
Sample records for highly conserved trna-modifying

  1. tRNA modifying enzymes, NSUN2 and METTL1, determine sensitivity to 5-fluorouracil in HeLa cells.

    Directory of Open Access Journals (Sweden)

    Mayumi Okamoto


    Full Text Available Nonessential tRNA modifications by methyltransferases are evolutionarily conserved and have been reported to stabilize mature tRNA molecules and prevent rapid tRNA decay (RTD. The tRNA modifying enzymes, NSUN2 and METTL1, are mammalian orthologs of yeast Trm4 and Trm8, which are required for protecting tRNA against RTD. A simultaneous overexpression of NSUN2 and METTL1 is widely observed among human cancers suggesting that targeting of both proteins provides a novel powerful strategy for cancer chemotherapy. Here, we show that combined knockdown of NSUN2 and METTL1 in HeLa cells drastically potentiate sensitivity of cells to 5-fluorouracil (5-FU whereas heat stress of cells revealed no effects. Since NSUN2 and METTL1 are phosphorylated by Aurora-B and Akt, respectively, and their tRNA modifying activities are suppressed by phosphorylation, overexpression of constitutively dephosphorylated forms of both methyltransferases is able to suppress 5-FU sensitivity. Thus, NSUN2 and METTL1 are implicated in 5-FU sensitivity in HeLa cells. Interfering with methylation of tRNAs might provide a promising rationale to improve 5-FU chemotherapy of cancer.

  2. Does high harmonic generation conserve angular momentum?

    CERN Document Server

    Fleischer, Avner; Diskin, Tzvi; Sidorenko, Pavel; Cohen, Oren


    High harmonic generation (HHG) is a unique and useful process in which infrared or visible radiation is frequency up converted into the extreme ultraviolet and x ray spectral regions. As a parametric process, high harmonic generation should conserve the radiation energy, momentum and angular momentum. Indeed, conservation of energy and momentum have been demonstrated. Angular momentum of optical beams can be divided into two components: orbital and spin (polarization). Orbital angular momentum is assumed to be conserved and recently observed deviations were attributed to propagation effects. On the other hand, conservation of spin angular momentum has thus far never been studied, neither experimentally nor theoretically. Here, we present the first study on the role of spin angular momentum in extreme nonlinear optics by experimentally generating high harmonics of bi chromatic elliptically polarized pump beams that interact with isotropic media. While observing that the selection rules qualitatively correspond...

  3. Forest conservation delivers highly variable coral reef conservation outcomes. (United States)

    Klein, Carissa J; Jupiter, Stacy D; Selig, Elizabeth R; Watts, Matthew E; Halpern, Benjamin S; Kamal, Muhammad; Roelfsema, Chris; Possingham, Hugh P


    Coral reefs are threatened by human activities on both the land (e.g., deforestation) and the sea (e.g., overfishing). Most conservation planning for coral reefs focuses on removing threats in the sea, neglecting management actions on the land. A more integrated approach to coral reef conservation, inclusive of land-sea connections, requires an understanding of how and where terrestrial conservation actions influence reefs. We address this by developing a land-sea planning approach to inform fine-scale spatial management decisions and test it in Fiji. Our aim is to determine where the protection of forest can deliver the greatest return on investment for coral reef ecosystems. To assess the benefits of conservation to coral reefs, we estimate their relative condition as influenced by watershed-based pollution and fishing. We calculate the cost-effectiveness of protecting forest and find that investments deliver rapidly diminishing returns for improvements to relative reef condition. For example, protecting 2% of forest in one area is almost 500 times more beneficial than protecting 2% in another area, making prioritization essential. For the scenarios evaluated, relative coral reef condition could be improved by 8-58% if all remnant forest in Fiji were protected rather than deforested. Finally, we determine the priority of each coral reef for implementing a marine protected area when all remnant forest is protected for conservation. The general results will support decisions made by the Fiji Protected Area Committee as they establish a national protected area network that aims to protect 20% of the land and 30% of the inshore waters by 2020. Although challenges remain, we can inform conservation decisions around the globe by tackling the complex issues relevant to integrated land-sea planning.

