher homologues, bis- and tris(sulfur pentafluorides, from the corresponding diaryl disulfides or aryl thiols. The method consists of two steps: (Step 1 treatment of a diaryl disulfide or an aryl thiol with chlorine in the presence of an alkali metal fluoride, and (step 2 treatment of the resulting arylsulfur chlorotetrafluoride with a fluoride source, such as ZnF2, HF, and Sb(III/V fluorides. The intermediate arylsulfur chlorotetrafluorides were isolated by distillation or recrystallization and characterized. The aspects of these new reactions are revealed and reaction mechanisms are discussed. As the method offers considerable improvement over previous methods in cost, yield, practicality, applicability, and large-scale production, the new processes described here can be employed as the first practical methods for the economical production of various arylsulfur pentafluorides and their higher homologues, which could then open up a new era of “super-trifluoromethyl” arene chemistry and its applications in many areas.

  7. Divergent Small Tim Homologues Are Associated with TbTim17 and Critical for the Biogenesis of TbTim17 Protein Complexes in Trypanosoma brucei

    Science.gov (United States)

    Smith, Joseph T.; Singha, Ujjal K.; Misra, Smita

    2018-01-01

    ABSTRACT The small Tim proteins belong to a group of mitochondrial intermembrane space chaperones that aid in the import of mitochondrial inner membrane proteins with internal targeting signals. Trypanosoma brucei, the protozoan parasite that causes African trypanosomiasis, possesses multiple small Tim proteins that include homologues of T. brucei Tim9 (TbTim9) and Tim10 (TbTim10) and a unique small Tim that shares homology with both Tim8 and Tim13 (TbTim8/13). Here, we found that these three small TbTims are expressed as soluble mitochondrial intermembrane space proteins. Coimmunoprecipitation and mass spectrometry analysis showed that the small TbTims stably associated with each other and with TbTim17, the major component of the mitochondrial inner membrane translocase in T. brucei. Yeast two-hybrid analysis indicated direct interactions among the small TbTims; however, their interaction patterns appeared to be different from those of their counterparts in yeast and humans. Knockdown of the small TbTims reduced cell growth and decreased the steady-state level of TbTim17 and T. brucei ADP/ATP carrier (TbAAC), two polytopic mitochondrial inner membrane proteins. Knockdown of small TbTims also reduced the matured complexes of TbTim17 in mitochondria. Depletion of any of the small TbTims reduced TbTim17 import moderately but greatly hampered the stability of the TbTim17 complexes in T. brucei. Altogether, our results revealed that TbTim9, TbTim10, and TbTim8/13 interact with each other, associate with TbTim17, and play a crucial role in the integrity and maintenance of the levels of TbTim17 complexes. IMPORTANCE Trypanosoma brucei is the causative agent of African sleeping sickness. The parasite’s mitochondrion represents a useful source for potential chemotherapeutic targets. Similarly to yeast and humans, mitochondrial functions depend on the import of proteins that are encoded in the nucleus and made in the cytosol. Even though the machinery involved in this

  8. Promoting Your Web Site.

    Science.gov (United States)

    Raeder, Aggi

    1997-01-01

    Discussion of ways to promote sites on the World Wide Web focuses on how search engines work and how they retrieve and identify sites. Appropriate Web links for submitting new sites and for Internet marketing are included. (LRW)

  9. Researching health promotion

    National Research Council Canada - National Science Library

    Platt, Stephen David; Watson, Jonathan

    2000-01-01

    ... the progress towards developing and implementing health promotion interventions that: * * * * are theoretically grounded, socio-culturally appropriate and sustainable involve the redistribution of resources towards those most in need reflect the principles of equity, participation and empowerment incorporate rigorous, methodologically ...

  10. Promoting Global Health

    Directory of Open Access Journals (Sweden)

    Margaret A. Winker, MD

    2015-11-01

    Full Text Available The Editor-in-Chief of the International Journal of MCH and AIDS (IJMA is a member of the World Association of Medical Editors (WAME. The Editorial Board of IJMA believes it is important that the statement on promoting global health and this accompanying editorial is brought to the attention of our readers. Medical journal editors have a social responsibility to promote global health by publishing, whenever possible, research that furthers health worldwide.

  11. Promoting renewable energy technologies

    DEFF Research Database (Denmark)

    Olsen, O.J.; Skytte, K.

    2004-01-01

    % of its annual electricity production. In this paper, we present and discuss the Danish experience as a case of promoting renewable energy technologies. The development path of the two technologies has been very different. Wind power is considered an outright success with fast deployment to decreasing...... technology and its particular context, it is possible to formulate some general principles that can help to create an effective and efficient policy for promoting new renewable energy technologies....

  12. Guarded Type Promotion

    DEFF Research Database (Denmark)

    Winther, Johnni

    2011-01-01

    conditional using the instanceof operator and thus the cast type is redundantly mentioned twice. We propose a new typing rule for Java called Guarded Type Promotion aimed at eliminating the need for the explicit casts when guarded. This new typing rule is backward compatible and has been fully implemented...... in a Java 6 compiler. Through our extensive testing of real-life code we show that guarded casts account for approximately one fourth of all casts and that Guarded Type Promotion can eliminate the need for 95 percent of these guarded casts....

  13. ROMANIAN TOURISM PROMOTION

    Directory of Open Access Journals (Sweden)

    Alexandru-Mircea NEDELEA

    2017-12-01

    Full Text Available The tourism industry is unlike any other because, instead of a product, you are selling a place and all the things it has to offer. You are competing with the entire world every time you promote tourism in a given destination, and this high level of competition demands a creative and unique approach. To be successful, your marketing should constantly put forth the best possible image of your destination, while creating interest on a broad scale in as many ways as possible. Romania has to conceive an efficient promotional mix in order to attract more tourists.

  14. Isolation and characterization of cyp19a1a and cyp19a1b promoters in the protogynous hermaphrodite orange-spotted grouper (Epinephelus coioides).

    Science.gov (United States)

    Zhang, Weimin; Lu, Huijie; Jiang, Haiyan; Li, Mu; Zhang, Shen; Liu, Qiongyou; Zhang, Lihong

    2012-02-01

    Aromatase (CYP19A1) catalyzes the conversion of androgens to estrogens. In teleosts, duplicated copies of cyp19a1 genes, namely cyp19a1a and cyp19a1b, were identified, however, the transcriptional regulation of these two genes remains poorly understood. In the present study, the 5'-flanking regions of the orange-spotted grouper cyp19a1a (gcyp19a1a) and cyp19a1b (gcyp19a1b) genes were isolated and characterized. The proximal promoter regions of both genes were relatively conserved when compared to those of the other teleosts. Notably, a conserved FOXO transcriptional factor binding site was firstly reported in the proximal promoter of gcyp19a1a, and deletion of the region (-112 to -60) containing this site significantly decreased the promoter activities. The deletion of the region (-246 to -112) containing the two conserved FTZ-F1 sites also dramatically decreased the transcriptional activities of gcyp19a1a promoter, and both two FTZ-F1 sites were shown to be stimulatory cis-acting elements. A FTZ-F1 homologue isolated from ricefield eel (eFTZ-F1) up-regulated gcyp19a1a promoter activities possibly via the FTZ-F1 sites, however, a previously identified orange-spotted grouper FTZ-F1 homologue (gFTZ-F1) did not activate the transcription of gcyp19a1a promoter unexpectedly. As to gcyp19a1b promoter, all the deletion constructs did not show good promoter activities in either TM4 or U251-MG cells. Estradiol (100nM) up-regulated gcyp19a1b promoter activities by about 13- and 36-fold in TM4 and U251-MG cells, respectively, via the conserved ERE motif, but did not stimulate gcyp19a1a promoter activities. These results are helpful to further elucidate the regulatory mechanisms of cyp19a1a and cyp19a1b expression in the orange-spotted grouper as well as other teleosts. Copyright © 2011 Elsevier Inc. All rights reserved.

  15. National promotional campaign

    Directory of Open Access Journals (Sweden)

    Pekevski Siniša

    2008-01-01

    Full Text Available Taking an attention to promotion as operational variable in marketing effort, author focused on so called ways of creating national images. As a case of very interesting activity paper discuss an experience of regional chamber of Croatia with activities in upgrading international recognition of national products as well as country as destination in such context.

  16. Buying time promotes happiness

    NARCIS (Netherlands)

    Whillans, Ashley; Dunn, Elizabeth; Smeets, Paul M.; Bekkers, R.H.F.P.; Norton, M.I.

    2017-01-01

    Around the world, increases in wealth have produced an unintended consequence: a rising sense of time scarcity. We provide evidence that using money to buy time can provide a buffer against this time famine, thereby promoting happiness. Using large, diverse samples from the United States, Canada,

  17. 50 Practical Promotion Ideas.

    Science.gov (United States)

    Madeyski, Tom

    1997-01-01

    Includes 50 cost-effective ideas for promoting camp in the areas of recruiting new campers, encouraging returning campers, advertising strategies, printing brochures and other written materials, using photographs, targeting groups for camp facility rental, and effectively using the media. (LP)

  18. Health and health promotion

    NARCIS (Netherlands)

    Kingma, E.M.

    2012-01-01

    Much of our social and political effort, including a portion of the research in this university, is directed towards the promotion of one goal: health. But what is health? Or rather, how should we define health so that it is an identifiable goalpost for our social policies and technological

  19. Promoting tourism destination image

    NARCIS (Netherlands)

    R. Govers (Robert); F.M. Go (Frank); K. Kumar (Kuldeep)

    2007-01-01

    textabstractThis article examines the role of tourism promotion as a component of destination image formation. It reports the findings of a study in which 1,100 respondents from around the globe described their previsit perceived image of seven sample destinations, as well as the information sources

  20. Promoting Continuing Education Programs.

    Science.gov (United States)

    Hendrickson, Gayle A.

    This handbook is intended for use by institutions in marketing their continuing education programs. A section on "Devising Your Strategy" looks at identifying a target audience, determining the marketing approach, and developing a marketing plan and promotional techniques. A discussion of media options looks at the advantages and…

  1. Promoting La Cultura Hispana

    Science.gov (United States)

    Pluviose, David

    2007-01-01

    Launched in 1985 at Arizona State University, the Hispanic Research Center's (HRC) efforts to promote Latino and Chicano art and issues have flourished in recent years. In 2004, the HRC hosted the Arizona International Latina/o Arts Festival in collaboration with the Mesa Southwest Museum. The HRC has also founded a mentoring institute for…

  2. CRP-ductin, the mouse homologue of gp-340/deleted in malignant brain tumors 1 (DMBT1), binds gram-positive and gram-negative bacteria and interacts with lung surfactant protein D

    DEFF Research Database (Denmark)

    Madsen, Jens; Tornøe, Ida; Nielsen, Ole

    2003-01-01

    CRP-ductin is a protein expressed mainly by mucosal epithelial cells in the mouse. Sequence homologies indicate that CRP-ductin is the mouse homologue of human gp-340, a glycoprotein that agglutinates microorganisms and binds the lung mucosal collectin surfactant protein-D (SP-D). Here we report...... that purified CRP-ductin binds human SP-D in a calcium-dependent manner and that the binding is not inhibited by maltose. The same properties have previously been observed for gp-340 binding of SP-D. CRP-ductin also showed calcium-dependent binding to both gram-positive and -negative bacteria. A polyclonal...... antibody raised against gp-340 reacted specifically with CRP-ductin in Western blots. Immunoreactivity to CRP-ductin was found in the exocrine pancreas, in epithelial cells throughout the gastrointestinal tract and in the parotid ducts. A panel of RNA preparations from mouse tissues was screened for CRP...

  3. SimCP3—An Advanced Homologue of SimCP2 as a Solution-Processed Small Molecular Host Material for Blue Phosphorescence Organic Light-Emitting Diodes

    Directory of Open Access Journals (Sweden)

    Yi-Ting Lee

    2016-09-01

    Full Text Available We have overcome the synthetic difficulty of 9,9′,9′′,9′′′,9′′′′,9′′′′′-((phenylsilanetriyltris(benzene-5,3,1-triylhexakis(9H-carbazole (SimCP3 an advanced homologue of previously known SimCP2 as a solution-processed, high triplet gap energy host material for a blue phosphorescence dopant. A series of organic light-emitting diodes based on blue phosphorescence dopant iridium (III bis(4,6-difluorophenylpyridinatopicolate, FIrpic, were fabricated and tested to demonstrate the validity of solution-processed SimCP3 in the device fabrication.

  4. Crystallization and preliminary X-ray diffraction studies of the ubiquitin-like (UbL) domain of the human homologue A of Rad23 (hHR23A) protein.

    Science.gov (United States)

    Chen, Yu Wai; Tajima, Toshitaka; Rees, Martin; Garcia-Maya, Mitla

    2009-09-01

    Human homologue A of Rad23 (hHR23A) plays dual roles in DNA repair as well as serving as a shuttle vehicle targeting polyubiquitinated proteins for degradation. Its N-terminal ubiquitin-like (UbL) domain interacts with the 19S proteasomal cap and provides the docking mechanism for protein delivery. Pyramidal crystals of the UbL domain of hHR23A were obtained by the hanging-drop vapour-diffusion method with ammonium sulfate as the crystallizing agent. The crystals diffracted to beyond 2 A resolution and belonged to the hexagonal space group P6(5)22, with unit-cell parameters a = b = 78.48, c = 63.57 A. The structure was solved by molecular replacement using the UbL domain of yeast Dsk2 as the search model.

  5. Synergistic regulation of the mouse orphan nuclear receptor SHP gene promoter by CLOCK-BMAL1 and LRH-1

    International Nuclear Information System (INIS)

    Oiwa, Ako; Kakizawa, Tomoko; Miyamoto, Takahide; Yamashita, Koh; Jiang, Wei; Takeda, Teiji; Suzuki, Satoru; Hashizume, Kiyoshi

    2007-01-01

    Small heterodimer partner (SHP; NR0B2) is an orphan nuclear receptor and acts as a repressor for wide variety of nuclear hormone receptors. We demonstrated here that mouse SHP mRNA showed a circadian expression pattern in the liver. Transient transfection of the mSHP promoter demonstrated that CLOCK-BMAL1, core circadian clock components, bound to E-box (CACGTG), and stimulated the promoter activity by 4-fold. Liver receptor homologue-1 (LRH-1; NR5A2) stimulated the mSHP promoter, and CLOCK-BMAL1 synergistically enhanced the LRH-1-mediated transactivation. Interestingly, SHP did not affect the CLOCK-BMAL1-mediated promoter activity, but strongly repressed the synergistic activation of CLOCK-BMAL1 and LRH-1. Furthermore, in vitro pull-down assays revealed the existence of direct protein-protein interaction between LRH-1 and CLOCK. In summary, this study shows that CLOCK-BMAL1, LRH-1 and SHP coordinately regulate the mSHP gene to generate the circadian oscillation. The cyclic expression of mSHP may affect daily activity of other nuclear receptors and contribute to circadian liver functions

  6. Influence of l-Leucine and l-Alanine on Lrp Regulation of foo, Coding for F1651, a Pap Homologue

    OpenAIRE

    Berthiaume, Frédéric; Crost, Cécile; Labrie, Vincent; Martin, Christine; Newman, Elaine B.; Harel, Josée

    2004-01-01

    The foo operon encodes F1651 fimbriae that belong to the P-regulatory family and are synthesized by septicemic Escherichia coli. Using an Lrp-deficient host and the lrp gene cloned under the arabinose pBAD promoter, we demonstrated that foo was transcribed proportionally to the amount of Lrp synthesized. l-Leucine and l-alanine decreased drastically the steady-state transcription of foo and modified phase variation, independently of the presence of FooI. Specific mutations in the C-terminal r...

  7. Advancement & Promotion Review: 2003

    CERN Multimedia

    2003-01-01

    Advancement, exceptional advancement and promotion decisions were made at the end of June, following the procedures published in Weekly Bulletin No. 13/2003. These decisions were included, where applicable, in the salaries for the month of July 2003. The award of the periodic step was communicated to staff by the salary shown on the July salary slip. All other decisions are communicated by separate notification. The names of staff receiving exceptional advancements or promotions are now published on the HR Division website and are accessible for consultation only at the following address: http://cern.ch/hr-div/internal/personnel/advlist_2003.asp It is recalled that change of career path proposals submitted to the Technical Engineers and Administrative Careers Committee (TEACC) or to Human Resources Division are being examined with a view to preparing the latters' recommendations by the end of September 2003. Final decisions will be applied retroactively to 1 July 2003. Human Resources Division Tel:...

  8. Examples of sales promotion

    Energy Technology Data Exchange (ETDEWEB)

    Winkel, L.

    The Gas, Electricity and Water Works Cologne (GEW) supplies 4,115 objects with district heat. The connected load totals 830,000 kJ/s, which over the last 10 years has been expanded by an average of 5.3% annually and is currently 2.2% above the national average. The extension of district heat supply has been accomplished without subsidies from the two ZIP programmes. The major objects in Cologne city are to a large extent linked to the GEW district heating network. The goal now is to win more smaller objects in the supply area. To achieve notable new connected load increases in the future, the GEW is conducting a sales promotion drive together with Cologne heating construction firms. The promotion is running under the slogan 'Magically Simple: Heating with District Heat'. Its strategy and execution are described here by the author.

  9. Promoting renewable energy technologies

    International Nuclear Information System (INIS)

    Grenaa Jensen, S.

    2004-06-01

    Technologies using renewable energy sources are receiving increasing interest from both public authorities and power producing companies, mainly because of the environmental advantages they procure in comparison with conventional energy sources. These technologies can be substitution for conventional energy sources and limit damage to the environment. Furthermore, several of the renewable energy technologies satisfy an increasing political goal of self-sufficiency within energy production. The subject of this thesis is promotion of renewable technologies. The primary goal is to increase understanding on how technological development takes place, and establish a theoretical framework that can assist in the construction of policy strategies including instruments for promotion of renewable energy technologies. Technological development is analysed by through quantitative and qualitative methods. (BA)

  10. ADVANCEMENT & PROMOTION REVIEW: 2002

    CERN Multimedia

    2002-01-01

    Advancement, exceptional advancement and promotion decisions were made at the beginning of July, under the new career structure scheme and following the procedures published in Weekly Bulletin No. 11/2002. These decisions were included, where applicable, in the salaries for the month of July 2002. The award of the periodic step was communicated to staff by the salary shown on the July salary slip. All other decisions are communicated by separate notification. The names of staff receiving exceptional advancements or promotions will be published this year on the HR Division website and are accessible for consultation only at the following address : http://cern.ch/hr-div/internal/personnel/advlist.asp It is recalled that change of career path proposals submitted to the Technical Engineers and Administrative Careers Committee (TEACC) or to Human Resources Division are being examined with a view to preparing the latters' recommendations by the end of September 2002. Final decisions will be applied retroactivel...

  11. Governmentality in health promotion

    DEFF Research Database (Denmark)

    Jelsøe, Erling; Land, Birgit; Pedersen, Kirsten Bransholm

    Objectives: Issues of governance in health promotion during the last 3-4 decades has increasingly been seen as characterized by health interventions and campaigns aimed at influencing the citizens to exhibit a certain desired behavior, that is an orientation towards generating self...... is not sufficient to ensure healthy behaviour. Such measures are used in the public as well as the private sector. In this paper we will give a number of examples of this development and a preliminary analysis of the social framework for its emergence. Methods: The paper will present a theoretical discussion...... was conducted as a case oriented search in relevant media and available documents illustrating the tendency towards using coercive measures to promote healthy behaviour. This was followed up through semi-structured interviews with actors from public authorities, organizations and companies with experience...

  12. : Healthy lifestyles’ promotion

    OpenAIRE

    Fernández Gómez, Erika; Díaz-Campo, Jesús

    2014-01-01

    International audience; The goal of this research was to analyse the advertising of food broadcast by the two Spanish private thematic channels aimed at children with more audience in Spain (Neox and Boing). A content analysis was made in order to study the commercials showed during the hours of children’s enhanced protection established by the normative of this country. The paper presents the increasing concern about kids´ obesity and the role of food industry. Healthy lifestyles are promote...

  13. Promoting Health, Producing Moralisms?

    DEFF Research Database (Denmark)

    Brogaard Kristensen, Dorthe; Askegaard, Søren; Hauge Jeppesen, Lene

    2010-01-01

    Based on an ethnographic study of 25 Danish consumers, the aim of this paper is threefold. Firstly, based on a critique of traditional approaches to consumer health campaigning, it argues for a more socially diversified approach for understanding consumer construction and pursuit of healthy...... behaviour. Secondly, it presents a typology of discourses that are employed by consumers in constructing their (health oriented) food consumption. Thirdly, it addresses certain social and moral dilemmas inherent in consumer health promotional campaigns....

  14. Functional dissection of the promoter of the pollen-specific gene NTP303 reveals a novel pollen-specific, and conserved cis-regulatory element.

    Science.gov (United States)

    Weterings, K; Schrauwen, J; Wullems, G; Twell, D

    1995-07-01

    Regulatory elements within the promoter of the pollen-specific NTP303 gene from tobacco were analysed by transient and stable expression analyses. Analysis of precisely targeted mutations showed that the NTP303 promoter is not regulated by any of the previously described pollen-specific cis-regulatory elements. However, two adjacent regions from -103 to -86 bp and from -86 to -59 bp were shown to contain sequences which positively regulated the NTP303 promoter. Both of these regions were capable of driving pollen-specific expression from a heterologous promoter, independent of orientation and in an additive manner. The boundaries of the minimal, functional NTP303 promoter were determined to lie within the region -86 to -51 bp. The sequence AAATGA localized from -94 to -89 bp was identified as a novel cis-acting element, of which the TGA triplet was shown to comprise an active part. This element was shown to be completely conserved in the similarly regulated promoter of the Bp 10 gene from Brassica napus encoding a homologue of the NTP303 gene.

  15. MicroRNA-155 promotes autophagy to eliminate intracellular mycobacteria by targeting Rheb.

    Science.gov (United States)

    Wang, Jinli; Yang, Kun; Zhou, Lin; Minhaowu; Wu, Yongjian; Zhu, Min; Lai, Xiaomin; Chen, Tao; Feng, Lianqiang; Li, Meiyu; Huang, Chunyu; Zhong, Qiu; Huang, Xi

    2013-01-01

    Mycobacterium tuberculosis is a hard-to-eradicate intracellular pathogen that infects one-third of the global population. It can live within macrophages owning to its ability to arrest phagolysosome biogenesis. Autophagy has recently been identified as an effective way to control the intracellular mycobacteria by enhancing phagosome maturation. In the present study, we demonstrate a novel role of miR-155 in regulating the autophagy-mediated anti-mycobacterial response. Both in vivo and in vitro studies showed that miR-155 expression was significantly enhanced after mycobacterial infection. Forced expression of miR-155 accelerated the autophagic response in macrophages, thus promoting the maturation of mycobacterial phagosomes and decreasing the survival rate of intracellular mycobacteria, while transfection with miR-155 inhibitor increased mycobacterial survival. However, macrophage-mediated mycobacterial phagocytosis was not affected after miR-155 overexpression or inhibition. Furthermore, blocking autophagy with specific inhibitor 3-methyladenine or silencing of autophagy related gene 7 (Atg7) reduced the ability of miR-155 to promote autophagy and mycobacterial elimination. More importantly, our study demonstrated that miR-155 bound to the 3'-untranslated region of Ras homologue enriched in brain (Rheb), a negative regulator of autophagy, accelerated the process of autophagy and sequential killing of intracellular mycobacteria by suppressing Rheb expression. Our results reveal a novel role of miR-155 in regulating autophagy-mediated mycobacterial elimination by targeting Rheb, and provide potential targets for clinical treatment.

  16. MicroRNA-155 promotes autophagy to eliminate intracellular mycobacteria by targeting Rheb.

    Directory of Open Access Journals (Sweden)

    Jinli Wang

    Full Text Available Mycobacterium tuberculosis is a hard-to-eradicate intracellular pathogen that infects one-third of the global population. It can live within macrophages owning to its ability to arrest phagolysosome biogenesis. Autophagy has recently been identified as an effective way to control the intracellular mycobacteria by enhancing phagosome maturation. In the present study, we demonstrate a novel role of miR-155 in regulating the autophagy-mediated anti-mycobacterial response. Both in vivo and in vitro studies showed that miR-155 expression was significantly enhanced after mycobacterial infection. Forced expression of miR-155 accelerated the autophagic response in macrophages, thus promoting the maturation of mycobacterial phagosomes and decreasing the survival rate of intracellular mycobacteria, while transfection with miR-155 inhibitor increased mycobacterial survival. However, macrophage-mediated mycobacterial phagocytosis was not affected after miR-155 overexpression or inhibition. Furthermore, blocking autophagy with specific inhibitor 3-methyladenine or silencing of autophagy related gene 7 (Atg7 reduced the ability of miR-155 to promote autophagy and mycobacterial elimination. More importantly, our study demonstrated that miR-155 bound to the 3'-untranslated region of Ras homologue enriched in brain (Rheb, a negative regulator of autophagy, accelerated the process of autophagy and sequential killing of intracellular mycobacteria by suppressing Rheb expression. Our results reveal a novel role of miR-155 in regulating autophagy-mediated mycobacterial elimination by targeting Rheb, and provide potential targets for clinical treatment.

  17. The study on Egr-1 promoter which is radioactive promoter

    International Nuclear Information System (INIS)

    Zhang Chunzhi; Guo Yang; Lv Zhonghong

    2006-01-01

    Radiogenetic therapy is a heated reaseach on oncotherapy. Early growth response gene-1 (Egr-1) gene promoter is a probably means in radiogenetic therapy. The article review studying on Egr-1 gene promoter and constructing regulating gene expressing system by radiation-inducible Egr-1 gene promoter. (authors)

  18. A soluble RecN homologue provides means for biochemical and genetic analysis of DNA double-strand break repair in Escherichia coli.

    Science.gov (United States)

    Grove, Jane I; Wood, Stuart R; Briggs, Geoffrey S; Oldham, Neil J; Lloyd, Robert G

    2009-12-03

    RecN is a highly conserved, SMC-like protein in bacteria. It plays an important role in the repair of DNA double-strand breaks and is therefore a key factor in maintaining genome integrity. The insolubility of Escherichia coli RecN has limited efforts to unravel its function. We overcame this limitation by replacing the resident coding sequence with that of Haemophilus influenzae RecN. The heterologous construct expresses Haemophilus RecN from the SOS-inducible E. coli promoter. The hybrid gene is fully functional, promoting survival after I-SceI induced DNA breakage, gamma irradiation or exposure to mitomycin C as effectively as the native gene, indicating that the repair activity is conserved between these two species. H. influenzae RecN is quite soluble, even when expressed at high levels, and is readily purified. Its analysis by ionisation-mass spectrometry, gel filtration and glutaraldehyde crosslinking indicates that it is probably a dimer under physiological conditions, although a higher multimer cannot be excluded. The purified protein displays a weak ATPase activity that is essential for its DNA repair function in vivo. However, no DNA-binding activity was detected, which contrasts with RecN from Bacillus subtilis. RecN proteins from Aquifex aeolicus and Bacteriodes fragilis also proved soluble. Neither binds DNA, but the Aquifex RecN has weak ATPase activity. Our findings support studies indicating that RecN, and the SOS response in general, behave differently in E. coli and B. subtilis. The hybrid recN reported provides new opportunities to study the genetics and biochemistry of how RecN operates in E. coli.

  19. Isolation and functional characterization of a cotton ubiquitination-related promoter and 5'UTR that drives high levels of expression in root and flower tissues

    Directory of Open Access Journals (Sweden)

    Viana Antonio AB

    2011-11-01

    Full Text Available Abstract Background Cotton (Gossypium spp. is an important crop worldwide that provides raw material to 40% of the textile fiber industry. Important traits have been studied aiming the development of genetically modified crops including resistance to insect and diseases, and tolerance to drought, cold and herbicide. Therefore, the characterization of promoters and regulatory regions is also important to achieve high gene expression and/or a specific expression pattern. Commonly, genes involved in ubiquitination pathways are highly and differentially expressed. In this study, we analyzed the expression of a cotton ubiquitin-conjugating enzyme (E2 family member with no previous characterization. Results Nucleotide analysis revealed high identity with cotton E2 homologues. Multiple alignment showed a premature stop codon, which prevents the encoding of the conserved cysteine residue at the E2 active site, and an intron that is spliced in E2 homologues, but not in GhGDRP85. The GhGDRP85 gene is highly expressed in different organs of cotton plants, and has high transcript levels in roots. Its promoter (uceApro2 and the 5'UTR compose a regulatory region named uceA1.7, and were isolated from cotton and studied in Arabidopsis thaliana. uceA1.7 shows strong expression levels, equaling or surpassing the expression levels of CaMV35S. The uceA1.7 regulatory sequence drives GUS expression 7-fold higher in flowers, 2-fold in roots and at similar levels in leaves and stems. GUS expression levels are decreased 7- to 15-fold when its 5'UTR is absent in uceApro2. Conclusions uceA1.7 is a strong constitutive regulatory sequence composed of a promoter (uceApro2 and its 5'UTR that will be useful in genetic transformation of dicots, having high potential to drive high levels of transgene expression in crops, particularly for traits desirable in flower and root tissues.

