WorldWideScience

Sample records for hiv-2 reverse transcriptase

  1. HIV-1 Non-Nucleoside Reverse Transcriptase Inhibitors

    DEFF Research Database (Denmark)

    Vanangamudi, Murugesan; Poongavanam, Vasanthanathan; Namasivayam, Vigneshwaran

    2017-01-01

    BACKGROUND: Design of inhibitors for HIV-1 reverse transcriptase inhibition (HIV-1 RT) is one of the successful chemotherapies for the treatment of HIV infection. Among the inhibitors available for HIV-1 RT, non-nucleoside reverse transcriptase inhibitors (NNRTIs) have shown to be very promising......: The conformation dependent-alignment based (CoMFA and CoMSIA) methods have been proven very successful ligand based strategy in the drug design. Here, CoMFA and CoMSIA studies reported for structurally distinct NNRTIs including thiazolobenzimidazole, dipyridodiazepinone, 1,1,3-trioxo [1,2,4]-thiadiazine...

  2. Interaction of HIV-1 reverse transcriptase ribonuclease H with an acylhydrazone inhibitor.

    Science.gov (United States)

    Gong, Qingguo; Menon, Lakshmi; Ilina, Tatiana; Miller, Lena G; Ahn, Jinwoo; Parniak, Michael A; Ishima, Rieko

    2011-01-01

    HIV-1 reverse transcriptase is a bifunctional enzyme, having both DNA polymerase (RNA- and DNA-dependent) and ribonuclease H activities. HIV-1 reverse transcriptase has been an exceptionally important target for antiretroviral therapeutic development, and nearly half of the current clinically used antiretrovirals target reverse transcriptase DNA polymerase. However, no inhibitors of reverse transcriptase ribonuclease H are on the market or in preclinical development. Several drug-like small molecule inhibitors of reverse transcriptase ribonuclease H have been described, but little structural information is available about the interactions between reverse transcriptase ribonuclease H and inhibitors that exhibit antiviral activity. In this report, we describe NMR studies of the interaction of a new ribonuclease H inhibitor, BHMP07, with a catalytically active HIV-1 reverse transcriptase ribonuclease H domain fragment. We carried out solution NMR experiments to identify the interaction interface of BHMP07 with the ribonuclease H domain fragment. Chemical shift changes of backbone amide signals at different BHMP07 concentrations clearly demonstrate that BHMP07 mainly recognizes the substrate handle region in the ribonuclease H fragment. Using ribonuclease H inhibition assays and reverse transcriptase mutants, the binding specificity of BHMP07 was compared with another inhibitor, dihydroxy benzoyl naphthyl hydrazone. Our results provide a structural characterization of the ribonuclease H inhibitor interaction and are likely to be useful for further improvements of the inhibitors. © 2010 John Wiley & Sons A/S.

  3. Natural Plant Alkaloid (Emetine Inhibits HIV-1 Replication by Interfering with Reverse Transcriptase Activity

    Directory of Open Access Journals (Sweden)

    Ana Luiza Chaves Valadão

    2015-06-01

    Full Text Available Ipecac alkaloids are secondary metabolites produced in the medicinal plant Psychotria ipecacuanha. Emetine is the main alkaloid of ipecac and one of the active compounds in syrup of Ipecac with emetic property. Here we evaluated emetine’s potential as an antiviral agent against Human Immunodeficiency Virus. We performed in vitro Reverse Transcriptase (RT Assay and Natural Endogenous Reverse Transcriptase Activity Assay (NERT to evaluate HIV RT inhibition. Emetine molecular docking on HIV-1 RT was also analyzed. Phenotypic assays were performed in non-lymphocytic and in Peripheral Blood Mononuclear Cells (PBMC with HIV-1 wild-type and HIV-harboring RT-resistant mutation to Nucleoside Reverse Transcriptase Inhibitors (M184V. Our results showed that HIV-1 RT was blocked in the presence of emetine in both models: in vitro reactions with isolated HIV-1 RT and intravirion, measured by NERT. Emetine revealed a strong potential of inhibiting HIV-1 replication in both cellular models, reaching 80% of reduction in HIV-1 infection, with low cytotoxic effect. Emetine also blocked HIV-1 infection of RT M184V mutant. These results suggest that emetine is able to penetrate in intact HIV particles, and bind and block reverse transcription reaction, suggesting that it can be used as anti-HIV microbicide. Taken together, our findings provide additional pharmacological information on the potential therapeutic effects of emetine.

  4. Crystal structures of HIV-1 nonnucleoside reverse transcriptase inhibitors: N-benzyl-4-methyl-benzimidazoles

    Science.gov (United States)

    Ziółkowska, Natasza E.; Michejda, Christopher J.; Bujacz, Grzegorz D.

    2009-07-01

    HIV-1 nonnucleoside reverse transcriptase inhibitors are potentially specific and effective drugs in AIDS therapy. The presence of two aromatic systems with an angled orientation in the molecule of the inhibitor is crucial for interactions with HIV-1 RT. The inhibitor drives like a wedge into the cluster of aromatic residues of RT HIV-1 and restrains the enzyme in a conformation that blocks the chemical step of nucleotide incorporation. Structural studies provide useful information for designing new, more active inhibitors. The crystal structures of four NNRTIs are presented here. The investigated compounds are derivatives of N-benzyl-4-methyl-benzimidazole with various aliphatic and aromatic substituents at carbon 2 positions and a 2,6-dihalogeno-substituted N-benzyl moiety. Structural data reported here show that the conformation of the investigated compounds is relatively rigid. Such feature is important for the nonnucleoside inhibitor binding to HIV-1 reverse transcriptase.

  5. Potent nonnucleoside reverse transcriptase inhibitors target HIV-1 Gag-Pol.

    Directory of Open Access Journals (Sweden)

    Anna Figueiredo

    2006-11-01

    Full Text Available Nonnucleoside reverse transcriptase inhibitors (NNRTIs target HIV-1 reverse transcriptase (RT by binding to a pocket in RT that is close to, but distinct, from the DNA polymerase active site and prevent the synthesis of viral cDNA. NNRTIs, in particular, those that are potent inhibitors of RT polymerase activity, can also act as chemical enhancers of the enzyme's inter-subunit interactions. However, the consequences of this chemical enhancement effect on HIV-1 replication are not understood. Here, we show that the potent NNRTIs efavirenz, TMC120, and TMC125, but not nevirapine or delavirdine, inhibit the late stages of HIV-1 replication. These potent NNRTIs enhanced the intracellular processing of Gag and Gag-Pol polyproteins, and this was associated with a decrease in viral particle production from HIV-1-transfected cells. The increased polyprotein processing is consistent with premature activation of the HIV-1 protease by NNRTI-enhanced Gag-Pol multimerization through the embedded RT sequence. These findings support the view that Gag-Pol multimerization is an important step in viral assembly and demonstrate that regulation of Gag-Pol/Gag-Pol interactions is a novel target for small molecule inhibitors of HIV-1 production. Furthermore, these drugs can serve as useful probes to further understand processes involved in HIV-1 particle assembly and maturation.

  6. Structural studies of series HIV-1 nonnucleoside reverse transcriptase inhibitors 1-(2,6-difluorobenzyl)-2-(2,6-difluorophenyl)-benzimidazoles with different 4-substituents

    Science.gov (United States)

    Ziółkowska, Natasza E.; Michejda, Christopher J.; Bujacz, Grzegorz D.

    2010-03-01

    Over the past 10 years, several anti-viral drugs have become available to fight the HIV infection. Antiretroviral treatment reduces the mortality of AIDS. Nonnucleoside inhibitors of HIV-1 reverse transcriptase are specific and potentially nontoxic drugs against AIDS. The crystal structures of five nonnucleoside inhibitors of HIV-1 reverse transcriptase are presented here. The structural parameters, especially those describing the angular orientation of the π-electron systems and influencing biological activity, were determined for all of the investigated inhibitors. The chemical character and orientation of the substituent at C4 position of the benzimidazole moiety substantially influences the anti-viral activity. The structural data of the investigated inhibitors is a good basis for modeling enzyme-inhibitor interactions for structure-assisted drug design.

  7. Mutation V111I in HIV-2 reverse transcriptase increases the fitness of the nucleoside analogue-resistant K65R and Q151M viruses

    NARCIS (Netherlands)

    I. Deuzing (Ilona); C. Charpentier (Charlotte); D.J. Wright (David Justin); S. Matheron (Sophie); J. Paton (Jack); D. Frentz (Dineke); D.A.M.C. van de Vijver (David); P.V. Coveney (Peter); D. Descamps (Diane); C.A.B. Boucher (Charles); N. Beerens (Nancy)

    2015-01-01

    textabstractInfection with HIV-2 can ultimately lead to AIDS, although disease progression is much slower than with HIV-1. HIV-2 patients are mostly treated with a combination of nucleoside reverse transcriptase (RT) inhibitors (NRTIs) and protease inhibitors designed for HIV-1. Many studies have

  8. Structural investigation of HIV-1 nonnucleoside reverse transcriptase inhibitors: 2-Aryl-substituted benzimidazoles

    Science.gov (United States)

    Ziółkowska, Natasza E.; Michejda, Christopher J.; Bujacz, Grzegorz D.

    2009-11-01

    Acquired immunodeficiency syndrome (AIDS) caused by the human immunodeficiency virus (HIV) is one of the most destructive epidemics in history. Inhibitors of HIV enzymes are the main targets to develop drugs against that disease. Nonnucleoside reverse transcriptase inhibitors of HIV-1 (NNRTIs) are potentially effective and nontoxic. Structural studies provide information necessary to design more active compounds. The crystal structures of four NNRTI derivatives of 2-aryl-substituted N-benzyl-benzimidazole are presented here. Analysis of the geometrical parameters shows that the structures of the investigated inhibitors are rigid. The important geometrical parameter is the dihedral angle between the planes of the π-electron systems of the benzymidazole and benzyl moieties. The values of these dihedral angles are in a narrow range for all investigated inhibitors. There is no significant difference between the structure of the free inhibitor and the inhibitor in the complex with RT HIV-1. X-ray structures of the investigated inhibitors are a good basis for modeling enzyme-inhibitor interactions in rational drug design.

  9. Molecular docking of (5E)-3-(2-aminoethyl)-5-(2- thienylmethylene)-1, 3-thiazolidine-2, 4-dione on HIV-1 reverse transcriptase: novel drug acting on enzyme.

    Science.gov (United States)

    Seniya, Chandrabhan; Yadav, Ajay; Uchadia, Kuldeep; Kumar, Sanjay; Sagar, Nitin; Shrivastava, Priyanka; Shrivastava, Shilpi; Wadhwa, Gulshan

    2012-01-01

    The study of Human immunodeficiency virus (HIV) in humans and animal models in last 31 years suggested that it is a causative agent of AIDS. This causes serious pandemic public health concern globally. It was reported that the HIV-1 reverse transcriptase (RT) played a critical role in the life cycle of HIV. Therefore, inhibition of HIV-1RT enzyme is one of the major and potential targets in the treatment of AIDS. The enzyme (HIV-1RT) was successfully targeted by non nucleotide reverse transcriptase inhibitors (NNRTIs). But frequent application of NNRTIs led drug resistance mutation on HIV infections. Therefore, there is a need to search new NNRTIs with appropriate pharmacophores. For the purpose, a virtually screened 3D model of unliganded HIV-1RT (1DLO) was explored. The unliganded HIV-1RT (1DLO) was docked with 4-thiazolidinone and its derivatives (ChemBank Database) by using AutoDock4. The best seven docking solutions complex were selected and analyzed by Ligplot. The analysis showed that derivative (5E)-3-(2- aminoethyl)-5-(2- thienylmethylene)-1, 3-thiazolidine-2, 4-dione (CID 3087795) has maximum potential against unliganded HIV-1RT (1DLO). The analysis was done on the basis of scoring and binding ability. The derivative (5E)-3-(2- aminoethyl)-5-(2- thienylmethylene)-1, 3-thiazolidine-2, 4-dione (CID 3087795) indicated minimum energy score and highest number of interactions with active site residue and could be a promising inhibitor for HIV-1 RT as Drug target.

  10. Structure of the HIV-1 reverse transcriptase Q151M mutant: insights into the inhibitor resistance of HIV-1 reverse transcriptase and the structure of the nucleotide-binding pocket of Hepatitis B virus polymerase

    International Nuclear Information System (INIS)

    Nakamura, Akiyoshi; Tamura, Noriko; Yasutake, Yoshiaki

    2015-01-01

    The structure of the HIV-1 reverse transcriptase Q151M mutant was determined at a resolution of 2.6 Å in space group P321. Hepatitis B virus polymerase (HBV Pol) is an important target for anti-HBV drug development; however, its low solubility and stability in vitro has hindered detailed structural studies. Certain nucleotide reverse transcriptase (RT) inhibitors (NRTIs) such as tenofovir and lamivudine can inhibit both HBV Pol and Human immunodeficiency virus 1 (HIV-1) RT, leading to speculation on structural and mechanistic analogies between the deoxynucleotide triphosphate (dNTP)-binding sites of these enzymes. The Q151M mutation in HIV-1 RT, located at the dNTP-binding site, confers resistance to various NRTIs, while maintaining sensitivity to tenofovir and lamivudine. The residue corresponding to Gln151 is strictly conserved as a methionine in HBV Pol. Therefore, the structure of the dNTP-binding pocket of the HIV-1 RT Q151M mutant may reflect that of HBV Pol. Here, the crystal structure of HIV-1 RT Q151M, determined at 2.6 Å resolution, in a new crystal form with space group P321 is presented. Although the structure of HIV-1 RT Q151M superimposes well onto that of HIV-1 RT in a closed conformation, a slight movement of the β-strands (β2–β3) that partially create the dNTP-binding pocket was observed. This movement might be caused by the introduction of the bulky thioether group of Met151. The structure also highlighted the possibility that the hydrogen-bonding network among amino acids and NRTIs is rearranged by the Q151M mutation, leading to a difference in the affinity of NRTIs for HIV-1 RT and HBV Pol

  11. Structure of the HIV-1 reverse transcriptase Q151M mutant: insights into the inhibitor resistance of HIV-1 reverse transcriptase and the structure of the nucleotide-binding pocket of Hepatitis B virus polymerase

    Energy Technology Data Exchange (ETDEWEB)

    Nakamura, Akiyoshi; Tamura, Noriko; Yasutake, Yoshiaki, E-mail: y-yasutake@aist.go.jp [National Institute of Advanced Industrial Science and Technology (AIST), 2-17-2-1 Tsukisamu-Higashi, Toyohira, Sapporo, Hokkaido 062-8517 (Japan)

    2015-10-23

    The structure of the HIV-1 reverse transcriptase Q151M mutant was determined at a resolution of 2.6 Å in space group P321. Hepatitis B virus polymerase (HBV Pol) is an important target for anti-HBV drug development; however, its low solubility and stability in vitro has hindered detailed structural studies. Certain nucleotide reverse transcriptase (RT) inhibitors (NRTIs) such as tenofovir and lamivudine can inhibit both HBV Pol and Human immunodeficiency virus 1 (HIV-1) RT, leading to speculation on structural and mechanistic analogies between the deoxynucleotide triphosphate (dNTP)-binding sites of these enzymes. The Q151M mutation in HIV-1 RT, located at the dNTP-binding site, confers resistance to various NRTIs, while maintaining sensitivity to tenofovir and lamivudine. The residue corresponding to Gln151 is strictly conserved as a methionine in HBV Pol. Therefore, the structure of the dNTP-binding pocket of the HIV-1 RT Q151M mutant may reflect that of HBV Pol. Here, the crystal structure of HIV-1 RT Q151M, determined at 2.6 Å resolution, in a new crystal form with space group P321 is presented. Although the structure of HIV-1 RT Q151M superimposes well onto that of HIV-1 RT in a closed conformation, a slight movement of the β-strands (β2–β3) that partially create the dNTP-binding pocket was observed. This movement might be caused by the introduction of the bulky thioether group of Met151. The structure also highlighted the possibility that the hydrogen-bonding network among amino acids and NRTIs is rearranged by the Q151M mutation, leading to a difference in the affinity of NRTIs for HIV-1 RT and HBV Pol.

  12. Review The Emerging Profile of Cross-Resistance among the Nonnucleoside HIV-1 Reverse Transcriptase Inhibitors

    OpenAIRE

    Nicolas Sluis-Cremer

    2014-01-01

    Nonnucleoside reverse transcriptase inhibitors (NNRTIs) are widely used to treat HIV-1-infected individuals; indeed most first-line antiretroviral therapies typically include one NNRTI in combination with two nucleoside analogs. In 2008, the next-generation NNRTI etravirine was approved for the treatment of HIV-infected antiretroviral therapy-experienced individuals, including those with prior NNRTI exposure. NNRTIs are also increasingly being included in strategies to prevent HIV-1 infectio...

  13. Fragment Based Strategies for Discovery of Novel HIV-1 Reverse Transcriptase and Integrase Inhibitors.

    Science.gov (United States)

    Latham, Catherine F; La, Jennifer; Tinetti, Ricky N; Chalmers, David K; Tachedjian, Gilda

    2016-01-01

    Human immunodeficiency virus (HIV) remains a global health problem. While combined antiretroviral therapy has been successful in controlling the virus in patients, HIV can develop resistance to drugs used for treatment, rendering available drugs less effective and limiting treatment options. Initiatives to find novel drugs for HIV treatment are ongoing, although traditional drug design approaches often focus on known binding sites for inhibition of established drug targets like reverse transcriptase and integrase. These approaches tend towards generating more inhibitors in the same drug classes already used in the clinic. Lack of diversity in antiretroviral drug classes can result in limited treatment options, as cross-resistance can emerge to a whole drug class in patients treated with only one drug from that class. A fresh approach in the search for new HIV-1 drugs is fragment-based drug discovery (FBDD), a validated strategy for drug discovery based on using smaller libraries of low molecular weight molecules (FBDD is aimed at not only finding novel drug scaffolds, but also probing the target protein to find new, often allosteric, inhibitory binding sites. Several fragment-based strategies have been successful in identifying novel inhibitory sites or scaffolds for two proven drug targets for HIV-1, reverse transcriptase and integrase. While any FBDD-generated HIV-1 drugs have yet to enter the clinic, recent FBDD initiatives against these two well-characterised HIV-1 targets have reinvigorated antiretroviral drug discovery and the search for novel classes of HIV-1 drugs.

  14. Synthesis and evaluation of "AZT-HEPT", "AZT-pyridinone", and "ddC-HEPT" conjugates as inhibitors of HIV reverse transcriptase.

    Science.gov (United States)

    Pontikis, R; Dollé, V; Guillaumel, J; Dechaux, E; Note, R; Nguyen, C H; Legraverend, M; Bisagni, E; Aubertin, A M; Grierson, D S; Monneret, C

    2000-05-18

    To test the concept that HIV reverse transcriptase could be effectively inhibited by "mixed site inhibitors", a series of seven conjugates containing both a nucleoside analogue component (AZT 1, ddC 2) and a nonnucleoside type inhibitor (HEPT analogue 12, pyridinone 27) were synthesized and evaluated for their ability to block HIV replication. The (N-3 and C-5)AZT-HEPT conjugates 15, 22, and 23 displayed 2-5 microM anti-HIV activity, but they had no effect on the replication of HIV-2 or the HIV-1 strain with the Y181C mutation. The (C-5)AZT-pyridinone conjugates 34-37 were found to be inactive. In marked contrast, the ddC-HEPT molecule 26 displayed the same potency (EC(50) = 0.45 microM) against HIV-1 (wild type and the Y181C nevirapine-resistant strain) and HIV-2 in cell culture. No synergistic effect was observed for these bis-substrate inhibitors, suggesting that the two individual inhibitor components in these molecules do not bind simultaneously in their respective sites. Interestingly, however, the results indicate that the AZT-HEPT conjugates and the ddC-HEPT derivative 26 inhibit reverse transcriptase (RT) in an opposite manner. One explanation for this difference is that the former compounds interact preferentially with the hydrophobic pocket in RT, whereas 26 (after supposed triphosphorylation) inhibits RT through binding in the catalytic site.

  15. Novel (2,6-difluorophenyl)(2-(phenylamino)pyrimidin-4-yl) methanones with restricted conformation as potent non-nucleoside reverse transcriptase inhibitors against HIV-1

    Czech Academy of Sciences Publication Activity Database

    Šimon, Petr; Baszczyňski, Ondřej; Šaman, David; Stepan, G.; Hu, E.; Lansdon, E. B.; Jansa, P.; Janeba, Zlatko

    2016-01-01

    Roč. 122, Oct 21 (2016), s. 185-195 ISSN 0223-5234 Institutional support: RVO:61388963 Keywords : diarylpyrimidine (DAPY) * etravirine * human immunodeficiency virus ( HIV ) * non-nucleoside reverse transcriptase inhibitors * NNRTIs * rilpivirine Subject RIV: CC - Organic Chemistry Impact factor: 4.519, year: 2016

  16. 4'-Ethynyl-2-fluoro-2'-deoxyadenosine, MK-8591: a novel HIV-1 reverse transcriptase translocation inhibitor.

    Science.gov (United States)

    Markowitz, Martin; Sarafianos, Stefan G

    2018-07-01

    4'-Ethynyl-2-fluoro-2'-deoxyadenosine (EFdA) is a nucleoside reverse transcriptase inhibitor (NRTI) with a novel mechanism of action, unique structure, and amongst NRTIs, unparalleled anti-HIV-1 activity. We will summarize its structure and function, antiviral activity, resistance profile, and potential as an antiretroviral for use in the treatment and preexposure prophylaxis of HIV-1 infection. EFdA is active against wild-type (EC50 as low as 50 pmol/l) and most highly NRTI-resistant viruses. The active metabolite, EFdA-triphosphate, has been shown to have a prolonged intracellular half-life in human and rhesus (Rh) blood cells. As a result, single drug doses tested in simian immunodeficiency virus mac251-infected Rh macaques and HIV-1-infected individuals exhibited robust antiviral activity of 7-10 days duration. Preclinical studies of EFdA as preexposure prophylaxis in the Rh macaque/simian/human immunodeficiency virus low-dose intrarectal challenge model have shown complete protection when given in clinically relevant doses. EFdA is a novel antiretroviral with activity against both wild-type and NRTI-resistant viruses. As a result of the prolonged intracellular half-life of its active moiety, it is amenable to flexibility in dosing of at least daily to weekly and perhaps longer.

  17. Polyurethane intravaginal ring for controlled delivery of dapivirine, a nonnucleoside reverse transcriptase inhibitor of HIV-1.

    Science.gov (United States)

    Gupta, Kavita M; Pearce, Serena M; Poursaid, Azadeh E; Aliyar, Hyder A; Tresco, Patrick A; Mitchnik, Mark A; Kiser, Patrick F

    2008-10-01

    Women-controlled methods for prevention of male-to-female sexual transmission of HIV-1 are urgently needed. Providing inhibitory concentrations of HIV-1 reverse transcriptase inhibitors to impede the replication of the virus in the female genital tissue offers a mechanism for prophylaxis of HIV-1. To this end, an intravaginal ring device that can provide long duration delivery of dapivirine, a nonnucleoside reverse transcriptase inhibitor of HIV-1, was developed utilizing a medical-grade polyether urethane. Monolithic intravaginal rings were fabricated and sustained release with cumulative flux linear with time was demonstrated under sink conditions for a period of 30 days. The release rate was directly proportional to the amount of drug loaded. Another release study conducted for a week utilizing liposome dispersions as sink conditions, to mimic the partitioning of dapivirine into vaginal tissue, also demonstrated release rates constant with time. These results qualify polyether urethanes for development of intravaginal rings for sustained delivery of microbicidal agents. (c) 2008 Wiley-Liss, Inc. and the American Pharmacists Association

  18. Sequence Quality Analysis Tool for HIV Type 1 Protease and Reverse Transcriptase

    OpenAIRE

    DeLong, Allison K.; Wu, Mingham; Bennett, Diane; Parkin, Neil; Wu, Zhijin; Hogan, Joseph W.; Kantor, Rami

    2012-01-01

    Access to antiretroviral therapy is increasing globally and drug resistance evolution is anticipated. Currently, protease (PR) and reverse transcriptase (RT) sequence generation is increasing, including the use of in-house sequencing assays, and quality assessment prior to sequence analysis is essential. We created a computational HIV PR/RT Sequence Quality Analysis Tool (SQUAT) that runs in the R statistical environment. Sequence quality thresholds are calculated from a large dataset (46,802...

  19. Biophysical Insights into the Inhibitory Mechanism of Non-Nucleoside HIV-1 Reverse Transcriptase Inhibitors

    Directory of Open Access Journals (Sweden)

    Nicolas Sluis-Cremer

    2013-11-01

    Full Text Available HIV-1 reverse transcriptase (RT plays a central role in HIV infection. Current United States Federal Drug Administration (USFDA-approved antiretroviral therapies can include one of five approved non-nucleoside RT inhibitors (NNRTIs, which are potent inhibitors of RT activity. Despite their crucial clinical role in treating and preventing HIV-1 infection, their mechanism of action remains elusive. In this review, we introduce RT and highlight major advances from experimental and computational biophysical experiments toward an understanding of RT function and the inhibitory mechanism(s of NNRTIs.

  20. Molecular docking and 3D-QSAR studies on triazolinone and pyridazinone, non-nucleoside inhibitor of HIV-1 reverse transcriptase.

    Science.gov (United States)

    Sivan, Sree Kanth; Manga, Vijjulatha

    2010-06-01

    Nonnucleoside reverse transcriptase inhibitors (NNRTIs) are allosteric inhibitors of the HIV-1 reverse transcriptase. Recently a series of Triazolinone and Pyridazinone were reported as potent inhibitors of HIV-1 wild type reverse transcriptase. In the present study, docking and 3D quantitative structure activity relationship (3D QSAR) studies involving comparative molecular field analysis (CoMFA) and comparative molecular similarity indices analysis (CoMSIA) were performed on 31 molecules. Ligands were built and minimized using Tripos force field and applying Gasteiger-Hückel charges. These ligands were docked into protein active site using GLIDE 4.0. The docked poses were analyzed; the best docked poses were selected and aligned. CoMFA and CoMSIA fields were calculated using SYBYL6.9. The molecules were divided into training set and test set, a PLS analysis was performed and QSAR models were generated. The model showed good statistical reliability which is evident from the r2 nv, q2 loo and r2 pred values. The CoMFA model provides the most significant correlation of steric and electrostatic fields with biological activities. The CoMSIA model provides a correlation of steric, electrostatic, acceptor and hydrophobic fields with biological activities. The information rendered by 3D QSAR model initiated us to optimize the lead and design new potential inhibitors.

  1. Evolving uses of oral reverse transcriptase inhibitors in the HIV-1 epidemic: From treatment to prevention

    NARCIS (Netherlands)

    R.K. Gupta (Ravindra); D.A.M.C. van de Vijver (David); S. Manicklal (Sheetal); M.A. Wainberg (Mark)

    2013-01-01

    textabstractThe HIV epidemic continues unabated, with no highly effective vaccine and no cure. Each new infection has significant economic, social and human costs and prevention efforts are now as great a priority as global antiretroviral therapy (ART) scale up. Reverse transcriptase inhibitors, the

  2. 2',3'-Dideoxycytidine and human immunodeficiency virus reverse transcriptase

    International Nuclear Information System (INIS)

    Starnes, M.C.

    1988-01-01

    2',3'-Dideoxycytidine (ddCyd) is a candidate for clinical trial in the treatment of Acquired Immunodeficiency Syndrome, as a result of its potent inhibition of Human Immunodeficiency Virus (HIV) replication. The cellular metabolism and cytotoxicity of ddCyd are, as well as the interaction of ddCTP and other nucleotide and pyrophosphate analogs with mammalian DNA polymerases and HIV reverse transcriptase (RT). In addition, some structural and functional characteristics of HIV RT are described. 5 μM ddCyd reduced Molt 4 cell division by 50% during a 48 h continuous exposure; however, a 24 h exposure to 0.5 μM ddCyd reduced clonogenic survival by 50%. [ 14 C]-dThd incorporation into DNA was reduced during exposure to ddCyd. Acid-soluble ddCyd metabolites were ddCMP, ddCDP, and ddCTP. Initial ddCyd phosphorylation was catalyzed primarily by cytoplasmic dCyd kinase, and ddCyd was not a substrate for human Cyd-dCyd deaminase. Metabolism of ddCyd was identical in mock and HIV infected H9 cells

  3. Immune pressure analysis of protease and reverse transcriptase ...

    African Journals Online (AJOL)

    /dn) were analyzed for 33 HIV-1 subtype C protease (PR) and reverse transcriptase (RT) nucleotide sequences each from antiretroviral naïve South African chronically infected individuals. The ds/dn ratios were calculated using the ...

  4. Trends of drug-resistance-associated mutations in the reverse transcriptase gene of HIV type 1 isolates from North India.

    Science.gov (United States)

    Azam, Mohd; Malik, Abida; Rizvi, Meher; Rai, Arvind

    2014-04-01

    A major cause of failure of antiretroviral therapy (ART) is the presence of drug-resistance-associated mutations in the polymerase gene of HIV-1. The paucity of data regarding potential drug resistance to reverse transcriptase inhibitors (RTIs) prompted us to carry out this study. This information will shed light on the extent of drug resistance already present in HIV strains and will give future directions in patient treatment and in drug design. Drug resistance genotyping of a partial reverse transcriptase gene was done in 103 HIV-1-infected patients, including the ART-naive and ART-experienced population. The drug resistance pattern was analyzed using the Stanford HIV-DR database, the IAS-USA mutation list and the REGA algorithm-v8.0. Subtyping was done using the REGA HIV-1 subtyping tool-v2.01. The majority of our sequences (96 %) were found to be subtype C, and four (3.8 %) were subtype A1. Significant prevalence of DR mutations (28 %) was observed in the RT gene. Major amino acid substitutions were seen at positions 41, 90, 98, 103, 106, 108, 138, 181, 184, 190, 215, and 219, which confer high/intermediate levels of resistance to most RTIs, independently or together. Our results show that there is an urgent need to tailor ART drug regimens to the individual to achieve optimum therapeutic outcome in North India.

  5. Prediction of mutational tolerance in HIV-1 protease and reverse transcriptase using flexible backbone protein design.

    Directory of Open Access Journals (Sweden)

    Elisabeth Humphris-Narayanan

    Full Text Available Predicting which mutations proteins tolerate while maintaining their structure and function has important applications for modeling fundamental properties of proteins and their evolution; it also drives progress in protein design. Here we develop a computational model to predict the tolerated sequence space of HIV-1 protease reachable by single mutations. We assess the model by comparison to the observed variability in more than 50,000 HIV-1 protease sequences, one of the most comprehensive datasets on tolerated sequence space. We then extend the model to a second protein, reverse transcriptase. The model integrates multiple structural and functional constraints acting on a protein and uses ensembles of protein conformations. We find the model correctly captures a considerable fraction of protease and reverse-transcriptase mutational tolerance and shows comparable accuracy using either experimentally determined or computationally generated structural ensembles. Predictions of tolerated sequence space afforded by the model provide insights into stability-function tradeoffs in the emergence of resistance mutations and into strengths and limitations of the computational model.

  6. Evaluation of nevirapine and/or hydroxyurea with nucleoside reverse transcriptase inhibitors in treatment-naive HIV-1-infected subjects

    NARCIS (Netherlands)

    Blanckenberg, Daniel H.; Wood, Robin; Horban, Andrzej; Beniowski, Marek; Boron-Kaczmarska, Anna; Trocha, Hanna; Halota, Waldemar; Schmidt, Reinhold E.; Fatkenheuer, G.; Jessen, Heiko; Lange, Joep M. A.

    2004-01-01

    Objective: To examine the effect of adding nevirapine (NVP) and/or hydroxyurea (HU) to a triple nucleoside analogue reverse transcriptase inhibitor (NRTI) regimen in terms of efficacy and tolerability. Methods: HIV-1-infected, treatment-naive adults were randomized, using a factorial design, to add

  7. NMR structure of the HIV-1 reverse transcriptase thumb subdomain

    Energy Technology Data Exchange (ETDEWEB)

    Sharaf, Naima G. [University of Pittsburgh, School of Medicine, Department of Structural Biology and Pittsburgh Center for HIV Protein Interactions (United States); Brereton, Andrew E. [Oregon State University, Department of Biochemistry and Biophysics, 2011 Ag & Life Sciences Bldg (United States); Byeon, In-Ja L. [University of Pittsburgh, School of Medicine, Department of Structural Biology and Pittsburgh Center for HIV Protein Interactions (United States); Andrew Karplus, P. [Oregon State University, Department of Biochemistry and Biophysics, 2011 Ag & Life Sciences Bldg (United States); Gronenborn, Angela M., E-mail: amg100@pitt.edu [University of Pittsburgh, School of Medicine, Department of Structural Biology and Pittsburgh Center for HIV Protein Interactions (United States)

    2016-12-15

    The solution NMR structure of the isolated thumb subdomain of HIV-1 reverse transcriptase (RT) has been determined. A detailed comparison of the current structure with dozens of the highest resolution crystal structures of this domain in the context of the full-length enzyme reveals that the overall structures are very similar, with only two regions exhibiting local conformational differences. The C-terminal capping pattern of the αH helix is subtly different, and the loop connecting the αI and αJ helices in the p51 chain of the full-length p51/p66 heterodimeric RT differs from our NMR structure due to unique packing interactions in mature RT. Overall, our data show that the thumb subdomain folds independently and essentially the same in isolation as in its natural structural context.

  8. A Novel Leu92 Mutant of HIV-1 Reverse Transcriptase with a Selective Deficiency in Strand Transfer Causes a Loss of Viral Replication.

    Science.gov (United States)

    Herzig, Eytan; Voronin, Nickolay; Kucherenko, Nataly; Hizi, Amnon

    2015-08-01

    The process of reverse transcription (RTN) in retroviruses is essential to the viral life cycle. This key process is catalyzed exclusively by the viral reverse transcriptase (RT) that copies the viral RNA into DNA by its DNA polymerase activity, while concomitantly removing the original RNA template by its RNase H activity. During RTN, the combination between DNA synthesis and RNA hydrolysis leads to strand transfers (or template switches) that are critical for the completion of RTN. The balance between these RT-driven activities was considered to be the sole reason for strand transfers. Nevertheless, we show here that a specific mutation in HIV-1 RT (L92P) that does not affect the DNA polymerase and RNase H activities abolishes strand transfer. There is also a good correlation between this complete loss of the RT's strand transfer to the loss of the DNA clamp activity of the RT, discovered recently by us. This finding indicates a mechanistic linkage between these two functions and that they are both direct and unique functions of the RT (apart from DNA synthesis and RNA degradation). Furthermore, when the RT's L92P mutant was introduced into an infectious HIV-1 clone, it lost viral replication, due to inefficient intracellular strand transfers during RTN, thus supporting the in vitro data. As far as we know, this is the first report on RT mutants that specifically and directly impair RT-associated strand transfers. Therefore, targeting residue Leu92 may be helpful in selectively blocking this RT activity and consequently HIV-1 infectivity and pathogenesis. Reverse transcription in retroviruses is essential for the viral life cycle. This multistep process is catalyzed by viral reverse transcriptase, which copies the viral RNA into DNA by its DNA polymerase activity (while concomitantly removing the RNA template by its RNase H activity). The combination and balance between synthesis and hydrolysis lead to strand transfers that are critical for reverse transcription

  9. Complete inactivation of HIV-1 using photo-labeled non-nucleoside reverse transcriptase inhibitors.

    Science.gov (United States)

    Rios, Adan; Quesada, Jorge; Anderson, Dallas; Goldstein, Allan; Fossum, Theresa; Colby-Germinario, Susan; Wainberg, Mark A

    2011-01-01

    We demonstrate that a photo-labeled derivative of the non-nucleoside reverse transcriptase inhibitor (NNRTI) dapivirine termed DAPY, when used together with exposure to ultraviolet light, was able to completely and irreversibly inactivate both HIV-1 RT activity as well as infectiousness in each of a T cell line and peripheral blood mononuclear cells. Control experiments using various concentrations of DAPY revealed that a combination of exposure to ultraviolet light together with use of the specific, high affinity photo-labeled compound was necessary for complete inactivation to occur. This method of HIV RT inactivation may have applicability toward preservation of an intact viral structure and warrants further investigation in regard to the potential of this approach to elicit a durable, broad protective immune response. Copyright © 2010 Elsevier B.V. All rights reserved.

  10. The emerging profile of cross-resistance among the nonnucleoside HIV-1 reverse transcriptase inhibitors.

    Science.gov (United States)

    Sluis-Cremer, Nicolas

    2014-07-31

    Nonnucleoside reverse transcriptase inhibitors (NNRTIs) are widely used to treat HIV-1-infected individuals; indeed most first-line antiretroviral therapies typically include one NNRTI in combination with two nucleoside analogs. In 2008, the next-generation NNRTI etravirine was approved for the treatment of HIV-infected antiretroviral therapy-experienced individuals, including those with prior NNRTI exposure. NNRTIs are also increasingly being included in strategies to prevent HIV-1 infection. For example: (1) nevirapine is used to prevent mother-to-child transmission; (2) the ASPIRE (MTN 020) study will test whether a vaginal ring containing dapivirine can prevent HIV-1 infection in women; (3) a microbicide gel formulation containing the urea-PETT derivative MIV-150 is in a phase I study to evaluate safety, pharmacokinetics, pharmacodynamics and acceptability; and (4) a long acting rilpivirine formulation is under-development for pre-exposure prophylaxis. Given their widespread use, particularly in resource-limited settings, as well as their low genetic barriers to resistance, there are concerns about overlapping resistance between the different NNRTIs. Consequently, a better understanding of the resistance and cross-resistance profiles among the NNRTI class is important for predicting response to treatment, and surveillance of transmitted drug-resistance.

  11. Probing the molecular mechanism of action of the HIV-1 reverse transcriptase inhibitor 4′-ethynyl-2-fluoro-2′-deoxyadenosine (EFdA) using pre-steady-state kinetics

    OpenAIRE

    Muftuoglu, Yagmur; Sohl, Christal D.; Mislak, Andrea C.; Mitsuya, Hiroaki; Sarafianos, Stefan G.; Anderson, Karen S.

    2014-01-01

    The novel antiretroviral 4′-ethynyl-2-fluoro-2′-deoxyadenosine (EFdA) is a potent nucleoside HIV-1 reverse transcriptase (RT) inhibitor (NRTI). Unlike other FDA-approved NRTIs, EFdA contains a 3′-hydroxyl. Pre-steady-state kinetics showed RT preferred incorporating EFdA-TP over native dATP. Moreover, RT slowly inserted nucleotides past an EFdA-terminated primer, resulting in delayed chain termination with unaffected fidelity. This is distinct from KP1212, another 3′-hydroxyl-containing RT inh...

  12. Do non-nucleoside reverse transcriptase inhibitors contribute to lipodystrophy?

    Science.gov (United States)

    Nolan, David

    2005-01-01

    Lipodystrophy complications, including lipoatrophy (pathological fat loss) and metabolic complications, have emerged as important long-term toxicities associated with antiretroviral therapy in the current era. The wealth of data that has accumulated over the past 6 years has now clarified the contribution of specific antiretroviral drugs to the risk of these clinical endpoints, with evidence that lipoatrophy is strongly associated with the choice of nucleoside reverse transcriptase inhibitor therapy (specifically, stavudine and to a lesser extent zidovudine). The aetiological basis of metabolic complications of antiretroviral therapy has proven to be complex, in that the risk appears to be modulated by a number of lifestyle factors that have made the metabolic syndrome highly prevalent in the general population, with additional contributions from HIV disease status itself, as well as from individual drugs within the HIV protease inhibitor class. The currently licensed non-nucleoside reverse transcriptase inhibitor (NNRTI) drugs, efavirenz and nevirapine, have been proven to have a favourable safety profile in terms of lipodystrophy complications. However, it must be noted that NNRTI drugs also have individual toxicity profiles that must be accounted for when considering and/or monitoring their use in the treatment of HIV infection.

  13. Design, synthesis and biological evaluations of N-Hydroxy thienopyrimidine-2,4-diones as inhibitors of HIV reverse transcriptase-associated RNase H.

    Science.gov (United States)

    Kankanala, Jayakanth; Kirby, Karen A; Huber, Andrew D; Casey, Mary C; Wilson, Daniel J; Sarafianos, Stefan G; Wang, Zhengqiang

    2017-12-01

    Human immunodeficiency virus (HIV) reverse transcriptase (RT) associated ribonuclease H (RNase H) is the only HIV enzymatic function not targeted by current antiviral drugs. Although various chemotypes have been reported to inhibit HIV RNase H, few have shown significant antiviral activities. We report herein the design, synthesis and biological evaluation of a novel N-hydroxy thienopyrimidine-2,3-dione chemotype (11) which potently and selectively inhibited RNase H with considerable potency against HIV-1 in cell culture. Current structure-activity-relationship (SAR) identified analogue 11d as a nanomolar inhibitor of RNase H (IC 50  = 0.04 μM) with decent antiviral potency (EC 50  = 7.4 μM) and no cytotoxicity (CC 50  > 100 μM). In extended biochemical assays compound 11d did not inhibit RT polymerase (pol) while inhibiting integrase strand transfer (INST) with 53 fold lower potency (IC 50  = 2.1 μM) than RNase H inhibition. Crystallographic and molecular modeling studies confirmed the RNase H active site binding mode. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  14. Review The Emerging Profile of Cross-Resistance among the Nonnucleoside HIV-1 Reverse Transcriptase Inhibitors

    Directory of Open Access Journals (Sweden)

    Nicolas Sluis-Cremer

    2014-07-01

    Full Text Available Nonnucleoside reverse transcriptase inhibitors (NNRTIs are widely used to treat HIV-1-infected individuals; indeed most first-line antiretroviral therapies typically include one NNRTI in combination with two nucleoside analogs. In 2008, the next-generation NNRTI etravirine was approved for the treatment of HIV-infected antiretroviral therapy-experienced individuals, including those with prior NNRTI exposure. NNRTIs are also increasingly being included in strategies to prevent HIV-1 infection. For example: (1 nevirapine is used to prevent mother-to-child transmission; (2 the ASPIRE (MTN 020 study will test whether a vaginal ring containing dapivirine can prevent HIV-1 infection in women; (3 a microbicide gel formulation containing the urea-PETT derivative MIV-150 is in a phase I study to evaluate safety, pharmacokinetics, pharmacodynamics and acceptability; and (4 a long acting rilpivirine formulation is under-development for pre-exposure prophylaxis. Given their widespread use, particularly in resource-limited settings, as well as their low genetic barriers to resistance, there are concerns about overlapping resistance between the different NNRTIs. Consequently, a better understanding of the resistance and cross-resistance profiles among the NNRTI class is important for predicting response to treatment, and surveillance of transmitted drug-resistance.

  15. Reverse transcriptase inhibitors as microbicides.

    Science.gov (United States)

    Lewi, Paul; Heeres, Jan; Ariën, Kevin; Venkatraj, Muthusamy; Joossens, Jurgen; Van der Veken, Pieter; Augustyns, Koen; Vanham, Guido

    2012-01-01

    The CAPRISA 004 study in South Africa has accelerated the development of vaginal and rectal microbicides containing antiretrovirals that target specific enzymes in the reproduction cycle of HIV, especially reverse transcriptase inhibitors (RTI). In this review we discuss the potential relevance of HIV-1 RTIs as microbicides, focusing in the nucleotide RTI tenofovir and six classes of nonnucleoside RTIs (including dapivirine, UC781, urea and thiourea PETTs, DABOs and a pyrimidinedione). Although tenofovir and dapivirine appear to be most advanced in clinical trials as potential microbicides, several issues remain unresolved, e.g., the importance of nonhuman primates as a "gatekeeper" for clinical trials, the emergence and spread of drug-resistant mutants, the combination of microbicides that target different phases of viral reproduction and the accessibility to microbicides in low-income countries. Thus, here we discuss the latest research on RTI as microbicides in the light of the continuing spread of the HIV pandemic from the point of view of medicinal chemistry, virological, and pharmaceutical studies.

  16. A376S in the connection subdomain of HIV-1 reverse transcriptase confers increased risk of virological failure to nevirapine therapy

    NARCIS (Netherlands)

    Paredes, Roger; Puertas, Maria Carmen; Bannister, Wendy; Kisic, Mónica; Cozzi-Lepri, Alessandro; Pou, Christian; Bellido, Rocío; Betancor, Gilberto; Bogner, Johannes; Gargalianos, Panagiotis; Bánhegyi, Dénes; Clotet, Bonaventura; Lundgren, Jens; Menéndez-Arias, Luis; Martinez-Picado, Javier; Losso, M.; Elias, C.; Vetter, N.; Zangerle, R.; Karpov, I.; Vassilenko, A.; Mitsura, V. M.; Suetnov, O.; Clumeck, N.; de Wit, S.; Poll, B.; Colebunders, R.; Vandekerckhove, L.; Hadziosmanovic, V.; Kostov, K.; Begovac, J.; Machala, L.; Rozsypal, H.; Sedlacek, D.; Nielsen, J.; Kronborg, G.; Benfield, T.; Larsen, M.; Gerstoft, J.; Katzenstein, T.; Hansen, A.-B. E.; Skinhøj, P.; Pedersen, C.; Oestergaard, L.; Zilmer, K.; Ristola, M.; Katlama, C.; Viard, J.-P.; Girard, P.-M.; Livrozet, J. M.; Vanhems, P.; Pradier, C.; Dabis, F.; Neau, D.; Rockstroh, J.; Schmidt, R.; van Lunzen, J.; Degen, O.; Stellbrink, H. J.; Staszewski, S.; Fätkenheuer, G.; Kosmidis, J.; Gargalianos, P.; Xylomenos, G.; Perdios, J.; Panos, G.; Filandras, A.; Karabatsaki, E.; Sambatakou, H.; Banhegyi, D.; Mulcahy, F.; Yust, I.; Turner, D.; Burke, M.; Pollack, S.; Hassoun, G.; Maayan, S.; Vella, S.; Esposito, R.; Mazeu, I.; Mussini, C.; Arici, C.; Pristera, R.; Mazzotta, F.; Gabbuti, A.; Vullo, V.; Lichtner, M.; Chirianni, A.; Montesarchio, E.; Gargiulo, M.; Antonucci, G.; Iacomi, F.; Narciso, P.; Vlassi, C.; Zaccarelli, M.; Lazzarin, A.; Finazzi, R.; Galli, M.; Ridolfo, A.; d'Arminio, A.; Rozentale, B.; Aldins, P.; Chaplinskas, S.; Hemmer, R.; Staub, T.; Reiss, P.; Ormaasen, V.; Maeland, A.; Brunn, J.; Knysz, B.; Gasiorowski, J.; Horban, A.; Bakowska, E.; Prokopowicz, D.; Flisiak, R.; Boron-Kaczmarska, A.; Pynka, M.; Beniowski, M.; Mularska, E.; Trocha, H.; Jablonowska, E.; Malolepsza, E.; Wojcik, K.; Antunes, F.; Valadas, E.; Mansinho, K.; Maltez, F.; Duiculescu, D.; Rakhmanova, A.; Vinogradova, E.; Buzunova, S.; Jevtovic, D.; Mokrás, M.; Staneková, D.; Tomazic, J.; González-Lahoz, J.; Soriano, V.; Martin-Carbonero, L.; Labarga, P.; Moreno, S.; Clotet, B.; Jou, A.; Paredes, R.; Tural, C.; Puig, J.; Bravo, I.; Gatell, J. M.; Miró, J. M.; Domingo, P.; Gutierrez, M.; Mateo, G.; Sambeat, M. A.; Karlsson, A.; Persson, P. O.; Ledergerber, B.; Weber, R.; Francioli, P.; Cavassini, M.; Hirschel, B.; Boffi, E.; Furrer, H.; Battegay, M.; Elzi, L.; Kravchenko, E.; Chentsova, N.; Kutsyna, G.; Servitskiy, S.; Krasnov, M.; Barton, S.; Johnson, A. M.; Mercey, D.; Phillips, A.; Johnson, M. A.; Murphy, M.; Weber, J.; Scullard, G.; Fisher, M.; Leen, C.; Gatell, J.; Gazzard, B.; Lundgren, J.; d'Arminio Monforte, A.; Kirk, O.; Mocroft, A.; Cozzi-Lepri, A.; Grint, D.; Ellefson, M.; Podlekareva, D.; Kjaer, J.; Peters, L.; Reekie, J.; Kowalska, J.; Tverland, J.; Fischer, A. H.

    2011-01-01

    The clinical relevance of mutations in the connection subdomain and the ribonuclease (RNase) H domain of HIV-1 reverse transcriptase (RT) is uncertain. The risk of virological failure to nonnucleoside RT inhibitor (NNRTI)-based antiretroviral therapy (ART) was evaluated in NNRTI-naive patients who

  17. A Rough Set-Based Model of HIV-1 Reverse Transcriptase Resistome

    Directory of Open Access Journals (Sweden)

    Marcin Kierczak

    2009-10-01

    Full Text Available Reverse transcriptase (RT is a viral enzyme crucial for HIV-1 replication. Currently, 12 drugs are targeted against the RT. The low fidelity of the RT-mediated transcription leads to the quick accumulation of drug-resistance mutations. The sequence-resistance relationship remains only partially understood. Using publicly available data collected from over 15 years of HIV proteome research, we have created a general and predictive rule-based model of HIV-1 resistance to eight RT inhibitors. Our rough set-based model considers changes in the physicochemical properties of a mutated sequence as compared to the wild-type strain. Thanks to the application of the Monte Carlo feature selection method, the model takes into account only the properties that significantly contribute to the resistance phenomenon. The obtained results show that drug-resistance is determined in more complex way than believed. We confirmed the importance of many resistance-associated sites, found some sites to be less relevant than formerly postulated and— more importantly—identified several previously neglected sites as potentially relevant. By mapping some of the newly discovered sites on the 3D structure of the RT, we were able to suggest possible molecular-mechanisms of drug-resistance. Importantly, our model has the ability to generalize predictions to the previously unseen cases. The study is an example of how computational biology methods can increase our understanding of the HIV-1 resistome.

  18. Synthesis, biological evaluation and molecular modeling of 2-Hydroxyisoquinoline-1,3-dione analogues as inhibitors of HIV reverse transcriptase associated ribonuclease H and polymerase.

    Science.gov (United States)

    Tang, Jing; Vernekar, Sanjeev Kumar V; Chen, Yue-Lei; Miller, Lena; Huber, Andrew D; Myshakina, Nataliya; Sarafianos, Stefan G; Parniak, Michael A; Wang, Zhengqiang

    2017-06-16

    Human immunodeficiency virus (HIV) reverse transcriptase (RT) associated ribonuclease H (RNase H) remains the only virally encoded enzymatic function not clinically validated as an antiviral target. 2-Hydroxyisoquinoline-1,3-dione (HID) is known to confer active site directed inhibition of divalent metal-dependent enzymatic functions, such as HIV RNase H, integrase (IN) and hepatitis C virus (HCV) NS5B polymerase. We report herein the synthesis and biochemical evaluation of a few C-5, C-6 or C-7 substituted HID subtypes as HIV RNase H inhibitors. Our data indicate that while some of these subtypes inhibited both the RNase H and polymerase (pol) functions of RT, potent and selective RNase H inhibition was achieved with subtypes 8-9 as exemplified with compounds 8c and 9c. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  19. Probing the molecular mechanism of action of the HIV-1 reverse transcriptase inhibitor 4'-ethynyl-2-fluoro-2'-deoxyadenosine (EFdA) using pre-steady-state kinetics.

    Science.gov (United States)

    Muftuoglu, Yagmur; Sohl, Christal D; Mislak, Andrea C; Mitsuya, Hiroaki; Sarafianos, Stefan G; Anderson, Karen S

    2014-06-01

    The novel antiretroviral 4'-ethynyl-2-fluoro-2'-deoxyadenosine (EFdA) is a potent nucleoside HIV-1 reverse transcriptase (RT) inhibitor (NRTI). Unlike other FDA-approved NRTIs, EFdA contains a 3'-hydroxyl. Pre-steady-state kinetics showed RT preferred incorporating EFdA-TP over native dATP. Moreover, RT slowly inserted nucleotides past an EFdA-terminated primer, resulting in delayed chain termination with unaffected fidelity. This is distinct from KP1212, another 3'-hydroxyl-containing RT inhibitor considered to promote viral lethal mutagenesis. New mechanistic features of RT inhibition by EFdA are revealed. Copyright © 2014 Elsevier B.V. All rights reserved.

  20. The RNA binding protein HuR does not interact directly with HIV-1 reverse transcriptase and does not affect reverse transcription in vitro

    Directory of Open Access Journals (Sweden)

    Gronenborn Angela M

    2010-05-01

    Full Text Available Abstract Background Lemay et al recently reported that the RNA binding protein HuR directly interacts with the ribonuclease H (RNase H domain of HIV-1 reverse transcriptase (RT and influences the efficiency of viral reverse transcription (Lemay et al., 2008, Retrovirology 5:47. HuR is a member of the embryonic lethal abnormal vision protein family and contains 3 RNA recognition motifs (RRMs that bind AU-rich elements (AREs. To define the structural determinants of the HuR-RT interaction and to elucidate the mechanism(s by which HuR influences HIV-1 reverse transcription activity in vitro, we cloned and purified full-length HuR as well as three additional protein constructs that contained the N-terminal and internal RRMs, the internal and C-terminal RRMs, or the C-terminal RRM only. Results All four HuR proteins were purified and characterized by biophysical methods. They are well structured and exist as monomers in solution. No direct protein-protein interaction between HuR and HIV-1 RT was detected using NMR titrations with 15N labeled HuR variants or the 15N labeled RNase H domain of HIV-1 RT. Furthermore, HuR did not significantly affect the kinetics of HIV-1 reverse transcription in vitro, even on RNA templates that contain AREs. Conclusions Our results suggest that HuR does not impact HIV-1 replication through a direct protein-protein interaction with the viral RT.

  1. Probing the molecular mechanism of action of the HIV-1 reverse transcriptase inhibitor 4′-ethynyl-2-fluoro-2′-deoxyadenosine (EFdA) using pre-steady-state kinetics

    Science.gov (United States)

    Muftuoglu, Yagmur; Sohl, Christal D.; Mislak, Andrea C.; Mitsuya, Hiroaki; Sarafianos, Stefan G.; Anderson, Karen S.

    2014-01-01

    The novel antiretroviral 4′-ethynyl-2-fluoro-2′-deoxyadenosine (EFdA) is a potent nucleoside HIV-1 reverse transcriptase (RT) inhibitor (NRTI). Unlike other FDA-approved NRTIs, EFdA contains a 3′-hydroxyl. Pre-steady-state kinetics showed RT preferred incorporating EFdA-TP over native dATP. Moreover, RT slowly inserted nucleotides past an EFdA-terminated primer, resulting in delayed chain termination with unaffected fidelity. This is distinct from KP1212, another 3′-hydroxyl-containing RT inhibitor considered to promote viral lethal mutagenesis. New mechanistic features of RT inhibition by EFdA are revealed. PMID:24632447

  2. Role of the K101E substitution in HIV-1 reverse transcriptase in resistance to rilpivirine and other nonnucleoside reverse transcriptase inhibitors.

    Science.gov (United States)

    Xu, Hong-Tao; Colby-Germinario, Susan P; Huang, Wei; Oliveira, Maureen; Han, Yingshan; Quan, Yudong; Petropoulos, Christos J; Wainberg, Mark A

    2013-11-01

    Resistance to the recently approved nonnucleoside reverse transcriptase inhibitor (NNRTI) rilpivirine (RPV) commonly involves substitutions at positions E138K and K101E in HIV-1 reverse transcriptase (RT), together with an M184I substitution that is associated with resistance to coutilized emtricitabine (FTC). Previous biochemical and virological studies have shown that compensatory interactions between substitutions E138K and M184I can restore enzyme processivity and the viral replication capacity. Structural modeling studies have also shown that disruption of the salt bridge between K101 and E138 can affect RPV binding. The current study was designed to investigate the impact of K101E, alone or in combination with E138K and/or M184I, on drug susceptibility, viral replication capacity, and enzyme function. We show here that K101E can be selected in cell culture by the NNRTIs etravirine (ETR), efavirenz (EFV), and dapivirine (DPV) as well as by RPV. Recombinant RT enzymes and viruses containing K101E, but not E138K, were highly resistant to nevirapine (NVP) and delavirdine (DLV) as well as ETR and RPV, but not EFV. The addition of K101E to E138K slightly enhanced ETR and RPV resistance compared to that obtained with E138K alone but restored susceptibility to NVP and DLV. The K101E substitution can compensate for deficits in viral replication capacity and enzyme processivity associated with M184I, while M184I can compensate for the diminished efficiency of DNA polymerization associated with K101E. The coexistence of K101E and E138K does not impair either viral replication or enzyme fitness. We conclude that K101E can play a significant role in resistance to RPV.

  3. Phylogenetic analysis of HIV-1 reverse transcriptase sequences from 382 patients recruited in JJ Hospital of Mumbai, India, between 2002 and 2008.

    Science.gov (United States)

    Deshpande, Alaka; Jauvin, Valerie; Pinson, Patricia; Jeannot, Anne Cecile; Fleury, Herve J

    2009-06-01

    Analysis of reverse transcriptase (RT) sequences of 382 HIV-1 isolates from untreated and treated patients recruited in JJ Hospital (Mumbai, India) between 2002 and 2008 shows that subtype C is largely predominant (98%) and that non-C sequences cluster with A1, B, CRF01_AE, and CRF06_cpx.

  4. Replication-dependent 65R→K reversion in human immunodeficiency virus type 1 reverse transcriptase double mutant K65R + L74V

    International Nuclear Information System (INIS)

    Sharma, Prem L.; Nurpeisov, Viktoria; Lee, Kimberly; Skaggs, Sara; Di San Filippo, Christina Amat; Schinazi, Raymond F.

    2004-01-01

    Understanding of the mechanisms of interaction among nucleoside reverse transcriptase inhibitor (NRTI)-selected mutations in the human immunodeficiency virus type 1 (HIV-1) reverse transcriptase (RT) coding sequence is essential for the design of newer drugs and for enhancing our vision of the structure function relationship among amino acids of the polymerase domain of HIV-1. Although several nucleoside reverse transcriptase inhibitors select RT mutations K65R and L74V, the combination of 65R + 74V is rare in clinics. A novel NRTI (-)-β-D-dioxolane-guanosine (DXG) is known to select in vitro either the 65R or 74V mutant virus (Antimicrob. Agents Chemother. 44 (2000) 1783). These mutations were not selected together during repeated passaging of the HIV-1 in the presence of this drug. To analyze the impact of these RT mutations on viral replication, a double mutant containing K65R + L74V was created by site-directed mutagenesis in a pNL4-3 background. Replication kinetic assays revealed that the mutant K65R + L74V is unstable, and 65R→K reversion occurs during replication of virus in phytohemagglutinin (PHA)-stimulated human peripheral blood mononuclear (PBM) cells in the absence of selection pressure. Replication kinetic assays in MT-2 cells demonstrated that double mutant 65R + 74V is highly attenuated for replication and the initiation of reversion is related to the increase in RT activity. Additionally, the suppression of viral replication in the presence of DXG or under suboptimal human recombinant interleukin-2 leads to minimal or no 65R→K reversion. These observations provide evidence that 65R→K reversion in the double mutant 65R + 74V is dependent on a specific rate of viral replication in a pNL4-3 background. A similar phenomenon may occur in vivo, which may have implications for treatment management strategies

  5. Sequence quality analysis tool for HIV type 1 protease and reverse transcriptase.

    Science.gov (United States)

    Delong, Allison K; Wu, Mingham; Bennett, Diane; Parkin, Neil; Wu, Zhijin; Hogan, Joseph W; Kantor, Rami

    2012-08-01

    Access to antiretroviral therapy is increasing globally and drug resistance evolution is anticipated. Currently, protease (PR) and reverse transcriptase (RT) sequence generation is increasing, including the use of in-house sequencing assays, and quality assessment prior to sequence analysis is essential. We created a computational HIV PR/RT Sequence Quality Analysis Tool (SQUAT) that runs in the R statistical environment. Sequence quality thresholds are calculated from a large dataset (46,802 PR and 44,432 RT sequences) from the published literature ( http://hivdb.Stanford.edu ). Nucleic acid sequences are read into SQUAT, identified, aligned, and translated. Nucleic acid sequences are flagged if with >five 1-2-base insertions; >one 3-base insertion; >one deletion; >six PR or >18 RT ambiguous bases; >three consecutive PR or >four RT nucleic acid mutations; >zero stop codons; >three PR or >six RT ambiguous amino acids; >three consecutive PR or >four RT amino acid mutations; >zero unique amino acids; or 15% genetic distance from another submitted sequence. Thresholds are user modifiable. SQUAT output includes a summary report with detailed comments for troubleshooting of flagged sequences, histograms of pairwise genetic distances, neighbor joining phylogenetic trees, and aligned nucleic and amino acid sequences. SQUAT is a stand-alone, free, web-independent tool to ensure use of high-quality HIV PR/RT sequences in interpretation and reporting of drug resistance, while increasing awareness and expertise and facilitating troubleshooting of potentially problematic sequences.

  6. Dideoxynucleoside HIV reverse transcriptase inhibitors and drug-related hepatotoxicity: a case report

    Directory of Open Access Journals (Sweden)

    Lapadula Giuseppe

    2007-05-01

    Full Text Available Abstract This report regards the case of a 43 year-old HIV-positive woman who developed an episode of serious transaminase elevation during stavudine-including antiretroviral therapy. Diagnostic assessment ruled out hepatitis virus co-infection, alcohol abuse besides other possible causes of liver damage. No signs of lactic acidosis were present. Liver biopsy showed portal inflammatory infiltrate, spotty necrosis, vacuoles of macro- and micro-vesicular steatosis, acidophil and foamy hepatocytes degeneration with organelles clumping, poorly formed Mallory bodies and neutrophil granulocytes attraction (satellitosis. A dramatic improvement in liver function tests occurred when stavudine was discontinued and a new antiretroviral regimen with different nucleoside reverse transcriptase inhibitors was used. The importance of considering hepatotoxicity as an adverse event of HAART including stavudine, even in absence of other signs of mitochondrial toxicity should therefore be underlined. Liver biopsy may provide further important information regarding patients with severe transaminase elevation, for a better understanding of the etiology of liver damage.

  7. Etravirine and rilpivirine resistance in HIV-1 subtype CRF01_AE-infected adults failing non-nucleoside reverse transcriptase inhibitor-based regimens.

    Science.gov (United States)

    Bunupuradah, Torsak; Ananworanich, Jintanat; Chetchotisakd, Ploenchan; Kantipong, Pacharee; Jirajariyavej, Supunnee; Sirivichayakul, Sunee; Munsakul, Warangkana; Prasithsirikul, Wisit; Sungkanuparph, Somnuek; Bowonwattanuwong, Chureeratana; Klinbuayaem, Virat; Petoumenos, Kathy; Hirschel, Bernard; Bhakeecheep, Sorakij; Ruxrungtham, Kiat

    2011-01-01

    We studied prevalence of etravirine (ETR) and rilpivirine (RPV) resistance in HIV-1 subtype CRF01_AE infection with first-line non-nucleoside reverse transcriptase inhibitor (NNRTI) failure. A total of 225 adults failing two nucleoside reverse transcriptase inhibitors (NRTIs) plus 1 NNRTI in Thailand with HIV RNA>1,000 copies/ml were included. Genotypic resistance results and HIV-1 subtype were interpreted by Stanford DR database. ETR resistance was calculated by the new Monogram weighted score (Monogram WS; ≥ 4 indicating high-level ETR resistance) and by DUET weighted score (DUET WS; 2.5-3.5 and ≥ 4 resulted in intermediate and reduce ETR response, respectively). RPV resistance interpretation was based on previous reports. Median (IQR) age was 38 (34-42) years, 41% were female and CDC A:B:C were 22%:21%:57%. HIV subtypes were 96% CRF01_AE and 4% B. Antiretrovirals at failure were lamivudine (100%), stavudine (93%), nevirapine (90%) and efavirenz (10%) with a median (IQR) duration of 3.4 (1.8-4.5) years. Median (IQR) CD4(+) T-cell count and HIV RNA were 194 (121-280) cells/mm³ and 4.1 (3.6-4.6) log₁₀ copies/ml, respectively. The common NNRTI mutations were Y181C (41%), G190A (22%) and K103N (19%). The proportion of patients with Monogram WS score ≥ 4 was 61.3%. By DUET WS, 49.8% and 7.5% of patients were scored 2.5-3.5 and ≥4, respectively. Only HIV RNA ≥ 4 log₁₀ copies/ml at failure was associated with both Monogram WS ≥ 4 (OR 2.3, 95% CI 1.3-3.9; P=0.003) and DUET WS ≥ 2.5 (OR 1.9, 95% CI 1.1-3.3; P=0.02). The RVP resistance-associated mutations (RAMs) detected were K101P (1.8%), Y181I (2.7%) and Y181V (3.6%). All patients with RPV mutation had ETR resistance. No E138R/E138K mutations were detected. Approximately 60% of patients had high-level ETR resistance. The role of ETR in second-line therapy is limited in late NNRTI failure settings. RVP RAMs were uncommon, but cross-resistance between ETR and RVP was high.

  8. Substrate-induced stable enzyme-inhibitor complex formation allows tight binding of novel 2-aminopyrimidin-4(3H)-ones to drug-resistant HIV-1 reverse transcriptase mutants.

    Science.gov (United States)

    Samuele, Alberta; Facchini, Marcella; Rotili, Dante; Mai, Antonello; Artico, Marino; Armand-Ugón, Mercedes; Esté, José A; Maga, Giovanni

    2008-09-01

    We recently reported the synthesis and biological evaluation of a novel series of 5-alkyl-2-(N,N-disubstituted)amino-6-(2,6-difluorophenylalkyl)-3,4-dihydropyrimidin-4(3H)-ones (F(2)-N,N-DABOs). These compounds are highly active against both wild-type HIV-1 and the K103N, Y181C, and Y188L mutant strains. Herein we present novel 6-(2-chloro-6-fluorophenylalkyl)-N,N-DABO (2-Cl-6-F-N,N-DABO) derivatives and investigate the molecular basis for their high-affinity binding to HIV-1 reverse transcriptase (RT). Our results show that the new compounds display higher association rates than the difluoro derivatives toward wild-type HIV-1 RT or drug-resistant RT mutant forms. We also show that they preferentially associate to either the free enzyme or the enzyme-nucleic acid binary complex, and that this binding is stabilized upon formation of the ternary complex between HIV-1 RT and both the nucleic acid and nucleotide substrates. Interestingly, one compound showed dissociation rates from the ternary complex with RT mutants K103N and Y181I 10-20-fold slower than from the corresponding complex with wild-type RT.

  9. Protein-mediated antagonism between HIV reverse transcriptase ligands nevirapine and MgATP.

    Science.gov (United States)

    Zheng, Xunhai; Mueller, Geoffrey A; DeRose, Eugene F; London, Robert E

    2013-06-18

    Nonnucleoside reverse transcriptase inhibitors (NNRTIs) play a central role in the treatment of AIDS, but their mechanisms of action are incompletely understood. The interaction of the NNRTI nevirapine (NVP) with HIV-1 reverse transcriptase (RT) is characterized by a preference for the open conformation of the fingers/thumb subdomains, and a reported variation of three orders of magnitude between the binding affinity of NVP for RT in the presence or absence of primer/template DNA. To investigate the relationship between conformation and ligand binding, we evaluated the use of methionine NMR probes positioned near the tip of the fingers or thumb subdomains. Such probes would be expected to be sensitive to changes in the local environment depending on the fractions of open and closed RT. Comparisons of the NMR spectra of three conservative mutations, I63M, L74M, and L289M, indicated that M63 showed the greatest shift sensitivity to the addition of NVP. The exchange kinetics of the M63 resonance are fast on the chemical shift timescale, but become slow in the presence of NVP due to the slow binding of RT with the inhibitor. The simplest model consistent with this behavior involves a rapid open/closed equilibrium coupled with a slow interaction of the inhibitor with the open conformation. Studies of RT in the presence of both NVP and MgATP indicate a strong negative cooperativity. Binding of MgATP reduces the fraction of RT bound to NVP, as indicated by the intensity of the NVP-perturbed M230 resonance, and enhances the dissociation rate constant of the NVP, resulting in an increase of the open/closed interconversion rate, so that the M63 resonance moves into the fast/intermediate-exchange regime. Protein-mediated interactions appear to explain most of the affinity variation of NVP for RT. Copyright © 2013 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  10. HIV Salvage Therapy Does Not Require Nucleoside Reverse Transcriptase Inhibitors: A Randomized, Controlled Trial.

    Science.gov (United States)

    Tashima, Karen T; Smeaton, Laura M; Fichtenbaum, Carl J; Andrade, Adriana; Eron, Joseph J; Gandhi, Rajesh T; Johnson, Victoria A; Klingman, Karin L; Ritz, Justin; Hodder, Sally; Santana, Jorge L; Wilkin, Timothy; Haubrich, Richard H

    2015-12-15

    Nucleoside reverse transcriptase inhibitors (NRTIs) are often included in antiretroviral regimens in treatment-experienced patients in the absence of data from randomized trials. To compare treatment success between participants who omit versus those who add NRTIs to an optimized antiretroviral regimen of 3 or more agents. Multicenter, randomized, controlled trial. (ClinicalTrials.gov: NCT00537394). Outpatient HIV clinics. Treatment-experienced patients with HIV infection and viral resistance. Open-label optimized regimens (not including NRTIs) were selected on the basis of treatment history and susceptibility testing. Participants were randomly assigned to omit or add NRTIs. The primary efficacy outcome was regimen failure through 48 weeks using a noninferiority margin of 15%. The primary safety outcome was time to initial episode of a severe sign, symptom, or laboratory abnormality before discontinuation of NRTI assignment. 360 participants were randomly assigned, and 93% completed a 48-week visit. The cumulative probability of regimen failure was 29.8% in the omit-NRTIs group versus 25.9% in the add-NRTIs group (difference, 3.2 percentage points [95% CI, -6.1 to 12.5 percentage points]). No significant between-group differences were found in the primary safety end points or the proportion of participants with HIV RNA level less than 50 copies/mL. No deaths occurred in the omit-NRTIs group compared with 7 deaths in the add-NRTIs group. Unblinded study design, and the study may not be applicable to resource-poor settings. Treatment-experienced patients with HIV infection starting a new optimized regimen can safely omit NRTIs without compromising virologic efficacy. Omitting NRTIs will reduce pill burden, cost, and toxicity in this patient population. National Institute of Allergy and Infectious Diseases, Boehringer Ingelheim, Janssen, Merck, ViiV Healthcare, Roche, and Monogram Biosciences (LabCorp).

  11. The connection domain in reverse transcriptase facilitates the in vivo annealing of tRNALys3 to HIV-1 genomic RNA

    Directory of Open Access Journals (Sweden)

    Niu Meijuan

    2004-10-01

    Full Text Available Abstract The primer tRNA for reverse transcription in HIV-1, tRNALys3, is selectively packaged into the virus during its assembly, and annealed to the viral genomic RNA. The ribonucleoprotein complex that is involved in the packaging and annealing of tRNALys into HIV-1 consists of Gag, GagPol, tRNALys, lysyl-tRNA synthetase (LysRS, and viral genomic RNA. Gag targets tRNALys for viral packaging through Gag's interaction with LysRS, a tRNALys-binding protein, while reverse transcriptase (RT sequences within GagPol (the thumb domain bind to tRNALys. The further annealing of tRNALys3 to viral RNA requires nucleocapsid (NC sequences in Gag, but not the NC sequences GagPol. In this report, we further show that while the RT connection domain in GagPol is not required for tRNALys3 packaging into the virus, it is required for tRNALys3 annealing to the viral RNA genome.

  12. Probing the communication of deoxythymidine triphosphate in HIV-1 reverse transcriptase by communication maps and interaction energy studies.

    Science.gov (United States)

    Gnanasekaran, Ramachandran

    2017-11-08

    We calculate communication maps for HIV-1 Reverse Transcriptase (RT) to elucidate energy transfer pathways between deoxythymidine triphosphate (dTTP) and other parts of the protein. This approach locates energy transport channels from the dTTP to remote regions of the protein via residues and water molecules. We examine the water dynamics near the catalytic site of HIV-1 RT by molecular dynamics (MD) simulations. We find that, within the catalytic site, the relaxation of water molecules is similar to that of the hydration water molecules present in other proteins and the relaxation time scale is fast enough to transport energy and helps in communication between dTTP and other residues in the system. To quantify energy transfer, we also calculate the interaction energies of dTTP, 2Mg 2+ , doxy-guanosine nucleotide (DG22) with their surrounding residues by using the B3LYP-D3 method. The results, from classical vibrational energy diffusivity and QM interaction energy, are complementary to identify the important residues involved in the process of polymerization. The positive and negative interactions by dTTP with different types of residues in the catalytic region make the residues transfer energy through vibrational communication.

  13. Reverse transcriptase inhibitors as potential colorectal microbicides.

    Science.gov (United States)

    Herrera, Carolina; Cranage, Martin; McGowan, Ian; Anton, Peter; Shattock, Robin J

    2009-05-01

    We investigated whether reverse transcriptase (RT) inhibitors (RTI) can be combined to inhibit human immunodeficiency virus type 1 (HIV-1) infection of colorectal tissue ex vivo as part of a strategy to develop an effective rectal microbicide. The nucleotide RTI (NRTI) PMPA (tenofovir) and two nonnucleoside RTI (NNRTI), UC-781 and TMC120 (dapivirine), were evaluated. Each compound inhibited the replication of the HIV isolates tested in TZM-bl cells, peripheral blood mononuclear cells, and colorectal explants. Dual combinations of the three compounds, either NRTI-NNRTI or NNRTI-NNRTI combinations, were more active than any of the individual compounds in both cellular and tissue models. Combinations were key to inhibiting infection by NRTI- and NNRTI-resistant isolates in all models tested. Moreover, we found that the replication capacities of HIV-1 isolates in colorectal explants were affected by single point mutations in RT that confer resistance to RTI. These data demonstrate that colorectal explants can be used to screen compounds for potential efficacy as part of a combination microbicide and to determine the mucosal fitness of RTI-resistant isolates. These findings may have important implications for the rational design of effective rectal microbicides.

  14. Computational drug design strategies applied to the modelling of human immunodeficiency virus-1 reverse transcriptase inhibitors

    Directory of Open Access Journals (Sweden)

    Lucianna Helene Santos

    2015-11-01

    Full Text Available Reverse transcriptase (RT is a multifunctional enzyme in the human immunodeficiency virus (HIV-1 life cycle and represents a primary target for drug discovery efforts against HIV-1 infection. Two classes of RT inhibitors, the nucleoside RT inhibitors (NRTIs and the nonnucleoside transcriptase inhibitors are prominently used in the highly active antiretroviral therapy in combination with other anti-HIV drugs. However, the rapid emergence of drug-resistant viral strains has limited the successful rate of the anti-HIV agents. Computational methods are a significant part of the drug design process and indispensable to study drug resistance. In this review, recent advances in computer-aided drug design for the rational design of new compounds against HIV-1 RT using methods such as molecular docking, molecular dynamics, free energy calculations, quantitative structure-activity relationships, pharmacophore modelling and absorption, distribution, metabolism, excretion and toxicity prediction are discussed. Successful applications of these methodologies are also highlighted.

  15. Naringin Reverses Hepatocyte Apoptosis and Oxidative Stress Associated with HIV-1 Nucleotide Reverse Transcriptase Inhibitors-Induced Metabolic Complications

    Directory of Open Access Journals (Sweden)

    Oluwafeyisetan O. Adebiyi

    2015-12-01

    Full Text Available Nucleoside Reverse Transcriptase Inhibitors (NRTIs have not only improved therapeutic outcomes in the treatment of HIV infection but have also led to an increase in associated metabolic complications of NRTIs. Naringin’s effects in mitigating NRTI-induced complications were investigated in this study. Wistar rats, randomly allotted into seven groups (n = 7 were orally treated daily for 56 days with 100 mg/kg zidovudine (AZT (groups I, II III, 50 mg/kg stavudine (d4T (groups IV, V, VI and 3 mL/kg of distilled water (group VII. Additionally, rats in groups II and V were similarly treated with 50 mg/kg naringin, while groups III and VI were treated with 45 mg/kg vitamin E. AZT or d4T treatment significantly reduced body weight and plasma high density lipoprotein concentrations but increased liver weights, plasma triglycerides and total cholesterol compared to controls, respectively. Furthermore, AZT or d4T treatment significantly increased oxidative stress, adiposity index and expression of Bax protein, but reduced Bcl-2 protein expression compared to controls, respectively. However, either naringin or vitamin E significantly mitigated AZT- or d4T-induced weight loss, dyslipidemia, oxidative stress and hepatocyte apoptosis compared to AZT- or d4T-only treated rats. Our results suggest that naringin reverses metabolic complications associated with NRTIs by ameliorating oxidative stress and apoptosis. This implies that naringin supplements could mitigate lipodystrophy and dyslipidemia associated with NRTI therapy.

  16. A randomized trial comparing initial HAART regimens of nelfinavir/nevirapine and ritonavir/saquinavir in combination with two nucleoside reverse transcriptase inhibitors

    DEFF Research Database (Denmark)

    Kirk, Ole; Lundgren, Jens D; Pedersen, Court

    2003-01-01

    BACKGROUND: A triple-class HAART regimen may be associated with a better virological effect than conventional regimens, but may also lead to toxicity and more profound resistance. METHODS: Randomized, controlled, open-label trial of 233 protease inhibitor- and non-nucleoside reverse transcriptase...... inhibitor-naive HIV-infected patients allocated to a regimen of nelfinavir and nevirapine (1250/200 mg twice daily; n = 118) or ritonavir and saquinavir (400/400 mg twice daily; n = 115), both in combination with two nucleoside reverse transcriptase inhibitors. The primary end-point was HIV RNA ... the long-term consequences of triple class HAART regimens, including the development of broad drug resistance....

  17. A376S in the connection subdomain of HIV-1 reverse transcriptase confers increased risk of virological failure to nevirapine therapy

    DEFF Research Database (Denmark)

    Paredes, Roger; Puertas, Maria Carmen; Bannister, Wendy

    2011-01-01

    Background. The clinical relevance of mutations in the connection subdomain and the ribonuclease (RNase) H domain of HIV-1 reverse transcriptase (RT) is uncertain. Methods. The risk of virological failure to nonnucleoside RT inhibitor (NNRTI)-based antiretroviral therapy (ART) was evaluated...... in NNRTI-naive patients who started NNRTIs in the EuroSIDA study after July 1997 according to preexisting substitutions in the connection subdomain and the RNase H domain of HIV-1 RT. An observed association between A376S and virological failure was further investigated by testing in vitro NNRTI...... = .013). A376S conferred selective low-level nevirapine resistance in vitro, and led to greater affinity for double-stranded DNA. Conclusions. The A376S substitution in the connection subdomain of HIV-1 RT causes selective nevirapine resistance and confers an increased risk of virological failure...

  18. Diagnosis, antiretroviral therapy, and emergence of resistance to antiretroviral agents in HIV-2 infection: a review

    Directory of Open Access Journals (Sweden)

    Maia Hightower

    Full Text Available Human immunodeficiency virus type 1 (HIV-1 and type 2 (HIV-2 are the causative agents of AIDS. HIV-2 is prevalent at moderate to high rates in West African countries, such as Senegal, Guinea, Gambia, and Cape Verde. Diagnosis of HIV-2 is made with a positive HIV-1/HIV-2 ELISA or simple/rapid assay, followed by one or two confirmatory tests specific for HIV-2. Following CD4+ T cell counts, HIV-2 viral burden and clinical signs and symptoms of immunodeficiency are beneficial in monitoring HIV-2 disease progression. Although non-nucleoside reverse transcriptase inhibitors are ineffective in treating HIV-2, nucleoside reverse transcriptase inhibitors and protease inhibitors can be effective in dual and triple antiretroviral regimens. Their use can decrease HIV-2 viral load, increase CD4+ T cell counts and improve AIDS-related symptoms. HIV-2 resistance to various nucleoside reverse transcriptase inhibitors and protease inhibitors, including zidovudine, lamivudine, ritonavir and indinavir, has been identified in some HIV-2 infected patients on antiretroviral therapy. The knowledge of HIV-2 peculiarities, when compared to HIV-1, is crucial to helping diagnose and guide the clinician in the choice of the initial antiretroviral regimen and for monitoring therapy success.

  19. Active methamphetamine use is associated with transmitted drug resistance to non-nucleoside reverse transcriptase inhibitors in individuals with HIV infection of unknown duration.

    Science.gov (United States)

    Cachay, Edward R; Moini, Niousha; Kosakovsky Pond, Sergei L; Pesano, Rick; Lie, Yolanda S; Aiem, Heidi; Butler, David M; Letendre, Scott; Mathews, Wm Christopher; Smith, Davey M

    2007-01-01

    Frequent methamphetamine use among recently HIV infected individuals is associated with transmitted drug resistance (TDR) to non-nucleoside reverse transcriptase inhibitors (NNRTI); however, the reversion time of TDR to drug susceptible HIV may exceed 3 years. We assessed whether recreational substance use is associated with detectable TDR among individuals newly diagnosed with HIV infection of unknown duration. Cross-sectional analysis. Subjects were enrolled at the University California, San Diego Early Intervention Program. Demographic, clinical and substance use data were collected using structured interviews. Genotypic resistance testing was performed using GeneSeq, Monogram Biosciences. We analyzed the association between substance use and TDR using bivariate analyses and the corresponding transmission networks using phylogenetic models. Between April 2004 and July 2006, 115 individuals with genotype data were enrolled. The prevalence of alcohol, marijuana and methamphetamine use were 98%, 71% and 64% respectively. Only active methamphetamine use in the 30 days prior to HIV diagnosis was independently associated with TDR to NNRTI (OR: 6.6; p=0.002). Despite not knowing the duration of their HIV infection, individuals reporting active methamphetamine use in the 30 days prior to HIV diagnosis are at an increased risk of having HIV strains that are resistant to NNRTI.

  20. Structural optimization of N1-aryl-benzimidazoles for the discovery of new non-nucleoside reverse transcriptase inhibitors active against wild-type and mutant HIV-1 strains.

    Science.gov (United States)

    Monforte, Anna Maria; De Luca, Laura; Buemi, Maria Rosa; Agharbaoui, Fatima E; Pannecouque, Christophe; Ferro, Stefania

    2018-02-01

    Non-nucleoside reverse transcriptase inhibitors (NNRTIs) are recommended components of preferred combination antiretroviral therapies used for the treatment of human immunodeficiency virus (HIV) infection. These regimens are extremely effective in suppressing virus replication. Recently, our research group identified some N 1 -aryl-2-arylthioacetamido-benzimidazoles as a novel class of NNRTIs. In this research work we report the design, the synthesis and the structure-activity relationship studies of new compounds (20-34) in which some structural modifications have been introduced in order to investigate their effects on reverse transcriptase (RT) inhibition and to better define the features needed to increase the antiviral activity. Most of the new compounds proved to be highly effective in inhibiting both RT enzyme at nanomolar concentrations and HIV-1 replication in MT4 cells with minimal cytotoxicity. Among them, the most promising N 1 -aryl-2-arylthioacetamido-benzimidazoles and N 1 -aryl-2-aryloxyacetamido-benzimidazoles were also tested toward a panel of single- and double-mutants strain responsible for resistance to NNRTIs, showing in vitro antiviral activity toward single mutants L100I, K103N, Y181C, Y188L and E138K. The best results were observed for derivatives 29 and 33 active also against the double mutants F227L and V106A. Computational approaches were applied in order to rationalize the potency of the new synthesized inhibitors. Copyright © 2017 Elsevier Ltd. All rights reserved.

  1. 5-Hydroxypyrido[2,3-b]pyrazin-6(5H)-one derivatives as novel dual inhibitors of HIV-1 reverse transcriptase-associated ribonuclease H and integrase.

    Science.gov (United States)

    Sun, Lin; Gao, Ping; Dong, Guanyu; Zhang, Xujie; Cheng, Xiqiang; Ding, Xiao; Wang, Xueshun; Daelemans, Dirk; De Clercq, Erik; Pannecouque, Christophe; Menéndez-Arias, Luis; Zhan, Peng; Liu, Xinyong

    2018-06-18

    We reported herein the design, synthesis and biological evaluation of a series of 5-hydroxypyrido[2,3-b]pyrazin-6(5H)-one derivatives as HIV-1 reverse transcriptase (RT) ribonuclease H (RNase H) inhibitors using a privileged structure-guided scaffold refining strategy. In view of the similarities between the pharmacophore model of RNase H and integrase (IN) inhibitors as well as their catalytic sites, we also performed IN inhibition assays. Notably, the majority of these derivatives inhibited RNase H and IN at micromolar concentrations. Among them, compound 7a exhibited similar inhibitory activity against RNase H and IN (IC 50 RNase H  = 1.77 μM, IC 50 IN  = 1.18 μM, ratio = 1.50). To the best of our knowledge, this is the first reported dual HIV-1 RNase H-IN inhibitor based on a 5-hydroxypyrido[2,3-b]pyrazin-6(5H)-one structure. Molecular modeling has been used to predict the binding mode of 7a in complex with the catalytic cores of HIV-1 RNase H and IN. Taken together these results strongly support the feasibility of developing HIV-1 dual inhibitors from analog-based optimization of divalent metal ion chelators. Recently, the identification of dual inhibitors proved to be a highly effective strategy for novel antivirals discovery. Therefore, these compounds appear to be useful leads that can be further modified to develop more valuable anti-HIV-1 molecules with suitable drug profiles. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

  2. Active Methamphetamine Use is Associated with Transmitted Drug Resis-tance to Non-Nucleoside Reverse Transcriptase Inhibitors in Individuals with HIV Infection of Unknown Duration

    Science.gov (United States)

    Cachay, Edward R; Moini, Niousha; Kosakovsky Pond, Sergei L; Pesano, Rick; Lie, Yolanda S; Aiem, Heidi; Butler, David M; Letendre, Scott; Mathews, Wm. Christopher; Smith, Davey M

    2007-01-01

    Background: Frequent methamphetamine use among recently HIV infected individuals is associated with transmitted drug resistance (TDR) to non-nucleoside reverse transcriptase inhibitors (NNRTI); however, the reversion time of TDR to drug susceptible HIV may exceed 3 years. We assessed whether recreational substance use is associated with detectable TDR among individuals newly diagnosed with HIV infection of unknown duration. Design: Cross-sectional analysis. Methods: Subjects were enrolled at the University California, San Diego Early Intervention Program. Demographic, clinical and substance use data were collected using structured interviews. Genotypic resistance testing was performed using GeneSeq™, Monogram Biosciences. We analyzed the association between substance use and TDR using bivariate analyses and the corresponding transmission networks using phylogenetic models. Results: Between April 2004 and July 2006, 115 individuals with genotype data were enrolled. The prevalence of alcohol, marijuana and methamphetamine use were 98%, 71% and 64% respectively. Only active methamphetamine use in the 30 days prior to HIV diagnosis was independently associated with TDR to NNRTI (OR: 6.6; p=0.002). Conclusion: Despite not knowing the duration of their HIV infection, individuals reporting active methamphetamine use in the 30 days prior to HIV diagnosis are at an increased risk of having HIV strains that are resistant to NNRTI. PMID:18923691

  3. Reverse Transcriptase Inhibitors as Potential Colorectal Microbicides▿ †

    Science.gov (United States)

    Herrera, Carolina; Cranage, Martin; McGowan, Ian; Anton, Peter; Shattock, Robin J.

    2009-01-01

    We investigated whether reverse transcriptase (RT) inhibitors (RTI) can be combined to inhibit human immunodeficiency virus type 1 (HIV-1) infection of colorectal tissue ex vivo as part of a strategy to develop an effective rectal microbicide. The nucleotide RTI (NRTI) PMPA (tenofovir) and two nonnucleoside RTI (NNRTI), UC-781 and TMC120 (dapivirine), were evaluated. Each compound inhibited the replication of the HIV isolates tested in TZM-bl cells, peripheral blood mononuclear cells, and colorectal explants. Dual combinations of the three compounds, either NRTI-NNRTI or NNRTI-NNRTI combinations, were more active than any of the individual compounds in both cellular and tissue models. Combinations were key to inhibiting infection by NRTI- and NNRTI-resistant isolates in all models tested. Moreover, we found that the replication capacities of HIV-1 isolates in colorectal explants were affected by single point mutations in RT that confer resistance to RTI. These data demonstrate that colorectal explants can be used to screen compounds for potential efficacy as part of a combination microbicide and to determine the mucosal fitness of RTI-resistant isolates. These findings may have important implications for the rational design of effective rectal microbicides. PMID:19258271

  4. Structural requirements for the binding of tRNA Lys3 to reverse transcriptase of the human immunodeficiency virus type 1

    NARCIS (Netherlands)

    Oude Essink, B. B.; Das, A. T.; Berkhout, B.

    1995-01-01

    Reverse transcription of the human immunodeficiency virus type 1 (HIV-1) RNA genome is primed by the cellular tRNA Lys3 molecule. Packaging of this tRNA primer during virion assembly is thought to be mediated by specific interactions with the reverse transcriptase (RT) protein. Portions of the tRNA

  5. Structural and Preclinical Studies of Computationally Designed Non-Nucleoside Reverse Transcriptase Inhibitors for Treating HIV infection

    Energy Technology Data Exchange (ETDEWEB)

    Kudalkar, Shalley N.; Beloor, Jagadish; Chan, Albert H.; Lee, Won-Gil; Jorgensen, William L.; Kumar, Priti; Anderson, Karen S.

    2017-02-06

    The clinical benefits of HIV-1 non-nucleoside reverse transcriptase (RT) inhibitors (NNRTIs) are hindered by their unsatisfactory pharmacokinetic (PK) properties along with the rapid development of drug-resistant variants. However, the clinical efficacy of these inhibitors can be improved by developing compounds with enhanced pharmacological profiles and heightened antiviral activity. We used computational and structure-guided design to develop two next-generation NNRTI drug candidates, compounds I and II, which are members of a class of catechol diethers. We evaluated the preclinical potential of these compounds in BALB/c mice because of their high solubility (510 µg/ml for compound I and 82.9 µg/ml for compound II), low cytotoxicity, and enhanced antiviral activity against wild-type (WT) HIV-1 RT and resistant variants. Additionally, crystal structures of compounds I and II with WT RT suggested an optimal binding to the NNRTI binding pocket favoring the high anti-viral potency. A single intraperitoneal dose of compounds I and II exhibited a prolonged serum residence time of 48 hours and concentration maximum (Cmax) of 4000- to 15,000-fold higher than their therapeutic/effective concentrations. These Cmax values were 4- to 15-fold lower than their cytotoxic concentrations observed in MT-2 cells. Compound II showed an enhanced area under the curve (0–last) and decreased plasma clearance over compound I and efavirenz, the standard of care NNRTI. Hence, the overall (PK) profile of compound II was excellent compared with that of compound I and efavirenz. Furthermore, both compounds were very well tolerated in BALB/c mice without any detectable acute toxicity. Taken together, these data suggest that compounds I and II possess improved anti-HIV-1 potency, remarkable in vivo safety, and prolonged in vivo circulation time, suggesting strong potential for further development as new NNRTIs for the potential treatment of HIV infection.

  6. Probing the mechanistic consequences of 5-fluorine substitution on cytidine nucleotide analogue incorporation by HIV-1 reverse transcriptase.

    Science.gov (United States)

    Ray, Adrian S; Schinazi, Raymond F; Murakami, Eisuke; Basavapathruni, Aravind; Shi, Junxing; Zorca, Suzana M; Chu, Chung K; Anderson, Karen S

    2003-05-01

    Beta-D and beta-L-enantiomers of 2',3'-dideoxycytidine analogues are potent chain-terminators and antimetabolites for viral and cellular replication. Seemingly small modifications markedly alter their antiviral and toxicity patterns. This review discusses previously published and recently obtained data on the effects of 5- and 2'-fluorine substitution on the pre-steady state incorporation of 2'-deoxycytidine-5'-monophosphate analogues by HIV-1 reverse transcriptase (RT) in light of their biological activity. The addition of fluorine at the 5-position of the pyrimidine ring altered the kinetic parameters for all nucleotides tested. Only the 5-fluorine substitution of the clinically relevant nucleosides (-)-beta-L-2',3'-dideoxy-3'-thia-5-fluorocytidine (L-FTC, Emtriva), and (+)-beta-D-2',3'-didehydro-2',3'-dideoxy-5-fluorocytidine (D-D4FC, Reverset), caused a higher overall efficiency of nucleotide incorporation during both DNA- and RNA-directed synthesis. Enhanced incorporation by RT may in part explain the potency of these nucleosides against HIV-1. In other cases, a lack of correlation between RT incorporation in enzymatic assays and antiviral activity in cell culture illustrates the importance of other cellular factors in defining antiviral potency. The substitution of fluorine at the 2' position of the deoxyribose ring negatively affects incorporation by RT indicating the steric gate of RT can detect electrostatic perturbations. Intriguing results pertaining to drug resistance have led to a better understanding of HIV-1 RT resistance mechanisms. These insights serve as a basis for understanding the mechanism of action for nucleoside analogues and, coupled with studies on other key enzymes, may lead to the more effective use of fluorine to enhance the potency and selectivity of antiviral agents.

