Varblane, Reet, 1952-
2002-01-01
Hiina nüüdiskultuuri avastamisest 1990-ndatel, traditsioonide püsimisest. Hiina praeguse maalikunsti väljapanek 1994. a. Sao Paulo biennaalil, näitus "Pariis-Peking" Pariisis 2002. a. Eesti-Hiina kultuurialane koostöö. Hiina maalikunsti näitus Eesti Rahvusraamatukogus. 2003. a. eesti ehtekunsti näitus Pekingis ja Guangzhou Guangdongi kunstimuuseumis.
USA pelgab Hiina tehnoloogialuuret / Tõnis Arnover
Arnover, Tõnis, 1952-
2005-01-01
Hiina Ameerika-vastasest majandusluurest. USA luureameti andmetel on USA-s loodud üle kolme tuhande Hiina firma, kelle ülesandeks on tööstusliku või sõjalise tehnoloogia hankimine. Vt. samas: Hiina firmad ostavad üha suuremaid USA ettevõtteid
Park World Tour Hiinas / Timo Sild
Sild, Timo, 1988-
2012-01-01
Reisikiri Eesti sportlaste osalemisest septembris Hiinas korraldatud Park World Tour orienteerumisvõistlustel - Changchunis toimunud kahepäevasel Vasa orienteerumisfestivalil, Chongqingi lähistel toimunud Hiina meistrivõistlustel orienteerumissprindis ja Wanshengis toimunud lühiraja Hiina meistrivõistlustel ning Bekingi botaanikaaias toimunud keskkooli ja ülikooli meistrivõistlustel
Turay, Abdul, 1967-
2011-01-01
Hiina on suur riik suure majandusega ja eestlasedki võiksid sealsele turule minna, kuid Eestis on Idamaad äraunustatud ja Hiinat tundma õppida on raske. Mais teatasid hiinlased, et neil on kavas avada eestikeelne telekanal. Hiina ühiskonna eripäradest. Hiinlaste ja eestlaste sarnasustest ning erinevustest
Hiina vaatab eurole lahkema pilguga / Romet Kreek
Kreek, Romet, 1972-
2010-01-01
Hiina ostis kriisi ajal juurde Euroopa võlakirju, Jaapani võlakirju ostis Hiina I poolaastal kiiremas tempos kui vähemalt viiel viimasel aastal, USA valitsuse võlakirju on Hiina vähendanud 7,7% võrra
Aasia: missioon "Hiina" / Xiaotian Zhang
Zhang, Xiaotian
2011-01-01
Hiina ja Põhjamaade ärisuhete pikk ajalugu. Eesti, Soome, Rootsi ja Hiina koostööprogramm BENCH (Beneficial Business Relations between the Central Baltic Region and China, 2007-2013). Diagramm "Soome, Rootsi ja Eesti Kaubavahetus Hiinaga"
Hiina naiskunstnike näitus / Maria-Kristiina Soomre
Soomre, Maria-Kristiina, 1978-
2001-01-01
Hongkongis avatud näitus "Hiina kunstilaval" keskendub hiina naiskunstnike Yu Cheni, Wang Jingi, Yuen Nimchi ja Hao Li loomingule ning on esimene samm võitluses hiina naiskunstnike soolise diskrimineerimise vastu.
Hiina reageeris karmilt Google'i lahkumisotsusele / Hendrik Vosman
Vosman, Hendrik
2010-01-01
Otsingumootor Google otsustas tsensuuri tõttu sulgeda oma Hiina portaali ja suunab otsingud ümber Honkongi lehele, mis on vaba mitmetest Mandri-Hiinas kehtivatest piirangutest. Google'i otsus kustus Hiinas esile terava reaktsiooni
Kultuurisild : eesti muinasjutud ilmusid hiina keeles
2010-01-01
18. okt. esitleti maailmanäitusel EXPO Hiinas Shanghais esimest eesti keelest hiina keelde tõlgitud raamatut, kogumikku August Jakobsoni ja Friedrich Reinhold Kreutzwaldi muinasjuttudest Jüri Mildebergi illustratsioonidega. Proua Evelin Ilves osales raamatu esitlusel Shanghai Lasteraamatukogus
14. ja 15. X viibivad Hiina kunstiakadeemia kutsel...
2005-01-01
Hangzhou rahvusvahelisel moedisainiharidust analüüsival konverentsil viibivad Tartu Kõrgema Kunstikooli rektor Vallo Nuust, tekstiiliosakonna juhataja Aet Ollisaar ja tekstiiliosakonna meister Signe Vilde. TKK delegatsiooni üks eesmärke Hiinas on TKK ja Hiina kunstiakadeemia või mõne teise Hiina kunstikõrgkooli õppejõudude vahetuse programmi algatamine
Kus suitsu, seal tuld : [suitsetamisest Hiinas] / Daniel Stone
Stone, Daniel
2016-01-01
Hiinas elab kolmandik maailma suitsetajatest, kes tõmbavad päevas seitse miljardit sigaretti. Maailma Terviseorganisatsioon prognoosib 2050. aastaks Hiinas kolm miljonit tubakaga seotud surmajuhtumit
Hiina tehaste kurb saatus / Dexter Roberts
Roberts, Dexter
2008-01-01
Hiina tootmisettevõtted on tootmiskulude hüppelise kasvu tõttu läbi elamas restruktureerimisfaasi, mille tagajärjel on mitmed ettevõtted sunnitud oma tootmise viima madalama tootmiskuluga piirkondadesse, tootmismahte suurendama efektiivsuse tõstmise ja kaadrivoolavuse peatamise kaudu või tegevuse lõpetama. Tabel: Tootmiskulude hüppeline kasv Hiinas. Lisa: Viited. Vt. samas: Keskklass pihtide vahel
USA-Hiina luurelennukitüli ähvardab suureks paisuda / Erkki Bahovski
Bahovski, Erkki, 1970-
2001-01-01
USA-Hiina tüli luurelennuki pärast võib kahjustada Hiina pääsu WTO-sse. Analüütikute arvates näitavad mitmed hiljutised intsidendid USA huvi Hiina sõjasaladuste vastu. Vt. samas "Eesti rannikut seirab Vene lennuk"
Rüütlit saadab Hiinas hiigelvõlgades firma juht / Tuuli Koch
Koch, Tuuli, 1978-
2005-01-01
President Arnold Rüütli 23. augustil alanud Hiina-visiidi ärimeeste delegatsiooni juhib AS-i Olexela Oil üks omanikest Juhan Kolk, kelle firmal on riigi ees ligi 40 miljoni krooni suurune maksuvõlg. Lisa: President Rüütel Hiinas. Riigivisiit Hiina Rahvavabariiki 23.-30.08.2005
Hiina kunstnikud kaebavad Veneetsia biennaali kohtusse / Maria-Kristiina Soomre
Soomre, Maria-Kristiina, 1978-
2000-01-01
1999. a. Veneetsia biennaalil auhinna võitnud hiina kunstniku Cai Guo Qiangi teos "Veneetsia maksukoguja hoov" on Hiinas tekitanud diskussiooni autoriõiguste teemal. Kaalutakse kohtuasja algatamist Cai Guo Qiangi, Harald Szeemanni ja Veneetsia biennaali vastu
Kas Hiina draakon õpib ka lendama? / Villu Zirnask
Zirnask, Villu, 1966-
2011-01-01
Uuringust, mille käigus püüti välja selgitada Hiina patendistrateegiat. (Markus Eberhardt, Christian Helmers, Zhihong Yu. Is the dragon learning to fly? An analysis of the Chinese patent explosion. (CSAE Working Paper WPS/2011-15). Tabel: USA-s enim patente registreerinud Hiina ettevõtted (1985-2006)
USA seab tõkkeid odavatele Hiinas toodetud kaupadele / Sirje Rank
Rank, Sirje, 1966-
2003-01-01
USA kaubandusdefitsiit Hiinaga kasvab, USA Kongress süüdistab Hiinat ebaausas konkurentsis ja on seadmas Hiina kaupadele impordipiiranguid. Hiina kaalub vastusanktsioone. Diagramm: Kaubandusdefitsiit Hiinaga süveneb
Hiina tervendus / kommenteerivad Anne, Julia, Weihong Song, Fagang Ren
2013-01-01
Tallinnas Tulika 19 asuvast Bai Lan Hiina massaažisalongist, kus ravitakse kuputeraapia, gua sha kraapimisplaatide, moksa, nõelravi ja punktmassaaži abil. Tui na massaaži ja hiina loodusteraapia protseduure kommenteerivad spetsialistid ning patsiendid Anne ja Julia
Oodata võib Hiina kaupade uputust. Ja mitte ainult odavate / Erik Aru
Aru, Erik
2010-01-01
Kui paljud eksperdid usuvad Hiina esiletõusu, siis mõnedel hinnangutel järgneb praegusele Hiina majanduse kiirele toibumisele majandusmulli lõhkemine. Nädalalehes The Economist käsitleti põhjusi, miks osa vaatlejaid tõmbab paralleele praeguse Hiina ja 1980-ndate lõpu Jaapani vahel
Tallinna loodetud Hiina terminal kerkib Ust-Luugas / Andres Reimer
Reimer, Andres
2006-01-01
Väidetavalt on Hiina transiidiettevõtjad jõudnud Ust-Luuga sadamas terminalipinda omava konteinervedude firmaga Pervõi Konteinernõi Terminal PKT kavatsuste protokollini. President Vladimir Putin on lubanud rajada Ust-Luuga sadamasse vabatsooni, mis tõenäoliselt annab võimaluse Hiina kaubanduskeskuse rajamisele. Lisa: Kaubatee Hiinasse
Hanson, Raimu, 1957-
2009-01-01
Hiina keeleteadlane Gao Jingyi on avaldanud raamatu, milles ta näitab, et hiina keel ning eesti keel ja teised läänemeresoome keeled mingil määral koos teiste uurali keeltega pärinevad ühisest allikast
Hiina (ja Aasia) mõistmine pole lootusetu üritus / Karin Dean
Dean, Karin
2011-01-01
Eestlaste Hiina-huvi ja mõistmise soov on tingitud paljuski Hiina turust ja majanduslikest võimalustest. Mida on vaja teada, et Hiinat (Aasiat) mõista. Aasia-teemalise hariduse võimalustest Eestis
"Jade Warrior" kupatab Soome sampo Hiina / Kätlin Kaldmaa
Kaldmaa, Kätlin, 1970-
2006-01-01
Soome ja Hiina mütoloogiat ühendav fantaasiafilm "Igavese armastuse sõdalane - Jade Warrior" (Soome, Hiina, Hollandi ja Eesti ühistöö) : stsenarist Iiro Küttner : režissöör Antti-Jussi Annila : võitluskunstide koreograaf Yu Yan Kai : osades Tommi Eronen, Zhang Jingchu, Markku Peltola. Lisatud Ave Randviiru, Elle Kulli ja Antti-Jussi Annila "Esimesed muljed"
Hiina õudusunenägu / Tiit Tuumalu
Tuumalu, Tiit, 1971-
2006-01-01
Kumus on 14. mail dokumentaalfilm Hiina Rahvavabariigi Tiibeti rahvast ja kultuuri hävitavast poliitikast "Tibet : Cray of the Snow Lion" : režissöör Tom Peosay (peaks olema Piozet) : Ameerika Ühendriigid 2002
Hiina lühike samm konverteeritava jüaani teel / Romet Kreek
Kreek, Romet, 1972-
2005-01-01
Hiina loobus jüaani seotusest USA dollariga ning võtab sihiks muuta see vabalt ujuva kursiga ja vabalt konventeeritavaks valuutaks. Vt. samas: USA avaldas Hiinale survet. Lisad: Aasia valuutad tugevnesid USA dollari vastu; Hiina aktsiaturg tõusis jüaani revalveerimise järel
Kuidas Hiinas raha teha / Jaanus Hämarsoo
Hämarsoo, Jaanus
2004-01-01
Tallinna Sadama juhatuse endine aseesimees, firma Worldwide Invest nõukogu esimees Jaan Toots meenutab reisi Hiinasse, kohtumisi Hiina ärimeestega. Eesti aukonsulite Hongkongis ja Macaus võõrustamisest Eestis
Fantaasiad Hiina teemadel / Leila Pärtelpoeg
Pärtelpoeg, Leila, 1927-
2006-01-01
Hiinas praegugi tootmises ja müügil olevate vanu vorme ja dekoratsioone järgivate esemete tutvustus: kitsas laud, fajanssnõu, punane kapp, tool, kandik, panipaik-kapp, azhuurne raam tikandite raamimiseks, väike laud. Lavastused: Madis Liplap kaubandusfirmas Vipex
Ameerika pitser Hiina arhitektuuril / Mid Bungers
Bungers, Mid
2005-01-01
Hiina nüüdisarhitektuurist, terasarhitektuurist, linnaplaneerimisest, arhitektuuribüroodest, koostööst välismaiste arhitektuuribüroodega, Pekingi suurimast arhitektuuribüroost China Architecture Design & Research Group, büroo olümpiaprojektidest. 1 värv. ill
Hiina haridusinnovatsioon neljaks tunniks Eestis / Mikk Kasesalk
Kasesalk, Mikk
2016-01-01
Shanghai on Hiina haridussüsteemi edulugu. Sealsete õppeasutuste esindajatega on võimalik kohtuda 13. mail Tallinna ülikoolis toimuval Shanghai haridusmessil. Tallinna ülikoolis on võimalik õppida Aasia uuringute eriala
Hiinas tunda krahhi hõngu / Romet Kreek
Kreek, Romet, 1972-
2010-01-01
Hiinas ei tohi pangad anda laenu kolmanda eluaseme ostuks. Pankadele on soovitatud mitte anda kinnisvaralaenu mitteresidentidest maksutuludeta inimestele ja neile, kel ei ole tõendit sotsiaalmaksu tasumise kohta. Euroopas langesid lennifirmade aktsiad umbes 5%
Hiina linna uued ilmed / Katja Koort
Koort, Katja
2007-01-01
Hiina nüüdiskunsti näitus "Linnailmed / City Expressions" Tallinna Kunstihoones kuni 28. I. Osalevad Guangzhou ja Guangzhouga seotud kunstnikud. Kuraatorid Reet Varblane ja Zuo Zhengyao, kujundaja Rosita Raud. Pikemalt Feng Fengi, Yu Xudongi, Zuo Zhengyao, Weng Feni, Li Bangyao ja Hu Xiangqiani töödest
Veneetsias võitis Hiina üllataja
2006-01-01
Veneetsia filmifestivali parima filmi peaauhind Kuldlõvi läks Hiina režissööri Jia Zhang-Ke filmile "Vaikelu" ("Dong"). Hõbelõvi said Alain Resnais' "Isiklikud hirmud avalikes kohtades" ("Coeurs") ja Emanuele Crialese "Kuldne uks" ("Nuodomondo"). Parima näitleja Coppa Volpi said Helen Mirren ja Ben Affleck
Ühinemise ja iseolemise vastuseis. Ideaalid ja reaalsus / Rein Tootmaa
Tootmaa, Rein
2001-01-01
Mängufilmid "Keiser ja palgamõrtsukas" ("Jing ke ci qin wang") : režissöör Chen Kaige : Jaapan-Hiina-Prantsusmaa 1999 ja "Tiiger ja draakon" ("Wo hu chang long") : režissöör Ang Lee : Hiina-Hongkong-Ameerika Ühendriigid 2000. Lisa : Aare Ermeli koostatud Chen Kaige ja Ang Lee loomingu lühikokkuvõtted. Kokkuvõte inglise keeles lk. 128
Hiina mänguasjavabrikud vallutavad mobiilimaailma / Kaido Einama
Einama, Kaido, 1971-
2008-01-01
Ülevaade visiidist Hiina moodsa suurlinna Shanghai elektroonikakauplustesse, kus puututi kokku tuntud kaubamärkide Nokia, Apple ning HTC toodete koopiatega - Nokla, HiPhone, MTC ja ZTC telefonidega. Lisa: Shanghai poodleja spikker
Skype'i eestlased piiluvad Hiina poole / Toivo Tänavsuu
Tänavsuu, Toivo
2006-01-01
Investeerimisfirma Ambient Sound Investments (ASI), mille omanikud said tuntuks internetitelefoni Skype loomisega, tegevusest Eestis ning plaanidest suunduda Hiina turule. Vt. samas: Viik: ASI on omalaadne arengufond
Kehra tudengil Karel Jõelehel on võimalus õppida Hiina ülikoolis / Külli Koppelmaa
Koppelmaa, Külli, 1970-
2016-01-01
Tallinna Ülikoolis Aasia uuringute erialal õppiv Karel Jõeleht osales üliõpilaste talendivõistluse "Chinese Bridge" Eesti eelvoorus. Selle võit tagas talle pääsu lõppvõistlusele Hiinas. Kõiki võistluse lõppvooru pääsenuid premeeriti võimalusega õppida 2017. aastal üks semester vabalt valitud Hiina ülikoolis
Wŏ shuō hànyŭ, nĭne? ehk Mina räägin hiina keelt, aga sina? / Piret Lakson
Lakson, Piret, 1989-
2012-01-01
Hiina keele õpetamisest Eestis ja Mustamäe gümnaasiumi noorest hiina keele õpetajast Wang Weist. Eesti koolidesse hiina keele õpetajate hankimine käib Tallinna ülikooli juurde loodud Konfutsiuse instituudi kaudu
Gigantide kokkupõrge: Google lahkub Hiina tsensuuri alt / Heiki Suurkask
Suurkask, Heiki, 1972-
2010-01-01
Google teatas, et Pekingi tsensuurile alistatud veebilehe Google.cn kasutajad juhitakse automaatselt Hongkongi tsenseerimata saidile Google.com.hk. Hiina reageeringust. Teabest, mida hiinlased internetist leida ei tohi
Hiina kompartei pole NLKP-ga võrreldav / Henri Kaselo
Kaselo, Henri
2005-01-01
20.-26. novembril Hiinas Pekingis ja sadamalinnas Tianjinis peetud Euroopa ja Aasia noorte kohtumisest, kus Eestit esindasid Keskerakonna noortekogu esimees Henri Kaselo ja Euroopa Noorte Sotsiaaldemokraatide aseesimees ning Toomas Hendrik Ilvese nõunik Rander Läntsi
Zhang Ke
2006-01-01
Intervjuu Hiina arhitektuuribüroo Standardarchitecture arhitektide Zhang Ke ja Zhang Hongiga ning arhitektuuribüroo Urbanus arhitekti Xiaodu Liuga Hollandis Hiina tänapäeva tutvustaval näitusel. Hiina arhitektide haridusest, oma arhitektuuribüroode töödest, tänapäeva hiina arhitektuurist, põhiprobleemidest
Kired ja mõrvad Vana-Hiina moodi / Ave Randviir
Randviir, Ave, 1981-
2006-01-01
Arvustus: Gulik, Robert van. Hiina järvemõrvad : kohtunik Di lahendab kolm juhtumit : [romaan] / inglise keelest tõlkinud Kersti Unt ; illustreeritud kaheteistkümne hiinapärase graafilise lehega autorilt. [Tallinn] : Tänapäev, 2006. (Kohtunik Di mõrvamüsteerium)
Plaanitav tollimaks viiks Hiina jalatsite hinna üles / Kaire Uusen
Uusen, Kaire
2006-01-01
Vt. ka Postimees : na russkom jazõke 2. okt. lk. 8. Euroopa Liidu riigid peavad otsustama, kas Hiina ja Vietnami odavatele nahkjalatsitele tuleks kehtestada kõrged tollimaksud. Majandusministeeriumi teatel ei toeta Eesti tollimaksu kehtestamist
Aids ähvardab Venemaa, Hiina ja India tulevikku / Neeme Raud
Raud, Neeme, 1969-
2002-01-01
Ameerika analüütik Nicholas Eberstadt prognoosib, et Hiina, India ja Venemaa võivad järgmise veerandsaja jooksul seista silmitsi suurema arvu HIV-i nakatanute ja aidsi surnutega kui kogu maailm seni tervikuna
Hiina mõistatus : Wang-Ba ja palju muudki / Erkki Bahovski
Bahovski, Erkki, 1970-
2008-01-01
Artikli autor annab ülevaate Euroopa Välissuhete Nõukogu tegevdirektori Mark Leonardi raamatust "What Does China Think?". Raamatu autori väide on lihtne: selleks, et aru saada maailma poliitikast, tuleb aru saada Hiinas toimuvast
Indian Academy of Sciences (India)
Home; Journals; Bulletin of Materials Science. H CHEN. Articles written in Bulletin of Materials Science. Volume 41 Issue 2 April 2018 pp 51. Effect of oxygen vacancies on Li-storage of anatase TiO 2 (001) facets: a first principles study · H CHEN Y H DING X Q TANG W ZHANG J R YIN P ZHANG Y JIANG · More Details ...
Haila, Anne
2008-01-01
Vaadeldakse, millised muutused on toimunud Hiina maahaldussüsteemis ja maakasutuses. Tagasivaade maareformide ajaloole, ülevaade Hiina kaasaegsetest reformidest ning seda toetavatest rahvusvahelistest nõustajatest. Mõningatest probleemidest, mida institutsionaalne muutus ja uus turujaotus on kaasa toonud, ebaselgetest omandiõigustest. Bibliograafia lk. 83
Hiina naise lugu võitis Kuldkaru / Annika Koppel
Koppel, Annika
2007-01-01
57. Berliini filmifestivali peaauhind Kuldkaru - hiina režissööri Wang Quanani film "Tuya abielu" ("Tuya de hun shi"), parima režissööri Hõbekaru - iisraellane Joseph Cedar ("Beafort"), parim meesnäitleja - Julio Chavez (Ariel Rotteri "Teine"), parim naisnäitleja - Nina Hossa (Christian Petzoldi "Yella"), väljapaistev kunstiline saavutus - Robert De Niro lavastajatöö ("Hea karjane")
Miks ekspordib Hiina Venemaale läbi Tallinna? / interv. Mihkel Kärmas
2005-01-01
Hiina suured kaubalennukid veavad Venemaale kaupu läbi Tallinna lennujaama. Lühiintervjuu Tallinna tolliinspektuuri kontrolltalituse juhataja Peeter Kõve, lennujaama turundusdirektori Eduard Tüüri ja lennuameti asedirektori Rein Porroga
Hiina : olümpiakahjum ettevõtetele / Dexter Roberts, Chi-Chu Tshang
Roberts, Dexter
2008-01-01
Hiina valitsus on kehtestanud paljudele tööstusettevõtetele nii olümpiamängude kui paraolümpia toimumise ajaks suurt majanduslikku kahju tekitavad ranged tootmispiirangud, mis võivad mõjutada isegi välisriikide tarbijaid
2005-01-01
Soome ja Hiina mütoloogiat ühendava fantaasiafilmi "Armuvalus sõdalane" (eelarve 39 milj. krooni) tootjad on Soome, Holland, Hiina ja Eesti (3,9 milj. krooni). Kaasa teeb ka Elle Kull, lavastab debütant AJ Annila
Võidurelvastumise tagasitulek : USA kiiluvees Venemaa ja Hiina / Heiki Suurkask
Suurkask, Heiki, 1972-
2007-01-01
USA eelarvekavas on ette nähtud kaitsekulutuste jätkuv suurenemine, suureneda võib ka relvajõudude isikkoosseis. Relvajõududele kulub USA-s ligi 4% SKT-st. Globaalselt liidetuna tõusid kõikide riikide kulutused relvajõududele 1990. aasta tasemele. Hiina ja Venemaa kaitsekulutustest. Lisad: Aasia riigid kasvatavad sõjalisi kulutusi; 25 riigil pole oma sõjaväge. Graafik: USA sõjalised kulutused
Hiina pisarate org. Autoritaarne kapitalism tulekul? / Slavoj Zhizhek ; tõlk. Kajar Pruul
Zhizhek, Slavoj
2008-01-01
Hiina kapitalism kui kordus kapitalismi arengust Euroopas. Kapitalismi ja autoritaarse valitsusvõimu kombinatsioon on taganud Hiinale kiire arengu, mis võib muuta ta järgmiseks globaalseks üliriigiks ning seeläbi seada ohtu Lääne ülemvõimu
21. sajandi hiina laine ja minimalistlik interjöör / Leila Pärtelpoeg
Pärtelpoeg, Leila, 1927-
2006-01-01
Nüüdisaegne minimalism ja Hiina Ming dünastia aegadest pärinev materjalikäsitlus ühilduvad moodsas hiinalikus interjööris. Sisekujundus: Leila Pärtelpoeg. Stilist Madis Liplap. 6 ill, 5 värv.
Kuldlõvi võitis üllatusena Hiina film tammi ehitamisest / A. L.
A. L.
2006-01-01
Veneetsia filmifestivali parima filmi peaauhind Kuldlõvi läks Hiina režissööri Jia Zhang-Ke filmile "Vaikelu" ("Dong"). Parima näitleja Coppa Volpi said Helen Mirren ja Ben Affleck, elutööauhinna sai režissöör David Lynch
Horseshoes in modified Chen's attractors
International Nuclear Information System (INIS)
Huang Yan; Yang Xiaosong
2005-01-01
In this paper we study dynamics of a class of modified Chen's attractors, we show that these attractors are chaotic by giving a rigorous verification for existence of horseshoes in these systems. We prove that the Poincare maps derived from these modified Chen's attractors are semi-conjugate to the 2-shift map
India on edukas selles, milles Hiina ei ole. Ja vastupidi / Ülle Pihlak
Pihlak, Ülle
2010-01-01
India majanduskasvu põhjustest ja tööstusharudest, kus areng on olnud kiirem: autotööstus, ravimitööstus, tarkvaraarendus. Lühidalt ka India riiklikust innovatsiooni toetamise süsteemist ning uudsetest haridus- ja majandusprogrammidest vaesuse vähendamiseks. Hiina ja India ärikeskkonna võrdlus
Naiste nappus kasvatab India ja Hiina ühiskondades vägivaldset käitumist / Arko Olesk
Olesk, Arko, 1981-
2006-01-01
Poisslapsi eelistav traditsioon on viinud meeste suure ülekaaluni Hiina ja India rahvastikus ning toidab kuritegevuse ja terrorismi kasvu. Ühe lapse poliitika. Lisa: Kas teate. Naiste osakaal rahvastikus
USA surus Brüsseli taanduma Hiina relvamüügi küsimuses / Neeme Raud
Raud, Neeme, 1969-
2005-01-01
Saksa välisministri Joschka Fischeri sõnul ei suutnud Euroopa Liidu välisministrid mitteametlikul kohtumisel Luksemburgis saavutada konsensust Hiina-vastase relvaembargo tühistamises. Lisa: Keeld Hiinale relvastust müüa
Titanisierung von Implantatoberflächen
Zimmermann, Hanngörg; Heinlein, Markus; Guldner, Norbert W.
Titan gilt seit Jahrzehnten als einer der wichtigsten Implantatwerkstoffe in der Medizin. Neben den guten mechanischen Eigenschaften (Leichtigkeit, hohe Festigkeit etc.), besitzen Titanimplantate vor allem eine hervorragende Körperverträglichkeit, so dass die Implantate optimal in den humanen Organismus integriert werden [1]. Ist jedoch aufgrund der Anforderungen an das Implantat eine hohe Flexibilität und/ oder Elastizität gefragt, so scheidet der Werkstoff Titan aufgrund seiner spröden und unflexiblen Materialeigenschaften aus. Die Folge ist der Einsatz von Implantatmaterialien, sowohl künstlichen als auch biologischen Ursprungs, welche nicht selten eine unzureichende Biokompatibilität aufweisen und somit zu Fremdköper- und immunologischen Reaktionen und Einkapselung des Implantates führen können. Die Erhöhung der Körperverträglichkeit, eine Adaption an das biologische Umfeld und eine hohe Biokompatibilität sind demzufolge die wichtigsten Eigenschaften bei der bedarfsgerechten Herstellung von Implantaten und Implantatoberflächen. Zur Gestaltung von innovativen, biokompatiblen Oberflächen stehen unterschiedliche technische Lösungsansätze zur Verfügung. Zum einen besteht die Möglichkeit, geeignete Oberflächeneigenschaften aus dem Grundmaterial selbst zu optimieren. Dies geschieht unter anderem durch Modifikation der Werkstoffoberflächen in Form von Texturierungen und Oberflächenrauhigkeiten. Zum anderen können die Oberflächeneigenschaften unabhängig von denen des Trägermaterials gestaltet werden. Durch Funktionalisierung der Oberflächen mit geeigneten Beschichtungen oder der Zugabe von Medikamenten (Drug Eluting) werden die Kunststoffimplantate dahingehend verändert, dass eine Steigerung der Körperakzeptanz erreicht wird. Die Titanbeschichtung von Implantatoberflächen kombiniert die positiven Materialeigenschaften von Titan und Polymer.
DEFF Research Database (Denmark)
Gimpel, Denise
been the first to write children’s literature. In 1914 she was among the first group of women to gain a Boxer Indemnity grant to study in America. The reiteration of these many “firsts” has led to a rather stereotypical portrait of Chen Hengzhe in Chinese sources and, as a result, in most Western...
Moskva kunstibiennaal reaktsiooni teenistuses? / Johannes Saar
Saar, Johannes, 1965-
2007-01-01
Moskva II rahvusvahelisest nüüdiskunsti biennaalist. Näitustest "Sotsart. Poliitiline kunst Venemaal" (kuraator Andrei Jerofejev), "Sotsart. Poliitiline kunst Hiinas" (kuraator Xin Don Chen), "Mõtlev realism" (kuraator Jekaterina Djegot) ja "Mina usun" (kuraator Oleg Kulik)
International Nuclear Information System (INIS)
Hughes, B.D.; Frankel, N.E.; Ninham, B.W.
1990-01-01
An alternative view is presented of the Chen's generalization of a formula of classic algebraic number theory, based on the Mellin transformation and Reimann's zeta function. The advantages of the Mellin transform, as a method with a primary role in asymptotic analysis, are outlined. 10 refs
Stability analysis of distributed order fractional chen system.
Aminikhah, H; Refahi Sheikhani, A; Rezazadeh, H
2013-01-01
We first investigate sufficient and necessary conditions of stability of nonlinear distributed order fractional system and then we generalize the integer-order Chen system into the distributed order fractional domain. Based on the asymptotic stability theory of nonlinear distributed order fractional systems, the stability of distributed order fractional Chen system is discussed. In addition, we have found that chaos exists in the double fractional order Chen system. Numerical solutions are used to verify the analytical results.
Stability Analysis of Distributed Order Fractional Chen System
Aminikhah, H.; Refahi Sheikhani, A.; Rezazadeh, H.
2013-01-01
We first investigate sufficient and necessary conditions of stability of nonlinear distributed order fractional system and then we generalize the integer-order Chen system into the distributed order fractional domain. Based on the asymptotic stability theory of nonlinear distributed order fractional systems, the stability of distributed order fractional Chen system is discussed. In addition, we have found that chaos exists in the double fractional order Chen system. Numerical solutions are used to verify the analytical results. PMID:24489508
Complete synchronization of two Chen-Lee systems
International Nuclear Information System (INIS)
Sheu, L-J; Chen, J-H; Chen, H-K; Tam, L-M; Lao, S-K; Chen, W-C; Lin, K-T
2008-01-01
This study demonstrates that complete synchronization of two Chen-Lee chaotic systems can be easily achieved. The upper bound of the Chen-Lee chaotic system is estimated numerically. A controller is designed to synchronize two chaotic systems. Sufficient conditions for synchronization are obtained using Lyapunov's direct method. Two numerical examples are presented to verify the proposed synchronization approach
Eine praktische Anwendung von CMC-Flächen in der Bionik
Apeltauer, Christian
2011-01-01
Die vorliegende Arbeit beschäftigt sich mit den theoretischen Grundlagen für die Entwicklung von Oberflächen, die unter Wasser möglichst lange eine Luftschicht an sich halten können. Ein natürliches Vorbild für solche Oberflächen ist die Pflanze Salvinia molesta; technisch interessieren solche Oberflächen zur Verringerung des Wasserwiderstandes von Schiffen und als Schutz vor Besiedlung durch Wasserorganismen. Wichtigste Gleichung bei der Entwicklung solcher Oberflächen ist...
Mechanical analysis of Chen chaotic system
International Nuclear Information System (INIS)
Liang, Xiyin; Qi, Guoyuan
2017-01-01
The Chen chaotic system is transformed into Kolmogorov type system, which is decomposed into four types of torques: inertial torque, internal torque, dissipation and external torque. By the combinations of different torques, five cases are studied to discover key factors of chaos generation and the physical meaning. The conversion among Hamiltonian energy, kinetic energy and potential energy is investigated in these five cases. The relationship between the energies and the parameters is studied. It concludes that the combination of these four types of torques is necessary conditions to produce chaos, and any combination of three types of torques cannot produce chaos in Chen system.
On a conjecture of Chen-Guo-Wang
Ning, Bo; Zheng, Yu
2015-01-01
Towards confirming Sun's conjecture on the strict log-concavity of combinatorial sequence involving the n$th$ Bernoulli number, Chen, Guo and Wang proposed a conjecture about the log-concavity of the function $\\theta(x)=\\sqrt[x]{2\\zeta(x)\\Gamma(x+1)}$ for $x\\in (6,\\infty)$, where $\\zeta(x)$ is the Riemann zeta function and $\\Gamma(x)$ is the Gamma function. In this paper, we first prove this conjecture along the spirit of Zhu's previous work. Second, we extend Chen et al.'s conjecture in the ...
DEFF Research Database (Denmark)
Gimpel, Denise
Chen Hengzhe has been celebrated as China’s first female professor, first professor of Western history, first person to publish a history of the West that was not a translation into Chinese. She is moreover celebrated as one of the first to write fiction and poetry in the vernacular and to have......; they speak to important questions in China today. This study, then, is not a biography of a person; it is an attempt to understand the way in which foreign influences (narratives of being, organizing, thinking, writing) seep into a person’s life and work and meld with the “home” influences (narratives...
Adaptive synchronization of hyperchaotic Chen system with uncertain parameters
International Nuclear Information System (INIS)
Park, Ju H.
2005-01-01
This article addresses control for the chaos synchronization of hyperchaotic Chen system with five uncertain parameters. Based on the Lyapunov stability theory, an adaptive control law is derived to make the states of two identical hyperchaotic Chen systems asymptotically synchronized. Finally, a numerical simulations is presented to show the effectiveness of the proposed chaos synchronization scheme
Berlinale tõstab kilbile "Teekonna Guatanamosse" / Grete Nootre
Nootre, Grete
2006-01-01
56. Berliini filmifestivali programmidest ja filmidest - Suurbritannia poliitiline mängufilm "Teekond Guatanamosse" ("The Road to Guatanamo") : režissöörid Michael Winterbottom, Mat Whitecross, Hiina mängufilm "Lubadus" ("Wu ji") : režissöör Chen Kaige, Suurbritannia - Saksamaa "V nagu vendette" ("V for Vendette") : režissöör James McTeigue
Chaos in the fractional order Chen system and its control
International Nuclear Information System (INIS)
Li Chunguang; Chen Guanrong
2004-01-01
In this letter, we study the chaotic behaviors in the fractional order Chen system. We found that chaos exists in the fractional order Chen system with order less than 3. The lowest order we found to have chaos in this system is 2.1. Linear feedback control of chaos in this system is also studied
A simple observer of the generalized Chen chaotic systems
International Nuclear Information System (INIS)
Sun, Y.-J.
2009-01-01
In this paper, the generalized Chen chaotic system is considered and the state observation problem of such a system is investigated. Based on the time-domain approach, a simple observer for the generalized Chen chaotic system is proposed to guarantee the global exponential stability of the resulting error system. Furthermore, the guaranteed exponential convergence rate can be correctly estimated. Finally, a numerical example is provided to illustrate the use of the main result.
The age grading and the Chen-Ruan cup product
DEFF Research Database (Denmark)
A. Hepworth, Richard
2010-01-01
We prove that the obstruction bundle used to define the cup-product in Chen-Ruan cohomology is determined by the so-called `age grading' or `degree-shifting numbers'. Indeed, the obstruction bundle can be directly computed using the age grading. We obtain a Kunneth Theorem for Chen-Ruan cohomology...... as a direct consequence of an elementary property of the age grading, and explain how several other results - including associativity of the cup-product - can be proved in a similar way....
Immunogenicity of novel sulfadimethoxide conjugates | Chen ...
African Journals Online (AJOL)
Immunogenicity of novel sulfadimethoxide conjugates. L Chen, J Su, X Zhang, L Li, X He. Abstract. Sulfadimethoxine (SDM) is an antibiotic commonly added to animal feeds. Anti-SDM antibodies are useful for the detection of residual SDM in foods, feeds and biological fluids by ELISA. In this study, we show that SDM is ...
Alternative implementation of the chaotic Chen-Lee system
International Nuclear Information System (INIS)
Sheu, L.-J.; Tam, L.-M.; Chen, H.-K.; Lao, S.-K.
2009-01-01
The chaotic Chen-Lee system was developed with a formalism based on the Euler equations for the motion of a rigid body. It was proved that this system is the governing set of equations for gyro motion with feedback control. Recently, studies were conducted to explore the dynamic behavior of this system, including fractional order behavior, the generation of hyperchaos and perturbation analysis, control and anti-control of chaos, synchronization, etc. In this study, we further explore (1) the stability of the equilibrium points and (2) the implementation of an electronic circuit using the Chen-Lee system. It is shown that not only is this system related to gyro motion but can also be applied to electronic circuits for encryption purposes.