  20. Isolation and functional characterization of a cotton ubiquitination-related promoter and 5'UTR that drives high levels of expression in root and flower tissues.

    Science.gov (United States)

    Viana, Antonio A B; Fragoso, Rodrigo R; Guimarães, Luciane M; Pontes, Naiara; Oliveira-Neto, Osmundo B; Artico, Sinara; Nardeli, Sarah M; Alves-Ferreira, Marcio; Batista, João A N; Silva, Maria C M; Grossi-de-Sa, Maria F

    2011-11-24

    Cotton (Gossypium spp.) is an important crop worldwide that provides raw material to 40% of the textile fiber industry. Important traits have been studied aiming the development of genetically modified crops including resistance to insect and diseases, and tolerance to drought, cold and herbicide. Therefore, the characterization of promoters and regulatory regions is also important to achieve high gene expression and/or a specific expression pattern. Commonly, genes involved in ubiquitination pathways are highly and differentially expressed. In this study, we analyzed the expression of a cotton ubiquitin-conjugating enzyme (E2) family member with no previous characterization. Nucleotide analysis revealed high identity with cotton E2 homologues. Multiple alignment showed a premature stop codon, which prevents the encoding of the conserved cysteine residue at the E2 active site, and an intron that is spliced in E2 homologues, but not in GhGDRP85. The GhGDRP85 gene is highly expressed in different organs of cotton plants, and has high transcript levels in roots. Its promoter (uceApro2) and the 5'UTR compose a regulatory region named uceA1.7, and were isolated from cotton and studied in Arabidopsis thaliana. uceA1.7 shows strong expression levels, equaling or surpassing the expression levels of CaMV35S. The uceA1.7 regulatory sequence drives GUS expression 7-fold higher in flowers, 2-fold in roots and at similar levels in leaves and stems. GUS expression levels are decreased 7- to 15-fold when its 5'UTR is absent in uceApro2. uceA1.7 is a strong constitutive regulatory sequence composed of a promoter (uceApro2) and its 5'UTR that will be useful in genetic transformation of dicots, having high potential to drive high levels of transgene expression in crops, particularly for traits desirable in flower and root tissues.

  1. Renewable energy sources (promotion)

    International Nuclear Information System (INIS)

    Cook, F.

    1986-01-01

    Permission to present a Bill to establish an independent commission directly responsible for the research, development and demonstration of clean, renewable, alternative sources of energy (to nuclear energy) is requested. The paragraphs of the preamble to the Bill are summarized by the Member seeking permission. The main reason for promoting renewable energy sources is opposition to the nuclear industry. One objection was raised. However, permission was granted to present the Bill and it was read for the first time with a second reading ordered for 7 March 1986. The Bill itself is not reprinted but the permission and question are reported verbatim. (U.K.)

  2. The Promoted Sibling

    DEFF Research Database (Denmark)

    Visholm, Steen

    to understand challenges to leaders in postmodern organisations. Theories about leadership has until now been occupied with the vertical relations in the organisations. To lead a team of creative people the leader has to pay attention both to the relations between leader and followers and to the relations...... to the psychodynamic understanding of families, groups and organisations. With a point of departure in a study of self-governing groups in a factory the paper introduces the concept: ‘the promoted sibling’ which provide quite some understanding of the middle managers challenges in his or her role and the challenges...

  3. Leadership Styles Promote Teamwork

    Directory of Open Access Journals (Sweden)

    Khater Aldoshan

    2015-08-01

    Full Text Available This paper will evaluate the importance of learning leadership styles and the explanation of when and how each one is used in the workforce. In this paper many experts have been cited that are well-known in the field of leadership. Also this paper will concentrate on the importance of teamwork in the workforce and there are many examples of how teamwork is effective for creating the best possible outcomes for creativity and productivity. In the television industry creativity is an essential component of the job description and inspirational leadership that promotes teamwork is essential.

  4. MetR and CRP bind to the Vibrio harveyi lux promoters and regulate luminescence.

    Science.gov (United States)

    Chatterjee, Jaidip; Miyamoto, Carol M; Zouzoulas, Athina; Lang, B Franz; Skouris, Nicolas; Meighen, Edward A

    2002-10-01

    The induction of luminescence in Vibrio harveyi at the later stages of growth is controlled by a quorum-sensing mechanism in addition to nutritional signals. However, the mechanism of transmission of these signals directly to the lux promoters is unknown and only one regulatory protein, LuxR, has been shown to bind directly to lux promoter DNA. In this report, we have cloned and sequenced two genes, crp and metR, coding for the nutritional regulators, CRP (cAMP receptor protein) and MetR (a LysR homologue), involved in catabolite repression and methionine biosynthesis respectively. The metR gene was cloned based on a general strategy to detect lux DNA-binding proteins expressed from a genomic library, whereas the crp gene was cloned based on its complementation of an Escherichia coli crp mutant. Both CRP and MetR were shown to bind to lux promoter DNA, with CRP being dependent on the presence of cAMP. Expression studies indicated that the two regulators had opposite effects on luminescence: CRP was an activator and MetR a repressor. Disruption of crp decreased luminescence by about 1,000-fold showing that CRP is a major activator of luminescence the same as LuxR, whereas disruption of MetR resulted in activation of luminescence over 10-fold, confirming its function as a repressor. Comparison of the levels of the autoinducers involved in quorum sensing excreted by V. harveyi, and the crp and metR mutants, showed that autoinducer production was not significantly different, thus indicating that the nutritional signals do not affect luminescence by changing the levels of the signals required for quorum sensing. Indeed, the large effects of these nutritional sensors show that luminescence is controlled by multiple signals related to the environment and the cell density which must be integrated at the molecular level to control expression at the lux promoters.

  5. [Promoting Research Integrity].

    Science.gov (United States)

    Suzuki, Hiromichi

    2018-01-01

     Japan Agency for Medical Research and Development (AMED) was launched in April 2015 to promote integrated medical research and development (R&D) ranging from basic research to practical applications, in order to smoothly achieve the nationwide application of research outcomes, and to establish an environment therefor. AMED consolidates budgets for R&D expenses, which had previously been allocated from different sources, such as the Ministry of Education, Culture, Sports, Science and Technology, the Ministry of Health, Labour and Welfare, and the Ministry of Economy, Trade and Industry. It provides funds strategically to universities, research institutions, etc. By promoting medical R&D, AMED aims to achieve the world's highest level of medical care/services to contribute to a society in which people live long and healthy lives. To achieve this mission, it is imperative that R&D funded by AMED is widely understood and supported. Maintaining and improving research integrity is a prerequisite to this end. AMED is taking various measures to ensure fair and appropriate R&D. It is asking researchers to participate in its responsible conduct in research (RCR) education program and to comply with its rules for managing conflicts of interest (COI). In addition, AMED also conducts a grant program to create and distribute a variety of educational materials on RCR and other matters. Further, AMED is establishing a platform that allows researchers to exchange information about research integrity, and it is undertaking additional measures, such as holding meetings and international symposia on research integrity.

  6. The promotion of happiness.

    Science.gov (United States)

    Klamut, Marian Kazimierz

    2002-01-01

    The human mind is capable of creating an internal world--the psychic sphere--including the phenomena characteristic of human nature, such as selfconsciousness, conscious experiences, conceptual thinking, symbolic language, dreams, art, creation of culture, sense of values, interest in the distant past and care about the distant future. According to the exceptionally concordant opinions of the sages and scholars of the East and the West it is just within this internal world that human happiness dwells. Happiness is a state of the spirit which consists in: internal peace, satisfaction with one's life, the joy of life, benevolence and cordiality towards oneself and towards others; sensitivity to the beauty of nature, culture and art; harmonious co-existence with the surroundings. The achievement and experiencing of the states of thus understood happiness depend mainly on ourselves and, similarly to the project of health promotion, require knowledge, willingness and possibilities. Happiness Promotion denotes the commendation and popularizing of a certain definite way of thinking and acting--showing the road which leads to the frequent experiencing of happy moments.

  7. Gene dosage effects of the imprinted delta-like homologue 1 (dlk1/pref1 in development: implications for the evolution of imprinting.

    Directory of Open Access Journals (Sweden)

    Simao Teixeira da Rocha

    2009-02-01

    Full Text Available Genomic imprinting is a normal process that causes genes to be expressed according to parental origin. The selective advantage conferred by imprinting is not understood but is hypothesised to act on dosage-critical genes. Here, we report a unique model in which the consequences of a single, double, and triple dosage of the imprinted Dlk1/Pref1, normally repressed on the maternally inherited chromosome, can be assessed in the growing embryo. BAC-transgenic mice were generated that over-express Dlk1 from endogenous regulators at all sites of embryonic activity. Triple dosage causes lethality associated with major organ abnormalities. Embryos expressing a double dose of Dlk1, recapitulating loss of imprinting, are growth enhanced but fail to thrive in early life, despite the early growth advantage. Thus, any benefit conferred by increased embryonic size is offset by postnatal lethality. We propose a negative correlation between gene dosage and survival that fixes an upper limit on growth promotion by Dlk1, and we hypothesize that trade-off between growth and lethality might have driven imprinting at this locus.

  8. Fission Yeast SCYL1/2 Homologue Ppk32: A Novel Regulator of TOR Signalling That Governs Survival during Brefeldin A Induced Stress to Protein Trafficking.

    Science.gov (United States)

    Kowalczyk, Katarzyna M; Petersen, Janni

    2016-05-01

    Target of Rapamycin (TOR) signalling allows eukaryotic cells to adjust cell growth in response to changes in their nutritional and environmental context. The two distinct TOR complexes (TORC1/2) localise to the cell's internal membrane compartments; the endoplasmic reticulum (ER), Golgi apparatus and lysosomes/vacuoles. Here, we show that Ppk32, a SCYL family pseudo-kinase, is a novel regulator of TOR signalling. The absence of ppk32 expression confers resistance to TOR inhibition. Ppk32 inhibition of TORC1 is critical for cell survival following Brefeldin A (BFA) induced stress. Treatment of wild type cells with either the TORC1 specific inhibitor rapamycin or the general TOR inhibitor Torin1 confirmed that a reduction in TORC1 activity promoted recovery from BFA induced stress. Phosphorylation of Ppk32 on two residues that are conserved within the SCYL pseudo-kinase family are required for this TOR inhibition. Phosphorylation on these sites controls Ppk32 protein levels and sensitivity to BFA. BFA induced ER stress does not account for the response to BFA that we report here, however BFA is also known to induce Golgi stress and impair traffic to lysosomes. In summary, Ppk32 reduce TOR signalling in response to BFA induced stress to support cell survival.

  9. A Phyletically Rare Gene Promotes the Niche-specific Fitness of an E. coli Pathogen during Bacteremia

    Science.gov (United States)

    Wiles, Travis J.; Lewis, Adam J.; Mobley, Harry L. T.; Casjens, Sherwood R.; Mulvey, Matthew A.

    2013-01-01

    In bacteria, laterally acquired genes are often concentrated within chromosomal regions known as genomic islands. Using a recently developed zebrafish infection model, we set out to identify unique factors encoded within genomic islands that contribute to the fitness and virulence of a reference urosepsis isolate—extraintestinal pathogenic Escherichia coli strain CFT073. By screening a series of deletion mutants, we discovered a previously uncharacterized gene, neaT, that is conditionally required by the pathogen during systemic infections. In vitro assays indicate that neaT can limit bacterial interactions with host phagocytes and alter the aggregative properties of CFT073. The neaT gene is localized within an integrated P2-like bacteriophage in CFT073, but was rarely found within other proteobacterial genomes. Sequence-based analyses revealed that neaT homologues are present, but discordantly conserved, within a phyletically diverse set of bacterial species. In CFT073, neaT appears to be unameliorated, having an exceptionally A+T-rich composition along with a notably altered codon bias. These data suggest that neaT was recently brought into the proteobacterial pan-genome from an extra-phyletic source. Interestingly, even in G+C-poor genomes, as found within the Firmicutes lineage, neaT-like genes are often unameliorated. Sequence-level features of neaT homologues challenge the common supposition that the A+T-rich nature of many recently acquired genes reflects the nucleotide composition of their genomes of origin. In total, these findings highlight the complexity of the evolutionary forces that can affect the acquisition, utilization, and assimilation of rare genes that promote the niche-dependent fitness and virulence of a bacterial pathogen. PMID:23459509

  10. TRYPTOPHAN PROMOTES CHARITABLE DONATING

    Directory of Open Access Journals (Sweden)

    Laura eSteenbergen

    2014-12-01

    Full Text Available The link between serotonin (5-HT and one of the most important elements of prosocial behavior, charity, has remained largely uninvestigated. In the present study, we tested whether charitable donating can be promoted by administering the food supplement L-Tryptophan (TRP, the biochemical precursor of 5-HT. Participants were compared with respect to the amount of money they donated when given the opportunity to make a charitable donation. As expected, compared to a neutral placebo, TRP appears to increase the participants’ willingness to donate money to a charity. This result supports the idea that the food we eat may act as a cognitive enhancer modulating the way we think and perceive the world and others.

  11. Anger Promotes Economic Conservatism.

    Science.gov (United States)

    Kettle, Keri L; Salerno, Anthony

    2017-10-01

    Research suggests that certain facets of people's political ideals can be motivated by different goals. Although it is widely accepted that emotions motivate goal-directed behavior, less is known about how emotion-specific goals may influence different facets of ideology. In this research, we examine how anger affects political ideology and through what mechanisms such effects occur. Drawing on the dual-process motivational model of ideology and the functionalist perspective of emotion, we propose that anger leads people to support conservative economic ideals, which promote economic independence and discourage societal resource sharing. Four studies support our hypothesis that anger can enhance support for an election candidate espousing conservative economic ideals. We find that anger shifts people toward economic conservatism by orienting them toward competition for resources. Implications and future research on the relationship between emotions and political ideology are discussed.

  12. Buying time promotes happiness.

    Science.gov (United States)

    Whillans, Ashley V; Dunn, Elizabeth W; Smeets, Paul; Bekkers, Rene; Norton, Michael I

    2017-08-08

    Around the world, increases in wealth have produced an unintended consequence: a rising sense of time scarcity. We provide evidence that using money to buy time can provide a buffer against this time famine, thereby promoting happiness. Using large, diverse samples from the United States, Canada, Denmark, and The Netherlands ( n = 6,271), we show that individuals who spend money on time-saving services report greater life satisfaction. A field experiment provides causal evidence that working adults report greater happiness after spending money on a time-saving purchase than on a material purchase. Together, these results suggest that using money to buy time can protect people from the detrimental effects of time pressure on life satisfaction.

  13. Ambient oxygen promotes tumorigenesis.

    Directory of Open Access Journals (Sweden)

    Ho Joong Sung

    2011-05-01

    Full Text Available Oxygen serves as an essential factor for oxidative stress, and it has been shown to be a mutagen in bacteria. While it is well established that ambient oxygen can also cause genomic instability in cultured mammalian cells, its effect on de novo tumorigenesis at the organismal level is unclear. Herein, by decreasing ambient oxygen exposure, we report a ∼50% increase in the median tumor-free survival time of p53-/- mice. In the thymus, reducing oxygen exposure decreased the levels of oxidative DNA damage and RAG recombinase, both of which are known to promote lymphomagenesis in p53-/- mice. Oxygen is further shown to be associated with genomic instability in two additional cancer models involving the APC tumor suppressor gene and chemical carcinogenesis. Together, these observations represent the first report directly testing the effect of ambient oxygen on de novo tumorigenesis and provide important physiologic evidence demonstrating its critical role in increasing genomic instability in vivo.

  14. Promoting household energy conservation

    International Nuclear Information System (INIS)

    Steg, Linda

    2008-01-01

    It is commonly assumed that households must change their behaviour to reduce the problems caused by increasing levels of fossil energy use. Strategies for behaviour change will be more effective if they target the most important causes of the behaviour in question. Therefore, this paper first discusses the factors influencing household energy use. Three barriers to fossil fuel energy conservation are discussed: insufficient knowledge of effective ways to reduce household energy use, the low priority and high costs of energy savings, and the lack of feasible alternatives. Next, the paper elaborates on the effectiveness and acceptability of strategies aimed to promote household energy savings. Informational strategies aimed at changing individuals' knowledge, perceptions, cognitions, motivations and norms, as well as structural strategies aimed at changing the context in which decisions are made, are discussed. This paper focuses on the psychological literature on household energy conservation, which mostly examined the effects of informational strategies. Finally, this paper lists important topics for future research

  15. The Saccharomyces cerevisiae RAD30 gene, a homologue of Escherichia coli dinB and umuC, is DNA damage inducible and functions in a novel error-free postreplication repair mechanism

    Energy Technology Data Exchange (ETDEWEB)

    McDonald, J. P. [NIH, Bethesda, MD. (United States); Levine, A. S.; Woodgate, R.

    1997-12-15

    Damage-inducible mutagenesis in prokaryotes is largely dependent upon the activity of the UmuD'C-like proteins. Since many DNA repair processes are structurally and/or functionally conserved between prokaryotes and eukaryotes, we investigated the role of RAD30, a previously uncharacterized Saccharomyces cerevisiae DNA repair gene related to the Escherichia coli dinB, umuC and S. cerevisiae REV1 genes, in UV resistance and UV-induced mutagenesis. Similar to its prokaryotic homologues, RAD30 was found to be damage inducible. Like many S. cerevisiae genes involved in error-prone DNA repair, epistasis analysis clearly places RAD30 in the RAD6 group and rad30 mutants display moderate UV sensitivity reminiscent of rev mutants. However, unlike rev mutants, no defect in UV-induced reversion was seen in rad30 strains. While rad6 and rad18 are both epistatic to rad30, no epistasis was observed with rev1, rev3, rev7 or rad5, all of which are members of the RAD6 epistasis group. These findings suggest that RD30 participates in a novel error-free repair pathway dependent on RAD6 and RAD18, but independent of REV1, REV3, REV7 and RAD5. (author)

  16. Ethnopoly promotes tolerance

    CERN Document Server

    CERN Bulletin

    2010-01-01

    On Friday 23 April, 225 primary school children from the eight schools in Meyrin-Cointrin and their accompanying adults took part in a big game of Ethnopoly. Private individuals, associations, administrations, shopkeepers and CERN all opened their doors to them to talk about their countries, their customs and what they are doing to promote tolerance and integration.   The CERN stand set up at ForumMeyrin for the Ethnopoly game. Scurrying from one place to another, the 10 and 11 year olds were made aware of the rich cultural diversity of their commune, which is home to 130 different nationalities. Physicists and engineers from CERN took up residence in the Forum Meyrin for the day in order to talk to the children about the advantages of international collaboration, a subject dear to the Organization's heart. They welcomed around fifty children in the course of the day, conveying to them a message of tolerance: despite their differences, the 10,000 scientists and other members of the CERN...

  17. What promotes longevity?

    Directory of Open Access Journals (Sweden)

    Agnieszka Kujawska

    2017-09-01

    Full Text Available Introduction Scientists try to answer on the need of a long life with a full physical capability Nonagenarians, centenarians and their closest family members are characterized by a survival benefit throughout life. Moreover, twin studies of longevity suggest that around 25% of the variation in lifespan in developed countries may be inherited. It is therefore worth to examine the role of inter-relationship between nature vs nurture in longevity increment. Material and methods Articles in the EBSCO database have been analyzed using keywords: longevity, gene, behavior, environment. The available literature was subjectively selected. Then, the newest version of every paper was searched for. Results Restriction of calories as well as intake of desirable nutrients can promote adequate control of metabolic pathways and gene expression. APOE, DRD4, Paraoxonase 1, SIRT 3 and SIRT 5 genes can play an important role in longevity. Conclusions Genetic profile and environmental factors seems to both influence on the longevity. Relationships between genetic profile, behavior pattern, quality of life, years spent free from activity limitations and longevity should be examined, to be able to give a recipe on living a long and happy life.

  18. Promotion and Fast Food Demand

    OpenAIRE

    Timothy J. Richards; Luis Padilla

    2009-01-01

    Many believe that fast food promotion is a significant cause of the obesity epidemic in North America. Industry members argue that promotion only reallocates brand shares and does not increase overall demand. We study the effect of fast food promotion on market share and total demand by estimating a discrete / continuous model of fast food restaurant choice and food expenditure that explicitly accounts for both spatial and temporal determinants of demand. Estimates are obtained using a unique...

  19. Health promotion in the workplace

    OpenAIRE

    Sultan T Al-Otaibi

    2016-01-01

    The objective of this review was to describe the scientific evidence for coordinating health promotion at the workplace and to discuss the required future research in this field. Literature review from March 1990 to November 2014 was performed. Using the keywords ′health, promotion, worksite and workplace′, literature was searched in the following databases: Medline, PubMed and Google Scholar; with no time limit. There is emerging evidence that workplace health promotion enhances the effectiv...

  20. Sales promotions and food consumption.

    Science.gov (United States)

    Hawkes, Corinna

    2009-06-01

    Sales promotions are widely used to market food to adults, children, and youth. Yet, in contrast to advertising, practically no attention has been paid to their impacts on dietary behaviors, or to how they may be used more effectively to promote healthy eating. This review explores the available literature on the subject. The objective is to identify if and what literature exists, examine the nature of this literature, and analyze what can be learned from it about the effects of sales promotions on food consumption. The review finds that while sales promotions lead to significant sales increases over the short-term, this does not necessarily lead to changes in food-consumption patterns. Nevertheless, there is evidence from econometric modeling studies indicating that sales promotions can influence consumption patterns by influencing the purchasing choices of consumers and encouraging them to eat more. These effects depend on the characteristics of the food product, sales promotion, and consumer. The complexity of the effects means that sales promotions aiming to encourage consumption of nutritious foods need to be carefully designed. These conclusions are based on studies that use mainly sales data as a proxy for dietary intake. The nutrition (and economics) research communities should add to this existing body of research to provide evidence on the impact of sales promotions on dietary intake and related behaviors. This would help support the development of a sales promotion environment conducive to healthy eating.

  1. Etude par génétique inverse du gène codant la protéine TARGET OF RAPAMYCIN d'Arabidopsis thaliana (AtTOR), l'homologue d'une kinase contrôlant la croissance cellulaire chez les eucaryotes

    OpenAIRE

    Menand, Benoit

    2002-01-01

    TOR (target of rapamycin) protein kinases were identified in yeast, mammals and Drosophila as central controllers of cell growth. Thu, G1 to S phases progression through the cell cycle is blocked by rapamycin, a drug which specifically inhibits TOR activity by forming a ternary complex with the peptidyl-prolyl isomerase FKBP12 (FK506 and rapamycin binding protein), and the FKBP-rapamycin binding domain (FRB) of TOR proteins. This work presents the study, the Arabidopsis homologue of yeast and...

  2. Cloning, characterization and promoter analysis of common carp

    Indian Academy of Sciences (India)

    Some members of hairy/Enhancer-of-split-related gene (HES) family have important effects on axial mesoderm segmentation and the establishment and maintenance of the somite fringe. In fishes, the her6 gene, a member of the HES family, is the homologue of hes1 in mammals and chicken. In this study, the her6 gene ...

  3. Biofilms promote altruism.

    Science.gov (United States)

    Kreft, Jan-Ulrich

    2004-08-01

    The origin of altruism is a fundamental problem in evolution, and the maintenance of biodiversity is a fundamental problem in ecology. These two problems combine with the fundamental microbiological question of whether it is always advantageous for a unicellular organism to grow as fast as possible. The common basis for these three themes is a trade-off between growth rate and growth yield, which in turn is based on irreversible thermodynamics. The trade-off creates an evolutionary alternative between two strategies: high growth yield at low growth rate versus high growth rate at low growth yield. High growth yield at low growth rate is a case of an altruistic strategy because it increases the fitness of the group by using resources economically at the cost of decreased fitness, or growth rate, of the individual. The group-beneficial behaviour is advantageous in the long term, whereas the high growth rate strategy is advantageous in the short term. Coexistence of species requires differences between their niches, and niche space is typically divided into four 'axes' (time, space, resources, predators). This neglects survival strategies based on cooperation, which extend the possibilities of coexistence, arguing for the inclusion of cooperation as the fifth 'axis'. Here, individual-based model simulations show that spatial structure, as in, for example, biofilms, is necessary for the origin and maintenance of this 'primitive' altruistic strategy and that the common belief that growth rate but not yield decides the outcome of competition is based on chemostat models and experiments. This evolutionary perspective on life in biofilms can explain long-known biofilm characteristics, such as the structural organization into microcolonies, the often-observed lack of mixing among microcolonies, and the shedding of single cells, as promoting the origin and maintenance of the altruistic strategy. Whereas biofilms enrich altruists, enrichment cultures, microbiology's paradigm

  4. Promotion mix and industrial marketing

    Directory of Open Access Journals (Sweden)

    Jovičić Dragoljub

    2007-01-01

    Full Text Available Promotion activities are very important and irreplaceable marketing instrument in placement of production goods. In contrast to final consumption goods, where advertising has an absolute priority compared to another promotion activities, personal sale and development of sale dominate during placement of production goods.

  5. Promotion mix and industrial marketing

    OpenAIRE

    Jovičić Dragoljub

    2007-01-01

    Promotion activities are very important and irreplaceable marketing instrument in placement of production goods. In contrast to final consumption goods, where advertising has an absolute priority compared to another promotion activities, personal sale and development of sale dominate during placement of production goods.

  6. PROMOTION STRATEGIES IN WINE MARKETING

    Directory of Open Access Journals (Sweden)

    Ştefan MATEI

    2014-06-01

    Full Text Available Marketing has proven to be very useful instrument in the wine industry, in fostering comprehensive, cohesive and effective strategies which wineries require to effectively compete in today’s almost saturated wine market. But within wine marketing, the promotion strategy, from our point of view, is the most important component of the winery that can ensure the success in the market or can shorten the life cycle of the product. This being said, the aim of the paper is twofold. Firstly, to determine and analyze the steps that are required to create a promotion strategy in the wine industry, by comparing different approaches. Secondly, to identify the instruments of the promotional mix that helps a winery to implement its promotional strategy. Bearing that in mind, the paper starts with some theoretical aspects regarding the promotion strategy and ends by providing a brief overview of the main findings.

  7. Literature promotion in Public Libraries

    DEFF Research Database (Denmark)

    Kann-Christensen, Nanna; Balling, Gitte

    2011-01-01

    This article discusses a model that can be used in order to analyse notions on literature promotion in public libraries. The model integrates different issues which interact with how literature promotion is understood and thought of in public libraries. Besides cultural policy we regard the logics...... of new public management (NPM) and professional logics in the field of public libraries. Cultural policy along with the identification of underlying logics present among politicians, government officials, managers and librarians/promoters of literature, play an important part in creating an understanding...... of literature promotion in Danish libraries. Thus the basic premise for the development of the model is that cultural policy (Policy) has an important influence on notions on literature promotion and other activities in public libraries, but that cultural policy must be seen in some kind of interaction...

  8. MCH promotes family planning.

    Science.gov (United States)

    Duan, Y

    1992-06-01

    Family planning (FP) has been promoted in China through improvements in maternal and child health (MCH) which have affected people's attitude toward childbearing. A case study of FP in Taicang County of Jiangsu Province, China is given. Total population is 446,620; natural increase is 10/1000. 99% of births have been planned in recent years. Contraceptive prevalence has reached 92.71%. Contraceptive awareness has opened people up to health education in general. The community participates in management of human wastes, improvement of water supplies, and parasite control in rural areas. MCH was begun in the early 1980s with premarital examinations, prenatal examinations, postnatal visits, and physical checkups. A systematic program has established in 1983. A pilot program integrating FP, MCH, and parasite control operated between 1984 and 1986, in 7 townships was established and MCH was institutionalized. Increases occurred in comprehensive care for women from 49.1% in 1984 to 78.3% in 1986. Children's coverage rose from 78.2% to 85.9%. Perinatal mortality dropped from 30.2/1000 to 20.8/1000. Neonatal mortality declined from 21.3/1000 to 17.3/1000. Infant mortality also decreased from 31.6/1000 to 21.5/1000. Integration of programs throughout the county was achieved after 1987. 99% of women used the MCH handbook. Between 1987 and 1990, the perinatal, neonatal, and infant mortality rate dropped to 12.9/1000, 9.5/1000, and 14.7/1000, respectively. MCH achievements are attributed to a strengthening of the MCH network to improve access and improve MCH workers' level of professional skill, to the availability of premarriage and couples of reproductive age services and child care, and to the contribution of research. Careful monitoring during pregnancy helped reduce the incidence of difficult labors for high risk women from 17.55 in 1984 to 11-15% in recent years. 99.9% deliver in hospitals. There were no maternal deaths in 1989 or 1990. Neonatal tetanus has been

  9. Molecular and functional characterization of a human ATM gene analogue at Arabidopsis thaliana; Caracterisation moleculaire et Fonctionnelle d'un Homologue du gene humain ATM chez Arabidopsis thaliana

    Energy Technology Data Exchange (ETDEWEB)

    Garcia, V.