  7. [Computational prediction of human immunodeficiency resistance to reverse transcriptase inhibitors].

    Science.gov (United States)

    Tarasova, O A; Filimonov, D A; Poroikov, V V

    2017-10-01

    Human immunodeficiency virus (HIV) causes acquired immunodeficiency syndrome (AIDS) and leads to over one million of deaths annually. Highly active antiretroviral treatment (HAART) is a gold standard in the HIV/AIDS therapy. Nucleoside and non-nucleoside inhibitors of HIV reverse transcriptase (RT) are important component of HAART, but their effect depends on the HIV susceptibility/resistance. HIV resistance mainly occurs due to mutations leading to conformational changes in the three-dimensional structure of HIV RT. The aim of our work was to develop and test a computational method for prediction of HIV resistance associated with the mutations in HIV RT. Earlier we have developed a method for prediction of HIV type 1 (HIV-1) resistance; it is based on the usage of position-specific descriptors. These descriptors are generated using the particular amino acid residue and its position; the position of certain residue is determined in a multiple alignment. The training set consisted of more than 1900 sequences of HIV RT from the Stanford HIV Drug Resistance database; for these HIV RT variants experimental data on their resistance to ten inhibitors are presented. Balanced accuracy of prediction varies from 80% to 99% depending on the method of classification (support vector machine, Naive Bayes, random forest, convolutional neural networks) and the drug, resistance to which is obtained. Maximal balanced accuracy was obtained for prediction of resistance to zidovudine, stavudine, didanosine and efavirenz by the random forest classifier. Average accuracy of prediction is 89%.

  8. Binding of Dumbbell Oligonucleotides to MoMuLV Reverse Transcriptase: Inhibitory Properties of RNase H Activity

    Directory of Open Access Journals (Sweden)

    Ajay Kumar

    2010-01-01

    Full Text Available Dumbbell oligonucleotides with loops of various chemistry were synthesized. Incubation of dumbbell oligonucleotides containing phosphorothioate bonds or trimethylene phosphate linkages in loops with S1 nuclease did not result in significant cleavage under conditions which led to the degradation of dumbbell oligonucleotide containing phophodiester bonds in the loops. The binding of reverse transcriptase of Moloney Murine Leukemia Virus (MoMuLV was evaluated with all the five oligonucleotides. The protein binds to all the dumbbell oligonucleotides with similar affinity. The dissociation constants evaluated using PAGE band mobility shift assays were of the order of 10-7. The inhibitory properties of the retroviral RNase H activity was evaluated using 3H –UTP-labeled RNA:RNA-DNA hybrid. It was found that the best dumbbell oligonucleotide, inhibitor contained phosphorothioate residues in both the loops. Our value studies demonstrated that this particularly designed oligonucleotide displays an IC50 of 18 nM in its inhibition on the reverse transcriptase RNase H activity, a magnitude lower than that of first nucleotide reverse transcriptase of HIV-1, tenofovir, introduced by Gilead Science in the market.

  9. A new general method for simultaneous fitting of temperature and concentration dependence of reaction rates yields kinetic and thermodynamic parameters for HIV reverse transcriptase specificity.

    Science.gov (United States)

    Li, An; Ziehr, Jessica L; Johnson, Kenneth A

    2017-04-21

    Recent studies have demonstrated the dominant role of induced fit in enzyme specificity of HIV reverse transcriptase and many other enzymes. However, relevant thermodynamic parameters are lacking, and equilibrium thermodynamic methods are of no avail because the key parameters can only be determined by kinetic measurement. By modifying KinTek Explorer software, we present a new general method for globally fitting data collected over a range of substrate concentrations and temperatures and apply it to HIV reverse transcriptase. Fluorescence stopped-flow methods were used to record the kinetics of enzyme conformational changes that monitor nucleotide binding and incorporation. The nucleotide concentration dependence was measured at temperatures ranging from 5 to 37 °C, and the raw data were fit globally to derive a single set of rate constants at 37 °C and a set of activation enthalpy terms to account for the kinetics at all other temperatures. This comprehensive analysis afforded thermodynamic parameters for nucleotide binding ( K d , Δ G , Δ H , and Δ S at 37 °C) and kinetic parameters for enzyme conformational changes and chemistry (rate constants and activation enthalpy). Comparisons between wild-type enzyme and a mutant resistant to nucleoside analogs used to treat HIV infections reveal that the ground state binding is weaker and the activation enthalpy for the conformational change step is significantly larger for the mutant. Further studies to explore the structural underpinnings of the observed thermodynamics and kinetics of the conformational change step may help to design better analogs to treat HIV infections and other diseases. Our new method is generally applicable to enzyme and chemical kinetics. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  10. Performance of 3 Rapid Tests for Discrimination Between HIV-1 and HIV-2 in Guinea-Bissau, West Africa

    DEFF Research Database (Denmark)

    Hønge, Bo Langhoff; Bjarnason Obinah, Magnús Pétur; Jespersen, Sanne

    2014-01-01

    As HIV-2 is intrinsically resistant to nonnucleoside reverse transcriptase inhibitors, it is mandatory to discriminate between HIV types before initiating antiretroviral treatment. Guinea-Bissau has the world's highest prevalence of HIV-2 and HIV-1/HIV-2 dually infected individuals. We evaluated ...... (agreement 90.9%) and SD Bioline HIV-1/2 3.0 (agreement 84.5%). Our results underscore the need for evaluation of tests in relevant populations before implementation....

  11. Etravirine and Rilpivirine Drug Resistance Among HIV-1 Subtype C Infected Children Failing Non-Nucleoside Reverse Transcriptase Inhibitor-Based Regimens in South India.

    Science.gov (United States)

    Saravanan, Shanmugam; Kausalya, Bagavathi; Gomathi, Selvamurthi; Sivamalar, Sathasivam; Pachamuthu, Balakrishnan; Selvamuthu, Poongulali; Pradeep, Amrose; Sunil, Solomon; Mothi, Sarvode N; Smith, Davey M; Kantor, Rami

    2017-06-01

    We have analyzed reverse transcriptase (RT) region of HIV-1 pol gene from 97 HIV-infected children who were identified as failing first-line therapy that included first-generation non-nucleoside RT inhibitors (Nevirapine and Efavirenz) for at least 6 months. We found that 54% and 65% of the children had genotypically predicted resistance to second-generation non-nucleoside RT inhibitors drugs Etravirine (ETR) and Rilpivirine, respectively. These cross-resistance mutations may compromise future NNRTI-based regimens, especially in resource-limited settings. To complement these investigations, we also analyzed the sequences in Stanford database, Monogram weighted score, and DUET weighted score algorithms for ETR susceptibility and found almost perfect agreement between the three algorithms in predicting ETR susceptibility from genotypic data.

  12. Use of nucleoside reverse transcriptase inhibitors and risk of myocardial infarction in HIV-infected patients

    DEFF Research Database (Denmark)

    Lundgren, Jens

    2008-01-01

    BACKGROUND: Two nucleos(t)ide reverse transcriptase inhibitors (NRTIs)--abacavir and didanosine--may each be associated with excess risk of myocardial infarction. The reproducibility of this finding in an independent dataset was explored and plausible biological mechanisms were sought. METHODS...

  13. In Vitro Evaluation of Nonnucleoside Reverse Transcriptase Inhibitors UC-781 and TMC120-R147681 as Human Immunodeficiency Virus Microbicides†

    Science.gov (United States)

    Van Herrewege, Yven; Michiels, Jo; Van Roey, Jens; Fransen, Katrien; Kestens, Luc; Balzarini, Jan; Lewi, Paul; Vanham, Guido; Janssen, Paul

    2004-01-01

    The nonnucleoside reverse transcriptase inhibitors UC-781 and TMC120-R147681 (Dapivirine) effectively prevented human immunodeficiency virus (HIV) infection in cocultures of monocyte-derived dendritic cells and T cells, representing primary targets in sexual transmission. Both drugs had a favorable therapeutic index. A 24-h treatment with 1,000 nM UC-781 or 100 nM TMC120-R147681 prevented cell-free HIV infection, whereas 10-fold-higher concentrations blocked cell-associated HIV. PMID:14693562

  14. Diaryltriazine non-nucleoside reverse transcriptase inhibitors are potent candidates for pre-exposure prophylaxis in the prevention of sexual HIV transmission.

    Science.gov (United States)

    Ariën, Kevin K; Venkatraj, Muthusamy; Michiels, Johan; Joossens, Jurgen; Vereecken, Katleen; Van der Veken, Pieter; Abdellati, Saïd; Cuylaerts, Vicky; Crucitti, Tania; Heyndrickx, Leo; Heeres, Jan; Augustyns, Koen; Lewi, Paul J; Vanham, Guido

    2013-09-01

    Pre-exposure prophylaxis and topical microbicides are important strategies in the prevention of sexual HIV transmission, especially since partial protection has been shown in proof-of-concept studies. In search of new candidate drugs with an improved toxicity profile and with activity against common non-nucleoside reverse transcriptase inhibitor (NNRTI)-resistant HIV, we have synthesized and investigated a library of 60 new diaryltriazine analogues. From this library, 15 compounds were evaluated in depth using a broad armamentarium of in vitro assays that are part of a preclinical testing algorithm for microbicide development. Antiviral activity was assessed in a cell line, and in primary human cells, against both subtype B and subtype C HIV-1 and against viruses resistant to therapeutic NNRTIs and the candidate NNRTI microbicide dapivirine. Toxicity towards primary blood-derived cells, cell lines originating from the female reproductive tract and female genital microflora was also studied. We identified several compounds with highly potent antiviral activity and toxicity profiles that are superior to that of dapivirine. In particular, compound UAMC01398 is an interesting new candidate that warrants further investigation because of its superior toxicity profile and potent activity against dapivirine-resistant viruses.

  15. Molecular Docking Studies of Marine Diterpenes as Inhibitors of Wild-Type and Mutants HIV-1 Reverse Transcriptase

    Directory of Open Access Journals (Sweden)

    Alessandra M. T. de Souza

    2013-10-01

    Full Text Available AIDS is a pandemic responsible for more than 35 million deaths. The emergence of resistant mutations due to drug use is the biggest cause of treatment failure. Marine organisms are sources of different molecules, some of which offer promising HIV-1 reverse transcriptase (RT inhibitory activity, such as the diterpenes dolabelladienotriol (THD, IC50 = 16.5 µM, (6R-6-hydroxydichotoma-3,14-diene-1,17-dial (HDD, IC50 = 10 µM and (6R-6-acetoxydichotoma-3,14-diene-1,17-dial (ADD, IC50 = 35 µM, isolated from a brown algae of the genus Dictyota, showing low toxicity. In this work, we evaluated the structure-activity relationship (SAR of THD, HDD and ADD as anti HIV-1 RT, using a molecular modeling approach. The analyses of stereoelectronic parameters revealed a direct relationship between activity and HOMO (Highest Occupied Molecular Orbital-LUMO (Lowest Unoccupied Molecular Orbital gap (ELUMO–EHOMO, where antiviral profile increases with larger HOMO-LUMO gap values. We also performed molecular docking studies of THD into HIV-1 RT wild-type and 12 different mutants, which showed a seahorse conformation, hydrophobic interactions and hydrogen bonds with important residues of the binding pocket. Based on in vitro experiments and docking studies, we demonstrated that mutations have little influence in positioning and interactions of THD. Following a rational drug design, we suggest a modification of THD to improve its biological activity.

  16. The development of HEPT-type HIV non-nucleoside reverse transcriptase inhibitors and its implications for DABO family.

    Science.gov (United States)

    Chen, Wenmin; Zhan, Peng; Wu, Jingde; Li, Zhenyu; Liu, Xinyong

    2012-01-01

    1-[(2-hydroxyethoxy)methyl]-6-(phenylthio)thymine (HEPT) was discovered as the first HIV-1 non-nucleoside reverse transcriptase inhibitors (NNRTIs) in 1989. The research on HEPT derivatives (HEPTs) has been lasted for more than 20 years and HEPT family is probably the most investigated NNRTI. Extensive molecular modifications on HEPT have led to many highly potent compounds with broad-resistance spectrum and optimal pharmacokinetic profiles. Moreover, X-crystallographic studies of HEPTs/RT complexes revealed the binding mode of HEPTs and the action mechanism of NNRTI, which has greatly facilitated the design of novel NNRTIs. Recently, the development of HEPTs was accelerated by the application of the "follow-on"-based chemical evolution strategies, such as designed multiple ligands (DMLs) and molecular hybridization (MH). Herein, this article will provide an insight into the development of HEPTs, including structural modifications, crystal structure of RT complexed with HEPTs and its structure-activity relationship (SAR). Additionally, this review also covers the emerging HEPT related dual inhibitors and HEPT-pyridinone hybrids, as well as the contributions of HEPTs to the development of dihydro-alkoxy-benzyl-oxopyrimidine (DABO) family, thus highlighting the importance of HEPTs on the development of NNRTIs.

  17. TNF α is involved in neuropathic pain induced by nucleoside reverse transcriptase inhibitor in rats

    Science.gov (United States)

    Zheng, Xuexing; Ouyang, Handong; Liu, Shue; Mata, Marina; Fink, David J.; Hao, Shuanglin

    2011-01-01

    In patients with HIV/AIDS, neuropathic pain is a common neurological complication. Infection with the HIV itself may lead to neuropathic pain, and painful symptoms are enhanced when patients are treated with nucleoside reverse transcriptase inhibitors (NRTI). The mechanisms by which NRTIs contribute to the development of neuropathic pain are not known. In the current studies, we tested the role of TNFα in antiretroviral drug-induced neuropathic pain. We administered 2′,3′-dideoxycytidine (ddC, one of the NRTIs) systemically to induce mechanical allodynia. We found that ddC induced overexpression of both mRNA and proteins of GFAP and TNFα in the spinal dorsal horn. TNFα was colocalized with GFAP in the spinal dorsal horn and with NeuN in the DRG. Knockdown of TNFα with siRNA blocked the mechanical allodynia induced by ddC. Intrathecal administration of glial inhibitor or recombinant TNF soluble receptor, reversed mechanical allodynia induced by ddC. These results suggest that TNFα is involved in NRTI-induced neuropathic pain. PMID:21741472

  18. Two proteins with reverse transcriptase activities associated with hepatitis B virus-like particles

    International Nuclear Information System (INIS)

    Bavand, M.R.; Laub, O.

    1988-01-01

    Recent studies suggest that hepatitis B virus (HBV), despite being a DNA virus, replicates via an RNA intermediate. The HBV life cycle is therefore a permuted version of the RNA retroviral life cycle. Sequence homology between retroviral reverse transcriptase and the putative HBV polymerase gene product suggests the presence of an HBV reverse transcriptase. As yet, there has been no direct evidence that reverse transcriptase activity is present in the viral particle. The authors used activity gel analysis to detect the in situ catalytic activities of DNA polymerases after sodium dodecyl sulfate-polyacrylamide gel electrophorsis. These studies demonstrated that HBV-like particles secreted by a differentiated human hepatoma cell line tranfected with genomic HBV DNA contain two major polymerase activities which migrate as ∼90- and ∼70-kilodalton (kDa) proteins. This demonstrated, for the first time, that HBV-like particles contain a novel DNA polymerase-reverse transcriptase activity. Furthermore, they propose that the 70-kDa reverse transcriptase may be produced by proteolytic self-cleavage of the 90-kDa precursor protein

  19. Application of 3D-QSAR, Pharmacophore, and Molecular Docking in the Molecular Design of Diarylpyrimidine Derivatives as HIV-1 Nonnucleoside Reverse Transcriptase Inhibitors.

    Science.gov (United States)

    Liu, Genyan; Wang, Wenjie; Wan, Youlan; Ju, Xiulian; Gu, Shuangxi

    2018-05-11

    Diarylpyrimidines (DAPYs), acting as HIV-1 nonnucleoside reverse transcriptase inhibitors (NNRTIs), have been considered to be one of the most potent drug families in the fight against acquired immunodeficiency syndrome (AIDS). To better understand the structural requirements of HIV-1 NNRTIs, three-dimensional quantitative structure⁻activity relationship (3D-QSAR), pharmacophore, and molecular docking studies were performed on 52 DAPY analogues that were synthesized in our previous studies. The internal and external validation parameters indicated that the generated 3D-QSAR models, including comparative molecular field analysis (CoMFA, q 2 = 0.679, R 2 = 0.983, and r pred 2 = 0.884) and comparative molecular similarity indices analysis (CoMSIA, q 2 = 0.734, R 2 = 0.985, and r pred 2 = 0.891), exhibited good predictive abilities and significant statistical reliability. The docking results demonstrated that the phenyl ring at the C₄-position of the pyrimidine ring was better than the cycloalkanes for the activity, as the phenyl group was able to participate in π⁻π stacking interactions with the aromatic residues of the binding site, whereas the cycloalkanes were not. The pharmacophore model and 3D-QSAR contour maps provided significant insights into the key structural features of DAPYs that were responsible for the activity. On the basis of the obtained information, a series of novel DAPY analogues of HIV-1 NNRTIs with potentially higher predicted activity was designed. This work might provide useful information for guiding the rational design of potential HIV-1 NNRTI DAPYs.

  20. Parallel screening of drug-like natural compounds using Caco-2 cell permeability QSAR model with applicability domain, lipophilic ligand efficiency index and shape property: A case study of HIV-1 reverse transcriptase inhibitors

    Science.gov (United States)

    Patel, Rikin D.; Kumar, Sivakumar Prasanth; Patel, Chirag N.; Shankar, Shetty Shilpa; Pandya, Himanshu A.; Solanki, Hitesh A.

    2017-10-01

    The traditional drug design strategy centrally focuses on optimizing binding affinity with the receptor target and evaluates pharmacokinetic properties at a later stage which causes high rate of attrition in clinical trials. Alternatively, parallel screening allows evaluation of these properties and affinity simultaneously. In a case study to identify leads from natural compounds with experimental HIV-1 reverse transcriptase (RT) inhibition, we integrated various computational approaches including Caco-2 cell permeability QSAR model with applicability domain (AD) to recognize drug-like natural compounds, molecular docking to study HIV-1 RT interactions and shape similarity analysis with known crystal inhibitors having characteristic butterfly-like model. Further, the lipophilic properties of the compounds refined from the process with best scores were examined using lipophilic ligand efficiency (LLE) index. Seven natural compound hits viz. baicalien, (+)-calanolide A, mniopetal F, fagaronine chloride, 3,5,8-trihydroxy-4-quinolone methyl ether derivative, nitidine chloride and palmatine, were prioritized based on LLE score which demonstrated Caco-2 well absorption labeling, encompassment in AD structural coverage, better receptor affinity, shape adaptation and permissible AlogP value. We showed that this integrative approach is successful in lead exploration of natural compounds targeted against HIV-1 RT enzyme.

  1. Zidovudine (AZT monotherapy selects for the A360V mutation in the connection domain of HIV-1 reverse transcriptase.

    Directory of Open Access Journals (Sweden)

    Jessica H Brehm

    Full Text Available We previously demonstrated in vitro that zidovudine (AZT selects for A371V in the connection domain and Q509L in ribonuclease H (RNase H domain of HIV-1 reverse transcriptase (RT which, together with the thymidine analog mutations D67N, K70R and T215F, confer greater than 100-fold AZT resistance. The goal of the current study was to determine whether AZT monotherapy in HIV-1 infected patients also selects the A371V, Q509L or other mutations in the C-terminal domains of HIV-1 RT.Full-length RT sequences in plasma obtained pre- and post-therapy were compared in 23 participants who received AZT monotherapy from the AIDS Clinical Trials Group study 175. Five of the 23 participants reached a primary study endpoint. Mutations significantly associated with AZT monotherapy included K70R (p = 0.003 and T215Y (p = 0.013 in the polymerase domain of HIV-1 RT, and A360V (p = 0.041 in the connection domain of HIV-1 RT. HIV-1 drug susceptibility assays demonstrated that A360V, either alone or in combination with thymidine analog mutations, decreased AZT susceptibility in recombinant viruses containing participant-derived full-length RT sequences or site-directed mutant RT. Biochemical studies revealed that A360V enhances the AZT-monophosphate excision activity of purified RT by significantly decreasing the frequency of secondary RNase H cleavage events that reduce the RNA/DNA duplex length and promote template/primer dissociation.The A360V mutation in the connection domain of RT was selected in HIV-infected individuals that received AZT monotherapy and contributed to AZT resistance.

  2. Nonnucleoside Reverse-transcriptase Inhibitor- vs Ritonavir-boosted Protease Inhibitor-based Regimens for Initial Treatment of HIV Infection

    DEFF Research Database (Denmark)

    Borges, Álvaro H; Lundh, Andreas; Tendal, Britta

    2016-01-01

    BACKGROUND: Previous studies suggest that nonnucleoside reverse-transcriptase inhibitors (NNRTIs) cause faster virologic suppression, while ritonavir-boosted protease inhibitors (PI/r) recover more CD4 cells. However, individual trials have not been powered to compare clinical outcomes. METHODS: ...

  3. Impact of HIV-1 subtype and antiretroviral therapy on protease and reverse transcriptase genotype: results of a global collaboration.

    Directory of Open Access Journals (Sweden)

    Rami Kantor

    2005-04-01

    Full Text Available The genetic differences among HIV-1 subtypes may be critical to clinical management and drug resistance surveillance as antiretroviral treatment is expanded to regions of the world where diverse non-subtype-B viruses predominate.To assess the impact of HIV-1 subtype and antiretroviral treatment on the distribution of mutations in protease and reverse transcriptase, a binomial response model using subtype and treatment as explanatory variables was used to analyze a large compiled dataset of non-subtype-B HIV-1 sequences. Non-subtype-B sequences from 3,686 persons with well characterized antiretroviral treatment histories were analyzed in comparison to subtype B sequences from 4,769 persons. The non-subtype-B sequences included 461 with subtype A, 1,185 with C, 331 with D, 245 with F, 293 with G, 513 with CRF01_AE, and 618 with CRF02_AG. Each of the 55 known subtype B drug-resistance mutations occurred in at least one non-B isolate, and 44 (80% of these mutations were significantly associated with antiretroviral treatment in at least one non-B subtype. Conversely, of 67 mutations found to be associated with antiretroviral therapy in at least one non-B subtype, 61 were also associated with antiretroviral therapy in subtype B isolates.Global surveillance and genotypic assessment of drug resistance should focus primarily on the known subtype B drug-resistance mutations.

  4. A trypsin inhibitor from rambutan seeds with antitumor, anti-HIV-1 reverse transcriptase, and nitric oxide-inducing properties.

    Science.gov (United States)

    Fang, Evandro Fei; Ng, Tzi Bun

    2015-04-01

    Nephelium lappaceum L., commonly known as "rambutan," is a typical tropical tree and is well known for its juicy and sweet fruit which has an exotic flavor. Chemical studies on rambutan have led to the identification of various components such as monoterpene lactones and volatile compounds. Here, a 22.5-kDa trypsin inhibitor (N . lappaceum trypsin inhibitor (NLTI)) was isolated from fresh rambutan seeds using liquid chromatographical techniques. NLTI reduced the proteolytic activities of both trypsin and α-chymotrypsin. Dithiothreitol reduced the trypsin inhibitory activity of NLTI at a concentration of 1 mM, indicating that an intact disulfide bond is essential to the activity. NLTI inhibited HIV-1 reverse transcriptase with an IC50 of 0.73 μM. In addition, NLTI manifested a time- and dose-dependent inhibitory effect on growth in many tumor cells. NLTI is one of the few trypsin inhibitors with nitric oxide-inducing activity and may find application in tumor therapy.

  5. A new strategy to inhibit the excision reaction catalysed by HIV-1 reverse transcriptase: compounds that compete with the template–primer

    Science.gov (United States)

    Cruchaga, Carlos; Anso, Elena; Font, María; Martino, Virginia S.; Rouzaut, Ana; Martinez-Irujo, Juan J.

    2007-01-01

    Inhibitors of the excision reaction catalysed by HIV-1 RT (reverse transcriptase) represent a promising approach in the fight against HIV, because these molecules would interfere with the main mechanism of resistance of this enzyme towards chain-terminating nucleotides. Only a limited number of compounds have been demonstrated to inhibit this reaction to date, including NNRTIs (non-nucleoside RT inhibitors) and certain pyrophosphate analogues. We have found previously that 2GP (2-O-galloylpunicalin), an antiviral compound extracted from the leaves of Terminalia triflora, was able to inhibit both the RT and the RNase H activities of HIV-1 RT without affecting cell proliferation or viability. In the present study, we show that 2GP also inhibited the ATP- and PPi-dependent phosphorolysis catalysed by wild-type and AZT (3′-azido-3′-deoxythymidine)-resistant enzymes at sub-micromolar concentrations. Kinetic and direct-binding analysis showed that 2GP was a non-competitive inhibitor against the nucleotide substrate, whereas it competed with the binding of RT to the template–primer (Kd=85 nM). As expected from its mechanism of action, 2GP was active against mutations conferring resistance to NNRTIs and AZT. The combination of AZT with 2GP was highly synergistic when tested in the presence of pyrophosphate, indicating that the inhibition of RT-catalysed phosphorolysis was responsible for the synergy found. Although other RT inhibitors that compete with the template–primer have been described, this is the first demonstration that these compounds can be used to block the excision of chain terminating nucleotides, providing a rationale for their combination with nucleoside analogues. PMID:17355225

  6. Intravaginal ring delivery of the reverse transcriptase inhibitor TMC 120 as an HIV microbicide.

    Science.gov (United States)

    Woolfson, A David; Malcolm, R Karl; Morrow, Ryan J; Toner, Clare F; McCullagh, Stephen D

    2006-11-15

    TMC 120 (Dapivirine) is a potent non-nucleoside reverse transcriptase inhibitor that is presently being developed as a vaginal HIV microbicide. To date, most vaginal microbicides under clinical investigation have been formulated as single-dose semi-solid gels, designed for application to the vagina before each act of intercourse. However, a clear rationale exists for providing long-term, controlled release of vaginal microbicides in order to afford continuous protection against heterosexually transmitted HIV infection and to improve user compliance. In this study we report on the incorporation of various pharmaceutical excipients into TMC 120 silicone, reservoir-type intravaginal rings (IVRs) in order to modify the controlled release characteristics of the microbicide. The results demonstrate that TMC 120 is released in zero-order fashion from the rings over a 28-day period and that release parameters could be modified by the inclusion of release-modifying excipients in the IVR. The hydrophobic liquid excipient isopropyl myristate had little effect on steady-state daily release rates, but did increase the magnitude and duration of burst release in proportion to excipient loading in the IVR. By comparison, the hydrophobic liquid poly(dimethylsiloxane) had little effect on TMC 120 release parameters. A hydrophilic excipient, lactose, had the surprising effect of decreasing TMC 120 burst release while increasing the apparent steady-state daily release in a concentration-dependent manner. Based on previous cell culture data and vaginal physiology, TMC120 is released from the various ring formulations in amounts potentially capable of maintaining a protective vaginal concentration. It is further predicted that the observed release rates may be maintained for at least a period of 1 year from a single ring device. TMC 120 release profiles and the mechanical properties of rings could be modified by the physicochemical nature of hydrophobic and hydrophilic excipients

  7. Deep sequencing analysis of HIV-1 reverse transcriptase at baseline and time of failure in patients receiving rilpivirine in the phase III studies ECHO and THRIVE.

    Science.gov (United States)

    Van Eygen, Veerle; Thys, Kim; Van Hove, Carl; Rimsky, Laurence T; De Meyer, Sandra; Aerssens, Jeroen; Picchio, Gaston; Vingerhoets, Johan

    2016-05-01

    Minority variants (1.0-25.0%) were evaluated by deep sequencing (DS) at baseline and virological failure (VF) in a selection of antiretroviral treatment-naïve, HIV-1-infected patients from the rilpivirine ECHO/THRIVE phase III studies. Linkage between frequently emerging resistance-associated mutations (RAMs) was determined. DS (llIumina®) and population sequencing (PS) results were available at baseline for 47 VFs and time of failure for 48 VFs; and at baseline for 49 responders matched for baseline characteristics. Minority mutations were accurately detected at frequencies down to 1.2% of the HIV-1 quasispecies. No baseline minority rilpivirine RAMs were detected in VFs; one responder carried 1.9% F227C. Baseline minority mutations associated with resistance to other non-nucleoside reverse transcriptase inhibitors (NNRTIs) were detected in 8/47 VFs (17.0%) and 7/49 responders (14.3%). Baseline minority nucleoside/nucleotide reverse transcriptase inhibitor (NRTI) RAMs M184V and L210W were each detected in one VF (none in responders). At failure, two patients without NNRTI RAMs by PS carried minority rilpivirine RAMs K101E and/or E138K; and five additional patients carried other minority NNRTI RAMs V90I, V106I, V179I, V189I, and Y188H. Overall at failure, minority NNRTI RAMs and NRTI RAMs were found in 29/48 (60.4%) and 16/48 VFs (33.3%), respectively. Linkage analysis showed that E138K and K101E were usually not observed on the same viral genome. In conclusion, baseline minority rilpivirine RAMs and other NNRTI/NRTI RAMs were uncommon in the rilpivirine arm of the ECHO and THRIVE studies. DS at failure showed emerging NNRTI resistant minority variants in seven rilpivirine VFs who had no detectable NNRTI RAMs by PS. © 2015 Wiley Periodicals, Inc.

  8. Inhibition of HIV-1 reverse transcriptase-catalyzed synthesis by intercalated DNA Benzo[a]Pyrene 7,8-Dihydrodiol-9,10-Epoxide adducts.

    Directory of Open Access Journals (Sweden)

    Parvathi Chary

    Full Text Available To aid in the characterization of the relationship of structure and function for human immunodeficiency virus type-1 reverse transcriptase (HIV-1 RT, this investigation utilized DNAs containing benzo[a]pyrene-7,8-dihydrodiol-9,10-epoxide (BPDE-modified primers and templates as a probe of the architecture of this complex. BPDE lesions that differed in their stereochemistry around the C10 position were covalently linked to N (6-adenine and positioned in either the primer or template strand of a duplex template-primer. HIV-1 RT exhibited a stereoisomer-specific and strand-specific difference in replication when the BPDE-lesion was placed in the template versus the primer strand. When the C10 R-BPDE adduct was positioned in the primer strand in duplex DNA, 5 nucleotides from the 3΄ end of the primer terminus, HIV-1 RT could not fully replicate the template, producing truncated products; this block to further synthesis did not affect rates of dissociation or DNA binding affinity. Additionally, when the adducts were in the same relative position, but located in the template strand, similar truncated products were observed with both the C10 R and C10 S BPDE adducts. These data suggest that the presence of covalently-linked intercalative DNA adducts distant from the active site can lead to termination of DNA synthesis catalyzed by HIV-1 RT.

  9. Inhibition of Human Immunodeficiency Virus Type 1 Infection by the Candidate Microbicide Dapivirine, a Nonnucleoside Reverse Transcriptase Inhibitor▿

    OpenAIRE

    Fletcher, P.; Harman, S.; Azijn, H.; Armanasco, N.; Manlow, P.; Perumal, D.; de Bethune, M.-P.; Nuttall, J.; Romano, J.; Shattock, R.

    2008-01-01

    Heterosexual transmission of human immunodeficiency virus (HIV) remains the major route of infection worldwide; thus, there is an urgent need for additional prevention strategies, particularly strategies that could be controlled by women, such as topical microbicides. Potential microbicide candidates must be both safe and effective. Using cellular and tissue explant models, we have evaluated the activity of the nonnucleoside reverse transcriptase inhibitor (NNRTI) dapivirine as a vaginal micr...

  10. Use of nucleoside reverse transcriptase inhibitors and risk of myocardial infarction in HIV-infected patients enrolled in the D:A:D study: a multi-cohort collaboration

    DEFF Research Database (Denmark)

    Sabin, Caroline A; Worm, Signe W; Weber, Rainer

    2008-01-01

    cohort of HIV-infected patients. METHODS: We used Poisson regression models to quantify the relation between cumulative, recent (currently or within the preceding 6 months), and past use of zidovudine, didanosine, stavudine, lamivudine, and abacavir and development of myocardial infarction in 33 347......BACKGROUND: Whether nucleoside reverse transcriptase inhibitors increase the risk of myocardial infarction in HIV-infected individuals is unclear. Our aim was to explore whether exposure to such drugs was associated with an excess risk of myocardial infarction in a large, prospective observational...... patients enrolled in the D:A:D study. We adjusted for cardiovascular risk factors that are unlikely to be affected by antiretroviral therapy, cohort, calendar year, and use of other antiretrovirals. FINDINGS: Over 157,912 person-years, 517 patients had a myocardial infarction. We found no associations...

  11. Standardized comparison of the relative impacts of HIV-1 reverse transcriptase (RT) mutations on nucleoside RT inhibitor susceptibility.

    Science.gov (United States)

    Melikian, George L; Rhee, Soo-Yon; Taylor, Jonathan; Fessel, W Jeffrey; Kaufman, David; Towner, William; Troia-Cancio, Paolo V; Zolopa, Andrew; Robbins, Gregory K; Kagan, Ron; Israelski, Dennis; Shafer, Robert W

    2012-05-01

    Determining the phenotypic impacts of reverse transcriptase (RT) mutations on individual nucleoside RT inhibitors (NRTIs) has remained a statistical challenge because clinical NRTI-resistant HIV-1 isolates usually contain multiple mutations, often in complex patterns, complicating the task of determining the relative contribution of each mutation to HIV drug resistance. Furthermore, the NRTIs have highly variable dynamic susceptibility ranges, making it difficult to determine the relative effect of an RT mutation on susceptibility to different NRTIs. In this study, we analyzed 1,273 genotyped HIV-1 isolates for which phenotypic results were obtained using the PhenoSense assay (Monogram, South San Francisco, CA). We used a parsimonious feature selection algorithm, LASSO, to assess the possible contributions of 177 mutations that occurred in 10 or more isolates in our data set. We then used least-squares regression to quantify the impact of each LASSO-selected mutation on each NRTI. Our study provides a comprehensive view of the most common NRTI resistance mutations. Because our results were standardized, the study provides the first analysis that quantifies the relative phenotypic effects of NRTI resistance mutations on each of the NRTIs. In addition, the study contains new findings on the relative impacts of thymidine analog mutations (TAMs) on susceptibility to abacavir and tenofovir; the impacts of several known but incompletely characterized mutations, including E40F, V75T, Y115F, and K219R; and a tentative role in reduced NRTI susceptibility for K64H, a novel NRTI resistance mutation.

  12. Computational Analysis of Molecular Interaction Networks Underlying Change of HIV-1 Resistance to Selected Reverse Transcriptase Inhibitors.

    Science.gov (United States)

    Kierczak, Marcin; Dramiński, Michał; Koronacki, Jacek; Komorowski, Jan

    2010-12-12

    Despite more than two decades of research, HIV resistance to drugs remains a serious obstacle in developing efficient AIDS treatments. Several computational methods have been developed to predict resistance level from the sequence of viral proteins such as reverse transcriptase (RT) or protease. These methods, while powerful and accurate, give very little insight into the molecular interactions that underly acquisition of drug resistance/hypersusceptibility. Here, we attempt at filling this gap by using our Monte Carlo feature selection and interdependency discovery method (MCFS-ID) to elucidate molecular interaction networks that characterize viral strains with altered drug resistance levels. We analyzed a number of HIV-1 RT sequences annotated with drug resistance level using the MCFS-ID method. This let us expound interdependency networks that characterize change of drug resistance to six selected RT inhibitors: Abacavir, Lamivudine, Stavudine, Zidovudine, Tenofovir and Nevirapine. The networks consider interdependencies at the level of physicochemical properties of mutating amino acids, eg,: polarity. We mapped each network on the 3D structure of RT in attempt to understand the molecular meaning of interacting pairs. The discovered interactions describe several known drug resistance mechanisms and, importantly, some previously unidentified ones. Our approach can be easily applied to a whole range of problems from the domain of protein engineering. A portable Java implementation of our MCFS-ID method is freely available for academic users and can be obtained at: http://www.ipipan.eu/staff/m.draminski/software.htm.

  13. Calibrated user-friendly reverse transcriptase-PCR assay

    DEFF Research Database (Denmark)

    Bor, M V; Sørensen, B S; Rammer, P

    1998-01-01

    We report a competitive reverse transcriptase-PCR (RT-PCR) assay and a calibrated user-friendly RT-PCR assay (CURT-PCR) for epidermal growth factor receptor (EGFR) mRNA. A calibrator was prepared from isolated rat liver RNA, and the amount of EGFR mRNA was determined by competitive RT-PCR. In CUR...

  14. A nonlinear QSAR study using oscillating search and SVM as an efficient algorithm to model the inhibition of reverse transcriptase by HEPT derivatives

    International Nuclear Information System (INIS)

    Ferkous, F.; Saihi, Y.

    2018-01-01

    Quantitative structure-activity relationships were constructed for 107 inhibitors of HIV-1 reverse transcriptase that are derivatives of 1-[(2-hydroxyethoxy)methyl]-6-(phenylthio)thymine (HEPT). A combination of a support vector machine (SVM) and oscillating search (OS) algorithms for feature selection was adopted to select the most appropriate descriptors. The application was optimized to obtain an SVM model to predict the biological activity EC50 of the HEPT derivatives with a minimum number of descriptors (SpMax4 B h (e) MLOGP MATS5m) and high values of R2 and Q2 (0.8662, 0.8769). The statistical results showed good correlation between the activity and three best descriptors were included in the best SVM model. The values of R2 and Q2 confirmed the stability and good predictive ability of the model. The SVM technique was adequate to produce an effective QSAR model and outperformed those in the literature and the predictive stages for the inhibitory activity of reverse transcriptase by HEPT derivatives. (author)

  15. APOBEC3G inhibits elongation of HIV-1 reverse transcripts.

    Directory of Open Access Journals (Sweden)

    Kate N Bishop

    2008-12-01

    Full Text Available APOBEC3G (A3G is a host cytidine deaminase that, in the absence of Vif, restricts HIV-1 replication and reduces the amount of viral DNA that accumulates in cells. Initial studies determined that A3G induces extensive mutation of nascent HIV-1 cDNA during reverse transcription. It has been proposed that this triggers the degradation of the viral DNA, but there is now mounting evidence that this mechanism may not be correct. Here, we use a natural endogenous reverse transcriptase assay to show that, in cell-free virus particles, A3G is able to inhibit HIV-1 cDNA accumulation not only in the absence of hypermutation but also without the apparent need for any target cell factors. We find that although reverse transcription initiates in the presence of A3G, elongation of the cDNA product is impeded. These data support the model that A3G reduces HIV-1 cDNA levels by inhibiting synthesis rather than by inducing degradation.

  16. Reverse transcriptase-quantitative polymerase chain reaction (RT ...

    African Journals Online (AJOL)

    The reverse transcriptase quantitative polymerase chain reaction (RT-qPCR) is a highly specific polymerase chain reaction (PCR) method that allows one to detect very low transcription levels of functional gene(s) in soil. RT-qPCR helps us to know the active members of the microbial community, and their activities can be ...

  17. Soft shell clams Mya arenaria with disseminated neoplasia demonstrate reverse transcriptase activity

    Science.gov (United States)

    House, M.L.; Kim, C.H.; Reno, P.W.

    1998-01-01

    Disseminated neoplasia (DN), a proliferative cell disorder of the circulatory system of bivalves, was first reported in oysters in 1969. Since that time, the disease has been determined to be transmissible through water-borne exposure, but the etiological agent has not been unequivocally identified. In order to determine if a viral agent, possibly a retrovirus, could be the causative agent of DN, transmission experiments were performed, using both a cell-free filtrate and a sucrose gradient-purified preparation of a cell-free filtrate of DN positive materials. Additionally, a PCR-enhanced reverse transcriptase assay was used to determine if reverse transcriptase was present in tissues or hemolymph from DN positive soft shell clams Mya arenaria. DN was transmitted to healthy clams by injection with whole DN cells, but not with cell-free flitrates prepared from either tissues from DN positive clams, or DN cells. The cell-free preparations from DN-positive tissues and hemolymph having high levels of DN cells in circulation exhibited positive reactions in the PCR-enhanced reverse transcriptase assay. Cell-free preparations of hemolymph from clams having low levels of DN (<0.1% of cells abnormal), hemocytes from normal soft shell clams, and normal soft shell clam tissues did not produce a positive reaction in the PCR enhanced reverse transcriptase assay.

  18. Introducing Catastrophe-QSAR. Application on Modeling Molecular Mechanisms of Pyridinone Derivative-Type HIV Non-Nucleoside Reverse Transcriptase Inhibitors

    Directory of Open Access Journals (Sweden)

    Marius Lazea

    2011-12-01

    Full Text Available The classical method of quantitative structure-activity relationships (QSAR is enriched using non-linear models, as Thom’s polynomials allow either uni- or bi-variate structural parameters. In this context, catastrophe QSAR algorithms are applied to the anti-HIV-1 activity of pyridinone derivatives. This requires calculation of the so-called relative statistical power and of its minimum principle in various QSAR models. A new index, known as a statistical relative power, is constructed as an Euclidian measure for the combined ratio of the Pearson correlation to algebraic correlation, with normalized t-Student and the Fisher tests. First and second order inter-model paths are considered for mono-variate catastrophes, whereas for bi-variate catastrophes the direct minimum path is provided, allowing the QSAR models to be tested for predictive purposes. At this stage, the max-to-min hierarchies of the tested models allow the interaction mechanism to be identified using structural parameter succession and the typical catastrophes involved. Minimized differences between these catastrophe models in the common structurally influential domains that span both the trial and tested compounds identify the “optimal molecular structural domains” and the molecules with the best output with respect to the modeled activity, which in this case is human immunodeficiency virus type 1 HIV-1 inhibition. The best molecules are characterized by hydrophobic interactions with the HIV-1 p66 subunit protein, and they concur with those identified in other 3D-QSAR analyses. Moreover, the importance of aromatic ring stacking interactions for increasing the binding affinity of the inhibitor-reverse transcriptase ligand-substrate complex is highlighted.

  19. Structure-based methods to predict mutational resistance to diarylpyrimidine non-nucleoside reverse transcriptase inhibitors.

    Science.gov (United States)

    Azeem, Syeda Maryam; Muwonge, Alecia N; Thakkar, Nehaben; Lam, Kristina W; Frey, Kathleen M

    2018-01-01

    Resistance to non-nucleoside reverse transcriptase inhibitors (NNRTIs) is a leading cause of HIV treatment failure. Often included in antiviral therapy, NNRTIs are chemically diverse compounds that bind an allosteric pocket of enzyme target reverse transcriptase (RT). Several new NNRTIs incorporate flexibility in order to compensate for lost interactions with amino acid conferring mutations in RT. Unfortunately, even successful inhibitors such as diarylpyrimidine (DAPY) inhibitor rilpivirine are affected by mutations in RT that confer resistance. In order to aid drug design efforts, it would be efficient and cost effective to pre-evaluate NNRTI compounds in development using a structure-based computational approach. As proof of concept, we applied a residue scan and molecular dynamics strategy using RT crystal structures to predict mutations that confer resistance to DAPYs rilpivirine, etravirine, and investigational microbicide dapivirine. Our predictive values, changes in affinity and stability, are correlative with fold-resistance data for several RT mutants. Consistent with previous studies, mutation K101P is predicted to confer high-level resistance to DAPYs. These findings were further validated using structural analysis, molecular dynamics, and an enzymatic reverse transcription assay. Our results confirm that changes in affinity and stability for mutant complexes are predictive parameters of resistance as validated by experimental and clinical data. In future work, we believe that this computational approach may be useful to predict resistance mutations for inhibitors in development. Published by Elsevier Inc.

  20. In Vitro Cross-Resistance Profiles of Rilpivirine, Dapivirine, and MIV-150, Nonnucleoside Reverse Transcriptase Inhibitor Microbicides in Clinical Development for the Prevention of HIV-1 Infection.

    Science.gov (United States)

    Giacobbi, Nicholas S; Sluis-Cremer, Nicolas

    2017-07-01

    Rilpivirine (RPV), dapivirine (DPV), and MIV-150 are in development as microbicides. It is not known whether they will block infection of circulating nonnucleoside reverse transcriptase inhibitor (NNRTI)-resistant human immunodeficiency virus type 1 (HIV-1) variants. Here, we demonstrate that the activity of DPV and MIV-150 is compromised by many resistant viruses containing single or double substitutions. High DPV genital tract concentrations from DPV ring use may block replication of resistant viruses. However, MIV-150 genital tract concentrations may be insufficient to inhibit many resistant viruses, including those harboring K103N or Y181C. Copyright © 2017 American Society for Microbiology.

  1. Comparative analysis of drug resistance mutations in the human immunodeficiency virus reverse transcriptase gene in patients who are non-responsive, responsive and naive to antiretroviral therapy.

    Science.gov (United States)

    Misbah, Mohammad; Roy, Gaurav; Shahid, Mudassar; Nag, Nalin; Kumar, Suresh; Husain, Mohammad

    2016-05-01

    Drug resistance mutations in the Pol gene of human immunodeficiency virus 1 (HIV-1) are one of the critical factors associated with antiretroviral therapy (ART) failure in HIV-1 patients. The issue of resistance to reverse transcriptase inhibitors (RTIs) in HIV infection has not been adequately addressed in the Indian subcontinent. We compared HIV-1 reverse transcriptase (RT) gene sequences to identify mutations present in HIV-1 patients who were ART non-responders, ART responders and drug naive. Genotypic drug resistance testing was performed by sequencing a 655-bp region of the RT gene from 102 HIV-1 patients, consisting of 30 ART-non-responding, 35 ART-responding and 37 drug-naive patients. The Stanford HIV Resistance Database (HIVDBv 6.2), IAS-USA mutation list, ANRS_09/2012 algorithm, and Rega v8.02 algorithm were used to interpret the pattern of drug resistance. The majority of the sequences (96 %) belonged to subtype C, and a few of them (3.9 %) to subtype A1. The frequency of drug resistance mutations observed in ART-non-responding, ART-responding and drug-naive patients was 40.1 %, 10.7 % and 20.58 %, respectively. It was observed that in non-responders, multiple mutations were present in the same patient, while in responders, a single mutation was found. Some of the drug-naive patients had more than one mutation. Thymidine analogue mutations (TAMs), however, were found in non-responders and naive patients but not in responders. Although drug resistance mutations were widely distributed among ART non-responders, the presence of resistance mutations in the viruses of drug-naive patients poses a big concern in the absence of a genotyping resistance test.

  2. Discovery of dapivirine, a nonnucleoside HIV-1 reverse transcriptase inhibitor, as a broad-spectrum antiviral against both influenza A and B viruses.

    Science.gov (United States)

    Hu, Yanmei; Zhang, Jiantao; Musharrafieh, Rami Ghassan; Ma, Chunlong; Hau, Raymond; Wang, Jun

    2017-09-01

    The emergence of multidrug-resistant influenza viruses poses a persistent threat to public health. The current prophylaxis and therapeutic interventions for influenza virus infection have limited efficacy due to the continuous antigenic drift and antigenic shift of influenza viruses. As part of our ongoing effort to develop the next generation of influenza antivirals with broad-spectrum antiviral activity and a high genetic barrier to drug resistance, in this study we report the discovery of dapivirine, an FDA-approved HIV nonnucleoside reverse transcriptase inhibitor, as a broad-spectrum antiviral against multiple strains of influenza A and B viruses with low micromolar efficacy. Mechanistic studies revealed that dapivirine inhibits the nuclear entry of viral ribonucleoproteins at the early stage of viral replication. As a result, viral RNA and protein synthesis were inhibited. Furthermore, dapivirine has a high in vitro genetic barrier to drug resistance, and its antiviral activity is synergistic with oseltamivir carboxylate. In summary, the in vitro antiviral results of dapivirine suggest it is a promising candidate for the development of the next generation of dual influenza and HIV antivirals. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. In vitro cross-resistance profile of nucleoside reverse transcriptase inhibitor (NRTI) BMS-986001 against known NRTI resistance mutations.

    Science.gov (United States)

    Li, Zhufang; Terry, Brian; Olds, William; Protack, Tricia; Deminie, Carol; Minassian, Beatrice; Nowicka-Sans, Beata; Sun, Yongnian; Dicker, Ira; Hwang, Carey; Lataillade, Max; Hanna, George J; Krystal, Mark

    2013-11-01

    BMS-986001 is a novel HIV nucleoside reverse transcriptase inhibitor (NRTI). To date, little is known about its resistance profile. In order to examine the cross-resistance profile of BMS-986001 to NRTI mutations, a replicating virus system was used to examine specific amino acid mutations known to confer resistance to various NRTIs. In addition, reverse transcriptases from 19 clinical isolates with various NRTI mutations were examined in the Monogram PhenoSense HIV assay. In the site-directed mutagenesis studies, a virus containing a K65R substitution exhibited a 0.4-fold change in 50% effective concentration (EC50) versus the wild type, while the majority of viruses with the Q151M constellation (without M184V) exhibited changes in EC50 versus wild type of 0.23- to 0.48-fold. Susceptibility to BMS-986001 was also maintained in an L74V-containing virus (0.7-fold change), while an M184V-only-containing virus induced a 2- to 3-fold decrease in susceptibility. Increasing numbers of thymidine analog mutation pattern 1 (TAM-1) pathway mutations correlated with decreases in susceptibility to BMS-986001, while viruses with TAM-2 pathway mutations exhibited a 5- to 8-fold decrease in susceptibility, regardless of the number of TAMs. A 22-fold decrease in susceptibility to BMS-986001 was observed in a site-directed mutant containing the T69 insertion complex. Common non-NRTI (NNRTI) mutations had little impact on susceptibility to BMS-986001. The results from the site-directed mutants correlated well with the more complicated genotypes found in NRTI-resistant clinical isolates. Data from clinical studies are needed to determine the clinically relevant resistance cutoff values for BMS-986001.

  4. A Novel Lectin with Antiproliferative and HIV-1 Reverse Transcriptase Inhibitory Activities from Dried Fruiting Bodies of the Monkey Head Mushroom Hericium erinaceum

    Science.gov (United States)

    Li, Yanrui; Zhang, Guoqing; Ng, Tzi Bun; Wang, Hexiang

    2010-01-01

    A lectin designated as Hericium erinaceum agglutinin (HEA) was isolated from dried fruiting bodies of the mushroom Hericium erinaceum with a chromatographic procedure which entailed DEAE-cellulose, CM-cellulose, Q-Sepharose, and FPLC Superdex 75. Its molecular mass was estimated to be 51 kDa and its N-terminal amino acid sequences was distinctly different from those of other isolated mushroom lectins. The hemagglutinating activity of HEA was inhibited at the minimum concentration of 12.5 mM by inulin. The lectin was stable at pH 1.9–12.1 and at temperatures up to 70°C, but was inhibited by Hg2+, Cu2+, and Fe3+ ions. The lectin exhibited potent mitogenic activity toward mouse splenocytes, and demonstrated antiproliferative activity toward hepatoma (HepG2) and breast cancer (MCF7) cells with an IC50 of 56.1 μM and 76.5 μM, respectively. It manifested HIV-1 reverse transcriptase inhibitory activity with an IC50 of 31.7 μM. The lectin exhibited potent mitogenic activity toward murine splenocytes but was devoid of antifungal activity. PMID:20625408

  5. A Novel Lectin with Antiproliferative and HIV-1 Reverse Transcriptase Inhibitory Activities from Dried Fruiting Bodies of the Monkey Head Mushroom Hericium erinaceum

    Directory of Open Access Journals (Sweden)

    Yanrui Li

    2010-01-01

    Full Text Available A lectin designated as Hericium erinaceum agglutinin (HEA was isolated from dried fruiting bodies of the mushroom Hericium erinaceum with a chromatographic procedure which entailed DEAE-cellulose, CM-cellulose, Q-Sepharose, and FPLC Superdex 75. Its molecular mass was estimated to be 51 kDa and its N-terminal amino acid sequences was distinctly different from those of other isolated mushroom lectins. The hemagglutinating activity of HEA was inhibited at the minimum concentration of 12.5 mM by inulin. The lectin was stable at pH 1.9–12.1 and at temperatures up to 70∘C, but was inhibited by Hg2+, Cu2+, and Fe3+ ions. The lectin exhibited potent mitogenic activity toward mouse splenocytes, and demonstrated antiproliferative activity toward hepatoma (HepG2 and breast cancer (MCF7 cells with an IC50 of 56.1 M and 76.5 M, respectively. It manifested HIV-1 reverse transcriptase inhibitory activity with an IC50 of 31.7 M. The lectin exhibited potent mitogenic activity toward murine splenocytes but was devoid of antifungal activity.

  6. Characterization of Nucleoside Reverse Transcriptase Inhibitor-Associated Mutations in the RNase H Region of HIV-1 Subtype C Infected Individuals.

    Science.gov (United States)

    Ngcapu, Sinaye; Theys, Kristof; Libin, Pieter; Marconi, Vincent C; Sunpath, Henry; Ndung'u, Thumbi; Gordon, Michelle L

    2017-11-08

    The South African national treatment programme includes nucleoside reverse transcriptase inhibitors (NRTIs) in both first and second line highly active antiretroviral therapy regimens. Mutations in the RNase H domain have been associated with resistance to NRTIs but primarily in HIV-1 subtype B studies. Here, we investigated the prevalence and association of RNase H mutations with NRTI resistance in sequences from HIV-1 subtype C infected individuals. RNase H sequences from 112 NRTI treated but virologically failing individuals and 28 antiretroviral therapy (ART)-naive individuals were generated and analysed. In addition, sequences from 359 subtype C ART-naive sequences were downloaded from Los Alamos database to give a total of 387 sequences from ART-naive individuals for the analysis. Fisher's exact test was used to identify mutations and Bayesian network learning was applied to identify novel NRTI resistance mutation pathways in RNase H domain. The mutations A435L, S468A, T470S, L484I, A508S, Q509L, L517I, Q524E and E529D were more prevalent in sequences from treatment-experienced compared to antiretroviral treatment naive individuals, however, only the E529D mutation remained significant after correction for multiple comparison. Our findings suggest a potential interaction between E529D and NRTI-treatment; however, site-directed mutagenesis is needed to understand the impact of this RNase H mutation.

  7. Design, synthesis and antiviral evaluation of novel heteroarylcarbothioamide derivatives as dual inhibitors of HIV-1 reverse transcriptase-associated RNase H and RDDP functions.

    Science.gov (United States)

    Corona, Angela; Onnis, Valentina; Deplano, Alessandro; Bianco, Giulia; Demurtas, Monica; Distinto, Simona; Cheng, Yung-Chi; Alcaro, Stefano; Esposito, Francesca; Tramontano, Enzo

    2017-08-31

    In the continuous effort to identify new HIV-1 inhibitors endowed with innovative mechanisms, the dual inhibition of different viral functions would provide a significant advantage against drug-resistant variants. The HIV-1 reverse transcriptase (RT)-associated ribonuclease H (RNase H) is the only viral-encoded enzymatic activity that still lacks an efficient inhibitor. We synthesized a library of 3,5-diamino-N-aryl-1H-pyrazole-4-carbothioamide and 4-amino-5-benzoyl-N-phenyl-2-(substituted-amino)-1H-pyrrole-3-carbothioamide derivatives and tested them against RNase H activity. We identified the pyrazolecarbothioamide derivative A15, able to inhibit viral replication and both RNase H and RNA-dependent DNA polymerase (RDDP) RT-associated activities in the low micromolar range. Docking simulations hypothesized its binding to two RT pockets. Site-directed mutagenesis experiments showed that, with respect to wt RT, V108A substitution strongly reduced A15 IC50 values (12.6-fold for RNase H inhibition and 4.7-fold for RDDP), while substitution A502F caused a 9.0-fold increase in its IC50 value for RNase H, not affecting the RDDP inhibition, reinforcing the hypothesis of a dual-site inhibition. Moreover, A15 retained good inhibition potency against three non-nucleoside RT inhibitor (NNRTI)-resistant enzymes, confirming a mode of action unrelated to NNRTIs and suggesting its potential as a lead compound for development of new HIV-1 RT dual inhibitors active against drug-resistant viruses. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  8. Development and Characterization of a Vaginal Film Containing Dapivirine, a Non- nucleoside Reverse Transcriptase Inhibitor (NNRTI), for prevention of HIV-1 sexual transmission.

    Science.gov (United States)

    Akil, Ayman; Parniak, Michael A; Dezzuitti, Charlene S; Moncla, Bernard J; Cost, Marilyn R; Li, Mingguang; Rohan, Lisa Cencia

    2011-06-01

    Dapivirine, a non-nucleoside reverse transcriptase inhibitor, is a potent and promising anti-HIV molecule. It is currently being investigated for use as a vaginal microbicide in two dosage forms, a semi-solid gel and a silicone elastomer ring. Quick-dissolving films are promising and attractive dosage forms that may provide an alternative platform for the vaginal delivery of microbicide drug candidates. Vaginal films may provide advantages such as discreet use, no product leakage during use, lack of requirement for an applicator for insertion, rapid drug release and minimal packaging and reduced wastage. Within this study the in vitro bioactivity of dapivirine as compared to the NNRTI UC781 was further established and a quick dissolve film was developed for vaginal application of dapivirine for prevention of HIV infection. The developed film was characterized with respect to its physical and chemical attributes including water content, mechanical strength, drug release profile, permeability, compatibility with lactobacilli and bioactivity. The anti-HIV activity of the formulated dapivirine film was confirmed in in vitro and ex vivo models. Importantly the physical and chemical properties of the film as well as its bioactivity were maintained for a period of 18 months. In conclusion, a vaginal film containing dapivirine was developed and characterized. The film was shown to prevent HIV-1 infection in vitro and ex vivo and have acceptable characteristics which make this film a promising candidate for testing as vaginal microbicide.

  9. 3D-QSAR CoMFA of a series of DABO derivatives as HIV-1 reverse transcriptase non-nucleoside inhibitors.

    Science.gov (United States)

    de Brito, Monique Araújo; Rodrigues, Carlos Rangel; Cirino, José Jair Vianna; de Alencastro, Ricardo Bicca; Castro, Helena Carla; Albuquerque, Magaly Girão

    2008-08-01

    A series of 74 dihydroalkoxybenzyloxopyrimidines (DABOs), a class of highly potent non-nucleoside reverse transcriptase inhibitors (NNRTIs), was retrieved from the literature and studied by comparative molecular field analysis (CoMFA) in order to derive three-dimensional quantitative structure-activity relationship (3D-QSAR) models. The CoMFA study has been performed with a training set of 59 compounds, testing three alignments and four charge schemes (DFT, HF, AM1, and PM3) and using defaults probe atom (Csp (3), +1 charge), cutoffs (30 kcal.mol (-1) for both steric and electrostatic fields), and grid distance (2.0 A). The best model ( N = 59), derived from Alignment 1 and PM3 charges, shows q (2) = 0.691, SE cv = 0.475, optimum number of components = 6, r (2) = 0.930, SEE = 0.226, and F-value = 115.544. The steric and electrostatic contributions for the best model were 43.2% and 56.8%, respectively. The external predictive ability (r (2) pred = 0.918) of the resultant best model was evaluated using a test set of 15 compounds. In order to design more potent DABO analogues as anti-HIV/AIDS agents, attention should be taken in order to select a substituent for the 4-oxopyrimidine ring, since, as revealed by the best CoMFA model, there are a steric restriction at the C2-position, a electron-rich group restriction at the C6-position ( para-substituent of the 6-benzyl group), and a steric allowed region at the C5-position.

  10. Design, Conformation, and Crystallography of 2-Naphthyl Phenyl Ethers as Potent Anti-HIV Agents

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Won-Gil; Chan, Albert H.; Spasov, Krasimir A.; Anderson, Karen S.; Jorgensen, William L.

    2016-12-08

    Catechol diethers that incorporate a 7-cyano-2-naphthyl substituent are reported as non-nucleoside inhibitors of HIV-1 reverse transcriptase (NNRTIs). Many of the compounds have 1–10 nM potencies toward wild-type HIV-1. An interesting conformational effect allows two unique conformers for the naphthyl group in complexes with HIV-RT. X-ray crystal structures for 4a and 4f illustrate the alternatives.

  11. Susceptibility of Human Endogenous Retrovirus Type K to Reverse Transcriptase Inhibitors.

    Science.gov (United States)

    Contreras-Galindo, Rafael; Dube, Derek; Fujinaga, Koh; Kaplan, Mark H; Markovitz, David M

    2017-12-01

    Human endogenous retroviruses (HERVs) make up 8% of the human genome. The HERV type K (HERV-K) HML-2 (HK2) family contains proviruses that are the most recent entrants into the human germ line and are transcriptionally active. In HIV-1 infection and cancer, HK2 genes produce retroviral particles that appear to be infectious, yet the replication capacity of these viruses and potential pathogenicity has been difficult to ascertain. In this report, we screened the efficacy of commercially available reverse transcriptase inhibitors (RTIs) at inhibiting the enzymatic activity of HK2 RT and HK2 genomic replication. Interestingly, only one provirus, K103, was found to encode a functional RT among those examined. Several nucleoside analogue RTIs (NRTIs) blocked K103 RT activity and consistently inhibited the replication of HK2 genomes. The NRTIs zidovudine (AZT), stavudine (d4T), didanosine (ddI), and lamivudine (3TC), and the nucleotide RTI inhibitor tenofovir (TDF), show efficacy in blocking K103 RT. HIV-1-specific nonnucleoside RTIs (NNRTIs), protease inhibitors (PIs), and integrase inhibitors (IIs) did not affect HK2, except for the NNRTI etravirine (ETV). The inhibition of HK2 infectivity by NRTIs appears to take place at either the reverse transcription step of the viral genome prior to HK2 viral particle formation and/or in the infected cells. Inhibition of HK2 by these drugs will be useful in suppressing HK2 infectivity if these viruses prove to be pathogenic in cancer, neurological disorders, or other diseases associated with HK2. The present studies also elucidate a key aspect of the life cycle of HK2, specifically addressing how they do, and/or did, replicate. IMPORTANCE Endogenous retroviruses are relics of ancestral virus infections in the human genome. The most recent of these infections was caused by HK2. While HK2 often remains silent in the genome, this group of viruses is activated in HIV-1-infected and cancer cells. Recent evidence suggests that these

  12. Docking and 3-D QSAR studies on indolyl aryl sulfones. Binding mode exploration at the HIV-1 reverse transcriptase non-nucleoside binding site and design of highly active N-(2-hydroxyethyl)carboxamide and N-(2-hydroxyethyl)carbohydrazide derivatives.

    Science.gov (United States)

    Ragno, Rino; Artico, Marino; De Martino, Gabriella; La Regina, Giuseppe; Coluccia, Antonio; Di Pasquali, Alessandra; Silvestri, Romano

    2005-01-13

    Three-dimensional quantitative structure-activity relationship (3-D QSAR) studies and docking simulations were developed on indolyl aryl sulfones (IASs), a class of novel HIV-1 non-nucleoside reverse transcriptase (RT) inhibitors (Silvestri, et al. J. Med. Chem. 2003, 46, 2482-2493) highly active against wild type and some clinically relevant resistant strains (Y181C, the double mutant K103N-Y181C, and the K103R-V179D-P225H strain, highly resistant to efavirenz). Predictive 3-D QSAR models using the combination of GRID and GOLPE programs were obtained using a receptor-based alignment by means of docking IASs into the non-nucleoside binding site (NNBS) of RT. The derived 3-D QSAR models showed conventional correlation (r(2)) and cross-validated (q(2)) coefficients values ranging from 0.79 to 0.93 and from 0.59 to 0.84, respectively. All described models were validated by an external test set compiled from previously reported pyrryl aryl sulfones (Artico, et al. J. Med. Chem. 1996, 39, 522-530). The most predictive 3-D QSAR model was then used to predict the activity of novel untested IASs. The synthesis of six designed derivatives (prediction set) allowed disclosure of new IASs endowed with high anti-HIV-1 activities.

  13. (3,4-dihydroisoquinolin-2(1H)-yl)

    Indian Academy of Sciences (India)

    Administrator

    HIV-1 reverse transcriptase (HIV-1 RT); non-nucleoside reverse transcriptase inhibitor. (NNRTI); docking; autodock; 1,2,3,4-tetrahydroisoquinoline. 1. Introduction. Acquired immuno deficiency syndrome (AIDS) is one of the most serious pandemic public health chal- lenges since 1981. 1. Human immuno deficiency virus.

  14. Development and customization of a color-coded microbeads-based assay for drug resistance in HIV-1 reverse transcriptase.

    Science.gov (United States)

    Gu, Lijun; Kawana-Tachikawa, Ai; Shiino, Teiichiro; Nakamura, Hitomi; Koga, Michiko; Kikuchi, Tadashi; Adachi, Eisuke; Koibuchi, Tomohiko; Ishida, Takaomi; Gao, George F; Matsushita, Masaki; Sugiura, Wataru; Iwamoto, Aikichi; Hosoya, Noriaki

    2014-01-01

    Drug resistance (DR) of HIV-1 can be examined genotypically or phenotypically. Although sequencing is the gold standard of the genotypic resistance testing (GRT), high-throughput GRT targeted to the codons responsible for DR may be more appropriate for epidemiological studies and public health research. We used a Japanese database to design and synthesize sequence-specific oligonucleotide probes (SSOP) for the detection of wild-type sequences and 6 DR mutations in the clade B HIV-1 reverse transcriptase region. We coupled SSOP to microbeads of the Luminex 100 xMAP system and developed a GRT based on the polymerase chain reaction (PCR)-SSOP-Luminex method. Sixteen oligoprobes for discriminating DR mutations from wild-type sequences at 6 loci were designed and synthesized, and their sensitivity and specificity were confirmed using isogenic plasmids. The PCR-SSOP-Luminex DR assay was then compared to direct sequencing using 74 plasma specimens from treatment-naïve patients or those on failing treatment. In the majority of specimens, the results of the PCR-SSOP-Luminex DR assay were concordant with sequencing results: 62/74 (83.8%) for M41, 43/74 (58.1%) for K65, 70/74 (94.6%) for K70, 55/73 (75.3%) for K103, 63/73 (86.3%) for M184 and 68/73 (93.2%) for T215. There were a number of specimens without any positive signals, especially for K65. The nucleotide position of A2723G, A2747G and C2750T were frequent polymorphisms for the wild-type amino acids K65, K66 and D67, respectively, and 14 specimens had the D67N mutation encoded by G2748A. We synthesized 14 additional oligoprobes for K65, and the sensitivity for K65 loci improved from 43/74 (58.1%) to 68/74 (91.9%). We developed a rapid high-throughput assay for clade B HIV-1 DR mutations, which could be customized by synthesizing oligoprobes suitable for the circulating viruses. The assay could be a useful tool especially for public health research in both resource-rich and resource-limited settings.

  15. Rilpivirine: a new non-nucleoside reverse transcriptase inhibitor.

    Science.gov (United States)

    Sharma, Mamta; Saravolatz, Louis D

    2013-02-01

    Rilpivirine is a new non-nucleoside reverse transcriptase inhibitor (NNRTI) that is approved for HIV-1 treatment-naive adult patients in combination with other antiretroviral agents. The recommended dose is a 25 mg tablet once daily taken orally with a meal. Due to cytochrome P450 3A4 enzyme induction or gastric pH increase, rilpivirine cannot be coadministered with a number of other drugs (anticonvulsants, rifabutin, rifampicin, rifapentine, proton pump inhibitors, systemic dexamethasone and St John's wort). Rilpivirine should be used with caution when coadministered with a drug with a known risk for torsade de pointes. Rilpivirine has a better tolerability than a comparative NNRTI, efavirenz, in clinical trials, with fewer central nervous system adverse effects, rashes, lipid abnormalities and discontinuation rates. Virological failure occurs more commonly with higher baseline viral loads (>100,000 copies/mL) and lower baseline CD4 counts (<50 cells/mm(3)). Seventeen NNRTI mutations have been associated with decreased susceptibility to rilpivirine: K101E/P, E138A/G/K/Q/R, V179L, Y181C/I/V, H221Y, F227C, M230I/L, Y188L and the combination L100I + K103N. Resistance to rilpivirine largely excludes future use of the NNRTI class.

  16. Murine leukemia virus pol gene products: analysis with antisera generated against reverse transcriptase and endonuclease fusion proteins expressed in Escherichia coli

    International Nuclear Information System (INIS)

    Hu, S.C.; Court, D.L.; Zweig, M.; Levin, J.G.

    1986-01-01

    The organization of the murine leukemia virus (MuLV) pol gene was investigated by expressing molecular clones containing AKR MuLV reverse transcriptase or endonuclease or both gene segments in Escherichia coli and generating specific antisera against the expressed bacterial proteins. Reaction of these antisera with detergent-disrupted virus precipitated and 80-kilodalton (kDa) protein, the MuLV reverse transcriptase, and a 46-kDa protein which we believe is the viral endonuclease. A third (50-kDa) protein, related to reverse transcriptase, was also precipitated. Bacterial extracts of clones expressing reverse transcriptase and endonuclease sequences competed with the viral 80- and 46-kDa proteins, respectively. These results demonstrate that the antisera are specific for viral reverse transcriptase and endonuclease. Immunoprecipitation of AKR MuLV with antisera prepared against a bacterial protein containing only endonuclease sequences led to the observation that reverse transcriptase and endonuclease can be associated as a complex involving a disulfide bond(s)

  17. In Vitro Antioxidant Properties, HIV-1 Reverse Transcriptase and Acetylcholinesterase Inhibitory Effects of Traditional Herbal Preparations Sold in South Africa

    Directory of Open Access Journals (Sweden)

    Johannes Van Staden

    2010-10-01

    Full Text Available The antioxidant potentials for fourteen multipurpose traditional herbal preparations sold in South Africa were determined using the DPPH radical scavenging, ferric reducing power and β-carotene-linoleic acid model system, the anti-HIV-1 reverse transcriptase (RT enzyme inhibitory effects using an ELISA kit and acetylcholinesterase (AChE enzyme inhibition using the microtitre plate assay. Nine of the herbal mixtures (Umzimba omubi, Umuthi wekukhwehlela ne zilonda, Mvusa ukunzi, Umpatisa inkosi, Imbiza ephuzwato, Vusa umzimba, Supreme one hundred, Sejeso herbal mixture Ingwe® and Ingwe® special muti exhibited higher antioxidant potentials, while only four (Imbiza ephuzwato, Ingwe® muthi mixture, Sejeso herbal mixture Ingwe® and African potato extractTM showed potent activity against the RT enzyme. Nine mixtures (Imbiza ephuzwato, Umpatisa inkosi, African potato extractTM, Sejeso herbal mixture Ingwe®, Vusa umzimba; Ingwe® muthi mixture, Ibhubezi™, Lion izifozonke Ingwe® and Ingwe® special muti showed AChE enzyme inhibitory activity greater than 50%. The observed activity exhibited by some of the herbal mixtures gives some credence to the manufacturers’ claims and goes part of the way towards validating their use against certain conditions such as oxidative stress, HIV/AIDS proliferation and some mental conditions. It is however, desirable to carry out further studies to determine the effects of mixing plant species/parts in one mixture on the antioxidant potency as well as isolating active constituents from the herbal mixtures.

  18. Prediction of the binding mode and resistance profile for a dual-target pyrrolyl diketo acid scaffold against HIV-1 integrase and reverse-transcriptase-associated ribonuclease H.

    Science.gov (United States)

    Yang, Fengyuan; Zheng, Guoxun; Fu, Tingting; Li, Xiaofeng; Tu, Gao; Li, Ying Hong; Yao, Xiaojun; Xue, Weiwei; Zhu, Feng

    2018-06-27

    The rapid emergence of drug-resistant variants is one of the most common causes of highly active antiretroviral therapeutic (HAART) failure in patients infected with HIV-1. Compared with the existing HAART, the recently developed pyrrolyl diketo acid scaffold targeting both HIV-1 integrase (IN) and reverse transcriptase-associated ribonuclease H (RNase H) is an efficient approach to counteract the failure of anti-HIV treatment due to drug resistance. However, the binding mode and potential resistance profile of these inhibitors with important mechanistic principles remain poorly understood. To address this issue, an integrated computational method was employed to investigate the binding mode of inhibitor JMC6F with HIV-1 IN and RNase H. By using per-residue binding free energy decomposition analysis, the following residues: Asp64, Thr66, Leu68, Asp116, Tyr143, Gln148 and Glu152 in IN, Asp443, Glu478, Trp536, Lys541 and Asp549 in RNase H were identified as key residues for JMC6F binding. And then computational alanine scanning was carried to further verify the key residues. Moreover, the resistance profile of the currently known major mutations in HIV-1 IN and 2 mutations in RNase H against JMC6F was predicted by in silico mutagenesis studies. The results demonstrated that only three mutations in HIV-1 IN (Y143C, Q148R and N155H) and two mutations in HIV-1 RNase H (Y501R and Y501W) resulted in a reduction of JMC6F potency, thus indicating their potential role in providing resistance to JMC6F. These data provided important insights into the binding mode and resistance profile of the inhibitors with a pyrrolyl diketo acid scaffold in HIV-1 IN and RNase H, which would be helpful for the development of more effective dual HIV-1 IN and RNase H inhibitors.

  19. Occurrence of transmitted HIV-1 drug resistance among Drug-naïve pregnant women in selected HIV-care centres in Ghana.

    Science.gov (United States)

    Martin-Odoom, Alexander; Adiku, Theophilus; Delgado, Elena; Lartey, Margaret; Ampofo, William K

    2017-03-01

    Access to antiretroviral therapy in Ghana has been scaled up across the country over the last decade. This study sought to determine the occurrence of transmitted HIV-1 drug resistance in pregnant HIV-1 positive women yet to initiate antiretroviral therapy at selected HIV Care Centres in Ghana. Plasma specimens from twenty-six (26) HIV seropositive pregnant women who were less than 28weeks pregnant with their first pregnancy and ART naïve were collected from selected HIV care centres in three (3) regions in Ghana. Genotypic testing was done for the reverse transcriptase gene and the sequences generated were analyzed for HIV-1 drug resistance mutations using the Stanford University HIV Drug Resistance Database. Resistance mutations associated with the reverse transcriptase gene were detected in 4 (15.4%) of the participants. At least one major drug resistance mutation in the reverse transcriptase gene was found in 3 (11.5%) of the women. The detection of transmitted HIV-1 drug resistance in this drug-naïve group in two regional HIV care sites is an indication of the need for renewed action in monitoring the emergence of transmitted HIV-1 drug resistance in Ghana. None declared.

  20. The structure of FIV reverse transcriptase and its implications for non-nucleoside inhibitor resistance.

    Directory of Open Access Journals (Sweden)

    Meytal Galilee

    2018-01-01

    Full Text Available Reverse transcriptase (RT is the target for the majority of anti-HIV-1 drugs. As with all anti-AIDS treatments, continued success of RT inhibitors is persistently disrupted by the occurrence of resistance mutations. To explore latent resistance mechanisms potentially accessible to therapeutically challenged HIV-1 viruses, we examined RT from the related feline immunodeficiency virus (FIV. FIV closely parallels HIV-1 in its replication and pathogenicity, however, is resistant to all non-nucleoside inhibitors (NNRTI. The intrinsic resistance of FIV RT is particularly interesting since FIV harbors the Y181 and Y188 sensitivity residues absent in both HIV-2 and SIV. Unlike RT from HIV-2 or SIV, previous efforts have failed to make FIV RT susceptible to NNRTIs concluding that the structure or flexibility of the feline enzyme must be profoundly different. We report the first crystal structure of FIV RT and, being the first structure of an RT from a non-primate lentivirus, enrich the structural and species repertoires available for RT. The structure demonstrates that while the NNRTI binding pocket is conserved, minor subtleties at the entryway can render the FIV RT pocket more restricted and unfavorable for effective NNRTI binding. Measuring NNRTI binding affinity to FIV RT shows that the "closed" pocket configuration inhibits NNRTI binding. Mutating the loop residues rimming the entryway of FIV RT pocket allows for NNRTI binding, however, it does not confer sensitivity to these inhibitors. This reveals a further layer of resistance caused by inherent FIV RT variances that could have enhanced the dissociation of bound inhibitors, or, perhaps, modulated protein plasticity to overcome inhibitory effects of bound NNRTIs. The more "closed" conformation of FIV RT pocket can provide a template for the development of innovative drugs that could unlock the constrained pocket, and the resilient mutant version of the enzyme can offer a fresh model for the study

  1. Detection of reverse transcriptase termination sites using cDNA ligation and massive parallel sequencing

    DEFF Research Database (Denmark)

    Kielpinski, Lukasz J; Boyd, Mette; Sandelin, Albin

    2013-01-01

    Detection of reverse transcriptase termination sites is important in many different applications, such as structural probing of RNAs, rapid amplification of cDNA 5' ends (5' RACE), cap analysis of gene expression, and detection of RNA modifications and protein-RNA cross-links. The throughput...... of these methods can be increased by applying massive parallel sequencing technologies.Here, we describe a versatile method for detection of reverse transcriptase termination sites based on ligation of an adapter to the 3' end of cDNA with bacteriophage TS2126 RNA ligase (CircLigase™). In the following PCR...

  2. High Potency of Indolyl Aryl Sulfone Nonnucleoside Inhibitors towards Drug-Resistant Human Immunodeficiency Virus Type 1 Reverse Transcriptase Mutants Is Due to Selective Targeting of Different Mechanistic Forms of the Enzyme

    Science.gov (United States)

    Cancio, Reynel; Silvestri, Romano; Ragno, Rino; Artico, Marino; De Martino, Gabriella; La Regina, Giuseppe; Crespan, Emmanuele; Zanoli, Samantha; Hübscher, Ulrich; Spadari, Silvio; Maga, Giovanni

    2005-01-01

    Indolyl aryl sulfone (IAS) nonnucleoside inhibitors have been shown to potently inhibit the growth of wild-type and drug-resistant human immunodeficiency virus type 1 (HIV-1), but their exact mechanism of action has not been elucidated yet. Here, we describe the mechanism of inhibition of HIV-1 reverse transcriptase (RT) by selected IAS derivatives. Our results showed that, depending on the substitutions introduced in the IAS common pharmacophore, these compounds can be made selective for different enzyme-substrate complexes. Moreover, we showed that the molecular basis for this selectivity was a different association rate of the drug to a particular enzymatic form along the reaction pathway. By comparing the activities of the different compounds against wild-type RT and the nonnucleoside reverse transcriptase inhibitor-resistant mutant Lys103Asn, it was possible to hypothesize, on the basis of their mechanism of action, a rationale for the design of drugs which could overcome the steric barrier imposed by the Lys103Asn mutation. PMID:16251294

  3. Purification and Characterization of a White Laccase with Pronounced Dye Decolorizing Ability and HIV-1 Reverse Transcriptase Inhibitory Activity from Lepista nuda

    Directory of Open Access Journals (Sweden)

    Mengjuan Zhu

    2016-03-01

    Full Text Available A strain LN07 with high laccase yield was identified as basidiomycete fungus Lepista nuda from which a white laccase without type I copper was purified and characterized. The laccase was a monomeric protein with a molecular mass of 56 kDa. Its N-terminal amino acid sequence was AIGPAADLHIVNKDISPDGF. Besides, eight inner peptide sequences were determined and lac4, lac5 and lac6 sequences were in the Cu2+ combination and conservation zones of laccases. HIV-1 reverse transcriptase was inhibited by the laccase with a half-inhibitory concentration of 0.65 μM. Cu2+ ions (1.5 mM enhanced the laccase production and the optimal pH and temperature of the laccase were pH 3.0 and 50 °C, respectively. The Km and Vmax of the laccase using ABTS as substrate were respectively 0.19 mM and 195 μM. Several dyes including laboratory dyes and textile dyes used in this study, such as Methyl red, Coomassie brilliant blue, Reactive brilliant blue and so on, were decolorized in different degrees by the purified laccase. By LC-MS analysis, Methyl red was structurally degraded by the laccase. Moreover, the laccase affected the absorbance at the maximum wavelength of many pesticides. Thus, the white laccase had potential commercial value for textile finishing and wastewater treatment.

  4. N348I in the connection domain of HIV-1 reverse transcriptase confers zidovudine and nevirapine resistance.

    Directory of Open Access Journals (Sweden)

    Soo-Huey Yap

    2007-12-01

    Full Text Available The catalytically active 66-kDa subunit of the human immunodeficiency virus type 1 (HIV-1 reverse transcriptase (RT consists of DNA polymerase, connection, and ribonuclease H (RNase H domains. Almost all known RT inhibitor resistance mutations identified to date map to the polymerase domain of the enzyme. However, the connection and RNase H domains are not routinely analysed in clinical samples and none of the genotyping assays available for patient management sequence the entire RT coding region. The British Columbia Centre for Excellence in HIV/AIDS (the Centre genotypes clinical isolates up to codon 400 in RT, and our retrospective statistical analyses of the Centre's database have identified an N348I mutation in the RT connection domain in treatment-experienced individuals. The objective of this multidisciplinary study was to establish the in vivo relevance of this mutation and its role in drug resistance.The prevalence of N348I in clinical isolates, the time taken for it to emerge under selective drug pressure, and its association with changes in viral load, specific drug treatment, and known drug resistance mutations was analysed from genotypes, viral loads, and treatment histories from the Centre's database. N348I increased in prevalence from below 1% in 368 treatment-naïve individuals to 12.1% in 1,009 treatment-experienced patients (p = 7.7 x 10(-12. N348I appeared early in therapy and was highly associated with thymidine analogue mutations (TAMs M41L and T215Y/F (p < 0.001, the lamivudine resistance mutations M184V/I (p < 0.001, and non-nucleoside RTI (NNRTI resistance mutations K103N and Y181C/I (p < 0.001. The association with TAMs and NNRTI resistance mutations was consistent with the selection of N348I in patients treated with regimens that included both zidovudine and nevirapine (odds ratio 2.62, 95% confidence interval 1.43-4.81. The appearance of N348I was associated with a significant increase in viral load (p < 0.001, which

  5. K70Q adds high-level tenofovir resistance to "Q151M complex" HIV reverse transcriptase through the enhanced discrimination mechanism.

    Directory of Open Access Journals (Sweden)

    Atsuko Hachiya

    2011-01-01

    Full Text Available HIV-1 carrying the "Q151M complex" reverse transcriptase (RT mutations (A62V/V75I/F77L/F116Y/Q151M, or Q151Mc is resistant to many FDA-approved nucleoside RT inhibitors (NRTIs, but has been considered susceptible to tenofovir disoproxil fumarate (TFV-DF or TDF. We have isolated from a TFV-DF-treated HIV patient a Q151Mc-containing clinical isolate with high phenotypic resistance to TFV-DF. Analysis of the genotypic and phenotypic testing over the course of this patient's therapy lead us to hypothesize that TFV-DF resistance emerged upon appearance of the previously unreported K70Q mutation in the Q151Mc background. Virological analysis showed that HIV with only K70Q was not significantly resistant to TFV-DF. However, addition of K70Q to the Q151Mc background significantly enhanced resistance to several approved NRTIs, and also resulted in high-level (10-fold resistance to TFV-DF. Biochemical experiments established that the increased resistance to tenofovir is not the result of enhanced excision, as K70Q/Q151Mc RT exhibited diminished, rather than enhanced ATP-based primer unblocking activity. Pre-steady state kinetic analysis of the recombinant enzymes demonstrated that addition of the K70Q mutation selectively decreases the binding of tenofovir-diphosphate (TFV-DP, resulting in reduced incorporation of TFV into the nascent DNA chain. Molecular dynamics simulations suggest that changes in the hydrogen bonding pattern in the polymerase active site of K70Q/Q151Mc RT may contribute to the observed changes in binding and incorporation of TFV-DP. The novel pattern of TFV-resistance may help adjust therapeutic strategies for NRTI-experienced patients with multi-drug resistant (MDR mutations.

  6. Detection of BCR-ABL Fusion mRNA Using Reverse Transcriptase Loop-mediated Isothermal Amplification

    Energy Technology Data Exchange (ETDEWEB)

    Dugan, L C; Hall, S; Kohlgruber, A; Urbin, S; Torres, C; Wilson, P

    2011-12-08

    RT-PCR is commonly used for the detection of Bcr-Abl fusion transcripts in patients diagnosed with chronic myelogenous leukemia, CML. Two fusion transcripts predominate in CML, Br-Abl e13a2 and e14a2. They have developed reverse transcriptase isothermal loop-mediated amplification (RT-LAMP) assays to detect these two fusion transcripts along with the normal Bcr transcript.

  7. Antitumor Activity and Mechanism of a Reverse Transcriptase Inhibitor, Dapivirine, in Glioblastoma

    OpenAIRE

    Liu, Weiwen; Song, Xian-lu; Zhao, Shan-chao; He, Minyi; Wang, Hai; Chen, Ziyang; Xiang, Wei; Yi, Guozhong; Qi, Songtao; Liu, Yawei

    2018-01-01

    Ethnopharmacological relevance: Dapivirine is one of reverse transcriptase inhibitors (RTIs). It is the prototype of diarylpyrimidines (DAPY), formerly known as TMC120 or DAPY R147681 (IUPAC name: 4- [[4-(2, 4, 6-trimethylphenyl) amino]-2-pyrimidinyl] amino]-benzonitrile; CAS no.244767-67-7). Aim: The purpose of this study is to investigate the antitumor activity of dapivirine, one of the RTIs, on U87 glioblastoma (GBM) cells in vitro and in vivo. Materials and Methods: U87 GBM cells were cul...

  8. Application of Reverse Transcriptase-PCR-DGGE as a rapid method for routine determination of Vibrio spp. in foods.

    Science.gov (United States)

    Chahorm, Kanchana; Prakitchaiwattana, Cheunjit

    2018-01-02

    The aim of this research was to evaluate the feasibility of PCR-DGGE and Reverse Transcriptase-PCR-DGGE techniques for rapid detection of Vibrio species in foods. Primers GC567F and 680R were initially evaluated for amplifying DNA and cDNA of ten references Vibrio species by PCR method. The GC-clamp PCR amplicons were separated according to their sequences by the DGGE using 10% (w/v) polyacrylamide gel containing 45-70% urea and formamide denaturants. Two pair of Vibrio species, which could not be differentiated on the gel, was Vibrio fluvialis - Vibrio furnissii and Vibrio parahaemolyticus - Vibrio harveyi. To determine the detection limit, in the community of 10 reference strains containing the same viable population, distinct DNA bands of 3 species; Vibrio cholerae, Vibrio mimicus and Vibrio alginolyticus were consistently observed by PCR-DGGE technique. In fact, 5 species; Vibrio cholerae, Vibrio mimicus, Vibrio alginolyticus, Vibrio parahaemolyticus and Vibrio fluvialis consistently observed by Reverse Transcriptase-PCR-DGGE. In the community containing different viable population increasing from 10 2 to 10 5 CFU/mL, PCR-DGGE analysis only detected the two most prevalent species, while RT-PCR-DGGE detected the five most prevalent species. Therefore, Reverse Transcriptase-PCR-DGGE was also selected for detection of various Vibrio cell conditions, including viable cell (VC), injured cells from frozen cultures (IVC) and injured cells from frozen cultures with pre-enrichment (PIVC). It was found that cDNA band of all cell conditions gave the same migratory patterns, except that multiple cDNA bands of Plesiomonas shigelloides under IVC and PIVC conditions were found. When Reverse Transcriptase-PCR-DGGE was used for detecting Vibrio parahaemolyticus in the pathogen-spiked food samples, Vibrio parahaemolyticus could be detected in the spiked samples containing at least 10 2 CFU/g of this pathogen. The results obtained also corresponded to standard method (USFDA, 2004

  9. Efavirenz or nevirapine in three-drug combination therapy with two nucleoside or nucleotide-reverse transcriptase inhibitors for initial treatment of HIV infection in antiretroviral-naïve individuals.

    Science.gov (United States)

    Mbuagbaw, Lawrence; Mursleen, Sara; Irlam, James H; Spaulding, Alicen B; Rutherford, George W; Siegfried, Nandi

    2016-12-10

    The advent of highly active antiretroviral therapy (ART) has reduced the morbidity and mortality due to HIV infection. The World Health Organization (WHO) ART guidelines focus on three classes of antiretroviral drugs, namely nucleoside or nucleotide reverse transcriptase inhibitors (NRTI), non-nucleoside reverse transcriptase inhibitors (NNRTI) and protease inhibitors. Two of the most common medications given as first-line treatment are the NNRTIs, efavirenz (EFV) and nevirapine (NVP). It is unclear which NNRTI is more efficacious for initial therapy. This systematic review was first published in 2010. To determine which non-nucleoside reverse transcriptase inhibitor, either EFV or NVP, is more effective in suppressing viral load when given in combination with two nucleoside reverse transcriptase inhibitors as part of initial antiretroviral therapy for HIV infection in adults and children. We attempted to identify all relevant studies, regardless of language or publication status, in electronic databases and conference proceedings up to 12 August 2016. We searched MEDLINE, Embase, the Cochrane Central Register of Controlled Trials (CENTRAL), the World Health Organization (WHO) International Clinical Trials Registry Platform (ICTRP) and ClinicalTrials.gov to 12 August 2016. We searched LILACS (Latin American and Caribbean Health Sciences Literature) and the Web of Science from 1996 to 12 August 2016. We checked the National Library of Medicine (NLM) Gateway from 1996 to 2009, as it was no longer available after 2009. We included all randomized controlled trials (RCTs) that compared EFV to NVP in people with HIV without prior exposure to ART, irrespective of the dosage or NRTI's given in combination.The primary outcome of interest was virological success. Other primary outcomes included mortality, clinical progression to AIDS, severe adverse events, and discontinuation of therapy for any reason. Secondary outcomes were change in CD4 count, treatment failure

  10. Molecularly imprinted nanoparticles for inhibiting ribonuclease in reverse transcriptase polymerase chain reaction

    DEFF Research Database (Denmark)

    Feng, Xiaotong; Ashley, Jon; Zhou, Tongchang

    2018-01-01

    Molecularly imprinted nanoparticles (nanoMIPs) are synthesized via a solid-phase approach using RNase as the template. The feasibility of employing the nanoMIPs as RNase inhibitor is successfully demonstrated in reverse transcriptase polymerase chain reaction (RT-PCR) assays, suggesting the tailor...

  11. Reverse Transcriptase Mechanism of Somatic Hypermutation: 60 Years of Clonal Selection Theory

    Directory of Open Access Journals (Sweden)

    Edward J. Steele

    2017-11-01

    Full Text Available The evidence for the reverse transcriptase mechanism of somatic hypermutation is substantial and multifactorial. In this 60th anniversary year of the publication of Sir MacFarlane Burnet’s Clonal Selection Theory, the evidence is briefly reviewed and updated.

  12. Long-term effectiveness of highly active antiretroviral therapy (HAART) in perinatally HIV-infected children in Denmark

    DEFF Research Database (Denmark)

    Bracher, Linda; Valerius, Niels Henrik; Rosenfeldt, Vibeke

    2007-01-01

    children treated with HAART. Initial HAART included 2 nucleoside reverse-transcriptase inhibitors in combination with either a protease inhibitor (n =38) or a non-nucleoside reverse-transcriptase inhibitor (n =12). 19 (39%) patients were previously treated with mono- or dual therapy. Baseline......The long-term impact of highly active antiretroviral therapy (HAART) on HIV-1 infected children is not well known. The Danish Paediatric HIV Cohort Study includes all patients ... characteristics were median CD4 percentage 14% and HIV-RNA viral load 4.9 log(10). Within the first 12 weeks of therapy approximately 60% achieved HIV-RNA viral load children changed the components of HAART. The proportion of children with CD4...

  13. High Levels of Transmitted HIV Drug Resistance in a Study in Papua New Guinea.

    Science.gov (United States)

    Lavu, Evelyn; Kave, Ellan; Mosoro, Euodia; Markby, Jessica; Aleksic, Eman; Gare, Janet; Elsum, Imogen A; Nano, Gideon; Kaima, Petronia; Dala, Nick; Gurung, Anup; Bertagnolio, Silvia; Crowe, Suzanne M; Myatt, Mark; Hearps, Anna C; Jordan, Michael R

    2017-01-01

    Papua New Guinea is a Pacific Island nation of 7.3 million people with an estimated HIV prevalence of 0.8%. ART initiation and monitoring are guided by clinical staging and CD4 cell counts, when available. Little is known about levels of transmitted HIV drug resistance in recently infected individuals in Papua New Guinea. Surveillance of transmitted HIV drug resistance in a total of 123 individuals recently infected with HIV and aged less than 30 years was implemented in Port Moresby (n = 62) and Mount Hagen (n = 61) during the period May 2013-April 2014. HIV drug resistance testing was performed using dried blood spots. Transmitted HIV drug resistance was defined by the presence of one or more drug resistance mutations as defined by the World Health Organization surveillance drug resistance mutations list. The prevalence of non-nucleoside reverse transcriptase inhibitor transmitted HIV drug resistance was 16.1% (95% CI 8.8%-27.4%) and 8.2% (95% CI 3.2%-18.2%) in Port Moresby and Mount Hagen, respectively. The prevalence of nucleoside reverse transcriptase inhibitor transmitted HIV drug resistance was 3.2% (95% CI 0.2%-11.7%) and 3.3% (95% CI 0.2%-11.8%) in Port Moresby and Mount Hagen, respectively. No protease inhibitor transmitted HIV drug resistance was observed. The level of non-nucleoside reverse transcriptase inhibitor drug resistance in antiretroviral drug naïve individuals recently infected with HIV in Port Moresby is amongst the highest reported globally. This alarming level of transmitted HIV drug resistance in a young sexually active population threatens to limit the on-going effective use of NNRTIs as a component of first-line ART in Papua New Guinea. To support the choice of nationally recommended first-line antiretroviral therapy, representative surveillance of HIV drug resistance among antiretroviral therapy initiators in Papua New Guinea should be urgently implemented.

