Copper transporters and chaperones CTR1, CTR2, ATOX1, and CCS as determinants of cisplatin sensitivity.

Science.gov (United States)

Bompiani, Kristin M; Tsai, Cheng-Yu; Achatz, Felix P; Liebig, Janika K; Howell, Stephen B

2016-09-01

The development of resistance to cisplatin (cDDP) is commonly accompanied by reduced drug uptake or increased efflux. Previous studies in yeast and murine embryonic fibroblasts have reported that the copper (Cu) transporters and chaperones participate in the uptake, efflux, and intracellular distribution of cDDP. However, there is conflicting data from studies in human cells. We used CRISPR-Cas9 genome editing to individually knock out the human copper transporters CTR1 and CTR2 and the copper chaperones ATOX1 and CCS. Isogenic knockout cell lines were generated in both human HEK-293T and ovarian carcinoma OVCAR8 cells. All knockout cell lines had slowed growth compared to parental cells, small changes in basal Cu levels, and varying sensitivities to Cu depending on the gene targeted. However, all of the knockouts demonstrated only modest 2 to 5-fold changes in cDDP sensitivity that did not differ from the range of sensitivities of 10 wild type clones grown from the same parental cell population. We conclude that, under basal conditions, loss of CTR1, CTR2, ATOX1, or CCS does not produce a change in cisplatin sensitivity that exceeds the variance found within the parental population, suggesting that they are not essential to the mechanism by which cDDP enters these cell lines and is transported to the nucleus.

Central móvil de hormigón asfáltico

Directory of Open Access Journals (Sweden)

Editorial, Equipo

1959-11-01

Full Text Available En números anteriores se han publicado varios tipos de centrales hormigoneras, y entre ellas una para la preparación de hormigones asfálticos. El tipo de Central que se describe ligeramente en este trabajo, de la casa Braham Patterson & Benham Ltd, inglesa, presenta su particularidad propia e interés dentro del campo de rendimiento de producción del orden de 25 toneladas por hora.

The H1 linker histones: multifunctional proteins beyond the nucleosomal core particle.

Science.gov (United States)

Hergeth, Sonja P; Schneider, Robert

2015-11-01

The linker histone H1 family members are a key component of chromatin and bind to the nucleosomal core particle around the DNA entry and exit sites. H1 can stabilize both nucleosome structure and higher-order chromatin architecture. In general, H1 molecules consist of a central globular domain with more flexible tail regions at both their N- and C-terminal ends. The existence of multiple H1 subtypes and a large variety of posttranslational modifications brings about a considerable degree of complexity and makes studying this protein family challenging. Here, we review recent progress in understanding the function of linker histones and their subtypes beyond their role as merely structural chromatin components. We summarize current findings on the role of H1 in heterochromatin formation, transcriptional regulation and embryogenesis with a focus on H1 subtypes and their specific modifications. © 2015 The Authors.

Information encoded in non-native states drives substrate-chaperone pairing.

Science.gov (United States)

Mapa, Koyeli; Tiwari, Satyam; Kumar, Vignesh; Jayaraj, Gopal Gunanathan; Maiti, Souvik

2012-09-05

Many proteins refold in vitro through kinetic folding intermediates that are believed to be by-products of native-state centric evolution. These intermediates are postulated to play only minor roles, if any, in vivo because they lack any information related to translation-associated vectorial folding. We demonstrate that refolding intermediate of a test protein, generated in vitro, is able to find its cognate chaperone, from the whole complement of Escherichia coli soluble chaperones. Cognate chaperone-binding uniquely alters the conformation of non-native substrate. Importantly, precise chaperone targeting of substrates are maintained as long as physiological molar ratios of chaperones remain unaltered. Using a library of different chaperone substrates, we demonstrate that kinetically trapped refolding intermediates contain sufficient structural features for precise targeting to cognate chaperones. We posit that evolution favors sequences that, in addition to coding for a functional native state, encode folding intermediates with higher affinity for cognate chaperones than noncognate ones. Copyright © 2012 Elsevier Ltd. All rights reserved.

Factores asociados con la compacidad final de los concretos asfálticos

Directory of Open Access Journals (Sweden)

Jorge Tamayo T.

1982-09-01

Full Text Available Se reconoce universalmente el alto grado de dependencia de las propiedades fundamentales que exhiben las capas de concreto asfáltico con su nivel de compacidad, por lo cual resulta importante estudiar los aspectos principales asociados con la optimización de esta característica. Resulta particularmente importante conocer las propiedades de los agregados en cuanto a su naturaleza, distribución granulométrica, tipo de llenante, forma de las partículas, así como las del asfalto en función de su comportamiento reológico y las relaciones entre estos ingredientes. En razón de la naturaleza termoplástica de las mezclas asfálticas, el control de la temperatura y la evolución de la misma por medio de las diversas fases del proceso, resulta determinante en la compacidad final. Otros factores igualmente incidentes son: la programación racional de las actividades, los equipos empleados y la secuencia de la compactación. Este documento pretende presentar algunas ideas sobre estos aspectos que permiten mejorar las prácticas constructivas existentes con miras a optimizar el comportamiento de los pavimentos flexibles.

The Role of Co-chaperones in Synaptic Proteostasis and Neurodegenerative Disease

Directory of Open Access Journals (Sweden)

Erica L. Gorenberg

2017-05-01

Full Text Available Synapses must be preserved throughout an organism's lifespan to allow for normal brain function and behavior. Synapse maintenance is challenging given the long distances between the termini and the cell body, reliance on axonal transport for delivery of newly synthesized presynaptic proteins, and high rates of synaptic vesicle exo- and endocytosis. Hence, synapses rely on efficient proteostasis mechanisms to preserve their structure and function. To this end, the synaptic compartment has specific chaperones to support its functions. Without proper synaptic chaperone activity, local proteostasis imbalances lead to neurotransmission deficits, dismantling of synapses, and neurodegeneration. In this review, we address the roles of four synaptic chaperones in the maintenance of the nerve terminal, as well as their genetic links to neurodegenerative disease. Three of these are Hsp40 co-chaperones (DNAJs: Cysteine String Protein alpha (CSPα; DNAJC5, auxilin (DNAJC6, and Receptor-Mediated Endocytosis 8 (RME-8; DNAJC13. These co-chaperones contain a conserved J domain through which they form a complex with heat shock cognate 70 (Hsc70, enhancing the chaperone's ATPase activity. CSPα is a synaptic vesicle protein known to chaperone the t-SNARE SNAP-25 and the endocytic GTPase dynamin-1, thereby regulating synaptic vesicle exocytosis and endocytosis. Auxilin binds assembled clathrin cages, and through its interactions with Hsc70 leads to the uncoating of clathrin-coated vesicles, a process necessary for the regeneration of synaptic vesicles. RME-8 is a co-chaperone on endosomes and may have a role in clathrin-coated vesicle endocytosis on this organelle. These three co-chaperones maintain client function by preserving folding and assembly to prevent client aggregation, but they do not break down aggregates that have already formed. The fourth synaptic chaperone we will discuss is Heat shock protein 110 (Hsp110, which interacts with Hsc70, DNAJAs, and

The H1 histone-specific proteinase is associated with nuclear matrix and stimulated by DNA containing breaks of denatured sites

International Nuclear Information System (INIS)

Gaziev, A.I.; Kutsyj, M.P.

1988-01-01

Discovery of proteinase in nuclear matrix specific of H1 histone and dependent presence of breaks or denatured sites in DNA permits to assume that the given enzyme, obviously, participates in replication and DNA repair, in regulation of genes expression. Removal of H1 histone by proteinase is, probably, necessary for procedure of these processes, and, obviously, this proteinase suffers conformational changes in the composition of the DNA-histone complex. H1 histone disintegration in nucleohistone containing damaged sites of DNA by specific proteinase, probably, represents one of the mechanisms for providing DNA repair in cells of higher organisms

Histone H1(0) mapping using monoclonal antibodies.

Science.gov (United States)

Dousson, S; Gorka, C; Gilly, C; Lawrence, J J

1989-06-01

Monoclonal antibodies (mAb) to ox liver histone H1 degree were produced and characterized. Two sets of mice were immunized either with pure H1(0) or with an H1(0)-yeast tRNA complex. Eleven hybridomas of various clonal origin were selected. Typing of the antibodies indicated that all but three IgM belonged to the IgG1 class and contained kappa light chains. Immunoblotting experiments using peptides derived from H1(0) or H5 treated by various proteolytic agents (trypsin, N-bromosuccinimide, cyanogen bromide, acetic acid), revealed that nine of the mAb reacted with the globular part of H1(0). More advanced characterization of the antigenic determinants allowed us to determine distinct regions within this globular part which are involved in the antigenic recognition. The peptopes could be subdivided into two groups. Three mAb bound to residues 24-27 and were specific for H1(0). Six mAb bound to residues 27-30 and were specific for H1(0) except one of them which strongly cross-reacted with H5 and GH5. Two mAb reacted with the entire histone H1(0) but failed to react with any of the peptides, suggesting that the corresponding epitope is a conformational antigenic determinant. In order to confirm the localization of the two distinct regions which are involved in the antigenic recognition, a synthetic decapeptide corresponding to the beginning of human H1(0) globular part (from residue 19 to residue 28) was synthesized. Inhibition experiments of the reaction between H1(0) and the various IgG1 mAb by increasing amounts of peptide-bovine serum albumin conjugates were then performed.

Chemical chaperones exceed the chaperone effects of RIC-3 in promoting assembly of functional α7 AChRs.

Directory of Open Access Journals (Sweden)

Alexander Kuryatov

Full Text Available Functional α7 nicotinic acetylcholine receptors (AChRs do not assemble efficiently in cells transfected with α7 subunits unless the cells are also transfected with the chaperone protein RIC-3. Despite the presence of RIC-3, large amounts of these subunits remain improperly assembled. Thus, additional chaperone proteins are probably required for efficient assembly of α7 AChRs. Cholinergic ligands can act as pharmacological chaperones to promote assembly of mature AChRs and upregulate the amount of functional AChRs. In addition, we have found that the chemical chaperones 4-phenylbutyric acid (PBA and valproic acid (VPA greatly increase the amount of functional α7 AChRs produced in a cell line expressing both α7 and RIC-3. Increased α7 AChR expression allows assay of drug action using a membrane potential-sensitive fluorescent indicator. Both PBA and VPA also increase α7 expression in the SH-SY5Y neuroblastoma cell line that endogenously expresses α7 AChRs. VPA increases expression of endogenous α7 AChRs in hippocampal neurons but PBA does not. RIC-3 is insufficient for optimal assembly of α7 AChRs, but provides assay conditions for detecting additional chaperones. Chemical chaperones are a useful pragmatic approach to express high levels of human α7 AChRs for drug selection and characterization and possibly to increase α7 expression in vivo.

Dicarbonyl Induced Structural Perturbations Make Histone H1 Highly Immunogenic and Generate an Auto-Immune Response in Cancer.

Directory of Open Access Journals (Sweden)

Abdul Rouf Mir

Full Text Available Increased oxidative stress under hyperglycemic conditions, through the interaction of AGEs with RAGE receptors and via activation of interleukin mediated transcription signalling, has been reported in cancer. Proteins modifications are being explored for their roles in the development and progression of cancer and autoantibody response against them is gaining interest as a probe for early detection of the disease. This study has analysed the changes in histone H1 upon modification by methylglyoxal (MG and its implications in auto-immunopathogenesis of cancer. Modified histone showed modifications in the aromatic residues, changed tyrosine microenvironment, intermolecular cross linking and generation of AGEs. It showed masking of hydrophobic patches and a hypsochromic shift in the in ANS specific fluorescence. MG aggressively oxidized histone H1 leading to the accumulation of reactive carbonyls. Far UV CD measurements showed di-carbonyl induced enhancement of the alpha structure and the induction of beta sheet conformation; and thermal denaturation (Tm studies confirmed the thermal stability of the modified histone. FTIR analysis showed amide I band shift, generation of a carboxyethyl group and N-Cα vibrations in the modified histone. LCMS analysis confirmed the formation of Nε-(carboxyethyllysine and electron microscopic studies revealed the amorphous aggregate formation. The modified histone showed altered cooperative binding with DNA. Modified H1 induced high titre antibodies in rabbits and the IgG isolated form sera of rabbits immunized with modified H1 exhibited specific binding with its immunogen in Western Blot analysis. IgG isolated from the sera of patients with lung cancer, prostate cancer, breast cancer and cancer of head and neck region showed better recognition for neo-epitopes on the modified histone, reflecting the presence of circulating autoantibodies in cancer. Since reports suggest a link between AGE-RAGE axis and

Murine hematopoietic stem cell dormancy controlled by induction of a novel short form of PSF1 by histone deacetylase inhibitors

International Nuclear Information System (INIS)

Han, Yinglu; Gong, Zhi-Yuan; Takakura, Nobuyuki

2015-01-01

Hematopoietic stem cells (HSCs) can survive long-term in a state of dormancy. Little is known about how histone deacetylase inhibitors (HDACi) affect HSC kinetics. Here, we use trichostatin A (TSA), a histone deacetylase inhibitor, to enforce histone acetylation and show that this suppresses cell cycle entry by dormant HSCs. Previously, we found that haploinsufficiency of PSF1, a DNA replication factor, led to attenuation of the bone marrow (BM) HSC pool size and lack of acute proliferation after 5-FU ablation. Because PSF1 protein is present in CD34 + transiently amplifying HSCs but not in CD34 − long-term reconstituting-HSCs which are resting in a dormant state, we analyzed the relationship between dormancy and PSF1 expression, and how a histone deacetylase inhibitor affects this. We found that CD34 + HSCs produce long functional PSF1 (PSF1a) but CD34 − HSCs produce a shorter possibly non-functional PSF1 (PSF1b, c, dominantly PSF1c). Using PSF1a-overexpressing NIH-3T3 cells in which the endogenous PSF1 promoter is suppressed, we found that TSA treatment promotes production of the shorter form of PSF1 possibly by inducing recruitment of E2F family factors upstream of the PSF1 transcription start site. Our data document one mechanism by which histone deacetylase inhibitors affect the dormancy of HSCs by regulating the DNA replication factor PSF1. - Highlights: • Hematopoetic stem cell dormancy is controlled by histone deacetylation inhibitors. • Dormancy of HSCs is associated with a shorter form of non-functional PSF1. • Histone deacetylase inhibitors suppress PSF1 promoter activity

Murine hematopoietic stem cell dormancy controlled by induction of a novel short form of PSF1 by histone deacetylase inhibitors

Energy Technology Data Exchange (ETDEWEB)

Han, Yinglu; Gong, Zhi-Yuan [Department of Signal Transduction, Research Institute for Microbial Diseases, Osaka University, 3-1 Yamada-oka, Suita, Osaka 565-0871 (Japan); Takakura, Nobuyuki, E-mail: ntakaku@biken.osaka-u.ac.jp [Department of Signal Transduction, Research Institute for Microbial Diseases, Osaka University, 3-1 Yamada-oka, Suita, Osaka 565-0871 (Japan); Japan Science Technology Agency, CREST, K' s Gobancho, 7, Gobancho, Chiyoda-ku, Tokyo 102-0076 (Japan)

2015-06-10

Hematopoietic stem cells (HSCs) can survive long-term in a state of dormancy. Little is known about how histone deacetylase inhibitors (HDACi) affect HSC kinetics. Here, we use trichostatin A (TSA), a histone deacetylase inhibitor, to enforce histone acetylation and show that this suppresses cell cycle entry by dormant HSCs. Previously, we found that haploinsufficiency of PSF1, a DNA replication factor, led to attenuation of the bone marrow (BM) HSC pool size and lack of acute proliferation after 5-FU ablation. Because PSF1 protein is present in CD34{sup +} transiently amplifying HSCs but not in CD34{sup −} long-term reconstituting-HSCs which are resting in a dormant state, we analyzed the relationship between dormancy and PSF1 expression, and how a histone deacetylase inhibitor affects this. We found that CD34{sup +} HSCs produce long functional PSF1 (PSF1a) but CD34{sup −} HSCs produce a shorter possibly non-functional PSF1 (PSF1b, c, dominantly PSF1c). Using PSF1a-overexpressing NIH-3T3 cells in which the endogenous PSF1 promoter is suppressed, we found that TSA treatment promotes production of the shorter form of PSF1 possibly by inducing recruitment of E2F family factors upstream of the PSF1 transcription start site. Our data document one mechanism by which histone deacetylase inhibitors affect the dormancy of HSCs by regulating the DNA replication factor PSF1. - Highlights: • Hematopoetic stem cell dormancy is controlled by histone deacetylation inhibitors. • Dormancy of HSCs is associated with a shorter form of non-functional PSF1. • Histone deacetylase inhibitors suppress PSF1 promoter activity.

DNA methylation requires a DNMT1 ubiquitin interacting motif (UIM) and histone ubiquitination.

Science.gov (United States)

Qin, Weihua; Wolf, Patricia; Liu, Nan; Link, Stephanie; Smets, Martha; La Mastra, Federica; Forné, Ignasi; Pichler, Garwin; Hörl, David; Fellinger, Karin; Spada, Fabio; Bonapace, Ian Marc; Imhof, Axel; Harz, Hartmann; Leonhardt, Heinrich

2015-08-01

DNMT1 is recruited by PCNA and UHRF1 to maintain DNA methylation after replication. UHRF1 recognizes hemimethylated DNA substrates via the SRA domain, but also repressive H3K9me3 histone marks with its TTD. With systematic mutagenesis and functional assays, we could show that chromatin binding further involved UHRF1 PHD binding to unmodified H3R2. These complementation assays clearly demonstrated that the ubiquitin ligase activity of the UHRF1 RING domain is required for maintenance DNA methylation. Mass spectrometry of UHRF1-deficient cells revealed H3K18 as a novel ubiquitination target of UHRF1 in mammalian cells. With bioinformatics and mutational analyses, we identified a ubiquitin interacting motif (UIM) in the N-terminal regulatory domain of DNMT1 that binds to ubiquitinated H3 tails and is essential for DNA methylation in vivo. H3 ubiquitination and subsequent DNA methylation required UHRF1 PHD binding to H3R2. These results show the manifold regulatory mechanisms controlling DNMT1 activity that require the reading and writing of epigenetic marks by UHRF1 and illustrate the multifaceted interplay between DNA and histone modifications. The identification and functional characterization of the DNMT1 UIM suggests a novel regulatory principle and we speculate that histone H2AK119 ubiquitination might also lead to UIM-dependent recruitment of DNMT1 and DNA methylation beyond classic maintenance.

Histone h1 depletion impairs embryonic stem cell differentiation.

Science.gov (United States)

Zhang, Yunzhe; Cooke, Marissa; Panjwani, Shiraj; Cao, Kaixiang; Krauth, Beth; Ho, Po-Yi; Medrzycki, Magdalena; Berhe, Dawit T; Pan, Chenyi; McDevitt, Todd C; Fan, Yuhong

2012-01-01

Pluripotent embryonic stem cells (ESCs) are known to possess a relatively open chromatin structure; yet, despite efforts to characterize the chromatin signatures of ESCs, the role of chromatin compaction in stem cell fate and function remains elusive. Linker histone H1 is important for higher-order chromatin folding and is essential for mammalian embryogenesis. To investigate the role of H1 and chromatin compaction in stem cell pluripotency and differentiation, we examine the differentiation of embryonic stem cells that are depleted of multiple H1 subtypes. H1c/H1d/H1e triple null ESCs are more resistant to spontaneous differentiation in adherent monolayer culture upon removal of leukemia inhibitory factor. Similarly, the majority of the triple-H1 null embryoid bodies (EBs) lack morphological structures representing the three germ layers and retain gene expression signatures characteristic of undifferentiated ESCs. Furthermore, upon neural differentiation of EBs, triple-H1 null cell cultures are deficient in neurite outgrowth and lack efficient activation of neural markers. Finally, we discover that triple-H1 null embryos and EBs fail to fully repress the expression of the pluripotency genes in comparison with wild-type controls and that H1 depletion impairs DNA methylation and changes of histone marks at promoter regions necessary for efficiently silencing pluripotency gene Oct4 during stem cell differentiation and embryogenesis. In summary, we demonstrate that H1 plays a critical role in pluripotent stem cell differentiation, and our results suggest that H1 and chromatin compaction may mediate pluripotent stem cell differentiation through epigenetic repression of the pluripotency genes.

Extracellular histones induce tissue factor expression in vascular endothelial cells via TLR and activation of NF-κB and AP-1.

Science.gov (United States)

Yang, Xinyu; Li, Lin; Liu, Jin; Lv, Ben; Chen, Fangping

2016-01-01

Extracellular histones have been recognized recently as proinflammatory mediators; they are released from dying cells in response to inflammatory challenge, contributing to endothelial cell dysfunction, thrombin formation, organ failure, and death during sepsis. Clinical studies suggest that the plasma concentration of the histone-DNA complex is correlated with the severity of DIC and is a poor independent prognostic marker in sepsis. In addition, platelet activation stimulates thrombus formation. Whether histones contribute to procoagulant activity in other ways remains elusive. In this study, we confirmed that histones induce tissue factor (TF) expression in a concentration- and time-dependent manner in vascular endothelial cells (ECs) and macrophages. However, histones did not affect TF pathway inhibitor expression. Moreover, blocking the cell surface receptors TLR4 and TLR2 with specific neutralizing antibodies significantly reduced histone-induced TF expression. Furthermore, histones enhanced the nuclear translocation of NF-κB (c-Rel/p65) and AP-1 expression in a time-dependent manner in ECs. Mutating NF-κB and AP-1 significantly reduced histone-induced TF expression. Altogether, our experiments suggest that histone induces TF expression in ECs via cell surface receptors TLR4 and TLR2, simultaneously depending on the activation of the transcription factors NF-κB and AP-1. Copyright © 2015 Elsevier Ltd. All rights reserved.

Biochemical studies on histones of the central nervous system. 1

International Nuclear Information System (INIS)

Schmitt, M.; Matthies, H.

1979-01-01

Rat brain histones were acetylated in vivo by intraventricular injection of [ 14 C]-acetate. More than 90% of the label is the result of a true acetylation. Enzymatic proteolysis of the labelled histone fraction and subsequent chromatographic investigation of the digestion products showed about 60% of the recovered radioactive material to be epsilon-acetyl lysine, whereas 22% of the radioactivity was found in an unidentified spot. (author)

Elevated nuclear sphingoid base-1-phosphates and decreased histone deacetylase activity after fumonisin B1 treatment in mouse embryonic fibroblasts

Energy Technology Data Exchange (ETDEWEB)

Gardner, Nicole M., E-mail: nicolegardner@creighton.edu [Department of Pharmacology, Creighton University School of Medicine, Omaha, NE 68178 (United States); Riley, Ronald T.; Showker, Jency L.; Voss, Kenneth A. [USDA-ARS, Toxicology and Mycotoxin Research Unit, Athens, GA 30605 (United States); Sachs, Andrew J.; Maddox, Joyce R.; Gelineau-van Waes, Janee B. [Department of Pharmacology, Creighton University School of Medicine, Omaha, NE 68178 (United States)

2016-05-01

Fumonisin B1 (FB1) is a mycotoxin produced by a common fungal contaminant of corn. Administration of FB1 to pregnant LM/Bc mice induces exencephaly in embryos, and ingestion of FB1-contaminated food during early pregnancy is associated with increased risk for neural tube defects (NTDs) in humans. FB1 inhibits ceramide synthase enzymes in sphingolipid biosynthesis, causing sphinganine (Sa) and bioactive sphinganine-1-phosphate (Sa1P) accumulation in blood, cells, and tissues. Sphingosine kinases (Sphk) phosphorylate Sa to form Sa1P. Upon activation, Sphk1 associates primarily with the plasma membrane, while Sphk2 is found predominantly in the nucleus. In cells over-expressing Sphk2, accumulation of Sa1P in the nuclear compartment inhibits histone deacetylase (HDAC) activity, causing increased acetylation of histone lysine residues. In this study, FB1 treatment in LM/Bc mouse embryonic fibroblasts (MEFs) resulted in significant accumulation of Sa1P in nuclear extracts relative to cytoplasmic extracts. Elevated nuclear Sa1P corresponded to decreased histone deacetylase (HDAC) activity and increased histone acetylation at H2BK12, H3K9, H3K18, and H3K23. Treatment of LM/Bc MEFs with a selective Sphk1 inhibitor, PF-543, or with ABC294640, a selective Sphk2 inhibitor, significantly reduced nuclear Sa1P accumulation after FB1, although Sa1P levels remained significantly increased relative to basal levels. Concurrent treatment with both PF-543 and ABC294640 prevented nuclear accumulation of Sa1P in response to FB1. Other HDAC inhibitors are known to cause NTDs, so these results suggest that FB1-induced disruption of sphingolipid metabolism leading to nuclear Sa1P accumulation, HDAC inhibition, and histone hyperacetylation is a potential mechanism for FB1-induced NTDs. - Highlights: • FB1 treatment results in accumulation of Sa1P primarily in the nucleus of MEFs. • FB1 treatment and elevated nuclear Sa1P are associated with HDAC inhibition. • Sphk2 inhibition alone

Elevated nuclear sphingoid base-1-phosphates and decreased histone deacetylase activity after fumonisin B1 treatment in mouse embryonic fibroblasts

International Nuclear Information System (INIS)

Gardner, Nicole M.; Riley, Ronald T.; Showker, Jency L.; Voss, Kenneth A.; Sachs, Andrew J.; Maddox, Joyce R.; Gelineau-van Waes, Janee B.

2016-01-01

Fumonisin B1 (FB1) is a mycotoxin produced by a common fungal contaminant of corn. Administration of FB1 to pregnant LM/Bc mice induces exencephaly in embryos, and ingestion of FB1-contaminated food during early pregnancy is associated with increased risk for neural tube defects (NTDs) in humans. FB1 inhibits ceramide synthase enzymes in sphingolipid biosynthesis, causing sphinganine (Sa) and bioactive sphinganine-1-phosphate (Sa1P) accumulation in blood, cells, and tissues. Sphingosine kinases (Sphk) phosphorylate Sa to form Sa1P. Upon activation, Sphk1 associates primarily with the plasma membrane, while Sphk2 is found predominantly in the nucleus. In cells over-expressing Sphk2, accumulation of Sa1P in the nuclear compartment inhibits histone deacetylase (HDAC) activity, causing increased acetylation of histone lysine residues. In this study, FB1 treatment in LM/Bc mouse embryonic fibroblasts (MEFs) resulted in significant accumulation of Sa1P in nuclear extracts relative to cytoplasmic extracts. Elevated nuclear Sa1P corresponded to decreased histone deacetylase (HDAC) activity and increased histone acetylation at H2BK12, H3K9, H3K18, and H3K23. Treatment of LM/Bc MEFs with a selective Sphk1 inhibitor, PF-543, or with ABC294640, a selective Sphk2 inhibitor, significantly reduced nuclear Sa1P accumulation after FB1, although Sa1P levels remained significantly increased relative to basal levels. Concurrent treatment with both PF-543 and ABC294640 prevented nuclear accumulation of Sa1P in response to FB1. Other HDAC inhibitors are known to cause NTDs, so these results suggest that FB1-induced disruption of sphingolipid metabolism leading to nuclear Sa1P accumulation, HDAC inhibition, and histone hyperacetylation is a potential mechanism for FB1-induced NTDs. - Highlights: • FB1 treatment results in accumulation of Sa1P primarily in the nucleus of MEFs. • FB1 treatment and elevated nuclear Sa1P are associated with HDAC inhibition. • Sphk2 inhibition alone

Rapid divergence of histones in Hydrozoa (Cnidaria) and evolution of a novel histone involved in DNA damage response in hydra.

Science.gov (United States)

Reddy, Puli Chandramouli; Ubhe, Suyog; Sirwani, Neha; Lohokare, Rasika; Galande, Sanjeev

2017-08-01

Histones are fundamental components of chromatin in all eukaryotes. Hydra, an emerging model system belonging to the basal metazoan phylum Cnidaria, provides an ideal platform to understand the evolution of core histone components at the base of eumetazoan phyla. Hydra exhibits peculiar properties such as tremendous regenerative capacity, lack of organismal senescence and rarity of malignancy. In light of the role of histone modifications and histone variants in these processes it is important to understand the nature of histones themselves and their variants in hydra. Here, we report identification of the complete repertoire of histone-coding genes in the Hydra magnipapillata genome. Hydra histones were classified based on their copy numbers, gene structure and other characteristic features. Genomic organization of canonical histone genes revealed the presence of H2A-H2B and H3-H4 paired clusters in high frequency and also a cluster with all core histones along with H1. Phylogenetic analysis of identified members of H2A and H2B histones suggested rapid expansion of these groups in Hydrozoa resulting in the appearance of unique subtypes. Amino acid sequence level comparisons of H2A and H2B forms with bilaterian counterparts suggest the possibility of a highly mobile nature of nucleosomes in hydra. Absolute quantitation of transcripts confirmed the high copy number of histones and supported the canonical nature of H2A. Furthermore, functional characterization of H2A.X.1 and a unique variant H2A.X.2 in the gastric region suggest their role in the maintenance of genome integrity and differentiation processes. These findings provide insights into the evolution of histones and their variants in hydra. Copyright © 2017 Elsevier GmbH. All rights reserved.