    2001-12-15

    The human ATM gene, whose inactivation is responsible for the human disease ataxia telangiectasia is conserved throughout the Eukaryotes and plays an important role in the cellular responses to DNA damage, in particular to DNA double-strand breaks (DSBs). Here we describe the identification of an Arabidopsis thaliana homologue of ATM (AtATM), and the molecular and cytological characterization of plants, hereafter called atm, carrying a disrupting T-DNA insertion in this gene. AtATM covers a 32 kb region on chromosome 3. The AtATM transcript has a complex structure, is 12 kb long and formed by 79 exons. The transcriptional level of AtATM is very low in all the tissues tested, and does not vary after exposure to ionizing radiations (IR). In atm plants, the protein is not detected suggesting the mutants are null. The atm mutants are partially sterile. Aberrant segregation of chromosomes during meiosis I on both male and female sides account for this sterility. However, meiotic recombination frequency is normal. Mutant plants are also hypersensitive to gamma rays and methyl methane sulfonate, but not to UV-B, pointing to a specific defect of atm mutants in the response to DNA DSBs. In plants, ionizing radiations induce a strong, rapid and transient transcriptional activation of genes involved in the cellular response to or the repair of DSBs. This transcriptional regulation of AtRAD51, AtPARP1, atGR1 and AtL1G4 is lost in the atm mutants . The absence of AtRAD51 induction associated with ionizing radiation sensitivity suggest that AtAtm play an important function in DSB repair by homologous recombination. In addition we show that homologous intra-chromosomal recombination frequency is elevated in the mutant comparing to wild-type, with or without gamma irradiation. These results show the implication of AtAtm in the genomic stability. (author)

  10. Bombyx mori nucleopolyhedrovirus nucleic acid binding proteins BRO-B and BRO-E associate with host T-cell intracellular antigen 1 homologue BmTRN-1 to influence protein synthesis during infection.

    Science.gov (United States)

    Kotani, Eiji; Muto, Sayaka; Ijiri, Hiroshi; Mori, Hajime

    2015-07-01

    Previous reports have indicated that the Bombyx mori nucleopolyhedrovirus (BmNPV) nucleic acid binding proteins BRO-B and BRO-E are expressed during the early stage of infection and that the BRO family likely supports the regulation of mRNA; however, no study has directly examined the function of BRO family proteins in virus-permissive cells. Here, we show that BRO-B and BRO-E associate with cellular T-cell intracellular antigen 1 homologue (BmTRN-1), a translational regulator, and other cellular translation-related proteins in silkworm cells during viral infection. We created BM-N cells that expressed BRO-B/E to study molecular interactions between BmTRN-1 and BRO-B/E and how they influenced protein synthesis. Fluorescent microscopy revealed that BmTRN-1 was localized in cytoplasmic foci during BmNPV infection. Immunofluorescence studies confirmed that BmTRN-1 and BRO-B/E were colocalized in the amorphous conspicuous cytoplasmic foci. Reporter gene studies revealed that co-expression of BRO-B/E synergistically led to a significant decrease in protein synthesis from a designed transcript carrying the 5'untranslated region of a cellular mRNA with no significant change of transcript abundance. Additionally, RNA interference-mediated knockdown of BmTRN-1 resulted in a marked inhibition of the ability of BRO-B/E to regulate the transcript. These results suggested that the association of BmTRN-1 with BRO-B/E is responsible for the inhibitory regulation of certain mRNAs at the post-transcriptional level and add an additional mechanism for how baculoviruses control protein synthesis during infection.

  11. The SANT2 domain of the murine tumor cell DnaJ-like protein 1 human homologue interacts with alpha1-antichymotrypsin and kinetically interferes with its serpin inhibitory activity.

    Science.gov (United States)

    Kroczynska, Barbara; Evangelista, Christina M; Samant, Shalaka S; Elguindi, Ebrahim C; Blond, Sylvie Y

    2004-03-19

    The murine tumor cell DnaJ-like protein 1 or MTJ1/ERdj1 is a membrane J-domain protein enriched in microsomal and nuclear fractions. We previously showed that its lumenal J-domain stimulates the ATPase activity of the molecular chaperone BiP/GRP78 (Chevalier, M., Rhee, H., Elguindi, E. C., and Blond, S. Y. (2000) J. Biol. Chem. 275, 19620-19627). MTJ1/ERdj1 also contains a large carboxyl-terminal cytosolic extension composed of two tryptophan-mediated repeats or SANT domains for which the function(s) is unknown. Here we describe the cloning of the human homologue HTJ1 and its interaction with alpha(1)-antichymotrypsin (ACT), a member of the serine proteinase inhibitor (serpin) family. The interaction was initially identified in a two-hybrid screening and further confirmed in vitro by dot blots, native electrophoresis, and fluorescence studies. The second SANT domain of HTJ1 (SANT2) was found to be sufficient for binding to ACT, both in yeast and in vitro. Single tryptophan-alanine substitutions at two strictly conserved residues significantly (Trp-497) or totally (Trp-520) abolished the interaction with ACT. SANT2 binds to human ACT with an intrinsic affinity equal to 0.5 nm. Preincubation of ACT with nearly stoichiometric concentrations of SANT2 wild-type but not SANT2: W520A results in an apparent loss of ACT inhibitory activity toward chymotrypsin. Kinetic analysis indicates that the formation of the covalent inhibitory complex ACT-chymotrypsin is significantly delayed in the presence of SANT2 with no change on the catalytic efficiency of the enzyme. This work demonstrates for the first time that the SANT2 domain of MTJ1/HTJ1/ERdj1 mediates stable and high affinity protein-protein interactions.

  12. Health promotion in the workplace

    Directory of Open Access Journals (Sweden)

    Sultan T Al-Otaibi

    2016-01-01

    Full Text Available The objective of this review was to describe the scientific evidence for coordinating health promotion at the workplace and to discuss the required future research in this field. Literature review from March 1990 to November 2014 was performed. Using the keywords ′health, promotion, worksite and workplace′, literature was searched in the following databases: Medline, PubMed and Google Scholar; with no time limit. There is emerging evidence that workplace health promotion enhances the effectiveness of effort to promote and protect workers′ health. It proves both cost-effective and cost-beneficial to health promotion at the worksite and subsequently further reduces absenteeism. However, future research is needed to identify the impact of other factors such as age, gender and race on workers′ exposure. There is also a need to develop valid tests to measure the outcome of these programmes at the workplace. Health promotion should be central to workplace planning and should be recognised as an integral part of proactive occupational health. Indeed, the workplace is viewed as one of the most popular venues for promoting health and preventing diseases among employees.

  13. Information technology in health promotion.

    Science.gov (United States)

    Lintonen, T P; Konu, A I; Seedhouse, D

    2008-06-01

    eHealth, the use of information technology to improve or enable health and health care, has recently been high on the health care development agenda. Given the vivid interest in eHealth, little reference has been made to the use of these technologies in the promotion of health. The aim of this present study was to conduct a review on recent uses of information technology in health promotion through looking at research articles published in peer-reviewed journals. Fifteen relevant journals with issues published between 2003 and June 2005 yielded altogether 1352 articles, 56 of which contained content related to the use of information technology in the context of health promotion. As reflected by this rather small proportion, research on the role of information technology is only starting to emerge. Four broad thematic application areas within health promotion were identified: use of information technology as an intervention medium, use of information technology as a research focus, use of information technology as a research instrument and use of information technology for professional development. In line with this rather instrumental focus, the concepts 'ePromotion of Health' or 'Health ePromotion' would come close to describing the role of information technology in health promotion.

  14. Promoting mental health as an essential aspect of health promotion.

    Science.gov (United States)

    Sturgeon, Shona

    2006-12-01

    This paper advocates that mental health promotion receive appropriate attention within health promotion. It is of great concern that, in practice, mental health promotion is frequently overlooked in health promotion programmes although the WHO definitions of health and the Ottawa Charter describe mental health as an integral part of health. It is suggested that more attention be given to addressing the determinants of mental health in terms of protective and risk factors for both physical and mental conditions, particularly in developing countries. Examples of evidence-based mental health programmes operating in widely diverse settings are presented to demonstrate that well designed interventions can contribute to the well-being of populations. It is advocated that particular attention be given to the intersectorial cooperation needed for this work.

  15. Health promotion: an ethical analysis.

    Science.gov (United States)

    Carter, Stacy M

    2014-04-01

    Thinking and practising ethically requires reasoning systematically about the right thing to do. Health promotion ethics - a form of applied ethics - includes analysis of health promotion practice and how this can be ethically justified. Existing frameworks can assist in such evaluation. These acknowledge the moral value of delivering benefits. But benefits need to be weighed against burdens, harms or wrongs, and these should be minimised: they include invading privacy, breaking confidentiality, restraining liberty, undermining self-determination or people's own values, or perpetuating injustice. Thinking about the ethics of health promotion also means recognising health promotion as a normative ideal: a vision of the good society. This ideal society values health, sees citizens as active and includes them in decisions that affect them, and makes the state responsible for providing all of its citizens, no matter how advantaged or disadvantaged, with the conditions and resources they need to be healthy. Ethicists writing about health promotion have focused on this relationship between the citizen and the state. Comparing existing frameworks, theories and the expressed values of practitioners themselves, we can see common patterns. All oppose pursuing an instrumental, individualistic, health-at-all-costs vision of health promotion. And all defend the moral significance of just processes: those that engage with citizens in a transparent, inclusive and open way. In recent years, some Australian governments have sought to delegitimise health promotion, defining it as extraneous to the role of the state. Good evidence is not enough to counter this trend, because it is founded in competing visions of a good society. For this reason, the most pressing agenda for health promotion ethics is to engage with communities, in a procedurally just way, about the role and responsibilities of the citizen and the state in promoting and maintaining good health.

  16. Photovoltaic module with adhesion promoter

    Science.gov (United States)

    Xavier, Grace

    2013-10-08

    Photovoltaic modules with adhesion promoters and methods for fabricating photovoltaic modules with adhesion promoters are described. A photovoltaic module includes a solar cell including a first surface and a second surface, the second surface including a plurality of interspaced back-side contacts. A first glass layer is coupled to the first surface by a first encapsulating layer. A second glass layer is coupled to the second surface by a second encapsulating layer. At least a portion of the second encapsulating layer is bonded directly to the plurality of interspaced back-side contacts by an adhesion promoter.

  17. Stress Managment and Health Promotion

    Directory of Open Access Journals (Sweden)

    Asghar Dadkhah

    2004-09-01

    Full Text Available Health promotion approach is utilized to address the prevention, management and early intervention for stress management and also to promote positive mental and psychological health. Stress affects everyone and must be managed effectively to reduce its chronic and deleterious effects this study consists of two sections: in first section the principals of health promotion in different human existence levels, prevention of disease related to stress, the effect of stress on human well-being, and stress management were discussed. In second section the role of rehabilitation specialists (Medical technologist, nurses, occupational therapists, physiotherapists, respiratory therapists, and social workers in stress management were counted.

  18. Does Labor Diversity Promote Entrepreneurship?

    DEFF Research Database (Denmark)

    Marino, Marianna; Parrotta, Pierpaolo; Pozzoli, Dario

    We find evidence that workforce educational diversity promotes entrepreneurial behavior of employees as well as the formation of new firms, whereas diversity in demographics hinders transitions to selfemployment. Ethnic diversity favors entrepreneurship in financial and business services....

  19. Local wisdom and health promotion

    DEFF Research Database (Denmark)

    Demaio, Alessandro Rhyll

    2011-01-01

    The respectful, appropriate use of local wisdom (LW) in health promotion increases penetration and longevity of positive behavior change. Collaborations based on mutual respect, flexibility and trust between health program organizers, traditional and local practitioners, and the communities being...... served are the goal for public health physicians in our modern, globalized world. This meta-analysis reviewed literature from the past 18 years drawn from a wide range of sources. This investigations proposes a grassroots, material shift toward regarding health promotion interventions as partnerships...... when planning, executing, and evaluating health promotion projects. This holistic approach would be based on the premise that LW is equal to expert opinion. This article endorses the integration of LW at every stage of the health promotion process concluding that it is through empowerment...

  20. Nutritional Recommendation Should Promote Sustainability.

    Science.gov (United States)

    Reber, Robert J.

    1991-01-01

    Any process or event that disrupts the flow of nutrients and energy becomes a nutrition problem. Nutritionists should promote practices that protect the integrity, stability, and beauty of the land community (soil, water, air, all biological species). (Author)

  1. Social Promotion: Problem or Solution?

    Science.gov (United States)

    Cunningham, William G.; Owens, Ray C.

    1976-01-01

    Social promotion is accomplishing what it was intended to do; it is relieving the various grades of over-age, floundering students. If we are to help these potential failures, we must devise new educational systems. (Editor)

  2. School health education and promotion

    DEFF Research Database (Denmark)

    Leahy, Deana; Simovska, Venka

    2018-01-01

    Purpose - This Special Issue is the second in a series that aims to place the spotlight on educational research and its contribution to the field of school-based health and wellbeing promotion. The purpose of both special issues is to bring together scholars from across the world to consider...... current developments in research on curricula, interventions, policies and practices concerning health education and promotion and related professional development of teachers. Design/methodology/approach – As in the first Special Issue published in 2017 (School health education and promotion: Health...... and wellbeing promotion. Additionally, an open call for papers was published on the Health Education website and on the EERA website. There was considerable interest from those such as researchers, scholars and practitioners, and as a result, we have been able to publish a second Special Issue. Findings...

  3. PARTICULARITIES OF MODERN PHARMACEUTICAL PROMOTION

    Directory of Open Access Journals (Sweden)

    Юрий Владимирович Тарасов

    2014-02-01

    Full Text Available Pharmaceutical products market is one of the most saturated consumers’ markets. Characteristic features of it are: high competition, fierce struggle for the customer, specific technologies of promotion. In conditions of globalization and increase in competition both in world pharmaceutical market and in the market of medicines and goods of medical purpose in Russia modern marketing techniques of promotion of the products to the end consumers are the key tools for strengthening market positions – both of producers of pharmaceutical goods and their suppliers, distributors, big whole-sale companies. Among main tools of promotion are: advertising, public relations, stimulation of sales on the market of medicines, personal sales, computer technologies. The article describes different technologies of promotion of medicines: indoor-advertising, hot lines, pharmaceutical exhibitions, packing. DOI: http://dx.doi.org/10.12731/2218-7405-2013-12-1

  4. Promotional Chat on the Internet

    OpenAIRE

    Dina Mayzlin

    2006-01-01

    Chat rooms, recommendation sites, and customer review sections allow consumers to overcome geographic boundaries and to communicate based on mutual interests. However, marketers also have incentives to supply promotional chat or reviews in order to influence the consumers' evaluation of their products. Moreover, firms can disguise their promotion as consumer recommendations due to the anonymity afforded by online communities. We explore this new setting where advertising and word of mouth bec...

  5. Promotion of development and introduction

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1995-09-01

    In order to promote effectively and smoothly development and introduction of oil substituting energies, comprehensive investigations for improving the energy demand and supply structures and investigations on development infrastructures will be conducted. Investigations will also be given on promoting improvements in overseas coal import base infrastructures, and demand/supply improvement, development and utilization of overseas energies. Investigations and guidance will be given on forming visions to improve demand/supply structures and to introduce and promote technologies thereof. In order to deepen further the understanding and recognition by the nation on oil substituting energies, such publicity activities will be carried out as provision of information, and promotion on popularization and education of energy demand/supply improving systems. For the purpose of promoting international exchanges, information exchange will be promoted on improving the energy demand/supply structures, so is on international information exchange. International cooperative operations on coal utilization, international cooperation on alcohol utilization technologies, and assistance to holding the world energy conferences will be carried out, and an Asia-Pacific Coal Demand and Supply Seminar will be held. In addition, training operations for coal engineers will be performed.

  6. [Five paradoxes in health promotion].

    Science.gov (United States)

    López-Dicastillo, Olga; Canga-Armayor, Navidad; Mujika, Agurtzane; Pardavila-Belio, Miren Idoia; Belintxon, Maider; Serrano-Monzó, Inmaculada; Pumar-Méndez, María J

    The World Health Organization states that health promotion is a key strategy to improve health, and it is conceived as a global process of enabling people to increase control over, and to improve, their health. Health promotion does not focus solely on empowering individuals dealing with their knowledge, attitudes and skills, but it also takes political, social, economic and environmental aspects influencing health and wellbeing into account. The complexity of applying these concepts is reflected in the five paradoxes in health promotion; these arise in between the rhetoric in health promotion and implementation. The detected paradoxes which are described herein involve the patient versus the person, the individual versus the group, disease professionals versus health professionals, disease indicators versus health indicators, and health as an expense versus health as an investment. Making these contradictions explicit can help determine why it is so complex to put the concepts related to health promotion into practice. It can also help to put forward aspects that need further work if health promotion is to put into practice. Copyright © 2017 SESPAS. Publicado por Elsevier España, S.L.U. All rights reserved.

  7. Drug promotion practices: A review.

    Science.gov (United States)

    Jacob, Nilan T

    2018-01-18

    Over the years, the pharmaceutical industry has been at the forefront of research and innovation in drug discovery and development. The process of drug discovery extending from preclinical studies to multicentric clinical trials and postmarketing phase is a costly affair running into billions of dollars. On the flip side, not all investigational molecules clear the trial phases and get approved, which puts pressure on the manufacturers to maximize the profit from approved drugs. It is in this key area that the practice of drug promotion plays its role. The World Health Organization defines drug promotion as "all informational and persuasive activities by manufacturers and distributors, the effect of which is to influence the prescription, supply, purchase or use of medicinal drugs". With its humble intent of creating awareness among healthcare professionals and updating their knowledge on recent advances in treatment options, drug promotion has been an important tool, but gradually it has evolved to embrace aggressive marketing strategies and sometimes unethical business and scientific practices where the need for profit-making eclipses commitment to patient care and scientific exploration. In this review, we discuss the evolution of drug promotion practices, the various types, its merits and demerits, the influence of drug promotion on physician prescribing behaviour, the role of regulatory bodies, unethical promotional practices and finally summarize with future directions. © 2018 The British Pharmacological Society.

  8. 7 CFR 1150.114 - Promotion.

    Science.gov (United States)

    2010-01-01

    ... and Orders; Milk), DEPARTMENT OF AGRICULTURE DAIRY PROMOTION PROGRAM Dairy Promotion and Research Order Definitions § 1150.114 Promotion. Promotion means actions such as paid advertising, sales... 7 Agriculture 9 2010-01-01 2009-01-01 true Promotion. 1150.114 Section 1150.114 Agriculture...

  9. 7 CFR 1210.312 - Promotion.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Promotion. 1210.312 Section 1210.312 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE WATERMELON RESEARCH AND PROMOTION PLAN Watermelon Research and Promotion Plan Definitions § 1210.312 Promotion. Promotion means any...

  10. 7 CFR 1216.23 - Promotion.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Promotion. 1216.23 Section 1216.23 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE PEANUT PROMOTION, RESEARCH, AND INFORMATION ORDER Peanut Promotion, Research, and Information Order Definitions § 1216.23 Promotion. Promotion...

  11. 77 FR 56552 - Holiday Mobile Shopping Promotion

    Science.gov (United States)

    2012-09-13

    ... POSTAL SERVICE 39 CFR Part 111 Holiday Mobile Shopping Promotion AGENCY: Postal Service \\TM... Postal Service, Domestic Mail Manual (DMM[supreg]) 709.3 to add a new temporary promotion during November... Promotion (``Promotion''), which will take place between November 7, 2012 and November 21, 2012 (``promotion...

  12. 7 CFR 1250.310 - Promotion.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Promotion. 1250.310 Section 1250.310 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE EGG RESEARCH AND PROMOTION Egg Research and Promotion Order Definitions § 1250.310 Promotion. Promotion means any action, including paid...

  13. 7 CFR 1260.122 - Promotion.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Promotion. 1260.122 Section 1260.122 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE BEEF PROMOTION AND RESEARCH Beef Promotion and Research Order Definitions § 1260.122 Promotion. Promotion means any action, including paid...

  14. 29 CFR 541.503 - Promotion work.

    Science.gov (United States)

    2010-07-01

    ... 29 Labor 3 2010-07-01 2010-07-01 false Promotion work. 541.503 Section 541.503 Labor Regulations... Outside Sales Employees § 541.503 Promotion work. (a) Promotion work is one type of activity often.... Promotion activities directed toward consummation of the employee's own sales are exempt. Promotional...

  15. Nicolas Sarkozy a recu son homologue estonien

    Index Scriptorium Estoniae

    2008-01-01

    Prantsusmaa president Nicolas Sarkozy pakkus 7. aprillil 2008 Elysée palees kohtumisel president Toomas Hendrik Ilvesega Eestile Prantsusmaa abi tuumaenergeetika küsimustes. Vabariigi President töövisiidil Pariisis 6.-8.04.2008

  16. Sport promotion in USA and Europe

    Directory of Open Access Journals (Sweden)

    Ognjenov Gajina

    2002-01-01

    Full Text Available Promotion as most viewable marketing activity is in sports for years. Many companies invest lots of funds for promotion of sport. Investing funds in sports they can promote their companies. This is called sponsorship.

  17. Brassica napusGLABRA3-1 promotes anthocyanin biosynthesis and trichome formation in true leaves when expressed in Arabidopsis thaliana.

    Science.gov (United States)

    Gao, C; Guo, Y; Wang, J; Li, D; Liu, K; Qi, S; Jin, C; Duan, S; Gong, J; Li, Z; Chen, M

    2018-01-01

    Previous studies have shown that GLABRA3 (AtGL3), a bHLH transcription factor, plays essential roles in anthocyanin biosynthesis and trichome formation in Arabidopsis thaliana. However, there have been no such studies of a homologue, BnGL3, from the closely related crop, Brassica napus. Here, we analysed the BnGL3-1 coding domain sequence from the B. napus cultivar QINYOU Seven, identified conserved protein domains and performed a phylogenetic analysis to elucidate its relationship with homologues form a range of plant species. When expressed in tobacco leaves as a fusion protein with green fluorescent protein, BnGL3-1 accumulated in the nucleus, consistent with its predicted function as a transcription factor. Ectopic expression of the BnGL3-1 gene in the A. thaliana gl3-3 mutant resulted in levels of anthocyanins and numbers of trichomes in true leaves that were higher than in wild-type plants. Moreover, overexpression of BnGL3-1 in gl3-3 compensated for the promotion and repression of genes involved in anthocyanin biosynthesis and trichome formation, respectively, that has been reported in gl3-3 young shoots and expanding true leaves. This study provides new insights into GL3 function in anthocyanin biosynthesis and trichome formation in crucifers, and represents a promising target for genetic manipulation of B. napus. © 2017 German Society for Plant Sciences and The Royal Botanical Society of the Netherlands.

  18. Introduction to Global Health Promotion.

    Science.gov (United States)

    Torres, Jennifer

    2017-03-01

    Global health education is becoming increasingly prominent in universities throughout the country especially in programs focused on health and behavioral sciences, law, economics, and political science. Introduction to Global Health Promotion is a book that can be used by both instructors and students in the field of global health. The book provides theories and models, human rights, and technology relevant to the field. In addition the book is designed to share best evidence for promoting health and reducing morbidity and mortality in a variety of areas. The book can be used by health educators, public health practitioners, professors, and students as a resource for research and practice in the field of health promotion and disease prevention.

  19. EXPERIENCES WITH IDEA PROMOTING INITIATIVES

    DEFF Research Database (Denmark)

    Gish, Liv

    2011-01-01

    In new product development a central activity is to provide new ideas. Over the last decades experiences with stimulating employee creativity and establishing idea promoting initiatives have been made in industrial practice. Such initiatives are often labeled Idea Management – a research field...... with a growing interest. In this paper I examine three different idea promoting initiatives carried out in Grundfos, a leading pump manufacturer. In the analysis I address what understandings of idea work are inscribed in the initiatives and what role these initiatives play in the organization with respect...... understandings of idea work are inscribed in the idea promoting initiatives as they to some degree have to fit with the understandings embedded in practice in order to work....

  20. AAHD's Health Promotion and Wellness, Part 2: Health Promotion Programs

    Science.gov (United States)

    Exceptional Parent, 2011

    2011-01-01

    This article is part 2 of a 4-part series on "Health Promotion and Wellness" from the American Association on Health and Disability (AAHD). According to the U.S. Census Bureau, more than 54 million people--one in five Americans--have a disability, and these Americans are more likely to report: (1) Being in poorer overall health; (2) Having less…

  1. Tunable promoters in systems biology

    DEFF Research Database (Denmark)

    Mijakovic, Ivan; Petranovic, Dina; Jensen, Peter Ruhdal

    2005-01-01

    The construction of synthetic promoter libraries has represented a major breakthrough in systems biology, enabling the subtle tuning of enzyme activities. A number of tools are now available that allow the modulation of gene expression and the detection of changes in expression patterns. But, how...

  2. Compulsory autonomy-promoting education

    NARCIS (Netherlands)

    A. Schinkel (Anders)

    2010-01-01

    textabstractToday, many liberal philosophers of education worry that certain kinds of education may frustrate the development of personal autonomy, with negative consequences for the individuals concerned, the liberal state, or both. Autonomy liberals hold not only that we should promote the

  3. University Festival Promotes STEM Education

    Science.gov (United States)

    Quagliata, Andrew B.

    2015-01-01

    STEM education is argued as an essential ingredient in preparing our children for careers of the future. This study describes a university festival that includes the promotion of STEM-related career interests in young people among its goals. A total of 203 participants between the age of 7 and 17 completed both pre-event and post-event surveys. In…

  4. Advertising and Sales Promotion Guide.

    Science.gov (United States)

    North Carolina State Dept. of Public Instruction, Raleigh. Div. of Vocational Education.

    This document contains teacher materials for a 4-unit, 1-year marketing education course in advertising and sales promotion offered in grades 11 and 12 in North Carolina. The preface contains a rationale for the development of the course, a course description, course objectives, a list of the instructional units of the course, and a list of the…

  5. Promoting PV in Latin America

    Energy Technology Data Exchange (ETDEWEB)

    Nogarin, Mauro

    2010-07-01

    The Euro Solar Programme is financed by the European Commission's Office of Cooperation and its main goal is to promote renewable energy in eight Latin American countries: Bolivia, Ecuador, El Salvador, Guatemala, Honduras, Nicaragua, Paraguay and Peru. (orig.)

  6. Artificial Promoters for Metabolic Optimization

    DEFF Research Database (Denmark)

    Jensen, Peter Ruhdal; Hammer, Karin

    1998-01-01

    In this article, we review some of the expression systems that are available for Metabolic Control Analysis and Metabolic Engineering, and examine their advantages and disadvantages in different contexts. In a recent approach, artificial promoters for modulating gene expression in micro-organisms...

  7. Health Promotion at the Ballpark.

    Science.gov (United States)

    Hodges, Bonni C

    2017-03-01

    The arrival of a new summer collegiate baseball league franchise to a small central New York city was seen as an opportunity for health promotion. The initiative was set up to explore two overarching questions: (1) Are summer collegiate baseball events acceptable to local public health organizations as viable places for health promotion activities addressing local health issues? (2) Are summer collegiate baseball organizations amenable to health promotion activities built in to their fan and/or player experiences? Planning and implementation were guided by precede-proceed, social cognitive theory, social marketing, and diffusion of innovations constructs. Environmental changes were implemented to support healthy eating and nontobacco use by players and fans; four health awareness nights were implemented at home games corresponding to local public health priorities and included public service announcements, between inning quizzes, information dissemination at concession and team market locations, and special guests. Sales and fan feedback support mostly healthy concession offerings and a tobacco-free ballpark; postseason evaluations from team staff and public health partners support continuing the trials of this sports event as a venue for health promotion.