  14. Pharmacokinetics and tolerability of the new second-generation nonnucleoside reverse- transcriptase inhibitor KM-023 in healthy subjects

    Directory of Open Access Journals (Sweden)

    Cha YJ

    2014-09-01

    Full Text Available Yu-Jung Cha,1,* Kyoung Soo Lim,2,* Min-Kyu Park,1 Stephen Schneider,3 Brian Bray,3 Myung-Chol Kang,3 Jae-Yong Chung,1 Seo Hyun Yoon,1 Joo-Youn Cho,1 Kyung-Sang Yu11Department of Clinical Pharmacology and Therapeutics, Seoul National University College of Medicine and Hospital, Seoul, South Korea; 2Department of Clinical Pharmacology and Therapeutics, CHA University School of Medicine and CHA Bundang Medical Center, Seongnam, South Korea; 3Kainos Medicine USA Inc., Morrisville, NC, USA *These authors contributed equally to this workBackground: KM-023 is a new second-generation nonnucleoside reverse-transcriptase inhibitor that is under development for the treatment of human immunodeficiency virus (HIV type 1 infection. Objective: This study determined KM-023 tolerability and pharmacokinetic characteristics in healthy subjects. Materials and methods: A randomized, double-blinded, placebo-controlled, dose-escalation study was conducted in 80 healthy South Korean male volunteers. The subjects were allocated to single- or multiple-dose (once daily for 7 days groups that received 75, 150, 300, or 600 mg drug or placebo in a 4:1 ratio. Safety and pharmacokinetic assessments were performed during the study. Plasma and urine concentrations were quantified using liquid chromatography–tandem mass spectrometry. Results: The average maximum concentration (Cmax and area under the concentration–time curve from time 0 to infinity (AUC∞ values of KM-023 for the 75–600 mg doses in the single-dose study ranged from 440.2 ng/mL to 1,245.4 ng/mL and 11,142.4 ng • h/mL to 33,705.6 ng • h/mL, respectively. Values of the mean Cmax at a steady state and AUC within the dosing interval ranged from 385.1 ng/mL to 1,096.7 ng/mL and 3,698.9 ng • h/mL to 10,232.6 ng • h/mL, respectively, following 75–600 mg doses in the multiple-dose study. Dose proportionality was not observed for KM-023. KM-023 showed a 0.6-fold accumulation after multiple doses in the 600

  15. Telomerase reverse transcriptase promoter mutations in glandular lesions of the urinary bladder.

    Science.gov (United States)

    Vail, Eric; Zheng, Xiaoyong; Zhou, Ming; Yang, Ximing; Fallon, John T; Epstein, Jonathan I; Zhong, Minghao

    2015-10-01

    Glandular lesions of the urinary bladder include a broad spectrum of entities ranging from completely benign to primary and secondary malignancies. The accurate diagnosis of these lesions is both important and challenging. Recently, studies suggest that telomerase reverse transcriptase (TERT) promoter mutations could be a biomarker for urothelial carcinoma (UC). We hypothesized that these mutations can distinguish UC with glandular differentiation from nephrogenic adenoma, primary adenocarcinoma of the urinary bladder (PAUB), or secondary malignancies. Twenty-five cases of benign glandular lesions (including nephrogenic adenoma); 29 cases of UC with glandular differentiation; 10 cases of PAUB; and 10 cases each of metastatic colon cancer, prostatic carcinoma, and carcinoma from Mullerian origin were collected. Slides were reviewed and selected to make sure the lesion was at least 10% to 20% of all tissue. Macrodissection was performed in some of cases, and genomic DNA was extracted from the tissue. Telomerase reverse transcriptase promoter mutations were determined by standard polymerase chain reaction sequencing. Twenty-one cases (72%) of UC with glandular differentiation were positive for TERT promoter mutations. However, none of the remaining cases (total 65 cases of benign lesions, PAUB, and metastatic carcinomas) was positive for TERT promoter mutation. Telomerase reverse transcriptase promoter mutations were highly associated with UC including UC with glandular differentiation but not other glandular lesions of bladder. Therefore, in conjunction with morphologic features, Immunohistochemistry stain profile, and clinical information, TERT promoter mutations could distinguish UC with glandular differentiation from other bladder glandular lesions. In addition, lack of TERT promoter mutations in primary adenocarcinoma of bladder suggests that this entity may have different origin or carcinogenesis from those of UC. Published by Elsevier Inc.

  16. Major groove binding track residues of the connection subdomain of human immunodeficiency virus type 1 reverse transcriptase enhance cDNA synthesis at high temperatures.

    Science.gov (United States)

    Matamoros, Tania; Barrioluengo, Verónica; Abia, David; Menéndez-Arias, Luis

    2013-12-23

    At high temperatures, RNA denaturation can improve the efficiency and specificity of reverse transcription. Refined structures and molecular models of HIV-1 reverse transcriptases (RTs) from phylogenetically distant clades (i.e., group M subtype B and group O) revealed a major interaction between the template-primer and the Arg³⁵⁸-Gly³⁵⁹-Ala³⁶⁰ triad in the large subunit of HIV-1M/B RT. However, fewer contacts were predicted for the equivalent Lys³⁵⁸-Ala³⁵⁹-Ser³⁶⁰ triad of HIV-1O RT and the nucleic acid. An engineered HIV-1O K358R/A359G/S360A RT showed increased cDNA synthesis efficiency above 68 °C, as determined by qualitative and quantitative reverse transcription polymerase chain reactions. In comparison with wild-type HIV-1O RT, the mutant enzyme showed higher thermal stability but retained wild-type RNase H activity. Mutations that increased the accuracy of HIV-1M/B RTs were tested in combination with the K358R/A359G/S360A triple mutation. Some of them (e.g., F61A, K65R, K65R/V75I, and V148I) had a negative effect on reverse transcription efficiency above 65 °C. RTs with improved DNA binding affinities also showed higher cDNA synthesis efficiencies at elevated temperatures. Two of the most thermostable RTs (i.e., mutants T69SSG/K358R/A359G/S360A and K358R/A359G/S360A/E478Q) showed moderately increased fidelity in forward mutation assays. Our results demonstrate that the triad of Arg³⁵⁸, Gly³⁵⁹, and Ala³⁶⁰ in the major groove binding track of HIV-1 RT is a major target for RT stabilization, and most relevant for improving reverse transcription efficiency at high temperatures.

  17. HIV Drug Resistance-Associated Mutations in Antiretroviral Naïve HIV-1-Infected Latin American Children

    Directory of Open Access Journals (Sweden)

    Luis E. Soto-Ramirez

    2010-01-01

    Full Text Available Our goal was to describe the presence of HIV drug resistance among HIV-1-infected, antiretroviral (ARV naïve children and adolescents in Latin America and to examine resistance in these children in relation to drug exposure in the mother. Genotyping was performed on plasma samples obtained at baseline from HIV-1-infected participants in a prospective cohort study in Brazil, Argentina, and Mexico (NISDI Pediatric Study. Of 713 HIV-infected children enrolled, 69 were ARV naïve and eligible for the analysis. At enrollment, mean age was 7.3 years; 81.2% were infected with HIV perinatally. Drug resistance mutations (DRMs were detected in 6 (8.7%; 95% confidence interval 3.1–18.2% ARV-naïve subjects; none of the mothers of these 6 received ARVs during their pregnancies and none of the children received ARV prophylaxis. Reverse transcriptase mutations K70R and K70E were detected in 3 and 2 subjects, respectively; protease mutation I50 V was detected in 1 subject. Three of the 6 children with DRMs initiated ARV therapy during followup, with a good response in 2. The overall rate of primary drug resistance in this pediatric HIV-infected population was low, and no subjects had more than 1 DRM. Mutations associated with resistance to nucleoside reverse transcriptase inhibitors were the most prevalent.

  18. The group II intron maturase: a reverse transcriptase and splicing factor go hand in hand.

    Science.gov (United States)

    Zhao, Chen; Pyle, Anna Marie

    2017-12-01

    The splicing of group II introns in vivo requires the assistance of a multifunctional intron encoded protein (IEP, or maturase). Each IEP is also a reverse-transcriptase enzyme that enables group II introns to behave as mobile genetic elements. During splicing or retro-transposition, each group II intron forms a tight, specific complex with its own encoded IEP, resulting in a highly reactive holoenzyme. This review focuses on the structural basis for IEP function, as revealed by recent crystal structures of an IEP reverse transcriptase domain and cryo-EM structures of an IEP-intron complex. These structures explain how the same IEP scaffold is utilized for intron recognition, splicing and reverse transcription, while providing a physical basis for understanding the evolutionary transformation of the IEP into the eukaryotic splicing factor Prp8. Copyright © 2017 Elsevier Ltd. All rights reserved.

  19. High level of APOBEC3F/3G editing in HIV-2 DNA vif and pol sequences from antiretroviral-naive patients.

    Science.gov (United States)

    Bertine, Mélanie; Charpentier, Charlotte; Visseaux, Benoit; Storto, Alexandre; Collin, Gilles; Larrouy, Lucile; Damond, Florence; Matheron, Sophie; Brun-Vézinet, Françoise; Descamps, Diane

    2015-04-24

    In HIV-1, hypermutation introduced by APOBEC3F/3G cytidine deaminase activity leads to defective viruses. In-vivo impact of APOBEC3F/3G editing on HIV-2 sequences remains unknown. The objective of this study was to assess the level of APOBEC3F/3G editing in HIV-2-infected antiretroviral-naive patients. Direct sequencing of vif and pol regions was performed on HIV-2 proviral DNA from antiretroviral-naive patients included in the French Agence Nationale de Recherches sur le SIDA et les hépatites virales CO5 HIV-2 cohort. Hypermutated sequences were identified using Hypermut2.0 program. HIV-1 proviral sequences from Genbank were also assessed. Among 82 antiretroviral-naive HIV-2-infected patients assessed, 15 (28.8%) and five (16.7%) displayed Vif proviral defective sequences in HIV-2 groups A and B, respectively. A lower proportion of defective sequences was observed in protease-reverse transcriptase region. A higher median number of G-to-A mutations was observed in HIV-2 group B than in group A, both in Vif and protease-reverse transcriptase regions (P = 0.02 and P = 0.006, respectively). Compared with HIV-1 Vif sequences, a higher number of Vif defective sequences was observed in HIV-2 group A (P = 0.00001) and group B sequences (P = 0.013). We showed for the first time a high level of APOBEC3F/3G editing in HIV-2 sequences from antiretroviral-naive patients. Our study reported a group effect with a significantly higher level of APOBEC3F/3G editing in HIV-2 group B than in group A sequences.

  20. Management of HIV During Pregnancy

    OpenAIRE

    Chamma JP; Monteleone VF; V dos Reis L; Bonafe SM; Panão M

    2016-01-01

    According to UNAIDS, in 2015, one hundred and fifty thousand children were infected by HIV worldwide, therefore the use of antiretroviral therapy (ARV) during pregnancy is an important development for the reduction of maternal-fetal transmission. The treatment of a pregnant woman is done by combining two different ARV classes. The combination of two nucleoside reverse transcriptase inhibitors (NRTIs) with one non-nucleoside reverse transcriptase inhibitor (NNRTI) or protease inhibitor (PI) is...

  1. Enzyme engineering through evolution: thermostable recombinant group II intron reverse transcriptases provide new tools for RNA research and biotechnology.

    Science.gov (United States)

    Collins, Kathleen; Nilsen, Timothy W

    2013-08-01

    Current investigation of RNA transcriptomes relies heavily on the use of retroviral reverse transcriptases. It is well known that these enzymes have many limitations because of their intrinsic properties. This commentary highlights the recent biochemical characterization of a new family of reverse transcriptases, those encoded by group II intron retrohoming elements. The novel properties of these enzymes endow them with the potential to revolutionize how we approach RNA analyses.

  2. Reverse Transcriptase-Containing Particles Induced in Rous Sarcoma Virus-Transformed Rat Cells by Arginine Deprivation

    Science.gov (United States)

    Kotler, Moshe; Weinberg, Eynat; Haspel, Osnat; Becker, Yechiel

    1972-01-01

    Incubation of rat cells transformed by Rous sarcoma virus (RSV) in an arginine-deficient medium resulted in accumulation of particles in the culture medium. Such particles did not appear when the transformed rat cells were incubated in a complete medium nor in the medium of primary rat cells which were incubated either in arginine-deficient or complete media. The particles which were released from the arginine-deprived transformed rat cells resemble C-type particles in their properties. These particles band in sucrose gradients at a density of 1.16 g/ml and contain 35S ribonucleic acid (RNA) molecules and a reverse transcriptase activity. Analysis of the cytoplasm of transformed and primary rat cells, deprived and undeprived of arginine, revealed the presence of reverse transcriptase-containing particles which banded in sucrose gradients at a density of 1.14 g/ml. These particles differed from the particles released into the medium by the arginine-deprived RSV-transformed rat cells. The deoxyribonucleic acid (DNA) molecules synthesized in vitro by the reverse transcriptase present in the particles isolated from the medium of arginine-deprived cells hybridized to RSV RNA, whereas the DNA synthesized by the cell-bound enzyme had no homology to RSV RNA. PMID:4116137

  3. Identification of a methylated oligoribonucleotide as a potent inhibitor of HIV-1 reverse transcription complex.

    Science.gov (United States)

    Grigorov, Boyan; Bocquin, Anne; Gabus, Caroline; Avilov, Sergey; Mély, Yves; Agopian, Audrey; Divita, Gilles; Gottikh, Marina; Witvrouw, Myriam; Darlix, Jean-Luc

    2011-07-01

    Upon HIV-1 infection of a target cell, the viral reverse transcriptase (RT) copies the genomic RNA to synthesize the viral DNA. The genomic RNA is within the incoming HIV-1 core where it is coated by molecules of nucleocapsid (NC) protein that chaperones the reverse transcription process. Indeed, the RT chaperoning properties of NC extend from the initiation of cDNA synthesis to completion of the viral DNA. New and effective drugs against HIV-1 continue to be required, which prompted us to search for compounds aimed at inhibiting NC protein. Here, we report that the NC chaperoning activity is extensively inhibited in vitro by small methylated oligoribonucleotides (mODN). These mODNs were delivered intracellularly using a cell-penetrating-peptide and found to impede HIV-1 replication in primary human cells at nanomolar concentrations. Extensive analysis showed that viral cDNA synthesis was severely impaired by mODNs. Partially resistant viruses with mutations in NC and RT emerged after months of passaging in cell culture. A HIV-1 molecular clone (NL4.3) bearing these mutations was found to replicate at high concentrations of mODN, albeit with a reduced fitness. Small, methylated ODNs such as mODN-11 appear to be a new type of highly potent inhibitor of HIV-1.

  4. Structural Insights into HIV Reverse Transcriptase Mutations Q151M and Q151M Complex That Confer Multinucleoside Drug Resistance

    Energy Technology Data Exchange (ETDEWEB)

    Das, Kalyan; Martinez, Sergio E.; Arnold, Eddy

    2017-04-10

    HIV-1 reverse transcriptase (RT) is targeted by multiple drugs. RT mutations that confer resistance to nucleoside RT inhibitors (NRTIs) emerge during clinical use. Q151M and four associated mutations, A62V, V75I, F77L, and F116Y, were detected in patients failing therapies with dideoxynucleosides (didanosine [ddI], zalcitabine [ddC]) and/or zidovudine (AZT). The cluster of the five mutations is referred to as the Q151M complex (Q151Mc), and an RT or virus containing Q151Mc exhibits resistance to multiple NRTIs. To understand the structural basis for Q151M and Q151Mc resistance, we systematically determined the crystal structures of the wild-type RT/double-stranded DNA (dsDNA)/dATP (complex I), wild-type RT/dsDNA/ddATP (complex II), Q151M RT/dsDNA/dATP (complex III), Q151Mc RT/dsDNA/dATP (complex IV), and Q151Mc RT/dsDNA/ddATP (complex V) ternary complexes. The structures revealed that the deoxyribose rings of dATP and ddATP have 3'-endo and 3'-exo conformations, respectively. The single mutation Q151M introduces conformational perturbation at the deoxynucleoside triphosphate (dNTP)-binding pocket, and the mutated pocket may exist in multiple conformations. The compensatory set of mutations in Q151Mc, particularly F116Y, restricts the side chain flexibility of M151 and helps restore the DNA polymerization efficiency of the enzyme. The altered dNTP-binding pocket in Q151Mc RT has the Q151-R72 hydrogen bond removed and has a switched conformation for the key conserved residue R72 compared to that in wild-type RT. On the basis of a modeled structure of hepatitis B virus (HBV) polymerase, the residues R72, Y116, M151, and M184 in Q151Mc HIV-1 RT are conserved in wild-type HBV polymerase as residues R41, Y89, M171, and M204, respectively; functionally, both Q151Mc HIV-1 and wild-type HBV are resistant to dideoxynucleoside analogs.

  5. Activities of the human immunodeficiency virus type 1 (HIV-1) protease inhibitor nelfinavir mesylate in combination with reverse transcriptase and protease inhibitors against acute HIV-1 infection in vitro.

    Science.gov (United States)

    Patick, A K; Boritzki, T J; Bloom, L A

    1997-10-01

    Nelfinavir mesylate (formerly AG1343) is a potent and selective, nonpeptidic inhibitor of human immunodeficiency virus type 1 (HIV-1) protease that was discovered by protein structure-based design methodologies. We evaluated the antiviral and cytotoxic effects of two-drug combinations of nelfinavir with the clinically approved antiretroviral therapeutics zidovudine (ZDV), lamivudine (3TC), dideoxycytidine (ddC; zalcitabine), stavudine (d4T), didanosine (ddI), indinavir, saquinavir, and ritonavir and a three-drug combination of nelfinavir with ZDV and 3TC against an acute HIV-1 strain RF infection of CEM-SS cells in vitro. Quantitative assessment of drug interaction was evaluated by a universal response surface approach (W. R. Greco, G. Bravo, and J. C. Parsons, Pharm. Rev. 47:331-385, 1995) and by the method of M. N. Prichard and C. Shipman (Antiviral Res. 14:181-206, 1990). Both analytical methods yielded similar results and showed that the two-drug combinations of nelfinavir with the reverse transcriptase inhibitors ZDV, 3TC, ddI, d4T, and ddC and the three-drug combination with ZDV and 3TC resulted in additive to statistically significant synergistic interactions. In a similar manner, the combination of nelfinavir with the three protease inhibitors resulted in additive (ritonavir and saquinavir) to slightly antagonistic (indinavir) interactions. In all combinations, minimal cellular cytotoxicity was observed with any drug alone and in combination. These results suggest that administration of combinations of the appropriate doses of nelfinavir with other currently approved antiretroviral therapeutic agents in vivo may result in enhanced antiviral activity with no associated increase in cellular cytotoxicity.

  6. Prevalence of genotypic HIV-1 drug resistance in Thailand, 2002

    Directory of Open Access Journals (Sweden)

    Watitpun Chotip

    2003-03-01

    Full Text Available Abstract Background The prices of reverse transcriptase (RT inhibitors in Thailand have been reduced since December 1, 2001. It is expected that reduction in the price of these inhibitors may influence the drug resistance mutation pattern of HIV-1 among infected people. This study reports the frequency of HIV-1 genetic mutation associated with drug resistance in antiretroviral-treated patients from Thailand. Methods Genotypic resistance testing was performed on samples collected in 2002 from 88 HIV-1 infected individuals. Automated DNA sequencing was used to genotype the HIV-1 polymerase gene isolated from patients' plasma. Results Resistance to protease inhibitors, nucleoside and non-nucleoside reverse transcriptase inhibitors were found in 10 (12%, 42 (48% and 19 (21% patients, respectively. The most common drug resistance mutations in the protease gene were at codon 82 (8%, 90 (7% and 54 (6%, whereas resistant mutations at codon 215 (45%, 67 (40%, 41 (38% and 184 (27% were commonly found in the RT gene. This finding indicates that genotypic resistance to nucleoside reverse transcriptase inhibitors was prevalent in 2002. The frequency of resistant mutations corresponding to non-nucleoside reverse transcriptase inhibitors was three times higher-, while resistant mutation corresponding to protease inhibitors was two times lower than those frequencies determined in 2001. Conclusion This study shows that the frequencies of RT inhibitor resistance mutations have been increased after the reduction in the price of RT inhibitors since December 2001. We believe that this was an important factor that influenced the mutation patterns of HIV-1 protease and RT genes in Thailand.

  7. Towards discovering dual functional inhibitors against both wild type and K103N mutant HIV-1 reverse transcriptases: molecular docking and QSAR studies on 4,1-benzoxazepinone analogues

    Science.gov (United States)

    Zhang, Zhenshan; Zheng, Mingyue; Du, Li; Shen, Jianhua; Luo, Xiaomin; Zhu, Weiliang; Jiang, Hualiang

    2006-05-01

    To find useful information for discovering dual functional inhibitors against both wild type (WT) and K103N mutant reverse transcriptases (RTs) of HIV-1, molecular docking and 3D-QSAR approaches were applied to a set of twenty-five 4,1-benzoxazepinone analogues of efavirenz (SUSTIVA®), some of them are active against the two RTs. 3D-QSAR models were constructed, based on their binding conformations determined by molecular docking, with r 2 cv values ranging from 0.656 to 0.834 for CoMFA and CoMSIA, respectively. The models were then validated to be highly predictive and extrapolative by inhibitors in two test sets with different molecular skeletons. Furthermore, CoMFA models were found to be well matched with the binding sites of both WT and K103N RTs. Finally, a reasonable pharmacophore model of 4,1-benzoxazepinones were established. The application of the model not only successfully differentiated the experimentally determined inhibitors from non-inhibitors, but also discovered two potent inhibitors from the compound database SPECS. On the basis of both the 3D-QSAR and pharmacophore models, new clues for discovering and designing potent dual functional drug leads against HIV-1 were proposed: (i) adopting positively charged aliphatic group at the cis-substituent of C3; (ii) reducing the electronic density at the position of O4; (iii) positioning a small branched aliphatic group at position of C5; (iv) using the negatively charged bulky substituents at position of C7.

  8. Indolylarylsulfones as HIV-1 non-nucleoside reverse transcriptase inhibitors: new cyclic substituents at indole-2-carboxamide.

    Science.gov (United States)

    La Regina, Giuseppe; Coluccia, Antonio; Brancale, Andrea; Piscitelli, Francesco; Gatti, Valerio; Maga, Giovanni; Samuele, Alberta; Pannecouque, Christophe; Schols, Dominique; Balzarini, Jan; Novellino, Ettore; Silvestri, Romano

    2011-03-24

    New indolylarylsulfone derivatives bearing cyclic substituents at indole-2-carboxamide linked through a methylene/ethylene spacer were potent inhibitors of the WT HIV-1 replication in CEM and PBMC cells with inhibitory concentrations in the low nanomolar range. Against the mutant L100I and K103N RT HIV-1 strains in MT-4 cells, compounds 20, 24-26, 36, and 40 showed antiviral potency superior to that of NVP and EFV. Against these mutant strains, derivatives 20, 24-26, and 40 were equipotent to ETV. Molecular docking experiments on this novel series of IAS analogues have also suggested that the H-bond interaction between the nitrogen atom in the carboxamide chain of IAS and Glu138:B is important in the binding of these compounds. These results are in accordance with the experimental data obtained on the WT and on the mutant HIV-1 strains tested.

  9. 3D QSAR Studies of DAMNI Analogs as Possible Non-nucleoside Reverse Transcriptase Inhibitors

    Directory of Open Access Journals (Sweden)

    S. Ganguly

    2008-01-01

    Full Text Available The non-nucleoside inhibitors of HIV-1-reverse transcriptase (NNRTIs are an important class of drugs employed in antiviral therapy. Recently, a novel family of NNRTIs commonly referred to as 1-[2-diarylmethoxy] ethyl 2-methyl-5-nitroimidazoles (DAMNI derivatives have been discovered. The 3D-QSAR studies on DAMNI derivatives as NNRTIs was performed by comparative molecular field analysis (CoMFA and comparative molecular similarity indices analysis (CoMSIA methods to determine the factors required for the activity of these compounds. The global minimum energy conformer of the template molecule 15, the most active molecule of the series, was obtained by simulated annealing method and used to build the structures of the molecules in the dataset. The combination of steric and electrostatic fields in CoMSIA gave the best results with cross-validated and conventional correlation coefficients of 0.654 and 0.928 respectively. The predictive ability of CoMFA and CoMSIA were determined using a test set of ten DAMNI derivatives giving predictive correlation coefficients of 0.92 and 0.98 respectively indicating good predictive power. Further, the robustness of the models was verified by bootstrapping analysis. The information obtained from CoMFA and CoMSIA 3D contour maps may be of utility in the design of more potent DAMNI analogs as NNRTIs in future.

  10. Novinky v léčbě HIV infekce

    Czech Academy of Sciences Publication Activity Database

    Krečmerová, Marcela

    2012-01-01

    Roč. 8, č. 1 (2012), s. 18-21 ISSN 1801-2434 Institutional support: RVO:61388963 Keywords : HIV * AIDS * cART * HAART * tenofovir * reverse transcriptase * HIV protease * mikrobicides Subject RIV: CC - Organic Chemistry

  11. Design and synthesis of N₁-aryl-benzimidazoles 2-substituted as novel HIV-1 non-nucleoside reverse transcriptase inhibitors.

    Science.gov (United States)

    Monforte, Anna-Maria; Ferro, Stefania; De Luca, Laura; Lo Surdo, Giuseppa; Morreale, Francesca; Pannecouque, Christophe; Balzarini, Jan; Chimirri, Alba

    2014-02-15

    A series of novel N1-aryl-2-arylthioacetamido-benzimidazoles were synthesized and evaluated as inhibitors of human immunodeficiency virus type-1 (HIV-1). Some of them proved to be effective in inhibiting HIV-1 replication at submicromolar and nanomolar concentration acting as HIV-1 non-nucleoside RT inhibitors (NNRTIs), with low cytotoxicity. The preliminary structure-activity relationship (SAR) of these new derivatives was discussed and rationalized by docking studies. Copyright © 2014 Elsevier Ltd. All rights reserved.

  12. Reverse Transcriptase drug resistance mutations in HIV-1 Subtype C infected patients on ART in Karonga District, Malawi

    LENUS (Irish Health Repository)

    Bansode, Vijay B

    2011-10-13

    Abstract Background Drug resistance testing before initiation of, or during, antiretroviral therapy (ART) is not routinely performed in resource-limited settings. High levels of viral resistance circulating within the population will have impact on treatment programs by increasing the chances of transmission of resistant strains and treatment failure. Here, we investigate Drug Resistance Mutations (DRMs) from blood samples obtained at regular intervals from patients on ART (Baseline-22 months) in Karonga District, Malawi. One hundred and forty nine reverse transcriptase (RT) consensus sequences were obtained via nested PCR and automated sequencing from blood samples collected at three-month intervals from 75 HIV-1 subtype C infected individuals in the ART programme. Results Fifteen individuals showed DRMs, and in ten individuals DRMs were seen from baseline samples (reported to be ART naïve). Three individuals in whom no DRMs were observed at baseline showed the emergence of DRMs during ART exposure. Four individuals who did show DRMs at baseline showed additional DRMs at subsequent time points, while two individuals showed evidence of DRMs at baseline and either no DRMs, or different DRMs, at later timepoints. Three individuals had immune failure but none appeared to be failing clinically. Conclusion Despite the presence of DRMs to drugs included in the current regimen in some individuals, and immune failure in three, no signs of clinical failure were seen during this study. This cohort will continue to be monitored as part of the Karonga Prevention Study so that the long-term impact of these mutations can be assessed. Documenting proviral population is also important in monitoring the emergence of drug resistance as selective pressure provided by ART compromises the current plasma population, archived viruses can re-emerge

  13. Similarities between long interspersed element-1 (LINE-1) reverse transcriptase and telomerase.

    Science.gov (United States)

    Kopera, Huira C; Moldovan, John B; Morrish, Tammy A; Garcia-Perez, Jose Luis; Moran, John V

    2011-12-20

    Long interspersed element-1 (LINE-1 or L1) retrotransposons encode two proteins (ORF1p and ORF2p) that contain activities required for conventional retrotransposition by a mechanism termed target-site primed reverse transcription. Previous experiments in XRCC4 or DNA protein kinase catalytic subunit-deficient CHO cell lines, which are defective for the nonhomologous end-joining DNA repair pathway, revealed an alternative endonuclease-independent (ENi) pathway for L1 retrotransposition. Interestingly, some ENi retrotransposition events in DNA protein kinase catalytic subunit-deficient cells are targeted to dysfunctional telomeres. Here we used an in vitro assay to detect L1 reverse transcriptase activity to demonstrate that wild-type or endonuclease-defective L1 ribonucleoprotein particles can use oligonucleotide adapters that mimic telomeric ends as primers to initiate the reverse transcription of L1 mRNA. Importantly, these ribonucleoprotein particles also contain a nuclease activity that can process the oligonucleotide adapters before the initiation of reverse transcription. Finally, we demonstrate that ORF1p is not strictly required for ENi retrotransposition at dysfunctional telomeres. Thus, these data further highlight similarities between the mechanism of ENi L1 retrotransposition and telomerase.

  14. A comparison of the ability of rilpivirine (TMC278 and selected analogues to inhibit clinically relevant HIV-1 reverse transcriptase mutants

    Directory of Open Access Journals (Sweden)

    Johnson Barry C

    2012-12-01

    Full Text Available Abstract Background The recently approved anti-AIDS drug rilpivirine (TMC278, Edurant is a nonnucleoside inhibitor (NNRTI that binds to reverse transcriptase (RT and allosterically blocks the chemical step of DNA synthesis. In contrast to earlier NNRTIs, rilpivirine retains potency against well-characterized, clinically relevant RT mutants. Many structural analogues of rilpivirine are described in the patent literature, but detailed analyses of their antiviral activities have not been published. This work addresses the ability of several of these analogues to inhibit the replication of wild-type (WT and drug-resistant HIV-1. Results We used a combination of structure activity relationships and X-ray crystallography to examine NNRTIs that are structurally related to rilpivirine to determine their ability to inhibit WT RT and several clinically relevant RT mutants. Several analogues showed broad activity with only modest losses of potency when challenged with drug-resistant viruses. Structural analyses (crystallography or modeling of several analogues whose potencies were reduced by RT mutations provide insight into why these compounds were less effective. Conclusions Subtle variations between compounds can lead to profound differences in their activities and resistance profiles. Compounds with larger substitutions replacing the pyrimidine and benzonitrile groups of rilpivirine, which reorient pocket residues, tend to lose more activity against the mutants we tested. These results provide a deeper understanding of how rilpivirine and related compounds interact with the NNRTI binding pocket and should facilitate development of novel inhibitors.

  15. Characterization of active reverse transcriptase and nucleoprotein complexes of the yeast retrotransposon Ty3 in vitro.

    Science.gov (United States)

    Cristofari, G; Gabus, C; Ficheux, D; Bona, M; Le Grice, S F; Darlix, J L

    1999-12-17

    Human immunodeficiency virus (HIV) and the distantly related yeast Ty3 retrotransposon encode reverse transcriptase (RT) and a nucleic acid-binding protein designated nucleocapsid protein (NCp) with either one or two zinc fingers, required for HIV-1 replication and Ty3 transposition, respectively. In vitro binding of HIV-1 NCp7 to viral 5' RNA and primer tRNA(3)(Lys) catalyzes formation of nucleoprotein complexes resembling the virion nucleocapsid. Nucleocapsid complex formation functions in viral RNA dimerization and tRNA annealing to the primer binding site (PBS). RT is recruited in these nucleoprotein complexes and synthesizes minus-strand cDNA initiated at the PBS. Recent results on yeast Ty3 have shown that the homologous NCp9 promotes annealing of primer tRNA(i)(Met) to a 5'-3' bipartite PBS, allowing RNA:tRNA dimer formation and initiation of cDNA synthesis at the 5' PBS (). To compare specific cDNA synthesis in a retrotransposon and HIV-1, we have established a Ty3 model system comprising Ty3 RNA with the 5'-3' PBS, primer tRNA(i)(Met), NCp9, and for the first time, highly purified Ty3 RT. Here we report that Ty3 RT is as active as retroviral HIV-1 or murine leukemia virus RT using a synthetic template-primer system. Moreover, and in contrast to what was found with retroviral RTs, retrotransposon Ty3 RT was unable to direct cDNA synthesis by self-priming. We also show that Ty3 nucleoprotein complexes were formed in vitro and that the N terminus of NCp9, but not the zinc finger, is required for complex formation, tRNA annealing to the PBS, RNA dimerization, and primer tRNA-directed cDNA synthesis by Ty3 RT. These results indicate that NCp9 chaperones bona fide cDNA synthesis by RT in the yeast Ty3 retrotransposon, as illustrated for NCp7 in HIV-1, reinforcing the notion that Ty3 NCp9 is an ancestor of HIV-1 NCp7.

  16. Lentin, a novel and potent antifungal protein from shitake mushroom with inhibitory effects on activity of human immunodeficiency virus-1 reverse transcriptase and proliferation of leukemia cells.

    Science.gov (United States)

    Ngai, Patrick H K; Ng, T B

    2003-11-14

    From the fruiting bodies of the edible mushroom Lentinus edodes, a novel protein designated lentin with potent antifungal activity was isolated. Lentin was unadsorbed on DEAE-cellulose, and adsorbed on Affi-gel blue gel and Mono S. The N-terminal sequence of lentin manifested similarity to endoglucanase. Lentin, which had a molecular mass of 27.5 kDa, inhibited mycelial growth in a variety of fungal species including Physalospora piricola, Botrytis cinerea and Mycosphaerella arachidicola. Lentin also exerted an inhibitory activity on HIV-1 reverse transcriptase and proliferation of leukemia cells.

  17. Crystallographic Study of a Novel Sub-Nanomolar Inhibitor Provides Insight on the Binding Interactions of Alkenyldiarylmethanes with Human Immunodeficiency Virus-1 (HIV-1) Reverse Transcriptase†

    Science.gov (United States)

    Cullen, Matthew D.; Ho, William C.; Bauman, Joseph D.; Das, Kalyan; Arnold, Eddy; Hartman, Tracy L.; Watson, Karen M.; Buckheit, Robert W.; Pannecouque, Christophe; De Clercq, Erik; Cushman, Mark

    2009-01-01

    Two crystal structures have been solved for separate complexes of alkenyldiarylmethane (ADAM) non-nucleoside reverse transcriptase inhibitors (NNRTI) 3 and 4 with HIV-1 reverse transcriptase (RT). The structures reveal inhibitor binding is exclusively hydrophobic in nature and the shape of the inhibitor-bound NNRTI binding pocket is unique among other reported inhibitor-RT crystal structures. Primarily, ADAMs 3 and 4 protrude from a large gap in the backside of the binding pocket, placing portions of the inhibitors unusually close to the polymerase active site and allowing 3 to form a weak hydrogen bond with Lys223. The lack of additional stabilizing interactions, beyond the observed hydrophobic surface contacts, between 4 and RT is quite perplexing given the extreme potency of the compound (IC50 ≤ nM). ADAM 4 was designed to be hydrolytically stable in blood plasma, and an investigation of its hydrolysis in rat plasma demonstrated it has a significantly prolonged half-life in comparison to ADAM lead compounds 1 and 2. PMID:19775161

  18. Lower genetic variability of HIV-1 and antiretroviral drug resistance in pregnant women from the state of Pará, Brazil.

    Science.gov (United States)

    Machado, Luiz Fernando Almeida; Costa, Iran Barros; Folha, Maria Nazaré; da Luz, Anderson Levy Bessa; Vallinoto, Antonio Carlos Rosário; Ishak, Ricardo; Ishak, Marluisa Oliveira Guimarães

    2017-04-12

    The present study aimed to describe the genetic diversity of HIV-1, as well as the resistance profile of the viruses identified in HIV-1 infected pregnant women under antiretroviral therapy in the state of Pará, Northern Brazil. Blood samples were collected from 45 HIV-1 infected pregnant to determine the virus subtypes according to the HIV-1 protease (PR) gene and part of the HIV-1 reverse transcriptase (RT) gene by sequencing the nucleotides of these regions. Drug resistance mutations and susceptibility to antiretroviral drugs were analyzed by the Stanford HIV Drug Resistance Database. Out of 45 samples, only 34 could be amplified for PR and 30 for RT. Regarding the PR gene, subtypes B (97.1%) and C (2.9%) were identified; for the RT gene, subtypes B (90.0%), F (6.7%), and C (3.3%) were detected. Resistance to protease inhibitors (PI) was identified in 5.8% of the pregnant, and mutations conferring resistance to nucleoside reverse transcriptase inhibitors were found in 3.3%, while mutations conferring resistance to non-nucleoside reverse transcriptase inhibitors were found in 3.3%. These results showed a low frequency of strains resistant to antiretroviral drugs, the prevalence of subtypes B and F, and the persistent low transmission of subtype C in pregnant of the state of Pará, Brazil.

  19. Structure-based design, synthesis, and biological evaluation of novel pyrrolyl aryl sulfones: HIV-1 non-nucleoside reverse transcriptase inhibitors active at nanomolar concentrations.

    Science.gov (United States)

    Artico, M; Silvestri, R; Pagnozzi, E; Bruno, B; Novellino, E; Greco, G; Massa, S; Ettorre, A; Loi, A G; Scintu, F; La Colla, P

    2000-05-04

    Pyrrolyl aryl sulfones (PASs) have been recently reported as a new class of human immunodeficiency virus type 1 (HIV-1) reverse transcriptase (RT) inhibitors acting at the non-nucleoside binding site of this enzyme (Artico, M.; et al. J. Med. Chem. 1996, 39, 522-530). Compound 3, the most potent inhibitor within the series (EC(50) = 0.14 microM, IC(50) = 0.4 microM, and SI > 1429), was then selected as a lead compound for a synthetic project based on molecular modeling studies. Using the three-dimensional structure of RT cocrystallized with the alpha-APA derivative R95845, we derived a model of the RT/3 complex by taking into account previously developed structure-activity relationships. Inspection of this model and docking calculations on virtual compounds prompted the design of novel PAS derivatives and related analogues. Our computational approach proved to be effective in making qualitative predictions, that is in discriminating active versus inactive compounds. Among the compounds synthesized and tested, 20 was the most active one, with EC(50) = 0.045 microM, IC(50) = 0.05 microM, and SI = 5333. Compared with the lead 3, these values represent a 3- and 8-fold improvement in the cell-based and enzyme assays, respectively, together with the highest selectivity achieved so far in the PAS series.

  20. Human Immunodeficiency Virus type-1 reverse transcriptase exists as post-translationally modified forms in virions and cells

    Directory of Open Access Journals (Sweden)

    Warrilow David

    2008-12-01

    Full Text Available Abstract Background HIV-1 reverse transcriptase (RT is a heterodimer composed of p66 and p51 subunits and is responsible for reverse transcription of the viral RNA genome into DNA. RT can be post-translationally modified in vitro which may be an important mechanism for regulating RT activity. Here we report detection of different p66 and p51 RT isoforms by 2D gel electrophoresis in virions and infected cells. Results Major isoforms of the p66 and p51 RT subunits were observed, with pI's of 8.44 and 8.31 respectively (p668.44 and p518.31. The same major isoforms were present in virions, virus-infected cell lysates and intracellular reverse transcription complexes (RTCs, and their presence in RTCs suggested that these are likely to be the forms that function in reverse transcription. Several minor RT isoforms were also observed. The observed pIs of the RT isoforms differed from the pI of theoretical unmodified RT (p668.53 and p518.60, suggesting that most of the RT protein in virions and cells is post-translationally modified. The modifications of p668.44 and p518.31 differed from each other indicating selective modification of the different RT subunits. The susceptibility of RT isoforms to phosphatase treatment suggested that some of these modifications were due to phosphorylation. Dephosphorylation, however, had no effect on in vitro RT activity associated with virions, infected cells or RTCs suggesting that the phospho-isoforms do not make a major contribution to RT activity in an in vitro assay. Conclusion The same major isoform of p66 and p51 RT is found in virions, infected cells and RTC's and both of these subunits are post-translationally modified. This post-translational modification of RT may be important for the function of RT inside the cell.

  1. Antitumor effect of combination of the inhibitors of two new oncotargets: proton pumps and reverse transcriptase.

    Science.gov (United States)

    Lugini, Luana; Sciamanna, Ilaria; Federici, Cristina; Iessi, Elisabetta; Spugnini, Enrico Pierluigi; Fais, Stefano

    2017-01-17

    Tumor therapy needs new approaches in order to improve efficacy and reduce toxicity of the current treatments. The acidic microenvironment and the expression of high levels of endogenous non-telomerase reverse transcriptase (RT) are common features of malignant tumor cells. The anti-acidic proton pump inhibitor Lansoprazole (LAN) and the non-nucleoside RT inhibitor Efavirenz (EFV) have shown independent antitumor efficacy. LAN has shown to counteract drug tumor resistance. We tested the hypothesis that combination of LAN and EFV may improve the overall antitumor effects. We thus pretreated human metastatic melanoma cells with LAN and then with EFV, both in 2D and 3D spheroid models. We evaluated the treatment effect by proliferation and cell death/apoptosis assays in classical and in pulse administration experiments. The action of EFV was negatively affected by the tumor microenvironmental acidity, and LAN pretreatment overcame the problem. LAN potentiated the cytotoxicity of EFV to melanoma cells and, when administered during the drug interruption period, prevented the replacement of tumor cell growth.This study supports the implementation of the current therapies with combination of Proton Pumps and Reverse Transcriptase inhibitors.

  2. Anti-HBV treatment induces novel reverse transcriptase mutations with reflective effect on HBV S antigen

    NARCIS (Netherlands)

    Cento, Valeria; van Hemert, Formijn; Neumann-Fraune, Maria; Mirabelli, Carmen; Di Maio, Velia-Chiara; Salpini, Romina; Bertoli, Ada; Micheli, Valeria; Gubertini, Guido; Romano, Sara; Visca, Michela; de Sanctis, Giuseppe-Maria; Berkhout, Ben; Marino, Nicoletta; Mazzotta, Francesco; Cappiello, Giuseppina; Spanò, Alberto; Sarrecchia, Cesare; Ceccherini-Silberstein, Francesca; Andreoni, Massimo; Angelico, Mario; Verheyen, Jens; Perno, Carlo Federico; Svicher, Valentina

    2013-01-01

    The identification of novel reverse-transcriptase (RT) drug-resistance mutations is critical in predicting the probability of success to anti-HBV treatment. Furthermore, due to HBV-RT/HBsAg gene-overlap, they can have an impact on HBsAg-detection and quantification. 356 full-length HBV-RT sequences

  3. Testing of viscous anti-HIV microbicides using Lactobacillus

    OpenAIRE

    Moncla, B.J.; Pryke, K.; Rohan, L. C.; Yang, H.

    2011-01-01

    The development of topical microbicides for intravaginal use to prevent HIV infection requires that the drugs and formulated products be nontoxic to the endogenous vaginal Lactobacillus. In 30 min exposure tests we found dapivirine, tenofovir and UC781 (reverse transcriptase inhibitor anti-HIV drugs) as pure drugs or formulated as film or gel products were not deleterious to Lactobacillus species; however, PSC-RANTES (a synthetic CCR5 antagonist) killed 2 strains of Lactobacillus jensenii. To...

  4. Inhibition of human immunodeficiency virus type 1 infection by the candidate microbicide dapivirine, a nonnucleoside reverse transcriptase inhibitor.

    Science.gov (United States)

    Fletcher, P; Harman, S; Azijn, H; Armanasco, N; Manlow, P; Perumal, D; de Bethune, M-P; Nuttall, J; Romano, J; Shattock, R

    2009-02-01

    Heterosexual transmission of human immunodeficiency virus (HIV) remains the major route of infection worldwide; thus, there is an urgent need for additional prevention strategies, particularly strategies that could be controlled by women, such as topical microbicides. Potential microbicide candidates must be both safe and effective. Using cellular and tissue explant models, we have evaluated the activity of the nonnucleoside reverse transcriptase inhibitor (NNRTI) dapivirine as a vaginal microbicide. In tissue compatibility studies, dapivirine was well tolerated by epithelial cells, T cells, macrophages, and cervical tissue explants. Dapivirine demonstrated potent dose-dependent inhibitory effects against a broad panel of HIV type 1 isolates from different clades. Furthermore, dapivirine demonstrated potent activity against a wide range of NNRTI-resistant isolates. In human cervical explant cultures, dapivirine was able not only to inhibit direct infection of mucosal tissue but also to prevent the dissemination of the virus by migratory cells. Activity was retained in the presence of semen or a cervical mucus simulant. Furthermore, dapivirine demonstrated prolonged inhibitory effects: it was able to prevent both localized and disseminated infection for as long as 6 days posttreatment. The prolonged protection observed following pretreatment of genital tissue and the lack of observable toxicity suggest that dapivirine has considerable promise as a potential microbicide candidate.

  5. Inhibition of Human Immunodeficiency Virus Type 1 Infection by the Candidate Microbicide Dapivirine, a Nonnucleoside Reverse Transcriptase Inhibitor▿

    Science.gov (United States)

    Fletcher, P.; Harman, S.; Azijn, H.; Armanasco, N.; Manlow, P.; Perumal, D.; de Bethune, M.-P.; Nuttall, J.; Romano, J.; Shattock, R.

    2009-01-01

    Heterosexual transmission of human immunodeficiency virus (HIV) remains the major route of infection worldwide; thus, there is an urgent need for additional prevention strategies, particularly strategies that could be controlled by women, such as topical microbicides. Potential microbicide candidates must be both safe and effective. Using cellular and tissue explant models, we have evaluated the activity of the nonnucleoside reverse transcriptase inhibitor (NNRTI) dapivirine as a vaginal microbicide. In tissue compatibility studies, dapivirine was well tolerated by epithelial cells, T cells, macrophages, and cervical tissue explants. Dapivirine demonstrated potent dose-dependent inhibitory effects against a broad panel of HIV type 1 isolates from different clades. Furthermore, dapivirine demonstrated potent activity against a wide range of NNRTI-resistant isolates. In human cervical explant cultures, dapivirine was able not only to inhibit direct infection of mucosal tissue but also to prevent the dissemination of the virus by migratory cells. Activity was retained in the presence of semen or a cervical mucus simulant. Furthermore, dapivirine demonstrated prolonged inhibitory effects: it was able to prevent both localized and disseminated infection for as long as 6 days posttreatment. The prolonged protection observed following pretreatment of genital tissue and the lack of observable toxicity suggest that dapivirine has considerable promise as a potential microbicide candidate. PMID:19029331

  6. T lymphocytes among HIV-infected and -uninfected infants: CD4/CD8 ratio as a potential tool in diagnosis of infection in infants under the age of 2 years

    OpenAIRE

    Bikoue Arsene; Gwanzura Christine; Tobaiwa Ocean; Rusakaniko Simbarashe; Nathoo Kusum J; Katzenstein David A; Zijenah Lynn S; Nhembe Margaret; Matibe Petronella; Janossy George

    2005-01-01

    Abstract Background Serologic tests for HIV infection in infants less than 18 months do not differentiate exposure and infection since maternally acquired IgG antibodies may be detected in infants. Thus, the gold standard for diagnosis of HIV-1 infection in infants under the age of 2 years is DNA or reverse transcriptase polymerase chain reaction. There is an urgent need to evaluate alternative and cost effective laboratory methods for early diagnosis of infant HIV-1 infection as well as iden...

  7. Telomerase Reverse Transcriptase Deficiency Prevents Neointima Formation Through Chromatin Silencing of E2F1 Target Genes.

    Science.gov (United States)

    Endorf, Elizabeth B; Qing, Hua; Aono, Jun; Terami, Naoto; Doyon, Geneviève; Hyzny, Eric; Jones, Karrie L; Findeisen, Hannes M; Bruemmer, Dennis

    2017-02-01

    Aberrant proliferation of smooth muscle cells (SMC) in response to injury induces pathological vascular remodeling during atherosclerosis and neointima formation. Telomerase is rate limiting for tissue renewal and cell replication; however, the physiological role of telomerase in vascular diseases remains to be determined. The goal of the present study was to determine whether telomerase reverse transcriptase (TERT) affects proliferative vascular remodeling and to define the molecular mechanism by which TERT supports SMC proliferation. We first demonstrate high levels of TERT expression in replicating SMC of atherosclerotic and neointimal lesions. Using a model of guidewire-induced arterial injury, we demonstrate decreased neointima formation in TERT-deficient mice. Studies in SMC isolated from TERT-deficient and TERT overexpressing mice with normal telomere length established that TERT is necessary and sufficient for cell proliferation. TERT deficiency did not induce a senescent phenotype but resulted in G1 arrest albeit hyperphosphorylation of the retinoblastoma protein. This proliferative arrest was associated with stable silencing of the E2F1-dependent S-phase gene expression program and not reversed by ectopic overexpression of E2F1. Finally, chromatin immunoprecipitation and accessibility assays revealed that TERT is recruited to E2F1 target sites and promotes chromatin accessibility for E2F1 by facilitating the acquisition of permissive histone modifications. These data indicate a previously unrecognized role for TERT in neointima formation through epigenetic regulation of proliferative gene expression in SMC. © 2016 American Heart Association, Inc.

  8. Detection of SYT-SSX mutant transcripts in formalin-fixed paraffin-embedded sarcoma tissues using one-step reverse transcriptase real-time PCR.

    Science.gov (United States)

    Norlelawati, A T; Mohd Danial, G; Nora, H; Nadia, O; Zatur Rawihah, K; Nor Zamzila, A; Naznin, M

    2016-04-01

    Synovial sarcoma (SS) is a rare cancer and accounts for 5-10% of adult soft tissue sarcomas. Making an accurate diagnosis is difficult due to the overlapping histological features of SS with other types of sarcomas and the non-specific immunohistochemistry profile findings. Molecular testing is thus considered necessary to confirm the diagnosis since more than 90% of SS cases carry the transcript of t(X;18)(p11.2;q11.2). The purpose of this study is to diagnose SS at molecular level by testing for t(X;18) fusion-transcript expression through One-step reverse transcriptase real-time Polymerase Chain Reaction (PCR). Formalin-fixed paraffin-embedded tissue blocks of 23 cases of soft tissue sarcomas, which included 5 and 8 cases reported as SS as the primary diagnosis and differential diagnosis respectively, were retrieved from the Department of Pathology, Tengku Ampuan Afzan Hospital, Kuantan, Pahang. RNA was purified from the tissue block sections and then subjected to One-step reverse transcriptase real-time PCR using sequence specific hydrolysis probes for simultaneous detection of either SYT-SSX1 or SYT-SSX2 fusion transcript. Of the 23 cases, 4 cases were found to be positive for SYT-SSX fusion transcript in which 2 were diagnosed as SS whereas in the 2 other cases, SS was the differential diagnosis. Three cases were excluded due to failure of both amplification assays SYT-SSX and control β-2-microglobulin. The remaining 16 cases were negative for the fusion transcript. This study has shown that the application of One-Step reverse transcriptase real time PCR for the detection SYT-SSX transcript is feasible as an aid in confirming the diagnosis of synovial sarcoma.

  9. Trans-activation of the 5' to 3' viral DNA strand transfer by nucleocapsid protein during reverse transcription of HIV1 RNA.

    Science.gov (United States)

    Darlix, J L; Vincent, A; Gabus, C; de Rocquigny, H; Roques, B

    1993-08-01

    Two DNA strand transfer reactions take place during reverse transcription of the retroviral genome. The first transfer, that of the minus-strand strong stop DNA from the 5' end of the viral RNA to the 3' end, has been studied in vitro with two RNAs mimicking the 5' and 3' regions of the HIV1 genome and with nucleocapsid protein, NCp7, and reverse transcriptase. The results show that NCp7 strongly activates the 5' to 3' DNA strand transfer during reverse transcription while a basic peptide resembling NCp7 is inactive. Activation of the first transfer by several NCp7 derived peptides and the influence of the terminal redundancies (R) present at the 5' and 3' ends of HIV1 RNA were also examined. The first transfer is optimal in the presence of intact NCp7 and necessitates R on both the 5' and 3' RNAs. Sequencing of full length viral DNA products reveals approximately 40% misincorporations at the first nucleotide beyond the transfer point. If such base misincorporations occur during proviral DNA synthesis with possible homologous recombinations it may well contribute to the high level of genetic variability of HIV.

  10. Cyclic GMP-AMP Synthase is an Innate Immune Sensor of HIV and Other Retroviruses

    OpenAIRE

    Gao, Daxing; Wu, Jiaxi; Wu, You-Tong; Du, Fenghe; Aroh, Chukwuemika; Yan, Nan; Sun, Lijun; Chen, Zhijian J.

    2013-01-01

    Retroviruses, including HIV, can activate innate immune responses, but the host sensors for retroviruses are largely unknown. Here we show that HIV infection activates cyclic-GMP-AMP (cGAMP) synthase (cGAS) to produce cGAMP, which binds to and activates the adaptor protein STING to induce type-I interferons and other cytokines. Inhibitors of HIV reverse transcriptase, but not integrase, abrogated interferon-β induction by the virus, suggesting that the reverse transcribed HIV DNA triggers the...

  11. Imidazo[1,2-a]pyridin-3-amines as potential HIV-1 non-nucleoside reverse transcriptase inhibitors

    CSIR Research Space (South Africa)

    Bode, ML

    2011-06-01

    Full Text Available ? Discovery Studio 2.5.5). The crystal structures of both the wild-type and K103N mutant forms of HIV-1 RT containing the diarylpyrimidine inhibitor rilpivirine (TMC-278) were used (pdb codes MEE and 3MEG, respectively).27 Etravirine (TMC-125... These drugs act by binding to a lipophilic, non-substrate binding pocket located about 10? from the substrate binding site. Binding induces conformational changes in the catalytic site, slowing catalytic activity markedly.3 About fifty structurally diverse...

  12. The telomerase reverse transcriptase subunit from the dimorphic fungus Ustilago maydis.

    Directory of Open Access Journals (Sweden)

    Dolores Bautista-España

    Full Text Available In this study, we investigated the reverse transcriptase subunit of telomerase in the dimorphic fungus Ustilago maydis. This protein (Trt1 contains 1371 amino acids and all of the characteristic TERT motifs. Mutants created by disrupting trt1 had senescent traits, such as delayed growth, low replicative potential, and reduced survival, that were reminiscent of the traits observed in est2 budding yeast mutants. Telomerase activity was observed in wild-type fungus sporidia but not those of the disruption mutant. The introduction of a self-replicating plasmid expressing Trt1 into the mutant strain restored growth proficiency and replicative potential. Analyses of trt1 crosses in planta suggested that Trt1 is necessary for teliospore formation in homozygous disrupted diploids and that telomerase is haploinsufficient in heterozygous diploids. Additionally, terminal restriction fragment analysis in the progeny hinted at alternative survival mechanisms similar to those of budding yeast.

  13. Amarogentin Induces Apoptosis of Liver Cancer Cells via Upregulation of p53 and Downregulation of Human Telomerase Reverse Transcriptase in Mice

    Science.gov (United States)

    Li, Runqin; Zhang, Yinglin

    2016-01-01

    Background and Objective: Amarogentin has been reported to have a preventive effect on liver cancer via inducing cancer cell apoptosis. We attempted to elucidate the roles of p53-associated apoptosis pathways in the chemopreventive mechanism of amarogentin. The findings of this study will facilitate the development of a novel supplementary strategy for the treatment of liver cancer. Materials and Methods: The purity of amarogentin was assessed by high-performance liquid chromatography. The inhibitory ratios of the liver cell lines were determined using a Cell Counting Kit-8 following treatment with a gradient concentration of amarogentin. Cell apoptosis was detected by flow cytometry using annexin V-fluorescein isothiocyanate/propidium iodide kits. The gene and protein expression of p53-associated molecules, such as Akt, human telomerase reverse transcriptase, RelA, and p38, was detected by real-time quantitative polymerase chain reaction, Western blotting, and immunohistochemical staining in liver cancer cells and mouse tumor tissues after treatment with amarogentin. Results: The inhibitory effect of amarogentin on cell proliferation was more obvious in liver cancer cells, and amarogentin was more likely to induce the apoptosis of liver cancer cells than that of normal liver cells. The gene and protein expression levels of Akt, RelA, and human telomerase reverse transcriptase were markedly higher in the control group than in the preventive group and treatment groups. Only the expression of human telomerase reverse transcriptase was downregulated, accompanied by the upregulation of p53. Conclusion: The results of our study suggest that amarogentin promotes apoptosis of liver cancer cells by the upregulation of p53 and downregulation of human telomerase reverse transcriptase and prevents the malignant transformation of these cells. PMID:27402632

  14. Free Energy-Based Virtual Screening and Optimization of RNase H Inhibitors of HIV-1 Reverse Transcriptase.

    Science.gov (United States)

    Zhang, Baofeng; D'Erasmo, Michael P; Murelli, Ryan P; Gallicchio, Emilio

    2016-09-30

    We report the results of a binding free energy-based virtual screening campaign of a library of 77 α-hydroxytropolone derivatives against the challenging RNase H active site of the reverse transcriptase (RT) enzyme of human immunodeficiency virus-1. Multiple protonation states, rotamer states, and binding modalities of each compound were individually evaluated. The work involved more than 300 individual absolute alchemical binding free energy parallel molecular dynamics calculations and over 1 million CPU hours on national computing clusters and a local campus computational grid. The thermodynamic and structural measures obtained in this work rationalize a series of characteristics of this system useful for guiding future synthetic and biochemical efforts. The free energy model identified key ligand-dependent entropic and conformational reorganization processes difficult to capture using standard docking and scoring approaches. Binding free energy-based optimization of the lead compounds emerging from the virtual screen has yielded four compounds with very favorable binding properties, which will be the subject of further experimental investigations. This work is one of the few reported applications of advanced-binding free energy models to large-scale virtual screening and optimization projects. It further demonstrates that, with suitable algorithms and automation, advanced-binding free energy models can have a useful role in early-stage drug-discovery programs.

  15. The future of pre-exposure prophylaxis (PrEP) for human immunodeficiency virus (HIV) infection.

    Science.gov (United States)

    Özdener, Ayşe Elif; Park, Tae Eun; Kalabalik, Julie; Gupta, Rachna

    2017-05-01

    People at high risk for HIV acquisition should be offered pre-exposure prophylaxis (PrEP). Tenofovir disoproxil fumarate (TDF)/emtricitabine (FTC) is currently the only medication recommended for pre-exposure prophylaxis (PrEP) by the Centers for Disease Control and Prevention (CDC) in people at high risk for HIV acquisition. This article will review medications currently under investigation and the future landscape of PrEP therapy. Areas covered: This article will review clinical trials that have investigated nontraditional regimens of TDF/FTC, antiretroviral agents from different drug classes such as integrase strand transfer inhibitors (INSTI), nucleoside reverse transcriptase inhibitors (NRTI), and non-nucleoside reverse transcriptase inhibitors (NNRTI) as potential PrEP therapies. Expert commentary: Currently, there are several investigational drugs in the pipeline for PrEP against HIV infection. Increased utilization of PrEP therapy depends on provider identification of people at high risk for HIV transmission. Advances in PrEP development will expand options and access for people and reduce the risk of HIV acquisition.

  16. Isolation and characterization of reverse transcriptase fragments of LTR retrotransposons from the genome of Chenopodium quinoa (Amaranthaceae).

    Science.gov (United States)

    Kolano, Bozena; Bednara, Edyta; Weiss-Schneeweiss, Hanna

    2013-10-01

    High heterogeneity was observed among conserved domains of reverse transcriptase ( rt ) isolated from quinoa. Only one Ty1- copia rt was highly amplified. Reverse transcriptase sequences were located predominantly in pericentromeric region of quinoa chromosomes. The heterogeneity, genomic abundance, and chromosomal distribution of reverse transcriptase (rt)-coding fragments of Ty1-copia and Ty3-gypsy long terminal repeat retrotransposons were analyzed in the Chenopodium quinoa genome. Conserved domains of the rt gene were amplified and characterized using degenerate oligonucleotide primer pairs. Sequence analyses indicated that half of Ty1-copia rt (51 %) and 39 % of Ty3-gypsy rt fragments contained intact reading frames. High heterogeneity among rt sequences was observed for both Ty1-copia and Ty3-gypsy rt amplicons, with Ty1-copia more heterogeneous than Ty3-gypsy. Most of the isolated rt fragments were present in quinoa genome in low copy numbers, with only one highly amplified Ty1-copia rt sequence family. The gypsy-like RNase H fragments co-amplified with Ty1-copia-degenerate primers were shown to be highly amplified in the quinoa genome indicating either higher abundance of some gypsy families of which rt domains could not be amplified, or independent evolution of this gypsy-region in quinoa. Both Ty1-copia and Ty3-gypsy retrotransposons were preferentially located in pericentromeric heterochromatin of quinoa chromosomes. Phylogenetic analyses of newly amplified rt fragments together with well-characterized retrotransposon families from other organisms allowed identification of major lineages of retroelements in the genome of quinoa and provided preliminary insight into their evolutionary dynamics.

  17. Measuring enzymatic HIV-1 susceptibility to two reverse transcriptase inhibitors as a rapid and simple approach to HIV-1 drug-resistance testing.

    Directory of Open Access Journals (Sweden)

    Dieter Hoffmann

    Full Text Available Simple and cost-effective approaches for HIV drug-resistance testing are highly desirable for managing increasingly expanding HIV-1 infected populations who initiate antiretroviral therapy (ART, particularly in resource-limited settings. Non-nucleoside reverse trancriptase inhibitor (NNRTI-based regimens with an NRTI backbone containing lamivudine (3TC or emtricitabine (FTC are preferred first ART regimens. Failure with these drug combinations typically involves the selection of NNRTI- and/or 3TC/FTC-resistant viruses. Therefore, the availability of simple assays to measure both types of drug resistance is critical. We have developed a high throughput screening test for assessing enzymatic resistance of the HIV-1 RT in plasma to 3TC/FTC and NNRTIs. The test uses the sensitive "Amp-RT" assay with a newly-developed real-time PCR format to screen biochemically for drug resistance in single reactions containing either 3TC-triphosphate (3TC-TP or nevirapine (NVP. Assay cut-offs were defined based on testing a large panel of subtype B and non-subtype B clinical samples with known genotypic profiles. Enzymatic 3TC resistance correlated well with the presence of M184I/V, and reduced NVP susceptibility was strongly associated with the presence of K103N, Y181C/I, Y188L, and G190A/Q. The sensitivity and specificity for detecting resistance were 97.0% and 96.0% in samples with M184V, and 97.4% and 96.2% for samples with NNRTI mutations, respectively. We further demonstrate the utility of an HIV capture method in plasma by using magnetic beads coated with CD44 antibody that eliminates the need for ultracentifugation. Thus our results support the use of this simple approach for distinguishing WT from NNRTI- or 3TC/FTC-resistant viruses in clinical samples. This enzymatic testing is subtype-independent and can assist in the clinical management of diverse populations particularly in resource-limited settings.

  18. Phylogeny and resistance profiles of HIV-1 POL sequences from rectal biopsies and blood

    DEFF Research Database (Denmark)

    Katzenstein, Terese Lea; Petersen, A B; Storgaard, M

    2010-01-01

    The phylogeny and resistance profiles of human immunodeficiency virus type 1 (HIV-1) protease (PR) and reverse transcriptase (RT) sequences were compared among six patients with HIV-1 who had received numerous treatments. RNA and DNA fractions were obtained from concurrent blood and rectal biopsy...

  19. In vitro transfection of the hepatitis B virus PreS2 gene into the human hepatocarcinoma cell line HepG2 induces upregulation of human telomerase reverse transcriptase

    International Nuclear Information System (INIS)

    Liu Hua; Luan Fang; Ju Ying; Shen Hongyu; Gao Lifen; Wang Xiaoyan; Liu Suxia; Zhang Lining; Sun Wensheng; Ma Chunhong

    2007-01-01

    The preS2 domain is the minimal functional unit of transcription activators that is encoded by the Hepatitis B virus (HBV) surface (S) gene. It is present in more than one-third of the HBV-integrates in HBV induced hepatocarcinoma (HCC). To further understand the functional role of PreS2 in hepatocytes, a PreS2 expression plasmid, pcS2, was constructed and stably transfected into HepG2 cells. We conducted growth curve and colony-forming assays to study the impact of PreS2 expression on cell proliferation. Cells transfected with PreS2 proliferated more rapidly and formed colonies in soft agar. PreS2 expressing cells also induced upregulation of human telomerase reverse transcriptase (hTERT) and telomerase activation by RT-PCR and the modified TRAP assay. Blocking expression of hTERT with antisense oligonuleotide reversed the growth rate in cells stably transfected with PreS2. Our data suggest that PreS2 may increase the malignant transformation of human HCC cell line HepG2 by upregulating hTERT and inducing telomerase activation

  20. In vitro transfection of the hepatitis B virus PreS2 gene into the human hepatocarcinoma cell line HepG2 induces upregulation of human telomerase reverse transcriptase

    Energy Technology Data Exchange (ETDEWEB)

    Hua, Liu [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Fang, Luan [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Ying, Ju [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Hongyu, Shen [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Lifen, Gao [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Xiaoyan, Wang [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Suxia, Liu [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Lining, Zhang [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Wensheng, Sun [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Chunhong, Ma [Institute of Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan 250012 (China); Key Laboratory for Experimental Teratology, Ministry of Education (China)]. E-mail: machunhong@sdu.edu.cn

    2007-04-06

    The preS2 domain is the minimal functional unit of transcription activators that is encoded by the Hepatitis B virus (HBV) surface (S) gene. It is present in more than one-third of the HBV-integrates in HBV induced hepatocarcinoma (HCC). To further understand the functional role of PreS2 in hepatocytes, a PreS2 expression plasmid, pcS2, was constructed and stably transfected into HepG2 cells. We conducted growth curve and colony-forming assays to study the impact of PreS2 expression on cell proliferation. Cells transfected with PreS2 proliferated more rapidly and formed colonies in soft agar. PreS2 expressing cells also induced upregulation of human telomerase reverse transcriptase (hTERT) and telomerase activation by RT-PCR and the modified TRAP assay. Blocking expression of hTERT with antisense oligonuleotide reversed the growth rate in cells stably transfected with PreS2. Our data suggest that PreS2 may increase the malignant transformation of human HCC cell line HepG2 by upregulating hTERT and inducing telomerase activation.

  1. Biotechnological applications of mobile group II introns and their reverse transcriptases: gene targeting, RNA-seq, and non-coding RNA analysis.

    Science.gov (United States)

    Enyeart, Peter J; Mohr, Georg; Ellington, Andrew D; Lambowitz, Alan M

    2014-01-13

    Mobile group II introns are bacterial retrotransposons that combine the activities of an autocatalytic intron RNA (a ribozyme) and an intron-encoded reverse transcriptase to insert site-specifically into DNA. They recognize DNA target sites largely by base pairing of sequences within the intron RNA and achieve high DNA target specificity by using the ribozyme active site to couple correct base pairing to RNA-catalyzed intron integration. Algorithms have been developed to program the DNA target site specificity of several mobile group II introns, allowing them to be made into 'targetrons.' Targetrons function for gene targeting in a wide variety of bacteria and typically integrate at efficiencies high enough to be screened easily by colony PCR, without the need for selectable markers. Targetrons have found wide application in microbiological research, enabling gene targeting and genetic engineering of bacteria that had been intractable to other methods. Recently, a thermostable targetron has been developed for use in bacterial thermophiles, and new methods have been developed for using targetrons to position recombinase recognition sites, enabling large-scale genome-editing operations, such as deletions, inversions, insertions, and 'cut-and-pastes' (that is, translocation of large DNA segments), in a wide range of bacteria at high efficiency. Using targetrons in eukaryotes presents challenges due to the difficulties of nuclear localization and sub-optimal magnesium concentrations, although supplementation with magnesium can increase integration efficiency, and directed evolution is being employed to overcome these barriers. Finally, spurred by new methods for expressing group II intron reverse transcriptases that yield large amounts of highly active protein, thermostable group II intron reverse transcriptases from bacterial thermophiles are being used as research tools for a variety of applications, including qRT-PCR and next-generation RNA sequencing (RNA-seq). The

  2. Towards novel therapeutics for HIV through fragment-based screening and drug design.

    Science.gov (United States)

    Tiefendbrunn, Theresa; Stout, C David

    2014-01-01

    Fragment-based drug discovery has been applied with varying levels of success to a number of proteins involved in the HIV (Human Immunodeficiency Virus) life cycle. Fragment-based approaches have led to the discovery of novel binding sites within protease, reverse transcriptase, integrase, and gp41. Novel compounds that bind to known pockets within CCR5 have also been identified via fragment screening, and a fragment-based approach to target the TAR-Tat interaction was explored. In the context of HIV-1 reverse transcriptase (RT), fragment-based approaches have yielded fragment hits with mid-μM activity in an in vitro activity assay, as well as fragment hits that are active against drug-resistant variants of RT. Fragment-based drug discovery is a powerful method to elucidate novel binding sites within proteins, and the method has had significant success in the context of HIV proteins.

  3. High-throughput sequencing of human plasma RNA by using thermostable group II intron reverse transcriptases

    Science.gov (United States)

    Qin, Yidan; Yao, Jun; Wu, Douglas C.; Nottingham, Ryan M.; Mohr, Sabine; Hunicke-Smith, Scott; Lambowitz, Alan M.

    2016-01-01

    Next-generation RNA-sequencing (RNA-seq) has revolutionized transcriptome profiling, gene expression analysis, and RNA-based diagnostics. Here, we developed a new RNA-seq method that exploits thermostable group II intron reverse transcriptases (TGIRTs) and used it to profile human plasma RNAs. TGIRTs have higher thermostability, processivity, and fidelity than conventional reverse transcriptases, plus a novel template-switching activity that can efficiently attach RNA-seq adapters to target RNA sequences without RNA ligation. The new TGIRT-seq method enabled construction of RNA-seq libraries from RNA in RNA in 1-mL plasma samples from a healthy individual revealed RNA fragments mapping to a diverse population of protein-coding gene and long ncRNAs, which are enriched in intron and antisense sequences, as well as nearly all known classes of small ncRNAs, some of which have never before been seen in plasma. Surprisingly, many of the small ncRNA species were present as full-length transcripts, suggesting that they are protected from plasma RNases in ribonucleoprotein (RNP) complexes and/or exosomes. This TGIRT-seq method is readily adaptable for profiling of whole-cell, exosomal, and miRNAs, and for related procedures, such as HITS-CLIP and ribosome profiling. PMID:26554030

  4. Coexistencia de variantes HIV-1 com insercao dipeptidica no gene da transcriptase reversa

    Directory of Open Access Journals (Sweden)

    Aline Aki Tanikawa

    2013-08-01

    Full Text Available O objetivo desta comunicação foi descrever a detecção de coexistência de variantes HIV-1 com inserções de dois aminoácidos entre os códons 69 e 70 da transcriptase reversa. Tais variantes foram isoladas de paciente do sexo masculino, 16 anos de idade, em tratamento no interior do estado de São Paulo. Após confirmação de falha terapêutica, foi realizado teste de resistência a antirretrovirais, a partir do qual foram detectadas duas variantes contendo inserções dos aminoácidos Ser-Gly/Ser-Ala no códon 69 da transcriptase reversa, além da mutação T69S. Tais inserções possuem baixa prevalência, não foram relatadas em caráter de coexistência no Brasil e estão relacionadas com a resistência a múltiplas drogas, tornando o achado relevante do ponto de vista epidemiológico.

  5. HIV drug resistance following a decade of the free antiretroviral therapy programme in India: A review.

    Science.gov (United States)

    Karade, Santosh; Chaturbhuj, Devidas N; Sen, Sourav; Joshi, Rajneesh K; Kulkarni, Smita S; Shankar, Subramanian; Gangakhedkar, Raman R

    2018-01-01

    The objective of this review was to assess the burden of HIV drug resistance mutations (DRM) in Indian adults exposed to first-line antiretroviral therapy (ART) as per national guidelines. An advanced search of the published literature on HIV drug resistance in India was performed in the PubMed and Scopus databases. Data pertaining to age, sex, CD4 count, viral load, and prevalence of nucleoside reverse transcriptase inhibitor (NRTI)/non-nucleoside reverse transcriptase inhibitor (NNRTI) DRM were extracted from each publication. Year-wise Indian HIV-1 reverse transcriptase (RT) sequences were retrieved from the Los Alamos HIV database and mutation analyses were performed. A time trend analysis of the proportion of sequences showing NRTI resistance mutations among individuals exposed to first-line ART was conducted. Overall, 23 studies (1046 unique RT sequences) were identified indicating a prevalence of drug resistance to NRTI and NNRTI. The proportion of RT sequences with any DRM, any NRTI DRM, and any NNRTI DRM was 78.39%, 68.83%, and 73.13%, respectively. The temporal trend analysis of individual DRM from sequences retrieved during 2004-2014 indicated a rising trend in K65R mutations (p=0.013). Although the overall burden of resistance against first-line ART agents remained steady over the study decade, periodic monitoring is essential. There is the need to develop an HIV-1 subtype C-specific resistance database in India. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  6. HIV-1 transmitted drug resistance and genetic diversity among patients from Piauí State, Northeast Brazil.

    Science.gov (United States)

    Moura, Maria Edileuza Soares; da Guarda Reis, Mônica Nogueira; Lima, Yanna Andressa Ramos; Eulálio, Kelsen Dantas; Cardoso, Ludimila Paula Vaz; Stefani, Mariane Martins Araújo

    2015-05-01

    HIV-1 transmitted-drug-resistance and genetic diversity are dynamic and may differ in distinct locations/risk groups. In Brazil, increased AIDS incidence and related mortality have been detected in the Northeast region, differently from the epicenter in the Southeast. This cross-sectional study describes transmitted-dru- resistance and HIV-1 subtypes in protease/PR and reverse transcriptase/RT regions among antiretroviral naïve patients from Piauí State, Northeast Brazil. Among 96 patients recruited 89 (92.7%) had HIV-1 PR/RT regions sequenced: 44 females and 45 males, 22 self-declared as men who have sex with men. Transmitted-drug-resistance was investigated by CPR tool (Stanford HIV-1 Drug Resistance/SDRM). HIV-1 subtypes were assigned by REGA and phylogenetic inference. Overall, transmitted-drug-resistance rate was 11.2% (10/89; CI 95%: 5.8-19.1%); 22.7% among men who have sex with men (5/22; CI 95%: 8.8-43.4%), 10% in heterosexual men (2/20; CI 95%: 1.7-29.3%) and 6.8% in women (3/44; CI 95%: 1.8-17.4%). Singleton mutations to protease-inhibitor/PI, nucleoside-reverse-transcriptase-inhibitor/NRTI or non-nucleoside-reverse-transcriptase-inhibitor/NNRTI predominated (8/10): PI mutations (M46L, V82F, L90M); NRTI mutations (M41L, D67N) and NNRTI mutations (K103N/S). Dual class resistance mutations to NRTI and NNRTI were observed: T215L (NRTI), Y188L (NNRTI) and T215N (NRTI), F227L (NNRTI). Subtype B prevailed (86.6%; 77/89), followed by subtype F1 (1.1%, 1/89) and subtype C (1.1%, 1/89). B/F1 and B/C intersubtype recombinants represented 11.2% (10/89). In Piauí State extensive testing of incidence and transmitted-drug-resistance in all populations with risk behaviors may help control AIDS epidemic locally. © 2015 Wiley Periodicals, Inc.

  7. Prevalence of HIV Antiretroviral Drug Resistance and Its Impacts on HIV-1 Virological Failures in Jiangsu, China: A Cross-Sectional Study

    Directory of Open Access Journals (Sweden)

    Ying Zhou

    2016-01-01

    Full Text Available Antiretroviral therapy (ART has been shown to improve survival of patients with Human Immunodeficiency Virus (HIV infection and to reduce HIV-1 transmission. Therefore, the Chinese central government initiated a national program to provide ART free of charge to HIV-1 patients. We conducted a cross-sectional survey in Jiangsu province to determine the level of drug resistance (DR in HIV-1 infected patients and the correlates of DR in virological failures in 2012. Approximately 10.4% of the HIV-1 patients in the study experienced virological failure after one year of ART and were divided into drug sensitive and drug resistant groups based on genotype determination. The viral loads (VLs in the drug resistant group were significantly lower than the drug sensitive group. There were two independent predictors of virological failure: male gender and increasing duration of treatment. The primary mutations observed in the study were against nucleoside reverse transcriptase inhibitors (NRTIs which were M184V (79.45% and K103N (33.70% in nonnucleoside reverse transcriptase inhibitors (NNRTIs. The overall rate of DR in Jiangsu province is still relatively low among treated patients. However, close monitoring of drug resistance in male patients in the early stages of treatment is vital to maintaining and increasing the benefits of HIV ART achieved to date.

  8. 2-(Alkyl/aryl)amino-6-benzylpyrimidin-4(3H)-ones as inhibitors of wild-type and mutant HIV-1: enantioselectivity studies.

    Science.gov (United States)

    Rotili, Dante; Samuele, Alberta; Tarantino, Domenico; Ragno, Rino; Musmuca, Ira; Ballante, Flavio; Botta, Giorgia; Morera, Ludovica; Pierini, Marco; Cirilli, Roberto; Nawrozkij, Maxim B; Gonzalez, Emmanuel; Clotet, Bonaventura; Artico, Marino; Esté, José A; Maga, Giovanni; Mai, Antonello

    2012-04-12

    The single enantiomers of two pyrimidine-based HIV-1 non-nucleoside reverse transcriptase inhibitors, 1 (MC1501) and 2 (MC2082), were tested in both cellular and enzyme assays. In general, the R forms were more potent than their S counterparts and racemates and (R)-2 was more efficient than (R)-1 and the reference compounds, with some exceptions. Interestingly, (R)-2 displayed a faster binding to K103N RT with respect to WT RT, while (R)-1 showed the opposite behavior. © 2012 American Chemical Society

  9. Antiretroviral drug susceptibility among drug-naive adults with recent HIV infection in Rakai, Uganda.

    Science.gov (United States)

    Eshleman, Susan H; Laeyendecker, Oliver; Parkin, Neil; Huang, Wei; Chappey, Colombe; Paquet, Agnes C; Serwadda, David; Reynolds, Steven J; Kiwanuka, Noah; Quinn, Thomas C; Gray, Ronald; Wawer, Maria

    2009-04-27

    To analyze antiretroviral drug susceptibility in HIV from recently infected adults in Rakai, Uganda, prior to the availability of antiretroviral drug treatment. Samples obtained at the time of HIV seroconversion (1998-2003) were analyzed using the GeneSeq HIV and PhenoSense HIV assays (Monogram Biosciences, Inc., South San Francisco, California, USA). Test results were obtained for 104 samples (subtypes: 26A, 1C, 66D, 9A/D, 1C/D, 1 intersubtype recombinant). Mutations used for genotypic surveillance of transmitted antiretroviral drug resistance were identified in six samples: three had nucleoside reverse transcriptase inhibitor (NRTI) surveillance mutations (two had M41L, one had K219R), and three had protease inhibitor surveillance mutations (I47V, F53L, N88D); none had nonnucleoside reverse transcriptase inhibitor (NNRTI) surveillance mutations. Other resistance-associated mutations were identified in some samples. However, none of the samples had a sufficient number of mutations to predict reduced antiretroviral drug susceptibility. Ten (9.6%) of the samples had reduced phenotypic susceptibility to at least one drug (one had partial susceptibility to didanosine, one had nevirapine resistance, and eight had resistance or partial susceptibility to at least one protease inhibitor). Fifty-three (51%) of the samples had hypersusceptibility to at least one drug (seven had zidovudine hypersusceptibility, 28 had NNRTI hypersusceptibility, 34 had protease inhibitor hypersusceptibility). Delavirdine hypersusceptibility was more frequent in subtype A than D. In subtype D, efavirenz hypersusceptibility was associated with substitutions at codon 11 in HIV-reverse transcriptase. Phenotyping detected reduced antiretroviral drug susceptibility and hypersusceptibility in HIV from some antiretroviral-naive Ugandan adults that was not predicted by genotyping. Phenotyping may complement genotyping for analysis of antiretroviral drug susceptibility in populations with nonsubtype B

  10. Increasing HIV-1 Drug Resistance Between 2010 and 2012 in Adults Participating in Population-Based HIV Surveillance in Rural KwaZulu-Natal, South Africa.

    Science.gov (United States)

    Manasa, Justen; Danaviah, Siva; Lessells, Richard; Elshareef, Muna; Tanser, Frank; Wilkinson, Eduan; Pillay, Sureshnee; Mthiyane, Hloniphile; Mwambi, Henry; Pillay, Deenan; de Oliveira, Tulio

    2016-08-01

    As more human immunodeficiency virus (HIV)-infected patients access combination antiretroviral therapy (cART), higher proportions of newly infected patients may be infected with drug-resistant viruses. Regular surveillance of transmitted drug resistance (TDR) is required in southern Africa where high rates of transmission persist despite rapid expansion of ART. Dried blood spot samples from cART-naive participants from two rounds of an annual population-based HIV surveillance program in rural KwaZulu-Natal were tested for HIV RNA, and samples with HIV RNA >10,000 copies/ml were genotyped for drug resistance. The 2009 surveillance of drug resistance mutation (SDRM) list was used for drug resistance interpretation. The data were added to previously published data from the same program, and the χ(2) test for trend was used to test for trend in estimated prevalence of any TDR. Seven hundred and one participants' data were analyzed: 67 (2010), 381 (2011), and 253 (2012). No TDR was detected in 2010. Years 2011 and 2012 had 18 participants with SDRMs 4.7% and 7.1%, respectively (p = .02, χ(2) test for trend). The nonnucleoside reverse transcriptase inhibitor mutation, K103N, was the most common mutation, occurring in 27 (3.8%) of the participants, while nucleoside reverse transcriptase inhibitor (NRTI) SDRMs were detected in 10 (1.4%) of the participants, of whom eight had only a single NRTI SDRM. The increase in levels of drug resistance observed in this population could be a signal of increasing transmission of drug-resistant HIV. Thus, continued surveillance is critical to inform public health policies around HIV treatment and prevention.

  11. Prevalence and patterns of HIV transmitted drug resistance in Guatemala.

    Science.gov (United States)

    Avila-Ríos, Santiago; Mejía-Villatoro, Carlos R; García-Morales, Claudia; Soto-Nava, Maribel; Escobar, Ingrid; Mendizabal, Ricardo; Girón, Amalia; García, Leticia; Reyes-Terán, Gustavo

    2011-12-01

    To assess human immunodeficiency virus (HIV) diversity and the prevalence of transmitted drug resistance (TDR) in Guatemala. One hundred forty-five antiretroviral treatment-naïve patients referred to the Roosevelt Hospital in Guatemala City were enrolled from October 2010 to March 2011. Plasma HIV pol sequences were obtained and TDR was assessed with the Stanford algorithm and the World Health Organization (WHO) TDR surveillance mutation list. HIV subtype B was highly prevalent in Guatemala (96.6%, 140/145), and a 2.8% (4/145) prevalence of BF1 recombinants and 0.7% (1/145) prevalence of subtype C viruses were found. TDR prevalence for the study period was 8.3% (12/145) with the Stanford database algorithm (score > 15) and the WHO TDR surveillance mutation list. Most TDR cases were associated with non-nucleoside reverse transcriptase inhibitors (NNRTIs) (83.3%, 10/12); a low prevalence of nucleoside reverse transcriptase inhibitors and protease inhibitors was observed in the cohort (Guatemala. TDR prevalence in Guatemala was at the intermediate level. Most TDR cases were associated with NNRTIs. Further and continuous TDR surveillance is necessary to gain more indepth knowledge about TDR spread and trends in Guatemala and to optimize treatment outcomes in the country.

  12. 1-(4-Bromobenzoyl-2-phenylpyrrolidine-2-carboxamide

    Directory of Open Access Journals (Sweden)

    Vahan Martirosyan

    2008-03-01

    Full Text Available In the title compound, C18H17BrN2O2, which is a potential human immunodeficiency virus type 1 (HIV-1 non-nucleoside reverse transcriptase inhibitor, the pyrrolidine ring exhibits an envelope conformation. In the crystal structure, intermolecular N—H...O hydrogen bonds [N...O = 2.861 (3 Å] link the molecules into centrosymmetric dimers.

  13. Extensive Mutagenesis of the Conserved Box E Motif in Duck Hepatitis B Virus P Protein Reveals Multiple Functions in Replication and a Common Structure with the Primer Grip in HIV-1 Reverse Transcriptase

    OpenAIRE

    Wang, Yong-Xiang; Luo, Cheng; Zhao, Dan; Beck, Jürgen; Nassal, Michael

    2012-01-01

    Hepadnaviruses, including the pathogenic hepatitis B virus (HBV), replicate their small DNA genomes through protein-primed reverse transcription, mediated by the terminal protein (TP) domain in their P proteins and an RNA stem-loop, ϵ, on the pregenomic RNA (pgRNA). No direct structural data are available for P proteins, but their reverse transcriptase (RT) domains contain motifs that are conserved in all RTs (box A to box G), implying a similar architecture; however, experimental support for...

  14. Risk Factors for Incident Diabetes in a Cohort Taking First-Line Nonnucleoside Reverse Transcriptase Inhibitor-Based Antiretroviral Therapy.

    Science.gov (United States)

    Karamchand, Sumanth; Leisegang, Rory; Schomaker, Michael; Maartens, Gary; Walters, Lourens; Hislop, Michael; Dave, Joel A; Levitt, Naomi S; Cohen, Karen

    2016-03-01

    Efavirenz is the preferred nonnucleoside reverse transcriptase inhibitor (NNRTI) in first-line antiretroviral therapy (ART) regimens in low- and middle-income countries, where the prevalence of diabetes is increasing. Randomized control trials have shown mild increases in plasma glucose in participants in the efavirenz arms, but no association has been reported with overt diabetes. We explored the association between efavirenz exposure and incident diabetes in a large Southern African cohort commencing NNRTI-based first-line ART. Our cohort included HIV-infected adults starting NNRTI-based ART in a private sector HIV disease management program from January 2002 to December 2011. Incident diabetes was identified by the initiation of diabetes treatment. Patients with prevalent diabetes were excluded. We included 56,298 patients with 113,297 patient-years of follow-up (PYFU) on first-line ART. The crude incidence of diabetes was 13.24 per 1000 PYFU. Treatment with efavirenz rather than nevirapine was associated with increased risk of developing diabetes (hazard ratio 1.27 (95% confidence interval (CI): 1.10-1.46)) in a multivariate analysis adjusting for age, sex, body mass index, baseline CD4 count, viral load, NRTI backbone, and exposure to other diabetogenic medicines. Zidovudine and stavudine exposure were also associated with an increased risk of developing diabetes. We found that treatment with efavirenz, as well as stavudine and zidovudine, increased the risk of incident diabetes. Interventions to detect and prevent diabetes should be implemented in ART programs, and use of antiretrovirals with lower risk of metabolic complications should be encouraged.

  15. In vitro resistance profile of the candidate HIV-1 microbicide drug dapivirine.

    Science.gov (United States)

    Schader, Susan M; Oliveira, Maureen; Ibanescu, Ruxandra-Ilinca; Moisi, Daniela; Colby-Germinario, Susan P; Wainberg, Mark A

    2012-02-01

    Antiretroviral-based microbicides may offer a means to reduce the sexual transmission of HIV-1. Suboptimal use of a microbicide may, however, lead to the development of drug resistance in users that are already, or become, infected with HIV-1. In such cases, the efficacy of treatments may be compromised since the same (or similar) antiretrovirals used in treatments are being developed as microbicides. To help predict which drug resistance mutations may develop in the context of suboptimal use, HIV-1 primary isolates of different subtypes and different baseline resistance profiles were used to infect primary cells in vitro in the presence of increasing suboptimal concentrations of the two candidate microbicide antiretrovirals dapivirine (DAP) and tenofovir (TFV) alone or in combination. Infections were ongoing for 25 weeks, after which reverse transcriptase genotypes were determined and scrutinized for the presence of any clinically recognized reverse transcriptase drug resistance mutations. Results indicated that suboptimal concentrations of DAP alone facilitated the emergence of common nonnucleoside reverse transcriptase inhibitor resistance mutations, while suboptimal concentrations of DAP plus TFV gave rise to fewer mutations. Suboptimal concentrations of TFV alone did not frequently result in the development of resistance mutations. Sensitivity evaluations for stavudine (d4T), nevirapine (NVP), and lamivudine (3TC) revealed that the selection of resistance as a consequence of suboptimal concentrations of DAP may compromise the potential for NVP to be used in treatment, a finding of potential relevance in developing countries.

  16. Susceptibility of recombinant porcine endogenous retrovirus reverse transcriptase to nucleoside and non-nucleoside inhibitors.

    Science.gov (United States)

    Wilhelm, M; Fishman, J A; Pontikis, R; Aubertin, A M; Wilhelm, F X

    2002-12-01

    Transplantation of organs, tissues or cells from pigs to humans could be a potential solution to the shortage of human organs for transplantation. Porcine endogenous retroviruses (PERVs) remain a major safety concern for porcine xenotransplantation. Thus, finding drugs that could be used as virological prophylaxis (or therapy) against PERV replication would be desirable. One of the most effective ways to block retroviral multiplication is to inhibit the enzyme reverse transcriptase (RT) which catalyzes the reverse transcription of viral RNA to proviral double-stranded DNA. We report here the cloning and expression of PERV RT and its susceptibility to several inhibitors. Our data demonstrate PERV susceptibility in vitro to the triphosphorylated nucleoside analog of zidovudine (AZT) and to ddGTP and to a lesser extent to ddTTP but almost no susceptibility to the non-nucleoside RT inhibitors tested.

  17. Elucidation of the TMab-6 Monoclonal Antibody Epitope Against Telomerase Reverse Transcriptase.

    Science.gov (United States)

    Kaneko, Mika K; Yamada, Shinji; Itai, Shunsuke; Chang, Yao-Wen; Nakamura, Takuro; Yanaka, Miyuki; Harada, Hiroyuki; Suzuki, Hiroyoshi; Kato, Yukinari

    2018-05-03

    Telomerase reverse transcriptase (TERT) and mutations of the TERT promoter are significant in the pathogenesis of 1p/19q-codeleted oligodendrogliomas and isocitrate dehydrogenase gene wild-type glioblastomas, as well as melanomas and squamous cell carcinomas. We previously developed an antihuman TERT monoclonal antibody (mAb), TMab-6, which is applicable in immunohistochemistry for human tissues. However, the binding epitope of TMab-6 against TERT is yet to be elucidated. In this study, enzyme-linked immunosorbent assay and immunohistochemistry were utilized for investigating the epitope of TMab-6. The findings revealed that the critical epitope of TMab-6 is the TERT sequence PSTSRPPRPWD; Thr310 and Ser311 of TERT are especially significant amino acids for TMab-6 recognition.

  18. Cancer risk and use of protease inhibitor or nonnucleoside reverse transcriptase inhibitor-based combination antiretroviral therapy: the D: A: D study

    NARCIS (Netherlands)

    Bruyand, M.; Ryom, L.; Shepherd, L.; Fatkenheuer, G.; Grulich, A.; Reiss, P.; Wit, S. de; Monforte, A.M.; Furrer, H.; Pradier, C.; Lundgren, J.; Sabin, C.; Warris, A.; et al.,

    2015-01-01

    BACKGROUND: The association between combination antiretroviral therapy (cART) and cancer risk, especially regimens containing protease inhibitors (PIs) or nonnucleoside reverse transcriptase inhibitors (NNRTIs), is unclear. METHODS: Participants were followed from the latest of D:A:D study entry or

  19. Cancer risk and use of protease inhibitor or nonnucleoside reverse transcriptase inhibitor-based combination antiretroviral therapy : the D: A: D study

    NARCIS (Netherlands)

    Bruyand, Mathias; Ryom, Lene; Shepherd, Leah; Fatkenheuer, Gerd; Grulich, Andrew; Reiss, Peter; de Wit, Stéphane; D Arminio Monforte, Antonella; Furrer, Hansjakob; Pradier, Christian; Lundgren, Jens; Sabin, Caroline; Schölvinck, Elisabeth H.

    2015-01-01

    BACKGROUND: The association between combination antiretroviral therapy (cART) and cancer risk, especially regimens containing protease inhibitors (PIs) or nonnucleoside reverse transcriptase inhibitors (NNRTIs), is unclear. METHODS: Participants were followed from the latest of D:A:D study entry or

  20. The brown algae Pl.LSU/2 group II intron-encoded protein has functional reverse transcriptase and maturase activities.