Further evidence for poly-ADP-ribosylated histones as DNA suppressors

International Nuclear Information System (INIS)

Yu, F.L.; Geronimo, I.H.; Bender, W.; Meginniss, K.E.

1986-01-01

For many years histones have been considered to be the gene suppressors in eukaryotic cells. Recently, the authors have found strong evidence indicating that poly-ADP-ribosylated histones, rather than histones, are the potent inhibitors of DNA-dependent RNA synthesis. They now report additional evidence for this concept: 1) using histone inhibitor isolated directly from nuclei, the authors are able to confirm their earlier findings that the inhibitor substances are sensitive to pronase, snake venom phosphodiesterase digestion and 0.1N KOH hydrolysis, and are resistant to DNase I and RNase A digestion, 2) the O.D. 260/O.D.280 ratio of the histone inhibitor is between pure protein and nuclei acid, suggesting the inhibitor substance is a nucleoprotein hybrid. This result directly supports the fact that the isolated histone inhibitor is radioactive poly (ADP-ribose) labeled, 3) commercial histones show big differences in inhibitor activity. The authors believe this reflects the variation in poly-ADP-ribosylation among commercial histones, and 4) 0.1N KOH hydrolysis eliminates the poly (ADP-ribose) radioactivity from the acceptor proteins as well as histone inhibitor activity. Yet, on gel, the inhibitor shows identical histone bands and stain intensity before and after hydrolysis, indicating the histones per se are qualitatively and quantitatively unaffected by alkaline treatment. This result strongly suggests that histones themselves are not capable of inhibiting DNA-dependent RNA synthesis

The RNA splicing factor ASF/SF2 inhibits human topoisomerase I mediated DNA relaxation

DEFF Research Database (Denmark)

Andersen, Félicie Faucon; Tange, Thomas Ø.; Sinnathamby, Thayaline

2002-01-01

Human topoisomerase I interacts with and phosphorylates the SR-family of RNA splicing factors, including ASF/SF2, and has been suggested to play an important role in the regulation of RNA splicing. Here we present evidence to support the theory that the regulation can go the other way around...

Biochemical Analysis Reveals the Multifactorial Mechanism of Histone H3 Clipping by Chicken Liver Histone H3 Protease

KAUST Repository

Chauhan, Sakshi

2016-09-02

Proteolytic clipping of histone H3 has been identified in many organisms. Despite several studies, the mechanism of clipping, the substrate specificity, and the significance of this poorly understood epigenetic mechanism are not clear. We have previously reported histone H3 specific proteolytic clipping and a protein inhibitor in chicken liver. However, the sites of clipping are still not known very well. In this study, we attempt to identify clipping sites in histone H3 and to determine the mechanism of inhibition by stefin B protein, a cysteine protease inhibitor. By employing site-directed mutagenesis and in vitro biochemical assays, we have identified three distinct clipping sites in recombinant human histone H3 and its variants (H3.1, H3.3, and H3t). However, post-translationally modified histones isolated from chicken liver and Saccharomyces cerevisiae wild-type cells showed different clipping patterns. Clipping of histone H3 N-terminal tail at three sites occurs in a sequential manner. We have further observed that clipping sites are regulated by the structure of the N-terminal tail as well as the globular domain of histone H3. We also have identified the QVVAG region of stefin B protein to be very crucial for inhibition of the protease activity. Altogether, our comprehensive biochemical studies have revealed three distinct clipping sites in histone H3 and their regulation by the structure of histone H3, histone modifications marks, and stefin B.

Rapid purification of recombinant histones.

Science.gov (United States)

Klinker, Henrike; Haas, Caroline; Harrer, Nadine; Becker, Peter B; Mueller-Planitz, Felix

2014-01-01

The development of methods to assemble nucleosomes from recombinant histones decades ago has transformed chromatin research. Nevertheless, nucleosome reconstitution remains time consuming to this day, not least because the four individual histones must be purified first. Here, we present a streamlined purification protocol of recombinant histones from bacteria. We termed this method "rapid histone purification" (RHP) as it circumvents isolation of inclusion bodies and thereby cuts out the most time-consuming step of traditional purification protocols. Instead of inclusion body isolation, whole cell extracts are prepared under strongly denaturing conditions that directly solubilize inclusion bodies. By ion exchange chromatography, the histones are purified from the extracts. The protocol has been successfully applied to all four canonical Drosophila and human histones. RHP histones and histones that were purified from isolated inclusion bodies had similar purities. The different purification strategies also did not impact the quality of octamers reconstituted from these histones. We expect that the RHP protocol can be readily applied to the purification of canonical histones from other species as well as the numerous histone variants.

Arginine-rich histones have strong antiviral activity for influenza A viruses.

Science.gov (United States)

Hoeksema, Marloes; Tripathi, Shweta; White, Mitchell; Qi, Li; Taubenberger, Jeffery; van Eijk, Martin; Haagsman, Henk; Hartshorn, Kevan L

2015-10-01

While histones are best known for DNA binding and transcription-regulating properties, they also have antimicrobial activity against a broad range of potentially pathogenic organisms. Histones are abundant in neutrophil extracellular traps, where they play an important role in NET-mediated antimicrobial killing. Here, we show anti-influenza activity of histones against both seasonal H3N2 and H1N1, but not pandemic H1N1. The arginine rich histones, H3 and H4, had greater neutralizing and viral aggregating activity than the lysine rich histones, H2A and H2B. Of all core histones, histone H4 is most potent in neutralizing IAV, and incubation with IAV with histone H4 results in a decrease in uptake and viral replication by epithelial cells when measured by qRT-PCR. The antiviral activity of histone H4 is mediated principally by direct effects on viral particles. Histone H4 binds to IAV as assessed by ELISA and co-sedimentation of H4 with IAV. H4 also induces aggregation, as assessed by confocal microscopy and light transmission assays. Despite strong antiviral activity against the seasonal IAV strains, H4 was inactive against pandemic H1N1. These findings indicate a possible role for histones in the innate immune response against IAV. © The Author(s) 2015.

Insight into the assembly of chaperones

Energy Technology Data Exchange (ETDEWEB)

May, R P [Institut Max von Laue - Paul Langevin (ILL), 38 - Grenoble (France); Stegmann, R; Manakova, E; Roessle, M; Hermann, T; Heumann, H [Max-Planck-Institut fuer Biochemie, Martinsried (Germany); Axmann, S; Plueckthun, A [Zurich Univ. (Switzerland); Wiedenmann, A [HMI, Berlin (Germany)

1997-04-01

Chaperones are proteins that help other proteins (substrate proteins) to acquire a `good` conformation. The folding is a dynamic process and involves repetitive binding and release of the chaperone components and of the substrate protein. Small-angle neutron scattering is used to investigate the structural changes that appear to happen during the folding process. (author). 2 refs.

The histones of the endosymbiont alga of Peridinium balticum (Dinophyceae).

Science.gov (United States)

Rizzo, P J; Morris, R L; Zweidler, A

1988-01-01

The histones of the endosymbiont nucleus of the binucleate dinoflagellate Peridinium balticum were characterized by amino acid analysis and peptide mapping, and compared to calf thymus histones. Using these and various other criteria we have identified two H1-like histones as well as the highly conserved histones H3 and H4. A 13,000 dalton component in sodium dodecyl sulphate (SDS) gels can be separated into two components in Triton-containing gels. We suggest that these histones (HPb1 and HPb2) correspond to the vertebrate histones H2A and H2B, respectively.

Organ distribution of histones after intravenous infusion of FITC histones or after sepsis.

Science.gov (United States)

Fattahi, Fatemeh; Grailer, Jamison J; Jajou, Lawrence; Zetoune, Firas S; Andjelkovic, Anuska V; Ward, Peter A

2015-03-01

Histones appear in plasma during infectious or non-infectious sepsis and are associated with multiorgan injury. In the current studies, intravenous infusion of histones resulted in their localization in major organs. In vitro exposure of mouse macrophages to histones caused a buildup of histones on cell membranes followed by localization into cytosol and into the nucleus. After polymicrobial sepsis (cecal ligation and puncture), histones appeared in plasma as well as in a multiorgan pattern, peaking at 8 h followed by decline. In lungs, histones and neutrophils appeared together, with evidence for formation of neutrophil extracellular traps (NETs), which represent an innate immune response to trap and kill bacteria and other infectious agents. In liver, there was intense NET formation, featuring linear patterns containing histones and strands of DNA. When neutrophils were activated in vitro with C5a or phorbol myristate acetate, NET formation ensued. While formation of NETs represents entrapment and killing of infectious agents, the simultaneous release from neutrophils of histones often results in tissue/organ damage.

Organ Distribution of Histones after Intravenous Infusion of FITC-Histones or after Sepsis

Science.gov (United States)

Fattahi, Fatemeh; Grailer, Jamison J.; Jajou, Lawrence; Zetoune, Firas S.; Andjelkovic, Anuska V.; Ward, Peter A.

2015-01-01

Histones appear in plasma during infectious or non-infectious sepsis and are associated with multiorgan injury. In the current studies, intravenous infusion of histones resulted in their localization in major organs. In vitro exposure of mouse macrophages to histones caused a buildup of histones on cell membranes followed by localization into cytosol and into the nucleus. After polymicrobial sepsis (cecal ligation and puncture, CLP), histones appeared in plasma as well as in a multiorgan pattern, peaking at 8 hr followed by decline. In lungs, histones and neutrophils appeared together, with evidence for formation of neutrophil extracellular traps (NETs), which represent an innate immune response to trap and kill bacteria and other infectious agents. In liver, there was intense NET formation, featuring linear patterns containing histones and strands of DNA. When neutrophils were activated in vitro with C5a or phorbol myristate acetate, NET formation ensued. While formation of NETs represents entrapment and killing of infectious agents, the simultaneous release from neutrophils of histones often results in tissue/organ damage. PMID:25680340

Estudo de misturas asf?lticas com res?duo de constru??o e demoli??o oriundo do munic?pio de Manaus-AM.

OpenAIRE

Melo, Diego Meneses de

2010-01-01

A disserta??o ora apresentada tem por objetivo realizar estudo sobre a utiliza??o de res?duos de constru??es e demoli??es (RCD) como agregado gra?do em concreto asf?ltico, buscando solu??o t?cnica e ambiental para a car?ncia hist?rica de agregados p?treos no munic?pio de Manaus-AM. A pesquisa exp?e caracter?sticas peculiares do material alternativo, comparando com o seixo rolado, elemento usual nas misturas asf?lticas utilizadas regionalmente. Realizouse a dosagem de uma mistur...

Nickel compounds induce histone ubiquitination by inhibiting histone deubiquitinating enzyme activity

International Nuclear Information System (INIS)

Ke Qingdong; Ellen, Thomas P.; Costa, Max

2008-01-01

Nickel (Ni) compounds are known carcinogens but underlying mechanisms are not clear. Epigenetic changes are likely to play an important role in nickel ion carcinogenesis. Previous studies have shown epigenetic effects of nickel ions, including the loss of histone acetylation and a pronounced increase in dimethylated H3K9 in nickel-exposed cells. In this study, we demonstrated that both water-soluble and insoluble nickel compounds induce histone ubiquitination (uH2A and uH2B) in a variety of cell lines. Investigations of the mechanism by which nickel increases histone ubiquitination in cells reveal that nickel does not affect cellular levels of the substrates of this modification, i.e., ubiquitin, histones, and other non-histone ubiquitinated proteins. In vitro ubiquitination and deubiquitination assays have been developed to further investigate possible effects of nickel on enzymes responsible for histone ubiquitination. Results from the in vitro assays demonstrate that the presence of nickel did not affect the levels of ubiquitinated histones in the ubiquitinating assay. Instead, the addition of nickel significantly prevents loss of uH2A and uH2B in the deubiquitinating assay, suggesting that nickel-induced histone ubiquitination is the result of inhibition of (a) putative deubiquitinating enzyme(s). Additional supporting evidence comes from the comparison of the response to nickel ions with a known deubiquitinating enzyme inhibitor, iodoacetamide (IAA). This study is the first to demonstrate such effects of nickel ions on histone ubiquitination. It also sheds light on the possible mechanisms involved in altering the steady state of this modification. The study provides further evidence that supports the notion that nickel ions alter epigenetic homeostasis in cells, which may lead to altered programs of gene expression and carcinogenesis

Contributions of chaperone/usher systems to cell binding, biofilm formation and Yersinia pestis virulence.

Science.gov (United States)

Felek, Suleyman; Jeong, Jenny J; Runco, Lisa M; Murray, Susan; Thanassi, David G; Krukonis, Eric S

2011-03-01

Yersinia pestis genome sequencing projects have revealed six intact uncharacterized chaperone/usher systems with the potential to play roles in plague pathogenesis. We cloned each locus and expressed them in the Δfim Escherichia coli strain AAEC185 to test the assembled Y. pestis surface structures for various activities. Expression of each chaperone/usher locus gave rise to specific novel fibrillar structures on the surface of E. coli. One locus, y0561-0563, was able to mediate attachment to human epithelial cells (HEp-2) and human macrophages (THP-1) but not mouse macrophages (RAW264.7), while several loci were able to facilitate E. coli biofilm formation. When each chaperone/usher locus was deleted in Y. pestis, only deletion of the previously described pH 6 antigen (Psa) chaperone/usher system resulted in decreased adhesion and biofilm formation. Quantitative RT-PCR (qRT-PCR) revealed low expression levels for each novel chaperone/usher system in vitro as well as in mouse tissues following intravenous infection. However, a Y. pestis mutant in the chaperone/usher locus y1858-1862 was attenuated for virulence in mice via the intravenous route of infection, suggesting that expression of this locus is, at some stage, sufficient to affect the outcome of a plague infection. qRT-PCR experiments also indicated that expression of the chaperone/usher-dependent capsule locus, caf1, was influenced by oxygen availability and that the well-described chaperone/usher-dependent pilus, Psa, was strongly induced in minimal medium even at 28 °C rather than 37 °C, a temperature previously believed to be required for Psa expression. These data indicate several potential roles for the novel chaperone/usher systems of Y. pestis in pathogenesis and infection-related functions such as cell adhesion and biofilm formation.

Chaperoning Roles of Macromolecules Interacting with Proteins in Vivo

Directory of Open Access Journals (Sweden)

Baik L. Seong

2011-03-01

Full Text Available The principles obtained from studies on molecular chaperones have provided explanations for the assisted protein folding in vivo. However, the majority of proteins can fold without the assistance of the known molecular chaperones, and little attention has been paid to the potential chaperoning roles of other macromolecules. During protein biogenesis and folding, newly synthesized polypeptide chains interact with a variety of macromolecules, including ribosomes, RNAs, cytoskeleton, lipid bilayer, proteolytic system, etc. In general, the hydrophobic interactions between molecular chaperones and their substrates have been widely believed to be mainly responsible for the substrate stabilization against aggregation. Emerging evidence now indicates that other features of macromolecules such as their surface charges, probably resulting in electrostatic repulsions, and steric hindrance, could play a key role in the stabilization of their linked proteins against aggregation. Such stabilizing mechanisms are expected to give new insights into our understanding of the chaperoning functions for de novo protein folding. In this review, we will discuss the possible chaperoning roles of these macromolecules in de novo folding, based on their charge and steric features.

Progressive methylation of ageing histones by Dot1 functions as a timer

NARCIS (Netherlands)

De Vos, Dirk; Frederiks, Floor; Terweij, Marit; van Welsem, Tibor; Verzijlbergen, Kitty F.; Iachina, Ekaterina; de Graaf, Erik L.; Altelaar, A. F. Maarten; Oudgenoeg, Gideon; Heck, Albert J. R.; Krijgsveldz, Jeroen; Bakker, Barbara M.; van Leeuwen, Fred

Post-translational modifications of histone proteins have a crucial role in regulating gene expression. If efficiently re-established after chromosome duplication, histone modifications could help propagate gene expression patterns in dividing cells by epigenetic mechanisms. We used an integrated

The role of Vif oligomerization and RNA chaperone activity in HIV-1 replication.

Science.gov (United States)

Batisse, Julien; Guerrero, Santiago; Bernacchi, Serena; Sleiman, Dona; Gabus, Caroline; Darlix, Jean-Luc; Marquet, Roland; Tisné, Carine; Paillart, Jean-Christophe

2012-11-01

The viral infectivity factor (Vif) is essential for the productive infection and dissemination of HIV-1 in non-permissive cells that involve most natural HIV-1 target cells. Vif counteracts the packaging of two cellular cytidine deaminases named APOBEC3G (A3G) and A3F by diverse mechanisms including the recruitment of an E3 ubiquitin ligase complex and the proteasomal degradation of A3G/A3F, the inhibition of A3G mRNA translation or by a direct competition mechanism. In addition, Vif appears to be an active partner of the late steps of viral replication by participating in virus assembly and Gag processing, thus regulating the final stage of virion formation notably genomic RNA dimerization and by inhibiting the initiation of reverse transcription. Vif is a small pleiotropic protein with multiple domains, and recent studies highlighted the importance of Vif conformation and flexibility in counteracting A3G and in binding RNA. In this review, we will focus on the oligomerization and RNA chaperone properties of Vif and show that the intrinsic disordered nature of some Vif domains could play an important role in virus assembly and replication. Experimental evidence demonstrating the RNA chaperone activity of Vif will be presented. Copyright © 2012 Elsevier B.V. All rights reserved.

Phosphorylation of rat thymus histones, its control and the effects thereon of γ-irradiation

International Nuclear Information System (INIS)

Fonagy, A.; Ord, M.G.; Stocken, L.A.

1977-01-01

The phosphate content of rat thymus histones was determined. As expected for a replicating tissue, histones 1 and 2B were more phosphorylated and had higher 32 P uptakes than did histones from resting liver nuclei; the other histones all showed 32 P uptake, but the phosphate content and uptake of histone 2A was about half that for liver histone 2A. When thymus nuclei were incubated in a slightly hypo-osmotic medium, non-histone proteins and phosphorylated histones were released into solution; this was enhanced if ATP was present in the medium. [γ- 32 P]ATP was incorporated into non-histone proteins, including Pl, and into the ADP-ribosylated form of histone 1; negligible 32 P was incorporated into the other, bound, histones. Histones 1 and 2B added to the incubation medium were extensively, and histones 2A and 4 slightly, phosphorylated. Histones released by increasing the ionic strength of the medium were phosphorylated. Added lysozyme and cytochrome c were neither bound nor phosphorylated, but added non-histone protein Pl was phosphorylated, causing other histones to be released from the nuclei, especially histones 2A and 3. The released histones were phosphorylated. γ-irradiation decreased 32 P uptake into the non-ADP-ribosylated histones 1 and 4; phosphorylation of histone 1 in vitro was unaffected. The importance of non-histone proteins, ATP availability and nuclear protein kinases to the control of histone phosphorylation in vivo is discussed. (author)

Interactive surface in the PapD chaperone cleft is conserved in pilus chaperone superfamily and essential in subunit recognition and assembly.

OpenAIRE

Slonim, L N; Pinkner, J S; Brändén, C I; Hultgren, S J

1992-01-01

The assembly of adhesive pili in Gram-negative bacteria is modulated by specialized periplasmic chaperone systems. PapD is the prototype member of the superfamily of periplasmic pilus chaperones. Previously, the alignment of chaperone sequences superimposed on the three dimensional structure of PapD revealed the presence of invariant, conserved and variable amino acids. Representative residues that protruded into the PapD cleft were targeted for site directed mutagenesis to investigate the pi...

Extracellular histone H1 is neurotoxic and drives a pro-inflammatory response in microglia [v1; ref status: indexed, http://f1000r.es/18z

Directory of Open Access Journals (Sweden)

Jonathan D Gilthorpe

2013-07-01

Full Text Available In neurodegenerative conditions and following brain trauma it is not understood why neurons die while astrocytes and microglia survive and adopt pro-inflammatory phenotypes. We show here that the damaged adult brain releases diffusible factors that can kill cortical neurons and we have identified histone H1 as a major extracellular candidate that causes neurotoxicity and activation of the innate immune system. Extracellular core histones H2A, H2B H3 and H4 were not neurotoxic. Innate immunity in the central nervous system is mediated through microglial cells and we show here for the first time that histone H1 promotes their survival, up-regulates MHC class II antigen expression and is a powerful microglial chemoattractant. We propose that when the central nervous system is degenerating, histone H1 drives a positive feedback loop that drives further degeneration and activation of immune defences which can themselves be damaging. We suggest that histone H1 acts as an antimicrobial peptide and kills neurons through mitochondrial damage and apoptosis.

Sigma-1 receptor chaperone at the ER-mitochondrion interface mediates the mitochondrion-ER-nucleus signaling for cellular survival.

Directory of Open Access Journals (Sweden)

Tomohisa Mori

Full Text Available The membrane of the endoplasmic reticulum (ER of a cell forms contacts directly with mitochondria whereby the contact is referred to as the mitochondrion-associated ER membrane or the MAM. Here we found that the MAM regulates cellular survival via an MAM-residing ER chaperone the sigma-1 receptor (Sig-1R in that the Sig-1R chaperones the ER stress sensor IRE1 to facilitate inter-organelle signaling for survival. IRE1 is found in this study to be enriched at the MAM in CHO cells. We found that IRE1 is stabilized at the MAM by Sig-1Rs when cells are under ER stress. Sig-1Rs stabilize IRE1 and thus allow for conformationally correct IRE1 to dimerize into the long-lasting, activated endonuclease. The IRE1 at the MAM also responds to reactive oxygen species derived from mitochondria. Therefore, the ER-mitochondrion interface serves as an important subcellular entity in the regulation of cellular survival by enhancing the stress-responding signaling between mitochondria, ER, and nucleus.

Sigma-1 receptor chaperone at the ER-mitochondrion interface mediates the mitochondrion-ER-nucleus signaling for cellular survival.

Science.gov (United States)

Mori, Tomohisa; Hayashi, Teruo; Hayashi, Eri; Su, Tsung-Ping

2013-01-01

The membrane of the endoplasmic reticulum (ER) of a cell forms contacts directly with mitochondria whereby the contact is referred to as the mitochondrion-associated ER membrane or the MAM. Here we found that the MAM regulates cellular survival via an MAM-residing ER chaperone the sigma-1 receptor (Sig-1R) in that the Sig-1R chaperones the ER stress sensor IRE1 to facilitate inter-organelle signaling for survival. IRE1 is found in this study to be enriched at the MAM in CHO cells. We found that IRE1 is stabilized at the MAM by Sig-1Rs when cells are under ER stress. Sig-1Rs stabilize IRE1 and thus allow for conformationally correct IRE1 to dimerize into the long-lasting, activated endonuclease. The IRE1 at the MAM also responds to reactive oxygen species derived from mitochondria. Therefore, the ER-mitochondrion interface serves as an important subcellular entity in the regulation of cellular survival by enhancing the stress-responding signaling between mitochondria, ER, and nucleus.

Binding of Histone H1 to DNA Is Differentially Modulated by Redox State of HMGB1

Czech Academy of Sciences Publication Activity Database

Muselíková Polanská, Eva; Pospíšilová, Š.; Štros, Michal

2014-01-01

Roč. 9, č. 2 (2014) E-ISSN 1932-6203 R&D Projects: GA ČR(CZ) GAP305/12/2475; GA MŠk(CZ) ED1.1.00/02.0068 Institutional support: RVO:68081707 Keywords : CHROMOSOMAL-PROTEIN HMG1 * MOBILITY GROUP-1 PROTEIN * LINKER HISTONES Subject RIV: BO - Biophysics Impact factor: 3.234, year: 2014

Histones bundle F-actin filaments and affect actin structure.

Science.gov (United States)

Blotnick, Edna; Sol, Asaf; Muhlrad, Andras

2017-01-01

Histones are small polycationic proteins complexed with DNA located in the cell nucleus. Upon apoptosis they are secreted from the cells and react with extracellular polyanionic compounds. Actin which is a polyanionic protein, is also secreted from necrotic cells and interacts with histones. We showed that both histone mixture (histone type III) and the recombinant H2A histone bundles F-actin, increases the viscosity of the F-actin containing solution and polymerizes G-actin. The histone-actin bundles are relatively insensitive to increase of ionic strength, unlike other polycation, histatin, lysozyme, spermine and LL-37 induced F-actin bundles. The histone-actin bundles dissociate completely only in the presence of 300-400 mM NaCl. DNA, which competes with F-actin for histones, disassembles histone induced actin bundles. DNase1, which depolymerizes F- to G-actin, actively unbundles the H2A histone induced but slightly affects the histone mixture induced actin bundles. Cofilin decreases the amount of F-actin sedimented by low speed centrifugation, increases light scattering and viscosity of F-actin-histone mixture containing solutions and forms star like superstructures by copolymerizing G-actin with H2A histone. The results indicate that histones are tightly attached to F-actin by strong electrostatic and hydrophobic forces. Since both histones and F-actin are present in the sputum of patients with cystic fibrosis, therefore, the formation of the stable histone-actin bundles can contribute to the pathology of this disease by increasing the viscosity of the sputum. The actin-histone interaction in the nucleus might affect gene expression.

Structural insights into the regulation and the recognition of histone marks by the SET domain of NSD1

International Nuclear Information System (INIS)

Morishita, Masayo; Di Luccio, Eric

2011-01-01

Highlights: → NSD1, NSD2/MMSET/WHSC1, and NSD3/WHSC1L1 are histone methyltransferases linked to numerous cancers. → Little is known about the NSD pathways and HMTase inhibitors are sorely needed in the epigenetic therapy of cancers. → We investigate the regulation and the recognition of histone marks by the SET domain of NSD1. → A unique and key mechanism is driven by a loop at the interface of the SET and postSET region. → Implications for developing specific and selective HMTase inhibitors are presented. -- Abstract: The development of epigenetic therapies fuels cancer hope. DNA-methylation inhibitors, histone-deacetylase and histone-methyltransferase (HMTase) inhibitors are being developed as the utilization of epigenetic targets is emerging as an effective and valuable approach to chemotherapy as well as chemoprevention of cancer. The nuclear receptor binding SET domain (NSD) protein is a family of three HMTases, NSD1, NSD2/MMSET/WHSC1, and NSD3/WHSC1L1 that are critical in maintaining the chromatin integrity. A growing number of studies have reported alterations or amplifications of NSD1, NSD2, or NSD3 in numerous carcinogenic events. Reducing NSDs activity through specific lysine-HMTase inhibitors appears promising to help suppressing cancer growth. However, little is known about the NSD pathways and our understanding of the histone lysine-HMTase mechanism is partial. To shed some light on both the recognition and the regulation of epigenetic marks by the SET domain of the NSD family, we investigate the structural mechanisms of the docking of the histone-H4 tail on the SET domain of NSD1. Our finding exposes a key regulatory and recognition mechanism driven by the flexibility of a loop at the interface of the SET and postSET region. Finally, we prospect the special value of this regulatory region for developing specific and selective NSD inhibitors for the epigenetic therapy of cancers.

Chaperones ameliorate beta cell dysfunction associated with human islet amyloid polypeptide overexpression.

Directory of Open Access Journals (Sweden)

Lisa Cadavez

Full Text Available In type 2 diabetes, beta-cell dysfunction is thought to be due to several causes, one being the formation of toxic protein aggregates called islet amyloid, formed by accumulations of misfolded human islet amyloid polypeptide (hIAPP. The process of hIAPP misfolding and aggregation is one of the factors that may activate the unfolded protein response (UPR, perturbing endoplasmic reticulum (ER homeostasis. Molecular chaperones have been described to be important in regulating ER response to ER stress. In the present work, we evaluate the role of chaperones in a stressed cellular model of hIAPP overexpression. A rat pancreatic beta-cell line expressing hIAPP exposed to thapsigargin or treated with high glucose and palmitic acid, both of which are known ER stress inducers, showed an increase in ER stress genes when compared to INS1E cells expressing rat IAPP or INS1E control cells. Treatment with molecular chaperone glucose-regulated protein 78 kDa (GRP78, also known as BiP or protein disulfite isomerase (PDI, and chemical chaperones taurine-conjugated ursodeoxycholic acid (TUDCA or 4-phenylbutyrate (PBA, alleviated ER stress and increased insulin secretion in hIAPP-expressing cells. Our results suggest that the overexpression of hIAPP induces a stronger response of ER stress markers. Moreover, endogenous and chemical chaperones are able to ameliorate induced ER stress and increase insulin secretion, suggesting that improving chaperone capacity can play an important role in improving beta-cell function in type 2 diabetes.

MS_HistoneDB, a manually curated resource for proteomic analysis of human and mouse histones.