2002-01-01
San Sebastiani 50. rahvusvaheliselt filmifestivalilt, kus parima filmi Kuldse Merikarbi sai hispaania režissööri Fernando Leon de Aranoa "Esmaspäevad päikese all" ("Los lunes al sol") ja venelase Valeri Todorovski "Armuke" ("Ljubovnik") sai parima stsenaariumi auhinna (Gennadi Ostrovski) ning parima operaatori auhinna (Sergei Mihhaltshuk). Hiina režissöör Chen Kaige sai režiipreemia filmi "Üheskoos" eest
Hopf bifurcation analysis of Chen circuit with direct time delay feedback
International Nuclear Information System (INIS)
Hai-Peng, Ren; Wen-Chao, Li; Ding, Liu
2010-01-01
Direct time delay feedback can make non-chaotic Chen circuit chaotic. The chaotic Chen circuit with direct time delay feedback possesses rich and complex dynamical behaviours. To reach a deep and clear understanding of the dynamics of such circuits described by delay differential equations, Hopf bifurcation in the circuit is analysed using the Hopf bifurcation theory and the central manifold theorem in this paper. Bifurcation points and bifurcation directions are derived in detail, which prove to be consistent with the previous bifurcation diagram. Numerical simulations and experimental results are given to verify the theoretical analysis. Hopf bifurcation analysis can explain and predict the periodical orbit (oscillation) in Chen circuit with direct time delay feedback. Bifurcation boundaries are derived using the Hopf bifurcation analysis, which will be helpful for determining the parameters in the stabilisation of the originally chaotic circuit
Synchronization and anti-synchronization coexist in Chen-Lee chaotic systems
International Nuclear Information System (INIS)
Chen, J.-H.; Chen, H.-K.; Lin, Y.-K.
2009-01-01
This study demonstrates that synchronization and anti-synchronization can coexist in Chen-Lee chaotic systems by direct linear coupling. Based on Lyapunov's direct method, a linear controller was designed to assure that two different types of synchronization can simultaneously be achieved. Further, the hybrid projective synchronization of Chen-Lee chaotic systems was studied using a nonlinear control scheme. The nonlinear controller was designed according to the Lyapunov stability theory to guarantee the hybrid projective synchronization, including synchronization, anti-synchronization, and projective synchronization. Finally, numerical examples are presented in order to illustrate the proposed synchronization approach.
Parametric study of the fractional-order Chen-Lee system
International Nuclear Information System (INIS)
Tam, L.M.; Tou, W.M.S.
2008-01-01
The dynamics of fractional-order systems have attracted a great deal of attention in recent years. In this paper, the effects of parameter changes on the dynamics of the fractional-order Chen-Lee system were studied numerically. The parameter ranges used were relatively broad. The order used for the system was fixed at 2.7 (q 1 = q 2 = q 3 = 0.9). The system displays rich dynamic behaviors, such as a fixed point, periodic motion (including period-3 motion), chaotic motion, and transient chaos. The chaotic motion identified was validated by the confirmation of a positive Lyapunov exponent. Period-doubling routes to chaos in the fractional-order Chen-Lee system were also found
Parametric study of the fractional-order Chen-Lee system
Energy Technology Data Exchange (ETDEWEB)
Tam, L.M. [Department of Electromechanical Engineering, Faculty of Science and Technology, University of Macau, Av. Padre Tomas Pereira S.J., Taipa, Macau (China)], E-mail: fstlmt@umac.mo; Tou, W.M.S. [Department of Electromechanical Engineering, Faculty of Science and Technology, University of Macau, Av. Padre Tomas Pereira S.J., Taipa, Macau (China)
2008-08-15
The dynamics of fractional-order systems have attracted a great deal of attention in recent years. In this paper, the effects of parameter changes on the dynamics of the fractional-order Chen-Lee system were studied numerically. The parameter ranges used were relatively broad. The order used for the system was fixed at 2.7 (q{sub 1} = q{sub 2} = q{sub 3} = 0.9). The system displays rich dynamic behaviors, such as a fixed point, periodic motion (including period-3 motion), chaotic motion, and transient chaos. The chaotic motion identified was validated by the confirmation of a positive Lyapunov exponent. Period-doubling routes to chaos in the fractional-order Chen-Lee system were also found.
Dynamics of fractional-ordered Chen system with delay
Indian Academy of Sciences (India)
Though this subject has a history of more than 300 years, utility and applicability of fractional calculus to various branches of science and engineering have been real- ... variants of Chen system and see the qualitative changes in attractor and ...
Comparing numerical methods for the solutions of the Chen system
International Nuclear Information System (INIS)
Noorani, M.S.M.; Hashim, I.; Ahmad, R.; Bakar, S.A.; Ismail, E.S.; Zakaria, A.M.
2007-01-01
In this paper, the Adomian decomposition method (ADM) is applied to the Chen system which is a three-dimensional system of ODEs with quadratic nonlinearities. The ADM yields an analytical solution in terms of a rapidly convergent infinite power series with easily computable terms. Comparisons between the decomposition solutions and the classical fourth-order Runge-Kutta (RK4) numerical solutions are made. In particular we look at the accuracy of the ADM as the Chen system changes from a non-chaotic system to a chaotic one. To highlight some computational difficulties due to a high Lyapunov exponent, a comparison with the Lorenz system is given
Impulsive synchronization of Chen's hyperchaotic system
International Nuclear Information System (INIS)
Haeri, Mohammad; Dehghani, Mahsa
2006-01-01
In this Letter the impulsive synchronization of the Chen's hyperchaotic systems is discussed. Some new and sufficient conditions on varying impulsive distance are established in order to guarantee the synchronizabillity of the systems using the synchronization method. In particular, some simple conditions are derived in synchronizing the systems by equal impulsive distances. Two illustrative examples are provided to show the feasibility and the effectiveness of the proposed method. The boundaries of the stable regions are also estimated
Ningrum, R. W.; Surarso, B.; Farikhin; Safarudin, Y. M.
2018-03-01
This paper proposes the combination of Firefly Algorithm (FA) and Chen Fuzzy Time Series Forecasting. Most of the existing fuzzy forecasting methods based on fuzzy time series use the static length of intervals. Therefore, we apply an artificial intelligence, i.e., Firefly Algorithm (FA) to set non-stationary length of intervals for each cluster on Chen Method. The method is evaluated by applying on the Jakarta Composite Index (IHSG) and compare with classical Chen Fuzzy Time Series Forecasting. Its performance verified through simulation using Matlab.
Sociology in Times of Crisis: Chen Da, National Salvation and the Indigenization of Knowledge
Directory of Open Access Journals (Sweden)
Ana Maria Candela
2015-08-01
Full Text Available Chen Da was one of the foremost sociologists of China from the 1920s to the 1940s. His intellectual habitus took shape from the long crisis that defined Chinese intellectual life from the mid-19th to mid-20th centuries, a period of continuous imperial assault on Chinese sovereignty. As China integrated into the capitalist world-system, neo-Confucian structures of knowledge came into question. Intellectuals took up sociology to guide China’s transition from an empire to a nation-state. Through his studies on labor, migration, and population, Chen Da contributed to the institutionalization of sociology in China. Chen sought to craft a theory of Chinese development that followed universal trajectories of progress but was also attuned to the complexity of Chinese society on the ground. Through his efforts to indigenize sociology, Chen developed a non-Marxist historical materialism, a deterritorialized and pluralistic conceptualization of China as a nation, and a theory of eugenic transformation centered on the concept of “mode of living.” The questions which Chen Da confronted are emblematic of the predicament faced by Chinese social scientists today, who again struggle with the dynamics of a deterritorialzied “Greater China,” rising social fragmentation, and refigured eugenic discourses and policies that aim to craft the Chinese people into ideal national subjects fit for post-socialist development.
A numeric-analytic method for approximating the chaotic Chen system
International Nuclear Information System (INIS)
Mossa Al-sawalha, M.; Noorani, M.S.M.
2009-01-01
The epitome of this paper centers on the application of the differential transformation method (DTM) the renowned Chen system which is described as a three-dimensional system of ODEs with quadratic nonlinearities. Numerical comparisons are made between the DTM and the classical fourth-order Runge-Kutta method (RK4). Our work showcases the precision of the DTM as the Chen system transforms from a non-chaotic system to a chaotic one. Since the Lyapunov exponent for this system is much higher compared to other chaotic systems, we shall highlight the difficulties of the simulations with respect to its accuracy. We wrap up our investigations to reveal that this direct symbolic-numeric scheme is effective and accurate.
Chang, Zhi-Min; Yang, Lin; Zhang, Zheng-Guang; Chen, Xiang-Sheng
2015-12-11
Two new species of the issid genus Neotetricodes Zhang et Chen (Hemiptera: Fulgoromorpha: Issidae): Neotetricodes longispinus Chang et Chen sp. nov. (China: Yunnan) and Neotetricodes xiphoideus Chang et Chen sp. nov. (China: Yunnan) are described and illustrated. The generic characteristic is redefined. A checklist and key to the species of the genus are provided. The female genitalia of the genus are firstly described.
How Memory Is Tested Influences What Is Measured: Reply to Wyble and Chen (2017)
Swallow, Khena M.; Jiang, Yuhong V.; Tan, Deborah H.
2017-01-01
In this response to Wyble and Chen's (2017) commentary on attribute amnesia, we hope to achieve several goals. First, we clarify how our view diverges from that described by Wyble and Chen. We argue that because the surprise memory test is disruptive, it is an insensitive tool for measuring the persistence of recently attended target attributes in…
Methodische Anregungen zu Literarischen Gesprächen in der Sekundarstufe
Spinner, Kaspar H.
2014-01-01
Methodische Anregungen zu Literarischen Gesprächen in der Sekundarstufe. - In: Standardorientierung im Lese- und Literaturunterricht der Sekundarstufe I / Cornelia Rosebrock ; Heike Wirthwein. - Baltmannsweiler : Schneider-Verl. Hohengehren, 2014. - S. 126-132
Ronald Malt or Chen Zhongwei: Who performed the first surgical replantation?
Fan, Ka-Wai
2018-01-01
This article discusses the contributions of the two pioneers of the surgical procedure of replantation-Ronald Malt in the US and Chen Zhongwei in China. Ronald Malt performed the reattachment surgery on a boy who had an accident in 1962, but he published his case report two years later in 1964. Chen Zhongwei performed a similar surgery on a worker who cut off his forearm in 1963, but he published his case report the same year. There is some debate about which one of these reputed surgeons should be given credit for being the first one to perform this breakthrough surgery, because although Malt was the first to perform the procedure, Zhongwei was the first to report it. To shed light on this controversy, criteria for scientific priority suggested by Ronald Vale and Anthony Hyman were applied. Although the criteria mainly favored Zhongwei as the pioneer of this procedure, he did not entirely fulfill one of the criteria. Therefore, the article could not present a definitive answer to the question, and it concludes by pointing out the highly commendable achievements and contributions of both Ronald Malt and Chen Zhongwei.
Chaos control of Chen chaotic dynamical system
International Nuclear Information System (INIS)
Yassen, M.T.
2003-01-01
This paper is devoted to study the problem of controlling chaos in Chen chaotic dynamical system. Two different methods of control, feedback and nonfeedback methods are used to suppress chaos to unstable equilibria or unstable periodic orbits (UPO). The Lyapunov direct method and Routh-Hurwitz criteria are used to study the conditions of the asymptotic stability of the steady states of the controlled system. Numerical simulations are presented to show these results
TEST OF THE CHEN-ROLL-ROSS MACROECONOMIC FACTOR MODEL: EVIDENCE FROM CROATIAN STOCK MARKET
Directory of Open Access Journals (Sweden)
Denis Dolinar
2015-12-01
Full Text Available This paper empirically examines the well-known Chen-Roll-Ross model on the Croatian stock market. Modifications of definitions of the Chen-Roll-Ross model variables showed as necessary because of doubtful availability and quality of input data needed. Namely, some macroeconomic and market variables are not available in the originally defined form or do not exist. In that sense this paper gives some alternative definitions for some model variables. Also, in order to improve statistical analysis, in this paper we have modified Fama-MacBeth technique in the way that second-pass regression was substituted with panel regression analysis. Based on the two-pass regression analysis of returns of 34 Croatian stocks on 4 macroeconomic variables during the seven-and-half-year observation period the following conclusion is made. In contrast to the results of Chen, Roll and Ross (1986 for the U.S. stock market, their model is not successful when describing a risk-return relation of Croatian stocks. Nevertheless, one observed version of the Chen-RollRoss model showed certain statistical significance. Namely, two risk factors in that version of the model were statistically significant: default premium, measured as risk premium for the corporate short-term bank loan financing, and term structure premium, measured on short-run basis.
Chaos synchronization between Chen system and Genesio system
International Nuclear Information System (INIS)
Wu Xianyong; Guan Zhihong; Wu Zhengping; Li Tao
2007-01-01
This Letter presents two synchronization schemes between two different chaotic systems. Active control synchronization and adaptive synchronization between Chen system and Genesio system are studied, different controllers are designed to synchronize the drive and response systems, active control synchronization is used when system parameters are known; adaptive synchronization is employed when system parameters are unknown or uncertain. Simulation results show the effectiveness of the proposed schemes
Tensioned Fabric Structures with Surface in the Form of Chen-Gackstatter
Directory of Open Access Journals (Sweden)
Yee Hooi Min
2016-01-01
Full Text Available Form-finding has to be carried out for tensioned fabric structure in order to determine the initial equilibrium shape under prescribed support condition and prestress pattern. Tensioned fabric structures are normally designed to be in the form of equal tensioned surface. Tensioned fabric structure is highly suited to be used for realizing surfaces of complex or new forms. However, research study on a new form as a tensioned fabric structure has not attracted much attention. Another source of inspiration minimal surface which could be adopted as form for tensioned fabric structure is very crucial. The aim of this study is to propose initial equilibrium shape of tensioned fabric structures in the form of Chen-Gackstatter. Computational form-finding using nonlinear analysis method is used to determine the Chen-Gackstatter form of uniformly stressed surfaces. A tensioned fabric structure must curve equally in opposite directions to give the resulting surface a three dimensional stability. In an anticlastic doubly curved surface, the sum of all positive and all negative curvatures is zero. This study provides an alternative choice for structural designer to consider the Chen-Gackstatter applied in tensioned fabric structures. The results on factors affecting initial equilibrium shape can serve as a reference for proper selection of surface parameter for achieving a structurally viable surface.
Lei, Ting; Belykh, Evgenii; Dru, Alexander B; Yagmurlu, Kaan; Elhadi, Ali M; Nakaji, Peter; Preul, Mark C
2016-07-01
Chen Jingrun (1933-1996), perhaps the most prodigious mathematician of his time, focused on the field of analytical number theory. His work on Waring's problem, Legendre's conjecture, and Goldbach's conjecture led to progress in analytical number theory in the form of "Chen's Theorem," which he published in 1966 and 1973. His early life was ravaged by the Second Sino-Japanese War and the Chinese Cultural Revolution. On the verge of solving Goldbach's conjecture in 1984, Chen was struck by a bicyclist while also bicycling and suffered severe brain trauma. During his hospitalization, he was also found to have Parkinson's disease. Chen suffered another serious brain concussion after a fall only a few months after recovering from the bicycle crash. With significant deficits, he remained hospitalized for several years without making progress while receiving modern Western medical therapies. In 1988 traditional Chinese medicine experts were called in to assist with his treatment. After a year of acupuncture and oxygen therapy, Chen could control his basic bowel and bladder functions, he could walk slowly, and his swallowing and speech improved. When Chen was unable to produce complex work or finish his final work on Goldbach's conjecture, his mathematical pursuits were taken up vigorously by his dedicated students. He was able to publish Youth Math, a mathematics book that became an inspiration in Chinese education. Although he died in 1996 at the age of 63 after surviving brutal political repression, being deprived of neurological function at the very peak of his genius, and having to be supported by his wife, Chen ironically became a symbol of dedication, perseverance, and motivation to his students and associates, to Chinese youth, to a nation, and to mathematicians and scientists worldwide.
An equilibrium point stabilization strategy for the Chen system
International Nuclear Information System (INIS)
Alvarez-Ramirez, Jose; Cevantes, Ilse; Femat, Ricardo
2004-01-01
The aim of this Letter is to address the equilibrium point stabilization problem of the Chen system by employing a simple linear feedback controller derived from time-scaling the dynamics of a single variable. The controller has the advantage of being easy to implement and a rigorous stability proof is provided based on singular perturbation arguments. Results are illustrated via numerical simulations
Generalized projective synchronization between Lorenz system and Chen's system
International Nuclear Information System (INIS)
Li Guohui
2007-01-01
On the basis of active backstepping design, this paper presents the generalized projective synchronization between two different chaotic systems: Lorenz system and Chen's system. The proposed method combines backstepping methods and active control without having to calculate the Lyapunov exponents and the eigenvalues of the Jacobian matrix, which makes it simple and convenient. Numerical simulations show that this method works very well
From Wang-Chen System with Only One Stable Equilibrium to a New Chaotic System Without Equilibrium
Pham, Viet-Thanh; Wang, Xiong; Jafari, Sajad; Volos, Christos; Kapitaniak, Tomasz
2017-06-01
Wang-Chen system with only one stable equilibrium as well as the coexistence of hidden attractors has attracted increasing interest due to its striking features. In this work, the effect of state feedback on Wang-Chen system is investigated by introducing a further state variable. It is worth noting that a new chaotic system without equilibrium is obtained. We believe that the system is an interesting example to illustrate the conversion of hidden attractors with one stable equilibrium to hidden attractors without equilibrium.
[Professor CHEN Xiuhua's experience in the treatment of atopic dermatitis].
Quan, Xiaohong; Li, Shuqian; Li, Ying
2017-03-12
Professor CHEN Xiuhua 's clinical experiences were introduced in the intervention on atopic dermatitis with external therapies of TCM acupuncture. On the basis of the theory as cultivating the earth and clearing the heart from professor CHEN Dacan and in terms of the disease stages and skin lesion characteristics, as well as in consideration of syndrome differen-tiation, the acupoints for strengthening the spleen and clearing heart fire are selected, such as Zhongwan (CV 12), Daheng (SP 15), Shuifen (CV 9), Tianshu (ST 25), Neiguan (PC 6) and Quchi (LI 11). For the repair of skin lesion, the integration of Chinese and western medicine is used, with the internal application and external use of Chinese herbal medicines involved. The topical ointments are selected rationally. The self-blood therapy is used with acupuncture, bleeding therapy and acupoint injection applied in combination on the basis of the theory of TCM zangfu organs and modern immunological mechanism, which stimulates the nonspecific immune response in the body and strengthens acupoint stimulus effects. Medical thread therapy of Guangxi Zhuang medicine is used in moxibustion for skin damage, which effectively stops itching and promotes wound healing and skin repair.
Self-Representation and Cultural Expectations: Yogi Chen and Religious Practices of Life-Writing
Directory of Open Access Journals (Sweden)
Richard K. Payne
2016-03-01
Full Text Available Explores the differences in self-representation as found in the autobiographical writings of Yogi Chen, Billy Graham, and the Dalai Lama. While the latter two are widely recognized in American popular religious culture, the former is virtually invisible outside the immigrant Chinese American community. This invisibility is consistent with fact that the religious praxes of immigrant communities remain largely under-studied. However, one additional factor appears to be the mismatch between the expectations of the dominant religious culture and the immigrant culture in terms of the ways in which religious leaders represent themselves. Both Billy Graham and the Dalai Lama present themselves in very humble terms, consistent with the expectations of the Pietist background to American popular religion. Yogi Chen on the contrary tends toward a self-aggrandizing style, which although consistent with the competitive nature of premodern Tibetan religious culture is not congruent with the expectations of American popular religion.
Theoretical and experimental study of Chen chaotic system with notch filter feedback control
International Nuclear Information System (INIS)
Ming, Zhang Xiao; Jian-Hua, Peng; Ju-Fang, Chen
2010-01-01
Since the past two decades, the time delay feedback control method has attracted more and more attention in chaos control studies because of its simplicity and efficiency compared with other chaos control schemes. Recently, it has been proposed to suppress low-dimensional chaos with the notch filter feedback control method, which can be implemented in a laser system. In this work, we have analytically determined the controllable conditions for notch filter feedback controlling of Chen chaotic system in terms of the Hopf bifurcation theory. The conditions for notch filter feedback controlled Chen chaoitc system having a stable limit cycle solution are given. Meanwhile, we also analysed the Hopf bifurcation direction, which is very important for parameter settings in notch filter feedback control applications. Finally, we apply the notch filter feedback control methods to the electronic circuit experiments and numerical simulations based on the theoretical analysis. The controlling results of notch filter feedback control method well prove the feasibility and reliability of the theoretical analysis. (general)
Maximilien Brice
2002-01-01
L. to r.: Dr Diether Blechschmidt, Adviser for Non Member States Relations, Dr Peter Jenni, Spokesman, ATLAS Experiment, Prof. Chen, Mr Jean-Luc Baldy, Head of the LHC Civil Engineering Group and Dr John Ellis, Adviser for Non Member States Relations.
Software-Lösungen in B2B-Verkaufsgesprächen wirkungsvoll einsetzen
Thoma, Axel Michael
2017-01-01
Dieser Beitrag befasst sich mit dem Einsatz von Software-Lösungen in B2B-Verkaufsgesprächen (auf Englisch: Digital Sales Enablement). Anhand aktueller Beispiele aus der Geschäftswelt wird erklärt, wie solche Lösungen helfen (1) die Produktivität zu steigern, (2) Kunden zu aktivieren und (3) Neugeschäft zu entwickeln. Ebenfalls werden die Konzeption und Umsetzung solcher Lösungen behandelt.
Jonsson, J.E.; Afton, A.D.
2009-01-01
Body size affects foraging and forage intake rates directly via energetic processes and indirectly through interactions with social status and social behaviour. Ambient temperature has a relatively greater effect on the energetics of smaller species, which also generally are more vulnerable to predator attacks than are larger species. We examined variability in an index of intake rates and an index of alertness in Lesser Snow Geese Chen caerulescens caerulescens and Ross's Geese Chen rossii wintering in southwest Louisiana. Specifically we examined variation in these response variables that could be attributed to species, age, family size and ambient temperature. We hypothesized that the smaller Ross's Geese would spend relatively more time feeding, exhibit relatively higher peck rates, spend more time alert or raise their heads up from feeding more frequently, and would respond to declining temperatures by increasing their proportion of time spent feeding. As predicted, we found that Ross's Geese spent more time feeding than did Snow Geese and had slightly higher peck rates than Snow Geese in one of two winters. Ross's Geese spent more time alert than did Snow Geese in one winter, but alert rates differed by family size, independent of species, in contrast to our prediction. In one winter, time spent foraging and walking was inversely related to average daily temperature, but both varied independently of species. Effects of age and family size on time budgets were generally independent of species and in accordance with previous studies. We conclude that body size is a key variable influencing time spent feeding in Ross's Geese, which may require a high time spent feeding at the expense of other activities. ?? 2008 The Authors.
Huang, Weiping; Li, Naiqi
2015-03-01
Through the collection of Practice of acupuncture and moxibustion written by CHEN Jingwen, the acupuncture master in the Republic of China, the academic characteristics on acupuncture and moxibusiton were analyzed. The literature comparison method was adopted to compare the works of LUO Zhaoju, ZENG Tianzhi and LI Wenxian, etc. at the same period. It was discovered that CHEN Jingwen was the medical master who systematicly brought up the theory of acupoint properties earlier in the modern times. Classifying drugs based on acupoints was his academic feature. Additionally, the compatibility therapy of Chinese medicine was introduced to explain the essential ideas on the acupoints combination. The treatment was determined on the basis of zangxiang theory and the reinforcing and reducing therapy of acupuncture was emphasized in the determination of treatment and prescription. CHEN Jingwen's theory of acupoint property had been stressed and spread among the medical scholars in the Republic of China and he had made the beneficial exploration for the development of modern acupuncture and moxibustion therapy.
Razgovor za tshashkoi kitaiskogo tshaja / Mingo Liu ; interv. Vitali Andrejev
Liu, Mingo
2005-01-01
Hiina kaubandusesinduse nõunik Eestis vastab küsimustele, mis puudutavad Eesti ja Hiina kaubanduskontakte, Hiina ettevõtja huvi Eesti turu vastu ja Eesti ettevõtja huvi Hiina vastu, võimalikke tõkkeid Eesti-Hiina kaubandussuhetes
Self-Representation and Cultural Expectations: Yogi Chen and Religious Practices of Life-Writing
Richard K. Payne
2016-01-01
Explores the differences in self-representation as found in the autobiographical writings of Yogi Chen, Billy Graham, and the Dalai Lama. While the latter two are widely recognized in American popular religious culture, the former is virtually invisible outside the immigrant Chinese American community. This invisibility is consistent with fact that the religious praxes of immigrant communities remain largely under-studied. However, one additional factor appears to be the mismatch between ...
Le jeu de la création : Le mangeur (2005 de Ying Chen
Directory of Open Access Journals (Sweden)
Nicole Dunham
2013-11-01
Full Text Available Le théoricien James Hans définit le jeu comme une déconstruction structurante, un processus de perpétuelle remise en question. Dans Le Mangeur (2005 de Ying Chen, la narratrice revit un épisode d’une de ses vies passées où elle meurt mangée, avalée, par son père, descendant dans le « tunnel » du ventre de ce dernier. Cependant, suite à cet événement, elle se retrouve dans un autre espace-temps où elle rencontre son mari, A.. Une équivalence s’établit dans le roman entre les éléments suivants : le ventre du père, les tableaux peints par ce dernier et l’espace-temps de A., et la fenêtre. Ces éléments deviennent des aires de jeu, remettant en question les concepts de l’intérieur et de l’extérieur et du créateur et de l’œuvre. En nous servant du texte « Le Tunnel » écrit par Ying Chen, nous démontrerons que cette notion du jeu s’applique également à l’ensemble de son œuvre.
Generation of hyperchaos from the Chen-Lee system via sinusoidal perturbation
International Nuclear Information System (INIS)
Tam, L.M.; Chen, J.H.; Chen, H.K.; Wai Meng Si Tou
2008-01-01
A system with more than one positive Lyapunov exponent can be classified as a hyperchaotic system. In this study, a sinusoidal perturbation was designed for generating hyperchaos from the Chen-Lee chaotic system. The hyperchaos was identified by the existence of two positive Lyapunov exponents and bifurcation diagrams. The system is hyperchaotic in several different regions of the parameters c, ε, and ω. It was found that this method not only can enhance or suppress chaotic behavior, but also induces chaos in non-chaotic parameter ranges. In addition, two interesting dynamical behaviors, Hopf bifurcation and intermittency, were also found in this study
Generation of hyperchaos from the Chen-Lee system via sinusoidal perturbation
Energy Technology Data Exchange (ETDEWEB)
Tam, L.M. [Department of Electromechanical Engineering, Faculty of Science and Technology, University of Macau, Av. Padre Thomas Pereira S.J., Taipa, Macau (China)], E-mail: fstlmt@umac.mo; Chen, J.H. [Department of Mechanical Engineering, Chung Hua University, Hsinchu, Taiwan (China); Chen, H.K. [Department of Mechanical Engineering, Hsiuping Institute of Technology, Taichung, Taiwan (China); Wai Meng Si Tou [Department of Electromechanical Engineering, Faculty of Science and Technology, University of Macau, Av. Padre Thomas Pereira S.J., Taipa, Macau (China)
2008-11-15
A system with more than one positive Lyapunov exponent can be classified as a hyperchaotic system. In this study, a sinusoidal perturbation was designed for generating hyperchaos from the Chen-Lee chaotic system. The hyperchaos was identified by the existence of two positive Lyapunov exponents and bifurcation diagrams. The system is hyperchaotic in several different regions of the parameters c, {epsilon}, and {omega}. It was found that this method not only can enhance or suppress chaotic behavior, but also induces chaos in non-chaotic parameter ranges. In addition, two interesting dynamical behaviors, Hopf bifurcation and intermittency, were also found in this study.
2011-11-16
... present ``Treatment of Cancer with Recombinant Immunotoxins: From Technology Transfer to the Patient.'' Dr. Pastan is an NIH Distinguished Investigator and Chief, Laboratory of Molecular Biology, National Cancer Institute Center for Cancer Research. This annual series honors Dr. Philip S. Chen, Jr. for his almost 50...
Wang, Ting; Guo, Rixin; Zhou, Guohong; Zhou, Xidan; Kou, Zhenzhen; Sui, Feng; Li, Chun; Tang, Liying; Wang, Zhuju
2016-07-21
Panax notoginseng (Burk.) F.H. Chen is a widely used traditional Chinese medicine known as Sanqi or Tianqi in China. This plant, which is distributed primarily in the southwest of China, has wide-ranging pharmacological effects and can be used to treat cardiovascular diseases, pain, inflammation and trauma as well as internal and external bleeding due to injury. This paper provides up-to-date information on investigations of this plant, including its botany, ethnopharmacology, phytochemistry, pharmacology and toxicology. The possible uses and perspectives for future investigation of this plant are also discussed. The relevant information on Panax notoginseng (Burk.) F.H. Chen was collected from numerous resources, including classic books about Chinese herbal medicine, and scientific databases, including Pubmed, SciFinder, ACS, Ebsco, Elsevier, Taylor, Wiley and CNKI. More than 200 chemical compounds have been isolated from Panax notoginseng (Burk.) F.H. Chen, including saponins, flavonoids and cyclopeptides. The plant has pharmacological effects on the cardiovascular system, immune system as well as anti-inflammatory, anti-atherosclerotic, haemostatic and anti-tumour activities, etc. Panax notoginseng is a valuable traditional Chinese medical herb with multiple pharmacological effects. This review summarizes the botany, ethnopharmacology, phytochemistry, pharmacology and toxicology of P. notoginseng, and presents the constituents and their corresponding chemical structures found in P. notoginseng comprehensively for the first time. Future research into its phytochemistry of bio-active components should be performed by using bioactivity-guided isolation strategies. Further work on elucidation of the structure-function relationship among saponins, understanding of multi-target network pharmacology of P. notoginseng, as well as developing its new clinical usage and comprehensive utilize will enhance the therapeutic potentials of P. notoginseng. Copyright © 2016
Security problems for a pseudorandom sequence generator based on the Chen chaotic system
Özkaynak, Fatih; Yavuz, Sırma
2013-09-01
Recently, a novel pseudorandom number generator scheme based on the Chen chaotic system was proposed. In this study, we analyze the security weaknesses of the proposed generator. By applying a brute force attack on a reduced key space, we show that 66% of the generated pseudorandom number sequences can be revealed. Executable C# code is given for the proposed attack. The computational complexity of this attack is O(n), where n is the sequence length. Both mathematical proofs and experimental results are presented to support the proposed attack.
Dark energy from cosmological fluids obeying a Shan-Chen non-ideal equation of state
Bini, Donato; Geralico, Andrea; Gregoris, Daniele; Succi, Sauro
2014-01-01
We consider a Friedmann-Robertson-Walker universe with a fluid source obeying a nonideal equation of state with ‘‘asymptotic freedom,’’ namely ideal gas behavior (pressure changes directly proportional to density changes) both at low and high density regimes, following a fluid dynamical model due to Shan and Chen. It is shown that, starting from an ordinary energy density component, such fluids naturally evolve towards a universe with a substantial ‘‘dark energy’’ component at the present tim...
International Nuclear Information System (INIS)
Moreno M, A.; Moreno B, A.
2000-01-01
In this work the incorporation of activation energy and frequency factor parameters proposed by R. Chen are presented in the original formulation of Randall and wilkins second order kinetics. The results concordance are compared between the calculus following the R. Chen methodology with those ones obtained by direct incorporation of the previously indicated in the Randall-Wilkins-Levy expression for a simulated thermoluminescent emission curve of two peaks with maximum peak temperature (tm): t m1=120 and t m2=190. (Author)
Energy Technology Data Exchange (ETDEWEB)
Moreno M, A. [Departamento de Apoyo en Ciencias Aplicadas, Benemerita Universidad Autonoma de Puebla, 4 Sur 104, Centro Historico, 72000 Puebla (Mexico); Moreno B, A
2000-07-01
In this work the incorporation of activation energy and frequency factor parameters proposed by R. Chen are presented in the original formulation of Randall and wilkins second order kinetics. The results concordance are compared between the calculus following the R. Chen methodology with those ones obtained by direct incorporation of the previously indicated in the Randall-Wilkins-Levy expression for a simulated thermoluminescent emission curve of two peaks with maximum peak temperature (tm): t m1=120 and t m2=190. (Author)
Chen-Nester-Tung quasi-local energy and Wang-Yau quasi-local mass
Liu, Jian-Liang; Yu, Chengjie
2017-10-01
In this paper, we show that the Chen-Nester-Tung (CNT) quasi-local energy with 4D isometric matching references is closely related to the Wang-Yau (WY) quasi-local energy. As a particular example, we compute the second variation of the CNT quasi-local energy for axially symmetric Kerr-like spacetimes with axially symmetric embeddings at the obvious critical point (0 , 0) and find that it is a saddle critical point in most of the cases. Also, as a byproduct, we generalize a previous result about the coincidence of the CNT quasi-local energy and Brown-York mass for axially symmetric Kerr-like spacetimes by Tam and the first author Liu and Tam (2016) to general spacetimes.
Eesti keel koos teiste läänemeresoome keeltega ja germaani keeled Hiinast vaadatuna / Ago Künnap
Künnap, Ago, 1941-
2009-01-01
Arvustus: Gao, Jingyi. [Hiina keel ja Põhja-Euroopa keeled. Hiina keele ning uurali keelte ja indo-euroopa keelte ühiste allikate alased avastused ja uurimused. Peking : Hiina Ühiskonnateaduste Kirjastus, 2008
Draakon teritab küüniseid / Kaarel Kaas
Kaas, Kaarel, 1978-
2005-01-01
Hiina-USA viimaste aastakümnete tõsisem konflikt, mis sai alguse Hainani intsidendist. Hiina suhtes 1989. a. kehtestatud relvaemargo kaotamisest. USA julgeoleku- ja Euroopa Liidu majandushuvid. Tabel: Hiina sõjaliste kulutuste ametlikud andmed
Modern process study on Chen Co and Ranwu Lake of Tibetan Plateau
Ju, J.
2013-12-01
Lakes are important junctions of geospheres. There are many lakes distributed on the Tibetan Plateau (TP). Lake sediment is one of the important media for retrieving the past environmental changes. Because of the uniqueness of environment of the TP, sediment, water and ecological system in lakes has local characteristic inevitably. Modern process research on different lakes will benefit interpreting the proxies more accurately. The development of observation station makes the observation and sampling more convenient. Modern process of lakes can be fulfilled in two ways, spatial or seasonal variation study, with a same aim finding out the dominant factors controlling the variations. Chen Co is a closed lake locating at inland area of southern Tibet. Ranwu Lake is an open lake locating at outflow area of SE Tibet. In this study, I studied the spatial and (or) seasonal variation of lake water and sediment in the two distinct types of lakes to make clear the mechanism of modern process. Particular attention was given to the pattern and degree of influence of rivers supplied by glaciers on lakes. Preliminary conclusions are outlined as follow: (1) In the lakes with glacier melt supplying rivers, the patterns of supply of the rivers to the lake are different. In close lake Chen Co, the influence of glacier melt is mainly reflected in the south lake area. In the open lake Ranwu Lake, the influence is comprehensive and direct. This difference influencing patterns how the lake sediments reflected the glacier melt under the past environmental changes. (2) The supply of Kaluxiong Qu River, supplied mainly by glacier melt, to Chen co has North-South difference: more directly to south lake area, reflecting by lower value of conductivity and pH, finer grain size and west to east transporting trend, greater deposition rate, more allogenic fine sediments, not obvious biological and endogenic deposition there. This enlightens the site selection for lake cores and interpretation of
Zhang, Xuedan; Zhang, Ruqing; Chen, Dexing
2014-01-01
Chen Ye, an official of the Southern Song Dynasty, also known as Chen Rihua as his styled name, was born in Changle, Fuzhou in the reign of Shaoxing, and died during the reign of Duanping. He had been consecutively in the positions of Jiang shi lang (Court Gentleman for Ceremonial Service), Zhi zhou (Prefect) of Lingding, the Ti xing (Judicial Commissioner) of Guangdong, the Zong ling (Overseer-general) of Sichuan, Shan ding (Reviser), Shu lin and other positions in Tongzhou, Yuanzhou. His works included 1 volume of Gu ling xian sheng nian pu (Mr. Guling's Chronological Biography), 1 volume of Tan xie (On Humor), 1 volume of Shi hua (Poetry), 8 volumes of Jin yuan li shu (Jin Yuan's Smart Technique), 3 volumes of Yi jian zhi lei bian (Classified Compilation of Yijian's Annals), (Zeng guang) Suo sui lu (Augmented Records of Trivial Matters), 5 volumes of Jia cang jing yan fang (Family-preserved Empirical Recipes). He also compiled the 8-volume Yin jiang zhi (Yinjiang's Annals), published the 2-volume Jia cang ji yao fang (Collected Essential Recipes from Family Preservation), and other proses and poetry. Jia cang jing yan fang was a formulary compiled by Chen Ye, which was lost. Altogether 74 of its recipes were cited in Fu ren da quan liang fang (Complete Effective Prescriptions for Women's Diseases), Shou qin yang lao shu (A Book for Pursuing Seniors' Longevity and Healthcare), Pu ji fang (Prescriptions for Universal Relief) and Yong le da dian (Yongle Encyclopedia).
Kirjad vallutatud Hiinast / Karl Rumor
Rumor, Karl, pseud., 1886-1971
2008-01-01
1937. a. alanud Hiina-Jaapani sõjast, poliitlistest oludest ja revolutsioonist Hiinas, hiinlastest ja Hiina suhetest teiste riikidega. Varem ilmunud: Uus Eesti 19.-20. aug, 1938, nr. 226-227; 12.-13., 16. sept. 1938, nr. 250-251, 254
"Külm sõda" Ida-Aasias / Märt Läänemets
Läänemets, Märt, 1962-
2005-01-01
Ameerika Ühendriikide "jätkusõda" Aasia-Vaikse ookeani poliitilises ruumis, kus peavastaseks ambitsioonikas Euraasia kommunistlik suurvõim Hiina. Kommunistlik diktatuuririik Hiina Taiwani-poliitika, relvamüügi embargo tühistamise nõudmisest. Vt. samas: Hiina relvastushanked Venemaalt
Le jeu de la création : Le mangeur (2005) de Ying Chen
Nicole Dunham
2013-01-01
Le théoricien James Hans définit le jeu comme une déconstruction structurante, un processus de perpétuelle remise en question. Dans Le Mangeur (2005) de Ying Chen, la narratrice revit un épisode d’une de ses vies passées où elle meurt mangée, avalée, par son père, descendant dans le « tunnel » du ventre de ce dernier. Cependant, suite à cet événement, elle se retrouve dans un autre espace-temps où elle rencontre son mari, A.. Une équivalence s’établit dans le roman entre les éléments suivants...