    Directory of Open Access Journals (Sweden)

    Madeleine Zerbato

    Full Text Available Group II introns are self-splicing mobile elements found in prokaryotes and eukaryotic organelles. These introns propagate by homing into precise genomic locations, following assembly of a ribonucleoprotein complex containing the intron-encoded protein (IEP and the spliced intron RNA. Engineered group II introns are now commonly used tools for targeted genomic modifications in prokaryotes but not in eukaryotes. We speculate that the catalytic activation of currently known group II introns is limited in eukaryotic cells. The brown algae Pylaiella littoralis Pl.LSU/2 group II intron is uniquely capable of in vitro ribozyme activity at physiological level of magnesium but this intron remains poorly characterized. We purified and characterized recombinant Pl.LSU/2 IEP. Unlike most IEPs, Pl.LSU/2 IEP displayed a reverse transcriptase activity without intronic RNA. The Pl.LSU/2 intron could be engineered to splice accurately in Saccharomyces cerevisiae and splicing efficiency was increased by the maturase activity of the IEP. However, spliced transcripts were not expressed. Furthermore, intron splicing was not detected in human cells. While further tool development is needed, these data provide the first functional characterization of the PI.LSU/2 IEP and the first evidence that the Pl.LSU/2 group II intron splicing occurs in vivo in eukaryotes in an IEP-dependent manner.

  1. The Advance of Technology of Reverse Transcriptase-Polymerase Chain Reaction in Identifying the Genome of Avian Influenza and Newcastle Diseases

    Directory of Open Access Journals (Sweden)

    Dyah Ayu Hewajuli

    2014-03-01

    Full Text Available Avian Influenza (AI viruses are zoonotic and caused death in humans. Newcastle Diseases (ND virus has an economical impact in poultry. Therefore, the identification and characterization of AI and ND viruses that are appropriate, accurate and quick are important to protect human and poultry health. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR was the latest gold standard to detect the genome of AI and ND viruses. Recently, RT-PCR was developed in routine diagnosis and research. RT-PCR is a method to amplify the sequences of DNA genome, preceded by reverse transcriptase process with the primer-mediated enzymatic. Some factors that influenced detection of AI and ND are design primer and probe, types of samples, enzyme, reagent composition, amplification temperature and cycles, technical and non-technical factors such as contamination and trained staff. Modified conventional and real time RT-PCR are able to improve the specificity and sensitivity of the test.

  2. Molecular Phylogenetics of Transmitted Drug Resistance in Newly Diagnosed HIV Type 1 Individuals in Denmark, a Nation-Wide Study

    DEFF Research Database (Denmark)

    Audelin, Anne Margrethe; Gerstoft, Jan; Obel, Niels

    2011-01-01

    Abstract Highly active antiretroviral treatment is compromised by viral resistance mutations. Transmitted drug resistance (TDR) is therefore monitored closely, but follow-up studies of these patients are limited. Virus from 1405 individuals diagnosed with HIV-1 in Denmark between 2001 and 2009...... without resistance mutations. We observed no difference in progression of the infection between individuals infected with TDR and individuals infected with wild-type HIV-1. The prevalence of TDR is low in Denmark and transmission of dual-drug-resistant HIV-1 is infrequent. The TDR isolates were shown...... resulting in a prevalence of 6.1%, with no changes over time. The main resistance mutations were nucleoside reverse transcriptase inhibitor (NRTI) mutation 215 revertants, as well as nonnucleoside reverse transcriptase inhibitor (NNRTI) mutation 103N/S and protease inhibitor (PI) mutations 90M and 85V...

  3. Molecular phylogenetics of transmitted drug resistance in newly diagnosed HIV Type 1 individuals in Denmark: a nation-wide study

    DEFF Research Database (Denmark)

    Audelin, Anne Margrethe; Gerstoft, Jan; Obel, Niels

    2011-01-01

    Abstract Highly active antiretroviral treatment is compromised by viral resistance mutations. Transmitted drug resistance (TDR) is therefore monitored closely, but follow-up studies of these patients are limited. Virus from 1405 individuals diagnosed with HIV-1 in Denmark between 2001 and 2009...... without resistance mutations. We observed no difference in progression of the infection between individuals infected with TDR and individuals infected with wild-type HIV-1. The prevalence of TDR is low in Denmark and transmission of dual-drug-resistant HIV-1 is infrequent. The TDR isolates were shown...... resulting in a prevalence of 6.1%, with no changes over time. The main resistance mutations were nucleoside reverse transcriptase inhibitor (NRTI) mutation 215 revertants, as well as nonnucleoside reverse transcriptase inhibitor (NNRTI) mutation 103N/S and protease inhibitor (PI) mutations 90M and 85V...

  4. The Depsipeptide Romidepsin Reverses HIV-1 Latency In Vivo.

    Directory of Open Access Journals (Sweden)

    Ole S Søgaard

    2015-09-01

    Full Text Available Pharmacologically-induced activation of replication competent proviruses from latency in the presence of antiretroviral treatment (ART has been proposed as a step towards curing HIV-1 infection. However, until now, approaches to reverse HIV-1 latency in humans have yielded mixed results. Here, we report a proof-of-concept phase Ib/IIa trial where 6 aviremic HIV-1 infected adults received intravenous 5 mg/m2 romidepsin (Celgene once weekly for 3 weeks while maintaining ART. Lymphocyte histone H3 acetylation, a cellular measure of the pharmacodynamic response to romidepsin, increased rapidly (maximum fold range: 3.7–7.7 relative to baseline within the first hours following each romidepsin administration. Concurrently, HIV-1 transcription quantified as copies of cell-associated un-spliced HIV-1 RNA increased significantly from baseline during treatment (range of fold-increase: 2.4–5.0; p = 0.03. Plasma HIV-1 RNA increased from <20 copies/mL at baseline to readily quantifiable levels at multiple post-infusion time-points in 5 of 6 patients (range 46–103 copies/mL following the second infusion, p = 0.04. Importantly, romidepsin did not decrease the number of HIV-specific T cells or inhibit T cell cytokine production. Adverse events (all grade 1–2 were consistent with the known side effects of romidepsin. In conclusion, romidepsin safely induced HIV-1 transcription resulting in plasma HIV-1 RNA that was readily detected with standard commercial assays demonstrating that significant reversal of HIV-1 latency in vivo is possible without blunting T cell-mediated immune responses. These finding have major implications for future trials aiming to eradicate the HIV-1 reservoir.clinicaltrials.gov NTC02092116.

  5. European recommendations for the clinical use of HIV drug resistance testing: 2011 update

    DEFF Research Database (Denmark)

    Vandamme, Anne-Mieke; Camacho, Ricardo J; Ceccherini-Silberstein, Francesca

    2011-01-01

    , and other drug targets (integrase and envelope) if such drugs were part of the failing regimen; (iii) consider testing for CCR5 tropism at virologic failure or when a change of therapy has to be made in absence of detectable viral load, and in the latter case test DNA or last detectable plasma RNA; (iv...... the following recommendations concerning the indications for resistance testing: for HIV-1 (i) test earliest sample for protease and reverse transcriptase drug resistance in drug-naive patients with acute or chronic infection; (ii) test protease and reverse transcriptase drug resistance at virologic failure...... is needed after treatment failure. The Panel recommends genotyping in most situations, using updated and clinically evaluated interpretation systems. It is mandatory that laboratories performing HIV resistance tests take part regularly in external quality assurance programs, and that they consider storing...

  6. Body composition and metabolic outcomes after 96 weeks of treatment with ritonavir-boosted lopinavir plus either nucleoside or nucleotide reverse transcriptase inhibitors or raltegravir in patients with HIV with virological failure of a standard first-line antiretroviral therapy regimen: a substudy of the randomised, open-label, non-inferiority SECOND-LINE study.

    Science.gov (United States)

    Boyd, Mark A; Amin, Janaki; Mallon, Patrick W G; Kumarasamy, Nagalingeswaran; Lombaard, Johan; Wood, Robin; Chetchotisakd, Ploenchan; Phanuphak, Praphan; Mohapi, Lerato; Azwa, Iskandar; Belloso, Waldo H; Molina, Jean-Michel; Hoy, Jennifer; Moore, Cecilia L; Emery, Sean; Cooper, David A

    2017-01-01

    Lipoatrophy is one of the most feared complications associated with the use of nucleoside or nucleotide reverse transcriptase inhibitors (N[t]RTIs). We aimed to assess soft-tissue changes in participants with HIV who had virological failure of a first-line antiretroviral (ART) regimen containing a non-nucleoside reverse transcriptase inhibitor plus two N(t)RTIs and were randomly assigned to receive a second-line regimen containing a boosted protease inhibitor given with either N(t)RTIs or raltegravir. Of the 37 sites that participated in the randomised, open-label, non-inferiority SECOND-LINE study, eight sites from five countries (Argentina, India, Malaysia, South Africa, and Thailand) participated in the body composition substudy. All sites had a dual energy x-ray absorptiometry (DXA) scanner and all participants enrolled in SECOND-LINE were eligible for inclusion in the substudy. Participants were randomly assigned (1:1), via a computer-generated allocation schedule, to receive either ritonavir-boosted lopinavir plus raltegravir (raltegravir group) or ritonavir-boosted lopinavir plus two or three N(t)RTIs (N[t]RTI group). Randomisation was stratified by site and screening HIV-1 RNA. Participants and investigators were not masked to group assignment, but allocation was concealed until after interventions were assigned. DXA scans were done at weeks 0, 48, and 96. The primary endpoint was mean percentage and absolute change in peripheral limb fat from baseline to week 96. We did intention-to-treat analyses of available data. This substudy is registered with ClinicalTrials.gov, number NCT01513122. Between Aug 1, 2010, and July 10, 2011, we recruited 211 participants into the substudy. The intention-to-treat population comprised 102 participants in the N(t)RTI group and 108 participants in the raltegravir group, of whom 91 and 105 participants, respectively, reached 96 weeks. Mean percentage change in limb fat from baseline to week 96 was 16·8% (SD 32·6) in the N

  7. Development of a reverse transcriptase loop-mediated isothermal amplification (LAMP) assay for the sensitive detection of Leishmania parasites in clinical samples

    NARCIS (Netherlands)

    Adams, Emily R.; Schoone, Gerard J.; Ageed, Al Farazdag; El Safi, Sayda; Schallig, Henk D. F. H.

    2010-01-01

    Here we describe a generic, reverse transcriptase-loop-mediated isothermal amplification (RT-LAMP) assay, for the identification of Leishmania species from clinical samples. LAMP is an isothermal reaction recently developed as a point-of-care diagnostic tool. Primers were designed in the conserved

  8. Prevalence of Drug-Resistance Mutations and Non–Subtype B Strains Among HIV-Infected Infants From New York State

    Science.gov (United States)

    Karchava, Marine; Pulver, Wendy; Smith, Lou; Philpott, Sean; Sullivan, Timothy J.; Wethers, Judith; Parker, Monica M.

    2010-01-01

    Summary Prevalence studies indicate that transmission of drug-resistant HIV has been rising in the adult population, but data from the perinatally infected pediatric population are limited. In this retrospective study, we sequenced the pol region of HIV from perinatally infected infants diagnosed in New York State in 2001–2002. Analyses of drug resistance, subtype diversity, and perinatal antiretroviral exposure were conducted, and the results were compared with those from a previous study of HIV-infected infants identified in 1998–1999. Eight of 42 infants (19.1%) had provirus carrying at least 1 drug-resistance mutation, an increase of 58% over the 1998–1999 results. Mutations conferring resistance to nucleoside reverse transcriptase inhibitors, nonnucleoside reverse transcriptase inhibitors, and protease inhibitors were detected in 7.1%, 11.9%, and 2.4% of specimens, respectively. Consistent with previous results, perinatal antiretroviral exposure was not associated with drug resistance (P = 0.70). Phylogenetic analysis indicated that 16.7% of infants were infected with a non–subtype B strain of HIV. It seems that drug-resistant and non–subtype B strains of HIV are becoming increasingly common in the perinatally infected population. Our results highlight the value of resistance testing for all HIV-infected infants upon diagnosis and the need to consider subtype diversity in diagnostic and treatment strategies. PMID:16868498

  9. Ex vivo analysis identifies effective HIV-1 latency–reversing drug combinations

    Science.gov (United States)

    Laird, Gregory M.; Bullen, C. Korin; Rosenbloom, Daniel I.S.; Martin, Alyssa R.; Hill, Alison L.; Durand, Christine M.; Siliciano, Janet D.; Siliciano, Robert F.

    2015-01-01

    Reversal of HIV-1 latency by small molecules is a potential cure strategy. This approach will likely require effective drug combinations to achieve high levels of latency reversal. Using resting CD4+ T cells (rCD4s) from infected individuals, we developed an experimental and theoretical framework to identify effective latency-reversing agent (LRA) combinations. Utilizing ex vivo assays for intracellular HIV-1 mRNA and virion production, we compared 2-drug combinations of leading candidate LRAs and identified multiple combinations that effectively reverse latency. We showed that protein kinase C agonists in combination with bromodomain inhibitor JQ1 or histone deacetylase inhibitors robustly induce HIV-1 transcription and virus production when directly compared with maximum reactivation by T cell activation. Using the Bliss independence model to quantitate combined drug effects, we demonstrated that these combinations synergize to induce HIV-1 transcription. This robust latency reversal occurred without release of proinflammatory cytokines by rCD4s. To extend the clinical utility of our findings, we applied a mathematical model that estimates in vivo changes in plasma HIV-1 RNA from ex vivo measurements of virus production. Our study reconciles diverse findings from previous studies, establishes a quantitative experimental approach to evaluate combinatorial LRA efficacy, and presents a model to predict in vivo responses to LRAs. PMID:25822022

  10. Limitations of the nested reverse transcriptase polymerase chain reaction on tyrosinase for the detection of malignant melanoma micrometastases in lymph nodes

    NARCIS (Netherlands)

    Calogero, A; Timmer-Bosscha, H; Tiebosch, ATMG; Mulder, NH; Hospers, GAP; Schraffordt Koops, H.

    The specificity and sensitivity of the nested reverse transcriptase polymerase chain reaction (RT-PCR) on tyrosinase was studied, for the detection of micrometastases of malignant melanoma. The specificity was assessed in the blood of six healthy donors, four patients with non-melanoma cancers of

  11. HIV drug resistance in infants increases with changing prevention of mother-to-child transmission regimens.

    Science.gov (United States)

    Poppe, Lisa K; Chunda-Liyoka, Catherine; Kwon, Eun H; Gondwe, Clement; West, John T; Kankasa, Chipepo; Ndongmo, Clement B; Wood, Charles

    2017-08-24

    The objectives of this study were to determine HIV drug resistance (HIVDR) prevalence in Zambian infants upon diagnosis, and to determine how changing prevention of mother-to-child transmission (PMTCT) drug regimens affect drug resistance. Dried blood spot (DBS) samples from infants in the Lusaka District of Zambia, obtained during routine diagnostic screening, were collected during four different years representing three different PMTCT drug treatment regimens. DNA extracted from dried blood spot samples was used to sequence a 1493 bp region of the reverse transcriptase gene. Sequences were analyzed via the Stanford HIVDRdatabase (http://hivdb.standford.edu) to screen for resistance mutations. HIVDR in infants increased from 21.5 in 2007/2009 to 40.2% in 2014. Nonnucleoside reverse transcriptase inhibitor resistance increased steadily over the sampling period, whereas nucleoside reverse transcriptase inhibitor resistance and dual class resistance both increased more than threefold in 2014. Analysis of drug resistance scores in each group revealed increasing strength of resistance over time. In 2014, children with reported PMTCT exposure, defined as infant prophylaxis and/or maternal treatment, showed a higher prevalence and strength of resistance compared to those with no reported exposure. HIVDR is on the rise in Zambia and presents a serious problem for the successful lifelong treatment of HIV-infected children. PMTCT affects both the prevalence and strength of resistance and further research is needed to determine how to mitigate its role leading to resistance.

  12. Cyclic GMP-AMP synthase is an innate immune sensor of HIV and other retroviruses.

    Science.gov (United States)

    Gao, Daxing; Wu, Jiaxi; Wu, You-Tong; Du, Fenghe; Aroh, Chukwuemika; Yan, Nan; Sun, Lijun; Chen, Zhijian J

    2013-08-23

    Retroviruses, including HIV, can activate innate immune responses, but the host sensors for retroviruses are largely unknown. Here we show that HIV infection activates cyclic guanosine monophosphate-adenosine monophosphate (cGAMP) synthase (cGAS) to produce cGAMP, which binds to and activates the adaptor protein STING to induce type I interferons and other cytokines. Inhibitors of HIV reverse transcriptase, but not integrase, abrogated interferon-β induction by the virus, suggesting that the reverse-transcribed HIV DNA triggers the innate immune response. Knockout or knockdown of cGAS in mouse or human cell lines blocked cytokine induction by HIV, murine leukemia virus, and simian immunodeficiency virus. These results indicate that cGAS is an innate immune sensor of HIV and other retroviruses.

  13. Selective serotonin reuptake inhibitor suppression of HIV infectivity and replication.

    Science.gov (United States)

    Benton, Tami; Lynch, Kevin; Dubé, Benoit; Gettes, David R; Tustin, Nancy B; Ping Lai, Jian; Metzger, David S; Blume, Joshua; Douglas, Steven D; Evans, Dwight L

    2010-11-01

    To test the hypothesis that the selective serotonin reuptake inhibitor (SSRI) citalopram would down-regulate human immunodeficiency virus (HIV) infectivity and that the greatest effects would be seen in people with depression. Depression is a risk factor for morbidity and mortality in HIV/acquired immune deficiency syndrome. Serotonin (5-HT) neurotransmission has been implicated in the pathobiology of depression, and pharmacologic therapies for depression target this system. The 5-HT transporter and 5-HT receptors are widely distributed throughout the central nervous and immune systems. Depression has been associated with suppression of natural killer cells and CD8(+) lymphocytes, key regulators of HIV infection. Ex vivo models for acute and chronic HIV infection were used to study the effects of citalopram on HIV viral infection and replication in 48 depressed and nondepressed women. For both the acute and chronic infection models, HIV reverse transcriptase activity was measured in the citalopram treatment condition and the control condition. The SSRI significantly down-regulated the reverse transcriptase response in both the acute and chronic infection models. Specifically, citalopram significantly decreased the acute HIV infectivity of macrophages. Citalopram also significantly decreased HIV viral replication in the latently infected T-cell line and in the latently infected macrophage cell line. There was no difference in down-regulation by depression status. These studies suggest that an SSRI enhances natural killer/CD8 noncytolytic HIV suppression in HIV/acquired immune deficiency syndrome and decreases HIV viral infectivity of macrophages, ex vivo, suggesting the need for in vivo studies to determine a potential role for agents targeting serotonin in the host defense against HIV.

  14. HIV-1 drug resistance in recently HIV-infected pregnant mother's naïve to antiretroviral therapy in Dodoma urban, Tanzania.

    Science.gov (United States)

    Vairo, Francesco; Nicastri, Emanuele; Liuzzi, Giuseppina; Chaula, Zainab; Nguhuni, Boniface; Bevilacqua, Nazario; Forbici, Federica; Amendola, Alessandra; Fabeni, Lavinia; De Nardo, Pasquale; Perno, Carlo Federico; Cannas, Angela; Sakhoo, Calistus; Capobianchi, Maria Rosaria; Ippolito, Giuseppe

    2013-09-21

    HIV resistance affects virological response to therapy and efficacy of prophylaxis in mother-to-child-transmission. The study aims to assess the prevalence of HIV primary resistance in pregnant women naïve to antiretrovirals. Cross sectional baseline analysis of a cohort of HIV + pregnant women (HPW) enrolled in the study entitled Antiretroviral Management of Antenatal and Natal HIV Infection (AMANI, peace in Kiswahili language). The AMANI study began in May 2010 in Dodoma, Tanzania. In this observational cohort, antiretroviral treatment was provided to all women from the 28th week of gestation until the end of the breastfeeding period. Baseline CD4 cell count, viral load and HIV drug-resistance genotype were collected. Drug-resistance analysis was performed on 97 naïve infected-mothers. The prevalence of all primary drug resistance and primary non-nucleoside reverse-transcriptase inhibitors resistance was 11.9% and 7.5%, respectively. K103S was found in two women with no M184V detection. HIV-1 subtype A was the most commonly identified, with a high prevalence of subtype A1, followed by C, D, C/D recombinant, A/C recombinant and A/D recombinant. HIV drug- resistance mutations were detected in A1 and C subtypes. Our study reports an 11.9% prevalence rate of primary drug resistance in naïve HIV-infected pregnant women from a remote area of Tanzania. Considering that the non-nucleoside reverse-transcriptase inhibitors are part of the first-line antiretroviral regimen in Tanzania and all of Africa, resistance surveys should be prioritized in settings where antiretroviral therapy programs are scaled up.

  15. Diarylpyrimidine-dihydrobenzyloxopyrimidine hybrids: new, wide-spectrum anti-HIV-1 agents active at (sub)-nanomolar level.

    Science.gov (United States)

    Rotili, Dante; Tarantino, Domenico; Artico, Marino; Nawrozkij, Maxim B; Gonzalez-Ortega, Emmanuel; Clotet, Bonaventura; Samuele, Alberta; Esté, José A; Maga, Giovanni; Mai, Antonello

    2011-04-28

    Here, we describe a novel small series of non-nucleoside reverse transcriptase inhibitors (NNRTIs) that combine peculiar structural features of diarylpyrimidines (DAPYs) and dihydro-alkoxy-benzyl-oxopyrimidines (DABOs). These DAPY-DABO hybrids (1-4) showed a characteristic SAR profile and a nanomolar anti-HIV-1 activity at both enzymatic and cellular level. In particular, the two compounds 4d and 2d, with a (sub)nanomolar activity against wild-type and clinically relevant HIV-1 mutant strains, were selected as lead compounds for next optimization studies.

  16. Rethinking the risk-benefit ratio of efavirenz in HIV-infected children

    NARCIS (Netherlands)

    Wijer, L van de; Schellekens, A.F.A.; Burger, D.M.; Homberg, J.R.; Mast, Q. de; Ven, A.J.A.M. van der

    2016-01-01

    The non-nucleoside reverse transcriptase inhibitor efavirenz is part of the WHO guidelines for preferred first-line treatment of HIV-1-infected adults, pregnant and lactating women, and children. Efavirenz is well known to cause CNS toxicity. Although good data for CNS toxicity are available for

  17. Lower expressions of the human bitter taste receptor TAS2R in smokers: reverse transcriptase-polymerase chain reaction analysis.

    Science.gov (United States)

    Aoki, Mieko; Takao, Tetsuya; Takao, Kyoichi; Koike, Fumihiko; Suganuma, Narufumi

    2014-01-01

    Despite the fact that smokers have deficit in detecting taste, particularly bitter taste, no study has investigated its biological correlate. In this context, we compared the expression of the bitter taste receptor gene, taste 2 receptor (TAS2R) in the tongues of smokers and non-smokers. Tissue samples were collected from the lateral portion of the tongues of 22 smokers and 22 age- and gender-matched healthy volunteers (19 males and three females) with no history of smoking. Reverse transcriptase-polymerase chain reaction was used to examine the expression of TAS2R in the two groups, and the effect of aging on TAS2R expression was also assessed. TAS2R expression was significantly lower among smokers than non-smokers (t = 6.525, P vs. 2.09 ± 2.8, mean ± SD, non-smokers vs. smokers). Further, a positive correlation between age and expression of TAS2R was observed in non-smokers (r = .642, P = .001), but not smokers (r = .124, P = .584). This correlation difference was significant (Z = 1.96, P = .0496). Smokers showed a significantly lower expression of the bitter taste receptor gene than non-smokers, which is potentially caused by their inability to acquire such receptors with age because of cigarette smoking, in contrast to non-smokers.

  18. Exploiting the anti-HIV 6-desfluoroquinolones to design multiple ligands.

    Science.gov (United States)

    Sancineto, Luca; Iraci, Nunzio; Barreca, Maria Letizia; Massari, Serena; Manfroni, Giuseppe; Corazza, Gianmarco; Cecchetti, Violetta; Marcello, Alessandro; Daelemans, Dirk; Pannecouque, Christophe; Tabarrini, Oriana

    2014-09-01

    It is getting clearer that many drugs effective in different therapeutic areas act on multiple rather than single targets. The application of polypharmacology concepts might have numerous advantages especially for disease such as HIV/AIDS, where the rapid emergence of resistance requires a complex combination of more than one drug. In this paper, we have designed three hybrid molecules combining WM5, a quinolone derivative we previously identified as HIV Tat-mediated transcription (TMT) inhibitor, with the tricyclic core of nevirapine and BILR 355BS (BILR) non-nucleoside reverse transcriptase inhibitors (NNRTIs) to investigate whether it could be possible to obtain molecules acting on both transcription steps of the HIV replicative cycle. One among the three designed multiple ligands, reached this goal. Indeed, compound 1 inhibited both TMT and reverse transcriptase (RT) activity. Unexpectedly, while the anti-TMT activity exerted by compound 1 resulted into a selective inhibition of HIV-1 reactivation from latently infected OM10.1 cells, the anti-RT properties shown by all of the synthesized compounds did not translate into an anti-HIV activity in acutely infected cells. Thus, we have herein produced the proof of concept that the design of dual TMT-RT inhibitors is indeed possible, but optimization efforts are needed to obtain more potent derivatives. Copyright © 2014 Elsevier Ltd. All rights reserved.

  19. Echocardiographic assessment of systolic pulmonary arterial pressure in HIV-positive patients.

    Directory of Open Access Journals (Sweden)

    Mehrnaz Rasoulinejad

    2014-11-01

    Full Text Available Pulmonary hypertension is rare but is one of the complications that occur due to HIV infection. Symptoms of HIV-associated pulmonary arterial hypertension are often non-specific but the main symptom of the disease is dyspnea. In this cross-sectional study, we measured systolic pulmonary arterial pressure (SPAP by echocardiographic methods among HIV-positive patients who received ART. This research is a descriptive, cross-sectional study of 170 HIV-positive patients that was conducted in Imam-Khomeini hospital, Tehran, Iran during 2011-2013. All patients regularly received antiretroviral therapy at least for recent 2 years. There were not any cardiopulmonary symptoms (cough, dyspnea, exertional fatigue and chest discomfort in these patients. All participants underwent echocardiography to estimate SPAP. The participants comprised 108 males (63.5% and 62 females (46.5%. The mean age of patients was 41 years old, and the mean duration of HIV infection was 5.5 years. The mean CD4 cell count was 401 cell/µl. The principal regimen of antiretroviral therapy included two nucleoside reverse transcriptase inhibitor (NRTI and one non-nucleoside reverse transcriptase inhibitor (NNRTI in the hospital. The mean of systolic pulmonary arterial pressure was 25 mmHg in the participants; 156 (93.4% of them had SPAP ≤ 30 mmHg (normal, six (3.6% had SPAP: 31-35 mmHg (borderline and five (3% had SPAP > 35 mmHg (pulmonary hypertension. Our results indicated a significant increase of pulmonary hypertension in asymptomatic HIV-positive patients that had no association with any other risk factor. Also, antiretroviral therapy was not a risk factor for pulmonary hypertension in this study.

  20. First line treatment response in patients with transmitted HIV drug resistance and well defined time point of HIV infection: updated results from the German HIV-1 seroconverter study.

    Directory of Open Access Journals (Sweden)

    Fabia Zu Knyphausen

    Full Text Available BACKGROUND: Transmission of drug-resistant HIV-1 (TDR can impair the virologic response to antiretroviral combination therapy. Aim of the study was to assess the impact of TDR on treatment success of resistance test-guided first-line therapy in the German HIV-1 Seroconverter Cohort for patients infected with HIV between 1996 and 2010. An update of the prevalence of TDR and trend over time was performed. METHODS: Data of 1,667 HIV-infected individuals who seroconverted between 1996 and 2010 were analysed. The WHO drug resistance mutations list was used to identify resistance-associated HIV mutations in drug-naïve patients for epidemiological analysis. For treatment success analysis the Stanford algorithm was used to classify a subset of 323 drug-naïve genotyped patients who received a first-line cART into three resistance groups: patients without TDR, patients with TDR and fully active cART and patients with TDR and non-fully active cART. The frequency of virologic failure 5 to 12 months after treatment initiation was determined. RESULTS: Prevalence of TDR was stable at a high mean level of 11.9% (198/1,667 in the HIV-1 Seroconverter Cohort without significant trend over time. Nucleotide reverse transcriptase inhibitor resistance was predominant (6.0% and decreased significantly over time (OR = 0.92, CI = 0.87-0.98, p = 0.01. Non-nucleoside reverse transcriptase inhibitor (2.4%; OR = 1.00, CI = 0.92-1.09, p = 0.96 and protease inhibitor resistance (2.0%; OR = 0.94, CI = 0.861.03, p = 0.17 remained stable. Virologic failure was observed in 6.5% of patients with TDR receiving fully active cART, 5,6% of patients with TDR receiving non-fully active cART and 3.2% of patients without TDR. The difference between the three groups was not significant (p = 0.41. CONCLUSION: Overall prevalence of TDR remained stable at a rather high level. No significant differences in the frequency of virologic failure were

  1. Low prevalence of primary HIV resistance in western Massachusetts.

    Science.gov (United States)

    Iarikov, Dmitri E; Irizarry-Acosta, Melina; Martorell, Claudia; Hoffman, Robert P; Skiest, Daniel J

    2010-01-01

    Most studies of primary antiretroviral (ARV) resistance have been conducted in large metropolitan areas with reported rates of 8% to 25%. We collected data on 99 HIV-1-infected antiretroviral-naive patients from several sites in Springfield, MA, who underwent genotypic resistance assay between 2004 and 2008. Only major resistance mutations per International AIDS Society-USA (IAS-USA) drug resistance mutations list were considered. The prevalence of resistance was 5% (5 of 99). Three patients had one nonnucleoside reverse transcriptase inhibitor (NNRTI) mutation: 103N, 103N, and 190A, 1 patient had a protease inhibitor (PI) mutation: 90M; and 1 patient had 3-class resistance with NNRTI: 181C, 190A, PI: 90M, and nucleoside analogue reverse transcriptase inhibitor (NRTI): 41L, 210W. Mean time from HIV diagnosis to resistance testing was shorter in patients with resistance versus those without: 9 (range 0.3-42 months) versus 27 (range 0.1-418 months), P = .11. There was a trend to lower mean CD4 count in those with resistance, 170 versus 318 cells/mm(3), P = .06. No differences were noted in gender, age, HIV risk category, or HIV RNA level. The low prevalence of primary resistance may be explained by differences in demographic and risk factors or may reflect the time from infection to resistance testing. Our findings emphasize the importance of continued resistance surveillance.

  2. Alkaloids from sponge, scaffolds for the inhibition of human immunodeficiency virus (hiv)

    KAUST Repository

    O'Rourke, Aubrie

    2016-05-06

    Anti-viral compounds with low cytotoxicity are identified from screening of products found in Red Sea sponges, including the sponge Stylissa carteri. The identified compounds can be brominated pyrrole-2- aminoimidazole alkaloids and derivatives thereof. Specific examples of identified compounds include oroidin, hymenialdisine, and debromohymenialdisine, as well as derivatives thereof. The compounds also can be useful scaffolds or pharmacores for further chemical modification and derivatization. Selected compounds, particularly oroidin, show selective anti-viral HIV-1 activity coupled with reduced cytotoxicity. The compounds can function as HIV reverse-transcriptase inhibitors, and molecular modeling can be used to confirm inhibition.

  3. Reverse transcriptase sequences from mulberry LTR retrotransposons: characterization analysis

    Directory of Open Access Journals (Sweden)

    Ma Bi

    2017-10-01

    Full Text Available Copia and Gypsy play important roles in structural, functional and evolutionary dynamics of plant genomes. In this study, a total of 106 and 101, Copia and Gypsy reverse transcriptase (rt were amplified respectively in the Morus notabilis genome using degenerate primers. All sequences exhibited high levels of heterogeneity, were rich in AT and possessed higher sequence divergence of Copia rt in comparison to Gypsy rt. Two reasons are likely to account for this phenomenon: a these elements often experience deletions or fragmentation by illegitimate or unequal homologous recombination in the transposition process; b strong purifying selective pressure drives the evolution of these elements through “selective silencing” with random mutation and eventual deletion from the host genome. Interestingly, mulberry rt clustered with other rt from distantly related taxa according to the phylogenetic analysis. This phenomenon did not result from horizontal transposable element transfer. Results obtained from fluorescence in situ hybridization revealed that most of the hybridization signals were preferentially concentrated in pericentromeric and distal regions of chromosomes, and these elements may play important roles in the regions in which they are found. Results of this study support the continued pursuit of further functional studies of Copia and Gypsy in the mulberry genome.

  4. Potent Inhibition of HIV-1 Replication in Resting CD4 T Cells by Resveratrol and Pterostilbene.

    Science.gov (United States)

    Chan, Chi N; Trinité, Benjamin; Levy, David N

    2017-09-01

    HIV-1 infection of resting CD4 T cells plays a crucial and numerically dominant role during virus transmission at mucosal sites and during subsequent acute replication and T cell depletion. Resveratrol and pterostilbene are plant stilbenoids associated with several health-promoting benefits. Resveratrol has been shown to inhibit the replication of several viruses, including herpes simplex viruses 1 and 2, papillomaviruses, severe acute respiratory syndrome virus, and influenza virus. Alone, resveratrol does not inhibit HIV-1 infection of activated T cells, but it does synergize with nucleoside reverse transcriptase inhibitors in these cells to inhibit reverse transcription. Here, we demonstrate that resveratrol and pterostilbene completely block HIV-1 infection at a low micromolar dose in resting CD4 T cells, primarily at the reverse transcription step. The anti-HIV effect was fully reversed by exogenous deoxynucleosides and Vpx, an HIV-1 and simian immunodeficiency virus protein that increases deoxynucleoside triphosphate (dNTP) levels. These findings are consistent with the reported ability of resveratrol to inhibit ribonucleotide reductase and to lower dNTP levels in cells. This study supports the potential use of resveratrol, pterostilbene, or related compounds as adjuvants in anti-HIV preexposure prophylaxis (PrEP) formulations. Copyright © 2017 American Society for Microbiology.

  5. Efavirenz Has the Highest Anti-Proliferative Effect of Non-Nucleoside Reverse Transcriptase Inhibitors against Pancreatic Cancer Cells.

    Directory of Open Access Journals (Sweden)

    Markus Hecht

    Full Text Available Cancer prevention and therapy in HIV-1-infected patients will play an important role in future. The non-nucleoside reverse transcriptase inhibitors (NNRTI Efavirenz and Nevirapine are cytotoxic against cancer cells in vitro. As other NNRTIs have not been studied so far, all clinically used NNRTIs were tested and the in vitro toxic concentrations were compared to drug levels in patients to predict possible anti-cancer effects in vivo.Cytotoxicity was studied by Annexin-V-APC/7AAD staining and flow cytometry in the pancreatic cancer cell lines BxPC-3 and Panc-1 and confirmed by colony formation assays. The 50% effective cytotoxic concentrations (EC50 were calculated and compared to the blood levels in our patients and published data.The in vitro EC50 of the different drugs in the BxPC-3 pancreatic cancer cells were: Efavirenz 31.5 μmol/l (= 9944 ng/ml, Nevirapine 239 μmol/l (= 63,786 ng/ml, Etravirine 89.0 μmol/l (= 38,740 ng/ml, Lersivirine 543 μmol/l (= 168,523 ng/ml, Delavirdine 171 μmol/l (= 78,072 ng/ml, Rilpivirine 24.4 μmol/l (= 8941 ng/ml. As Efavirenz and Rilpivirine had the highest cytotoxic potential and Nevirapine is frequently used in HIV-1 positive patients, the results of these three drugs were further studied in Panc-1 pancreatic cancer cells and confirmed with colony formation assays. 205 patient blood levels of Efavirenz, 127 of Rilpivirine and 31 of Nevirapine were analyzed. The mean blood level of Efavirenz was 3587 ng/ml (range 162-15,363 ng/ml, of Rilpivirine 144 ng/ml (range 0-572 ng/ml and of Nevirapine 4955 ng/ml (range 1856-8697 ng/ml. Blood levels from our patients and from published data had comparable Efavirenz levels to the in vitro toxic EC50 in about 1 to 5% of all patients.All studied NNRTIs were toxic against cancer cells. A low percentage of patients taking Efavirenz reached in vitro cytotoxic blood levels. It can be speculated that in HIV-1 positive patients having high Efavirenz blood levels pancreatic

  6. Efavirenz poisoning in a 12 year old HIV negative African boy ...

    African Journals Online (AJOL)

    Efavirenz is an oral antiretroviral drug in the class of non nucleoside reverse transcriptase inhibitors. Toxicity at therapeutic doses has been documented but there is scarcity of data on presentation and management of Efavirenz overdose. We describe a case of Efavirenz poisoning in a 12-year old HIV Negative African boy ...

  7. A second chance for telomerase reverse transcriptase in anticancer immunotherapy.

    Science.gov (United States)

    Zanetti, Maurizio

    2017-02-01

    Telomerase reverse transcriptase (TERT) is a self-antigen that is expressed constitutively in many tumours, and is, therefore, an important target for anticancer immunotherapy. In the past 10 years, trials of immunotherapy with TERT-based vaccines have demonstrated only modest benefits. In this Perspectives, I discuss the possible immunological reasons for this limited antitumour efficacy, and propose that advances in our understanding of the genetics and biology of the involvement of TERT in cancer provides the basis for renewed interest in TERT- based immunotherapy. Telomerase and TERT are expressed in cancer cells at every stage of tumour evolution, from the cancer stem cell to circulating tumour cells and tumour metastases. Many cancer types also harbour cells with mutations in the TERT promoter region, which increase transcriptional activation of this gene. These new findings should spur new interest in the development of TERT-based immunotherapies that are redesigned in line with established immunological considerations and working principles, and are tailored to patients stratified on the basis of TERT-promoter mutations and other underlying tumour characteristics. Thus, despite the disappointment of previous clinical trials, TERT offers the potential for personalized immunotherapy, perhaps in combination with immune-checkpoint inhibition.

  8. Radiation-induced progressive decreasing in the expression of reverse transcriptase gene of hEST2 and telomerase activity

    International Nuclear Information System (INIS)

    Zhu Hanneng; Chen Wenying; Xiong Sidong

    2000-01-01

    Telomerase is a ribonucleoprotein complex that adds heximeric repeats called telomeres to the growing ends of chromosomal DNA. Telomerase activity is present in a vast majority of tumors but is repressed in most normal tissues. Human telomerase catalytic subunit gene (hEST2) reverse transcriptase (RT) segment was cloned by PCR according to the sequence published in GeneBank. PCR was used to investigate the expression of the hEST2 RT segment in diverse tumors as well as in various normal tissues. Results indicated that hEST2 RT segment was detectable in tumor cells lines but not in normal cells and tissues. In order to identify the relationship between telomerase and the biological effect of radiation injury, HeLa cells, KB cells and A431 cells were employed to measure the change in telomerase activity after 60 Co-ray irradiation at RNA level and protein level. Quantitative PCR determined that expression of hEST2 RT segment that encodes seven motifs of the human telomeras decreased with increasing dosage of radiation. In addition, a PCR-based telomeric repeat amplification protocol was used to assay telomerase activity after exposure to radiation. The results strongly support the experiments we had made: Telomerase activity decreases with increasing dosage of radiation. We conclude that detection of the hEST2 RT segment by Northern blotting is a new method for detecting telomerase activity. Furthermore, radiation can cause a dose-dependent decrease in telomerase activity. The effect of radiation on telomerase is one possible reason for the death of cancer cells after irradiation. (author)

  9. Risk of triple-class virological failure in children with HIV: a retrospective cohort study

    DEFF Research Database (Denmark)

    Castro, Hannah; Judd, Ali; Gibb, Diana M

    2011-01-01

    In adults with HIV treated with antiretroviral drug regimens from within the three original drug classes (nucleoside or nucleotide reverse transcriptase inhibitors [NRTIs], non-NRTIs [NNRTIs], and protease inhibitors), virological failure occurs slowly, suggesting that long-term virological...... failure to the three original drugs classes in children....

  10. Safety, tolerability and pharmacokinetics of doravirine, a novel HIV non-nucleoside reverse transcriptase inhibitor, after single and multiple doses in healthy subjects.

    Science.gov (United States)

    Anderson, Matt S; Gilmartin, Jocelyn; Cilissen, Caroline; De Lepeleire, Inge; Van Bortel, Luc; Dockendorf, Marissa F; Tetteh, Ernestina; Ancona, June K; Liu, Rachael; Guo, Ying; Wagner, John A; Butterton, Joan R

    2015-01-01

    Doravirine is a novel non-nucleoside inhibitor of HIV-1 reverse transcriptase with potent activity against wild-type virus (95% inhibitory concentration 19 nM, 50% human serum). Doravirine has low potential to cause drug-drug interactions since it is primarily eliminated by oxidative metabolism and does not inhibit or significantly induce drug-metabolizing enzymes. The pharmacokinetics and safety of doravirine were investigated in two double-blind, dose-escalation studies in healthy males. Thirty-two subjects received single doses of doravirine (6-1,200 mg) or matching placebo tablets; 40 subjects received doravirine (30-750 mg) or matching placebo tablets once daily for 10 days. In addition, the effect of doravirine (120 mg for 14 days) on single-dose pharmacokinetics of the CYP3A substrate midazolam was evaluated (10 subjects). The maximum plasma concentration (Cmax) of doravirine was achieved within 1-5 h with an apparent terminal half-life of 12-21 h. Consistent with single-dose pharmacokinetics, steady state was achieved after approximately 7 days of once daily administration, with accumulation ratios (day 10/day 1) of 1.1-1.5 in the area under the plasma concentration-time curve during the dosing interval (AUC0-24 h), Cmax and trough plasma concentration (C24 h). All dose levels produced C24 h>19 nM. Administration of 50 mg doravirine with a high-fat meal was associated with slight elevations in AUC time zero to infinity (AUC0-∞) and C24 h with no change in Cmax. Midazolam AUC0-∞ was slightly reduced by coadministration of doravirine (geometric mean ratio 0.82, 90% CI 0.70, 0.97). There was no apparent relationship between adverse event frequency or intensity and doravirine dose. No rash or significant central nervous system events other than headache were reported. Doravirine is generally well tolerated in single doses up to 1,200 mg and multiple doses up to 750 mg once daily for up to 10 days, with a pharmacokinetic profile supportive of once

  11. APOBEC3DE Inhibits LINE-1 Retrotransposition by Interacting with ORF1p and Influencing LINE Reverse Transcriptase Activity.

    Directory of Open Access Journals (Sweden)

    Weizi Liang

    Full Text Available Human long interspersed elements 1 (LINE-1 or L1 is the only autonomous non-LTR retroelement in humans and has been associated with genome instability, inherited genetic diseases, and the development of cancer. Certain human APOBEC3 family proteins are known to have LINE-1 restriction activity. The mechanisms by which APOBEC3 affects LINE-1 retrotransposition are not all well characterized; here, we confirm that both A3B and A3DE have a strong ability to inhibit LINE-1 retrotransposition. A3DE interacts with LINE-1 ORF1p to target LINE-1 ribonucleoprotein particles in an RNA-dependent manner. Moreover, A3DE binds to LINE-1 RNA and ORF1 protein in cell culture system. Fluorescence microscopy demonstrated that A3DE co-localizes with ORF1p in cytoplasm. Furthermore, A3DE inhibits LINE-1 reverse transcriptase activity in LINE-1 ribonucleoprotein particles in a cytidine deaminase-independent manner. In contrast, A3B has less inhibitory effects on LINE-1 reverse transcriptase activity despite its strong inhibition of LINE-1 retrotransposition. This study demonstrates that different A3 proteins have been evolved to inhibit LINE-1 activity through distinct mechanisms.

  12. Generation and Characterization of a Defective HIV-1 Virus as an Immunogen for a Therapeutic Vaccine

    Science.gov (United States)

    García-Pérez, Javier; García, Felipe; Blanco, Julia; Escribà-García, Laura; Gatell, Jose Maria; Alcamí, Jose; Plana, Montserrat; Sánchez-Palomino, Sonsoles

    2012-01-01

    Background The generation of new immunogens able to elicit strong specific immune responses remains a major challenge in the attempts to obtain a prophylactic or therapeutic vaccine against HIV/AIDS. We designed and constructed a defective recombinant virus based on the HIV-1 genome generating infective but non-replicative virions able to elicit broad and strong cellular immune responses in HIV-1 seropositive individuals. Results Viral particles were generated through transient transfection in producer cells (293-T) of a full length HIV-1 DNA carrying a deletion of 892 base pairs (bp) in the pol gene encompassing the sequence that codes for the reverse transcriptase (NL4-3/ΔRT clone). The viral particles generated were able to enter target cells, but due to the absence of reverse transcriptase no replication was detected. The immunogenic capacity of these particles was assessed by ELISPOT to determine γ-interferon production in a cohort of 69 chronic asymptomatic HIV-1 seropositive individuals. Surprisingly, defective particles produced from NL4-3/ΔRT triggered stronger cellular responses than wild-type HIV-1 viruses inactivated with Aldrithiol-2 (AT-2) and in a larger proportion of individuals (55% versus 23% seropositive individuals tested). Electron microscopy showed that NL4-3/ΔRT virions display immature morphology. Interestingly, wild-type viruses treated with Amprenavir (APV) to induce defective core maturation also induced stronger responses than the same viral particles generated in the absence of protease inhibitors. Conclusions We propose that immature HIV-1 virions generated from NL4-3/ΔRT viral clones may represent new prototypes of immunogens with a safer profile and stronger capacity to induce cellular immune responses than wild-type inactivated viral particles. PMID:23144996

  13. An RNA secondary structure bias for non-homologous reverse transcriptase-mediated deletions in vivo

    DEFF Research Database (Denmark)

    Duch, Mogens; Carrasco, Maria L; Jespersen, Thomas

    2004-01-01

    Murine leukemia viruses harboring an internal ribosome entry site (IRES)-directed translational cassette are able to replicate, but undergo loss of heterologous sequences upon continued passage. While complete loss of heterologous sequences is favored when these are flanked by a direct repeat......, deletion mutants with junction sites within the heterologous cassette may also be retrieved, in particular from vectors without flanking repeats. Such deletion mutants were here used to investigate determinants of reverse transcriptase-mediated non-homologous recombination. Based upon previous structural...... result from template switching during first-strand cDNA synthesis and that the choice of acceptor sites for non-homologous recombination are guided by non-paired regions. Our results may have implications for recombination events taking place within structured regions of retroviral RNA genomes...

  14. Short communication: prevalence of HIV type 1 transmitted drug resistance in Slovenia: 2005-2010.

    Science.gov (United States)

    Lunar, Maja M; Židovec Lepej, Snježana; Abecasis, Ana B; Tomažič, Janez; Vidmar, Ludvik; Karner, Primož; Vovko, Tomaž D; Pečavar, Blaž; Maver, Polona J; Seme, Katja; Poljak, Mario

    2013-02-01

    Slovenia is a small European country with a total of 547 HIV-infected individuals cumulatively reported by the end of 2011. However, the estimated incidence rate of HIV infections increased from 7.0 per million in 2003 to 26.8 per million in 2011. In this study, we assessed the prevalence of transmitted drug resistance (TDR) in the past 6 years (2005-2010) and analyzed the time trend of the proportion of men having sex with men (MSM) and HIV-1 subtype B among newly diagnosed individuals in a 15-year period (1996-2010) in Slovenia. Among 150 patients included in the study, representing 63% of HIV-1 newly diagnosed patients in 2005-2010, TDR was found in seven patients (4.7%). The prevalence of TDR to nucleoside reverse transcriptase inhibitors, nonnucleoside reverse transcriptase inhibitors, and protease inhibitors was 2% (3/150), 2% (3/150), and 0.7% (1/150), respectively. The majority of patients were infected with subtype B (134/150, 89%), while subtype A was detected in 6.0% (9/150), subtype D in 1.3% (2/150), and subtype G and CRF02_AG in 0.7% (one patient each). Three of 150 sequences could not be typed. Infection with subtype B was found to be significantly associated with male gender, Slovenia being reported as the country of the patient's nationality and origin of the virus, CDC class A, mode of transmission with homosexual/bisexual contact, sex with an anonymous person, and a higher CD4(+) count. Among patients carrying the subtype B virus, an MSM transmission route was reported in 87% of patients. Although the prevalence of TDR in Slovenia is still below the European average, active surveillance should be continued, especially among MSM, the most vulnerable population for HIV-1 infection in this part of Europe.

  15. Lack of Evidence for Molecular Mimicry in HIV-Infected Subjects.

    Directory of Open Access Journals (Sweden)

    Peter D Burbelo

    Full Text Available Previous studies in HIV patients have reported autoantibodies to several human proteins, including erythropoietin (EPO, interferon-α (IFN-α, interleukin-2 (IL-2, and HLA-DR, as potential mediators of anemia or immunosuppression. The etiology of these autoantibodies has been attributed to molecular mimicry between HIV epitopes and self-proteins. Here, the Luciferase Immunoprecipitation System (LIPS was used to investigate the presence of such autoantibodies in HIV-infected adults. High levels of antibodies to HIV proteins such as capsid (p24, matrix (p17, envelope (gp41, and reverse transcriptase (RT were detected using LIPS in both untreated and anti-retroviral-treated HIV-infected individuals but not in uninfected controls. LIPS readily detected anti-EPO autoantibodies in serum samples from subjects with presumptive pure red cell aplasia but not in any of the samples from HIV-infected or uninfected individuals. Similarly, subjects with HIV lacked autoantibodies to IFN-α, IL-2, HLA-DR and the immunoglobulin lambda light chain; all purported targets of molecular mimicry. While molecular mimicry between pathogen proteins and self-proteins is a commonly proposed mechanism for autoantibody production, the findings presented here indicate such a process is not common in HIV disease.

  16. Continued indinavir versus switching to indinavir/ritonavir in HIV-infected patients with suppressed viral load.

    NARCIS (Netherlands)

    Arnaiz, J.A.; Mallolas, J.; Podzamczer, D.; Gerstoft, J.; Lundgren, J.D.; Cahn, P.; Fatkenheuer, G.; D'Arminio-Monforte, A.; Casiro, A.; Reiss, P.; Burger, D.M.; Stek Jr, M.; Gatell, J.M.

    2003-01-01

    OBJECTIVE: To compare continued indinavir (IDV) 8-hourly (q8h) with switching to indinavir/ritonavir (IDV/RTV) 12-hourly (q12h) in HIV-positive patients having suppressed viral load with IDV q8h plus two nucleoside reverse transcriptase inhibitors (NRTI). DESIGN: Multicentre, international,

  17. Continued indinavir versus switching to indinavir/ritonavir in HIV-infected patients with suppressed viral load

    NARCIS (Netherlands)

    Arnaiz, Juan A.; Mallolas, Josep; Podzamczer, Daniel; Gerstoft, Jan; Lundgren, Jens D.; Cahn, Pedro; Fätkenheuer, Gerd; D'Arminio-Monforte, Antonella; Casiró, Arnaldo; Reiss, Peter; Burger, David M.; Stek, Michael; Gatell, José M.

    2003-01-01

    Objective: To compare continued indinavir (IDV) 8-hourly (q8h) with switching to indinavir/ritonavir (IDV/RTV) 12-hourly (q12h) in HIV-positive patients having suppressed viral load with IDV q8h plus two nucleoside reverse transcriptase inhibitors (NRTI). Design: Multicentre, international,

  18. Expression of telomerase reverse transcriptase in radiation-induced chronic human skin ulcer

    International Nuclear Information System (INIS)

    Zhao Po; Li Zhijun; Lu Yali; Zhong Mei; Gu Qingyang; Wang Dewen

    2001-01-01

    Objective: To investigate the expression of the catalytic subunit of telomerase, telomerase reverse transcriptase (TRT) and the possible relationship between the TRT and cancer transformation or poor healing in radiation-induced chronic ulcer of human skin. Methods: Rabbit antibody against human TRT and SP immunohistochemical method were used to detect TRT expression in 24 cases of formalin-fixed, paraffin-embed human skin chronic ulcer tissues induced by radiation, 5 cases of normal skin, 2 of burned skin, and 8 of carcinoma. Results: The positive rate for TRT was 58.3%(14/24) in chronic radiation ulcers, of which the strongly positive rate was 41.7%(10/24) and the weakly positive 16.7%(4/24), 0% in normal (0/5) and burned skin (0/2), and 100% in carcinoma (8/8). The strongly positive expression of TRT was observed almost always in the cytoplasm and nucleus of squamous epithelial cells of proliferative epidermis but the negative and partly weakly positive expression in the smooth muscles, endothelia of small blood vessels and capillaries, and fibroblasts. Chronic inflammtory cells, plasmacytes and lymphocytes also showed weakly positive for TRT. Conclusion: TRT expression could be involved in the malignant transformation of chronic radiation ulcer into squamous carcinoma, and in the poor healing caused by sclerosis of small blood vessels and lack of granulation tissue consisting of capillaries and fibroblasts

  19. Taking aim at a moving target: designing drugs to inhibit drug-resistant HIV-1 reverse transcriptases.

    Science.gov (United States)

    Sarafianos, Stefan G; Das, Kalyan; Hughes, Stephen H; Arnold, Eddy

    2004-12-01

    HIV undergoes rapid genetic variation; this variation is caused primarily by the enormous number of viruses produced daily in an infected individual. Because of this variation, HIV presents a moving target for drug and vaccine development. The variation within individuals has led to the generation of diverse HIV-1 subtypes, which further complicates the development of effective drugs and vaccines. In general, it is more difficult to hit a moving target than a stationary target. Two broad strategies for hitting a moving target (in this case, HIV replication) are to understand the movement and to aim at the portions that move the least. In the case of anti-HIV drug development, the first option can be addressed by understanding the mechanism(s) of drug resistance and developing drugs that effectively inhibit mutant viruses. The second can be addressed by designing drugs that interact with portions of the viral machinery that are evolutionarily conserved, such as enzyme active sites.

  20. Viral resuppression and detection of drug resistance following interruption of a suppressive non-nucleoside reverse transcriptase inhibitor-based regimen

    DEFF Research Database (Denmark)

    Fox, Zoe; Phillips, Andrew; Cohen, Cal

    2008-01-01

    the NRTIs, or by replacing the NNRTI with another drug before interruption. Simultaneous interruption of all antiretrovirals was discouraged. Resuppression rates 4-8 months after reinitiating NNRTI-therapy were assessed, as was the detection of drug-resistance mutations within 2 months of the treatment...... regimen. NNRTI drug-resistance mutations were observed in a relatively high proportion of patients. These data provide additional support for a staggered or switched interruption strategy for NNRTI drugs.......BACKGROUND: Interruption of a non-nucleoside reverse transcriptase inhibitor (NNRTI)-regimen is often necessary, but must be performed with caution because NNRTIs have a low genetic barrier to resistance. Limited data exist to guide clinical practice on the best interruption strategy to use...

  1. Short Communication: Prevalence of HIV Type 1 Transmitted Drug Resistance in Slovenia: 2005–2010

    Science.gov (United States)

    Lunar, Maja M.; Židovec Lepej, Snježana; Abecasis, Ana B.; Tomažič, Janez; Vidmar, Ludvik; Karner, Primož; Vovko, Tomaž D.; Pečavar, Blaž; Maver, Polona J.; Seme, Katja

    2013-01-01

    Abstract Slovenia is a small European country with a total of 547 HIV-infected individuals cumulatively reported by the end of 2011. However, the estimated incidence rate of HIV infections increased from 7.0 per million in 2003 to 26.8 per million in 2011. In this study, we assessed the prevalence of transmitted drug resistance (TDR) in the past 6 years (2005–2010) and analyzed the time trend of the proportion of men having sex with men (MSM) and HIV-1 subtype B among newly diagnosed individuals in a 15-year period (1996–2010) in Slovenia. Among 150 patients included in the study, representing 63% of HIV-1 newly diagnosed patients in 2005–2010, TDR was found in seven patients (4.7%). The prevalence of TDR to nucleoside reverse transcriptase inhibitors, nonnucleoside reverse transcriptase inhibitors, and protease inhibitors was 2% (3/150), 2% (3/150), and 0.7% (1/150), respectively. The majority of patients were infected with subtype B (134/150, 89%), while subtype A was detected in 6.0% (9/150), subtype D in 1.3% (2/150), and subtype G and CRF02_AG in 0.7% (one patient each). Three of 150 sequences could not be typed. Infection with subtype B was found to be significantly associated with male gender, Slovenia being reported as the country of the patient's nationality and origin of the virus, CDC class A, mode of transmission with homosexual/bisexual contact, sex with an anonymous person, and a higher CD4+ count. Among patients carrying the subtype B virus, an MSM transmission route was reported in 87% of patients. Although the prevalence of TDR in Slovenia is still below the European average, active surveillance should be continued, especially among MSM, the most vulnerable population for HIV-1 infection in this part of Europe. PMID:22860694

  2. Antiretroviral Drug Use in a Cohort of HIV-Uninfected Women in the United States: HIV Prevention Trials Network 064.

    Directory of Open Access Journals (Sweden)

    Iris Chen

    Full Text Available Antiretroviral (ARV drug use was analyzed in HIV-uninfected women in an observational cohort study conducted in 10 urban and periurban communities in the United States with high rates of poverty and HIV infection. Plasma samples collected in 2009-2010 were tested for the presence of 16 ARV drugs. ARV drugs were detected in samples from 39 (2% of 1,806 participants: 27/181 (15% in Baltimore, MD and 12/179 (7% in Bronx, NY. The ARV drugs detected included different combinations of non-nucleoside reverse transcriptase inhibitors and protease inhibitors (1-4 drugs/sample. These data were analyzed in the context of self-reported data on ARV drug use. None of the 39 women who had ARV drugs detected reported ARV drug use at any study visit. Further research is needed to evaluate ARV drug use by HIV-uninfected individuals.

  3. Enhanced activity of carbosilane dendrimers against HIV when combined with reverse transcriptase inhibitor drugs: searching for more potent microbicides

    Directory of Open Access Journals (Sweden)

    Vacas-Córdoba E

    2014-07-01

    Full Text Available Enrique Vacas-Córdoba,1–3 Marta Galán,3,4 Francisco J de la Mata,3,4 Rafael Gómez,3,4 Marjorie Pion,1–3 M Ángeles Muñoz-Fernández1–3 1Laboratorio InmunoBiología Molecular, Hospital General Universitario Gregorio Marañón, Madrid, Spain; 2Instituto de Investigación Sanitaria del Gregorio Marañón, Madrid, Spain; 3Networking Research Center on Bioengineering, Biomaterials and Nanomedicine, (CIBER-BBN, Madrid, Spain; 4Dendrimers for Biomedical Applications Group (BioInDen, University of Alcalá, Madrid, Spain Abstract: Self-administered topical microbicides or oral preexposure prophylaxis could be very helpful tools for all risk groups to decrease the human immunodeficiency virus (HIV-1 infection rates. Up until now, antiretrovirals (ARVs have been the most advanced microbicide candidates. Nevertheless, the majority of clinical trials has failed in HIV-1 patients. Nanotechnology offers suitable approaches to develop novel antiviral agents. Thereby, new nanosystems, such as carbosilane dendrimers, have been shown to be safe and effective compounds against HIV with great potential as topical microbicides. In addition, because most of the attempts to develop effective topical microbicides were unsuccessful, combinatorial strategies could be a valid approach when designing new microbicides. We evaluated various combinations of anionic carbosilane dendrimers with sulfated (G3-S16 and naphthyl sulfonated (G2-NF16 ended groups with different ARVs against HIV-1 infection. The G3-S16 and G2-NF16 dendrimers showed a synergistic or additive activity profile with zidovudine, efavirenz, and tenofovir in the majority of the combinations tested against the X4 and R5 tropic HIV-1 in cell lines, as well as in human primary cells. Therefore, the combination of ARVs and polyanionic carbosilane dendrimers enhances the antiviral potency of the individual compounds, and our findings support further clinical research on combinational approaches as

  4. Endogenous reverse transcriptase (RT) activity and Chromatin remodeling in normal and transformed cells and early embryos

    International Nuclear Information System (INIS)

    Spadafora, C.; Sciamanna, I.; Misteli, T.

    2009-01-01

    Endogenous Reverse Transcriptase (RT) is an enzyme encoded by two classes of genomic retro-elements: retro-transposons and endogenous retroviruses. Basal levels of RT are expressed in all non pathological, differentiated tissues while high RT expression levels characterize tumorigenic cells, germ cells and embryonic tissues. Preliminary studies carried out in our laboratory have shown that RT inhibition using pharmacological inhibitors (nevirapine and efavirenz, two drugs currently used in AIDS therapy) drastically reduces cell proliferation, promotes differentiation of tumorigenic cells in vitro, induces a reprogrammed gene expression and antagonizes tumor progression in nude mice inoculated with tumorigenic human cell lines, including melanoma, prostate and colon carcinoma and microcitoma

  5. THE APLICATION OF REVERSE TRANSCRIPTASE-POLYMERASE CHAIN REACTION FOR THE DIAGNOSIS OF CANINE DISTEMPER

    Directory of Open Access Journals (Sweden)

    I Nyoman Suartha

    2008-03-01

    Full Text Available A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward and 5’- CAAGATAACCATGTACGGTGC-3’ (backward. A single band of 300 bp which was specific for canine distemper virus CDV was detected in fifteen out of twenty samples. It is therefore evident that confirmative diagnostics of canine distemper disease can be established with RT-PCR technique.

  6. High HIV-1 Diversity and Prevalence of Transmitted Drug Resistance Among Antiretroviral-Naive HIV-Infected Pregnant Women from Rio de Janeiro, Brazil.

    Science.gov (United States)

    Delatorre, Edson; Silva-de-Jesus, Carlos; Couto-Fernandez, José Carlos; Pilotto, Jose H; Morgado, Mariza G

    2017-01-01

    Antiretroviral (ARV) resistance mutations in human immunodeficiency virus type 1 (HIV-1) infection may reduce the efficacy of prophylactic therapy to prevent mother-to-child transmission (PMTCT) and future treatment options. This study evaluated the diversity and the prevalence of transmitted drug resistance (TDR) in protease (PR) and reverse transcriptase (RT) regions of HIV-1 pol gene among 87 ARV-naive HIV-1-infected pregnant women from Rio de Janeiro, Brazil, between 2012 and 2015. The viral diversity comprised HIV-1 subtypes B (67.8%), F1 (17.2%), and C (4.6%); the circulating recombinant forms 12_BF (2.3%), 28/29_BF, 39_BF, 02_AG (1.1% each) and unique recombinants forms (4.5%). The overall prevalence of any TDR was 17.2%, of which 5.7% for nucleoside RT inhibitors, 5.7% for non-nucleoside RT inhibitors, and 8% for PR inhibitors. The TDR prevalence found in this population may affect the virological outcome of the standard PMTCT ARV-regimens, reinforcing the importance of continuous monitoring.

  7. Synthesis and biological properties of novel 2-aminopyrimidin-4(3H)-ones highly potent against HIV-1 mutant strains.

    Science.gov (United States)

    Mai, Antonello; Artico, Marino; Rotili, Dante; Tarantino, Domenico; Clotet-Codina, Imma; Armand-Ugón, Mercedes; Ragno, Rino; Simeoni, Silvia; Sbardella, Gianluca; Nawrozkij, Maxim B; Samuele, Alberta; Maga, Giovanni; Esté, José A

    2007-11-01

    Following the disclosure of dihydro-alkoxy-, dihydro-alkylthio-, and dihydro-alkylamino-benzyl-oxopyrimidines (DABOs, S-DABOs, and NH-DABOs) as potent and selective anti-HIV-1 agents belonging to the non-nucleoside reverse transcriptase inhibitor (NNRTI) class, we report here the synthesis and biological evaluation of a novel series of DABOs bearing a N,N-disubstituted amino group or a cyclic amine at the pyrimidine-C2 position, a hydrogen atom or a small alkyl group at C5 and/or at the benzylic position, and the favorable 2,6-difluorobenzyl moiety at the C6 position (F2-N,N-DABOs). The new compounds were highly active up to the subnanomolar level against both wt HIV-1 and the Y181C mutant and at the submicromolar to nanomolar range against the K103N and Y188L mutant strains. Such derivatives were more potent than S-DABOs, NH-DABOs, and nevirapine and efavirenz were chosen as reference drugs. The higher inhibitor adaptability to the HIV-1 RT non-nucleoside binding site (NNBS) may account for the higher inhibitory effect exerted by the new molecules against the mutated RTs.

  8. HIV transmitted drug resistance in adult and pediatric populations in Panama Farmacorresistencia transmitida del VIH en poblaciones adultas y pediátricas en Panamá

    OpenAIRE

    Juan Castillo; Griselda Arteaga; Yaxelis Mendoza; Alexander A. Martínez; Rigoberto Samaniego; Dora Estripeaut; Kathleen R. Page; Rebecca E. Smith; Nestor Sosa; Juan M. Pascale

    2011-01-01

    OBJECTIVE: To investigate the prevalence of transmitted drug-resistant HIV among adults in Panama by using a modified World Health Organization Threshold Survey (WHO-TS) and to investigate rates of initial resistance among HIV-positive infants in Panama. METHODS: At the Gorgas Memorial Institute, 47 HIV-positive adults were genotyped for mutations associated with transmitted drug resistance (TDR) in the reverse transcriptase and protease genes of HIV-1, according to WHO-TS guidelines, modifie...

  9. Retrotransposon-Encoded Reverse Transcriptase in the Genesis, Progression and Cellular Plasticity of Human Cancer

    International Nuclear Information System (INIS)

    Sinibaldi-Vallebona, Paola; Matteucci, Claudia; Spadafora, Corrado

    2011-01-01

    LINE-1 (Long Interspersed Nuclear Elements) and HERVs (Human Endogenous Retroviruses) are two families of autonomously replicating retrotransposons that together account for about 28% of the human genome. Genes harbored within LINE-1 and HERV retrotransposons, particularly those encoding the reverse transcriptase (RT) enzyme, are generally expressed at low levels in differentiated cells, but their expression is upregulated in transformed cells and embryonic tissues. Here we discuss a recently discovered RT-dependent mechanism that operates in tumorigenesis and reversibly modulates phenotypic and functional variations associated with tumor progression. Downregulation of active LINE-1 elements drastically reduces the tumorigenic potential of cancer cells, paralleled by reduced proliferation and increased differentiation. Pharmacological RT inhibitors (e.g., nevirapine and efavirenz) exert similar effects on tumorigenic cell lines, both in culture and in animal models. The HERV-K family play a distinct complementary role in stress-dependent transition of melanoma cells from an adherent, non-aggressive, to a non-adherent, highly malignant, growth phenotype. In synthesis, the retrotransposon-encoded RT is increasingly emerging as a key regulator of tumor progression and a promising target in a novel anti-cancer therapy

  10. Bone mineral density and inflammatory and bone biomarkers after darunavir-ritonavir combined with either raltegravir or tenofovir-emtricitabine in antiretroviral-naive adults with HIV-1: a substudy of the NEAT001/ANRS143 randomised trial

    NARCIS (Netherlands)

    Bernardino, Jose I.; Mocroft, Amanda; Mallon, Patrick W.; Wallet, Cedrick; Gerstoft, Jan; Russell, Charlotte; Reiss, Peter; Katlama, Christine; de Wit, Stephane; Richert, Laura; Babiker, Abdel; Buño, Antonio; Castagna, Antonella; Girard, Pierre-Marie; Chene, Genevieve; Raffi, Francois; Arribas, Jose R.; Dedes, Nikos; Allavena, Clotilde; Autran, Brigitte; Antinori, Andrea; Bucciardini, Raffaella; Vella, Stefano; Horban, Andrzej; Arribas, Jose; Babiker, Abdel G.; Boffito, Marta; Pillay, Deenan; Pozniak, Anton; Franquet, Xavier; Schwarze, Siegfried; Grarup, Jesper; Fischer, Aurelie; Diallo, Alpha; Molina, Jean-Michel; Saillard, Juliette; Moecklinghoff, Christiane; Stellbrink, Hans-Jurgen; van Leeuwen, Remko; Gatell, Jose; Sandstrom, Eric; Flepp, Markus; Ewings, Fiona; George, Elizabeth C.; Hudson, Fleur; Pearce, Gillian; Quercia, Romina; Prins, Jan; Wit, Ferdinand W. N. M.; Nieuwkerk, Pythia

    2015-01-01

    Osteopenia, osteoporosis, and low bone mineral density are frequent in patients with HIV. We assessed the 96 week loss of bone mineral density associated with a nucleoside or nucleotide reverse transcriptase inhibitor (NtRTI)-sparing regimen. Antiretroviral-naive adults with HIV were enrolled in 78

  11. The Prevalence of Transmitted Drug Resistance in Newly Diagnosed HIV-Infected Individuals in Croatia: The Role of Transmission Clusters of Men Who Have Sex with Men Carrying the T215S Surveillance Drug Resistance Mutation

    Science.gov (United States)

    Grgic, Ivana; Lunar, Maja M.; Poljak, Mario; Vince, Adriana; Vrakela, Ivana Baca; Planinic, Ana; Seme, Katja; Begovac, Josip

    2013-01-01

    Abstract The aim of this study was to determine the prevalence of transmitted drug resistance (TDR) in newly diagnosed and treatment-naive HIV-infected patients from Croatia and evaluate a possible contribution of transmission clusters to the spread of resistant virus. The study enrolled treatment-naive HIV-infected patients that entered clinical care at the Croatian Reference Center for HIV/AIDS between 2006 and 2008. The protease gene and a part of the reverse transcriptase gene of the HIV-1 genome were sequenced by using the Trugene HIV-1 Genotyping System. The prevalence of transmitted drug resistance was analyzed by using the surveillance drug resistance mutations (SDRM) list recommended by the WHO in 2009. We report findings for 118 of 180 eligible patients (65.6% coverage). SDRM were detected in 26 of 118 patients (22.0%) who were infected with subtype B and belonged mostly to the men having sex with men (MSM). The majority of patients with primary resistance carried SDRM associated with resistance to nucleoside analogues reverse transcriptase inhibitors (NRTIs, 23 of 118 patients, 19.5%). The most frequently found NRTI SDRM was T215S (17 of 118 patients, 14.4%). SDRM associated with resistance to nonnucleoside reverse transcriptase inhibitors were detected in three (2.5%) patients and primary resistance to protease inhibitors was not detected. Non-B subtypes were detected in 13/118 patients (11%). A total of 12 transmission pairs and eight distinct transmission clusters were identified with the largest cluster harboring sequences from 19 patients; among them all but two were carrying the T215S mutation. This study showed a high prevalence of TDR in newly diagnosed MSM from Croatia and is an important contribution concerning the relationship between local transmission clusters and the spread of resistant virus. PMID:22906365

  12. HIV-1 drug resistance genotyping from antiretroviral therapy (ART naïve and first-line treatment failures in Djiboutian patients

    Directory of Open Access Journals (Sweden)

    Elmi Abar Aden

    2012-10-01

    Full Text Available Abstract In this study we report the prevalence of antiretroviral drug resistant HIV-1 genotypes of virus isolated from Djiboutian patients who failed first-line antiretroviral therapy (ART and from ART naïve patients. Patients and methods A total of 35 blood samples from 16 patients who showed first-line ART failure (>1000 viral genome copies/ml and 19 ART-naïve patients were collected in Djibouti from October 2009 to December 2009. Both the protease (PR and reverse transcriptase (RT genes were amplified and sequenced using National Agency for AIDS Research (ANRS protocols. The Stanford HIV database algorithm was used for interpretation of resistance data and genotyping. Results Among the 16 patients with first-line ART failure, nine (56.2% showed reverse transcriptase inhibitor-resistant HIV-1 strains: two (12.5% were resistant to nucleoside (NRTI, one (6.25% to non-nucleoside (NNRTI reverse transcriptase inhibitors, and six (37.5% to both. Analysis of the DNA sequencing data indicated that the most common mutations conferring drug resistance were M184V (38% for NRTI and K103N (25% for NNRTI. Only NRTI primary mutations K101Q, K103N and the PI minor mutation L10V were found in ART naïve individuals. No protease inhibitor resistant strains were detected. In our study, we found no detectable resistance in ∼ 44% of all patients who experienced therapeutic failure which was explained by low compliance, co-infection with tuberculosis and malnutrition. Genotyping revealed that 65.7% of samples were infected with subtype C, 20% with CRF02_AG, 8.5% with B, 2.9% with CRF02_AG/C and 2.9% with K/C. Conclusion The results of this first study about drug resistance mutations in first-line ART failures show the importance of performing drug resistance mutation test which guides the choice of a second-line regimen. This will improve the management of HIV-infected Djiboutian patients. Virtual slides The virtual slide(s for this article can be found

  13. 6-(1-Benzyl-1H-pyrrol-2-yl)-2,4-dioxo-5-hexenoic acids as dual inhibitors of recombinant HIV-1 integrase and ribonuclease H, synthesized by a parallel synthesis approach.

    Science.gov (United States)

    Costi, Roberta; Métifiot, Mathieu; Esposito, Francesca; Cuzzucoli Crucitti, Giuliana; Pescatori, Luca; Messore, Antonella; Scipione, Luigi; Tortorella, Silvano; Zinzula, Luca; Novellino, Ettore; Pommier, Yves; Tramontano, Enzo; Marchand, Christophe; Di Santo, Roberto

    2013-11-14

    The increasing efficiency of HAART has helped to transform HIV/AIDS into a chronic disease. Still, resistance and drug-drug interactions warrant the development of new anti-HIV agents. We previously discovered hit 6, active against HIV-1 replication and targeting RNase H in vitro. Because of its diketo-acid moiety, we speculated that this chemotype could serve to develop dual inhibitors of both RNase H and integrase. Here, we describe a new series of 1-benzyl-pyrrolyl diketohexenoic derivatives, 7a-y and 8a-y, synthesized following a parallel solution-phase approach. Those 50 analogues have been tested on recombinant enzymes (RNase H and integrase) and in cell-based assays. Approximately half (22) exibited inhibition of HIV replication. Compounds 7b, 7u, and 8g were the most active against the RNase H activity of reverse-transcriptase, with IC50 values of 3, 3, and 2.5 μM, respectively. Compound 8g was also the most potent integrase inhibitor with an IC50 value of 26 nM.

  14. Differential Regulation of Telomerase Reverse Transcriptase Promoter Activation and Protein Degradation by Histone Deacetylase Inhibition.

    Science.gov (United States)

    Qing, Hua; Aono, Jun; Findeisen, Hannes M; Jones, Karrie L; Heywood, Elizabeth B; Bruemmer, Dennis

    2016-06-01

    Telomerase reverse transcriptase (TERT) maintains telomeres and is rate limiting for replicative life span. While most somatic tissues silence TERT transcription resulting in telomere shortening, cells derived from cancer or cardiovascular diseases express TERT and activate telomerase. In the present study, we demonstrate that histone deacetylase (HDAC) inhibition induces TERT transcription and promoter activation. At the protein level in contrast, HDAC inhibition decreases TERT protein abundance through enhanced degradation, which decreases telomerase activity and induces senescence. Finally, we demonstrate that HDAC inhibition decreases TERT expression during vascular remodeling in vivo. These data illustrate a differential regulation of TERT transcription and protein stability by HDAC inhibition and suggest that TERT may constitute an important target for the anti-proliferative efficacy of HDAC inhibitors. © 2015 Wiley Periodicals, Inc.

  15. Telomerase reverse transcriptase mediated immortalization of human bone marrow stromal cells

    Directory of Open Access Journals (Sweden)

    Yong Teng

    2014-02-01

    Full Text Available Primary human bone marrow stromal cells (hMSCs were transfected with human telomerase reverse transcriptase (hTERT gene with lipofection method. The hTERT transfected hMSCs of passage 100 underwent chondrogenesis induction with dexamethasone, transforming the growth factor β and vitamin C, osteogenesis induction with dexamethasone, β glycerophosphoric acid and vitamin C, and cardiomyocyte induction with 5-azacytidine. After 7, 14, 21 and 28 days of induction, immunocytochemistry was performed to detect the expressions of type I and II collagen and osteocalcin, and alizarin red staining was performed to detect the bone nodule formation in osteogenesis induction. Immunocytochemistry was carried out to detect the striated muscle actin expression in cardiomyocytes. The hMSCs undergoing successful transfection were positive for the hTERT. The hTERT transfected cells were grown in vitro successfully and passaged for 136 generations. Results showed that these cells could be induced to differentiate into chondrocytes, bone and myocardial cells. Introduction of exogenous hTERT into hMSCs could achieve immortalized hMSCs with the potential of multi-directional differentiation. Thus, these cells could be applied as seed cells in tissue engineering.

  16. Antitumor Activity and Mechanism of a Reverse Transcriptase Inhibitor, Dapivirine, in Glioblastoma.

    Science.gov (United States)

    Liu, Weiwen; Song, Xian-Lu; Zhao, Shan-Chao; He, Minyi; Wang, Hai; Chen, Ziyang; Xiang, Wei; Yi, Guozhong; Qi, Songtao; Liu, Yawei

    2018-01-01

    Dapivirine is one of reverse transcriptase inhibitors (RTIs). It is the prototype of diarylpyrimidines (DAPY), formerly known as TMC120 or DAPY R147681 (IUPAC name: 4- [[4-(2, 4, 6-trimethylphenyl) amino]-2-pyrimidinyl] amino]-benzonitrile; CAS no.244767-67-7). The purpose of this study is to investigate the antitumor activity of dapivirine, one of the RTIs, on U87 glioblastoma (GBM) cells in vitro and in vivo . U87 GBM cells were cultured and treated with or without dapivirine. Cell viability was evaluated by CCK-8 (Cell Counting Kit 8, CCK-8) assay; apoptosis was analyzed by flow cytometry; cell migration was evaluated by Boyden Chamber assay; Western blotting was performed to detect proteins related to apoptosis, epithelial-to-mesenchymal transition and autophagy. PathScan intracellular signaling array kit was used to detect important and well-characterized signaling molecules. Tumor xenograft model in nude mice was used to evaluate the antitumorigenic effect in vivo . Dapivirine weakened proliferation of glioma cells and induced the apoptosis of U87 glioblastoma cells. Furthermore, dapivirine regulated autophagy and induced Akt, Bad and SAPK/JNK activations. Moreover, the inhibition of glioma cell growth by dapivirine was also observed in nude mice in vivo . In summary, in our study dapivirine exposure induces stress, resulting in JNK and PI3K/Akt pathway activation through diminished inhibition of the apoptosis and autophagy cascade in U87 GBM cells, which inhibits cell growth in vitro and in vivo .

  17. 7-Chloro-11a-phenyl-2,3,5,10,11,11a-hexahydro-1H-pyrrolo[2,1-c][1,4]benzodiazepine-5,11-dione

    Directory of Open Access Journals (Sweden)

    Vahan Martirosyan

    2008-03-01

    Full Text Available The title compound, C18H15ClN2O2, is a potential human immunodeficiency virus type-1 (HIV-1 non-nucleoside reverse transcriptase inhibitor. The pyrrolidine ring adopts an envelope and the diazepine ring a boat conformation. In the crystal structure, two isomers (R and S form centrosymmetric dimers via N—H...O hydrogen bonds.

  18. Protease inhibitor associated mutations compromise the efficacy of therapy in human immunodeficiency virus – 1 (HIV-1 infected pediatric patients: a cross-sectional study

    Directory of Open Access Journals (Sweden)

    Petrova Anna

    2007-07-01

    Full Text Available Abstract Background Although the introduction of combined therapy with reverse transcriptase and protease inhibitors has resulted in considerable decrease in HIV related mortality; it has also induced the development of multiple drug-resistant HIV-1 variants. The few studies on HIV-1 mutagenesis in HIV infected children have not evaluated the impact of HIV-1 mutations on the clinical, virological and immunological presentation of HIV disease that is fundamental to optimizing the treatment regimens for these patients. Results A cross sectional study was conducted to evaluate the impact of treatment regimens and resistance mutation patterns on the clinical, virological, and immunological presentation of HIV disease in 41 children (25 male and 16 female at the Robert Wood Johnson Pediatric AIDS Program in New Brunswick, New Jersey. The study participants were symptomatic and had preceding treatment history with combined ARV regimens including protease inhibitors (PIs, nucleoside reverse transcriptase inhibitors (NRTIs and non-nucleoside reverse transcriptase inhibitors (NNRTIs. Fifteen (36.6% children were treated with NRTI+NNRTI+ PI, 6 (14.6% with NRTI+NNRTIs, 13 (31.7% with NRTI+PIs, and the remaining 7 (17.1% received NRTIs only. Combined ARV regimens did not significantly influence the incidence of NRTI and NNRTI associated mutations. The duration of ARV therapy and the child's age had no significant impact on the ARV related mutations. The clinico-immunological presentation of the HIV disease was not associated with ARV treatment regimens or number of resistance mutations. However, primary mutations in the protease (PR gene increased the likelihood of plasma viral load (PVL ≥ 10,000 copies/mL irrespective of the child's age, duration of ARV therapy, presence of NRTI and NNRTI mutation. Viremia ≥ 10,000 copies/mL was recorded in almost all the children with primary mutations in the PR region (n = 12/13, 92.3% as compared with only 50.0% (n

  19. Applicability of integrated cell culture reverse transcriptase quantitative PCR (ICC-RTqPCR) for the simultaneous detection of the four human enteric enterovirus species in disinfection studies

    Science.gov (United States)

    A newly developed integrated cell culture reverse transcriptase quantitative PCR (ICC-RTqPCR) method and its applicability in UV disinfection studies is described. This method utilizes a singular cell culture system coupled with four RTqPCR assays to detect infectious serotypes t...

  20. Reverse transcriptase genes are highly abundant and transcriptionally active in marine plankton assemblages

    KAUST Repository

    Lescot, Magali

    2015-11-27

    Genes encoding reverse transcriptases (RTs) are found in most eukaryotes, often as a component of retrotransposons, as well as in retroviruses and in prokaryotic retroelements. We investigated the abundance, classification and transcriptional status of RTs based on Tara Oceans marine metagenomes and metatranscriptomes encompassing a wide organism size range. Our analyses revealed that RTs predominate large-size fraction metagenomes (>5 μm), where they reached a maximum of 13.5% of the total gene abundance. Metagenomic RTs were widely distributed across the phylogeny of known RTs, but many belonged to previously uncharacterized clades. Metatranscriptomic RTs showed distinct abundance patterns across samples compared with metagenomic RTs. The relative abundances of viral and bacterial RTs among identified RT sequences were higher in metatranscriptomes than in metagenomes and these sequences were detected in all metatranscriptome size fractions. Overall, these observations suggest an active proliferation of various RT-assisted elements, which could be involved in genome evolution or adaptive processes of plankton assemblage.

  1. Reverse transcriptase genes are highly abundant and transcriptionally active in marine plankton assemblages

    KAUST Repository

    Lescot, Magali; Hingamp, Pascal; Kojima, Kenji K; Villar, Emilie; Romac, Sarah; Veluchamy, Alaguraj; Boccara, Martine; Jaillon, Olivier; Ludicone, Daniele; Bowler, Chris; Wincker, Patrick; Claverie, Jean-Michel; Ogata, Hiroyuki

    2015-01-01

    Genes encoding reverse transcriptases (RTs) are found in most eukaryotes, often as a component of retrotransposons, as well as in retroviruses and in prokaryotic retroelements. We investigated the abundance, classification and transcriptional status of RTs based on Tara Oceans marine metagenomes and metatranscriptomes encompassing a wide organism size range. Our analyses revealed that RTs predominate large-size fraction metagenomes (>5 μm), where they reached a maximum of 13.5% of the total gene abundance. Metagenomic RTs were widely distributed across the phylogeny of known RTs, but many belonged to previously uncharacterized clades. Metatranscriptomic RTs showed distinct abundance patterns across samples compared with metagenomic RTs. The relative abundances of viral and bacterial RTs among identified RT sequences were higher in metatranscriptomes than in metagenomes and these sequences were detected in all metatranscriptome size fractions. Overall, these observations suggest an active proliferation of various RT-assisted elements, which could be involved in genome evolution or adaptive processes of plankton assemblage.

  2. The reverse transcriptase encoded by LINE-1 retrotransposons in the genesis, progression and therapy of cancer

    Directory of Open Access Journals (Sweden)

    Ilaria eSciamanna

    2016-02-01

    Full Text Available In higher eukaryotic genomes, Long Interspersed Nuclear Element 1 (LINE-1 retrotransposons represent a large family of repeated genomic elements. They transpose using a reverse transcriptase (RT, which they encode as part of the ORF2p product. RT inhibition in cancer cells, either via RNA interference-dependent silencing of active LINE-1 elements, or using RT inhibitory drugs, reduces cancer cell proliferation, promotes their differentiation and antagonizes tumor progression in animal models. Indeed, the nonnucleoside RT inhibitor efavirenz has recently been tested in a phase II clinical trial with metastatic prostate cancer patients. An in-depth analysis of ORF2p in a mouse model of breast cancer showed ORF2p to be precociously expressed in precancerous lesions and highly abundant in advanced cancer stages, while being barely detectable in normal breast tissue, providing a rationale for the finding that RT-expressing tumours are therapeutically sensitive to RT inhibitors. We summarise mechanistic and gene profiling studies indicating that highly abundant LINE-1-derived RT can sequester RNA substrates for reverse transcription in tumor cells, entailing the formation of RNA:DNA hybrid molecules and impairing the overall production of regulatory miRNAs, with a global impact on the cell transcriptome. Based on these data, LINE-1-ORF2 encoded RT has a tumor-promoting potential that is exerted at an epigenetic level. We propose a model whereby LINE1-RT drives a previously unrecognized global regulatory process, the deregulation of which drives cell transformation and tumorigenesis and possibly implicated in cancer cell heterogeneity.

  3. The reverse transcriptase encoded by LINE-1 retrotransposons in the genesis, progression and therapy of cancer

    Science.gov (United States)

    Sciamanna, Ilaria; De Luca, Chiara; Spadafora, Corrado

    2016-02-01

    In higher eukaryotic genomes, Long Interspersed Nuclear Element 1 (LINE-1) retrotransposons represent a large family of repeated genomic elements. They transpose using a reverse transcriptase (RT), which they encode as part of the ORF2p product. RT inhibition in cancer cells, either via RNA interference-dependent silencing of active LINE-1 elements, or using RT inhibitory drugs, reduces cancer cell proliferation, promotes their differentiation and antagonizes tumor progression in animal models. Indeed, the nonnucleoside RT inhibitor efavirenz has recently been tested in a phase II clinical trial with metastatic prostate cancer patients. An in-depth analysis of ORF2p in a mouse model of breast cancer showed ORF2p to be precociously expressed in precancerous lesions and highly abundant in advanced cancer stages, while being barely detectable in normal breast tissue, providing a rationale for the finding that RT-expressing tumours are therapeutically sensitive to RT inhibitors. We summarise mechanistic and gene profiling studies indicating that highly abundant LINE-1-derived RT can “sequester” RNA substrates for reverse transcription in tumor cells, entailing the formation of RNA:DNA hybrid molecules and impairing the overall production of regulatory miRNAs, with a global impact on the cell transcriptome. Based on these data, LINE-1-ORF2 encoded RT has a tumor-promoting potential that is exerted at an epigenetic level. We propose a model whereby LINE1-RT drives a previously unrecognized global regulatory process, the deregulation of which drives cell transformation and tumorigenesis and possibly implicated in cancer cell heterogeneity.

  4. The history of antiretrovirals: key discoveries over the past 25 years.

    Science.gov (United States)

    De Clercq, Erik

    2009-09-01

    Within 25 years after zidovudine (3'-azido-2',3'-dideoxythymidine, AZT) was first described as an inhibitor of HIV replication, 25 anti-HIV drugs have been formally approved for clinical use in the treatment of HIV infections: seven nucleoside reverse transcriptase inhibitors (NRTIs): zidovudine, didanosine, zalcitabine, stavudine, lamivudine, abacavir and emtricitabine; one nucleotide reverse transcriptase inhibitor (NtRTI): tenofovir [in its oral prodrug form: tenofovir disoproxil fumarate (TDF)]; four non-nucleoside reverse transcriptase inhibitors (NNRTIs): nevirapine, delavirdine, efavirenz and etravirine; ten protease inhibitors (PIs): saquinavir, ritonavir, indinavir, nelfinavir, amprenavir, lopinavir, atazanavir, fosamprenavir, tipranavir and darunavir; one fusion inhibitor (FI): enfuvirtide; one co-receptor inhibitor (CRI): maraviroc and one integrase inhibitor (INI): raltegravir. These compounds are used in various drug combination (some at fixed dose) regimens so as to achieve the highest possible benefit and tolerability, and to diminish the risk of virus-drug resistance development. (c) 2009 John Wiley & Sons, Ltd.

  5. PRACTICE OF USING VIRAL PROTEASE INHIBITORS IN CHILDREN WITH HIV INFECTION

    Directory of Open Access Journals (Sweden)

    V.B. Denisenko

    2010-01-01

    Full Text Available Selection of the most effective and safest high-active antiretroviral therapies is a critical issue faced by modern HIV medicine. Authors studied 28 children with HIV infection aged from 3 to 7 divided into two groups administered a combination of two HIV reverse transcriptase nucleoside inhibitors with viral protease nelfinavir inhibitors (n = 13 and lopinavir/ritonavir (n = 15. The subjects in both groups demonstrated a decreased frequency of HIV-associated symptoms and opportunistic infections, positive dynamics of immunological indicators, suppression of HIV replication. When lopinavir/ritonavir was administered, there was more even better dynamics in clinical, immunological and virologic parameters, which allows this medication to be recommended as a antiretroviral therapy for children. Key words: HIV infection, lopinavir/ritonavir, nelfinavir, children. (Pediatric Pharmacology. – 2010; 7(1:62-67

  6. Flazinamide, a novel β-carboline compound with anti-HIV actions

    International Nuclear Information System (INIS)

    Wang Yunhua; Tang Jianguo; Wang Ruirui; Yang Liumeng; Dong Zejun; Du Li; Shen Xu; Liu Jikai; Zheng Yongtang

    2007-01-01

    A β-carboline compound, flazin isolated from Suillus granulatus has been shown weak anti-HIV-1 activity. Based on the structure of flazin, flazinamide [1-(5'- hydromethyl-2'-furyl)-β-carboline-3-carboxamide] was synthesized and its anti-HIV activities were evaluated in the present study. The cytotoxicity of flazinamide was about 4.1-fold lower than that of flazin. Flazinamide potently reduced syncytium formation induced by HIV-1IIIB with EC50 value of 0.38 μM, the EC50 of flazinamide was about 6.2-fold lower than that of flazin. Flazinamide also inhibited HIV-2ROD and HIV-2CBL-20 infection with EC50 values of 0.57 and 0.89 μM, respectively. Flazinamide reduced p24 antigen expression in HIV-1IIIB acute infected C8166 and in clinical isolated strain HIV-1KM018 infected PBMC, with EC50 values of 1.45 and 0.77 μM, respectively. Flazinamide did not suppress HIV-1 replication in chronically infected H9 cells. Flazinamide blocked the fusion between normal cells and HIV-1 or HIV-2 chronically infected cells. It weakly inhibited activities of recombinant HIV-1 reverse transcriptase, protease or integrase at higher concentrations. In conclusion, the conversion of the carboxyl group in 3 position of flazin markedly enhanced the anti-viral activity (TI value increased from 12.1 to 312.2) and flazinamide might interfere in the early stage of HIV life cycle

  7. Synthesis of a novel series of 4-arylpiperazinyl derivatives linked to a 2-(pyridin-3-yl)-1H-benzimidazole as new Delavirdine analogues

    International Nuclear Information System (INIS)

    Pessoa-Mahana, David; Nunez, Andres; Espinosa, Christian; Mella-Raipn, Jaime; Pessoa-Mahana, Hernan

    2010-01-01

    The synthesis of a series of substituted arylpiperazines linked to a 2-(pyridin-3-yl)-1H-benzo[d]imidazole scaffold through an alkylic linker is reported. The novel 1-(2-(4-arylpiperazin-1-yl)alkyl)-2-(pyridin-3-yl)-1H-benzimidazole derivatives are structurally related to the anti-HIV-1 drug Delavirdine and belong to the bis(heteroaryl)piperazines family (BHAPs), a well known HIV-1 reverse transcriptase inhibitors group. (author)

  8. An overview of the molecular and epidemiological features of HIV-1 infection in two major cities of Bahia state, Brazil.

    Science.gov (United States)

    Amaral, Amanda Gm; Oliveira, Isabele B; Carneiro, Diego C; Alcantara, Luiz Cj; Monteiro-Cunha, Joana P

    2017-06-01

    The high mutation rate of the human immunodeficiency virus (HIV) has created a public health challenge because the use of antiretroviral drugs can generate selective pressure that drives resistance in these viruses. The aim of this work was to characterise the molecular and epidemiological profile of HIV in Bahia, Brazil. DNA sequences from regions of HIV gag, pol, and env genes were obtained from previous studies performed in this area between 2002 and 2012. Their genotype and drug-resistance mutations were identified using bioinformatics tools. Clinical and epidemiological data were analysed. Among 263 individuals (46.4% male), 97.5% were asymptomatic and 49.1% were receiving treatment. Most of the individuals were 31 to 40 years old (36.9%) and infected through heterosexual contact (40.7%). The predominant genotype was B (68.1%) followed by BF recombinants (18.6%). Among the individuals infected with either F or BF genotypes, 68.4% were women and 76.8% were infected through heterosexual transmission. The prevalence of associated mutations conferring antiretroviral resistance was 14.2%, with 3.8% of all mutations conferring resistance to protease inhibitors, 9.43% to nucleoside reverse transcriptase inhibitors, and 8.5% to non-nucleoside reverse transcriptase inhibitors. Drug resistance was higher in individuals receiving treatment (26.1%) than in the drug-naïve (4.3%) individuals. This study will contribute to the understanding and monitoring of HIV epidemic in this Brazilian region.