  8. Sales promotions and channel coordination

    NARCIS (Netherlands)

    B. Wierenga (Berend); H. Soethoudt (Han)

    2009-01-01

    textabstractConsumer sales promotions are usually the result of the decisions of two marketing channel parties, the manufacturer and the retailer. In making these decisions, each party normally follows its own interest: i.e. maximizes its own profit. Unfortunately, this results in a suboptimal

  9. Sales promotion and channel coordination

    NARCIS (Netherlands)

    Wierenga, B.; Soethoudt, J.M.

    2010-01-01

    Consumer sales promotions are usually the result of the decisions of two marketing channel parties, the manufacturer and the retailer. In making these decisions, each party normally follows its own interest: i.e. maximizes its own profit. Unfortunately, this results in a suboptimal outcome for the

  10. Compulsory Autonomy-Promoting Education

    Science.gov (United States)

    Schinkel, Anders

    2010-01-01

    Today, many liberal philosophers of education worry that certain kinds of education may frustrate the development of personal autonomy, with negative consequences for the individuals concerned, the liberal state, or both. Autonomy liberals hold not only that we should promote the development of autonomy in children, but also that this aim should…

  11. 7 CFR 1215.16 - Promotion.

    Science.gov (United States)

    2010-01-01

    ... Promotion. Promotion means any action, including paid advertising, to enhance the image or desirability of... 7 Agriculture 10 2010-01-01 2010-01-01 false Promotion. 1215.16 Section 1215.16 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE POPCORN PROMOTION, RESEARCH, AND...

  12. 7 CFR 1160.111 - Promotion.

    Science.gov (United States)

    2010-01-01

    ... demand for fluid milk products. (b) Advertising, which means any advertising or promotion program... 7 Agriculture 9 2010-01-01 2009-01-01 true Promotion. 1160.111 Section 1160.111 Agriculture... and Orders; Milk), DEPARTMENT OF AGRICULTURE FLUID MILK PROMOTION PROGRAM Fluid Milk Promotion Order...

  13. 7 CFR 1219.22 - Promotion.

    Science.gov (United States)

    2010-01-01

    ... in the United States, including paid advertising, sales promotion, and publicity. Promotion... 7 Agriculture 10 2010-01-01 2010-01-01 false Promotion. 1219.22 Section 1219.22 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE HASS AVOCADO PROMOTION, RESEARCH...

  14. 7 CFR 1230.22 - Promotion.

    Science.gov (United States)

    2010-01-01

    ... Promotion. Promotion means any action, including but not limited to paid advertising and retail or food... 7 Agriculture 10 2010-01-01 2010-01-01 false Promotion. 1230.22 Section 1230.22 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE PORK PROMOTION, RESEARCH, AND...

  15. Evaluation of synthetic promoters in Physcomitrella patens

    DEFF Research Database (Denmark)

    Peramuna, Anantha; Bae, Hansol; Rasmussen, Erling Koch

    2018-01-01

    Securing a molecular toolbox including diverse promoters is essential for genome engineering. However, native promoters have limitations such as the available number or the length of the promoter. In this work, three short synthetic promoters were characterized by using the yellow fluorescent...

  16. 7 CFR 1218.17 - Promotion.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Promotion. 1218.17 Section 1218.17 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE BLUEBERRY PROMOTION, RESEARCH, AND INFORMATION ORDER Blueberry Promotion, Research, and Information Order Definitions § 1218.17 Promotion...

  17. 5 CFR 532.407 - Promotion.

    Science.gov (United States)

    2010-01-01

    ... 5 Administrative Personnel 1 2010-01-01 2010-01-01 false Promotion. 532.407 Section 532.407... Administration § 532.407 Promotion. (a) An employee who is promoted is entitled to be paid at the lowest.... (c) If the promotion is to a position in a different wage area, the agency shall determine the...

  18. 78 FR 24239 - Temporary Mailing Promotion

    Science.gov (United States)

    2013-04-24

    ... POSTAL REGULATORY COMMISSION [Docket No. R2013-6; Order No. 1702] Temporary Mailing Promotion... offering a Technology Credit Promotion. This notice informs the public of the Postal Service's filing and... changes associated with offering a Technology Credit Promotion.\\1\\ The promotion is planned to begin on...

  19. Measuring the Cost of Supermarket Promotions

    DEFF Research Database (Denmark)

    Gao, Cixiu

    2014-01-01

    The widespread use of retail promotions and the magnitude of dollars spent on them call economists to examine the role of promotional costs in shaping the coordination of pricing and promotion decisions. In this study, I estimate the marginal cost of price promotion in the retail industry. The es...

  20. Characterization of a Staphylococcus aureus surface virulence factor that promotes resistance to oxidative killing and infectious endocarditis.

    Science.gov (United States)

    Malachowa, Natalia; Kohler, Petra L; Schlievert, Patrick M; Chuang, Olivia N; Dunny, Gary M; Kobayashi, Scott D; Miedzobrodzki, Jacek; Bohach, Gregory A; Seo, Keun Seok

    2011-01-01

    Staphylococcus aureus is a prominent human pathogen and a leading cause of community- and hospital-acquired bacterial infections worldwide. Herein, we describe the identification and characterization of the S. aureus 67.6-kDa hypothetical protein, named for the surface factor promoting resistance to oxidative killing (SOK) in this study. Sequence analysis showed that the SOK gene is conserved in all sequenced S. aureus strains and homologous to the myosin cross-reactive antigen of Streptococcus pyogenes. Immunoblotting and immunofluorescence analysis showed that SOK was copurified with membrane fractions and was exposed on the surface of S. aureus Newman and RN4220. Comparative analysis of wild-type S. aureus and an isogenic deletion strain indicated that SOK contributes to both resistance to killing by human neutrophils and to oxidative stress. In addition, the S. aureus sok deletion strain showed dramatically reduced aortic valve vegetation and bacterial cell number in a rabbit endocarditis model. These results, plus the suspected role of the streptococcal homologue in certain diseases such as acute rheumatic fever, suggest that SOK plays an important role in cardiovascular and other staphylococcal infections.

  1. C. elegans AMPKs promote survival and arrest germline development during nutrient stress

    Directory of Open Access Journals (Sweden)

    Masamitsu Fukuyama

    2012-08-01

    Mechanisms controlling development, growth, and metabolism are coordinated in response to changes in environmental conditions, enhancing the likelihood of survival to reproductive maturity. Much remains to be learned about the molecular basis underlying environmental influences on these processes. C. elegans larvae enter a developmentally dormant state called L1 diapause when hatched into nutrient-poor conditions. The nematode pten homologue daf-18 is essential for maintenance of survival and germline stem cell quiescence during this period (Fukuyama et al., 2006; Sigmond et al., 2008, but the details of the signaling network(s in which it functions remain to be elucidated. Here, we report that animals lacking both aak-1 and aak-2, which encode the two catalytic α subunits of AMP-activated protein kinase (AMPK, show reduced viability and failure to maintain mitotic quiescence in germline stem cells during L1 diapause. Furthermore, failure to arrest germline proliferation has a long term consequence; aak double mutants that have experienced L1 diapause develop into sterile adults when returned to food, whereas their continuously fed siblings are fertile. Both aak and daf-18 appear to maintain germline quiescence by inhibiting activity of the common downstream target, TORC1 (TOR Complex 1. In contrast, rescue of the lethality phenotype indicates that aak-2 acts not only in the intestine, as does daf-18, but also in neurons, likely promoting survival by preventing energy deprivation during L1 diapause. These results not only provide evidence that AMPK contributes to survival during L1 diapause in a manner distinct from that by which it controls dauer diapause, but they also suggest that AMPK suppresses TORC1 activity to maintain stem cell quiescence.

  2. Functional, genetic and chemical characterization of biosurfactants produced by plant growth-promoting Pseudomonas putida 267.

    Science.gov (United States)

    Kruijt, Marco; Tran, Ha; Raaijmakers, Jos M

    2009-08-01

    Plant growth-promoting Pseudomonas putida strain 267, originally isolated from the rhizosphere of black pepper, produces biosurfactants that cause lysis of zoospores of the oomycete pathogen Phytophthora capsici. The biosurfactants were characterized, the biosynthesis gene(s) partially identified, and their role in control of Phytophthora damping-off of cucumber evaluated. The biosurfactants were shown to lyse zoospores of Phy. capsici and inhibit growth of the fungal pathogens Botrytis cinerea and Rhizoctonia solani. In vitro assays further showed that the biosurfactants of strain 267 are essential in swarming motility and biofilm formation. In spite of the zoosporicidal activity, the biosurfactants did not play a significant role in control of Phytophthora damping-off of cucumber, since both wild type strain 267 and its biosurfactant-deficient mutant were equally effective, and addition of the biosurfactants did not provide control. Genetic characterization revealed that surfactant biosynthesis in strain 267 is governed by homologues of PsoA and PsoB, two nonribosomal peptide synthetases involved in production of the cyclic lipopeptides (CLPs) putisolvin I and II. The structural relatedness of the biosurfactants of strain 267 to putisolvins I and II was supported by LC-MS and MS-MS analyses. The biosurfactants produced by Ps. putida 267 were identified as putisolvin-like CLPs; they are essential in swarming motility and biofilm formation, and have zoosporicidal and antifungal activities. Strain 267 provides excellent biocontrol activity against Phytophthora damping-off of cucumber, but the lipopeptide surfactants are not involved in disease suppression. Pseudomonas putida 267 suppresses Phy. capsici damping-off of cucumber and provides a potential supplementary strategy to control this economically important oomycete pathogen. The putisolvin-like biosurfactants exhibit zoosporicidal and antifungal activities, yet they do not contribute to biocontrol of Phy

  3. Fisetin Attenuates AKT Associated Growth Promoting Events in AflatoxinB1 Induced Hepatocellular Carcinoma.

    Science.gov (United States)

    Maurya, Brajesh Kumar; Trigun, Surendra Kumar

    2017-12-29

    Recently we have reported that Fisetin, a natural flavonol, is able to regress Aflatoxin-B1 (AFB1) induced hepatocellular carcinoma (HCC) by suppressing reactive oxygen species (ROS) led pro-inflammatory factors in rats. In the current study, we aimed to delineate whether Fisetin does so by modulating the cell growth promoting signaling cascade in HCC. The reciprocal interplay of 3-phosphoinositol kinase (PI3K) vs phosphatase and tensin homologue deleted on chromosome 10 (PTEN) displays Akt, a protein kinase B, to get phosphorylated at Thr308 by a 3-phosphoinositol dependent kinase 1 (PDK1). This commits cells of neoplastic niche to undergo rapid proliferation by p-Akt thr308 dependent phosphorylation of glycogen synthase kinase 3β (GSK3β) at Ser 9 position. In this study, the effect of in vivo treatment of 20 mg/kg b.w. Fisetin on relative profile of all these factors were studied in the liver from the HCC rats induced by two doses of 1mg/kg b.w. AFB1 i.p. As compared to the untreated HCC liver, liver from Fisetin treated HCC group rats showed a significant decline in the activity and level of p-Aktthr308 which was consistent with a similar decline in PDK1 level. Concordantly, the level of p-GSK3βSer 9 was also found to be declined significantly in those Fisetin-treated HCC livers. A concomitant decline in immunohistochemically detected number of the proliferating cell nuclear antigen (PCNA), a cell proliferation marker, in the HCC liver, further confirmed anti-cell proliferative role of Fisetin during HCC growth in vivo. This findings suggest that Fisetin is able to suppress Akt dependent cell growth signaling mechanisms in HCC mainly by down regulating PDK1 dependent Akt phosphorylation. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  4. 阴道毛滴虫Rac1蛋白的cDNA克隆和序列分析%Molecular Cloning and Characterization of a Rac1 Homologue cDNA from Trichomonas vaginalis

    Institute of Scientific and Technical Information of China (English)

    傅玉才; 章家新; 郑晓虹; 刘红

    2004-01-01

    Objective To clone and characterize a Racl homologue from Trichomonas vaginalis for studying cell cycle of the organism. Methods A cDNA library derived from T. vaginalis mRNA was constructed into λ TriplEx2 phage vector. An expression sequence tag program was launched. Sequences of cDNA clones were analyzed using NCBI BLAST algorithms, and ClustalW and Treeview programs. Results A cDNA clone with a length of 714 base pairs was isolated. The sequence analysis showed that the cDNA clone has an open reading frame with 600 bp. The deduced amino acid sequence from the open reading frame contains 200 residuals and is most homologous to Rac1 subfamily of Rho GTPases with > 60% identity. The conserved sequence elements of Rho GTPases, such as GTP-binding sites, GTPase-activating protein (GAP) interaction motifs, GTP-dissociation inhibitors (GDI) interaction motifs, guanine nucleotide exchange factor (GEF) interaction elements, etc, were detected in the amino acid sequence. The phylogenetic analysis showed that the cDNA clone is grouped in the Rac subfamily and is more closely related to Rac1 proteins of protozoa. Conclusion The cDNA clone isolated belongs to Rac subfamily of Rho GTPases and is probably a Rac1 protein of T. vaginalis.%目的获得阴道毛滴虫Rac1蛋白的cDNA克隆,研究其在细胞周期中的调解作用.方法提取阴道毛滴虫总RNA,构建cDNA表达文库,随机分离cDNA克隆并测序.用在线生物分析软件NCBI BLAST、ClustalW以及Treeview等程序进行序列分析.结果获得一株有714 bp的cDNA克隆.序列分析表明,该克隆开放阅读框具600 bp,推测肽链具200个氨基酸.该肽链与Rho家族中Rac1鸟苷三磷酸(GTP)酶同源性最高(>60%),并具多种Rho GTP酶的保守基序,如GTP结合部位、GTP酶激活蛋白作用基序、GTP分离抑制因子作用基序、鸟嘌呤核苷酸交换因子作用基序等.进化树分析显示该克隆属于Rac亚家族GTP酶,与原虫Rac1蛋白最接近.结论该克隆

  5. Oral health promotion at worksites

    DEFF Research Database (Denmark)

    Schou, L

    1989-01-01

    Many workplace-based health promotion programmes have been reported but only a few include or focus specifically on oral health. Although certain obstacles to oral health promotion in the workplace exist from the management side, from the dental profession and from the employees, these seem...... to be of a scale that can easily be overcome: moreover, numerous potential benefits exist. From the employer's point of view, the main arguments in favour are reduced health care costs, increased productivity and reduced absenteeism. The benefits to the dental profession are possible increases in utilization...... of services and less restraint from fee payment structures and physical environments. The immediate benefit to the employees is easy access to dental services. In addition, work-related dental hazards can be compensated for or prevented and screening activities can be more easily organized. The literature...

  6. Competitive intransitivity promotes species coexistence.

    Science.gov (United States)

    Laird, Robert A; Schamp, Brandon S

    2006-08-01

    Using a spatially explicit cellular automaton model with local competition, we investigate the potential for varied levels of competitive intransitivity (i.e., nonhierarchical competition) to promote species coexistence. As predicted, on average, increased levels of intransitivity result in more sustained coexistence within simulated communities, although the outcome of competition also becomes increasingly unpredictable. Interestingly, even a moderate degree of intransitivity within a community can promote coexistence, in terms of both the length of time until the first competitive exclusion and the number of species remaining in the community after 500 simulated generations. These results suggest that modest levels of intransitivity in nature, such as those that are thought to be characteristic of plant communities, can contribute to coexistence and, therefore, community-scale biodiversity. We explore a potential connection between competitive intransitivity and neutral theory, whereby competitive intransitivity may represent an important mechanism for "ecological equivalence."

  7. Promoting Exit from Violent Extremism

    DEFF Research Database (Denmark)

    Dalgaard-Nielsen, Anja

    2013-01-01

    A number of Western countries are currently adding exit programs targeting militant Islamists to their counterterrorism efforts. Drawing on research into voluntary exit from violent extremism, this article identifies themes and issues that seem to cause doubt, leading to exit. It then provides a ...... the influence attempt as subtle as possible, use narratives and self-affirmatory strategies to reduce resistance to persuasion, and consider the possibility to promote attitudinal change via behavioral change as an alternative to seek to influence beliefs directly....

  8. South Asia's health promotion kaleidoscope.

    Science.gov (United States)

    Mukhopadhyay, Alok

    2007-01-01

    South Asia has 22 percent of the world's population but only 1.3 percent of the global income. Consequently 40 percent of the population is living in absolute poverty. However the health transition in some of its countries including India and Sri Lanka is a testimony to the fact that there are proven solutions to the problems of health and development within the region. The countries of the region have much in common, including a democratic political system, four major religions, a vibrant and living tradition of voluntarism and an extensive health infrastructure which is operating well below par. Despite the underlying unity, South Asia enjoys enormous cultural, linguistic and ethnic diversity. In this large, complex and vibrant region, health promotion is a challenging task, but it also holds the key to a dramatic change in the global health situation. Many of these solutions lie in wider areas of socio-political action. There are much needed shifts in the health promotion and development efforts, particularly in the area of poverty and social justice; gender inequity; population stabilisation; health and environment; control of communicable and non-communicable diseases; and urban health strategies. The principle of cooperation, partnership and intersectoral collaboration for health will be explored. Developing an appropriate, sustainable and people centred health and development strategy in the coming decades is an enormous challenge. There has been an attempt to focus on the emerging needs of the region, which call for health promotion, and involvement of civil society, private sector and the governments bestowed with the increased responsibility of ensuring health security for people. Strengthening the existing health systems, allocating adequate resources for health development and ensuring community participation are all prerequisites to the success of health promotion in the region.

  9. PROMOTION STRATEGIES IN WINE MARKETING

    OpenAIRE

    Ştefan MATEI

    2014-01-01

    Marketing has proven to be very useful instrument in the wine industry, in fostering comprehensive, cohesive and effective strategies which wineries require to effectively compete in today’s almost saturated wine market. But within wine marketing, the promotion strategy, from our point of view, is the most important component of the winery that can ensure the success in the market or can shorten the life cycle of the product. This being said, the aim of the paper is twofold. Firstly, to deter...

  10. Sport promotion and sales management

    Directory of Open Access Journals (Sweden)

    Zahra Aminiroshan

    2014-06-01

    Full Text Available At the beginning of third millennium, the world of sport has been experiencing new marketing techniques to introduce products and services. The purpose of this study was to compare advertising and sales promotion strategies, the effects of different strategies in sport production companies to retain or to gain market share among selected firms, which were active in Iran. The method of survey was descriptive – analytical and some questionnaires were used for collecting data in Likert scale. The validity of the questionnaire were estimated by interview with professors and exports in marketing and sport marketing and the reliability was assessed by using Cronbach's alpha (α= 0.89. Statistical population of the study includes Sport Goods-Producing companies in Iran (N= 180 and 122 firms formed the study sample. For testing the hypothesis, we have used Paired Samples T-Test. The analysis of findings showed that there was a meaningful difference between using advertising and sales promotion strategies. In general, we can say, there are some limited applications of using techniques and methods of sales promotion strategies in Iranian sport industry and methods of advertising. Consequently, regarding the intense competition among companies as well as fast growth of markets and fast changes in consumer’s behavior, identifying the best methods for corresponding relationship to customer would be required.

  11. Incentives to promote family planning.

    Science.gov (United States)

    Heil, Sarah H; Gaalema, Diann E; Herrmann, Evan S

    2012-11-01

    Over the past 60 years, population control has become an increasingly urgent issue worldwide as a growing population strains already limited resources. The use of financial incentives to promote family planning is an innovative approach that has potential to make a contribution to efforts to better manage population growth. This report reviews eight studies that examined the effect of incentives on family planning. Published studies that tested the impact of incentives to promote some aspect of family planning and included an appropriate control or comparison condition were reviewed. Incentives have been used to promote attendance at contraceptive education sessions, adoption and continuation of contraceptive methods, sterilization, and to limit family size. All but one of the eight studies reviewed reported positive outcomes, but weaknesses in study design and execution limit the strength of the conclusions that can be drawn. Review of this literature suggests that family planning behaviors, like other behaviors, are sensitive to incentives. Given the tremendous need for efficacious interventions in global efforts to manage population growth, further research on this topic using more rigorous experimental methods is warranted. Copyright © 2012 Elsevier Inc. All rights reserved.

  12. Engineered Promoters for Potent Transient Overexpression.

    Directory of Open Access Journals (Sweden)

    Dan Y Even

    Full Text Available The core promoter, which is generally defined as the region to which RNA Polymerase II is recruited to initiate transcription, plays a pivotal role in the regulation of gene expression. The core promoter consists of different combinations of several short DNA sequences, termed core promoter elements or motifs, which confer specific functional properties to each promoter. Earlier studies that examined the ability to modulate gene expression levels via the core promoter, led to the design of strong synthetic core promoters, which combine different core elements into a single core promoter. Here, we designed a new core promoter, termed super core promoter 3 (SCP3, which combines four core promoter elements (the TATA box, Inr, MTE and DPE into a single promoter that drives prolonged and potent gene expression. We analyzed the effect of core promoter architecture on the temporal dynamics of reporter gene expression by engineering EGFP expression vectors that are driven by distinct core promoters. We used live cell imaging and flow cytometric analyses in different human cell lines to demonstrate that SCPs, particularly the novel SCP3, drive unusually strong long-term EGFP expression. Importantly, this is the first demonstration of long-term expression in transiently transfected mammalian cells, indicating that engineered core promoters can provide a novel non-viral strategy for biotechnological as well as gene-therapy-related applications that require potent expression for extended time periods.

  13. Natural selection promotes antigenic evolvability.

    Science.gov (United States)

    Graves, Christopher J; Ros, Vera I D; Stevenson, Brian; Sniegowski, Paul D; Brisson, Dustin

    2013-01-01

    The hypothesis that evolvability - the capacity to evolve by natural selection - is itself the object of natural selection is highly intriguing but remains controversial due in large part to a paucity of direct experimental evidence. The antigenic variation mechanisms of microbial pathogens provide an experimentally tractable system to test whether natural selection has favored mechanisms that increase evolvability. Many antigenic variation systems consist of paralogous unexpressed 'cassettes' that recombine into an expression site to rapidly alter the expressed protein. Importantly, the magnitude of antigenic change is a function of the genetic diversity among the unexpressed cassettes. Thus, evidence that selection favors among-cassette diversity is direct evidence that natural selection promotes antigenic evolvability. We used the Lyme disease bacterium, Borrelia burgdorferi, as a model to test the prediction that natural selection favors amino acid diversity among unexpressed vls cassettes and thereby promotes evolvability in a primary surface antigen, VlsE. The hypothesis that diversity among vls cassettes is favored by natural selection was supported in each B. burgdorferi strain analyzed using both classical (dN/dS ratios) and Bayesian population genetic analyses of genetic sequence data. This hypothesis was also supported by the conservation of highly mutable tandem-repeat structures across B. burgdorferi strains despite a near complete absence of sequence conservation. Diversification among vls cassettes due to natural selection and mutable repeat structures promotes long-term antigenic evolvability of VlsE. These findings provide a direct demonstration that molecular mechanisms that enhance evolvability of surface antigens are an evolutionary adaptation. The molecular evolutionary processes identified here can serve as a model for the evolution of antigenic evolvability in many pathogens which utilize similar strategies to establish chronic infections.

  14. Natural selection promotes antigenic evolvability.

    Directory of Open Access Journals (Sweden)

    Christopher J Graves

    Full Text Available The hypothesis that evolvability - the capacity to evolve by natural selection - is itself the object of natural selection is highly intriguing but remains controversial due in large part to a paucity of direct experimental evidence. The antigenic variation mechanisms of microbial pathogens provide an experimentally tractable system to test whether natural selection has favored mechanisms that increase evolvability. Many antigenic variation systems consist of paralogous unexpressed 'cassettes' that recombine into an expression site to rapidly alter the expressed protein. Importantly, the magnitude of antigenic change is a function of the genetic diversity among the unexpressed cassettes. Thus, evidence that selection favors among-cassette diversity is direct evidence that natural selection promotes antigenic evolvability. We used the Lyme disease bacterium, Borrelia burgdorferi, as a model to test the prediction that natural selection favors amino acid diversity among unexpressed vls cassettes and thereby promotes evolvability in a primary surface antigen, VlsE. The hypothesis that diversity among vls cassettes is favored by natural selection was supported in each B. burgdorferi strain analyzed using both classical (dN/dS ratios and Bayesian population genetic analyses of genetic sequence data. This hypothesis was also supported by the conservation of highly mutable tandem-repeat structures across B. burgdorferi strains despite a near complete absence of sequence conservation. Diversification among vls cassettes due to natural selection and mutable repeat structures promotes long-term antigenic evolvability of VlsE. These findings provide a direct demonstration that molecular mechanisms that enhance evolvability of surface antigens are an evolutionary adaptation. The molecular evolutionary processes identified here can serve as a model for the evolution of antigenic evolvability in many pathogens which utilize similar strategies to establish

  15. How Bureaucracy Promotes Inclusive Organizing

    DEFF Research Database (Denmark)

    Holck, Lotte

    Diversity literature in general and Feminist in particular have long promoted alternatives to bureaucracy on the premise that this form of governance is far from gender- and race-neutral, and that inclusive organizing necessitate a flatter, decentralized and more ‘organic’ set-up (Ferguson 1984...... and opportunities conducive to their inclusion. Guided by Ashcraft (2001) concept of organized dissonance, this paper explores how the combination of apparent incongruent elements of stability/flexibility and formality/informality might offer a passage for inclusive organizing....

  16. PROMOTION OF MONTENEGRO THROUGH SPORTS

    Directory of Open Access Journals (Sweden)

    Dervis Selhanovic

    2011-03-01

    Full Text Available Modern social structures of Montenegro exist in a hypercomplex and very dynamic environment. The complexity and dynamism are, in part, a consequence of the general characteristics of the modern age, and in part, of the transition processes which have affected the Montenegrin society. The transition processes are taking place at all levels and subsystems of the community, and its sociological milieu is facing inevitability of adaptation and immersion in such processes and trends. There is no more positive promotion for a country than a sports promotion. There is no expert team, public relations agency or a lawyer than can win Montenegro a front page. We can talk about the importance of sports for the promotion of Montenegro from another point of view. If we compare the number of occurrences of names of the selected Montenegrin athletes with that of politicians, scientists or artists in different internet search engines, we will realize how great is the capacity of marketing potential that lies in Montenegrin sports and top athletes as representatives of the products and services with the label - Made in Montenegro. In addition to the success of the Montenegrin athletes globally, the promotion of Montenegro through sports is directly contributed by the major sporting events and contests, on account of which Montenegro presented itself not only as an excellent host and organizer, but also demonstrated the remarkable state and marketing capabilities and competencies. Reputation (image is not achieved overnight. Its semiological and symbolic charge includes all (visual, vocal, environmental, personal, active inputs, which need to be channelled and created. Indeed, continual work in creating and maintaining the image of Montenegro is a public relations function. With efficiently and professionally developed media and PR strategy, the modern state of Montenegro may expect to favourably position its image at the international scene, and to present its

  17. Trade promotion of irradiated food

    International Nuclear Information System (INIS)

    1986-10-01

    The meeting carried out by the Group was attended by invited specialists on legislation, marketing, consumer attitudes and industry interested in the application of food irradiation. The major objectives of the meeting were to identify barriers and constraints to trade in irradiated food and to recommend actions to be carried out by the Group to promote trade in such foods. The report of the meeting and selected 9 background papers used at the meeting are presented. A separate abstract was prepared for each of these papers

  18. Phosphazene-promoted anionic polymerization

    KAUST Repository

    Zhao, Junpeng

    2014-01-01

    In the recent surge of metal-free polymerization techniques, phosphazene bases have shown their remarkable potential as organic promoters/catalysts for the anionic polymerization of various types of monomers. By complexation with the counterion (e.g. proton or lithium cation), phosphazene base significantly improve the nucleophilicity of the initiator/chain-end resulting in rapid and usually controlled anionic/quasi-anionic polymerization. In this review, we will introduce the general mechanism, i.e. in situ activation (of initiating sites) and polymerization, and summarize the applications of such a mechanism on macromolecular engineering toward functionalized polymers, block copolymers and complex macromolecular architectures.

  19. Office of Disease Prevention and Health Promotion

    Science.gov (United States)

    ... Health Literacy Health Care Quality Healthy People healthfinder Office of Disease Prevention and Health Promotion Spotlight: This ... 16/2017 This site is coordinated by the Office of Disease Prevention and Health Promotion, Office of ...

  20. Indian herb 'Sanjeevani' (Selaginella bryopteris) can promote ...

    Indian Academy of Sciences (India)

    Unknown

    The aqueous extract of S. bryopteris possesses growth-promoting activity as ... promote growth and protect against heat shock and apoptotic activities of ..... Physical parameters .... tive stress and the use of anti-oxidants in diabetes: Linking.