Science.gov (United States)

El Kennani, Sara; Adrait, Annie; Shaytan, Alexey K; Khochbin, Saadi; Bruley, Christophe; Panchenko, Anna R; Landsman, David; Pflieger, Delphine; Govin, Jérôme

2017-01-01

Histones and histone variants are essential components of the nuclear chromatin. While mass spectrometry has opened a large window to their characterization and functional studies, their identification from proteomic data remains challenging. Indeed, the current interpretation of mass spectrometry data relies on public databases which are either not exhaustive (Swiss-Prot) or contain many redundant entries (UniProtKB or NCBI). Currently, no protein database is ideally suited for the analysis of histones and the complex array of mammalian histone variants. We propose two proteomics-oriented manually curated databases for mouse and human histone variants. We manually curated >1700 gene, transcript and protein entries to produce a non-redundant list of 83 mouse and 85 human histones. These entries were annotated in accordance with the current nomenclature and unified with the "HistoneDB2.0 with Variants" database. This resource is provided in a format that can be directly read by programs used for mass spectrometry data interpretation. In addition, it was used to interpret mass spectrometry data acquired on histones extracted from mouse testis. Several histone variants, which had so far only been inferred by homology or detected at the RNA level, were detected by mass spectrometry, confirming the existence of their protein form. Mouse and human histone entries were collected from different databases and subsequently curated to produce a non-redundant protein-centric resource, MS_HistoneDB. It is dedicated to the proteomic study of histones in mouse and human and will hopefully facilitate the identification and functional study of histone variants.

A study for the structural and functional regulation of chaperon protein by radiation

International Nuclear Information System (INIS)

Lee, Seung Sik; Chung, Byung Yeoup; Kim, Jin Hong

2011-01-01

The purpose of the this project provides new application areas for radiation technology for improvement of protein activities using radiation through the structural changes and functional regulations of molecular chaperon. Research scope includes 1) isolation of molecular chaperon proteins related radiation response from Psedomonads and purification of recombinant protein from E. coli., 2) the establishment of effective irradiation dose for the structural changes of chaperon protein, 3) analysis of the structural and functional changes of molecular chaperon by gamma irradiation. Main results are as follow: the chaperon activities of 2-Cys peroxiredxin show the maximum (about 3 times) at 15-30 kGy of gamma irradiation, but they were reduced greater than 30 kGy of gamma rays: the peroxidase activities show a tendency to decrease with increasing gamma irradiation: the structural change of peroxiredoxin (PP1084 and PA3529) by gamma irradiation (the formation of low molecular weight complexes or fragmentation of peroxiredoxin by gamma irradiation, the increase of beta-sheet and random coil by gamma irradiation and the decrease of alpha-helix and turn by gamma irradiation, and increased chaperon activity is related with increased hydrophobicity)

Histones bundle F-actin filaments and affect actin structure.

Directory of Open Access Journals (Sweden)

Edna Blotnick

Full Text Available Histones are small polycationic proteins complexed with DNA located in the cell nucleus. Upon apoptosis they are secreted from the cells and react with extracellular polyanionic compounds. Actin which is a polyanionic protein, is also secreted from necrotic cells and interacts with histones. We showed that both histone mixture (histone type III and the recombinant H2A histone bundles F-actin, increases the viscosity of the F-actin containing solution and polymerizes G-actin. The histone-actin bundles are relatively insensitive to increase of ionic strength, unlike other polycation, histatin, lysozyme, spermine and LL-37 induced F-actin bundles. The histone-actin bundles dissociate completely only in the presence of 300-400 mM NaCl. DNA, which competes with F-actin for histones, disassembles histone induced actin bundles. DNase1, which depolymerizes F- to G-actin, actively unbundles the H2A histone induced but slightly affects the histone mixture induced actin bundles. Cofilin decreases the amount of F-actin sedimented by low speed centrifugation, increases light scattering and viscosity of F-actin-histone mixture containing solutions and forms star like superstructures by copolymerizing G-actin with H2A histone. The results indicate that histones are tightly attached to F-actin by strong electrostatic and hydrophobic forces. Since both histones and F-actin are present in the sputum of patients with cystic fibrosis, therefore, the formation of the stable histone-actin bundles can contribute to the pathology of this disease by increasing the viscosity of the sputum. The actin-histone interaction in the nucleus might affect gene expression.

PARP-1 Interaction with and Activation by Histones and Nucleosomes.

Science.gov (United States)

Thomas, Colin; Kotova, Elena; Tulin, Alexei V

2017-01-01

Poly(ADP-ribose) Polymerase 1 (PARP-1) is an abundant chromatin associated protein, typical for most eukaryotic nuclei. The localization of PARP-1 in chromatin and its enzymatic activation involves multiple interactions of PARP-1 with nucleosomal histones, other proteins, and DNA. We report a set of methods designed to reconstitute PARP-1 regulation in vitro. These methods involve the expression of PARP-1 and PARP-1-regulating proteins using bacterial and eukaryotic systems, purification of these proteins using chromatography, testing of individual interactions in vitro, assembly of active complexes, and reconstitution of PARP-1 regulating reactions in vitro.

Redundant Control of Adipogenesis by Histone Deacetylases 1 and 2*

OpenAIRE

Haberland, Michael; Carrer, Michele; Mokalled, Mayssa H.; Montgomery, Rusty L.; Olson, Eric N.

2010-01-01

Adipocyte differentiation is a well defined process that is under the control of transcriptional activators and repressors. We show that histone deacetylase (HDAC) inhibitors efficiently block adipocyte differentiation in vitro. This effect is specific to adipogenesis, as another mesenchymal differentiation process, osteoblastogenesis, is enhanced upon HDAC inhibition. Through the systematic genetic deletion of HDAC genes in cultured mesenchymal precursor cells, we show that deletion of HDAC1...

Estudio experimental de microaglomerado asfáltico antiderrapante modificado con NFU

OpenAIRE

Botasso, Gerardo; Segura, Adrián

2013-01-01

Dadas las actuales mayores velocidades de circulación en vías urbanas y rurales, tipologías de vehículos y aumento de accidentes por excesos de velocidad, son necesarios nuevos diseños de mezclas asfálticas que permitan mayor adherencia neumático calzada y mejor evacuación del agua de la calzada para así disminuir las distancias de frenado. Para tal fin se ha considerado utilizar micromezclas en caliente en donde, a efectos de garantizar una adecuada macro y microtextura, se otorgan discontin...

Plasmodium falciparum Hsp70-z, an Hsp110 homologue, exhibits independent chaperone activity and interacts with Hsp70-1 in a nucleotide-dependent fashion.

Science.gov (United States)

Zininga, Tawanda; Achilonu, Ikechukwu; Hoppe, Heinrich; Prinsloo, Earl; Dirr, Heini W; Shonhai, Addmore

2016-05-01

The role of molecular chaperones, among them heat shock proteins (Hsps), in the development of malaria parasites has been well documented. Hsp70s are molecular chaperones that facilitate protein folding. Hsp70 proteins are composed of an N-terminal nucleotide binding domain (NBD), which confers them with ATPase activity and a C-terminal substrate binding domain (SBD). In the ADP-bound state, Hsp70 possesses high affinity for substrate and releases the folded substrate when it is bound to ATP. The two domains are connected by a conserved linker segment. Hsp110 proteins possess an extended lid segment, a feature that distinguishes them from canonical Hsp70s. Plasmodium falciparum Hsp70-z (PfHsp70-z) is a member of the Hsp110 family of Hsp70-like proteins. PfHsp70-z is essential for survival of malaria parasites and is thought to play an important role as a molecular chaperone and nucleotide exchange factor of its cytosolic canonical Hsp70 counterpart, PfHsp70-1. Unlike PfHsp70-1 whose functions are fairly well established, the structure-function features of PfHsp70-z remain to be fully elucidated. In the current study, we established that PfHsp70-z possesses independent chaperone activity. In fact, PfHsp70-z appears to be marginally more effective in suppressing protein aggregation than its cytosol-localized partner, PfHsp70-1. Furthermore, based on coimmunoaffinity chromatography and surface plasmon resonance analyses, PfHsp70-z associated with PfHsp70-1 in a nucleotide-dependent fashion. Our findings suggest that besides serving as a molecular chaperone, PfHsp70-z could facilitate the nucleotide exchange function of PfHsp70-1. These dual functions explain why it is essential for parasite survival.

FKBP immunophilins and Alzheimer's disease: A chaperoned affair

Indian Academy of Sciences (India)

2011-07-08

Jul 8, 2011 ... FKBP immunophilins and Alzheimer's disease: A chaperoned affair. Weihuan Cao Mary ... Keywords. Alzheimer's disease; amyloid precursor protein; beta amyloid; FKBP; FK506; immunophilins; tau ... 43 | Issue 1. March 2018.

The effect of histone deacetylase inhibitors on AHSP expression

Science.gov (United States)

Ziari, Katayoun; Ranjbaran, Reza; Nikouyan, Negin

2018-01-01

Alpha-hemoglobin stabilizing protein (AHSP) is a molecular chaperone that can reduce the damage caused by excess free α-globin to erythroid cells in patients with impaired β-globin chain synthesis. We assessed the effect of sodium phenylbutyrate and sodium valproate, two histone deacetylase inhibitors (HDIs) that are being studied for the treatment of hemoglobinopathies, on the expression of AHSP, BCL11A (all isoforms), γ-globin genes (HBG1/2), and some related transcription factors including GATA1, NFE2, EKLF, KLF4, and STAT3. For this purpose, the K562 cell line was cultured for 2, 4, and 6 days in the presence and absence of sodium phenylbutyrate and sodium valproate. Relative real-time qRT-PCR analysis of mRNA levels was performed to determine the effects of the two compounds on gene expression. Expression of all target mRNAs increased significantly (p sodium valproate had a more considerable effect than sodium phenylbutyrate (p sodium valproate after 6 days. Both compounds repressed the expression of BCL11A (-XL, -L, -S) and up-regulated GATA1, NFE2, EKLF, KLF4, STAT3, AHSP, and γ-globin genes expression. Moreover, sodium valproate showed a stronger effect on repressing BCL11A and escalating the expression of other target genes. The findings of this in vitro experiment could be considered in selecting drugs for clinical use in patients with β-hemoglobinopathies. PMID:29389946

Role of Chromatin assembly factor 1 in DNA replication of Plasmodium falciparum.

Science.gov (United States)

Gupta, Mohit Kumar; Agarawal, Meetu; Banu, Khadija; Reddy, K Sony; Gaur, Deepak; Dhar, Suman Kumar

2018-01-01

Nucleosome assembly in P. falciparum could be the key process in maintaining its genomic integrity as DNA replicates more than once per cell cycle during several stages of its life cycle. Here, we report the functional characterization of P. falciparum chromatin assembly factor 1 (CAF1), which interacts with several proteins namely PfCAF2, Histones, PfHP1 and others. Consistent with the above findings, we demonstrate the presence of PfCAF1 at the telomeric repeat regions, central and subtelomeric var genes of multiple var gene family along with PfHP1. Further, we report the upregulation of PfCAF1 after treatment with genotoxic agents like MMS and HU. Together, these findings establish role of PfCAF1 in heterochromatin maintenance and as histone chaperone in nucleosome assembly and DNA damage repair. Copyright © 2017 Elsevier Inc. All rights reserved.

Systems analysis of chaperone networks in the malarial parasite Plasmodium falciparum.

Directory of Open Access Journals (Sweden)

Soundara Raghavan Pavithra

2007-09-01

Full Text Available Molecular chaperones participate in the maintenance of cellular protein homeostasis, cell growth and differentiation, signal transduction, and development. Although a vast body of information is available regarding individual chaperones, few studies have attempted a systems level analysis of chaperone function. In this paper, we have constructed a chaperone interaction network for the malarial parasite, Plasmodium falciparum. P. falciparum is responsible for several million deaths every year, and understanding the biology of the parasite is a top priority. The parasite regularly experiences heat shock as part of its life cycle, and chaperones have often been implicated in parasite survival and growth. To better understand the participation of chaperones in cellular processes, we created a parasite chaperone network by combining experimental interactome data with in silico analysis. We used interolog mapping to predict protein-protein interactions for parasite chaperones based on the interactions of corresponding human chaperones. This data was then combined with information derived from existing high-throughput yeast two-hybrid assays. Analysis of the network reveals the broad range of functions regulated by chaperones. The network predicts involvement of chaperones in chromatin remodeling, protein trafficking, and cytoadherence. Importantly, it allows us to make predictions regarding the functions of hypothetical proteins based on their interactions. It allows us to make specific predictions about Hsp70-Hsp40 interactions in the parasite and assign functions to members of the Hsp90 and Hsp100 families. Analysis of the network provides a rational basis for the anti-malarial activity of geldanamycin, a well-known Hsp90 inhibitor. Finally, analysis of the network provides a theoretical basis for further experiments designed toward understanding the involvement of this important class of molecules in parasite biology.

Histones of Chlamydomonas reinhardtii. Synthesis, acetylation, and methylation

International Nuclear Information System (INIS)

Waterborg, J.H.; Robertson, A.J.; Tatar, D.L.; Borza, C.M.; Davie, J.R.

1995-01-01

Histones of the green alga Chlamydomonas reinhardtii were prepared by a new method and fractionated by reversed-phase high-performance liquid chromatography. Acid-urea-Triton gel analysis and tritiated acetate labeling demonstrated high levels of steady-state acetylation for the single histone H3 protein, in contrast to low levels on histones H4 and H2B. Twenty percent of histone H3 is subject to dynamic acetylation with, on average, three acetylated lysine residues per protein molecule. Histone synthesis in light-dark-synchronized cultures was biphasic with pattern differences between two histone H1 variants, between two H2A variants, and between H2B and ubiquitinated H2B. Automated protein sequence analysis of histone H3 demonstrated a site-specific pattern of steady-state acetylation between 7 and 17% at five of the six amino-terminal lysines and of monomethylation between 5 and 81% at five of the eight amino-terminal lysines in a pattern that may limit dynamic acetylation. An algal histone H3 sequence was confirmed by protein sequencing with a since threonine as residue 28 instead of the serine(28)-alanine(29) sequence, present in all other known plant and animal H3 histones

Endoplasmic reticulum proteins SDF2 and SDF2L1 act as components of the BiP chaperone cycle to prevent protein aggregation.

Science.gov (United States)

Fujimori, Tsutomu; Suno, Ryoji; Iemura, Shun-Ichiro; Natsume, Tohru; Wada, Ikuo; Hosokawa, Nobuko

2017-08-01

The folding of newly synthesized proteins in the endoplasmic reticulum (ER) is assisted by ER-resident chaperone proteins. BiP (immunoglobulin heavy-chain-binding protein), a member of the HSP70 family, plays a central role in protein quality control. The chaperone function of BiP is regulated by its intrinsic ATPase activity, which is stimulated by ER-resident proteins of the HSP40/DnaJ family, including ERdj3. Here, we report that two closely related proteins, SDF2 and SDF2L1, regulate the BiP chaperone cycle. Both are ER-resident, but SDF2 is constitutively expressed, whereas SDF2L1 expression is induced by ER stress. Both luminal proteins formed a stable complex with ERdj3 and potently inhibited the aggregation of different types of misfolded ER cargo. These proteins associated with non-native proteins, thus promoting the BiP-substrate interaction cycle. A dominant-negative ERdj3 mutant that inhibits the interaction between ERdj3 and BiP prevented the dissociation of misfolded cargo from the ERdj3-SDF2L1 complex. Our findings indicate that SDF2 and SDF2L1 associate with ERdj3 and act as components in the BiP chaperone cycle to prevent the aggregation of misfolded proteins, partly explaining the broad folding capabilities of the ER under various physiological conditions. © 2017 Molecular Biology Society of Japan and John Wiley & Sons Australia, Ltd.

Trichostatin A, a histone deacetylase inhibitor, suppresses JAK2/STAT3 signaling via inducing the promoter-associated histone acetylation of SOCS1 and SOCS3 in human colorectal cancer cells.

Science.gov (United States)

Xiong, Hua; Du, Wan; Zhang, Yan-Jie; Hong, Jie; Su, Wen-Yu; Tang, Jie-Ting; Wang, Ying-Chao; Lu, Rong; Fang, Jing-Yuan

2012-02-01

Aberrant janus kinase/signal transducers and activators of transcription (JAK/STAT) signaling is involved in the oncogenesis of several cancers. Suppressors of cytokine signaling (SOCS) genes and SH2-containing protein tyrosine phosphatase 1 (SHP1) proteins, which are negative regulators of JAK/STAT signaling, have been reported to have tumor suppressor functions. However, in colorectal cancer (CRC) cells, the mechanisms that regulate SOCS and SHP1 genes, and the cause of abnormalities in the JAK/STAT signaling pathway, remain largely unknown. The present study shows that trichostatin A (TSA), a histone deacetylase (HDAC) inhibitor, leads to the hyperacetylation of histones associated with the SOCS1 and SOCS3 promoters, but not the SHP1 promoter in CRC cells. This indicates that histone modifications are involved in the regulation of SOCS1 and SOCS3. Moreover, upregulation of SOCS1 and SOCS3 expression was achieved using TSA, which also significantly downregulated JAK2/STAT3 signaling in CRC cells. We also demonstrate that TSA suppresses the growth of CRC cells, and induces G1 cell cycle arrest and apoptosis through the regulation of downstream targets of JAK2/STAT3 signaling, including Bcl-2, survivin and p16(ink4a) . Therefore, our data demonstrate that TSA may induce SOCS1 and SOCS3 expression by inducing histone modifications and consequently inhibits JAK2/STAT3 signaling in CRC cells. These results also establish a mechanistic link between the inhibition of JAK2/STAT3 signaling and the anticancer action of TSA in CRC cells. Copyright © 2011 Wiley Periodicals, Inc.

Decrease of H1 histone and changes in chromatin structure and transcription in pea seedlings after γ-irradiation

International Nuclear Information System (INIS)

Bagi, G.; Hidvegi, E.J.

1983-01-01

Seeds and seedlings of pea have been irradiated between zero to 300 Gy doses of 60 Co gamma-irradiation and examinations were carried out on the chromatin of shoots of 1-week-old etiolated seedlings. There was only a slight change in the gross composition of chromatin after irradiation (in the mass ratios of DNA:RNA:histone:non-histone proteins). Separation of histones, however, showed that after 300 Gy irradiation the quantity of H1 histones decreased by 33% after seed irradiation and 43% after seedling irradiation. The ratio of H1 subfractions also changed. Enzymes DNAase II and micrococcal nuclease digested the chromatin of the irradiated sample 30% faster than the unirradiated one. Transcription kinetics of chromatin showed a gradual decrease of Ksub(m) value on increasing doses of irradiation. There was, however, no difference in the rate of transcription of DNAs, isolated from the chromatin of the control and irradiated samples. Protease and RNAase activity of whole shoots showed enhancement after irradiation. These data suggest that irradiation of either seeds or seedlings results in loosening of the seedling chromatin structure, while there is no change in basic nucleosomal structure. The specific degradation or dissociation of histone H1, localized in the internucleosomal region may be responsible for these changes in the higher order structure of chromatin. This may explain the easier accessibility of chromatin to DNAase II after irradiation and the more tightly bound RNA polymerase, exhibited in decreasing Ksub(m) values. (Auth.)

Chaperone-like properties of tobacco plastid thioredoxins f and m

Science.gov (United States)

Sanz-Barrio, Ruth; Fernández-San Millán, Alicia; Carballeda, Jon; Corral-Martínez, Patricia; Seguí-Simarro, José M.; Farran, Inmaculada

2012-01-01

Thioredoxins (Trxs) are ubiquitous disulphide reductases that play important roles in the redox regulation of many cellular processes. However, some redox-independent functions, such as chaperone activity, have also been attributed to Trxs in recent years. The focus of our study is on the putative chaperone function of the well-described plastid Trxs f and m. To that end, the cDNA of both Trxs, designated as NtTrxf and NtTrxm, was isolated from Nicotiana tabacum plants. It was found that bacterially expressed tobacco Trx f and Trx m, in addition to their disulphide reductase activity, possessed chaperone-like properties. In vitro, Trx f and Trx m could both facilitate the reactivation of the cysteine-free form of chemically denatured glucose-6 phosphate dehydrogenase (foldase chaperone activity) and prevent heat-induced malate dehydrogenase aggregation (holdase chaperone activity). Our results led us to infer that the disulphide reductase and foldase chaperone functions prevail when the proteins occur as monomers and the well-conserved non-active cysteine present in Trx f is critical for both functions. By contrast, the holdase chaperone activity of both Trxs depended on their oligomeric status: the proteins were functional only when they were associated with high molecular mass protein complexes. Because the oligomeric status of both Trxs was induced by salt and temperature, our data suggest that plastid Trxs could operate as molecular holdase chaperones upon oxidative stress, acting as a type of small stress protein. PMID:21948853

Characterization of monomeric DNA-binding protein Histone H1 in Leishmania braziliensis.

Science.gov (United States)

Carmelo, Emma; González, Gloria; Cruz, Teresa; Osuna, Antonio; Hernández, Mariano; Valladares, Basilio

2011-08-01

Histone H1 in Leishmania presents relevant differences compared to higher eukaryote counterparts, such as the lack of a DNA-binding central globular domain. Despite that, it is apparently fully functional since its differential expression levels have been related to changes in chromatin condensation and infectivity, among other features. The localization and the aggregation state of L. braziliensis H1 has been determined by immunolocalization, mass spectrometry, cross-linking and electrophoretic mobility shift assays. Analysis of H1 sequences from the Leishmania Genome Database revealed that our protein is included in a very divergent group of histones H1 that is present only in L. braziliensis. An antibody raised against recombinant L. braziliensis H1 recognized specifically that protein by immunoblot in L. braziliensis extracts, but not in other Leishmania species, a consequence of the sequence divergences observed among Leishmania species. Mass spectrometry analysis and in vitro DNA-binding experiments have also proven that L. braziliensis H1 is monomeric in solution, but oligomerizes upon binding to DNA. Finally, despite the lack of a globular domain, L. braziliensis H1 is able to form complexes with DNA in vitro, with higher affinity for supercoiled compared to linear DNA.

HMGB1 and Extracellular Histones Significantly Contribute to Systemic Inflammation and Multiple Organ Failure in Acute Liver Failure

Directory of Open Access Journals (Sweden)

Runkuan Yang

2017-01-01

Full Text Available Acute liver failure (ALF is the culmination of severe liver cell injury from a variety of causes. ALF occurs when the extent of hepatocyte death exceeds the hepatic regenerative capacity. ALF has a high mortality that is associated with multiple organ failure (MOF and sepsis; however, the underlying mechanisms are still not clear. Emerging evidence shows that ALF patients/animals have high concentrations of circulating HMGB1, which can contribute to multiple organ injuries and mediate gut bacterial translocation (BT. BT triggers/induces systemic inflammatory responses syndrome (SIRS, which can lead to MOF in ALF. Blockade of HMGB1 significantly decreases BT and improves hepatocyte regeneration in experimental acute fatal liver injury. Therefore, HMGB1 seems to be an important factor that links BT and systemic inflammation in ALF. ALF patients/animals also have high levels of circulating histones, which might be the major mediators of systemic inflammation in patients with ALF. Extracellular histones kill endothelial cells and elicit immunostimulatory effect to induce multiple organ injuries. Neutralization of histones can attenuate acute liver, lung, and brain injuries. In conclusion, HMGB1 and histones play a significant role in inducing systemic inflammation and MOF in ALF.

HMGB1 and Extracellular Histones Significantly Contribute to Systemic Inflammation and Multiple Organ Failure in Acute Liver Failure.

Science.gov (United States)

Yang, Runkuan; Zou, Xiaoping; Tenhunen, Jyrki; Tønnessen, Tor Inge

2017-01-01

Acute liver failure (ALF) is the culmination of severe liver cell injury from a variety of causes. ALF occurs when the extent of hepatocyte death exceeds the hepatic regenerative capacity. ALF has a high mortality that is associated with multiple organ failure (MOF) and sepsis; however, the underlying mechanisms are still not clear. Emerging evidence shows that ALF patients/animals have high concentrations of circulating HMGB1, which can contribute to multiple organ injuries and mediate gut bacterial translocation (BT). BT triggers/induces systemic inflammatory responses syndrome (SIRS), which can lead to MOF in ALF. Blockade of HMGB1 significantly decreases BT and improves hepatocyte regeneration in experimental acute fatal liver injury. Therefore, HMGB1 seems to be an important factor that links BT and systemic inflammation in ALF. ALF patients/animals also have high levels of circulating histones, which might be the major mediators of systemic inflammation in patients with ALF. Extracellular histones kill endothelial cells and elicit immunostimulatory effect to induce multiple organ injuries. Neutralization of histones can attenuate acute liver, lung, and brain injuries. In conclusion, HMGB1 and histones play a significant role in inducing systemic inflammation and MOF in ALF.

The ribosome-bound chaperones RAC and Ssb1/2p are required for accurate translation in Saccharomyces cerevisiae.

Science.gov (United States)

Rakwalska, Magdalena; Rospert, Sabine

2004-10-01

The chaperone homologs RAC (ribosome-associated complex) and Ssb1/2p are anchored to ribosomes; Ssb1/2p directly interacts with nascent polypeptides. The absence of RAC or Ssb1/2p results in a similar set of phenotypes, including hypersensitivity against the aminoglycoside paromomycin, which binds to the small ribosomal subunit and compromises the fidelity of translation. In order to understand this phenomenon we measured the frequency of translation termination and misincorporation in vivo and in vitro with a novel reporter system. Translational fidelity was impaired in the absence of functional RAC or Ssb1/2p, and the effect was further enhanced by paromomycin. The mutant strains suffered primarily from a defect in translation termination, while misincorporation was compromised to a lesser extent. Consistently, a low level of soluble translation termination factor Sup35p enhanced growth defects in the mutant strains. Based on the combined data we conclude that RAC and Ssb1/2p are crucial in maintaining translational fidelity beyond their postulated role as chaperones for nascent polypeptides.

Histone turnover within nonproliferating cells

International Nuclear Information System (INIS)

Commerford, S.L.; Carsten, A.L.; Cronkite, E.P.

1982-01-01

The turnover of DNA and histones in the livers and brains of mice has been determined. These mice had been exposed to constant levels of tritiated water from conception until they were 8 months old. At this point, exposure to tritium was discontinued, and the tritium remaining in DNA and histones was measured at various intervals afterward. The half-lives calculated for these components (with 95% confidence limits given in parentheses) were 117 (85 to 188) days for liver histone, 318 (241 to 466) days for liver DNA, 159 (129 to 208) days for brain histone and 593 (376 to 1406) days for brain DNA. The difference between histone and DNA turnover is statistically significant for both tissues and indicates that histone turnover within tissues cannot be solely accounted for by cell turnover within the tissue but also must include histone turnover within living cells. The half-life of histone within cells is estimated to be 117 (88 to 178) days in liver and 223 (187 to 277) days in brain

Evidence for alternative quaternary structure in a bacterial Type III secretion system chaperone

Energy Technology Data Exchange (ETDEWEB)

Barta, Michael L.; Zhang, Lingling; Picking, Wendy L.; Geisbrecht, Brian V. (UMKC); (OKLU)

2010-10-05

Type III secretion systems are a common virulence mechanism in many Gram-negative bacterial pathogens. These systems use a nanomachine resembling a molecular needle and syringe to provide an energized conduit for the translocation of effector proteins from the bacterial cytoplasm to the host cell cytoplasm for the benefit of the pathogen. Prior to translocation specialized chaperones maintain proper effector protein conformation. The class II chaperone, Invasion plasmid gene (Ipg) C, stabilizes two pore forming translocator proteins. IpgC exists as a functional dimer to facilitate the mutually exclusive binding of both translocators. In this study, we present the 3.3 {angstrom} crystal structure of an amino-terminally truncated form (residues 10-155, denoted IpgC10-155) of the class II chaperone IpgC from Shigella flexneri. Our structure demonstrates an alternative quaternary arrangement to that previously described for a carboxy-terminally truncated variant of IpgC (IpgC{sup 1-151}). Specifically, we observe a rotationally-symmetric 'head-to-head' dimerization interface that is far more similar to that previously described for SycD from Yersinia enterocolitica than to IpgC1-151. The IpgC structure presented here displays major differences in the amino terminal region, where extended coil-like structures are seen, as opposed to the short, ordered alpha helices and asymmetric dimerization interface seen within IpgC{sup 1-151}. Despite these differences, however, both modes of dimerization support chaperone activity, as judged by a copurification assay with a recombinant form of the translocator protein, IpaB. Conclusions: From primary to quaternary structure, these results presented here suggest that a symmetric dimerization interface is conserved across bacterial class II chaperones. In light of previous data which have described the structure and function of asymmetric dimerization, our results raise the possibility that class II chaperones may

An overview on molecular chaperones enhancing solubility of expressed recombinant proteins with correct folding.

Science.gov (United States)

Mamipour, Mina; Yousefi, Mohammadreza; Hasanzadeh, Mohammad

2017-09-01

The majority of research topics declared that most of the recombinant proteins have been expressed by Escherichia coli in basic investigations. But the majority of high expressed proteins formed as inactive recombinant proteins that are called inclusion body. To overcome this problem, several methods have been used including suitable promoter, environmental factors, ladder tag to secretion of proteins into the periplasm, gene protein optimization, chemical chaperones and molecular chaperones sets. Co-expression of the interest protein with molecular chaperones is one of the common methods The chaperones are a group of proteins, which are involved in making correct folding of recombinant proteins. Chaperones are divided two groups including; cytoplasmic and periplasmic chaperones. Moreover, periplasmic chaperones and proteases can be manipulated to increase the yields of secreted proteins. In this article, we attempted to review cytoplasmic chaperones such as Hsp families and periplasmic chaperones including; generic chaperones, specialized chaperones, PPIases, and proteins involved in disulfide bond formation. Copyright © 2017 Elsevier B.V. All rights reserved.