  9. [Analysis on HIV-1 genetics and threshold of drug resistance in Dehong prefecture of Yunnan province in 2013].

    Science.gov (United States)

    Ma, Yanling; Wang, Jibao; Xing, Hui; Chen, Min; Yao, Shitang; Chen, Huichao; Yang, Jin; Li, Yanling; Duan, Song; Jia, Manhong

    2015-06-01

    To study the HIV-1 genotypes and transmitted drug resistance (TDR) in Dehong prefecture of Yunnan province in 2013. Referring to the guidelines for HIV drug resistance threshold survey (HIVDR-TS), 54 plasma samples of recently reported HIV-infected individuals, aged between 16 and 25 years, were collected in Dehong prefecture from January to August 2013. Genotyping of partial pol gene was performed by using reverse transcriptional PCR. HIV-1 genotype. Prevalent levels of HIV-1 drug resistance transmission were analyzed. Forty-eight plasma samples were successfully sequenced and analyzed. Among them, 45.8% were Chinese and the rest 54.2% were all Burmese. Based on pol sequences, identified HIV genotypes included subtype C (41.7%), URF (31.3%), CRF01_AE (12.5%), CRF07_BC (10.4%), CRF08_BC (2.1%) and subtype B (2.1%), C subtype appeared dominated in Chinese while URF was dominated in Burmese. One drug resistant mutation to non-nucleoside reverse transcriptase inhibitors (NNRTIs) was detected in one sequence from Burmese. Based on the statistical method of HIVDR-TS, the prevalence of transmitted HIV-1 drug resistance was adjusted as scientific management for people living with HIV/AIDS should be strictly followed. Meanwhile, relevant surveillance, including drug resistance surveillance should also be performed among cross-border migrant population.

  10. High prevalence of HIV-1 transmitted drug-resistance mutations from proviral DNA massively parallel sequencing data of therapy-naïve chronically infected Brazilian blood donors.

    Directory of Open Access Journals (Sweden)

    Rodrigo Pessôa

    Full Text Available An improved understanding of the prevalence of low-abundance transmitted drug-resistance mutations (TDRM in therapy-naïve HIV-1-infected patients may help determine which patients are the best candidates for therapy. In this study, we aimed to obtain a comprehensive picture of the evolving HIV-1 TDRM across the massive parallel sequences (MPS of the viral entire proviral genome in a well-characterized Brazilian blood donor naïve to antiretroviral drugs.The MPS data from 128 samples used in the analysis were sourced from Brazilian blood donors and were previously classified by less-sensitive (LS or "detuned" enzyme immunoassay as non-recent or longstanding HIV-1 infections. The Stanford HIV Resistance Database (HIVDBv 6.2 and IAS-USA mutation lists were used to interpret the pattern of drug resistance. The minority variants with TDRM were identified using a threshold of ≥ 1.0% and ≤ 20% of the reads sequenced. The rate of TDRM in the MPS data of the proviral genome were compared with the corresponding published consensus sequences of their plasma viruses.No TDRM were detected in the integrase or envelope regions. The overall prevalence of TDRM in the protease (PR and reverse transcriptase (RT regions of the HIV-1 pol gene was 44.5% (57/128, including any mutations to the nucleoside analogue reverse transcriptase inhibitors (NRTI and non-nucleoside analogue reverse transcriptase inhibitors (NNRTI. Of the 57 subjects, 43 (75.4% harbored a minority variant containing at least one clinically relevant TDRM. Among the 43 subjects, 33 (76.7% had detectable minority resistant variants to NRTIs, 6 (13.9% to NNRTIs, and 16 (37.2% to PR inhibitors. The comparison of viral sequences in both sources, plasma and cells, would have detected 48 DNA provirus disclosed TDRM by MPS previously missed by plasma bulk analysis.Our findings revealed a high prevalence of TDRM found in this group, as the use of MPS drastically increased the detection of these

  11. Population-based monitoring of emerging HIV-1 drug resistance on antiretroviral therapy and associated factors in a sentinel site in Cameroon: low levels of resistance but poor programmatic performance.

    Directory of Open Access Journals (Sweden)

    Serge C Billong

    Full Text Available BACKGROUND: Scale-up of antiretroviral therapy (ART in resource-limited settings has drastically reduced HIV-related morbidity and mortality. However, challenges in long-term ART, adherence and HIV drug resistance (HIVDR itself, require monitoring to limit HIVDR emergence among ART-experienced populations, in order to ensure regimen efficacy. METHODS: A longitudinal study was conducted from 2009-2011 in a cohort of 141 HIV-infected adult patients (aged >21 at the national social insurance centre hospital in Yaounde, Cameroon. As per-WHO HIVDR protocol, HIV-1 protease-reverse transcriptase genotyping was performed at baseline and at endpoint (12 months on first-line ART using ViroSeq™ Genotyping kit. RESULTS: At baseline, a prevalence of 3.6% (5/139 HIVDR was observed [protease inhibitors M46I (1/5, G73A (1/5, L90LM (1/5; nucleoside reverse transcriptase inhibitors: M184V (1/5, T215F (1/5; non-nucleoside reverse transcriptase inhibitors: K103N (1/5, Y181Y/C (2/5, M230ML (1/5]. At endpoint, 54.0% (76 patients were followed-up, 9.2% (13 died, and 3.5% (5 transferred, 38.5% (47 lost to follow-up (LTFU. 69.7% (53/76 of those followed-up had viremia <40 copies/ml and 90.8% (69/76 <1000 copies/ml. 4/7 patients with viremia ≥1000 copies/ml harbored HIVDR (prevalence: 5.3%; 4/76, with M184V/I (4/4 and K103K/N (3/4 being the most prevalent mutations. LTFU was favored by costs for consultation/laboratory tests, drug shortages, workload (physician/patient ratio: 1/180 and community disengagement. CONCLUSIONS: Low levels of HIVDR at baseline and at endpoint suggest a probable effectiveness of ART regimens used in Cameroon. However the possible high rate of HIVDR among LTFUs limited the strengths of our findings. Evaluating HIVDR among LTFU, improving adherence, task shifting, subsidizing/harmonizing costs for routine follow-up, are urgent measures to ensure an improved success of the country ART performance.

  12. Antiretroviral Drugs for Treatment and Prevention of HIV Infection in Adults

    Science.gov (United States)

    Günthard, Huldrych F.; Saag, Michael S.; Benson, Constance A.; del Rio, Carlos; Eron, Joseph J.; Gallant, Joel E.; Hoy, Jennifer F.; Mugavero, Michael J.; Sax, Paul E.; Thompson, Melanie A.; Gandhi, Rajesh T.; Landovitz, Raphael J.; Smith, Davey M.; Jacobsen, Donna M.; Volberding, Paul A.

    2016-01-01

    IMPORTANCE New data and therapeutic options warrant updated recommendations for the use of antiretroviral drugs (ARVs) to treat or to prevent HIV infection in adults. OBJECTIVE To provide updated recommendations for the use of antiretroviral therapy in adults (aged ≥18 years) with established HIV infection, including when to start treatment, initial regimens, and changing regimens, along with recommendations for using ARVs for preventing HIV among those at risk, including preexposure and postexposure prophylaxis. EVIDENCE REVIEW A panel of experts in HIV research and patient care convened by the International Antiviral Society-USA reviewed data published in peer-reviewed journals, presented by regulatory agencies, or presented as conference abstracts at peer-reviewed scientific conferences since the 2014 report, for new data or evidence that would change previous recommendations or their ratings. Comprehensive literature searches were conducted in the PubMed and EMBASE databases through April 2016. Recommendations were by consensus, and each recommendation was rated by strength and quality of the evidence. FINDINGS Newer data support the widely accepted recommendation that antiretroviral therapy should be started in all individuals with HIV infection with detectable viremia regardless of CD4 cell count. Recommended optimal initial regimens for most patients are 2 nucleoside reverse transcriptase inhibitors (NRTIs) plus an integrase strand transfer inhibitor (InSTI). Other effective regimens include nonnucleoside reverse transcriptase inhibitors or boosted protease inhibitors with 2 NRTIs. Recommendations for special populations and in the settings of opportunistic infections and concomitant conditions are provided. Reasons for switching therapy include convenience, tolerability, simplification, anticipation of potential new drug interactions, pregnancy or plans for pregnancy, elimination of food restrictions, virologic failure, or drug toxicities. Laboratory

  13. Identification of N-phenyl-N'-(2,2,6,6-tetramethyl-piperidin-4-yl)-oxalamides as a new class of HIV-1 entry inhibitors that prevent gp120 binding to CD4

    International Nuclear Information System (INIS)

    Zhao Qian; Ma Liying; Jiang Shibo; Lu Hong; Liu Shuwen; He Yuxian; Strick, Nathan; Neamati, Nouri; Debnath, Asim Kumar

    2005-01-01

    We have identified two N-phenyl-N'-(2,2,6,6-tetramethyl-piperidin-4-yl)-oxalamide analogs as a novel class of human immunodeficiency virus type 1 (HIV-1) entry inhibitors that block the gp120-CD4 interaction, using database screening techniques. The lead compounds, NBD-556 and NBD-557, are small molecule organic compounds with drug-like properties. These compounds showed potent cell fusion and virus-cell fusion inhibitory activity at low micromolar levels. A systematic study showed that these compounds target viral entry by inhibiting the binding of HIV-1 envelope glycoprotein gp120 to the cellular receptor CD4 but did not inhibit reverse transcriptase, integrase, or protease, indicating that they do not target the later stages of the HIV-1 life cycle to inhibit HIV-1 infection. These compounds were equally potent inhibitors of both X4 and R5 viruses tested in CXCR4 and CCR5 expressing cell lines, respectively, indicating that their anti-HIV-1 activity is not dependent on the coreceptor tropism of the virus. A surface plasmon resonance study, which measures binding affinity, clearly demonstrated that these compounds bind to unliganded HIV-1 gp120 but not to the cellular receptor CD4. NBD-556 and NBD-557 were active against HIV-1 laboratory-adapted strains including an AZT-resistant strain and HIV-1 primary isolates, indicating that these compounds can potentially be further modified to become potent HIV-1 entry inhibitors

  14. Pharmacokinetics and Pharmacodynamics of Atazanavir in HIV-1-Infected Children Treated With Atazanavir Powder and Ritonavir: Combined Analysis of the PRINCE-1 and -2 Studies.

    Science.gov (United States)

    Sevinsky, Heather; Zaru, Luna; Wang, Reena; Xu, Xiaohui; Pikora, Cheryl; Correll, Todd A; Eley, Timothy

    2018-06-01

    Two clinical studies (PRINCE-1 and -2) in HIV-1-infected children assessed the safety, efficacy and pharmacokinetics of dual nucleos(t)ide reverse transcriptase inhibitor background therapy plus once-daily atazanavir (ATV) powder formulation boosted with ritonavir (ATV + RTV). Here, we present a combined analysis of ATV pharmacokinetics and pharmacodynamics across these studies. Intensive 24-hour pharmacokinetic profiles at steady state compared ATV exposures (area under the concentration-time curve in one dosing interval) in 5 ATV + RTV baseline weight-band dosing categories, with historic data in adults receiving ATV + RTV 300/100 mg capsules. Repeated ATV Ctrough measurements over 48 weeks explored relationships between ATV composite Ctrough quartiles (CCQs) with virologic efficacy and key safety parameters. Of 146 children included in this combined analysis, 49.3% were male, 56.8% were Black/African American and 62.3% were antiretroviral experienced. Proportions with HIV-1 RNA <50 copies/mL at week 48 were 13/32, 24/32, 19/32 and 13/28 in the lowest through highest ATV CCQs, respectively. Mean changes from baseline in total bilirubin at week 48 were +0.3, +0.5, +0.6 and +1.0 mg/dL in the lowest through highest ATV CCQs, respectively. Corresponding proportions with adverse events of hyperbilirubinemia by week 48 were 1/36, 4/36, 5/36 and 13/35, respectively. Changes from baseline in total amylase or electrocardiogram parameters and adverse events of diarrhea did not vary by ATV CCQs. Weight-band dosing of ATV + RTV plus optimized dual nucleos(t)ide reverse transcriptase inhibitors in young HIV-1-infected children achieved similar ATV exposure to that in adults; no unexpected safety findings occurred, and with the exception of lower virologic suppression in the lowest ATV CCQ, there was no apparent trend in virologic suppression across ATV CCQs.

  15. Evaluation of sequence ambiguities of the HIV-1 pol gene as a method to identify recent HIV-1 infection in transmitted drug resistance surveys.

    Science.gov (United States)

    Andersson, Emmi; Shao, Wei; Bontell, Irene; Cham, Fatim; Cuong, Do Duy; Wondwossen, Amogne; Morris, Lynn; Hunt, Gillian; Sönnerborg, Anders; Bertagnolio, Silvia; Maldarelli, Frank; Jordan, Michael R

    2013-08-01

    Identification of recent HIV infection within populations is a public health priority for accurate estimation of HIV incidence rates and transmitted drug resistance at population level. Determining HIV incidence rates by prospective follow-up of HIV-uninfected individuals is challenging and serological assays have important limitations. HIV diversity within an infected host increases with duration of infection. We explore a simple bioinformatics approach to assess viral diversity by determining the percentage of ambiguous base calls in sequences derived from standard genotyping of HIV-1 protease and reverse transcriptase. Sequences from 691 recently infected (≤1 year) and chronically infected (>1 year) individuals from Sweden, Vietnam and Ethiopia were analyzed for ambiguity. A significant difference (p<0.0001) in the proportion of ambiguous bases was observed between sequences from individuals with recent and chronic infection in both HIV-1 subtype B and non-B infection, consistent with previous studies. In our analysis, a cutoff of <0.47% ambiguous base calls identified recent infection with a sensitivity and specificity of 88.8% and 74.6% respectively. 1,728 protease and reverse transcriptase sequences from 36 surveys of transmitted HIV drug resistance performed following World Health Organization guidance were analyzed for ambiguity. The 0.47% ambiguity cutoff was applied and survey sequences were classified as likely derived from recently or chronically infected individuals. 71% of patients were classified as likely to have been infected within one year of genotyping but results varied considerably amongst surveys. This bioinformatics approach may provide supporting population-level information to identify recent infection but its application is limited by infection with more than one viral variant, decreasing viral diversity in advanced disease and technical aspects of population based sequencing. Standardization of sequencing techniques and base calling

  16. Imidazo[1,2-a]pyridines as NNRTIs

    CSIR Research Space (South Africa)

    Bode, ML

    2010-01-01

    Full Text Available The enzyme reverse transcriptase (RT) is a validated target for the development of anti-HIV drugs. Drugs acting against RT may act at either the catalytic site (NRTIs) or the allosteric site (NNRTIs). During random screening of a small in...

  17. Leptin upregulates telomerase activity and transcription of human telomerase reverse transcriptase in MCF-7 breast cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Ren, He, E-mail: herenrh@yahoo.com.cn [Key Laboratory of Breast Cancer Prevention and Therapy, Tianjin Medical University, Ministry of Education, Tianjin Medical University Cancer Hospital, Tianjin (China); Zhao, Tiansuo; Wang, Xiuchao; Gao, Chuntao; Wang, Jian; Yu, Ming [Key Laboratory of Breast Cancer Prevention and Therapy, Tianjin Medical University, Ministry of Education, Tianjin Medical University Cancer Hospital, Tianjin (China); Hao, Jihui, E-mail: jihuihao@yahoo.com [Key Laboratory of Breast Cancer Prevention and Therapy, Tianjin Medical University, Ministry of Education, Tianjin Medical University Cancer Hospital, Tianjin (China)

    2010-03-26

    The aim was to analyze the mechanism of leptin-induced activity of telomerase in MCF-7 breast cancer cells. We found that leptin activated telomerase in a dose-dependent manner; leptin upregulated the expression of Human Telomerase Reverse Transcriptase (hTERT) at mRNA and protein levels; blockade of signal transducer and activator of transcription 3 (STAT3) phosphorylation significantly counteracted leptin-induced hTERT transcription and protein expression; chromatin immunoprecipitation analysis showed that leptin enhanced the binding of STAT3 to the hTERT promoter. This study uncovers a new mechanism of the proliferative effect of leptin on breast cancer cells and provides a new explanation of obesity-related breast cancer.

  18. Prevalence of drug resistance and importance of viral load measurements in Honduran HIV-infected patients failing antiretroviral treatment.

    Science.gov (United States)

    Murillo, Wendy; de Rivera, I L; Parham, L; Jovel, E; Palou, E; Karlsson, A C; Albert, J

    2010-02-01

    The Honduran HIV/AIDS Program began to scale up access to HIV therapy in 2002. Up to May 2008, more than 6000 patients received combination antiretroviral therapy (cART). As HIV drug resistance is the major obstacle for effective treatment, the purpose of this study was to assess the prevalence of antiretroviral drug resistance in Honduran HIV-1-infected individuals. We collected samples from 138 individuals (97 adults and 41 children) on cART with virological, immunological or clinical signs of treatment failure. HIV-1 pol sequences were obtained using an in-house method. Resistance mutations were identified according to the 2007 International AIDS Society (IAS)-USA list and predicted susceptibility to cART was scored using the ANRS algorithm. Resistance mutations were detected in 112 patients (81%), 74% in adults and 98% in children. Triple-, dual- and single-class drug resistance was documented in 27%, 43% and 11% of the study subjects, respectively. Multiple logistic regression showed that resistance was independently associated with type of treatment failure [virological failure (odds ratio (OR) = 1) vs. immunological failure (OR = 0.11; 95% confidence interval (CI) 0.030-0.43) vs. clinical failure (OR = 0.037; 95% CI 0.0063-0.22)], route of transmission (OR = 42.8; 95% CI 3.73-491), and years on therapy (OR = 1.81; 95% CI 1.11-2.93). The prevalence of antiretroviral resistance was high in Honduran HIV-infected patients with signs of treatment failure. A majority of study subjects showed dual- or triple-class resistance to nucleoside reverse transcriptase inhibitors, nonnucleoside reverse transcriptase inhibitors and protease inhibitors. Virologically defined treatment failure was a strong predictor of resistance, indicating that viral load testing is needed to correctly identify patients with treatment failure attributable to resistance.

  19. Basic science and pathogenesis of ageing with HIV: potential mechanisms and biomarkers.

    Science.gov (United States)

    Lagathu, Claire; Cossarizza, Andrea; Béréziat, Véronique; Nasi, Milena; Capeau, Jacqueline; Pinti, Marcello

    2017-06-01

    : The increased prevalence of age-related comorbidities and mortality is worrisome in ageing HIV-infected patients. Here, we aim to analyse the different ageing mechanisms with regard to HIV infection. Ageing results from the time-dependent accumulation of random cellular damage. Epigenetic modifications and mitochondrial DNA haplogroups modulate ageing. In antiretroviral treatment-controlled patients, epigenetic clock appears to be advanced, and some haplogroups are associated with HIV infection severity. Telomere shortening is enhanced in HIV-infected patients because of HIV and some nucleoside analogue reverse transcriptase inhibitors. Mitochondria-related oxidative stress and mitochondrial DNA mutations are increased during ageing and also by some nucleoside analogue reverse transcriptase inhibitors. Overall, increased inflammation or 'inflammageing' is a major driver of ageing and could result from cell senescence with secreted proinflammatory mediators, altered gut microbiota, and coinfections. In HIV-infected patients, the level of inflammation and innate immunity activation is enhanced and related to most comorbidities and to mortality. This status could result, in addition to age, from the virus itself or viral protein released from reservoirs, from HIV-enhanced gut permeability and dysbiosis, from antiretroviral treatment, from frequent cytomegalovirus and hepatitis C virus coinfections, and also from personal and environmental factors, as central fat accumulation or smoking. Adaptive immune activation and immunosenescence are associated with comorbidities and mortality in the general population but are less predictive in HIV-infected patients. Biomarkers to evaluate ageing in HIV-infected patients are required. Numerous systemic or cellular inflammatory, immune activation, oxidative stress, or senescence markers can be tested in serum or peripheral blood mononuclear cells. The novel European Study to Establish Biomarkers of Human Ageing MARK

  20. Vitamin E concentrations in adults with HIV/AIDS on highly active antiretroviral therapy.

    Science.gov (United States)

    Itinoseki Kaio, Daniella J Itinoseki; Rondó, Patricia Helen C; Luzia, Liania Alves; Souza, José Maria P; Firmino, Aline Vale; Santos, Sigrid Sousa

    2014-09-15

    HIV/AIDS patients are probably more predisposed to vitamin E deficiency, considering that they are more exposed to oxidative stress. Additionally, there are an extensive number of drugs in the highly active antiretroviral therapy (HAART) regimens that may interfere with vitamin E concentrations. The objective of this study was to compare serum concentrations of alpha-tocopherol in 182 HIV/AIDS patients receiving different HAART regimens. The patients were divided into three groups according to regimen: nucleoside analog reverse-transcriptase inhibitors (NRTIs) + non-nucleoside analog reverse-transcriptase inhibitors (NNRTIs); NRTIs + protease inhibitors + ritonavir; NRTIs + other classes. Alpha-tocopherol was assessed by high-performance liquid chromatography. Multiple linear regression analysis was used to evaluate the effects of HAART regimen, time of use, and compliance with the regimen on alpha-tocopherol concentrations. Alpha-tocopherol concentrations were on average 4.12 μmol/L lower for the NRTIs + other classes regimen when compared to the NRTIs + NNRTIs regimen (p = 0.037). A positive association (p < 0.001) was observed between alpha-tocopherol and cholesterol concentrations, a finding due, in part, to the relationship between liposoluble vitamins and lipid profile. This study demonstrated differences in alpha-tocopherol concentrations between patients using different HAART regimens, especially regimens involving the use of new drugs. Long-term prospective cohort studies are needed to monitor vitamin E status in HIV/AIDS patients since the beginning of treatment.

  1. The changing molecular epidemiology of HIV in the Philippines.

    Science.gov (United States)

    Salvaña, Edsel Maurice T; Schwem, Brian E; Ching, Patrick R; Frost, Simon D W; Ganchua, Sharie Keanne C; Itable, Jill R

    2017-08-01

    The Philippines has one of the fastest-growing HIV epidemics in the world. Possible reasons for this include increased testing, increased local transmission, and possibly more aggressive strains of HIV. This study sought to determine whether local molecular subtypes of HIV have changed. Viruses from 81 newly diagnosed, treatment-naive HIV patients were genotyped using protease and reverse transcriptase genes. Demographic characteristics and CD4 count data were collected. The cohort had an average age of 29 years (range 19-51 years), CD4+ count of 255 cells/mm 3 (range 2-744 cells/mm 3 ), and self-reported acquisition time of 2.42 years (range 0.17-8.17 years). All were male, including 79 men who have sex with men (MSM). The genotype distribution was 77% CRF01_AE, 22% B, and 1% C. Previous data from 1985-2000 showed that most Philippine HIV infections were caused by subtype B (71%, n=100), followed by subtype CRF01_AE (20%). Comparison with the present cohort showed a significant shift in subtype (pepidemiology of HIV in the Philippines has changed, with the more aggressive CRF01_AE now being the predominant subtype. Copyright © 2017 The Author(s). Published by Elsevier Ltd.. All rights reserved.

  2. Perinatal acquisition of drug-resistant HIV-1 infection: mechanisms and long-term outcome

    Directory of Open Access Journals (Sweden)

    Dollfus Catherine

    2009-09-01

    Full Text Available Abstract Background Primary-HIV-1-infection in newborns that occurs under antiretroviral prophylaxis that is a high risk of drug-resistance acquisition. We examine the frequency and the mechanisms of resistance acquisition at the time of infection in newborns. Patients and Methods We studied HIV-1-infected infants born between 01 January 1997 and 31 December 2004 and enrolled in the ANRS-EPF cohort. HIV-1-RNA and HIV-1-DNA samples obtained perinatally from the newborn and mother were subjected to population-based and clonal analyses of drug resistance. If positive, serial samples were obtained from the child for resistance testing. Results Ninety-two HIV-1-infected infants were born during the study period. Samples were obtained from 32 mother-child pairs and from another 28 newborns. Drug resistance was detected in 12 newborns (20%: drug resistance to nucleoside reverse transcriptase inhibitors was seen in 10 cases, non-nucleoside reverse transcriptase inhibitors in two cases, and protease inhibitors in one case. For 9 children, the detection of the same resistance mutations in mothers' samples (6 among 10 available and in newborn lymphocytes (6/8 suggests that the newborn was initially infected by a drug-resistant strain. Resistance variants were either transmitted from mother-to-child or selected during subsequent temporal exposure under suboptimal perinatal prophylaxis. Follow-up studies of the infants showed that the resistance pattern remained stable over time, regardless of antiretroviral therapy, suggesting the early cellular archiving of resistant viruses. The absence of resistance in the mother of the other three children (3/10 and neonatal lymphocytes (2/8 suggests that the newborns were infected by a wild-type strain without long-term persistence of resistance when suboptimal prophylaxis was stopped. Conclusion This study confirms the importance of early resistance genotyping of HIV-1-infected newborns. In most cases (75%, drug

  3. HIV type-1 genotypic resistance profiles in vertically infected patients from Argentina reveal an association between K103N+L100I and L74V mutations.

    Science.gov (United States)

    Aulicino, Paula C; Rocco, Carlos A; Mecikovsky, Debora; Bologna, Rosa; Mangano, Andrea; Sen, Luisa

    2010-01-01

    Patterns and pathways of HIV type-1 (HIV-1) antiretroviral (ARV) drug resistance-associated mutations in clinical isolates are conditioned by ARV history and factors such as viral subtype and fitness. Our aim was to analyse the frequency and association of ARV drug resistance mutations in a group of long-term vertically infected patients from Argentina. Plasma samples from 71 patients (38 children and 33 adolescents) were collected for genotypic HIV-1 ARV resistance testing during the period between February 2006 and October 2008. Statistically significant pairwise associations between ARV resistance mutations in pol, as well as associations between mutations and drug exposure, were identified using Fisher's exact tests with Bonferroni and false discovery rate corrections. Phylogenetic analyses were performed for subtype assignment. In protease (PR), resistance-associated mutations M46I/L, I54M/L/V/A/S and V82A/F/T/S/M/I were associated with each other and with minor mutations at codons 10, 24 and 71. Mutations V82A/F/T/S/M/I were primarily selected by the administration of ritonavir (RTV) in an historical ARV regimen. In reverse transcriptase, thymidine analogue mutation (TAM)1 profile was more common than TAM2. The non-nucleoside K103N+L100I mutations were observed at high frequency (15.5%) and were significantly associated with the nucleoside mutation L74V in BF recombinants. Associations of mutations at PR sites reflect the frequent use of RTV at an early time in this group of patients and convergent resistance mechanisms driven by the high exposure to protease inhibitors, as well as local HIV-1 diversity. The results provide clinical evidence of a molecular interaction between K103N+L100I and L74V mutations at the reverse transcriptase gene in vivo, limiting the future use of second-generation non-nucleoside reverse transcriptase inhibitors such as etravirine.

  4. Metabolic health across the BMI spectrum in HIV-infected and HIV-uninfected men.

    Science.gov (United States)

    Lake, Jordan E; Li, Xiuhong; Palella, Frank J; Erlandson, Kristine M; Wiley, Dorothy; Kingsley, Lawrence; Jacobson, Lisa P; Brown, Todd T

    2018-01-02

    In the general population, metabolic health often declines as BMI increases. However, some obese individuals maintain metabolic health. HIV and antiretroviral therapy have been associated with metabolic disturbances. We hypothesized that HIV-infected (HIV) men on suppressive antiretroviral therapy experience less metabolic health than HIV-uninfected (HIV) men across all BMI categories. In a cross-sectional analysis of 1018 HIV and 1092 HIV men enrolled in the multicenter AIDS cohort study, Poisson regression with robust variance determined associations between HIV serostatus and metabolic health prevalence (defined as meeting ≤2 of 5 National Cholesterol Education Program Adult Treatment Panel III metabolic syndrome criteria), adjusting for age, race, BMI category, smoking, and hepatitis C virus infection status. HIV men were younger (54 vs. 59 years) and had lower median BMI (25 vs. 27 kg/m). Nonobese HIV men had lower metabolic health prevalence than HIV men (BMI ≤25 kg/m: 80 vs. 94%, P BMI 25-29 kg/m: 64 vs. 71%, P = 0.05), but metabolic health prevalence among obese men did not differ by HIV serostatus (BMI 30-34 kg/m: 35 vs. 39%, P = 0.48; BMI ≥35 kg/m: 27 vs. 25%, P = 0.79). In the adjusted model, nonobese HIV men were less likely to demonstrate metabolic health than nonobese HIV men. Among HIV men, per year darunavir, zidovudine, and stavudine use were associated with lower metabolic health likelihood. Metabolically healthy obesity prevalence does not differ by HIV serostatus. However, among nonobese men, HIV infection is associated with lower metabolic health prevalence, with associations between lack of metabolic health and darunavir and thymidine analog nucleoside reverse transcriptase inhibitor exposure observed.

  5. New subtypes and genetic recombination in HIV type 1-infecting patients with highly active antiretroviral therapy in Peru (2008-2010).

    Science.gov (United States)

    Yabar, Carlos Augusto; Acuña, Maribel; Gazzo, Cecilia; Salinas, Gabriela; Cárdenas, Fanny; Valverde, Ada; Romero, Soledad

    2012-12-01

    HIV-1 subtype B is the most frequent strain in Peru. However, there is no available data about the genetic diversity of HIV-infected patients receiving highly active antiretroviral therapy (HAART) here. A group of 267 patients in the Peruvian National Treatment Program with virologic failure were tested for genotypic evidence of HIV drug resistance at the Instituto Nacional de Salud (INS) of Peru between March 2008 and December 2010. Viral RNA was extracted from plasma and the segments of the protease (PR) and reverse transcriptase (RT) genes were amplified by reverse transcriptase polymerase chain reaction (RT-PCR), purified, and fully sequenced. Consensus sequences were submitted to the HIVdb Genotypic Resistance Interpretation Algorithm Database from Stanford University, and then aligned using Clustal X v.2.0 to generate a phylogenetic tree using the maximum likelihood method. Intrasubtype and intersubtype recombination analyses were performed using the SCUEAL program (Subtype Classification by Evolutionary ALgo-rithms). A total of 245 samples (91%) were successfully genotyped. The analysis obtained from the HIVdb program showed 81.5% resistance cases (n=198). The phylogenetic analysis revealed that subtype B was predominant in the population (98.8%), except for new cases of A, C, and H subtypes (n=4). Of these cases, only subtype C was imported. Likewise, recombination analysis revealed nine intersubtype and 20 intrasubtype recombinant cases. This is the first report of the presence of HIV-1 subtypes C and H in Peru. The introduction of new subtypes and circulating recombinants forms can make it difficult to distinguish resistance profiles in patients and consequently affect future treatment strategies against HIV in this country.

  6. HIV-1 drug resistance before initiation or re-initiation of first-line antiretroviral therapy in low-income and middle-income countries: a systematic review and meta-regression analysis

    NARCIS (Netherlands)

    Gupta, Ravindra K.; Gregson, John; Parkin, Neil; Haile-Selassie, Hiwot; Tanuri, Amilcar; Andrade Forero, Liliana; Kaleebu, Pontiano; Watera, Christine; Aghokeng, Avelin; Mutenda, Nicholus; Dzangare, Janet; Hone, San; Hang, Zaw Zaw; Garcia, Judith; Garcia, Zully; Marchorro, Paola; Beteta, Enrique; Giron, Amalia; Hamers, Raph; Inzaule, Seth; Frenkel, Lisa M.; Chung, Michael H.; de Oliveira, Tulio; Pillay, Deenan; Naidoo, Kogie; Kharsany, Ayesha; Kugathasan, Ruthiran; Cutino, Teresa; Hunt, Gillian; Avila Rios, Santiago; Doherty, Meg; Jordan, Michael R.; Bertagnolio, Silvia

    2018-01-01

    Pretreatment drug resistance in people initiating or re-initiating antiretroviral therapy (ART) containing non-nucleoside reverse transcriptase inhibitors (NNRTIs) might compromise HIV control in low-income and middle-income countries (LMICs). We aimed to assess the scale of this problem and whether

  7. 1-Benzyl-2-(1H-indol-3-yl-5-oxopyrrolidine-2-carbonitrile

    Directory of Open Access Journals (Sweden)

    Raymond Schinazi

    2008-02-01

    Full Text Available In the title compound, C20H17N3O, a potential anti-human immunodeficiency virus type 1 (HIV-1 non-nucleoside reverse-transcriptase inhibitor, the pyrrolidine ring has an envelope conformation. In the crystal structure, adjacent molecules are connected into infinite chains via an N—H...O hydrogen bond.

  8. Synthesis and Anti-HIV-1 Activity of New MKC-442 Analogues with an Alkynyl-Substituted 6-Benzyl Group

    DEFF Research Database (Denmark)

    Aly, Youssef L.; Pedersen, Erik Bjerreg.; La Colla, Paolo

    2007-01-01

    Synthesis and antiviral activities are reported of a series of 6-(3-alkynyl benzyl)-substituted analogues of MKC-442 (6-benzyl-1-(ethoxymethyl)-5-isopropyluracil), a highly potent agent against HIV. The 3-alkynyl group is assumed to give a better stacking of the substituted benzyl group to reverse...... transcriptase (RT) and this was believed to improve antiviral activity against HIV-1. The bromo derivatives, 5-alkyl-6-(3-bromo-benzyl)-1-ethoxymethyl derivatives 7a, b and 5-alkyl-6-(3-bromobenzyl)-1-allyloxymethyl derivatives 9a, b, showed activity against HIV on the same level as their corresponding...

  9. An assessment of the relationship between the World Health Organization HIV drug resistance early warning indicators and HIV drug resistance acquisition.

    Science.gov (United States)

    St-Jean, M; Harrigan, P R; Sereda, P; Montaner, Jsg; Lima, V D

    2017-05-01

    The World Health Organization (WHO)'s HIV drug resistance (HIVDR) early warning indicators (EWIs) measure antiretroviral therapy (ART)-site factors associated with HIVDR prevention, without HIVDR laboratory testing. We assessed the relationship between EWIs and HIVDR acquisition using data from British Columbia, Canada. Eligible patients were ART-naïve, were ≥ 19 years old, had initiated ART between 1 January 2000 and 31 December 2012, had ≥ 15 months of follow-up, and were without transmitted HIVDR. Patients were followed for acquired HIVDR until 31 March 2014, the last contact date, or death. We built logistic regression models to assess the associations and predictive ability of individual indicators and of the EWI Score (the number of indicators for which a patient did not meet the criteria) on HIVDR acquisition (to any class of HIVDR, lamivudine (3TC)/emtricitabine (FTC), nonnucleoside reverse transcriptase inhibitors (NNRTIs), nucleoside reverse transcriptase inhibitors (NRTIs) or protease inhibitors (PIs)]). All explored EWIs were associated with at least one class of HIVDR, with the exception of 'ART prescribing practices'. We observed a dose-response relationship between acquiring HIVDR to any antiretroviral class and an increasing EWI score in our predictive logistic regression model. The area under the curve was 0.848 (excellent discrimination). The adjusted odds ratios for acquiring any class of HIVDR for an EWI score of 1, 2 and ≥ 3 versus 0 were 2.30 [95% confidence Interval (CI) 1.21-4.38], 3.35 (95% CI: 1.86-6.03) and 7.26 (95% CI: 4.18-12.61), respectively. Several EWIs were associated with and predictive of HIVDR, supporting the WHO EWIs as a component of the HIVDR prevention method in settings where HIVDR testing is not routinely or widely available. © 2016 British HIV Association.

  10. High Rates of Baseline Drug Resistance and Virologic Failure Among ART-naive HIV-infected Children in Mali.

    Science.gov (United States)

    Crowell, Claudia S; Maiga, Almoustapha I; Sylla, Mariam; Taiwo, Babafemi; Kone, Niaboula; Oron, Assaf P; Murphy, Robert L; Marcelin, Anne-Geneviève; Traore, Ban; Fofana, Djeneba B; Peytavin, Gilles; Chadwick, Ellen G

    2017-11-01

    Limited data exist on drug resistance and antiretroviral treatment (ART) outcomes in HIV-1-infected children in West Africa. We determined the prevalence of baseline resistance and correlates of virologic failure (VF) in a cohort of ART-naive HIV-1-infected children baseline (before ART) and at 6 months. Resistance was defined according to the Stanford HIV Genotypic Resistance database. VF was defined as viral load ≥1000 copies/mL after 6 months of ART. Logistic regression was used to evaluate factors associated with VF or death >1 month after enrollment. Post hoc, antiretroviral concentrations were assayed on baseline samples of participants with baseline resistance. One-hundred twenty children with a median age 2.6 years (interquartile range: 1.6-5.0) were included. Eighty-eight percent reported no prevention of mother-to-child transmission exposure. At baseline, 27 (23%), 4 (3%) and none had non-nucleoside reverse transcriptase inhibitor (NNRTI), nucleoside reverse transcriptase inhibitor or protease inhibitor resistance, respectively. Thirty-nine (33%) developed VF and 4 died >1 month post-ART initiation. In multivariable analyses, poor adherence [odds ratio (OR): 6.1, P = 0.001], baseline NNRTI resistance among children receiving NNRTI-based ART (OR: 22.9, P baseline NNRTI resistance (OR: 5.8, P = 0.018) were significantly associated with VF/death. Ten (38%) with baseline resistance had detectable levels of nevirapine or efavirenz at baseline; 7 were currently breastfeeding, but only 2 reported maternal antiretroviral use. Baseline NNRTI resistance was common in children without reported NNRTI exposure and was associated with increased risk of treatment failure. Detectable NNRTI concentrations were present despite few reports of maternal/infant antiretroviral use.

  11. Ritonavir-boosted darunavir combined with raltegravir or tenofovir-emtricitabine in antiretroviral-naive adults infected with HIV-1: 96 week results from the NEAT001/ANRS143 randomised non-inferiority trial

    NARCIS (Netherlands)

    Raffi, François; Babiker, Abdel G.; Richert, Laura; Molina, Jean-Michel; George, Elizabeth C.; Antinori, Andrea; Arribas, Jose R.; Grarup, Jesper; Hudson, Fleur; Schwimmer, Christine; Saillard, Juliette; Wallet, Cédrick; Jansson, Per O.; Allavena, Clotilde; van Leeuwen, Remko; Delfraissy, Jean-François; Vella, Stefano; Chêne, Geneviève; Pozniak, Anton; Dedes, Nikos; Autran, Brigitte; Bucciardini, Raffaella; Horban, Andrzej; Arribas, José; Boffito, Marta; Pillay, Deenan; Franquet, Xavier; Schwarze, Siegfried; Fischer, Aurélie; Diallo, Alpha; Moecklinghoff, Christiane; Stellbrink, Hans-Jürgen; Gatell, José; Sandström, Eric; Flepp, Markus; Ewings, Fiona; Pearce, Gillian; Quercia, Romina; Rogatto, Felipe; Leavitt, Randi; Nguyen, Bach-Yen; Goebel, Frank; Marcotullio, Simone; Kaur, Navrup; Sasieni, Peter; Spencer-Drake, Christina; Peto, Tim; Miller, Veronica; Arnault, Fabien; Boucherie, Céline; Jean, Delphine; Paniego, Virginie; Paraina, Felasoa; Rouch, Elodie; Soussi, Malika; Taieb, Audrey; Touzeau, Guillaume; Cursley, Adam; Dodds, Wendy; Hoppe, Anne; Kummeling, Ischa; Pacciarini, Filippo; Paton, Nick; Russell, Charlotte; Taylor, Kay; Ward, Denise; Aagaard, Bitten; Eid, Marius; Gey, Daniela; Jensen, Birgitte Gram; Jakobsen, Marie-Louise; Jensen, Karoline; Joensen, Zillah Maria; Larsen, Ellen Moseholm; Pahl, Christiane; Pearson, Mary; Nielsen, Birgit Riis; Reilev, Søren Stentoft; Christ, Ilse; Lathouwers, Desiree; Manting, Corry; Mendy, Bienvenu Yves; Metro, Annie; Couffin-Cadiergues, Sandrine; Knellwolf, Anne-Laure; Palmisano, Lucia; Aznar, Esther; Barea, Cristina; Cotarelo, Manuel; Esteban, Herminia; Girbau, Iciar; Moyano, Beatriz; Ramirez, Miriam; Saiz, Carmen; Sanchez, Isabel; Yllescas, Maria; Binelli, Andrea; Colasanti, Valentina; Massella, Maurizio; Anagnostou, Olga; Gioukari, Vicky; Touloumi, Giota; Schmied, Brigitte; Rieger, Armin; Vetter, Norbert; de Wit, Stephane; Florence, Eric; Vandekerckhove, Linos; Gerstoft, Jan; Mathiesen, Lars; Katlama, Christine; Cabie, André; Cheret, Antoine; Dupon, Michel; Ghosn, Jade; Girard, Pierre-Marie; Goujard, Cécile; Lévy, Yves; Morlat, Philippe; Neau, Didier; Obadia, Martine; Perre, Philippe; Piroth, Lionel; Reynes, Jacques; Tattevin, Pierre; Raffi, Francois; Ragnaud, Jean Marie; Weiss, Laurence; Yazdanpanah, Yazdan; Yeni, Patrick; Zucman, David; Behrens, Georg; Esser, Stefan; Fätkenheuer, Gerd; Hoffmann, Christian; Jessen, Heiko; Rockstroh, Jürgen; Schmidt, Reinhold; Stephan, Christoph; Unger, Stefan; Hatzakis, Angelos; Daikos, George L.; Papadopoulos, Antonios; Skoutelis, Athamasios; Banhegyi, Denes; Mallon, Paddy; Mulcahy, Fiona; Andreoni, Massimo; Bonora, Stefano; Castelli, Francesco; Monforte, Antonella D.'Arminio; Galli, Massimo; Lazzarin, Adriano; Mazzotta, Francesco; Vullo, Vincenzo; Prins, Jan; Richter, Clemens; Verhagen, Dominique; Eeden, Van; Doroana, Manuela; Antunes, Francisco; Maltez, Fernando; Sarmento-Castro, Rui; Gonzalez Garcia, Juan; López Aldeguer, José; Clotet, Bonaventura; Domingo, Pere; Gatell, Jose M.; Knobel, Hernando; Marquez, Manuel; Pilar Miralles, Martin; Portilla, Joaquin; Soriano, Vicente; Tellez, Maria-Jesus; Thalme, Anders; Blaxhult, Anders; Gisslen, Magnus; Winston, Alan; Fox, Julie; Gompels, Mark; Herieka, Elbushra; Johnson, Margaret; Leen, Clifford; Teague, Alastair; Williams, Ian; Boyd, Mark Alastair; Møller, Nina Friis; Larsen, Ellen Frøsig Moseholm; Le Moing, Vincent; Wit, Ferdinand W. N. M.; Kowalska, Justyna; Berenguer, Juan; Moreno, Santiago; Müller, Nicolas J.; Török, Estée; Post, Frank; Angus, Brian; Boucher, Charles; Calvez, Vincent; Collins, Simon; Dunn, David; Fox, Zoe; Perno, Carlo Federico; Ammassari, Adriana; Stoehr, Wolgang; Schmidt, Reinhold Ernst; Odermarsky, Michal; Smith, Colette; Thiébaut, Rodolphe; Arribas, Jose; de La Serna, Jose Ignacio Bernardino; Castagna, Antonella; Furrer, Hans-Jackob; Mocroft, Amanda; Reiss, Peter; Fragola, Vincenzo; Lauriola, Marco; Murri, Rita; Nieuwkerk, Pythia; Spire, Bruno; Volny-Anne, Alain; West, Brian; Amieva, Hélène; Llibre Codina, Josep Maria

    2014-01-01

    Standard first-line antiretroviral therapy for HIV-1 infection includes two nucleoside or nucleotide reverse transcriptase inhibitors (NtRTIs), but these drugs have limitations. We assessed the 96 week efficacy and safety of an NtRTI-sparing regimen. Between August, 2010, and September, 2011, we

  12. HIV Protease Inhibitor Use During Pregnancy Is Associated With Decreased Progesterone Levels, Suggesting a Potential Mechanism Contributing to Fetal Growth Restriction

    Science.gov (United States)

    Papp, Eszter; Mohammadi, Hakimeh; Loutfy, Mona R.; Yudin, Mark H.; Murphy, Kellie E.; Walmsley, Sharon L.; Shah, Rajiv; MacGillivray, Jay; Silverman, Michael; Serghides, Lena

    2015-01-01

    Background. Protease inhibitor (PI)–based combination antiretroviral therapy (cART) is administered during pregnancy to prevent perinatal human immunodeficiency virus (HIV) transmission. However, PI use has been associated with adverse birth outcomes, including preterm delivery and small-for-gestational-age (SGA) births. The mechanisms underlying these outcomes are unknown. We hypothesized that PIs contribute to these adverse events by altering progesterone levels. Methods. PI effects on trophoblast progesterone production were assessed in vitro. A mouse pregnancy model was used to assess the impact of PI-based cART on pregnancy outcomes and progesterone levels in vivo. Progesterone levels were assessed in plasma specimens from 27 HIV-infected and 17 HIV-uninfected pregnant women. Results. PIs (ritonavir, lopinavir, and atazanavir) but not nucleoside reverse transcriptase inhibitors (NRTIs) or nonnucleoside reverse transcriptase inhibitors reduced trophoblast progesterone production in vitro. In pregnant mice, PI-based cART but not dual-NRTI therapy was associated with significantly lower progesterone levels that directly correlated with fetal weight. Progesterone supplementation resulted in a significant improvement in fetal weight. We observed lower progesterone levels and smaller infants in HIV-infected women receiving PI-based cART, compared with the control group. In HIV-infected women, progesterone levels correlated significantly with birth weight percentile. Conclusions. Our data suggest that PI use in pregnancy may lead to lower progesterone levels that could contribute to adverse birth outcomes. PMID:25030058

  13. Short communication: high prevalence of drug resistance in HIV type 1-infected children born in Honduras and Belize 2001 to 2004.

    Science.gov (United States)

    Parham, Leda; de Rivera, Ivette Lorenzana; Murillo, Wendy; Naver, Lars; Largaespada, Natalia; Albert, Jan; Karlsson, Annika C

    2011-10-01

    Antiretroviral therapy has had a great impact on the prevention of mother-to-child transmission (MTCT) of HIV-1. However, development of drug resistance, which could be subsequently transmitted to the child, is a major concern. In Honduras and Belize the prevalence of drug resistance among HIV-1-infected children remains unknown. A total of 95 dried blood spot samples was obtained from HIV-1-infected, untreated children in Honduras and Belize born during 2001 to 2004, when preventive antiretroviral therapy was often suboptimal and consisted of monotherapy with nevirapine or zidovudine. Partial HIV-1 pol gene sequences were successfully obtained from 66 children (Honduras n=55; Belize n=11). Mutations associated with drug resistance were detected in 13% of the Honduran and 27% of the Belizean children. Most of the mutations detected in Honduras (43%) and all mutations detected in Belize were associated with resistance to nonnucleoside reverse transcriptase inhibitors, which was expected from the wide use of nevirapine to prevent MTCT during the study period. In addition, although several mothers reported that they had not received antiretroviral therapy, mutations associated with resistance to nucleoside reverse transcriptase inhibitors and protease inhibitors were found in Honduras. This suggests prior and unreported use of these drugs, or that these women had been infected with resistant virus. The present study demonstrates, for the first time, the presence of drug resistance-associated mutations in HIV-1-infected Honduran and Belizean children.

  14. HIV protease inhibitor use during pregnancy is associated with decreased progesterone levels, suggesting a potential mechanism contributing to fetal growth restriction.

    Science.gov (United States)

    Papp, Eszter; Mohammadi, Hakimeh; Loutfy, Mona R; Yudin, Mark H; Murphy, Kellie E; Walmsley, Sharon L; Shah, Rajiv; MacGillivray, Jay; Silverman, Michael; Serghides, Lena

    2015-01-01

    Protease inhibitor (PI)-based combination antiretroviral therapy (cART) is administered during pregnancy to prevent perinatal human immunodeficiency virus (HIV) transmission. However, PI use has been associated with adverse birth outcomes, including preterm delivery and small-for-gestational-age (SGA) births. The mechanisms underlying these outcomes are unknown. We hypothesized that PIs contribute to these adverse events by altering progesterone levels. PI effects on trophoblast progesterone production were assessed in vitro. A mouse pregnancy model was used to assess the impact of PI-based cART on pregnancy outcomes and progesterone levels in vivo. Progesterone levels were assessed in plasma specimens from 27 HIV-infected and 17 HIV-uninfected pregnant women. PIs (ritonavir, lopinavir, and atazanavir) but not nucleoside reverse transcriptase inhibitors (NRTIs) or nonnucleoside reverse transcriptase inhibitors reduced trophoblast progesterone production in vitro. In pregnant mice, PI-based cART but not dual-NRTI therapy was associated with significantly lower progesterone levels that directly correlated with fetal weight. Progesterone supplementation resulted in a significant improvement in fetal weight. We observed lower progesterone levels and smaller infants in HIV-infected women receiving PI-based cART, compared with the control group. In HIV-infected women, progesterone levels correlated significantly with birth weight percentile. Our data suggest that PI use in pregnancy may lead to lower progesterone levels that could contribute to adverse birth outcomes. © The Author 2014. Published by Oxford University Press on behalf of the Infectious Diseases Society of America.

  15. Polymorphisms of HIV RT gene among the ART naïve native drug exposed rural PLHA

    Directory of Open Access Journals (Sweden)

    K Mohana Krishnan

    2012-01-01

    Full Text Available Background: The number of people living with human immunodeficiency virus (HIV is increasing day by day in India. The disease has now spread from urban areas to rural areas. The proof reading of the reverse transcriptase enzyme is poor, which may lead to genetic diversity within the HIV strains, which in turn leads to problems like failure or resistance in antiretroviral treatment. This study is designed to find out the polymorphisms of the reverse transcriptase gene of HIV, after the native drug pressure among antiretroviral therapy (ART naïve rural people living with HIV/AIDS (RPLHA. Materials and Methods : A total of 207 HIV-Reactive patients were allowed to take native drugs from the local area and were advised to attend the center for HIV after six months for a follow-up. At the time of the follow-up visit, a second blood sample was taken from 20 reactive native-drug exposed ART-naïve patients. The plasma was separated and transported at 20°C to the YRG Care Center for genotyping. Results: Among the 20 HIV-reactive samples processed for gene sequencing analysis to detect the genotypic variations, only one sample (5% showed high-level mutational resistance variations and the predominant polymorphisms detected were V35T (100%, K122E (94.44%, and V60I (88.88%. Conclusions: The presence of drug-resistance mutations, although minimal, was important, as the drug-resistant strains could spread among the RPLHA and to their sexual partners. There was a definite need to generate a drug resistance database and the polymorphic pattern of Indian strains concern to the future clinical management of the disease, and a vaccine design to contain the disease.

  16. Guanidinylated 3-gluconamidopropyl methacrylamide-s-3-aminopropyl methacrylamide copolymer as siRNA carriers for inhibiting human telomerase reverse transcriptase expression.

    Science.gov (United States)

    Wu, Yang; Ji, Jinkai; Yang, Ran; Zhang, Xiaoqiang; Li, Yuanhui; Pu, Yuepu; Li, Xinsong

    2013-01-01

    In this report, a series of well-defined glucose- and guanidine-based cationic copolymers as gene carriers were developed to inhibit human telomerase reverse transcriptase (hTERT) gene expression. First of all, guandinylated 3-gluconamidopropyl methacrylamide-s-3-aminopropyl methacrylamide copolymers (guanidinylated GAPMA-s-APMA, abbreviated as GGA) were prepared via aqueous reversible addition--fragmentation chain transfer polymerization (RAFT). Then, three target hTERT siRNA TERT-1, TERT-2 and TERT-3 were designed and combined with GGA copolymers to form siRNA/GGA polyplexes. The polyplexes were examined by dynamic light scattering and agarose gel electrophoresis. The results indicated that GGA copolymers can condense siRNA effectively to form particles with the diameter from 157 nm to 411 nm and zeta potential values in the range from +3.7 to +15.8 mV at various charge ratios (N/P). The MTT assay data of siRNA/GGA polyplexes on human hepatocellular liver carcinoma cells (HepG2) indicated that GGA copolymer had better cell viabilities than polyethylenimine (PEI). Furthermore, the transfection of siRNA/GGA polyplexes was detected by real-time quantitative PCR (RT-qPCR) in HepG2. It was found that siRNA/GGA polyplexes could effectively silence hTERT mRNA expression in serum-free media (paminopropyl methacrylamide copolymers might be promise in gene delivery.

  17. HIV-1 isolation from infected peripheral blood mononuclear cells.

    Science.gov (United States)

    Dispinseri, Stefania; Saba, Elisa; Vicenzi, Elisa; Kootstra, Neeltje A; Schuitemaker, Hanneke; Scarlatti, Gabriella

    2014-01-01

    Human immunodeficiency virus 1 (HIV-1) isolation from peripheral blood mononuclear cells (PBMCs) allows retrieval of replication-competent viral variants. In order to impose the smallest possible selective pressure on the viral isolates, isolation must be carried out in primary cultures of cells and not in tumor derived cell lines. The procedure involves culture of PBMCs from an infected patient with phytohemagglutinin (PHA)-stimulated PBMC from seronegative donors, which provide susceptible target cells for HIV replication. HIV can be isolated from the bulk population of PBMCs or after cloning of the cells to obtain viral biological clones. Viral production is determined with p24 antigen (Ag) detection assays or with reverse transcriptase (RT) activity assay. Once isolated, HIV-1 can be propagated by infecting PHA-stimulated PBMCs from healthy donors. Aliquots from culture with a high production of virus are stored for later use.

  18. Pengembangan Sejumlah Primer untuk Reverse Transcriptase Polymerase Chain Reaction Guna Melacak Virus Flu Burung di Indonesia (DEVELOPMENt OF PRIMERS FOR REVERSE TRANSCRIPTASE POLYMERASE CHAIN REACTION TO DETECT AVIAN INFLUENZA VIRUS IN INDONESIA

    Directory of Open Access Journals (Sweden)

    Ni Luh Putu Indi Dharmayanti

    2016-07-01

    Full Text Available Until recently, two clades of of avian influenza viruses (AIVs designated as 2.3.2 and 2.2.3 havebeen circulating in Indonesia. Mutations of AIV genes have cretaed many more variants of the virus. It istherefore important to evaluate the appropriate methods used for the detection and diagnosis of AI virusin the field. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR have been used as a standardmethod for detection of AIV in many laboratories in Indonesia. The success of RT-PCR for detection ofAIV virus is dependent on the nucleotide sequences of primer that match with the circulating of AIVs. Theaims of this study was to develop RT-PCR by designing primers for H5 subtype specific to the circulatingAIVs in the field. The primers were designed using Primer Design software, and optimization andvalidation of the primer were conducted using AIVs that have been characterized in the previous study.The primers were then used RT-PCR using AIV isolates from field samples and their sensitivity andspecificity were then determined. The results showed that the H5 primers designed in this study, H5-IDand H5-NLP, was able to detect the AIVs in field samples better than the H5-specific primers have beenused previously. In conclusion, H5 primers designed based on recent viruses in the field showed betterresults in the detection of AI virus as compared to the previous primers. As AIV-H5N1 subtype in the fieldwill continue to change and evolve, the use of primers designed in this study is recommended for diagnosisof H5 AIV.

  19. A real-time reverse transcriptase polymerase chain reaction for detection and quantification of Vesiculovirus

    Directory of Open Access Journals (Sweden)

    Aline Lavado Tolardo

    2016-06-01

    Full Text Available Vesiculoviruses (VSV are zoonotic viruses that cause vesicular stomatitis disease in cattle, horses and pigs, as well as sporadic human cases of acute febrile illness. Therefore, diagnosis of VSV infections by reliable laboratory techniques is important to allow a proper case management and implementation of strategies for the containment of virus spread. We show here a sensitive and reproducible real-time reverse transcriptase polymerase chain reaction (RT-PCR for detection and quantification of VSV. The assay was evaluated with arthropods and serum samples obtained from horses, cattle and patients with acute febrile disease. The real-time RT-PCR amplified the Piry, Carajas, Alagoas and Indiana Vesiculovirus at a melting temperature 81.02 ± 0.8ºC, and the sensitivity of assay was estimated in 10 RNA copies/mL to the Piry Vesiculovirus. The viral genome has been detected in samples of horses and cattle, but not detected in human sera or arthropods. Thus, this assay allows a preliminary differential diagnosis of VSV infections.

  20. Apoptosis and reduced cell proliferation of HL-60 cell line caused by human telomerase reverse transcriptase inhibition by siRNA.

    Science.gov (United States)

    Miri-Moghaddam, Ebrahim; Deezagi, Abdolkhaleg; Soheili, Zahra Sohaila; Shariati, Parvin

    2010-01-01

    The close correlation between telomerase activity and human telomerase reverse transcriptase (hTERT) expression has made hTERT to be considered as a selective molecular target for human cancer therapy. In this study, the ability of short-interfering RNA (siRNA) to downregulate hTERT expression and its correlation with cell growth and apoptosis in the promyelocytic cell line HL-60 was evaluated. hTERT siRNA was designed and transfected to HL-60. hTERT mRNA expression, cell proliferation and apoptotic cells were measured. The results indicated that hTERT siRNA resulted in 97.2 ± 0.6% downregulation of the hTERT mRNA content; inhibition of the cell proliferation rate was about 52.8 ± 2.3% and the apoptotic index of cells was 30.5 ± 1.5%. hTERT plays an essential role in cell proliferation and control of the viability of leukemic cells, thus promising the development of drugs for leukemia. Copyright © 2010 S. Karger AG, Basel.

  1. Plastid, nuclear and reverse transcriptase sequences in the mitochondrial genome of Oenothera: is genetic information transferred between organelles via RNA?

    Science.gov (United States)

    Schuster, W; Brennicke, A

    1987-01-01

    We describe an open reading frame (ORF) with high homology to reverse transcriptase in the mitochondrial genome of Oenothera. This ORF displays all the characteristics of an active plant mitochondrial gene with a possible ribosome binding site and 39% T in the third codon position. It is located between a sequence fragment from the plastid genome and one of nuclear origin downstream from the gene encoding subunit 5 of the NADH dehydrogenase. The nuclear derived sequence consists of 528 nucleotides from the small ribosomal RNA and contains an expansion segment unique to nuclear rRNAs. The plastid sequence contains part of the ribosomal protein S4 and the complete tRNA(Ser). The observation that only transcribed sequences have been found i more than one subcellular compartment in higher plants suggests that interorganellar transfer of genetic information may occur via RNA and subsequent local reverse transcription and genomic integration. PMID:14650433

  2. Comparison of reverse transcriptase PCR, reverse transcriptase loop-mediated isothermal amplification, and culture-based assays for Salmonella detection from pork processing environments.

    Science.gov (United States)

    Techathuvanan, Chayapa; Draughon, Frances Ann; D'Souza, Doris Helen

    2011-02-01

    Novel rapid Salmonella detection assays without the need for sophisticated equipment or labor remain in high demand. Real-time reverse transcriptase PCR (RT-PCR) assays, though rapid and sensitive, require expensive thermocyclers, while a novel RT loop-mediated isothermal amplification (RT-LAMP) method requires only a simple water bath. Our objective was to compare the detection sensitivity of Salmonella Typhimurium from the pork processing environment by RT-LAMP, RT-PCR, and culture-based assays. Carcass and surface swabs and carcass rinses were obtained from a local processing plant. Autoclaved carcass rinses (500 ml) were spiked with Salmonella Typhimurium and filtered. Filters were placed in stomacher bags containing tetrathionate broth (TTB) and analyzed with or without 10-h enrichment at 37 °C. Natural swabs were stomached with buffered peptone water, and natural carcass rinses were filtered, preenriched, and further enriched in TTB. Serially-diluted enriched samples were enumerated by spread plating on xylose lysine Tergitol 4 agar. RNA was extracted from 5 ml of enriched TTB with TRIzol. RT-LAMP assay using previously described invA primers was conducted at 62 °C for 90 min in a water bath with visual detection and by gel electrophoresis. SYBR Green I-based-real-time RT-PCR was carried out with invA primers followed by melt temperature analysis. The results of RT-LAMP detection for spiked carcass rinses were comparable to those of RT-PCR and cultural plating, with detection limits of 1 log CFU/ml, although they were obtained significantly faster, within 24 h including preenrichment and enrichment. RT-LAMP showed 4 of 12 rinse samples positive, while RT-PCR showed 1 of 12 rinse samples positive. For swabs, 6 of 27 samples positive by RT-LAMP and 5 of 27 by RT-PCR were obtained. This 1-day RT-LAMP assay shows promise for routine Salmonella screening by the pork industry. Copyright ©, International Association for Food Protection

  3. Viral dynamics in primary HIV-1 infection. Karolinska Institutet Primary HIV Infection Study Group.

    Science.gov (United States)

    Lindbäck, S; Karlsson, A C; Mittler, J; Blaxhult, A; Carlsson, M; Briheim, G; Sönnerborg, A; Gaines, H

    2000-10-20

    To study the natural course of viremia during primary HIV infection (PHI). Eight patients were followed from a median of 5 days from the onset of PHI illness. Plasma HIV-1 RNA levels were measured frequently and the results were fitted to mathematical models. HIV-1 RNA levels were also monitored in nine patients given two reverse transcriptase inhibitors and a protease inhibitor after a median of 7 days from the onset of PHI illness. HIV-1 RNA appeared in the blood during the week preceding onset of PHI illness and increased rapidly during the first viremic phase, reaching a peak at a mean of 7 days after onset of illness. This was followed by a phase of rapidly decreasing levels of HIV-1 RNA to an average of 21 days after onset. Viral density continued to decline thereafter but at a 5- to 50-fold lower rate; a steady-state level was reached at a median of 2 months after onset of PHI. Peak viral density levels correlated significantly with levels measured between days 50 and 600. Initiation of antiretroviral treatment during PHI resulted in rapidly declining levels to below 50 copies/mL. This study demonstrates the kinetic phases of viremia during PHI and indicates two new contributions to the natural history of HIV-1 infection: PHI peak levels correlate with steady-state levels and HIV-1 RNA declines biphasically; an initial rapid decay is usually followed by a slow decay, which is similar to the initial changes seen with antiviral treatment.

  4. Efficacy and safety of rilpivirine in treatment-naive, HIV-1-infected patients with hepatitis B virus/hepatitis C virus coinfection enrolled in the Phase III randomized, double-blind ECHO and THRIVE trials

    DEFF Research Database (Denmark)

    Nelson, Mark; Amaya, Gerardo; Clumeck, Nathan

    2012-01-01

    OBJECTIVES: The efficacy and hepatic safety of the non-nucleoside reverse transcriptase inhibitors rilpivirine (TMC278) and efavirenz were compared in treatment-naive, HIV-infected adults with concurrent hepatitis B virus (HBV) and/or hepatitis C virus (HCV) infection in the pooled week 48 analys...

  5. Intracytoplasmic maturation of the human immunodeficiency virus type 1 reverse transcription complexes determines their capacity to integrate into chromatin

    Directory of Open Access Journals (Sweden)

    Kashanchi Fatah

    2006-01-01

    Full Text Available Abstract Background The early events of the HIV-1 life cycle include entry of the viral core into target cell, assembly of the reverse transcription complex (RTCs performing reverse transcription, its transformation into integration-competent complexes called pre-integration complexes (PICs, trafficking of complexes into the nucleus, and finally integration of the viral DNA into chromatin. Molecular details and temporal organization of these processes remain among the least investigated and most controversial problems in the biology of HIV. Results To quantitatively evaluate maturation and nuclear translocation of the HIV-1 RTCs, nucleoprotein complexes isolated from the nucleus (nRTC and cytoplasm (cRTC of HeLa cells infected with MLV Env-pseudotyped HIV-1 were analyzed by real-time PCR. While most complexes completed reverse transcription in the cytoplasm, some got into the nucleus before completing DNA synthesis. The HIV-specific RNA complexes could get into the nucleus when reverse transcription was blocked by reverse transcriptase inhibitor, although nuclear import of RNA complexes was less efficient than of DNA-containing RTCs. Analysis of the RTC nuclear import in synchronized cells infected in the G2/M phase of the cell cycle showed enrichment in the nuclei of RTCs containing incomplete HIV-1 DNA compared to non-synchronized cells, where RTCs with complete reverse transcripts prevailed. Immunoprecipitation assays identified viral proteins IN, Vpr, MA, and cellular Ini1 and PML associated with both cRTCs and nRTCs, whereas CA was detected only in cRTCs and RT was diminished in nRTCs. Cytoplasmic maturation of the complexes was associated with increased immunoreactivity with anti-Vpr and anti-IN antibodies, and decreased reactivity with antibodies to RT. Both cRTCs and nRTCs carried out endogenous reverse transcription reaction in vitro. In contrast to cRTCs, in vitro completion of reverse transcription in nRTCs did not increase their

  6. Rapid Genome Detection of Schmallenberg Virus and Bovine Viral Diarrhea Virus by Use of Isothermal Amplification Methods and High-Speed Real-Time Reverse Transcriptase PCR

    OpenAIRE

    Aebischer, Andrea; Wernike, Kerstin; Hoffmann, Bernd; Beer, Martin

    2014-01-01

    Over the past few years, there has been an increasing demand for rapid and simple diagnostic tools that can be applied outside centralized laboratories by using transportable devices. In veterinary medicine, such mobile test systems would circumvent barriers associated with the transportation of samples and significantly reduce the time to diagnose important infectious animal diseases. Among a wide range of available technologies, high-speed real-time reverse transcriptase quantitative PCR (R...

  7. No Evidence for Decay of the Latent Reservoir in HIV-1–Infected Patients Receiving Intensive Enfuvirtide-Containing Antiretroviral Therapy

    Science.gov (United States)

    Gandhi, Rajesh T.; Bosch, Ronald J.; Aga, Evgenia; Albrecht, Mary; Demeter, Lisa M.; Dykes, Carrie; Bastow, Barbara; Para, Michael; Lai, Jun; Siliciano, Robert F.; Siliciano, Janet D.; Eron, Joseph J.

    2010-01-01

    Human immunodeficiency virus type 1 (HIV-1) persists in a latent reservoir of infected resting memory CD4 cells in patients receiving antiretroviral therapy. We assessed whether multitarget therapy with enfuvirtide, 2 reverse-transcriptase inhibitors, and a ritonavir-boosted protease inhibitor leads to decay of this reservoir. Nineteen treatment-naive patients initiated this regimen; 9 experienced virologic suppression and continued enfuvirtide-containing therapy for at least 48 weeks. In enfuvirtide-treated patients with virological suppression, there was no decay of the latent reservoir (95% confidence interval for half-life, 11 months to infinity). The stability of the latent reservoir despite intensive therapy suggests that new strategies are needed to eradicate HIV-1 from this reservoir. PMID:20001856

  8. Drug resistance mutations in HIV type 1 isolates from naive patients eligible for first line antiretroviral therapy in JJ Hospital, Mumbai, India.

    Science.gov (United States)

    Deshpande, Alake; Karki, Surendra; Recordon-Pinson, Patricia; Fleury, Herve J

    2011-12-01

    More than 50 HIV-1-infected patients, naive of antiretroviral therapy (ART) but eligible for first line ART in JJ Hospital, Mumbai, India were investigated for surveillance drug resistance mutations (SDRMs); all but one virus belonged to subtype C; we could observe SDRMs to nonnucleoside reverse transcriptase inhibitors and protease inhibitors in 9.6% of the patients.

  9. Effects of nucleic acid local structure and magnesium ions on minus-strand transfer mediated by the nucleic acid chaperone activity of HIV-1 nucleocapsid protein

    OpenAIRE

    Wu, Tiyun; Heilman-Miller, Susan L.; Levin, Judith G.

    2007-01-01

    HIV-1 nucleocapsid protein (NC) is a nucleic acid chaperone, which is required for highly specific and efficient reverse transcription. Here, we demonstrate that local structure of acceptor RNA at a potential nucleation site, rather than overall thermodynamic stability, is a critical determinant for the minus-strand transfer step (annealing of acceptor RNA to (−) strong-stop DNA followed by reverse transcriptase (RT)-catalyzed DNA extension). In our system, destabilization of a stem-loop stru...

  10. Cardiovascular disease risk factors in HIV patients--association with antiretroviral therapy. Results from the DAD study

    DEFF Research Database (Denmark)

    Friis-Møller, Nina; Weber, Rainer; Reiss, Peter

    2003-01-01

    , a prospective multinational cohort study initiated in 1999. METHODS: Cross-sectional analyses of CVD risk factors at baseline. The data collected includes data on demographic variables, cigarette smoking, diabetes mellitus, hypertension, dyslipidaemia, body mass index, stage of HIV infection, antiretroviral...... to the prevalence among antiretroviral therapy (ART)-naive subjects. Subjects who have discontinued ART as well as subjects receiving nucleoside reverse transcriptase inhibitors had similar cholesterol levels to treatment-naive subjects. Higher CD4 cell count, lower plasma HIV RNA levels, clinical signs......OBJECTIVE: To determine the prevalence of risk factors for cardiovascular disease (CVD) among HIV-infected persons, and to investigate any association between such risk factors, stage of HIV disease, and use of antiretroviral therapies. DESIGN: Baseline data from 17,852 subjects enrolled in DAD...

  11. The predictive and prognostic potential of plasma telomerase reverse transcriptase (TERT) RNA in rectal cancer patients

    Science.gov (United States)

    Rampazzo, Enrica; Del Bianco, Paola; Bertorelle, Roberta; Boso, Caterina; Perin, Alessandro; Spiro, Giovanna; Bergamo, Francesca; Belluco, Claudio; Buonadonna, Angela; Palazzari, Elisa; Leonardi, Sara; De Paoli, Antonino; Pucciarelli, Salvatore; De Rossi, Anita

    2018-01-01

    Background: Preoperative chemoradiotherapy (CRT) followed by surgery is the standard care for locally advanced rectal cancer, but tumour response to CRT and disease outcome are variable. The current study aimed to investigate the effectiveness of plasma telomerase reverse transcriptase (TERT) levels in predicting tumour response and clinical outcome. Methods: 176 rectal cancer patients were included. Plasma samples were collected at baseline (before CRT=T0), 2 weeks after CRT was initiated (T1), post-CRT and before surgery (T2), and 4–8 months after surgery (T3) time points. Plasma TERT mRNA levels and total cell-free RNA were determined using real-time PCR. Results: Plasma levels of TERT were significantly lower at T2 (P<0.0001) in responders than in non-responders. Post-CRT TERT levels and the differences between pre- and post-CRT TERT levels independently predicted tumour response, and the prediction model had an area under curve of 0.80 (95% confidence interval (CI) 0.73–0.87). Multiple analysis demonstrated that patients with detectable TERT levels at T2 and T3 time points had a risk of disease progression 2.13 (95% CI 1.10–4.11)-fold and 4.55 (95% CI 1.48–13.95)-fold higher, respectively, than those with undetectable plasma TERT levels. Conclusions: Plasma TERT levels are independent markers of tumour response and are prognostic of disease progression in rectal cancer patients who undergo neoadjuvant therapy. PMID:29449673

  12. Antiretroviral Drug Use in a Cross-Sectional Population Survey in Africa: NIMH Project Accept (HPTN 043).

    Science.gov (United States)

    Fogel, Jessica M; Clarke, William; Kulich, Michal; Piwowar-Manning, Estelle; Breaud, Autumn; Olson, Matthew T; Marzinke, Mark A; Laeyendecker, Oliver; Fiamma, Agnès; Donnell, Deborah; Mbwambo, Jessie K K; Richter, Linda; Gray, Glenda; Sweat, Michael; Coates, Thomas J; Eshleman, Susan H

    2017-02-01

    Antiretroviral (ARV) drug treatment benefits the treated individual and can prevent HIV transmission. We assessed ARV drug use in a community-randomized trial that evaluated the impact of behavioral interventions on HIV incidence. Samples were collected in a cross-sectional survey after a 3-year intervention period. ARV drug testing was performed using samples from HIV-infected adults at 4 study sites (Zimbabwe; Tanzania; KwaZulu-Natal and Soweto, South Africa; survey period 2009-2011) using an assay that detects 20 ARV drugs (6 nucleoside/nucleotide reverse transcriptase inhibitors, 3 nonnucleoside reverse transcriptase inhibitors, and 9 protease inhibitors; maraviroc; raltegravir). ARV drugs were detected in 2011 (27.4%) of 7347 samples; 88.1% had 1 nonnucleoside reverse transcriptase inhibitors ± 1-2 nucleoside/nucleotide reverse transcriptase inhibitors. ARV drug detection was associated with sex (women>men), pregnancy, older age (>24 years), and study site (P < 0.0001 for all 4 variables). ARV drugs were also more frequently detected in adults who were widowed (P = 0.006) or unemployed (P = 0.02). ARV drug use was more frequent in intervention versus control communities early in the survey (P = 0.01), with a significant increase in control (P = 0.004) but not in intervention communities during the survey period. In KwaZulu-Natal, a 1% increase in ARV drug use was associated with a 0.14% absolute decrease in HIV incidence (P = 0.018). This study used an objective, biomedical approach to assess ARV drug use on a population level. This analysis identified factors associated with ARV drug use and provided information on ARV drug use over time. ARV drug use was associated with lower HIV incidence at 1 study site.

  13. Bystander CD4+ T lymphocytes survive in HIV-infected human lymphoid tissue

    Science.gov (United States)

    Grivel, Jean-Charles; Biancotto, Angelique; Ito, Yoshinori; Lima, Rosangela G.; Margolis, Leonid B.

    2003-01-01

    HIV infection is associated with depletion of CD4(+) T cells. The mechanisms of this phenomenon remain to be understood. In particular, it remains controversial whether and to what extent uninfected ("bystander") CD4(+) T cells die in HIV-infected individuals. We address this question using a system of human lymphoid tissue ex vivo. Tissue blocks were inoculated with HIV-1. After productive infection was established, they were treated with the reverse transcriptase inhibitor nevirapine to protect from infection those CD4(+) T cells that had not yet been infected. These CD4(+) T cells residing in HIV-infected tissue are by definition bystanders. Our results demonstrate that after nevirapine application the number of bystander CD4(+) T cells is conserved. Thus, in the context of HIV-infected human lymphoid tissue, productive HIV infection kills infected cells but is not sufficient to cause the death of a significant number of uninfected CD4(+) T cells.

  14. Strand transfer and elongation of HIV-1 reverse transcription is facilitated by cell factors in vitro.

    Directory of Open Access Journals (Sweden)

    David Warrilow

    Full Text Available Recent work suggests a role for multiple host factors in facilitating HIV-1 reverse transcription. Previously, we identified a cellular activity which increases the efficiency of HIV-1 reverse transcription in vitro. Here, we describe aspects of the activity which shed light on its function. The cellular factor did not affect synthesis of strong-stop DNA but did improve downstream DNA synthesis. The stimulatory activity was isolated by gel filtration in a single fraction of the exclusion volume. Velocity-gradient purified HIV-1, which was free of detectable RNase activity, showed poor reverse transcription efficiency but was strongly stimulated by partially purified cell proteins. Hence, the cell factor(s did not inactivate an RNase activity that might degrade the viral genomic RNA and block completion of reverse transcription. Instead, the cell factor(s enhanced first strand transfer and synthesis of late reverse transcription suggesting it stabilized the reverse transcription complex. The factor did not affect lysis of HIV-1 by Triton X-100 in the endogenous reverse transcription (ERT system, and ERT reactions with HIV-1 containing capsid mutations, which varied the biochemical stability of viral core structures and impeded reverse transcription in cells, showed no difference in the ability to be stimulated by the cell factor(s suggesting a lack of involvement of the capsid in the in vitro assay. In addition, reverse transcription products were found to be resistant to exogenous DNase I activity when the active fraction was present in the ERT assay. These results indicate that the cell factor(s may improve reverse transcription by facilitating DNA strand transfer and DNA synthesis. It also had a protective function for the reverse transcription products, but it is unclear if this is related to improved DNA synthesis.

  15. HIV-1 subtypes and mutations associated to antiretroviral drug resistance in human isolates from Central Brazil Subtipos e mutações associadas à resistência aos anti-retrovirais em isolados de HIV-1 do Distrito Federal

    Directory of Open Access Journals (Sweden)

    Daniela Marreco Cerqueira

    2004-09-01

    Full Text Available The detection of polymorphisms associated to HIV-1 drug-resistance and genetic subtypes is important for the control and treatment of HIV-1 disease. Drug pressure selects resistant variants that carry mutations in the viral reverse transcriptase (RT and protease (PR genes. For a contribution to the public health authorities in planning the availability of therapeutic treatment, we therefore described the genetic variability, the prevalence of mutations associated to drug resistance and the antiretroviral resistance profile in HIV-1 isolates from infected individuals in Central Brazil. Nineteen HIV-1 RNA samples from a Public Health Laboratory of the Federal District were reversely transcribed and cDNAs were amplified by nested PCR. One fragment of 297 bp coding the entire protease gene, and another of 647 bp, corresponding to the partial RT gene (codons 19-234, were obtained. Automated sequencing and BLAST analysis revealed the presence of 17 B and 2 F1 HIV-1 subtypes. The amino acid sequences were analyzed for the presence of resistance-associated mutations. A total of 6 PR mutations, 2 major and 4 accessory, and 8 RT mutations related to drug resistance were found. Our data suggest a high prevalence of HIV-1 B subtype in the studied population of Federal District as well as the presence of genetically-resistant strains in individuals failing treatment.A detecção de polimorfismos do HIV-1 que estejam associados à resistência às drogas anti-retrovirais e aos subtipos genéticos é importante para o controle e tratamento da infecção pelo HIV-1. A pressão exercida pela terapia anti-retroviral seleciona variantes resistentes com mutações nos genes virais da transcriptase reversa (RT e da protease (PR. Assim, visando contribuir com as autoridades de saúde pública na perspectiva de planejar a disponibilidade de um tratamento terapêutico, nós descrevemos a variabilidade genética e a prevalência de mutações associadas à resist

  16. IL-15 STIMULATED NATURAL KILLER CELLS CLEAR HIV-1 INFECTED CELLS FOLLOWING LATENCY REVERSAL EX VIVO.

    Science.gov (United States)

    Garrido, Carolina; Abad-Fernandez, Maria; Tuyishime, Marina; Pollara, Justin J; Ferrari, Guido; Soriano-Sarabia, Natalia; Margolis, David M

    2018-03-28

    Current efforts towards HIV eradication include approaches to augment immune recognition and elimination of persistently infected cells following latency reversal. Natural killer (NK) cells, the main effectors of the innate immune system, recognize and clear targets using different mechanisms than CD8 + T cells, offering an alternative or complementary approach for HIV clearance strategies. We assessed the impact of IL-15 treatment on NK cell function and the potential of stimulated NK cells to clear the HIV reservoir. We measured NK cell receptor expression, antibody-dependent cell-dependent cytotoxicity (ADCC), cytotoxicity, IFN-γ production and antiviral activity in autologous HIV replication systems. All NK cell functions were uniformly improved by IL-15, and more importantly, IL-15-treated NK cells were able to clear latently HIV infected cells after exposure to vorinostat, a clinically relevant latency reversing agent. We also demonstrate that NK cells from HIV infected individuals aviremic on antiretroviral therapy can be efficiently stimulated with IL-15. Our work opens a promising line of investigation towards future immunotherapies to clear persistent HIV infection using NK cells. IMPORTANCE In the search for an HIV cure, strategies to enhance immune function to allow recognition and clearance of HIV infected cells following latency reversal are being evaluated. Natural killer (NK) cells possess characteristics that can be exploited for immunotherapy against persistent HIV infection. We demonstrate that NK cells from HIV-positive donors can be strongly stimulated with IL-15, improving their antiviral and cytotoxic potential, and more importantly, clearing HIV infected cells after latency reversal with a clinically relevant drug. Our results encourage further investigation to design NK cell-based immunotherapies to achieve HIV eradication. Copyright © 2018 American Society for Microbiology.

  17. Surveillance of transmitted HIV drug resistance using matched plasma and dried blood spot specimens from voluntary counseling and testing sites in Ho Chi Minh City, Vietnam, 2007-2008.

    Science.gov (United States)

    Duc, Nguyen Bui; Hien, Bui Thu; Wagar, Nick; Tram, Tran Hong; Giang, Le Truong; Yang, Chunfu; Wolfe, Mitchell I; Hien, Nguyen Tran; Tuan, Nguyen Anh

    2012-05-01

    During 2007-2008, surveillance of transmitted human immunodeficiency virus (HIV) drug resistance (TDR) was performed following World Health Organization guidance among clients with newly diagnosed HIV infection attending voluntary counseling and testing (VCT) sites in Ho Chi Minh City (HCMC), Vietnam. Moderate (5%-15%) TDR to nonnucleoside reverse-transcriptase inhibitors (NNRTIs) was observed among VCT clients aged 18-21 years. Follow-up surveillance of TDR in HCMC and other geographic regions of Vietnam is warranted. Data generated will guide the national HIV drug resistance surveillance strategy and support selection of current and future first-line antiretroviral therapy and HIV prevention programs.

  18. Reverse transcriptase directs viral evolution in a deep ocean methane seep

    Science.gov (United States)

    Paul, B. G.; Bagby, S. C.

    2013-12-01

    Deep ocean methane seeps are sites of intense microbial activity, with complex communities fueled by aerobic and anaerobic methanotrophy. Methane consumption in these communities has a substantial impact on the global carbon cycle, yet little is known about their evolutionary history or their likely evolutionary trajectories in a warming ocean. As in other marine systems, viral predation and virally mediated horizontal gene transfer are expected to be major drivers of evolutionary change in these communities; however, the host cells' resistance to cultivation has impeded direct study of the viral population. We conducted a metagenomic study of viruses in the anoxic sediments of a deep methane seep in the Santa Monica Basin in the Southern California Bight. We retrieved 1660 partial viral genomes, tentatively assigning 1232 to bacterial hosts and 428 to archaea. One abundant viral genome, likely hosted by Clostridia species present in the sediment, was found to encode a diversity-generating retroelement (DGR), a module for reverse transcriptase-mediated directed mutagenesis of a distal tail fiber protein. While DGRs have previously been described in the viruses of human pathogens, where diversification of viral tail fibers permits infection of a range of host cell types, to our knowledge this is the first description of such an element in a marine virus. By providing a mechanism for massively broadening potential host range, the presence of DGRs in these systems may have a major impact on the prevalence of virally mediated horizontal gene transfer, and even on the phylogenetic distances across which genes are moved.

  19. Sero- and Molecular Epidemiology of HIV-1 in Papua Province, Indonesia

    Directory of Open Access Journals (Sweden)

    Muhammad Qushai Yunifiar M

    2017-11-01

    Full Text Available Background: human immunodeficiency virus (HIV infection and acquired immune deficiency syndrome (AIDS cause serious health problems and affect the Indonesian economy. Papua province has the highest prevalence of HIV infection in the country; however, epidemiological data are limited. Therefore, in order to reveal the current situation of HIV/AIDS in Papua province, sero- and molecular epidemiological studies of HIV were conducted. Methods: serological tests were conducted on 157 healthy individuals from the general population residing in Paniai, Papua. In addition, a molecular epidemiological study was then conducted on HIV type 1 (HIV-1 genes derived from infected individuals. Peripheral blood samples from HIV-1-positive individuals and 15 additionally enrolled, previously confirmed HIV-1-positive individuals were subjected to a genotypic analysis. Results: serological tests revealed that 2 out of 157 (1.27% healthy individuals were HIV-positive. In addition, HIV-1 subtyping revealed that subtype B and CRF01_AE were the major subtype and circulating recombinant form (CRF of HIV-1 prevalent in the region, while subtype A1 and a recombinant form including viral gene fragments of CRF01_AE and subtype B was also detected. In addition, HIV drug resistance-associated major mutations were detected in the reverse transcriptase gene derived from infected individual on antiretroviral therapy. Conclusion: these results provide important information for clearer understanding on the current situation of HIV/AIDS in Papua province in Indonesia.

  20. Telomerase activity-independent function of telomerase reverse transcriptase is involved in acrylamide-induced neuron damage.

    Science.gov (United States)

    Zhang, P; Pan, H; Wang, J; Liu, X; Hu, X

    2014-07-01

    Polyacrylamide is used widely in industry, and its decomposition product, acrylamide (ACR), readily finds its way into commonly consumed cosmetics and baked and fried foods. ACR exerts potent neurotoxic effects in human and animal models. Telomerase reverse transcriptase (TERT), the catalytic subunit of telomerase, traditionally has been considered to play an important role in maintaining telomere length. Emerging evidence has shown, however, that TERT plays an important role in neuroprotection by inhibiting apoptosis and excitotoxicity, and by promoting angiogenesis, neuronal survival and neurogenesis, which are closely related to the telomere-independent functions of TERT. We investigated whether and how the TERT pathway is involved in ACR induced neurotoxicity in rat cortical neurons. We found that ACR 1) significantly reduced the viability of cortical neurons as measured by MTT assay, 2) induced neuron apoptosis as revealed by FITC-conjugated Annexin V/PI double staining and flow cytometry (FACS) analysis, 3) elevated expression of cleaved caspase-3, and 4) decreased bcl-2 expression of cortical neurons. ACR also increased intracellular ROS levels in cortical neurons, increased MDA levels and reduced GSH, SOD and GSH-Px levels in mitochondria in a dose-dependent manner. We found that TERT expression in mitochondria was increased by ACR at concentrations of 2.5 and 5.0 mM, but TERT expression was decreased by 10 mM ACR. Telomerase activity, however, was undetectable in rat cortical neurons. Our results suggest that the TERT pathway is involved in ACR induced apoptosis of cortical neurons. TERT also may exert its neuroprotective role in a telomerase activity-independent way, especially in mitochondria.

  1. Sequential emergence and clinical implications of viral mutants with K70E and K65R mutation in reverse transcriptase during prolonged tenofovir monotherapy in rhesus macaques with chronic RT-SHIV infection

    Directory of Open Access Journals (Sweden)

    Pedersen Niels C

    2007-04-01

    Full Text Available Abstract Background We reported previously on the emergence and clinical implications of simian immunodeficiency virus (SIVmac251 mutants with a K65R mutation in reverse transcriptase (RT, and the role of CD8+ cell-mediated immune responses in suppressing viremia during tenofovir therapy. Because of significant sequence differences between SIV and HIV-1 RT that affect drug susceptibilities and mutational patterns, it is unclear to what extent findings with SIV can be extrapolated to HIV-1 RT. Accordingly, to model HIV-1 RT responses, 12 macaques were inoculated with RT-SHIV, a chimeric SIV containing HIV-1 RT, and started on prolonged tenofovir therapy 5 months later. Results The early virologic response to tenofovir correlated with baseline viral RNA levels and expression of the MHC class I allele Mamu-A*01. For all animals, sensitive real-time PCR assays detected the transient emergence of K70E RT mutants within 4 weeks of therapy, which were then replaced by K65R mutants within 12 weeks of therapy. For most animals, the occurrence of these mutations preceded a partial rebound of plasma viremia to levels that remained on average 10-fold below baseline values. One animal eventually suppressed K65R viremia to undetectable levels for more than 4 years; sequential experiments using CD8+ cell depletion and tenofovir interruption demonstrated that both CD8+ cells and continued tenofovir therapy were required for sustained suppression of viremia. Conclusion This is the first evidence that tenofovir therapy can select directly for K70E viral mutants in vivo. The observations on the clinical implications of the K65R RT-SHIV mutants were consistent with those of SIVmac251, and suggest that for persons infected with K65R HIV-1 both immune-mediated and drug-dependent antiviral activities play a role in controlling viremia. These findings suggest also that even in the presence of K65R virus, continuation of tenofovir treatment as part of HAART may be

  2. Lipid profile of HIV-infected patients in relation to antiretroviral therapy: a review.

    Science.gov (United States)

    Souza, Suelen Jorge; Luzia, Liania Alves; Santos, Sigrid Sousa; Rondó, Patrícia Helen Carvalho

    2013-01-01

    This study reviewed the lipid profile of human immunodeficiency virus/acquired immunodeficiency syndrome (HIV/AIDS) patients in relation to use of antiretroviral therapy (ART), and its different classes of drugs. A total of 190 articles published in peer-reviewed journals were retrieved from PubMed and LILACS databases; 88 of them met the selection criteria and were included in the review. Patients with HIV/AIDS without ART presented an increase of triglycerides and decreases of total cholesterol, low density lipoprotein (LDL-c), and high density lipoprotein (HDL-c) levels. Distinct ART regimens appear to promote different alterations in lipid metabolism. Protease inhibitors, particularly indinavir and lopinavir, were commonly associated with hypercholesterolemia, high LDL-c, low HDL-c, and hypertriglyceridemia. The protease inhibitor atazanavir is apparently associated with a more advantageous lipid profile. Some nucleoside reverse-transcriptase inhibitors (didanosine, stavudine, and zidovudine) induced lipoatrophy and hypertriglyceridemia, whereas abacavir increased the risk of cardiovascular diseases even in the absence of apparent lipid disorders, and tenofovir resulted in lower levels of cholesterol and triglycerides. Although non-nucleoside reverse-transcriptase inhibitors predisposed to hypertriglyceridemia and hypercholesterolemia, nevirapine was particularly associated with high HDL-c levels, a protective factor against cardiovascular diseases. Therefore, the infection itself, different classes of drugs, and some drugs from the same class of ART appear to exert distinct alterations in lipid metabolism. Copyright © 2013 Elsevier Editora Ltda. All rights reserved.

  3. Antiretroviral Drugs for Treatment and Prevention of HIV Infection in Adults: 2016 Recommendations of the International Antiviral Society-USA Panel.

    Science.gov (United States)

    Günthard, Huldrych F; Saag, Michael S; Benson, Constance A; del Rio, Carlos; Eron, Joseph J; Gallant, Joel E; Hoy, Jennifer F; Mugavero, Michael J; Sax, Paul E; Thompson, Melanie A; Gandhi, Rajesh T; Landovitz, Raphael J; Smith, Davey M; Jacobsen, Donna M; Volberding, Paul A

    2016-07-12

    New data and therapeutic options warrant updated recommendations for the use of antiretroviral drugs (ARVs) to treat or to prevent HIV infection in adults. To provide updated recommendations for the use of antiretroviral therapy in adults (aged ≥18 years) with established HIV infection, including when to start treatment, initial regimens, and changing regimens, along with recommendations for using ARVs for preventing HIV among those at risk, including preexposure and postexposure prophylaxis. A panel of experts in HIV research and patient care convened by the International Antiviral Society-USA reviewed data published in peer-reviewed journals, presented by regulatory agencies, or presented as conference abstracts at peer-reviewed scientific conferences since the 2014 report, for new data or evidence that would change previous recommendations or their ratings. Comprehensive literature searches were conducted in the PubMed and EMBASE databases through April 2016. Recommendations were by consensus, and each recommendation was rated by strength and quality of the evidence. Newer data support the widely accepted recommendation that antiretroviral therapy should be started in all individuals with HIV infection with detectable viremia regardless of CD4 cell count. Recommended optimal initial regimens for most patients are 2 nucleoside reverse transcriptase inhibitors (NRTIs) plus an integrase strand transfer inhibitor (InSTI). Other effective regimens include nonnucleoside reverse transcriptase inhibitors or boosted protease inhibitors with 2 NRTIs. Recommendations for special populations and in the settings of opportunistic infections and concomitant conditions are provided. Reasons for switching therapy include convenience, tolerability, simplification, anticipation of potential new drug interactions, pregnancy or plans for pregnancy, elimination of food restrictions, virologic failure, or drug toxicities. Laboratory assessments are recommended before treatment, and

  4. HIV shedding in cervico-vaginal secretions in pregnant women.

    Science.gov (United States)

    Gardella, Barbara; Roccio, Marianna; Maccabruni, Anna; Mariani, Bianca; Panzeri, Lucia; Zara, Francesca; Spinillo, Arsenio

    2011-07-01

    The purpose of this study was to evaluate the presence of HIV-1 in cervico-vaginal secretions of pregnant as compared to non-pregnant HIV-seropositive women. We compared 43 known HIV seropositive pregnant patients versus 241 age-matched (± 2 years) control non-pregnant HIV-seropositive subjects. In pregnant patients blood and cervico-vaginal samples were obtained during each trimester of pregnancy. In control subjects the same samples were obtained at enrolment. HIV-1 RNA was measured in plasma; proviral HIV-1 DNA, cell-associated and cell-free HIV-1 RNA in cervico-vaginal secretion by competitive polymerase chain reaction (cRT-PCR) and reverse transcriptase PCR. The genital shedding of HIV-DNA (22/43 as compared to 79/241, p = 0.02), and cell-free HIV-RNA detection (26/43 as compared to 72/241, p pregnant than in non pregnant women. Pregnancy correlated with a significant positive trend in the cervico-vaginal load of HIV-DNA (Spearman Rho= 0.149, p= 0.012), and cell-free HIV-RNA (Spearman Rho= 0.253, p HIV-RNA transcripts (Spearman Rho = 0.06, p= 0.31). After correction for potential confounders, first trimester pregnant women had increased rates of genital HIV- DNA (odds ratio = 1.94, 95% confidence interval = 1.01 3.78) and cell-free HIV-RNA (odds ratio = 4.07, 95% confidence interval = 1.97 8.41) detection compared to nonpregnant controls. The shedding of genital HIV was increased in pregnant compared to non pregnant subjects, even in patients with undetectable viremia. In this low-risk HIV-positive population the risks of vertical or horizontal transmissions should not be underestimated.