  4. 76 FR 82075 - Highly Erodible Land and Wetland Conservation (United States)


    .... These changes to the regulations are made to implement provisions specified in the Food, Conservation... Conservation.'' The regulations have been in place since the implementation of the requirements in the Food... Secretary 7 CFR Part 12 RIN 0560-AH97 Highly Erodible Land and Wetland Conservation AGENCY: Office of the...

  5. Readings in Wildlife and Fish Conservation, High School Conservation Curriculum Project. (United States)

    Ensminger, Jack

    This publication is a tentative edition of readings on Wildlife and Fish Conservation in Louisiana, and as such it forms part of one of the four units of study designed for an experimental high school course, the "High School Conservation Curriculum Project." The other three units are concerned with Forest Conervation, Soil and Water…

  6. Furrow Dike Water Conservation Practices in the Texas High Plains


    Wistrand, Glen L.


    Furrow diking can prevent irrigation and rainfall runoff, conserve energy use, prevent soil loss, amd allow producers to reclaim land otherwise unusable, depending on soil, climate, and crops grown in a given area. Initial investment to use this technique may be recovered within the first season. This study analyzes the effects of diking on water and soil conservation, crop yields, costs, and energy use in farming, using examples of farms in the Texas High Plains area.

  7. Conservation agriculture in high tunnels: soil health and profit enhancement (United States)

    In 2013, through the USDA’s Evans-Allen capacity grant, the high tunnel became an on-farm research laboratory for conservation agriculture. Dr. Manuel R. Reyes, Professor and his research team from the North Carolina Agriculture and Technology State University (NCATSU), Greensboro, North Carolina (1...

  8. Generation of monoclonal antibodies against highly conserved antigens.

    Directory of Open Access Journals (Sweden)

    Hongzhe Zhou

    Full Text Available BACKGROUND: Therapeutic antibody development is one of the fastest growing areas of the pharmaceutical industry. Generating high-quality monoclonal antibodies against a given therapeutic target is very crucial for the success of the drug development. However, due to immune tolerance, some proteins that are highly conserved between mice and humans are not very immunogenic in mice, making it difficult to generate antibodies using a conventional approach. METHODOLOGY/PRINCIPAL FINDINGS: In this report, the impaired immune tolerance of NZB/W mice was exploited to generate monoclonal antibodies against highly conserved or self-antigens. Using two highly conserved human antigens (MIF and HMGB1 and one mouse self-antigen (TNF-alpha as examples, we demonstrate here that multiple clones of high affinity, highly specific antibodies with desired biological activities can be generated, using the NZB/W mouse as the immunization host and a T cell-specific tag fused to a recombinant antigen to stimulate the immune system. CONCLUSIONS/SIGNIFICANCE: We developed an efficient and universal method for generating surrogate or therapeutic antibodies against "difficult antigens" to facilitate the development of therapeutic antibodies.

  9. Helicity conservation in gauge boson scattering at high energy. (United States)

    Gounaris, G J; Renard, F M


    We remark that the high energy gauge boson scattering processes involving two-body initial and final states satisfy certain selection rules described as helicity conservation of the gauge boson amplitudes (GBHC). These rules are valid at the Born level, as well as at the level of the leading and subleading 1-loop logarithmic corrections, in both the standard model and the minimal supersymmetric standard model (MSSM). A "fermionic equivalence" theorem is also proved, which suggests that GBHC is valid at all orders in the MSSM at sufficiently high energies, where the mass suppressed contributions are neglected.

  10. 77 FR 74167 - Information Collection Request: Highly Erodible Land Conservation and Wetland Conservation (United States)


    ... information is collected in support of the conservation compliance provisions of Title XII of the Food Security Act of 1985 (the 1985 Farm Bill), as amended by the Food, Conservation, and Energy Act of 2008... Security Act of 1985 (16 U.S.C. 3801-3862), as amended by the Food, Conservation, and Energy Act of 2008...