Ida-igatsuse põhjapiir / Raivo Paltser
Paltser, Raivo
2006-01-01
Hiina traditsiooni järgija R. Paltseri nägemus Lääne inimese ihalusest Vana-Hiina kultuuri järele, kung-fust. Toodud mõningaid näiteid Soome ja Hiina mütoloogiat ühendavast fantaasiafilmist "Igavese armastuse sõdalane - Jade Warrior"
Vigurtuled sügisöös / Jaan Mettik
Mettik, Jaan
2008-01-01
Montreali Botaanikaaia hiina aia hiina laternate festivalist "Tuhat ja üks tähte". 1991. a. avatud hiina aia arhitekt on Le Weizhong. Laternate joonised saadetakse Hiinasse, kus Shangai ja selle ümbruse meistrid laternad kunstkäsitööna valmis teevad. 17 värv. ill
Pitchfork bifurcation and circuit implementation of a novel Chen hyper-chaotic system
International Nuclear Information System (INIS)
Dong En-Zeng; Chen Zeng-Qiang; Chen Zai-Ping; Ni Jian-Yun
2012-01-01
In this paper, a novel four dimensional hyper-chaotic system is coined based on the Chen system, which contains two quadratic terms and five system parameters. The proposed system can generate a hyper-chaotic attractor in wide parameters regions. By using the center manifold theorem and the local bifurcation theory, a pitchfork bifurcation is demonstrated to arise at the zero equilibrium point. Numerical analysis demonstrates that the hyper-chaotic system can generate complex dynamical behaviors, e.g., a direct transition from quasi-periodic behavior to hyper-chaotic behavior. Finally, an electronic circuit is designed to implement the hyper-chaotic system, the experimental results are consist with the numerical simulations, which verifies the existence of the hyper-chaotic attractor. Due to the complex dynamic behaviors, this new hyper-chaotic system is useful in the secure communication. (general)
Miks Põhja-Korea on Hiinale ebamugav teema / Christopher Hill ; tõlkinud Villu Zirnask
Hill, Christopher
2011-01-01
Hiina suhtumisest oma naaberriiki. Hiina mõistab, et Põhja-Korea ei saa oma praegusel kujul püsima jääda ja on püüdnud julgustada sealseid juhte viima majandusreformi ellu poliitiliste muutusteta, sest Põhja-Korea lõpp tähendaks USA võitu ja Hiina kaotust
Üllatav seiklusfantaasia Soomest / Alar Niineväli
Niineväli, Alar
2006-01-01
Soome ja Hiina mütoloogiat ühendav fantaasiafilm "Igavese armastuse sõdalane - Jade Warrior" (Soome, Hiina, Hollandi ja Eesti ühistöö) : režissöör Antti-Jussi Annila : võitluskunstide koreograaf Yu Yan Kai : osades Tommi Eronen, Zhang Jingchu, Elle Kull. Lisa "Soome film sai Hiinas hea lepingu
Wormholes supported by phantom energy from Shan-Chen cosmological fluids
Energy Technology Data Exchange (ETDEWEB)
Wang, Deng [Nankai University, Theoretical Physics Division, Chern Institute of Mathematics, Tianjin (China); Meng, Xin-He [Nankai University, Department of Physics, Tianjin (China); Institute of Theoretical Physics, CAS, State key Lab of Theoretical Physics, Beijing (China)
2016-03-15
In the present paper, the exact solutions of spherically symmetrical Einstein field equations describing wormholes supported by phantom energy that violates the null energy condition from Shan-Chen background fluid are obtained. We have considered the important case of the model parameter ψ ∼ 1, which corresponds to the ''saturation effect'', and this regime corresponds to an effective form of ''asymptotic freedom'' for the fluids, but occurring at cosmological rather than subnuclear scales. Then we investigate the allowed range for the values of the model parameters g and ω when the spacetime metrics describe wormholes and discuss the possible singularities of the solutions, finding that the obtained spacetimes are geodesically complete. Furthermore, we construct two traversable wormholes through matching our obtained interior solutions to the exterior Schwarzschild solutions and analyze the traversabilities of the wormholes. Finally, we consider the case of anisotropic pressure and discover that the transverse pressure also crosses the phantom divide -1 with the growth of the wormhole dimension, and it tends to be the same as the radial pressure with the growth of the wormhole radius. (orig.)
Aasia Reini ääres / Kaire Nurk
Nurk, Kaire, 1960-
2002-01-01
Näitusest CHINaRT" Duisburgis Küppersmühle muuseumis. Eksponeeritud 40 hiina kunstniku peamiselt 2002. a. valminud teosed. Kuraatorid Walter Smerling, Fan Di. Oberhauseni lossis näitus "Hiina - traditsioon ja modernsus", kus on väljas tööd Kölni kunstikogujate Peter ja Irene Ludwigi kogust, Hiina rahvusmuuseumist Pekingis, Uli Siggi erakogust Luzernist jm
Le fictif et le réel dans L’Empereur et l’assassin de Chen Kaige
Giafferri, Xiaomin
2008-01-01
Comme tout texte historique littéraire refait l’Histoire en la manipulant, le récit filmique est doublement mensongère du fait de sa double représentation : le décor et les acteurs représentent une situation qui est la fiction, et le film lui-même représente sous forme d’images juxtaposées cette première représentation. Sans vouloir faire la part du réel et de l’imaginaire, le présent travail tente de montrer comment, dans le film L’empereur et l’assassin de Chen Kaige, l’illusion de l’authen...
2007-01-01
Eesti ja Hiina suhetest. Juttu on ka president Toomas Hendrik Ilvese 2006. a. oktoobris toimunud kohtumisest Hiina Rahva poliitilise konsultatiivkonverentsi rahvusliku komitee esimehe Jia Quinglingiga
Estonian-Chinese cohesion / Liina Lelmi
Lelmi, Liina
2009-01-01
Eesti-Hiina majandussuhetest. Hiina asepeaministri Zhang Dejiangi Eesti visiidist ja kohtumisest peaminister Andrus Ansipi, välisminister Urmas Paeti ning majandus- ja kommunikatsiooniminister Juhan Partsiga
Hiinlased õõnestavad ameeriklaste positsiooni maailma edukamate seas / Villu Zirnask
Zirnask, Villu, 1966-
2008-01-01
Maailma kümne väärtuslikuma börsiettevõtte hulgas on neli Hiina ettevõtet, ka suurima turuväärtusega on Hiina ettevõte Petro China. Ernst & Youngi andmeil on suuremate börsiettevõtete esisajasse kuuluvate Hiina firmade koguväärtus kasvanud võrreldes 2006. aasta lõpuga 123%, USA ettevõtete oma aga vähenenud 10%. Lisa: Uus IPO-rekord. Tabelid
Mark Leonard : Venemaal on kinnisidee kontrollida ümbruskonda / Mark Leonard ; interv. Liisa Past
Leonard, Mark
2007-01-01
Euroopa välissuhete nõukogu juht vastab küsimustele, kas praeguse Euroopa konfliktid ja vastuolud ei õõnesta tema võimalust olla maailmas oluline jõud, kas Venemaast saab kunagi EL-i liige ja mille poolest ta Euroopast erineb, kas Hiina hakkab ka poliitikas silma paistmiseks jõudu koguma, milline on Hiina ja Venemaa tegelik eesmärk, miks on Hiina inimõiguste küsimus Euroopa aruteludest kadunud
Jaapan peibutab odavate aktsiatega / Fredy-Edwin Esse
Esse, Fredy-Edwin
2010-01-01
Tänu deflatsioonile on Jaapani aktsiad suhteliselt odavad riiklike võlakirjade suhtes. Swedbanki hinnangul tasuks Jaapanisse investeerimist kaaluda, panga hinnangul muutub Jaapani aktsiaturg Hiina omast ahvatlevamaks, kui Hiina karmistab finantstingimusi
Silmakirjalike lubaduste konksu otsas / Qinglian He
He, Qinglian
2008-01-01
Kommunistliku partei valitsuse ajal ei ole Hiinas vaba ajakirjandust olnud, pärast Lhasa märtsirahutusi asus Hiina veelgi tugevamalt meediat kontrollima, et Tiibetis toimunut välismaailma ees varjata
Implementation of Organizational Changes in Chinese Companies / Wei Sun, Ruth Alas
Sun, Wei
2007-01-01
Põhja-Hiina 160 ettevõttes läbi viidud uuringu alusel analüüsitakse organisatsioonilisi muutusi, nende mõju ja vastumõju, taustaks institutsionaliseerumise olulised etapid Hiina ajaloos. Lisa: Tabelid
The impact of systematic landscape conservation planning on ecosystem: Chen Youlan river watershed
Chen, Chi-ju
2017-04-01
Heraclitus said that "no man ever steps in the same river twice." Everything continues to change. Land use change will keep redefine itself and subject the Earth and humankind to collateral changes. Humankind benefits from ecosystem in many ways. The ecosystem provides people with nutrients, enriches soil with sediment, and sustains all living organisms with water; these benefits are known as ecosystem services. In Taiwan, land use change has impacted ecosystem and biodiversity on various levels. Thus, we took six land use scenarios from 1999 to 2005 in Chen Youlan river watershed as our case study, intending to observe the course of ecosystem and biodiversity changes and the cause of it. Systematic Landscape conservation planning (SLCP) framework can be adopted when designing land use policy to safeguard human interests and ecosystem. This study use SLCP to develop ecosystem services and biodiversity protection strategies. Several strategies were designed by using 1999 to 2005 data as provision to protect the intactness of future ecosystem services and biodiversity. This research explores the potential and possible impacts of different land use protection strategies in the future. It is possible to identify the conservation priority of a certain region by using the Zonation meta-algorithm. This study selects the zonation critical protection area (Joint set of Yushan National Park) as strategy A, B and C. Strategy D takes Yushan National Park as a protected area; unstable hot spots in 1999/03 (Joint set of Yushan National Park) are selected as strategy E. Next, we used Kappa statistical method to find the minimal ecosystem services change and biodiversity hotspots change of the five aforementioned strategies and compared with those from 1999/03. By the Kappa statistical method, we further prioritized the important conservation areas by strategy A, B, C, E in the future. The results can not only serve as management reference for government agencies, but also develop
Kung fu-film alustas 15 000 vaatajaga
2006-01-01
Soome ja Hiina mütoloogiat ühendav fantaasiafilm "Igavese armastuse sõdalane - Jade Warrior" (Soome, Hiina ja Eesti ühistöö) kogus Soome kinolevis avanädalavahetusel suhteliselt tagasihoidliku kassa
Kak voznikajut superderzhavõ / Harold James ; tõlk. Jevgenija Unanjants
James, Harold
2005-01-01
Hiina kiire majandusliku arengu võrdlus protsessidega Saksamaal ja Jaapanis. Kui Hiina tahab vältida Saksamaa XX sajandi alguse saatust, peab ta toetama oma edukat majanduslikku moderniseerimist põhiseaduslike ja poliitiliste reformidega
Eesti filmi "Jade Warrior" esilinastus Torontos / Andres Laasik
Laasik, Andres, 1960-2016
2006-01-01
Soome ja Hiina mütoloogiat ühendav fantaasiafilm "Igavese armastuse sõdalane - Jade Warrior" (Soome, Hiina ja Eesti ühistöö) esilinastus eile Toronto filmifestivalil. Andmed filmi tootmise ja levitamise kohta
The flea beetle genus Meishania Chen & Wang is revised and five new species - M. cangshanensis sp. nov., M. flavipennis sp. nov., M. fulvotigera sp. nov., and M. sichuanica sp. nov. from China and M. bhutanensis sp. nov. from Bhutan - are described. All species of Meishania are illustrated and a key...
Starshina Vaskov i utshitel Konfutsi
2005-01-01
Boris Vassiljevi romaani "Aga koidikud on siin vaiksed" järgi valmis Hiina Kesktelevisiooni tellimusel 19-jaoline samanimeline teleseriaal. Peaosades vene näitlejad, režissöör Mao Weinin : Hiina 2003-2005
Raamat sõja seadustest / Linnart Mäll
Mäll, Linnart
2001-01-01
Vana-Hiina sõjateoreetikute Sun Zi ja Sun Bini raamatust: Sun, Zi ; Sun, Bin. Sõja seadused / klassikalisest hiina keelest tõlkinud ja kommenteerinud Märt Läänemets. Tln. : Eesti Keele Sihtasutus, 2001. (Sõjandusvaramu. Klassika)
EBS läks hiinlaste pärast riigiga kohtusse / Jan Andresoo
Andresoo, Jan
2006-01-01
Eesti Kõrgema Kommertskooli 78 Hiina päritolu magistrandist ei pruugi enamik kõrgkooli lõpetada, sest haridusministeerium on seadnud kahtluse alla Hiinas junior college'i lõpetanud tudengite haridustaseme, millest ei piisa magistriõpingute alustamiseks
Gromkaja ataka v Tihhom okeane / Ruslan Kadrmatov
Kadrmatov, Ruslan
2006-01-01
Hiina allveelaev lähenes 26. oktoobril Vaikses ookeanis USA lennukikandjale Kitty Hawk ja tõusis enne avastamist oma rakettide ja torpeedode tegevusraadiuses pinnale. Eksperdid usuvad, et aastaks 2025 hakkab Vaikse ookeani regioonis oma allveelaevastikuga domineerima Hiina
Eesti teeb koos soomlaste ja hiinlastega kung-fu filmi / Mari Rebane
Rebane, Mari
2005-01-01
Soome ja Hiina mütoloogiat ühendava fantaasiafilmi "Armuvalus sõdalane" (eelarve 39 milj. krooni) tootjad on Soome, Holland, Hiina ja Eesti (3,9 milj. krooni). Kaasa teeb ka Elle Kull, lavastab debütant AJ Annila
Soome kaudu Hiinasse / Jaan Ruus
Ruus, Jaan, 1938-2017
2005-01-01
Soome ja Hiina mütoloogiat ühendava fantaasiafilmi "Armuvalus sõdalane" (eelarve 39 milj. krooni) tootjad on Soome, Holland, Hiina ja Eesti (3,9 milj. krooni). Kaasa teeb ka Elle Kull, lavastab debütant AJ Annila
Kolga koolis andsid tunde hiinlased / Ülle Tamm
Tamm, Ülle
2016-01-01
Tallinna Ülikooli Konfutsiuse Instituudi neli õppejõudu - Zhuoya Wu, Xiuping Huang, Sandra Sainio ja Kristiina Kraft viisid Kolga koolis toimunud Hiina päeval läbi töötubasid ja loenguid hiina keelest ja kultuurist
ASEAN rühib mööda USAst ja Euroopast
2004-01-01
Vientianis toimunud ASEAN-i ja Hiina tippkohtumisel kirjutati alla ASEAN-i ja Hiina koostööleppele, mille siht on kõikide nendevaheliste tollipiiride kaotamine aastaks 2010. ASEAN-i ja USA ning ASEAN-i ja Euroopa vahelise kaubanduse mahust
[Grand gathering held in Beijing to mark 4th world conference on women
2005-01-01
President Arnold Rüütel külastas Hiinas Ülemaailmse Naiste Kongressi kümnenda sünnipäeva mälestuskonverentsi, kus arutati sugudevahelist võrdsust. Internetis ka lehe ingliskeelne versioon. Riigivisiit Hiina Rahvavabariiki 23.-30.08.2005
Ai Weiwei - 21. sajandi märter? / Tanel Veenre
Veenre, Tanel, 1977-
2011-01-01
Hiina kunstniku, inimõiguslase ja teisitimõtleja Ai Weiwei elust, õpingutest, loomingust ja tegevusest. Hiinas kunstniku tagakiusamisest, arreteerimisest, maksupettuses süüdistamisest jm. Kunstniku toetajatest. Inglise kunstileht Art Review valis Ai Weiwei 2011. a. kõige mõjuvõimsamaks kunstitegelaseks
Välispartnerid viivad Eesti filmi maailma kuulsust koguma / Andres Laasik
Laasik, Andres, 1960-2016
2006-01-01
Soome ja Hiina mütoloogiat ühendav fantaasiafilm "Igavese armastuse sõdalane - Jade Warrior" (Soome, Hiina, Hollandi ja Eesti ühistöö) edukast levitamisest maailma kinodes. Ka teiste koostööfilmide ("Ruudi", "Leiutajateküla Lotte") levitamisest
Deputat Riigikogu v bojevike v stilje kung-fu / Alina Zelimhanova
Zelimhanova, Alina
2005-01-01
Soome ja Hiina mütoloogiat ühendava fantaasiafilmi "Armuvalus sõdalane" (eelarve ca 40 milj. krooni, tootjad Soome, Holland, Hiina ja Eesti) võtted algavad täna Vihterpalu rabas. Kaasa teeb ka Elle Kull, lavastab debütant AJ Annila
Eestis algasid kung-fu-filmi võtted / Andri Maimets
Maimets, Andri, 1979-
2005-01-01
Soome ja Hiina mütoloogiat ühendava fantaasiafilmi "Armuvalus sõdalane" (eelarve ca 40 milj. krooni, tootjad Soome, Holland, Hiina ja Eesti) võtted algavad täna Vihterpalu rabas. Kaasa teeb ka Elle Kull, lavastab debütant AJ Annila
Soomlaste Sampo jahvatab eestlaste ja hiinlaste jõul / Annika Koppel
Koppel, Annika
2006-01-01
Soome ja Hiina mütoloogiat ühendav fantaasiafilm "Igavese armastuse sõdalane - Jade Warrior". Film valmis Soome, Hiina, Hollandi ja Eesti ühistöös 2006, režissöör Antti-Jussi Annila. Esilinastus Eestis 20. X kobarkinos
DVD. Alar Niineväli soovitab / Alar Niineväli
Niineväli, Alar
2007-01-01
Soome ja Hiina mütoloogiat ühendav 2006.a. fantaasiafilm "Igavese armastuse sõdalane - Jade Warrior" (Soome, Hiina, Hollandi ja Eesti ühistöö) : režissöör Antti-Jussi Annila : osades Tommi Eronen, Zhang Jingchu, Markku Peltola
Põhja-Korea viibutas taas lõuna poole sõjarusikat / Hendrik Vosman
Vosman, Hendrik
2010-01-01
Põhja-Korea rannikul toimusid suurtükiplahvatused, Lõuna-Korea teatel oli tõenäoliselt tegemist põhjakorealaste õppusega. Hiina hoiatas, et riigid hoiduksid ilma tema loata sõjalisest tegevusest Hiina majandusvetes. Lõuna-Korea ja USA alustavad mereväemanöövreid
Kaks uut näitust 24 tunni galeriis
2003-01-01
Aadressil www.kunstikeskus.ee väljapanekud "Suur Hiina naeratus" hiina kunstnike - Song Haizeng, Du Xinjian, Xue Jiye, Wang Jing, Wu Meng Chun, Zhong Biao - töödest ja "Raffa oma galerii" kunstilehekülge külastanud inimeste online-joonistusmasina abiga joonistatud piltidest
Soome-ugri kung fu / Jüri Laulik
Laulik, Jüri, 1959-
2006-01-01
Soome ja Hiina mütoloogiat ühendav fantaasiafilm "Igavese armastuse sõdalane - Jade Warrior" (Soome, Hiina, Hollandi ja Eesti ühistöö) : stsenarist Iiro Küttner : režissöör Antti-Jussi Annila. Eestipoole produtsent Margus Õunapuu Eesti osast filmis
"Made In China" päästmine / Andrei Hvostov
Hvostov, Andrei, 1963-
2007-01-01
Kaubandussõjast USA ja Hiina vahel. Kui USA poliitikud süüdistavad Hiinat tervistkahjustava toidu ja ohtlike mänguasjade ekspordis, siis Peking süüdistab USA-d ebakindlate turbiinide tarnimises. Oma kaupade paremaks tutvustamiseks on Hiina ostnud nõustamisteenuse PR-firmalt Ogilvy & Mather
Hu on poolel teel / James Miles
Miles, James
2006-01-01
2007. aastal toimuv kommunistliku partei 17. kongress tähistab Hiina presidendi Hu Jintao jaoks oma võimuaja poole peale jõudmist, ees ootavad sellised väljakutsed nagu olümpiamängude korraldamine, valimiskeeris Taiwanis ning hullunud majanduse stabiliseerimine. Vt samas: Hiina avanemise pidu
Pekingi punased olümpiamedalid / Leslie Leino
Leino, Leslie
2007-01-01
Autor käsitleb Eesti poliitikute artikleid, mis puudutasid Hiina olümpiamängude boikottimise teemat. Ta leiab, et peaksime inimõiguste ja muid probleeme tõstatama ratsionaalsetes piirides. Hiinas endas väideldakse juba ammu inimõiguste teemal. Mõõdukas probleemidele osutamine näitab Eesti selgroogu
Igavese armastuse sõdalane : mitte just klassika, aga ajaloo verstapost küll / Ilmar Raag
Raag, Ilmar, 1968-
2006-01-01
Soome ja Hiina mütoloogiat ühendavast fantaasiafilmist "Igavese armastuse sõdalane - Jade Warrior" (Soome, Hiina, Hollandi, Eesti ühistöö) : stsenarist Iiro Küttner, režissöör Antti-Jussi Annila, võitluskunstide koreograaf Yu Yan Kai, osades - Tommi Eronen, Zhang Jingchu, Markku Peltola, Elle Kull
Fassaadikunstist ja teesklusest / Margit Tõnson
Tõnson, Margit, 1978-
2006-01-01
Soome ja Hiina mütoloogiat ühendav fantaasiafilm "Igavese armastuse sõdalane - Jade Warrior" (Soome, Hiina, Hollandi ja Eesti ühistöö) : stsenarist Iiro Küttner : režissöör Antti-Jussi Annila : võitluskunstide koreograaf Yu Yan Kai : osades Tommi Eronen, Zhang Jingchu, Markku Peltola
Ajaloolise ja isikliku mälu arheoloogiast tulevikuvisioonideni / Katrin Kivimaa
Kivimaa, Katrin, 1969-
2005-01-01
Kuni 15. I 2006 Victoria ja Alberti muuseumis avatud näitusest "Mineviku ja tuleviku vahel", mis annab ülevaate hiina kaasaegse foto- ja videokunsti ning dokumentatsioonide kaudu ka performance'i hiljutisest arengust ja hetkeseisust ning toob nähtavale praegust hiina kultuuri mõjutavate traditsioonide ja uuenduste keerulise sasipuntra
CERN Photo Service
2008-01-01
21 October 2008 - LHC Inauguration - IHEP Beijing representative Prof. Chen, People's Republic of China, welcomed by CERN Director-General R. Aymar, CERN Chief Scientific Officer J. Engelen and CERN Financial Officer S. Lettow.
Le fictif et le réel dans L’Empereur et l’assassin de Chen Kaige
Directory of Open Access Journals (Sweden)
Xiaomin Giafferri
2008-12-01
Full Text Available Comme tout texte historique littéraire refait l’Histoire en la manipulant, le récit filmique est doublement mensongère du fait de sa double représentation : le décor et les acteurs représentent une situation qui est la fiction, et le film lui-même représente sous forme d’images juxtaposées cette première représentation. Sans vouloir faire la part du réel et de l’imaginaire, le présent travail tente de montrer comment, dans le film L’empereur et l’assassin de Chen Kaige, l’illusion de l’authenticité s’établit à travers les mécanismes de la fictionnalisation de l’Histoire. L’observation de leur manifestation est amenée à considérer deux axes principaux : l’organisation du récit et la mise en scène des personnages.
Экспортеры нефти намерены отказаться от доллара
2009-01-01
Pärsia lahe riigid plaanivad koos Venemaa, Hiina, Jaapani ja Prantsusmaaga lõpetada nafta kauplemise dollarites ning võtta kasutusele erinevad valuutad, näiteks Jaapani jeeni, Hiina jüaani, euro, kulla ning Pärsia Lahe Koostöönõukogu riikide, kaasa arvatud Saudi Araabia, Abu Dhabi, Kuveidi ja Katari uue ühisvaluuta
Maximilien Brice
2007-01-01
Chinese Commission of Science Technology and Industry for National Defense Senior Vice Minister CHEN Qiufa exchanging gifts at luncheon and signing the Guest Book on 1st November 2007 with CERN Director-General R. Aymar.
Mak, Kwok-Kei; Lai, Ching-Man; Ko, Chih-Hung; Chou, Chien; Kim, Dong-Il; Watanabe, Hiroko; Ho, Roger C M
2014-10-01
The Revised Chen Internet Addiction Scale (CIAS-R) was developed to assess Internet addiction in Chinese populations, but its psychometric properties in adolescents have not been examined. This study aimed to evaluate the factor structure and psychometric properties of CIAS-R in Hong Kong Chinese adolescents. 860 Grade 7 to 13 students (38 % boys) completed the CIAS-R, the Young's Internet Addiction Test (IAT), and the Health of the Nation Outcome Scales for Children and Adolescents (HoNOSCA) in a survey. The prevalence of Internet addiction as assessed by CIAS-R was 18 %. High internal consistency and inter-item correlations were reported for the CIAS-R. Results from the confirmatory factor analysis suggested a four-factor structure of Compulsive Use and Withdrawal, Tolerance, Interpersonal and Health-related Problems, and Time Management Problems. Moreover, results of hierarchical multiple regression supported the incremental validity of the CIAS-R to predict mental health outcomes beyond the effects of demographic differences and self-reported time spent online. The CIAS is a reliable and valid measure of internet addiction problems in Hong Kong adolescents. Future study is warranted to validate the cutoffs of the CIAS-R for identification of adolescents with Internet use problems who may have mental health needs.
Directory of Open Access Journals (Sweden)
Chih-Hung Ko
2005-12-01
Full Text Available The aim of this study was to establish the optimal cut-off points of the Chen Internet Addiction Scale (CIAS, to screen for and diagnose Internet addiction among adolescents in the community by using the well- established diagnostic criteria of Internet addiction. This survey of 454 adolescents used screening (57/58 and diagnostic (63/64 cut-off points of the CIAS, a self-reported instrument, based on the results of systematic diagnostic interviews by psychiatrists. The area under the curve of the receiver operating characteristic curve revealed that CIAS has good diagnostic accuracy (89.6%. The screening cut-off point had high sensitivity (85.6% and the diagnostic cut-off point had the highest diagnostic accuracy, classifying 87.6% of participants correctly. Accordingly, the screening point of the CIAS could provide a screening function in two-stage diagnosis, and the diagnostic point could serve as a diagnostic criterion in one-stage massive epidemiologic research.
Ground-state magnetization of the Ising spin glass: A recursive numerical method and Chen-Ma scaling
Sepehrinia, Reza; Chalangari, Fartash
2018-03-01
The ground-state properties of quasi-one-dimensional (Q1D) Ising spin glass are investigated using an exact numerical approach and analytical arguments. A set of coupled recursive equations for the ground-state energy are introduced and solved numerically. For various types of coupling distribution, we obtain accurate results for magnetization, particularly in the presence of a weak external magnetic field. We show that in the weak magnetic field limit, similar to the 1D model, magnetization exhibits a singular power-law behavior with divergent susceptibility. Remarkably, the spectrum of magnetic exponents is markedly different from that of the 1D system even in the case of two coupled chains. The magnetic exponent makes a crossover from being dependent on a distribution function to a constant value independent of distribution. We provide an analytic theory for these observations by extending the Chen-Ma argument to the Q1D case. We derive an analytical formula for the exponent which is in perfect agreement with the numerical results.
Politics in the Western Maya Region (I: Ajawil/Ajawlel and Ch'e'n
Directory of Open Access Journals (Sweden)
Péter Bíró
2011-01-01
Full Text Available In a series of articles I reflect on the use of various expressions which are connected to what we call the political in the inscriptions of the Classic Maya Western Region. These words express concepts which help to understand the intricate details of the interactions between the political entities and their internal organisations in the Classic Maya Lowlands. Words such as 7ajawil, 7ajawlel, the kennings built on the base of ch'e7n (cave, pond, the emblem glyphs and titles will be examined in light of what they tell us about the functioning of the political organisation of the Classic Period in a constrained region.En una serie de artículos como éste investigo el uso de varias palabras en las inscripciones mayas de la época Clásica de la Región Occidental vinculadas con lo que nosotros llamamos "política". Estas palabras expresan conceptos que ayudan a entender los matices de las relaciones entre las entidades políticas de las Tierras Bajas Mayas y su organización interna. Términos como ajaw'ü I ajawlel, los difrasismos con base ch'e'n (cueva, pozo, los glifos emblemas y los títulos serán examinados tomando en cuenta la información que nos proporcionan sobre el funcionamiento de la organización política de la época Clásica en una región restringida.
Franson, J. Christian; Hoffman, D.J.; Schmutz, J.A.
2009-01-01
Reduced populations of emperor geese (Chen canagica), a Bering Sea endemic, provided the need to assess plasma biochemistry values as indicators of population health. A precursory step to such an investigation was to evaluate patterns of variability in plasma biochemistry values among age, sex, and reproductive period. Plasma from 63 emperor geese was collected on their breeding grounds on the Yukon-Kuskokwim Delta in western Alaska, USA. The geese sampled included 18 incubating adult females captured, in mid June, on their nests by using bow nets, and 30 adults and 15 goslings captured in corral traps in late July and early August, when the adults were molting their wing feathers and the goslings were 5-6 weeks old. Plasma was evaluated for 15 biochemical parameters, by comparing results among age, sex, and sampling period (incubation versus wing-feather molt). Ten of the 15 biochemical parameters assayed differed among adults during incubation, the adults during molt, and the goslings at molt, whereas sex differences were noted in few parameters.
Lake, B.C.; Schmutz, J.A.; Lindberg, M.S.; Ely, Craig R.; Eldridge, W.D.; Broerman, F.J.
2008-01-01
We studied body mass of prefledging Emperor Geese Chen canagica at three locations across the Yukon-Kuskokwim Delta, Alaska, during 1990-2004 to investigate whether large-scale variation in body mass was related to interspecific competition for food. From 1990 to 2004, densities of Cackling Geese Branta hutchinsii minima more than doubled and were c. 2-5?? greater than densities of Emperor Geese, which were relatively constant over time. Body mass of prefledging Emperor Geese was strongly related (negatively) to interspecific densities of geese (combined density of Cackling and Emperor Geese) and positively related to measures of food availability (grazing lawn extent and net above-ground primary productivity (NAPP)). Grazing by geese resulted in consumption of ??? 90% of the NAPP that occurred in grazing lawns during the brood-rearing period, suggesting that density-dependent interspecific competition was from exploitation of common food resources. Efforts to increase the population size of Emperor Geese would benefit from considering competitive interactions among goose species and with forage plants. ?? 2008 The Authors.
Debris flow run off simulation and verification ‒ case study of Chen-You-Lan Watershed, Taiwan
Directory of Open Access Journals (Sweden)
M.-L. Lin
2005-01-01
Full Text Available In 1996 typhoon Herb struck the central Taiwan area, causing severe debris flow in many subwatersheds of the Chen-You-Lan river watershed. More severe cases of debris flow occurred following Chi-Chi earthquake, 1999. In order to identify the potentially affected area and its severity, the ability to simulate the flow route of debris is desirable. In this research numerical simulation of debris flow deposition process had been carried out using FLO-2D adopting Chui-Sue river watershed as the study area. Sensitivity study of parameters used in the numerical model was conducted and adjustments were made empirically. The micro-geomorphic database of Chui-Sue river watershed was generated and analyzed to understand the terrain variations caused by the debris flow. Based on the micro-geomorphic analysis, the debris deposition in the Chui-Sue river watershed in the downstream area, and the position and volume of debris deposition were determined. The simulated results appeared to agree fairly well with the results of micro-geomorphic study of the area when not affected by other inflow rivers, and the trends of debris distribution in the study area appeared to be fairly consistent.
Hirschheydt, Monika von
2015-01-01
Arvustus: Nürnberg, Reiner, Höxtermann, Ekkehard, Voigt, Martina. Elisabeth Schiemann 1881-1972. Vom AußBruch der Genetik und der Frauen in den UmBrüchen des 20. Jahrhunderts. Beiträge eines Symposiums zum 200. Gründungsjubiläum der Humboldt-Universität Berlin. Rangsdorf: Basilisken-Presse 2014
Pikad varjud Taevase Rahu väljakul / Paul A. Goble
Goble, Paul Alan, 1949-
2005-01-01
Saksamaa ja Prantsusmaa tahtsid tühistada Hiina suhtes kehtestatud relvaembargo, kuid Suurbritannia, Taani, Rootsi ja Holland olid keelu tühistamise vastu. Autor meenutab eestlastele, et Lääne otsus sanktsioneerida Hiinat pärast sündmusi Taevase Rahu väljakul aitas kaasa ka Eesti taasiseseisvumisele, seepärast võiks ka Eesti toetada embargo jätkamist senikaua, kuni Hiina tunnistab tollaste sündmuste ajal demonstrantide kallal sooritatud kuritegusid ja alustab riigi demokratiseerimist
Maximilien Brice
2012-01-01
6 June 2012 - Chinese Nanjing University President J.Chen in the ATLAS visitor centre with Member of the ATLAS Collaboration I. Wingerter and International Relations Office Adviser E. Tsesmelis. M. Qi, Nanjing University and ATLAS Collaboration, accompanies the delegation.
Zhang, Wen-Yan; Lin, Chao-Yuan
2017-04-01
The Soil Conservation Service Curve Number (SCS-CN) method, which was originally developed by the USDA Natural Resources Conservation Service, is widely used to estimate direct runoff volume from rainfall. The runoff Curve Number (CN) parameter is based on the hydrologic soil group and land use factors. In Taiwan, the national land use maps were interpreted from aerial photos in 1995 and 2008. Rapid updating of post-disaster land use map is limited due to the high cost of production, so the classification of satellite images is the alternative method to obtain the land use map. In this study, Normalized Difference Vegetation Index (NDVI) in Chen-You-Lan Watershed was derived from dry and wet season of Landsat imageries during 2003 - 2008. Land covers were interpreted from mean value and standard deviation of NDVI and were categorized into 4 groups i.e. forest, grassland, agriculture and bare land. Then, the runoff volume of typhoon events during 2005 - 2009 were estimated using SCS-CN method and verified with the measured runoff data. The result showed that the model efficiency coefficient is 90.77%. Therefore, estimating runoff by using the land cover map classified from satellite images is practicable.
Directory of Open Access Journals (Sweden)
Hongyang Zhang
2016-01-01
Full Text Available Yin-Chen-Hao-Tang (YCHT is a famous Chinese medicine formula which has long been used in clinical practice for treating various liver diseases, such as liver fibrosis. However, to date, the mechanism for its anti-fibrotic effects remains unclear. In this paper, an ultra-performance liquid chromatography-time-of-flight mass spectrometry (UPLC-TOF-MS-based metabolomic study was performed to characterize dimethylnitrosamine (DMN-induced liver fibrosis in rats and evaluate the therapeutic effects of YCHT. Partial least squares-discriminant analysis (PLS-DA showed that the model group was well separated from the control group, whereas the YCHT-treated group exhibited a tendency to restore to the controls. Seven significantly changed fibrosis-related metabolites, including unsaturated fatty acids and lysophosphatidylcholines (Lyso-PCs, were identified. Moreover, statistical analysis demonstrated that YCHT treatment could reverse the levels of most metabolites close to the normal levels. These results, along with histological and biochemical examinations, indicate that YCHT has anti-fibrotic effects, which may be due to the suppression of oxidative stress and resulting lipid peroxidation involved in hepatic fibrogenesis. This study offers new opportunities to improve our understanding of liver fibrosis and the anti-fibrotic mechanisms of YCHT.
Energy Technology Data Exchange (ETDEWEB)
Nemchinsky, V A [Key College, 225 Dania Beach Blvd, Dania Beach, FL 33040 (United States)
2007-07-07
The heating history of a droplet during its flight can be divided into two phases: (a) the initial phase when evaporation, although it occurs, does not change the heat balance of the droplet much (the case considered in our previous paper and (b) the final phase when the cooling due to evaporation balances the heat flux from the plasma. The later phase is considered in Chen's comment. In our reply, a very straightforward consideration demonstrates that even in the final phase of the droplet flight, the 'rocket' effect can be significant. (reply)
Khan, Sabeel M.; Sunny, D. A.; Aqeel, M.
2017-09-01
Nonlinear dynamical systems and their solutions are very sensitive to initial conditions and therefore need to be approximated carefully. In this article, we present and analyze nonlinear solution characteristics of the periodically forced Chen system with the application of a variational method based on the concept of finite time-elements. Our approach is based on the discretization of physical time space into finite elements where each time-element is mapped to a natural time space. The solution of the system is then determined in natural time space using a set of suitable basis functions. The numerical algorithm is presented and implemented to compute and analyze nonlinear behavior at different time-step sizes. The obtained results show an excellent agreement with the classical RK-4 and RK-5 methods. The accuracy and convergence of the method is shown by comparing numerically computed results with the exact solution for a test problem. The presented method has shown a great potential in dealing with the solutions of nonlinear dynamical systems and thus can be utilized in delineating different features and characteristics of their solutions.
Maximilien Brice
2007-01-01
Chinese Commission of Science Technology and Industry for National Defense Senior Vice Minister CHEN Qiufa visiting ALICE experiment on 1st November 2007 with CERN Director-General R. Aymar and Adviser J.-P. Revol. Thursday, 1st and Friday, 2nd November 2007
Tuggle, B.N.; Crites, John L.