Current trends in chaperone use by plastic and reconstructive surgeons.

Science.gov (United States)

Choudry, Umar; Barta, Ruth J; Kim, Nicholas

2013-06-01

There is a paucity of literature regarding the use of chaperones by surgeons when examining patients. Use of a chaperone not only makes the patient comfortable but also potentially protects the surgeon from perceived misconduct. This is especially true for plastic surgeons who examine sensitive areas commonly. The purpose of this study was to determine the current trends in chaperone use by plastic surgeons when examining patients. A 23-question online survey was sent to all members of the American Society of Plastic Surgeons. Data collected online were analyzed using Student t test and Pearson χ test. A P use by plastic surgeons during all examinations of patients was 30%. This rate increased up to 60% while examining sensitive areas. Male surgeons reported a higher frequency of chaperone use than female surgeons (P use compared to reconstructive surgeons (P = 0.001). Similarly, surgeons who had been in practice for more than 20 years reported a higher rate of chaperone use compared to surgeons in practice for less than 20 years (P = 0.032). Sixty-one (7.6%; 56 male and 5 female) surgeons reported being accused of inappropriate behavior by patients, of whom 49 (80%) did not have a chaperone present. There was no significant difference among male and female surgeons in rates of being accused of inappropriate behavior (7.9% vs 4.2%, P = 0.19). There was a higher rate of chaperone use by male plastic surgeons, surgeons with more than 20 years experience, and cosmetic surgeons. Despite the difference in chaperone use between the sexes, both had similar rates of being accused of inappropriate behavior during examinations by patients, and although these incidents were quite low, most had no chaperone present during those examinations.

Analysis of the subcellular localization of the human histone methyltransferase SETDB1

Energy Technology Data Exchange (ETDEWEB)

Tachibana, Keisuke, E-mail: nya@phs.osaka-u.ac.jp [Graduate School of Pharmaceutical Sciences, Osaka University, 1-6 Yamadaoka, Suita, Osaka 565-0871 (Japan); Gotoh, Eiko; Kawamata, Natsuko [Graduate School of Pharmaceutical Sciences, Osaka University, 1-6 Yamadaoka, Suita, Osaka 565-0871 (Japan); Ishimoto, Kenji [Graduate School of Pharmaceutical Sciences, Osaka University, 1-6 Yamadaoka, Suita, Osaka 565-0871 (Japan); Laboratory for System Biology and Medicine, Research Center for Advanced Science and Technology, The University of Tokyo, 4-6-1 Komaba, Meguro, Tokyo 153-8904 (Japan); Uchihara, Yoshie [Graduate School of Pharmaceutical Sciences, Osaka University, 1-6 Yamadaoka, Suita, Osaka 565-0871 (Japan); Iwanari, Hiroko [Department of Quantitative Biology and Medicine, Research Center for Advanced Science and Technology, The University of Tokyo, 4-6-1 Komaba, Meguro, Tokyo 153-8904 (Japan); Sugiyama, Akira; Kawamura, Takeshi [Radioisotope Center, The University of Tokyo, 2-11-16 Yayoi, Bunkyo, Tokyo 113-0032 (Japan); Mochizuki, Yasuhiro [Department of Quantitative Biology and Medicine, Research Center for Advanced Science and Technology, The University of Tokyo, 4-6-1 Komaba, Meguro, Tokyo 153-8904 (Japan); Tanaka, Toshiya [Laboratory for System Biology and Medicine, Research Center for Advanced Science and Technology, The University of Tokyo, 4-6-1 Komaba, Meguro, Tokyo 153-8904 (Japan); Sakai, Juro [Division of Metabolic Medicine, Research Center for Advanced Science and Technology, The University of Tokyo, 4-6-1 Komaba, Meguro, Tokyo 153-8904 (Japan); Hamakubo, Takao [Department of Quantitative Biology and Medicine, Research Center for Advanced Science and Technology, The University of Tokyo, 4-6-1 Komaba, Meguro, Tokyo 153-8904 (Japan); Kodama, Tatsuhiko [Laboratory for System Biology and Medicine, Research Center for Advanced Science and Technology, The University of Tokyo, 4-6-1 Komaba, Meguro, Tokyo 153-8904 (Japan); and others

2015-10-02

SET domain, bifurcated 1 (SETDB1) is a histone methyltransferase that methylates lysine 9 on histone H3. Although it is important to know the localization of proteins to elucidate their physiological function, little is known of the subcellular localization of human SETDB1. In the present study, to investigate the subcellular localization of hSETDB1, we established a human cell line constitutively expressing enhanced green fluorescent protein fused to hSETDB1. We then generated a monoclonal antibody against the hSETDB1 protein. Expression of both exogenous and endogenous hSETDB1 was observed mainly in the cytoplasm of various human cell lines. Combined treatment with the nuclear export inhibitor leptomycin B and the proteasome inhibitor MG132 led to the accumulation of hSETDB1 in the nucleus. These findings suggest that hSETDB1, localized in the nucleus, might undergo degradation by the proteasome and be exported to the cytosol, resulting in its detection mainly in the cytosol. - Highlights: • Endogenous human SETDB1 was localized mainly in the cytoplasm. • Combined treatment with LMB and MG132 led to accumulation of human SETDB1 in the nucleus. • HeLa cells expressing EFGP-hSETDB1 are useful for subcellular localization analyses.

Analysis of the subcellular localization of the human histone methyltransferase SETDB1

International Nuclear Information System (INIS)

Tachibana, Keisuke; Gotoh, Eiko; Kawamata, Natsuko; Ishimoto, Kenji; Uchihara, Yoshie; Iwanari, Hiroko; Sugiyama, Akira; Kawamura, Takeshi; Mochizuki, Yasuhiro; Tanaka, Toshiya; Sakai, Juro; Hamakubo, Takao; Kodama, Tatsuhiko

2015-01-01

SET domain, bifurcated 1 (SETDB1) is a histone methyltransferase that methylates lysine 9 on histone H3. Although it is important to know the localization of proteins to elucidate their physiological function, little is known of the subcellular localization of human SETDB1. In the present study, to investigate the subcellular localization of hSETDB1, we established a human cell line constitutively expressing enhanced green fluorescent protein fused to hSETDB1. We then generated a monoclonal antibody against the hSETDB1 protein. Expression of both exogenous and endogenous hSETDB1 was observed mainly in the cytoplasm of various human cell lines. Combined treatment with the nuclear export inhibitor leptomycin B and the proteasome inhibitor MG132 led to the accumulation of hSETDB1 in the nucleus. These findings suggest that hSETDB1, localized in the nucleus, might undergo degradation by the proteasome and be exported to the cytosol, resulting in its detection mainly in the cytosol. - Highlights: • Endogenous human SETDB1 was localized mainly in the cytoplasm. • Combined treatment with LMB and MG132 led to accumulation of human SETDB1 in the nucleus. • HeLa cells expressing EFGP-hSETDB1 are useful for subcellular localization analyses.

The use of a chaperone in obstetrical and gynaecological practice.

LENUS (Irish Health Repository)

Afaneh, I

2012-02-01

The aim of this study was to assess the use of a chaperone in obstetrical and gynaecological practice in Ireland and to explore patients\\' opinions. Two questionnaires were designed; one for patients and the other one was sent to 145 gynaecologists in Ireland. One hundred and fifty two women took part in this survey of whom 74 were gynaecological and 78 were obstetric patients. Ninety five (65%) patients felt no need for a chaperone during a vaginal examination (VE) by a male doctor. On the other hand 34 (23%) participating women would request a chaperone if being examined by a female doctor. Among clinicians 116 (80%) responded by returning the questionnaire. Overall 60 (52%) always used a chaperone in public practice, in contrast to 24 (27%) in private practice. The study demonstrated that most patients do not wish to have a chaperone during a VE but a small proportion would still request one regardless of the examiner\\'s gender. Patients should be offered the choice of having a chaperone and their opinion should be respected and documented.

The use of a chaperone in obstetrical and gynaecological practice.

LENUS (Irish Health Repository)

Afaneh, I

2010-05-01

The aim of this study was to assess the use of a chaperone in obstetrical and gynaecological practice in Ireland and to explore patients\\' opinions. Two questionnaires were designed; one for patients and the other one was sent to 145 gynaecologists in Ireland. One hundred and fifty two women took part in this survey of whom 74 were gynaecological and 78 were obstetric patients. Ninety five (65%) patients felt no need for a chaperone during a vaginal examination (VE) by a male doctor. On the other hand 34 (23%) participating women would request a chaperone if being examined by a female doctor. Among clinicians 116 (80%) responded by returning the questionnaire. Overall 60 (52%) always used a chaperone in public practice, in contrast to 24 (27%) in private practice. The study demonstrated that most patients do not wish to have a chaperone during a VE but a small proportion would still request one regardless of the examiner\\'s gender. Patients should be offered the choice of having a chaperone and their opinion should be respected and documented.

Identification of novel post-translational modifications in linker histones from chicken erythrocytes.

Science.gov (United States)

Sarg, Bettina; Lopez, Rita; Lindner, Herbert; Ponte, Inma; Suau, Pedro; Roque, Alicia

2015-01-15

Chicken erythrocyte nuclei were digested with micrococcal nuclease and fractionated by centrifugation in low-salt buffer into soluble and insoluble fractions. Post-translational modifications of the purified linker histones of both fractions were analyzed by LC-ESI-MS/MS. All six histone H1 subtypes (H1.01, H1.02, H1.03, H1.10, H1.1L and H1.1R) and histone H5 were identified. Mass spectrometry analysis enabled the identification of a wide range of PTMs, including N(α)-terminal acetylation, acetylation, formylation, phosphorylation and oxidation. A total of nine new modifications in chicken linker histones were mapped, most of them located in the N-terminal and globular domains. Relative quantification of the modified peptides showed that linker histone PTMs were differentially distributed among both chromatin fractions, suggesting their relevance in the regulation of chromatin structure. The analysis of our results combined with previously reported data for chicken and some mammalian species showed that most of the modified positions were conserved throughout evolution, highlighting their importance in specific linker histone functions and epigenetics. Post-translational modifications of linker histones could have a role in the regulation of gene expression through the modulation of chromatin higher-order structure and chromatin remodeling. Finding new PTMs in linker histones is the first step to elucidate their role in the histone code. In this manuscript we report nine new post-translational modifications of the linker histones from chicken erythrocytes, one in H5 and eight in the H1 subtypes. Chromatin fractionated by centrifugation in low-salt buffer resulted in two fractions with different contents and compositions of linker histones and enriched in specific core histone PTMs. Of particular interest is the fact that linker histone PTMs were differentially distributed in both chromatin fractions, suggesting specific functions. Future studies are needed to

Antiferromagnetism in the organic conductor bis-tetramethyltetraselenafulvalene hexafluoroarsenate [(TMTSF)2AsF6]: Static magnetic susceptibility

DEFF Research Database (Denmark)

Mortensen, Kell; Tomkiewicz, Yaffa; Bechgaard, Klaus

1982-01-01

The anisotropy in the static magnetic susceptibility of bis-tetramethyltetraselenafulvalene hexafluoroarsenate [(TMTSF)2AsF6] has been investigated above and below the metal-to-insulator transition for a range of fields between 0.5 and 30 kG. The results are consistent with the expectations of a ...

Localization of MRP-1 to the outer mitochondrial membrane by the chaperone protein HSP90β.

Science.gov (United States)

Roundhill, Elizabeth; Turnbull, Doug; Burchill, Susan

2016-05-01

Overexpression of plasma membrane multidrug resistance-associated protein 1 (MRP-1) in Ewing's sarcoma (ES) predicts poor outcome. MRP-1 is also expressed in mitochondria, and we have examined the submitochondrial localization of MRP-1 and investigated the mechanism of MRP-1 transport and role of this organelle in the response to doxorubicin. The mitochondrial localization of MRP-1 was examined in ES cell lines by differential centrifugation and membrane solubilization by digitonin. Whether MRP-1 is chaperoned by heat shock proteins (HSPs) was investigated by immunoprecipitation, immunofluorescence microscopy, and HSP knockout using small hairpin RNA and inhibitors (apoptozole, 17-AAG, and NVPAUY). The effect of disrupting mitochondrial MRP-1-dependent efflux activity on the cytotoxic effect of doxorubicin was investigated by counting viable cell number. Mitochondrial MRP-1 is glycosylated and localized to the outer mitochondrial membrane, where it is coexpressed with HSP90. MRP-1 binds to both HSP90 and HSP70, although only inhibition of HSP90β decreases expression of MRP-1 in the mitochondria. Disruption of mitochondrial MRP-1-dependent efflux significantly increases the cytotoxic effect of doxorubicin (combination index, MRP-1 is expressed in the outer mitochondrial membrane and is a client protein of HSP90β, where it may play a role in the doxorubicin-induced resistance of ES.-Roundhill, E., Turnbull, D., Burchill, S. Localization of MRP-1 to the outer mitochondrial membrane by the chaperone protein HSP90β. © FASEB.

FACT prevents the accumulation of free histones evicted from transcribed chromatin and a subsequent cell cycle delay in G1.

Directory of Open Access Journals (Sweden)

Macarena Morillo-Huesca

2010-05-01

Full Text Available The FACT complex participates in chromatin assembly and disassembly during transcription elongation. The yeast mutants affected in the SPT16 gene, which encodes one of the FACT subunits, alter the expression of G1 cyclins and exhibit defects in the G1/S transition. Here we show that the dysfunction of chromatin reassembly factors, like FACT or Spt6, down-regulates the expression of the gene encoding the cyclin that modulates the G1 length (CLN3 in START by specifically triggering the repression of its promoter. The G1 delay undergone by spt16 mutants is not mediated by the DNA-damage checkpoint, although the mutation of RAD53, which is otherwise involved in histone degradation, enhances the cell-cycle defects of spt16-197. We reveal how FACT dysfunction triggers an accumulation of free histones evicted from transcribed chromatin. This accumulation is enhanced in a rad53 background and leads to a delay in G1. Consistently, we show that the overexpression of histones in wild-type cells down-regulates CLN3 in START and causes a delay in G1. Our work shows that chromatin reassembly factors are essential players in controlling the free histones potentially released from transcribed chromatin and describes a new cell cycle phenomenon that allows cells to respond to excess histones before starting DNA replication.

Histone H2A mobility is regulated by its tails and acetylation of core histone tails

International Nuclear Information System (INIS)

Higashi, Tsunehito; Matsunaga, Sachihiro; Isobe, Keisuke; Morimoto, Akihiro; Shimada, Tomoko; Kataoka, Shogo; Watanabe, Wataru; Uchiyama, Susumu; Itoh, Kazuyoshi; Fukui, Kiichi

2007-01-01

Histone tail domains play important roles in cellular processes, such as replication, transcription, and chromosome condensation. Histone H2A has one central and two tail domains, and their functions have mainly been studied from a biochemical perspective. In addition, analyses based on visualization have been employed for functional analysis of some chromatin proteins. In this study, we analyzed histone H2A mobility in vivo by two-photon FRAP, and elucidated that the histone H2A N- and C-terminal tails regulate its mobility. We found that histone H2A mobility was increased following treatment of host cells with a histone deacetylase inhibitor. Our results support a model in which core histone tails directly regulate transcription by interacting with nucleosome DNA via electrostatic interactions

Transrepressive Function of TLX Requires the Histone Demethylase LSD1 ▿ †

Science.gov (United States)

Yokoyama, Atsushi; Takezawa, Shinichiro; Schüle, Roland; Kitagawa, Hirochika; Kato, Shigeaki

2008-01-01

TLX is an orphan nuclear receptor (also called NR2E1) that regulates the expression of target genes by functioning as a constitutive transrepressor. The physiological significance of TLX in the cytodifferentiation of neural cells in the brain is known. However, the corepressors supporting the transrepressive function of TLX have yet to be identified. In this report, Y79 retinoblastoma cells were subjected to biochemical techniques to purify proteins that interact with TLX, and we identified LSD1 (also called KDM1), which appears to form a complex with CoREST and histone deacetylase 1. LSD1 interacted with TLX directly through its SWIRM and amine oxidase domains. LSD1 potentiated the transrepressive function of TLX through its histone demethylase activity as determined by a luciferase assay using a genomically integrated reporter gene. LSD1 and TLX were recruited to a TLX-binding site in the PTEN gene promoter, accompanied by the demethylation of H3K4me2 and deacetylation of H3. Knockdown of either TLX or LSD1 derepressed expression of the endogenous PTEN gene and inhibited cell proliferation of Y79 cells. Thus, the present study suggests that LSD1 is a prime corepressor for TLX. PMID:18391013

Biologic activities of molecular chaperones and pharmacologic chaperone imidazole-containing dipeptide-based compounds: natural skin care help and the ultimate challenge: implication for adaptive responses in the skin.

Science.gov (United States)

Babizhayev, Mark A; Nikolayev, Gennady M; Nikolayeva, Juliana G; Yegorov, Yegor E

2012-03-01

Accumulation of molecular damage and increased molecular heterogeneity are hallmarks of photoaged skin and pathogenesis of human cutaneous disease. Growing evidence demonstrates the ability of molecular chaperone proteins and of pharmacologic chaperones to decrease the environmental stress and ameliorate the oxidation stress-related and glycation disease phenotypes, suggesting that the field of chaperone therapy might hold novel treatments for skin diseases and aging. In this review, we examine the evidence suggesting a role for molecular chaperone proteins in the skin and their inducer and protecting agents: pharmacologic chaperone imidazole dipeptide-based agents (carcinine and related compounds) in cosmetics and dermatology. Furthermore, we discuss the use of chaperone therapy for the treatment of skin photoaging diseases and other skin pathologies that have a component of increased glycation and/or free radical-induced oxidation in their genesis. We examine biologic activities of molecular and pharmacologic chaperones, including strategies for identifying potential chaperone compounds and for experimentally demonstrating chaperone activity in in vitro and in vivo models of human skin disease. This allows the protein to function and traffic to the appropriate location in the skin, thereby increasing protein activity and cellular function and reducing stress on skin cells. The benefits of imidazole dipeptide antioxidants with transglycating activity (such as carcinine) in skin care are that they help protect and repair cell membrane damage and help retain youthful, younger-looking skin. All skin types will benefit from daily, topical application of pharmacologic chaperone antioxidants, anti-irritants, in combination with water-binding protein agents that work to mimic the structure and function of healthy skin. General strategies are presented addressing ground techniques to improve absorption of usually active chaperone proteins and dipeptide compounds, include

Substrate- and Cofactor-independent Inhibition of Histone Demethylase KDM4C

DEFF Research Database (Denmark)

Leurs, Ulrike; Lohse, Brian; Rand, Kasper Dyrberg

2014-01-01

Inhibition of histone demethylases has within recent years advanced into a new strategy for treating cancer and other diseases. Targeting specific histone demethylases can be challenging as the active sites of KDM1A-B and KDM-4A-D histone demethylases, respectively, are highly conserved. Most...... inhibitors developed up-to-date target either the cofactor- or substrate-binding sites of these enzymes, resulting in a lack of selectivity and off-target effects. This study describes the discovery of the first peptide-based inhibitors of KDM4 histone demethylases that do not share the histone peptide...... sequence, or inhibit through substrate competition. Through screening of DNA-encoded peptide libraries against KDM1 and -4 histone demethylases by phage display, two cyclic peptides targeting the histone demethylase KDM4C were identified and developed as inhibitors by amino acid replacement, truncation...

Increased phosphorylation of histone H3 at serine 10 is involved in Epstein-Barr virus latent membrane protein-1-induced carcinogenesis of nasopharyngeal carcinoma

International Nuclear Information System (INIS)

Li, Binbin; Huang, Guoliang; Zhang, Xiangning; Li, Rong; Wang, Jian; Dong, Ziming; He, Zhiwei

2013-01-01

Increased histone H3 phosphorylation is an essential regulatory mechanism for neoplastic cell transformation. We aimed to explore the role of histone H3 phosphorylation at serine10 (p-H3Ser10) in Epstein-Barr virus (EBV) latent membrane protein-1 (LMP1)-induced carcinogenesis of nasopharyngeal carcinoma (NPC). The expression of p-H3Ser10 was detected by the immunohistochemical analysis in NPC, chronic nasopharyngitis and normal nasopharynx tissues, and its correlation with LMP1 was analyzed in NPC tissues and cell lines. Using the small interfering RNA (siRNA)-H3 and histone H3 mutant (S10A), the effect of histone H3 Ser10 motif on LMP1-induced CNE1 cell proliferation, transformation and activator protein-1 (AP-1) activation were evaluated by CCK-8, focus-forming and reporter gene assay respectively. Mitogen- and stress-activated kinase 1 (MSK1) kinase activity and phosphorylation were detected by in vitro kinase assay and western blot. Using MSK1 inhibitor H89 or siRNA-MSK1, the regulatory role of MSK1 on histone H3 phosphorylation and AP-1 activation were analyzed. Immunohistochemical analysis revealed that the expression of p-H3Ser10 was significantly higher in the poorly differentiated NPC tissues than that in chronic nasopharyngitis (p <0.05) and normal nasopharynx tissues (p <0.001). Moreover, high level of p-H3Ser10 was positively correlated with the expression of LMP1 in NPC tissues (χ 2 =6.700, p =0.01; C=0.350) and cell lines. The knockdown and mutant (S10A) of histone H3 suppressed LMP1-induced CNE1 cell proliferation, foci formation and AP-1 activation. In addition, LMP1 could increase MSK1 kinase activity and phosphorylation. MSK1 inhibitor H89 or knockdown of MSK1 by siRNA blocked LMP1-induced phosphorylation of histone H3 at Ser10 and AP-1 activation. EBV-LMP1 can induce phosphorylation of histone H3 at Ser10 via MSK1. Increased phosphorylation of histone H3 at Ser10 is likely a crucial regulatory mechanism involved in LMP1-induced carcinogenesis of

Hepatic steatosis in transgenic mice overexpressing human histone deacetylase 1

International Nuclear Information System (INIS)

Wang, Ai-Guo; Seo, Sang-Beom; Moon, Hyung-Bae; Shin, Hye-Jun; Kim, Dong Hoon; Kim, Jin-Man; Lee, Tae-Hoon; Kwon, Ho Jeong; Yu, Dae-Yeul; Lee, Dong-Seok

2005-01-01

It is generally thought that histone deacetylases (HDACs) play important roles in the transcriptional regulation of genes. However, little information is available concerning the specific functions of individual HDACs in disease states. In this study, two transgenic mice lines were established which harbored the human HDAC1 gene. Overexpressed HDAC1 was detected in the nuclei of transgenic liver cells, and HDAC1 enzymatic activity was significantly higher in the transgenic mice than in control littermates. The HDAC1 transgenic mice exhibited a high incidence of hepatic steatosis and nuclear pleomorphism. Molecular studies showed that HDAC1 may contribute to nuclear pleomorphism through the p53/p21 signaling pathway

Identification and characterization of the genes encoding the core histones and histone variants of Neurospora crassa.

OpenAIRE

Hays, Shan M; Swanson, Johanna; Selker, Eric U

2002-01-01

We have identified and characterized the complete complement of genes encoding the core histones of Neurospora crassa. In addition to the previously identified pair of genes that encode histones H3 and H4 (hH3 and hH4-1), we identified a second histone H4 gene (hH4-2), a divergently transcribed pair of genes that encode H2A and H2B (hH2A and hH2B), a homolog of the F/Z family of H2A variants (hH2Az), a homolog of the H3 variant CSE4 from Saccharomyces cerevisiae (hH3v), and a highly diverged ...

Engineered disulfide bonds restore chaperone-like function of DJ-1 mutants linked to familial Parkinson's disease.

Science.gov (United States)

Logan, Todd; Clark, Lindsay; Ray, Soumya S

2010-07-13

Loss-of-function mutations such as L166P, A104T, and M26I in the DJ-1 gene (PARK7) have been linked to autosomal-recessive early onset Parkinson's disease (PD). Cellular and structural studies of the familial mutants suggest that these mutations may destabilize the dimeric structure. To look for common dynamical signatures among the DJ-1 mutants, short MD simulations of up to 1000 ps were conducted to identify the weakest region of the protein (residues 38-70). In an attempt to stabilize the protein, we mutated residue Val 51 to cysteine (V51C) to make a symmetry-related disulfide bridge with the preexisting Cys 53 on the opposite subunit. We found that the introduction of this disulfide linkage stabilized the mutants A104T and M26I against thermal denaturation, improved their ability to scavenge reactive oxygen species (ROS), and restored a chaperone-like function of blocking alpha-synuclein aggregation. The L166P mutant was far too unstable to be rescued by introduction of the V51C mutation. The results presented here point to the possible development of pharmacological chaperones, which may eventually lead to PD therapeutics.

Hsp40 function in yeast prion propagation: Amyloid diversity necessitates chaperone functional complexity.

Science.gov (United States)

Sporn, Zachary A; Hines, Justin K

2015-01-01

Yeast prions are heritable protein-based elements, most of which are formed of amyloid aggregates that rely on the action of molecular chaperones for transmission to progeny. Prions can form distinct amyloid structures, known as 'strains' in mammalian systems, that dictate both pathological progression and cross-species infection barriers. In yeast these same amyloid structural polymorphisms, called 'variants', dictate the intensity of prion-associated phenotypes and stability in mitosis. We recently reported that [PSI(+)] prion variants differ in the fundamental domain requirements for one chaperone, the Hsp40/J-protein Sis1, which are mutually exclusive between 2 different yeast prions, demonstrating a functional plurality for Sis1. Here we extend that analysis to incorporate additional data that collectively support the hypothesis that Sis1 has multiple functional roles that can be accomplished by distinct sets of domains. These functions are differentially required by distinct prions and prion variants. We also present new data regarding Hsp104-mediated prion elimination and show that some Sis1 functions, but not all, are conserved in the human homolog Hdj1/DNAJB1. Importantly, of the 10 amyloid-based prions indentified to date in Saccharomyces cerevisiae, the chaperone requirements of only 4 are known, leaving a great diversity of amyloid structures, and likely modes of amyloid-chaperone interaction, largely unexplored.

Modulation of the functional association between the HIV-1 intasome and the nucleosome by histone amino-terminal tails.

Science.gov (United States)

Benleulmi, Mohamed S; Matysiak, Julien; Robert, Xavier; Miskey, Csaba; Mauro, Eric; Lapaillerie, Delphine; Lesbats, Paul; Chaignepain, Stéphane; Henriquez, Daniel R; Calmels, Christina; Oladosu, Oyindamola; Thierry, Eloïse; Leon, Oscar; Lavigne, Marc; Andreola, Marie-Line; Delelis, Olivier; Ivics, Zoltán; Ruff, Marc; Gouet, Patrice; Parissi, Vincent

2017-11-28

Stable insertion of the retroviral DNA genome into host chromatin requires the functional association between the intasome (integrase·viral DNA complex) and the nucleosome. The data from the literature suggest that direct protein-protein contacts between integrase and histones may be involved in anchoring the intasome to the nucleosome. Since histone tails are candidates for interactions with the incoming intasomes we have investigated whether they could participate in modulating the nucleosomal integration process. We show here that histone tails are required for an optimal association between HIV-1 integrase (IN) and the nucleosome for efficient integration. We also demonstrate direct interactions between IN and the amino-terminal tail of human histone H4 in vitro. Structure/function studies enabled us to identify amino acids in the carboxy-terminal domain of IN that are important for this interaction. Analysis of the nucleosome-binding properties of catalytically active mutated INs confirmed that their ability to engage the nucleosome for integration in vitro was affected. Pseudovirus particles bearing mutations that affect the IN/H4 association also showed impaired replication capacity due to altered integration and re-targeting of their insertion sites toward dynamic regions of the chromatin with lower nucleosome occupancy. Collectively, our data support a functional association between HIV-1 IN and histone tails that promotes anchoring of the intasome to nucleosomes and optimal integration into chromatin.

Radiation damage to histones

International Nuclear Information System (INIS)

Mee, L.K.; Adelstein, S.J.

1985-01-01

The damage to histones irradiated in isolation is being elaborated to aid the identification of the crosslinking sites in radiation-induced DNA-histone adducts. Histones are being examined by amino acid analysis to determine the destruction of residues and by polyacrylamide gel electrophoresis to delineate changes in conformation. For the slightly lysine-rich histone, H2A, a specific attack on selective residues has been established, the aromatic residues, tyrosine and phenylalanine, and the heterocyclic residue, histidine, being significantly destroyed. In addition, a significant increase in aspartic acid was found; this may represent a radiation product from scission of the ring in the histidine residues. The similarity of the effects on residues in nitrous oxide-saturated and nitrogen-saturated solutions suggests that OH . and e/sub aq//sup -/ are equally efficient and selective in their attack. On gel electrophoresis degradation of the histone H2A was found to be greatest for irradiations in nitrous oxide-saturated solutions, suggesting CH . is the most effective radical for producing changes in conformation; O/sub 2//sup -/ was essentially ineffective. Other histones are being examined for changes in amino acid composition, conformation, and for the formation of radiation products

Interactions of acetylated histones with DNA as revealed by UV laser induced histone-DNA crosslinking

International Nuclear Information System (INIS)

Stefanovsky, V.Yu.; Dimitrov, S.I.; Angelov, D.; Pashev, I.G.