  11. ABCE1 is a highly conserved RNA silencing suppressor.

    Directory of Open Access Journals (Sweden)

    Kairi Kärblane

    Full Text Available ATP-binding cassette sub-family E member 1 (ABCE1 is a highly conserved protein among eukaryotes and archaea. Recent studies have identified ABCE1 as a ribosome-recycling factor important for translation termination in mammalian cells, yeast and also archaea. Here we report another conserved function of ABCE1. We have previously described AtRLI2, the homolog of ABCE1 in the plant Arabidopsis thaliana, as an endogenous suppressor of RNA silencing. In this study we show that this function is conserved: human ABCE1 is able to suppress RNA silencing in Nicotiana benthamiana plants, in mammalian HEK293 cells and in the worm Caenorhabditis elegans. Using co-immunoprecipitation and mass spectrometry, we found a number of potential ABCE1-interacting proteins that might support its function as an endogenous suppressor of RNA interference. The interactor candidates are associated with epigenetic regulation, transcription, RNA processing and mRNA surveillance. In addition, one of the identified proteins is translin, which together with its binding partner TRAX supports RNA interference.

  12. Antibody Recognition of a Highly Conserved Influenza Virus Epitope

    Energy Technology Data Exchange (ETDEWEB)

    Ekiert, Damian C.; Bhabha, Gira; Elsliger, Marc-André; Friesen, Robert H.E.; Jongeneelen, Mandy; Throsby, Mark; Goudsmit, Jaap; Wilson, Ian A.; Scripps; Crucell


    Influenza virus presents an important and persistent threat to public health worldwide, and current vaccines provide immunity to viral isolates similar to the vaccine strain. High-affinity antibodies against a conserved epitope could provide immunity to the diverse influenza subtypes and protection against future pandemic viruses. Cocrystal structures were determined at 2.2 and 2.7 angstrom resolutions for broadly neutralizing human antibody CR6261 Fab in complexes with the major surface antigen (hemagglutinin, HA) from viruses responsible for the 1918 H1N1 influenza pandemic and a recent lethal case of H5N1 avian influenza. In contrast to other structurally characterized influenza antibodies, CR6261 recognizes a highly conserved helical region in the membrane-proximal stem of HA1 and HA2. The antibody neutralizes the virus by blocking conformational rearrangements associated with membrane fusion. The CR6261 epitope identified here should accelerate the design and implementation of improved vaccines that can elicit CR6261-like antibodies, as well as antibody-based therapies for the treatment of influenza.

  13. Dynamic Epigenetic Control of Highly Conserved Noncoding Elements

    KAUST Repository

    Seridi, Loqmane


    Background Many noncoding genomic loci have remained constant over long evolutionary periods, suggesting that they are exposed to strong selective pressures. The molecular functions of these elements have been partially elucidated, but the fundamental reason for their extreme conservation is still unknown. Results To gain new insights into the extreme selection of highly conserved noncoding elements (HCNEs), we used a systematic analysis of multi-omic data to study the epigenetic regulation of such elements during the development of Drosophila melanogaster. At the sequence level, HCNEs are GC-rich and have a characteristic oligomeric composition. They have higher levels of stable nucleosome occupancy than their flanking regions, and lower levels of mononucleosomes and H3.3, suggesting that these regions reside in compact chromatin. Furthermore, these regions showed remarkable modulations in histone modification and the expression levels of adjacent genes during development. Although HCNEs are primarily initiated late in replication, about 10% were related to early replication origins. Finally, HCNEs showed strong enrichment within lamina-associated domains. Conclusion HCNEs have distinct and protective sequence properties, undergo dynamic epigenetic regulation, and appear to be associated with the structural components of the chromatin, replication origins, and nuclear matrix. These observations indicate that such elements are likely to have essential cellular functions, and offer insights into their epigenetic properties.