1984-01-01
Three species of trichostrongylid nematodes were removed from the gizzards of 25 lesser snow geese, Chen caerulescens caerulescens, collected at Winisk, Ont. A 100% prevalence of infection was noted in the sampled population with each bird harboring two or more of the following species: Epomidiostomum crami (prevalence, 92%; mean intensity, 18.7 ± 13.3), Amidostomum anseris (prevalence, 84%; mean intensity, 9.6 ± 9.8), and Amidostomum spatulatum (prevalence, 84%; mean intensity, 11.2 ± 9.8). When large burdens (>30) of both A. anseris and A. spatulatum were present in the mucosal lining of the gizzard, progressive degeneration of the epithilium and koilin linings was noted in 16% of the geese examined. Severe necrotic granulomata observed in the gizzard muscle of 36% of the geese were associated with sizable burdens (>25) of E. crami which were found burrowed in the gizzard muscle.
Yang, Qiaoling; Yang, Fan; Tang, Xiaowen; Ding, Lili; Xu, Ying; Xiong, Yinhua; Wang, Zhengtao; Yang, Li
2015-04-16
Yin-Chen-Hao-Tang (YCHT), a commonly used as a traditional chinese medicine for liver disease. Several studies indicated that YCHT may improving hepatic triglyceride metabolism and anti-apoptotic response as well as decreasing oxidative stress .However, little is known about the role of YCHT in chlorpromazine (CPZ) -induced chlolestatic liver injury. Therefore, we aimed to facilitate the understanding of the pathogenesis of cholestatic liver injury and evaluate the effect of Yin-Chen-Hao-Tang (YCHT) on chlorpromazine (CPZ)-induced cholestatic liver injury in rats based on the change of bile acids (BAs) and free fatty acids (FFAs) alone with the biochemical indicators and histological examination. We conducted an experiment on CPZ-induced cholestatic liver injury in Wistar rats with and without YCHT for nine consecutive days. Serum levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), albumin (ALB), total bilirubin (TBIL), total cholesterol (TC), triglycerides (TG), low density lipoprotein-cholesterol (LDL-C) were measured to evaluate the protective effect of YCHT against chlorpromazine (CPZ)-induced cholestatic liver injury. Histopathology of the liver tissue showed that pathological injuries were relieved after YCHT pretreatment. In addition, ultra-performance lipid chromatography coupled with quadrupole mass spectrometry (UPLC-MS) and gas chromatography coupled with mass spectrometry (GC-MS) was applied to determine the content of bile acids, free fatty acids, respectively. Obtained data showed that YCHT attenuated the effect of CPZ-induced cholestatic liver injury, which was manifested by the serum biochemical parameters and histopathology of the liver tissue. YCHT regulated the lipid levels as indicated by the reversed serum levels of TC, TG, and LDL-C. YCHT also regulated the disorder of BA and FFA metabolism by CPZ induction. Results indicated that YCHT exerted a protective effect on CPZ-induced cholestasis liver injury. The variance of
Hiina minimaastikud / Jaan Mettik
Mettik, Jaan
2007-01-01
Hiinlaste minimaastike kunstist pen jing (maastik potis). Tavaliselt jaotatakse pen jing kolmeks: puukujuline, maastikku imiteeriv ning vee ja maa oma. Minimaastikele võib lisada tillukesi pagoode, inimkujukesi jm. Soositud on ohtralt dekoreeritud potid. 7 värv. ill
Writing Beyond the Wall: Translation, Cross-cultural Exchange, and Chen Ran's 'A Private Life'
Directory of Open Access Journals (Sweden)
Kay Schaffer
2006-09-01
Full Text Available The past decade has witnessed an unprecedented rise in the global flow of knowledge, nowhere more apparent in the exchange of ideas between China and modern western democracies. Our interest concerns one aspect of this global flow— the translation of Chinese women’s autobiographical writing into English. Taking Chen Ran’s A Private Life (English edition, 2004 as a point of departure, the paper explores issues of translingual practice and cross-cultural exchange. It considers what escapes or is lost in translation as well as the additive potential of the host text. It is sometimes the case that the translation can deliberately make certain ambiguities visible—whether from pragmatic, market-driven motivations or from more complex political, historical and cultural considerations. These negotiations of meaning that occur in the translation process can reverberate on the critical reception of texts in both the ‘guest’ and ‘host’ languages (Liu 1995, with open-ended, incomplete and indeterminate effects. The paper examines the effects of the omission of a brief parenthetical section of three paragraphs from one chapter of the Chinese edition of A Private Life. Yet, even that small emendation changes the original text as a cultural object and alters potential modes of its reception. In this case, the translation results in a loss of ambiguity, irony, philosophic and rhetorical sophistication while also offering additive potentials that enhance the generation of new meanings in the translingual exchange, here with reference Tiananmen and contemporary feminism in China. The translation process provides new channels for readers, writers and theorists to dialogue and communicate across gaps of difference, despite inhibiting factors like the imposition of local restraints, the universalising pressures of western modernity, and asymmetrical relations of power between guest and host language contexts.
Motomura, Hiroyuki; Causse, Romain; Béarez, Philippe; Mishra, Subhrendu Sekhar
2015-09-29
The Indo-West Pacific species, Neomerinthe erostris (Alcock 1896), originally described as Scorpaena erostris, is redescribed as a senior synonym of Scorpaena gibbifrons Fowler 1938, N. rotunda Chen 1981, and N. bathyperimensis Zajonz & Klausewitz 2002. Although the latter three nominal species have been regarded as valid species and N. erostris has not been reported since 1898, examinations of type specimens of the four nominal species revealed that they represent a single species. A lectotype of Scorpaena erostris is herein designated. Neomerinthe erostris is characterized by having a distinct longitudinal ridge on the lateral surface of the maxilla and a strongly rounded dorsal profile of the head.
Rogers : Hiinat ootab suur tulevik, Venemaad lagunemine / Jim Rogers ; interv. Villu Zirnask
Rogers, Jim
2005-01-01
Investeerimisguru-maailmarändur Jim Rogers toorainetesse investeerimisest, Venemaa ja Hiina majanduslikust arengust, uue Euroopa aktsiaturgudest ning elustandardist, Türgi võimalikust liitumisest Euroopa Liiduga
Kuidas jääda hiinlaseks / Ülle Dreifeldt
Dreifeldt, Ülle
2001-01-01
Pariisi 8. Ülikooli teatrikateedri tudeng National Taiwan Junior College of Performing Arts'i hiina klassikalise ooperi intensiivkursustest - ooperi koolist, õppetöö korraldusest, pekingi ooperist
Stuart Johnson: NATO on Eesti julgeolekugarantii / intervjueerinud Margus Kolga
Johnson, Stuart
2008-01-01
USA julgeolekuanalüütik tutvustab Ühendriikide kaitsepoliitika dokumenti "Quadrennial Defence Review 2006" (QDR). Ettevalmistus reeglitega sõjaks. Venemaa, Hiina ja India tulevik. Soovitused Eestile
Stuart Johnson: NATO on eesti julgeolekugarantii / Stuart Johnson ; interv. Margus Kolga
Johnson, Stuart
2006-01-01
Mõjukas USA julgeolekuanalüütik tutvustab Ühendriikide kaitsepoliitika dokumenti "Quadrennial Defence Review 2006" (QDR). Ettevalmistus reeglitega sõjaks. Venemaa, Hiina ja India tulevik. Soovitused Eestile
Исраэль, Мярт, 1983-
2011-01-01
Hiinas Shenzhenis toimunud universiaadil võitis kettaheitja Märt Israel kuldmedali. M. Israel on Eesti suurimaid lootusi augusti lõpus Lõuna-Koreas algavatel kergejõustiku maailmameistrivõistlustel
Abielu hiina tundmatuga / Allar Tankler
Tankler, Allar, 1981-
2000-01-01
Vt. ka Moldojozh Estonii : Subbota Mar/18 lk. 13. Messias Koreast, pastor Sun Myung Moon laulatas eesti mehe Peter Ljashevitshi ja hiinlanna Gui Zhen Yuani 1995. aastal Valgevenes, kus noorpaar nägi teineteist esimest korda elus Ühinemise liikumise massilaulatusel
Muusikauudiseid maailmast / Nele-Eva Steinfeld
Steinfeld, Nele-Eva
2016-01-01
Lühisõnumeid maailmast: Suri Pierre Boulez. Lahkus Kurt Masur. Hiinas uhiuus ooperimaja. Suri David Bowie. Bachtracki edetabelid aastast 2015. Nikolaus Harnoncourt lahkub lavaelust. Beethoveni autogramm oksjonil jne.
Investeerija märksõnad : USA ning tervishoiu- ja IT-sektor / Uwe Zöllner
Zöllner, Uwe
2008-01-01
USA elanike tarbimise mõjust globaalsele majandusruumile. Aktsiainvesteeringuid plaanides tasuks silmas pidada tervishoiu- ja infotehnoloogiasektori ettevõtteid ning vaadata USA poole. Lisa: Hiina eksport võrreldes riigisisese tarbimisega
Vabad valimised kõigepealt / Robert Kagan
Kagan, Robert
2007-01-01
Carnegie' sihtasutuse teadur kirjutab USA, Venemaa ja Hiina näiteil, et autokraatia ja diktatuurid ei kao iseenesest lihtsalt majandusvabaduse edenedes, vaid demokraatlikud jõud peavad selleks kaasa aitama
Myanmari aitab üksnes aeg / Mihkel Mutt
Mutt, Mihkel, 1953-
2007-01-01
Myanmaris (Birmas) toimunud buda munkade meeleavaldusest, hunta tegevusest ja suhetest Hiinaga. Autori hinnangul võib valitsev diktatuur aru saada muutuste paratamatusest ja hakata riiki Hiina kombel ülaltpoolt reformima
Netiajastu teeb autokraadid leidlikuks / Kalmo Hent
Kalmo, Hent, 1979-
2010-01-01
Riiklike huvide kaitsmiseks ja saavutamiseks on nii Hiina kui Venemaa asunud internetis looma oma inforuumi ning kehtestama internetitsensuuri, mis võimaldab mõjutada ja kontrollida sündmuste kajastamist
Bagatellid : maailm / Mirjam Tally
Tally, Mirjam, 1976-
2007-01-01
New Yorgi Filharmoonikute hooaeg jätkub hiina solistidega. Heliplaadid mehhiko tenorilt Rolando Villazonilt. Skandaalid Soome Rahvusooperis. Philip Glass leidis tunnustust kodulinnas Baltimore'is. Rõõmurohke Grammyde aasta 2007
Eestlased tõid universiaadilt kaks neljandat kohta / Annes Aus
Aus, Annes
2009-01-01
Hiinas, Harbinis 18.-28. veebruaril toimunud üliõpilaste taliuniversiaadist, kus kõige paremini esinesid Eesti sportlastest Tallinna Ülikooli Kunstide Instituudis õppiv Jelena Glebova ja Kunstiakadeemias tudeeriv Mark Duubas
Mees, kes mängis head natsi / Ulrich Tukur ; intervjueerinud Maria Ulfsak-Šeripova
Tukur, Ulrich, 1957-
2010-01-01
Festivali "Uus saksa kino" raames on oodata Eestisse saksa kino elavat klassikut, kel kandev roll Michael Haneke auhinnatud filmis "Valge pael" ja nimosa filmis "John Rabe" (Saksamaa-Hiina-Prantsusmaa 2009)
Määdness in da haus! / Erik Morna
Morna, Erik, 1969-
2006-01-01
Autor tutvustab kahtkümmet ebatavalise kujuga elupaika USA-s, Jaapanis, Hiinas, Hollandis, Austrias, Saksamaal, Inglismaal, Tšehhis (arhitekt Frank Gehry), Itaalias (arhitekt Mario Cavalle) ja Eestis - pilpamaja Suure-Jaanis
Rumor, Karl, pseud., 1886-1971
2008-01-01
Kommetest, ettevalmistusest abieluks, perekonnaelust, ilukultuurist Jaapanis. 1937. a. alanud Hiina-Jaapani sõjast. Varem ilmunud: Uus Eesti 1.-3. juuli 1938, nr. 177-179; 1., 6. august 1938, nr. 208, 213
Kui nuustakulased Berliinis käisid / Jaak Lõhmus
Lõhmus, Jaak
2007-01-01
57. Berliini filmifestivali peaauhinna Kuldkaru sai Hiina režissööri Wang Quanani film "Tuya abielu" ("Tuya de hun shi"). Ka teistest auhinnasaajatest. Kokkuvõte festivalist ja eestlastest festivalil
Aasia transiit kipub Eestisse. Sadamad endiselt rekordkursil / Jaana Pikalev
Pikalev, Jaana
2011-01-01
Korea suurim transpordifirma Hanjin Group on huvitatud mitmest Eestist Kesk-Aasiasse liikuva konteinerirongi kasutamise võimalusest. Hiina Fuzhou sadamast väljuvad riikliku firma Sinotransi ekspedeeritavad konteinerid hakkavad liikuma Eesti kaudu
Maailma kõige populaarsemad kirjanikud 2008
2009-01-01
2008. a. igakuiste ilukirjanduse müügiedetabelite analüüsist 9 riigis - USA, Hiina, Hispaania, Holland, Itaalia, Prantsusmaa, Rootsi, Saksamaaa ja Inglismaa (koost. The Bookseller,Publishers Weekly, Livres Hebdo)
2015-01-01
Küsimusele, mis on põhilised teemad, mis pakuvad keskkonnaajaloolastele huvi ja millised on peamised väljakutsed, vastavad keskkonnaajaloolased Austria, Aafrika, Hiina, Austraalia, USA,Colombia, Iisraeli ja India ülikoolidest
Leedu päritolu kasiinoärimees püsib rikkuselt kolmanda ameeriklasena / Erik Aru
Aru, Erik
2006-01-01
Väidetavalt Leedu päritolu kasiinoärimehest Sheldon Adelsonist, tema rivaliteedist Steve Wynniga, nende tegevus Hiina Rahvavabariigi territooriumil Macaos. Lisa: Las Vegas kolib Aasiasse. Tabel : Las Vegas Sands Corporation
Taiwan püüab arendada suhteid Aafrika maadega / Allan Espenberg
Espenberg, Allan
2007-01-01
Taibeis toimus Aafrika maade ja Taiwani esimene tippkohtumine ning tööstus- ja kaubandusringkondade Taiwani-Aafrika progressiivse partnerluse foorum, põhiteemaks "Heaolu ja säästev areng". Hiina pahameel
Hiinlane, kes leidis Tallinnast linnahalli / Eda Post
Post, Eda, 1983-
2007-01-01
Tallinna Tehnikakõrgkooli konverentsi "Linn kui elukeskkond" peaesineja Hiina arhitekt Chi Ti-Nan (s. 1957) korraldas üliõpilastega töötoa, et leida uusi ideid Tallinna Linnahalli elavdamiseks ja rakenduseks
Hiinlased seljatasid Bank of America / Tarvo Vaarmets
Vaarmets, Tarvo
2007-01-01
Hiina suurpanga Industrial & Commercial Bank of China (ICBC) aktsia hind kerkis Shangai börsil 5,5 protsendi võrra. Diagramm: ICBC aktsia hind; Tabel: 10 suurimat panka maailmas. Kommenteerib Romet Kreek
Tunda ära korratamatut = Recognizing the unrepeatable / Kaja Pae
Pae, Kaja
2011-01-01
Ruumiplaneerimisest. Linnaplaneerimisest 20. sajandil. Fredric Jamesoni düstoopia kontseptsioonist. Ehitusbuumiaegsest ehitusest Hiina näitel. Monumentaalsetest linnaehitusprogrammidest. Ehitusbuumiaegses Eestis tekkinud ruumilisest situatsioonist. Linna tihedusest, spontaansest ruumist. Avaliku ruumi kasutamisest. Kirjeldamatuse ilmingust
Karnau, Andrus
2010-01-01
1. jaanuaril liitub Eesti euroga. Eesti majandusest. Maailmas on käimas kolm valuutasõda: Hiina jeeni ümber, maailma rikkamate riikide keskpankade ümber ja arenevate riikide valitsuste valuutainterventsioonide ümber
Kevadet tervitavad suupisted / Agnes Männe
Männe, Agnes
2016-01-01
Hiina idapiirkonnast pärit kevadrullide valmistamise õpetus: värsked vegan kevadrullid riisipaberiga (kuumtöötluseta), banaani kevadrull filotainaga (ahjus küpsetatud), vürtsikad kanaliha kevadrullid filotaignas (friteeritud)
Hiinlased upitavad Venezuelat kosmosesse / Allan Espenberg
Espenberg, Allan
2005-01-01
Mullu kirjutasid Venezuela ja Hiina on alla kirjutanud kosmosekokkuleppele, lisaks sõlmiti veel kümmekond lepingut kahepoolsete sidemete tihendamiseks põllumajanduses, mäetööstuses, transpordis, energeetikas, telekommunikatsioonis ja turismis
Sõbrad hukkusid Iisraeli pommide all / Allar Viivik
Viivik, Allar
2006-01-01
ÜRO rahuvalvevägedes teeniv Madis Morel Iisraeli rünnakust kolleegide tugipunktile Lõuna-Liibanonis, kus hukkusid Austria, Hiina, Kanada ja Soome rahuvaatleja. Kaart: Iisraeli rünnakus hukkus Khiamis neli sinikiivrit
Indiast saab maailma rahvarohkeim riik / Tõnu Prei
Prei, Tõnu, 1950-
2005-01-01
ÜRO rahvastikuraporti andmeil on maakera elanike arv 2050. a. 9,1 miljardit, kusjuures poole 2,6-miljardilisest juurdekasvust annavad vaid 9 riiki - India, Pakistan, Nigeeria, Kongo, Bangladesh, Uganda, USA, Etioopia ja Hiina
New World species of the genus Calliscelio Ashmead (Hymenoptera, Platygastridae, Scelioninae
Directory of Open Access Journals (Sweden)
Hua-yan Chen
2017-01-01
Full Text Available The genus Calliscelio Ashmead is presumed to be a diverse group of parasitoids of the eggs of crickets (Orthoptera: Gryllidae. A least one species has been found to be an important factor in depressing cricket pest populations. The New World species of Calliscelio are revised. Forty-two species are recognized, 3 are redescribed: C. bisulcatus (Kieffer, C. laticinctus Ashmead, C. rubriclavus (Ashmead, comb. n.; and 38 are described as new: C. absconditum Chen & Johnson, sp. n., C. absum Chen & Johnson, sp. n., C. alcoa Chen & Masner, sp. n., C. amadoi Chen & Johnson, sp. n., C. armila Chen & Masner, sp. n., C. bidens Chen & Masner, sp. n., C. brachys Chen & Johnson, sp. n., C. brevinotaulus Chen & Johnson, sp. n., C. brevitas Chen & Johnson, sp. n., C. carinigena Chen & Johnson, sp. n., C. crater Chen & Johnson, sp. n., C. crena Chen & Johnson, sp. n., C. eboris Chen & Johnson, sp. n., C. extenuatus Chen & Johnson, sp. n., C. flavicauda Chen & Johnson, sp. n., C. foveolatus Chen & Johnson, sp. n., C. gatineau Chen & Johnson, sp. n., C. glaber Chen & Masner, sp. n., C. granulatus Chen & Masner, sp. n., C. latifrons Chen & Johnson, sp. n., C. levis Chen & Johnson, sp. n., C. longius Chen & Johnson, sp. n., C. magnificus Chen & Masner, sp. n., C. migma Chen & Johnson, sp. n., C. minutia Chen & Johnson, sp. n., C. paraglaber Chen & Johnson, sp. n., C. pararemigio Chen & Masner, sp. n., C. prolixus Chen & Johnson, sp. n., C. punctatifrons Chen & Johnson, sp. n., C. remigio Chen & Masner, sp. n., C. ruga Chen & Johnson, sp. n., C. rugicoxa Chen & Masner, sp. n., C. sfina Chen & Johnson, sp. n., C. storea Chen & Johnson, sp. n., C. suni Chen & Johnson, sp. n., C. telum Chen & Johnson, sp. n., C. torqueo Chen & Johnson, sp. n., C. virga Chen & Johnson, sp. n. Four species are treated as junior synonyms of Calliscelio rubriclavus (Ashmead: Anteris nigriceps Ashmead, syn. n., Caloteleia marlattii Ashmead, syn. n., Caloteleia grenadensis Ashmead, syn. n
2006-01-01
Nn tuuma klubi liikmed USA, Venemaa (NSVL järglane), Suurbritannia, Prantsusmaa ja Hiina, tuumarelva leviku piiramise leping, strateegiliste ja taktikaliste tuumalõhkepeade omanikud, riigid, kus tegeldakse tuumarelvade väljatöötamisega
Oodatud terminal lubab transiidiärile häid aegu / Lauri Linnamäe
Linnamäe, Lauri
2008-01-01
Muugale rajatavast konteinervedude terminalist saaks rahvusvahelise kaubanduse sõlmpunkt, mis elavdab kaubandust Läänemere äärsetes sadamates, uus terminal avaks läbi Eesti Hiina kaupade transiidi Venemaale. Kaart: Otsetee Hiinast Eestisse
Restoran Cha Dao = Restaurant Cha Dao
2012-01-01
Tallinnas Suur-Patarei 2 asuva Hiina restorani Cha Dao sisekujundusest. Restorani mööbel, v.a toolid, projekteeriti eritellimusena. Sisearhitekt Dmitri Pisarenko (DM3 OÜ), loetletud tema töid. Arhitekt Meeli Truu
Ermel, Aare, 1957-2013
2006-01-01
Kolmest iseseisvast armastusloost koosnev episoodfilm "Eros" : režissöörid Wong Kar-Wai ("Käsi"), Steven Soderbergh ("Tasakaal" / "Equilibrium"), Michelangelo Antonioni ("Asjade ohtlik käik") : Hongkong - Hiina - USA - Prantsuse - Itaalia 2004
Uued videod ja DVD-d / Tiit Tuumalu
Tuumalu, Tiit, 1971-
2007-01-01
Hiina võitluskunstide film "Seitse mõõka" (režii Tsui Hark), USA õudusfilm "100 laiba maja" (Rob Zombie), Suurbritannia - Prantsusmaa komöödiafilm "Olla Stanley Kubrick" (Alan Conway, peaosas John Malkovich)
Eesti saadab EXPO-le hoiupõrsad / Vahur Koorits
Koorits, Vahur, 1981-
2009-01-01
2010. aasta EXPO toimub Hiinas Shanghais, teemaks "Parem linn, parem elu". Eesti paviljoni ideekonkursi võitis Illimar Truverki, Andres Labi, Janno Roosi, Ionel Lehari, Priit Hameri ja Kristian Paljasma töö "Savecity.org"
Suurlinnaelu ilu ja valu : uus millennium - linnastumise ajajärk / Ragne Nukk
Nukk, Ragne, 1984-
2011-01-01
Rahvusvaheline fotonäitus "Metropol - suurlinnaelu linnaajastul" Eesti Arhitektuurimuuseumis 11. detsembrini 2011. Lühidalt Marcus Koppeni, Yang Yongliangi (Hiina), Ivan Mihhailovi (Venemaa), Hans Wilschuti, Christoph Gieleni (Ameerika) töödest. Globaliseerumisest ja linnastumisest
Klein, Naomi
2008-01-01
Energia kallinemise ja veokulude suurenemisega aeglustub globaliseerumine, Hiina muutub tarbimiskapitalismi omaksvõtuga sarnasemaks läänega ning lääs sarnaneb üha enam Hiinaga seoses kodanike vabaduse ohverdamisega jälgimistegevusele
Tiibeti toetajad petsid Gerd Kanterilt allkirja välja / Henrik Kalmet
Kalmet, Henrik
2008-01-01
Kettaheite maailmameister Gerd Kanteri allkiri seisis paljude teiste olümpialaste omade seas veebilehel "Sport for peace" ehk "Sport rahu eest" avaldatud pöördumise järel, mis oli mõeldud Hiina presidendile
Prizõ "Tjomnõhh notshei" ushli aziatam
2005-01-01
Auhinnad IX PÖFFi Euraasia võistlusprogrammi filmidele. Grand prix läks hiina filmile "Shanghai unistus" (režii Wang Xiaoshuai), eesti ajakirjanikud pidasid parimaks vene filmi "Garpastum" (režii Aleksei German jun)
Autoritaarse kapitalismi pealetung / Timothy Garton Ash ; tõlk. Priit Simson
Garton Ash, Timothy, 1955-
2008-01-01
Autor on seisukohal, et 8. augustil teatasid oma naasmisest ajalooareenile kaks suurriiki: Venemaa ja Hiina. Nad on esitanud väljakutse läänele ning esindavad alternatiivseid versioone autoritaarsest kapitalismist või kapitalistlikust autoritarismist
Jianmin, Ho
2003-01-01
Ettekanne 3.-4. detsembrini 2003 Tallinnas toimunud rahvusvahelisel konverents-näitusel "Logistics and transport in international trade" teeb ülevaate Hiina majanduslikust arengust, väliskaubanduse olukorrast ning arenguprogrammist logistika ja transpordi valdkonnas.Tabelid
Ameerika jääb number üheks / Robert Kagan ; interv. Eric Follath
Kagan, Robert
2008-01-01
Intervjuus ajakirjale Der Spiegel kõneleb Ameerika neokonservatiivist õpetlane ja John McCaini nõunik Bushi-Cheney aastate pärandist, Ameerika ja selle tulevase presidendi ees seisvatest ülesannetest ning Hiina ja Venemaa kasvavast agressiivsusest
Maailm aastal 2026 / Daniel Franklin
Franklin, Daniel
2005-01-01
Aastaks 2026 ennustatakse, et maailma tugevama majandusega riikideks on Hiina ja USA ning Euroopa majandus hääbub. Diagrammid: SKP 2006/2026 ostujõu pariteedi alusel, % kogu maailmast; SKP 2006/2026 turuvahetuskursi alusel, % kogu maailmast
Changing world, changing security / Jüri Kadak
Kadak, Jüri, 1941-
2004-01-01
Maailma majanduse ja julgeoleku aktuaalsetest probleemidest 21. sajandil. Hiina majanduslikust edust, tuumarelva arengust kolmanda maailma riikides. Terrorismi levikust. Venemaa geograafilis-strateegilise ülemvõimu vähenemisest, riigi partnerlusest Euroopa Liidu ning NATO-ga. Tabelid. Skeemid
Iraanis on soovi korral diplomaatiale ruumi lahedalt / Gwynne Dyer
Dyer, Gwynne
2006-01-01
USA, Suurbritannia ja Prantsusmaa poolt ÜRO Julgeolekunõukogule esitatud resolutsiooniprojekt Iraani tuumaaktsioonide kohta kukutas läbi edasiste läbirääkimiste võimaluse, Venemaa ja Hiina panevad resolutsioonile vältimatult veto
Sukeldumine oma ununenud ellu / Aita Kivi
Kivi, Aita, 1954-
2000-01-01
Sisu : Margaret Atwood. Pinnaletõus; Christine Bückner. Pärast lahutust; Danielle Steel. Kingitus; Judith Michael. Valede võrgus; Salvador DalÍ. Geeniuse päevik; Danielle Steel. Kurjus; Vladimir Megre. Anastasia; Theodora Lau. Hiina horoskoop
2009-01-01
Läti suursaadik Ingrida Levrence avas esimese Double Coffee kohviku Hiina pealinnas Pekingi südames. Rahvusvaheline kohvikukett kavatseb laieneda mõne kohviku võrra igal aastal. Seni tegutsetakse Lätis, Eestis, Leedus, Ukrainas ja Valgevenes
Pekingi kunstielu / Reet Varblane
Varblane, Reet, 1952-
2005-01-01
Peking nüüdiskunsti keskusena. Hiina rahvuskunsti muuseumist (NAMOC), kultuurikeskusest Factory 798, Punase Värava galeriist (juhataja Brian Wallace), rahvusvahelisest kunstilaagrist BIAC (Beijing International Art Camp), East End Art Village'ist, kaasaja kunsti instituudist jm.
Ühendriikide firmad sihivad idaturge / tõlk. Eva Rüütel
2003-01-01
IBM, Veritas, International Data Corp. jt. USA tehnoloogiaettevõtted suunavad oma toodangut Ida-Euroopasse ja Aasiasse, kus Hiina, India ja Lõuna-Korea eeldavad, et kulutused tehnoloogiale kasvavad käesoleval aastal üle kümne protsendi.
Miks me peame Hiinaga hästi läbi saama? / Mart Nutt
Nutt, Mart, 1962-
2011-01-01
Autor märgib, et iseseisvunud Eesti võttis viivitamatult omaks pragmaatilise reaalpoliitika, 1991. a. septembris tunnustas Eesti ühe Hiina poliitikat. Pragmatismi ja väärtuste dilemmas jääb riikide puhul alati peale pragmatism
WTO kõnelused on noateral / Sirje Rank
Rank, Sirje, 1966-
2008-01-01
Maailma Kaubandusorganisatsiooni vabakaubanduse kõnelustel Genfis on Euroopa Liidu ja USA kõrval üha häälekamad ka arenevad riigid eesotsas Brasiilia, Hiina ja Indiaga. USA ja Euroopa Liit tahavad lõpetada igasugused järeleandmised
Connections between corporate social responsibility and innovation climate / Ülle Übius, Ruth Alas
Übius, Ülle
2009-01-01
Innovatsioonikeskkonna ja korporatiivse sotsiaalse vastutuse kahe aspekti vaheliste seoste uuringust, mis viidi läbi Eesti, Hiina, Saksamaa, Soome, Tšehhi, Slovakkia ja Jaapani elektrilis-elektrooniliste masinate jaemüügi ning masinaehitusega tegelevates ettevõtetes. Tabelid, skeem
Eesti ehitusturu kasv tipneb 2006. aastal / Ain Hinsberg
Hinsberg, Ain
2002-01-01
Taanis asuva uuringufirma European Construction Research, mis jälgib ja prognoosib Ida- ja Lääne-Euroopa ning Lähis-Ida, Hiina ja Aasia ehitusturgu, ennustab Eestile jätkuvat kasvu. Diagramm: Eesti ehitusturu areng 1999-2010
8. detsembrini Hiina Vabariigi Taiwani pealinnas...
2002-01-01
Taipei X rahvusvahelisel graafika ja joonistuste biennaalil esindab Eestit Benjamin Vasserman tööga "Haripunkt". Peapreemiad: Vara Chaiyanitaya (Tai), Rensong Pan (joonistuste kategooria, Taiwan). B. Vasserman sai septembris Rumeenias Cluj III rahvusvahelisel väikegraafika biennaalil žürii kiituse. Peapreemia: Vladimir Gazovic (Slovakkia)
Eesti põrsad Hiinas / Janno Roos
Roos, Janno, 1976-
2009-01-01
Shanghai EXPO Eesti paviljoni konkursi võidutööst "Savecity.org". Võidutöö autorid Illimar Truverk AET-Arhitektid, Priit Hamer AET-Arhitektid, Janno Roos Ruumilabor, Andres Labi Ruumilabor, Ionel Lehari Identity, Kristian Paljasma Identity, Meelis Opmann Identity ja Maret Põldre Identity
Koputa end terveks! / Ursula Zimmermann
Zimmermann, Ursula
2015-01-01
Emotsionaalse vabaduse tehnikast (EFT) ehk koputusmeetodist, mis kasutab väga lihtsale eneseanalüüsile ja sisendusele lisaks aastatuhandeid tagasi väljatöötatud traditsioonilisi Hiina akupunktuuri punkte, et keha energiaväljas energia liikuma saada
Kinolevi filme tutvustab Tiit Tuumalu / Tiit Tuumalu
Tuumalu, Tiit, 1971-
2008-01-01
Põnevusfilm "Eela orus" ("In the Valley of Elah") : režissöör Paul Haggis : Ameerika Ühendriigid 2007 ja Wong Kar-Wai mängufilm "Minu mustikakarva ööd" ("My Blueberry Nights") : Hiina - Hongkong - Prantsusmaa 2007
Külalisena üle-aasialisel sümpoosionil / Leida Talts
Talts, Leida
1999-01-01
Hiinas Macao linnas peetud IV rahvusvahelisest Aasia noorsoouuringute sümpoosionist, mille eesmärgiks oli analüüsida muutusi, mis 1990. aastatel on Aasia regiooni sotsiaalmajanduslikus arengus toimunud, pöörates erilist tähelepanu noortele
Стуруа, Мэлор, 1928-
2010-01-01
Hiina skulptoritest Gao Zhenist ja Gao Qiangist, kes esinevad kunstnikunime Gao Vennad (Gao Brothers) all. Vendade dissidentlikust loomingust, nende skulptuurist "Mao süü" (Mao's Guilt), mis kujutab diktaator Mao Zedongi põlvili ja eemaldatava-külgekruvitava peaga
Medvezhja shkura dostalas kitaiskim kinematografistam / Lauri Kärk
Kärk, Lauri, 1954-
2007-01-01
57. Berliini filmifestivali peaauhinna Kuldkaru sai Hiina režissööri Wang Quanani film "Tuya abielu" ("Tuya de hun shi"). Autor oma eelistusest - Sam Garbarski mängufilmist "Irina Palm". Lisatud tähtsamaid auhindu saanute nimekiri
Berlinale karunahk "Tuya abielu" turvamas / Lauri Kärk
Kärk, Lauri, 1954-
2007-01-01
57. Berliini filmifestivali peaauhinna Kuldkaru sai Hiina režissööri Wang Quanani film "Tuya abielu" ("Tuya de hun shi"). Autor oma eelistusest - Sam Garbarski mängufilmist "Irina Palm". Lisatud tähtsamaid auhindu saanute nimekiri
Seadused, mis ajavad naerma / Mariliis Jõras, Riivo Riismaa
Jõras, Mariliis
2008-01-01
Eestis ja teistes riikides kehtinud ja kehtivatest kummalistest liikluseeskirjadest ja -määrustest. Lisatud: Eesti liikluseeskirjad ; Kanada, Ameerika Ühendriigid, Inglismaa, Tšehhi, Luxembourg, Belgia, Sloveenia, Korea, Hispaania, Saudi Araabia, Portugal, Albaania, Hiina, Austraalia, Taani, Horvaatia, Šveits
Erna kostitas Jakobi malevkonna kaitseliitlasi muda, vee ja villidega / Urmas Hännile
Hännile, Urmas
2003-01-01
Pärnumaa maleva liikmete muljeid Erna retkest. Vt. samas intervjuud Erna retke staabiülema, Rootsi Kuningriigi kaitseväe kolonelleitnanti Jaak Kallaku ja Hiina Rahvavabariigi Soome saatkonna sõjaväeatashee, brigaadikindrali Liu Mengiga. Tabel: "Erna Retk 2003"
Tarkvarahiid Microsoft kergitas kogu aasta kasumiootust / Annika Matson
Matson, Annika, 1976-
2006-01-01
Tarkvaratootja Microsoft tõstis pärast kvartalikasumi kasvu kogu jooksva majandusaasta kasumiprognoosi. Diagramm. Vt. samas: Euroopa Liit võib monopoliseisuses Microsofti trahvida kahe miljoni euroga päevas; Hiina ja India võivad piraatlusest loobuda 10 aasta pärast
Kividraakonid ja kuuvärav / Tiina Tammet
Tammet, Tiina, 1971-
2004-01-01
Hiina aiast. Filosoofilisest tagamaast, aiast kui maailmamudelist, majast ja aiast, kividraakonitest ning igavese elu taimedest. Illustratsiooniks 13 fotot Austraalias Sydneys asuvast Sõpruse aiast (Chinese Garden of Friendship), mis on üks suuremaid hiinlaste poolt loodud aedu väljaspool Hiinat
Logistikaärimeeste uues huviorbiidis on Vietnam / Jaana Pikalev
Pikalev, Jaana
2010-01-01
Eesti Logistikaklastri delegatsioon läheb visiidile Vietnami ja Hiinasse. Eesmärk on tutvuda Vietnami turu võimalustega ning luua suhteid Vietnami klientide ja arvamusliidritega. Hiinas külastatakse logistika- ja transpordimessi. Kavas on alla kirjutada koostöömemorandumid
PÖFF käib vaikselt edasi / Margit Adorf
Adorf, Margit, 1974-
2007-01-01
PÖFFi filme: Wong Kar-Wai mängufilm "Mu mustikakarva ööd" ("My Blueberry Nights") : Hongkong - Hiina - Prantsusmaa 2007 ja loodusfilm "Arktika lugu" ("Arctic Tale") : režissöörid Sarah Robertson, Adam Ravetch : Ameerika Ühendriigid 2007
USA investeerimisguru Jim Rogers : ärge kartke investeerida tooraineturule / Romet Kreek
Kreek, Romet, 1972-
2005-01-01
Ilmunud ka: Delovõje Vedomosti 9. märts lk. 25. Varajane huvi tooraineturule investeerimise vastu mängis suurt rolli Jim Rogersi edus hedge fond'i Quantum kaasjuhina. Lisa: Lõigake kasu Hiina kasvust; Kuue aasta eest külastas Eestit
Mida mäletati eelmisel aastalõpul? / Riho Laurisaar
Laurisaar, Riho
2006-01-01
Autor annab ülevaate, millest kirjutati New York Times'i aastalõpuväljaandes Turning Points 2005. aasta lõpul ning sündmusest, mis jäi suurema tähelepanuta - USA naftakompanii UNOCAL ülevõtmisest Hiina riigi poolt
Vostotshnaja granitsa JeS pod kitaiskim rentgenom / Arseni Novenkov
Novenkov, Arseni
2006-01-01
Eesti tollitöötajad ja piirivalvurid said veoste ja muude objektide läbivalgustamiseks kaasaegsed seadmed, mis on valmistanud Hiina firma Nuctech Co Ltd. 49,4 miljoni krooni suuruse kogumaksumuse finantseerivad Eesti riik ja Euroopa Liidu Schengen Facility programm
Meiessaar, Maris
2009-01-01
PÖff-i filmidest - "Merehädaline kuul" (rež. Lee Hey-Jun; Lõuna-Korea), "Nanjing: Elu ja surma linn" (rež. Lu Chuan; Hiina), "Kuu" (rež. Duncan Jones; Suurbritannia), "Rip! A Remix Manifesto" (rež. Brett Gaylor; Kanada)
В Южной Корее вновь пишут о болезни Ким Чен Ира / Эвелин Калдоя
Калдоя, Эвелин, 1980-
2009-01-01
Viidates Lõuna-Korea ja Hiina luureandmetele, väidab Lõuna-Korea meedia, et Põhja-Korea liidril Kim Jong-ilil on kõhunäärmevähk ja talle pole antud elada rohkem kui 5 aastat. Põhja-Korea valitsejadünastia
Lõuna-Korea teatel võib Kim peagi surra / Evelyn Kaldoja
Kaldoja, Evelyn, 1980-
2009-01-01
Viidates Lõuna-Korea ja Hiina luureandmetele, väidab Lõuna-Korea meedia, et Põhja-Korea liidril Kim Jong-ilil on kõhunäärmevähk ja talle pole antud elada rohkem kui 5 aastat. Põhja-Korea valitsejadünastia
2017-10-01
Reports an error in "Is Political Behavior a Viable Coping Strategy to Perceived Organizational Politics? Unveiling the Underlying Resource Dynamics" by Shuhua Sun and Huaizhong Chen ( Journal of Applied Psychology , Advanced Online Publication, May 22, 2017, np). In the article, Table 1 contained a formatting error. Correlation coefficient values in the last four cells of column 6 were misplaced with correlation coefficient values in the last four cells of column 7. All versions of this article have been corrected. (The following abstract of the original article appeared in record 2017-22542-001.) We conduct a theory-driven empirical investigation on whether political behavior, as a coping strategy to perceived organizational politics, creates resource trade-offs in moderating the relationship between perceived organizational politics and task performance. Drawing on conservation of resources theory, we hypothesize that political behavior mitigates the adverse effect of perceived organizational politics on task performance via psychological empowerment, yet exacerbates its adverse effect on task performance via emotional exhaustion. Three-wave multisource data from a sample of 222 employees and their 75 supervisors were collected for hypothesis testing. Findings supported our hypotheses. Our study enhances understandings of the complex resource dynamics of using political behavior to cope with perceived organizational politics and highlights the need to move stress-coping research from a focus on the stress-buffering effect of coping on outcomes to a focus on the underlying competing resource dynamics. (PsycINFO Database Record (c) 2017 APA, all rights reserved).