1989-01-01

The interaction of acetylated histones with DNA in chromatin has been studied by UV laser-induced crosslinking histones to DNA. After irradiation of the nuclei, the covalently linked protein-DNA complexes were isolated and the presence of histones in them demonstrated immunochemically. When chromatin from irradiated nuclei was treated with clostripain, which selectively cleaved the N-terminal tails of core histones, no one of them was found covalently linked to DNA, thus showing that crosslinking proceeded solely via the N-terminal regions. However, the crosslinking ability of the laser was preserved both upon physiological acetylation of histones, known to be restricted to the N-terminal tails, and with chemically acetylated chromatin. This finding is direct evidence that the postsynthetic histone acetylation does not release the N-terminal tails from interaction with DNA

Applying chaperones to protein-misfolding disorders: molecular chaperones against α-synuclein in Parkinson's disease.

Science.gov (United States)

Chaari, Ali; Hoarau-Véchot, Jessica; Ladjimi, Moncef

2013-09-01

Parkinson's disease (PD) is a neurodegenerative disorder characterized by the accumulation of a protein called α-synuclein (α-syn) into inclusions known as lewy bodies (LB) within neurons. This accumulation is also due to insufficient formation and activity of dopamine produced in certain neurons within the substantia nigra. Lewy bodies are the pathological hallmark of the idiopathic disorder and the cascade that allows α-synuclein to misfold, aggregate and form these inclusions has been the subject of intensive research. Targeting these early steps of oligomerization is one of the main therapeutic approaches in order to develop neurodegenerative-modifying agents. Because the folding and refolding of alpha synuclein is the key point of this cascade, we are interested in this review to summarize the role of some molecular chaperones proteins such as Hsp70, Hsp90 and small heat shock proteins (sHsp) and Hsp 104. Hsp70 and its co-chaperone, Hsp70 and small heat shock proteins can prevent neurodegeneration by preventing α-syn misfolding, oligomerization and aggregation in vitro and in Parkinson disease animal models. Hsp104 is able to resolve disordered protein aggregates and cross beta amyloid conformers. Together, these chaperones have a complementary effect and can be a target for therapeutic intervention in PD. Published by Elsevier B.V.

The Malarial Exported PFA0660w Is an Hsp40 Co-Chaperone of PfHsp70-x.

Directory of Open Access Journals (Sweden)

Michael O Daniyan

Full Text Available Plasmodium falciparum, the human pathogen responsible for the most dangerous malaria infection, survives and develops in mature erythrocytes through the export of proteins needed for remodelling of the host cell. Molecular chaperones of the heat shock protein (Hsp family are prominent members of the exportome, including a number of Hsp40s and a Hsp70. PFA0660w, a type II Hsp40, has been shown to be exported and possibly form a complex with PfHsp70-x in the infected erythrocyte cytosol. However, the chaperone properties of PFA0660w and its interaction with human and parasite Hsp70s are yet to be investigated. Recombinant PFA0660w was found to exist as a monomer in solution, and was able to significantly stimulate the ATPase activity of PfHsp70-x but not that of a second plasmodial Hsp70 (PfHsp70-1 or a human Hsp70 (HSPA1A, indicating a potential specific functional partnership with PfHsp70-x. Protein binding studies in the presence and absence of ATP suggested that the interaction of PFA0660w with PfHsp70-x most likely represented a co-chaperone/chaperone interaction. Also, PFA0660w alone produced a concentration-dependent suppression of rhodanese aggregation, demonstrating its chaperone properties. Overall, we have provided the first biochemical evidence for the possible role of PFA0660w as a chaperone and as co-chaperone of PfHsp70-x. We propose that these chaperones boost the chaperone power of the infected erythrocyte, enabling successful protein trafficking and folding, and thereby making a fundamental contribution to the pathology of malaria.

Imprinted CDKN1C is a tumor suppressor in rhabdoid tumor and activated by restoration of SMARCB1 and histone deacetylase inhibitors.

Directory of Open Access Journals (Sweden)

Elizabeth M Algar

Full Text Available SMARCB1 is deleted in rhabdoid tumor, an aggressive paediatric malignancy affecting the kidney and CNS. We hypothesized that the oncogenic pathway in rhabdoid tumors involved epigenetic silencing of key cell cycle regulators as a consequence of altered chromatin-remodelling, attributable to loss of SMARCB1, and that this hypothesis if proven could provide a biological rationale for testing epigenetic therapies in this disease. We used an inducible expression system to show that the imprinted cell cycle inhibitor CDKN1C is a downstream target for SMARCB1 and is transcriptionally activated by increased histone H3 and H4 acetylation at the promoter. We also show that CDKN1C expression induces cell cycle arrest, CDKN1C knockdown with siRNA is associated with increased proliferation, and is able to compete against the anti-proliferative effect of restored SMARCB1 expression. The histone deacetylase inhibitor (HDACi, Romidepsin, specifically restored CDKN1C expression in rhabdoid tumor cells through promoter histone H3 and H4 acetylation, recapitulating the effect of SMARCB1 on CDKNIC allelic expression, and induced cell cycle arrest in G401 and STM91-01 rhabdoid tumor cell lines. CDKN1C expression was also shown to be generally absent in clinical specimens of rhabdoid tumor, however CDKN1A and CDKN1B expression persisted. Our observations suggest that maintenance of CDKN1C expression plays a critical role in preventing rhabdoid tumor growth. Significantly, we report for the first time, parallels between the molecular pathways of SMARCB1 restoration and Romidepsin treatment, and demonstrate a biological basis for the further exploration of histone deacetylase inhibitors as relevant therapeutic reagents in the treatment of rhabdoid tumor.

Interaction of HP1 and Brg1/Brm with the globular domain of histone H3 is required for HP1-mediated repression.

Directory of Open Access Journals (Sweden)

Marc Lavigne

2009-12-01

Full Text Available The heterochromatin-enriched HP1 proteins play a critical role in regulation of transcription. These proteins contain two related domains known as the chromo- and the chromoshadow-domain. The chromo-domain binds histone H3 tails methylated on lysine 9. However, in vivo and in vitro experiments have shown that the affinity of HP1 proteins to native methylated chromatin is relatively poor and that the opening of chromatin occurring during DNA replication facilitates their binding to nucleosomes. These observations prompted us to investigate whether HP1 proteins have additional histone binding activities, envisioning also affinity for regions potentially occluded by the nucleosome structure. We find that the chromoshadow-domain interacts with histone H3 in a region located partially inside the nucleosomal barrel at the entry/exit point of the nucleosome. Interestingly, this region is also contacted by the catalytic subunits of the human SWI/SNF complex. In vitro, efficient SWI/SNF remodeling requires this contact and is inhibited in the presence of HP1 proteins. The antagonism between SWI/SNF and HP1 proteins is also observed in vivo on a series of interferon-regulated genes. Finally, we show that SWI/SNF activity favors loading of HP1 proteins to chromatin both in vivo and in vitro. Altogether, our data suggest that HP1 chromoshadow-domains can benefit from the opening of nucleosomal structures to bind chromatin and that HP1 proteins use this property to detect and arrest unwanted chromatin remodeling.

Histone variants and lipid metabolism

NARCIS (Netherlands)

Borghesan, Michela; Mazzoccoli, Gianluigi; Sheedfar, Fareeba; Oben, Jude; Pazienza, Valerio; Vinciguerra, Manlio

2014-01-01

Within nucleosomes, canonical histones package the genome, but they can be opportunely replaced with histone variants. The incorporation of histone variants into the nucleosome is a chief cellular strategy to regulate transcription and cellular metabolism. In pathological terms, cellular steatosis

A brief histone in time: understanding the combinatorial functions of histone PTMs in the nucleosome context.

Science.gov (United States)

Ng, Marlee K; Cheung, Peter

2016-02-01

It has been over 50 years since Allfrey et al. proposed that histone acetylation regulates RNA synthesis, and the study of histone modifications has progressed at an extraordinary pace for the past two decades. In this review, we provide a perspective on some key events and advances in our understanding of histone modifications. We also highlight reagents and tools from past to present that facilitated progress in this research field. Using histone H3 phosphorylation as an underlying thread, we review the rationale that led to the proposal of the histone code hypothesis, as well as examples that illustrate the concepts of combinatorial histone modifications and cross-talk pathways. We further highlight the importance of investigating these mechanisms in the context of nucleosomes rather than just at the histone level and present current and developing approaches for such studies. Overall, research on histone modifications has yielded great mechanistic insights into the regulation of genomic functions, and extending these studies using nucleosomes will further elucidate the complexity of these pathways in a more physiologically relevant context.

Chaperones and the Proteasome System: Regulating the Construction and Demolition of Striated Muscle

Directory of Open Access Journals (Sweden)

Casey Carlisle

2017-12-01

Full Text Available Protein folding factors (chaperones are required for many diverse cellular functions. In striated muscle, chaperones are required for contractile protein function, as well as the larger scale assembly of the basic unit of muscle, the sarcomere. The sarcomere is complex and composed of hundreds of proteins and the number of proteins and processes recognized to be regulated by chaperones has increased dramatically over the past decade. Research in the past ten years has begun to discover and characterize the chaperones involved in the assembly of the sarcomere at a rapid rate. Because of the dynamic nature of muscle, wear and tear damage is inevitable. Several systems, including chaperones and the ubiquitin proteasome system (UPS, have evolved to regulate protein turnover. Much of our knowledge of muscle development focuses on the formation of the sarcomere but recent work has begun to elucidate the requirement and role of chaperones and the UPS in sarcomere maintenance and disease. This review will cover the roles of chaperones in sarcomere assembly, the importance of chaperone homeostasis and the cooperation of chaperones and the UPS in sarcomere integrity and disease.

Interplay between chromatin modulators and histone acetylation regulates the formation of accessible chromatin in the upstream regulatory region of fission yeast fbp1.

Science.gov (United States)

Adachi, Akira; Senmatsu, Satoshi; Asada, Ryuta; Abe, Takuya; Hoffman, Charles S; Ohta, Kunihiro; Hirota, Kouji

2018-05-03

Numerous noncoding RNA transcripts are detected in eukaryotic cells. Noncoding RNAs transcribed across gene promoters are involved in the regulation of mRNA transcription via chromatin modulation. This function of noncoding RNA transcription was first demonstrated for the fission yeast fbp1 gene, where a cascade of noncoding RNA transcription events induces chromatin remodeling to facilitate transcription factor binding. We recently demonstrated that the noncoding RNAs from the fbp1 upstream region facilitate binding of the transcription activator Atf1 and thereby promote histone acetylation. Histone acetylation by histone acetyl transferases (HATs) and ATP-dependent chromatin remodelers (ADCRs) are implicated in chromatin remodeling, but the interplay between HATs and ADCRs in this process has not been fully elucidated. Here, we examine the roles played by two distinct ADCRs, Snf22 and Hrp3, and by the HAT Gcn5 in the transcriptional activation of fbp1. Snf22 and Hrp3 redundantly promote disassembly of chromatin in the fbp1 upstream region. Gcn5 critically contributes to nucleosome eviction in the absence of either Snf22 or Hrp3, presumably by recruiting Hrp3 in snf22∆ cells and Snf22 in hrp3∆ cells. Conversely, Gcn5-dependent histone H3 acetylation is impaired in snf22∆/hrp3∆ cells, suggesting that both redundant ADCRs induce recruitment of Gcn5 to the chromatin array in the fbp1 upstream region. These results reveal a previously unappreciated interplay between ADCRs and histone acetylation in which histone acetylation facilitates recruitment of ADCRs, while ADCRs are required for histone acetylation.

Histone Lysine Methylation and Neurodevelopmental Disorders

Directory of Open Access Journals (Sweden)

Jeong-Hoon Kim

2017-06-01

Full Text Available Methylation of several lysine residues of histones is a crucial mechanism for relatively long-term regulation of genomic activity. Recent molecular biological studies have demonstrated that the function of histone methylation is more diverse and complex than previously thought. Moreover, studies using newly available genomics techniques, such as exome sequencing, have identified an increasing number of histone lysine methylation-related genes as intellectual disability-associated genes, which highlights the importance of accurate control of histone methylation during neurogenesis. However, given the functional diversity and complexity of histone methylation within the cell, the study of the molecular basis of histone methylation-related neurodevelopmental disorders is currently still in its infancy. Here, we review the latest studies that revealed the pathological implications of alterations in histone methylation status in the context of various neurodevelopmental disorders and propose possible therapeutic application of epigenetic compounds regulating histone methylation status for the treatment of these diseases.

Investigation of the reactions of histone protein hydroperoxides and their role in DNA damage

International Nuclear Information System (INIS)

Luxford, C.; Dean, R.T.; Davies, M.J.

1998-01-01

Free radical attack on DNA results in base changes, cross-linking and strand cleavage leading to mutations if unrepaired. Histone proteins are intimately involved in DNA packaging and are excellent candidates for investigating DNA damage arising from protein-OOH-derived radicals. This study aimed (i) to investigate the formation of hydroperoxide on the linker histone H1 via radical reactions in the presence of O 2 ; (ii) to examine the radicals formed from transition metal ion-catalyzed breakdown of histone H1-OOH and (iii) to determine whether histone H1-OOH-derived radicals can damage DNA and free bases. (i) Histone H1 solutions were γ-irradiated ( 60 Co source) in the presence of O 2 and histone H1-OOH concentrations determined using a manual iodometric assay. Formation ( histone H1-OOH was dose-dependent and, in the absence of light or transition metal ions these hydroperoxides were found to be very stable (half life of 24 hours at 4degC ). (ii) Electron Paramagnetic Resonance (EPR) spectroscopy and spin trapping was used t investigate the Cu + -catalyzed breakdown of histone H1-OOH to form histone H1 protein side chain and -backbone carbon-centred radicals. Further EPR/spin trapping experiments showed that histone H1-OOH-derived radicals can oxidise pyrimidine bases (eg. uridine with the resultant trapping of three radical species; two pyrimidine radicals, C5-yl and Ct yl adducts (via addition of histone H1-OOH-derived radicals to the C5-C6 double bond o the pyrimidine ring) and an acyl radical adduct, whose origin is currently unknown. (iii) Damage to DNA and 2'-deoxyguanosine after reaction of histone H1-OOH-derive radicals were detected and quantified using HPLC (with EC and UV detection). We have identified 8-oxo-7,8-dihydro-2'-deoxyguanosine (8-oxodG) as a significant product ( histone H1-OOH-derived oxidative DNA modification. Increasing histone H1-OOH concentrations resulted in a concomitant increase in the amount of 8-oxodG formed. Our studies show

1H, 15N and 13C resonance assignments of the J-domain of co-chaperone Sis1 from Saccharomyces cerevisiae.

Science.gov (United States)

Pinheiro, Glaucia M S; Amorim, Gisele C; Iqbal, Anwar; Ramos, C H I; Almeida, Fabio C L

2018-04-30

Protein folding in the cell is usually aided by molecular chaperones, from which the Hsp70 (Hsp = heat shock protein) family has many important roles, such as aiding nascent folding and participating in translocation. Hsp70 has ATPase activity which is stimulated by binding to the J-domain present in co-chaperones from the Hsp40 family. Hsp40s have many functions, as for instance the binding to partially folded proteins to be delivered to Hsp70. However, the presence of the J-domain characterizes Hsp40s or, by this reason, as J-proteins. The J-domain alone can stimulate Hsp70 ATPase activity. Apparently, it also maintains the same conformation as in the whole protein although structural information on full J-proteins is still missing. This work reports the 1 H, 15 N and 13 C resonance assignments of the J-domain of a Hsp40 from Saccharomyces cerevisiae, named Sis1. Secondary structure and order parameter prediction from chemical shifts are also reported. Altogether, the data show that Sis1 J-domain is highly structured and predominantly formed by α-helices, results that are in very good agreement with those previously reported for the crystallographic structure.

Impact of histone H4 lysine 20 methylation on 53BP1 responses to chromosomal double strand breaks.

Directory of Open Access Journals (Sweden)

Andrea J Hartlerode

Full Text Available Recruitment of 53BP1 to chromatin flanking double strand breaks (DSBs requires γH2AX/MDC1/RNF8-dependent ubiquitination of chromatin and interaction of 53BP1 with histone H4 methylated on lysine 20 (H4K20me. Several histone methyltransferases have been implicated in 53BP1 recruitment, but their quantitative contributions to the 53BP1 response are unclear. We have developed a multi-photon laser (MPL system to target DSBs to subfemtoliter nuclear volumes and used this to mathematically model DSB response kinetics of MDC1 and of 53BP1. In contrast to MDC1, which revealed first order kinetics, the 53BP1 MPL-DSB response is best fitted by a Gompertz growth function. The 53BP1 MPL response shows the expected dependency on MDC1 and RNF8. We determined the impact of altered H4K20 methylation on 53BP1 MPL response kinetics in mouse embryonic fibroblasts (MEFs lacking key H4K20 histone methyltransferases. This revealed no major requirement for the known H4K20 dimethylases Suv4-20h1 and Suv4-20h2 in 53BP1 recruitment or DSB repair function, but a key role for the H4K20 monomethylase, PR-SET7. The histone methyltransferase MMSET/WHSC1 has recently been implicated in 53BP1 DSB recruitment. We found that WHSC1 homozygous mutant MEFs reveal an alteration in balance of H4K20 methylation patterns; however, 53BP1 DSB responses in these cells appear normal.

Structural Mechanisms of Nucleosome Recognition by Linker Histones.

Science.gov (United States)

Zhou, Bing-Rui; Jiang, Jiansheng; Feng, Hanqiao; Ghirlando, Rodolfo; Xiao, T Sam; Bai, Yawen

2015-08-20

Linker histones bind to the nucleosome and regulate the structure of chromatin and gene expression. Despite more than three decades of effort, the structural basis of nucleosome recognition by linker histones remains elusive. Here, we report the crystal structure of the globular domain of chicken linker histone H5 in complex with the nucleosome at 3.5 Å resolution, which is validated using nuclear magnetic resonance spectroscopy. The globular domain sits on the dyad of the nucleosome and interacts with both DNA linkers. Our structure integrates results from mutation analyses and previous cross-linking and fluorescence recovery after photobleach experiments, and it helps resolve the long debate on structural mechanisms of nucleosome recognition by linker histones. The on-dyad binding mode of the H5 globular domain is different from the recently reported off-dyad binding mode of Drosophila linker histone H1. We demonstrate that linker histones with different binding modes could fold chromatin to form distinct higher-order structures. Copyright © 2015 Elsevier Inc. All rights reserved.

Resveratrol Reactivates Latent HIV through Increasing Histone Acetylation and Activating Heat Shock Factor 1.

Science.gov (United States)

Zeng, Xiaoyun; Pan, Xiaoyan; Xu, Xinfeng; Lin, Jian; Que, Fuchang; Tian, Yuanxin; Li, Lin; Liu, Shuwen

2017-06-07

The persistence of latent HIV reservoirs presents a significant challenge to viral eradication. Effective latency reversing agents (LRAs) based on "shock and kill" strategy are urgently needed. The natural phytoalexin resveratrol has been demonstrated to enhance HIV gene expression, although its mechanism remains unclear. In this study, we demonstrated that resveratrol was able to reactivate latent HIV without global T cell activation in vitro. Mode of action studies showed resveratrol-mediated reactivation from latency did not involve the activation of silent mating type information regulation 2 homologue 1 (SIRT1), which belonged to class-3 histone deacetylase (HDAC). However, latent HIV was reactivated by resveratrol mediated through increasing histone acetylation and activation of heat shock factor 1 (HSF1). Additionally, synergistic activation of the latent HIV reservoirs was observed under cotreatment with resveratrol and conventional LRAs. Collectively, this research reveals that resveratrol is a natural LRA and shows promise for HIV therapy.

The histone demethylase Jarid1b is required for hematopoietic stem cell self-renewal

DEFF Research Database (Denmark)

Stewart, Morag H; Albert, Mareike; Sroczynska, Patrycja

2015-01-01

Jarid1b/KDM5b is a histone demethylase that regulates self-renewal and differentiation in stem cells and cancer, however its function in hematopoiesis is unclear. Here, we find that Jarid1b is highly expressed in primitive hematopoietic compartments and is overexpressed in acute myeloid leukemias...... compromises hematopoietic stem cell (HSC) self-renewal capacity and suggest that Jarid1b is a positive regulator of HSC potential.......Jarid1b/KDM5b is a histone demethylase that regulates self-renewal and differentiation in stem cells and cancer, however its function in hematopoiesis is unclear. Here, we find that Jarid1b is highly expressed in primitive hematopoietic compartments and is overexpressed in acute myeloid leukemias....... Constitutive genetic deletion of Jarid1b did not impact steady-state hematopoiesis. In contrast, acute deletion of Jarid1b from bone marrow increased peripheral blood T cells and, following secondary transplantation, resulted in loss of bone marrow reconstitution. Our results reveal that deletion of Jarid1b...

Investigation of certain physical–chemical features of oil recovery by an optimized alkali–surfactant–foam (ASF) system

NARCIS (Netherlands)

Hosseini Nasab, S.M.; Zitha, P.L.J.

2017-01-01

The objective of this study is to discover a synergistic effect between foam stability in bulk and micro-emulsion phase behaviour to design a high-performance chemical system for an optimized alkaline–surfactant–foam (ASF) flooding for enhanced oil recovery (EOR). The focus is on the interaction

Polímeros como modificadores asfálticos

Directory of Open Access Journals (Sweden)

Letícia SocaI da Silva

2009-12-01

Full Text Available

Neste trabalho foram preparadas diferentes misturas de ligante asfáltico modificado com polímeros. Foram utilizadas quatro amostras de polímeros, sendo duas de SBS, uma de SEBS e uma de Polietileno Modificado, as quais foram caracterizadas quanto a sua estrutura e propriedades térmicas através de técnicas de Ressonância Magnética Nuclear (RMN, Cromatografia por Permeação a Gel (GPC, Análise Termogravimétrica (TGA e Calorimetria Diferencial de Varredura (DSC. O ligante modificado foi avaliado quanto a sua viscosidade, retorno elástico, comportamento reológico e estabilidade à estocagem. Foram correlacionadas a estrutura química e as transições térmicas dos polímeros com as características do ligante modificado. Os polímeros do tipo SBS foram os melhores modificadores de asfalto, quando comparado com os demais polímeros avaliados.

Histones trigger sterile inflammation by activating the NLRP3 inflammasome.

Science.gov (United States)

Allam, Ramanjaneyulu; Darisipudi, Murthy Narayana; Tschopp, Jurg; Anders, Hans-Joachim

2013-12-01

Sterile cell death mediated inflammation is linked to several pathological disorders and involves danger recognition of intracellular molecules released by necrotic cells that activate different groups of innate pattern recognition receptors. Toll-like receptors directly interact with their extrinsic or intrinsic agonists and induce multiple proinflammatory mediators. In contrast, the NLRP3 inflammasome is rather thought to represent a downstream element integrating various indirect stimuli into proteolytic cleavage of interleukin (IL)-1β and IL-18. Here, we report that histones released from necrotic cells induce IL-1β secretion in an NLRP3-ASC-caspase-1-dependent manner. Genetic deletion of NLRP3 in mice significantly attenuated histone-induced IL-1β production and neutrophil recruitment. Furthermore, necrotic cells induced neutrophil recruitment, which was significantly reduced by histone-neutralizing antibodies or depleting extracellular histones via enzymatic degradation. These results identify cytosolic uptake of necrotic cell-derived histones as a triggering mechanism of sterile inflammation, which involves NLRP3 inflammasome activation and IL-1β secretion via oxidative stress. © 2013 WILEY‐VCH Verlag GmbH & Co. KGaA, Weinheim.

Development of a new rapid HPLC method for the fractionation of histones

International Nuclear Information System (INIS)

Gurley, L.R.; Valdez, J.G.; Prentice, D.A.; Spall, W.D.

1983-01-01

To study histone functions, it is necessary to fractionate the histones into their five classes (H1, H2A, H2B, H3 and H4) and then to subfractionate these classes into variants having slightly different primary structures and into different phosphorylated and acetylated forms. With the advent of high-performance liquid chromatography (HPLC), it was hoped that laborious and time-consuming conventional methods could be replaced by a simple, rapid, high-resolving HPLC method for fractionating histones. However, problems of irreversible adsorption of the histones to HPLC column packings discouraged this development. Our laboratory has now determined that the strong adsorption of histones to HPLC columns results from two different forces: (1) polar interactions between the histones and the silanol groups of silica-based HPLC column packing, and (2) hydrophobic interactions between the histones and the bound organic phase of the column packings. By minimizing these forces, we have succeeded in developing an HPLC method suitable for histone studies

Chaperone use during intimate examinations in primary care: postal survey of family physicians

Directory of Open Access Journals (Sweden)

Upshur Ross EG

2005-12-01

Full Text Available Abstract Background Physicians have long been advised to have a third party present during certain parts of a physical examination; however, little is known about the frequency of chaperone use for those specific intimate examinations regularly performed in primary care. We aimed to determine the frequency of chaperone use among family physicians across a variety of intimate physical examinations for both male and female patients, and also to identify the factors associated with chaperone use. Methods Questionnaires were mailed to a randomly selected sample of 500 Ontario members of the College of Family Physicians of Canada. Participants were asked about their use of chaperones when performing a variety of intimate examinations, namely female pelvic, breast, and rectal exams and male genital and rectal exams. Results 276 of 500 were returned (56%, of which 257 were useable. Chaperones were more commonly used with female patients than with males (t = 9.09 [df = 249], p Conclusion Clinical practice concerning the use of chaperones during intimate exams continues to be discordant with the recommendations of medical associations and medico-legal societies. Chaperones are used by only a minority of Ontario family physicians. Chaperone use is higher for examinations of female patients than of male patients and is highest for female pelvic exams. The availability of a nurse in the clinic to act as a chaperone is associated with more frequent use of chaperones.

Endoplasmic reticulum chaperones and their roles in the immunogenicity of cancer vaccines

Directory of Open Access Journals (Sweden)

Michael William Graner

2015-01-01

Full Text Available The endoplasmic reticulum (ER is a major site of passage for proteins en route to other organelles, to the cell surface, and to the extracellular space. It is also the transport route for peptides generated in the cytosol by the proteasome into the ER for loading onto major histocompatibility complex class I (MHC I molecules for eventual antigen presentation at the cell surface. Chaperones within the ER are critical for many of these processes; however, outside the ER certain of those chaperones may play important and direct roles in immune responses. In some cases, particular ER chaperones have been utilized as vaccines against tumors or infectious disease pathogens when purified from tumor tissue or recombinantly generated and loaded with antigen. In other cases, the cell surface location of ER chaperones has implications for immune responses as well as possible tumor resistance. We have produced heat shock protein/chaperone protein-based cancer vaccines called CRCL (Chaperone-Rich Cell Lysate that are conglomerates of chaperones enriched from solid tumors by an isoelectric focusing technique. These preparations have been effective against numerous murine tumors, as well as in a canine with an advanced lung carcinoma treated with autologous CRCL. We also published extensive proteomic analyses of CRCL prepared from human surgically-resected tumor samples. Of note, these preparations contained at least ten ER chaperones and a number of other residents, along with many other chaperones/heat shock proteins. Gene ontology and network analyses utilizing these proteins essentially recapitulate the antigen presentation pathways and interconnections. In conjunction with our current knowledge of cell surface/extracellular ER chaperones, these data collectively suggest that a systems-level view may provide insight into the potent immune stimulatory activities of CRCL with an emphasis on the roles of ER components in those processes.

The fragile X mental retardation protein has nucleic acid chaperone properties.

Science.gov (United States)

Gabus, Caroline; Mazroui, Rachid; Tremblay, Sandra; Khandjian, Edouard W; Darlix, Jean-Luc

2004-01-01

The fragile X syndrome is the most common cause of inherited mental retardation resulting from the absence of the fragile X mental retardation protein (FMRP). FMRP contains two K-homology (KH) domains and one RGG box that are landmarks characteristic of RNA-binding proteins. In agreement with this, FMRP associates with messenger ribonucleoparticles (mRNPs) within actively translating ribosomes, and is thought to regulate translation of target mRNAs, including its own transcript. To investigate whether FMRP might chaperone nucleic acid folding and hybridization, we analysed the annealing and strand exchange activities of DNA oligonucleotides and the enhancement of ribozyme-directed RNA substrate cleavage by FMRP and deleted variants relative to canonical nucleic acid chaperones, such as the cellular YB-1/p50 protein and the retroviral nucleocapsid protein HIV-1 NCp7. FMRP was found to possess all the properties of a potent nucleic acid chaperone, requiring the KH motifs and RGG box for optimal activity. These findings suggest that FMRP may regulate translation by acting on RNA-RNA interactions and thus on the structural status of mRNAs.

Analysis of nucleic acid chaperoning by the prion protein and its inhibition by oligonucleotides.