  14. High cumulants of conserved charges and their statistical uncertainties (United States)

    Li-Zhu, Chen; Ye-Yin, Zhao; Xue, Pan; Zhi-Ming, Li; Yuan-Fang, Wu


    We study the influence of measured high cumulants of conserved charges on their associated statistical uncertainties in relativistic heavy-ion collisions. With a given number of events, the measured cumulants randomly fluctuate with an approximately normal distribution, while the estimated statistical uncertainties are found to be correlated with corresponding values of the obtained cumulants. Generally, with a given number of events, the larger the cumulants we measure, the larger the statistical uncertainties that are estimated. The error-weighted averaged cumulants are dependent on statistics. Despite this effect, however, it is found that the three sigma rule of thumb is still applicable when the statistics are above one million. Supported by NSFC (11405088, 11521064, 11647093), Major State Basic Research Development Program of China (2014CB845402) and Ministry of Science and Technology (MoST) (2016YFE0104800)

  15. High-pressure, flux-conserving tokamak equilibria

    Energy Technology Data Exchange (ETDEWEB)

    Dory, R.A.; Peng, Y.K.M.


    Magnetohydrodynamic (MHD) tokamak equilibria are found with values of ..beta.. up to 20 percent and prescribed MHD safety factor values (e.g., q(axis) = 1 and q(edge) = 4.8) for tokamaks with aspect ratio A = 4 and D-shaped cross section. If such equilibria could be attained experimentally, they would be very attractive for decreasing the projected costs of tokamak power reactors substantially. In the flux-conserving tokamak (FCT) model, where rapid heating is applied to an already relatively hot plasma, these high ..beta.. equilibria are achievable. We study the quasi-static evolution of FCT equilibria as ..beta.. increases. An operating window is found in the pressure profile width w/sub p/: for high ..beta.. the values of w/sub p/ must lie between 0.40 and 0.55 of the plasma minor width. Within this window, plasma current and poloidal ..beta.. increase monotonically with ..beta... For fixed plasma boundary, significant poloidal surface currents are induced, but these can be eliminated by small increases in the plasma minor radius, the pressure profile width, and the vacuum toroidal field.

  16. 78 FR 13566 - Energy Conservation Program for High-Intensity Discharge Lamps: Public Meeting and Availability... (United States)


    ... Part 431 RIN 1904-AC36 Energy Conservation Program for High-Intensity Discharge Lamps: Public Meeting... conservation standards for high-intensity discharge (HID) lamps. The meeting will cover the analytical... High-Intensity Discharge Lamps, EERE-2010-BT-STD-0043 and/or RIN 1904-AC36, 1000 Independence Avenue SW...

  17. Assessment of selected conservation measures for high-temperature process industries

    Energy Technology Data Exchange (ETDEWEB)

    Kusik, C L; Parameswaran, K; Nadkarni, R; O& #x27; Neill, J K; Malhotra, S; Hyde, R; Kinneberg, D; Fox, L; Rossetti, M


    Energy conservation projects involving high-temperature processes in various stages of development are assessed to quantify their energy conservation potential; to determine their present status of development; to identify their research and development needs and estimate the associated costs; and to determine the most effective role for the Federal government in developing these technologies. The program analyzed 25 energy conserving processes in the iron and steel, aluminium, copper, magnesium, cement, and glassmaking industries. A preliminary list of other potential energy conservation projects in these industries is also presented in the appendix. (MCW)

  18. Telomeric expression sites are highly conserved in Trypanosoma brucei.

    Directory of Open Access Journals (Sweden)

    Christiane Hertz-Fowler

    Full Text Available Subtelomeric regions are often under-represented in genome sequences of eukaryotes. One of the best known examples of the use of telomere proximity for adaptive purposes are the bloodstream expression sites (BESs of the African trypanosome Trypanosoma brucei. To enhance our understanding of BES structure and function in host adaptation and immune evasion, the BES repertoire from the Lister 427 strain of T. brucei were independently tagged and sequenced. BESs are polymorphic in size and structure but reveal a surprisingly conserved architecture in the context of extensive recombination. Very small BESs do exist and many functioning BESs do not contain the full complement of expression site associated genes (ESAGs. The consequences of duplicated or missing ESAGs, including ESAG9, a newly named ESAG12, and additional variant surface glycoprotein genes (VSGs were evaluated by functional assays after BESs were tagged with a drug-resistance gene. Phylogenetic analysis of constituent ESAG families suggests that BESs are sequence mosaics and that extensive recombination has shaped the evolution of the BES repertoire. This work opens important perspectives in understanding the molecular mechanisms of antigenic variation, a widely used strategy for immune evasion in pathogens, and telomere biology.