Veneetsia festivali avab Frida Kahlo eluloofilm / Tiit Tuumalu
Tuumalu, Tiit, 1971-
2002-01-01
Kuu aja pärast algavast Veneetsia 59. filmifestivalist, mille direktor on endine Berliini festivali korraldaja Moritz De Hadeln ja žüriid juhib hiina staar Gong Li. Pikemalt võistlusprogrammi avafilmist "Frida", mille režissööriks on Julie Taymor
Eksootilised maitsed / Sergo Sarapuu
Sarapuu, Sergo
2016-01-01
Eksootilistest taimedest ja viljadest: laimkinkan, sõrmlaim (finger lime), draakonivili, granadill, okra, aed-harakputk, enoki ja Shimeji seened, kurkum, kalgan, lehtkapsas e kale, lootose juur, lilla porgand, kartul `Blue Congo`, roosa-valgetriibuline peet, soolarohi ja paksoi e hiina lehtnaeris ning mini-paksoi
Tsaari-Venemaa spioon sajanditagusel Siiditeel tuletab meelde ajaloo tähtsust / Marje Aksli
Aksli, Marje
2010-01-01
Kanadas elavast väliseesti päritolu ajakirjanikust, kirjanikust ja analüütikust Eric Enno Tammest ja tema raamatust "The Horse that leaps through clouds", milles on juttu spionaažist, Siiditeest ja tänapäeva Hiina tõusust
Shanghai viisik tõrjub sõjakat islamit / Kaivo Kopli
Kopli, Kaivo
2001-01-01
Shanghai viisiku koostööga püüab Hiina tõrjuda ühtaegu nii islamiseparatismi ohtu kui ka USA mõjuvõimu oma kirdepiiridel. Shanghai viisiku tippkohtumisel on oodata Usbekistani võtmist rühmituse kuuendaks liikmeks. Kaart: Shanghai viisik
Tallinna Ülikooli Balti Filmi- ja Meediakool vaatab itta
2007-01-01
Täna antakse Kinomajas avalöök Tallinna Ülikooli Balti Filmi- ja Meediakooli koostööle filmi- ja telekooliga Pekingist. Näha saab Hiina režissööride Xie Fei ja Wu Lani filmi "Hunani tüdruk"
Kriminaalne Hiinamaa / Mart Juur
Juur, Mart, 1964-
2006-01-01
Arvustus: Gulik, Robert van. Hiina järvemõrvad : kohtunik Di lahendab kolm juhtumit : [romaan] / inglise keelest tõlkinud Kersti Unt ; illustreeritud kaheteistkümne hiinapärase graafilise lehega autorilt. [Tallinn] : Tänapäev, 2006. (Kohtunik Di mõrvamüsteerium)
Premium Motorsi priimad päevad / Raigo Neudorf
Neudorf, Raigo
2007-01-01
Automüüja Premium Motors on edu saavutanud luksusmaasturi Hummer ning teiste USA eksklusiivsete automarkide müügiõigusega. Tabel: Rentaabel äri. Vt. samas: Palun kaks roosat Hummerit; Premium Motors hakkab sügisel Hiina maastureid müüma.
Kõik ei ole päris nii, nagu paistab / Reet Varblane
Varblane, Reet, 1952-
2007-01-01
Hiina nüüdiskunsti näitus "Linnailmed / City Expressions" (koostööprojekt Guangzhou kunstiakadeemia muuseumiga) Tallinna Kunstihoones kuni 28. I ja aafrika nüüdiskunsti näitus "Aafrika. Taassegu / Africa. Remix" Stockholmi Moderna Museet'is kuni 14. I
Appi! Mida ette võtta? / Siret Seeder
Seeder, Siret
2009-01-01
Harmooniaõpetus feng shui on Hiina filosoofia haru, mille kohaselt on võimalik inimest ümbritsevate ja temas toimivale energiate harmoniseerimise abil luua selline elutee nagu soovime. Ühe abivahendina kasutatakse ruumi. Spetsialist Siret Seeder tutvustab intuitiivse e vormikoolkonna bagua 8 tsooni teooriat
Hallipäiste leegionid tulevad / Carolyn Moynihan ; tõlk. Ingrid Vooglaid
Moynihan, Carolyn
2007-01-01
Globaalsest vananemisest, Jaapani elanikkonna vananemisest ja vähenemisest. Autor leiab, et Lääs vajab üha rohkem tööjõudu teiste rahvaste hulgast ning õigus võib olla neil, kelle arvates võib Euroopa muutuda "Euraabiaks". Hiina ees seisvast vananemiskriisist
Sigaretitootmine koondub aina väiksema hulga suurfirmade kätte / Erik Aru
Aru, Erik
2007-01-01
Lääne suurimad sigaretitootjad ei pääse Hiina turule, kus tarbitakse umbes 30% maailma toodangust. Maailma neljas sigaretitootja Briti Imperial Tobacco kavandab tööstusharu kuuenda numbri, Altadise omandamist. Sigarettide levik Euroopas 19. ja 20. sajandil. Lisa: Läänemaailma suurimad
Pavljuk, Semjon
2013-01-01
Lühitutvustus ja soovitusi Pekingi põhiliste vaatamisväärsuste külastamiseks - Tian'anmeni (Taevase Rahu) väljak, Keelatud linn, Suur Hiina müür, Suvepalee, restoran Peking Duck, olümpiapark, öine turg ja rahvustoit bāozi
Bagatellid : maailm / Mirjam Tally
Tally, Mirjam, 1976-
2008-01-01
Helilooja Judith Weir sai Briti maineka autasu. Daniel Barenboim võttis Palestiina kodakondsuse. Portos keskendutakse sel aastal Põhjamaade muusikale. Wigmore Halli resideerivaks heliloojaks sai Luke Bedford. Sony Classics annab välja Glenn Gouldi eksklusiivse "Kogutud teosed". Tõusev täht - hiina naisdirigent Xian Zhang
Tartu- ja Viljandimaa 2025 : Nobeli preemia, tuumajaam ja laevaühendus Peterburiga / Rein Sikk
Sikk, Rein, 1961-
2014-01-01
Milline võiks olla elu peaga Eestis ehk Tartu ja Viljandi maakondades aastal 2025? Kas Võrtsjärve veerde tuleb tuumajaam? Kas Tartust saab laevaga Peterburi? Kas Viljandi folk püsib või kaob? Kas Salvest murrab Hiina turule? Küsimustele vastasid 14 asjatundjat
Põhja-Korea tuumasoovi üle räägitakse jälle läbi / Liisi Poll
Poll, Liisi, 1980-
2007-01-01
Ilmunud ka: Postimees : na russkom jazõke, 9. veebr, 2007, lk. 13. 8. veebruaril jätkusid pärast pikka pausi Põhja-Korea, Lõuna-Korea, USA, Jaapani, Hiina ja Venemaa läbirääkimised, sundimaks Põhja-Koread loobuma tuumaprogrammist. Lisa: Tuumarelvaga paariariik
USA-ga kokku leppinud Põhja-Korea lubas lõpetada tuumarelvastumise / Kaivo Kopli
Kopli, Kaivo
2005-01-01
Põhja-Korea nõustus peale kaht aastat kestnud läbirääkimisi loobuma oma tuumaprogrammist ja -relvadest. Läbirääkimiste ülejäänud osalised - Hiina, USA, Lõuna-Korea, Venemaa ja Jaapan - lubasid Põhja-Koreale vastutasuks energiaabi ja julgeolekutagatisi
Biennaalitsirkus, biennaalileib / Katrin Kivimaa
Kivimaa, Katrin, 1969-
2007-01-01
52. Veneetsia biennaalist. Eesti paviljonis esineb Marko Mäetamm näitusega "I love my family". Lähemalt prantsuse kunstniku Sophie Calle ja inglise kunstniku Tracey Emini töödest. Hiina kunstnike Yang Fudongi filmist "Seitse intellektuaali bambusmetsas" ja Yang Zhenzhongi videoinstallatsioonist "I Will Die"
Aasia tiigrid on tagasi jalul / Sirje Rank
Rank, Sirje, 1966-
2007-01-01
Aasia on 1997. aastal puhkenud majanduskriisist toibunud ning valitsemas on uus buum, kus majanduskasv on maailma kõige kiiremaid, kuid kasvu keskmes on uued riigid - India, Hiina ja Vietnam. Diagramm: Aasia kriis kukutas valuutasid ja börse. Vt. samas: Balti tiigrid Euroopa Liidu kaitsva vihmavarju all
Naftakartell hädas kasvanud nõudluse rahuldamisega / Tõnis Oja
Oja, Tõnis, 1957-
2004-01-01
Vaatamata OPEC-i otsusele suurendada naftatootmist 2 miljoni barreli võrra ööpäevas, on eelkõige Hiina kiire majanduskasvu ja USA tarbimise püsiva suurenemise tõttu nõudlus jätkuvalt pakkumisest suurem. Diagramm: OPEC loodab toodangukvootide suurendamisega nafta hinnatõusu peatada
Kopenhaagen 2009 - kohtumine, mis peaks päästma maailma / Heiki Suurkask
Suurkask, Heiki, 1972-
2009-01-01
Põhjustest, miks ei ole häid väljavaateid saavutada Kopenhaagenis uus kliimamuutusi pidurdav kokkulepe. Hiina on kasvatanud CO₂ emissiooni võrreldes 1990. a. seisuga 153%, kuid kavatseb vähendada vaid heitgaaside koguse suhet oma SKT-sse, samas on plaanis tööstustoodangut kahekordistada
Igas riigis omad probleemid ja omad lahendused / Herb Brody ; tõlk. Peeter Peetersoo
Brody, Herb
2005-01-01
Brasiilia, Hiina, Tšiili, Saksamaa, Lõuna-Aafrika Vabariigi, Hollandi ja Ameerika Ühendriikide ajakirjanikud ning Technology Review toimetajad annavad ülevaate nimetatud riikides arendatavatest tehnoloogilistest projektidest, mis on kohalikele majandustele olulisimad. Lisatud statistilised lühiülevaaded tähtsamatest tehnoloogiasektoritest. Lisa: Ülemaailmne tehnoloogia arvudes
Helen Mirren krooniti Veneetsias kuningannaks / Triin Tael
Tael, Triin
2006-01-01
Näitleja võitis parima naisnäitleja auhinna Elizabet II rolliga Stephen Frears'i filmis "Kuninganna" ("The Queen"). Parima filmi peaauhind Kuldlõvi läks Hiina režissööri Jia Zhang-Ke filmile "Vaikelu" ("Dong"). Ka teistest Veneetsia 63. filmifestivali võitjatest
Õnnitlused Vabariigi Presidendile ja eesti rahvale Eesti Vabariigi 75. aastapäeva puhul
1993-01-01
Boriss Jeltsin, kuninganna Elisabeth, kuninganna Margrethe, kuningas Carl Gustaf, M. Koivisto, Th. Klestil (Austria Vabariigi Liidupresident), Yang Shangkun (Hiina Rahvavabariigi President), Shanker Daval Sharma, kuningas Baudouin, A. Ogi (Šveitsi Konföderatsiooni President), kuningas Harald, patriarh Aleksius. Ilmunud ka: Päevaleht 26. veebr. lk. 1
Kaletsky, Anatole
2010-01-01
Davosi majandusfoorumil väljaütlemata jäänud seisukohast, mille järgi Lääs seisab väljakutse ees luua uus kapitalismiversioon, mis oleks kohastunud 21. sajandi vajadustega ning eriti võitlusega Hiina dünaamilise ja enesekindla autoritaarse süsteemiga
Tiibeti viimane võimalus / Roy Strider
Strider, Roy, 1974-
2008-01-01
Tiibeti väljaõppeta vabadusvõitlejate-meeleavaldajate piinamistest hiinlaste poolt, Hiina võimude taktikast konflikti lahendamisel. Tiibeti ülestõusu peaeesmärgiks on oma jõuriismeid kokku võttes tõmmata maailma tähelepanu kultuurilisele ja füüsilisele genotsiidile, kirjutab autor
Vanuatu-Taiwani sõprus masendab Hiinat / Allan Espenberg
Espenberg, Allan
2004-01-01
Taiwan hakkab laiendama ja tihendama majanduslikku, tehnilist, turismi- ja põllumajandusalast koostööd Vanuatuga. Hiina kasutab suhtlemisel maailma riikidega vastavalt vajadusele survepoliitikat eeskätt majanduse ja rahanduse vallas ning pakub riikidele Taiwaniga suhtlemise lõpetamise eest erinevat finants- ja majandusabi. Lisa: Vanuatu vabariik
Geopoliitika 2026. aastal / Urmas Kiil
Kiil, Urmas
2006-01-01
Londonis asuva uurimiskeskuse Center for European Reform välispoliitika osakonna juhataja Mark Leonardi väitel areneb lähitulevikus maailm mitmepolaarsuse suunas ning tulevikumaailmas konkureerib võimu ja mõjujõu pärast neli võimupiirkonda - Ameerika, Euroopa, Venemaa-Hiina ning religioossed mõjutsoonid
"Jade Warrior" sai Hispaanias kolm preemiat
2007-01-01
Eesti osalusega Soome-Hiina kung fu film "Igavese armastuse sõdalane - Jade Warrior" võitis 1. Ibiza ja Formentera filmifestivalil kolm Falco d'Ori auhinda (AJ Annila - parim debüüt-lavastaja, Jukka Uusitalo - filmikunstniku töö eest, Henri Blomberg - operaatritöö eest)
Schmutz, J.A.; Laing, K.K.
2002-01-01
Broods of geese spend time feeding according to availability and quality of food plants, subject to inherent foraging and digestive constraints. We studied behavioral patterns of broods of Emperor Geese (Chen canagica) on the Yukon–Kuskokwim Delta, Alaska, and examined how feeding and alert behavior varied in relation to habitat and goose density. During 1994–1996, time spent feeding by Emperor Goose goslings and adult females was positively related to multispecies goose densities near observation blinds, and not to just Emperor Goose density. Similarly, body mass of Emperor Goose goslings was more strongly related (negatively) to multispecies goose densities than intraspecific densities. A grazing experiment in 1995 indicated that most above ground primary production by Carex subspathacea, a preferred food plant, was consumed by grazing geese. Those results demonstrate that interspecific competition for food occurred, with greatest support for goslings whose behavioral repertoire is limited primarily to feeding, digesting, and resting. Although the more abundant Cackling Canada Geese (Branta canadensis minima) differed from Emperor Geese in their preferred use of habitats during brooding rearing (Schmutz 2001), the two species occurred in equal abundance in habitats preferred by Emperor Goose broods. Thus, Cackling Canada Geese were a numerically significant competitor with Emperor Geese. Comparing these results to an earlier study, time spent feeding by goslings, adult females, and adult males were greater during 1993–1996 than during 1985–1986. During the interval between those studies, densities of Cackling Canada Geese increased two to three times whereas Emperor Goose numbers remained approximately stable, which implies that interspecific competition affected foraging behavior over a long time period. These density-dependent changes in foraging behavior and body mass indicate that interspecific competition affects nutrient acquisition and gosling
Taustast. "Muumia" sündis vaarao hauakambris / Kristiina Davidjants
Davidjants, Kristiina, 1974-
2008-01-01
Mängufilm "Muumia: draakonkeisri hauakamber" ("The Mummy: Tomg of the Drago Emperor") : režissöör Rob Cohen : Ameerika Ühendriigid - Kanada - Saksamaa - Hiina 2008. Esimesest samateemalisest filmist "Muumia" : produtsent Carl Laemmle : režissöör Karl Freund : peaosas Boris Karloff : Ameerika Ühendriigid 1932
Otto von Habsburg : III maailmasõda on läbi / Otto von Habsburg ; interv. Marianne Mikko
Habsburg, Otto von, 1912-2011
2002-01-01
Otto von Habsburg vastab küsimustele, mis puudutavad Euroopa konvendi presidendi teadet, et Türgi koht ei ole EL-is, Iraagi võimalikku ründamist, Hiina ja Venemaa suhteid, Tšetšeeniat, tshetsheene ja terrorismi, Venemaa, EL-i ja USA suhteid, III maailmasõda, Eesti Vabariigi tulevikku
Damrosch, David
2007-01-01
Johann Wolfgang von Goethe erasekretäri Peter Eckermanni teosest "Vestlused Goethega tema elu viimastel aastatel", Goethe vaadetest kirjandusele, maailmakirjanduse mõisest. Ka kirjanduse tõlkimisest tänapäeval, sinoloog Stephen Oweni vaadetest ja hiina luuletaja Bei Dao luulest. Artikkel sisaldab ka Bei Dao luuletuste näiteid
Usmirenije Severnoi Korei / Joseph S. Nye ; tõlk. Nikolai Zhdanovitsh
Nye, Joseph S.
2006-01-01
USA president George Bush lootis, et tal õnnestub Põhja-Korea tuumaprobleemi lahendada režiimi vahetamisega. Arvestati, et isolatsioon ja sanktsioonid viivad Kim Jong Il'i diktatuuri kukutamiseni. Kuna režiim osutus vastupidavaks, nõustuti kuuepoolsete läbirääkimistega Hiina, Venemaa, Jaapani ja mõlema Koreaga
Mannheimis võitis film kodututest lastest / Annika Koppel
Koppel, Annika
2002-01-01
Mannheimi-Heidelbergi 51. filmifestival Saksamaal, kus peaauhinna võitis prantsuse režissööri Christophe Ruggia "Põrgulised" ("Les Diables") ja FIPRESCI ja R:W: Fassbinderi auhinna 9 norra noore režissööri poliitiline pilakomöödia "Enamik inimesi elab Hiinas" ("Folk flest bor I Kina")
Gasellid ja kilpkonnad / Hans-Werner Sinn
Sinn, Hans-Werner, 1948-
2010-01-01
Müncheni ülikooli professori sõnul on maailm praegu jagunenud kaheks riikide rühmaks - üks on teel jõulise taastumise poole, teine annab märku uutest probleemidest. Esimesse kuuluvad Brasiilia, Venemaa, India ja Hiina, teises rühmas on võlaprobleemidega riigid eesotsas USA-ga. Euroopa riikidest
Armastuse feng shui / Peeter Rüberg
Rüberg, Peeter
2000-01-01
Järg Jan/13;20;27/Feb/3;10;17;23/Mar/2;9;16 ;30/Apr/13/May/4;11 lk. 22;38;56;70;87;102;118;134;150;166;198;230;278 ;296Vanal hiina kodu- ja elukunstil on igaks armuelu juhtumiks varuks praktilisi nõuandeid ja võtteid
Berlinalel hõrku kinokunsti maitsmas / Annika Koppel
Koppel, Annika
2007-01-01
57. Berliini filmifestivali auhinnatud filmidest. Peaauhind Kuldkaru - hiina režissööri Wang Quanani film "Tuya abielu" ("Tuya de hun shi"), parima režissööri Hõbekaru - iisraellane Joseph Cedar ("Beafort"), parim meesnäitleja - Julio Chavez (Ariel Rotteri "Teine"), parim naisnäitleja - Nina Hossa (Christian Petzoldi "Yella")
Autoritaarsete kapitalistide tagasitulek / Azar Gat ; tõlk. Kajar Pruul
Gat, Azar
2008-01-01
Mittedemokraatlike suurriikide Venemaa ja Hiina esilekerkimine võib ohustada liberaalse demokraatia juhtivat rolli maailmas. Autor nendib, et nii, nagu kogu 20. sajandi kestel, on ka edaspidi Ameerika Ühendriigid tähtsaim tagatis sellele, et liberaalset demokraatiat ei surutaks kaitseseisundisse ega pagendataks kergesti rünnatavale positsioonile rahvusvahelise süsteemi perifeerias
Inetu pardipoja juubel / Tõnu Ojala
Ojala, Tõnu, 1969-
2008-01-01
Oktoober tehnika ajaloos: 7. oktoobril 1948 tegi oma debüüdi Pariisi autonäitusel Citroën 2CV. 15. oktoobril 2003. aastal saatis Hiina kosmosesse sõjaväelenduri Yang Liwei. 11. oktoobril 1968. a startis esimene mehitatud Apollo-missioon. 1. oktoobril 1908. aastal jõudis Ameerikas turule Ford-T
O'Neill: majanduse uut tõusu hakkavad vedama 15 riiki
2010-01-01
Goldman Sachsi varahalduse juhi Jim O'Neilli hinnangul kujuneb keskmise ja suure tulu saajate arvu dramaatiline kasv BRIC-riikides (Brasiilia, Venemaa, India, Hiina) ja N-11 riikides (Mehhiko, Türgi, Korea, Iraan, Egiptus, Nigeeria, Pakistan, Filipiinid, Bangladesh, Vietnam) suurimaks tarbimist vedavaks jõuks maailmas lähema 10 aasta jooksul ja sealt edasi
Directory of Open Access Journals (Sweden)
Li Xi-Ying
2013-02-01
postpectalis sp. n. are described. All species are illustrated and keyed. In total 30 species of Opiinae are sequenced and the cladograms are presented. Neopius Gahan, 1917, Opiognathus Fischer, 1972, Opiostomus Fischer, 1972, and Rhogadopsis Brèthes, 1913, are treated as a valid genera based on molecular and morphological differences. Opius vittata Chen & Weng, 2005 (not Opius vittatus Ruschka, 1915, O. ambiguus Weng & Chen, 2005 (not Wesmael, 1835 and O. mitis Chen & Weng, 2005 (not Fischer, 1963 are primary homonyms and are renamed into Phaedrotoma depressa Li & van Achterberg, nom. n., Opius cheni Li & van Achterberg, nom. n. and O. wengi Li & van Achterberg, nom. n., respectively. Phaedrotoma terga (Chen & Weng, 2005 comb. n., Diachasmimorpha longicaudata (Ashmead, 1905 and Biosteres pavitita Chen & Weng, 2005, are reported new for Hunan, Opiostomus aureliae (Fischer, 1957 comb. n. is new for China and Hunan; Xynobius maculipennis (Enderlein, 1912 comb. n. is new for Hunan and continental China and Rhogadopsis longuria (Chen & Weng, 2005 comb. n. is new for Hunan. The following new combinations are given: Apodesmia puncta (Weng & Chen, 2005 comb. n., A. tracta (Weng & Chen, 2005 comb. n., Areotetes laevigatus (Weng & Chen, 2005 comb. n., Phaedrotoma dimidia (Chen & Weng, 2005 comb. n., P. improcera (Weng & Chen, 2005 comb. n., P. amputata (Weng & Chen, 2005 comb. n., P. larga (Weng & Chen, 2005 comb. n., P. osculas (Weng & Chen, 2005 comb. n., P. postuma (Chen & Weng, 2005 comb. n., P. rugulosa (Chen & Weng, 2005 comb. n., P. tabularis (Weng & Chen, 2005 comb. n., Rhogadopsis apii (Chen & Weng, 2005 comb. n., R. dimidia (Chen & Weng, 2005 comb. n., R. diutia (Chen & Weng, 2005 comb. n., R. longuria (Chen & Weng, 2005 comb. n., R. pratellae (Weng & Chen, 2005 comb. n., R. pratensis (Weng & Chen, 2005 comb. n., R. sculpta (Chen & Weng, 2005 comb. n., R. sulcifer (Fischer, 1975 comb. n., R. tabidula (Weng & Chen, 2005 comb. n., Xynobius complexus (Weng & Chen, 2005 comb. n
Baidu.com ajas investorid hulluks / Raivo Sormunen
Sormunen, Raivo, 1976-
2005-01-01
Maailma kasutatavuse poolest kuuenda Hiina Interneti otsingumootori aktsia tõusis kohe peale avalikku esmaemissiooni päevaga 354%, mis on suurim hinnatõus mitte-USA aktsiate hulgas läbi ajaloo. Diagramm: Baidu.com aktsia meeletus kõikumises. Lisa: Baidu.com - väike hiiglasuur ettevõte. Vt. samas: Baidu on ülisuure riski otsijale
Eesti tahab Aasia paisuvast pirukast oma osa haugata / Adele Pao
Pao, Adele
2011-01-01
Majandus- ja kommunikatsiooniministeeriumis on valmimas programm, mille sihiks on suurendada eksporti Aasia riikidesse ja suurendada Eesti atraktiivsust sealsete investorite silmis. Arengufond töötab Eesti ja India majandusssuhete kallal, Kaubandus-Tööstuskoda püüab Hiina turu suhtes leida ühist keelt Rootsi ja Soome partneritega. Diagramm: Aasia riikide kasvuootused Europast suuremad
S&P: meie kohus oli USA riigireitingut alandada / Heiki Suurkask
Suurkask, Heiki, 1972-
2011-01-01
Standard & Poor´s langetas USA reitingut tasemelt AAA tasemeni AA+. Agentuuri esindaja sõnul oli reitingu alandamine nende kohustus, sest nende arvates oli USA senine reiting liiga kõrge. Hiina nõuab, et USA hakkaks oma võlaprobleemiga tegelema. AAA reiting on nüüd vaid 15 riigil või territooriumil maailmas
PÖFFil võidutses Aasia / Tiit Tuumalu
Tuumalu, Tiit, 1971-
2005-01-01
Auhinnad IX PÖFFi Euraasia võistlusprogrammi filmidele. Grand prix läks hiina filmile "Shanghai unistus" (režii Wang Xiaoshuai). Žürii liikmed Eva Isaksen, Thomas Mauch, Jaak Allik, Sven Grünberg avaldavad lühiarvamusi. Lisatud nimekiri "9. Pimedate Ööde filmifestival andis välja järgmised auhinnad"
Võistluskavade parimad said eile pärjatud / Andres Laasik
Laasik, Andres, 1960-2016
2011-01-01
15. Pimedate Ööde Filmifestivali võitjatest. Parim Euraasia film "Lihtne elu" (režissöör Ann Hui, Hiina), parim režissöör Lynne Ramsay ("Me peame Kevinist rääkima", Suurbritannia). Balti filmide konkursil parim Eesti film "Surnuaiavahi tütar", parim operaator Mart Taniel ("Idioot", Eesti). Auhindade võitjad loetletud
Mälupuutuja puudutus / Reet Varblane
Varblane, Reet, 1952-
1998-01-01
Ando Keskküla kuraatornäitus "Puutujad" Tallinna Kunstihoones, näituse lähtekohtadest. Moskvalaste AESi rühmituse (Tatjana Arzamazova, Lev Jevzotovitch, Jevgeni Svjatski), hiina kunstniku Zhang¡Dali, Teemu Mäki, vene kunstniku Juri Alberti, Izabella Gustowska, Saara Ekströmi, Mart Viljuse töödest, poola kunstniku Maciej Toporowiczi videost "Kinnisidee".
Kuhu küll raha kasvama panna? / Silvia Viidik
Viidik, Silvia, 1972-
2010-01-01
Bloomberg korraldas oma kõige professionaalsemate klientide küsitluse parimate ja halvimate investeerimisvõimaluste väljaselgitamiseks. Küsitluse kohaselt on parimad investeerimise sihtkohad Brasiilia, Hiina ja India, mõnevõrra vähem eelistatakse USA-d. Kehvemateks piirkondadeks peeti Euroopa Liitu, Jaapanit, Suurbritanniat ja ka USA-d. Enim võib teenida aktsiaturgudel ja toorainetes
Suur kera väikese sees / Kalju Kruusa
Kruusa, Kalju, pseud., 1973-
2010-01-01
Tutvustus: Hullunud pilv / Ikkyū Sōjun ; klassikalisest hiina keelest tõlkinud ja kommenteerinud Rein Raud. Tallinn : TLU Press, 2010 ; Lind tulemäe kohal : valik XX sajandi teise poole türgi luulet / tõlkinud Andres Ehin ja Ly Seppel. Tallinn : Kultuurileht, 2010 ; Narain, Kunwar. See ainuke maailm : valitud luuletused. Lelle : Allikaääre, 2010
2008. aasta menukaimad / Udo Uibo
Uibo, Udo, 1956-
2009-01-01
2008. aasta raamatumüügi tulemustest, mulluste menukamate kirjanike nimestikust, mis põhineb USA, Suurbritannia, Prantsusmaa, Saksamaa, Itaalia, Hollandi, Hiina, Hispaania ja Rootsi igakuistel ilukirjanduslike bestsellerite edetabelitel. Esikümnesse kuuluvad: Khaled Hossein, Stieg Larsson, Ken Follett, Stephenie Meyer, Muriel Barbery, Carlos Ruiz Zafón, Anna Gavalda, John Grisham, J. K. Rowling, Henning Mankell
Truverk, Illimar, 1967-
2010-01-01
Üks autoreid Eesti paviljonist 1.05.-31.10. 2010 avatud maailmanäitusel EXPO 2010 teemal "Better city, better life". Eesti projekti "Savecity.org" autorid: Illimar Truverk, Ionel Lehari, Janno Roos, Andres Labi, kaasautorid: Priit Hamer, Kristian Paljasmaa, projekteerijad, sisekujundus: Agabus, Endjärv & Truverk Arhitektid, Ruumilabor, Identity. Konstruktor (Hiina): CCI Engineering Design & Consultant Co. Ltd. Projekt: 2009
Serviti, Eesti, serviti! / Toomas Tiivel ; intervjueerinud Urve Eslas
Tiivel, Toomas, 1952-
2009-01-01
EXPO 2010 teemal "Parem linn, parem elu" toimub 1. maist 31. oktoobrini 2010 Hiinas Shanghais. Eesti paviljoni ideekonkursist. Žürii koosseis. Loetletud neli lõppvalikusse jõudnud tööd. Võitis töö "Savecity.org" (Illimar Truverk, Andres Labi, Janno Roos, Ionel Lehari, Priit Hamer, Kristian Paljasma). Paviljoni püstitamisest Shanghaisse. Heale paviljonile iseloomulikest joontest
Kui palju on vaja ohvreid / Silver Meikar
Meikar, Silver, 1978-
2008-01-01
Ilmunud ka: Sakala 27. märts lk. 2, Keskus apr. nr. 4 lk. 56-57, Pärnu Postimees 2. mai lk. 15. Parlamendiliikme sõnul peab maailma üldsus Hiina suhtes otsustavalt käituma ning ta kutsub Eesti sportlasi ja poliitikuid üles Pekingi olümpiamängude avatseremoonial mitte osalema. Ajalehes Keskus kommenteerib Urmas Pappel
Algas jaht Veneetsia Kuldlõvile / Andres Laasik
Laasik, Andres, 1960-2016
2002-01-01
Täna algavast Veneetsia 59. filmifestivalist, mille direktor on endine Berliini festivali korraldaja Moritz De Hadeln ja žüriid juhib hiina staar Gong Li. Pikemalt võistlusprogrammist ja programmist "Vastuvoolu", kus linastub ka rootslase Lukas Moodyssoni "Lilja 4-Ever", mis filmitud peaasjalikult Paldiskis, suurtes rollides Tallinna Vene Draamateatri näitlejad ja episoodis Tõnu Kark
Euroopa tunnustab inimõiguste eest võitlejaid / Tõnu Prei
Prei, Tõnu, 1950-
2007-01-01
Euroopa Parlamendi täiskogu istungil tehakse parlamendikomisjoni esimeeste konverentsil teatavaks otsus Sahharaovi auhinna tänavuse laureaadi kohta. Auhinna kandidaadid on Sudaani inimõiguste küsimustega tegelev advokaat Salih Mahmud Osman, Hiina inimõiguste eest võitlejad Zeng Jinyan ja Hu Jia ning Tšetšeenias inimõiguste rikkumisi ja piinamisjuhtumeid uurinud vene ajakirjanik Anna Politkovskaja
Katrin Denev pokazala harakter
2006-01-01
Veneetsia 63. filmifestivali auhinnatutest, kellest vaid Stephen Frears'i filmis "Kuninganna" ("The Queen") peaosa kehastanud Helen Mirren oli üks favoriitidest. Parima filmi peaauhind Kuldlõvi läks üllatuslikult Hiina režissööri Jia Zhang-Ke filmile "Vaikelu" ("Dong"). Ka teistest Veneetsia 63. filmifestivali võitjatest. Festivali žüriid juhatas Catherine Deneuve
Suvemuusika kontserdisari Nissis
2007-01-01
Kontsertidest Nissi kirikus: Peterburi mungakloostri koor Optina Pustõn 23. juunil, poola organist Andrezy Chorosinski 7. juulil, ansambel Tallinn Baroque 14. juulil, tšehhi organist Pavel Czerny 28. juulil, hiina kontratenor Ka Bo Chan ja kitarrist Heiki Mätlik 11. augustil, Eesti Televisiooni tütarlastekoor Aarne Saluveeri dirigeerimisel 25. augustil/Optina Pustõn - vene koor
China Report, Political, Sociological and Military Affairs, No. 445.
1983-08-11
2052 0981], Chen Dingming [7115 7844 6900], Jin Xiulan [6855 4423 5695] (F, Mongolian), Zhao Nanqi [6392 0589 6386] Korean), Suo Jingxian [4792...Pen Center and the Guangzhou Pen Center will be headed by Chen Huangmei, another vice-president of the China center and a noted critic. The...1728 4426 6311], Zhang Tengxiao [1728 7506 7197], Chen Dingmou [7115 0002 5399], Chen Lunfen [7115 0243 5358] (F), Chen Xitong [7115 1585 0681
Technical Digest of the 1998 Summer Topical Meeting on Organic Optics and Optoelectronics
1998-07-01
Larry Dalton, University of Southern California, Los Angeles, CA Harold Fetterman , University of California, Los Angeles, CA Steve Forrest...OPTIC MODULATORS H. Fetterman , D. Chen, A. Udupa. D. Bhattachaya, B. Tsap University of Califonia, Los Angeles 90024 S. Lee, A. Chen, J. Chen, W...Chen, H.R. Fetterman , A. Chen, W.H. Steier, and L. R. Dalton, Appl. Phys. Lett. 70, (1997). 2. T.A. Tumolillo and P.R. Ashley, Appl. Phys. Lett. 62
Institute of Scientific and Technical Information of China (English)
陳智超
2010-01-01
Every historian should answer two questions related to each other, i. e. what is the relationship between history and reality and what is that between historiography and reality. Moreover, Chinese historians should answer other two questions also re-lated to each other, namely what is the relationship between China and the West and what is that between Chinese culture and Western culture. Based on their own outlook on the ancient and the present as well as on China and the West, every conscious Chinese historian of the 20 th century was bound to cherish a definite sense of responsi-bility and determined what role they played and what way they chose when taking on this responsibility. The present paper expounds Prof. Chen Yuan’ s answers to the above questions andhis practice concerned with them in the four stages of his lifetime.