  1. Sonic Hedgehog Signaling Promotes Tumor Growth

    National Research Council Canada - National Science Library

    Bushman, Wade

    2007-01-01

    ... of the DOD New Investigator award indicate that Shh signaling promotes tumor growth. This proposal addresses the hypothesis that Sonic hedgehog signaling promotes tumor growth by activating stromal cell gene expression...

  2. Promoting Racial Equality in the Nursing Curriculum.

    Science.gov (United States)

    Foolchand, M. K.

    1995-01-01

    Equality in nursing education and the profession can be promoted in the following ways: a working policy on racism and equal opportunities; curriculum content that explores stereotypes, values, attitudes, and prejudices; and multicultural health research, education, and promotion. (SK)

  3. Four MicroRNAs Promote Prostate Cell Proliferation with Regulation of PTEN and Its Downstream Signals In Vitro

    Science.gov (United States)

    Xue, Jing-lun; Chen, Jin-zhong

    2013-01-01

    Background Phosphatase and tensin homologue (PTEN), as a tumor suppressor, plays vital roles in tumorigenesis and progression of prostate cancer. However, the mechanisms of PTEN regulation still need further investigation. We here report that a combination of four microRNAs (miR-19b, miR-23b, miR-26a and miR-92a) promotes prostate cell proliferation by regulating PTEN and its downstream signals in vitro. Methodology/Principal Findings We found that the four microRNAs (miRNAs) could effectively suppress PTEN expression by directly interacting with its 3’ UTR in prostate epithelial and cancer cells. Under-expression of the four miRNAs by antisense neutralization up-regulates PTEN expression, while overexpression of the four miRNAs accelerates epithelial and prostate cancer cell proliferation. Furthermore, the expression of the four miRNAs could, singly or jointly, alter the expression of the key components in the phosphoinositide 3-kinase (PI3K)/Akt pathway, including PIK3CA, PIK3CD, PIK3R1 and Akt, along with their downstream signal, cyclin D1. Conclusions These results suggested that the four miRNAs could promote prostate cancer cell proliferation by co-regulating the expression of PTEN, PI3K/Akt pathway and cyclin D1 in vitro. These findings increase understanding of the molecular mechanisms of prostate carcinogenesis and progression, even provide valuable insights into the diagnosis, prognosis, and rational design of novel therapeutics for prostate cancer. PMID:24098737

  4. Tau deletion promotes brain insulin resistance.

    Science.gov (United States)

    Marciniak, Elodie; Leboucher, Antoine; Caron, Emilie; Ahmed, Tariq; Tailleux, Anne; Dumont, Julie; Issad, Tarik; Gerhardt, Ellen; Pagesy, Patrick; Vileno, Margaux; Bournonville, Clément; Hamdane, Malika; Bantubungi, Kadiombo; Lancel, Steve; Demeyer, Dominique; Eddarkaoui, Sabiha; Vallez, Emmanuelle; Vieau, Didier; Humez, Sandrine; Faivre, Emilie; Grenier-Boley, Benjamin; Outeiro, Tiago F; Staels, Bart; Amouyel, Philippe; Balschun, Detlef; Buee, Luc; Blum, David

    2017-08-07

    The molecular pathways underlying tau pathology-induced synaptic/cognitive deficits and neurodegeneration are poorly understood. One prevalent hypothesis is that hyperphosphorylation, misfolding, and fibrillization of tau impair synaptic plasticity and cause degeneration. However, tau pathology may also result in the loss of specific physiological tau functions, which are largely unknown but could contribute to neuronal dysfunction. In the present study, we uncovered a novel function of tau in its ability to regulate brain insulin signaling. We found that tau deletion leads to an impaired hippocampal response to insulin, caused by altered IRS-1 and PTEN (phosphatase and tensin homologue on chromosome 10) activities. Our data also demonstrate that tau knockout mice exhibit an impaired hypothalamic anorexigenic effect of insulin that is associated with energy metabolism alterations. Consistently, we found that tau haplotypes are associated with glycemic traits in humans. The present data have far-reaching clinical implications and raise the hypothesis that pathophysiological tau loss-of-function favors brain insulin resistance, which is instrumental for cognitive and metabolic impairments in Alzheimer's disease patients. © 2017 Marciniak et al.

  5. Sales promotion strategies in Procter&Gamble

    OpenAIRE

    Šebesta, Miroslav

    2017-01-01

    The thesis gives comprehensive overview on the topic of sales promotions. The special focus is devoted to activities of Procter & Gamble on the Czech market. With increasing importance of sales promotions on the Czech market, the thesis aims to introduce main academic findings concerning sales promotions and test them on brands of Procter & Gamble. The next goal is to find out whether sales promotion strategies of Procter & Gamble provide a competitive advantage for the company on the Czech m...

  6. 7 CFR 1220.121 - Promotion.

    Science.gov (United States)

    2010-01-01

    ... promotion means any action, including paid advertising, technical assistance, and trade servicing activities... 7 Agriculture 10 2010-01-01 2010-01-01 false Promotion. 1220.121 Section 1220.121 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE SOYBEAN PROMOTION, RESEARCH, AND...

  7. Do Promotions Benefit Manufacturers, Retailers or Both?

    NARCIS (Netherlands)

    S. Srinivasan (Shuba); K.H. Pauwels (Koen); D.M. Hanssens (Dominique); M.G. Dekimpe (Marnik)

    2002-01-01

    textabstractWhile there has been strong managerial and academic interest in price promotions, much of the focus has been on the impact of such promotions on category sales, brand sales and brand choice. In contrast, little is known about the long-run impact of price promotions on manufacturer and

  8. Employer's information and promotion-seeking activities

    OpenAIRE

    Epstein, Gil S.

    2012-01-01

    This paper presents a model in which promotion of employees within the internal firm hierarchy is determined by the individuals' allocation of time between promotion/rent-seeking and productive activity. We consider the effect of an increase in the employer's knowledge (information) regarding the employees' productivity levels on the total time spent by the workers in non-productive promotion-seeking activities.

  9. Do online gossipers promote brands?

    Science.gov (United States)

    Okazaki, Shintaro; Rubio, Natalia; Campo, Sara

    2013-02-01

    Online gossip has been recognized as small talk on social networking sites (SNSs) that influences consumer behavior, but little attention has been paid to its role. This study makes three theoretical predictions: (a) propensity to gossip online leads to greater information value, entertainment value, and friendship value; (b) upon exposure to a high-involvement product, online gossipers are more willing to spread such information through electronic word-of-mouth (eWOM) in search of prestige or fame as a knowledge expert; and (c) this tendency will be more pronounced when they are connected with strong ties (rather than weak ties) and belong to a large network (rather than a small network). An experimental survey was conducted with a scenario method. In total, 818 general consumers participated in the survey. A multivariate analysis of variance (ANOVA) provides empirical support for prediction (1). With regard to predictions (2) and (3), a series of three-way and two-way between-subjective ANOVAs were performed. When a high-involvement product is promoted, gossipers, rather than nongossipers, are more willing to participate in eWOM on an SNS. Furthermore, a significant interaction effect indicates that online gossipers' willingness to particiapte in eWOM would be more pronounced if they belonged to a large network rather than a small network. However, when a low-involvement product is promoted, no interaction effect is found between online gossip and network size. In closing, theoretical and managerial implications are discussed, while important limitations are recognized.

  10. International energy-promotion-activities

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1995-09-01

    Comprehensive promotion of energy and environmental measures are demanded in order to realize improvement in energy demand/supply structures in developing countries where increase in energy demand is anticipated. To achieve this goal, technical transfer related to energy saving technologies and clean coal as well as international energy promotion activities are implemented in China and Indonesia since fiscal 1993. In the field of energy saving, model operations are performed to improve efficiency in such energy consuming fields as steel making, power generation, and oil refining, in addition to cooperation in structuring databases and establishing master plans. In the clean coal field, model operations are conducted to reduce environmental load in coal utilizing areas, in addition to cooperation in establishing master plans for coal utilization. This paper describes feasibility studies on environmentally harmonious coal utilization systems in developing countries, assistance to introduction thereof, and joint verification operations. To rationalize international energy usage, basic surveys on energy utilization efficiency improvement and model operations are carried out mainly in the Asia-Pacific countries.

  11. The epidemiology of drug promotion.

    Science.gov (United States)

    Silverman, M

    1977-01-01

    A survey was conducted on the promotion of 28 prescription drugs in the form of 40 different products marketed in the United States and Latin America by 23 multinational pharmaceutical companies. Striking differences were found in the manner in which the identical drug, marketed by the identical company or its foreign affiliate, was described to physicians in the United States and to physicians in Latin America. In the United States, the listed indications were usually few in number, while the contraindications, warnings, and potential adverse reactions were given in extensive detail. In Latin America, the listed indications were far more numerous, while the hazards were usually minimized, glossed over, or totally ignored. The differences were not simply between the United States on the one hand and all the Latin American countries on the other. There were substantial differences within Latin America, with the same global company telling one story in Mexico, another in Central America, a third in Ecuador and Colombia, and yet another in Brazil. The companies have sought to defend these practices by contending that they are not breaking any Latin American laws. In some countries, however, such promotion is in clear violation of the law. The corporate ethics and social responsibilities concerned here call for examination and action.

  12. Promoting breast screening in Glasgow.

    Science.gov (United States)

    Cohen, L; Dobson, H; McGuire, F

    2000-03-01

    To establish whether there is a role for advertising in the promotion of the Breast Screening Programme and what the role of advertising might be. Four hundred and sixty questionnaires were completed by women attending their breast screening appointment. Quantitative and qualitative data were collected from the static unit at Calder Street and the mobile unit in Govan. The advertising (budget 30,000 Pounds) campaign ran over an eight week period in the Govan, Paisley Road West and Cardonald areas of Glasgow. Media used included press advertising, The Glasgow Underground, adshells, bus advertising (interiors) and poster distribution via local outlets. Forty-two per cent of the sample were aware of the campaign. Ninety-seven per cent liked the campaign images. Eighty eight per cent felt that breast screening should be advertised more. Screening uptake increased in the areas covered by the advertising campaign. Govan -58%-71% and Ibrox (Paisley Road West and Cardonald) -59%-61%. Women were very supportive of the role of advertising for the Breast Screening Programme. In particular they found the campaign images and messages reassuring, supportive and credible. Their views suggest that the role of advertising should be: To raise awareness of the service To make women more conscious of the benefits of screening To change public perceptions of the screening process However, it is recognised that a fully integrated approach is required for the promotion of the service to account for the improvement in uptake, as advertising cannot be expected to work in isolation.

  13. CAUSE AND EFFECT IN PROMOTING A PROJECT

    Directory of Open Access Journals (Sweden)

    SEVERIAN-VLĂDUȚ IACOB

    2013-12-01

    Full Text Available For a project to be considered successful it is necessary, besides a proper coordination, to be also done a good and wide promotion. In view of communication, promotion and maintenance ensures the organization's image. Disturbances occurring in any type of project, as a result of poor promotion, affect the image of the team and highlight the weaknesses in its management. Therefore, the promotion should be permanently monitored and evaluated. Cause-effect analysis is one of the ways we can identify some of nonconformities of the promotion process within a project.

  14. Stimulating innovative research in health promotion.

    Science.gov (United States)

    Larouche, Annie; Potvin, Louise

    2013-06-01

    The Global Working Group on Health Promotion Research (GWG HPR) of the International Union for Health Promotion and Education (IUHPE) presents a collection of four articles illustrating innovative avenues for health promotion research. This commentary synthesizes the contributions of these articles while attempting to define the contours of research in health promotion. We propose that innovation in research involves the adoption of a reflexive approach wherein consideration of context plays different roles. The reflexive process consists of questioning what is taken for granted in the conceptualization and operationalization of research. It involves linking research findings and its theoretical foundations to characteristics and goals of the field and observed realities, while orienting reflection on specific objects. The reflexive nature of the research activity is of paramount importance for innovation in health promotion. With the publication of this series, the GWG HPR wishes to strengthen health promotion research capacity at the global level and reaffirm health promotion as a specific research domain.

  15. Self-tracking as Health promotion

    DEFF Research Database (Denmark)

    Jelsøe, Erling

    Self-tracking has become widespread in many parts of the world and is understood by many of its proponents as a way to obtain bodily control and through that to improve healthy living. As such self-tracking can be understood as a particular approach to practicing individual health promotion (even...... though this is not the only incentive for self-tracking). Even though health promotion is often seen as an activity, which resonates with a focus on individual responsibility, such a conception of health promotion contrasts with a broader critical concept of health promotion that emphasize social...... an analysis of social and community oriented dimensions of self-tracking as a form of health promotion compared to the above mentioned broad critical approach to health promotion in order to identify the contradictions as well as common traits and discuss implications for health promoting initiatives...

  16. Chaenomeles – health promoting benefits

    Science.gov (United States)

    Watychowicz, Katarzyna; Janda, Katarzyna; Jakubczyk, Karolina; Wolska, Jolanta

    Chaenomeles is a genus of deciduous spiny in the family of Rosaceae (Pomoideae subfamily). For centuries, the plant was used for a treatment of anemia, rheumatism, gout and cardiovascular diseases. The chemical composition studies of Chaenomeles showed the presence of many biologically active compounds, such as: phenolic compounds, organic acids, terpenoids, alcohols, ketones or aldehydes. Fruit of Chaenomeles has the largest applying potential due to extensive use of medicinal and high concentration of vitamin C. Recent in vivo and in vitro studies suggest that Chaenomeles fruit can help in the healing process of diabetes, tumor, allergies and liver diseases. Futhermore the plant has many positive qualities, like: hepatoprotective effect, anti-inflammatory properties, antioxidant action, antimicrobial and neuroprotective effect. Chaenomeles fruit may promote the growth of beneficial intestinal microflora and contribute to the regulation of body weight. The aim of this review was to summarize the information and data on the chemical composition and therapeutic properties of Chaenomeles.

  17. Promoting sustainability through green chemistry

    Energy Technology Data Exchange (ETDEWEB)

    Kirchhoff, Mary M. [American Chemical Society, 1155 Sixteenth Street, NW, Washington, DC 20036 (United States)

    2005-06-15

    Green chemistry is an important tool in achieving sustainability. The implementation of green chemistry, the design of chemical products and processes that reduce or eliminate the use and generation of hazardous substances, is essential if the expanding global population is to enjoy an increased standard of living without having a negative impact on the health of the planet. Cleaner technologies will allow the chemical enterprise to provide society with the goods and services on which it depends in an environmentally responsible manner. Green chemistry provides solutions to such global challenges as climate change, sustainable agriculture, energy, toxics in the environment, and the depletion of natural resources. A collaborative effort by industry, academia, and government is needed to promote the adoption of the green chemistry technologies necessary to achieve a sustainable society.

  18. NEDDylation promotes stress granule assembly.

    Science.gov (United States)

    Jayabalan, Aravinth Kumar; Sanchez, Anthony; Park, Ra Young; Yoon, Sang Pil; Kang, Gum-Yong; Baek, Je-Hyun; Anderson, Paul; Kee, Younghoon; Ohn, Takbum

    2016-07-06

    Stress granules (SGs) harbour translationally stalled messenger ribonucleoproteins and play important roles in regulating gene expression and cell fate. Here we show that neddylation promotes SG assembly in response to arsenite-induced oxidative stress. Inhibition or depletion of key components of the neddylation machinery concomitantly inhibits stress-induced polysome disassembly and SG assembly. Affinity purification and subsequent mass-spectrometric analysis of Nedd8-conjugated proteins from translationally stalled ribosomal fractions identified ribosomal proteins, translation factors and RNA-binding proteins (RBPs), including SRSF3, a previously known SG regulator. We show that SRSF3 is selectively neddylated at Lys85 in response to arsenite. A non-neddylatable SRSF3 (K85R) mutant do not prevent arsenite-induced polysome disassembly, but fails to support the SG assembly, suggesting that the neddylation pathway plays an important role in SG assembly.

  19. Public Relations as Promotional Activity

    Directory of Open Access Journals (Sweden)

    Almira CURRI-MEMETI

    2011-11-01

    Full Text Available Public relations give opportunity to the organization to present its image and personality to its own “public”- users, supporters, sponsors, donors, local community and other public.It is about transferring the message to the public, but that is a twoway street. You must communicate with your public, but at the same time you must give opportunity to the public to communicate easier with you. The real public relations include dialog – you should listen to the others, to see things through their perspective. This elaborate is made with the purpose to be useful for every organization, not for the sensational promotion of its achievements, but to become more critical towards its work. Seeing the organization in the way that the other see it, you can become better and sure that you are giving to your users the best service possible.

  20. Promoting Teen Mothers' Mental Health.

    Science.gov (United States)

    Freed, Patricia; SmithBattle, Lee

    2016-01-01

    In this second article in a two-part series, we call for the integration of strengths-based and trauma-informed care into services for teen mothers. Nurses working with teen mothers in health clinics, schools and home visiting programs can play a pivotal role in promoting their mental health. Many teen mothers have high levels of psychological distress and histories of adverse experiences that cannot be ignored, and cannot solely be addressed by referral to mental health services. Nurses must be prepared to assess for trauma and be open to listening to teen mothers' experiences. Principles of strengths-based and trauma-informed care are complementary and can be integrated in clinical services so that teen mothers' distress is addressed and their strengths and aspirations are supported. Potential screening tools, interviewing skills and basic strategies to alleviate teen mothers' distress are discussed.

  1. Do Online Gossipers Promote Brands?

    Science.gov (United States)

    Rubio, Natalia; Campo, Sara

    2013-01-01

    Abstract Online gossip has been recognized as small talk on social networking sites (SNSs) that influences consumer behavior, but little attention has been paid to its role. This study makes three theoretical predictions: (a) propensity to gossip online leads to greater information value, entertainment value, and friendship value; (b) upon exposure to a high-involvement product, online gossipers are more willing to spread such information through electronic word-of-mouth (eWOM) in search of prestige or fame as a knowledge expert; and (c) this tendency will be more pronounced when they are connected with strong ties (rather than weak ties) and belong to a large network (rather than a small network). An experimental survey was conducted with a scenario method. In total, 818 general consumers participated in the survey. A multivariate analysis of variance (ANOVA) provides empirical support for prediction (1). With regard to predictions (2) and (3), a series of three-way and two-way between-subjective ANOVAs were performed. When a high-involvement product is promoted, gossipers, rather than nongossipers, are more willing to participate in eWOM on an SNS. Furthermore, a significant interaction effect indicates that online gossipers' willingness to particiapte in eWOM would be more pronounced if they belonged to a large network rather than a small network. However, when a low-involvement product is promoted, no interaction effect is found between online gossip and network size. In closing, theoretical and managerial implications are discussed, while important limitations are recognized. PMID:23276259

  2. Health promotion and dental caries.

    Science.gov (United States)

    Maltz, Marisa; Jardim, Juliana Jobim; Alves, Luana Severo

    2010-01-01

    The central idea of the Brazilian health system is to prevent the establishment of disease or detect it as early as possible. Prevention and treatment of dental caries are related to behavioral factors, including dietary and oral hygiene habits, which are related to many chronic diseases. Dental health promotion therefore should be fully integrated into broadly based health-promoting strategies and actions such as food and health policies, and general hygiene (including oral hygiene), among others. For decades, a linear relationship between sugar consumption and caries has been observed. Recent data has indicated that this relationship is not as strong as it used to be before the widespread use of fluoride. However, diet is still a key factor acting in the carious process. Oral hygiene is a major aspect when it comes to caries, since dental biofilm is its etiological factor. Oral hygiene procedures are effective in controlling dental caries, especially if plaque removal is performed adequately and associated with fluoride. An alternative to a more efficient biofilm control in occlusal areas is the use of dental sealants, which are only indicated for caries-active individuals. If a cavity is formed as a consequence of the metabolic activity of the biofilm, a restorative material or a sealant can be placed to block access of the biofilm to the oral environment in order to prevent caries progress. The prevention of dental caries based on common risk-factor strategies (diet and hygiene) should be supplemented by more disease-specific policies such as rational use of fluoride, and evidence-based dental health care.

  3. Health promotion and dental caries

    Directory of Open Access Journals (Sweden)

    Marisa Maltz

    2010-01-01

    Full Text Available The central idea of the Brazilian health system is to prevent the establishment of disease or detect it as early as possible. Prevention and treatment of dental caries are related to behavioral factors, including dietary and oral hygiene habits, which are related to many chronic diseases. Dental health promotion therefore should be fully integrated into broadly based health-promoting strategies and actions such as food and health policies, and general hygiene (including oral hygiene, among others. For decades, a linear relationship between sugar consumption and caries has been observed. Recent data has indicated that this relationship is not as strong as it used to be before the widespread use of fluoride. However, diet is still a key factor acting in the carious process. Oral hygiene is a major aspect when it comes to caries, since dental biofilm is its etiological factor. Oral hygiene procedures are effective in controlling dental caries, especially if plaque removal is performed adequately and associated with fluoride. An alternative to a more efficient biofilm control in occlusal areas is the use of dental sealants, which are only indicated for caries-active individuals. If a cavity is formed as a consequence of the metabolic activity of the biofilm, a restorative material or a sealant can be placed to block access of the biofilm to the oral environment in order to prevent caries progress. The prevention of dental caries based on common risk-factor strategies (diet and hygiene should be supplemented by more disease-specific policies such as rational use of fluoride, and evidence-based dental health care.

  4. Phytoextraction to promote sustainable development

    Directory of Open Access Journals (Sweden)

    C.W.N. Anderson

    2013-10-01

    Full Text Available Mining makes a positive contribution to the economy of Indonesia. Significant earnings accrue through the export of tin, coal, copper, nickel and gold. Of these commodities, gold carries the highest unit value. But not all gold mining is regulated. Indonesia has a significant Artisanal and Small Scale Gold Mining (ASGM industry, defined as any informal and unregulated system of gold mining. These operations are often illegal, unsafe and are environmentally and socially destructive. New technology is needed to support the sustainable exploitation of gold and other precious metal resources in locations where ASGM is currently practised. This technology must be simple, cheap, easy to operate and financially rewarding. A proven option that needs to be promoted is phytoextraction. This is technology where plants are used to extract metals from waste rock, soil or water. These metals can subsequently be recovered from the plant in pure form, and sold or recycled. Gold phytoextraction is a commercially available technology, while international research has shown that phytoextraction will also work for mercury. In the context of ASGM operations, tailings could be contained in specific ‘farming areas’ and cropped using phytoextraction technology. The banning of ASGM operations is not practicable or viable. Poverty would likely become more extreme if a ban were enforced. Instead, new technology options are essential to promote the sustainable development of this industry. Phytoextraction would involve community and worker engagement, education and employment. New skills in agriculture created through application of the technology would be transferrable to the production of food, fibre and timber crops on land adjacent to the mining operations. Phytoextraction could therefore catalyse sustainable development in artisanal gold mining areas throughout Indonesia.

  5. Health promotion practices in primary care groups.

    Science.gov (United States)

    Heidemann, Ivonete Teresinha Schulter Buss; Alonso da Costa, Maria Fernanda Baeta Neves; Hermida, Patrícia Madalena Vieira; Marçal, Cláudia Cossentino Bruck; Antonini, Fabiano Oliveira; Cypriano, Camilla Costa

    2018-04-01

    This is a descriptive-exploratory study using a qualitative approach, conducted in ten municipalities in southern Brazil. Data were obtained by talking to 21 nurses from February to November 2012, through semi-structured interviews using questions to probe their health promotion practices. Data were analyzed through thematic analysis focused on health promotion concepts. We identified four themes about health promotion practices of family health nurses in Brazil: a) training of nurses for health promotion practice was weak; b) nurses formed health promotion groups around diseases and life stages; c) nurses formed groups to meet community needs; and d) nurses used health promotion techniques in group work. These family health nurses were somewhat aware of the importance of health promotion, and how to assist the population against various ailments using some health promotion strategies. The main weaknesses were the lack of understanding about health promotion concepts, and the difficulty of understanding the relevance of its practice, probably attributable to limitations in training. We conclude that primary care groups in Brazil's unified health system could do better in applying health promotion concepts in their practice.

  6. Alcohol promotions in Australian supermarket catalogues.

    Science.gov (United States)

    Johnston, Robyn; Stafford, Julia; Pierce, Hannah; Daube, Mike

    2017-07-01

    In Australia, most alcohol is sold as packaged liquor from off-premises retailers, a market increasingly dominated by supermarket chains. Competition between retailers may encourage marketing approaches, for example, discounting, that evidence indicates contribute to alcohol-related harms. This research documented the nature and variety of promotional methods used by two major supermarket retailers to promote alcohol products in their supermarket catalogues. Weekly catalogues from the two largest Australian supermarket chains were reviewed for alcohol-related content over 12 months. Alcohol promotions were assessed for promotion type, product type, number of standard drinks, purchase price and price/standard drink. Each store catalogue included, on average, 13 alcohol promotions/week, with price-based promotions most common. Forty-five percent of promotions required the purchase of multiple alcohol items. Wine was the most frequently promoted product (44%), followed by beer (24%) and spirits (18%). Most (99%) wine cask (2-5 L container) promotions required multiple (two to three) casks to be purchased. The average number of standard drinks required to be purchased to participate in catalogue promotions was 31.7 (SD = 24.9; median = 23.1). The median price per standard drink was $1.49 (range $0.19-$9.81). Cask wines had the lowest cost per standard drink across all product types. Supermarket catalogues' emphasis on low prices/high volumes of alcohol reflects that retailers are taking advantage of limited restrictions on off-premise sales and promotion, which allow them to approach market competition in ways that may increase alcohol-related harms in consumers. Regulation of alcohol marketing should address retailer catalogue promotions. [Johnston R, Stafford J, Pierce H, Daube M. Alcohol promotions in Australian supermarket catalogues. Drug Alcohol Rev 2017;36:456-463]. © 2016 Australasian Professional Society on Alcohol and other Drugs.

  7. Health promotion in occupational health.

    Science.gov (United States)

    Kaijser, C F O

    2005-01-01

    To describe a Swedish approach to occupational health and its implications for health promotion. We start business with a new customer by creating a health policy for the whole company. Every year a follow-up is presented to top management where decisions are taken on what to do for the coming period. The result from a paper mill is presented where cost savings were five times more than expected. We have found that close follow-up and the use of personalized reminders is very useful for individuals. We have also found the importance of working more with "the softer side" i.e. looking into a person's total life situation. Management training activities are essential. This training includes for instance personality, communication and conflict handling seminars and every manager has to go through those seminars. The focus is moved from sick care to health improvement. The result is measured in long-term health for individuals. To reach that level you have to be healthy and have no absences for at least two years. The Swedish occupational health system is a unique system for creating health. With a specially trained staff including MDs, nurses, physiotherapists, psychologists, management consultants and engineers, and working from prevention to treatment, they can create a total view of both individual health and customer company wealth. Working closely together in teams and in close cooperation with customers, they can initiate great changes in both these dimensions.

  8. Petrochemical promoters in catalytic cracking

    International Nuclear Information System (INIS)

    Gomez, Maria; Vargas, Clemencia; Lizcano, Javier

    2010-01-01

    This study is based on the current scheme followed by a refinery with available Catalytic Cracking capacity to process new feedstocks such as Straight Run Naphtha and Naphthas from FCC. These feedstocks are of petrochemical interest to produce Ethane, Ethylene, Propylene, i-Butane, Toluene and Xylene. To evaluate the potential of these new streams versus the Cracking-charged Residues, it was performed a detailed chemical analysis on the structural groups in carbons [C1-C12] at the reactor product obtained in pilot plant. A catalyst with and without Propylene Promoter Additive was used. This study analyzes the differences in the chemical composition of the feedstocks, relating them to the yield of each petrochemical product. Straight Run Naphthas with a high content of Naphthenes, and Paraffines n[C5-C12] and i[C7-C12] are selective to the production of i-Butane and Propane, while Naphthas from FCC with a high content of n[C5-C12]Olefins, i-Olefins, and Aromatics are more selective to Propylene, Toluene, and Xylene. Concerning Catalytic Cracking of Naphthas, the Additive has similar selectivity for all the petrochemical products, their yields increase by about one point with 4%wt of Additive, while in cracking of Residues, the Additive increases in three points Propylene yield, corresponding to a selectivity of 50% (?C3= / ?LPG).

  9. Promotional Tool of Marketing: An Islamic Perspective

    OpenAIRE

    Muhammad Anwar; Mohammad Saeed

    1996-01-01

    Promotional tools of marketing, (e.g., personal selling, advertising, sales promotion, public relations, promotional games as well as contests), play a key role in creating consumer awareness about the qualities of various products and services available on the market, and can go a long way in contributing to economic progress and social development. Muslim marketers have to be conscious of their position and role in managing marketing activities. The Qur'anic view about man and his resources...