  19. Texas High Plains Initiative for Strategic and Innovative Irrigation Management and Conservation

    National Research Council Canada - National Science Library

    Weinheimer, Justin; Johnson, Phillip; Mitchell, Donna; Johnson, Jeff; Kellison, Rick


    The strategic management of irrigation applications to improve water‐use efficiency and meet economic objectives has been identified as a key factor in the conservation of water resources in the Texas High Plains region...

  20. 7 CFR Exhibit M to Subpart G of... - Implementation Procedures for the Conservation of Wetlands and Highly Erodible Land Affecting... (United States)


    ... B, Highly Erodible Land Conservation, and Subtitle C, Wetland Conservation, of Title XII of the Food... technical guide and properly approved by the appropriate SCS conservation district or the SCS. To apply this... 7 Agriculture 13 2010-01-01 2009-01-01 true Implementation Procedures for the Conservation of...

  1. Homologous high-throughput expression and purification of highly conserved E coli proteins

    Directory of Open Access Journals (Sweden)

    Duchmann Rainer


    Full Text Available Abstract Background Genetic factors and a dysregulated immune response towards commensal bacteria contribute to the pathogenesis of Inflammatory Bowel Disease (IBD. Animal models demonstrated that the normal intestinal flora is crucial for the development of intestinal inflammation. However, due to the complexity of the intestinal flora, it has been difficult to design experiments for detection of proinflammatory bacterial antigen(s involved in the pathogenesis of the disease. Several studies indicated a potential association of E. coli with IBD. In addition, T cell clones of IBD patients were shown to cross react towards antigens from different enteric bacterial species and thus likely responded to conserved bacterial antigens. We therefore chose highly conserved E. coli proteins as candidate antigens for abnormal T cell responses in IBD and used high-throughput techniques for cloning, expression and purification under native conditions of a set of 271 conserved E. coli proteins for downstream immunologic studies. Results As a standardized procedure, genes were PCR amplified and cloned into the expression vector pQTEV2 in order to express proteins N-terminally fused to a seven-histidine-tag. Initial small-scale expression and purification under native conditions by metal chelate affinity chromatography indicated that the vast majority of target proteins were purified in high yields. Targets that revealed low yields after purification probably due to weak solubility were shuttled into Gateway (Invitrogen destination vectors in order to enhance solubility by N-terminal fusion of maltose binding protein (MBP, N-utilizing substance A (NusA, or glutathione S-transferase (GST to the target protein. In addition, recombinant proteins were treated with polymyxin B coated magnetic beads in order to remove lipopolysaccharide (LPS. Thus, 73% of the targeted proteins could be expressed and purified in large-scale to give soluble proteins in the range of 500

  2. Simple and High-Accurate Schemes for Hyperbolic Conservation Laws

    Directory of Open Access Journals (Sweden)

    Renzhong Feng


    Full Text Available The paper constructs a class of simple high-accurate schemes (SHA schemes with third order approximation accuracy in both space and time to solve linear hyperbolic equations, using linear data reconstruction and Lax-Wendroff scheme. The schemes can be made even fourth order accurate with special choice of parameter. In order to avoid spurious oscillations in the vicinity of strong gradients, we make the SHA schemes total variation diminishing ones (TVD schemes for short by setting flux limiter in their numerical fluxes and then extend these schemes to solve nonlinear Burgers’ equation and Euler equations. The numerical examples show that these schemes give high order of accuracy and high resolution results. The advantages of these schemes are their simplicity and high order of accuracy.