Li, Xi-Ying; van Achterberg, Cornelis; Tan, Ji-Cai
2013-01-01
van Achterberg & Li, gen. n. (type species: Areotetes carinuliferus sp. n.) and Coleopioides van Achterberg & Li, gen. n. (type species: Coleopioides postpectalis sp. n. are described. All species are illustrated and keyed. In total 30 species of Opiinae are sequenced and the cladograms are presented. Neopius Gahan, 1917, Opiognathus Fischer, 1972, Opiostomus Fischer, 1972, and Rhogadopsis Brèthes, 1913, are treated as a valid genera based on molecular and morphological differences. Opius vittata Chen & Weng, 2005 (not Opius vittatus Ruschka, 1915), Opius ambiguus Weng & Chen, 2005 (not Wesmael, 1835) and Opius mitis Chen & Weng, 2005 (not Fischer, 1963) are primary homonymsandarerenamed into Phaedrotoma depressa Li & van Achterberg, nom. n., Opius cheni Li & van Achterberg, nom. n. andOpius wengi Li & van Achterberg, nom. n., respectively. Phaedrotoma terga (Chen & Weng, 2005) comb. n.,Diachasmimorpha longicaudata (Ashmead, 1905) and Biosteres pavitita Chen & Weng, 2005, are reported new for Hunan, Opiostomus aureliae (Fischer, 1957) comb. n. is new for China and Hunan; Xynobius maculipennis(Enderlein, 1912) comb. n. is new for Hunan and continental China and Rhogadopsis longuria (Chen & Weng, 2005) comb. n. is new for Hunan. The following new combinations are given: Apodesmia puncta (Weng & Chen, 2005) comb. n., Apodesmia tracta (Weng & Chen, 2005) comb. n., Areotetes laevigatus (Weng & Chen, 2005) comb. n., Phaedrotoma dimidia (Chen & Weng, 2005) comb. n., Phaedrotoma improcera (Weng & Chen, 2005) comb. n., Phaedrotoma amputata (Weng & Chen, 2005) comb. n., Phaedrotoma larga (Weng & Chen, 2005) comb. n., Phaedrotoma osculas (Weng & Chen, 2005) comb. n., Phaedrotoma postuma (Chen & Weng, 2005) comb. n., Phaedrotoma rugulosa (Chen & Weng, 2005) comb. n., Phaedrotoma tabularis (Weng & Chen, 2005) comb. n., Rhogadopsis apii (Chen & Weng, 2005) comb. n., Rhogadopsis dimidia (Chen & Weng, 2005) comb. n., Rhogadopsis diutia (Chen & Weng, 2005) comb. n., Rhogadopsis
Reference: 291 [Arabidopsis Phenome Database[Archive
Lifescience Database Archive (English)
Full Text Available 291 http://metadb.riken.jp/db/SciNetS_ria224i/cria224u4ria224u16244906i Chai Mao-Feng...d chloroplast protection. 4 553-64 16244906 2005 Nov Plant molecular biology An Rui|Chai Mao-Feng|Chen Jia|Chen Qi-Jun|Chen Ye-Miao|Wang Xue-Chen
Euroopa kaks tulevikku / Joschka Fischer
Fischer, Joschka, 1948-
2007-01-01
Autor analüüsib Euroopa Liidu tulevikku, põhiseaduse lepingu väljavaateid ja rõhutab EL-i vajadust toime tulla üleilmsete väljakutsetega, sest 21. sajandil jätkub suurte riikide nagu Hiina, India, USA ja Jaapani tõus. EL-il on kaks võimalust: kas maailmaga kaasa minna või hääbuda, kirjutab autor
Eesti kirjab EXPO paviljoni rahvamustritega / Rein Sikk
Sikk, Rein, 1961-
2009-01-01
Eesti paviljoni projekteerimine Hiinas Shanghais 1. maist 31. oktoobrini 2010 toimuvaks maailmanäituseks EXPO 2010 on lõppemas. Oktoobris algavast paviljoni ehitamisest ja sisustamisest ning Eestist EXPO-l osaleda soovijatest. Eesti osalemise peasõnum: "Me elame siin ja meil on siin hea elada". Eesti paviljoni konkursi võidutöö "Savecity.org" autoritest nimetatud: Illimar Truverk, Andres Labi, Janno Roos, Ionel Lehari
FIAT-i juht : maailma jääb alles vaid kuus suurt autotootjat / Erik Aru
Aru, Erik
2008-01-01
FIAT-i tegevjuhi Sergio Marchionne hinnangul jääb kriisi lõpuks alles üks Ameerika, üks Saksa, üks Prantsuse, üks Hiina ja üks võimalik üleeuroopaline autotootja. Analüütik Jürgen Pieperi hinnangul on kõige haavatavamad FIAT, BMW ja PSA/Peugeot-Citroen, alles jäävad VW, Renault-Nissan ja Daimler
Uued filmitiigrid oriendist üllatavad vaatajat ootamatu modernismiga / Andres Laasik
Laasik, Andres, 1960-2016
2005-01-01
IX Pimedate Ööde Filmifestivali filme Aasiast - "Troopikahaigus" : režissöör Apichatpong Weerasethakul : Tai - Prantsusmaa 2004, "Massöör" : režissöör Brillante Mendoza : Filipiinid 2005, "Päevalill" : režissöör Zhang Yang : Hiina 2005. Lisatud "Euroopasse pürib ka Türgi film" Yesim Ustaoglu filmist "Oodates pilvi"
DEFF Research Database (Denmark)
Wilmot-Dear, Christine Melanie; Friis, Ib; Govaerts, R. H. A.
2014-01-01
(H. Lév.) C.J. Chen in Chen et al. as the correct name for the variety named in the revision as B. zollingeriana Wedd. var. podocarpa (W.T. Wang) W.T. Wang & C.J. Chen in Chen et al., (3) that the combination B. spicata (Thunb.) Thunb., based on Urtica spicata Thunb., is not illegitimate, as stated...
U.S. Environmental Protection Agency — These data describe the chromatography characteristics of the MARGA instrument software as compared to an alternative, independent technique for chromatogram...
Bagatellid : maailm / Nele-Eva Steinfeld, Ivo Heinloo
Steinfeld, Nele-Eva
2011-01-01
Muusikasõnumeid maailmast: Hollandi kultuurielu kriis. Toetus Londoni Filharmooniaorkestrist vallandatud muusikutele. Veebilehest: arkivmusic.eu. Lahkus Kurt Sanderling. Hiinas keelustati ajaloolise sisuga ooper. Dirigent Mark Gorenstein vallandati ametist. Beethoveni kvarteti taastatud osa. Värskeid plaadilepinguid. Bostoni sümfooniaorkester otsib muusikalist juhti. Fabio Luisil probleem kodumaiste ooperimajadega. Itaalia jazzi pevad New Yorgis. Värskeid plaate jazzimaailmast. Tony Bennett purustas rekordi. DownBeati aasta jazzmuusik on Jason Moran
Teist aastat järjest edestasid Euroopa kapitaliturud IPO-de arvult ja kogumahult USA omi
2007-01-01
Ilmunud ka: Finansovõi Menedzhment : infovõpusk nr. 14 mai lk. 10-11. PricewaterhouseCoopersi väljaande IPO Watch Europe 2006 järgi jätkub Euroopa edu USA ja Suur-Hiina ees IPO-de pakkumise arvu ja kapitali kaasamise osas. Tabelid: Euroopa suurimad IPO-d 2006; Euroopa suurimad IPO-d 2005; Euroopa IPO-de jagunemine börside lõikes, 2005-2006
Piebalgs : põlevkivist toodetud elekter jääb / Andris Piebalgs ; interv. Ahto Lobjakas
Piebalgs, Andris, 1957-
2008-01-01
Euroopa Komisjoni energiapoliitika volinik vastab küsimustele, mis puudutavad kasvuhooneefekti pidurdamiseks Euroopa Komisjoni poolt väljapakutud meetmete tegelikku mõju maailmas, kus suurimad saastajad USA, Hiina ja India ei seo end sarnaste kohustustega, teiste riikide valmisolekut EL-i eesmärkidega kaasa minna, Eesti valikuid elektritootmises energiajulgeoleku seisukohalt, Vene-Saksa gaasijuhet ja Musta mere gaasijuhet South Sream. Diagramm: Eesti elanik on Euroopa suuremaid saastajaid
Seven new species of Begonia (Begoniaceae) in Northern Vietnam and Southern China
Chen, Wen-Hong; Radbouchoom, Sirilak; Nguyen, Hieu Quang; Nguyen, Hiep Tien; Nguyen4, Khang Sinh; Shui, Yu-Min
2018-01-01
Abstract Since 2016, KIB (Kunming Institute of Botany) and CPC (Centre for Plant Conservation of Vietnam) have conducted several surveys in the transboundary karst regions in Northern Vietnam and Southern China and seven new species in the genus Begonia Linn. (Begoniaceae) are firstly described. Amongst them, two species, Begonia albopunctata Y.M. Shui, W.H. Chen & H.Q. Nguyen and B. erectocarpa H.Q. Nguyen, Y.M. Shui & W.H. Chen, respectively belong to section Sphenanthera with berry fruits and section Leprosae with clavate berry fruits; four species, B. gulongshanensis Y.M. Shui & W. H. Chen, B. minissima H.Q. Nguyen, Y.M. Shui & W.H. Chen, B. mollissima Y.M. Shui, H.Q. Nguyen & W.H. Chen, B. rhytidophylla Y.M. Shui & W.H. Chen, belong to section Coelocentrum with parietal placentation; one species, Begonia bambusetorum H.Q. Nguyen, Y.M. Shui & W.H. Chen, belongs to section Diploclinium with 3-loculed ovary and capsules. The diagnostic characters of these species are described and illustrated in the text and photographs. PMID:29416422
Two new genera and three new species of Epipaschiinae Meyrick from China (Lepidoptera, Pyralidae
Directory of Open Access Journals (Sweden)
Mingqiang Wang
2017-12-01
Full Text Available Two new genera of Epipaschiinae are described. The genus Arcanusa Wang, Chen & Wu, gen. n. is established for Ar. apexiarcanusa Wang, Chen & Wu, sp. n. and Ar. sinuosa (Moore, 1888, comb. n., described in Scopocera Moore, 1888 (junior synonym of Stericta Lederer, 1863. The female genitalia of Ar. sinuosa (Moore, 1888, comb. n. are described for the first time. Androconia Wang, Chen & Wu, gen. n. is erected, including two new species, An. rallusa Wang, Chen & Wu, sp. n. and An. morulusa Wang, Chen & Wu, sp. n. Illustrations of all adults and their genitalia, and a key to the two new genera are provided.
Kes tooks Liibüa tagasi naftakaardile? / Heiki Suurkask
Suurkask, Heiki, 1972-
2011-01-01
Kodusõda Liibüas on naftatootmise samahästi kui seisma pannud, nüüd oodatakse välisfirmasid tootmist taaskäivitama. Uue võimuga koostööst on huvitatud Itaalia nafta- ja gaasikompanii ENI. Energiahiid BP on valmis Liibüasse naasma kohe, kui tingimused võimaldavad. Hiina, kes importis Liibüast naftat 150 000 barrelit päevas, tahab säilitada oma privileege
Kuidas möödus majandusaasta 2006 / Lembo Tanning, Toivo Tanning
Tanning, Lembo
2007-01-01
Ilmunud ka: Buhgalterskije Novosti, nr. 4, 2007, lk. 36-40. Ülevaade viimase kümne aasta maailmamajanduse arengutest sisemajanduse kogutoodangu ja väliskaubanduse põhjal. Tabelid: G-7 SKP 2000. aasta hindades ja rahavahetuskursiga, mld USD; USA väliskaubandus ja -teenused, mld USD-d, 2004-2006. Graafik: Hiina RV SKP, triljon jüaani, 1990-2006. Diagramm: Maailma suurimad eksportöörid, mld USD, 2004-2006
Hiinlasest Shakespeare'ks. Eestlasest Shakespeare / Udo Uibo
Uibo, Udo, 1956-
2011-01-01
Ajalehe "Shanghai Daily" (21.04 2011) teatel kavatsevat hiina kirjanik Zhang Yiyi oma viimase menuk aromaaniga teenitud 1, 2 miljonit jüaani (u. 153 00 dollarit) kulutada iluoperatsioonile, mille eesmärgiks on muuta nägu William Shakespeare'i sarnaseks. Nii olla artikli autor okupatsiooni ajal näinud Ain Kaalepil ainult Shakespeare'i sonettidest koosnevat käsikirja, mida kaunistas tema portree soenguga à la Shakespeare'i
Helsingi : lumekirik ja ilusad asjad / Tõnu Kaalep
Kaalep, Tõnu, 1966-2018
2000-01-01
Kultuuripealinna Helsingi 2000 üritusi. Senati väljakul 7. II sisseõnnistatud lumekoopia 1812. a. lammutatud Ulrika Eleonora kirikust. Disainimuuseumis: Philippe Starcki rändav retrospektiivnäitus 'Vanity Cases by Starck', maailmadisaini väljapanek 'Design World', Soome uudistööde väljapanek 'Find', Eesti väljapanek 'Estonian Design in Focus', hiina päritolu inglise ehtekunstniku Peter Chang'i näitus
Tropical Journal of Pharmaceutical Research - Vol 15, No 3 (2016)
African Journals Online (AJOL)
Wan Wu, Wei Chen, Qiong Jin, 447-451 ... Chung-Shih Chen, Mei-Lin Wang, Rosa Huang Liu, Shih-Pin Chen, Tsong-Ming Lu, Wei-Yu Tsai, Chien-Fu Huang, ... Yan-Qiong Li, Rui Hu, Li-Hui Zhong, Qian Sun, You-Ping Yan, 527-533.
Construction of full-length cDNA library of white flower Salvia ...
African Journals Online (AJOL)
STORAGESEVER
2009-05-18
May 18, 2009 ... of S. miltiorrhiza bge (Yuan et al., 1990; Wang et al.,. 1998; Huang et al., 2000). Hairy roots and ... or A. tumefaciens strains (Chen et al., 1997; Song et al.,. 1997). ..... Chen H, Yuan JP, Chen F, Zhang YL, Song JY (1997).
Journal of Genetics | Indian Academy of Sciences
Indian Academy of Sciences (India)
Author Affiliations. Chen Bin1 Zeng Zhirong1 Wu Xiaoqin1 Chen Minhu1 Li Mei1 Gao Xiang1 Chen Baili1 Hu Pinjin1. Department of Gastroenterology, the First Affiliated Hospital, Sun Yat-sen University, 58 Zhongshan II Road, Guangzhou 510080, People's Republic of China ...
Sadhana | Indian Academy of Sciences
Indian Academy of Sciences (India)
Influence of free water content on the compressive mechanical behaviour of cement mortar under high strain rate · Jikai Zhou Xudong Chen Longqiang Wu Xiaowei Kan ... pp 111-117. Mechanical properties of concrete to cyclic uniaxial tensile loading using variable waveforms · YUZHI CHEN XUDONG CHEN JINGWU BU.
African Journals Online (AJOL)
Items 51 - 100 of 1309 ... Li-Long Liu, Kai Xu, Lu-Mei Kang, Shu-Ping Jiang, Qing-Hua Wang, ... CR Sewani-Rusike, JE Iputo, EJ Ndebia, M Gondwe, DR Kamadyaapa ... K-M Man, W-C Chen, H-M Wang, H-Y Chen, J-L Shen, L-D Chen, F-J Tsai, ...
Seks korraks kõik: 15. PÖFF sai läbi, "Eesti film 100" ootab ees
2011-01-01
15. Pimedate Ööde Filmifestivali võitjatest. Parim Euraasia film "Lihtne elu" (režissöör Ann Hui, Hiina), parim režissöör Lynne Ramsay "Me peame Kevinist rääkima" (Suurbritannia), parim meeesnäitleja Sven Nordin filmist "Norra pojad", parim naisnäitleja Deanie Ip filmist "Lihne elu". Elutööauhinnad said Rein Raamat, Rein Maran, Fridrik Thor Fridriksson ja Aleksandr Sokurov
Arhitektuuribiennaalil arhitektuurile mõeldes / Karin Hallas-Murula
Hallas-Murula, Karin, 1957-
2008-01-01
Veneetsia arhitektuuribiennaalist teemal "Out there : Architecture Beyond Buildings". Biennaali üldkuraator Aaron Betsky. Eestlaste gaasitoruinstallatsioonist (autorid Maarja Kask, Ralf Lõoke, Neeme Külm). Lühidalt Hispaania, Inglismaa, Prantsusmaa, Hollandi, Taani, Saksamaa, Hiina ja Poola ekspositsioonidest, pikemalt Venemaa paviljonist. Nigel Coatsi, Zaha Hadidi, Frank Gehry, Herzog & de Meuroni ja Ai Weiwei töödest biennaalil, filmist Rem Koolhaasi Bordeaux' villast. Vt. repliik: Ruudi, Ingrid. Hea Sirbi toimetus! (Sirp, 2009, 30. jaan., lk. 8)
"Water Cube" ehk Pekingi Rahvuslik veekeskus
2005-01-01
2003. a. rahvusvahelise arhitektuurivõistluse võitnud projektis osalesid inseneribüroo Arup, arhitektuurifirma PTW, CSCEC - Hiina riiklik ehitus- ja projekteerimiskorporatsioon ning CSCEC Shenzheni Disainiinstituut. Projektis rakendati ja koordineeriti kaastöid 12-st erinevast teadusharust ja neljast riigist pärit 80 Arupi insenerilt ja spetsialistilt. Konstruktsioonist, tehnoloogiast, tuleohutusest, energia taastootmise süsteemidest. Inseneriteaduse artiklit kommenteerivad arhitekt Kalle Komissarov ja insener Heiki Meos. Kuivõrd saavad eesti arhitektid inseneridelt innovaatilisust oodata. 7 ill
Sobolev, Mari, 1968-
1998-01-01
Rotermanni soolaladu: Mark Raidpere ja Ene-Liis Semper "Mäng 4. käel"; Kunstihoone: Tony Craggi skulptuurid; Adamson-Ericu muuseum: Eduard Ole 100. sünniaastapäevale pühendatud näitus; Kastellaanimaja galerii: "Tee Raamat": Anu Purre kirjutus-kunstistuudio EKSTEKST GRUPP ja stuudio sõprade näitus (T-särkidest raamat-installatsioonid); Tervishoiumuuseum: "In vino..."; Tammsaare muuseum:"Tiibeti muistne kultuur. Hiina maastikud"; Kullo galerii: Huvikeskuse Kullo aastanäitus.
Directory of Open Access Journals (Sweden)
Zhilin Chen
2017-02-01
Full Text Available Three new species of the genus Gnamptogenys Roger, 1863 are described from southern China: Gnamptogenys dentihumera Chen, Lattke & Zhou, sp. n., Gnamptogenys nanlingensis Chen, Lattke & Zhou, sp. n. and Gnamptogenys quadrutinodules Chen, Lattke & Zhou, sp. n. A distribution map and an identification key to workers for the known species of China are provided.
Reference: 418 [Arabidopsis Phenome Database[Archive
Lifescience Database Archive (English)
Full Text Available 418 http://metadb.riken.jp/db/SciNetS_ria224i/cria224u4ria224u16856986i Chai Mao-Feng...cid responses in Arabidopsis. 5 665-74 16856986 2006 Sep The Plant journal An Rui|Chai Mao-Feng|Chen Jia|Chen Qi-Jun|Wang Xue-Chen|Wei Peng-Cheng|Yang Shuhua
Indian Academy of Sciences (India)
Smith and Carson ... Z. Physikal. Chenn., 1908, 6, 200. 13. Ephraim ... Z. anord. Chen., 190S, 58, 33S. 14. Wright ... J. Chen. Soc, 1915, 107, 1527. 15. Amadori ... Gazetta, 1922, 1, 52, 387. 16. Mori ... J. Chen. Soc., Japa), 1923, 44, 730. 17. Waradachari and Subra- Proc. Ind. Acad, Sci., 1936, 3 A, 428. Ilala. 18. Hervey and ...
Calycosin regulates glucocorticoid-induced apoptosis via Nrf2/ARE ...
African Journals Online (AJOL)
Lifeng Fu1, WeiLiang Wu2, Jian Zhu2, Shu Qiang2, Jansong Chen2* ... Results: CA reduced the apoptosis and accumulation of ROS in DEX-treated cells. ..... its downstream effectors (Figure 5 A-C). However .... Cao J, Chen Z, Zhu Y, Li Y, Guo C, Gao K, Chen L, Shi ... Hong W. Experimental study on the effect of Calycosin.
Lapiku maailma haprus / Joseph S. Nye ; tõlk. Liis Auväärt
Nye, Joseph S.
2006-01-01
Ilmunud ka: Molodjozh Estonii 28. aug. lk. 6-7. Käsitledes globaliseerumist ja Thomas Friedmani lapiku maa metafoori, ütleb autor, et ka 1914. oli maailmamajandus äärmiselt integreeritud, kuid vastastikune majanduslik sõltuvus vähenes järgmise 30 aasta jooksul, muutudes ühtseks alles 70-ndatel. Mõnede arvates mängib Hiina tänapäeval sama rolli, mida mängis Saksamaa XX sajandil. Oht lapikule maale tuleb mitteriiklikelt jõududelt
Indian Academy of Sciences (India)
Beak P and Chen C W 1985 Tetrahedron Lett. 4979. Boatman R J, Whitlock B J and Whitlock H W 1977 J. An. Chen. Soc. 99 4822. Diamond S E, Szalkiewicz A and Mares F 1979 J. Ann. Chen. Soc. 101 490. Ellefson C R 1979 J. Org. Chem. 44 1533. Gschwend H W and Rodriguez H R 1979 Organic reactions 26 Chapter I.
National Research Council Canada - National Science Library
1993-01-01
...; AGRICULTURE - Further Reform of Grain Circulation, Prices Advocated, Chen Yaobang on Market Challenges Facing Agriculture, Chen Yaobang on Restructuring of Crop Planting, MILITARY, PUBLIC SECURITY...
Hybrid Chaos Synchronization of Four-Scroll Systems via Active Control
Karthikeyan, Rajagopal; Sundarapandian, Vaidyanathan
2014-03-01
This paper investigates the hybrid chaos synchronization of identical Wang four-scroll systems (Wang, 2009), identical Liu-Chen four-scroll systems (Liu and Chen, 2004) and non-identical Wang and Liu-Chen four-scroll systems. Active control method is the method adopted to achieve the hybrid chaos synchronization of the four-scroll chaotic systems addressed in this paper and our synchronization results are established using Lyapunov stability theory. Since the Lyapunov exponents are not required for these calculations, the active control method is effective and convenient to hybrid synchronize identical and different Wang and Liu-Chen four-scroll chaotic systems. Numerical simulations are also shown to illustrate and validate the hybrid synchronization results derived in this paper.
Eesti läheb Pekingisse / Karin Hallas-Murula
Hallas-Murula, Karin, 1957-
2008-01-01
Pekingi Eesti saatkonnahoone konkursist žüriiliikme pilguga. Premeeritud ja esiletõstetud töödest. Võidutöö autorid - Lauri Vaimel, Andres Põime, Liisa Põime; II koht - Erik Nobel ja Nobel Arkitekten, Taani-Eesti; III koht - Kalle Vellevoog, Velle Kadalipp, Tiiu Truus, Martin Prommik; ostudega esiletõstetud tööde autorid - Priit Pent ja Raul Järg Bucoma OÜ-st ning Jan Skolimowski, Peeter Loo, Kaspar Kruuse ja Li Vene KAMP Arhitektide OÜ-st. Hiina ja Pekingi uusehitistest, arhitektidest
Väljavalituse tunne / Jaak Kilmi
Kilmi, Jaak, 1973-
2005-01-01
Lühihinnang IX Pimedate Ööde Filmifestivali mängufilmidele - "Garpastum" : režissöör Aleksei German jun : Venemaa 2005, "Kohe paradiisi" ("Paradise Now") : režissöör Hany Abu-Assad : Holland - Saksamaa - Prantsusmaa 2005, "Maavärinate klaverihäälestaja" (Piano Tuner of the Earthquakes") : režissöörid Stephen ja Timothy Quay : Suurbritannia - Saksamaa - Prantsusmaa 2005, "Kolmel ajal" ("Three Times") : režissöör Hou Hsiao-hsien : Taiwan - Hiina 2005
Bagatellid : maailm / Nele-Eva Steinfeld, Ivo Heinloo
Steinfeld, Nele-Eva
2011-01-01
Muusikasõnumeid maailmast: Helsingis avati uus kultuurikeskus Helsingi Musiikkitalo. Montrealis sain endale uue kontserdimaja La Maison Symphonique de Montreal. Lahkus tenor Salvatore Licitra. James Levine loobus Metropolitan Opera sügishooaja etenduste dirigeerimisest. Iisraeli Filharmoonikute kontsert BBC Promsil häiritud. Deutsche Grammophon kolis Berliini. Siemens loobub Bayereuthi festivali spondeerimisest. Kultuurivahetus Viini Riigiooperi ja La Scala ooperiteatrite vahel. MTV premeeris popimaailma tippe. Hiina tsenseerib Lääne popmuusikuid. uus Grammyde jagamise kord põhjustab pahameelt. Return to Forever taas koos. Chick Corea juubel
Eesti tekstiilitööstus pöördub Šveitsi suunas / Mikk Salu
Salu, Mikk, 1975-
2005-01-01
Autor toob näiteid, kuidas Šveitsi tekstiilitööstusettevõtted on suutnud konkurentsis püsima jääda, ning võrdleb Šveitsi tekstiili- ja rõivatööstuse kogueksporti Eesti omaga. Euroopas ja USA-s on tekstiili- ja rõivatööstuses probleem suur tööjõukulu, Euroopa Komisjon otsib võimalusi rakendada Hiina importtoodangu suhtes kaitsemeetmeid. Lisad: Õmblusmasina küsimus; Võitjad ja kaotajad. Diagramm: Tekstiili- ja rõivatoodang 2004
New Jurassic tettigarctid cicadas from China with a novel example of disruptive coloration
Directory of Open Access Journals (Sweden)
Jun Chen
2016-12-01
Full Text Available Tettigarctidae is the most primitive family of Cicadoidea, with only two relict species. Although they are relatively well known from Eurasia, Australia, Africa, and South America, their Mesozoic examples are typically preserved only as isolated forewings. Herein, a new genus Sanmai Chen, Zhang, and B. Wang with three new species (Sanmai kongi Chen, Zhang, and B. Wang, S. mengi Chen, Zhang, and B. Wang, and S. xuni Chen, Zhang, and B. Wang are described based on fossil specimens from the Middle–Upper Jurassic of northeastern China, with well-preserved body structures, forewing and hindwing venations, making it the hitherto best known extinct tettigarctid taxon. The new genus, provisionally assigned to the tribe Turutanoviini, provides some new information about the evolution and palaeobiogeography of Mesozoic Tettigarctidae. The genus Paraprosbole is synonymized with Shuraboprosbole. In addition, the coloration pattern of forewing, prominent on some specimens of Sanmai kongi Chen, Zhang, and B. Wang sp. nov. and Sanmai xuni Chen, Zhang, and B. Wang sp. nov., represents a novel example of disruptive coloration in Tettigarctidae, which can effectively break up the body outline as well as surface, and so likely enabled these cicadas to reduce the detectability of potential predators.
Soil Behavior Under Blast Loading
2010-12-01
in detail (Lade 2005, Prevost and Popescu 1996, Chen and Baladi 1985). Models that are appropriate to be implemented into finite element programs...Chen and Baladi 1985). As the soil strain hardens, both the cone and the end cap expand. This concept of cap envelope was a major step forward...hardening cap model (Chen and Baladi 1985) 17 The modified Cam-clay model was developed at Cambridge University by Roscoe et al. (1963). This
USA investor loodab raha teenida Brasiilias ja Hiinas / Annika Matson
Matson, Annika, 1976-
2006-01-01
Ilmunud ka: Delovõje Vedomosti 14. juuni lk. 25. USA investeerimisfirma Cumberland Advisors juht David Kotok osales Äripäeva korraldatud majanduskollokviumil. Tema investeerimisfirma on paigutanud raha Ida-Euroopasse, Hiinasse ja Lõuna-Ameerikasse. Vt. samas: Väikeinvestoril tuleb aktsiaid ostes kodutööd teha
Hiina kiire majanduskasv kergitab nafta hinda / Lauri Matsulevitsh, Annika Matson
Matsulevitsh, Lauri
2005-01-01
Toornafta hind on praegu rekordiliselt kõrgel tasemel, tõustes 12. augustil Londoni naftabörsil 66,45 dollarini barrelist. Hinnatõusu peamisteks põhjusteks peetakse Pärsia lahe ebastabiilset olukorda ja Aasia kiirest majanduskasvust tingitud tarbimise kasvu. Diagrammid: Nafta hind on aastaga kallinenud poole võrra; Nafta tarbimise järsku kasvu on oodata Aasias. Vt. samas lühiintervjuud Statoil Eesti juht Helle Kirsiga: Bensiini hind jõuab 14 kroonini
Eesti ilmumine Hiina rahvale - EXPO 2010 paviljon Shanghais / Anneliis Aunapuu
Aunapuu, Anneliis
2009-01-01
Shanghai EXPO Eesti paviljoni konkursi võidutööst "Savecity.org", autorid Ionel Lehari, Kristian Paljasma, Illimar Truverk, Priit Hamer, Janno Roos, Andres Labi. Premeeritud tööd. Žürii koosseis. Konkursitöödest on avatud näitus Eesti Arhitektuurimuuseumis 24. maini
Hiina põlevkivikeemikud uurisid VKG tootmist / Peeter Lilleväli
Lilleväli, Peeter
2004-01-01
Ilmunud ka: Severnoje Poberezhje, 26. aug. 2004, lk. 1. Fushun Mining Group Co. Ltd juht Yin Liangi sõnul on nende firma tegelenud põlevkivist õli tootmisega üle 40 aasta, kuid kuna Eesti kogemus on sellel alal kaks korda pikem, huvituvad nad siin kasutatavast tehnoloogiast
Maailmade loomine ja rahvuspaviljonid Veneetsias / Kati Ilves
Ilves, Kati, 1984-
2009-01-01
53. Veneetsia biennaal "Making Worlds / Fare Mondi / Maailmu luues" 7. VI-22. XI, kuraator Daniel Birnbaum. Hiina kunstniku Chu Yuni tööst "Constellation / Tähtkuju" kuraatorinäitusel. Lühidalt USA (Bruce Nauman) ja Hispaania (Miquel Barcelo) paviljonidest, pikemalt Taani ja Põhjamaade (kunstnike-kuraatorite Michael Elmgreeni ja Ingar Dragseti projekt "The Collectors / Kogujad"), Prantsuse (Claude Lévèque'i "Le Grand Soir / Suur öö", kuraator Christian Bernard) ja Egiptuse (Adel El Siwi ja Ahmad Askalany "Leggermente monumentale / Kergelt monumentaalne") paviljonidest
Kinetic investigation on enantioselective hydrolytic resolution of ...
African Journals Online (AJOL)
Kinetic investigation on enantioselective hydrolytic resolution of epichlorohydrin by crude epoxide hydrolase from domestic duck liver. X Ling, D Lu, J Wang, J Chen, L Ding, J Chen, H Chai, P Ouyang ...
77 FR 11620 - Notice of Request for the Extension of a Currently Approved Information Collection
2012-02-27
... Reduction Act of 1995, this notice announces the intention of the Federal Transit Administration (FTA) to... INFORMATION CONTACT: Roy Chen, FTA Office of Technology, (202) 366-0462, or email: royweishun.chen@dot.gov...
1992-01-01
AND PROPERTIES OF WIDE BAND-GAP Il-VI STRAINED- LAYER SUPERLATTICE 227 Hailong Wang. Jie Cui. Aidong Shen. Liang Xu, Yunliang Chen. and Yuhua Shen IN...WANG JIE CUI AIDONG SHEN LIANG XU YUNLIANG CHEN AND YUHUA SHEN Shanghai Institute of Optics and Fine Mechanics, Academia Sinica P.O.Box 800-216 Shanghai...He Zujou, Cao Huazhe, Su Wuda, Chen Zhongcai, Zhon Feng and Wang Erguang, Thin Solid Films, 139,261(1986). 22) Xin Li and T.L.Tansley, J.AppI.Phys
Effects of water stress and seed mass on germination and ...
African Journals Online (AJOL)
enoh
2012-03-01
Mar 1, 2012 ... polyvinylpyrrolidone; TCA, trichloroacetic acid; NBT, nitroblue tetrazolium; TBA ..... seeds had weaker resistances to moderate stress (-0.6. MPa) compared with .... Chen YN,Chen YP,Li WH,Zhang HF (2003). Response of ...
Blazar Sequence in Fermi Era Liang Chen
Indian Academy of Sciences (India)
Abstract. In this paper, we review the latest research results on the topic of blazar sequence. It seems that the blazar sequence is phenomenally ruled out, while the theoretical blazar sequence still holds. We point out that black hole mass is a dominated parameter accounting for high-power- high-synchrotron-peaked and ...
How Many Women Are Affected by or at Risk of Preeclampsia?
... pregnancy outcomes: Differences among 4 racial/ethnic groups. American Journal of Public Health, 95 (9), 1545–1551. Lin, H. C., Chen, S. F., Lin, H. C., & Chen, Y. H. (2010). Increased risk of adverse pregnancy outcomes ...
Proceedings – Mathematical Sciences | Indian Academy of Sciences
Indian Academy of Sciences (India)
Author Affiliations. Yanheng Chen1 2 Guiyun Chen1. School of Mathematics and Statistics, Southwest University, Chongqing 400715, People's Republic of China; School of Mathematics and Statistics, Chongqing Three Gorges University, Chongqing 404100, People's Republic of China ...
The validity and accuracy in foot-to-foot bioelectrical impedance ...
African Journals Online (AJOL)
The validity and accuracy in foot-to-foot bioelectrical impedance analysis measuring models referenced by dual-energy X-ray absorptiometry in body composition in standing position. KC Hsieh, HK Lu, CH Chen, TR Jang, YY Chen, MF Kao ...
Mechanisms of all-trans retinoic acid-induced differentiation of acute ...
Indian Academy of Sciences (India)
Author Affiliations. Ji-Wang Zhang1 Jian Gu1 Zhen-Yi Wang1 Sai-Juan Chen1 Zhu Chen1. Shanghai Institute of Hematology, Ruijin Hospital Affiliated to Shanghai Second Medical University, 197 Ruijin Road II, Shanghai 200025, People's Republic of China ...
New St-chromosome-specific molecular markers for identifying ...
Indian Academy of Sciences (India)
et al. 1994) or JJsSt (Chen et al. 1998) was widely used in wheat breeding programme (Chen .... Japan). Table 1. The features of primers used in this study. Homologous ..... Redinbaugh M. G., Jones T. A. and Zhang Y. T. 2000 Ubiquity of.
Sadhana | Indian Academy of Sciences
Indian Academy of Sciences (India)
YUZHI CHEN1 2 XUDONG CHEN2 JINGWU BU3. Architectural Engineering Institute, Jinling Institute of Technology, Nanjing 211169, China; College of Civil and Transportation Engineering, Hobai University, Nanjing 210098, China; College of Water Conservancy and Hydropower Engineering, Hohai University, Nanjing ...
LDRD 2013 Annual Report: Laboratory Directed Research and Development Program Activities
Energy Technology Data Exchange (ETDEWEB)
Bookless, W. [Brookhaven National Lab. (BNL), Upton, NY (United States)
2013-12-31
This LDRD project establishes a research program led by Jingguang Chen, who has started a new position as a Joint Appointee between BNL and Columbia University as of FY2013. Under this project, Dr. Chen will establish a new program in catalysis science at BNL and Columbia University. The LDRD program will provide initial research funding to start research at both BNL and Columbia. At BNL, Dr. Chen will initiate laboratory research, including hiring research staff, and will collaborate with the existing BNL catalysis and electrocatalysis research groups. At Columbia, a subcontract to Dr. Chen will provide startup funding for his laboratory research, including initial graduate student costs. The research efforts will be linked under a common Catalysis Program in Sustainable Fuels. The overall impact of this project will be to strengthen the BNL catalysis science program through new linked research thrusts and the addition of an internationally distinguished catalysis scientist.
Enhancement of Radiation Therapy in Prostate Cancer by DNA-PKcs Inhibitor
2015-09-01
Center, Urology Habib , Amyn; UTSouthwestern Medical Center, Neurology & Neurotherapeutics Chen, Benjamin; UTSouthwestern Medical Center, Radiation...Tsong Hsieh 3,5,7 , Amyn A. Habib 4,5,6 , Benjamin Chen 1,4 and Debabrata Saha 1,4 1 Department of Radiation Oncology, 3 Department of Urology, 4
The effects of reciprocal cross on inheritance of DNA methylation in ...
African Journals Online (AJOL)
enoh
2012-03-20
Mar 20, 2012 ... DNA methylation plays an important role for regulation of gene expression. To study ... genes, and newly acquired epigenetic states of trans- ... GACTGCGTACCAATTCAGA(E6). ATCATGAGTCCTGCTCGGTAC(H6). GACTGCGTACCAATTCAGT(E7) ..... Chen XQ, Ma Y, Chen F, Song WQ, Zhang L (2009).
Pitfalls in VAR based return decompositions: A clarification
DEFF Research Database (Denmark)
Engsted, Tom; Pedersen, Thomas Quistgaard; Tanggaard, Carsten
in their analysis is not "cashflow news" but "inter- est rate news" which should not be zero. Consequently, in contrast to what Chen and Zhao claim, their decomposition does not serve as a valid caution against VAR based decompositions. Second, we point out that in order for VAR based decompositions to be valid......Based on Chen and Zhao's (2009) criticism of VAR based return de- compositions, we explain in detail the various limitations and pitfalls involved in such decompositions. First, we show that Chen and Zhao's interpretation of their excess bond return decomposition is wrong: the residual component...
African Journal of Traditional, Complementary and Alternative ...
African Journals Online (AJOL)
Anti-tumour effects of polysaccharides isolated from Artemisia Annua L by inducing cell apoptosis and immunomodulatory anti-hepatoma effects of polysaccharides · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. J Chen, J Chen, X Wang, C Liu, 15-22.
Trend analysis and change point detection of annual and seasonal ...
Indian Academy of Sciences (India)
elevation ranges from 0 m in the coastal areas of the. Persian Gulf to over ... been explained by Kang and Yusof (2012); Dhorde ...... J L 2004 Detection of statistically significant trends in ... Sun H, Chen Y, Li W, Li F, Chen Y, Hao X and Yang Y.
The Response of Small Scale Rigid Targets to Shallow Buried Explosive Detonations
2011-09-01
properties as applied in this work was based on some of the standard defini- tions of soil constitutive properties as found in, e.g., Chen and Baladi [18...Technology Corporation; 2007. [18] Chen WF, Baladi GY. Soil plasticity: theory and implementation. New York: Elsevier Science; 1985. [19] Zimmerman
Enhanced Thermal Transport of Surfaces with Superhydrophobic Coatings
2015-07-01
resistance conferred by superhydrophobic fluorinated polyacrylate-silica composite coatings on cold-rolled steel. Journal of Applied Polymer Science... thiolates on metals as a form of nanotechnology. ChemInform. 2005:36. doi: 10.1002/chin.200532281. 9. Chen C-H, Cai Q, Tsai C, Chen C-L, Xiong G
Evaluation of effectiveness in a novel wound healing ointment ...