  10. Is the Lamb Promotion Still Working?

    OpenAIRE

    Capps, Oral, Jr.; Williams, Gary W.

    2008-01-01

    This objective of this study is to update last year’s analysis of the effectiveness of the lamb advertising and promotion program of the American Lamb Board (ALB). The main conclusion is that the lamb checkoff program is still working effectively to increase lamb consumption and sales in the United States. The analysis shows that ALB lamb promotion programs have generated roughly 8 additional pounds of total lamb consumption per dollar spent on advertising and promotion and $44.45 in addition...

  11. Years of Service and Probability of Promotion

    OpenAIRE

    Katharine G. Abraham; James L. Medoff

    1983-01-01

    This study provides evidence which we believe challenges some conventional assumptions about the promotion process. Based on survey information collected from a large random sample of U.S. private sector firms, we reach two main conclusions. First,seniority independent of productivity appears to play a significant role even in nonunion promotion decisions. Second, the differences between union and nonunion promotion processes, at least with regard to the weight assigned to seniority per se, a...

  12. The Signalling Role of Promotion in Japan

    OpenAIRE

    Okamura, Kazuaki

    2011-01-01

    Under asymmetric information conditions regarding worker productivity between current and prospective employers, a worker's promotion signals his/her productivity. In this Paper, we tested the signalling role of promotion, using Japanese micro-level data. We found that among lower-level positions, promotion seems to signal a worker's ability, and both the business cycle and foreign-capital ratio of his/her company significantly strengthen this effects. These results suggest that external labo...

  13. Marketing instruments of foreign trade promotion

    OpenAIRE

    Bjelić Predrag

    2011-01-01

    Instruments of promotion as a part of marketing mix are usually associated with companies but more and more countries use this instrument in order to boost their exports. These foreign trade promotion instruments are now popular in many countries in the world since their use is not opposed to any World Trade Organization rules. Marketing instruments of trade promotions are the most important. They include National Exhibitions and National labels of origin and quality. In order to coordinate t...

  14. Exploiting nucleotide composition to engineer promoters.

    Directory of Open Access Journals (Sweden)

    Manfred G Grabherr

    Full Text Available The choice of promoter is a critical step in optimizing the efficiency and stability of recombinant protein production in mammalian cell lines. Artificial promoters that provide stable expression across cell lines and can be designed to the desired strength constitute an alternative to the use of viral promoters. Here, we show how the nucleotide characteristics of highly active human promoters can be modelled via the genome-wide frequency distribution of short motifs: by overlapping motifs that occur infrequently in the genome, we constructed contiguous sequence that is rich in GC and CpGs, both features of known promoters, but lacking homology to real promoters. We show that snippets from this sequence, at 100 base pairs or longer, drive gene expression in vitro in a number of mammalian cells, and are thus candidates for use in protein production. We further show that expression is driven by the general transcription factors TFIIB and TFIID, both being ubiquitously present across cell types, which results in less tissue- and species-specific regulation compared to the viral promoter SV40. We lastly found that the strength of a promoter can be tuned up and down by modulating the counts of GC and CpGs in localized regions. These results constitute a "proof-of-concept" for custom-designing promoters that are suitable for biotechnological and medical applications.

  15. Comparative analyses of bidirectional promoters in vertebrates

    Directory of Open Access Journals (Sweden)

    Taylor James

    2008-05-01

    Full Text Available Abstract Background Orthologous genes with deep phylogenetic histories are likely to retain similar regulatory features. In this report we utilize orthology assignments for pairs of genes co-regulated by bidirectional promoters to map the ancestral history of the promoter regions. Results Our mapping of bidirectional promoters from humans to fish shows that many such promoters emerged after the divergence of chickens and fish. Furthermore, annotations of promoters in deep phylogenies enable detection of missing data or assembly problems present in higher vertebrates. The functional importance of bidirectional promoters is indicated by selective pressure to maintain the arrangement of genes regulated by the promoter over long evolutionary time spans. Characteristics unique to bidirectional promoters are further elucidated using a technique for unsupervised classification, known as ESPERR. Conclusion Results of these analyses will aid in our understanding of the evolution of bidirectional promoters, including whether the regulation of two genes evolved as a consequence of their proximity or if function dictated their co-regulation.

  16. Health Promotion and Wellness Staffing Methods

    National Research Council Canada - National Science Library

    Thomsen, Kim

    1999-01-01

    .... Health promotion and wellness programs positively influence the military mission readiness and force protection, increase productivity, reduce health care costs, minimize illness and non-battle...

  17. Characterization of the N-terminal segment used by the barley yellow dwarf virus movement protein to promote interaction with the nuclear membrane of host plant cells.

    Science.gov (United States)

    Dennison, Sarah Rachel; Harris, Frederick; Brandenburg, Klaus; Phoenix, David Andrew

    2007-11-01

    The barley yellow dwarf virus movement protein (BYDV-MP) requires its N-terminal sequence to promote the transport of viral RNA into the nuclear compartment of host plant cells. Here, graphical analysis predicts that this sequence would form a membrane interactive amphiphilic alpha-helix. Confirming this prediction, NT1, a peptide homologue of the BYDV-MP N-terminal sequence, was found to be alpha-helical (65%) in the presence of vesicles mimics of the nuclear membrane. The peptide increased the fluidity of these nuclear membrane mimics (rise in wavenumber of circa 0.5-1.0 cm(-1)) and induced surface pressure changes of 2 mN m(-1) in lipid monolayers with corresponding compositions. Taken with isotherm analysis these results suggest that BYDV-MP forms an N-terminal amphiphilic alpha-helix, which partitions into the nuclear membrane primarily through thermodynamically stable associations with the membrane lipid headgroup region. We speculate that these associations may play a role in targeting of the nuclear membrane by BYDM-MP.

  18. Promoting Strong Written Communication Skills

    Science.gov (United States)

    Narayanan, M.

    2015-12-01

    The reason that an improvement in the quality of technical writing is still needed in the classroom is due to the fact that universities are facing challenging problems not only on the technological front but also on the socio-economic front. The universities are actively responding to the changes that are taking place in the global consumer marketplace. Obviously, there are numerous benefits of promoting strong written communication skills. They can be summarized into the following six categories. First, and perhaps the most important: The University achieves learner satisfaction. The learner has documented verbally, that the necessary knowledge has been successfully acquired. This results in learner loyalty that in turn will attract more qualified learners.Second, quality communication lowers the cost per pupil, consequently resulting in increased productivity backed by a stronger economic structure and forecast. Third, quality communications help to improve the cash flow and cash reserves of the university. Fourth, having high quality communication enables the university to justify the need for high costs of tuition and fees. Fifth, better quality in written communication skills result in attracting top-quality learners. This will lead to happier and satisfied learners, not to mention greater prosperity for the university as a whole. Sixth, quality written communication skills result in reduced complaints, thus meaning fewer hours spent on answering or correcting the situation. The University faculty and staff are thus able to devote more time on scholarly activities, meaningful research and productive community service. References Boyer, Ernest L. (1990). Scholarship reconsidered: Priorities of the Professorate.Princeton, NJ: Carnegie Foundation for the Advancement of Teaching. Hawkins, P., & Winter, J. (1997). Mastering change: Learning the lessons of the enterprise.London: Department for Education and Employment. Buzzel, Robert D., and Bradley T. Gale. (1987

  19. The construction of a library of synthetic promoters revealed some specific features of strong Streptomyces promoters

    DEFF Research Database (Denmark)

    Seghezzi, Nicolas; Amar, Patrick; Købmann, Brian

    2011-01-01

    Streptomyces are bacteria of industrial interest whose genome contains more than 73% of bases GC. In order to define, in these GC-rich bacteria, specific sequence features of strong promoters, a library of synthetic promoters of various sequence composition was constructed in Streptomyces. To do so...... cloned into the promoter-probe plasmid pIJ487 just upstream of the promoter-less aphII gene that confers resistance to neomycin. This synthetic promoter library was transformed into Streptomyces lividans, and the resulting transformants were screened for their ability to grow in the presence of different...... projects. Thirty-eight promoters were sequenced, and the sequences of the 14 weakest and 14 strongest promoters were compared using the WebLogo software with small sample correction. This comparison revealed that the −10 box, the −10 extended motif as well as the spacer of the strong Streptomyces promoters...

  20. Linking Core Promoter Classes to Circadian Transcription.

    Directory of Open Access Journals (Sweden)

    Pål O Westermark

    2016-08-01

    Full Text Available Circadian rhythms in transcription are generated by rhythmic abundances and DNA binding activities of transcription factors. Propagation of rhythms to transcriptional initiation involves the core promoter, its chromatin state, and the basal transcription machinery. Here, I characterize core promoters and chromatin states of genes transcribed in a circadian manner in mouse liver and in Drosophila. It is shown that the core promoter is a critical determinant of circadian mRNA expression in both species. A distinct core promoter class, strong circadian promoters (SCPs, is identified in mouse liver but not Drosophila. SCPs are defined by specific core promoter features, and are shown to drive circadian transcriptional activities with both high averages and high amplitudes. Data analysis and mathematical modeling further provided evidence for rhythmic regulation of both polymerase II recruitment and pause release at SCPs. The analysis provides a comprehensive and systematic view of core promoters and their link to circadian mRNA expression in mouse and Drosophila, and thus reveals a crucial role for the core promoter in regulated, dynamic transcription.

  1. Composing a Tumor Specific Bacterial Promoter.

    Directory of Open Access Journals (Sweden)

    Igor V Deyneko

    Full Text Available Systemically applied Salmonella enterica spp. have been shown to invade and colonize neoplastic tissues where it retards the growth of many tumors. This offers the possibility to use the bacteria as a vehicle for the tumor specific delivery of therapeutic molecules. Specificity of such delivery is solely depending on promoter sequences that control the production of a target molecule. We have established the functional structure of bacterial promoters that are transcriptionally active exclusively in tumor tissues after systemic application. We observed that the specific transcriptional activation is accomplished by a combination of a weak basal promoter and a strong FNR binding site. This represents a minimal set of control elements required for such activation. In natural promoters, additional DNA remodeling elements are found that alter the level of transcription quantitatively. Inefficiency of the basal promoter ensures the absence of transcription outside tumors. As a proof of concept, we compiled an artificial promoter sequence from individual motifs representing FNR and basal promoter and showed specific activation in a tumor microenvironment. Our results open possibilities for the generation of promoters with an adjusted level of expression of target proteins in particular for applications in bacterial tumor therapy.

  2. Marketing instruments of foreign trade promotion

    Directory of Open Access Journals (Sweden)

    Bjelić Predrag

    2011-01-01

    Full Text Available Instruments of promotion as a part of marketing mix are usually associated with companies but more and more countries use this instrument in order to boost their exports. These foreign trade promotion instruments are now popular in many countries in the world since their use is not opposed to any World Trade Organization rules. Marketing instruments of trade promotions are the most important. They include National Exhibitions and National labels of origin and quality. In order to coordinate the application of these instruments countries have established national bodies for trade promotion. Many studies in the past had argued that national Agencies established to promote export did not had any real success, but recent studies indicate that they could have a significant impact on country export promotion. The result of this rise in impact of national export promotion agencies is due to international effort spearheaded by International Trade Center. The aim of this paper is to point out types and methods of marketing instruments application in trade promotion and to present the effectiveness of these instruments applications.

  3. Promotion of oral health by community nurses.

    Science.gov (United States)

    Garry, Brendan; Boran, Sue

    2017-10-02

    To explore the enablers and barriers perceived by community nurses in the promotion of oral health in an adult community trust directorate. Oral health care promotion in community care settings is being neglected. England and Wales have witnessed marked improvements in periodontal disease; however, no improvements have been seen in older people. A qualitative methodology was employed, where eight nurses from Band 5 to 7 were interviewed using a semi-structured approach. The data was analysed thematically. Data analysis was organised into four themes: professional self-concept and the development of knowledge, skills and attitudes necessary in the promotion of oral health; the impact an organisation has on the promotion of oral health and an exploration of the enablers and barriers identified by the community nurses while delivering care; the relationships between the nurse and patient and the potential impact on oral health promotion; the concept of self-regard in relation to the promotion of oral health and its overall impact. A commitment to improving oral health and requests for additional educational input were apparent. Organisational enablers and barriers were identified, alongside the crucial role a positive self-regard for oral health care may play in the promotion of oral health. Nurses need relevant education, organisational support, adequate resources and support from a multidisciplinary team to deliver optimal oral health promotion.

  4. Electrochemical Promotion of Catalytic Reactions Using

    DEFF Research Database (Denmark)

    Petrushina, Irina; Bjerrum, Niels; Cleemann, Lars Nilausen

    2007-01-01

    This paper presents the results of a study on electrochemical promotion (EP) of catalytic reactions using Pt/C/polybenzimidazole(H3PO4)/Pt/C fuel cell performed by the Energy and Materials Science Group (Technical University of Denmark) during the last 6 years[1-4]. The development of our...... understanding of the nature of the electrochemical promotion is also presented....

  5. The double jeopardy of sales promotions.

    Science.gov (United States)

    Jones, J P

    1990-01-01

    The maturing of most consumer markets in the United States has put great pressure on manufacturers in their search for growth. They have concentrated on building sales and expanding share proportions in the stagnant markets with devices like niche products, product extensions, mergers, and international ventures. They have shifted emphasis to sales promotions at the expense of advertising. But promotions, when you come right down to it, mean price reductions. Trade promotions are almost always rebates, and consumer promotions are usually temporary price reductions or coupons. The cost in reduced profit, demonstrated mathematically through calculations of price elasticity, is severe. Besides, when the promotion is over, the manufacturer has not moved forward an inch in shoring up the brand franchise. Promotions bring volatile demand, whereas the producer seeks stable demand. By sustaining a brand image and building customer loyalty, on the other hand, theme advertising can stabilize demand. Moreover, this type of advertising is less likely than promotion is to invite destructive competitive retaliation. Calculation of the advertising elasticity of a brand indicates that sometimes even modest sales increases can produce healthy profit improvement. In a well-planned marketing campaign, there is often good reason to include trade or consumer promotion--to counter a leading competitor's moves, for example. But there is no point in carrying out wild swings at rivals in a struggle for market share. Mathematical techniques can aid the efficiency of marketing planning and put on a more rational basis the decision on where to put the dollars.

  6. A new method for promoting lily flowering

    African Journals Online (AJOL)

    Jane

    2011-08-08

    Aug 8, 2011 ... FT is thought to be the florigen in plants. In this research, a new method for promoting lily flowering was introduced. The function of FT gene cloned from Arabidopsis on promoting lily flowering was analyzed. pET-30a-FT vector was constructed to indicate the expression of FT:eGFP fuse protein in.

  7. Activities for Engaging Schools in Health Promotion

    Science.gov (United States)

    Bardi, Mohammad; Burbank, Andrea; Choi, Wayne; Chow, Lawrence; Jang, Wesley; Roccamatisi, Dawn; Timberley-Berg, Tonia; Sanghera, Mandeep; Zhang, Margaret; Macnab, Andrew J.

    2014-01-01

    Purpose: The purpose of this paper is to describe activities used to initiate health promotion in the school setting. Design/Methodology/Approach: Description of successful pilot Health Promoting School (HPS) initiatives in Canada and Uganda and the validated measures central to each program. Evaluation methodologies: quantitative data from the…

  8. Marketing and Promotion of Library Services

    Science.gov (United States)

    Nicholas, Julie

    As librarians we should be actively marketing and promoting our library services. This paper aims to demystify marketing for librarians. Practical solutions are provided on how to implement a marketing strategy, with particular emphasis on the value of using electronic information resources. It also shows the link between promoting library services and raising the profile of the library.

  9. Promoting people's health: challenges and opportunities.

    Science.gov (United States)

    Heitkamp, P

    1998-01-01

    Promoting health underlines the right of each individual to the highest attainable standard of health. It stresses the importance of the participation of people and recognizes different sociocultural values and beliefs that are prevalent throughout the world. Working on health development has a sustainable effect only when done comprehensively: personal development, community development, organizational development, and political development. The international conferences that have marked the way of health promotion have been goal posts of an energetic movement to strengthen health worldwide. The Ottawa Charter on Health Promotion has been a worldwide source of guidance for health promotion through its five strategies: building health policy, creating supportive elements, strengthening community action, developing personal skills, and reorienting health services. Moreover, the Jakarta Declaration on "Leading Health Promotion into the 21st Century" identifies five priorities in the next millennium: 1) promote social responsibility for health; 2) increase investments for health development; 3) consolidate and expand partnerships for health; 4) increase community capacity and empower the individual in matters of health; and 5) secure an infrastructure for health promotion. Increasing the investment in health development calls for the need to find new mechanisms for funding as well as reorienting existing resources towards health promotion and health education.

  10. 7 CFR 1209.17 - Promotion.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Promotion. 1209.17 Section 1209.17 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (MARKETING AGREEMENTS... CONSUMER INFORMATION ORDER Mushroom Promotion, Research, and Consumer Information Order Definitions § 1209...

  11. Physical activity and health promotion strategies among ...

    African Journals Online (AJOL)

    EB

    out information regarding physical activity were most common methods used in promotion of physical activity. Policies on ... highlighted. Conclusion: Although physiotherapists experience barriers to promoting physical activity, they have good physical activity .... workplace tended to vary from lack of books or articles on.

  12. 76 FR 34871 - Mobile Barcode Promotion

    Science.gov (United States)

    2011-06-15

    .... The mobile barcodes must be used for marketing, promotional or educational purposes. They may not be... POSTAL SERVICE 39 CFR Part 111 Mobile Barcode Promotion AGENCY: Postal Service TM . ACTION: Final... and flats, and Standard Mail[reg] letters and flats bearing two-dimensional mobile barcodes. DATES...

  13. PROMOTIONAL STRATEGY OF THE ALBA IULIA FORTRESS

    OpenAIRE

    Andreea Muntean; Lucian Marina

    2008-01-01

    The specific character of The Fortress of Alba Iulia results from its value as anelement of historical and cultural patrimony. This value must be kept and brought into prominence,and for this it must be promoted with the help of cultural tourism. This paper presents some issuesregarding the promotional strategy of the Alba Iulia Fortress.

  14. 17 CFR 200.70 - Business promotions.

    Science.gov (United States)

    2010-04-01

    ... AND ETHICS; AND INFORMATION AND REQUESTS Canons of Ethics § 200.70 Business promotions. A member must not engage in any other business, employment or vocation while in office, nor may he ever use the... 17 Commodity and Securities Exchanges 2 2010-04-01 2010-04-01 false Business promotions. 200.70...

  15. Identifying Opinion Leaders to Promote Behavior Change

    Science.gov (United States)

    Valente, Thomas W.; Pumpuang, Patchareeya

    2007-01-01

    This article reviews 10 techniques used to identify opinion leaders to promote behavior change. Opinion leaders can act as gatekeepers for interventions, help change social norms, and accelerate behavior change. Few studies document the manner in which opinion leaders are identified, recruited, and trained to promote health. The authors categorize…

  16. Intelligent promotion of city and gas enterprise

    Energy Technology Data Exchange (ETDEWEB)

    1989-07-01

    This paper studied the conception of intelligent promotion in cities, present situation and future trend, and reported how gas enterprises should respond. The intelligent promotion is divided into two areas, namely, that in the business buildings and that in private houses. Thia paper studied mainly for that in business buildings and then the concept of intelligent promotion in private houses was arranged. The intelligent promotion was thought by dividing four systems, that is, space and equipment system, service and management system, human system, and social system. But present intelligent promotion is carried out only a part of three systems except last one. A part of human system and social system are remained as the future problems. 4 figs., 2 tabs.

  17. Promoting exports in the energy technology area

    International Nuclear Information System (INIS)

    Iten, R.; Oettli, B.; Jochem, E.; Mannsbart, W.

    2001-01-01

    This report for the Swiss Federal Office of Energy (SFOE) examines the position of Switzerland as a leader in the investment goods markets for energy-efficiency products and for technologies for using renewable forms of energy. The report quotes figures for exports in these areas and discusses the difficulty of extracting useful data on these products from normal statistical data. Analyses made by a group of experts from the export-oriented technology field, energy service providers and representatives of export promotion institutions are presented and figures are quoted for various product categories. Factors promoting the competitiveness of Swiss products are discussed as well as those impeding it. An analysis of export potential is presented and measures to promote export are discussed. The report also discusses the aids and promotion activities that are considered necessary by companies in the field and the macro-economic perspectives of increased export promotion

  18. Does workplace health promotion reach shift workers?

    DEFF Research Database (Denmark)

    Nabe-Nielsen, Kirsten; Garde, Anne Helene; Clausen, Thomas

    2015-01-01

    OBJECTIVES: One reason for health disparities between shift and day workers may be that workplace health promotion does not reach shift workers to the same extent as it reaches day workers. This study aimed to investigate the association between shift work and the availability of and participation...... in workplace health promotion. METHODS: We used cross-sectional questionnaire data from a large representative sample of all employed people in Denmark. We obtained information on the availability of and participation in six types of workplace health promotion. We also obtained information on working hours, ie......). RESULTS: In the general working population, fixed evening and fixed night workers, and employees working variable shifts including night work reported a higher availability of health promotion, while employees working variable shifts without night work reported a lower availability of health promotion...

  19. What makes health promotion research distinct?

    Science.gov (United States)

    Woodall, James; Warwick-Booth, Louise; South, Jane; Cross, Ruth

    2018-02-01

    There have been concerns about the decline of health promotion as a practice and discipline and, alongside this, calls for a clearer articulation of health promotion research and what, if anything, makes it distinct. This discussion paper, based on a review of the literature, the authors' own experiences in the field, and a workshop delivered by two of the authors at the 8th Nordic Health Promotion Conference, seeks to state the reasons why health promotion research is distinctive. While by no means exhaustive, the paper suggests four distinctive features. The paper hopes to be a catalyst to enable health promotion researchers to be explicit in their practice and to begin the process of developing an agreed set of research principles.

  20. The Nordic Health Promotion Research Network (NHPRN).

    Science.gov (United States)

    Ringsberg, Karin C

    2015-08-01

    The Nordic Health Promotion Research Network (NHPRN) was established in 2007 at the Nordic School of Public Health (NHV). This article aims to describe the foundation of the NHPRN, the development and the present status of the work of NHPRN. The NHPRN consists of about 50 senior and junior researchers from all Nordic countries. It is a working network that aims to develop the theoretical understanding of health promotion, to create research cooperation in health promotion from a Nordic perspective and to extend the scope of health promotion through education. Network members meet biannually to discuss and further develop research within the field and are also responsible for the Nordic conference on Health Promotion, organized every 3 years. The NHV hosted the network between 2007 and 2014; and the World Health Organisation (WHO) will assume this role in 2015. © 2015 the Nordic Societies of Public Health.

  1. Promoter2.0: for the recognition of PolII promoter sequences

    DEFF Research Database (Denmark)

    Knudsen, Steen; Knudsen, Steen

    1999-01-01

    transcription start sites. On standardized test setsconsisting of human genomic DNA, the performance of Promoter2.0 compares well with other softwaredeveloped for the same purpose. Availability : Promoter2.0 is available as a Web server at http://www.cbs.dtu.dk/services/promoter/ Contact : steen@cbs.dtu.dk...

  2. Promoting Health in Early Childhood Environments: A Health-Promotion Approach

    Science.gov (United States)

    Minniss, Fiona Rowe; Wardrope, Cheryl; Johnston, Donni; Kendall, Elizabeth

    2013-01-01

    This paper investigates the mechanisms by which a health-promotion intervention might influence the health-promoting behaviours of staff members working in early childhood centres. The intervention was an ecological health-promotion initiative that was implemented within four early childhood centres in South-East Queensland, Australia. In-depth,…

  3. Ionizing radiation in tumor promotion and progression

    International Nuclear Information System (INIS)

    Mitchel, R.E.J.

    1990-08-01

    Chronic exposure to beta radiation has been tested as a tumor promoting or progressing agent. The dorsal skins of groups of 25 female SENCAR mice were chemically initiated with a single exposure to DMBA, and chronic exposure to strontium-90/yttrium-90 beta radiation was tested as a stage 1, stage 2 or complete skin tumor promoter. Exposure of initiated mice to 0.5 gray twice a week for 13 weeks produced no papillomas, indicating no action as a complete promoter. Another similar group of animals was chemically promoted through stage 1 (with TPA) followed by 0.5 gray of beta radiation twice a week for 13 weeks. Again no papillomas developed indicating no action of chronic radiation as a stage 2 tumor promoter. The same radiation exposure protocol in another DMBA initiated group receiving both stage 1 and 2 chemical promotion resulted in a decrease in papilloma frequency, compared to the control group receiving no beta irradiation, indicating a tumor preventing effect of radiation at stage 2 promotion, probably by killing initiated cells. Chronic beta radiation was tested three different ways as a stage 1 tumor promoter. When compared to the appropriate control, beta radiation given after initiation as a stage 1 promoter (0.5 gray twice a week for 13 weeks), after initiation and along with a known stage 1 chemical promoter (1.0 gray twice a week for 2 weeks), or prior to initiation as a stage 1 promoter (0.5 gray twice a week for 4 weeks), each time showed a weak (∼ 15% stimulation) but statistically significant (p<0.01) ability to act as a stage 1 promoter. When tested as a tumor progressing agent delivered to pre-existing papillomas, beta radiation (0.5 gray twice a week for 13 weeks) increased carcinoma frequency from 0.52 to 0.68 carcinoma/animal, but this increase was not statistically significant at the 95% confidence level. We conclude that in the addition to the known initiating, progressing and complete carcinogenic action of acute exposures to ionizing

  4. Data describing the effect of DRD4 promoter polymorphisms on promoter activity

    Directory of Open Access Journals (Sweden)

    Shoin Tei

    2016-06-01

    Full Text Available This data article tested whether polymorphisms within the dopamine D4 receptor (DRD4 gene promoter can lead to differences in the promoter activity. The variants, a 120-bp variable number tandem repeat (VNTR, −906 T/C, −809 G/A, −616G/C, and −521C/T, were introduced into the DRD4 promoter and the promoter activity was measured in a neural cell line using the luciferase assay. However, no differences were detected among the haplotypes investigated, and the in vitro data obtained from our protocol could not support the involvement of DRD4 promoter polymorphisms in heritable human traits.

  5. THE PROMOTIONAL ACTIVITY IN THE TOURISTIC SECTOR

    Directory of Open Access Journals (Sweden)

    Costel Iliuta Negricea

    2008-05-01

    Full Text Available The promotion as one of the components of the marketing mix, laying stress, în this regard,on its role în the deployment of the tourism companies’ activity, the structure of the promotional activity în thetouristic sector as well as the use of the promotional strategies în the attainment of the development targets ofthe tourism companies.So, în the paper there have been mentioned the three levels at which it is made the touristic promotionîn Romania, respectively nationally, by the Ministry of the Tourism, under whose subordination it is theTourism National Authority, the second level is the regional/local one, concerning the activity carried out bythe Centers/Offices of Touristic Information from a series of localities, and the last level refers to the microone, respectively at the level of the tourism companies, which promote their offer individually (the most often.The important role of the promotion în the deployment of the activity of the tourism companies isbeing highlighted by the fact that this makes the connection between the activity of an organization and itscustomers (effective or potential, and, în the touristic field, the content of the promotional activity is stronglystressed by the features of this type of services and of the system of creation and delivery, as well as of thepurchasing behaviour.