  5. Frequent Cross-Resistance to Dapivirine in HIV-1 Subtype C-Infected Individuals after First-Line Antiretroviral Therapy Failure in South Africa.

    Science.gov (United States)

    Penrose, Kerri J; Wallis, Carole L; Brumme, Chanson J; Hamanishi, Kristen A; Gordon, Kelley C; Viana, Raquel V; Harrigan, P Richard; Mellors, John W; Parikh, Urvi M

    2017-02-01

    A vaginal ring containing dapivirine (DPV) has shown moderate protective efficacy against HIV-1 acquisition, but the activity of DPV against efavirenz (EFV)- and nevirapine (NVP)-resistant viruses that could be transmitted is not well defined. We investigated DPV cross-resistance of subtype C HIV-1 from individuals on failing NVP- or EFV-containing antiretroviral therapy (ART) in South Africa. Plasma samples were obtained from individuals with >10,000 copies of HIV RNA/ml and with HIV-1 containing at least one non-nucleoside reverse transcriptase (NNRTI) mutation. Susceptibility to NVP, EFV, and DPV in TZM-bl cells was determined for recombinant HIV-1 LAI containing bulk-amplified, plasma-derived, full-length reverse transcriptase sequences. Fold change (FC) values were calculated compared with a composite 50% inhibitory concentration (IC 50 ) from 12 recombinant subtype C HIV-1 LAI plasma-derived viruses from treatment-naive individuals in South Africa. A total of 25/100 (25%) samples showed >500-FCs to DPV compared to treatment-naive samples with IC 50 s exceeding the maximum DPV concentration tested (132 ng/ml). A total of 66/100 (66%) samples displayed 3- to 306-FCs, with a median IC 50 of 17.6 ng/ml. Only 9/100 (9%) samples were susceptible to DPV (FC 500-fold resistance to DPV compared to samples with a ≤500-fold resistance. A total of 91% of samples with NNRTI-resistant HIV-1 from individuals on failing first-line ART in South Africa exhibited ≥3-fold cross-resistance to DPV. This level of resistance exceeds expected plasma concentrations, but very high genital tract DPV concentrations from DPV ring use could block viral replication. It is critically important to assess the frequency of transmitted and selected DPV resistance in individuals using the DPV ring. Copyright © 2017 American Society for Microbiology.

  6. Decrease of vitamin D concentration in patients with HIV infection on a non nucleoside reverse transcriptase inhibitor-containing regimen

    Directory of Open Access Journals (Sweden)

    Colebunders Robert

    2010-11-01

    Full Text Available Abstract Background Vitamin D is an important determinant of bone health and also plays a major role in the regulation of the immune system. Interestingly, vitamin D status before the start of highly active antiretroviral therapy (HAART has been recently associated with HIV disease progression and overall mortality in HIV-positive pregnant women. We prospectively studied vitamin D status in HIV individuals on HAART in Belgium. We selected samples from HIV-positive adults starting HAART with a pre-HAART CD4 T-cell count >100 cells/mm3 followed up for at least 12 months without a treatment change. We compared 25-hydroxyvitamin D plasma [25-(OHD] concentration in paired samples before and after 12 months of HAART. 25-(OHD levels are presented using two different cut-offs: Results Vitamin D deficiency was common before HAART, the frequency of plasma 25-(OHD concentrations below 20 ng/ml and 30 below ng/ml was 43.7% and 70.1% respectively. After 12 months on HAART, the frequency increased to 47.1% and 81.6%. HAART for 12 months was associated with a significant decrease of plasma 25-(OHD concentration (p = 0.001. Decreasing plasma 25-(OHD concentration on HAART was associated in the multivariate model with NNRTI-based regimen (p = 0.001 and lower body weight (p = 0.008. Plasma 25-(OHD concentrations decreased significantly in both nevirapine and efavirenz-containing regimens but not in PI-treated patients. Conclusions Vitamin D deficiency is frequent in HIV-positive individuals and NNRTI therapy further decreases 25-(OHD concentrations. Consequently, vitamin D status need to be checked regularly in all HIV-infected patients and vitamin D supplementation should be given when needed.

  7. Prevalence of drug resistance mutations and non-B subtypes in newly diagnosed HIV-1 patients in Denmark

    DEFF Research Database (Denmark)

    Jørgensen, Louise B; Christensen, Marianne B; Gerstoft, Jan

    2003-01-01

    The aim of this study was to monitor the prevalence of drug resistance mutations in newly diagnosed HIV-1 positive individuals in Denmark. In addition we assessed the prevalence of non-B subtypes based on phylogenetic analysis of the pol gene. Plasma samples from 104 newly diagnosed HIV-1 positive...... patients were obtained in the year 2000. The entire protease gene and 320 amino acids of the reverse transcriptase gene were genotyped. Sequences were obtained from 97 patients. No subjects displayed primary resistance mutations in the protease gene, whereas all carried 1 or more secondary mutations....... Resistance mutations in the RT-gene associated with NRTI-resistance were found in 1 patient, who was infected with zidovudine resistant HIV-1 harbouring the M41L mutation in combination with T215S and L210S. The T215S mutation has been showed to be associated with reversion of zidovudine resistance. The T215...

  8. Antiretroviral medication prescribing errors are common with hospitalization of HIV-infected patients.

    Science.gov (United States)

    Commers, Tessa; Swindells, Susan; Sayles, Harlan; Gross, Alan E; Devetten, Marcel; Sandkovsky, Uriel

    2014-01-01

    Errors in prescribing antiretroviral therapy (ART) often occur with the hospitalization of HIV-infected patients. The rapid identification and prevention of errors may reduce patient harm and healthcare-associated costs. A retrospective review of hospitalized HIV-infected patients was carried out between 1 January 2009 and 31 December 2011. Errors were documented as omission, underdose, overdose, duplicate therapy, incorrect scheduling and/or incorrect therapy. The time to error correction was recorded. Relative risks (RRs) were computed to evaluate patient characteristics and error rates. A total of 289 medication errors were identified in 146/416 admissions (35%). The most common was drug omission (69%). At an error rate of 31%, nucleoside reverse transcriptase inhibitors were associated with an increased risk of error when compared with protease inhibitors (RR 1.32; 95% CI 1.04-1.69) and co-formulated drugs (RR 1.59; 95% CI 1.19-2.09). Of the errors, 31% were corrected within the first 24 h, but over half (55%) were never remedied. Admissions with an omission error were 7.4 times more likely to have all errors corrected within 24 h than were admissions without an omission. Drug interactions with ART were detected on 51 occasions. For the study population (n = 177), an increased risk of admission error was observed for black (43%) compared with white (28%) individuals (RR 1.53; 95% CI 1.16-2.03) but no significant differences were observed between white patients and other minorities or between men and women. Errors in inpatient ART were common, and the majority were never detected. The most common errors involved omission of medication, and nucleoside reverse transcriptase inhibitors had the highest rate of prescribing error. Interventions to prevent and correct errors are urgently needed.

  9. Clinical epidemiology of bocavirus, rhinovirus, two polyomaviruses and four coronaviruses in HIV-infected and HIV-uninfected South African children.

    Directory of Open Access Journals (Sweden)

    Marta C Nunes

    Full Text Available Advances in molecular diagnostics have implicated newly-discovered respiratory viruses in the pathogenesis of pneumonia. We aimed to determine the prevalence and clinical characteristics of human bocavirus (hBoV, human rhinovirus (hRV, polyomavirus-WU (WUPyV and -KI (KIPyV and human coronaviruses (CoV-OC43, -NL63, -HKU1 and -229E among children hospitalized with lower respiratory tract infections (LRTI.Multiplex real-time reverse-transcriptase polymerase chain reaction was undertaken on archived nasopharyngeal aspirates from HIV-infected and -uninfected children (<2 years age hospitalized for LRTI, who had been previously investigated for respiratory syncytial virus, human metapneumovirus, parainfluenza I-III, adenovirus and influenza A/B.At least one of these viruses were identified in 274 (53.0% of 517 and in 509 (54.0% of 943 LRTI-episodes in HIV-infected and -uninfected children, respectively. Human rhinovirus was the most prevalent in HIV-infected (31.7% and -uninfected children (32.0%, followed by CoV-OC43 (12.2% and hBoV (9.5% in HIV-infected; and by hBoV (13.3% and WUPyV (11.9% in HIV-uninfected children. Polyomavirus-KI (8.9% vs. 4.8%; p = 0.002 and CoV-OC43 (12.2% vs. 3.6%; p<0.001 were more prevalent in HIV-infected than -uninfected children. Combined with previously-tested viruses, respiratory viruses were identified in 60.9% of HIV-infected and 78.3% of HIV-uninfected children. The newly tested viruses were detected at high frequency in association with other respiratory viruses, including previously-investigated viruses (22.8% in HIV-infected and 28.5% in HIV-uninfected children.We established that combined with previously-investigated viruses, at least one respiratory virus was identified in the majority of HIV-infected and HIV-uninfected children hospitalized for LRTI. The high frequency of viral co-infections illustrates the complexities in attributing causality to specific viruses in the aetiology of LRTI and may indicate a

  10. A Novel Reverse-Transcriptase Real-Time PCR Method for Quantification of Viable Vibrio Parahemolyticus in Raw Shrimp Based on a Rapid Construction of Standard Curve Method

    OpenAIRE

    Mengtong Jin; Haiquan Liu; Wenshuo Sun; Qin Li; Zhaohuan Zhang; Jibing Li; Yingjie Pan; Yong Zhao

    2015-01-01

    Vibrio parahemolyticus is an important pathogen that leads to food illness associated seafood. Therefore, rapid and reliable methods to detect and quantify the total viable V. parahaemolyticus in seafood are needed. In this assay, a RNA-based real-time reverse-transcriptase PCR (RT-qPCR) without an enrichment step has been developed for detection and quantification of the total viable V. parahaemolyticus in shrimp. RNA standards with the target segments were synthesized in vitro with T7 RNA p...

  11. Phylogeny and resistance profiles of HIV-1 POL sequences from rectal biopsies and blood

    DEFF Research Database (Denmark)

    Katzenstein, T L; Petersen, A B; Storgaard, M

    2010-01-01

    The phylogeny and resistance profiles of human immunodeficiency virus type 1 (HIV-1) protease (PR) and reverse transcriptase (RT) sequences were compared among six patients with HIV-1 who had received numerous treatments. RNA and DNA fractions were obtained from concurrent blood and rectal biopsy...... samples. Phylogenetic trees and resistance profiles showed that the rectal mucosa and the peripheral blood mononuclear cells (PBMCs) harbored different HIV-1 strains. The resistance-associated mutations found in each strain corresponded to the treatment history of the patients. The resistance mutations...... acquired during earlier treatment regimens were detected in the sequences obtained from the rectal samples and in the PBMCs in several of the patients. Also, differences in the resistance profiles were observed between anatomical sites and between RNA and DNA fractions. Thus, a single sample probably...

  12. Formation of stable and functional HIV-1 nucleoprotein complexes in vitro.

    Science.gov (United States)

    Tanchou, V; Gabus, C; Rogemond, V; Darlix, J L

    1995-10-06

    HIV genomic RNA resides within the nucleocapsid, in the interior of the virus, which serves to protect the RNA against nuclease degradation and to promote its reverse transcription. To investigate the role of nucleocapsid protein (NCp7) in the stability and replication of genomic RNA within the nucleocapsid, we used NCp7, reverse transcriptase (RT) and RNAs representing the 5' and 3' regions of the genome to reconstitute functional HIV-1 nucleocapsids. The nucleoprotein complexes generated in vitro were found to be stable, which, according to biochemical and genetic data, probably results from the tight binding of NCp7 molecules to the RNA and strong NCp7/NCp7 interactions. The nucleoprotein complexes efficiently protected viral RNA against RNase degradation and, at the same time, promoted viral DNA synthesis by RT. DNA strand transfer from the 5' to the 3' RNA template was very efficient in nucleoprotein complexes formed in the presence of both RNAs, but not when the RNAs were in separate complexes. These results indicate that the in vitro reconstituted HIV-1 nucleoprotein complexes function like virion nucleocapsids and thus provide a way to study at the molecular level this viral substructure and the synthesis of proviral DNA, and to search for new anti-HIV agents.

  13. Studies on Parameters Influencing the Performance of Reverse Transcriptase Polymerase Chain Reaction (RT-PCR in Detecting Prunus Necrotic Ringpot Virus (PNRSV

    Directory of Open Access Journals (Sweden)

    M. Usta

    2005-08-01

    Full Text Available In order to have a more detailed understanding of the various factors influencing a reverse transcriptase polymerase chain reaction (RT-PCR, a number of important parameters such as Mg+2, primer, enzyme concentration and others were optimized for the detection of Prunus necrotic ringspot virus (PNRSV. Using a PNRSV isolate with a pair of primers, complementary DNA of viral genome as template, and an appropriate enzyme together with magnesium chloride, the following optimal conditions were identified: primer concentration between 0.2 and 0.0002 pmol µl-1 and 0.06–2 units µl-1 for Taq DNA polymerase enzyme for a 50 µl reaction volume when other parameters were optimum; magnesium chloride concentration less than 2.5 mM; dNTP concentration between 1 and 10 mM. The optimum cDNA amount should be ~360 ng for a 50 µl reaction mixture. When these optimized concentrations and/or values of the main PCR parameters were brought together for a new RT-PCR, a clear and a reliable PNRSV detection having no background was performed from both growth-chamber and field-grown PNRSV-infected plants.

  14. A Robust PCR Protocol for HIV Drug Resistance Testing on Low-Level Viremia Samples

    Directory of Open Access Journals (Sweden)

    Shivani Gupta

    2017-01-01

    Full Text Available The prevalence of drug resistance (DR mutations in people with HIV-1 infection, particularly those with low-level viremia (LLV, supports the need to improve the sensitivity of amplification methods for HIV DR genotyping in order to optimize antiretroviral regimen and facilitate HIV-1 DR surveillance and relevant research. Here we report on a fully validated PCR-based protocol that achieves consistent amplification of the protease (PR and reverse transcriptase (RT regions of HIV-1 pol gene across many HIV-1 subtypes from LLV plasma samples. HIV-spiked plasma samples from the External Quality Assurance Program Oversight Laboratory (EQAPOL, covering various HIV-1 subtypes, as well as clinical specimens were used to optimize and validate the protocol. Our results demonstrate that this protocol has a broad HIV-1 subtype coverage and viral load span with high sensitivity and reproducibility. Moreover, the protocol is robust even when plasma sample volumes are limited, the HIV viral load is unknown, and/or the HIV subtype is undetermined. Thus, the protocol is applicable for the initial amplification of the HIV-1 PR and RT genes required for subsequent genotypic DR assays.

  15. HIV-1 replication in cell lines harboring INI1/hSNF5 mutations

    Directory of Open Access Journals (Sweden)

    Wu Xuhong

    2006-08-01

    Full Text Available Abstract Background INI1/hSNF5 is a cellular protein that directly interacts with HIV-1 integrase (IN. It is specifically incorporated into HIV-1 virions. A dominant negative mutant derived from INI1 inhibits HIV-1 replication. Recent studies indicate that INI1 is associated with pre-integration and reverse transcription complexes that are formed upon viral entry into the target cells. INI1 also is a tumor suppressor, biallelically deleted/mutated in malignant rhabdoid tumors. We have utilized cell lines derived from the rhabdoid tumors, MON and STA-WT1, that harbor either null or truncating mutations of INI1 respectively, to assess the effect of INI1 on HIV-1 replication. Results We found that while HIV-1 virions produced in 293T cells efficiently transduced MON and STA-WT1 cells, HIV-1 particle production was severely reduced in both of these cells. Reintroduction of INI1 into MON and STA-WT1 significantly enhanced the particle production in both cell lines. HIV-1 particles produced in MON cells were reduced for infectivity, while those produced in STA-WT1 were not. Further analysis indicated the presence of INI1 in those virions produced from STA-WT1 but not from those produced from MON cells. HIV-1 produced in MON cells were defective for synthesis of early and late reverse transcription products in the target cells. Furthermore, virions produced in MON cells were defective for exogenous reverse transcriptase activity carried out using exogenous template, primer and substrate. Conclusion Our results suggest that INI1-deficient cells exhibit reduced particle production that can be partly enhanced by re-introduction of INI1. Infectivity of HIV-1 produced in some but not all INI1 defective cells, is affected and this defect may correlate to the lack of INI1 and/or some other proteins in these virions. The block in early events of virion produced from MON cells appears to be at the stage of reverse transcription. These studies suggest that

  16. HIV-1 replication in cell lines harboring INI1/hSNF5 mutations.

    Science.gov (United States)

    Sorin, Masha; Yung, Eric; Wu, Xuhong; Kalpana, Ganjam V

    2006-08-31

    INI1/hSNF5 is a cellular protein that directly interacts with HIV-1 integrase (IN). It is specifically incorporated into HIV-1 virions. A dominant negative mutant derived from INI1 inhibits HIV-1 replication. Recent studies indicate that INI1 is associated with pre-integration and reverse transcription complexes that are formed upon viral entry into the target cells. INI1 also is a tumor suppressor, biallelically deleted/mutated in malignant rhabdoid tumors. We have utilized cell lines derived from the rhabdoid tumors, MON and STA-WT1, that harbor either null or truncating mutations of INI1 respectively, to assess the effect of INI1 on HIV-1 replication. We found that while HIV-1 virions produced in 293T cells efficiently transduced MON and STA-WT1 cells, HIV-1 particle production was severely reduced in both of these cells. Reintroduction of INI1 into MON and STA-WT1 significantly enhanced the particle production in both cell lines. HIV-1 particles produced in MON cells were reduced for infectivity, while those produced in STA-WT1 were not. Further analysis indicated the presence of INI1 in those virions produced from STA-WT1 but not from those produced from MON cells. HIV-1 produced in MON cells were defective for synthesis of early and late reverse transcription products in the target cells. Furthermore, virions produced in MON cells were defective for exogenous reverse transcriptase activity carried out using exogenous template, primer and substrate. Our results suggest that INI1-deficient cells exhibit reduced particle production that can be partly enhanced by re-introduction of INI1. Infectivity of HIV-1 produced in some but not all INI1 defective cells, is affected and this defect may correlate to the lack of INI1 and/or some other proteins in these virions. The block in early events of virion produced from MON cells appears to be at the stage of reverse transcription. These studies suggest that presence of INI1 or some other host factor in virions and

  17. Class 1-Selective Histone Deacetylase (HDAC) Inhibitors Enhance HIV Latency Reversal while Preserving the Activity of HDAC Isoforms Necessary for Maximal HIV Gene Expression.

    Science.gov (United States)

    Zaikos, Thomas D; Painter, Mark M; Sebastian Kettinger, Nadia T; Terry, Valeri H; Collins, Kathleen L

    2018-03-15

    Combinations of drugs that affect distinct mechanisms of HIV latency aim to induce robust latency reversal leading to cytopathicity and elimination of the persistent HIV reservoir. Thus far, attempts have focused on combinations of protein kinase C (PKC) agonists and pan-histone deacetylase inhibitors (HDIs) despite the knowledge that HIV gene expression is regulated by class 1 histone deacetylases. We hypothesized that class 1-selective HDIs would promote more robust HIV latency reversal in combination with a PKC agonist than pan-HDIs because they preserve the activity of proviral factors regulated by non-class 1 histone deacetylases. Here, we show that class 1-selective agents used alone or with the PKC agonist bryostatin-1 induced more HIV protein expression per infected cell. In addition, the combination of entinostat and bryostatin-1 induced viral outgrowth, whereas bryostatin-1 combinations with pan-HDIs did not. When class 1-selective HDIs were used in combination with pan-HDIs, the amount of viral protein expression and virus outgrowth resembled that of pan-HDIs alone, suggesting that pan-HDIs inhibit robust gene expression induced by class 1-selective HDIs. Consistent with this, pan-HDI-containing combinations reduced the activity of NF-κB and Hsp90, two cellular factors necessary for potent HIV protein expression, but did not significantly reduce overall cell viability. An assessment of viral clearance from in vitro cultures indicated that maximal protein expression induced by class 1-selective HDI treatment was crucial for reservoir clearance. These findings elucidate the limitations of current approaches and provide a path toward more effective strategies to eliminate the HIV reservoir. IMPORTANCE Despite effective antiretroviral therapy, HIV evades eradication in a latent form that is not affected by currently available drug regimens. Pharmacologic latency reversal that leads to death of cellular reservoirs has been proposed as a strategy for

  18. ONIOM DFT/PM3 calculations on the interaction between dapivirine and HIV-1 reverse transcriptase, a theoretical study.

    Science.gov (United States)

    Liang, Y H; Chen, F E

    2007-08-01

    Theoretical investigations of the interaction between dapivirine and the HIV-1 RT binding site have been performed by the ONIOM2 (B3LYP/6-31G (d,p): PM3) and B3LYP/6-31G (d,p) methods. The results derived from this study indicate that this inhibitor dapivirine forms two hydrogen bonds with Lys101 and exhibits strong π-π stacking or H…π interaction with Tyr181 and Tyr188. These interactions play a vital role in stabilizing the NNIBP/dapivirine complex. Additionally, the predicted binding energy of the BBF optimized structure for this complex system is -18.20 kcal/mol.

  19. Cervical Shedding of HIV-1 RNA Among Women With Low Levels of Viremia While Receiving Highly Active Antiretroviral Therapy

    Science.gov (United States)

    Neely, Michael N.; Benning, Lorie; Xu, Jiaao; Strickler, Howard D.; Greenblatt, Ruth M.; Minkoff, Howard; Young, Mary; Bremer, James; Levine, Alexandra M.; Kovacs, Andrea

    2011-01-01

    Background Among women with low o r undetectable quantities of HIV-1 RNA in plasma, factors associated with genital HIV-1 RNA shedding, including choice of treatment regimen, are poorly characterized. Methods We measured HIV-1 RNA in cervical swab specimens obtained from participants in the Women’s Interagency HIV Study who had concurrent plasma viral RNA levels <500 copies/mL, and we assessed factors associated with genital HIV shedding. The study was powered to determine the relative effects of antiretroviral protease inhibitors (PIs) versus nonnucleoside reverse transcriptase inhibitors (NNRTIs) on viral RNA shedding. Results Overall, 44 (15%) of 290 women had detectable HIV-1 RNA in cervical specimens. In the final multivariate model, shedding was independently associated with NNRTI (vs. PI) use (odds ratio [OR], 95% confidence interval [CI]: 2.24, 1.13 to 4.45) and illicit drug use (OR, 95% CI: 2.41, 0.96 to 5.69). Conclusions This is the largest study to define risks for genital HIV-1 RNA shedding in women with low/undetectable plasma virus. Shedding in this population was common, and NNRTI-based highly active antiretroviral therapy (HAART) (vs. PI-based HAART) was associated with genital HIV shedding. Further study is required to determine the impact of these findings on transmission of HIV from mother to child or to sexual partners. PMID:17106279

  20. Oral keratinocytes support non-replicative infection and transfer of harbored HIV-1 to permissive cells.

    Science.gov (United States)

    Vacharaksa, Anjalee; Asrani, Anil C; Gebhard, Kristin H; Fasching, Claudine E; Giacaman, Rodrigo A; Janoff, Edward N; Ross, Karen F; Herzberg, Mark C

    2008-07-17

    Oral keratinocytes on the mucosal surface are frequently exposed to HIV-1 through contact with infected sexual partners or nursing mothers. To determine the plausibility that oral keratinocytes are primary targets of HIV-1, we tested the hypothesis that HIV-1 infects oral keratinocytes in a restricted manner. To study the fate of HIV-1, immortalized oral keratinocytes (OKF6/TERT-2; TERT-2 cells) were characterized for the fate of HIV-specific RNA and DNA. At 6 h post inoculation with X4 or R5-tropic HIV-1, HIV-1gag RNA was detected maximally within TERT-2 cells. Reverse transcriptase activity in TERT-2 cells was confirmed by VSV-G-mediated infection with HIV-NL4-3Deltaenv-EGFP. AZT inhibited EGFP expression in a dose-dependent manner, suggesting that viral replication can be supported if receptors are bypassed. Within 3 h post inoculation, integrated HIV-1 DNA was detected in TERT-2 cell nuclei and persisted after subculture. Multiply spliced and unspliced HIV-1 mRNAs were not detectable up to 72 h post inoculation, suggesting that HIV replication may abort and that infection is non-productive. Within 48 h post inoculation, however, virus harbored by CD4 negative TERT-2 cells trans infected co-cultured peripheral blood mononuclear cells (PBMCs) or MOLT4 cells (CD4+ CCR5+) by direct cell-to-cell transfer or by releasing low levels of infectious virions. Primary tonsil epithelial cells also trans infected HIV-1 to permissive cells in a donor-specific manner. Oral keratinocytes appear, therefore, to support stable non-replicative integration, while harboring and transmitting infectious X4- or R5-tropic HIV-1 to permissive cells for up to 48 h.

  1. Oral keratinocytes support non-replicative infection and transfer of harbored HIV-1 to permissive cells

    Directory of Open Access Journals (Sweden)

    Giacaman Rodrigo A

    2008-07-01

    Full Text Available Abstract Background Oral keratinocytes on the mucosal surface are frequently exposed to HIV-1 through contact with infected sexual partners or nursing mothers. To determine the plausibility that oral keratinocytes are primary targets of HIV-1, we tested the hypothesis that HIV-1 infects oral keratinocytes in a restricted manner. Results To study the fate of HIV-1, immortalized oral keratinocytes (OKF6/TERT-2; TERT-2 cells were characterized for the fate of HIV-specific RNA and DNA. At 6 h post inoculation with X4 or R5-tropic HIV-1, HIV-1gag RNA was detected maximally within TERT-2 cells. Reverse transcriptase activity in TERT-2 cells was confirmed by VSV-G-mediated infection with HIV-NL4-3Δenv-EGFP. AZT inhibited EGFP expression in a dose-dependent manner, suggesting that viral replication can be supported if receptors are bypassed. Within 3 h post inoculation, integrated HIV-1 DNA was detected in TERT-2 cell nuclei and persisted after subculture. Multiply spliced and unspliced HIV-1 mRNAs were not detectable up to 72 h post inoculation, suggesting that HIV replication may abort and that infection is non-productive. Within 48 h post inoculation, however, virus harbored by CD4 negative TERT-2 cells trans infected co-cultured peripheral blood mononuclear cells (PBMCs or MOLT4 cells (CD4+ CCR5+ by direct cell-to-cell transfer or by releasing low levels of infectious virions. Primary tonsil epithelial cells also trans infected HIV-1 to permissive cells in a donor-specific manner. Conclusion Oral keratinocytes appear, therefore, to support stable non-replicative integration, while harboring and transmitting infectious X4- or R5-tropic HIV-1 to permissive cells for up to 48 h.

  2. A Leu to Ile but not Leu to Val change at HIV-1 reverse transcriptase codon 74 in the background of K65R mutation leads to an increased processivity of K65R+L74I enzyme and a replication competent virus

    Directory of Open Access Journals (Sweden)

    Crumpacker Clyde S

    2011-01-01

    Full Text Available Abstract Background The major hurdle in the treatment of Human Immunodeficiency virus type 1 (HIV-1 includes the development of drug resistance-associated mutations in the target regions of the virus. Since reverse transcriptase (RT is essential for HIV-1 replication, several nucleoside analogues have been developed to target RT of the virus. Clinical studies have shown that mutations at RT codon 65 and 74 which are located in β3-β4 linkage group of finger sub-domain of RT are selected during treatment with several RT inhibitors, including didanosine, deoxycytidine, abacavir and tenofovir. Interestingly, the co-selection of K65R and L74V is rare in clinical settings. We have previously shown that K65R and L74V are incompatible and a R→K reversion occurs at codon 65 during replication of the virus. Analysis of the HIV resistance database has revealed that similar to K65R+L74V, the double mutant K65R+L74I is also rare. We sought to compare the impact of L→V versus L→I change at codon 74 in the background of K65R mutation, on the replication of doubly mutant viruses. Methods Proviral clones containing K65R, L74V, L74I, K65R+L74V and K65R+L74I RT mutations were created in pNL4-3 backbone and viruses were produced in 293T cells. Replication efficiencies of all the viruses were compared in peripheral blood mononuclear (PBM cells in the absence of selection pressure. Replication capacity (RC of mutant viruses in relation to wild type was calculated on the basis of antigen p24 production and RT activity, and paired analysis by student t-test was performed among RCs of doubly mutant viruses. Reversion at RT codons 65 and 74 was monitored during replication in PBM cells. In vitro processivity of mutant RTs was measured to analyze the impact of amino acid changes at RT codon 74. Results Replication kinetics plot showed that all of the mutant viruses were attenuated as compared to wild type (WT virus. Although attenuated in comparison to WT virus

  3. Peripheral neuropathy in HIV: an analysis of evidence-based approaches.

    Science.gov (United States)

    Nicholas, Patrice K; Corless, Inge B; Evans, Linda A

    2014-01-01

    Peripheral neuropathy is a common and vexing symptom for people living with HIV infection (PLWH). Neuropathy occurs in several different syndromes and is identified in the literature as distal sensory polyneuropathy or distal sensory peripheral neuropathy. More recently, the HIV literature has focused on the syndrome as painful HIV-associated sensory neuropathy, addressing the symptom rather than the underlying pathophysiology. Assessment of neuropathy in PLWH is critical and must be incorporated into nursing practice for each visit. Neuropathy has been attributed to the direct effects of HIV, exposure to antiretroviral medications (particularly the nucleoside reverse transcriptase inhibitors), advanced immune suppression, and comorbid tuberculosis infection and exposure to antituberculosis medications. Evidence supports the importance of addressing neuropathy in PLWH with pharmacologic treatment regimens and complementary/alternative approaches. This paper examines the pathophysiology, evidence, and approaches to managing peripheral neuropathy. A case study has been included to illustrate a patient's experience with neuropathy symptoms. Copyright © 2014 Association of Nurses in AIDS Care. Published by Elsevier Inc. All rights reserved.

  4. Detection by reverse transcriptase-polymerase chain reaction and molecular characterization of subtype B avian metapneumovirus isolated in Brazil.

    Science.gov (United States)

    Chacón, Jorge Luis; Brandão, Paulo E; Buim, Marcos; Villarreal, Laura; Ferreira, Antonio J Piantino

    2007-10-01

    Subtype B avian metapneumovirus (aMPV) was isolated and detected by reverse transcriptase-polymerase chain reaction (RT-PCR) in Brazilian commercial laying chicken flocks with no history of vaccination against aMPV and presenting respiratory signs and decreased egg production. RT-PCR results from samples from three affected flocks revealed that the three isolates were subtype B. Partial sequence analysis of the G glycoprotein gene confirmed that the samples belonged to subtype B and were not of the vaccine type. Comparison of nucleotide and amino acid sequences of the G gene of the three Brazilian aMPV samples with subtype B isolates from other countries revealed 95.1% to 96.1% identity. Nucleotide sequences showed 100% identity among the Brazilian subtype B samples and 95.6% identity with the subtype B vaccine strain used in Brazil. This work describes the circulation of subtype B aMPV in Brazil and discusses its importance in terms of disease epidemiology.

  5. HIV-1 drug resistance prevalence, drug susceptibility and variant characterization in the Jacobi Medical Center paediatric cohort, Bronx, NY, USA.

    Science.gov (United States)

    de Mulder, M; York, V A; Wiznia, A A; Michaud, H A; Nixon, D F; Holguin, A; Rosenberg, M G

    2014-03-01

    With the advent of combined antiretroviral therapy (cART), perinatally HIV-infected children are surviving into adolescence and beyond. However, drug resistance mutations (DRMs) compromise viral control, affecting the long-term effectiveness of ART. The aims of this study were to detect and identify DRMs in a HIV-1 infected paediatric cohort. Paired plasma and dried blood spots (DBSs) specimens were obtained from HIV-1 perinatally infected patients attending the Jacobi Medical Center, New York, USA. Clinical, virological and immunological data for these patients were analysed. HIV-1 pol sequences were generated from samples to identify DRMs according to the International AIDS Society (IAS) 2011 list. Forty-seven perinatally infected patients were selected, with a median age of 17.7 years, of whom 97.4% were carrying subtype B. They had a mean viral load of 3143 HIV-1 RNA copies/mL and a mean CD4 count of 486 cells/μL at the time of sampling. Nineteen patients (40.4%) had achieved undetectable viraemia (40.5% had a CD4 count of > 500 cells/μL. Most of the patients (97.9%) had received cART, including protease inhibitor (PI)-based regimens in 59.6% of cases. The DRM prevalence was 54.1, 27.6 and 27.0% for nucleoside reverse transcriptase inhibitors (NRTIs), PIs and nonnucleoside reverse transcriptase inhibitors (NNRTIs), respectively. Almost two-thirds (64.9%) of the patients harboured DRMs to at least one drug class and 5.4% were triple resistant. The mean nucleotide similarity between plasma and DBS sequences was 97.9%. Identical DRM profiles were present in 60% of plasma-DBS paired sequences. A total of 30 DRMs were detected in plasma and 26 in DBSs, with 23 present in both. Although more perinatally HIV-1-infected children are reaching adulthood as a result of advances in cART, our study cohort presented a high prevalence of resistant viruses, especially viruses resistant to NRTIs. DBS specimens can be used for DRM detection. © 2013 British HIV Association.

  6. Ritonavir-boosted darunavir combined with raltegravir or tenofovir-emtricitabine in antiretroviral-naive adults infected with HIV-1

    DEFF Research Database (Denmark)

    Raffi, François; Babiker, Abdel G; Richert, Laura

    2014-01-01

    BACKGROUND: Standard first-line antiretroviral therapy for HIV-1 infection includes two nucleoside or nucleotide reverse transcriptase inhibitors (NtRTIs), but these drugs have limitations. We assessed the 96 week efficacy and safety of an NtRTI-sparing regimen. METHODS: Between August, 2010......-inferior to standard treatment and represents a treatment option for patients with CD4 cell counts higher than 200 cells per μL. FUNDING: European Union Sixth Framework Programme, Inserm-ANRS, Gilead Sciences, Janssen Pharmaceuticals, Merck Laboratories....

  7. Molecular epidemiological analysis of env and pol sequences in newly diagnosed HIV type 1-infected, untreated patients in Hungary.

    Science.gov (United States)

    Mezei, Mária; Ay, Eva; Koroknai, Anita; Tóth, Renáta; Balázs, Andrea; Bakos, Agnes; Gyori, Zoltán; Bánáti, Ferenc; Marschalkó, Márta; Kárpáti, Sarolta; Minárovits, János

    2011-11-01

    The aim of our study was to monitor the diversity of HIV-1 strains circulating in Hungary and investigate the prevalence of resistance-associated mutations to reverse transcriptase (RT) and protease (PR) inhibitors in newly diagnosed, drug-naive patients. A total of 30 HIV-1-infected patients without prior antiretroviral treatment diagnosed during the period 2008-2010 were included into this study. Viral subtypes and the presence of RT, PR resistance-associated mutations were established by sequencing. Classification of HIV-1 strains showed that 29 (96.6%) patients were infected with subtype B viruses and one patient (3.3%) with subtype A virus. The prevalence of HIV-1 strains with transmitted drug resistance mutations in newly diagnosed individuals was 16.6% (5/30). This study showed that HIV-1 subtype B is still highly predominant in Hungary and documented a relatively high transmission rate of drug resistance in our country.

  8. Current concepts of metabolic abnormalities in HIV patients: focus on lipodystrophy.

    Science.gov (United States)

    Kolter, Donald P

    2003-12-01

    HIV infection is associated with a number of metabolic abnormalities, including lipodystrophy, a difficult-to-define disorder whose characteristics include hyperlipidemia, insulin resistance, and fat redistribution. Current data suggest that lipodystrophy is caused by multiple factors. Dual-nucleoside reverse transcriptase inhibitor therapy combined with protease inhibitor therapy has been shown to increase the risk of metabolic abnormalities, but susceptibility independent of drug effects has also been shown. While many of the treatments for the broad range of signs and symptoms of lipodystrophy bring about improvements in patient status, none have been demonstrated to bring about a return to baseline levels.

  9. Effectiveness of etravirine-based therapy for treatment-experienced HIV-infected patients.

    Science.gov (United States)

    Huerta García, Gloria; Mata-Marín, José Antonio; Domínguez-Hermosillo, Juan Carlos; Chavez-García, Marcelino; Banda-Lara, Marco Issac; Nuñez-Rodríguez, Nohemi; Cruz-Herrera, Javier Enrique; Sandoval-Ramírez, Jorge Luis; Villagómez-Ruiz, Alfredo; Manjarrez-Tellez, Bulmaro; Gaytan-Martínez, Jesús Enrique

    2016-06-30

    Treatment options are limited for HIV-1-infected individuals who have received extensive previous antiretroviral therapy. ETV has shown significant clinical benefits in treatment-experienced HIV-1+ patients with antiretroviral resistance. The aim of this study was to evaluate the effectiveness of ETV plus optimized background regimen in real-life conditions in a cohort of highly HIV-1 antiretroviral-experienced patients. Retrospective cohort of treatment-experienced HIV-1-infected adults with virological failure who started therapy with an ETV-containing regimen. The effectiveness was evaluated using HIV-1 RNA viral load and changes in CD4+ cell count after 48 weeks of treatment. Forty-two patients ≥ 16 years of age were included; 74% were men, and the median age was 45 years (IQR 41-53). All participants had prior non-nucleoside reverse transcriptase inhibitor use (55% nevirapine, 83%, efavirenz, and 28% both). Baseline median HIV-1 RNA viral load was 15,598 copies/mL (IQR 2651-84,175) and CD4+ cell count was 276 cells/mL (IQR 155-436). After 48 weeks of treatment, 90.5% (95% CI 78-96) of patients had HIV-1 RNA viral load treatment to a median of 407 cells/mL (IQR 242-579); p HIV-1 RNA viral load ≥ 100,000 copies/mL (OR 7.6; 95% CI 1.2-44.80; p = 0.025). Our study provides clinically important evidence of the effectiveness and safety of ETV in highly antiretroviral-experienced HIV-1-infected patients.

  10. HIV Latency Reversing Agents have diverse effects on Natural Killer Cell Function

    Directory of Open Access Journals (Sweden)

    Carolina Garrido

    2016-09-01

    Full Text Available In an effort to clear persistent HIV infection, and achieve a durable therapy-free remission of HIV disease, extensive pre-clinical studies and early pilot clinical trials are underway to develop and test agents that can reverse latent HIV infection and present viral antigen to the immune system for clearance. It is therefore critical to understand the impact of latency reversing agents (LRAs on the function of immune effectors needed to clear infected cells. We assessed the impact of LRAs on the function of natural killer (NK cells, the main effector cells of the innate immune system. We studied the effects of three histone deacetylase inhibitors (SAHA or vorinostat, romidepsin and panobinostat and two protein kinase C (PKC agonists (prostratin and ingenol on the antiviral activity, cytotoxicity, cytokine secretion, phenotype and viability of primary NK cells. We found that ex vivo exposure to vorinostat had minimal impact on all parameters assessed, while panobinostat caused a decrease in NK cell viability, antiviral activity and cytotoxicity. Prostratin caused NK cell activation and interestingly, improved antiviral activity. Overall, we found that LRAs can alter the function and fate of NK cells, and these effects must be carefully considered as strategies are developed to clear persistent HIV infection.

  11. Tenofovir-based regimens associated with less drug resistance in HIV-1-infected Nigerians failing first-line antiretroviral therapy.

    Science.gov (United States)

    Etiebet, Mary-Ann A; Shepherd, James; Nowak, Rebecca G; Charurat, Man; Chang, Harry; Ajayi, Samuel; Elegba, Olufunmilayo; Ndembi, Nicaise; Abimiku, Alashle; Carr, Jean K; Eyzaguirre, Lindsay M; Blattner, William A

    2013-02-20

    In resource-limited settings, HIV-1 drug resistance testing to guide antiretroviral therapy (ART) selection is unavailable. We retrospectively conducted genotypic analysis on archived samples from Nigerian patients who received targeted viral load testing to confirm treatment failure and report their drug resistance mutation patterns. Stored plasma from 349 adult patients on non-nucleoside reverse transcriptase inhibitor (NNRTI) regimens was assayed for HIV-1 RNA viral load, and samples with more than 1000 copies/ml were sequenced in the pol gene. Analysis for resistance mutations utilized the IAS-US 2011 Drug Resistance Mutation list. One hundred and seventy-five samples were genotyped; the majority of the subtypes were G (42.9%) and CRF02_AG (33.7%). Patients were on ART for a median of 27 months. 90% had the M184V/I mutation, 62% had at least one thymidine analog mutation, and 14% had the K65R mutation. 97% had an NNRTI resistance mutation and 47% had at least two etravirine-associated mutations. In multivariate analysis tenofovir-based regimens were less likely to have at least three nucleoside reverse transcriptase inhibitor (NRTI) mutations after adjusting for subtype, previous ART, CD4, and HIV viral load [P < 0.001, odds ratio (OR) 0.04]. 70% of patients on tenofovir-based regimens had at least two susceptible NRTIs to include in a second-line regimen compared with 40% on zidovudine-based regimens (P = 0.04, OR = 3.4). At recognition of treatment failure, patients on tenofovir-based first-line regimens had fewer NRTI drug-resistant mutations and more active NRTI drugs available for second-line regimens. These findings can inform strategies for ART regimen sequencing to optimize long-term HIV treatment outcomes in low-resource settings.

  12. Small-molecule screening using a human primary cell model of HIV latency identifies compounds that reverse latency without cellular activation

    Science.gov (United States)

    Yang, Hung-Chih; Xing, Sifei; Shan, Liang; O’Connell, Karen; Dinoso, Jason; Shen, Anding; Zhou, Yan; Shrum, Cynthia K.; Han, Yefei; Liu, Jun O.; Zhang, Hao; Margolick, Joseph B.; Siliciano, Robert F.

    2009-01-01

    The development of highly active antiretroviral therapy (HAART) to treat individuals infected with HIV-1 has dramatically improved patient outcomes, but HAART still fails to cure the infection. The latent viral reservoir in resting CD4+ T cells is a major barrier to virus eradication. Elimination of this reservoir requires reactivation of the latent virus. However, strategies for reactivating HIV-1 through nonspecific T cell activation have clinically unacceptable toxicities. We describe here the development of what we believe to be a novel in vitro model of HIV-1 latency that we used to search for compounds that can reverse latency. Human primary CD4+ T cells were transduced with the prosurvival molecule Bcl-2, and the resulting cells were shown to recapitulate the quiescent state of resting CD4+ T cells in vivo. Using this model system, we screened small-molecule libraries and identified a compound that reactivated latent HIV-1 without inducing global T cell activation, 5-hydroxynaphthalene-1,4-dione (5HN). Unlike previously described latency-reversing agents, 5HN activated latent HIV-1 through ROS and NF-κB without affecting nuclear factor of activated T cells (NFAT) and PKC, demonstrating that TCR pathways can be dissected and utilized to purge latent virus. Our study expands the number of classes of latency-reversing therapeutics and demonstrates the utility of this in vitro model for finding strategies to eradicate HIV-1 infection. PMID:19805909

  13. Cardiovascular disease risk factors in HIV patients--association with antiretroviral therapy. Results from the DAD study

    DEFF Research Database (Denmark)

    Friis-Møller, Nina; Weber, Rainer; Reiss, Peter

    2003-01-01

    , a prospective multinational cohort study initiated in 1999. METHODS: Cross-sectional analyses of CVD risk factors at baseline. The data collected includes data on demographic variables, cigarette smoking, diabetes mellitus, hypertension, dyslipidaemia, body mass index, stage of HIV infection, antiretroviral......OBJECTIVE: To determine the prevalence of risk factors for cardiovascular disease (CVD) among HIV-infected persons, and to investigate any association between such risk factors, stage of HIV disease, and use of antiretroviral therapies. DESIGN: Baseline data from 17,852 subjects enrolled in DAD...... therapy. RESULTS: Almost 25% of the study population were at an age where there is an appreciable risk of CVD, with those receiving a protease inhibitor (PI) and/or non-nucleoside reverse transcriptase inhibitor (NNRTI) tending to be older. 1.4% had a previous history of CVD and 51.5% were cigarette...

  14. On the Origin of Reverse Transcriptase-Using CRISPR-Cas Systems and Their Hyperdiverse, Enigmatic Spacer Repertoires.

    Science.gov (United States)

    Silas, Sukrit; Makarova, Kira S; Shmakov, Sergey; Páez-Espino, David; Mohr, Georg; Liu, Yi; Davison, Michelle; Roux, Simon; Krishnamurthy, Siddharth R; Fu, Becky Xu Hua; Hansen, Loren L; Wang, David; Sullivan, Matthew B; Millard, Andrew; Clokie, Martha R; Bhaya, Devaki; Lambowitz, Alan M; Kyrpides, Nikos C; Koonin, Eugene V; Fire, Andrew Z

    2017-07-11

    Cas1 integrase is the key enzyme of the clustered regularly interspaced short palindromic repeat (CRISPR)-Cas adaptation module that mediates acquisition of spacers derived from foreign DNA by CRISPR arrays. In diverse bacteria, the cas1 gene is fused (or adjacent) to a gene encoding a reverse transcriptase (RT) related to group II intron RTs. An RT-Cas1 fusion protein has been recently shown to enable acquisition of CRISPR spacers from RNA. Phylogenetic analysis of the CRISPR-associated RTs demonstrates monophyly of the RT-Cas1 fusion, and coevolution of the RT and Cas1 domains. Nearly all such RTs are present within type III CRISPR-Cas loci, but their phylogeny does not parallel the CRISPR-Cas type classification, indicating that RT-Cas1 is an autonomous functional module that is disseminated by horizontal gene transfer and can function with diverse type III systems. To compare the sequence pools sampled by RT-Cas1-associated and RT-lacking CRISPR-Cas systems, we obtained samples of a commercially grown cyanobacterium- Arthrospira platensis Sequencing of the CRISPR arrays uncovered a highly diverse population of spacers. Spacer diversity was particularly striking for the RT-Cas1-containing type III-B system, where no saturation was evident even with millions of sequences analyzed. In contrast, analysis of the RT-lacking type III-D system yielded a highly diverse pool but reached a point where fewer novel spacers were recovered as sequencing depth was increased. Matches could be identified for a small fraction of the non-RT-Cas1-associated spacers, and for only a single RT-Cas1-associated spacer. Thus, the principal source(s) of the spacers, particularly the hypervariable spacer repertoire of the RT-associated arrays, remains unknown. IMPORTANCE While the majority of CRISPR-Cas immune systems adapt to foreign genetic elements by capturing segments of invasive DNA, some systems carry reverse transcriptases (RTs) that enable adaptation to RNA molecules. From

  15. Tenofovir-related nephrotoxicity: case report and review of the literature.

    Science.gov (United States)

    James, Christopher W; Steinhaus, Mary C; Szabo, Susan; Dressier, Robert M

    2004-03-01

    Tenofovir is a nucleotide reverse transcriptase inhibitor for treatment of human immunodeficiency virus (HIV) infection. Several cases of renal failure associated with tenofovir therapy recently have been reported. A 54-year-old man with HIV experienced decreasing renal function and Fanconi's syndrome secondary to tenofovir therapy. His condition gradually improved after discontinuation of the drug. The available medical literature for reported cases of tenofovir-related nephrotoxicity indicates that this complication is apparently rare. However, our case report and literature review underscore the importance of monitoring renal function when treating patients with any nucleotide reverse transcriptase inhibitor.

  16. Leptin as a critical regulator of hepatocellular carcinoma development through modulation of human telomerase reverse transcriptase

    Directory of Open Access Journals (Sweden)

    Stefanou Nikolaos

    2010-08-01

    Full Text Available Abstract Background Numerous epidemiological studies have documented that obesity is associated with hepatocellular carcinoma (HCC. The aim of this study was to investigate the biological actions regulated by leptin, the obesity biomarker molecule, and its receptors in HCC and the correlation between leptin and human telomerase reverse transcriptase (hTERT, a known mediator of cellular immortalization. Methods We investigated the relationship between leptin, leptin receptors and hTERT mRNA expression in HCC and healthy liver tissue samples. In HepG2 cells, chromatin immunoprecipitation assay was used to study signal transducer and activator of transcription-3 (STAT3 and myc/mad/max transcription factors downstream of leptin which could be responsible for hTERT regulation. Flow cytometry was used for evaluation of cell cycle modifications and MMP1, 9 and 13 expression after treatment of HepG2 cells with leptin. Blocking of leptin's expression was achieved using siRNA against leptin and transfection with liposomes. Results We showed, for the first time, that leptin's expression is highly correlated with hTERT expression levels in HCC liver tissues. We also demonstrated in HepG2 cells that leptin-induced up-regulation of hTERT and TA was mediated through binding of STAT3 and Myc/Max/Mad network proteins on hTERT promoter. We also found that leptin could affect hepatocellular carcinoma progression and invasion through its interaction with cytokines and matrix mettaloproteinases (MMPs in the tumorigenic microenvironment. Furthermore, we showed that histone modification contributes to leptin's gene regulation in HCC. Conclusions We propose that leptin is a key regulator of the malignant properties of hepatocellular carcinoma cells through modulation of hTERT, a critical player of oncogenesis.

  17. Emergence of Lamivudine-Resistant HBV during Antiretroviral Therapy Including Lamivudine for Patients Coinfected with HIV and HBV in China

    Science.gov (United States)

    Li, Yijia; Zhu, Ting; Song, Xiaojing; Huang, Ying; Yang, Feifei; Guan, Shuo; Xie, Jing; Gohda, Jin; Hosoya, Noriaki; Kawana-Tachikawa, Ai; Liu, Wenjun; Gao, George Fu; Iwamoto, Aikichi; Li, Taisheng; Ishida, Takaomi

    2015-01-01

    In China, HIV-1-infected patients typically receive antiretroviral therapy (ART) that includes lamivudine (3TC) as a reverse-transcriptase inhibitor (RTI) (ART-3TC). Previous studies from certain developed countries have shown that, in ART-3TC, 3TC-resistant HBV progressively emerges at an annual rate of 15–20% in patients coinfected with HIV-1 and HBV. This scenario in China warrants investigation because >10% of all HIV-infected patients in China are HBV carriers. We measured the occurrence of 3TC-resistant HBV during ART-3TC for HIV-HBV coinfection and also tested the effect of tenofovir disoproxil fumarate (TDF) used as an additional RTI (ART-3TC/TDF) in a cohort study in China. We obtained 200 plasma samples collected from 50 Chinese patients coinfected with HIV-1 and HBV (positive for hepatitis B surface antigen) and examined them for the prevalence of 3TC-resistant HBV by directly sequencing PCR products that covered the HBV reverse-transcriptase gene. We divided the patients into ART-3TC and ART-3TC/TDF groups and compared the efficacy of treatment and incidence of drug-resistance mutation between the groups. HIV RNA and HBV DNA loads drastically decreased in both ART-3TC and ART-3TC/TDF groups. In the ART-3TC group, HBV breakthrough or insufficient suppression of HBV DNA loads was observed in 20% (10/50) of the patients after 96-week treatment, and 8 of these patients harbored 3TC-resistant mutants. By contrast, neither HBV breakthrough nor treatment failure was recorded in the ART-3TC/TDF group. All of the 3TC-resistant HBV mutants emerged from the cases in which HBV DNA loads were high at baseline. Our results clearly demonstrated that ART-3TC is associated with the emergence of 3TC-resistant HBV in patients coinfected with HIV-1 and HBV and that ART-3TC/TDF reduces HBV DNA loads to an undetectable level. These findings support the use of TDF-based treatment regimens for patients coinfected with HIV-1 and HBV. PMID:26288093

  18. Body fat distribution in perinatally HIV-infected and HIV-exposed but uninfected children in the era of highly active antiretroviral therapy: outcomes from the Pediatric HIV/AIDS Cohort Study1234

    Science.gov (United States)

    Jacobson, Denise L; Patel, Kunjal; Siberry, George K; Van Dyke, Russell B; DiMeglio, Linda A; Geffner, Mitchell E; Chen, Janet S; McFarland, Elizabeth J; Borkowsky, William; Silio, Margarita; Fielding, Roger A; Siminski, Suzanne; Miller, Tracie L

    2011-01-01

    Background: Associations between abnormal body fat distribution and clinical variables are poorly understood in pediatric HIV disease. Objective: Our objective was to compare total body fat and its distribution in perinatally HIV-infected and HIV-exposed but uninfected (HEU) children and to evaluate associations with clinical variables. Design: In a cross-sectional analysis, children aged 7–16 y in the Pediatric HIV/AIDS Cohort Study underwent regionalized measurements of body fat via anthropometric methods and dual-energy X-ray absorptiometry. Multiple linear regression was used to evaluate body fat by HIV, with adjustment for age, Tanner stage, race, sex, and correlates of body fat in HIV-infected children. Percentage total body fat was compared with NHANES data. Results: Males accounted for 47% of the 369 HIV-infected and 51% of the 176 HEU children. Compared with HEU children, HIV-infected children were older, were more frequently non-Hispanic black, more frequently had Tanner stage ≥3, and had lower mean height (−0.32 compared with 0.29), weight (0.13 compared with 0.70), and BMI (0.33 compared with 0.63) z scores. On average, HIV-infected children had a 5% lower percentage total body fat (TotF), a 2.8% lower percentage extremity fat (EF), a 1.4% higher percentage trunk fat (TF), and a 10% higher trunk-to-extremity fat ratio (TEFR) than did the HEU children and a lower TotF compared with NHANES data. Stavudine use was associated with lower EF and higher TF and TEFR. Non-nucleotide reverse transcriptase inhibitor use was associated with higher TotF and EF and lower TEFR. Conclusion: Although BMI and total body fat were significantly lower in the HIV-infected children than in the HEU children, body fat distribution in the HIV-infected children followed a pattern associated with cardiovascular disease risk and possibly related to specific antiretroviral drugs. PMID:22049166

  19. Pharmacodynamic Activity of Dapivirine and Maraviroc Single Entity and Combination Topical Gels for HIV-1 Prevention.

    Science.gov (United States)

    Dezzutti, Charlene S; Yandura, Sarah; Wang, Lin; Moncla, Bernard; Teeple, Elizabeth A; Devlin, Brid; Nuttall, Jeremy; Brown, Elizabeth R; Rohan, Lisa C

    2015-11-01

    Dapivirine (DPV), a non-nucleoside reverse transcriptase inhibitor, and maraviroc (MVC), a CCR5 antagonist, were formulated into aqueous gels designed to prevent mucosal HIV transmission. 0.05% DPV, 0.1% MVC, 0.05% DPV/0.1% MVC and placebo gels were evaluated for pH, viscosity, osmolality, and in vitro release. In vitro assays and mucosal tissues were used to evaluate anti-HIV activity. Viability (Lactobacilli only) and epithelial integrity in cell lines and mucosal tissues defined safety. The gels were acidic and viscous. DPV gel had an osmolality of 893 mOsm/kg while the other gels had an osmolality of <100 mOsm/kg. MVC release was similar from the single and combination gels (~5 μg/cm(2)/min(1/2)), while DPV release was 10-fold less from the single as compared to the combination gel (0.4331 μg/cm(2)/min(1/2)). Titrations of the gels showed 10-fold more drug was needed to protect ectocervical than colonic tissue. The combination gel showed ~10- and 100-fold improved activity as compared to DPV and MVC gel, respectively. All gels were safe. The DPV/MVC gel showed a benefit blocking HIV infection of mucosal tissue compared to the single entity gels. Combination products with drugs affecting unique steps in the viral replication cycle would be advantageous for HIV prevention.

  20. Transmitted drug resistance and type of infection in newly diagnosed HIV-1 individuals in Honduras.

    Science.gov (United States)

    Murillo, Wendy; Paz-Bailey, Gabriela; Morales, Sonia; Monterroso, Edgar; Paredes, Mayte; Dobbs, Trudy; Parekh, Bharat S; Albert, Jan; Rivera, Ivette Lorenzana de

    2010-12-01

    Transmitted drug resistance (TDR) reduces the efficacy of antiretroviral treatment and is a public health concern. To gain insight in the epidemiology of TDR in Honduras by evaluating the amount of TDR in a representative sample of newly diagnosed individuals and by determining whether these are recent or established infections. Two hundred treatment-naïve, newly diagnosed HIV-positive individuals representing different population groups (general population, Garifunas ethnic group, female sex workers and men who have sex with men) and different geographic regions were enrolled during April 2004-April 2007. The HIV-1 pol gene was sequenced to identify drug-resistant mutations and TDR was scored as recommended by the WHO. Specimens were classified as recent or established infections using the BED assay. Among 200 samples analyzed from Honduran patients the prevalence of TDR was 7% (95% CI: 3.9-11.5%), 5% for non-nucleoside reverse transcriptase inhibitors (NNRTIs), 3% for nucleoside reverse transcriptase inhibitors (NRTIs) and 0.5% for protease inhibitors (PIs). Testing of these samples with the BED assay revealed that 12% of the specimens were associated with recent infections. TDR was significantly more common in specimens with recent infection (21%) than established infection (5%) (p=0.016). The prevalence of TDR in Honduras was moderate (7%). The percentage of specimens who were recently infected was low (12%), suggesting that late HIV diagnosis is common. The TDR prevalence was higher in recent than in established infections, which may indicate that TDR is increasing over time. The higher prevalence of NNRTI and NRTI mutations as compared to PI mutations is probably due to a broader and longer use of these drugs in Honduras. Copyright © 2010 Elsevier B.V. All rights reserved.

  1. [Mutations of resistance of HIV-1 in previously untreated patients at penitentiary centers of the Autonomous Community of Valencia, Spain. REPRICOVA study].

    Science.gov (United States)

    García-Guerrero, Julio; Herrero, Agustín; Vera, Enrique; Almenara, José M; Araújo, Rosa; Saurí, Vicente V; Castellano, Juan C; Fernández-Clemente, Luis; Bedia, Miguel; Llorente, María I; González-Morán, Francisco

    2002-03-02

    Our purpose was to determine the prevalence of mutations of resistance to nucleoside inhibitors of reverse transcriptase (NIRT) and protease inhibitors (PI) in the HIV-1 genotype of naïve infected subjects in the prisons of the Autonomous Community of Valencia, Spain. Multicentric, descriptive, cross-sectional study of prevalence including a systematic stratified and randomised sampling by centres. Demographic, clinical, virological and immunological data were collected. The HIV gene of protease and transcriptase was studied in peripheral blood plasma samples by means of double PCR amplification and subsequent automatic sequence. Reference: wild strain HXB2. Plasma was obtained from 133 individuals (119 men and 14 women). 117 samples were selected and the rest did not have enough copies for transcription. With regard to NIRT, 7 samples (5.2% of total) showed some mutation of resistance: M41L, D67N, L210W and K219Q, all them secondary to and associated with resistance to zidovudine, abacavir as well as group B multinucleoside-resistance. With regard to PI, only one sample showed a primary mutation, M46I, which was associated with resistance to indinavir. Moreover, a further 41 samples were found to express some secondary mutation. In our series, there was a low number of primary mutations of resistance. These results allow us to exclude the systematic use of resistance tests before an initiation antiretroviral therapy.

  2. Protecting the fetus against HIV infection: a systematic review of placental transfer of antiretrovirals.

    Science.gov (United States)

    McCormack, Shelley A; Best, Brookie M

    2014-11-01

    Maternal-to-fetal transfer of antiretroviral drugs contributes to prevention of vertical transmission of HIV. This systematic review discusses published studies containing data pertaining to the pharmacokinetics of placental transfer of antiretrovirals in humans, including paired cord and maternal plasma samples collected at the time of delivery as well as ex vivo placental perfusion models. Articles pertaining to placental transfer of antiretrovirals were identified from PubMed, from references of included articles, and from US Department of Health and Human Services Panel on Treatment of HIV-infected Pregnant Women and Prevention of Perinatal Transmission guidelines. Articles from non-human animal models or that had no original maternal-to-fetal transfer data were excluded. PRISMA guidelines were followed. A total of 103 published studies were identified. Data across studies appeared relatively consistent for the nucleoside reverse transcriptase inhibitors (NRTIs) and the non-nucleotide reverse transcriptase inhibitors (NNRTIs), with cord to maternal ratios approaching 1 for many of these agents. The protease inhibitors atazanavir and lopinavir exhibited consistent maternal-to-fetal transfer across studies, although the transfer may be influenced by variations in drug-binding proteins. The protease inhibitors indinavir, nelfinavir, and saquinavir exhibited unreliable placental transport, with cord blood concentrations that were frequently undetectable. Limited data, primarily from case reports, indicate that darunavir and raltegravir provide detectable placental transfer. These findings appear consistent with current guidelines of using two NRTIs plus an NNRTI, atazanavir/ritonavir, or lopinavir/ritonavir to maximize placental transfer as well as to optimally suppress maternal viral load. Darunavir/ritonavir and raltegravir may reasonably serve as second-line agents.

  3. Testing of viscous anti-HIV microbicides using Lactobacillus.

    Science.gov (United States)

    Moncla, B J; Pryke, K; Rohan, L C; Yang, H

    2012-02-01

    The development of topical microbicides for intravaginal use to prevent HIV infection requires that the drugs and formulated products be nontoxic to the endogenous vaginal Lactobacillus. In 30min exposure tests we found dapivirine, tenofovir and UC781 (reverse transcriptase inhibitor anti-HIV drugs) as pure drugs or formulated as film or gel products were not deleterious to Lactobacillus species; however, PSC-RANTES (a synthetic CCR5 antagonist) killed 2 strains of Lactobacillus jensenii. To demonstrate the toxicity of formulated products a new assay was developed for use with viscous and non-viscous samples that we have termed the Lactobacillus toxicity test. We found that the vortex mixing of vaginal Lactobacillus species can lead to reductions in bacterial viability. Lactobacillus can survive briefly, about 2s, but viability declines with increased vortex mixing. The addition of heat inactivated serum or bovine serum albumin, but not glycerol, prevented the decrease in bacterial viability. Bacillus atrophaeus spores also demonstrated loss of viability upon extended mixing. We observed that many of the excipients used in film formulation and the films themselves also afford protection from the killing during vortex mixing. This method is of relevance for toxicity for cidal activities of viscous products. Copyright © 2011 Elsevier B.V. All rights reserved.

  4. Higher levels of Zidovudine resistant HIV in the colon compared to blood and other gastrointestinal compartments in HIV infection

    Directory of Open Access Journals (Sweden)

    van Marle Guido

    2010-09-01

    Full Text Available Abstract Background The gut-associated lymphoid tissue (GALT is the largest lymphoid organ infected by human immunodeficiency virus type 1 (HIV-1. It serves as a viral reservoir and host-pathogen interface in infection. This study examined whether different parts of the gut and peripheral blood lymphocytes (PBL contain different drug-resistant HIV-1 variants. Methods Gut biopsies (esophagus, stomach, duodenum and colon and PBL were obtained from 8 HIV-1 infected preHAART (highly active antiretroviral therapy patients at three visits over 18 months. Patients received AZT, ddI or combinations of AZT/ddI. HIV-1 Reverse transcriptase (RT-coding sequences were amplified from viral DNA obtained from gut tissues and PBL, using nested PCR. The PCR fragments were cloned and sequenced. The resulting sequences were subjected to phylogenetic analyses, and antiretroviral drug mutations were identified. Results Phylogenetic and drug mutation analyses revealed differential distribution of drug resistant mutations in the gut within patients. The level of drug-resistance conferred by the RT sequences was significantly different between different gut tissues and PBL, and varied with antiretroviral therapy. The sequences conferring the highest level of drug-resistance to AZT were found in the colon. Conclusion This study confirms that different drug-resistant HIV-1 variants are present in different gut tissues, and it is the first report to document that particular gut tissues may select for drug resistant HIV-1 variants.

  5. Executive summary of the GeSIDA/National AIDS Plan consensus document on antiretroviral therapy in adults infected by the human immunodeficiency virus (updated January 2014).

    Science.gov (United States)

    Berenguer, Juan; Polo, Rosa; Lozano, Fernando; López Aldeguer, José; Antela, Antonio; Arribas, José Ramón; Asensi, Víctor; Blanco, José Ramón; Clotet, Bonaventura; Domingo, Pere; Galindo, María José; Gatell, José María; González-García, Juan; Iribarren, José Antonio; Locutura, Jaime; López, Juan Carlos; Mallolas, Josep; Martínez, Esteban; Miralles, Celia; Miró, José M; Moreno, Santiago; Palacios, Rosario; Pérez Elías, María Jesús; Pineda, Juan Antonio; Podzamczer, Daniel; Portilla, Joaquín; Pulido, Federico; Ribera, Esteban; Riera, Melchor; Rubio, Rafael; Santos, Jesús; Sanz, Jesús; Tuset, Montserrat; Vidal, Francesc; Rivero, Antonio

    2014-01-01

    In this update, antiretroviral therapy (ART) is recommended for all patients infected by type 1 human immunodeficiency virus (HIV-1). The strength and grade of the recommendation varies with clinical circumstances, number of CD4 cells, comorbid conditions and prevention of transmission of HIV. The objective of ART is to achieve an undetectable plasma viral load. Initial ART should always comprise a combination of 3 drugs, including 2 nucleoside reverse transcriptase inhibitors and a third drug from a different family (non-nucleoside reverse transcriptase inhibitor, protease inhibitor, or integrase inhibitor). This update presents the causes and criteria for switching ART in patients with undetectable plasma viral load and in cases of virological failure. An update is also provided for the specific criteria for ART in special situations (acute infection, HIV-2 infection, and pregnancy) and with comorbid conditions (tuberculosis or other opportunistic infections, kidney disease, liver disease, and cancer). Copyright © 2014 Elsevier España, S.L.U. y Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica. All rights reserved.

  6. The successes and failures of HIV drug discovery.

    Science.gov (United States)

    Hashimoto, Chie; Tanaka, Tomohiro; Narumi, Tetsuo; Nomura, Wataru; Tamamura, Hirokazu

    2011-10-01

    To date, several anti-human immunodeficiency virus (HIV) drugs, including reverse transcriptase inhibitors and protease inhibitors, have been developed and used clinically for the treatment of patients infected with HIV. Recently, novel drugs have been discovered which have different mechanisms of action from those of the above inhibitors, including entry inhibitors and integrase (IN) inhibitors; the clinical use of three of these inhibitors has been approved. Other inhibitors are still in development. This review article summarizes the history of the development of anti-HIV drugs and also focuses on successes in the development of these entry and IN inhibitors, along with looking at exploratory approaches for the development of other inhibitors. Currently used highly active antiretroviral therapy can be subject to a loss of efficacy, due to the emergence of multi-drug resistant (MDR) strains; a change of regimens of the drug combination is required to combat this, along with careful monitoring of the virus and CD4 in the blood, by methods such as cellular tropism testing. In such a situation, entry inhibitors such as CCR5/CXCR4 antagonists, CD4 mimics, fusion inhibitors and IN inhibitors might be optional agents for an expansion of the drug repertoire available to patients at all stages of HIV infection.

  7. Dissimilarities in the metabolism of antiretroviral drugs used in HIV pre-exposure prophylaxis in colon and vagina tissues.

    Science.gov (United States)

    To, Elaine E; Hendrix, Craig W; Bumpus, Namandjé N

    2013-10-01

    Attempts to prevent HIV infection through pre-exposure prophylaxis (PrEP) include topical application of anti-HIV drugs to the mucosal sites of infection; however, a potential role for local drug metabolizing enzymes in modulating the exposure of the mucosal tissues to these drugs has yet to be explored. Here we present the first report that enzymes belonging to the cytochrome P450 (CYP) and UDP-glucuronosyltransferase (UGT) families of drug metabolizing enzymes are expressed and active in vaginal and colorectal tissue using biopsies collected from healthy volunteers. In doing so, we discovered that dapivirine and maraviroc, a non-nucleoside reverse transcriptase inhibitor and an entry inhibitor currently in development as microbicides for HIV PrEP, are differentially metabolized in colorectal tissue and vaginal tissue. Taken together, these data should help to guide the optimization of small molecules being developed for HIV PrEP. Copyright © 2013 Elsevier Inc. All rights reserved.

  8. Incidence and risk factors of herpes zoster among hiv-positive patients in the german competence network for HIV/AIDS (KompNet): a cohort study analysis.

    Science.gov (United States)

    Jansen, Klaus; Haastert, Burkhard; Michalik, Claudia; Guignard, Adrienne; Esser, Stefan; Dupke, Stephan; Plettenberg, Andreas; Skaletz-Rorowski, Adriane; Brockmeyer, Norbert H

    2013-08-10

    HIV infection is a risk factor for the development of Herpes zoster (HZ) and its complications. Prior to antiretroviral therapy (ART), HZ incidence in HIV-infected individuals ranged from 2.9-5.1/100 person-years. There is limited evidence for the impact of ART on HZ occurrence among HIV-infected adults. We analysed the incidence of, and risk factors for, HZ in a large cohort of German HIV-positive patients. The study population was taken from the German KompNet cohort, a nationwide multicenter HIV cohort study. The study population was defined by age (≥ 18 years), year of first positive HIV diagnosis, CD4 values ± 6 months from HIV diagnosis (t0), and month of HZ diagnosis. Incidences were estimated using a Poisson distribution, and uni- and multivariate Cox proportional Hazard ratio (HR) regression models were fitted to identify risk factors for developing an initial HZ episode. Independent variables were sex, age at HIV diagnosis, route of HIV transmission, ART status, CD4 count before HZ episode, immunosuppressive medication, and mode of data documentation (retrospective or prospective). HZ incidence in the overall study population was 1.2/100 person-years. In a subset of patients for that we were able to examine risk factors the following was observed: We examined 3,757 individuals whose mean age at t0 was 38 years. Of those individuals, 96% were diagnosed with HIV in 1996 or later, with a mean observation time of 5.8 years. HZ episodes (n = 362) were recorded in 326 patients (8.7%), resulting in annual HZ incidences of 1.7/100 person-years overall, and 1.6/100 person-years for initial HZ cases. The main risk factors associated with an initial HZ episode were: not partaking in ART compared with an ART regimen containing a non-nucleoside reverse-transcriptase inhibitor (HR 0.530, p study HZ incidences were lower than in previous studies relating to HIV-positive patients. We showed that ART is an important protective factor for HZ episodes.

  9. Novel Bifunctional Quinolonyl Diketo Acid Derivatives as HIV-1 Integrase Inhibitors: Design, Synthesis, Biological Activities and Mechanism of Action

    Science.gov (United States)

    Di Santo, Roberto; Costi, Roberta; Roux, Alessandra; Artico, Marino; Lavecchia, Antonio; Marinelli, Luciana; Novellino, Ettore; Palmisano, Lucia; Andreotti, Mauro; Amici, Roberta; Galluzzo, Clementina Maria; Nencioni, Lucia; Palamara, Anna Teresa; Pommier, Yves; Marchand, Christophe

    2008-01-01

    The virally encoded integrase protein is an essential enzyme in the life cycle of the HIV-1 virus and represents an attractive and validated target in the development of therapeutics against HIV infection. Drugs that selectively inhibit this enzyme, when used in combination with inhibitors of reverse transcriptase and protease, are believed to be highly effective in suppressing the viral replication. Among the HIV-1 integrase inhibitors, the β-diketo acids (DKAs) represent a major lead for anti-HIV-1drug development. In this study, novel bifunctional quinolonyl diketo acid derivatives were designed, synthesized and tested for their inhibitory ability against HIV-1 integrase. The compounds are potent inhibitors of integrase activity. Particularly, derivative 8 is a potent IN inhibitor for both steps of the reaction (3′-processing and strand transfer) and exhibits both high antiviral activity against HIV-1 infected cells and low cytotoxicity. Molecular modeling studies provide a plausible mechanism of action, which is consistent with ligand SARs and enzyme photo-crosslinking experiments. PMID:16539381

  10. Incorporation of deoxyribonucleotides and ribonucleotides by a dNTP-binding cleft mutated reverse transcriptase in hepatitis B virus core particles

    International Nuclear Information System (INIS)

    Kim, Hee-Young; Kim, Hye-Young; Jung, Jaesung; Park, Sun; Shin, Ho-Joon; Kim, Kyongmin

    2008-01-01

    Our recent observation that hepatitis B virus (HBV) DNA polymerase (P) might initiate minus-strand DNA synthesis without primer [Kim et al., (2004) Virology 322, 22-30], raised a possibility that HBV P protein may have the potential to function as an RNA polymerase. Thus, we mutated Phe 436, a bulky amino acid with aromatic side chain, at the putative dNTP-binding cleft in reverse transcriptase (RT) domain of P protein to smaller amino acids (Gly or Val), and examined RNA polymerase activity. HBV core particles containing RT dNTP-binding cleft mutant P protein were able to incorporate 32 P-ribonucleotides, but not HBV core particles containing wild type (wt), priming-deficient mutant, or RT-deficient mutant P proteins. Since all the experiments were conducted with core particles isolated from transfected cells, our results indicate that the HBV RT mutant core particles containing RT dNTP-binding cleft mutant P protein could incorporate both deoxyribonucleotides and ribonucleotides in replicating systems

  11. Cerebrospinal fluid abacavir concentrations in HIV-positive patients following once-daily administration.

    Science.gov (United States)

    Calcagno, A; Pinnetti, C; De Nicolò, A; Scarvaglieri, E; Gisslen, M; Tempestilli, M; D'Avolio, A; Fedele, V; Di Perri, G; Antinori, A; Bonora, S

    2018-06-01

    Abacavir is a widely used nucleotide reverse transcriptase inhibitor, for which cerebrospinal fluid (CSF) exposure has been previously assessed in twice-daily recipients. We studied abacavir CSF concentrations in 61 and nine HIV-positive patients taking abacavir once daily and twice daily, respectively. Patients on once-daily abacavir had higher plasma and CSF concentrations (96 vs. 22 ng ml -1 , P = 0.038 and 123 vs. 49 ng ml -1 , P = 0.038) but similar CSF-to-plasma ratios (0.8 vs. 0.5, P = 0.500). CSF abacavir concentrations were adequate in patients receiving once-daily treatment. © 2018 The British Pharmacological Society.

  12. T lymphocytes among HIV-infected and -uninfected infants: CD4/CD8 ratio as a potential tool in diagnosis of infection in infants under the age of 2 years

    Directory of Open Access Journals (Sweden)

    Bikoue Arsene

    2005-02-01

    Full Text Available Abstract Background Serologic tests for HIV infection in infants less than 18 months do not differentiate exposure and infection since maternally acquired IgG antibodies may be detected in infants. Thus, the gold standard for diagnosis of HIV-1 infection in infants under the age of 2 years is DNA or reverse transcriptase polymerase chain reaction. There is an urgent need to evaluate alternative and cost effective laboratory methods for early diagnosis of infant HIV-1 infection as well as identifying infected infants who may benefit from cotrimoxazole prophylaxis and/or initiation of highly active antiretroviral therapy. Methods Whole blood was collected in EDTA from 137 infants aged 0 to 18 months. DNA polymerase chain reaction was used as the reference standard for diagnosis of HIV-1 infection. T-cell subset profiles were determined by flow cytometry. Results Seventy-six infants were DNA PCR positive while 61 were negative. The median CD4 counts of PCR negative infants were significantly higher than those of the PCR positive infants, p . The median CD4/CD8 ratio and the %CD4 of the PCR positive infants were both significantly lower than those of the negative infants, p . The CD4/CD8 ratio had a >98% sensitivity for diagnosis of HIV-1 infection and a specificity of >98%. Conclusion The CD4/CD8 ratio appears useful in identifying HIV-infected infants. The development of lower cost and more robust flow cytometric methods that provide both CD4/CD8 ratio and %CD4 may be cost-effective for HIV-1 diagnosis and identification of infants for cotrimoxazole prophylaxis and/or highly active antiretroviral therapy.

  13. Six Highly Conserved Targets of RNAi Revealed in HIV-1-Infected Patients from Russia Are Also Present in Many HIV-1 Strains Worldwide.

    Science.gov (United States)

    Kretova, Olga V; Fedoseeva, Daria M; Gorbacheva, Maria A; Gashnikova, Natalya M; Gashnikova, Maria P; Melnikova, Nataliya V; Chechetkin, Vladimir R; Kravatsky, Yuri V; Tchurikov, Nickolai A

    2017-09-15

    RNAi has been suggested for use in gene therapy of HIV/AIDS, but the main problem is that HIV-1 is highly variable and could escape attack from the small interfering RNAs (siRNAs) due to even single nucleotide substitutions in the potential targets. To exhaustively check the variability in selected RNA targets of HIV-1, we used ultra-deep sequencing of six regions of HIV-1 from the plasma of two independent cohorts of patients from Russia. Six RNAi targets were found that are invariable in 82%-97% of viruses in both cohorts and are located inside the domains specifying reverse transcriptase (RT), integrase, vpu, gp120, and p17. The analysis of mutation frequencies and their characteristics inside the targets suggests a likely role for APOBEC3G (apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3G, A3G) in G-to-A mutations and a predominant effect of RT biases in the detected variability of the virus. The lowest frequency of mutations was detected in the central part of all six targets. We also discovered that the identical RNAi targets are present in many HIV-1 strains from many countries and from all continents. The data are important for both the understanding of the patterns of HIV-1 mutability and properties of RT and for the development of gene therapy approaches using RNAi for the treatment of HIV/AIDS. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  14. HIV genotype resistance testing in antiretroviral (ART) exposed Indian children--a need of the hour.

    Science.gov (United States)

    Shah, Ira; Parikh, Shefali

    2013-04-01

    Development of drug resistance in HIV infected children with treatment failure is a major impediment to selection of appropriate therapy. HIV genotype resistance assays predict drug resistance on the basis of mutations in the viral genome. However, their clinical utility, especially in a resource limited setting is still a subject of debate. The authors report two cases in which both the children suffered from treatment failure of various antiretroviral therapy regimes. In both the cases, Genotype Resistance Testing (GRT) prompted a radical change from proposed failure therapy as per existing guidelines. GRT was specifically important for the selection of a new dual Nucleoside reverse transcriptase inhibitors (NRTI) component of failure regimen by identifying TAMS and M184V mutations in the HIV genome. These case reports highlight the importance of GRT in children failing multiple antiretroviral regimes; and emphasizes the need to recognize situations where GRT is absolutely essential to guide appropriate therapy, even in a resource limited setting.

  15. Full Viral Suppression, Low-Level Viremia, and Quantifiable Plasma HIV-RNA at the End of Pregnancy in HIV-Infected Women on Antiretroviral Treatment.

    Science.gov (United States)

    Baroncelli, Silvia; Pirillo, Maria F; Tamburrini, Enrica; Guaraldi, Giovanni; Pinnetti, Carmela; Degli Antoni, Anna; Galluzzo, Clementina M; Stentarelli, Chiara; Amici, Roberta; Floridia, Marco

    2015-07-01

    There is limited information on full viral suppression and low-level HIV-RNA viremia in HIV-infected women at the end of pregnancy. We investigated HIV-RNA levels close to delivery in women on antiretroviral treatment in order to define rates of complete suppression, low-level viremia, and quantifiable HIV-RNA, exploring as potential determinants some clinical and viroimmunological variables. Plasma samples from a national study in Italy, collected between 2003 and 2012, were used. According to plasma HIV-RNA levels, three groups were defined: full suppression (target not detected), low-level viremia (target detected but HIV-RNA (≥37 copies/ml). Multivariable logistic regression was used to define determinants of full viral suppression and of quantifiable HIV-RNA. Among 107 women evaluated at a median gestational age of 35 weeks, 90 (84.1%) had HIV-RNA HIV-RNA was 109 copies/ml (IQR 46-251), with only one case showing resistance (mutation M184V; rate: 9.1%). In multivariable analyses, women with higher baseline HIV-RNA levels and with hepatitis C virus (HCV) coinfection were significantly more likely to have quantifiable HIV-RNA in late pregnancy. Full viral suppression was significantly more likely with nonnucleoside reverse transcriptase inhibitor (NNRTI)-based regimens and significantly less likely with higher HIV-RNA in early pregnancy. No cases of HIV transmission occurred. In conclusion, HIV-infected pregnant women showed a high rate of viral suppression and a low resistance rate before delivery. In most cases no target HIV-RNA was detected in plasma, suggesting a low risk of subsequent virological rebound and development of resistance. Women with high levels of HIV-RNA in early pregnancy and those who have concomitant HCV infection should be considered at higher risk of having quantifiable HIV-RNA at the end of pregnancy.

  16. Six Highly Conserved Targets of RNAi Revealed in HIV-1-Infected Patients from Russia Are Also Present in Many HIV-1 Strains Worldwide

    Directory of Open Access Journals (Sweden)

    Olga V. Kretova

    2017-09-01

    Full Text Available RNAi has been suggested for use in gene therapy of HIV/AIDS, but the main problem is that HIV-1 is highly variable and could escape attack from the small interfering RNAs (siRNAs due to even single nucleotide substitutions in the potential targets. To exhaustively check the variability in selected RNA targets of HIV-1, we used ultra-deep sequencing of six regions of HIV-1 from the plasma of two independent cohorts of patients from Russia. Six RNAi targets were found that are invariable in 82%–97% of viruses in both cohorts and are located inside the domains specifying reverse transcriptase (RT, integrase, vpu, gp120, and p17. The analysis of mutation frequencies and their characteristics inside the targets suggests a likely role for APOBEC3G (apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3G, A3G in G-to-A mutations and a predominant effect of RT biases in the detected variability of the virus. The lowest frequency of mutations was detected in the central part of all six targets. We also discovered that the identical RNAi targets are present in many HIV-1 strains from many countries and from all continents. The data are important for both the understanding of the patterns of HIV-1 mutability and properties of RT and for the development of gene therapy approaches using RNAi for the treatment of HIV/AIDS. Keywords: HIV-1, RNAi targets, gene therapy, ultra-deep sequencing, conserved HIV-1 sequences

  17. In vitro HIV-1 evolution in response to triple reverse transcriptase inhibitors & in silico phenotypic analysis.

    Directory of Open Access Journals (Sweden)

    Barbara A Rath

    Full Text Available Effectiveness of ART regimens strongly depends upon complex interactions between the selective pressure of drugs and the evolution of mutations that allow or restrict drug resistance.Four clinical isolates from NRTI-exposed, NNRTI-naive subjects were passaged in increasing concentrations of NVP in combination with 1 µM 3 TC and 2 µM ADV to assess selective pressures of multi-drug treatment. A novel parameter inference procedure, based on a stochastic viral growth model, was used to estimate phenotypic resistance and fitness from in vitro combination passage experiments.Newly developed mathematical methods estimated key phenotypic parameters of mutations arising through selective pressure exerted by 3 TC and NVP. Concentrations of 1 µM 3 TC maintained the M184V mutation, which was associated with intrinsic fitness deficits. Increasing NVP concentrations selected major NNRTI resistance mutations. The evolutionary pathway of NVP resistance was highly dependent on the viral genetic background, epistasis as well as stochasticity. Parameter estimation indicated that the previously unrecognized mutation L228Q was associated with NVP resistance in some isolates.Serial passage of viruses in the presence of multiple drugs may resemble the selection of mutations observed among treated individuals and populations in vivo and indicate evolutionary preferences and restrictions. Phenotypic resistance estimated here "in silico" from in vitro passage experiments agreed well with previous knowledge, suggesting that the unique combination of "wet-" and "dry-lab" experimentation may improve our understanding of HIV-1 resistance evolution in the future.

  18. Comparison of single and boosted protease inhibitor versus nonnucleoside reverse transcriptase inhibitor-containing cART regimens in antiretroviral-naïve patients starting cART after January 1, 2000

    DEFF Research Database (Denmark)

    Mocroft, A; Horban, A; Clumeck, N

    2006-01-01

    increase) response in antiretroviral-naïve patients starting either a single protease inhibitor (PI; n = 183), a ritonavir-boosted PI regimen (n = 197), or a nonnucleoside reverse transcriptase inhibitor (NNRTI)-based cART regimen (n = 447) after January 1, 2000, and the odds of lack of virologic...... or immunologic response at 3 years after starting cART. METHOD: Cox proportional hazards models and logistic regression. RESULTS: After adjustment, compared to patients taking an NNRTI-regimen, patients taking a single-PI regimen were significantly less likely to achieve a viral load (VL)

  19. Frequency of intron loss correlates with processed pseudogene abundance: a novel strategy to test the reverse transcriptase model of intron loss.

    Science.gov (United States)

    Zhu, Tao; Niu, Deng-Ke

    2013-03-05

    Although intron loss in evolution has been described, the mechanism involved is still unclear. Three models have been proposed, the reverse transcriptase (RT) model, genomic deletion model and double-strand-break repair model. The RT model, also termed mRNA-mediated intron loss, suggests that cDNA molecules reverse transcribed from spliced mRNA recombine with genomic DNA causing intron loss. Many studies have attempted to test this model based on its predictions, such as simultaneous loss of adjacent introns, 3'-side bias of intron loss, and germline expression of intron-lost genes. Evidence either supporting or opposing the model has been reported. The mechanism of intron loss proposed in the RT model shares the process of reverse transcription with the formation of processed pseudogenes. If the RT model is correct, genes that have produced more processed pseudogenes are more likely to undergo intron loss. In the present study, we observed that the frequency of intron loss is correlated with processed pseudogene abundance by analyzing a new dataset of intron loss obtained in mice and rats. Furthermore, we found that mRNA molecules of intron-lost genes are mostly translated on free cytoplasmic ribosomes, a feature shared by mRNA molecules of the parental genes of processed pseudogenes and long interspersed elements. This feature is likely convenient for intron-lost gene mRNA molecules to be reverse transcribed. Analyses of adjacent intron loss, 3'-side bias of intron loss, and germline expression of intron-lost genes also support the RT model. Compared with previous evidence, the correlation between the abundance of processed pseudogenes and intron loss frequency more directly supports the RT model of intron loss. Exploring such a correlation is a new strategy to test the RT model in organisms with abundant processed pseudogenes.

  20. Immunological responses during a virologically failing antiretroviral regimen are associated with in vivo synonymous mutation rates of HIV type-1 env

    DEFF Research Database (Denmark)

    Mens, Helene; Jørgensen, Louise Bruun; Kronborg, Gitte

    2009-01-01

    BACKGROUND: Little is known about the underlying causes of differences in immunological response to antiretroviral therapy during multidrug-resistant (MDR) HIV type-1 (HIV-1) infection. This study aimed to identify virological factors associated with immunological response during therapy failure...... for analysis. In a longitudinal mixed-effects model, plasma HIV-1 RNA only tended to predict immunological response (P=0.06), whereas minor protease inhibitor (PI) and nucleoside reverse transcriptase (NRTI) mutations at baseline correlated significantly with CD4+ T-cell count slopes (r= -0.56, P=0.04 and r......= -0.64, P=0.008, respectively). Interestingly, synonymous mutations of env correlated inversely with CD4+ T-cell count slopes (r=-0.60; P=0.01) and individuals with codons under positive selection had significantly better CD4+ T-cell responses than individuals without (0.42 versus -5.34; P=0...

  1. Autocatalytic caspase-3 driven by human telomerase reverse transcriptase promoter suppresses human ovarian carcinoma growth in vitro and in mice.

    Science.gov (United States)

    Song, Yue; Xia, Zhijun; Shen, Keng; Zhai, Xingyue

    2013-05-01

    To construct recombinant adenoviruses AdHT-rev-casp3 and Ad-rev-casp3, which express autocatalysis caspase-3 driven by human telomerase reverse transcriptase promoter and cytomegalovirus promoter, respectively; and to investigate their antitumor effects on ovarian cancer in vitro and in vivo. Cell viabilities were determined using the cell counting kit 8 and flow cytometry. Reverse transcriptase polymerase chain reaction and immunoblotting assays were used to detect cellular apoptotic activities after treatments. Tumor growth and survival of mice bearing AO cells were studied. AdHT-rev-casp3 significantly suppressed the survival of AO cells in a dose-dependent modality with a viability rate of 60.45% ± 7.8% at an multiplicity of infection (MOI) of 70 and 42.18 ± 5.3% at an MOI of 100, which was somewhat lower than that of the AO cells treated with Ad-rev-casp3 (32.28% ± 5.3% and 21.84% ± 3.4%, respectively). In contrast, AdHT-rev-casp3 induced little human umbilical vein epithelial cell (HUVEC) death with a viability rate of 98.52% ± 6.9% at an MOI of 70, whereas Ad-rev-casp3 induced significant cell death in HUVEC with a viability rate of 27.14% ± 5.4%. Additionally, AdHT-rev-casp3 (MOI = 70) caused significant apoptosis in AO cells with an apoptotic rate of 25.97%, whereas it caused undetectable apoptosis in HUVECs with the rate of only 1.75%. Ad-rev-casp3 (MOI = 70) caused strong apoptosis in both AO and HUVECs, with the rate of 35.82% and 38.12%, respectively. AdHT-rev-casp3 caused markedly higher levels of active caspase-3, causing no detectable active caspase-3 expression in HUVECs. The tumor growth suppression rate of AdHT-rev-casp3 was 54.94%, significantly higher than that of phosphate-buffered saline at the end point of the study. AdHT-rev-casp3 significantly improved the survival of mice receiving intraperitoneal inoculation of AO cells with little liver damage, with the mean survival of 177 ± 12 days. AdHT-rev-casp3 causes effective apoptosis

  2. Sentinel surveillance of HIV-1 transmitted drug resistance, acute infection and recent infection.

    Directory of Open Access Journals (Sweden)

    Hong-Ha M Truong

    Full Text Available HIV-1 acute infection, recent infection and transmitted drug resistance screening was integrated into voluntary HIV counseling and testing (VCT services to enhance the existing surveillance program in San Francisco. This study describes newly-diagnosed HIV cases and characterizes correlates associated with infection.A consecutive sample of persons presenting for HIV VCT at the municipal sexually transmitted infections (STI clinic from 2004 to 2006 (N = 9,868 were evaluated by standard enzyme-linked immunoassays (EIA. HIV antibody-positive specimens were characterized as recent infections using a less-sensitive EIA. HIV-RNA pooled testing was performed on HIV antibody-negative specimens to identify acute infections. HIV antibody-positive and acute infection specimens were evaluated for drug resistance by sequence analysis. Multivariable logistic regression was performed to evaluate associations. The 380 newly-diagnosed HIV cases included 29 acute infections, 128 recent infections, and 47 drug-resistant cases, with no significant increases or decreases in prevalence over the three years studied. HIV-1 transmitted drug resistance prevalence was 11.0% in 2004, 13.4% in 2005 and 14.9% in 2006 (p = 0.36. Resistance to non-nucleoside reverse transcriptase inhibitors (NNRTI was the most common pattern detected, present in 28 cases of resistance (59.6%. Among MSM, recent infection was associated with amphetamine use (AOR = 2.67; p<0.001, unprotected anal intercourse (AOR = 2.27; p<0.001, sex with a known HIV-infected partner (AOR = 1.64; p = 0.02, and history of gonorrhea (AOR = 1.62; p = 0.03.New HIV diagnoses, recent infections, acute infections and transmitted drug resistance prevalence remained stable between 2004 and 2006. Resistance to NNRTI comprised more than half of the drug-resistant cases, a worrisome finding given its role as the backbone of first-line antiretroviral therapy in San Francisco as well as worldwide. The integration of HIV-1 drug

  3. Telomerase Activation in Atherosclerosis and Induction of Telomerase Reverse Transcriptase Expression by Inflammatory Stimuli in Macrophages

    Science.gov (United States)

    Gizard, Florence; Heywood, Elizabeth B.; Findeisen, Hannes M.; Zhao, Yue; Jones, Karrie L.; Cudejko, Cèline; Post, Ginell R.; Staels, Bart; Bruemmer, Dennis

    2010-01-01

    Objective Telomerase serves as a critical regulator of tissue renewal. Although telomerase activity is inducible in response to various environmental cues, it remains unknown whether telomerase is activated during the inflammatory remodeling underlying atherosclerosis formation. To address this question, we investigated in the present study the regulation of telomerase in macrophages and during atherosclerosis development in LDL-receptor-deficient mice. Methods and Results We demonstrate that inflammatory stimuli activate telomerase in macrophages by inducing the expression of the catalytic subunit telomerase reverse transcriptase (TERT). Reporter and chromatin immunoprecipitation assays identified a previously unrecognized NF-κB response element in the TERT promoter, to which NF-κB is recruited during inflammation. Inhibition of NF-κB signaling completely abolished the induction of TERT expression, characterizing TERT as a bona fide NF-κB target gene. Furthermore, functional experiments revealed that TERT-deficiency results in a senescent cell phenotype. Finally, we demonstrate high levels of TERT expression in macrophages of human atherosclerotic lesions and establish that telomerase is activated during atherosclerosis development in LDL-receptor-deficient mice. Conclusion These results characterize TERT as a previously unrecognized NF-κB target gene in macrophages and demonstrate that telomerase is activated during atherosclerosis. This induction of TERT expression prevents macrophage senescence and may have important implications for the development of atherosclerosis. PMID:21106948

  4. Structure-Activity Analysis of Vinylogous Urea Inhibitors of Human Immunodeficiency Virus-Encoded Ribonuclease H ▿

    OpenAIRE

    Chung, Suhman; Wendeler, Michaela; Rausch, Jason W.; Beilhartz, Greg; Gotte, Matthias; O'Keefe, Barry R.; Bermingham, Alun; Beutler, John A.; Liu, Shixin; Zhuang, Xiaowei; Le Grice, Stuart F. J.