African Journals Online (AJOL)
Evaluation of effectiveness in a novel wound healing ointment-crocodile oil burn ointment. Hua-Liang Li, Yi-Tao Deng, Zi-Ran Zhang, Qi-Rui Fu, Ya-Hui Zheng, Xing-Mei Cao, Jing Nie, Li-Wen Fu, Li-Ping Chen, You-Xiong Xiong, Dong-Yan Shen, Qing-Xi Chen ...
2014-09-18
22:477– 505 , 2007. [21] Bushnell, Michael L. and Vishwani Agrawal. Essentials of Electronic Testing for Digital, Memory, and Mixed-Signal VLSI...Investigation”. Knowledge and information systems, 10(4):453–472, 2006. [68] Liang, Nia -Chiang, Ping-Chieh Chen, Tony Sun, Guang Yang, Ling-Jyh Chen
A comparative study assessing a new tool for occluding ...
African Journals Online (AJOL)
0.630, p=0.068 and p=0.047, respectively) (Table 2). A comparative study assessing a new tool for occluding parenchymal blood flow during liver resection for hepatocellular carcinoma. S Zhou, X-J Xue, R-R Li, D-F Chen, W-Y Chen, G-X Liu, ...
A novel contiguous deletion involving NDP, MAOB and EFHC2 gene ...
Indian Academy of Sciences (India)
Home; Journals; Journal of Genetics; Volume 96; Issue 6. A novel contiguous deletion involving NDP, MAOBand EFHC2gene in a patient with familial Norrie disease: bilateral blindness and leucocoria without other deficits. BEI JIA LIPING HUANG YAOYU CHEN SIPING LIU CUIHUA CHEN KE XIONG LANLIN SONG YULAI ...
The roles of electronic books in the transformation of learning and instruction
Huang, Ronghuai; Chen, Nian-Shing; Kang, Myunghee; McKenney, Susan; Churchill, Daniel
2014-01-01
Huang, R., Chen, N., Kang, M. McKenney, S. & Churchill, D. (2013). The roles of electronic books in the transformation of learning and instruction. In N. Chen, R. Huang, Kinshuk, Y. Li, D. G. Sampson (Eds.) Proceedings of the IEEE 13th International Conference on Advanced Learning Technologies
2009-09-01
this project: A. Noman M. Ahsanuzzaman, Steve Acree, Nandita Basu, Sten Berglund, Carol Bratt, Gordon Brown, Xaisong Chen, Jaehyun Cho, Pat Clark...A.S.C. Chen (eds). Chapelle, F.H., J.S. Widdowson, J.S. Bruner, E. Mendez , and C.C. Casey (2003). Methodology for Estimating Times of Remediation
A novel contiguous deletion involving NDP, MAOB and EFHC2 gene ...
Indian Academy of Sciences (India)
Home; Journals; Journal of Genetics; Volume 96; Issue 6. A novel contiguous deletion involving NDP, MAOBitalic> and EFHC2italic> gene in a patient with familial Norrie disease: bilateral blindness and leucocoria without other deficits. BEI JIA LIPING HUANG YAOYU CHEN SIPING LIU CUIHUA CHEN KE XIONG LANLIN ...
Sadhana | Indian Academy of Sciences
Indian Academy of Sciences (India)
Home; Journals; Sadhana. B Chen. Articles written in Sadhana. Volume 38 Issue 4 August 2013 pp 557-569. Flexibility-based structural damage identification using Gauss–Newton method · B Chen S Nagarajaiah · More Details Abstract Fulltext PDF. Structural damage will change the dynamic characteristics, including ...
Kutsealase väljaõppega tegelev AEL Eestis / Leila Pärtelpoeg
Pärtelpoeg, Leila, 1927-
1998-01-01
Soome Ammatti Edistys Liitto (AEL) korraldas 1995.-1998. a. Tartu Kunstikooli juures kunsti- ja ehituskoolide õpetajatele restaureerimisalase koolituse, mille viisid läbi Maija-Liisa Hirvi, Leena Hakli, Juta Jokinen. Kursusest, praktikast 1996-1998. Marmoreerimiseks valiti Palmse supelmaja (ehitatud 1980, projekt Aarne Kann). Vinjetid kuppelsaali eesruumidesse maalis Eve Erman. Kohvik avati 1998. a. mais. Illusoorsete seinamaalingute loomisest Järlepa mõisa 1997. a., teema valikust lähtuvalt Järlepaga seotud A. J. von Krusensternist. Gravüüride valik - Kai Tuvik. Objektide sisearhitekt Leila Pärtelpoeg. Käsitsimaalitud tapeedid valmistatakse Järlepa Hiina salongi augustis 1998
THREE NEW SPECIES OF CRAMBINAE(LEPIDOPTERA : PYRALIDAE) IN CHINA
Institute of Scientific and Technical Information of China (English)
CHENTie-mei; SONGShi-mei; YUANDe-cheng
2003-01-01
Three new species of Crambinae from China, Eschata truncata Song & Chen, sp. nov., Eschata tricornia Song & Chen, sp. nov., Pseudargyria acuta Song & Chen, sp. nov. and the female of Girdharia tau-romma Kapur are described, with figures and illustrations of genitalia provided. E. truncata resembles E.smithi Bleszynski, but valva with one short truncated process in costa; E. tricornia differed from all recorded species by valva with a triangular process on dorsum; P. acuta resembles P. marginepunctalis (Hampson), but with cucullus rapidly pointed and aedeagus with one group of cornuti. E. bleszynskiella Minet is proposed as a junior synonym of E. shanghaiensis Wang & Sung.
2011-09-01
applied in this work was based on some of the standard definitions of soil constitutive properties as found in, e.g., Chen and Baladi [20], and...Livermore, CA. [20] Chen, W. F., and Baladi , G. Y., 1985. Soil Plasticity: Theory and Implementation. Elsevier Science, New York. [21] Zimmerman, H.D
Canivez, Gary L.; Kush, Joseph C.
2013-01-01
Weiss, Keith, Zhu, and Chen (2013a) and Weiss, Keith, Zhu, and Chen (2013b), this issue, report examinations of the factor structure of the Wechsler Adult Intelligence Scale-Fourth Edition (WAIS-IV) and Wechsler Intelligence Scale for Children-Fourth Edition (WISC-IV), respectively; comparing Wechsler Hierarchical Model (W-HM) and…
75 FR 4509 - Uniform Criteria for State Observational Surveys of Seat Belt Use
2010-01-28
... statistical issues: Ms. Chou-Lin Chen, Chief, Mathematical Analysis Division, National Center for Statistics..., Washington, DC 20590. Telephone number: 202-366-1048; E- mail: Chou-Lin.Chen@dot.gov . For legal issues: Ms..., and reduce burden. E. Paperwork Reduction Act Under the Paperwork Reduction Act of 1995, a person is...
Journal of Genetics | Indian Academy of Sciences
Indian Academy of Sciences (India)
... Refresher Courses · Symposia · Live Streaming. Home; Journals; Journal of Genetics; Volume 95; Issue 1. Novel NPHS1 gene mutations in a Chinese family with congenital nephrotic syndrome. Fengjie Yang Yaxian Chen Yu Zhang Liru Qiu Yu Chen Jianhua Zhou. Research Note Volume 95 Issue 1 March 2016 pp 161- ...
A reviewof the pharmacologicalmechanism of traditional Chinese ...
African Journals Online (AJOL)
A reviewof the pharmacologicalmechanism of traditional Chinese medicine in the intervention of coronary heart disease and stroke. W Zhang, K Gao, K Gao, J Liu, J Liu, H Zhao, H Zhao, J Wang, J Wang, Y Li, Y Li, G Murtaza, G Murtaza, J Chen, J Chen, W Wang, W Wang ...
African Journal of Biotechnology - Vol 10, No 60 (2011)
African Journals Online (AJOL)
Microsatellite variability reveals significant genetic differentiation of giant pandas (Ailuropoda melanoleuca) in the Minshan A habitat · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. J Yang, R Hou, F Shen, X Yang, L Zhang, L Chen, W Chen, W Zhang, Q Zhu, Z Zhang ...
Journal of Chemical Sciences | Indian Academy of Sciences
Indian Academy of Sciences (India)
Home; Journals; Journal of Chemical Sciences. Chen Chai. Articles written in Journal of Chemical Sciences. Volume 126 Issue 3 May 2014 pp 813-820 Regular Articles. First total synthesis of Boehmenan · Yamu Xia Xiaoli Dai Haixin Liu Chen Chai · More Details Abstract Fulltext PDF. The first total synthesis of dilignan ...
Three novel antioxidants from Cinnamomum plants | Cheng | African ...
African Journals Online (AJOL)
Three novel antioxidants from Cinnamomum plants. K-C Cheng, H-A Chen, P-F Wu, W-L Yang, H-M Wang, C-Y Chen. Abstract. In this study, we identified three novel antioxidants, subamolide C (1), subamolide E (2) and isokotomolide A (3) from the constitutes of Cinnamomum subavenium and Cinnamomum kotoense.
van Achterberg, Cornelis; Long, Khuat Dang
2010-01-01
Abstract The species of seventeen genera of Agathidinae (Braconidae) from Vietnam are revised: Agathis Latreille, 1804, Bassus Fabricius, 1804; Biroia Szépligeti, 1900; Braunsia Kriechbaumer, 1894; Camptothlipsis Enderlein, 1920; Coccygidium de Saussure, 1892; Coronagathis gen. n. (type species: Coronagathis cornifera sp. n.); Cremnops Foerster, 1862; Disophrys Foerster, 1862; Earinus Wesmael, 1837; Euagathis Szépligeti, 1900; Gyragathis gen. n. (type species: Gyragathis quyi sp. n.), Gyrochus Enderlein, 1920; Lytopylus Foerster, 1862; Therophilus Wesmael, 1837; Troticus Brullé, 1846, and Zelodia gen. n. (type species: Zelomorpha varipes van Achterberg & Maetô, 1990). Keys to the Vietnamese species are given. Sixty-five species are recognised, of which twelve species are newly recorded for Vietnam: Bassus albifasciatus (Watanabe, 1934), Coccygidium angostura (Bhat & Gupta, 1977), Cremnops atricornis (Smith, 1874), stat. n., Disophrys erythrocephala Cameron, 1900, Gyrochus yunnanensis Wang, 1984, Lytopylus romani (Shestakov, 1940), comb. n., Therophilus festivus (Muesebeck, 1953), comb. n., Therophilus javanus (Bhat & Gupta, 1977), comb. n., Therophilus lienhuachihensis (Chou & Sharkey, 1989), comb. n., Therophilus marshi (Bhat & Gupta, 1977), comb. n., Zelodia absoluta (Chen & Yang, 1998), comb. n. and Zelodia longidorsata (Bhat & Gupta, 1977), comb. n. Forty-two species are new to science: Agathis citrinisoma sp. n., Bassus albobasalis sp. n., Bassus albozonatus sp. n., Biroia soror sp. n., Braunsia bicolorata sp. n., Braunsia devriesi sp. n., Braunsia maculifera sp. n., Braunsia nigrapiculata sp. n., Braunsia pumatica sp. n., Camptothlipsis hanoiensis sp. n., Coronagathis cornifera sp. n., Earinus aurantius sp. n., Earinus brevistigmus sp. n., Euagathis flavosoma sp. n., Disophrys maculifera sp. n., Disophrys quymanhi sp. n., Disophrys rhinoides sp. n., Gyragathis quyi sp. n., Therophilus annuliferus sp. n., Therophilus cattienensis sp. n., Therophilus
Lateral strukturierte Oberflächen zur THz-Strahlmanipulation
Jahn, David; Koch, Martin (Prof. Dr.)
2018-01-01
Die Terahertz-Zeitbereichsspektroskopie ist mittlerweile eine etablierte spektroskopische Methode im Frequenzbereich von 0;2 THz bis etwa 5 THz. Mit der stetigen Verbesserung von Zeitbereichs-Spektrometern, in den letzten Jahren hauptsächlich vorangetrieben durch die Verbesserung der Materialsysteme sowohl im photoleitenden Emitter als auch im Detektor sind heute Systeme mit bis zu 90 dB SNR und 4;5 THz Brandbreite verfügbar. Auch der Einfluss anderer Systemkomponenten, deren Beitrag zum...
C. Huang , G. Zhao , HW Zhang & YQ Chen
Indian Academy of Sciences (India)
the host stars' birth cloud with higher abundance of Si will make the cloud ... with the metallicity distribution of nearby field F, G, or K stars which are known to .... In the early stage of planetesimal accumulation, the rate of growth of planetesimal.
Chaos synchronization of the fractional-order Chen's system
International Nuclear Information System (INIS)
Zhu Hao; Zhou Shangbo; He Zhongshi
2009-01-01
In this paper, based on the stability theorem of linear fractional systems, a necessary condition is given to check the chaos synchronization of fractional systems with incommensurate order. Chaos synchronization is studied by utilizing the Pecora-Carroll (PC) method and the coupling method. The necessary condition can also be used as a tool to confirm results of a numerical simulation. Numerical simulation results show the effectiveness of the necessary condition.
Genome-Wide Chromosomal Targets of Oncogenic Transcription Factors
2008-04-01
Altman, W.E., Attiya, S., Bader, J.S., Bemben, L.A., Berka , J., Braverman, M.S., Chen, Y.J., Chen, Z., et al. 2005. Genome sequencing in microfabricated...software after filtering to exclude bad spots. qPCR validation. Primer pairs used in Figure 1 were designed to cover three peaks and three troughs in
Journal of Biosciences | Indian Academy of Sciences
Indian Academy of Sciences (India)
Home; Journals; Journal of Biosciences. Chen Fang. Articles written in Journal of Biosciences. Volume 30 Issue 3 June 2005 pp 351-357 Articles. Expression of a ribosome inactivating protein (curcin 2) in Jatropha curcas is induced by stress · Wei Qin Huang Ming-Xing Xu Ying Zhang Xin-Shen Chen Fang · More Details ...
The genus Bryoerythrophyllum (Musci, Pottiaceae in Antarctica
Directory of Open Access Journals (Sweden)
Sollman Philip
2015-07-01
Full Text Available Antarctic material of the genus Bryoerythrophyllum P. C. Chen was studied from all specimens present in KRAM. Bryoerythrophyllum recurvirostrum (Hedw. P. C. Chen var. antarcticum L. I. Savicz & Smirnova is treated as a distinct species: B. antarcticum (L. I. Savicz & Smirnova P. Sollman, stat. nov. Three species are now known in the Antarctic region: B. antarcticum, B. recurvirostrum and B. rubrum (Jur. ex Geh. P. C. Chen. Bryoerythrophyllum rubrum is reported for the first time from the Antarctic. It is a bipolar species. A key to the taxa is given. These species are described and briefly discussed, with notes on illustrations, reproduction, habitat, world range, distribution and elevation in Antarctica.
(DEPSCOR FY 09) Obfuscation and Deobfuscation of Intent of Computer Programs
2012-12-21
increased as the malware distribution mechanism has moved to the web through infected sites. In this use a site is hacked so as to distribute malware to...Simpósio Brasileiro em Segurança da Informaçao e de Sistemas Computacionais (2009). (Chen et al., 2012) Jundong Chen, Matthias R. Brust, Vir V. Phoha
The effects of growth time on the quality of graphene synthesized by ...
Indian Academy of Sciences (India)
by LPCVD. A JAFARI, R ALIPOUR∗ and M GHORANNEVISS ..... Li T, Hass J, Marchenkoy A N, Conrad E H, First P N and de ... Ni Z H, Chen W, Fan X F, Kuo J L, Yu T, Wee A T S ... Chen S, Cai W, Piner R D, Suk J W, Wu Y, Ren Y, Kang Y.
African Journals Online (AJOL)
Vol 9, No 1 (2006), Splenectomy in a rural surgical practice, Abstract PDF. E Alufohai, OO Odusanya. Vol 20, No 9 (2017), Spontaneous Retropharyngeal Emphysema: A Case Report, Abstract PDF. T-H Chi, C-C Hung, R-F Chen, C-H Yuan, J-C Chen. Vol 5, No 2 (2002), Spontaneous Rupture Of A Massive Hydrocephalus ...
Phase relation of LaFe11· 6Si1· 4 compounds annealed at different ...
Indian Academy of Sciences (India)
Home; Journals; Bulletin of Materials Science; Volume 35; Issue 2. Phase relation of LaFe11.6Si1.4 compounds annealed at different high-temperature and the magnetic property of LaFe11.6−CoSi1.4 compounds. Xiang Chen Yungui Chen Yongbai Tang. Volume 35 Issue 2 April 2012 pp 175-182 ...
Hsieh, Hui-Chen
2016-01-01
Developing the ability to speak English is a daunting task that has long been omitted in a test-driven pedagogy context (Chang, 2011; Li, 2012a, 2012b; Chen & Tsai, 2012; Katchen, 1989, 1995). Since speaking is not tested for school admissions, most students are not motivated to learn it (Chang, 2011; Chen & Tsai, 2012). Now, globalization…
Vehicle/Guideway Interaction in Maglev Systems
1992-03-01
Technology Division Materials and Components in Maglev Systems Technology Division Materials and Components Technology Division byY. Cai, S. S. Chen, and D. M...Transportation Systems Reports (UC-330, Vehicle/Guideway Interaction in Maglev Systems by Y. Cai and S. S. Chen Materials and Components Technology Division D. M...Surface Irregularities ...................................... 32 4 Vehicle/Guideway Interaction in Transrapid Maglev System .................. 34 4.1
Indian Academy of Sciences (India)
20. Nevill GA and Cook D 1969 Can. J. Chen. 47 743. 21. Glasel GA 1969 Org. Magn. Reson. 1481. 22. Soundarajan S 1958 Trans. Faraday Soc. 54147. 23. Rein R 1971 Int. J. Quant. Chem., Symp, 4341. 24. Woet D 1972.J. Am. Chen, Soc. 94.8213. 25. Bideau.JP, Huong PV and Toure S 1976 Acta Crystallogr. B32481.
2010-02-19
... Company Ltd., 13/F, Number 181, Sec 1, Datong Rd., Sijhih City, Taipei, Taiwan; and (4) Yi-Lan Chen, a.k.a., Kevin Chen, 13/F, Number 181, Sec 1, Datong Rd., Sijhih City, Taipei, Taiwan, and 7th Floor, Number 17... the requirements of the Paperwork Reduction Act of 1995 (44 U.S.C. 3501 et seq.) (PRA), unless that...
Clinton: USA kaotab infosõjas Hiina, Venemaa ja Al Jazeeraga / Kaivo Kopli
Kopli, Kaivo
2011-01-01
USA välisministri Hillary Clintoni hinnangul on USA propaganda nõrgenenud ning USA mõjuvõim väheneb pidevalt. H. Clintoni vastusest Senati väliskomisjonis senaator Richard Lugari küsimusele USA pingutustest diplomaatilise kommunikatsiooni vallas
On the Unsteady-Motion Theory of Magnetic Forces for Maglev
1993-11-01
DivisionEnergy Technology Division Forces for Maglev Energy Technology DivisionEnergy Technology Division by S. S. Chen, S. Zhu, and Y. Cai APQ 4 袲...On the Unsteady-Motion Theory of Magnetic Forces for Maglev by S. S. Chen, S. Zhu, and Y. Cai Energy Technology Division November 1993 Work supported...vi On The Unsteady-Motion Theory of Magnetic Forces for Maglev by S. S
On integral equation methods for electromagnetic scattering by biperiodic structures
Bugert, Beatrice
2014-01-01
In der vorliegenden Arbeit verwenden wir Integralgleichungsmethoden, um die Streuung von zeitharmonischen elektromagnetischen ebenen Wellen an biperiodischen mehrschichtigen Strukturen zu untersuchen. Solche Strukturen modellieren wir durch die vertikale Anordnung einer endlichen Anzahl an sich nicht schneidenden, polyedrisch Lipschitz regulären Grenzflächen. Wir unterscheiden Streuobjekte bestehend aus einer Oberfläche und solche bestehend aus mindestens zwei Oberflächen. Das elektromagnetis...
DEFF Research Database (Denmark)
Henriksen, Knud; Sporring, Jon; Hornbæk, Kasper
2004-01-01
reviews and provides a mathematical foundation for virtual trackballs. The first, but still popular, virtual trackball was described by Chen et al. [CHECK END OF SENTENCE]. We show that the virtual trackball by Chen et al. does not rotate the object along the intended great circular arc on the virtual...... trackball and we give a correction. Another popular virtual trackball is Shoemake's quaternion implementation [CHECK END OF SENTENCE], which we show to be a special case of the virtual trackball by Chen et al.. Shoemake extends the scope of the virtual trackball to the full screen. Unfortunately, Shoemake......'s virtual trackball is inhomogeneous and discontinuous with consequences for usability. Finally, we review Bell's virtual trackball [CHECK END OF SENTENCE] and discuss studies of the usability of virtual trackballs....
2018-02-01
Retracted Review article: Nucleophagy in Human Disease: Beyond the Physiological Role. [Tohoku J. Exp. Med., 2018, 244 (1), 75-81. doi: 10.1620/tjem.244.75.] The above Review article was published online on January 27, 2018. Soon after its publication (on February 1, 2018), Dr. Nian Fu and Prof. Linxi Chen informed the Editor-in-Chief, The Tohoku Journal of Experimental Medicine (TJEM), about serious violation of publication ethics. Indeed, Dr. Nian Fu and Prof. Linxi Chen were astonished to find their names as coauthors of this Review article, because they were not involved in the submission process of this Review article and they do not know any of other coauthors. In addition, the Review article is similar to their unpublished manuscript. After a thorough investigation in accordance with the recommendations of the Committee on Publication Ethics (COPE), the Editor-in-Chief of TJEM decided to retract this Review article. The reasons for Retraction are summarized below: forged authors and an unexpected case of plagiarism. Forged authors: Dr. Nian Fu and Prof. Linxi Chen were added as co-authors of the Review article without their knowledge. In fact, the signature provided by Prof. Linxi Chen is apparently different from the signature of a coauthor, named Linxi Chen, on the AUTHORS’ RESPONSIBILITY FORM, provided by the corresponding author of the Review article. More critically, the signature provided by Dr. Nian Fu is completely different from the signature of Nian Fu, because the Chinese characters are different between the two signatures. In addition, the replies from three authors (Ming Zhou, Hongwen Ji and Yong Xia) clearly indicate that they misunderstand the identity of Dr. Nina Fu. We also attempted to contact two authors, named Nian Fu and Linxi Chen, via e-mail. As expected, the forged authors did not respond to our inquiries, despite that their e-mail addresses appear to be active. An unexpected case of plagiarism: This Review article is similar to the
1989-05-17
brand , which symbolizes feudal autocracy, in that the new form has been posited in the hopes that reform can forcefully be implemented so as to...ucts; name- brand and high-quality products; products of energy, communications, transportation, and raw mate- rial industries; aid agriculture...1986 election. Chen Weiye fought a skillful battle although he had been seen as an underdog . The smashing victory of Chen Weiye and Huang Wentai plus
Viets, Carmen
2001-01-01
Faseroptische SERS-Sensoren wurden durch die Beschichtung der Endflächen von optischen Fasern mit rauhen Metallfilmen erzeugt. Zu den verschiedenen Präparationstechniken, die angewendet und verglichen wurden, gehörten das langsame Aufdampfen von Metall-Inselfilmen und das Bedampfen von Nanopartikeln, aufgerauhten oder elektronenlithographisch strukturierten Oberflächen mit Metallfilmen. Der Einfluß der Laserleistung auf die Messungen mit SERS-Sensoren wurde untersucht, und es wurden maximale ...
Unconventional Density Wave and Superfluidity in Cold Atom Systems
2014-06-01
Tsai, Chairperson Professor Kirill Shtengel Professor Vivek Aji 3 Copyright by Chen-Yen Lai 2014 4 The Dissertation of Chen-Yen Lai is approved...thank my dissertation committee members, Professor Vivek Aji and Pro- fessor Kirill Shtengel, for their help, kindness, insightful comments and...near balance to a stripe-CDW ( red ) as the imbalance increases. The insert shows the strong imbalance region, where single species p-wave majority
Quasi-Static Evolution, Catastrophe, and Failed Eruption of Solar Flux Ropes
2016-12-30
Ropes James Chen Beam Physics Branch Plasma Physics Division December 30, 2016 Approved for public release; distribution is unlimited. i REPORT...pressure gradient force combine to balance the major radial hoop force. The macroscopic forces on the flux ropes and onset conditions are quantified...Solar physics theory 67-4989-07 Quasi-Static Evolution, Catastrophe, and “Failed” Eruption of Solar Flux Ropes James Chen1 Plasma Physics Division
Aerial Logistics Management for Carrier Onboard Delivery
2016-09-01
NAVAL POSTGRADUATE SCHOOL MONTEREY, CALIFORNIA THESIS AERIAL LOGISTICS MANAGEMENT FOR CARRIER ONBOARD DELIVERY by Samuel L. Chen September 2016...AND SUBTITLE AERIAL LOGISTICS MANAGEMENT FOR CARRIER ONBOARD DELIVERY 5. FUNDING NUMBERS 6. AUTHOR(S) Samuel L. Chen 7. PERFORMING ORGANIZATION NAME(S...delivery (COD) is the use of aircraft to transport people and cargo from a forward logistics site (FLS) to a carrier strike group (CSG). The goal of
The Role of Protein Elongation Factor eEF1A2 in Breast Cancer
2006-09-01
apoptosis . A summary of common EMT markers is listed in Table I. Importantly, these developmental regulators can induce EMT in a nondevelopmental...1978; Chen et al., 1997), apoptosis (Chen et al., 1997), and metabolic regulation (Bissell et al., 1977) has been known for decades, the molecular...marks the Spemann organizer in vertebrate gastrulation and is one of the fi rst identifi ed regulators of embryological patterning (De Robertis et al
Massive Star Formation: Accreting from Companion X. Chen1 ...
Indian Academy of Sciences (India)
Abstract. We report the possible accretion from companion in the mas- sive star forming region (G350.69–0.49). This region seems to be a binary system composed of a diffuse object (possible nebulae or UC HII region) and a Massive Young Stellar Object (MYSO) seen in Spitzer IRAC image. The diffuse object and MYSO ...
Mitochondrial genome of Taiwan pig ( Sus Scrofa ) | Chen | African ...
African Journals Online (AJOL)
The purpose of this study is to investigate the complete nucleotide sequence of the mitochondrial genome of the Taiwan Lanyu pig (Sus scrofa) and its phylogenetic relationships with other pig breeds. Thirty-four forward and reverse primers were designed. Sequencing was performed in both directions. The results showed ...
Food Fortification to Prevent and Control Iron Deficiency | Chen ...
African Journals Online (AJOL)
It is essential to prevent the fortification iron from reacting with the absorption inhibitors. To ensure adequate absorption therefore, various factors must be considered before initiating a fortification programme. These include cost effectiveness of fortification in increasing absorbable iron, palatability of the fortified food and the ...
Chemische Reaktionen auf Oberflächen - eine SFG Studie
Kirsch, Harald
2014-01-01
This thesis focused on the investigation of chemical reactions on surfaces by usage of Sum Frequency Generation (SFG) spectroscopy and Thermal Desorption Spectroscopy (TDS). Understanding of chemical reactions on surfaces is of critical importance for modification and optimization of a variety of environmental and industrial processes, but the complexity of the ongoing reactions under "realistic" conditions often hinders an understanding on a molecular level. The aim of this work was to get i...
Existence of positive periodic solution of mutualism system with several delays
International Nuclear Information System (INIS)
Wu Haihui; Xia Yonghui; Lin Muren
2008-01-01
In this paper, by using Mawhin coincidence degree, some sufficient conditions are obtained for the global existence of positive periodic solutions of a mutualism systems with bounded and unbounded delays. Our results generalize significantly improve those of Gopalsamy and He [Gopalsamy K, He XZ. Persistence, attractivity, and delay in facultative mutualism. J Math Anal Appl 1997;215:154-73], Yang et al. [Yang F, Jiang D, Ying A. Existence of positive solution of multidelays facultative mutualism system. J Eng Math 2002;3:64-8], Chen et al. [Chen FD, Shi JL, Chen XX. Periodicity in Lotka-Volterra facultative mutualism system with several delays. J Eng Math 2004;21(3)] and Xia and Lin [Xia YH, Lin M, Existence of positive periodic solution of mutualism system with infinite delays. Ann Diff Eqs 2005;21(3):448-53
Robust anonymous authentication scheme for telecare medical information systems.
Xie, Qi; Zhang, Jun; Dong, Na
2013-04-01
Patient can obtain sorts of health-care delivery services via Telecare Medical Information Systems (TMIS). Authentication, security, patient's privacy protection and data confidentiality are important for patient or doctor accessing to Electronic Medical Records (EMR). In 2012, Chen et al. showed that Khan et al.'s dynamic ID-based authentication scheme has some weaknesses and proposed an improved scheme, and they claimed that their scheme is more suitable for TMIS. However, we show that Chen et al.'s scheme also has some weaknesses. In particular, Chen et al.'s scheme does not provide user's privacy protection and perfect forward secrecy, is vulnerable to off-line password guessing attack and impersonation attack once user's smart card is compromised. Further, we propose a secure anonymity authentication scheme to overcome their weaknesses even an adversary can know all information stored in smart card.
Transparent and Stretchable High-Performance Supercapacitors Based on Wrinkled Graphene Electrodes
2013-12-18
2, 870–875. 38. Chen, T.; Dai, L. Carbon Nanomaterials for High- Performance Supercapacitors . Mater. Today 2013, 16, 272–280. 39. Stoller, M. D...High-Performance Supercapacitors Based onWrinkledGraphene Electrodes Tao Chen,† Yuhua Xue,† Ajit K. Roy,‡ and Liming Dai†,* †Center of Advanced Science...electrodes and the associated supercapacitor cells cannot be both trans- parent and stretchable.1318 It is highly desirable to integrate the
Wang, Xiaolin; Wang,Qingbing; Li,Jianfeng; An,Sai; Chen,Yi; Jiang,Chen
2015-01-01
Qingbing Wang,1,2 Jianfeng Li,3 Sai An,3 Yi Chen,1 Chen Jiang,3 Xiaolin Wang1,2 1Department of Interventional Radiology, Zhongshan Hospital, Fudan University, 2Shanghai Institute of Medical Imaging, 3Key Laboratory of Smart Drug Delivery, Ministry of Education, Department of Pharmaceutics, School of Pharmacy, Fudan University, Shanghai, People’s Republic of China Background: Gene therapy is a very promising technology for treatment of pancreatic ductal adenocarci...
2013-01-01
Mian BM. Hedgehog Signaling Pathway Activation in Bladder Transitional Cell Carcinoma (TCC). J Urol., 2010, 184(1):344-351. PMID: 20488474 3...Tanner MJ, Welliver RC Jr, Chen M, Shtutman M, Godoy A, Smith G, Mian BM, Buttyan R. Effects of Androgen Receptor and Androgen on Gene Expression in...activities. Proc. Natl. Acad. Sci. USA, 2012, 109(34):13799-804. PMID: 22869755 Manuscripts in Preparation 1. Chen M* (co-first author), Li N*, Carkner
CLEAR: Cross-Layer Exploration for Architecting Resilience
2017-03-01
unavailable, or in an economy mode (low resilience, low power mode) when ABFT is available. However, the overheads outweigh benefits (details in [Cheng 16b...layer r Design, Automation , & Test in Europe, 2010. [Chen 05] Chen, Z. and J. Dong table real number codes based on random m Lecture Notes in...tolerate soft errors in processor c ACM/EDAC/IEEE Design Automation Conf., 2016. [Cheng 16b] Cheng, E., et al. -layer exploration for architecting
Agent Reasoning Transparency: The Influence of Information Level on Automation-Induced Complacency
2017-06-30
automation performance using working memory capacity. Ergonomics . 2014;57(3):295–318. Barber D, Davis L, Nicholson D, Finkelstein N, Chen JYC. The...ELEMENT NUMBER 6. AUTHOR(S) Julia L Wright, Jessie YC Chen, Michael J Barnes, and Peter A Hancock 5d. PROJECT NUMBER 5e. TASK NUMBER 5f. WORK ...Appendix C. Cube Comparisons Test 131 Appendix D. Spatial Orientation Test 135 Appendix E. National Aeronautics and Space Administration-Task Load Index
Märts - kirjutajate lõikuskuu / Rein Veidemann
Veidemann, Rein, 1946-
2003-01-01
Kultuurkapitali kirjandusauhindadest ja nende saajatest. Proosa - Jüri Ehlvest, "Hobune eikusagilt"; luule - Karl Martin Sinijärv, "Artutart & 39"; näitekirjandus - Vaino Vahing, "Mängud ja kõnelused" ; lastekirjandus - Heino Kiik, "Kuresaapad"; esseistika - Peeter Mudist, "Ratsukäik"; tõlge eesti keelde - Mati Sirkel, Franz Kafka "Hiina müüri ehitamisel"; tõlge eesti keelest (Via Estica) - Antoine Chalvin, Jaan Kaplinski "Le désir de la pousière"; artiklipreemia - Tõnu Õnnepalu, "Kui...Küpsemine. Aleksander Suumani kaks luuletust ja üks raamat ("Meil siin Hüperboreas")", ilmus Loomingus, nr. 5-6; venekeelsete autorite auhind - Mihhail Veller - viimase 10 aasta proosaloomingu eest, ka ilmus 2002. a. eesti keeles tema "Nulltund"
Chen YC; Ho HO; Chiu CC; Sheu MT
2013-01-01
Ying-Chen Chen,1,* Hsiu-O Ho,1,* Chiao-Chi Chiu,1 Ming-Thau Sheu1,2 1School of Pharmacy, College of Pharmacy, Taipei Medical University, 2Clinical Research Center and Traditional Herbal Medicine Research Center, Taipei Medical University Hospital, Taipei, Taiwan*These authors contributed equally to this workAbstract: In this study, alendronate, the most commonly used biphosphonate for treating osteoporosis, was formulated as gastroretentive dosage form (GRDF) tablets to enhance its oral bioav...
Chen,Wei; Ju,Jing; Yang,Yehong; Wang,Hao; Chen,Wenjie; Zhao,Xuelan; Ye,Hongying; Zhang,Yu
2018-01-01
Wei Chen,1 Jing Ju,1 Yehong Yang,2 Hao Wang,3 Wenjie Chen,1 Xuelan Zhao,1 Hongying Ye,2 Yu Zhang1 1Department of Geriatrics, Huashan Hospital, Fudan University, Shanghai, China; 2Department of Endocrinology, Huashan Hospital, Fudan University, Shanghai, China; 3Core Center of Animal Facility, School of Medicine, Fudan University, Shanghai, China Introduction: Diabetic cardiomyopathy is characterized by an imbalance between myocyte death and regeneration mediated by the progressive loss of c...
Reforming China’s Criminal Procedure Law
Winckler, Hugo
2014-01-01
Sources:- Wang Jianxun, “The provisions of the reform of criminal procedural law legalising secret investigations are a step backwards,” Caijing wang, 5 September 2011.- Chen Youxi, “The legalisation of secret investigations is an important violation of political integrity,” Zhongguo wangluo dianshitai – CNTV web site, Opinion section, 27 November 2011.- Wu Zhehua, “Chen Weidong discusses reform of the criminal procedure law: Behind each article there is a story,” Zhongguoguangbo wang, 8 Marc...
Chen, Ming; Anderson, Erik; Hill, Geoffrey; Chen, John J; Patrianakos, Thomas
2015-01-01
Ming Chen,1 Erik Anderson,2 Geoffrey Hill,3 John J Chen,4 Thomas Patrianakos2 1Department of Surgery, University of Hawaii, Honolulu, HI, 2Department of Ophthalmology, John H Stroger, Jr Hospital of Cook County, Chicago, IL, 3Department of Ophthalmology, UT Southwestern Medical Center, Dallas, TX, 4Biostatistics Core, John A Burns School of Medicine, University of Hawaii, Honolulu, HI, USA Purpose: To compare cumulative dissipated energy between two phacoemulsification mac...
Chen, Ming; Sweeney, Henry W; Luke, Becky; Chen, Mindy; Brown, Mathew
2009-01-01
Ming Chen1, Henry W Sweeney2, Becky Luke3, Mindy Chen4, Mathew Brown51University of Hawaii, Honolulu, Hawaii, USA; 2Research Support Services, the Queens Medical Center, Honolulu, Hawaii, USA; 3Surgical Suite, Honolulu, Hawaii, USA; 4University of California, Irvine, CA, USA; 5University of California, San Diego, CA, USAAbstract: Cumulative dissipated energy (CDE) was used with Infiniti® Vision System (Alcon Labs) as an energy delivery guide to compare four different phaco techniques ...
Chen, Ming
2009-01-01
Ming Chen1, Henry W Sweeney2, Becky Luke3, Mindy Chen4, Mathew Brown51University of Hawaii, Honolulu, Hawaii, USA; 2Research Support Services, the Queens Medical Center, Honolulu, Hawaii, USA; 3Surgical Suite, Honolulu, Hawaii, USA; 4University of California, Irvine, CA, USA; 5University of California, San Diego, CA, USAAbstract: Cumulative dissipated energy (CDE) was used with Infiniti® Vision System (Alcon Labs) as an energy delivery guide to compare four different phaco techniques ...
Tung, Li-Chen; Lin, Chin-Kai; Hsieh, Ching-Lin; Chen, Ching-Chi; Huang, Chin-Tsan; Wang, Chun-Hou
2013-01-01
Li-Chen Tung,1,# Chin-Kai Lin,2,# Ching-Lin Hsieh,3,4 Ching-Chi Chen,1 Chin-Tsan Huang,1 Chun-Hou Wang5,6 1Department of Physical Medicine and Rehabilitation, Chi Mei Medical Center, Tainan, 2Program of Early Intervention, Department of Early Childhood Education, National Taichung University of Education, Taichung, 3School of Occupational Therapy, College of Medicine, National Taiwan University, Taipei, 4Department of Physical Medicine and Rehabilitation, National Taiwan University Hospital, ...