  6. ONLINE PROMOTION OF FINANCIAL INVESTMENT SERVICES COMPANIES

    Directory of Open Access Journals (Sweden)

    Ioana Ancuta Iancu

    2016-12-01

    Full Text Available When we think about promotion in financial investment services companies, we have to consider, not only the offline or traditional type of promotion (personal communication, advertising, sales promotion, public relations and organization identity but online promotion as well. Due to the fact that for more and more people, Internet represents the most important mean of communication, financial investment services companies marketing specialists have a variety of tools at hand. In this study we will describe the most important online promotion tools, like: E-mail Marketing, advertising, search engines, networks socialization, M-Marketing and promotion through web pages. Specific methods of online promotion enable real-time knowledge of the investor’s behavior and can also address to them most effectively. The purpose of this theoretical study is to increase the rate of knowledge and usage of online marketing, in a very conservatory sector of the financial market: Financial Investment Services Companies Marketing. By promoting online a company, a product or a service the marketing specialists can target specific customer, segments and quantify results, which is almost impossible on such a scale and with such precision by traditional methods of promotion. Based on the literature and our own experience, methods were taken up and adapted in financial investment services companies. We show the present state of online marketing, make proposals and describe difficulties which can be encountered when an e-marketing strategy is made. The conclusion of our study is that more and more companies use online tools in their marketing strategies. There is a change in attitude by the Financial Investment Services Companies web pages: from a reserved one in 2010 to one open to innovation in 2015; we believe that SSIF Broker is an illustrative example in this regard. Instead, our opinion is that Search Engine Optimization should be used more by SSIF Broker

  7. The impact of the distance-dependent promotional effect on the promotion cost sharing decision

    Science.gov (United States)

    Sheen, Gwo-Ji; Wang, Shih-Yen; Yeh, Yingchieh

    2016-02-01

    This paper considers the promotion cost sharing decision between a supplier and a retailer. The customer demand is affected by both national and local promotional effects while the local promotional effect on a customer is dependent on the distance between the retailer and this customer. We propose a continuous approximation approach to modelling the sum of the customer demand in the whole market area served by the retailer. A model is provided to help managers decide on the retail price, the local advertising expenditure, the national advertising expenditure, and the supplier participation rate, with consideration of the influence of distance on the promotional effect. We also find that the supplier's promotion cost sharing rate increases as the market size increases or the influence of distance on the promotional effect decreases. A numerical example is given to show that the nature of distance-dependent promotional effect has a significant impact on the decisions and profits.

  8. The contemporary Romanian paradigm of marketing promotion

    Directory of Open Access Journals (Sweden)

    Manic Marius

    2018-01-01

    Full Text Available Contemporary marketing takes place in the field of permanent interconnection, of instant information and immediate rewards. Communication through marketing promotion will take these characteristics into account or will be just an inefficient spending. The Romanian market is no different from the global one. Marketing promotion currently has new tools that lead to new challenges in that it makes use of traditional, yet pow erful forms, but also absolute ways of communication. The Romanian promotion is helped today by these tools, but its task is more complex than it was a decade ago .

  9. Promotional activities of banks in Serbia

    Directory of Open Access Journals (Sweden)

    Zelenović Vera

    2008-01-01

    Full Text Available The paper is focused on banking sector in Serbia, particulary on promotional activities of banks in public and on media. The authors of paper tried to find cause and effect relationship between business success and working quality on the one hand and investment in promotion activities of bank on the other hand, like important instrument of bank's business policy realization. Promotional activities appear like successful instrument in order to increase satisfaction of the bank's clients, which effect the increase of successfulness of banks' business.

  10. Promotion on the industrial products market

    Directory of Open Access Journals (Sweden)

    Raluca-Dania TODOR

    2015-12-01

    Full Text Available The literature abounds with articles and books on marketing and especially promoting consumer products. As consumers for these goods we are exposed each day to promotional messages of major product brands in order to attract or retain us when we are already buyers. Fewer things have been written about how to do promotion of industrial goods, which are a special category of goods, but have a very high quota in trade of goods, both nationally and internationally. This article will analy

  11. Promotional Strategy of Advent Himalaya Trekks Private Limited

    OpenAIRE

    Gurung, Sabin

    2017-01-01

    The purpose of conducting this thesis was to study on the promotional strategy of a trekking company. The aim of this thesis was to study on current promotional strategy and suggest the case company with new and effective ideas and tools for promotion. The theoretical part of this thesis includes basic knowledge of marketing, promotion, promotional mix and promotional strategy. Also, a short overview of tourism business of Nepal and promotional strengths of the case company is also done. H...

  12. Promoting Community Health Resources: Preferred Communication Strategies

    Science.gov (United States)

    Background: Community health promotion efforts involve communicating resource information to priority populations. Which communication strategies are most effective is largely unknown for specific populations. Objective: A random-dialed telephone survey was conducted to assess health resource comm...

  13. Isolation of phytohormones producing plant growth promoting ...

    African Journals Online (AJOL)

    PRECIOUS

    2009-11-02

    Nov 2, 2009 ... phytohormones indole-3-acetic acid (IAA), gibberellic acid (GA3), trans-zeatin riboside (t-zr) and abscisic acid ... soil of Pakistan and their growth promoting effects have .... adapt themselves to salty environment of Khewra salt.

  14. 21 CFR 314.640 - Promotional materials.

    Science.gov (United States)

    2010-04-01

    ... Efficacy Studies Are Not Ethical or Feasible § 314.640 Promotional materials. For drug products being... publication within 120 days following marketing approval. After 120 days following marketing approval, unless...

  15. Ethics, equality and evidence in health promotion

    DEFF Research Database (Denmark)

    Vallgårda, Signild

    2014-01-01

    Abstract Aim: The Danish National Board of Health has expressed its commitment to social equality in health, evidence-informed health promotion and public health ethics, and has issued guidelines for municipalities on health promotion, in Danish named prevention packages.The aim of this article...... is to analyse whether the Board of Health adheres to ideals of equality, evidence and ethics in these guidelines. Methods: An analysis to detect statements about equity, evidence and ethics in 10 health promotion packages directed at municipalities with the aim of guiding the municipalities towards evidence......-informed disease prevention and health promotion. Results: Despite declared intentions of prioritizing social equality in health, these intentions are largely absent from most of the packages.When health inequalities are mentioned, focus is on the disadvantaged or the marginalized. Several interventions...

  16. Can collusion promote sustainable consumption and production?

    NARCIS (Netherlands)

    Schinkel, M.P.; Spiegel, Y.

    2016-01-01

    Several competition authorities have taken public interest considerations, such as promoting sustainable consumption and production, into account in cartel proceedings.We show that when consumers value sustainable products and firms choose investments in sustainability before choosing output,

  17. Can Collusion Promote Sustainable Consumption and Production?

    NARCIS (Netherlands)

    Schinkel, M.P.; Spiegel, Y.

    Several competition authorities consider the exemption of horizontal agreements among firms from antitrust liability if the agreements sufficiently promote public interest objectives such as sustainable consumption and production. We show that when consumers value sustainable products and firms

  18. 7 CFR 1221.23 - Promotion.

    Science.gov (United States)

    2010-01-01

    ... sorghum. This includes paid advertising and public relations. ... Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (MARKETING AGREEMENTS.... Promotion means any action taken to present a favorable image of sorghum to the public and the end-user...

  19. Health promotion settings: principles and practice

    National Research Council Canada - National Science Library

    Scriven, Angela; Hodgins, Margaret

    2012-01-01

    ...: www.sagepublications.comHealth Promotion Settings Principles and Practice Edited by Angela Scriven and Margaret HodginsEditorial arrangement, Introduction to Part II © Angela Scriven and Margaret...

  20. Health promotion capacity building in South Africa.

    Science.gov (United States)

    Wills, Jane; Rudolph, Michael

    2010-09-01

    Health promotion in South Africa is in its early stages and while there is some institutional development and capacity building for managers, there has been relative disregard and lack of attention of the wider health promotion workforce who carry out community-based health promotion activities. This article describes one regional education and training programme for health promoters as well as the limited available evidence on the impact of the project on learners and organizations. Marked differences before and after the implementation of the training activities were reported in relation to behaviour change communication and project planning, in addition to self-reported positive change in knowledge, confidence and a high level of participant satisfaction. Investment in individual skills development needs to be accompanied by wider workforce development with organizational/institutional development and recognised competencies frameworks.

  1. Processes and outcomes in school health promotion

    DEFF Research Database (Denmark)

    Simovska, Venka

    2012-01-01

    This is the second special issue of Health Education which features research, theory and practice based perspectives on what counts as desirable outcomes of health promotion in schools in terms of health as well as education, and the effective processes in schools which lead to these outcomes....... The focus in the first special issue was on highlighting the argument that the question about the outcomes of the health-promoting schools should not be limited to narrowly defined health outcomes but needs to be closely linked with the core tasks and values of the school. Building further on this argument......, the papers in this issue feature a number of research issues of relevance for the effectiveness of the health-promoting schools approach, as well as a variety of research and evaluation methodologies contributing to the debate about what counts as reliable evidence within the health-promoting schools...

  2. Ayurvedic Amalaki Rasayana promotes improved stress tolerance

    Indian Academy of Sciences (India)

    Ayurvedic Amalaki Rasayana promotes improved stress tolerance and thus ... and some otheringredients, and is used for general good health and healthy aging. ... Wild-type larvae/flies rearedon AR-supplemented food survived the various ...

  3. Promoting consumer empowerment through entrepreneurship: a proposal.

    Science.gov (United States)

    Prince, Jonathan D

    2007-01-01

    In order to promote life control, this proposal suggests strategies to help people who use community mental health services to access small loans or "microcredit" for entrepreneurship in self-help groups.

  4. Worksite health promotion programs in college settings

    Science.gov (United States)

    Hill-Mey, Patricia E.; Kumpfer, Karol L.; Merrill, Ray M.; Reel, Justine; Hyatt-Neville, Beverly; Richardson, Glenn E.

    2015-01-01

    The purpose of this paper is to describe the multifaceted nature and benefits of worksite health promotion programs (WHPPs), with emphasis on the college setting. An assessment of the peer-reviewed literature was conducted of articles published since 2000. Several search engines were accessed and selected key words were used. Most studies examining WHPPs have focused on return on investment and productivity. Research that targets the softer side-benefits of health promotion programs in the workplace is less available. Although the college setting offers some advantages for implementing health promotion programs. They may also have unique challenges due to their large and diverse employee population. There is little research to show the effectiveness and unique challenges of college-based health promotion programs. PMID:25861657

  5. Promoters and barriers in hospital team communication

    DEFF Research Database (Denmark)

    Rabøl, Louise Isager; McPhail, Mette Arnsfelt; Østergaard, Doris

    2012-01-01

    on teamwork and communication promote safe information exchange. Lack of standard assignments and procedures, a flat hierarchy that leaves responsibility unclear, different agendas for the treatment of the patient, interruptions, and multimultitasking, inhibit safe information exchange. Conclusion: Power...

  6. Professional competences in school health promotion

    DEFF Research Database (Denmark)

    Carlsson, Monica Susanne

    2015-01-01

    shows that ‘a production logic’ and economic values are emphasized in the motivation of the project and in the knowledge base underpinning the competency-framework. The discussion of the responsiveness of the formulations in relation to school health promotion points out that there are matches between......The purpose of the study is to critically explore the formulations of competencies and standards in the European project “Developing Competencies and Professional Standards for Health Promotion Capacity Building in Europe”, and to discuss them in relation to school health promotion. The analysis...... these formulations, and essential values and approaches in school health promotion. However, by underemphasizing the potential of education and learning, and reducing changes at individual and group level to behavioral change, the formulations of competencies and standards are not in concert with essential values...

  7. Promoting media and information literacy in libraries

    NARCIS (Netherlands)

    Huysmans, F.; Franke, M.

    2016-01-01

    Librarians and (public) libraries are active in promoting information literacy and (more recently) media literacy. After a brief historical sketch, this document describes how public libraries assist patrons and educational institutions in enhancing knowledge, skills and attitudes needed to

  8. Gel shift analysis of the empA promoter region in Vibrio anguillarum

    Directory of Open Access Journals (Sweden)

    Denkin Steven M

    2004-10-01

    Full Text Available Abstract Background The induction of metalloprotease encoded by empA in Vibrio anguillarum occurs at high cell density in salmon intestinal mucus. Previously we have shown that there are significant differences in empA expression in two strains of V. anguillarum, M93Sm and NB10. It is hypothesized that differences in empA regulation are due to differences in binding of regulatory elements. Results Two strains of V. anguillarum, M93Sm and NB10, were examined and compared for the presence of DNA regulatory proteins that bind to and control the empA promoter region. Gel mobility shift assays, using a digoxigenin (DIG-labeled oligomer containing a lux box-like element and the promoter for empA, were done to demonstrate the presence of a DNA-binding protein. Protein extracts from NB10 cells incubated in Luria Bertani broth + 2% NaCl (LB20, nine salts solution + 200 μg/ml mucus (NSSM, 3M (marine minimal medium, or NSS resulted in a gel mobility shift. No gel mobility shift was seen when protein extracts from either LB20- or NSSM-grown M93Sm cells were mixed with the DIG-labeled empA oligomer. The azocasein assay detected protease activity in all incubation conditions for NB10 culture supernatants. In contrast, protease activity was detected in M93Sm culture supernatants only when incubated in NSSM. Since the luxR homologue in V. anguillarum, vanT, has been cloned, sequenced, and shown to be required for protease activity, we wanted to determine if vanT mutants of NB10 exhibit the same gel shift observed in the wild-type. Site-directed mutagenesis was used to create vanT mutants in V. anguillarum M93Sm and NB10 to test whether VanT is involved with the gel mobility shift. Both vanT mutants, M02 and NB02, did not produce protease activity in any conditions. However, protein extracts from NB02 incubated in each condition still exhibited a gel shift when mixed with the DIG-labeled empA oligomer. Conclusions The data demonstrate that protein extracts of V

  9. Iconic cuisines, marketing and place promotion

    OpenAIRE

    Everett, Sally

    2015-01-01

    This chapter looks at how food and drink narratives are utilised to promote and create place identities. By exploring the concepts of heritage branding and constructed historical narratives, it illustrates how iconic cuisines are being employed to promote place and attract consumers. It argues that the marketing process is more than utilising established aspects of heritage cuisines and historical truths, as it is often about creating narratives to meet the evolving needs of destinations and ...

  10. Cultural aspects of ageing and health promotion.

    Science.gov (United States)

    Mariño, R J

    2015-03-01

    The emphasis of Australian Government policy is on the promotion of good health in later life and positive experiences with ageing. Conceptually, a new gerontology framework has replaced the study of disease, decline, loss and disability. Within this framework, health promotion offers a mechanism by which individuals can be assisted to create environments that offer better opportunities for continued participation in society and improved quality of health and self-care. Oral health is instrumental to older people's health, life satisfaction, quality of life and perception of self. Australia is culturally diverse, composed of numerous ethno-cultural groups coexisting within a larger, predominant culture, creating a multicultural and multiracial society. However, despite this cultural diversity, the well documented ageing profile of the Australian population and repeated calls for comprehensive geriatric assessment, the oral health of older adults remains a challenge for oral health providers and for society. A major challenge will be to translate existing knowledge and experience of disease prevention and health promotion into appropriate programmes for older adults. Health promotion is the key to improving oral health in later life as it encourages older adults to be proactive in regard to their health. Therefore, increased efforts should be directed towards identifying opportunities for health promotion activities and the development of community based models that encourage older people to improve and maintain their oral health. Ignoring opportunities for health promotion may increase inequalities in oral health and may lead to even greater demands for curative and oral rehabilitative services from these groups This article firstly provides a brief rationale for oral health promotion. Its second part explores the influence of culture on health beliefs, behaviours and outcomes in older adults and how oral health can relate to cultural background. The last section

  11. The impact of promotion in franchising

    OpenAIRE

    Buljubašić, Iva; Borić, Marta

    2014-01-01

    Franchising is a model of company growth, which significantly reduces uncertainty in the riskiest stages of growth: business start–up and growth phase. The impact of promotion in franchising has not been investigated in relevant literature. Therefore, this paper examines the impact of promotion on franchising through unconventional marketing on the example of private company X which is the main context of the present study. This private company X was chosen as a relevant example b...

  12. Evaluation of Results from Sales Promotion Activities

    Directory of Open Access Journals (Sweden)

    Olimpia Ban

    2007-02-01

    Full Text Available An essential element of the sales promotion strategy and not only is the evaluation of the results obtained from the activities performed. Due to their nature and applicability, the evaluation of the sales promotion is much easier to be achieved, but it raises some problems. Using a hypothetical example, we have tried to develop a "classic" evaluation model of the specialty literature.

  13. Promoting tourism destinations: A strategic marketing approach

    OpenAIRE

    Soteriades, Marios D.; Avgeli, Vasiliki A.

    2007-01-01

    This paper provides an outline of principal marketing strategy issues and their application in promoting tourism destinations. It provides an overview of a report prepared for the Tourism Promotion Committee (T.P.C.) of Heraklion District, Crete. In the context of the tourist industry, the ‘product’ is an experience achieved through the combination of a diverse range of products and services. Nowadays tourism destinations face new and increasing marketing challenges arising from changing tour...

  14. Integrating physical and mental health promotion strategies

    OpenAIRE

    Palma, Jessica Anne

    2010-01-01

    While health is defined as ‘a state of complete physical, mental and social well-being’, physical and mental health have traditionally been separated. This paper explores the question: How can physical and mental health promotion strategies be integrated and addressed simultaneously? A literature review on why physical and mental health are separated and why these two areas need to be integrated was conducted. A conceptual framework for how to integrate physical and mental health promotion st...

  15. Television and the promotion of mental health

    OpenAIRE

    Milošević Ljiljana

    2011-01-01

    Current media campaigns, realized within national campaigns and actions on mental health prevention and promotion, are considered in this paper, in the context of expert public relation, as well as the whole society, towards mental health. Mental health promotion is determined as a range of activities by which individuals, community and society are being enabled to take control over mental health determinants and to improve it, but also as an action for improvement of mental health posi...

  16. Food Blogger Instagram: Promotion Through Social Media

    Directory of Open Access Journals (Sweden)

    M. Fariz Syahbani

    2017-04-01

    ABSTRACT Do promotions through food blogger account is the way that is currently being sought after by the culinary business operators to introduce their restaurant. Bloggers have a significant impact of people searching for information through social sites before making a purchase. In other words, the food blogger become a benchmark for people in considering whether or not a restaurant worth visiting. This research aims to determine of promotion through food blogger on social media instagram towards purchase intention of college student in Bandung. This research is a quantitative research. The method used is descriptive - causal. The sampling technique used is a non-probability sample of the type of incidental sampling. The data collection was distributed with questionnaires to 400 respondents who are collage students in Bandung was using instagram and recognizing the phenomenon of food bloggers as media promotion. Data analysis technique used is multiple linear regression analysis. The research results, food blogger promotion through social media on instagram be in good category. Purchase intention of college student at Bandung in good categories. Promotion through food blogger on social media instagram partial effect consisting of context, communication, collaboration and connection to the buying interest of collage students in Bandung and simultaneously influence the buying interest of collage students in Bandung. From this study, it appears that through the instagram as an effective media campaign can provide an explanation and the message delivered effectively and efficiently for displaying a variety of contexts with good multimedia features. Keyword : Promotion, Social Media Marketing, Food Blogger, Purchase Intention

  17. Moderating Effects of Sales Promotion Types

    Directory of Open Access Journals (Sweden)

    Fernando de Oliveira Santini

    2015-04-01

    Full Text Available This paper aims to analyze the influence sales promotion types have on the relationship between perception of financial risk and perception of utilitarian and hedonic value on consumer purchase intentions. To this end, an experiment was conducted involving 589 participants divided into two groups defined by distinct scenarios in which the sales promotion type (monetary vs. non-monetary was manipulated. The working hypotheses predicted a direct and positive relationship between the perception of (hedonic and utilitarian consumption value and purchase intention for a promoted product and a negative relationship between the perception of consumption value and the perception of financial risk. In addition, it was supposed that the sales promotion type would moderate these direct relationships and that a monetary promotion would have a stronger effect on the relationship between purchase intention and perceived product utility, whereas a non-monetary promotion would have a stronger effect on the other relationships (hedonic value and financial risk perceptions. Analysis of the outcomes supported the proposed hypotheses.

  18. PROMOTING TOURISTIC BRAND ”BUCOVINA”

    Directory of Open Access Journals (Sweden)

    Liliana HÎNCU

    2015-04-01

    Full Text Available The concept of tourism product appears as a part of the travel agencies and the tourist areas such as: Bucovina and Maramures, Danube Delta, Dobrogea etc. Tourist areas have become real brands along the sights of Romania. Associations promote tourism, tourist information centers and tourist promotion offices of Romania, together with ANAT should devise strategies to promote tourism brands representing Romania. Regarding tourism brand, it is a picture element, which identifies the products or services of a tourist zone. Customers are the ones who decide if that brand live up to their expectations or not. Travel Branding is a process of creating and maintaining a brand in the hospitality industry. Travel Branding refers to identifying and exploiting competitive advantages in our case about the strengths of your product or Bucovina tourist area. Bucovina ,,Neverland” promoting a full of beauty. I think it can awaken from the numbness Romanian tourism. Just as red Bordeaux promote France among others, as well as Voronet blue is a Romanian brand, internationally recognized, and I think that is the most important national tourism brand. After many this area is considered a wonderland of Romania, a pearl of the country that can make the most to promote the culture and traditions of this part of Europe, so-called Switzerland of Romania. It's an area where natural beauty is complemented by monasteries and hospitality of the people of the lands.

  19. Functional analysis of human and chimpanzee promoters.

    Science.gov (United States)

    Heissig, Florian; Krause, Johannes; Bryk, Jaroslaw; Khaitovich, Philipp; Enard, Wolfgang; Pääbo, Svante

    2005-01-01

    It has long been argued that changes in gene expression may provide an additional and crucial perspective on the evolutionary differences between humans and chimpanzees. To investigate how often expression differences seen in tissues are caused by sequence differences in the proximal promoters, we tested the expression activity in cultured cells of human and chimpanzee promoters from genes that differ in mRNA expression between human and chimpanzee tissues. Twelve promoters for which the corresponding gene had been shown to be differentially expressed between humans and chimpanzees in liver or brain were tested. Seven showed a significant difference in activity between the human promoter and the orthologous chimpanzee promoter in at least one of the two cell lines used. However, only three of them showed a difference in the same direction as in the tissues. Differences in proximal promoter activity are likely to be common between humans and chimpanzees, but are not linked in a simple fashion to gene-expression levels in tissues. This suggests that several genetic differences between humans and chimpanzees might be responsible for a single expression difference and thus that relevant expression differences between humans and chimpanzees will be difficult to predict from cell culture experiments or DNA sequences.

  20. 7 CFR 1250.341 - Research, education, and promotion.

    Science.gov (United States)

    2010-01-01

    ... program or project; and (e) No advertising or promotion programs shall use false or unwarranted claims or... 7 Agriculture 10 2010-01-01 2010-01-01 false Research, education, and promotion. 1250.341 Section... RESEARCH AND PROMOTION Egg Research and Promotion Order Research, Education, and Promotion § 1250.341...

  1. 7 CFR 982.58 - Research, promotion, and market development.

    Science.gov (United States)

    2010-01-01

    ... development, and marketing promotion, including paid advertising, designed to assist, improve, or promote the... direct expenditures for such marketing promotion including paid advertising as may be authorized. The... promotion including paid advertising, that promotes the sale of hazelnuts, hazelnut products, or their uses...

  2. 7 CFR 1160.301 - Promotion, consumer education and research.

    Science.gov (United States)

    2010-01-01

    ... (2) The evaluation of consumer education, promotion and research activities implemented under the... 7 Agriculture 9 2010-01-01 2009-01-01 true Promotion, consumer education and research. 1160.301... PROGRAM Fluid Milk Promotion Order Promotion, Consumer Education and Research § 1160.301 Promotion...

  3. Nurses and Teachers: Partnerships for Green Health Promotion

    Science.gov (United States)

    Sendall, Marguerite C.; Lidstone, John; Fleming, MaryLou; Domocol, Michelle

    2013-01-01

    Background: The term "green health promotion" is given to health promotion underpinned by the principles of ecological health and sustainability. Green health promotion is supported philosophically by global health promotion documents such as the 1986 Ottawa Charter for Health Promotion and the ecological public health movement. Green…

  4. 7 CFR 1150.161 - Promotion, research and nutrition education.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 9 2010-01-01 2009-01-01 true Promotion, research and nutrition education. 1150.161... MARKETING SERVICE (Marketing Agreements and Orders; Milk), DEPARTMENT OF AGRICULTURE DAIRY PROMOTION PROGRAM Dairy Promotion and Research Order Promotion, Research and Nutrition Education § 1150.161 Promotion...

  5. Assessing environmental assets for health promotion program planning: a practical framework for health promotion practitioners.

    Science.gov (United States)

    Springer, Andrew E; Evans, Alexandra E

    2016-01-01

    Conducting a health needs assessment is an important if not essential first step for health promotion planning. This paper explores how health needs assessments may be further strengthened for health promotion planning via an assessment of environmental assets rooted in the multiple environments (policy, information, social and physical environments) that shape health and behavior. Guided by a behavioral-ecological perspective- one that seeks to identify environmental assets that can influence health behavior, and an implementation science perspective- one that seeks to interweave health promotion strategies into existing environmental assets, we present a basic framework for assessing environmental assets and review examples from the literature to illustrate the incorporation of environmental assets into health program design. Health promotion practitioners and researchers implicitly identify and apply environmental assets in the design and implementation of health promotion interventions;this paper provides foundation for greater intentionality in assessing environmental assets for health promotion planning.

  6. Employer and Promoter Perspectives on the Quality of Health Promotion Within the Healthy Workplace Accreditation.

    Science.gov (United States)

    Tung, Chen-Yin; Yin, Yun-Wen; Liu, Chia-Yun; Chang, Chia-Chen; Zhou, Yi-Ping

    2017-07-01

    To explore the employers' and promoters' perspective of health promotion quality according to the healthy workplace accreditation. We assessed the perspectives of 85 employers and 81 health promoters regarding the quality of health promotion at their workplaces. The method of measurement referenced the European Network for Workplace Health Promotion (ENWHP) quality criteria. In the large workplaces, the accredited corporation employers had a higher impression (P health promoters from different sized workplaces with or without accreditation (P > 0.05). It seems that employers' perspectives of healthy workplace accreditation surpassed employers from non-accredited workplaces. Specifically, large accredited corporations could share their successful experiences to encourage a more involved workplace in small-medium workplaces.

  7. Development of a promoter shutoff system in Aspergillus oryzae using a sorbitol-sensitive promoter.

    Science.gov (United States)

    Oda, Ken; Terado, Shiho; Toyoura, Rieko; Fukuda, Hisashi; Kawauchi, Moriyuki; Iwashita, Kazuhiro

    2016-09-01

    Promoter shutoff is a general method for analyzing essential genes, but in the fungus Aspergillus oryzae, no tightly repressed promoters have been reported. To overcome the current limitations of conditional promoters, we examined sorbitol- and galactose-responsive genes using microarrays to identify regulatable genes with only minor physiological and genetic effects. We identified two sorbitol-induced genes (designated as sorA and sorB), cloned their promoters, and built a regulated egfp and brlA expression system. Growth medium-dependent enhanced green fluorescence protein (EGFP) fluorescence and conidiation were confirmed for egfp and brlA under the control of their respective promoters. We also used this shutoff system to regulate the essential rhoA, which demonstrated the expected growth inhibition under repressed growth conditions. Our new sorbitol promoter shutoff system developed can serve as a valuable new tool for essential gene analyses of filamentous fungi.

  8. Deletion analysis of susy-sl promoter for the identification of optimal promoter sequence

    International Nuclear Information System (INIS)

    Bacha, S.; Khatoon, A.; Asif, M.; Bshir, A.

    2015-01-01

    The promoter region of sucrose synthase (susy-Sl) was identified and isolated from tomato. The 5? deletion analysis was carried out for the identification of minimum optimal promoter. Transgenic lines of Arabidopsis thaliana were developed by floral dip method incorporating various promoter deletion cassettes controlling GUS reporter gene. GUS assay of transgenic tissues indicated that full length susy-Sl promoter and its deletion mutants were constitutively expressed in vegetative and floral tissues of A. thaliana. The expression was observed in roots, shoots and flowers of A. thaliana. Analysis of 5? deletion series of susy-Sl promoter showed that a minimum of 679 bp fragment of the promoter was sufficient to drive expression of GUS reporter gene in the major tissues of transgenic A. thaliana. (author)

  9. The promotion of sales on the consumer markets: Offer of a new approach of promotional management

    OpenAIRE

    FRANCISCO JAVIER VILLABA MERLO; IÑAKI PERIÁÑEZ CAÑADILLAS

    2002-01-01

    Nowadays, there are many factors that have provoked a greater use of promotion by some manufacturers in the consumption markets. Traditionally, firms have used promotion as the last resource for the achievement of the goals of selling. When we analyse promotional management, this kind of performance represents an orientation to sales. In our field work we justify the breaking-off with this management philosophy, starting with a newdefinition for “sales promotion”, that includes the internal c...

  10. Promoter2.0: for the recognition of PolII promoter sequences

    DEFF Research Database (Denmark)

    Knudsen, Steen; Knudsen, Steen

    1999-01-01

    Motivation : A new approach to the prediction of eukaryotic PolII promoters from DNA sequence takesadvantage of a combination of elements similar to neural networks and genetic algorithms to recognize a set ofdiscrete subpatterns with variable separation as one pattern: a promoter. The neural...... of optimization, the algorithm was able todiscriminate between vertebrate promoter and non-promoter sequences in a test set with a correlationcoefficient of 0.63. In addition, all five known transcription start sites on the plus strand of the completeadenovirus genome were within 161 bp of 35 predicted...