Science.gov (United States)

Guichard, Cécile; Ivanyi-Nagy, Roland; Sharma, Kamal Kant; Gabus, Caroline; Marc, Daniel; Mély, Yves; Darlix, Jean-Luc

2011-10-01

Prion diseases are unique neurodegenerative illnesses associated with the conversion of the cellular prion protein (PrP(C)) into the aggregated misfolded scrapie isoform, named PrP(Sc). Recent studies on the physiological role of PrP(C) revealed that this protein has probably multiple functions, notably in cell-cell adhesion and signal transduction, and in assisting nucleic acid folding. In fact, in vitro findings indicated that the human PrP (huPrP) possesses nucleic acid binding and annealing activities, similarly to nucleic acid chaperone proteins that play essential roles in cellular DNA and RNA metabolism. Here, we show that a peptide, representing the N-terminal domain of huPrP, facilitates nucleic acid annealing by two parallel pathways nucleated through the stem termini. We also show that PrP of human or ovine origin facilitates DNA strand exchange, ribozyme-directed cleavage of an RNA template and RNA trans-splicing in a manner similar to the nucleocapsid protein of HIV-1. In an attempt to characterize inhibitors of PrP-chaperoning in vitro we discovered that the thioaptamer 5'-GACACAAGCCGA-3' was extensively inhibiting the PrP chaperoning activities. At the same time a recently characterized methylated oligoribonucleotide inhibiting the chaperoning activity of the HIV-1 nucleocapsid protein was poorly impairing the PrP chaperoning activities.

The Chlamydia type III secretion system C-ring engages a chaperone-effector protein complex.

Directory of Open Access Journals (Sweden)

Kris E Spaeth

2009-09-01

Full Text Available In Gram-negative bacterial pathogens, specialized chaperones bind to secreted effector proteins and maintain them in a partially unfolded form competent for translocation by type III secretion systems/injectisomes. How diverse sets of effector-chaperone complexes are recognized by injectisomes is unclear. Here we describe a new mechanism of effector-chaperone recognition by the Chlamydia injectisome, a unique and ancestral line of these evolutionarily conserved secretion systems. By yeast two-hybrid analysis we identified networks of Chlamydia-specific proteins that interacted with the basal structure of the injectisome, including two hubs of protein-protein interactions that linked known secreted effector proteins to CdsQ, the putative cytoplasmic C-ring component of the secretion apparatus. One of these protein-interaction hubs is defined by Ct260/Mcsc (Multiple cargo secretion chaperone. Mcsc binds to and stabilizes at least two secreted hydrophobic proteins, Cap1 and Ct618, that localize to the membrane of the pathogenic vacuole ("inclusion". The resulting complexes bind to CdsQ, suggesting that in Chlamydia, the C-ring of the injectisome mediates the recognition of a subset of inclusion membrane proteins in complex with their chaperone. The selective recognition of inclusion membrane proteins by chaperones may provide a mechanism to co-ordinate the translocation of subsets of inclusion membrane proteins at different stages in infection.

Polypeptide binding properties of the chaperone calreticulin

DEFF Research Database (Denmark)

Jørgensen, C S; Heegaard, N H; Holm, A

2000-01-01

Calreticulin is a highly conserved eukaryotic ubiquitious protein located mainly in the endoplasmic reticulum. Two major characteristics of calreticulin are its chaperone activity and its lectin properties, but its precise function in intracellular protein and peptide processing remains to be elu......Calreticulin is a highly conserved eukaryotic ubiquitious protein located mainly in the endoplasmic reticulum. Two major characteristics of calreticulin are its chaperone activity and its lectin properties, but its precise function in intracellular protein and peptide processing remains...

Circulating Extracellular Histones Are Clinically Relevant Mediators of Multiple Organ Injury.

Science.gov (United States)

Kawai, Chihiro; Kotani, Hirokazu; Miyao, Masashi; Ishida, Tokiko; Jemail, Leila; Abiru, Hitoshi; Tamaki, Keiji

2016-04-01

Extracellular histones are a damage-associated molecular pattern (DAMP) involved in the pathogenesis of various diseases. The mechanisms of histone-mediated injury in certain organs have been extensively studied, but an understanding of the pathophysiological role of histone-mediated injury in multiple organ injury remains elusive. To elucidate this role, we systemically subjected C57BL/6 mice to various doses of histones and performed a chronological evaluation of the morphological and functional changes in the lungs, liver, and kidneys. Notably, histone administration ultimately led to death after a dose-dependent aggravation of multiple organ injury. In chronological studies, pulmonary and hepatic injuries occurred within 15 minutes, whereas renal injuries presented at a later phase, suggesting that susceptibility to extracellular histones varies among organs. Histones bound to pulmonary and hepatic endothelial cells immediately after administration, leading to endothelial damage, which could be ameliorated by pretreatment with heparin. Furthermore, release of another DAMP, high-mobility group protein box 1, followed the histone-induced tissue damage, and an antibody against the molecule ameliorated hepatic and renal failure in a late phase. These findings indicate that extracellular histones induce multiple organ injury in two progressive stages-direct injury to endothelial cells and the subsequent release of other DAMPs-and that combination therapies against extracellular histones and high-mobility group protein box 1 may be a promising strategy for treating multiple organ injury. Copyright © 2016 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.

Circulating histones for predicting prognosis after cardiac surgery: a prospective study.

Science.gov (United States)

Gao, Hongxiang; Zhang, Naipu; Lu, Fangfang; Yu, Xindi; Zhu, Limin; Mo, Xi; Wang, Wei

2016-11-01

The objective of this study was to assess the perioperative changes in circulating histones and their relationships with other biomarkers and clinical outcomes after cardiac surgery with cardiopulmonary bypass (CPB) in patients. Forty-eight patients with congenital cardiac diseases undergoing corrective procedure with CPB were prospectively enrolled in this study. Circulating histones, N-terminal pro-brain natriuretic peptide (NT-proBNP), procalcitonin (PCT) and C-reactive protein (CRP) were measured preoperatively (T0) and at 0 (T1), 24 (T2), 48 (T3) and 72 (T4) h postoperatively. The relationships between biomarkers and clinical outcomes were analysed. Circulating histones, NT-proBNP, PCT and CRP increased significantly postoperatively, with histones reaching the peak value earliest at T1. Circulating histone levels were higher in patients with adverse events. Receiver operating characteristic curve analysis showed that peak histone levels had a better predictive value for adverse events postoperatively. Peak histone levels correlated with the peak level of NT-proBNP (r = 0.563, P histones reached peak levels faster than NT-proBNP, PCT and CRP. Furthermore, peak histone levels correlated with biomarkers and postoperative clinical outcomes. Circulating histones may be used as a prognostic indicator for patients after cardiac surgery with CPB. ClinicalTrials.gov (ID: NCT02325765). © The Author 2016. Published by Oxford University Press on behalf of the European Association for Cardio-Thoracic Surgery. All rights reserved.

Histone H4 Lysine 20 methylation

DEFF Research Database (Denmark)

Jørgensen, Stine; Schotta, Gunnar; Sørensen, Claus Storgaard

2013-01-01

of histones have emerged as key regulators of genomic integrity. Intense research during the past few years has revealed histone H4 lysine 20 methylation (H4K20me) as critically important for the biological processes that ensure genome integrity, such as DNA damage repair, DNA replication and chromatin...... compaction. The distinct H4K20 methylation states are mediated by SET8/PR-Set7 that catalyses monomethylation of H4K20, whereas SUV4-20H1 and SUV4-20H2 enzymes mediate further H4K20 methylation to H4K20me2 and H4K20me3. Disruption of these H4K20-specific histone methyltransferases leads to genomic...

Thermodynamic stability of complexes of BF3, PF5 and AsF5 with chlorine fluorides, oxyfluorides, and related compounds

International Nuclear Information System (INIS)

Trowbridge, L.D.

1996-07-01

The recent discovery of solid, water sensitive, arsenic-containing deposits in auxiliary process piping in the PGDP led to a search for explanations that could account for such accumulated material. A plausible explanation for the deposits is the formation of complexes of AsF 5 with one or more gases that may have been present as a result of cascade equipment cleanup activities. A literature search was performed. The target of the search was literature that would provide information on the dissociation pressure of complexes of AsF 5 or its hydrolysis products with any gases that may be (at least intermittently) present in the cascade location where the deposits were found. While the precise information sought (namely reliable, accurate dissociation pressures of such complexes at cascade temperatures) was not found in the detail desired. other information on these or similar complexes was obtained which permits prediction of the conditions under which the complexes might form, dissociate, or migrate, and how they might behave in the presence of atmospheric moisture. Information was gathered on potential AsF 5 complexes with ClF, ClF 3 , ClF 5 , ClF 3 O, ClO 2 F, and ClO 3 F. Information was also collected on many other related complexes as it was encountered, particularly for series of complexes which could assist in predicting chemical trends. Thermodynamic analysis and property estimation methods have been used to generate provisional estimates of the dissociation pressures of the two complexes ClF 3 *AsF 5 and ClO 2 F*AsF 5 . In addition, several hydrolysis species have been identified, and stability properties of the most relevant such complex (H 3 O*AsF 6 ) have similarly been estimated. While the predicted dissociation pressures are somewhat uncertain. they do lead to a tentative picture of the formation and behavior of such complexes in a cascade cleanup environment

The Salmonella type III effector SspH2 specifically exploits the NLR co-chaperone activity of SGT1 to subvert immunity.

Directory of Open Access Journals (Sweden)

Amit P Bhavsar

Full Text Available To further its pathogenesis, S. Typhimurium delivers effector proteins into host cells, including the novel E3 ubiquitin ligase (NEL effector SspH2. Using model systems in a cross-kingdom approach we gained further insight into the molecular function of this effector. Here, we show that SspH2 modulates innate immunity in both mammalian and plant cells. In mammalian cell culture, SspH2 significantly enhanced Nod1-mediated IL-8 secretion when transiently expressed or bacterially delivered. In addition, SspH2 also enhanced an Rx-dependent hypersensitive response in planta. In both of these nucleotide-binding leucine rich repeat receptor (NLR model systems, SspH2-mediated phenotypes required its catalytic E3 ubiquitin ligase activity and interaction with the conserved host protein SGT1. SGT1 has an essential cell cycle function and an additional function as an NLR co-chaperone in animal and plant cells. Interaction between SspH2 and SGT1 was restricted to SGT1 proteins that have NLR co-chaperone function and accordingly, SspH2 did not affect SGT1 cell cycle functions. Mechanistic studies revealed that SspH2 interacted with, and ubiquitinated Nod1 and could induce Nod1 activity in an agonist-independent manner if catalytically active. Interestingly, SspH2 in vitro ubiquitination activity and protein stability were enhanced by SGT1. Overall, this work adds to our understanding of the sophisticated mechanisms used by bacterial effectors to co-opt host pathways by demonstrating that SspH2 can subvert immune responses by selectively exploiting the functions of a conserved host co-chaperone.

Lymphocytes From Patients With Type 1 Diabetes Display a Distinct Profile of Chromatin Histone H3 Lysine 9 Dimethylation

Science.gov (United States)

Miao, Feng; Smith, David D.; Zhang, Lingxiao; Min, Andrew; Feng, Wei; Natarajan, Rama

2008-01-01

OBJECTIVE—The complexity of interactions between genes and the environment is a major challenge for type 1 diabetes studies. Nuclear chromatin is the interface between genetics and environment and the principal carrier of epigenetic information. Because histone tail modifications in chromatin are linked to gene transcription, we hypothesized that histone methylation patterns in cells from type 1 diabetic patients can provide novel epigenetic insights into type 1 diabetes and its complications. RESEARCH DESIGN AND METHODS—We used chromatin immunoprecipitation (ChIP) linked to microarray (ChIP-chip) approach to compare genome-wide histone H3 lysine 9 dimethylation (H3K9me2) patterns in blood lymphocytes and monocytes from type 1 diabetic patients versus healthy control subjects. Bioinformatics evaluation of methylated candidates was performed by Ingenuity Pathway Analysis (IPA) tools. RESULTS—A subset of genes in the type 1 diabetic cohort showed significant increase in H3K9me2 in lymphocytes but not in monocytes. CLTA4, a type 1 diabetes susceptibility gene, was one of the candidates displaying increased promoter H3K9me2 in type 1 diabetes. IPA identified two high-scoring networks that encompassed genes showing altered H3K9me2. Many of them were associated with autoimmune and inflammation-related pathways, such as transforming growth factor-β, nuclear factor-κB, p38 mitogen-activated protein kinase, toll-like receptor, and interleukin-6. IPA also revealed biological relationships between these networks and known type 1 diabetes candidate genes. CONCLUSIONS—The concerted and synergistic alteration of histone methylation within the identified network in lymphocytes might have an effect on the etiology of type 1 diabetes and its complications. These studies provide evidence of a novel association between type 1 diabetes and altered histone methylation of key genes that are components of type 1 diabetes–related biological pathways and also a new

Concepción de marketing internacional para la importación de membranas asfálticas de origen argentino para edificaciones en el Estado Plurinacional de Bolivia

OpenAIRE

Fuentes Orellana, Mayra A.

2015-01-01

La tesis tiene como objetivo determinar cuales son los lineamientos de marketing internacional para la importación de membranas asfálticas desde Argentina hasta Bolivia. Objetivo General: Determinar los lineamientos idóneos en un marco genérico, para la importación de membranas asfálticas bajo un análisis de las herramientas del marketing internacional. Objetivos Específicos: -Identificar la estrategia de marketing internacional adecuado para planificar...

Histone deacetylases (HDACs and brain function

Directory of Open Access Journals (Sweden)

Claude-Henry Volmar

2015-01-01

Full Text Available Modulation of gene expression is a constant and necessary event for mammalian brain function. An important way of regulating gene expression is through the remodeling of chromatin, the complex of DNA, and histone proteins around which DNA wraps. The “histone code hypothesis” places histone post-translational modifications as a significant part of chromatin remodeling to regulate transcriptional activity. Acetylation of histones by histone acetyl transferases and deacetylation by histone deacetylases (HDACs at lysine residues are the most studied histone post-translational modifications in cognition and neuropsychiatric diseases. Here, we review the literature regarding the role of HDACs in brain function. Among the roles of HDACs in the brain, studies show that they participate in glial lineage development, learning and memory, neuropsychiatric diseases, and even rare neurologic diseases. Most HDACs can be targeted with small molecules. However, additional brain-penetrant specific inhibitors with high central nervous system exposure are needed to determine the cause-and-effect relationship between individual HDACs and brain-associated diseases.

IL-1β-specific recruitment of GCN5 histone acetyltransferase induces the release of PAF1 from chromatin for the de-repression of inflammatory response genes.

Science.gov (United States)

Kim, Nari; Sun, Hwa-Young; Youn, Min-Young; Yoo, Joo-Yeon

2013-04-01

To determine the functional specificity of inflammation, it is critical to orchestrate the timely activation and repression of inflammatory responses. Here, we explored the PAF1 (RNA polymerase II associated factor)-mediated signal- and locus-specific repression of genes induced through the pro-inflammatory cytokine interleukin (IL)-1β. Using microarray analysis, we identified the PAF1 target genes whose expression was further enhanced by PAF1 knockdown in IL-1β-stimulated HepG2 hepatocarcinomas. PAF1 bound near the transcription start sites of target genes and dissociated on stimulation. In PAF1-deficient cells, more elongating RNA polymerase II and acetylated histones were observed, although IL-1β-mediated activation and recruitment of nuclear factor κB (NF-κB) were not altered. Under basal conditions, PAF1 blocked histone acetyltransferase general control non-depressible 5 (GCN5)-mediated acetylation on H3K9 and H4K5 residues. On IL-1β stimulation, activated GCN5 discharged PAF1 from chromatin, allowing productive transcription to occur. PAF1 bound to histones but not to acetylated histones, and the chromatin-binding domain of PAF1 was essential for target gene repression. Moreover, IL-1β-induced cell migration was similarly controlled through counteraction between PAF1 and GCN5. These results suggest that the IL-1β signal-specific exchange of PAF1 and GCN5 on the target locus limits inappropriate gene induction and facilitates the timely activation of inflammatory responses.

Angular dependent torque measurements on CaFe0.88Co0.12AsF

Science.gov (United States)

Xiao, H.; Gao, B.; Ma, Y. H.; Li, X. J.; Mu, G.; Hu, T.

2016-08-01

Out-of-plane angular dependent torque measurements were performed on CaFe0.88Co0.12AsF (Ca1 1 1 1) single crystals. In the normal state, the torque data shows \\sin 2θ angular dependence and H 2 magnetic field dependence, as a result of paramagnetism. In the mixed state, the torque signal is a combination of the vortex torque and paramagnetic torque, and the former allows the determination of the anisotropy parameter γ. At T   =  11.5 K, γ (11.5 K ≃ 0.5 T c)  =  19.1, which is similar to the result of SmFeAsO0.8F0.2, γ ≃ 23 at T≃ 0.4{{T}\\text{c}} . So the 11 1 1 is more anisotropic compared to 11 and 122 families of iron-based superconductors. This may suggest that the electronic coupling between layers in 1 1 1 1 is less effective than in 11 and 122 families.

Targeting Histone Abnormality in Triple Negative Breast Cancer

Science.gov (United States)

2015-08-01

κB pathway in triple negative breast cancer . 8th International Nitric Oxide Conference & 6th International Nitrite/ Nitrate Conference, Cleveland, OH...1 AWARD NUMBER: W81XWH-14-1-0237 TITLE: Targeting Histone Abnormality in Triple-Negative Breast Cancer PRINCIPAL INVESTIGATOR: Yi...TITLE AND SUBTITLE 5a. CONTRACT NUMBER Targeting Histone Abnormality in Triple-Negative Breast Cancer 5b. GRANT NUMBER W81XWH-14-1-0237 5c

SIRT3 restricts HBV transcription and replication via epigenetic regulation of cccDNA involving SUV39H1 and SETD1A histone methyltransferases.

Science.gov (United States)

Ren, Ji-Hua; Hu, Jie-Li; Cheng, Sheng-Tao; Yu, Hai-Bo; Wong, Vincent Kam Wai; Law, Betty Yuen Kwan; Yang, Yong-Feng; Huang, Ying; Liu, Yi; Chen, Wei-Xian; Cai, Xue-Fei; Tang, Hua; Hu, Yuan; Zhang, Wen-Lu; Liu, Xiang; Long, Quan-Xin; Zhou, Li; Tao, Na-Na; Zhou, Hong-Zhong; Yang, Qiu-Xia; Ren, Fang; He, Lin; Gong, Rui; Huang, Ai-Long; Chen, Juan

2018-04-06

Hepatitis B virus (HBV) infection remains a major health problem worldwide. Maintenance of the covalently closed circular DNA (cccDNA) which serves as a template for HBV RNA transcription is responsible for the failure of eradicating chronic HBV during current antiviral therapy. cccDNA is assembled with cellular histone proteins into chromatin, but little is known about the regulation of HBV chromatin by histone posttranslational modifications. In this study, we identified SIRT3 as a host factor restricting HBV transcription and replication by screening seven members of Sirtuin family which is the class III histone deacetylase. Ectopic SIRT3 expression significantly reduced total HBV RNAs, 3.5-kb RNA as well as replicative intermediate DNA in HBV-infected HepG2-NTCP cells and PHH. In contrast, gene silencing of SIRT3 promoted HBV transcription and replication. Mechanistic study found nuclear SIRT3 was recruited to the HBV cccDNA, where it deacetylated histone 3 lysine 9 (H3K9). Importantly, occupancy of SIRT3 onto cccDNA could increase the recruitment of histone methyltransferase SUV39H1 to cccDNA and decrease recruitment of SETD1A, leading to a marked increase of H3K9me3 and a decrease of H3K4me3 on cccDNA. Moreover, SIRT3-mediated HBV cccDNA transcriptional repression involved decreased binding of host RNA polymerase II and transcription factor YY1 to cccDNA. Finally, viral protein HBx could relieve SIRT3-mediated cccDNA transcriptional repression by inhibiting both SIRT3 expression and its recruitment to cccDNA. SIRT3 is a novel host factor epigenetically restricting HBV cccDNA transcription by acting cooperatively with histone methyltransferase. These data provided a rational for the use of SIRT3 activators in the prevention or treatment of HBV infection. This article is protected by copyright. All rights reserved. © 2018 by the American Association for the Study of Liver Diseases.

RNAi-Mediated Reverse Genetic Screen Identified Drosophila Chaperones Regulating Eye and Neuromuscular Junction Morphology

Directory of Open Access Journals (Sweden)

Sandeep Raut

2017-07-01

Full Text Available Accumulation of toxic proteins in neurons has been linked with the onset of neurodegenerative diseases, which in many cases are characterized by altered neuronal function and synapse loss. Molecular chaperones help protein folding and the resolubilization of unfolded proteins, thereby reducing the protein aggregation stress. While most of the chaperones are expressed in neurons, their functional relevance remains largely unknown. Here, using bioinformatics analysis, we identified 95 Drosophila chaperones and classified them into seven different classes. Ubiquitous actin5C-Gal4-mediated RNAi knockdown revealed that ∼50% of the chaperones are essential in Drosophila. Knocking down these genes in eyes revealed that ∼30% of the essential chaperones are crucial for eye development. Using neuron-specific knockdown, immunocytochemistry, and robust behavioral assays, we identified a new set of chaperones that play critical roles in the regulation of Drosophila NMJ structural organization. Together, our data present the first classification and comprehensive analysis of Drosophila chaperones. Our screen identified a new set of chaperones that regulate eye and NMJ morphogenesis. The outcome of the screen reported here provides a useful resource for further elucidating the role of individual chaperones in Drosophila eye morphogenesis and synaptic development.

Hsp100/ClpB Chaperone Function and Mechanism

Energy Technology Data Exchange (ETDEWEB)

Vierling, Elizabeth [Univ. of Massachusetts, Amherst, MA (United States). Dept. of Biochemistry and Molecular Biology

2015-01-27

The supported research investigated the mechanism of action of a unique class of molecular chaperones in higher plants, the Hsp100/ClpB proteins, with the ultimate goal of defining how these chaperones influence plant growth, development, stress tolerance and productivity. Molecular chaperones are essential effectors of cellular “protein quality control”, which comprises processes that ensure the proper folding, localization, activation and turnover of proteins. Hsp100/ClpB proteins are required for temperature acclimation in plants, optimal seed yield, and proper chloroplast development. The model plant Arabidopsis thaliana and genetic and molecular approaches were used to investigate two of the three members of the Hsp100/ClpB proteins in plants, cytosolic AtHsp101 and chloroplast-localized AtClpB-p. Investigating the chaperone activity of the Hsp100/ClpB proteins addresses DOE goals in that this activity impacts how “plants generate and assemble components” as well as “allowing for their self repair”. Additionally, Hsp100/ClpB protein function in plants is directly required for optimal “utilization of biological energy” and is involved in “mechanisms that control the architecture of energy transduction systems”.

Effect of glycation on α-crystallin structure and chaperone-like function

Science.gov (United States)

Kumar, P. Anil; Kumar, M. Satish; Reddy, G. Bhanuprakash

2007-01-01

The chaperone-like activity of α-crystallin is considered to play an important role in the maintenance of the transparency of the eye lens. However, in the case of aging and in diabetes, the chaperone function of α-crystallin is compromized, resulting in cataract formation. Several post-translational modifications, including non-enzymatic glycation, have been shown to affect the chaperone function of α-crystallin in aging and in diabetes. A variety of agents have been identified as the predominant sources for the formation of AGEs (advanced glycation end-products) in various tissues, including the lens. Nevertheless, glycation of α-crystallin with various sugars has resulted in divergent results. In the present in vitro study, we have investigated the effect of glucose, fructose, G6P (glucose 6-phosphate) and MGO (methylglyoxal), which represent the major classes of glycating agents, on the structure and chaperone function of α-crystallin. Modification of α-crystallin with all four agents resulted in the formation of glycated protein, increased AGE fluorescence, protein cross-linking and HMM (high-molecular-mass) aggregation. Interestingly, these glycation-related profiles were found to vary with different glycating agents. For instance, CML [Nϵ-(carboxymethyl)lysine] was the predominant AGE formed upon glycation of α-crystallin with these agents. Although fructose and MGO caused significant conformational changes, there were no significant structural perturbations with glucose and G6P. With the exception of MGO modification, glycation with other sugars resulted in decreased chaperone activity in aggregation assays. However, modification with all four sugars led to the loss of chaperone activity as assessed using an enzyme inactivation assay. Glycation-induced loss of α-crystallin chaperone activity was associated with decreased hydrophobicity. Furthermore, α-crystallin isolated from glycated TSP (total lens soluble protein) had also increased AGE

N terminus of Swr1 binds to histone H2AZ and provides a platform for subunit assembly in the chromatin remodeling complex.

Science.gov (United States)

Wu, Wei-Hua; Wu, Chwen-Huey; Ladurner, Andreas; Mizuguchi, Gaku; Wei, Debbie; Xiao, Hua; Luk, Ed; Ranjan, Anand; Wu, Carl

2009-03-06

Variant histone H2AZ-containing nucleosomes are involved in the regulation of gene expression. In Saccharomyces cerevisiae, chromatin deposition of histone H2AZ is mediated by the fourteen-subunit SWR1 complex, which catalyzes ATP-dependent exchange of nucleosomal histone H2A for H2AZ. Previous work defined the role of seven SWR1 subunits (Swr1 ATPase, Swc2, Swc3, Arp6, Swc5, Yaf9, and Swc6) in maintaining complex integrity and H2AZ histone replacement activity. Here we examined the function of three additional SWR1 subunits, bromodomain containing Bdf1, actin-related protein Arp4 and Swc7, by analyzing affinity-purified mutant SWR1 complexes. We observed that depletion of Arp4 (arp4-td) substantially impaired the association of Bdf1, Yaf9, and Swc4. In contrast, loss of either Bdf1 or Swc7 had minimal effects on overall complex integrity. Furthermore, the basic H2AZ histone replacement activity of SWR1 in vitro required Arp4, but not Bdf1 or Swc7. Thus, three out of fourteen SWR1 subunits, Bdf1, Swc7, and previously noted Swc3, appear to have roles auxiliary to the basic histone replacement activity. The N-terminal region of the Swr1 ATPase subunit is necessary and sufficient to direct association of Bdf1 and Swc7, as well as Arp4, Act1, Yaf9 and Swc4. This same region contains an additional H2AZ-H2B specific binding site, distinct from the previously identified Swc2 subunit. These findings suggest that one SWR1 enzyme might be capable of binding two H2AZ-H2B dimers, and provide further insight on the hierarchy and interdependency of molecular interactions within the SWR1 complex.

Histones induce rapid and profound thrombocytopenia in mice

Science.gov (United States)

Bhandari, Ashish A.

2011-01-01

Histones are released from dying cells and contribute to antimicrobial defense during infection. However, extracellular histones are a double-edged sword because they also damage host tissue and may cause death. We studied the interactions of histones with platelets. Histones bound to platelets, induced calcium influx, and recruited plasma adhesion proteins such as fibrinogen to induce platelet aggregation. Hereby fibrinogen cross-linked histone-bearing platelets and triggered microaggregation. Fibrinogen interactions with αIIbβ3 integrins were not required for this process but were necessary for the formation of large platelet aggregates. Infused histones associated with platelets in vivo and caused a profound thrombocytopenia within minutes after administration. Mice lacking platelets or αIIbβ3 integrins were protected from histone-induced death but not from histone-induced tissue damage. Heparin, at high concentrations, prevented histone interactions with platelets and protected mice from histone-induced thrombocytopenia, tissue damage, and death. Heparin and histones are evolutionary maintained. Histones may combine microbicidal with prothrombotic properties to fight invading microbes and maintain hemostasis after injury. Heparin may provide an innate counter mechanism to neutralize histones and diminish collateral tissue damage. PMID:21700775

Post-Translational Modifications of Histones in Human Sperm.

Science.gov (United States)

Krejčí, Jana; Stixová, Lenka; Pagáčová, Eva; Legartová, Soňa; Kozubek, Stanislav; Lochmanová, Gabriela; Zdráhal, Zbyněk; Sehnalová, Petra; Dabravolski, Siarhei; Hejátko, Jan; Bártová, Eva

2015-10-01

We examined the levels and distribution of post-translationally modified histones and protamines in human sperm. Using western blot immunoassay, immunofluorescence, mass spectrometry (MS), and FLIM-FRET approaches, we analyzed the status of histone modifications and the protamine P2. Among individual samples, we observed variability in the levels of H3K9me1, H3K9me2, H3K27me3, H3K36me3, and H3K79me1, but the level of acetylated (ac) histones H4 was relatively stable in the sperm head fractions, as demonstrated by western blot analysis. Sperm heads with lower levels of P2 exhibited lower levels of H3K9ac, H3K9me1, H3K27me3, H3K36me3, and H3K79me1. A very strong correlation was observed between the levels of P2 and H3K9me2. FLIM-FRET analysis additionally revealed that acetylated histones H4 are not only parts of sperm chromatin but also appear in a non-integrated form. Intriguingly, H4ac and H3K27me3 were detected in sperm tail fractions via western blot analysis. An appearance of specific histone H3 and H4 acetylation and H3 methylation in sperm tail fractions was also confirmed by both LC-MS/MS and MALDI-TOF MS analysis. Taken together, these data indicate that particular post-translational modifications of histones are uniquely distributed in human sperm, and this distribution varies among individuals and among the sperm of a single individual. © 2015 Wiley Periodicals, Inc.

Tofacitinib and analogs as inhibitors of the histone kinase PRK1 (PKN1).