Lanthanide metal-organic frameworks
International Nuclear Information System (INIS)
Cheng, Peng
2015-01-01
This book contains the following nine chapters: lanthanide metal-organic frameworks: syntheses, properties, and potential applications (Stephen Fordham, Xuan Wang, Mathieu Bosch, Hong-Cai Zhou); 2. chiral lanthanide metal-organic frameworks (Weisheng Liu, Xiaoliang Tang); 3. Porous lanthanide metal-organic frameworks for gas storage and separation (Bin Li, Banglin Chen); 4. Luminescent lanthanide metal-organic frameworks (Xue-Zhi Song, Shu-Yan Song, Hong-Jie Zhang); 5. Metal-organic frameworks based on lanthanide clusters (Lian Chen, Feilong Jiang, Kang Zhou, Mingyan Wu, Maochun Hong); 6. metal-organic frameworks with d-f cyanide bridges: structural diversity, bonding regime, and magnetism (Marilena Ferbinteanu, Fanica Cimpoesu, Stefania Tanase); 7. transition-lanthanide heterometal-organic frameworks: synthesis, structures, and properties (Wei Shi, Ke Liu, Peng Cheng); 8: MOFs of uranium and the actinides (Juan Su, Jiesheng Chen); 9. Nanostructured and/or nanoscale lanthanide metal-organic frameworks (Zhonghao Zhang, Zhiping Zheng).
Lanthanide metal-organic frameworks
Energy Technology Data Exchange (ETDEWEB)
Cheng, Peng (ed.) [Nankai Univ., Tianjin (China). Dept. of Chemistry
2015-03-01
This book contains the following nine chapters: lanthanide metal-organic frameworks: syntheses, properties, and potential applications (Stephen Fordham, Xuan Wang, Mathieu Bosch, Hong-Cai Zhou); 2. chiral lanthanide metal-organic frameworks (Weisheng Liu, Xiaoliang Tang); 3. Porous lanthanide metal-organic frameworks for gas storage and separation (Bin Li, Banglin Chen); 4. Luminescent lanthanide metal-organic frameworks (Xue-Zhi Song, Shu-Yan Song, Hong-Jie Zhang); 5. Metal-organic frameworks based on lanthanide clusters (Lian Chen, Feilong Jiang, Kang Zhou, Mingyan Wu, Maochun Hong); 6. metal-organic frameworks with d-f cyanide bridges: structural diversity, bonding regime, and magnetism (Marilena Ferbinteanu, Fanica Cimpoesu, Stefania Tanase); 7. transition-lanthanide heterometal-organic frameworks: synthesis, structures, and properties (Wei Shi, Ke Liu, Peng Cheng); 8: MOFs of uranium and the actinides (Juan Su, Jiesheng Chen); 9. Nanostructured and/or nanoscale lanthanide metal-organic frameworks (Zhonghao Zhang, Zhiping Zheng).
Riskikapitalist : "Uus Euroopa on meie Hiina ja India" / Danny Rimer ; interv. Kristjan Otsmann
Rimer, Danny
2006-01-01
Euroopa suurimate riskikapitalide hulka kuuluva Index Venturesi partner Danny Rimer otsib kõikjalt Euroopast, ka Eestist, ettevõtteid, mis suudavad luua uut läbilöögivõimelist tehnoloogiat. Kuumad teemad riskikapitali maailmas, ettevõtete valik, kuhu investeerida. Lisa: Index Ventures
Scattering of plane waves by rough surfaces in the sense of Born approximation
Arnold, Thomas
2014-01-01
Das Thema dieser Arbeit ist die Streuung elektromagnetischer ebener Wellen an rauen Oberflächen, also an ebenen Oberflächen mit glatten und beschränkten Störungen. Darüber hinaus wird ein kleiner Kontrast der Materialkonstanten zwischen dem Deckmaterial und dem Material unter der rauen Oberfläche angenommen. Unter diesen Voraussetzungen wird ein Fernfeld-Formel für das gestreute Feld mit Hilfe von Born-Approximation und Fourier-Techniken hergeleitet. Dieser Ansatz basiert auf einer Modifikati...
Distributed mechatronics controller for modular wall climbing robot
CSIR Research Space (South Africa)
Tlale, NS
2006-07-01
Full Text Available - climbing robot for inspection in nuclear power plants.”, Proc. IEEE Int. Conf. on Robotics and Automation, pp. 409-1414. (Chen 2001) Chen, D-. J., 2001, “Architecture for Systematic Development of Mechatronics Software Systems”, Licentiate Thesis... provide a more cost effective solution to the problem (Luk et al 1991). Such robots are termed service robots by the International Service Robot Association (ISRA) (Pransky 1996). They are defined as machines that sense, think, and act to benefit (or...
Bai,Fang; Yin,You; Chen,Ting; Chen,Jihui; Ge,Meixin; Lu,Yunshu; Xie,Fangyuan; Zhang,Jian; Wu,Kejin; Liu,Yan
2018-01-01
Fang Bai,1–3,* You Yin,4,* Ting Chen,1,* Jihui Chen,1 Meixin Ge,2 Yunshu Lu,2 Fangyuan Xie,5 Jian Zhang,1 Kejin Wu,3 Yan Liu1,6 1Department of Pharmacy, Xinhua Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai, 2Department of General Surgery, Xinhua Hospital, Affiliated to Shanghai Jiao Tong University, School of Medicine, Shanghai, 3Department of Breast Surgery, Obstetrics and Gynaecology Hospital, Fudan University, Shanghai, 4Department of Neurology, Changzheng...
Chen,Hong; Xu,Hong; Meng,Yugang; Zhang,Yun; Chen,Junying; Wei,Xiaoning
2016-01-01
Hong Chen,1 Hong Xu,1 Yu-gang Meng,1 Yun Zhang,2 Jun-ying Chen,1 Xiao-ning Wei1 1Department of Gynaecology, The First Affiliated Hospital of Guangxi Medical University, Nanning, Guangxi, 2Department of Gynaecology, The People’s Hospital of Suzhou High Tech District, Suzhou, Jiangsu, People’s Republic of China Background: Uterine leiomyoma is one of the most common benign tumors in women. It dramatically decreases the quality of life in the affected women. However, there ...
Directory of Open Access Journals (Sweden)
Haoyu Liu
2017-03-01
Full Text Available A second species of Qingryllus Chen & Zheng is described and illustrated, Q. jiguanshanensis sp. n., from Sichuan, China. This new species is similar to Q. striofemorus Chen & Zheng, 1995, but differs from the latter by the posterior margin of pronotum being distinctly widened, the veins of tegmina yellowish-white only on lateral side of dorsal area, and the epiphallus distinctly widened posteriorly. A distribution map of the species of this genus and habitus photographs of the new species are presented.
2012-08-06
K2-2 COMPUTATIONAL STUDY OF EXTERNAL FIXATION DEVICES SURFACE HEATING IN 1.5T AND 3T MRI SYSTEMS Yan Liu*1, Jianxiang Shen1, Ji Chen1, Wolfgang...communications have been ex- panding rapidly with the proliferation of consumer wireless devices such as smart phones, tablet PCs, handheld gaming devices, and...Computational Study of External Fixation Devices Surface Heating in 1.5T and 3T MRI Systems Yan Liu* (1) , Jianxiang Shen (1) , Ji Chen (1) , and
Is the Chinese Army the Real Winner in PLA Reforms
2016-10-01
44 Commentary / The Chinese Army and PLA Reforms JFQ 83, 4th Quarter 2016 Is the Chinese Army the Real Winner in PLA Reforms? By Phillip C. Saunders...and John Chen G round force officers run China’s military, the People’s Liberation Army ( PLA ). About 70 percent of PLA soldiers serve in the PLA ...Saunders and Chen 45 services and arms of the PLA ” has meant reductions in “technologically backward” PLAA units and personnel increases for the other
International Nuclear Information System (INIS)
Taherkhani, Farid; Akbarzadeh, Hamed; Feyzi, Mostafa; Rafiee, Hamid Reza
2015-01-01
Molecular dynamics simulation has been implemented for doping effect on melting temperature, heat capacity, self-diffusion coefficient of gold–copper bimetallic nanostructure with 55 total gold and copper atom numbers and its bulk alloy. Trend of melting temperature for gold–copper bimetallic nanocluster is not same as melting temperature copper–gold bulk alloy. Molecular dynamics simulation of our result regarding bulk melting temperature is consistence with available experimental data. Molecular dynamics simulation shows that melting temperature of gold–copper bimetallic nanocluster increases with copper atom fraction. Semi-empirical potential model and quantum Sutton–Chen potential models do not change melting temperature trend with copper doping of gold–copper bimetallic nanocluster. Self-diffusion coefficient of copper atom is greater than gold atom in gold–copper bimetallic nanocluster. Semi-empirical potential within the tight-binding second moment approximation as new application potential model for melting temperature of gold–copper bulk structure shows better result in comparison with EAM, Sutton–Chen potential, and quantum Sutton–Chen potential models
Energy Technology Data Exchange (ETDEWEB)
Taherkhani, Farid, E-mail: faridtaherkhani@gmail.com, E-mail: f.taherkhani@razi.ac.ir [Razi University, Department of Physical Chemistry (Iran, Islamic Republic of); Akbarzadeh, Hamed [Hakim Sabzevari University, Department of Chemistry (Iran, Islamic Republic of); Feyzi, Mostafa; Rafiee, Hamid Reza [Razi University, Department of Physical Chemistry (Iran, Islamic Republic of)
2015-01-15
Molecular dynamics simulation has been implemented for doping effect on melting temperature, heat capacity, self-diffusion coefficient of gold–copper bimetallic nanostructure with 55 total gold and copper atom numbers and its bulk alloy. Trend of melting temperature for gold–copper bimetallic nanocluster is not same as melting temperature copper–gold bulk alloy. Molecular dynamics simulation of our result regarding bulk melting temperature is consistence with available experimental data. Molecular dynamics simulation shows that melting temperature of gold–copper bimetallic nanocluster increases with copper atom fraction. Semi-empirical potential model and quantum Sutton–Chen potential models do not change melting temperature trend with copper doping of gold–copper bimetallic nanocluster. Self-diffusion coefficient of copper atom is greater than gold atom in gold–copper bimetallic nanocluster. Semi-empirical potential within the tight-binding second moment approximation as new application potential model for melting temperature of gold–copper bulk structure shows better result in comparison with EAM, Sutton–Chen potential, and quantum Sutton–Chen potential models.
Li, Feng; Chen, Yan; Liu, Shubo; Qi, Jian; Wang, Weiying; Wang, Chenhua; Zhong, Ruiyue; Chen, Zhijun; Li, Xiaoming; Guan, Yuanzhou; Kong, Wei; Zhang, Yong
2017-01-01
Feng Li,1 Yan Chen,1,2 Shubo Liu,1 Jian Qi,1 Weiying Wang,1 Chenhua Wang,1 Ruiyue Zhong,1 Zhijun Chen,1 Xiaoming Li,1 Yuanzhou Guan,1 Wei Kong,1,2 Yong Zhang1,2 1National Engineering Laboratory for AIDS Vaccine, School of Life Sciences, Jilin University, Changchun, 2Key Laboratory for Molecular Enzymology and Engineering, the Ministry of Education, School of Life Sciences, Jilin University, Changchun, China Abstract: Zein-based nano/microparticles have been demonstrated to be promising carr...
International Nuclear Information System (INIS)
Hu Manfeng; Xu Zhenyuan; Zhang Rong; Hu Aihua
2007-01-01
Based on the active control idea and the invariance principle of differential equations, a general scheme of adaptive full state hybrid projective synchronization (FSHPS) and parameters identification of a class of chaotic (hyper-chaotic) systems with linearly dependent uncertain parameters is proposed in this Letter. With this effective scheme parameters identification and FSHPS of chaotic and hyper-chaotic systems can be realized simultaneously. Numerical simulations on the chaotic Chen system and the hyper-chaotic Chen system are presented to verify the effectiveness of the proposed scheme
2013-10-01
Wu K, Wang L, Jiao X, Ju X, Li Z, Ertel A, Addya S, McCue P, Lisanti MP, Wang C, Davis RJ, Mardon G, Pestell RG. Androgen therapy resistant...Li Z, Hu J, Chen K, Wu J, Pestell RG. DACH1 inhibited prostate cancer cellular proliferation and Interleukon-6 signaling. AACR 103rd Annual Meeting...March 31 – April 4, 2012, Chicago, IL. Wang J, Cai S, Chen K, Sun Y, Li S, Pestell RG, Wu K. Regulation of AR transcriptional activity and
Directory of Open Access Journals (Sweden)
Martha C. Martínez Quintanilla
2017-04-01
Full Text Available Existen organismos silvestres que son altamente vulnerables ante estresores antropogénicos y naturales, estos organismos pueden ser de utilidad para evaluar la salud ambiental mediante diferentes indicadores confiables, sencillos, rápidos, económicos para determinar y si es posible reducir estos efectos negativos. En este estudio proponemos al ganso nevado (Chen caerulescens como posible biomonitor de estrés y genotóxicos ambientales mediante la relación heterófilo/linfocito (H/L, la prueba de micronúcleos (EMN, prolongaciones nucleares en eritrocitos (EPN y eritrocitos policromáticos (EPC. Durante la temporada de caza (2012-2013 en el humedal de Málaga, Durango, México, colectamos 18 organismos. Los eritrocitos fueron las células más abundantes, de núcleo y morfología elípticos, de tamaño 12.68 ± 0.89 µm. Observamos heterófilos (11.07±1.32 µm, eosinófilos (9.67±1.26 µm, basófilos (5.75 ± 0.78 µm, monocitos (10.49±1.36 µm y linfocitos (6.53±1.0 µm. No identificamos alteración en las proporciones ni en la morfología de leucocitos, sin embargo, es necesario un mayor número de organismos para establecer los parámetros sanguíneos de base normal para esta especie. La relación h/l fue de 0.41 ± 0.11 este valor es similar a lo reportado para esta y otras especies de aves consideradas como sanas. Establecimos la frecuencia basal de EMN (2.6±1.45, epn (249.2 ± 89.74 y EPC (156.5 ± 50. El ganso nevado es un organismo que se perfila como buen candidato a biomonitor ambiental debido a la frecuencia basal de su relación H/L, EMN, EPN y EPC, pero debe probarse en condiciones estandarizadas y a través de estudios en zonas con y sin contaminación.
A Brief Introduction of Air Traffic Management
Institute of Scientific and Technical Information of China (English)
1997-01-01
Air Traffic Management (ATM) started publication in 1995 by Air Traffic Management Bureau of CAAC. It is the first magazine about ATM field in CAAC. The chairman of Editorial Board of ATM is Mr. Bao Peide, Vice Minister of CAAC. Mr. Chen Ziye, Vice President of the 1st Research Institute of CAAC and Chen Xuhua, General Director of Air Traffic Management Bureau are vice chairmen of the editorial board, and six general directors of local air traffic management bureau and some professors and experts are members of the editorial board.
A glimpse into the littoral nutrient dynamics of a lake system connected to the sea
CSIR Research Space (South Africa)
Taljaard, Susan
2018-01-01
Full Text Available -situ sources are those situated in the floodplains of water bodies such as septic tank systems from low-lying developments (e.g. Chen, 1988; Fraterrigo and Downing, 2008). The smaller, dynamic and more linear nature of over 80% of South Africa’s estuaries... of agricultural watersheds in central Navarre (Spain). Agric. Water Manage. 95 1111–1128. https://doi.org/10.1016/j.agwat.2008.06.013 CHEN M (1988) Pollution of ground water by nutrients and fecal coliforms from lakeshore septic tank systems. Water Air Soil...
清末民初における『レ・ミゼラブル』の移入と日本 : 陳景韓訳「哀史之一節逸犯」を例として
梁, 艶; Liang, Yan
2011-01-01
Victor Hugo was introduced into China through his Japanese translations. However, the route of the reception of his masterpiece Les Misérables in China has not yet been explained clearly. In this paper, I will take Ai Shi Zhi Yi Jie Yi Fan, a Chinese translation by Chen Jinghan of a part of Les Misérables, as an example to see how Les Misérables was introduced into China. By examining Japanese translations of Les Misérables, I come to the conclusion that Chen was influenced by Kuroiwa Ruikô's...
The Secret of Guided Missile Re-Entry,
1986-06-25
I RD-PAI169 598 THE SECRET OF GUIDED MISSILE RE-ENTRY(U) FOREIGN / I TECHNOLOGY DIV NRIGHT-PATTERSON RFB OH J CHEN ET AL. I 25 JUN 96 FTD-ID(RS)T...TECHNOLOGY DIVISION THE SECRET OF GUIDED MISSILE RE-ENTRY by Chen Jingzhong, An Sehua J L 0 7 ’:;85’ ’ 0 *Approved for public release; Distribution...unlimite t d. :. 86 7 034.. FTD- ID(RS)T-0459-86 HUMAN TRANSLATION FTD-ID(RS)T-0459-86 25 June 1986 MICROFICHE NR: F - - 0Q 9? THE SECRET OF GUIDED
Initiation and Propagation of Coronal Mass Ejections P. F. Chen
Indian Academy of Sciences (India)
Introduction. Coronal mass ejections (CMEs) have been observed for over 30 years. They keep being an intriguing research topic, not only because they are now realized to be the major driver for space weather disturbances, which are intimately connected to human activities, but also because they themselves are full of ...
Die Beifuß-Ambrosie auf Ackerflächen - ein Problem?
Directory of Open Access Journals (Sweden)
Verschwele, Arnd
2014-07-01
Full Text Available Common ragweed (Ambrosia artemisiifolia is spreading on agricultural fields in Germany, mainly in Brandenburg and Bayern. Competitive crops like winter cereals and oilseed-rape can reduce growth of this plant better than spring crops. In maize or cereals a chemical control is possible, but problems may arise because of the late emergence of ragweed and its high ability to regrowth. In crops like sunflower or lupines herbicide choice is limited and thus preventive control measures are crucial. An integrated approach is needed in order to avoid yield losses and to stop the spreading of ragweed in Germany.
Diskrepanz: Die EU-Frauenpolitik zwischen Deregulierung und Gleichheitsansprüchen
Directory of Open Access Journals (Sweden)
Ingrid Biermann
2003-03-01
Full Text Available In von neun Autorinnen verfassten Beiträgen gibt der Band Einblicke in zentrale Felder der EU-Politik: die europäische Wirtschafts- und Währungsunion (EWWU, die Strukturpolitik, die Gleichstellungspolitik und das Gender Mainstreaming, die Osterweiterung sowie die Ausarbeitung einer europäischen Verfassung. Damit werden wesentliche Teile des Maastricht-Vertrags (1992, des Amsterdamer Vertrags (1997 und des Nizza-Vertrags (2000 behandelt. Hierdurch bildet dieser Band eine wichtige Grundlage für die Diskussion über die Frauenpolitik der EU.
Optimum profit model considering production, quality and sale problem
Chen, Chung-Ho; Lu, Chih-Lun
2011-12-01
Chen and Liu ['Procurement Strategies in the Presence of the Spot Market-an Analytical Framework', Production Planning and Control, 18, 297-309] presented the optimum profit model between the producers and the purchasers for the supply chain system with a pure procurement policy. However, their model with a simple manufacturing cost did not consider the used cost of the customer. In this study, the modified Chen and Liu's model will be addressed for determining the optimum product and process parameters. The authors propose a modified Chen and Liu's model under the two-stage screening procedure. The surrogate variable having a high correlation with the measurable quality characteristic will be directly measured in the first stage. The measurable quality characteristic will be directly measured in the second stage when the product decision cannot be determined in the first stage. The used cost of the customer will be measured by adopting Taguchi's quadratic quality loss function. The optimum purchaser's order quantity, the producer's product price and the process quality level will be jointly determined by maximising the expected profit between them.
Choi, Younsung; Nam, Junghyun; Lee, Donghoon; Kim, Jiye; Jung, Jaewook; Won, Dongho
2014-01-01
An anonymous user authentication scheme allows a user, who wants to access a remote application server, to achieve mutual authentication and session key establishment with the server in an anonymous manner. To enhance the security of such authentication schemes, recent researches combined user's biometrics with a password. However, these authentication schemes are designed for single server environment. So when a user wants to access different application servers, the user has to register many times. To solve this problem, Chuang and Chen proposed an anonymous multiserver authenticated key agreement scheme using smart cards together with passwords and biometrics. Chuang and Chen claimed that their scheme not only supports multiple servers but also achieves various security requirements. However, we show that this scheme is vulnerable to a masquerade attack, a smart card attack, a user impersonation attack, and a DoS attack and does not achieve perfect forward secrecy. We also propose a security enhanced anonymous multiserver authenticated key agreement scheme which addresses all the weaknesses identified in Chuang and Chen's scheme.
Tänu sümpoosionile teatakse Kohilat ka Taiwanis, Koreas ja Hiinas / Teet Teder
Teder, Teet
2009-01-01
9. Kohila rahvusvahelisest keraamikasümpoosionist, mille üks korraldajaid on Aigi Orav. Ameerika keraamikust Anthony Stellacciost. 25. 07 avatakse Tohisoo mõisapargis sümpoosioni käigus loodud tööde näitus, esineb vanamuusikaansambel Rondellus. Leo Rohlin Kohila keraamikasümpoosioni olulisusest, lühidalt tema näitusest "Ajast aega" Eesti Kunstiakadeemia galeriis
[A review for a traditional Chinese medical journal Shou Shi Yi Bao].
Xiao, Mei-Hua; Sun, Wen-Zhong
2009-06-01
Shou Shi Yi Bao was a journal of traditional Chinese medicine (TCM) during the period from 1935 to 1937, and was originated by Chen Huan-yun, a TCM physician in Suzhou. It is mainly to transmit the knowledge of TCM and to promote the epidemic prevention capacity of local public. The editorial characteristics and historical value of the journal were explored in initial background, staff writers, editorial policies, contents and the Editor Chen's medical ideas. Shou Shi Yi Bao was supported by many famous TCM physicians, although the journal was originated from the civil society. It was an academic TCM journal with perfect practicability for orientating to the public and highlighting the academic spirit. Chen Huan-yun was a resolute defender of TCM, and had many opinions on clinical practice and lots of scientific suggestions on TCM development. Shou Shi Yi Bao reflected the main characteristics of TCM journals in 1930s. The journal was one of the important documents to study the TCM history during the period of the Republic of China in Jiangsu Province, and it also set a stage for the struggle between TCM and Western medicine at that time. The documentary information of the journal has literature and history values in reflecting the historical process of TCM self-improvement. The success of the journal was due to not only the broken-up sectarian bias and cooperation of the TCM practitioners but also the preponderant geographic and cultural circumstances of Suzhou as well as Chen Huan-yun's profound knowledge in traditional Chinese culture and medicine.
Kultuurkapitali kirjandusauhinnad jagatud
2003-01-01
Proosa - Jüri Ehlvest, "Hobune eikusagilt"; luule - Karl Martin Sinijärv, "Artutart & 39"; näitekirjandus - Vaino Vahing, "Mängud ja kõnelused" ; lastekirjandus - Heino Kiik, "Kuresaapad"; esseistika - Peeter Mudist, "Ratsukäik"; tõlge eesti keelde - Mati Sirkel, Franz Kafka "Hiina müüri ehitamisel"; tõlge eesti keelest (Via Estica) - Antoine Chalvin, Jaan Kaplinski "Le désir de la pousière"; artiklipreemia - Tõnu Õnnepalu, "Kui...Küpsemine. Aleksander Suumani kaks luuletust ja üks raamat ("Meil siin Hüperboreas"), ilmus Loomingus, nr. 5-6; venekeelsete autorite auhind - Mihhail Veller - viimase 10 aasta proosaloomingu eest, ka ilmus 2002. a. eesti keeles tema "Nulltund". Vt. ka: Postimees, 7. märts, lk. 15 ; Eesti Päevaleht : Arkaadia, 7. märts, lk. 20 ; Looming, 2003, nr. 4, lk. 632-633
2012-02-10
Cremer , J-Y Chen, C.K. Westbrook, L.Q. Maurice, J. Propul. Power 18 (1) (2002) 192–198. K. Harstad, J. Bellan / Combustion and Flame 157 (2010) 1594... Cremer , J.-Y. Chen, C.K. Westbrook, L.Q. Maurice, J. Propuls. Power 18 (1) (2002) 192–198. a 10-9 10-7 10-5 10-3 10-1 101 N oh (m ol /m 3 ) T0 = 800...Caltech by the Army Research Office under the direction of Drs. David Mann, Kevin McNesby and Ralph Anthenien. References 1U. C. Müeller, N. Peters, A
Spiegelberg, Jakob; Rusz, Ján
2015-12-01
In the framework of the slice transition operator technique, a general multislice theory for electron scattering in crystals is developed. To achieve this generalization, we combine the approaches for inelastic scattering derived by Yoshioka [J. Phys. Soc. Jpn. 12, 6 (1957)] and backscattering based on the formalism of Chen and Van Dyck [Ultramicroscopy 70, 29-44 (1997)]. A computational realization of the obtained equations is suggested. The proposed computational scheme is tested on elastic backscattering of electrons, where we consider single backscattering in analogy to the computational scheme proposed by Chen and Van Dyck. Copyright © 2015 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Gordon C. K. Cheung
2010-04-01
Full Text Available Taiwan’s Legislative Yuan and Presidential elections in January and March 2008 respectively re-orientated cross-Strait relations from hostility to co-operation. On 4 November 2008, Chen Yunlin, head of the Association for Relations Across the Taiwan Straits (ARATS, and Chiang Pin-kun (Jiang Bingkun, chairman of Taiwan’s Straits Exchange Foundation (SEF, meeting in the Second Chiang-Chen Talks in Taiwan, took a historical step in the further development of cross-Strait relations. Agreements were signed on direct air and sea transport, postal services and food-safety security. On 22 December 2009, the Fourth Chiang- Chen Talks took place in Taizhong and more substantial and technical agreements were signed on agriculture, inspection/ accreditation and fisheries. It seems that continuous integration between China and Taiwan is inevitable. To address the implications of this process for Taiwan’s domestic economy, four dimensions of the current cross-Strait relationship are scrutinized: guanxi, plutocracy, legalism and the idea of a Chinese Common Market. It is argued that in order to intensify economic co-operation across the Taiwan Strait, more institutionalization of the cross-Strait relationship must be brought about.
Vibration mechanism of fuel rod in axial flow
International Nuclear Information System (INIS)
Kang, Heung Seok; Yoon, Kyung Ho; Kim, Hyung Kyu; Song, Kee Nam
1998-08-01
This is a review on the previous researches for the vibration of fuel rod induced by axial flow. The analysis methods are classified into three categories accordingly as the researchers postulate the vibration to be self-excited, forced and parametric; the self-excited mechanism by Burgreen and Quinn, the forced one by Reavis, Gorman, kanazawa, and S. Chen, and the parametric one by Y. Chen. Quinn supposed that the centrifugal force by flow exaggerated the natural bow in the cylinder, and the flexural force by it diminished the bow by turns; this interactive motion leaded cylinder to vibration. The supporters to the forced mechanism considered the forces arising from pressure perturbation within the boundary layers as vibrating sources. Y. Chen insisted that the cylinder could only be excited to vibration in resonance by the small oscillation of mean flow velocity. The previous studies were based on the simple boundary conditions such as hinged-hinged or fixed-fixed single span. Therefore, for the more accurate prediction of the fuel rod vibration in reactor, the further studies need to reflect the actual boundary conditions of the fuel rod like axial force and continuous supports by grids. (author). 25 refs
Adaptive feedback synchronization of Lue system
International Nuclear Information System (INIS)
Han, X.; Lu, J.-A.; Wu, X.
2004-01-01
This letter further improves and extends the works of Chen and Lue [Chaos, Solitons and Fractals 14 (2002) 643] and Wang et al. [Phys. Lett. A 312 (2003) 34]. In detail, the linear feedback synchronization and adaptive feedback synchronization for Lue system are discussed. And the lower bound of the feedback gain in linear feedback synchronization is presented. The adaptive feedback synchronization with only one controller is designed, which improves the proof in the work by Wang et al. The adaptive synchronization with two controllers for completely uncertain Lue system is also discussed, which extends the work of Chen and Lue. Also, numerical simulations show the effectiveness of these methods
Pollen Flora of Yuenyang Lake Nature Preserve, Taiwan (IV
Directory of Open Access Journals (Sweden)
Yu-Fa Wang
2002-06-01
Full Text Available Yuenyang Lake is an acidic lake situated within a nature preserve in northern Taiwan. The pollen of nineteen taxa, belonging to five families, was collected from this nature preserve and investigated with light and scanning electron microscopy. The results of this investigation are supplementary work to the previous publications in this journal (Chen and Wang, 1999, 2001; Wang and Chen, 2001. A total of 4 pollen classes were identified on the basis of the aperture on the pollen wall: 3-colpate, 6-colpate, 3-colporate, and 4-7-colporate pollen. These results could be useful in the reconstruction of vegetation history around the Yuenyang Lake.
Nguyen, Tung T; Tran, Binh T T; Nguyen, Anh D
2014-09-22
The 'acaecate' Pheretima group from Vietnam is revised, with description of a new species, Polypheretima mekongmontis sp. nov. A total of 18 species of three genera, Metapheretima Michaelsen, 1928, Planapheretima Michaelsen, 1934, and Polypheretima Michaelsen, 1934 has been recorded from Vietnam. Caecate species of Planapheretima are included here as well. Planapheretima arboricola (Rosa, 1890), Pl. lacertina (Chen, 1946), Pl. tenebrica (Chen, 1946), Polypheretima elongata (Perrier, 1872), and Po. taprobanae (Beddard, 1892) are originally recorded from other countries; all remaining species are native to Vietnam. The species Polypheretima tani (Thai, 1996) and Po. tiencanhensis (Pham, 1995) are transferred to the genus Metapheretima. A key to species and distribution maps are also presented.
Critical node lifetimes in random networks via the Chen-Stein method
Franceschetti, M.; Meester, R.W.J.
2006-01-01
This correspondence considers networks where nodes are connected randomly and can fail at random times. It provides scaling laws that allow to find the critical time at which isolated nodes begin to appear in the system as its size tends to infinity. Applications are in the areas of sensor and
Chen and Xiaodong Afr J Tradit Complement Altern Med. (2013) 10 ...
African Journals Online (AJOL)
AJTCAM
As an ancient medicine, Solanum nigrum Linne has been playing an important role in the treatment of cancer in China since ancient times. It is reported in the literatures that Solanum nigrum Linne can inhibit tumour cell growth and promote apoptosis of tumour cells, and has immunomodulatory and cytotoxic effects (Son et ...
VizieR Online Data Catalog: Sample of Fermi Blazars (Chen+, 2016)
Chen, Y.-Y.; Zhang, X.; Xiong, D.-R.; Wang, S.-J.; Yu, X.-L.
2016-04-01
We tried to select a large number of blazars with reliable redshift, radio core and extended radio luminosity at 1.4GHz. Firstly, we considered the following samples of blazars to get the radio core luminosity and extended luminosity at 1.4GHz: Kharb et al. (2010, J/ApJ/710/764), Antonucci & Ulvestad (1985ApJ...294..158A), Cassaro et al. (1999A&AS..139..601C), Murphy et al. (1993MNRAS.264..298M), Landt & Bignall (2008MNRAS.391..967L), Caccianiga & Marcha (2004, Cat. J/MNRAS/348/973), Giroletti et al. (2004). We cross-correlated these samples with the Fermi LAT Third Source Catalog (3FGL), and we acquired the 3FGL spectral index and energy flux at 0.1-100GeV from clean sources in 3FGL (Fermi-LAT Collaboration 2015, J/ApJS/218/23) Using these catalogs, we compiled 201 Fermi blazars. (1 data file).
REVIEW: LOVE IN LHASA Lhasa hong chen 拉萨红尘
Directory of Open Access Journals (Sweden)
Reviewed by Wu Jing 吴晶
2018-05-01
Full Text Available Published in 2002, Love in Lhasa is Baima's first novel. The background is the 1980s at a time when China was engaging in fast-paced development of industrialization and commercialization as part of the Reform and Opening Up that began in the late 1970s. Most of the novel's episodes are set on the Tibetan Plateau where local Tibetans are affected by the trend of modernization. Young people in particular have increased opportunities to go out and see the world and also experience more challenges in dealing with issues of self-identity, and exploring the meaning of their existence. Against such a fast-changing social background, Tibetan women are faced with poignant life choices, especially as compared to traditional women. The novel's plot unfolds with the parallel life trajectories of the two female characters, Langsa and Yama, who are classmates and close friends at Tibet Military College. After graduation, the two young women leave the army and work in non-military areas as nurses. Langsa, the narrator, falls in love with a pilgrim, Varma, who comes from an isolated part of Tibet where Tibetan, Hui, and Han nationalities live together. They enjoy their otherworldly, extremely romantic relationship, and in the end, choose to live a reclusive life in the unknown hinterlands of Tibet. In contrast, Yama, the heroine, undergoes more complicated love experiences. Yama is the focus of this novel, embodying qualities of a "lost girl," such as beauty, rebelliousness, freedom-loving, desire, dreamer, degradation, and despair. After a pre-marriage affair with Di, a young Han man, she marries Zedan, a Tibetan, and her first real love. Disappointed by domestic life, she succumbs to temptation and has an extra-marital affair with Xu Nan in Shanghai. ...
Erne, Jaanika 1967-
2013-01-01
Arvustus: Nicola Casarini. Remaking Global Order: The Evolution of Europe-China Realtions and its Implications for East Asia and the United States. Oxford: Oxford University Press, 2010. (Oxford Scholarship Online.) 344 pp
Oberflächenstrukturierung metallischer Werkstoffe, z. B. für stents
Stöver, Michael; Wintermantel, Erich
Eine topologische Oberflächenmodifikation von metallischen Implantaten kann aus verschiedenen Gründen sinnvoll sein. Im Allgemeinen lassen sich zwei Hauptziele unterscheiden. Zum einen dienen Oberflächen dazu, bestimmte Zellreaktionen zu forcieren. Die Anwendungsbeispiele reichen hier von sehr rauen Oberflächen in Fällen wo eine gute Integration eines Permanentimplantates in das Gewebe erwünscht ist bis hin zu glatt polierten Oberflächen. Letztere werden in erster Linie dort eingesetzt, wo das Implantat in direktem Kontakt mit Blut ist. Ein Beispiel für die Erforderlichkeit einer hohen Rauheit (Rz > 100 μm) sind meist aus Titan gefertigte Schäfte von Gelenksimplantaten [1,2]. Die Autoren machten den Vorschlag, die Aufrauung von Titan- und Edelstahl-Stents analog der Aufrauung bei Hüftprothesenschäften zu versuchen, um eine noch bessere Biokompatibilität zu erreichen. [7, 8 ,9]. Sehr glatte Oberflächen, in der Regel mit Rz Werten von unter 0,1 μm, sind z. B. bei Herzklappenprothesen und der Innenseite von Gefäßstützen gefordert. Mittlere Rauheiten werden oft bei temporären Implantaten eingesetzt, in die in reguliertem Maße Gewebe einwachsen, allerdings keine unlösbare Verbindung bilden sollen. Sehr genau eingestellt werden müssen auch die Oberflächentopographien bei Implantaten in sehr empfindlichen Gebieten wie z. B. der Gehirnregion. Hierbei muss eine gute Verankerung im Gewebe vorhanden sein, um ein Verrutschen des Implantates zu verhindern. Zum anderen darf keine überschüssige Zellproliferation entstehen, um ein Einwachsen in sensible Regionen zu verhindern. Zum anderen werden Oberflächenmikrostrukturen genutzt, um Wirkstoffe in Implantate einzubringen, die lokal über einen bestimmten Zeitraum freigesetzt werden sollen. Als wichtigste Wirkstoffe sind hier Antibiotika und entzündungshemmende Mittel sowie im kardiovaskulären Bereich Proliferationshemmer zu nennen.
清江浦运河与运口考%A Study On Qingjiang Pu Canal and Transport
Institute of Scientific and Technical Information of China (English)
荀德麟
2015-01-01
The digging of Qingjiang Pu canal and the rise of Qingjiang Pu city are closely linked with Chen Xu-an who administered water transport for thirty years. He was a founder and establisher of the river system in Ming and Qing Dynasties. Chen Xuan followed the old canal———the sand river and dug Qingjiang Pu ( not named Qingjiang Pu) , most of which was dug on the old course of the original beneaped sand-river canal dug by Qiao Weiyue in Song dynasty ( called Qingjiang Pu after Yuan Yanyou five years) . Chen Xuan built four floodgates in the Qingjiang Pu canal, and the riverway between the Mopan mouth and the Yachen mouth was a newly section dug by Chen Xuan ( of course, it is not excluded that part of the other old rivers or water courses was used for this section) .%清江浦运河的开凿与清江浦城的兴起,与陈瑄息息相关,陈瑄督理河漕凡三十年,是明清时期漕运制度的确立者和奠基人。陈瑄循沙河旧渠,开凿清江浦(非命名清江浦),大部分是在原来淤浅的宋乔维岳沙河运河(元延祐五年后称清江浦)旧渠上开凿的。陈瑄在清江浦运河上建四道闸,磨盘口至鸭陈口的这一段河道,是陈瑄新开挖的部分。
Taiwan in 2004: Elections, Referenda, and Other Democratic Challenges
National Research Council Canada - National Science Library
Dumbaugh, Kerry
2005-01-01
.... In both the presidential and legislative election campaigns, Chen emphasized gaining a separate international identity for Taiwan -- an emphasis to which Beijing strenuously objected as dangerously...
Institute of Scientific and Technical Information of China (English)
无
2009-01-01
Chen et al.proposed the concepts of effective temperature of photon and entropy constant of photon in a recent paper [Chen Z S,Mo S P,Hu P.Recent progress in thermodynamics of radiation―exergy of radiation,effective temperature of photon and entropy constant of photon.Sci China Ser E-Tech Sci,2008,51(8):1096―1109] by enduing a single photon with macroscale thermodynamic parameters such as exergy and entropy.This paper argues that applying these concepts and their inferences to macro-scale thermodynamic system will lead to the results which conflict with macroscale thermodynamic laws.This means that the concepts of effective temperature of photon and entropy constant of photon are not correct.