    2010-01-01

    Vinylogous ureas 2-amino-5,6,7,8-tetrahydro-4H-cyclohepta[b]thiophene-3-carboxamide and N-[3-(aminocarbonyl)-4,5-dimethyl-2-thienyl]-2-furancarboxamide (compounds 1 and 2, respectively) were recently identified to be modestly potent inhibitors of the RNase H activity of HIV-1 and HIV-2 reverse transcriptase (RT). Both compounds shared a 3-CONH2-substituted thiophene ring but were otherwise structurally unrelated, which prevented a precise definition of the pharmacophore. We have therefore exa...

  5. The Intelence aNd pRezista Once A Day Study (INROADS): a multicentre, single-arm, open-label study of etravirine and darunavir/ritonavir as dual therapy in HIV-1-infected early treatment-experienced subjects.

    Science.gov (United States)

    Ruane, P J; Brinson, C; Ramgopal, M; Ryan, R; Coate, B; Cho, M; Kakuda, T N; Anderson, D

    2015-05-01

    Following antiretroviral therapy failure, patients are often treated with a three-drug regimen that includes two nucleoside/tide reverse transcriptase inhibitors [N(t)RTIs]. An alternative two-drug nucleoside-sparing regimen may decrease the pill burden and drug toxicities associated with the use of N(t)RTIs. The Intelence aNd pRezista Once A Day Study (INROADS; NCT01199939) evaluated the nucleoside-sparing regimen of etravirine 400 mg with darunavir/ritonavir 800/100 mg once-daily in HIV-1-infected treatment-experienced subjects or treatment-naïve subjects with transmitted resistance. In this exploratory phase 2b, single-arm, open-label, multicentre, 48-week study, the primary endpoint was the proportion of subjects who achieved HIV-1 RNA treatment-experienced subjects or treatment-naïve subjects with transmitted resistance was virologically efficacious and well tolerated. © 2014 British HIV Association.

  6. An intravaginal ring that releases the NNRTI MIV-150 reduces SHIV transmission in macaques.

    Science.gov (United States)

    Singer, Rachel; Mawson, Paul; Derby, Nina; Rodriguez, Aixa; Kizima, Larisa; Menon, Radhika; Goldman, Daniel; Kenney, Jessica; Aravantinou, Meropi; Seidor, Samantha; Gettie, Agegnehu; Blanchard, James; Piatak, Michael; Lifson, Jeffrey D; Fernández-Romero, José A; Robbiani, Melissa; Zydowsky, Thomas M

    2012-09-05

    Microbicides may prevent HIV and sexually transmitted infections (STIs) in women; however, determining the optimal means of delivery of active pharmaceutical ingredients remains a major challenge. We previously demonstrated that a vaginal gel containing the non-nucleoside reverse transcriptase inhibitor MIV-150 partially protected macaques from SHIV-RT (simian/HIV reverse transcriptase) infection, and the addition of zinc acetate rendered the gel significantly protective. We test the activity of MIV-150 without the addition of zinc acetate when delivered from either ethylene vinyl acetate (EVA) or silicone intravaginal rings (IVRs). MIV-150 was successfully delivered, because it was detected in vaginal fluids and tissues by radioimmunoassay in pharmacokinetic studies. Moreover, EVA IVRs significantly protected macaques from SHIV-RT infection. Our results demonstrate that MIV-150-containing IVRs have the potential to prevent HIV infection and highlight the possible use of IVRs for delivering drugs that block HIV and other STIs.

  7. Compartmentalization of the gut viral reservoir in HIV-1 infected patients

    Directory of Open Access Journals (Sweden)

    Grant Tannika

    2007-12-01

    Full Text Available Abstract Background Recently there has been an increasing interest and appreciation for the gut as both a viral reservoir as well as an important host-pathogen interface in human immunodefiency virus type 1 (HIV-1 infection. The gut associated lymphoid tissue (GALT is the largest lymphoid organ infected by HIV-1. In this study we examined if different HIV-1 quasispecies are found in different parts of the gut of HIV-1 infected individuals. Results Gut biopsies (esophagus, stomach, duodenum and colorectum were obtained from eight HIV-1 infected preHAART (highly active antiretroviral therapy patients. HIV-1 Nef and Reverse transcriptase (RT encoding sequences were obtained through nested PCR amplification from DNA isolated from the gut biopsy tissues. The PCR fragments were cloned and sequenced. The resulting sequences were subjected to various phylogenetic analyses. Expression of the nef gene and viral RNA in the different gut tissues was determined using real-time RT-PCR. Phylogenetic analysis of the Nef protein-encoding region revealed compartmentalization of viral replication in the gut within patients. Viral diversity in both the Nef and RT encoding region varied in different parts of the gut. Moreover, increased nef gene expression (p Conclusion Our results indicated that different HIV-1 quasispecies populate different parts of the gut, and that viral replication in the gut is compartmentalized. These observations underscore the importance of the gut as a host-pathogen interface in HIV-1 infection.

  8. Selection and Characterization of Drug-Resistant Variants of Human Immunodeficiency Virus (AIDS).

    Science.gov (United States)

    1995-10-01

    on Antiviral Reserach, Santa Fe, New Mexico , 1995. Page 18 APPENDIX Page 19 p - FACTFILE Mutations in HIV-1 Reverse Transcriptase and Protease...including herpes simplex viruses, varicella -zoster Resistance of clinical HIV-1 isolates to foscarnet has not virus, cytomegalovirus (CMV), hepatitis B...This effect of the Tyr-208 substitution was not ob- reported previously for herpes simplex viruses, varicella -zoster served in MT-2 cells, however. virus

  9. The allosteric HIV-1 integrase inhibitor BI-D affects virion maturation but does not influence packaging of a functional RNA genome.

    Directory of Open Access Journals (Sweden)

    Nikki van Bel

    Full Text Available The viral integrase (IN is an essential protein for HIV-1 replication. IN inserts the viral dsDNA into the host chromosome, thereby aided by the cellular co-factor LEDGF/p75. Recently a new class of integrase inhibitors was described: allosteric IN inhibitors (ALLINIs. Although designed to interfere with the IN-LEDGF/p75 interaction to block HIV DNA integration during the early phase of HIV-1 replication, the major impact was surprisingly found on the process of virus maturation during the late phase, causing a reverse transcription defect upon infection of target cells. Virus particles produced in the presence of an ALLINI are misformed with the ribonucleoprotein located outside the virus core. Virus assembly and maturation are highly orchestrated and regulated processes in which several viral proteins and RNA molecules closely interact. It is therefore of interest to study whether ALLINIs have unpredicted pleiotropic effects on these RNA-related processes. We confirm that the ALLINI BI-D inhibits virus replication and that the produced virus is non-infectious. Furthermore, we show that the wild-type level of HIV-1 genomic RNA is packaged in virions and these genomes are in a dimeric state. The tRNAlys3 primer for reverse transcription was properly placed on this genomic RNA and could be extended ex vivo. In addition, the packaged reverse transcriptase enzyme was fully active when extracted from virions. As the RNA and enzyme components for reverse transcription are properly present in virions produced in the presence of BI-D, the inhibition of reverse transcription is likely to reflect the mislocalization of the components in the aberrant virus particle.

  10. The allosteric HIV-1 integrase inhibitor BI-D affects virion maturation but does not influence packaging of a functional RNA genome.

    Science.gov (United States)

    van Bel, Nikki; van der Velden, Yme; Bonnard, Damien; Le Rouzic, Erwann; Das, Atze T; Benarous, Richard; Berkhout, Ben

    2014-01-01

    The viral integrase (IN) is an essential protein for HIV-1 replication. IN inserts the viral dsDNA into the host chromosome, thereby aided by the cellular co-factor LEDGF/p75. Recently a new class of integrase inhibitors was described: allosteric IN inhibitors (ALLINIs). Although designed to interfere with the IN-LEDGF/p75 interaction to block HIV DNA integration during the early phase of HIV-1 replication, the major impact was surprisingly found on the process of virus maturation during the late phase, causing a reverse transcription defect upon infection of target cells. Virus particles produced in the presence of an ALLINI are misformed with the ribonucleoprotein located outside the virus core. Virus assembly and maturation are highly orchestrated and regulated processes in which several viral proteins and RNA molecules closely interact. It is therefore of interest to study whether ALLINIs have unpredicted pleiotropic effects on these RNA-related processes. We confirm that the ALLINI BI-D inhibits virus replication and that the produced virus is non-infectious. Furthermore, we show that the wild-type level of HIV-1 genomic RNA is packaged in virions and these genomes are in a dimeric state. The tRNAlys3 primer for reverse transcription was properly placed on this genomic RNA and could be extended ex vivo. In addition, the packaged reverse transcriptase enzyme was fully active when extracted from virions. As the RNA and enzyme components for reverse transcription are properly present in virions produced in the presence of BI-D, the inhibition of reverse transcription is likely to reflect the mislocalization of the components in the aberrant virus particle.

  11. HIV-1 Variants and Drug Resistance in Pregnant Women from Bata (Equatorial Guinea): 2012-2013.

    Science.gov (United States)

    Alvarez, Patricia; Fernández McPhee, Carolina; Prieto, Luis; Martín, Leticia; Obiang, Jacinta; Avedillo, Pedro; Vargas, Antonio; Rojo, Pablo; Benito, Agustín; Ramos, José Tomás; Holguín, África

    2016-01-01

    This is the first study describing drug resistance mutations (DRM) and HIV-1 variants among infected pregnant women in Equatorial Guinea (GQ), a country with high (6.2%) and increasing HIV prevalence. Dried blood spots (DBS) were collected from November 2012 to December 2013 from 69 HIV-1 infected women participating in a prevention of mother-to-child transmission program in the Hospital Regional of Bata and Primary Health Care Centre María Rafols, Bata, GQ. The transmitted (TDR) or acquired (ADR) antiretroviral drug resistance mutations at partial pol sequence among naive or antiretroviral therapy (ART)-exposed women were defined following WHO or IAS USA 2015 lists, respectively. HIV-1 variants were identified by phylogenetic analyses. A total of 38 of 69 HIV-1 specimens were successfully amplified and sequenced. Thirty (79%) belonged to ART-experienced women: 15 exposed to nucleoside reverse transcriptase inhibitors (NRTI) monotherapy, and 15 to combined ART (cART) as first regimen including two NRTI and one non-NRTI (NNRTI) or one protease inhibitor (PI). The TDR rate was only found for PI (3.4%). The ADR rate was 37.5% for NNRTI, 8.7% for NRTI and absent for PI or NRTI+NNRTI. HIV-1 group M non-B variants caused most (97.4%) infections, mainly (78.9%) recombinants: CRF02_AG (55.2%), CRF22_A101 (10.5%), subtype C (10.5%), unique recombinants (5.3%), and A3, D, F2, G, CRF06_cpx and CRF11_cpx (2.6% each). The high rate of ADR to retrotranscriptase inhibitors (mainly to NNRTIs) observed among pretreated pregnant women reinforces the importance of systematic DRM monitoring in GQ to reduce HIV-1 resistance transmission and to optimize first and second-line ART regimens when DRM are present.

  12. Designing robust control-based HIV-treatment

    Directory of Open Access Journals (Sweden)

    Fredy Andrés Olarte Dussán

    2008-05-01

    Full Text Available Designing a robust control-based treatment for human immunodeficiency virus (HIV-infected patients was studied. The dynamics of the immune system’s response to infection was modelled using a 5th order nonlinear model with separate efficacy coefficients for protease inhibitor (PIs and reverse transcriptase inhibitors (RTIs. The immune res-ponse has been represented as an uncertain system due to errors in parameter estimation and the existence of un-modelled dynamics. A polytopic system was constructed incorporating all possible system parameter values. A con-trol system was designed using robust pole location techniques stabilising the polytopic system around an equilibrium point having a low viral load. Numerical simulation results (including the organism’s pharmacokinetical response to anti-retroviral drugs showed that the control law could lead to long-term stable conditions, even in extreme cases.

  13. Finding Relational Associations in HIV Resistance Mutation Data

    Science.gov (United States)

    Richter, Lothar; Augustin, Regina; Kramer, Stefan

    HIV therapy optimization is a hard task due to rapidly evolving mutations leading to drug resistance. Over the past five years, several machine learning approaches have been developed for decision support, mostly to predict therapy failure from the genotypic sequence of viral proteins and additional factors. In this paper, we define a relational representation for an important part of the data, namely the sequences of a viral protein (reverse transcriptase), their mutations, and the drug resistance(s) associated with those mutations. The data were retrieved from the Los Alamos National Laboratories' (LANL) HIV databases. In contrast to existing work in this area, we do not aim directly for predictive modeling, but take one step back and apply descriptive mining methods to develop a better understanding of the correlations and associations between mutations and resistances. In our particular application, we use the Warmr algorithm to detect non-trivial patterns connecting mutations and resistances. Our findings suggest that well-known facts can be rediscovered, but also hint at the potential of discovering yet unknown associations.

  14. Development of dapivirine vaginal ring for HIV prevention.

    Science.gov (United States)

    Devlin, Bríd; Nuttall, Jeremy; Wilder, Susan; Woodsong, Cynthia; Rosenberg, Zeda

    2013-12-01

    In the continuing effort to develop effective HIV prevention methods for women, a vaginal ring containing the non-nucleoside reverse transcriptase inhibitor dapivirine is currently being tested in two safety and efficacy trials. This paper reviews dapivirine ring's pipeline development process, including efforts to determine safe and effective dosing levels as well as identify delivery platforms with the greatest likelihood of success for correct and consistent use. Dapivirine gel and other formulations were developed and tested in preclinical and clinical studies. Multiple vaginal ring prototypes were also tested, resulting in the current ring design as well as additional designs under consideration for future testing. Efficacy results from clinical trials are expected in 2015. Through ongoing consultations with national regulatory authorities, licensure requirements for dapivirine vaginal ring approval have been defined. This article is based on a presentation at the "Product Development Workshop 2013: HIV and Multipurpose Prevention Technologies," held in Arlington, Virginia on February 21-22, 2013. It forms part of a special supplement to Antiviral Research. Copyright © 2013 Elsevier B.V. All rights reserved.

  15. Safety and Efficacy of Atazanavir Powder and Ritonavir in HIV-1-Infected Infants and Children From 3 Months to The PRINCE-2 Study.

    Science.gov (United States)

    Cotton, Mark F; Liberty, Afaaf; Torres-Escobar, Indiana; Gonzalez-Tome, Maria Isabel; Lissens, Jurgen; Zaru, Luna; Klauck, Isabelle; Cambilargiu, Daniela; Pikora, Cheryl; Correll, Todd A

    2018-06-01

    Novel antiretroviral formulations that are palatable, safe, and effective are needed for infants and children. PRINCE-2 is an ongoing clinical trial assessing safety, efficacy, and palatability of once-daily atazanavir powder formulation boosted with ritonavir (ATV + RTV) plus optimized dual nucleos(t)ide reverse transcriptase inhibitors therapy in antiretroviral-naïve/experienced children with screening HIV-1 RNA ≥1000 copies/mL. Children 3 months to <11 years received ATV + RTV by 5 baseline weight bands: 5 to <10 kg = 150/80 mg; 5 to <10 kg = 200/80 mg; 10 to <15 kg = 200/80 mg; 15 to <25 kg = 250/80 mg; and 25 to <35 kg = 300/100 mg. Of 99 treated children, 83.8% and 59.6% remained on ATV powder until 24 and 48 weeks, respectively. Through 48 weeks, the most common adverse events were upper respiratory tract infections (33.3%), gastroenteritis (28.3%), vomiting (21.2%) and hyperbilirubinemia (18.2%; none leading to treatment discontinuation). Serious adverse events occurred in 20.2% of patients. Laboratory grade 3-4 hyperbilirubinemia occurred in 9.2% and elevated total/pancreatic amylase in 33.7%/3.1%. At week 24, proportions with virologic suppression (HIV-1 RNA <50 copies/mL; intention-to-treat analysis) across weight bands were 10/23 (43.5%), 2/12 (16.5%), 10/21 (47.6%), 19/35 (54.3%) and 5/8 (62.5%), respectively. Virologic suppression was similar in antiretroviral-naïve/experienced patients and lowest in the 5 to <10 kg = 200/80 mg group, likely because of higher baseline HIV-1 RNA and discontinuation (66.7%). Overall, virologic suppression at weeks 24 (46.5%) and 48 (43.0%) was comparable. At week 48, 83.3% and 74.1% of caregivers reported no trouble giving ATV powder and RTV, respectively. ATV powder palatability, efficacy and lack of unexpected safety findings support its use for HIV-1-infected children ≥3 months to <11 years.

  16. HDAC inhibition induces HIV-1 protein and enables immune-based clearance following latency reversal

    DEFF Research Database (Denmark)

    Wu, Guoxin; Swanson, Michael; Talla, Aarthi

    2017-01-01

    Promising therapeutic approaches for eradicating HIV include transcriptional activation of provirus from latently infected cells using latency-reversing agents (LRAs) and immune-mediated clearance to purge reservoirs. Accurate detection of cells capable of producing viral antigens and virions......, and the measurement of clearance of infected cells, is essential to assessing therapeutic efficacy. Here, we apply enhanced methodology extending the sensitivity limits for the rapid detection of subfemtomolar HIV gag p24 capsid protein in CD4+ T cells from ART-suppressed HIV+ individuals, and we show viral protein...... induction following treatment with LRAs. Importantly, we demonstrate that clinical administration of histone deacetylase inhibitors (HDACis; vorinostat and panobinostat) induced HIV gag p24, and ex vivo stimulation produced sufficient viral antigen to elicit immune-mediated cell killing using anti-gp120/CD3...

  17. Association of telomerase reverse transcriptase promoter mutations with clinicopathological features and prognosis of thyroid cancer: a meta-analysis

    Directory of Open Access Journals (Sweden)

    Su X

    2016-11-01

    Full Text Available Xingyun Su,1 Xiaoxia Jiang,1 Weibin Wang,1 Haiyong Wang,1 Xin Xu,2 Aihui Lin,1 Xiaodong Teng,3 Huiling Wu,4 Lisong Teng1 1Department of Surgical Oncology, 2Department of Medical Oncology, 3Department of Pathology, 4Department of Plastic Surgery, First Affiliated Hospital, School of Medicine, Zhejiang University, Hangzhou, Zhejiang, People’s Republic of China Abstract: The clinicopathological and prognostic significance of telomerase reverse transcriptase (TERT promoter mutations have been widely investigated in thyroid cancer; however, the results are still discrepant. Systematic searches were performed in PubMed, Web of Science, Scopus, Ovid, and the Cochran Library databases for relevant articles prior to April 2016. Mutation rates were synthesized by R statistical software. The odds ratio or standardized mean difference with 95% confidence interval was pooled by Stata. A total of 22 studies with 4,907 cases were included in this meta-analysis. TERT promoter mutations tended to present in aggressive histological types including poorly differentiated thyroid cancer (33.37%, anaplastic thyroid cancer (38.69%, and tall-cell variant papillary thyroid cancer (30.23%. These promoter mutations were likely to exist in older patients and males and were well associated with larger tumor size, extrathyroidal extension, vascular invasion, lymph node metastasis, distant metastasis, advanced tumor stage, disease recurrence/persistence, and mortality. In addition, TERT promoter mutations (especially C228T tended to coexist with BRAFV600E mutation, which indicated more aggressive tumor behavior. Therefore, TERT promoter mutations may be promising biomarkers for early diagnosis, risk stratification, prognostic prediction, and management of thyroid cancer. Keywords: TERT promoter mutations, thyroid cancer, clinicopathological features, prognosis, BRAFV600E mutation

  18. IL-10 mediated by herpes simplex virus vector reduces neuropathic pain induced by HIV gp120 combined with ddC in rats.

    Science.gov (United States)

    Zheng, Wenwen; Huang, Wan; Liu, Shue; Levitt, Roy C; Candiotti, Keith A; Lubarsky, David A; Hao, Shuanglin

    2014-07-30

    HIV-associated sensory neuropathy affects over 50% of HIV patients and is a common peripheral nerve complication of HIV infection and highly active antiretroviral therapy (HAART). Evidence shows that painful HIV sensory neuropathy is influenced by neuroinflammatory events that include the proinflammatory molecules, MAP Kinase, tumor necrosis factor-α (TNFα), stromal cell-derived factor 1-α (SDF1α), and C-X-C chemokine receptor type 4 (CXCR4). However, the exact mechanisms of painful HIV sensory neuropathy are not known, which hinders our ability to develop effective treatments. In this study, we investigated whether inhibition of proinflammatory factors reduces the HIV-associated neuropathic pain state. Neuropathic pain was induced by peripheral HIV coat protein gp120 combined with 2',3'-dideoxycytidine (ddC, one of the nucleoside reverse transcriptase inhibitors (NRTIs)). Mechanical threshold was tested using von Frey filament fibers. Non-replicating herpes simplex virus (HSV) vectors expressing interleukin 10 (IL10) were inoculated into the hindpaws of rats. The expression of TNFα, SDF1α, and CXCR4 in the lumbar spinal cord and L4/5 dorsal root ganglia (DRG) was examined using western blots. IL-10 expression mediated by the HSV vectors resulted in a significant elevation of mechanical threshold. The anti-allodynic effect of IL-10 expression mediated by the HSV vectors lasted more than 3 weeks. The area under the effect-time curves (AUC) in mechanical threshold in rats inoculated with the HSV vectors expressing IL-10, was increased compared with the control vectors, indicating antinociceptive effect of the IL-10 vectors. The HSV vectors expressing IL-10 also concomitantly reversed the upregulation of p-p38, TNFα, SDF1α, and CXCR4 induced by gp120 in the lumbar spinal dorsal horn and/or the DRG at 2 and/or 4 weeks. The blocking of the signaling of these proinflammatory molecules is able to reduce HIV-related neuropathic pain, which provide a novel

  19. Population-based surveillance of HIV drug resistance emerging on treatment and associated factors at sentinel antiretroviral therapy sites in Namibia.

    Science.gov (United States)

    Hong, Steven Y; Jonas, Anna; DeKlerk, Michael; Shiningavamwe, Andreas; Desta, Tiruneh; Badi, Alfons; Morris, Lynn; Hunt, Gillian M; Ledwaba, Johanna; Sheehan, Heidi B; Lau, Kiger; Trotter, Andrew; Tang, Alice M; Wanke, Christine; Jordan, Michael R

    2015-04-01

    The World Health Organization (WHO) prospective surveys of acquired HIV drug resistance (HIVDR) evaluate HIVDR emerging after the first year of antiretroviral therapy (ART) and associated factors. Consecutive ART starters in 2009 were enrolled at 3 sentinel sites in Namibia. Genotyping was performed at start and after 12 months in patients with HIV viral load (VL) >1000 copies per mL. HIVDR outcomes were: HIVDR prevention (VL ≤1000 copies/mL), possible HIVDR (VL >1000 copies/mL without detectable HIVDR or loss to follow-up or ART stop), and HIVDR (VL >1000 copies/mL with detectable HIVDR). Adherence was assessed using medication possession ratio (MPR). Of 394 starters, at 12 months, 80% were on first-line ART, 1% died, 4% transferred out, 1% stopped ART, <1% switched to second-line, and 15% were lost to follow-up. Among patients on first-line, 77% had VL testing, and 94% achieved VL ≤1000 copies per mL. At baseline, 7% had HIVDR. After 12 months, among patients with VL testing, 5% had HIVDR. A majority of patients failing therapy had high-level resistance to nonnucleoside reverse transcriptase inhibitors but none to protease inhibitors. All sites achieved the WHO target of ≥70% HIVDR prevention. Factors associated with not achieving HIVDR prevention were: baseline resistance to nonnucleoside reverse transcriptase inhibitors [odds ratio (OR) 3.0, P = 0.023], WHO stage 3 or 4 at baseline (OR 2.0, P = 0.012), and MPR <75% (OR 4.9, P = 0.021). Earlier ART initiation and removal of barriers to on-time drug pickups may help to prevent HIVDR. These data inform decisions at national and global levels on the effectiveness of first- and second-line regimens.

  20. Adenosine 3',5'-cyclic monophosphate (cAMP)-dependent phosphoregulation of mitochondrial complex I is inhibited by nucleoside reverse transcriptase inhibitors

    International Nuclear Information System (INIS)

    Lund, Kaleb C.; Wallace, Kendall B.

    2008-01-01

    Nucleoside analog reverse transcriptase inhibitors (NRTIs) are known to directly inhibit mitochondrial complex I activity as well as various mitochondrial kinases. Recent observations that complex I activity and superoxide production are modulated through cAMP-dependent phosphorylation suggests a mechanism through which NRTIs may affect mitochondrial respiration via kinase-dependent protein phosphorylation. In the current study, we examine the potential for NRTIs to inhibit the cAMP-dependent phosphorylation of complex I and the associated NADH:CoQ oxidoreductase activities and rates of superoxide production using HepG2 cells. Phosphoprotein staining of immunocaptured complex I revealed that 3'-azido-3'-deoxythymidine (AZT; 10 and 50 μM), AZT monophosphate (150 μM), and 2',3'-dideoxycytidine (ddC; 1 μM) prevented the phosphorylation of the NDUFB11 subunit of complex I. This was associated with a decrease in complex I activity with AZT and AZT monophosphate only. In the presence of succinate, superoxide production was increased with 2',3'-dideoxyinosine (ddI; 10 μM) and ddC (1 μM). In the presence of succinate + cAMP, AZT showed an inverse dose-dependent effect on superoxide production. None of the NRTIs examined inhibit PKA activity suggesting that the observed effects are due to a direct interaction with complex I. These data demonstrate a direct effect of NRTIs on cAMP-dependent regulation of mitochondrial bioenergetics independent of DNA polymerase-γ activity; in the case of AZT, these observations may provide a mechanism for the observed long-term toxicity with this drug

  1. Prevalence, awareness, treatment, and control rate of hypertension in HIV-infected patients: the HIV-HY study.

    Science.gov (United States)

    De Socio, Giuseppe Vittorio; Ricci, Elena; Maggi, Paolo; Parruti, Giustino; Pucci, Giacomo; Di Biagio, Antonio; Calza, Leonardo; Orofino, Giancarlo; Carenzi, Laura; Cecchini, Enisia; Madeddu, Giordano; Quirino, Tiziana; Schillaci, Giuseppe

    2014-02-01

    We aimed to assess the prevalence of hypertension in an unselected human immunodeficiency virus (HIV)-infected population and to identify factors associated with hypertension prevalence, treatment, and control. We used a multicenter, cross-sectional, nationwide study that sampled 1,182 unselected, consecutive, HIV-infected patients. Office blood pressure was accurately measured with standard procedures. Patients were 71% men and 92% white, with a median age of 47 years (range = 18-78); 6% were antiretroviral treatment naive. The overall prevalence of hypertension was 29.3%; high-normal pressure accounted for an additional 12.3%. Among hypertensive subjects, 64.9% were aware of their hypertensive condition, 52.9% were treated, and 33.0% were controlled (blood pressure < 140/90 mm Hg). Blood pressure-lowering medications were used in monotherapy in 54.3% of the subjects. Angiotensin-converting enzyme inhibitors and angiotensin receptor blockers were the most frequently used drugs (76.1%: monotherapy = 39.1%, combination treatment = 37.0%). In multivariable regression models, hypertension was independently predicted by traditional risk factors, including age ≥50 years, male sex, family history of cardiovascular disease, body mass index ≥25 kg/m2, previous cardiovascular events, diabetes, central obesity, and metabolic syndrome, as well as by duration of HIV infection, duration of antiretroviral therapy, and nadir CD4+ T-cell count <200/μl. The choice of protease inhibitors vs. nonnucleoside reverse transcriptase inhibitors as a third antiretroviral drug was irrelevant. Hypertension affects nearly 30% of HIV adult outpatients in Italy. More than one-third of the hypertensive subjects are unaware of their condition, and more than two-thirds are uncontrolled. A higher level of attention to the diagnosis and treatment of hypertension is mandatory in this setting.

  2. A novel peptide-nucleotide dual vaccine of human telomerase reverse transcriptase induces a potent cytotoxic T-cell response in vivo

    International Nuclear Information System (INIS)

    Guo, Hong; Hao, Jia; Wu, Chao; Shi, Yun; Zhao, Xiao-yan; Fang, Dian-chun

    2007-01-01

    Human telomerase reverse transcriptase (hTERT) is highly expressed in over 85% of human cancers, which makes it a broadly applicable molecular target for cancer therapy. Several groups have demonstrated that hTERT can efficiently evoke specific cytotoxic T lymphocytes (CTL) responses for malignant tumors. In the present study, we developed a novel virus-like particulate peptide-nucleotide dual vaccine (PNDV) of hTERT, which was composed of a low-affinity epitope variant with encoding full-length gene in the same virus-size particulate. We verified the formation of PNDV by DNA retarding assay, DNase I protection assay and transmission electron microscopy, and confirmed its immunogenicity and transfection activities in mammalian cells. Furthermore, in vivo immunization of HLA-A2.1 transgenic mice generated efficient IFN-γ secretion and hTERT-specific CTLs which are known to cause selective cell death of telomerase positive gastrointestinal cancer cells. To our knowledge, this represents the first report on collocating a low-affinity epitope variant with a full-length hTERT gene for anti-cancer vaccine design. This novel strategy for vaccine design not only enables enhanced immunity to a universal tumor antigen, but also has the potential to generate CTLs effective in telomerase-positive tumor cells of diverse tissue origins. Therefore, our findings bear significant implications for immunotherapy of human cancers

  3. Comparison of glycerolisation with cryopreservation methods on HIV-1 inactivation

    International Nuclear Information System (INIS)

    Van Baare, J.; Pagnon, J.; Cameron, P.; Vardaxis, N.; Middlekoop, E.; Crowe, S.

    1999-01-01

    Cryopreservation and glycerolisation are two successful long-term preservation methods for human cadaveric donor skin, which is used in the treatment of bum patients. High concentrations of glycerol has been shown to be antibacterial and virucidal. Because fear of possible transmission of HIV-1 following allograft transplantation, this study was undertaken to investigate whether HIV can be effectively eliminated from skin explants. HIV-1 Ba-L, which has been shown to infect monocytes in skin explants and also dendritic cells, was. For the experiments we used cell-free virus, exogenously HIV infected peripheral blood mononuclear cells (PBMCs) and exogenously HIV infected cadaver split skin. Different concentrations of glycerol at various temperatures and the glycerolisation procedure as used by the Euro Skin Bank were used to determine the effects on HIV-1 Ba-L infectivity. For the cryopreservation technique we used 10% DMSO and a controlled rate freezer. HIV-1 Ba-L transfer was determined by adding uninfected PBMCs to the infected material and reverse transcriptase was measured. Cell-free HIV-1 Ba-L was not inactivated by 50% glycerol but was effectively inactivated within 30 minutes by 70% and 85% glycerol at 4 degree C, room temperature and 37 degree C. In contrast, cell-free HIV-1 Ba-L was not inactivated by cryopreservation. Most importantly, we have shown that HIV-1 Ba-L present in split skin is inactivated by incubating skin in 70% glycerol for three hours at 37-C. HIV in exogenously infected skin was not inactivated by cryopreservation. High concentrations of glycerol effectively inactivates free HIV-1 Ba-L and intracellular HIV-1 Ba-L. Also the current glycerolisation procedure carried out by the Euro Skin Bank effectively inactivates infectious virus. However, the cryopreservation technique did not show any reduction in HIV-1 Ba-L infectivity

  4. Suppression of APOBEC3-mediated restriction of HIV-1 by Vif

    Directory of Open Access Journals (Sweden)

    Yuqing eFeng

    2014-08-01

    Full Text Available The APOBEC3 restriction factors are a family of deoxycytidine deaminases that are able to suppress replication of viruses with a single-stranded DNA intermediate by inducing mutagenesis and functional inactivation of the virus. Of the seven human APOBEC3 enzymes, only APOBEC3-D, -F, -G, and -H appear relevant to restriction of HIV-1 in CD4+ T cells and will be the focus of this review. The restriction of HIV-1 occurs most potently in the absence of HIV-1 Vif that induces polyubiquitination and degradation of APOBEC3 enzymes through the proteasome pathway. To restrict HIV-1, APOBEC3 enzymes must be encapsidated into budding virions. Upon infection of the target cell during reverse transcription of the HIV-1 RNA into (-DNA APOBEC3 enzymes deaminate cytosines to forms uracils in single-stranded (- DNA regions. Upon replication of the (-DNA to (+DNA, the HIV-1 reverse transcriptase incorporates adenines opposite the uracils thereby inducing C/G to T/A mutations that can functionally inactivate HIV-1. APOBEC3G is the most studied APOBEC3 enzyme and it is known that Vif attempts to thwart APOBEC3 function not only by inducing its proteasomal degradation but by several degradation-independent mechanisms such as inhibiting APOBEC3G virion encapsidation, mRNA translation, and for those APOBEC3G molecules that still become virion encapsidated, Vif can inhibit APOBEC3G mutagenic activity. Although most Vif variants can induce efficient degradation of APOBEC3-D, -F, and -G, there appears to be differential sensitivity to Vif-mediated degradation for APOBEC3H. This review examines APOBEC3-mediated HIV restriction mechanisms, how Vif acts as a substrate receptor for a Cullin5 ubiquitin ligase complex to induce degradation of APOBEC3s, and the determinants and functional consequences of the APOBEC3 and Vif interaction from a biological and biochemical perspective.

  5. Trade-off between synergy and efficacy in combinations of HIV-1 latency-reversing agents.

    Science.gov (United States)

    Gupta, Vipul; Dixit, Narendra M

    2018-02-01

    Eradicating HIV-1 infection is difficult because of the reservoir of latently infected cells that gets established soon after infection, remains hidden from antiretroviral drugs and host immune responses, and retains the capacity to reignite infection following the cessation of treatment. Drugs called latency-reversing agents (LRAs) are being developed to reactivate latently infected cells and render them susceptible to viral cytopathicity or immune killing. Whereas individual LRAs have failed to induce adequate reactivation, pairs of LRAs have been identified recently that act synergistically and hugely increase reactivation levels compared to individual LRAs. The maximum synergy achievable with LRA pairs is of clinical importance, as it would allow latency-reversal with minimal drug exposure. Here, we employed stochastic simulations of HIV-1 transcription and translation in latently infected cells to estimate this maximum synergy. We incorporated the predominant mechanisms of action of the two most promising classes of LRAs, namely, protein kinase C agonists and histone deacetylase inhibitors, and quantified the activity of individual LRAs in the two classes by mapping our simulations to corresponding in vitro experiments. Without any adjustable parameters, our simulations then quantitatively captured experimental observations of latency-reversal when the LRAs were used in pairs. Performing simulations representing a wide range of drug concentrations, we estimated the maximum synergy achievable with these LRA pairs. Importantly, we found with all the LRA pairs we considered that concentrations yielding the maximum synergy did not yield the maximum latency-reversal. Increasing concentrations to increase latency-reversal compromised synergy, unravelling a trade-off between synergy and efficacy in LRA combinations. The maximum synergy realizable with LRA pairs would thus be restricted by the desired level of latency-reversal, a constrained optimum we elucidated with

  6. MicroRNA Regulation of Telomerase Reverse Transcriptase (TERT: Micro Machines Pull Strings of Papier-Mâché Puppets

    Directory of Open Access Journals (Sweden)

    Ammad Ahmad Farooqi

    2018-04-01

    Full Text Available Substantial fraction of high-quality information is continuously being added into the existing pool of knowledge related to the biology of telomeres. Based on the insights gleaned from decades of research, it is clear that chromosomal stability needs a highly controlled and dynamic balance of DNA gain and loss in each terminal tract of telomeric repeats. Telomeres are formed by tandem repeats of TTAGGG sequences, which are gradually lost with each round of division of the cells. Targeted inhibition of telomerase to effectively induce apoptosis in cancer cells has attracted tremendous attention and overwhelmingly increasingly list of telomerase inhibitors truthfully advocates pharmacological significance of telomerase. Telomerase reverse transcriptase (TERT is a multi-talented and catalytically active component of the telomerase-associated protein machinery. Different proteins of telomerase-associated machinery work in a synchronized and orchestrated manner to ensure proper maintenance of telomeric length of chromosomes. Rapidly emerging scientific findings about regulation of TERT by microRNAs has revolutionized our understanding related to the biology of telomeres and telomerase. In this review, we have comprehensively discussed how different miRNAs regulate TERT in different cancers. Use of miRNA-based therapeutics against TERT in different cancers needs detailed research in preclinical models for effective translation of laboratory findings to clinically effective therapeutics.

  7. The safety and pharmacokinetics of a reverse transcriptase inhibitor, 3TC, in patients with HIV infection: a phase I study

    NARCIS (Netherlands)

    van Leeuwen, R.; Lange, J. M.; Hussey, E. K.; Donn, K. H.; Hall, S. T.; Harker, A. J.; Jonker, P.; Danner, S. A.

    1992-01-01

    To determine the safety and pharmacokinetics of the nucleoside analogue, 3TC. A Phase I, open-label, single-centre study. Twenty asymptomatic, HIV-infected male patients with CD4 lymphocyte counts < 500 x 10(6)/l who had not received previous antiretroviral therapy completed the study. Each patient

  8. Maintenance of differentiation potential of human bone marrow mesenchymal stem cells immortalized by human telomerase reverse transcriptase gene despite of extensive proliferation

    International Nuclear Information System (INIS)

    Abdallah, Basem M.; Haack-Sorensen, Mandana; Burns, Jorge S.; Elsnab, Birgitte; Jakob, Franz; Hokland, Peter; Kassem, Moustapha

    2005-01-01

    Human bone marrow mesenchymal stem cells (hMSC) represent a population of stem cells that are capable of differentiation into multiple lineages. However, these cells exhibit senescence-associated growth arrest and phenotypic changes during long-term in vitro culture. We have recently demonstrated that overexpression of human telomerase reverse transcriptase (hTERT) in hMSC reconstitutes telomerase activity and extends life span of the cells [Nat. Biotechnol. 20 (2002) 592]. In the present study, we have performed extensive characterization of three independent cell lines derived from the parental hMSC-TERT cell line based on different plating densities during expansion in culture: 1:2 (hMSC-TERT2), 1:4 (hMSC-TERT4), and 1:20 (hMSC-TERT20). The 3 cell lines exhibited differences in morphology and growth rates but they all maintained the characteristics of self-renewing stem cells and the ability to differentiate into multiple mesoderm-type cell lineages: osteoblasts, adipocytes, chondrocytes, and endothelial-like cells over a 3-year period in culture. Also, surface marker studies using flow cytometry showed a pattern similar to that known from normal hMSC. Thus, telomerization of hMSC by hTERT overexpression maintains the stem cell phenotype of hMSC and it may be a useful tool for obtaining enough number of cells with a stable phenotype for mechanistic studies of cell differentiation and for tissue engineering protocols

  9. Targeted Transgenic Overexpression of Mitochondrial Thymidine Kinase (TK2) Alters Mitochondrial DNA (mtDNA) and Mitochondrial Polypeptide Abundance : Transgenic TK2, mtDNA, and Antiretrovirals

    OpenAIRE

    Hosseini, Seyed H.; Kohler, James J.; Haase, Chad P.; Tioleco, Nina; Stuart, Tami; Keebaugh, Erin; Ludaway, Tomika; Russ, Rodney; Green, Elgin; Long, Robert; Wang, Liya; Eriksson, Staffan; Lewis, William

    2007-01-01

    Mitochondrial toxicity limits nucleoside reverse transcriptase inhibitors (NRTIs) for acquired immune deficiency syndrome. NRTI triphosphates, the active moieties, inhibit human immunodeficiency virus reverse transcriptase and eukaryotic mitochondrial DNA polymerase pol-γ. NRTI phosphorylation seems to correlate with mitochondrial toxicity, but experimental evidence is lacking. Transgenic mice (TGs) with cardiac overexpression of thymidine kinase isoforms (mitochondrial TK2 and cytoplasmic TK...

  10. Development of elvitegravir resistance and linkage of integrase inhibitor mutations with protease and reverse transcriptase resistance mutations.

    Directory of Open Access Journals (Sweden)

    Mark A Winters

    Full Text Available Failure of antiretroviral regimens containing elvitegravir (EVG and raltegravir (RAL can result in the appearance of integrase inhibitor (INI drug-resistance mutations (DRMs. While several INI DRMs have been identified, the evolution of EVG DRMs and the linkage of these DRMs with protease inhibitor (PI and reverse transcriptase inhibitor (RTI DRMs have not been studied at the clonal level. We examined the development of INI DRMs in 10 patients failing EVG-containing regimens over time, and the linkage of INI DRMs with PI and RTI DRMs in these patients plus 6 RAL-treated patients. A one-step RT-nested PCR protocol was used to generate a 2.7 kB amplicon that included the PR, RT, and IN coding region, and standard cloning and sequencing techniques were used to determine DRMs in 1,277 clones (mean 21 clones per time point. Results showed all patients had multiple PI, NRTI, and/or NNRTI DRMs at baseline, but no primary INI DRM. EVG-treated patients developed from 2 to 6 strains with different primary INI DRMs as early as 2 weeks after initiation of treatment, predominantly as single mutations. The prevalence of these strains fluctuated and new strains, and/or strains with new combinations of INI DRMs, developed over time. Final failure samples (weeks 14 to 48 typically showed a dominant strain with multiple mutations or N155H alone. Single N155H or multiple mutations were also observed in RAL-treated patients at virologic failure. All patient strains showed evidence of INI DRM co-located with single or multiple PI and/or RTI DRMs on the same viral strand. Our study shows that EVG treatment can select for a number of distinct INI-resistant strains whose prevalence fluctuates over time. Continued appearance of new INI DRMs after initial INI failure suggests a potent, highly dynamic selection of INI resistant strains that is unaffected by co-location with PI and RTI DRMs.

  11. Expression of dopamine receptors in the subthalamic nucleus of the rat: characterization using reverse transcriptase-polymerase chain reaction and autoradiography

    International Nuclear Information System (INIS)

    Flores, G.; Liang, J.J.; Sierra, A.; Martinez-Fong, D.; Quirion, R.; Aceves, J.; Srivastava, L.K.

    1999-01-01

    We analysed the expression of dopamine receptor subtypes in the subthalamic nucleus by means of reverse transcriptase-polymerase chain reaction. We also studied, using autoradiography, all pharmacologically characterized dopamine receptors in four subregions of the subthalamic nucleus. For comparison, dopamine receptor subtypes were also evaluated in brain regions where they are more abundant and well characterized. The radioligands used were: [ 3 H]SCH-23390, [ 3 H]emonapride and [ 3 H]2-dipropylamino-7-hydroxy-1,2,3,4-tetrahydronaphthalene for dopamine D 1 , D 2 and D 3 receptors, respectively; and [ 3 H]YM-09151-2 in the presence of raclopride for dopamine D 4 receptors. Finally, we also evaluated the effect of unilateral 6-hydroxydopamine injection into the medial forebrain bundle on dopamine receptor levels expressed in the ipsilateral subthalamic nucleus. The lesion was estimated by decrease in the binding of [ 3 H]WIN-35428, a specific dopamine transporter label. D 1 , D 2 and D 3 receptor messenger RNAs and binding sites were present in the subthalamic nucleus, but no messenger RNA for D 4 receptors was found, although specific binding sites for these receptors were observed. As compared to the intact side, the 6-hydroxydopamine lesion did not change D 1 receptors, increased D 2 receptors, and decreased D 3 receptors and the dopamine transporter. The results suggest that postsynaptic D 1 , D 2 or D 3 receptors can mediate the effect of dopamine on subthalamic nucleus neuronal activity. D 4 receptors would mediate exclusively presynaptic effects.These results reinforce the idea that dopamine receptors in the subthalamic nucleus may play an important role in the physiology of the basal ganglia and in the pathophysiology of Parkinson's disease. (Copyright (c) 1999 Elsevier Science B.V., Amsterdam. All rights reserved.)

  12. In Vitro Transduction and Target-Mutagenesis Efficiency of HIV-1 pol Gene Targeting ZFN and CRISPR/Cas9 Delivered by Various Plasmids and/or Vectors: Toward an HIV Cure.

    Science.gov (United States)

    Okee, Moses; Bayiyana, Alice; Musubika, Carol; Joloba, Moses L; Ashaba-Katabazi, Fred; Bagaya, Bernard; Wayengera, Misaki

    2018-01-01

    Efficiency of artificial restriction enzymes toward curing HIV has only been separately examined, using differing delivery vehicles. We compared the in vitro transduction and target-mutagenesis efficiency of consortium plasmid and adenoviral vector delivered HIV-1 pol gene targeting zinc finger nuclease (ZFN) with CRISPR/Cas, Custom-ZFN, CRISPR-Cas-9, and plasmids and vectors (murCTSD_pZFN, pGS-U-gRNA, pCMV-Cas-D01A, Ad5-RGD); cell lines (TZM-bl and ACH-2/J-Lat cells); and the latency reversing agents prostratin, suberoylanilide hydroxamic acid, and phorbol myristate acetate. Cell lines were grown in either Dulbecco's modified Eagle's medium or Roswell Park Memorial Institute with the antibiotics kanamycin, zeocin, and efavirenz. Efficiency was assayed by GFP/luciferase activity and/or validated by yeast MEL1 reporter assay, CEL1 restriction fragment assay, and quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR). Ad5-RGD vectors had better transduction efficiency than murCTSD and pGS-U-gRNA/pCMV-Cas-D01A plasmids. CRISPR/Cas9 exhibited better target-mutagenesis efficiency relative to ZFN (delivered by either plasmid or Ad5 vector) based on gel electrophoresis of pol gene amplicons within ACH-2 and J-Lat cells. Ad-5-RGD vectors enhanced target mutagenesis of ZFN, relative to murCTSD_pZFN plasmids, to levels of CRISPR/Cas9 plasmids. Similar reduction of luciferase activity among TZM-bl treated with Ad5-ZFN vectors relative to CRISPR/Cas-9 and murCTSD_pZFN plasmids was observed on challenge with HIV-1. qRT-PCR of HIV-1 pol gene transcripts affirmed that Ad5 (RGD) vectors enhanced target mutagenesis of ZFN. Whereas CRISPR/Cas-9 may possess inherent superior target-mutagenesis efficiency; the efficiency of ZFN (off-target toxicity withstanding) can be enhanced by altering delivery vehicle from plasmid to Ad5 (RGD) vectors.

  13. TMC125 exerts similar initial antiviral potency as a five-drug, triple class antiretroviral regimen

    NARCIS (Netherlands)

    Sankatsing, Sanjay U. C.; Weverling, Gerrit J.; Peeters, Monika; van't Klooster, Gerben; Gruzdev, Boris; Rakhmanova, Aza; Danner, Sven A.; Jurriaans, Suzanne; Prins, Jan M.; Lange, Joep M. A.

    2003-01-01

    Objective: TMC125, a next generation, non-nucleoside reverse transcriptase inhibitor (NNRTI), demonstrated a remarkable decline of plasma HIV-1 RNA during a phase IIa study. We compared the initial rate of decline of plasma HIV-1 RNA achieved by TMC125 monotherapy with that of a triple class,

  14. Compounds acting against HIV: Imidazo[1,2-a]pyridines as non-nucleoside reverse transcriptase inhibitors (NNRTIs)

    CSIR Research Space (South Africa)

    Bode, M

    2010-09-01

    Full Text Available .6 µM N N NH Cl Res Act = 3% IC50 = 2 µM MAGI IC50 = 0.2 µM N N NH Cl Res Act = 5% IC50 = 3.5 µM MAGI IC50 = 0.18 µM N N NH Cl Res Act = 13% IC50 = 8 µM MAGI IC50 = 0.6 µM N N NH Cl Cl Res Act = 4% IC50 = 1.5 µM MAGI IC50... 2010 www.csir.co.za N N NH N N NH Cl N N NH Cl CN IC50= 4.4 uM (RT) IC50= 0.16 uM (PBMC) IC50= 0.41 uM (MAGI) cf . Nevirapine IC50=0.67 uM (RT) IC50=0.033 uM (PBMC) IC50= 29 uM (RT) IC50= 41 uM (PBMC) cf...

  15. A Critical Subset Model Provides a Conceptual Basis for the High Antiviral Activity of Major HIV Drugs**

    Science.gov (United States)

    Shen, Lin; Rabi, S. Alireza; Sedaghat, Ahmad R.; Shan, Liang; Lai, Jun; Xing, Sifei; Siliciano, Robert F.

    2012-01-01

    Control of HIV-1 replication was first achieved with regimens that included a nonnucleoside reverse transcriptase inhibitor (NNRTI) or a protease inhibitor (PI); however, an explanation for the high antiviral activity of these drugs has been lacking. Indeed, conventional pharmacodynamic measures like IC50 (drug concentration causing 50% inhibition) do not differentiate NNRTIs and PIs from less active nucleoside reverse transcriptase inhibitors (NRTIs). Drug inhibitory potential depends on the slope of the dose-response curve (m), which represents how inhibition increases as a function of increasing drug concentration and is related to the Hill coefficient, a measure of intramolecular cooperativity in ligand binding to a multivalent receptor. Although NNRTIs and PIs bind univalent targets, they unexpectedly exhibit cooperative dose-response curves (m > 1). We show that this cooperative inhibition can be explained by a model in which infectivity requires participation of multiple copies of a drug target in an individual life cycle stage. A critical subset of these target molecules must be in the unbound state. Consistent with experimental observations, this model predicts m > 1 for NNRTIs and PIs and m = 1 in situations where a single drug target/virus mediates a step in the life cycle, as is the case with NRTIs and integrase strand transfer inhibitors. This model was tested experimentally by modulating the number of functional drug targets per virus, and dose-response curves for modulated virus populations fit model predictions. This model explains the high antiviral activity of two drug classes important for successful HIV-1 treatment and defines a characteristic of good targets for antiviral drugs in general, namely, intermolecular cooperativity. PMID:21753122

  16. Role of seminal plasma in the anti-HIV-1 activity of candidate microbicides

    Directory of Open Access Journals (Sweden)

    Li Yun-Yao

    2006-10-01

    Full Text Available Abstract Background Evaluation of microbicides for prevention of HIV-1 infection in macaque models for vaginal infection has indicated that the concentrations of active compounds needed for protection by far exceed levels sufficient for complete inhibition of infection in vitro. These experiments were done in the absence of seminal plasma (SP, a vehicle for sexual transmission of the virus. To gain insight into the possible effect of SP on the performance of selected microbicides, their anti-HIV-1 activity in the presence, and absence of SP, was determined. Methods The inhibitory activity of compounds against the X4 virus, HIV-1 IIIB, and the R5 virus, HIV-1 BaL was determined using TZM-bl indicator cells and quantitated by measuring β-galactosidase induced by infection. The virucidal properties of cellulose acetate 1,2-benzene-dicarboxylate (CAP, the only microbicide provided in water insoluble, micronized form, in the presence of SP was measured. Results The HIV-1 inhibitory activity of the polymeric microbicides, poly(naphthalene sulfonate, cellulose sulfate, carrageenan, CAP (in soluble form and polystyrene sulfonate, respectively, was considerably (range ≈ 4 to ≈ 73-fold diminished in the presence of SP (33.3%. Formulations of micronized CAP, providing an acidic buffering system even in the presence of an SP volume excess, effectively inactivated HIV-1 infectivity. Conclusion The data presented here suggest that the in vivo efficacy of polymeric microbicides, acting as HIV-1 entry inhibitors, might become at least partly compromised by the inevitable presence of SP. These possible disadvantages could be overcome by combining the respective polymers with acidic pH buffering systems (built-in for formulations of micronized CAP or with other anti-HIV-1 compounds, the activity of which is not affected by SP, e.g. reverse transcriptase and zinc finger inhibitors.

  17. Effects of exogenous ATM gene on mRNA expression of human telomerase reverse transcriptase in AT cells induced by irradiation

    International Nuclear Information System (INIS)

    Sheng Fangjun; Cao Jianping; Luo Jialin; Zhu Wei; Liu Fenju; Feng Shuang; Song Jianyuan; Li Chong

    2005-01-01

    The study is to observe effects of exogenous ATM gene on mRNA expression of hTERT (human telomerase reverse transcriptase) in fibroblast cells (AT5BIVA cells) from skin of Ataxia-telangiectasia (AT) patients and to study the regulation of ATM to hTERT. Using reverse transcription polymerase chain reaction (RT-PCR), mRNA expression of hTERT in AT, PEBS7-AT, ATM + -AT and GM cells irradiated with 0 and 3 Gy of 60 Co γ-rays were examined respectively. The difference of the mRNA expression of hTERT among AT, PEBS7-AT, ATM + -AT and GM cells were analyzed. Difference of the mRNA expression of hTERT between 0 Gy and 3 Gy groups was analyzed, too. The results showed that the mRNA expression of hTERT in GM cells was negative, but positive mRNA expression of hTERT in AT cells. The mRNA expression of hTERT in ATM + -AT cells decreased significantly (p 60 Co γ-rays, the mRNA expression of hTERT in GM cells was positive, and that in AT, PEBS7-AT, ATM + -AT cells was increased (p + -AT cells was lower than that in AT and PEBS7-AT cells respectively (p<0.05). It is postulated that exogenous ATM is able to downregulate the mRNA expression of hTERT in AT cells, ionizing radiation can induce the mRNA expression of hTERT in cells and telomerase anticipates the repair of damaged DNA. (authors)

  18. Single Nucleotide Polymorphisms in Cellular Drug Transporters Are Associated with Intolerance to Antiretroviral Therapy in Brazilian HIV-1 Positive Individuals.

    Directory of Open Access Journals (Sweden)

    Mônica Barcellos Arruda

    Full Text Available Adverse reactions are the main cause of treatment discontinuation among HIV+ individuals. Genes related to drug absorption, distribution, metabolism and excretion (ADME influence drug bioavailability and treatment response. We have investigated the association between single nucleotide polymorphisms (SNPs in 29 ADME genes and intolerance to therapy in a case-control study including 764 individuals. Results showed that 15 SNPs were associated with intolerance to nucleoside and 11 to non-nucleoside reverse transcriptase inhibitors (NRTIs and NNRTIs, and 8 to protease inhibitors (PIs containing regimens under alpha = 0.05. After Bonferroni adjustment, two associations remained statistically significant. SNP rs2712816, at SLCO2B1 was associated to intolerance to NRTIs (ORGA/AA = 2.37; p = 0.0001, while rs4148396, at ABCC2, conferred risk of intolerance to PIs containing regimens (ORCT/TT = 2.64; p = 0.00009. Accordingly, haplotypes carrying rs2712816A and rs4148396T alleles were also associated to risk of intolerance to NRTIs and PIs, respectively. Our data reinforce the role of drug transporters in response to HIV therapy and may contribute to a future development of personalized therapies.

  19. Suicide Inhibitors of Reverse Transcriptase in the Therapy of AIDS and Other Retroviruses

    Science.gov (United States)

    1989-07-01

    are shown below. One of the first, [N-(L-3-tran carboxyxiran-2-carbonyl)-L-leucyl]-amido (4-guanido) butane was isolated from Asperg /II japonicus and...using uridine nucleosides to enhance the antiviral selectivity. j, Synthesis of Uridine 2’ and 3*-Ribosoiroxr’es 3*-uridine spiroxirane was...system used (Figure 2). Also shown in this figure is the enhanced sensitivity of the vaccif recombinant HIV-RT to Foscarnet when expressed in monkey kidney

  20. A single dose of a MIV-150/Zinc acetate gel provides 24 h of protection against vaginal simian human immunodeficiency virus reverse transcriptase infection, with more limited protection rectally 8-24 h after gel use.

    Science.gov (United States)

    Kenney, Jessica; Singer, Rachel; Derby, Nina; Aravantinou, Meropi; Abraham, Ciby J; Menon, Radhika; Seidor, Samantha; Zhang, Shimin; Gettie, Agegnehu; Blanchard, James; Piatak, Michael; Lifson, Jeffrey D; Fernández-Romero, José A; Zydowsky, Thomas M; Robbiani, Melissa

    2012-11-01

    Previously we showed that repeated vaginal application of a MIV-150/zinc acetate carrageenan (MIV-150/ZA/CG) gel and a zinc acetate carrageenan (ZA/CG) gel significantly protected macaques from vaginal simian human immunodeficiency virus reverse transcriptase (SHIV-RT) infection. Gels were applied either daily for 2 weeks or every other day for 4 weeks, and the animals were challenged 4-24 h later. Herein, we examined the effects of a single vaginal dose administered either before or after virus challenge. Encouraged by the vaginal protection seen with MIV-150/ZA/CG, we also tested it rectally. Vaginal applications of MIV-150/ZA/CG, ZA/CG, and CG gel were performed once 8-24 h before, 1 h after, or 24 h before and 1 h after vaginal challenge. Rectal applications of MIV-150/ZA/CG and CG gel were performed once 8 or 24 h before rectal challenge. While vaginal pre-challenge and pre/post-challenge application of MIV-150/ZA/CG gel offered significant protection (88%, pinfection prechallenge, but not significantly, and the effect was completely lost post-challenge. Rectal application of MIV-150/ZA/CG gel afforded limited protection against rectal challenge when applied 8-24 h before challenge. Thus, MIV-150/ZA/CG gel is a highly effective vaginal microbicide that demonstrates 24 h of protection from vaginal infection and may demonstrate efficacy against rectal infection when given close to the time of HIV exposure.

  1. The molecular epidemiology of HIV-1 in the Comunidad Valenciana (Spain): analysis of transmission clusters.

    Science.gov (United States)

    Patiño-Galindo, Juan Ángel; Torres-Puente, Manoli; Bracho, María Alma; Alastrué, Ignacio; Juan, Amparo; Navarro, David; Galindo, María José; Ocete, Dolores; Ortega, Enrique; Gimeno, Concepción; Belda, Josefina; Domínguez, Victoria; Moreno, Rosario; González-Candelas, Fernando

    2017-09-14

    HIV infections are still a very serious concern for public heath worldwide. We have applied molecular evolution methods to study the HIV-1 epidemics in the Comunidad Valenciana (CV, Spain) from a public health surveillance perspective. For this, we analysed 1804 HIV-1 sequences comprising protease and reverse transcriptase (PR/RT) coding regions, sampled between 2004 and 2014. These sequences were subtyped and subjected to phylogenetic analyses in order to detect transmission clusters. In addition, univariate and multinomial comparisons were performed to detect epidemiological differences between HIV-1 subtypes, and risk groups. The HIV epidemic in the CV is dominated by subtype B infections among local men who have sex with men (MSM). 270 transmission clusters were identified (>57% of the dataset), 12 of which included ≥10 patients; 11 of subtype B (9 affecting MSMs) and one (n = 21) of CRF14, affecting predominately intravenous drug users (IDUs). Dated phylogenies revealed these large clusters to have originated from the mid-80s to the early 00 s. Subtype B is more likely to form transmission clusters than non-B variants and MSMs to cluster than other risk groups. Multinomial analyses revealed an association between non-B variants, which are not established in the local population yet, and different foreign groups.

  2. Generation of thermostable Moloney murine leukemia virus reverse transcriptase variants using site saturation mutagenesis library and cell-free protein expression system.

    Science.gov (United States)

    Katano, Yuta; Li, Tongyang; Baba, Misato; Nakamura, Miyo; Ito, Masaaki; Kojima, Kenji; Takita, Teisuke; Yasukawa, Kiyoshi

    2017-12-01

    We attempted to increase the thermostability of Moloney murine leukemia virus (MMLV) reverse transcriptase (RT). The eight-site saturation mutagenesis libraries corresponding to Ala70-Arg469 in the whole MMLV RT (Thr24-Leu671), in each of which 1 out of 50 amino acid residues was replaced with other amino acid residue, were constructed. Seven-hundred and sixty eight MMLV RT clones were expressed using a cell-free protein expression system, and their thermostabilities were assessed by the temperature of thermal treatment at which they retained cDNA synthesis activity. One clone D200C was selected as the most thermostable variant. The highest temperature of thermal treatment at which D200C exhibited cDNA synthesis activity was 57ºC, which was higher than for WT (53ºC). Our results suggest that a combination of site saturation mutagenesis library and cell-free protein expression system might be useful for generation of thermostable MMLV RT in a short period of time for expression and selection.

  3. Executive summary of the GESIDA/National AIDS Plan Consensus Document on Antiretroviral Therapy in Adults Infected by the Human Immunodeficiency Virus (Updated January 2016).

    Science.gov (United States)

    2016-01-01

    In this update, antiretroviral therapy (ART) is recommended for all patients infected by type 1 human immunodeficiency virus (HIV-1). The objective of ART is to achieve an undetectable plasma viral load (PVL). Initial ART should comprise 3 drugs, namely, 2 nucleoside reverse transcriptase inhibitors (NRTI), and 1 drug from another family. Four of the recommended regimens, all of which have an integrase strand transfer inhibitor (INSTI) as the third drug, are considered a preferred regimen; a further 6 regimens, which are based on an INSTI, a non-nucleoside reverse transcriptase inhibitor (NNRTI), or a protease inhibitor boosted with cobicistat or ritonavir (PI/COBI, PI/r), are considered alternatives. The reasons and criteria for switching ART are presented both for patients with an undetectable PVL and for patients who experience virological failure, in which case the rescue regimen should include 3 (or at least 2) drugs that are fully active against HIV. The specific criteria for ART in special situations (acute infection, HIV-2 infection, pregnancy) and comorbid conditions (tuberculosis and other opportunistic infections, kidney disease, liver disease, and cancer) are updated. Copyright © 2016 Elsevier España, S.L.U. and Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica. All rights reserved.

  4. Similarities and differences in the nucleic acid chaperone activity of HIV-2 and HIV-1 nucleocapsid proteins in vitro.

    Science.gov (United States)

    Pachulska-Wieczorek, Katarzyna; Stefaniak, Agnieszka K; Purzycka, Katarzyna J

    2014-07-03

    influence the efficiency of reverse transcription and other key steps of the HIV-2 replication cycle.

  5. Dyslipidemia in HIV Infected Children Receiving Highly Active Antiretroviral Therapy.

    Science.gov (United States)

    Mandal, Anirban; Mukherjee, Aparna; Lakshmy, R; Kabra, Sushil K; Lodha, Rakesh

    2016-03-01

    To assess the prevalence of dyslipidemia and lipodystrophy in Indian children receiving non-nucleoside reverse transcriptase inhibitor (NNRTI) based highly active antiretroviral therapy (HAART) and to determine the associated risk factors for the same. The present cross-sectional study was conducted at a Pediatric Clinic of a tertiary care teaching center in India, from May 2011 through December 2012. HIV infected children aged 5-15 y were enrolled if they did not have any severe disease or hospital admission within last 3 mo or receive any medications known to affect the lipid profile. Eighty-one children were on highly active antiretroviral therapy (HAART) for at least 6 mo and 16 were receiving no antiretroviral therapy (ART). Participants' sociodemographic, nutritional, clinical, and laboratory data were recorded in addition to anthropometry and evidence of lipodystrophy. Fasting lipid profile, apolipoprotein A1 and B levels were done for all the children. Among the children on highly active antiretroviral therapy (HAART), 38.3 % had dyslipidemia and 80.2 % had lipodystrophy, while 25 % antiretroviral therapy (ART) naïve HIV infected children had dyslipidemia. No clinically significant risk factors could be identified that increased the risk of dyslipidemia or lipodystrophy in children on highly active antiretroviral therapy (HAART). There is a high prevalence of dyslipidemia and lipodystrophy in Indian children with HIV infection with an imminent need to establish facilities for testing and treatment of these children for metabolic abnormalities.

  6. A quantitative reverse-transcriptase PCR assay for the assessment of drug activities against intracellular Theileria annulata schizonts

    Directory of Open Access Journals (Sweden)

    Isabel Hostettler

    2014-12-01

    Full Text Available Intracellular schizonts of the apicomplexans Theileria annulata and Theileria parva immortalize bovine leucocytes thereby causing fatal immunoproliferative diseases. Buparvaquone, a hydroxynaphthoquinone related to parvaquone, is the only drug available against Theileria. The drug is only effective at the onset of infection and emerging resistance underlines the need for identifying alternative compounds. Current drug assays employ monitoring of proliferation of infected cells, with apoptosis of the infected host cell as a read-out, but it is often unclear whether active compounds directly impair the viability of the parasite or primarily induce host cell death. We here report on the development of a quantitative reverse transcriptase real time PCR method based on two Theileria genes, tasp and tap104, which are both expressed in schizonts. Upon in vitro treatment of T. annulata infected bovine monocytes with buparvaquone, TaSP and Tap104 mRNA expression levels significantly decreased in relation to host cell actin already within 4 h of drug exposure, while significant differences in host cell proliferation were detectable only after 48–72 h. TEM revealed marked alterations of the schizont ultrastructure already after 2 h of buparvaquone treatment, while the host cell remained unaffected. Expression of TaSP and Tap104 proteins showed a marked decrease only after 24 h. Therefore, the analysis of expression levels of mRNA coding for TaSP and Tap104 allows to directly measuring impairment of parasite viability. We subsequently applied this method using a series of compounds affecting different targets in other apicomplexan parasites, and show that monitoring of TaSP- and Tap104 mRNA levels constitutes a suitable tool for anti-theilerial drug development.

  7. Clinical and virological efficacy of etravirine plus two active Nucleos(tide analogs in an heterogeneous HIV-infected population.

    Directory of Open Access Journals (Sweden)

    Luis F López-Cortés

    Full Text Available Etravirine (ETV is recommended in combination with a boosted protease inhibitor plus an optimized background regimen for salvage therapy, but there is limited experience with its use in combination with two nucleos(tide reverse-transcriptase inhibitors (NRTIs. This multicenter study aimed to assess the efficacy of this combination in two scenarios: group A subjects without virologic failure on or no experience with non-nucleoside reverse-transcriptase inhibitors (NNRTIs switched due to adverse events and group B subjects switched after a virologic failure on an efavirenz- or nevirapine-based regimen. The primary endpoint was efficacy at 52 weeks analysed by intention-to-treat. Virologic failure was defined as the inability to suppress plasma HIV-RNA to 200 copies/mL in patients who had previously achieved a viral suppression or had an undetectable viral load at inclusion. Two hundred eighty seven patients were included. Treatment efficacy rates in group A and B were 88.0% (CI95, 83.9-92.1% and 77.4% (CI95, 65.0-89.7%, respectively; the rates reached 97.2% (CI95, 95.1-99.3% and 90.5% (CI95, 81.7-99.3, by on-treatment analysis. The once-a-day ETV treatment was as effective as the twice daily dosing regimen. Grade 1-2 adverse events were observed motivating a treatment switch in 4.2% of the subjects. In conclusion, ETV (once- or twice daily plus two analogs is a suitable, well-tolerated combination both as a switching strategy and after failure with first generation NNRTIs, ensuring full drug activity.ClinicalTrials.gov NCT01437241.

  8. Evidence for a relief of repression mechanism for activation of the human telomerase reverse transcriptase promoter.

    Science.gov (United States)

    Wang, Shuwen; Zhu, Jiyue

    2003-05-23

    The transcriptional activation of human telomerase reverse transcriptase (hTERT) is an important step during cellular immortalization and tumorigenesis. To study how this activation occurs during immortalization, we have established a set of genetically related pre-crisis cells and their immortal progeny. As expected, hTERT mRNA was detected in our telomerase-positive immortal cells but not in pre-crisis cells or telomerase-negative immortal cells. However, transiently transfected luciferase reporters controlled by hTERT promoter sequences exhibited similar levels of luciferase activity in both telomerase-positive and -negative cells, suggesting that the endogenous chromatin context is likely required for hTERT regulation. Analysis of chromatin susceptibility to DNase I digestion consistently identified a DNase I hypersensitivity site (DHS) near the hTERT transcription initiation site in telomerase-positive cells. In addition, the histone deacetylase inhibitor trichostatin A (TSA) induced hTERT transcription and also a general increase in chromatin sensitivity to DNase treatment in telomerase-negative cells. The TSA-induced hTERT transcription in pre-crisis cells was accompanied by the formation of a DHS at the hTERT promoter. Furthermore, the TSA-induced hTERT transcription and chromatin alterations were not blocked by cycloheximide, suggesting that this induction does not require de novo protein synthesis and that TSA induces hTERT expression through the inhibition of histone deacetylation at the hTERT promoter. Taken together, our results suggest that the endogenous chromatin environment plays a critical role in the regulation of hTERT expression during cellular immortalization.

  9. Targeted HIV-1 Latency Reversal Using CRISPR/Cas9-Derived Transcriptional Activator Systems.

    Directory of Open Access Journals (Sweden)

    Julia K Bialek

    Full Text Available CRISPR/Cas9 technology is currently considered the most advanced tool for targeted genome engineering. Its sequence-dependent specificity has been explored for locus-directed transcriptional modulation. Such modulation, in particular transcriptional activation, has been proposed as key approach to overcome silencing of dormant HIV provirus in latently infected cellular reservoirs. Currently available agents for provirus activation, so-called latency reversing agents (LRAs, act indirectly through cellular pathways to induce viral transcription. However, their clinical performance remains suboptimal, possibly because reservoirs have diverse cellular identities and/or proviral DNA is intractable to the induced pathways. We have explored two CRISPR/Cas9-derived activator systems as targeted approaches to induce dormant HIV-1 proviral DNA. These systems recruit multiple transcriptional activation domains to the HIV 5' long terminal repeat (LTR, for which we have identified an optimal target region within the LTR U3 sequence. Using this target region, we demonstrate transcriptional activation of proviral genomes via the synergistic activation mediator complex in various in culture model systems for HIV latency. Observed levels of induction are comparable or indeed higher than treatment with established LRAs. Importantly, activation is complete, leading to production of infective viral particles. Our data demonstrate that CRISPR/Cas9-derived technologies can be applied to counteract HIV latency and may therefore represent promising novel approaches in the quest for HIV elimination.

  10. Pre-exposure prophylaxis of HIV

    Science.gov (United States)

    Naswa, Smriti; Marfatia, Y. S.

    2011-01-01

    Pre-exposure prophylaxis (PrEP) is an experimental approach to HIV prevention and consists of antiretroviral drugs to be taken before potential HIV exposure in order to reduce the risk of HIV infection and continued during periods of risk. An effective PrEP could provide an additional safety net to sexually active persons at risk, when combined with other prevention strategies. Women represent nearly 60% of adults infected with HIV and PrEP can be a female-controlled prevention method for women who are unable to negotiate condom use. Two antiretroviral nucleoside analog HIV-1 reverse transcriptase inhibitor drugs are currently under trial as PrEP drugs, namely tenofovirdisoproxilfumarate (TDF) alone and TDF in combination with emricitabine (FTC), to be taken as daily single dose oral drugs. There are 11 ongoing trials of ARV-based prevention in different at risk populations across the world. The iPrex trial showed that daily use of oral TDF/FTC by MSM resulted in 44% reduction in the incidence of HIV. This led to publication of interim guidance by CDC to use of PrEP by health providers for MSM. Few other trials are Bangkok Tenofovir Study, Partners PrEP Study, FEM-PrEP study, and VOICE (MTN-003) study. Future trials are being formulated for intermittent PrEP (iPrEP) where drugs are taken before and after sex, “stand-in dose” iPrEP, vaginal or rectal PrEP, etc. There are various issues/concerns with PrEP such as ADRs and resistance to TDF/FTC, adherence to drugs, acceptability, sexual disinhibition, use of PrEP as first line of defense for HIV without other prevention strategies, and cost. The PrEP has a potential to address unmet need in public health if delivered as a part of comprehensive toolkit of prevention services, including risk-reduction, correct and consistent use of condoms, and diagnosis and treatment of sexually transmitted infections. PMID:21799568

  11. Long-term analysis of resistance development in HIV-1 positive patients treated with protease and reverse transcriptase inhibitors: Correlation of the genotype and disease progression

    Czech Academy of Sciences Publication Activity Database

    Prejdová, Jana; Weber, Jan; Machala, L.; Reiniš, Milan; Linka, M.; Brůčková, M.; Vandasová, M.; Staňková, M.; Konvalinka, Jan

    2005-01-01

    Roč. 49, č. 1 (2005), 29-36 ISSN 0001-723X R&D Projects: GA MZd(CZ) NI6339 Grant - others:5th Framework(XE) QLK2-CT-2001-02360 Institutional research plan: CEZ:AV0Z4055905 Keywords : HIV * protease inhibitors * resistance development Subject RIV: CE - Biochemistry Impact factor: 0.696, year: 2005

  12. Structural Basis for the Inhibition of RNase H Activity of HIV-1 Reverse Transcriptase by RNase H Active Site-Directed Inhibitors

    Energy Technology Data Exchange (ETDEWEB)

    Su, Hua-Poo; Yan, Youwei; Prasad, G. Sridhar; Smith, Robert F.; Daniels, Christopher L.; Abeywickrema, Pravien D.; Reid, John C.; Loughran, H. Marie; Kornienko, Maria; Sharma, Sujata; Grobler, Jay A.; Xu, Bei; Sardana, Vinod; Allison, Timothy J.; Williams, Peter D.; Darke, Paul L.; Hazuda, Daria J.; Munshi, Sanjeev (Merck)

    2010-09-02

    HIV/AIDS continues to be a menace to public health. Several drugs currently on the market have successfully improved the ability to manage the viral burden in infected patients. However, new drugs are needed to combat the rapid emergence of mutated forms of the virus that are resistant to existing therapies. Currently, approved drugs target three of the four major enzyme activities encoded by the virus that are critical to the HIV life cycle. Although a number of inhibitors of HIV RNase H activity have been reported, few inhibit by directly engaging the RNase H active site. Here, we describe structures of naphthyridinone-containing inhibitors bound to the RNase H active site. This class of compounds binds to the active site via two metal ions that are coordinated by catalytic site residues, D443, E478, D498, and D549. The directionality of the naphthyridinone pharmacophore is restricted by the ordering of D549 and H539 in the RNase H domain. In addition, one of the naphthyridinone-based compounds was found to bind at a second site close to the polymerase active site and non-nucleoside/nucleotide inhibitor sites in a metal-independent manner. Further characterization, using fluorescence-based thermal denaturation and a crystal structure of the isolated RNase H domain reveals that this compound can also bind the RNase H site and retains the metal-dependent binding mode of this class of molecules. These structures provide a means for structurally guided design of novel RNase H inhibitors.

  13. ORIGINAL ARTICLES Symptomatic hyperlactataemia in adults on ...

    African Journals Online (AJOL)

    2008-09-29

    Sep 29, 2008 ... in combination with other antiretroviral drugs in a schedule .... males developed gynaecomastia without other symptoms of ..... nucleoside reverse transcriptase inhibitor (NRTI)-induced lactic acidosis in HIV-infected patients in ...

  14. Journal of Chemical Sciences | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    HIV-1 reverse transcriptase; MD simulations; ribonuclease H activity; retroviral therapy; conformational transition; protein-nucleic acid interactions. ... Details of key interactions found at the interface of enzyme-nucleic acid complex that are ...

  15. Discovery of novel piperidine-substituted indolylarylsulfones as potent HIV NNRTIs via structure-guided scaffold morphing and fragment rearrangement.

    Science.gov (United States)

    Li, Xiao; Gao, Ping; Huang, Boshi; Zhou, Zhongxia; Yu, Zhao; Yuan, Zheng; Liu, Huiqing; Pannecouque, Christophe; Daelemans, Dirk; De Clercq, Erik; Zhan, Peng; Liu, Xinyong

    2017-01-27

    To further explore the chemical space around the entrance channel of HIV-1 reverse transcriptase (RT), a series of novel indolylarylsulfones (IASs) bearing N-substituted piperidine at indole-2-carboxamide were identified as potent HIV NNRTIs by structure-guided scaffold morphing and fragment rearrangement. All the IASs exhibited moderate to excellent potency against wild-type HIV-1 with EC 50 values ranging from 0.62 μM to 0.006 μM 8 (EC 50  = 6 nM) and 18 (EC 50  = 9 nM) were identified as the most potent compounds, which were more active than NVP and DLV, and reached the same order of EFV and ETV. Furthermore, most compounds maintained high activity agaist various single HIV-1 mutants (L100I, K103N, E138K, Y181C) as well as one double mutant (F227L/V106A) with EC 50 values in low-micromolar to double-digit nanomolar concentration ranges. Especially, 8 displayed outstanding potency against L100I (EC 50  = 17 nM with a 2.8-fold resistance ratio) and 18 was relatively more potent to E138K mutant (EC 50  = 43 nM with a 4.7-fold resistance ratio). Preliminary SARs and molecular modeling studies were also discussed in detail, which may provide valuable insights for further optimization. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  16. Dynamic HIV-1 genetic recombination and genotypic drug resistance among treatment-experienced adults in northern Ghana.

    Science.gov (United States)

    Nii-Trebi, Nicholas Israel; Brandful, James Ashun Mensah; Ibe, Shiro; Sugiura, Wataru; Barnor, Jacob Samson; Bampoh, Patrick Owiredu; Yamaoka, Shoji; Matano, Tetsuro; Yoshimura, Kazuhisa; Ishikawa, Koichi; Ampofo, William Kwabena

    2017-11-01

    There have been hardly any reports on the human immunodeficiency virus type 1 (HIV-1) drug-resistance profile from northern Ghana since antiretroviral therapy (ART) was introduced over a decade ago. This study investigated prevailing HIV-1 subtypes and examined the occurrence of drug resistance in ART-experienced patients in Tamale, the capital of the Northern Region of Ghana. A cross-sectional study was carried out on HIV-infected adult patients receiving first-line ART. HIV viral load (VL) and CD4 + T-cell counts were measured. The pol gene sequences were analysed for genotypic resistance by an in-house HIV-1 drug-resistance test; the prevailing HIV-1 subtypes were analysed in detail.Results/Key findings. A total of 33 subjects were studied. Participants comprised 11 males (33.3 %) and 22 (66.7 %) females, with a median age of 34.5 years [interquartile range (IQR) 30.0-40.3]. The median duration on ART was 12 months (IQR 8.0-24). Of the 24 subjects successfully genotyped, 10 (41.7 %) viruses possessed at least one mutation conferring resistance to nucleoside or non-nucleoside reverse-transcriptase inhibitors (NRTIs/NNRTIs). Two-class drug resistance to NRTI and NNRTI was mostly detected (25 %, 6/24). The most frequent mutations were lamivudine-resistance M184V and efavirenz/nevirapine-resistance K103N. HIV-1 subtype CRF02_AG was predominant (79.2 %). Other HIV-1 subtypes detected were G (8.3 %), A3 (4.2 %) and importantly two (8.3 %) unique HIV-1 recombinant forms with CRF02_AG/A3 mosaic. HIV-1 shows high genetic diversity and on-going viral genetic recombination in the study region. Nearly 42 % of the patients studied harboured a drug-resistant virus. The study underscores the need for continued surveillance of HIV-1 subtype diversity; and of drug-resistance patterns to guide selection of second-line regimens in northern Ghana.

  17. Labeling of multiple HIV-1 proteins with the biarsenical-tetracysteine system.

    Directory of Open Access Journals (Sweden)

    Cândida F Pereira

    Full Text Available Due to its small size and versatility, the biarsenical-tetracysteine system is an attractive way to label viral proteins for live cell imaging. This study describes the genetic labeling of the human immunodeficiency virus type 1 (HIV-1 structural proteins (matrix, capsid and nucleocapsid, enzymes (protease, reverse transcriptase, RNAse H and integrase and envelope glycoprotein 120 with a tetracysteine tag in the context of a full-length virus. We measure the impact of these modifications on the natural virus infection and, most importantly, present the first infectious HIV-1 construct containing a fluorescently-labeled nucleocapsid protein. Furthermore, due to the high background levels normally associated with the labeling of tetracysteine-tagged proteins we have also optimized a metabolic labeling system that produces infectious virus containing the natural envelope glycoproteins and specifically labeled tetracysteine-tagged proteins that can easily be detected after virus infection of T-lymphocytes. This approach can be adapted to other viral systems for the visualization of the interplay between virus and host cell during infection.

  18. Antiretroviral treatment is associated with increased attentional load-dependent brain activation in HIV patients.

    Science.gov (United States)

    Chang, L; Yakupov, R; Nakama, H; Stokes, B; Ernst, T

    2008-06-01

    The purpose of this paper was to determine whether antiretroviral medications, especially the nucleoside analogue reverse transcriptase inhibitors, lead to altered brain activation due to their potential neurotoxic effects in patients with human immunodeficiency virus (HIV) infection. Forty-two right-handed men were enrolled in three groups: seronegative controls (SN, n = 18), HIV subjects treated with antiretroviral medications (HIV+ARV, n = 12), or not treated with antiretroviral medications (HIV+NARV, n = 12). Each subject performed a set of visual attention tasks with increasing difficulty or load (tracking two, three or four balls) during functional magnetic resonance imaging. HIV subjects, both groups combined, showed greater load-dependent increases in brain activation in the right frontal regions compared to SN (p-corrected = 0.006). HIV+ARV additionally showed greater load-dependent increases in activation compared to SN in bilateral superior frontal regions (p-corrected = 0.032) and a lower percent accuracy on the performance of the most difficult task (tracking four balls). Region of interest analyses further demonstrated that SN showed load-dependent decreases (with repeated trials despite increasing difficulty), while HIV subjects showed load-dependent increases in activation with the more difficult tasks, especially those on ARVs. These findings suggest that chronic ARV treatments may lead to greater requirement of the attentional network reserve and hence less efficient usage of the network and less practice effects in these HIV patients. As the brain has a limited reserve capacity, exhausting the reserve capacity in HIV+ARV would lead to declined performance with more difficult tasks that require more attention.

  19. Clinical presentation and opportunistic infections in HIV-1, HIV-2 and HIV-1/2 dual seropositive patients in Guinea-Bissau

    DEFF Research Database (Denmark)

    Sørensen, Allan; Jespersen, Sanne; Katzenstein, Terese L

    2016-01-01

    HIV-2 is prevalent. In this study, we aimed to characterize the clinical presentations among HIV-1, HIV-2 and HIV-1/2 dual seropositive patients. Methods: In a cross-sectional study, newly diagnosed HIV patients attending the HIV outpatient clinic at Hospital Nacional Sim~ao Mendes in Guinea......-Bissau were enrolled. Demographical and clinical data were collected and compared between HIV-1, HIV-2 and HIV-1/2 dual seropositive patients. Results: A total of 169 patients (76% HIV-1, 17% HIV-2 and 6% HIV 1/2) were included in the study between 21 March 2012 and 14 December 2012. HIV-1 seropositive...... antigen. Conclusion: HIV-1 and HIV-1/2 seropositive patients have lower CD4 cell counts than HIV-2 seropositive patients when diagnosed with HIV with only minor clinical and demographic differences among groups. Few patients were diagnosed with TB and cryptococcal disease was not found to be a major...

  20. An integrated chemical biology approach reveals the mechanism of action of HIV replication inhibitors.

    Science.gov (United States)

    Pagano, Nicholas; Teriete, Peter; Mattmann, Margrith E; Yang, Li; Snyder, Beth A; Cai, Zhaohui; Heil, Marintha L; Cosford, Nicholas D P

    2017-12-01

    Continuous flow (microfluidic) chemistry was employed to prepare a small focused library of dihydropyrimidinone (DHPM) derivatives. Compounds in this class have been reported to exhibit activity against the human immunodeficiency virus (HIV), but their molecular target had not been identified. We tested the initial set of DHPMs in phenotypic assays providing a hit (1i) that inhibited the replication of the human immunodeficiency virus HIV in cells. Flow chemistry-driven optimization of 1i led to the identification of HIV replication inhibitors such as 1l with cellular potency comparable with the clinical drug nevirapine (NVP). Mechanism of action (MOA) studies using cellular and biochemical assays coupled with 3D fingerprinting and in silico modeling demonstrated that these drug-like probe compounds exert their effects by inhibiting the viral reverse transcriptase polymerase (RT). This led to the design and synthesis of the novel DHPM 1at that inhibits the replication of drug resistant strains of HIV. Our work demonstrates that combining flow chemistry-driven analogue refinement with phenotypic assays, in silico modeling and MOA studies is a highly effective strategy for hit-to-lead optimization applicable to the discovery of future therapeutic agents. Copyright © 2017. Published by Elsevier Ltd.

  1. HIV-1 transmission patterns in antiretroviral therapy-naive, HIV-infected North Americans based on phylogenetic analysis by population level and ultra-deep DNA sequencing.

    Directory of Open Access Journals (Sweden)

    Lisa L Ross

    Full Text Available Factors that contribute to the transmission of human immunodeficiency virus type 1 (HIV-1, especially drug-resistant HIV-1 variants remain a significant public health concern. In-depth phylogenetic analyses of viral sequences obtained in the screening phase from antiretroviral-naïve HIV-infected patients seeking enrollment in EPZ108859, a large open-label study in the USA, Canada and Puerto Rico (ClinicalTrials.gov NCT00440947 were examined for insights into the roles of drug resistance and epidemiological factors that could impact disease dissemination. Viral transmission clusters (VTCs were initially predicted from a phylogenetic analysis of population level HIV-1 pol sequences obtained from 690 antiretroviral-naïve subjects in 2007. Subsequently, the predicted VTCs were tested for robustness by ultra deep sequencing (UDS using pyrosequencing technology and further phylogenetic analyses. The demographic characteristics of clustered and non-clustered subjects were then compared. From 690 subjects, 69 were assigned to 1 of 30 VTCs, each containing 2 to 5 subjects. Race composition of VTCs were significantly more likely to be white (72% vs. 60%; p = 0.04. VTCs had fewer reverse transcriptase and major PI resistance mutations (9% vs. 24%; p = 0.002 than non-clustered sequences. Both men-who-have-sex-with-men (MSM (68% vs. 48%; p = 0.001 and Canadians (29% vs. 14%; p = 0.03 were significantly more frequent in VTCs than non-clustered sequences. Of the 515 subjects who initiated antiretroviral therapy, 33 experienced confirmed virologic failure through 144 weeks while only 3/33 were from VTCs. Fewer VTCs subjects (as compared to those with non-clustering virus had HIV-1 with resistance-associated mutations or experienced virologic failure during the course of the study. Our analysis shows specific geographical and drug resistance trends that correlate well with transmission clusters defined by HIV sequences of similarity

  2. Changing electrolyte and acido-basic profile in HIV-infected patients in the HAART era.

    Science.gov (United States)

    Isnard Bagnis, Corinne; Du Montcel, Sophie Tezenas; Fonfrede, Michele; Jaudon, Marie Chantal; Thibault, Vincent; Carcelain, Guislaine; Valantin, Marc Antoine; Izzedine, Hassan; Servais, Aude; Katlama, Christine; Deray, Gilbert

    2006-01-01

    HIV-infected patients may develop a variety of underreported metabolic abnormalities that may be classified into HIVAN, specific HIV abnormalities, coincidental renal disorders and anti-retroviral-treatment-induced side effects. Our descriptive cross-sectional study evaluates the prevalence of electrolyte and acid base disorders in HIV patients in the HAART era in a tertiary care teaching hospital. All consecutive HIV-infected patients (n = 1,232) presenting at our Department of Infectious Disease over 3 months were included. All available biochemical data obtained at admission or on the day of the visit were analyzed. We identified risk factors for electrolyte and acid base disorders with univariate regression analysis and multivariate stepwise regression analysis. Variables tested for significance included age, sex, absolute CD4 and CD8 counts, hepatitis B and C antibodies, and use and type of anti-retroviral medication. Most frequent and clinically relevant abnormalities were hyperuricemia in 41.3%, hypophosphatemia in 17.2% and low bicarbonate level in 13.6% of HIV-tested patients. Plasma magnesium was out of the normal range in 38.9% and blood glucose in 25.3% of the tested patients. When CD4 count was below 200/mm3, 9.2% of tested patients experienced low serum calcium (vs. 0.5% if CD4 count >200/mm3, p 200/mm3, p 200/mm3, p < 0.0001). Protease inhibitor treatment was a significant risk factor of hyperuricemia (p < 0.003). Non-nucleoside reverse transcriptase inhibitor therapy was significantly associated with less hyperuricemia (OR = 0.6, 95% CI 0.38-0.96) and with hypophosphatemia (OR = 2.0, 95% CI 1.1-3.4). The profile of biochemical abnormalities in HIV-infected patients has changed, hyperuricemia and hypophosphatemia being the most prevalent. Causes are poorly understood. Interpretation of drug-induced side effects in the HIV patient is only meaningful if performed versus a control group of patients. Copyright 2006 S. Karger AG, Basel

  3. Molecular phylodynamics of the heterosexual HIV epidemic in the United Kingdom.

    Directory of Open Access Journals (Sweden)

    Gareth J Hughes

    2009-09-01

    Full Text Available The heterosexual risk group has become the largest HIV infected group in the United Kingdom during the last 10 years, but little is known of the network structure and dynamics of viral transmission in this group. The overwhelming majority of UK heterosexual infections are of non-B HIV subtypes, indicating viruses originating among immigrants from sub-Saharan Africa. The high rate of HIV evolution, combined with the availability of a very high density sample of viral sequences from routine clinical care has allowed the phylodynamics of the epidemic to be investigated for the first time. Sequences of the viral protease and partial reverse transcriptase coding regions from 11,071 patients infected with HIV of non-B subtypes were studied. Of these, 2774 were closely linked to at least one other sequence by nucleotide distance. Including the closest sequences from the global HIV database identified 296 individuals that were in UK-based groups of 3 or more individuals. There were a total of 8 UK-based clusters of 10 or more, comprising 143/2774 (5% individuals, much lower than the figure of 25% obtained earlier for men who have sex with men (MSM. Sample dates were incorporated into relaxed clock phylogenetic analyses to estimate the dates of internal nodes. From the resulting time-resolved phylogenies, the internode lengths, used as estimates of maximum transmission intervals, had a median of 27 months overall, over twice as long as obtained for MSM (14 months, with only 2% of transmissions occurring in the first 6 months after infection. This phylodynamic analysis of non-B subtype HIV sequences representing over 40% of the estimated UK HIV-infected heterosexual population has revealed heterosexual HIV transmission in the UK is clustered, but on average in smaller groups and is transmitted with slower dynamics than among MSM. More effective intervention to restrict the epidemic may therefore be feasible, given effective diagnosis programmes.

  4. Challenges in Initiating Antiretroviral Therapy in 2010

    Directory of Open Access Journals (Sweden)

    Cécile L Tremblay

    2010-01-01

    Full Text Available Many clinical trials have shown that initiating antiretroviral therapy (ART at higher rather than lower CD4 T cell-positive counts results in survival benefit. Early treatment can help prevent end-organ damage associated with HIV replication and can decrease infectivity. The mainstay of treatment is either a non-nucleoside reverse transcriptase inhibitor or a ritonavir-boosted protease inhibitor in combination with two nucleoside reverse transcriptase inhibitors. While effective at combating HIV, ART can produce adverse alterations of lipid parameters, with some studies suggesting a relationship between some anti-retroviral agents and cardiovascular disease. As the HIV-positive population ages, issues such as hypertension and diabetes must be taken into account when initiating ART. Adhering to ART can be difficult; however, nonoptimal adherence to ART can result in the development of resistance; thus, drug characteristics and the patient’s preparedness to begin therapy must be considered. Reducing the pill burden through the use of fixed-dose antiretroviral drug combinations can facilitate adherence.

  5. Docking mode of delvardine and its analogues into the p66 domain ...

    Indian Academy of Sciences (India)

    SEARCHU

    Delvardine and its structural derivatives are important non-nucleoside HIV-1 reverse transcriptase inhibitors (NNRTIs). .... [PDB ID:1REV] was taken from the Protein Data Bank ... Water molecules were removed and H atoms were added.

  6. Short Communication Phylogenetic Characterization of HIV Type 1 CRF01_AE V3 Envelope Sequences in Pregnant Women in Northern Vietnam

    Science.gov (United States)

    Caridha, Rozina; Ha, Tran Thi Thanh; Gaseitsiwe, Simani; Hung, Pham Viet; Anh, Nguyen Mai; Bao, Nguyen Huy; Khang, Dinh Duy; Hien, Nguyen Tran; Cam, Phung Dac; Chiodi, Francesca

    2012-01-01

    Abstract Characterization of HIV-1 strains is important for surveillance of the HIV-1 epidemic. In Vietnam HIV-1-infected pregnant women often fail to receive the care they are entitled to. Here, we analyzed phylogenetically HIV-1 env sequences from 37 HIV-1-infected pregnant women from Ha Noi (n=22) and Hai Phong (n=15), where they delivered in 2005–2007. All carried CRF01_AE in the gp120 V3 region. In 21 women CRF01_AE was also found in the reverse transcriptase gene. We compared their env gp120 V3 sequences phylogenetically in a maximum likelihood tree to those of 198 other CRF01_AE sequences in Vietnam and 229 from neighboring countries, predominantly Thailand, from the HIV-1 database. Altogether 464 sequences were analyzed. All but one of the maternal sequences colocalized with sequences from northern Vietnam. The maternal sequences had evolved the least when compared to sequences collected in Ha Noi in 2002, as shown by analysis of synonymous and nonsynonymous changes, than to other Vietnamese sequences collected earlier and/or elsewhere. Since the HIV-1 epidemic in women in Vietnam may still be underestimated, characterization of HIV-1 in pregnant women is important to observe how HIV-1 has evolved and follow its molecular epidemiology. PMID:21936713

  7. Inhibition of both HIV-1 reverse transcription and gene expression by a cyclic peptide that binds the Tat-transactivating response element (TAR RNA.