  11. Engineering of synthetic, stress-responsive yeast promoters

    DEFF Research Database (Denmark)

    Rajkumar, Arun Stephen; Liu, Guodong; Bergenholm, David

    2016-01-01

    Advances in synthetic biology and our understanding of the rules of promoter architecture have led to the development of diverse synthetic constitutive and inducible promoters in eukaryotes and prokaryotes. However, the design of promoters inducibleby specific endogenous or environmental conditions...

  12. Compilation and analysis of Escherichia coli promoter DNA sequences.

    OpenAIRE

    Hawley, D K; McClure, W R

    1983-01-01

    The DNA sequence of 168 promoter regions (-50 to +10) for Escherichia coli RNA polymerase were compiled. The complete listing was divided into two groups depending upon whether or not the promoter had been defined by genetic (promoter mutations) or biochemical (5' end determination) criteria. A consensus promoter sequence based on homologies among 112 well-defined promoters was determined that was in substantial agreement with previous compilations. In addition, we have tabulated 98 promoter ...

  13. Localization and regulation of bacteriophage Mu promoters

    International Nuclear Information System (INIS)

    Stoddard, S.F.; Howe, M.M.

    1989-01-01

    Mu promoters active during the lytic cycle were located by isolating RNA at various times after induction of Mu prophages, radiolabeling it by capping in vitro, and hybridizing it to Mu DNA fragments on Southern blots. Signals were detected from four new promoters in addition to the previously characterized P e (early), P cM (repressor), and P mom (late) promoters. A major signal upstream of C was first observed at 12 min and intensified thereafter with RNA from cts and C amber but not replication-defective prophages; these characteristics indicate that this signal arises from a middle promoter, which we designate P m . With 20- and 40-min RNA, four additional major signals originated in the C-lys, F-G-I, N-P, and com-mom regions. These signals were missing with RNA from C amber and replication-defective prophages and therefore reflected the activity of late promoters, one of which we presume was P mom . Uninduced lysogens showed weak signals from five regions, one from the early regulatory region, three between genes B and lys, and one near the late genes K, L, and M. The first of these probably resulted from P cM activity; the others remain to be identified

  14. Electrochemical promotion of sulfur dioxide catalytic oxidation

    DEFF Research Database (Denmark)

    Petrushina, Irina; Bandur, Viktor; Cappeln, Frederik Vilhelm

    2000-01-01

    investigation was to study a possible non-Faradaic electrochemical promotion of the liquid-phase catalytic reaction. It has been shown that there are two negative potential promotion areas with maximum effects at approximately -0.1 and -0.2 V, and one positive potential promotion area with the maximum effect...... between 0.1 and 0.3 V. There were no Faradaic reactions in the negative polarization region, and there was an anodic current which was less than 16% of the theoretical value for an exclusively Faradaic SO2 oxidation. Therefore the promotion effects at negative polarization are completely non-Faradaic. All...... the promotion effects have been explained as mainly due to charging of the electric double layer at the gold electrode. The effect at -0.2 V also depends on the V2O5 concentration and is more pronounced at higher V2O5 concentrations. This has been ascribed to a destruction of the vanadium polymeric chains...

  15. Promoter Motifs in NCLDVs: An Evolutionary Perspective

    Science.gov (United States)

    Oliveira, Graziele Pereira; Andrade, Ana Cláudia dos Santos Pereira; Rodrigues, Rodrigo Araújo Lima; Arantes, Thalita Souza; Boratto, Paulo Victor Miranda; Silva, Ludmila Karen dos Santos; Dornas, Fábio Pio; Trindade, Giliane de Souza; Drumond, Betânia Paiva; La Scola, Bernard; Kroon, Erna Geessien; Abrahão, Jônatas Santos

    2017-01-01

    For many years, gene expression in the three cellular domains has been studied in an attempt to discover sequences associated with the regulation of the transcription process. Some specific transcriptional features were described in viruses, although few studies have been devoted to understanding the evolutionary aspects related to the spread of promoter motifs through related viral families. The discovery of giant viruses and the proposition of the new viral order Megavirales that comprise a monophyletic group, named nucleo-cytoplasmic large DNA viruses (NCLDV), raised new questions in the field. Some putative promoter sequences have already been described for some NCLDV members, bringing new insights into the evolutionary history of these complex microorganisms. In this review, we summarize the main aspects of the transcription regulation process in the three domains of life, followed by a systematic description of what is currently known about promoter regions in several NCLDVs. We also discuss how the analysis of the promoter sequences could bring new ideas about the giant viruses’ evolution. Finally, considering a possible common ancestor for the NCLDV group, we discussed possible promoters’ evolutionary scenarios and propose the term “MEGA-box” to designate an ancestor promoter motif (‘TATATAAAATTGA’) that could be evolved gradually by nucleotides’ gain and loss and point mutations. PMID:28117683

  16. Promoter Motifs in NCLDVs: An Evolutionary Perspective

    Directory of Open Access Journals (Sweden)

    Graziele Pereira Oliveira

    2017-01-01

    Full Text Available For many years, gene expression in the three cellular domains has been studied in an attempt to discover sequences associated with the regulation of the transcription process. Some specific transcriptional features were described in viruses, although few studies have been devoted to understanding the evolutionary aspects related to the spread of promoter motifs through related viral families. The discovery of giant viruses and the proposition of the new viral order Megavirales that comprise a monophyletic group, named nucleo-cytoplasmic large DNA viruses (NCLDV, raised new questions in the field. Some putative promoter sequences have already been described for some NCLDV members, bringing new insights into the evolutionary history of these complex microorganisms. In this review, we summarize the main aspects of the transcription regulation process in the three domains of life, followed by a systematic description of what is currently known about promoter regions in several NCLDVs. We also discuss how the analysis of the promoter sequences could bring new ideas about the giant viruses’ evolution. Finally, considering a possible common ancestor for the NCLDV group, we discussed possible promoters’ evolutionary scenarios and propose the term “MEGA-box” to designate an ancestor promoter motif (‘TATATAAAATTGA’ that could be evolved gradually by nucleotides’ gain and loss and point mutations.

  17. Reliability assessments in qualitative health promotion research.

    Science.gov (United States)

    Cook, Kay E

    2012-03-01

    This article contributes to the debate about the use of reliability assessments in qualitative research in general, and health promotion research in particular. In this article, I examine the use of reliability assessments in qualitative health promotion research in response to health promotion researchers' commonly held misconception that reliability assessments improve the rigor of qualitative research. All qualitative articles published in the journal Health Promotion International from 2003 to 2009 employing reliability assessments were examined. In total, 31.3% (20/64) articles employed some form of reliability assessment. The use of reliability assessments increased over the study period, ranging from qualitative articles decreased. The articles were then classified into four types of reliability assessments, including the verification of thematic codes, the use of inter-rater reliability statistics, congruence in team coding and congruence in coding across sites. The merits of each type were discussed, with the subsequent discussion focusing on the deductive nature of reliable thematic coding, the limited depth of immediately verifiable data and the usefulness of such studies to health promotion and the advancement of the qualitative paradigm.

  18. Promotional Tool of Marketing: An Islamic Perspective

    Directory of Open Access Journals (Sweden)

    Muhammad Anwar

    1996-12-01

    Full Text Available Promotional tools of marketing, (e.g., personal selling, advertising, sales promotion, public relations, promotional games as well as contests, play a key role in creating consumer awareness about the qualities of various products and services available on the market, and can go a long way in contributing to economic progress and social development. Muslim marketers have to be conscious of their position and role in managing marketing activities. The Qur'anic view about man and his resources should be the basis for designing promotional tools and media strategies. The latter are meant to inculcate Islamic values, build the characters of customers and marketers and uphold truth in the society. Ethical behavior in advertising and other promotional activities must be based on a strong foundation of Islamic tenets and injunctions. There is a need to develop not only general guidelines for achieving marketing goals and corporate objectives in a morally acceptable manner, but also to devise an Islamic code of marketing by Muslim marketers, corporate leaders, and sharīʿah experts.

  19. The promotion of reading in Education Framework

    Directory of Open Access Journals (Sweden)

    Maite Monar van Vliet

    2012-11-01

    Full Text Available The research implants a theoretical-practical vision of reading promotion at the educative field. On one hand, they show us the state of the issue focusing on the legislative field, the research and promotion of virtual reading and, concretely, in the País Valenciano case, a practical research location. A panoramic from the nowadays legislation is established parting from the UNESCO. The LOE and the reading plans. Specialists’ different studies enrich the vision and virtual platforms complete the established theoretical description. On the other hand, a qualitative field work is done with the objective of evaluating the benefits of webs, blogs and wikis in the classroom for reading promotion during the school year 2010-2011 with three groups in three different centres. The work consists of watching the digital platforms application for the reading promotion in the classroom and analysing its usefulness through some cases studies, a discussion group and the triangulation. The research concludes with some reflections which invite the reader to approach to the reading promotion at the educational field of virtual technology.

  20. Meanings of care in health promotion.

    Science.gov (United States)

    Falcón, Gladys Carmela Santos; Erdmann, Alacoque Lorenzini; Backes, Dirce Stein

    2008-01-01

    The objective of the study is to understand the meaning built by students and professors on health promotion in the teaching and learning process of health care in Nursing. It is a qualitative study using ground theory as a methodological reference. Data was collected through interviews, with three samples groups, 13 students and four professors, by classroom observation, and through meetings with nursing professors. The central subject resulting from this analysis was: constructing teaching and learning in order, disorder and self organization for a new way of caring promoting health. The teaching/learning process directed at health promotion develops in a stage of crisis, going from a state of order to a state of disorder that is uncertain and contradictory regarding what society understands about health.

  1. Tissue Specific Promoters in Colorectal Cancer

    Directory of Open Access Journals (Sweden)

    A. R. Rama

    2015-01-01

    Full Text Available Colorectal carcinoma is the third most prevalent cancer in the world. In the most advanced stages, the use of chemotherapy induces a poor response and is usually accompanied by other tissue damage. Significant progress based on suicide gene therapy has demonstrated that it may potentiate the classical cytotoxic effects in colorectal cancer. The inconvenience still rests with the targeting and the specificity efficiency. The main target of gene therapy is to achieve an effective vehicle to hand over therapeutic genes safely into specific cells. One possibility is the use of tumor-specific promoters overexpressed in cancers. They could induce a specific expression of therapeutic genes in a given tumor, increasing their localized activity. Several promoters have been assayed into direct suicide genes to cancer cells. This review discusses the current status of specific tumor-promoters and their great potential in colorectal carcinoma treatment.

  2. Health Promotion Viewed in a Critical Perspective

    DEFF Research Database (Denmark)

    Mik-Meyer, Nanna

    2014-01-01

    The aim of this paper is to reflect critically on the current health promotion initiatives targeting overweight individuals in Western countries. The paper’s methodological approach is to draw on analytical findings from my and other sociologists’ empirical work on how the problems of overweight...... people are being defined in various settings in Denmark, England, Australia and the US. I try to illustrate how health promotion targeting overweight individuals can not only be seen as a project aimed at securing longer lives and fewer illnesses for people carrying excess fat but also a moral project...... that, in a more general sense, aims to tell people how they ought to live their lives. I link this moral aspect of health promotion to a) the medicalization tendency in current Western society (e.g. a growing pharmaceutical industry and its economic interest in transforming the human condition of being...

  3. ELECTROCHEMICAL PROMOTED CATALYSIS: TOWARDS PRACTICAL UTILIZATION

    Directory of Open Access Journals (Sweden)

    DIMITRIOS TSIPLAKIDES

    2008-07-01

    Full Text Available Electrochemical promotion (EP of catalysis has already been recognized as “a valuable development in catalytic research” (J. Pritchard, 1990 and as “one of the most remarkable advances in electrochemistry since 1950” (J. O’M. Bockris, 1996. Laboratory studies have clearly elucidated the phenomenology of electrochemical promotion and have proven that EP is a general phenomenon at the interface of catalysis and electrochemistry. The major progress toward practical utilization of EP is surveyed in this paper. The focus is given on the electropromotion of industrial ammonia synthesis catalyst, the bipolar EP and the development of a novel monolithic electropromoted reactor (MEPR in conjunction with the electropromotion of thin sputtered metal films. Future perspectives of electrochemical promotion applications in the field of hydrogen technologies are discussed.

  4. Duality of Health Promotion and Sustainable Development

    DEFF Research Database (Denmark)

    Pedersen, Kirsten Bransholm; Land, Birgit; Kjærgård, Bente

    2015-01-01

    reduction and how these strategies affect the prospects for promoting health and sustainable food production and consumption. Danish food waste reduction strategies are used as examples with references to selected policy documents on food waste reduction strategies launched by international organisations...... sustainability and, vice versa, sustainability conditions health. Thus, to avoid unintended, negative effects the strategies directed towards sustainable development must be correlated with strategies for health promotion. The conceptual model is used to take a closer look at the complexities of food waste...... of food as food waste is reduced. The lack of attention given to reducing the oversupply of food calls for governance initiatives directed towards reducing the overproduction of primary food produce in order to reap the environmental benefits and the health promotion benefits of reducing food waste...

  5. The advanced glycation end-product Nϵ -carboxymethyllysine promotes progression of pancreatic cancer: implications for diabetes-associated risk and its prevention.

    Science.gov (United States)

    Menini, Stefano; Iacobini, Carla; de Latouliere, Luisa; Manni, Isabella; Ionta, Vittoria; Blasetti Fantauzzi, Claudia; Pesce, Carlo; Cappello, Paola; Novelli, Francesco; Piaggio, Giulia; Pugliese, Giuseppe

    2018-03-13

    Diabetes is an established risk factor for pancreatic cancer (PaC), together with obesity, a Western diet, and tobacco smoking. The common mechanistic link might be the accumulation of advanced glycation end-products (AGEs), which characterizes all of the above disease conditions and unhealthy habits. Surprisingly, however, the role of AGEs in PaC has not been examined yet, despite the evidence of a tumour-promoting role of receptor for advanced glycation end-products (RAGE), the receptor for AGEs. Here, we tested the hypothesis that AGEs promote PaC through RAGE activation. To this end, we investigated the effects of the AGE N ϵ -carboxymethyllysine (CML) in human pancreatic ductal adenocarcinoma (PDA) cell lines and in a mouse model of Kras-driven PaC interbred with a bioluminescent model of proliferation. Tumour growth was monitored in vivo by bioluminescence imaging and confirmed by histology. CML promoted PDA cell growth and RAGE expression, in a concentration-dependent and time-dependent manner, and activated downstream tumourigenic signalling pathways. These effects were counteracted by RAGE antagonist peptide (RAP). Exogenous AGE administration to PaC-prone mice induced RAGE upregulation in pancreatic intraepithelial neoplasias (PanINs) and markedly accelerated progression to invasive PaC. At 11 weeks of age (6 weeks of CML treatment), PaC was observed in eight of 11 (72.7%) CML-treated versus one of 11 (9.1%) vehicle-treated [control (Ctr)] mice. RAP delayed PanIN development in Ctr mice but failed to prevent PaC promotion in CML-treated mice, probably because of competition with soluble RAGE for binding to AGEs and/or compensatory upregulation of the RAGE homologue CD166/ activated leukocyte cell adhesion molecule, which also favoured tumour spread. These findings indicate that AGEs modulate the development and progression of PaC through receptor-mediated mechanisms, and might be responsible for the additional risk conferred by diabetes and other

  6. Milestones in Nordic Health Promotion research.

    Science.gov (United States)

    Haglund, Bo J A; Tillgren, Per

    2018-02-01

    Based on the storytelling tradition and analyses of conference material, this article provides an overview of the evolving Nordic Health Promotion Research Network (NHPRN) and its conferences over the last 20 years. The story goes from the planning of the first conference in Bergen, Norway, back in 1996 to the eighth conference in Jyväskylä, Finland, in 2016. There have been three phases of development. During the first phase, 1996-2007, the five first conferences were initiated and implemented by departments of public health in the Nordic countries. The World Health Organization (WHO) collaborative centres of Health Promotion in Bergen University and a group at Karolinska Institute, Department of Social Medicine, creating supportive environments for health in Stockholm played key roles in initiating and supporting NHPRN. During the second phase, 2007-2014, the network was strengthened and supported by the Nordic School of Public Health (NHV) in Gothenburg. The third phase started when NHV closed down in 2015 and networking activities were transferred to the European Office of WHO in Copenhagen. The Nordic Health Promotion Research Conference series has served several purposes and will continue to do so. They are important Nordic meeting places, stimulating Health Promotion research, as well as explicitly managing ongoing concerns in the international Health Promotion community. This is reflected in the shift of foci over time. The content of the conferences has been highly responsive to whatever challenges are particularly relevant at different points in time, while also contributing to developing Health Promotion as a discipline, given that every conference has built on the previous ones.

  7. The architecture of mammalian ribosomal protein promoters

    Directory of Open Access Journals (Sweden)

    Perry Robert P

    2005-02-01

    Full Text Available Abstract Background Mammalian ribosomes contain 79 different proteins encoded by widely scattered single copy genes. Coordinate expression of these genes at transcriptional and post-transcriptional levels is required to ensure a roughly equimolar accumulation of ribosomal proteins. To date, detailed studies of only a very few ribosomal protein (rp promoters have been made. To elucidate the general features of rp promoter architecture, I made a detailed sequence comparison of the promoter regions of the entire set of orthologous human and mouse rp genes. Results A striking evolutionarily conserved feature of most rp genes is the separation by an intron of the sequences involved in transcriptional and translational regulation from the sequences with protein encoding function. Another conserved feature is the polypyrimidine initiator, which conforms to the consensus (Y2C+1TY(T2(Y3. At least 60 % of the rp promoters contain a largely conserved TATA box or A/T-rich motif, which should theoretically have TBP-binding capability. A remarkably high proportion of the promoters contain conserved binding sites for transcription factors that were previously implicated in rp gene expression, namely upstream GABP and Sp1 sites and downstream YY1 sites. Over 80 % of human and mouse rp genes contain a transposable element residue within 900 bp of 5' flanking sequence; very little sequence identity between human and mouse orthologues was evident more than 200 bp upstream of the transcriptional start point. Conclusions This analysis has provided some valuable insights into the general architecture of mammalian rp promoters and has identified parameters that might coordinately regulate the transcriptional activity of certain subsets of rp genes.

  8. A Menagerie of Promotional Characters: Promoting Food to Children through Food Packaging

    Science.gov (United States)

    Hebden, Lana; King, Lesley; Kelly, Bridget; Chapman, Kathy; Innes-Hughes, Christine

    2011-01-01

    Objective: To determine the extent to which (1) promotional characters are used on food packaging for healthful and less-healthful food and (2) different companies use this persuasive marketing strategy. Design: Cross-sectional supermarket audit of all food and beverages featuring promotional characters on the packaging. Setting: Three Australian…

  9. A single-copy galK promoter cloning vector suitable for cloning strong promoters

    DEFF Research Database (Denmark)

    Dandanell, Gert; Court, Donald L.; Hammer, Karin

    1986-01-01

    We report the construction of lambda galK promoter cloning vectors for cloning and characterization of strong promoters. This phage, which contains a unique HindIII cloning site, was applied to the cloning and analysis of transcription initiations of the regulatory region of the deo-operon of...

  10. Streamlining Appointment, Promotion, and Tenure Procedures to Promote Early-Career Faculty Success.

    Science.gov (United States)

    Smith, Shannon B; Hollerbach, Ann; Donato, Annemarie Sipkes; Edlund, Barbara J; Atz, Teresa; Kelechi, Teresa J

    2016-01-01

    A critical component of the progression of a successful academic career is being promoted in rank. Early-career faculty are required to have an understanding of appointment, promotion, and tenure (APT) guidelines, but many factors often impede this understanding, thwarting a smooth and planned promotion pathway for professional advancement. This article outlines the steps taken by an APT committee to improve the promotion process from instructor to assistant professor. Six sigma's DMAIC improvement model was selected as the guiding operational framework to remove variation in the promotion process. After faculty handbook revisions were made, several checklists developed, and a process review rubric was implemented; recently promoted faculty were surveyed on satisfaction with the process. Faculty opinions captured in the survey suggest increased transparency in the process and perceived support offered by the APT committee. Positive outcomes include a strengthened faculty support framework, streamlined promotion processes, and improved faculty satisfaction. Changes to the APT processes resulted in an unambiguous and standardized pathway for successful promotion. Copyright © 2016 Elsevier Inc. All rights reserved.

  11. Conceptualizing Parental Autonomy Support: Adolescent Perceptions of Promotion of Independence versus Promotion of Volitional Functioning

    Science.gov (United States)

    Soenens, Bart; Vansteenkiste, Maarten; Lens, Willy; Luyckx, Koen; Goossens, Luc; Beyers, Wim; Ryan, Richard M.

    2007-01-01

    In current research on parenting, 2 ways of conceptualizing perceived parental autonomy support can be distinguished. Parental autonomy support can be defined in terms of promotion of independence (PI) or in terms of promotion of volitional functioning (PVF). This study aimed to establish the empirical distinctiveness of both conceptualizations…

  12. Options for promoting high-biodiversity REDD+

    Energy Technology Data Exchange (ETDEWEB)

    Swan, Steve; Mcnally, Richard; Grieg-Gran, Maryanne; Roe, Dilys; Mohammed, Essam Yassin

    2011-11-15

    International climate and biodiversity conventions agree that to be effective in the long term, strategies to reduce emissions from deforestation, forest degradation, conservation and enhancement of forest carbon stocks, and sustainable forest management (REDD+), must not undermine biodiversity. But how do countries achieve 'high-biodiversity REDD+' in practice? At a global level, options include immediate policy strengthening in international negotiations; promotion of co-benefit standards; and financial incentives and preferences for buying countries. At a national level, developing countries can also promote high-biodiversity REDD+ through more coherent policies; integrated planning; regulatory and economic instruments; and improved monitoring of biodiversity impacts.

  13. Pet dogs as promoters of wellbeing.

    Science.gov (United States)

    While, Alison

    2017-07-02

    The rise in life expectancy requires strategies to enable healthy ageing and the promotion of a high quality of life in old age. Poor mental health including depression and social isolation can blight older people's lives. Despite the positive benefits of physical activity for both mental and physical health, only a minority of those over 65 years are attaining the recommended levels of physical activity. The evidence relating to the benefits of pet dogs as promoters of wellbeing is set out in this article, although meeting their care needs may place an additional strain on an older person and/or their carer who has limited resources and physical capabilities.

  14. TOURISM PROMOTION FOR UNKNOWN AREAS IN ROMANIA

    Directory of Open Access Journals (Sweden)

    Fotache Lacramioara

    2013-12-01

    Full Text Available The paper is an effort to unknown areas identity affirmation, through collaborative development of advertising mix, with an emphasis on virtual platforms as admissible solution for increasing visibility. Based upon comparative effective analysis of categories of communication particularities, it is suggested a positioning strategic solution, via virtual advertising platform as unique, integrated, complex and very attractive tourism product promotion, fitted for the internal and international tourism circuit. The active promotion of the specified territorial identity will launch a brand with an impact among tourists by using marketing techniques and innovating technical means and prioritizing tourism as a principal vector of local and regional development.

  15. Competitive Reactions to Advertising and Promotion Attacks

    OpenAIRE

    Jan-Benedict E. M. Steenkamp; Vincent R. Nijs; Dominique M. Hanssens; Marnik G. Dekimpe

    2005-01-01

    How do competitors react to each other's price-promotion and advertising attacks? What are the reasons for the observed reaction behavior? We answer these questions by performing a large-scale empirical study on the short-run and long-run reactions to promotion and advertising shocks in over 400 consumer product categories over a four-year time span. Our results clearly show that the most predominant form of competitive response is passive in nature. When a reaction does occur, it is usually ...

  16. Health promotion, environmental health and Agenda 21.

    Science.gov (United States)

    Scriven, A; Young, S

    1998-04-01

    In 1992, at the Rio Earth Summit, many governments, including our own, committed themselves to developing local strategies for sustainable development in the form of Local Agenda 21. Sustainable development is discussed, as is the philosophy and practice of health promotion and environmental health. Common approaches are identified and the links in relation to key areas of activities, strategies, values and principles are outlined. Finally, recommendations are made and conclusions drawn in relation to the overlap between environmental health action, Agenda 21 strategies and health promotion practice.

  17. The role of promotion in alcoholism treatment marketing.

    Science.gov (United States)

    Jones, M A; Self, D R; Owens, C A; Kline, T A

    1988-01-01

    This article is an overview of the promotion function as a part of the ATM's marketing mix. It approaches various promotion decision areas from a managerial perspective, focusing upon some key components of promotion planning. Rather than provide specific operational or implementation details (how to write a brochure) it is more conceptual in nature and offers a framework for promotion planners. The article addresses promotion management, promotion objectives, analysis for promotion planning, the promotion mix, and addresses the benefits and limitations of some specific promotion tools available to the ATM manager. It treats ATMs as a service and reveals specific implications for promotion strategy dictated by services. The article also reports promotion tools employed by Alabama ATMs citing data from the Alabama study.

  18. Employer and Promoter Perspectives on the Quality of Health Promotion Within the Healthy Workplace Accreditation

    Science.gov (United States)

    Tung, Chen-Yin; Yin, Yun-Wen; Liu, Chia-Yun; Chang, Chia-Chen; Zhou, Yi-Ping

    2017-01-01

    Objectives: To explore the employers’ and promoters’ perspective of health promotion quality according to the healthy workplace accreditation. Methods: We assessed the perspectives of 85 employers and 81 health promoters regarding the quality of health promotion at their workplaces. The method of measurement referenced the European Network for Workplace Health Promotion (ENWHP) quality criteria. Results: In the large workplaces, the accredited corporation employers had a higher impression (P workplace employers had a slightly higher perspective than non-accredited ones. Nevertheless, there were no differences between the perspectives of health promoters from different sized workplaces with or without accreditation (P > 0.05). Conclusions: It seems that employers’ perspectives of healthy workplace accreditation surpassed employers from non-accredited workplaces. Specifically, large accredited corporations could share their successful experiences to encourage a more involved workplace in small–medium workplaces. PMID:28691998

  19. The Aspergillus fumigatus SchASCH9 kinase modulates SakAHOG1 MAP kinase activity and it is essential for virulence.

    Science.gov (United States)

    Alves de Castro, Patrícia; Dos Reis, Thaila Fernanda; Dolan, Stephen K; Oliveira Manfiolli, Adriana; Brown, Neil Andrew; Jones, Gary W; Doyle, Sean; Riaño-Pachón, Diego M; Squina, Fábio Márcio; Caldana, Camila; Singh, Ashutosh; Del Poeta, Maurizio; Hagiwara, Daisuke; Silva-Rocha, Rafael; Goldman, Gustavo H

    2016-11-01

    The serine-threonine kinase TOR, the Target of Rapamycin, is an important regulator of nutrient, energy and stress signaling in eukaryotes. Sch9, a Ser/Thr kinase of AGC family (the cAMP-dependent PKA, cGMP- dependent protein kinase G and phospholipid-dependent protein kinase C family), is a substrate of TOR. Here, we characterized the fungal opportunistic pathogen Aspergillus fumigatus Sch9 homologue (SchA). The schA null mutant was sensitive to rapamycin, high concentrations of calcium, hyperosmotic stress and SchA was involved in iron metabolism. The ΔschA null mutant showed increased phosphorylation of SakA, the A. fumigatus Hog1 homologue. The schA null mutant has increased and decreased trehalose and glycerol accumulation, respectively, suggesting SchA performs different roles for glycerol and trehalose accumulation during osmotic stress. The schA was transcriptionally regulated by osmotic stress and this response was dependent on SakA and MpkC. The double ΔschA ΔsakA and ΔschA ΔmpkC mutants were more sensitive to osmotic stress than the corresponding parental strains. Transcriptomics and proteomics identified direct and indirect targets of SchA post-exposure to hyperosmotic stress. Finally, ΔschA was avirulent in a low dose murine infection model. Our results suggest there is a complex network of interactions amongst the A. fumigatus TOR, SakA and SchA pathways. © 2016 John Wiley & Sons Ltd.

  20. What Structures and Mechanisms Promote Women's Political ...

    African Journals Online (AJOL)

    The primary objective of this study was to compare the different structures and mechanisms used in South Africa and Cameroon to promote gender equality and women's empowerment in leadership position. The unit of analysis was parliament, political parties and government. A purposively sample of 120 participants, ...