Science.gov (United States)

Ostrovskyi, Dmytro; Rumpf, Tobias; Eib, Julia; Lumbroso, Alexandre; Slynko, Inna; Klaeger, Susan; Heinzlmeir, Stephanie; Forster, Michael; Gehringer, Matthias; Pfaffenrot, Ellen; Bauer, Silke Mona; Schmidtkunz, Karin; Wenzler, Sandra; Metzger, Eric; Kuster, Bernhard; Laufer, Stefan; Schüle, Roland; Sippl, Wolfgang; Breit, Bernhard; Jung, Manfred

2016-09-01

The histone kinase PRK1 has been identified as a potential target to combat prostate cancer but selective PRK1 inhibitors are lacking. The US FDA -approved JAK1-3 inhibitor tofacitinib also potently inhibits PRK1 in vitro. We show that tofacitinib also inhibits PRK1 in a cellular setting. Using tofacitinib as a starting point for structure-activity relationship studies, we identified a more potent and another more selective PRK1 inhibitor compared with tofacitinib. Furthermore, we found two potential PRK1/JAK3-selectivity hotspots. The identified inhibitors and the selectivity hotspots lay the basis for the development of selective PRK1 inhibitors. The identification of PRK1, but also of other cellular tofacitinib targets, has implications on its clinical use and on future development of tofacitinib-like JAK inhibitors. [Formula: see text].

Magnetism and Pressure-Induced Superconductivity of Checkerboard-Type Charge-Ordered Molecular Conductor β-(meso-DMBEDT-TTF2X (X = PF6 and AsF6

Directory of Open Access Journals (Sweden)

Yutaka Nishio

2012-11-01

Full Text Available The metallic state of the molecular conductor β-(meso-DMBEDT-TTF2X (DMBEDT-TTF = 2-(5,6-dihydro-1,3-dithiolo[4,5-b][1,4]dithiin-2-ylidene-5,6-dihydro-5,6-dimethyl-1,3-dithiolo[4,5-b][1,4]dithiin, X = PF6, AsF6 is transformed into the checkerboard-type charge-ordered state at around 75–80 K with accompanying metal-insulator (MI transition on the anisotropic triangular lattice. With lowering temperatures, the magnetic susceptibility decreases gradually and reveals a sudden drop at the MI transition. By applying pressure, the charge-ordered state is suppressed and superconductivity appears in β-(meso-DMBEDT-TTF2AsF6 as well as in the reported β-(meso-DMBEDT-TTF2PF6. The charge-ordered spin-gapped state and the pressure-induced superconducting state are discussed through the paired-electron crystal (PEC model, where the spin-bonded electron pairs stay and become mobile in the crystal, namely the valence-bond solid (VBS and the resonant valence bonded (RVB state in the quarter-filled band structure.

No need to be HAMLET or BAMLET to interact with histones: binding of monomeric alpha-lactalbumin to histones and basic poly-amino acids.

Science.gov (United States)

Permyakov, Serge E; Pershikova, Irina V; Khokhlova, Tatyana I; Uversky, Vladimir N; Permyakov, Eugene A

2004-05-18

The ability of a specific complex of human alpha-lactalbumin with oleic acid (HAMLET) to induce cell death with selectivity for tumor and undifferentiated cells was shown recently to be mediated by interaction of HAMLET with histone proteins irreversibly disrupting chromatin structure [Duringer, C., et al. (2003) J. Biol. Chem. 278, 42131-42135]. Here we show that monomeric alpha-lactalbumin (alpha-LA) in the absence of fatty acids is also able to bind efficiently to the primary target of HAMLET, histone HIII, regardless of Ca(2+) content. Thus, the modification of alpha-LA by oleic acid is not required for binding to histones. We suggest that interaction of negatively charged alpha-LA with the basic histone stabilizes apo-alpha-LA and destabilizes the Ca(2+)-bound protein due to compensation for excess negative charge of alpha-LA's Ca(2+)-binding loop by positively charged residues of the histone. Spectrofluorimetric curves of titration of alpha-LA by histone H3 were well approximated by a scheme of cooperative binding of four alpha-LA molecules per molecule of histone, with an equilibrium dissociation constant of 1.0 microM. Such a stoichiometry of binding implies that the binding process is not site-specific with respect to histone and likely is driven by just electrostatic interactions. Co-incubation of positively charged poly-amino acids (poly-Lys and poly-Arg) with alpha-LA resulted in effects which were similar to those caused by histone HIII, confirming the electrostatic nature of the alpha-LA-histone interaction. In all cases that were studied, the binding was accompanied by aggregation. The data indicate that alpha-lactalbumin can be used as a basis for the design of antitumor agents, acting through disorganization of chromatin structure due to interaction between alpha-LA and histone proteins.

Structural Bioinformatics and Protein Docking Analysis of the Molecular Chaperone-Kinase Interactions: Towards Allosteric Inhibition of Protein Kinases by Targeting the Hsp90-Cdc37 Chaperone Machinery

Directory of Open Access Journals (Sweden)

Gennady Verkhivker

2013-11-01

Full Text Available A fundamental role of the Hsp90-Cdc37 chaperone system in mediating maturation of protein kinase clients and supporting kinase functional activity is essential for the integrity and viability of signaling pathways involved in cell cycle control and organism development. Despite significant advances in understanding structure and function of molecular chaperones, the molecular mechanisms and guiding principles of kinase recruitment to the chaperone system are lacking quantitative characterization. Structural and thermodynamic characterization of Hsp90-Cdc37 binding with protein kinase clients by modern experimental techniques is highly challenging, owing to a transient nature of chaperone-mediated interactions. In this work, we used experimentally-guided protein docking to probe the allosteric nature of the Hsp90-Cdc37 binding with the cyclin-dependent kinase 4 (Cdk4 kinase clients. The results of docking simulations suggest that the kinase recognition and recruitment to the chaperone system may be primarily determined by Cdc37 targeting of the N-terminal kinase lobe. The interactions of Hsp90 with the C-terminal kinase lobe may provide additional “molecular brakes” that can lock (or unlock kinase from the system during client loading (release stages. The results of this study support a central role of the Cdc37 chaperone in recognition and recruitment of the kinase clients. Structural analysis may have useful implications in developing strategies for allosteric inhibition of protein kinases by targeting the Hsp90-Cdc37 chaperone machinery.

Deletion of the Mitochondrial Chaperone TRAP-1 Uncovers Global Reprogramming of Metabolic Networks

Directory of Open Access Journals (Sweden)

Sofia Lisanti

2014-08-01

Full Text Available Reprogramming of metabolic pathways contributes to human disease, especially cancer, but the regulators of this process are unknown. Here, we have generated a mouse knockout for the mitochondrial chaperone TRAP-1, a regulator of bioenergetics in tumors. TRAP-1−/− mice are viable and showed reduced incidence of age-associated pathologies, including obesity, inflammatory tissue degeneration, dysplasia, and spontaneous tumor formation. This was accompanied by global upregulation of oxidative phosphorylation and glycolysis transcriptomes, causing deregulated mitochondrial respiration, oxidative stress, impaired cell proliferation, and a switch to glycolytic metabolism in vivo. These data identify TRAP-1 as a central regulator of mitochondrial bioenergetics, and this pathway could contribute to metabolic rewiring in tumors.

Destabilization of the Outer and Inner Mitochondrial Membranes by Core and Linker Histones

Science.gov (United States)

Cascone, Annunziata; Bruelle, Celine; Lindholm, Dan; Bernardi, Paolo; Eriksson, Ove

2012-01-01

Background Extensive DNA damage leads to apoptosis. Histones play a central role in DNA damage sensing and may mediate signals of genotoxic damage to cytosolic effectors including mitochondria. Methodology/Principal Findings We have investigated the effects of histones on mitochondrial function and membrane integrity. We demonstrate that both linker histone H1 and core histones H2A, H2B, H3, and H4 bind strongly to isolated mitochondria. All histones caused a rapid and massive release of the pro-apoptotic intermembrane space proteins cytochrome c and Smac/Diablo, indicating that they permeabilize the outer mitochondrial membrane. In addition, linker histone H1, but not core histones, permeabilized the inner membrane with a collapse of the membrane potential, release of pyridine nucleotides, and mitochondrial fragmentation. Conclusions We conclude that histones destabilize the mitochondrial membranes, a mechanism that may convey genotoxic signals to mitochondria and promote apoptosis following DNA damage. PMID:22523586

The heat-shock protein/chaperone network and multiple stress resistance.

Science.gov (United States)

Jacob, Pierre; Hirt, Heribert; Bendahmane, Abdelhafid

2017-04-01

Crop yield has been greatly enhanced during the last century. However, most elite cultivars are adapted to temperate climates and are not well suited to more stressful conditions. In the context of climate change, stress resistance is a major concern. To overcome these difficulties, scientists may help breeders by providing genetic markers associated with stress resistance. However, multistress resistance cannot be obtained from the simple addition of single stress resistance traits. In the field, stresses are unpredictable and several may occur at once. Consequently, the use of single stress resistance traits is often inadequate. Although it has been historically linked with the heat stress response, the heat-shock protein (HSP)/chaperone network is a major component of multiple stress responses. Among the HSP/chaperone 'client proteins', many are primary metabolism enzymes and signal transduction components with essential roles for the proper functioning of a cell. HSPs/chaperones are controlled by the action of diverse heat-shock factors, which are recruited under stress conditions. In this review, we give an overview of the regulation of the HSP/chaperone network with a focus on Arabidopsis thaliana. We illustrate the role of HSPs/chaperones in regulating diverse signalling pathways and discuss several basic principles that should be considered for engineering multiple stress resistance in crops through the HSP/chaperone network. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

G1- and S-phase syntheses of histones H1 and H1o in mitotically selected CHO cells: utilization of high-performance liquid chromatography

International Nuclear Information System (INIS)

D'Anna, J.A.; Thayer, M.M.; Tobey, R.A.; Gurley, L.R.

1985-01-01

The authors have employed high-performance liquid chromatography (HPLC) to investigate the syntheses of histones H1 and H1o as synchronized cells traverse from mitosis to S phase. Chinese hamster (line CHO) cells were synchronized by mitotic selection, and, at appropriate times, they were pulse labeled for 1 h with [ 3 H]lysine. Histones H1 and H1o were extracted by blending radiolabeled and carrier cells directly in 0.83 M HC1O 4 ; the total HC1O 4 -soluble, Cl 3 CCO 2 H-precipitable proteins were then separated by a modification of an HPLC system employing three mu Bondapak reversed-phase columns. These procedures (1) produce minimally perturbed populations of synchronized proliferating cells and (2) maximize the recovery of radiolabeled histones during isolation and analysis. Measurements of rates of synthesis indicate that the rate of H1 synthesis increases as cells traverse from early to mid G1; as cells enter S phase, the rate of H1 synthesis increases an additional congruent to 22-fold and is proportional to the number of S-phase cells. In contrast to H1, the rate of H1o synthesis is nearly constant throughout G1. As cells progress into S phase, the rate of H1o synthesis increases so that it also appears to be proportional to the number of S-phase cells. Except for the first 1-2 h after mitotic selection, these results are similar to those obtained when cells are synchronized in G1 with the isoleucine deprivation procedure

Critical electrolyte concentration of spermatozoal chromatin containing histone H1 variants

Directory of Open Access Journals (Sweden)

J.R.P. Falco

1999-06-01

Full Text Available The critical electrolyte concentrations (CEC of sperm chromatin from animal species known or suspected to contain histone H1 variants were compared by examining the affinity of their DNA-protein complexes for toluidine blue in the presence of Mg2+. Bullfrog, sea urchin, bee and bumblebee spermatozoa were studied. The CEC for Rana catesbeiana and two sea urchin species were similar to that of histone H5-containing chromatin from chicken erythrocytes, thus confirming the biochemical and structural similarities of these DNA-protein complexes. The CEC for bees and the bumblebee, Bombus atratus, showed no particular phylogenetic relationship. We concluded that the CEC of histone H1-containing sperm cell chromatin is a useful indicator of variability in DNA-protein complexes but is of little phylogenetic value.Valores de concentração crítica de eletrólitos (CEC da cromatina de espermatozóides de espécies conhecidas ou suspeitas de apresentarem variantes da histona H1 foram comparados entre si. O objetivo foi estabelecer semelhanças ou diferenças nos complexos DNA-proteína de espermatozóides dessas espécies em nível citoquímico. A afinidade por moléculas de azul de toluidina em condições de competição com íons Mg2+ foi investigada nos espermatozóides do sapo boi e de ouriços do mar, abelhas e mamangava. Uma íntima relação entre os valores de CEC de Rana catesbeiana e de duas espécies de ouriço do mar com os da cromatina de eritrócitos de frango, que contém a histona H5, foi vista estar de acordo com certas semelhanças bioquímicas e estruturais entre seus complexos DNA-proteína. Quanto aos dados para abelhas e para a mamangava Bombus atratus, não se pôde associar a variabilidade em valores de CEC com a posição das espécies na respectiva árvore filogenética. Conclui-se, portanto, que a CEC de cromatina de espermatozóides que contêm histona H1 é um indicador útil da influência de variantes de H1 na organiza

Chaperones and intimate physical examinations: what do male and female patients want?

Science.gov (United States)

Fan, V C; Choy, H T; Kwok, G Yj; Lam, H G; Lim, Q Y; Man, Y Y; Tang, C K; Wong, C C; Yu, Y F; Leung, G Kk

2017-02-01

Many studies of patients' perception of a medical chaperone have focused on female patients; that of male patients are less well studied. Moreover, previous studies were largely based on patient populations in English-speaking countries. Therefore, this study was conducted to investigate the perception and attitude of male and female Chinese patients to the presence of a chaperone during an intimate physical examination. A cross-sectional guided questionnaire survey was conducted on a convenient sample of 150 patients at a public teaching hospital in Hong Kong. Over 90% of the participants considered the presence of a chaperone appropriate during intimate physical examination, and 84% felt that doctors, irrespective of gender, should always request the presence of a chaperone. The most commonly cited reasons included the availability of an objective account should any legal issue arise, protection against sexual harassment, and to provide psychological support. This contrasted with the experience of those who had previously undergone an intimate physical examination of whom only 72.6% of women and 35.7% of men had reportedly been chaperoned. Among female participants, 75.0% preferred to be chaperoned during an intimate physical examination by a male doctor, and 28.6% would still prefer to be chaperoned when being examined by a female doctor. Among male participants, over 50% indicated no specific preference but a substantial minority reported a preference for chaperoned examination (21.2% for male doctor and 25.8% for female doctor). Patients in Hong Kong have a high degree of acceptance and expectations about the role of a medical chaperone. Both female and male patients prefer such practice regardless of physician gender. Doctors are strongly encouraged to discuss the issue openly with their patients before they conduct any intimate physical examination.

RNA chaperoning and intrinsic disorder in the core proteins of Flaviviridae.

Science.gov (United States)

Ivanyi-Nagy, Roland; Lavergne, Jean-Pierre; Gabus, Caroline; Ficheux, Damien; Darlix, Jean-Luc

2008-02-01

RNA chaperone proteins are essential partners of RNA in living organisms and viruses. They are thought to assist in the correct folding and structural rearrangements of RNA molecules by resolving misfolded RNA species in an ATP-independent manner. RNA chaperoning is probably an entropy-driven process, mediated by the coupled binding and folding of intrinsically disordered protein regions and the kinetically trapped RNA. Previously, we have shown that the core protein of hepatitis C virus (HCV) is a potent RNA chaperone that can drive profound structural modifications of HCV RNA in vitro. We now examined the RNA chaperone activity and the disordered nature of core proteins from different Flaviviridae genera, namely that of HCV, GBV-B (GB virus B), WNV (West Nile virus) and BVDV (bovine viral diarrhoea virus). Despite low-sequence similarities, all four proteins demonstrated general nucleic acid annealing and RNA chaperone activities. Furthermore, heat resistance of core proteins, as well as far-UV circular dichroism spectroscopy suggested that a well-defined 3D protein structure is not necessary for core-induced RNA structural rearrangements. These data provide evidence that RNA chaperoning-possibly mediated by intrinsically disordered protein segments-is conserved in Flaviviridae core proteins. Thus, besides nucleocapsid formation, core proteins may function in RNA structural rearrangements taking place during virus replication.

Progress and potential of non-inhibitory small molecule chaperones for the treatment of Gaucher disease and its implications for Parkinson disease.

Science.gov (United States)

Jung, Olive; Patnaik, Samarjit; Marugan, Juan; Sidransky, Ellen; Westbroek, Wendy

2016-05-01

Gaucher disease, caused by pathological mutations GBA1, encodes the lysosome-resident enzyme glucocerebrosidase, which cleaves glucosylceramide into glucose and ceramide. In Gaucher disease, glucocerebrosidase deficiency leads to lysosomal accumulation of substrate, primarily in cells of the reticulo-endothelial system. Gaucher disease has broad clinical heterogeneity, and mutations in GBA1 are a risk factor for the development of different synucleinopathies. Insights into the cell biology and biochemistry of glucocerebrosidase have led to new therapeutic approaches for Gaucher disease including small chemical chaperones. Such chaperones facilitate proper enzyme folding and translocation to lysosomes, thereby preventing premature breakdown of the enzyme in the proteasome. This review discusses recent progress in developing chemical chaperones as a therapy for Gaucher disease, with implications for the treatment of synucleinopathies. It focuses on the development of non-inhibitory glucocerebrosidase chaperones and their therapeutic advantages over inhibitory chaperones, as well as the challenges involved in identifying and validating chemical chaperones.

Comportamiento mecánico y dinámico de una mezcla asfáltica con adición de fibras

Directory of Open Access Journals (Sweden)

Oscar Javier Reyes Ortiz

2005-01-01

Full Text Available El artículo refiere el análisis experimental en el laboratorio, del efecto de la adición de fibras de polipropileno por vía seca (reemplazo de material granular por fibra sobre las propiedades mecánicas y dinámicas de una mezcla. Inicialmente se caracteriza el material granular y asfalto CA60/70, se realiza el diseño de la mezcla asfáltica de granulometría 0/10 (IDU RSV 2002 y asfalto de acuerdo con la metodología Marshall; se evalúa el efecto de fibras sobre las propiedades mecánicas mediante la evaluación de la estabilidad y fluencia, y dinámicamente por su valor de deformación permanente y modulo dinámico. Los resultados muestran un efecto positivo de las fibras en la modificación de la mezcla asfáltica. El modulo dinámico aumenta en un 45% promedio en un porcentaje de adición de 0.60%; la deformación permanente disminuye en 27.6% para una adición de fibras de 0.60% y 48.8% para la adición de fibras de 0.75%, respectivamente. Este comportamiento refleja otra alternativa eficaz para mejorar la mezcla asfáltica, aumentando la resistencia a la disgregación por efecto abrasivo del tráfico y retardando el inicio y propagación del agrietamiento por ahuellamiento

Main: AS1CAMV [PLACE

Lifescience Database Archive (English)

Full Text Available MV 35S promoter; from -85 to -58 (subdomain AI); Binding with ASF-1 (activation sequence factor 1) from pea ...and tobacco; Expression in root and leaf; CaMV 35S promoter; ASF-1; leaf; root; as-1; Cauliflower mosaic virus; CaMV; CCACTGACGTAAGGGATGACGCACAATCC ...

Histone deacetylase inhibition abolishes stress-induced spatial memory impairment.

Science.gov (United States)

Vargas-López, Viviana; Lamprea, Marisol R; Múnera, Alejandro

2016-10-01

Acute stress induced before spatial training impairs memory consolidation. Although non-epigenetic underpinning of such effect has been described, the epigenetic mechanisms involved have not yet been studied. Since spatial training and intense stress have opposite effects on histone acetylation balance, it is conceivable that disruption of such balance may underlie acute stress-induced spatial memory consolidation impairment and that inhibiting histone deacetylases prevents such effect. Trichostatin-A (TSA, a histone deacetylase inhibitor) was used to test its effectiveness in preventing stress' deleterious effect on memory. Male Wistar rats were trained in a spatial task in the Barnes maze; 1-h movement restraint was applied to half of them before training. Immediately after training, stressed and non-stressed animals were randomly assigned to receive either TSA (1mg/kg) or vehicle intraperitoneal injection. Twenty-four hours after training, long-term spatial memory was tested; plasma and brain tissue were collected immediately after the memory test to evaluate corticosterone levels and histone H3 acetylation in several brain areas. Stressed animals receiving vehicle displayed memory impairment, increased plasma corticosterone levels and markedly reduced histone H3 acetylation in prelimbic cortex and hippocampus. Such effects did not occur in stressed animals treated with TSA. The aforementioned results support the hypothesis that acute stress induced-memory impairment is related to histone deacetylation. Copyright © 2016 Elsevier Inc. All rights reserved.

Endoplasmic reticulum (ER Chaperones and Oxidoreductases: Critical Regulators of Tumor Cell Survival and Immunorecognition

Directory of Open Access Journals (Sweden)

Thomas eSimmen

2014-10-01

Full Text Available Endoplasmic reticulum (ER chaperones and oxidoreductases are abundant enzymes that mediate the production of fully folded secretory and transmembrane proteins. Resisting the Golgi and plasma membrane-directed bulk flow, ER chaperones and oxidoreductases enter retrograde trafficking whenever they are pulled outside of the ER. However, solid tumors are characterized by the increased production of reactive oxygen species (ROS, combined with reduced blood flow that leads to low oxygen supply and ER stress. Under these conditions, hypoxia and the unfolded protein response (UPR upregulate ER chaperones and oxidoreductases. When this occurs, ER oxidoreductases and chaperones become important regulators of tumor growth. However, under these conditions, these proteins not only promote the production of proteins, but also alter the properties of the plasma membrane and hence modulate tumor immune recognition. For instance, high levels of calreticulin serve as an eat-me signal on the surface of tumor cells. Conversely, both intracellular and surface BiP/GRP78 promotes tumor growth. Other ER folding assistants able to modulate the properties of tumor tissue include protein disulfide isomerase (PDI, Ero1α and GRP94. Understanding the roles and mechanisms of ER chaperones in regulating tumor cell functions and immunorecognition will lead to important insight for the development of novel cancer therapies.

The ESASSI-08 cruise in the South Scotia Ridge region: Water masses, currents, and the ASF

Science.gov (United States)

Palmer, M.; Gomis, D.; Flexas, M. M.; Jordà, G.; Orsi, A. H.

2009-04-01

The ESASSI-08 oceanographic cruise carried out in January 2008 was the major milestone of ESASSI, the Spanish component of SASSI (a core project of the International Polar Year devoted to study the shelf-slope exchanges in different locations of Antarctica). The specific objectives of ESASSI, the sampling strategy and the overall distribution of the main variables across the 11 sections covered by the cruise are presented in a poster. Here we focus on three specific issues: i) the observation of strong tidal currents over some of the sampled slopes; ii) the path of the Antarctic Slope Front (ASF) over the SSR; and iii) the outflow of dense, ventilated water from the Weddell Sea into the South Scotia Sea. The main results are: i) Strong tidal currents with a significant diurnal component were observed over the southern slope of the SSR. Three tidal models are compared with the observations and used to de-tide ADCP currents. ii) The signature of the ASF is clearly detected on the southern slopes of the SSR (on the Weddell Sea flank). Over the northern slopes (the Scotia Sea flank), however, only weak signatures of frontal structures are observed; an in-depth biochemical analysis will be required to link the structures observed over the two flanks of the SSR. What seems clear is that the ASF does not extend further than Elephant Island, since southwestward of that island the shelf and the slope are fully occupied by Circumpolar Deep Water (CDW) from the Antarctic Circumpolar Current. iii) The shallower component of Weddell Sea Deep Water (Upper WSDW) flows over the SSR and pours into the Scotia Sea except to the east of Elephant Island, where the channels are less than 1500 m deep. The densest component of WSDW (Lower WSDW) is observed at both flanks of the SSR, but again a more detailed analysis of biochemical data will be required to prove a direct flux of this water mass across the SSR. Weddell Sea Bottom Water (WSBW) is not observed in any of the sampled sections.

Selective histonedeacetylase inhibitor M344 intervenes in HIV-1 latency through increasing histone acetylation and activation of NF-kappaB.

Directory of Open Access Journals (Sweden)

Hao Ying

Full Text Available Histone deacetylase (HDAC inhibitors present an exciting new approach to activate HIV production from latently infected cells to potentially enhance elimination of these cells and achieve a cure. M344, a novel HDAC inhibitor, shows robust activity in a variety of cancer cells and relatively low toxicity compared to trichostatin A (TSA. However, little is known about the effects and action mechanism of M344 in inducing HIV expression in latently infected cells.Using the Jurkat T cell model of HIV latency, we demonstrate that M344 effectively reactivates HIV-1 gene expression in latently infected cells. Moreover, M344-mediated activation of the latent HIV LTR can be strongly inhibited by a NF-κB inhibitor aspirin. We further show that M344 acts by increasing the acetylation of histone H3 and histone H4 at the nucleosome 1 (nuc-1 site of the HIV-1 long terminal repeat (LTR and by inducing NF-κB p65 nuclear translocation and direct RelA DNA binding at the nuc-1 region of the HIV-1 LTR. We also found that M344 synergized with prostratin to activate the HIV-1 LTR promoter in latently infected cells.These results suggest the potential of M344 in anti-latency therapies and an important role for histone modifications and NF-κB transcription factors in regulating HIV-1 LTR gene expression.

Disruption of histone modification and CARM1 recruitment by arsenic represses transcription at glucocorticoid receptor-regulated promoters.

Science.gov (United States)

Barr, Fiona D; Krohmer, Lori J; Hamilton, Joshua W; Sheldon, Lynn A

2009-08-26

Chronic exposure to inorganic arsenic (iAs) found in the environment is one of the most significant and widespread environmental health risks in the U.S. and throughout the world. It is associated with a broad range of health effects from cancer to diabetes as well as reproductive and developmental anomalies. This diversity of diseases can also result from disruption of metabolic and other cellular processes regulated by steroid hormone receptors via aberrant transcriptional regulation. Significantly, exposure to iAs inhibits steroid hormone-mediated gene activation. iAs exposure is associated with disease, but is also used therapeutically to treat specific cancers complicating an understanding of iAs action. Transcriptional activation by steroid hormone receptors is accompanied by changes in histone and non-histone protein post-translational modification (PTM) that result from the enzymatic activity of coactivator and corepressor proteins such as GRIP1 and CARM1. This study addresses how iAs represses steroid receptor-regulated gene transcription. PTMs on histones H3 and H4 at the glucocorticoid receptor (GR)-activated mouse mammary tumor virus (MMTV) promoter were identified by chromatin immunoprecipitation analysis following exposure to steroid hormone+/-iAs. Histone H3K18 and H3R17 amino acid residues had significantly different patterns of PTMs after treatment with iAs. Promoter interaction of the coactivator CARM1 was disrupted, but the interaction of GRIP1, a p160 coactivator through which CARM1 interacts with a promoter, was intact. Over-expression of CARM1 was able to fully restore and GRIP1 partially restored iAs-repressed transcription indicating that these coactivators are functionally associated with iAs-mediated transcriptional repression. Both are essential for robust transcription at steroid hormone regulated genes and both are associated with disease when inappropriately expressed. We postulate that iAs effects on CARM1 and GRIP1 may underlie some

High-resolution structure of the native histone octamer

International Nuclear Information System (INIS)

Wood, Christopher M.; Nicholson, James M.; Lambert, Stanley J.; Chantalat, Laurent; Reynolds, Colin D.; Baldwin, John P.