    Directory of Open Access Journals (Sweden)

    Matthew S Lalonde

    2011-05-01

    Full Text Available The RNA response element TAR plays a critical role in HIV replication by providing a binding site for the recruitment of the viral transactivator protein Tat. Using a structure-guided approach, we have developed a series of conformationally-constrained cyclic peptides that act as structural mimics of the Tat RNA binding region and block Tat-TAR interactions at nanomolar concentrations in vitro. Here we show that these compounds block Tat-dependent transcription in cell-free systems and in cell-based reporter assays. The compounds are also cell permeable, have low toxicity, and inhibit replication of diverse HIV-1 strains, including both CXCR4-tropic and CCR5-tropic primary HIV-1 isolates of the divergent subtypes A, B, C, D and CRF01_AE. In human peripheral blood mononuclear cells, the cyclic peptidomimetic L50 exhibited an IC(50 ∼250 nM. Surprisingly, inhibition of LTR-driven HIV-1 transcription could not account for the full antiviral activity. Timed drug-addition experiments revealed that L-50 has a bi-phasic inhibition curve with the first phase occurring after HIV-1 entry into the host cell and during the initiation of HIV-1 reverse transcription. The second phase coincides with inhibition of HIV-1 transcription. Reconstituted reverse transcription assays confirm that HIV-1 (- strand strong stop DNA synthesis is blocked by L50-TAR RNA interactions in-vitro. These findings are consistent with genetic evidence that TAR plays critical roles both during reverse transcription and during HIV gene expression. Our results suggest that antiviral drugs targeting TAR RNA might be highly effective due to a dual inhibitory mechanism.

  8. Resistance Mutations outside the Integrase Coding Region Have an Effect on Human Immunodeficiency Virus Replicative Fitness but Do Not Affect Its Susceptibility to Integrase Strand Transfer Inhibitors

    Czech Academy of Sciences Publication Activity Database

    Weber, Jan; Rose, J. D.; Vazquez, A. C.; Winner, D.; Margot, N.; McColl, D. J.; Miller, M. D.; Quinones-Mateu, M. E.

    2013-01-01

    Roč. 8, č. 6 (2013), e65631/1-e65631/14 E-ISSN 1932-6203 R&D Projects: GA MŠk(CZ) LK11207 Institutional support: RVO:61388963 Keywords : HIV -1 reverse-transcriptase * viral fitness * antiretroviral therapy * clinical-implications Subject RIV: EE - Microbiology, Virology Impact factor: 3.534, year: 2013 http://www.plosone.org/article/info%3Adoi%2F10.1371%2Fjournal.pone.0065631

  9. HIV transmitted drug resistance in adult and pediatric populations in Panama Farmacorresistencia transmitida del VIH en poblaciones adultas y pediátricas en Panamá

    Directory of Open Access Journals (Sweden)

    Juan Castillo

    2011-12-01

    Full Text Available OBJECTIVE: To investigate the prevalence of transmitted drug-resistant HIV among adults in Panama by using a modified World Health Organization Threshold Survey (WHO-TS and to investigate rates of initial resistance among HIV-positive infants in Panama. METHODS: At the Gorgas Memorial Institute, 47 HIV-positive adults were genotyped for mutations associated with transmitted drug resistance (TDR in the reverse transcriptase and protease genes of HIV-1, according to WHO-TS guidelines, modified to include patients ≤ 26 years old. Prevalence rates for drug-resistance mutations against three classes of antiretroviral drugs-nucleoside analog reverse transcriptase inhibitors (NRTIs, non-nucleoside reverse transcriptase inhibitors (NNRTIs, and protease inhibitors-were calculated as low ( 15.0%. Twenty-five infant patients were also geno-typed and prevalence rates for drug-resistance mutations were calculated. RESULTS: TDR among Panamanian adults was moderate: 6 of 47 HIV-positive adults showed one or more mutations associated with TDR. Horizontal TDR mutations were moderate for NRTIs and NNRTIs and low for protease inhibitors. Vertical transmission of HIV in Panama has decreased for 2002-2007, but vertical HIV TDR prevalence is moderate (12.0% and is emerging as a problem due to incomplete antiretroviral coverage in pregnancy. CONCLUSIONS: The prevalence of HIV TDR indicated by this study, combined with known rates of HIV infection in Panama, suggests more extensive surveys are needed to identify risk factors associated with transmission of HIV drug resistance. Specific WHO-TS guidelines for monitoring vertical transmission of drug-resistant HIV should be established.OBJETIVO: Investigar la prevalencia de farmacorresistencia transmitida del VIH en adultos en Panamá mediante un estudio del umbral modificado de la Organización Mundial de la Salud (OMS e investigar las tasas de resistencia inicial en lactantes seropositivos para el VIH en Panamá. M

  10. Reptin is required for the transcription of telomerase reverse transcriptase and over-expressed in gastric cancer

    Directory of Open Access Journals (Sweden)

    Liu Tiantian

    2010-05-01

    Full Text Available Abstract Background Telomerase is activated in oncogenesis, which confers an immortal phenotype to cancer cells. The AAA + ATPase Reptin is required for telomerase biogenesis by maintaining telomerase RNA (hTER stability and is aberrantly expressed in certain cancers. Given its role in chromatin remodeling and transcription regulation, we determined the effect of Reptin on the transcription of the telomerase reverse transcriptase (hTERT gene, a key component of the telomerase complex and its expression in gastric cancer. Results Knocking down Reptin or its partner Pontin using small interfering RNA in gastric and cervical cancer cells led to significant decreases in hTERT mRNA, but hTERT promoter activity was inhibited in only Reptin-depleted cells. Reptin interacted with the c-MYC oncoprotein and its stimulatory effect on the hTERTpromoter was significantly dependent on functional E-boxes in the promoter. Moreover, Reptin bound to the hTERT proximal promoter and the loss of the Reptin occupancy led to dissociation of c-MYC from the hTERT promoter in Reptin-depleted cells. Reptin inhibition dramatically impaired clonogenic potential of gastric cancer cells by inducing cell growtharrest and over-expression of Reptin was observed in primary gastric cancer specimens. Conclusions The hTERT gene is a direct target of Reptin, and hTERT transcription requires constitutive expression of Reptin and its cooperation with c-MYC. Thus, Reptin regulates telomerase at two different levels. This finding, together with the requirementof Reptin for the clonogenic potential of cancer cells and its over-expression in gastriccancer and other solid tumors, suggests that Reptin may be a putative therapeutic target.

  11. A Novel Aspartic Protease with HIV-1 Reverse Transcriptase Inhibitory Activity from Fresh Fruiting Bodies of the Wild Mushroom Xylaria hypoxylon

    Directory of Open Access Journals (Sweden)

    Qing-Xiu Hu

    2012-01-01

    Full Text Available A novel aspartic protease with HIV-1 RT inhibitory activity was isolated and characterized from fruiting bodies of the wild mushroom Xylaria hypoxylon. The purification protocol comprised distilled water homogenization and extraction step, three ion exchange chromatographic steps (on DEAE-cellulose, Q-Sepharose, and CM-cellulose in succession, and final purification was by FPLC on Superdex 75. The protease was adsorbed on all the three ion exchangers. It was a monomeric protein with a molecular mass of 43 kDa as estimated by SDS-PAGE and FPLC. Its N-terminal amino acid sequence was HYTELLSQVV, which exhibited no sequence homology to other proteases reported. The activity of the protease was adversely affected by Pepstatin A, indicating that it is an aspartic protease. The protease activity was maximal or nearly so in the pH range 6–8 and in the temperature range 35–60°C. The purified enzyme exhibited HIV-1 RT inhibitory activity with an IC50 value of 8.3 μM, but was devoid of antifungal, ribonuclease, and hemagglutinating activities.

  12. A novel duplex real-time reverse transcriptase-polymerase chain reaction assay for the detection of hepatitis C viral RNA with armored RNA as internal control

    Directory of Open Access Journals (Sweden)

    Meng Shuang

    2010-06-01

    Full Text Available Abstract Background The hepatitis C virus (HCV genome is extremely heterogeneous. Several HCV infections can not be detected using currently available commercial assays, probably because of mismatches between the template and primers/probes. By aligning the HCV sequences, we developed a duplex real-time reverse transcriptase-polymerase chain reaction (RT-PCR assay using 2 sets of primers/probes and a specific armored RNA as internal control. The 2 detection probes were labelled with the same fluorophore, namely, 6-carboxyfluorescein (FAM, at the 5' end; these probes could mutually combine, improving the power of the test. Results The limit of detection of the duplex primer/probe assay was 38.99 IU/ml. The sensitivity of the assay improved significantly, while the specificity was not affected. All HCV genotypes in the HCV RNA Genotype Panel for Nucleic Acid Amplification Techniques could be detected. In the testing of 109 serum samples, the performance of the duplex real-time RT-PCR assay was identical to that of the COBAS AmpliPrep (CAP/COBAS TaqMan (CTM assay and superior to 2 commercial HCV assay kits. Conclusions The duplex real-time RT-PCR assay is an efficient and effective viral assay. It is comparable with the CAP/CTM assay with regard to the power of the test and is appropriate for blood-donor screening and laboratory diagnosis of HCV infection.

  13. Vpx overcomes a SAMHD1-independent block to HIV reverse transcription that is specific to resting CD4 T cells.

    Science.gov (United States)

    Baldauf, Hanna-Mari; Stegmann, Lena; Schwarz, Sarah-Marie; Ambiel, Ina; Trotard, Maud; Martin, Margarethe; Burggraf, Manja; Lenzi, Gina M; Lejk, Helena; Pan, Xiaoyu; Fregoso, Oliver I; Lim, Efrem S; Abraham, Libin; Nguyen, Laura A; Rutsch, Frank; König, Renate; Kim, Baek; Emerman, Michael; Fackler, Oliver T; Keppler, Oliver T

    2017-03-07

    Early after entry into monocytes, macrophages, dendritic cells, and resting CD4 T cells, HIV encounters a block, limiting reverse transcription (RT) of the incoming viral RNA genome. In this context, dNTP triphosphohydrolase SAM domain and HD domain-containing protein 1 (SAMHD1) has been identified as a restriction factor, lowering the concentration of dNTP substrates to limit RT. The accessory lentiviral protein X (Vpx) proteins from the major simian immunodeficiency virus of rhesus macaque, sooty mangabey, and HIV-2 (SIVsmm/SIVmac/HIV-2) lineage packaged into virions target SAMHD1 for proteasomal degradation, increase intracellular dNTP pools, and facilitate HIV cDNA synthesis. We find that virion-packaged Vpx proteins from a second SIV lineage, SIV of red-capped mangabeys or mandrills (SIVrcm/mnd-2), increased HIV infection in resting CD4 T cells, but not in macrophages, and, unexpectedly, acted in the absence of SAMHD1 degradation, dNTP pool elevation, or changes in SAMHD1 phosphorylation. Vpx rcm/mnd-2 virion incorporation resulted in a dramatic increase of HIV-1 RT intermediates and viral cDNA in infected resting CD4 T cells. These analyses also revealed a barrier limiting HIV-1 infection of resting CD4 T cells at the level of nuclear import. Single amino acid changes in the SAMHD1-degrading Vpx mac239 allowed it to enhance early postentry steps in a Vpx rcm/mnd-2-like fashion. Moreover, Vpx enhanced HIV-1 infection of SAMHD1-deficient resting CD4 T cells of a patient with Aicardi-Goutières syndrome. These results indicate that Vpx, in addition to SAMHD1, overcomes a previously unappreciated restriction for lentiviruses at the level of RT that acts independently of dNTP concentrations and is specific to resting CD4 T cells.

  14. Use of a novel virus inactivation method for a multicenter avian influenza real-time reverse transcriptase-polymerase chain reaction proficiency study.

    Science.gov (United States)

    Spackman, Erica; Suarez, David L

    2005-01-01

    Proficiency assessments are important elements in quality control for diagnostic laboratories. Traditionally, proficiency testing for polymerase chain reaction (PCR)-based assays has involved the use of clinical samples, samples "spiked" with live agents or DNA plasmids. Because of government regulations and biosecurity concerns, distribution of live high-consequence pathogens of livestock and poultry, such as avian influenza, is not possible, and DNA plasmids are not technically suitable for evaluating RNA virus detection. Therefore, a proficiency testing panel using whole avian influenza in a diluent containing a phenolic disinfectant that inactivates the virus while preserving the RNA for at least 8 weeks at -70 C was developed and used in a multicenter proficiency assessment for a type A influenza real-time reverse transcriptase (RT)-PCR test. The test, which was highly standardized, except for variation in the real-time RT-PCR equipment used, was shown to be highly reproducible by proficiency testing in 12 laboratories in the United States, Canada, and Hong Kong. Variation in cycle threshold values among 35 data sets and 490 samples was minimal (CV = 5.19%), and sample identifications were highly accurate (96.7% correct identifications) regardless of real-time PCR instrumentation.

  15. Effect of captan on the exonuclease activities of DNA polymerase I from E. coli and reverse transcriptase from avian myeloblastosis virus

    International Nuclear Information System (INIS)

    Freeman-Wittig, M.J.B.

    1986-01-01

    The DNA pol I polymerase activity is known to be inhibited by captan. When captan was tested for its ability to alter the exonuclease activity of DNA pol I, degradation was enhanced at high substrate concentrations. At low concentrations of DNA, captan was inhibitory. By assaying the two exonuclease activities separately it was shown that the differential effect by captan was the result of a combined inhibition of the 3' → 5' exonuclease and enhancement of the 5' → 3' exonuclease. Studies employing [ 14 C] captan showed that the alterations in DNA pol I activities were a result of the irreversible binding of captan to the enzyme in a ratio of 1:1. The effect of captan on AMV reverse transcriptase RNase H activity was also studied. RNase H activity appeared to be more sensitive to captan than was the polymerase activity. Inhibition of the polymerase activity could be prevented by deoxynucleotide triphosphate and was increased by templateprimer. RNase H activity, which showed a sigmoidal relationship between activity and substrate concentration, decreased in V/sub max/ with no change in the Hill coefficient in the presence of captan

  16. Episodic sexual transmission of HIV revealed by molecular phylodynamics.

    Directory of Open Access Journals (Sweden)

    Fraser Lewis

    2008-03-01

    Full Text Available The structure of sexual contact networks plays a key role in the epidemiology of sexually transmitted infections, and their reconstruction from interview data has provided valuable insights into the spread of infection. For HIV, the long period of infectivity has made the interpretation of contact networks more difficult, and major discrepancies have been observed between the contact network and the transmission network revealed by viral phylogenetics. The high rate of HIV evolution in principle allows for detailed reconstruction of links between virus from different individuals, but often sampling has been too sparse to describe the structure of the transmission network. The aim of this study was to analyze a high-density sample of an HIV-infected population using recently developed techniques in phylogenetics to infer the short-term dynamics of the epidemic among men who have sex with men (MSM.Sequences of the protease and reverse transcriptase coding regions from 2,126 patients, predominantly MSM, from London were compared: 402 of these showed a close match to at least one other subtype B sequence. Nine large clusters were identified on the basis of genetic distance; all were confirmed by Bayesian Monte Carlo Markov chain (MCMC phylogenetic analysis. Overall, 25% of individuals with a close match with one sequence are linked to 10 or more others. Dated phylogenies of the clusters using a relaxed clock indicated that 65% of the transmissions within clusters took place between 1995 and 2000, and 25% occurred within 6 mo after infection. The likelihood that not all members of the clusters have been identified renders the latter observation conservative.Reconstruction of the HIV transmission network using a dated phylogeny approach has revealed the HIV epidemic among MSM in London to have been episodic, with evidence of multiple clusters of transmissions dating to the late 1990s, a period when HIV prevalence is known to have doubled in this

  17. Use of a Vaginal Ring Containing Dapivirine for HIV-1 Prevention in Women.

    Science.gov (United States)

    Baeten, Jared M; Palanee-Phillips, Thesla; Brown, Elizabeth R; Schwartz, Katie; Soto-Torres, Lydia E; Govender, Vaneshree; Mgodi, Nyaradzo M; Matovu Kiweewa, Flavia; Nair, Gonasagrie; Mhlanga, Felix; Siva, Samantha; Bekker, Linda-Gail; Jeenarain, Nitesha; Gaffoor, Zakir; Martinson, Francis; Makanani, Bonus; Pather, Arendevi; Naidoo, Logashvari; Husnik, Marla; Richardson, Barbra A; Parikh, Urvi M; Mellors, John W; Marzinke, Mark A; Hendrix, Craig W; van der Straten, Ariane; Ramjee, Gita; Chirenje, Zvavahera M; Nakabiito, Clemensia; Taha, Taha E; Jones, Judith; Mayo, Ashley; Scheckter, Rachel; Berthiaume, Jennifer; Livant, Edward; Jacobson, Cindy; Ndase, Patrick; White, Rhonda; Patterson, Karen; Germuga, Donna; Galaska, Beth; Bunge, Katherine; Singh, Devika; Szydlo, Daniel W; Montgomery, Elizabeth T; Mensch, Barbara S; Torjesen, Kristine; Grossman, Cynthia I; Chakhtoura, Nahida; Nel, Annalene; Rosenberg, Zeda; McGowan, Ian; Hillier, Sharon

    2016-12-01

    Antiretroviral medications that are used as prophylaxis can prevent acquisition of human immunodeficiency virus type 1 (HIV-1) infection. However, in clinical trials among African women, the incidence of HIV-1 infection was not reduced, probably because of low adherence. Longer-acting methods of drug delivery, such as vaginal rings, may simplify use of antiretroviral medications and provide HIV-1 protection. We conducted a phase 3, randomized, double-blind, placebo-controlled trial of a monthly vaginal ring containing dapivirine, a non-nucleoside HIV-1 reverse-transcriptase inhibitor, involving women between the ages of 18 and 45 years in Malawi, South Africa, Uganda, and Zimbabwe. Among the 2629 women who were enrolled, 168 HIV-1 infections occurred: 71 in the dapivirine group and 97 in the placebo group (incidence, 3.3 and 4.5 per 100 person-years, respectively). The incidence of HIV-1 infection in the dapivirine group was lower by 27% (95% confidence interval [CI], 1 to 46; P=0.046) than that in the placebo group. In an analysis that excluded data from two sites that had reduced rates of retention and adherence, the incidence of HIV-1 infection in the dapivirine group was lower by 37% (95% CI, 12 to 56; P=0.007) than that in the placebo group. In a post hoc analysis, higher rates of HIV-1 protection were observed among women over the age of 21 years (56%; 95% CI, 31 to 71; Pdapivirine reduced the risk of HIV-1 infection among African women, with increased efficacy in subgroups with evidence of increased adherence. (Funded by the National Institutes of Health; ClinicalTrials.gov number, NCT01617096 .).

  18. Adipocytes Impair Efficacy of Antiretroviral Therapy

    Science.gov (United States)

    Couturier, Jacob; Winchester, Lee C.; Suliburk, James W.; Wilkerson, Gregory K.; Podany, Anthony T.; Agarwal, Neeti; Chua, Corrine Ying Xuan; Nehete, Pramod N.; Nehete, Bharti P.; Grattoni, Alessandro; Sastry, K. Jagannadha; Fletcher, Courtney V.; Lake, Jordan E.; Balasubramanyan, Ashok; Lewis, Dorothy E.

    2018-01-01

    Adequate distribution of antiretroviral drugs to infected cells in HIV patients is critical for viral suppression. In humans and primates, HIV- and SIV-infected CD4 T cells in adipose tissues have recently been identified as reservoirs for infectious virus. To better characterize adipose tissue as a pharmacological sanctuary for HIV-infected cells, in vitro experiments were conducted to assess antiretroviral drug efficacy in the presence of adipocytes, and drug penetration in adipose tissue cells (stromal-vascular-fraction cells and mature adipocytes) was examined in treated humans and monkeys. Co-culture experiments between HIV-1-infected CD4 T cells and primary human adipocytes showed that adipocytes consistently reduced the antiviral efficacy of the nucleotide reverse transcriptase inhibitor tenofovir and its prodrug forms tenofovir disoproxil fumarate (TDF) and tenofovir alafenamide (TAF). In HIV-infected persons, LC-MS/MS analysis of intracellular lysates derived from adipose tissue stromal-vascular-fraction cells or mature adipocytes suggested that integrase inhibitors penetrate adipose tissue, whereas penetration of nucleoside/nucleotide reverse transcriptase inhibitors such as TDF, emtricitabine, abacavir, and lamivudine is restricted. The limited distribution and functions of key antiretroviral drugs within fat depots may contribute to viral persistence in adipose tissue. PMID:29630975

  19. Early nucleoside reverse transcriptase inhibitors for the treatment of HIV: a brief history of stavudine (D4T) and its comparison with other dideoxynucleosides.

    Science.gov (United States)

    Martin, John C; Hitchcock, Michael J M; De Clercq, Erik; Prusoff, William H

    2010-01-01

    The occasion of this 25th anniversary issue encouraged us to reminisce about the important history of the discovery of the dideoxynucleoside analogues for the treatment of HIV/AIDS and to chronicle our thoughts about a particular exciting and rewarding period of our scientific careers. Following the identification of the anti-HIV activity of zidovudine (AZT), we participated in the urgent quest to discover optimal treatments of HIV infection and AIDS. A number of previously synthesized nucleoside analogues were comparatively evaluated, and stavudine (D4T) emerged as a promising candidate for development. Following clinical evaluation, D4T became a mainstay of the initial antiretroviral combination therapy, prolonging and saving numerous lives. It has only recently been supplanted by better-tolerated treatments. This article forms part of a special issue of Antiviral Research marking the 25th anniversary of antiretroviral drug discovery and development, vol. 85, issue 1, 2010. Copyright 2009 Elsevier B.V. All rights reserved.

  20. Course of c-myc mRNA expression in the regenerating mouse testis determined by competitive reverse transcriptase polymerase chain reaction.

    Science.gov (United States)

    Amendola, R

    1994-11-01

    The c-myc proto-oncogene is a reliable marker of the "G0-early G1" transition, and its down-regulation is believed to be necessary to obtain cellular differentiation. In murine spermatogenesis, the level of c-myc transcripts does not correlate with the rate of cellular division. Proliferation of supposed staminal spermatogonia to reproduce themselves is induced with a local 5 Gy X-ray dose in 90-day-old C57Bl/6 mice. c-myc quantification by a newly developed competitive reverse transcriptase polymerase chain reaction (RT-PCR) was carried out to follow the expression course of this proto-oncogene. Damage and restoration of spermatogenesis were analyzed at days 3, 6, 9, 10, 13, 30, and 60 after injury by relative testes/body weight determination and histological examination. Proliferative status was determined by histone H3 Northern blot analysis. c-myc mRNA level was 10 times higher after 3 days in the irradiated animals compared to the controls. An increasing number of copies were noted up to 10 days, but promptly decreased to the base level found for irradiated mice from 13 to 60 days. Interestingly, the expression of histone H3 detected S phase only in testes at 60 days from damage.

  1. Safety and pharmacokinetics of dapivirine delivery from matrix and reservoir intravaginal rings to HIV-negative women.

    Science.gov (United States)

    Nel, Annalene; Smythe, Shanique; Young, Katherine; Malcolm, Karl; McCoy, Clare; Rosenberg, Zeda; Romano, Joseph

    2009-08-01

    Vaginal microbicides for the prevention of HIV transmission may be an important option for protecting women from infection. Incorporation of dapivirine, a lead candidate nonnucleoside reverse transcriptase inhibitor, into intravaginal rings (IVRs) for sustained mucosal delivery may increase microbicide product adherence and efficacy compared with conventional vaginal formulations. Twenty-four healthy HIV-negative women 18-35 years of age were randomly assigned (1:1:1) to dapivirine matrix IVR, dapivirine reservoir IVR, or placebo IVR. Dapivirine concentrations were measured in plasma and vaginal fluid samples collected at sequential time points over the 33-day study period (28 days of IVR use, 5 days of follow-up). Safety was assessed by pelvic/colposcopic examinations, clinical laboratory tests, and adverse events. Both IVR types were safe and well tolerated with similar adverse events observed in the placebo and dapivirine groups. Dapivirine from both IVR types was successfully distributed throughout the lower genital tract at concentrations over 4 logs greater than the EC50 against wild-type HIV-1 (LAI) in MT4 cells. Maximum concentration (Cmax) and area under the concentration-time curve (AUC) values were significantly higher with the matrix than reservoir IVR. Mean plasma concentrations of dapivirine were <2 ng/mL. These findings suggest that IVR delivery of microbicides is a viable option meriting further study.

  2. The effect of efavirenz versus nevirapine-containing regimens on immunologic, virologic and clinical outcomes in a prospective observational study

    NARCIS (Netherlands)

    Collaboration, H.-C.; Koopmans †, P.P.; Brouwer, A.M.; Dofferhoff, A.S.M.; Flier, M. van der; Groot, R. de; Hofstede, H.J.M. ter; Keuter, M.; Ven, A.J.A.M. van der; et al.,

    2012-01-01

    OBJECTIVE: To compare regimens consisting of either efavirenz or nevirapine and two or more nucleoside reverse transcriptase inhibitors (NRTIs) among HIV-infected, antiretroviral-naive, and AIDS-free individuals with respect to clinical, immunologic, and virologic outcomes. DESIGN: Prospective

  3. Increased chemokine signaling in a model of HIV1-associated peripheral neuropathy

    Directory of Open Access Journals (Sweden)

    Buchanan David J

    2009-08-01

    Full Text Available Abstract Painful distal sensory polyneuropathy (DSP is the most common neurological complication of HIV1 infection. Although infection with the virus itself is associated with an incidence of DSP, patients are more likely to become symptomatic following initiation of nucleoside reverse transcriptase inhibitor (NRTI treatment. The chemokines monocyte chemoattractant protein-1 (MCP1/CCL2 and stromal derived factor-1 (SDF1/CXCL12 and their respective receptors, CCR2 and CXCR4, have been implicated in HIV1 related neuropathic pain mechanisms including NRTI treatment in rodents. Utilizing a rodent model that incorporates the viral coat protein, gp120, and the NRTI, 2'3'-dideoxycytidine (ddC, we examined the degree to which chemokine receptor signaling via CCR2 and CXCR4 potentially influences the resultant chronic hypernociceptive behavior. We observed that following unilateral gp120 sciatic nerve administration, rats developed profound tactile hypernociception in the hindpaw ipsilateral to gp120 treatment. Behavioral changes were also present in the hindpaw contralateral to the injury, albeit delayed and less robust. Using immunohistochemical studies, we demonstrated that MCP1 and CCR2 were upregulated by primary sensory neurons in lumbar ganglia by post-operative day (POD 14. The functional nature of these observations was confirmed using calcium imaging in acutely dissociated lumbar dorsal root ganglion (DRG derived from gp120 injured rats at POD 14. Tactile hypernociception in gp120 treated animals was reversed following treatment with a CCR2 receptor antagonist at POD 14. Some groups of animals were subjected to gp120 sciatic nerve injury in combination with an injection of ddC at POD 14. This injury paradigm produced pronounced bilateral tactile hypernociception from POD 14–48. More importantly, functional MCP1/CCR2 and SDF1/CXCR4 signaling was present in sensory neurons. In contrast to gp120 treatment alone, the hypernociceptive behavior

  4. Identification of HIV Mutation as Diagnostic Biomarker through Next Generation Sequencing.

    Science.gov (United States)

    Shaw, Wen Hui; Lin, Qianqian; Muhammad, Zikry Zhiwei Bin Roslee; Lee, Jia Jun; Khong, Wei Xin; Ng, Oon Tek; Tan, Eng Lee; Li, Peng

    2016-07-01

    Current clinical detection of Human immunodeficiency virus 1 (HIV-1) is used to target viral genes and proteins. However, the immunoassay, such as viral culture or Polymerase Chain Reaction (PCR), lacks accuracy in the diagnosis, as these conventional assays rely on the stable genome and HIV-1 is a highly-mutated virus. Next generation sequencing (NGS) promises to be transformative for the practice of infectious disease, and the rapidly reducing cost and processing time mean that this will become a feasible technology in diagnostic and research laboratories in the near future. The technology offers the superior sensitivity to detect the pathogenic viruses, including unknown and unexpected strains. To leverage the NGS technology in order to improve current HIV-1 diagnosis and genotyping methods. Ten blood samples were collected from HIV-1 infected patients which were diagnosed by RT PCR at Singapore Communicable Disease Centre, Tan Tock Seng Hospital from October 2014 to March 2015. Viral RNAs were extracted from blood plasma and reversed into cDNA. The HIV-1 cDNA samples were cleaned up using a PCR purification kit and the sequencing library was prepared and identified through MiSeq. Two common mutations were observed in all ten samples. The common mutations were identified at genome locations 1908 and 2104 as missense and silent mutations respectively, conferring S37N and S3S found on aspartic protease and reverse transcriptase subunits. The common mutations identified in this study were not previously reported, therefore suggesting the potential for them to be used for identification of viral infection, disease transmission and drug resistance. This was especially the case for, missense mutation S37N which could cause an amino acid change in viral proteases thus reducing the binding affinity of some protease inhibitors. Thus, the unique common mutations identified in this study could be used as diagnostic biomarkers to indicate the origin of infection as being

  5. Characteristics of HIV-2 and HIV-1/HIV-2 Dually Seropositive Adults in West Africa Presenting for Care and Antiretroviral Therapy: The IeDEA-West Africa HIV-2 Cohort Study.

    Science.gov (United States)

    Ekouevi, Didier K; Balestre, Eric; Coffie, Patrick A; Minta, Daouda; Messou, Eugene; Sawadogo, Adrien; Minga, Albert; Sow, Papa Salif; Bissagnene, Emmanuel; Eholie, Serge P; Gottlieb, Geoffrey S; Dabis, François; Zannou, Djimon Marcel; Ahouada, Carin; Akakpo, Jocelyn; Ahomadegbé, Christelle; Bashi, Jules; Gougounon-Houéto, Alice; Azon-Kouanou, Angèle; Houngbé, Fabien; Koumakpaï, Sikiratou; Alihonou, Florence; d'Almeida, Marcelline; Hodonou, Irvine; Hounhoui, Ghislaine; Sagbo, Gracien; Tossa-Bagnan, Leïla; Adjide, Herman; Drabo, Joseph; Bognounou, René; Dienderé, Arnaud; Traore, Eliezer; Zoungrana, Lassane; Zerbo, Béatrice; Sawadogo, Adrien Bruno; Zoungrana, Jacques; Héma, Arsène; Soré, Ibrahim; Bado, Guillaume; Tapsoba, Achille; Yé, Diarra; Kouéta, Fla; Ouedraogo, Sylvie; Ouédraogo, Rasmata; Hiembo, William; Gansonré, Mady; Messou, Eugène; Gnokoro, Joachim Charles; Koné, Mamadou; Kouakou, Guillaume Martial; Bosse, Clarisse Amani; Brou, Kouakou; Assi, Achi Isidore; Chenal, Henri; Hawerlander, Denise; Soppi, Franck; Minga, Albert; Abo, Yao; Bomisso, Germain; Eholié, Serge Paul; Amego, Mensah Deborah Noelly; Andavi, Viviane; Diallo, Zelica; Ello, Frédéric; Tanon, Aristophane Koffi; Koule, Serge Olivier; Anzan, Koffi Charles; Guehi, Calixte; Aka, Edmond Addi; Issouf, Koffi Ladji; Kouakou, Jean-Claude; N'gbeche, Marie-Sylvie; Touré, Pety; Avit-Edi, Divine; Kouakou, Kouadio; Moh, Magloire; Yao, Valérie Andoblé; Folquet, Madeleine Amorissani; Dainguy, Marie-Evelyne; Kouakou, Cyrille; Méa-Assande, Véronique Tanoh; Oka-Berete, Gladys; Zobo, Nathalie; Acquah, Patrick; Kokora, Marie-Berthe; Eboua, Tanoh François; Timité-Konan, Marguerite; Ahoussou, Lucrèce Diecket; Assouan, Julie Kebé; Sami, Mabéa Flora; Kouadio, Clémence; Renner, Lorna; Goka, Bamenla; Welbeck, Jennifer; Sackey, Adziri; Owiafe, Seth Ntiri; Wejse, Christian; Silva, Zacarias José Da; Paulo, Joao; Rodrigues, Amabelia; da Silva, David; Medina, Candida; Oliviera-Souto, Ines; Ostergaard, Lars; Laursen, Alex; Sodemann, Morten; Aaby, Peter; Fomsgaard, Anders; Erikstrup, Christian; Eugen-Olsen, Jesper; Maïga, Moussa Y; Diakité, Fatoumata Fofana; Kalle, Abdoulaye; Katile, Drissa; Traore, Hamar Alassane; Minta, Daouda; Cissé, Tidiani; Dembelé, Mamadou; Doumbia, Mohammed; Fomba, Mahamadou; Kaya, Assétou Soukho; Traoré, Abdoulaye M; Traoré, Hamady; Toure, Amadou Abathina; Dicko, Fatoumata; Sylla, Mariam; Berthé, Alima; Traoré, Hadizatou Coulibaly; Koïta, Anta; Koné, Niaboula; N'diaye, Clémentine; Coulibaly, Safiatou Touré; Traoré, Mamadou; Traoré, Naïchata; Charurat, Man; Ajayi, Samuel; Dapiap, Stephen; Otu; Igbinoba, Festus; Benson, Okwara; Adebamowo, Clément; James, Jesse; Obaseki; Osakede, Philip; Olasode, John; Sow, Papa Salif; Diop, Bernard; Manga, Noël Magloire; Tine, Judicael Malick; Signate Sy, Haby; Ba, Abou; Diagne, Aida; Dior, Hélène; Faye, Malick; Gueye, Ramatoulaye Diagne; Mbaye, Aminata Diack; Patassi, Akessiwe; Kotosso, Awèrou; Kariyare, Benjamin Goilibe; Gbadamassi, Gafarou; Komi, Agbo; Mensah-Zukong, Kankoé Edem; Pakpame, Pinuwe; Lawson-Evi, Annette Koko; Atakouma, Yawo; Takassi, Elom; Djeha, Améyo; Ephoévi-Gah, Ayoko; Djibril, Sherifa El-Hadj; Dabis, François; Bissagnene, Emmanuel; Arrivé, Elise; Coffie, Patrick; Ekouevi, Didier; Jaquet, Antoine; Leroy, Valériane; Lewden, Charlotte; Sasco, Annie; Azani, Jean-Claude; Allou, Gérard; Balestre, Eric; Bohossou, Franck; Karcher, Sophie; Gonsan, Jules Mahan; Carrou, Jérôme Le; Lenaud, Séverin; Nchot, Célestin; Malateste, Karen; Yao, Amon Roseamonde; Siloué, Bertine; Clouet, Gwenaelle; Djetouan, Hugues; Doring, Alexandra; Kouakou, Adrienne; Rabourdin, Elodie; Rivenc, Jean; Anglaret, Xavier; Ba, Boubacar; Essanin, Jean Bosco; Ciaranello, Andrea; Datté, Sébastien; Desmonde, Sophie; Diby, Jean-Serge Elvis; Gottlieb, Geoffrey S; Horo, Apollinaire Gninlgninrin; Kangah, Serge N'zoré; Malvy, Denis; Meless, David; Mounkaila-Harouna, Aida; Ndondoki, Camille; Shiboski, Caroline; Thiébaut, Rodolphe; Pac-Ci; Abidjan

    2013-01-01

    HIV-2 is endemic in West Africa. There is a lack of evidence-based guidelines on the diagnosis, management and antiretroviral therapy (ART) for HIV-2 or HIV-1/HIV-2 dual infections. Because of these issues, we designed a West African collaborative cohort for HIV-2 infection within the framework of the International epidemiological Databases to Evaluate AIDS (IeDEA). We collected data on all HIV-2 and HIV-1/HIV-2 dually seropositive patients (both ARV-naive and starting ART) and followed-up in clinical centres in the IeDEA-WA network including a total of 13 clinics in five countries: Benin, Burkina-Faso Côte d'Ivoire, Mali, and Senegal, in the West Africa region. Data was merged for 1,754 patients (56% female), including 1,021 HIV-2 infected patients (551 on ART) and 733 dually seropositive for both HIV-1 and HIV 2 (463 on ART). At ART initiation, the median age of HIV-2 patients was 45.3 years, IQR: (38.3-51.7) and 42.4 years, IQR (37.0-47.3) for dually seropositive patients (p = 0.048). Overall, 16.7% of HIV-2 patients on ART had an advanced clinical stage (WHO IV or CDC-C). The median CD4 count at the ART initiation is 166 cells/mm(3), IQR (83-247) among HIV-2 infected patients and 146 cells/mm(3), IQR (55-249) among dually seropositive patients. Overall, in ART-treated patients, the CD4 count increased 126 cells/mm(3) after 24 months on ART for HIV-2 patients and 169 cells/mm(3) for dually seropositive patients. Of 551 HIV-2 patients on ART, 5.8% died and 10.2% were lost to follow-up during the median time on ART of 2.4 years, IQR (0.7-4.3). This large multi-country study of HIV-2 and HIV-1/HIV-2 dual infection in West Africa suggests that routine clinical care is less than optimal and that management and treatment of HIV-2 could be further informed by ongoing studies and randomized clinical trials in this population.

  6. Characteristics of HIV-2 and HIV-1/HIV-2 Dually Seropositive Adults in West Africa Presenting for Care and Antiretroviral Therapy: The IeDEA-West Africa HIV-2 Cohort Study.

    Directory of Open Access Journals (Sweden)

    Didier K Ekouevi

    Full Text Available HIV-2 is endemic in West Africa. There is a lack of evidence-based guidelines on the diagnosis, management and antiretroviral therapy (ART for HIV-2 or HIV-1/HIV-2 dual infections. Because of these issues, we designed a West African collaborative cohort for HIV-2 infection within the framework of the International epidemiological Databases to Evaluate AIDS (IeDEA.We collected data on all HIV-2 and HIV-1/HIV-2 dually seropositive patients (both ARV-naive and starting ART and followed-up in clinical centres in the IeDEA-WA network including a total of 13 clinics in five countries: Benin, Burkina-Faso Côte d'Ivoire, Mali, and Senegal, in the West Africa region.Data was merged for 1,754 patients (56% female, including 1,021 HIV-2 infected patients (551 on ART and 733 dually seropositive for both HIV-1 and HIV 2 (463 on ART. At ART initiation, the median age of HIV-2 patients was 45.3 years, IQR: (38.3-51.7 and 42.4 years, IQR (37.0-47.3 for dually seropositive patients (p = 0.048. Overall, 16.7% of HIV-2 patients on ART had an advanced clinical stage (WHO IV or CDC-C. The median CD4 count at the ART initiation is 166 cells/mm(3, IQR (83-247 among HIV-2 infected patients and 146 cells/mm(3, IQR (55-249 among dually seropositive patients. Overall, in ART-treated patients, the CD4 count increased 126 cells/mm(3 after 24 months on ART for HIV-2 patients and 169 cells/mm(3 for dually seropositive patients. Of 551 HIV-2 patients on ART, 5.8% died and 10.2% were lost to follow-up during the median time on ART of 2.4 years, IQR (0.7-4.3.This large multi-country study of HIV-2 and HIV-1/HIV-2 dual infection in West Africa suggests that routine clinical care is less than optimal and that management and treatment of HIV-2 could be further informed by ongoing studies and randomized clinical trials in this population.

  7. HIV-1 drug resistance surveillance in antiretroviral treatment-naive individuals from a reference hospital in Guatemala, 2010-2013.

    Science.gov (United States)

    Avila-Ríos, Santiago; García-Morales, Claudia; Garrido-Rodríguez, Daniela; Tapia-Trejo, Daniela; Girón-Callejas, Amalia Carolina; Mendizábal-Burastero, Ricardo; Escobar-Urias, Ingrid Yessenia; García-González, Blanca Leticia; Navas-Castillo, Sabrina; Pinzón-Meza, Rodolfo; Mejía-Villatoro, Carlos Rodolfo; Reyes-Terán, Gustavo

    2015-04-01

    The recent expansion of antiretroviral treatment (ART) coverage in middle/low-income countries has been associated with increasing prevalence of HIV pre-ART drug resistance (PDR). We assessed PDR prevalence, patterns, and trends in Guatemala. Blood samples from 1,084 ART-naive individuals, enrolled from October 2010 to December 2013 at the Roosevelt Hospital in Guatemala City, were obtained. PDR was evaluated using the WHO mutation list for transmitted drug resistance (TDR) surveillance. An overall PDR prevalence of 7.3% (95% CI 5.8-9.0%) was observed for the whole study period. TDR to nonnucleoside reverse transcriptase inhibitors (NNRTI) was the highest (4.9%, p500 and 350-500 CD4(+) T cells/μl (7.4% and 8.7%, respectively) compared to individuals with Guatemala remains at an intermediate level. Nevertheless, we have shown evidence suggesting increasing trends in NNRTI PDR, which need to be taken into account in national HIV management policies.

  8. Prevalence of drug-resistant mutation among drug-treated HIV/AIDS inpatient in Airlangga University teaching hospital, Surabaya, Indonesia

    Science.gov (United States)

    Rachman, B. E.; Khairunisa, S. Q.; Witaningrum, A. M.; Yunifiar, M. Q.; Widiyanti, P.; Nasronudin

    2018-03-01

    Increased use of antiretroviral therapy did not completely reduce the incidence of HIV/AIDShospitalization. Various factors can be involved. The aim of this study is to examine HIV-1 drug resistance mutations profile in drug-treated HIV/AIDS patients who underwent hospitalization. HIV/AIDS patients who are admitted to hospital who had received ART are included in the study and then examined for the presence of drug resistance-associated mutations. A total of 17 samples were included in the study, but only 11 samples that could be sequence analyzed. On the mutation examination of drug resistance in reverse transcriptase gene, it werefound a major mutation in K103N (9%) and G190A (9%). Most minor mutations were found in A98S (18.1%), followed by M41L, M184V, L210W, T215Y, V108l, Y181C and H221Y at 9% each. Whereas, on examination of drug resistance mutations in protease genes, there is a major mutation in I84V of 9%. Most minor mutations on M36I (45.4%), followed by L10I (36.3%), H69K (36.3%), I93L (27.2%), G16E, L89M, K20R 18.1%, L64V and V771I 9% respectively.A large number of mutated samples pose a challenge in long-term antiretroviral treatment, so a breakthrough policy is needed to minimize the impact.

  9. Comparison of genotypic resistance profiles and virological response between patients starting nevirapine and efavirenz in EuroSIDA

    DEFF Research Database (Denmark)

    Bannister, Wendy P; Ruiz, Lidia; Cozzi-Lepri, Alessandro

    2008-01-01

    OBJECTIVE: To compare virological outcome and genotypic resistance profiles in HIV-1-infected patients starting non-nucleoside reverse transcriptase inhibitor (NNRTI)-containing regimens. METHODS: NNRTI-naive patients were included who started treatment with nevirapine (NVP) or efavirenz (EFV) wi...

  10. Synthesis of spiro[indolo-1,5-benzodiazepines] from 3-acetyl ...

    Indian Academy of Sciences (India)

    Unknown

    also as potent virucides and non-nucleoside inhibi- tors of HIV-1 reverse transcriptase.2 Beside this,. 1,5-benzodiazepines ... printed circuits.8 Here we report the synthesis of spiro ... 3d. 5,6-Benzo 1727. 1701. 1672. 3218 3382. 4⋅22 (d, 2H, J = 17⋅91 Hz), 3⋅81 (d, 2H,. J = 17⋅8 .... R1 = R2 = CH3 show 88⋅88% inhibition.

  11. Prognostic role of a multigene reverse transcriptase-PCR assay in patients with node-negative breast cancer not receiving adjuvant systemic therapy.

    Science.gov (United States)

    Esteva, Francisco J; Sahin, Aysegul A; Cristofanilli, Massimo; Coombes, Kevin; Lee, Sang-Joon; Baker, Joffre; Cronin, Maureen; Walker, Michael; Watson, Drew; Shak, Steven; Hortobagyi, Gabriel N

    2005-05-01

    To test the ability of a reverse transcriptase-PCR (RT-PCR) assay, based on gene expression profiles, to accurately determine the risk of recurrence in patients with node-negative breast cancer who did not receive systemic therapy using formalin-fixed, paraffin-embedded tissue. A secondary objective was to determine whether the quantitative RT-PCR data correlated with immunohistochemistry assay data regarding estrogen receptor, progesterone receptor, and human epidermal growth factor receptor 2 status. We obtained archival paraffin-embedded tissue from patients with invasive breast cancer but no axillary lymph node involvement who had received no adjuvant systemic therapy and been followed for at least 5 years. RNA was extracted from three 10-microm-thick sections. The expression of 16 cancer-related genes and 5 reference genes was quantified using RT-PCR. A gene expression algorithm was used to calculate a recurrence score for each patient. We then assessed the ability of the test to accurately predict distant recurrence-free survival in this population. We identified 149 eligible patients. Median age at diagnosis was 59 years; mean tumor diameter was 2 cm; and 69% of tumors were estrogen receptor positive. Median follow-up was 18 years. The 5-year disease-free survival rate for the group was 80%. The 21 gene-based recurrence score was not predictive of distant disease recurrence. However, a high concordance between RT-PCR and immunohistochemical assays for estrogen receptor, progesterone receptor, and human epidermal growth factor receptor 2 status was noted. RT-PCR can be done on paraffin-embedded tissue to validate the large numbers of genes associated with breast cancer recurrence. However, further work needs to be done to develop an assay to identify the likelihood of recurrent disease in patients with node-negative breast cancer who do not receive adjuvant tamoxifen or chemotherapy.

  12. On the Origin of Reverse Transcriptase-Using CRISPR-Cas Systems and Their Hyperdiverse, Enigmatic Spacer Repertoires

    Directory of Open Access Journals (Sweden)

    Sukrit Silas

    2017-07-01

    Full Text Available Cas1 integrase is the key enzyme of the clustered regularly interspaced short palindromic repeat (CRISPR-Cas adaptation module that mediates acquisition of spacers derived from foreign DNA by CRISPR arrays. In diverse bacteria, the cas1 gene is fused (or adjacent to a gene encoding a reverse transcriptase (RT related to group II intron RTs. An RT-Cas1 fusion protein has been recently shown to enable acquisition of CRISPR spacers from RNA. Phylogenetic analysis of the CRISPR-associated RTs demonstrates monophyly of the RT-Cas1 fusion, and coevolution of the RT and Cas1 domains. Nearly all such RTs are present within type III CRISPR-Cas loci, but their phylogeny does not parallel the CRISPR-Cas type classification, indicating that RT-Cas1 is an autonomous functional module that is disseminated by horizontal gene transfer and can function with diverse type III systems. To compare the sequence pools sampled by RT-Cas1-associated and RT-lacking CRISPR-Cas systems, we obtained samples of a commercially grown cyanobacterium—Arthrospira platensis. Sequencing of the CRISPR arrays uncovered a highly diverse population of spacers. Spacer diversity was particularly striking for the RT-Cas1-containing type III-B system, where no saturation was evident even with millions of sequences analyzed. In contrast, analysis of the RT-lacking type III-D system yielded a highly diverse pool but reached a point where fewer novel spacers were recovered as sequencing depth was increased. Matches could be identified for a small fraction of the non-RT-Cas1-associated spacers, and for only a single RT-Cas1-associated spacer. Thus, the principal source(s of the spacers, particularly the hypervariable spacer repertoire of the RT-associated arrays, remains unknown.

  13. New prognostic factor telomerase reverse transcriptase promotor mutation presents without MR imaging biomarkers in primary glioblastoma

    Energy Technology Data Exchange (ETDEWEB)

    Ersoy, Tunc F.; Simon, Matthias [University Hospital Bonn, Department of Neurosurgery and Stereotaxy, Bonn (Germany); Ev. Krankenhaus Bielefeld, Department of Neurosurgery, Bielefeld (Germany); Keil, Vera C.; Hadizadeh, Dariusch R.; Schild, Hans H. [University Hospital Bonn, Department of Radiology, Bonn (Germany); Gielen, Gerrit H.; Waha, Andreas [University Hospital Bonn, Institute of Neuropathology, Bonn (Germany); Fimmers, Rolf [IMBIE, University Hospital Bonn, Bonn (Germany); Heidenreich, Barbara; Kumar, Rajiv [DFKZ, Department of Molecular Genetic Epidemiology, Heidelberg (Germany)

    2017-12-15

    Magnetic resonance (MR) imaging biomarkers can assist in the non-invasive assessment of the genetic status in glioblastomas (GBMs). Telomerase reverse transcriptase (TERT) promoter mutations are associated with a negative prognosis. This study was performed to identify MR imaging biomarkers to forecast the TERT mutation status. Pre-operative MRIs of 64/67 genetically confirmed primary GBM patients (51/67 TERT-mutated with rs2853669 polymorphism) were analyzed according to Visually AcceSAble Rembrandt Images (VASARI) (https: //wiki.cancerimagingarchive.net/display/Public/VASARI+Research+Project) imaging criteria by three radiological raters. TERT mutation and O{sup 6}-methylguanine-DNA methyltransferase (MGMT) hypermethylation data were obtained through direct and pyrosequencing as described in a previous study. Clinical data were derived from a prospectively maintained electronic database. Associations of potential imaging biomarkers and genetic status were assessed by Fisher and Mann-Whitney U tests and stepwise linear regression. No imaging biomarkers could be identified to predict TERT mutational status (alone or in conjunction with TERT promoter polymorphism rs2853669 AA-allele). TERT promoter mutations were more common in patients with tumor-associated seizures as first symptom (26/30 vs. 25/37, p = 0.07); these showed significantly smaller tumors [13.1 (9.0-19.0) vs. 24.0 (16.6-37.5) all cm{sup 3}; p = 0.007] and prolonged median overall survival [17.0 (11.5-28.0) vs. 9.0 (4.0-12.0) all months; p = 0.02]. TERT-mutated GBMs were underrepresented in the extended angularis region (p = 0.03), whereas MGMT-methylated GBMs were overrepresented in the corpus callosum (p = 0.03) and underrepresented temporomesially (p = 0.01). Imaging biomarkers for prediction of TERT mutation status remain weak and cannot be derived from the VASARI protocol. Tumor-associated seizures are less common in TERT mutated glioblastomas. (orig.)

  14. Indolyl aryl sulfones (IASs): development of highly potent NNRTIs active against wt-HIV-1 and clinically relevant drug resistant mutants.

    Science.gov (United States)

    Silvestri, Romano; Artico, Marino

    2005-01-01

    Indolyl aryl sulfones (IASs) are a potent class of NNRTIs developed from L-737,126, a lead agent discovered by Merck AG. IAS derivatives are endowed with inhibitory activities against wt HIV-1 in the low nanomolar concentration range. Introduction of two methyl groups at positions 3 and 5 of the phenyl ring of the aryl sulfonyl moiety furnished IAS derivatives such as 5-chloro- or 5-bromo-3-[(3,5-dimethylphenyl)sulfonyl]indole-2-carboxyamide, which showed very potent and selective anti-HIV-1 activity against some mutants carrying NNRTI resistant mutations at positions 103 and 181 of the reverse transcriptase. IAS derivatives bearing 2-hydroxyethylcarboxyamide or 2-hydroxyethylcarboxyhydrazide groups at position 2 of the indole nucleus were more active than L-737,126 against the K103N-Y181C double mutant. A great improvement of antiviral activity against wt HIV-1 and resistant mutants was obtained by coupling 1-3 simple amino acids, such as glycine and alanine, in sequence, with the 3-[(3,5-dimethylphenyl)sulfonyl]-1H-indole-2-carbonyl moiety. The transformation of the chain terminus into amide or hydrazide, produced short peptides with high selectivity and potent activity against wt HIV-1, and the viral mutants Y181C, K103N-Y181C and EFV(R). IAS having two halogen atoms at the indole showed potent inhibitory activity against the Y181C and the EFV(R) resistant mutant strains. In particular, the introduction of a fluorine atom at position 4 of the indole ring notably contributed to improve the antiviral activities against both wt and the related resistant mutants. 5-Nitro-IASs were highly active against wt HIV-1 and exhibited low cytotoxicity. Experimental data highlighted the class IAS derivatives as promising candidates for clinical trials.

  15. Will dapivirine redeem the promises of anti-HIV microbicides? Overview of product design and clinical testing.

    Science.gov (United States)

    das Neves, José; Martins, João Pedro; Sarmento, Bruno

    2016-08-01

    Microbicides are being developed in order to prevent sexual transmission of HIV. Dapivirine, a non-nucleoside reverse transcriptase inhibitor, is one of the leading drug candidates in the field, currently being tested in various dosage forms, namely vaginal rings, gels, and films. In particular, a ring allowing sustained drug release for 1month is in an advanced stage of clinical testing. Two parallel phase III clinical trials are underway in sub-Saharan Africa and results are expected to be released in early 2016. This article overviews the development of dapivirine and its multiple products as potential microbicides, with particular emphasis being placed on clinical evaluation. Also, critical aspects regarding regulatory approval, manufacturing, distribution, and access are discussed. Copyright © 2015 Elsevier B.V. All rights reserved.

  16. Molecular epidemiology of co-infection with hepatitis B virus and human immunodeficiency virus (HIV) among adult patients in Harare, Zimbabwe.

    Science.gov (United States)

    Baudi, Ian; Iijima, Sayuki; Chin'ombe, Nyasha; Mtapuri-Zinyowera, Sekesai; Murakami, Shuko; Isogawa, Masanori; Hachiya, Atsuko; Iwatani, Yasumasa; Tanaka, Yasuhito

    2017-02-01

    The objective of this study was to determine the prevalence of co-infection with hepatitis B virus (HBV) and human immunodeficiency virus (HIV) and the genetic characteristics of both viruses among pre-HIV-treatment patients in Harare, Zimbabwe. This cross-sectional survey involved 176 remnant plasma samples collected from consenting HIV patients (median age 35 [18-74]) between June and September 2014. HBV seromarkers were determined by high-sensitivity chemiluminescence assays. Molecular evolutionary analyses were conducted on the basal core promoter/precore (BCP/PC) and S regions of HBV, as well as part of the HIV pol region. Of the 176 participants (65.7% female), 19 (10.8%) were positive for HBsAg (median 0.033 IU/ml (IQR 0.01-415). The HBsAg incidence was higher in men than women (P = 0.009). HBsAg-positive subjects had lower median CD4 counts (P = 0.016). HBV DNA was detectable in 12 HBsAg-positive samples (median 3.36 log cp/ml (2.86-4.51), seven being amplified and sequenced. All isolates were subgenotype A1 without HBV drug resistance mutations but each had at least one BCP/PC mutation. PreS deletion mutants and small S antigen variants M133I/T and D144G were identified. Of the 164 HIV isolates successfully genotyped, 163 (99.4%) were HIV-1 subtype C and only one was HIV-1 subtype F1. Sixteen (9.8%) had at least one drug resistance mutation, predominantly non-nucleoside reverse transcriptase inhibitor-related mutations, observed mostly among female participants. This study shows that co-infection with HBV is present among HIV patients enrolling into HIV care in Zimbabwe, suggesting that HBV screening and monitoring programmes be strengthened in this context. J. Med. Virol. 89:257-266, 2017. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  17. Short-Term Dynamic and Local Epidemiological Trends in the South American HIV-1B Epidemic.

    Science.gov (United States)

    Junqueira, Dennis Maletich; de Medeiros, Rubia Marília; Gräf, Tiago; Almeida, Sabrina Esteves de Matos

    2016-01-01

    The human displacement and sexual behavior are the main factors driving the HIV-1 pandemic to the current profile. The intrinsic structure of the HIV transmission among different individuals has valuable importance for the understanding of the epidemic and for the public health response. The aim of this study was to characterize the HIV-1 subtype B (HIV-1B) epidemic in South America through the identification of transmission links and infer trends about geographical patterns and median time of transmission between individuals. Sequences of the protease and reverse transcriptase coding regions from 4,810 individuals were selected from GenBank. Maximum likelihood phylogenies were inferred and submitted to ClusterPicker to identify transmission links. Bayesian analyses were applied only for clusters including ≥5 dated samples in order to estimate the median maximum inter-transmission interval. This study analyzed sequences sampled from 12 South American countries, from individuals of different exposure categories, under different antiretroviral profiles, and from a wide period of time (1989-2013). Continentally, Brazil, Argentina and Venezuela were revealed important sites for the spread of HIV-1B among countries inside South America. Of note, from all the clusters identified about 70% of the HIV-1B infections are primarily occurring among individuals living in the same geographic region. In addition, these transmissions seem to occur early after the infection of an individual, taking in average 2.39 years (95% CI 1.48-3.30) to succeed. Homosexual/Bisexual individuals transmit the virus as quickly as almost half time of that estimated for the general population sampled here. Public health services can be broadly benefitted from this kind of information whether to focus on specific programs of response to the epidemic whether as guiding of prevention campaigns to specific risk groups.

  18. Short-Term Dynamic and Local Epidemiological Trends in the South American HIV-1B Epidemic.

    Directory of Open Access Journals (Sweden)

    Dennis Maletich Junqueira

    Full Text Available The human displacement and sexual behavior are the main factors driving the HIV-1 pandemic to the current profile. The intrinsic structure of the HIV transmission among different individuals has valuable importance for the understanding of the epidemic and for the public health response. The aim of this study was to characterize the HIV-1 subtype B (HIV-1B epidemic in South America through the identification of transmission links and infer trends about geographical patterns and median time of transmission between individuals. Sequences of the protease and reverse transcriptase coding regions from 4,810 individuals were selected from GenBank. Maximum likelihood phylogenies were inferred and submitted to ClusterPicker to identify transmission links. Bayesian analyses were applied only for clusters including ≥5 dated samples in order to estimate the median maximum inter-transmission interval. This study analyzed sequences sampled from 12 South American countries, from individuals of different exposure categories, under different antiretroviral profiles, and from a wide period of time (1989-2013. Continentally, Brazil, Argentina and Venezuela were revealed important sites for the spread of HIV-1B among countries inside South America. Of note, from all the clusters identified about 70% of the HIV-1B infections are primarily occurring among individuals living in the same geographic region. In addition, these transmissions seem to occur early after the infection of an individual, taking in average 2.39 years (95% CI 1.48-3.30 to succeed. Homosexual/Bisexual individuals transmit the virus as quickly as almost half time of that estimated for the general population sampled here. Public health services can be broadly benefitted from this kind of information whether to focus on specific programs of response to the epidemic whether as guiding of prevention campaigns to specific risk groups.

  19. Molecular docking, QSAR and ADMET based mining of natural compounds against prime targets of HIV.

    Science.gov (United States)

    Vora, Jaykant; Patel, Shivani; Sinha, Sonam; Sharma, Sonal; Srivastava, Anshu; Chhabria, Mahesh; Shrivastava, Neeta

    2018-01-07

    AIDS is one of the multifaceted diseases and this underlying complexity hampers its complete cure. The toxicity of existing drugs and emergence of multidrug-resistant virus makes the treatment worse. Development of effective, safe and low-cost anti-HIV drugs is among the top global priority. Exploration of natural resources may give ray of hope to develop new anti-HIV leads. Among the various therapeutic targets for HIV treatment, reverse transcriptase, protease, integrase, GP120, and ribonuclease are the prime focus. In the present study, we predicted potential plant-derived natural molecules for HIV treatment using computational approach, i.e. molecular docking, quantitative structure activity relationship (QSAR), and ADMET studies. Receptor-ligand binding studies were performed using three different software for precise prediction - Discovery studio 4.0, Schrodinger and Molegrow virtual docker. Docking scores revealed that Mulberrosides, Anolignans, Curcumin and Chebulic acid are promising candidates that bind with multi targets of HIV, while Neo-andrographolide, Nimbolide and Punigluconin were target-specific candidates. Subsequently, QSAR was performed using biologically proved compounds which predicted the biological activity of compounds. We identified Anolignans, Curcumin, Mulberrosides, Chebulic acid and Neo-andrographolide as potential natural molecules for HIV treatment from results of molecular docking and 3D-QSAR. In silico ADMET studies showed drug-likeness of these lead molecules. Structure similarities of identified lead molecules were compared with identified marketed drugs by superimposing both the molecules. Using in silico studies, we have identified few best fit molecules of natural origin against identified targets which may give new drugs to combat HIV infection after wet lab validation.

  20. Nevirapine and efavirenz elicit different changes in lipid profiles in antiretroviral-therapy-naive patients infected with HIV-1.

    Directory of Open Access Journals (Sweden)

    Frank van Leth

    2004-10-01

    Full Text Available BACKGROUND: Patients infected with HIV-1 initiating antiretroviral therapy (ART containing a non-nucleoside reverse transcriptase inhibitor (NNRTI show presumably fewer atherogenic lipid changes than those initiating most ARTs containing a protease inhibitor. We analysed whether lipid changes differed between the two most commonly used NNRTIs, nevirapine (NVP and efavirenz (EFV. METHODS AND FINDINGS: Prospective analysis of lipids and lipoproteins was performed in patients enrolled in the NVP and EFV treatment groups of the 2NN study who remained on allocated treatment during 48 wk of follow-up. Patients were allocated to NVP (n = 417, or EFV (n = 289 in combination with stavudine and lamivudine. The primary endpoint was percentage change over 48 wk in high-density lipoprotein cholesterol (HDL-c, total cholesterol (TC, TC:HDL-c ratio, non-HDL-c, low-density lipoprotein cholesterol, and triglycerides. The increase of HDL-c was significantly larger for patients receiving NVP (42.5% than for patients receiving EFV (33.7%; p = 0.036, while the increase in TC was lower (26.9% and 31.1%, respectively; p = 0.073, resulting in a decrease of the TC:HDL-c ratio for patients receiving NVP (-4.1% and an increase for patients receiving EFV (+5.9%; p < 0.001. The increase of non-HDL-c was smaller for patients receiving NVP (24.7% than for patients receiving EFV (33.6%; p = 0.007, as were the increases of triglycerides (20.1% and 49.0%, respectively; p < 0.001 and low-density lipoprotein cholesterol (35.0% and 40.0%, respectively; p = 0.378. These differences remained, or even increased, after adjusting for changes in HIV-1 RNA and CD4+ cell levels, indicating an effect of the drugs on lipids over and above that which may be explained by suppression of HIV-1 infection. The increases in HDL-c were of the same order of magnitude as those seen with the use of the investigational HDL-c-increasing drugs. CONCLUSION: NVP-containing ART shows larger increases in HDL

  1. Nanoformulations of Rilpivirine for Topical Pericoital and Systemic Coitus-Independent Administration Efficiently Prevent HIV Transmission

    Science.gov (United States)

    Date, Abhijit A.; Long, Julie M.; Nochii, Tomonori; Belshan, Michael; Shibata, Annemarie; Vincent, Heather; Baker, Caroline E.; Thayer, William O.; Kraus, Guenter; Lachaud-Durand, Sophie; Williams, Peter; Destache, Christopher J.; Garcia, J. Victor

    2015-01-01

    Vaginal HIV transmission accounts for the majority of new infections worldwide. Currently, multiple efforts to prevent HIV transmission are based on pre-exposure prophylaxis with various antiretroviral drugs. Here, we describe two novel nanoformulations of the reverse transcriptase inhibitor rilpivirine for pericoital and coitus-independent HIV prevention. Topically applied rilpivirine, encapsulated in PLGA nanoparticles, was delivered in a thermosensitive gel, which becomes solid at body temperature. PLGA nanoparticles with encapsulated rilpivirine coated the reproductive tract and offered significant protection to BLT humanized mice from a vaginal high-dose HIV-1 challenge. A different nanosuspension of crystalline rilpivirine (RPV LA), administered intramuscularly, protected BLT mice from a single vaginal high-dose HIV-1 challenge one week after drug administration. Using transmitted/founder viruses, which were previously shown to establish de novo infection in humans, we demonstrated that RPV LA offers significant protection from two consecutive high-dose HIV-1 challenges one and four weeks after drug administration. In this experiment, we also showed that, in certain cases, even in the presence of drug, HIV infection could occur without overt or detectable systemic replication until levels of drug were reduced. We also showed that infection in the presence of drug can result in acquisition of multiple viruses after subsequent exposures. These observations have important implications for the implementation of long-acting antiretroviral formulations for HIV prevention. They provide first evidence that occult infections can occur, despite the presence of sustained levels of antiretroviral drugs. Together, our results demonstrate that topically- or systemically administered rilpivirine offers significant coitus-dependent or coitus-independent protection from HIV infection. PMID:26271040

  2. Meta-analysis and time series modeling allow a systematic review of primary HIV-1 drug-resistant prevalence in Latin America and Caribbean.

    Science.gov (United States)

    Coelho, Antonio Victor Campos; De Moura, Ronald Rodrigues; Da Silva, Ronaldo Celerino; Kamada, Anselmo Jiro; Guimarães, Rafael Lima; Brandão, Lucas André Cavalcanti; Coelho, Hemílio Fernandes Campos; Crovella, Sergio

    2015-01-01

    Here we review the prevalence of HIV-1 primary drug resistance in Latin America and Caribbean using meta-analysis as well as time-series modeling. We also discuss whether there could be a drawback to HIV/AIDS programs due to drug resistance in Latin America and Caribbean in the next years. We observed that, although some studies report low or moderate primary drug resistance prevalence in Caribbean countries, this evidence needs to be updated. In other countries, such as Brazil and Argentina, the prevalence of drug resistance appears to be rising. Mutations conferring resistance against reverse transcriptase inhibitors were the most frequent in the analyzed populations (70% of all mutational events). HIV-1 subtype B was the most prevalent in Latin America and the Caribbean, although subtype C and B/F recombinants have significant contributions in Argentina and Brazil. Thus, we suggest that primary drug resistance in Latin America and the Caribbean could have been underestimated. Clinical monitoring should be improved to offer better therapy, reducing the risk for HIV-1 resistance emergence and spread, principally in vulnerable populations, such as men who have sex with men transmission group, sex workers and intravenous drug users.

  3. Profile of Mutations in the Reverse Transcriptase and Overlapping Surface Genes of Hepatitis B Virus (HBV) in Treatment-Naïve Indonesian HBV Carriers.

    Science.gov (United States)

    Yamani, Laura Navika; Yano, Yoshihiko; Utsumi, Takako; Wasityastuti, Widya; Rinonce, Hanggoro Tri; Widasari, Dewiyani Indah; Juniastuti; Lusida, Maria Inge; Soetjipto; Hayashi, Yoshitake

    2017-11-22

    Mutations in the reverse transcriptase (RT) region of the hepatitis B virus (HBV) genome are an important factor in low therapeutic effectiveness. Nonetheless, the prevalence of these mutations in HBV strains isolated previously in Indonesia has not been systematically examined. Therefore, in this study, we investigated the profile of mutations in the RT region and the associations of these mutations with amino acid changes in the surface protein in the virus of treatment-naïve Indonesian HBV carriers. Overall, 96 sequences of the full-length Indonesian HBV genomes (genotype B, n = 54; genotype C, n = 42) were retrieved from the National Center for Biotechnology Information. Naturally occurring primary and/or compensatory drug resistance mutations were found in 6/54 (11.1%) genotype B strains and in 1/42 (2.4%) genotype C strains. The potential mutations underlying resistance to a nucleos(t)ide analog and/or pretreatment mutations were more frequent in both genotypes but more frequent in genotype C strains than in genotype B strains. The A-B interdomain region in the RT gene was more frequently mutated in genotype C than in genotype B (3.51 ± 2.53 vs. 1.08 ± 1.52, P < 0.001). Knowledge about the mutational profiles of the RT gene and changes in the surface protein may help clinicians to select the most appropriate antiviral drug and vaccination or HBV immunoglobulin regimen for management of HBV infection in Indonesia.

  4. Humanized mice recapitulate key features of HIV-1 infection: a novel concept using long-acting anti-retroviral drugs for treating HIV-1.

    Directory of Open Access Journals (Sweden)

    Marc Nischang

    Full Text Available BACKGROUND: Humanized mice generate a lymphoid system of human origin subsequent to transplantation of human CD34+ cells and thus are highly susceptible to HIV infection. Here we examined the efficacy of antiretroviral treatment (ART when added to food pellets, and of long-acting (LA antiretroviral compounds, either as monotherapy or in combination. These studies shall be inspiring for establishing a gold standard of ART, which is easy to administer and well supported by the mice, and for subsequent studies such as latency. Furthermore, they should disclose whether viral breakthrough and emergence of resistance occurs similar as in HIV-infected patients when ART is insufficient. METHODS/PRINCIPAL FINDINGS: NOD/shi-scid/γ(cnull (NOG mice were used in all experimentations. We first performed pharmacokinetic studies of the drugs used, either added to food pellets (AZT, TDF, 3TC, RTV or in a LA formulation that permitted once weekly subcutaneous administration (TMC278: non-nucleoside reverse transcriptase inhibitor, TMC181: protease inhibitor. A combination of 3TC, TDF and TMC278-LA or 3TC, TDF, TMC278-LA and TMC181-LA suppressed the viral load to undetectable levels in 15/19 (79% and 14/14 (100% mice, respectively. In successfully treated mice, subsequent monotherapy with TMC278-LA resulted in viral breakthrough; in contrast, the two LA compounds together prevented viral breakthrough. Resistance mutations matched the mutations most commonly observed in HIV patients failing therapy. Importantly, viral rebound after interruption of ART, presence of HIV DNA in successfully treated mice and in vitro reactivation of early HIV transcripts point to an existing latent HIV reservoir. CONCLUSIONS/SIGNIFICANCE: This report is a unique description of multiple aspects of HIV infection in humanized mice that comprised efficacy testing of various treatment regimens, including LA compounds, resistance mutation analysis as well as viral rebound after treatment

  5. Early initiation of highly active antiretroviral therapy fails to reverse immunovirological abnormalities in gut-associated lymphoid tissue induced by acute HIV infection.

    Science.gov (United States)

    Tincati, Camilla; Biasin, Mara; Bandera, Alessandra; Violin, Michela; Marchetti, Giulia; Piacentini, Luca; Vago, Gian Luca; Balotta, Claudia; Moroni, Mauro; Franzetti, Fabio; Clerici, Mario; Gori, Andrea

    2009-01-01

    During the acute phase of HIV infection, large CD4+ T-cell depletion occurs in the gastrointestinal tract. The kinetics of CD4+ T-cell decrease and highly active antiretroviral therapy (HAART)-mediated immune reconstitution were evaluated. Rectosigmoid colonic (RSC) biopsies and blood samples of nine patients with acute HIV infection were collected. CD4+ T-cell count, HIV RNA, intracellular HIV DNA and messenger RNA cytokine expression were evaluated before and after 6 months of HAART. All nine patients presented symptomatic retroviral infection. Early HAART was associated with a sustained and comparable reduction of HIV RNA in plasma, peripheral blood mononuclear cells (PBMCs) and RSC biopsies. HIV DNA decreased in PBMCs, but was only marginally reduced in RSC biopsies. Comparisons between reduction rates of HIV DNA in these two compartments confirmed that HIV DNA clearance was less efficient in RSC biopsies compared with PBMCs. Assessment of immunological profiles in PBMCs and RSC biopsies showed that the T-helper (Th)1-like/Th2-like ratio was sharply decreased in RSC biopsies and increased in PBMCs throughout the study period. A persistent Th2-like profile was detected in RSC biopsies. Efficient clearing of HIV DNA observed in PBMCs correlated with the establishment of a more favourable Th1-like profile. A less efficient clearance of intracellular HIV DNA following early introduction of HAART is associated with persistent immunological impairment in gut-associated lymphoid tissue (GALT), which is reflected by the skewed expression of cytokines in this reservoir. The present study shows that early initiation of HAART, in the short-term, is not effective in containing the establishment of HIV infection and in reversing associated immunological GALT abnormalities.

  6. Telomerase reverse transcriptase locus polymorphisms and cancer risk: a field synopsis and meta-analysis.

    Science.gov (United States)

    Mocellin, Simone; Verdi, Daunia; Pooley, Karen A; Landi, Maria T; Egan, Kathleen M; Baird, Duncan M; Prescott, Jennifer; De Vivo, Immaculata; Nitti, Donato

    2012-06-06

    Several recent studies have provided evidence that polymorphisms in the telomerase reverse transcriptase (TERT) gene sequence are associated with cancer development, but a comprehensive synopsis is not available. We conducted a systematic review and meta-analysis of the available molecular epidemiology data regarding the association between TERT locus polymorphisms and predisposition to cancer. A systematic review of the English literature was conducted by searching PubMed, Embase, Cancerlit, Google Scholar, and ISI Web of Knowledge databases for studies on associations between TERT locus polymorphisms and cancer risk. Random-effects meta-analysis was performed to pool per-allele odds ratios for TERT locus polymorphisms and risk of cancer, and between-study heterogeneity and potential bias sources (eg, publication and chasing bias) were assessed. Because the TERT locus includes the cleft lip and palate transmembrane 1-like (CLPTM1L) gene, which is in linkage disequilibrium with TERT, CLPTM1L polymorphisms were also analyzed. Cumulative evidence for polymorphisms with statistically significant associations was graded as "strong," "moderate," and "weak" according to the Venice criteria. The joint population attributable risk was calculated for polymorphisms with strong evidence of association. Eighty-five studies enrolling 490 901 subjects and reporting on 494 allelic contrasts were retrieved. Data were available on 67 TERT locus polymorphisms and 24 tumor types, for a total of 221 unique combinations of polymorphisms and cancer types. Upon meta-analysis, a statistically significant association with the risk of any cancer type was found for 22 polymorphisms. Strong, moderate, and weak cumulative evidence for association with at least one tumor type was demonstrated for 11, 9, and 14 polymorphisms, respectively. For lung cancer, which was the most studied tumor type, the estimated joint population attributable risk for three polymorphisms (TERT rs2736100, intergenic

  7. Tetrahymena telomerase protein p65 induces conformational changes throughout telomerase RNA (TER) and rescues telomerase reverse transcriptase and TER assembly mutants.

    Science.gov (United States)

    Berman, Andrea J; Gooding, Anne R; Cech, Thomas R

    2010-10-01

    The biogenesis of the Tetrahymena telomerase ribonucleoprotein particle (RNP) is enhanced by p65, a La family protein. Single-molecule and biochemical studies have uncovered a hierarchical assembly of the RNP, wherein the binding of p65 to stems I and IV of telomerase RNA (TER) causes a conformational change that facilitates the subsequent binding of telomerase reverse transcriptase (TERT) to TER. We used purified p65 and variants of TERT and TER to investigate the conformational rearrangements that occur during RNP assembly. Nuclease protection assays and mutational analysis revealed that p65 interacts with and stimulates conformational changes in regions of TER beyond stem IV. Several TER mutants exhibited telomerase activity only in the presence of p65, revealing the importance of p65 in promoting the correct RNP assembly pathway. In addition, p65 rescued TERT assembly mutants but not TERT activity mutants. Taken together, these results suggest that p65 stimulates telomerase assembly and activity in two ways. First, by sequestering stems I and IV, p65 limits the ensemble of structural conformations of TER, thereby presenting TERT with the active conformation of TER. Second, p65 acts as a molecular buttress within the assembled RNP, mutually stabilizing TER and TERT in catalytically active conformations.

  8. Selection of HIV resistance associated with antiretroviral therapy initiated due to pregnancy and suspended postpartum.

    Science.gov (United States)

    Ellis, Giovanina M; Huang, Sharon; Hitti, Jane; Frenkel, Lisa M

    2011-11-01

    Compare the risk of HIV drug resistance in women stopping suppressive nelfinavir (NFV)-based or Nevirapine (NVP)-based antiretroviral therapy (ART) after pregnancy. Specimens collected after stopping ART were tested for drug resistance by an oligonucleotide ligation assay and consensus sequencing. When postpartum drug resistance was detected, specimens obtained at study entry and during ART were evaluated. Sixteen of 38 women with ART-induced suppression of viral replication suspended ART postpartum. Resistance mutations were detected in 75% who stopped NFV-ART and in 50% who stopped NVP-ART. M184V, associated with Lamivudine resistance, was more frequent among those randomized to NFV-ART compared with NVP-ART (6 of 8 versus 1 of 8; P = 0.04), and nonnucleoside reverse transcriptase inhibitor resistance was detected in 4 of 8 stopping NVP-ART. HIV drug resistance was frequently observed among women who stopped suppressive NVP-ART or NFV-ART postpartum. This suggests that NFV-ART may have suboptimal potency, that staggering discontinuation of NVP-ART may be warranted, and/or ART adherence may be lax in women who choose to stop ART postpartum.

  9. Intracellular HIV-1 Gag localization is impaired by mutations in the nucleocapsid zinc fingers

    Directory of Open Access Journals (Sweden)

    Muriaux Delphine

    2007-08-01

    Full Text Available Abstract Background The HIV-1 nucleocapsid protein (NC is formed of two CCHC zinc fingers flanked by highly basic regions. HIV-1 NC plays key roles in virus structure and replication via its nucleic acid binding and chaperoning properties. In fact, NC controls proviral DNA synthesis by reverse transcriptase (RT, gRNA dimerization and packaging, and virion assembly. Results We previously reported a role for the first NC zinc finger in virion structure and replication 1. To investigate the role of both NC zinc fingers in intracellular Gag trafficking, and in virion assembly, we generated series of NC zinc fingers mutations. Results show that all Zinc finger mutations have a negative impact on virion biogenesis and maturation and rendered defective the mutant viruses. The NC zinc finger mutations caused an intracellular accumulation of Gag, which was found either diffuse in the cytoplasm or at the plasma membrane but not associated with endosomal membranes as for wild type Gag. Evidences are also provided showing that the intracellular interactions between NC-mutated Gag and the gRNA were impaired. Conclusion These results show that Gag oligomerization mediated by gRNA-NC interactions is required for correct Gag trafficking, and assembly in HIV-1 producing cells and the release of infectious viruses.

  10. Feline coronavirus quantitative reverse transcriptase polymerase chain reaction on effusion samples in cats with and without feline infectious peritonitis.

    Science.gov (United States)

    Longstaff, Louise; Porter, Emily; Crossley, Victoria J; Hayhow, Sophie E; Helps, Christopher R; Tasker, Séverine

    2017-02-01

    Objectives The aim of the study was to determine whether feline coronavirus (FCoV) RNA in effusion samples can be used as a diagnostic marker of feline infectious peritonitis (FIP); and in FCoV RNA-positive samples to examine amino acid codons in the FCoV spike protein at positions 1058 and 1060 where leucine and alanine, respectively, have been associated with systemic or virulent (FIP) FCoV infection. Methods Total RNA was extracted from effusion samples from 20 cats with confirmed FIP and 23 cats with other diseases. Feline coronavirus RNA was detected using a reverse transcriptase quantitative polymerase chain reaction assay (qRT-PCR), and positive samples underwent pyrosequencing of position 1058 with or without Sanger sequencing of position 1060 in the FCoV spike protein. Results Seventeen (85%) of the effusion samples from 20 cats with FIP were positive for FCoV RNA, whereas none of the 23 cats with other diseases were positive. Pyrosequencing of the 17 FCoV-positive samples showed that 11 (65%) of the cats had leucine and two (12%) had methionine at position 1058. Of the latter two samples with methionine, one had alanine at position 1060. Conclusions and relevance A positive FCoV qRT-PCR result on effusions appears specific for FIP and may be a useful diagnostic marker for FIP in cats with effusions. The majority of FCoVs contained amino acid changes previously associated with systemic spread or virulence (FIP) of the virus.

  11. RELATED FACTORS FOR COLONIZATION BY Candida SPECIES IN THE ORAL CAVITY OF HIV-INFECTED INDIVIDUALS

    Directory of Open Access Journals (Sweden)

    Ralciane de Paula MENEZES

    2015-10-01

    Full Text Available The colonization of the oral cavity is a prerequisite to the development of oropharyngeal candidiasis. Aims: The aims of this study were: to evaluate colonization and quantify Candida spp. in the oral cavity; to determine the predisposing factors for colonization; and to correlate the levels of CD4+ cells and viral load with the yeast count of colony forming units per milliliter (CFU/mL in HIV-positive individuals treated at a University Hospital. Saliva samples were collected from 147 HIV patients and were plated on Sabouraud Dextrose Agar (SDA and chromogenic agar, and incubated at 30 ºC for 72 h. Colonies with similar morphology in both media were counted and the result expressed in CFU/mL. Results: Of the 147 HIV patients, 89 had positive cultures for Candida spp., with a total of 111 isolates, of which C. albicans was the most frequent species (67.6%, and the mean of colonies counted was 8.8 × 10³ CFU/mL. The main predisposing factors for oral colonization by Candida spp. were the use of antibiotics and oral prostheses. The use of reverse transcriptase inhibitors appears to have a greater protective effect for colonization. A low CD4+ T lymphocyte count is associated with a higher density of yeast in the saliva of HIV patients.

  12. Emergent HIV-1 Drug Resistance Mutations Were Not Present at Low-Frequency at Baseline in Non-Nucleoside Reverse Transcriptase Inhibitor-Treated Subjects in the STaR Study.

    Science.gov (United States)

    Porter, Danielle P; Daeumer, Martin; Thielen, Alexander; Chang, Silvia; Martin, Ross; Cohen, Cal; Miller, Michael D; White, Kirsten L

    2015-12-07

    At Week 96 of the Single-Tablet Regimen (STaR) study, more treatment-naïve subjects that received rilpivirine/emtricitabine/tenofovir DF (RPV/FTC/TDF) developed resistance mutations compared to those treated with efavirenz (EFV)/FTC/TDF by population sequencing. Furthermore, more RPV/FTC/TDF-treated subjects with baseline HIV-1 RNA >100,000 copies/mL developed resistance compared to subjects with baseline HIV-1 RNA ≤100,000 copies/mL. Here, deep sequencing was utilized to assess the presence of pre-existing low-frequency variants in subjects with and without resistance development in the STaR study. Deep sequencing (Illumina MiSeq) was performed on baseline and virologic failure samples for all subjects analyzed for resistance by population sequencing during the clinical study (n = 33), as well as baseline samples from control subjects with virologic response (n = 118). Primary NRTI or NNRTI drug resistance mutations present at low frequency (≥2% to 20%) were detected in 6.6% of baseline samples by deep sequencing, all of which occurred in control subjects. Deep sequencing results were generally consistent with population sequencing but detected additional primary NNRTI and NRTI resistance mutations at virologic failure in seven samples. HIV-1 drug resistance mutations emerging while on RPV/FTC/TDF or EFV/FTC/TDF treatment were not present at low frequency at baseline in the STaR study.

  13. Emergent HIV-1 Drug Resistance Mutations Were Not Present at Low-Frequency at Baseline in Non-Nucleoside Reverse Transcriptase Inhibitor-Treated Subjects in the STaR Study

    Directory of Open Access Journals (Sweden)

    Danielle P. Porter

    2015-12-01

    Full Text Available At Week 96 of the Single-Tablet Regimen (STaR study, more treatment-naïve subjects that received rilpivirine/emtricitabine/tenofovir DF (RPV/FTC/TDF developed resistance mutations compared to those treated with efavirenz (EFV/FTC/TDF by population sequencing. Furthermore, more RPV/FTC/TDF-treated subjects with baseline HIV-1 RNA >100,000 copies/mL developed resistance compared to subjects with baseline HIV-1 RNA ≤100,000 copies/mL. Here, deep sequencing was utilized to assess the presence of pre-existing low-frequency variants in subjects with and without resistance development in the STaR study. Deep sequencing (Illumina MiSeq was performed on baseline and virologic failure samples for all subjects analyzed for resistance by population sequencing during the clinical study (n = 33, as well as baseline samples from control subjects with virologic response (n = 118. Primary NRTI or NNRTI drug resistance mutations present at low frequency (≥2% to 20% were detected in 6.6% of baseline samples by deep sequencing, all of which occurred in control subjects. Deep sequencing results were generally consistent with population sequencing but detected additional primary NNRTI and NRTI resistance mutations at virologic failure in seven samples. HIV-1 drug resistance mutations emerging while on RPV/FTC/TDF or EFV/FTC/TDF treatment were not present at low frequency at baseline in the STaR study.

  14. High-throughput screening using pseudotyped lentiviral particles: a strategy for the identification of HIV-1 inhibitors in a cell-based assay.

    Science.gov (United States)

    Garcia, Jean-Michel; Gao, Anhui; He, Pei-Lan; Choi, Joyce; Tang, Wei; Bruzzone, Roberto; Schwartz, Olivier; Naya, Hugo; Nan, Fa-Jun; Li, Jia; Altmeyer, Ralf; Zuo, Jian-Ping

    2009-03-01

    Two decades after its discovery the human immunodeficiency virus (HIV) is still spreading worldwide and killing millions. There are 25 drugs formally approved for HIV currently on the market, but side effects as well as the emergence of HIV strains showing single or multiple resistances to current drug-therapy are causes for concern. Furthermore, these drugs target only 4 steps of the viral cycle, hence the urgent need for new drugs and also new targets. In order to tackle this problem, we have devised a cell-based assay using lentiviral particles to look for post-entry inhibitors of HIV-1. We report here the assay development, validation as well as confirmation of the hits using both wild-type and drug-resistant HIV-1 viruses. The screening was performed on an original library, rich in natural compounds and pure molecules from Traditional Chinese Medicine pharmacopoeia, which had never been screened for anti-HIV activity. The identified hits belong to four chemical sub-families that appear to be all non-nucleoside reverse transcriptase inhibitors (NNRTIs). Secondary tests with live viruses showed that there was good agreement with pseudotyped particles, confirming the validity of this approach for high-throughput drug screens. This assay will be a useful tool that can be easily adapted to screen for inhibitors of viral entry.

  15. Optimizing HIV-1 protease production in Escherichia coli as fusion protein

    Directory of Open Access Journals (Sweden)

    Piubelli Luciano

    2011-06-01

    Full Text Available Abstract Background Human immunodeficiency virus (HIV is the etiological agent in AIDS and related diseases. The aspartyl protease encoded by the 5' portion of the pol gene is responsible for proteolytic processing of the gag-pol polyprotein precursor to yield the mature capsid protein and the reverse transcriptase and integrase enzymes. The HIV protease (HIV-1Pr is considered an attractive target for designing inhibitors which could be used to tackle AIDS and therefore it is still the object of a number of investigations. Results A recombinant human immunodeficiency virus type 1 protease (HIV-1Pr was overexpressed in Escherichia coli cells as a fusion protein with bacterial periplasmic protein dithiol oxidase (DsbA or glutathione S-transferase (GST, also containing a six-histidine tag sequence. Protein expression was optimized by designing a suitable HIV-1Pr cDNA (for E. coli expression and to avoid autoproteolysis and by screening six different E. coli strains and five growth media. The best expression yields were achieved in E. coli BL21-Codon Plus(DE3-RIL host and in TB or M9 medium to which 1% (w/v glucose was added to minimize basal expression. Among the different parameters assayed, the presence of a buffer system (based on phosphate salts and a growth temperature of 37°C after adding IPTG played the main role in enhancing protease expression (up to 10 mg of chimeric DsbA:HIV-1Pr/L fermentation broth. GST:HIVPr was in part (50% produced as soluble protein while the overexpressed DsbA:HIV-1Pr chimeric protein largely accumulated in inclusion bodies as unprocessed fusion protein. A simple refolding procedure was developed on HiTrap Chelating column that yielded a refolded DsbA:HIV-1Pr with a > 80% recovery. Finally, enterokinase digestion of resolubilized DsbA:HIV-1Pr gave more than 2 mg of HIV-1Pr per liter of fermentation broth with a purity ≤ 80%, while PreScission protease cleavage of soluble GST:HIVPr yielded ~ 0.15 mg of pure HIV-1

  16. Synergy against drug-resistant HIV-1 with the microbicide antiretrovirals, dapivirine and tenofovir, in combination.

    Science.gov (United States)

    Schader, Susan M; Colby-Germinario, Susan P; Schachter, Jordana R; Xu, Hongtao; Wainberg, Mark A

    2011-08-24

    To evaluate the candidate antiretroviral microbicide compounds, dapivirine (DAP) and tenofovir (TFV), alone and in combination against the transmission of wild-type and nonnucleoside reverse transcriptase inhibitor (NNRTI)-resistant HIV-1 from different subtypes. We determined single-drug efficacy of the RTIs, DAP and TFV, against subtype B and non-B wild-type and NNRTI-resistant HIV-1 in vitro. To assess breadth of activity, compounds were tested alone and in combination against wild-type and NNRTI-resistant subtype C primary HIV-1 isolates and complimentary clonal HIV-1 from subtypes B, C and CRF02_AG to control for viral variation. Early infection was quantified by counting light units emitted from TZM-bl cells less than 48-h postinfection. Combination ratios were based on drug inhibitory concentrations (IC(50)s) and combined effects were determined by calculating combination indices. Both candidate microbicide antiretrovirals demonstrated potent anti-NNRTI-resistant HIV-1 activity in vitro, albeit the combination protected better than the single-drug treatments. Of particular interest, the DAP with TFV combination exhibited synergy (50% combination index, CI(50) = 0.567) against subtype C NNRTI-resistant HIV-1, whereas additivity (CI(50) = 0.987) was observed against the wild-type counterpart from the same patient. The effect was not compounded by the presence of subdominant viral fractions, as experiments using complimentary clonal subtype C wild-type (CI(50) = 0.968) and NNRTI-resistant (CI(50) = 0.672) HIV-1, in lieu of the patient quasispecies, gave similar results. This study supports the notion that antiretroviral drug combinations may retain antiviral activity against some drug-resistant HIV-1 despite subtype classification and quasispecies diversity.

  17. Diabetes mellitus in HIV-infected patients receiving antiretroviral ...

    African Journals Online (AJOL)

    Primary analysis using conditional logistic regression was employed to estimate univariate .... Refers to first-line regimen in Botswana – either non-nucleoside reverse transcriptase inhibitor-based regimen (NVP or. EFV) or .... Public Health.

  18. Historical development of vaginal microbicides to prevent sexual transmission of HIV in women: from past failures to future hopes.

    Science.gov (United States)

    Notario-Pérez, Fernando; Ruiz-Caro, Roberto; Veiga-Ochoa, María-Dolores

    2017-01-01

    Infection with human immunodeficiency virus (HIV) remains a global public health concern and is particularly serious in low- and middle-income countries. Widespread sexual violence and poverty, among other factors, increase the risk of infection in women, while currently available prevention methods are outside the control of most. This has driven the study of vaginal microbicides to prevent sexual transmission of HIV from men to women in recent decades. The first microbicides evaluated were formulated as gels for daily use and contained different substances such as surfactants, acidifiers and monoclonal antibodies, which failed to demonstrate efficacy in clinical trials. A gel containing the reverse transcriptase inhibitor tenofovir showed protective efficacy in women. However, the lack of adherence by patients led to the search for dosage forms capable of releasing the active principle for longer periods, and hence to the emergence of the vaginal ring loaded with dapivirine, which requires a monthly application and is able to reduce the sexual transmission of HIV. The future of vaginal microbicides will feature the use of alternative dosage forms, nanosystems for drug release and probiotics, which have emerged as potential microbicides but are still in the early stages of development. Protecting women with vaginal microbicide formulations would, therefore, be a valuable tool for avoiding sexual transmission of HIV.

  19. HIV-associated Lipodystrophy Syndrome: A Review of Clinical Aspects

    Directory of Open Access Journals (Sweden)

    Jean-Guy Baril

    2005-01-01

    Full Text Available Approximately two years after the introduction of highly active antiretroviral therapy for the treatment of HIV infection, body shape changes and metabolic abnormalities were increasingly observed. Initially, these were ascribed to protease inhibitors, but it is now clear that nucleoside reverse transcriptase inhibitors also contribute to lipodystrophy syndrome. The syndrome groups together clinical conditions describing changes in body fat distribution that include lipoatrophy, lipoaccumulation or both. However, there does not appear to be a direct link between lipoatrophy and lipoaccumulation that would support a single mechanism for the redistribution of body fat. Currently, there is no clear definition of lipodystrophy, which explains the difficulty in determining its prevalence and etiology. There are no current guidelines for the treatment of fat distribution abnormalities that occur in the absence of other metabolic complications. The present article reviews the current state of knowledge of the definition, symptoms, risk factors, pathogenesis, diagnosis and treatment of the morphological changes associated with lipodystrophy syndrome.

  20. HIV-associated lipodystrophy syndrome: A review of clinical aspects

    Science.gov (United States)

    Baril, Jean-Guy; Junod, Patrice; LeBlanc, Roger; Dion, Harold; Therrien, Rachel; Laplante, François; Falutz, Julian; Côté, Pierre; Hébert, Marie-Nicole; Lalonde, Richard; Lapointe, Normand; Lévesque, Dominic; Pinault, Lyse; Rouleau, Danielle; Tremblay, Cécile; Trottier, Benoît; Trottier, Sylvie; Tsoukas, Chris; Weiss, Karl

    2005-01-01

    Approximately two years after the introduction of highly active antiretroviral therapy for the treatment of HIV infection, body shape changes and metabolic abnormalities were increasingly observed. Initially, these were ascribed to protease inhibitors, but it is now clear that nucleoside reverse transcriptase inhibitors also contribute to lipodystrophy syndrome. The syndrome groups together clinical conditions describing changes in body fat distribution that include lipoatrophy, lipoaccumulation or both. However, there does not appear to be a direct link between lipoatrophy and lipoaccumulation that would support a single mechanism for the redistribution of body fat. Currently, there is no clear definition of lipodystrophy, which explains the difficulty in determining its prevalence and etiology. There are no current guidelines for the treatment of fat distribution abnormalities that occur in the absence of other metabolic complications. The present article reviews the current state of knowledge of the definition, symptoms, risk factors, pathogenesis, diagnosis and treatment of the morphological changes associated with lipodystrophy syndrome. PMID:18159551