2005-01-01

The high-resolution (1.90 Å) model of the native histone octamer allows structural comparisons to be made with the nucleosome-core particle, along with an identification of a likely core-histone binding site. Crystals of native histone octamers (H2A–H2B)–(H4–H3)–(H3′–H4′)–(H2B′–H2A′) from chick erythrocytes in 2 M KCl, 1.35 M potassium phosphate pH 6.9 diffract X-rays to 1.90 Å resolution, yielding a structure with an R work value of 18.7% and an R free of 22.2%. The crystal space group is P6 5 , the asymmetric unit of which contains one complete octamer. This high-resolution model of the histone-core octamer allows further insight into intermolecular interactions, including water molecules, that dock the histone dimers to the tetramer in the nucleosome-core particle and have relevance to nucleosome remodelling. The three key areas analysed are the H2A′–H3–H4 molecular cluster (also H2A–H3′–H4′), the H4–H2B′ interaction (also H4′–H2B) and the H2A′–H4 β-sheet interaction (also H2A–H4′). The latter of these three regions is important to nucleosome remodelling by RNA polymerase II, as it is shown to be a likely core-histone binding site, and its disruption creates an instability in the nucleosome-core particle. A majority of the water molecules in the high-resolution octamer have positions that correlate to similar positions in the high-resolution nucleosome-core particle structure, suggesting that the high-resolution octamer model can be used for comparative studies with the high-resolution nucleosome-core particle

A Common Histone Modification Code on C4 Genes in Maize and Its Conservation in Sorghum and Setaria italica1[W][OA

Science.gov (United States)

Heimann, Louisa; Horst, Ina; Perduns, Renke; Dreesen, Björn; Offermann, Sascha; Peterhansel, Christoph

2013-01-01

C4 photosynthesis evolved more than 60 times independently in different plant lineages. Each time, multiple genes were recruited into C4 metabolism. The corresponding promoters acquired new regulatory features such as high expression, light induction, or cell type-specific expression in mesophyll or bundle sheath cells. We have previously shown that histone modifications contribute to the regulation of the model C4 phosphoenolpyruvate carboxylase (C4-Pepc) promoter in maize (Zea mays). We here tested the light- and cell type-specific responses of three selected histone acetylations and two histone methylations on five additional C4 genes (C4-Ca, C4-Ppdk, C4-Me, C4-Pepck, and C4-RbcS2) in maize. Histone acetylation and nucleosome occupancy assays indicated extended promoter regions with regulatory upstream regions more than 1,000 bp from the transcription initiation site for most of these genes. Despite any detectable homology of the promoters on the primary sequence level, histone modification patterns were highly coregulated. Specifically, H3K9ac was regulated by illumination, whereas H3K4me3 was regulated in a cell type-specific manner. We further compared histone modifications on the C4-Pepc and C4-Me genes from maize and the homologous genes from sorghum (Sorghum bicolor) and Setaria italica. Whereas sorghum and maize share a common C4 origin, C4 metabolism evolved independently in S. italica. The distribution of histone modifications over the promoters differed between the species, but differential regulation of light-induced histone acetylation and cell type-specific histone methylation were evident in all three species. We propose that a preexisting histone code was recruited into C4 promoter control during the evolution of C4 metabolism. PMID:23564230

Inhibitors of Histone Deacetylases Are Weak Activators of the FMR1 Gene in Fragile X Syndrome Cell Lines

Directory of Open Access Journals (Sweden)

Alexander A. Dolskiy

2017-01-01

Full Text Available Fragile X syndrome is the most common cause of inherited intellectual disability in humans. It is a result of CGG repeat expansion in the 5′ untranslated region (5′ UTR of the FMR1 gene. This gene encodes the FMRP protein that is involved in neuronal development. Repeat expansion leads to heterochromatinization of the promoter, gene silencing, and the subsequent absence of FMRP. To date, there is no specific therapy for the syndrome. All treatments in clinic practice provide symptomatic therapy. The development of drug therapy for Fragile X syndrome treatment is connected with the search for inhibitors of enzymes that are responsible for heterochromatinization. Here, we report a weak transcriptional activity of the FMR1 gene and the absence of FMRP protein after Fragile X syndrome cell lines treatment with two FDA approved inhibitors of histone deacetylases, romidepsin and vorinostat. We demonstrate that romidepsin, an inhibitor of class I histone deacetylases, does not activate FMR1 expression in patient cell cultures, whereas vorinostat, an inhibitor of classes I and II histone deacetylases, activates a low level of FMR1 expression in some patient cell lines.

Extracellular histones induce erythrocyte fragility and anemia.

Science.gov (United States)

Kordbacheh, Farzaneh; O'Meara, Connor H; Coupland, Lucy A; Lelliott, Patrick M; Parish, Christopher R

2017-12-28

Extracellular histones have been shown to play an important pathogenic role in many diseases, primarily through their cytotoxicity toward nucleated cells and their ability to promote platelet activation with resultant thrombosis and thrombocytopenia. In contrast, little is known about the effect of extracellular histones on erythrocyte function. We demonstrate in this study that histones promote erythrocyte aggregation, sedimentation, and using a novel in vitro shear stress model, we show that histones induce erythrocyte fragility and lysis in a concentration-dependent manner. Furthermore, histones impair erythrocyte deformability based on reduced passage of erythrocytes through an artificial spleen. These in vitro results were mirrored in vivo with the injection of histones inducing anemia within minutes of administration, with a concomitant increase in splenic hemoglobin content. Thrombocytopenia and leukopenia were also observed. These findings suggest that histones binding to erythrocytes may contribute to the elevated erythrocyte sedimentation rates observed in inflammatory conditions. Furthermore, histone-induced increases in red blood cell lysis and splenic clearance may be a significant factor in the unexplained anemias seen in critically ill patients. © 2017 by The American Society of Hematology.

Chemical Inhibition of Histone Deacetylases 1 and 2 Induces Fetal Hemoglobin through Activation of GATA2.

Directory of Open Access Journals (Sweden)

Jeffrey R Shearstone

Full Text Available Therapeutic intervention aimed at reactivation of fetal hemoglobin protein (HbF is a promising approach for ameliorating sickle cell disease (SCD and β-thalassemia. Previous studies showed genetic knockdown of histone deacetylase (HDAC 1 or 2 is sufficient to induce HbF. Here we show that ACY-957, a selective chemical inhibitor of HDAC1 and 2 (HDAC1/2, elicits a dose and time dependent induction of γ-globin mRNA (HBG and HbF in cultured primary cells derived from healthy individuals and sickle cell patients. Gene expression profiling of erythroid progenitors treated with ACY-957 identified global changes in gene expression that were significantly enriched in genes previously shown to be affected by HDAC1 or 2 knockdown. These genes included GATA2, which was induced greater than 3-fold. Lentiviral overexpression of GATA2 in primary erythroid progenitors increased HBG, and reduced adult β-globin mRNA (HBB. Furthermore, knockdown of GATA2 attenuated HBG induction by ACY-957. Chromatin immunoprecipitation and sequencing (ChIP-Seq of primary erythroid progenitors demonstrated that HDAC1 and 2 occupancy was highly correlated throughout the GATA2 locus and that HDAC1/2 inhibition led to elevated histone acetylation at well-known GATA2 autoregulatory regions. The GATA2 protein itself also showed increased binding at these regions in response to ACY-957 treatment. These data show that chemical inhibition of HDAC1/2 induces HBG and suggest that this effect is mediated, at least in part, by histone acetylation-induced activation of the GATA2 gene.

Individual Impact of Distinct Polysialic Acid Chain Lengths on the Cytotoxicity of Histone H1, H2A, H2B, H3 and H4

Directory of Open Access Journals (Sweden)

Kristina Zlatina

2017-12-01

Full Text Available Neutrophils are able to neutralize pathogens by phagocytosis, by the release of antimicrobial components, as well as by the formation of neutrophil extracellular traps (NETs. The latter possibility is a DNA-meshwork mainly consisting of highly concentrated extracellular histones, which are not only toxic for pathogens, but also for endogenous cells triggering several diseases. To reduce the negative outcomes initiated by extracellular histones, different approaches like antibodies against histones, proteases, and the polysaccharide polysialic acid (polySia were discussed. We examined whether each of the individual histones is a binding partner of polySia, and analyzed their respective cytotoxicity in the presence of this linear homopolymer. Interestingly, all of the histones (H1, H2A, H2B, H3, and H4 seem to interact with α2,8-linked sialic acids. However, we observed strong differences regarding the required chain length of polySia to bind histone H1, H2A, H2B, H3, and H4. Moreover, distinct degrees of polymerization were necessary to act as a cytoprotective agent in the presence of the individual histones. In sum, the outlined results described polySia-based strategies to bind and/or to reduce the cytotoxicity of individual histones using distinct polySia chain length settings.

Histone Deacetylase Inhibition Downregulates Collagen 3A1 in Fibrotic Lung Fibroblasts

Directory of Open Access Journals (Sweden)

Victor J. Thannickal

2013-09-01

Full Text Available Idiopathic pulmonary fibrosis (IPF is a deadly disease characterized by chronic inflammation and excessive collagen accumulation in the lung. Myofibroblasts are the primary collagen-producing cells in pulmonary fibrosis. Histone deacetylase inhibitor (HDACi can affect gene expression, and some, such as suberoylanilide hydroxamic acid (SAHA, are US FDA approved for cancer treatment. In this study, we investigated SAHA’s effects on the expression of collagen III alpha 1 (COL3A1 in primary human IPF fibroblasts and in a murine model of pulmonary fibrosis. We observed that increased COL3A1 expression in IPF fibroblasts can be substantially reduced by SAHA treatment at the level of transcription as detected by RT-PCR; collagen III protein level was also reduced, as detected by Western blots and immunofluorescence. The deacetylation inhibitor effect of SAHA was verified by observing higher acetylation levels of both histone H3 and H4 in treated IPF cells. Chromatin immunoprecipitation (ChIP experiments demonstrated that the reduced expression of COL3A1 by SAHA is with increased association of the repressive chromatin marker, H3K27Me3, and decreased association of the active chromatin marker, H3K9Ac. In our murine model of bleomycin-induced pulmonary fibrosis, the SAHA treated group demonstrated significantly less collagen III, as detected by immunohistochemistry. Our data indicate that the HDACi SAHA alters the chromatin associated with COL3A1, resulting in its decreased expression.

Study of receptor-chaperone interactions using the optical technique of spectroscopic ellipsometry.

Science.gov (United States)

Kriechbaumer, Verena; Tsargorodskaya, Anna; Mustafa, Mohd K; Vinogradova, Tatiana; Lacey, Joanne; Smith, David P; Abell, Benjamin M; Nabok, Alexei

2011-07-20

This work describes a detailed quantitative interaction study between the novel plastidial chaperone receptor OEP61 and isoforms of the chaperone types Hsp70 and Hsp90 using the optical method of total internal reflection ellipsometry (TIRE). The receptor OEP61 was electrostatically immobilized on a gold surface via an intermediate layer of polycations. The TIRE measurements allowed the evaluation of thickness changes in the adsorbed molecular layers as a result of chaperone binding to receptor proteins. Hsp70 chaperone isoforms but not Hsp90 were shown to be capable of binding OEP61. Dynamic TIRE measurements were carried out to evaluate the affinity constants of the above reactions and resulted in clear discrimination between specific and nonspecific binding of chaperones as well as differences in binding properties between the highly similar Hsp70 isoforms. Copyright © 2011 Biophysical Society. Published by Elsevier Inc. All rights reserved.

Gallic Acid Decreases Inflammatory Cytokine Secretion Through Histone Acetyltransferase/Histone Deacetylase Regulation in High Glucose-Induced Human Monocytes.

Science.gov (United States)

Lee, Wooje; Lee, Sang Yeol; Son, Young-Jin; Yun, Jung-Mi

2015-07-01

Hyperglycemia contributes to diabetes and several diabetes-related complications. Gallic acid is a polyhydroxy phenolic compound found in various natural products. In this study, we investigated the effects and mechanism of gallic acid on proinflammatory cytokine secretion in high glucose-induced human monocytes (THP-1 cells). THP-1 cells were cultured under normoglycemic or hyperglycemic conditions, in the absence or presence of gallic acid. Hyperglycemic conditions significantly induced histone acetylation, nuclear factor-κB (NF-κB) activation, and proinflammatory cytokine release from THP-1 cells, whereas gallic acid suppressed NF-κB activity and cytokine release. It also significantly reduced CREB-binding protein/p300 (CBP/p300, a NF-κB coactivator) gene expression, acetylation levels, and CBP/p300 histone acetyltransferase (HAT) activity. In addition, histone deacetylase 2 (HDAC2) expression was significantly induced. These results suggest that gallic acid inhibits hyperglycemic-induced cytokine production in monocytes through epigenetic changes involving NF-κB. Therefore, gallic acid may have potential for the treatment and prevention of diabetes and its complications.

HiHiMap: single-cell quantitation of histones and histone posttranslational modifications across the cell cycle by high-throughput imaging.

Science.gov (United States)

Zane, Linda; Chapus, Fleur; Pegoraro, Gianluca; Misteli, Tom

2017-08-15

We describe Hi gh-throughput Hi stone Map ping (HiHiMap), a high-throughput imaging method to measure histones and histone posttranslational modifications (PTMs) in single cells. HiHiMap uses imaging-based quantification of DNA and cyclin A to stage individual cells in the cell cycle to determine the levels of histones or histone PTMs in each stage of the cell cycle. As proof of principle, we apply HiHiMap to measure the level of 21 core histones, histone variants, and PTMs in primary, immortalized, and transformed cells. We identify several histone modifications associated with oncogenic transformation. HiHiMap allows the rapid, high-throughput study of histones and histone PTMs across the cell cycle and the study of subpopulations of cells. © 2017 Zane et al. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).

Immune activation by histones: plusses and minuses in inflammation.

Science.gov (United States)

Pisetsky, David S

2013-12-01

Histones are highly cationic proteins that are essential components of the cell nucleus, interacting with DNA to form the nucleosome and regulating transcription. Histones, however, can transit from the cell nucleus during cell death and, once in an extracellular location, can serve as danger signals and activate immune cells. An article in this issue of the European Journal of Immunology [Eur. J. Immunol. 2013. 43: 3336-3342] reports that histones can activate monocyte-derived DCs via the NRLP3 inflammasome to induce the production of IL-1β. As such, histones, which can also stimulate TLRs, may drive events in the immunopathogenesis of a wide range of acute and chronic diseases marked by sterile inflammation. While the mechanism of this stimulation is not known, the positive charge of histones may provide a structural element to promote interaction with cells and activation of downstream signaling systems. © 2013 WILEY‐VCH Verlag GmbH & Co. KGaA, Weinheim.

Presence of Cytotoxic Extracellular Histones in Machine Perfusate of Donation After Circulatory Death Kidneys.

Science.gov (United States)

van Smaalen, Tim C; Beurskens, Daniëlle M H; Hoogland, E R Pieter; Winkens, Bjorn; Christiaans, Maarten H L; Reutelingsperger, Chris P; van Heurn, L W Ernest; Nicolaes, Gerry A F

2017-04-01

Extracellular histones are cytotoxic molecules that are related to cell stress and death. They have been shown to play a crucial role in multiple pathophysiologic processes like sepsis, inflammation, vascular dysfunction, and thrombosis. Their role in organ donation and graft function and survival is still unknown. The aim of this study was to assess whether an association exists between the presence of extracellular histones in machine perfusates and deceased donor kidney viability. Machine perfusates of 390 donations after circulatory death kidneys were analyzed for histone concentration, and corresponding graft function and survival were assessed. Extracellular histone concentrations were significantly higher in perfusates of kidneys with posttransplant graft dysfunction (primary nonfunction and delayed graft function) and were an independent risk factor for delayed graft function (odds ratio, 2.152; 95% confidence interval [95% CI], 1.199-3.863) and 1 year graft failure (hazard ratio, 1.386; 95% CI, 1.037-1.853), but not for primary nonfunction (odds ratio, 1.342; 95% CI, 0.900-2.002). One year graft survival was 12% higher in the group with low histone concentrations (P = 0.008) as compared with the group that contained higher histone concentrations. This study warrants future studies to probe for a possible role of cytotoxic extracellular histones in organ viability and suggests that quantitation of extracellular histones might contribute to assessment of posttransplant graft function and survival.

Comparison of intra-organellar chaperone capacity for dealing with stress-induced protein unfolding.

Science.gov (United States)

Hageman, Jurre; Vos, Michel J; van Waarde, Maria A W H; Kampinga, Harm H

2007-11-23

Molecular chaperones are essential for cells to prevent that partially unfolded proteins form non-functional, toxic aggregates. This requirement is increased when cells experience protein unfolding stresses and such could affect all compartments in the eukaryotic cell. Whether all organelles are equipped with comparable chaperone capacities is largely unknown, mainly due to the lack of suitable reporters that allow such a comparison. Here we describe the development of fluorescent luciferase reporters that are sorted to various cellular locations (nucleus, cytoplasm, endoplasmic reticulum, and peroxisomes) and that differ minimally in their intrinsic thermal stability properties. When heating living cells, the rate of inactivation was most rapid for the nuclear-targeted luciferase, indicating that the nucleus is the most sensitive organelle toward heat-induced denaturing stress. Post-heat re-activation, however, occurred at equal kinetics irrespective of luciferase localization. Also, induction of thermotolerance by a priming heat treatment, that coordinately up-regulates all heat-inducible chaperones, resulted in a transient heat resistance of the luciferase in all organelles in a comparable manner. Overexpression of the main heat-inducible Hsp70 family member, HspA1A, protected only the cytosolic and nuclear, but not the other luciferases. Together, our data suggest that in each compartment investigated, including the peroxisome in which so far no chaperones could be detected, chaperone machines are present and can be induced with activities similar to those present in the cytosolic/nuclear compartment.

Dissociation of histone and DNA synthesis in x-irradiated HeLa cells

International Nuclear Information System (INIS)

Bases, R.; Mendez, F.

1971-01-01

Although histone synthesis and DNA synthesis are normally very well coordinated in HeLa cells, their histone synthesis proved relatively resistant to inhibition by ionizing radiation. During the first 24 h after 1,000 R the rate of cellular DNA synthesis progressively fell to small fractions of control values while histone synthesis with much less relative reduction. Acrylamide gel electropherograms of the acid soluble nuclear histones synthesized by irradiated HeLa cells were qualitatively normal

Overview of the Classical Histone Deacetylase Enzymes and Histone Deacetylase Inhibitors

OpenAIRE

Ververis, Katherine; Karagiannis, Tom C.

2012-01-01

The important role of histone deacetylase enzymes in regulating gene expression, cellular proliferation, and survival has made them attractive targets for the development of histone deacetylase inhibitors as anticancer drugs. Suberoylanilide hydroxamic acid (Vorinostat, Zolinza), a structural analogue of the prototypical Trichostatin A, was approved by the US Food and Drug Administration for the treatment of advanced cutaneous T-cell lymphoma in 2006. This was followed by approval of the cycl...

Role of Subunit Exchange and Electrostatic Interactions on the Chaperone Activity of Mycobacterium leprae HSP18

Science.gov (United States)

Nandi, Sandip Kumar; Panda, Alok Kumar; Chakraborty, Ayon; Ray, Sougata Sinha; Biswas, Ashis

2015-01-01

Mycobacterium leprae HSP18, a major immunodominant antigen of M. leprae pathogen, is a small heat shock protein. Previously, we reported that HSP18 is a molecular chaperone that prevents aggregation of different chemically and thermally stressed client proteins and assists refolding of denatured enzyme at normal temperature. We also demonstrated that it can efficiently prevent the thermal killing of E. coli at higher temperature. However, molecular mechanism behind the chaperone function of HSP18 is still unclear. Therefore, we studied the structure and chaperone function of HSP18 at normal temperature (25°C) as well as at higher temperatures (31–43°C). Our study revealed that the chaperone function of HSP18 is enhanced significantly with increasing temperature. Far- and near-UV CD experiments suggested that its secondary and tertiary structure remain intact in this temperature range (25–43°C). Besides, temperature has no effect on the static oligomeric size of this protein. Subunit exchange study demonstrated that subunits of HSP18 exchange at 25°C with a rate constant of 0.018 min-1. Both rate of subunit exchange and chaperone activity of HSP18 is found to increase with rise in temperature. However, the surface hydrophobicity of HSP18 decreases markedly upon heating and has no correlation with its chaperone function in this temperature range. Furthermore, we observed that HSP18 exhibits diminished chaperone function in the presence of NaCl at 25°C. At elevated temperatures, weakening of interactions between HSP18 and stressed client proteins in the presence of NaCl results in greater reduction of its chaperone function. The oligomeric size, rate of subunit exchange and structural stability of HSP18 were also found to decrease when electrostatic interactions were weakened. These results clearly indicated that subunit exchange and electrostatic interactions play a major role in the chaperone function of HSP18. PMID:26098662

Role of Subunit Exchange and Electrostatic Interactions on the Chaperone Activity of Mycobacterium leprae HSP18.

Science.gov (United States)

Nandi, Sandip Kumar; Panda, Alok Kumar; Chakraborty, Ayon; Sinha Ray, Sougata; Biswas, Ashis

2015-01-01

Mycobacterium leprae HSP18, a major immunodominant antigen of M. leprae pathogen, is a small heat shock protein. Previously, we reported that HSP18 is a molecular chaperone that prevents aggregation of different chemically and thermally stressed client proteins and assists refolding of denatured enzyme at normal temperature. We also demonstrated that it can efficiently prevent the thermal killing of E. coli at higher temperature. However, molecular mechanism behind the chaperone function of HSP18 is still unclear. Therefore, we studied the structure and chaperone function of HSP18 at normal temperature (25°C) as well as at higher temperatures (31-43°C). Our study revealed that the chaperone function of HSP18 is enhanced significantly with increasing temperature. Far- and near-UV CD experiments suggested that its secondary and tertiary structure remain intact in this temperature range (25-43°C). Besides, temperature has no effect on the static oligomeric size of this protein. Subunit exchange study demonstrated that subunits of HSP18 exchange at 25°C with a rate constant of 0.018 min(-1). Both rate of subunit exchange and chaperone activity of HSP18 is found to increase with rise in temperature. However, the surface hydrophobicity of HSP18 decreases markedly upon heating and has no correlation with its chaperone function in this temperature range. Furthermore, we observed that HSP18 exhibits diminished chaperone function in the presence of NaCl at 25°C. At elevated temperatures, weakening of interactions between HSP18 and stressed client proteins in the presence of NaCl results in greater reduction of its chaperone function. The oligomeric size, rate of subunit exchange and structural stability of HSP18 were also found to decrease when electrostatic interactions were weakened. These results clearly indicated that subunit exchange and electrostatic interactions play a major role in the chaperone function of HSP18.

Identification and Interrogation of Combinatorial Histone Modifications

Directory of Open Access Journals (Sweden)

Kelly R Karch

2013-12-01

Full Text Available Histone proteins are dynamically modified to mediate a variety of cellular processes including gene transcription, DNA damage repair, and apoptosis. Regulation of these processes occurs through the recruitment of non-histone proteins to chromatin by specific combinations of histone post-translational modifications (PTMs. Mass spectrometry has emerged as an essential tool to discover and quantify histone PTMs both within and between samples in an unbiased manner. Developments in mass spectrometry that allow for characterization of large histone peptides or intact protein has made it possible to determine which modifications occur simultaneously on a single histone polypeptide. A variety of techniques from biochemistry, biophysics, and chemical biology have been employed to determine the biological relevance of discovered combinatorial codes. This review first describes advancements in the field of mass spectrometry that have facilitated histone PTM analysis and then covers notable approaches to probe the biological relevance of these modifications in their nucleosomal context.

Sex-specific expression of the X-linked histone demethylase gene Jarid1c in brain.

Directory of Open Access Journals (Sweden)

Jun Xu

Full Text Available Jarid1c, an X-linked gene coding for a histone demethylase, plays an important role in brain development and function. Notably, JARID1C mutations cause mental retardation and increased aggression in humans. These phenotypes are consistent with the expression patterns we have identified in mouse brain where Jarid1c mRNA was detected in hippocampus, hypothalamus, and cerebellum. Jarid1c expression and associated active histone marks at its 5'end are high in P19 neurons, indicating that JARID1C demethylase plays an important role in differentiated neuronal cells. We found that XX mice expressed Jarid1c more highly than XY mice, independent of their gonadal types (testes versus ovaries. This increased expression in XX mice is consistent with Jarid1c escape from X inactivation and is not compensated by expression from the Y-linked paralogue Jarid1d, which is expressed at a very low level compared to the X paralogue in P19 cells. Our observations suggest that sex-specific expression of Jarid1c may contribute to sex differences in brain function.

Evaluation of Proteomic Search Engines for the Analysis of Histone Modifications

Science.gov (United States)

2015-01-01

Identification of histone post-translational modifications (PTMs) is challenging for proteomics search engines. Including many histone PTMs in one search increases the number of candidate peptides dramatically, leading to low search speed and fewer identified spectra. To evaluate database search engines on identifying histone PTMs, we present a method in which one kind of modification is searched each time, for example, unmodified, individually modified, and multimodified, each search result is filtered with false discovery rate less than 1%, and the identifications of multiple search engines are combined to obtain confident results. We apply this method for eight search engines on histone data sets. We find that two search engines, pFind and Mascot, identify most of the confident results at a reasonable speed, so we recommend using them to identify histone modifications. During the evaluation, we also find some important aspects for the analysis of histone modifications. Our evaluation of different search engines on identifying histone modifications will hopefully help those who are hoping to enter the histone proteomics field. The mass spectrometry proteomics data have been deposited to the ProteomeXchange Consortium with the data set identifier PXD001118. PMID:25167464

Evaluation of proteomic search engines for the analysis of histone modifications.

Science.gov (United States)

Yuan, Zuo-Fei; Lin, Shu; Molden, Rosalynn C; Garcia, Benjamin A

2014-10-03

Identification of histone post-translational modifications (PTMs) is challenging for proteomics search engines. Including many histone PTMs in one search increases the number of candidate peptides dramatically, leading to low search speed and fewer identified spectra. To evaluate database search engines on identifying histone PTMs, we present a method in which one kind of modification is searched each time, for example, unmodified, individually modified, and multimodified, each search result is filtered with false discovery rate less than 1%, and the identifications of multiple search engines are combined to obtain confident results. We apply this method for eight search engines on histone data sets. We find that two search engines, pFind and Mascot, identify most of the confident results at a reasonable speed, so we recommend using them to identify histone modifications. During the evaluation, we also find some important aspects for the analysis of histone modifications. Our evaluation of different search engines on identifying histone modifications will hopefully help those who are hoping to enter the histone proteomics field. The mass spectrometry proteomics data have been deposited to the ProteomeXchange Consortium with the data set identifier PXD001118.

Characterization of human papillomavirus type 16 pseudovirus containing histones.

Science.gov (United States)

Kim, Hyoung Jin; Kwag, Hye-Lim; Kim, Hong-Jin

2016-08-27

Pseudoviruses (PsVs) that encapsidate a reporter plasmid DNA have been used as surrogates for native human papillomavirus (HPV), whose continuous production is technically difficult. HPV PsVs have been designed to form capsids made up of the major capsid protein L1 and the minor capsid proteins L2. HPV PsVs have been produced in 293TT cells transfected with plasmid expressing L1 and L2 protein and plasmid containing the reporter gene. Several studies have suggested that naturally occurring HPV virions contain cellular histones, and histones have also been identified in mature HPV PsVs. However, the effect of the histones on the properties of the PsVs has not been investigated. Using heparin chromatography, we separated mature HPV type 16 PsVs into three fractions (I, II, and III) according to their heparin-binding affinities. The amounts of cellular histone and cellular nucleotides per PsV were found to increase in the order fraction I, II and III. It appeared that PsVs in fraction I contains just small amount of cellular histone in Western blot analysis. The proportions of the three fractions in PsV preparations were 83.4, 7.5, and 9.1 % for fraction I, II, and III PsVs, respectively. In the electron microscope PsVs in fraction I appeared to have a more condensed structure than those in fractions II and III. Under the electron microscope fraction II and III PsVs appeared to be covered by substantial amounts of cellular histone while there was no visible histone covering PsVs of fraction I. Also the levels of reporter gene expression in infections of fraction II and III PsVs to 293TT cells were significantly lower than those in infections of fraction I PsV, and fraction II and III particles had significantly reduced immunogenicity. Our findings suggest that the involvement of large amounts of cellular histones during PsV formation interferes with the structural integrity of the PsVs and affects their immunogenicity. The fraction I particle therefore has the most

Jeffery G. Linger | NREL

Science.gov (United States)

Reassembly During DNA Repair," Mutation Research (2007) "Global Replication-Independent Histone H4 Exchange in Budding Yeast," Eukaryotic Cell (2006) "Dominant Mutants of the Saccharomyces and Sir Protein Recruitment," Genetics (2006) "The Yeast Histone Chaperone Chromatin

Quantitative analysis of histone modifications: formaldehyde is a source of pathological n(6-formyllysine that is refractory to histone deacetylases.

Directory of Open Access Journals (Sweden)

Bahar Edrissi

Full Text Available Aberrant protein modifications play an important role in the pathophysiology of many human diseases, in terms of both dysfunction of physiological modifications and the formation of pathological modifications by reaction of proteins with endogenous electrophiles. Recent studies have identified a chemical homolog of lysine acetylation, N(6-formyllysine, as an abundant modification of histone and chromatin proteins, one possible source of which is the reaction of lysine with 3'-formylphosphate residues from DNA oxidation. Using a new liquid chromatography-coupled to tandem mass spectrometry method to quantify all N(6-methyl-, -acetyl- and -formyl-lysine modifications, we now report that endogenous formaldehyde is a major source of N(6-formyllysine and that this adduct is widespread among cellular proteins in all compartments. N(6-formyllysine was evenly distributed among different classes of histone proteins from human TK6 cells at 1-4 modifications per 10(4 lysines, which contrasted strongly with lysine acetylation and mono-, di-, and tri-methylation levels of 1.5-380, 5-870, 0-1400, and 0-390 per 10(4 lysines, respectively. While isotope labeling studies revealed that lysine demethylation is not a source of N(6-formyllysine in histones, formaldehyde exposure was observed to cause a dose-dependent increase in N(6-formyllysine, with use of [(13C,(2H2]-formaldehyde revealing unchanged levels of adducts derived from endogenous sources. Inhibitors of class I and class II histone deacetylases did not affect the levels of N(6-formyllysine in TK6 cells, and the class III histone deacetylase, SIRT1, had minimal activity (<10% with a peptide substrate containing the formyl adduct. These data suggest that N(6-formyllysine is refractory to removal by histone deacetylases, which supports the idea that this abundant protein modification could interfere with normal regulation of gene expression if it arises at conserved sites of physiological protein secondary

Involvement of histone methyltransferase GLP in HIV-1 latency through catalysis of H3K9 dimethylation