  3. High-resolution satellite imagery is an important yet underutilized resource in conservation biology. (United States)

    Boyle, Sarah A; Kennedy, Christina M; Torres, Julio; Colman, Karen; Pérez-Estigarribia, Pastor E; de la Sancha, Noé U


    Technological advances and increasing availability of high-resolution satellite imagery offer the potential for more accurate land cover classifications and pattern analyses, which could greatly improve the detection and quantification of land cover change for conservation. Such remotely-sensed products, however, are often expensive and difficult to acquire, which prohibits or reduces their use. We tested whether imagery of high spatial resolution (≤5 m) differs from lower-resolution imagery (≥30 m) in performance and extent of use for conservation applications. To assess performance, we classified land cover in a heterogeneous region of Interior Atlantic Forest in Paraguay, which has undergone recent and dramatic human-induced habitat loss and fragmentation. We used 4 m multispectral IKONOS and 30 m multispectral Landsat imagery and determined the extent to which resolution influenced the delineation of land cover classes and patch-level metrics. Higher-resolution imagery more accurately delineated cover classes, identified smaller patches, retained patch shape, and detected narrower, linear patches. To assess extent of use, we surveyed three conservation journals (Biological Conservation, Biotropica, Conservation Biology) and found limited application of high-resolution imagery in research, with only 26.8% of land cover studies analyzing satellite imagery, and of these studies only 10.4% used imagery ≤5 m resolution. Our results suggest that high-resolution imagery is warranted yet under-utilized in conservation research, but is needed to adequately monitor and evaluate forest loss and conversion, and to delineate potentially important stepping-stone fragments that may serve as corridors in a human-modified landscape. Greater access to low-cost, multiband, high-resolution satellite imagery would therefore greatly facilitate conservation management and decision-making.

  4. High-Order Entropy Stable Finite Difference Schemes for Nonlinear Conservation Laws: Finite Domains (United States)

    Fisher, Travis C.; Carpenter, Mark H.


    Developing stable and robust high-order finite difference schemes requires mathematical formalism and appropriate methods of analysis. In this work, nonlinear entropy stability is used to derive provably stable high-order finite difference methods with formal boundary closures for conservation laws. Particular emphasis is placed on the entropy stability of the compressible Navier-Stokes equations. A newly derived entropy stable weighted essentially non-oscillatory finite difference method is used to simulate problems with shocks and a conservative, entropy stable, narrow-stencil finite difference approach is used to approximate viscous terms.

  5. Butterflies of the high-altitude Atacama Desert: habitat use and conservation


    Emma eDespland


    The butterfly fauna of the high-altitude desert of Northern Chile, though depauperate, shows high endemism, is poorly known and is of considerable conservation concern. This study surveys butterflies along the Andean slope between 2400 and 5000 m asl (prepuna, puna and Andean steppe habitats) as well as in high and low-altitude wetlands and in the neoriparian vegetation of agricultural sites. We also include historical sightings from museum records. We compare abundances between altitudes, be...



    Johnson, Jeffrey W.; Johnson, Phillip N.; Segarra, Eduardo; Willis, David B.


    Three alternative groundwater conservation policies were examined for their impact on the regional economy of the Southern High Plains of Texas using nonlinear optimization models and an input-output model. Restriction of drawdown of the aquifer was found to be more effective than proposed water use fees.

  7. Prospects for Parity Non-conservation Experiments with Highly Charged Heavy Ions


    Maul, M.; Schäfer, A.; Greiner, W.; Indelicato, P.


    We discuss the prospects for parity non-conservation experiments with highly charged heavy ions. Energy levels and parity mixing for heavy ions with two to five electrons are calculated. We investigate two-photon-transitions and the possibility to observe interference effects between weak-matrix elements and Stark matrix elements for periodic electric field configurations.

  8. Balancing forest-regeneration probabilities and maintenance costs in dry grasslands of high conservation priority (United States)

    Bolliger, Janine; Edwards, Thomas C.; Eggenberg, Stefan; Ismail, Sascha; Seidl, Irmi; Kienast, Felix


    Abandonment of agricultural land has resulted in forest regeneration in species-rich dry grasslands across European mountain regions and threatens conservation efforts in this vegetation type. To support national conservation strategies, we used a site-selection algorithm (MARXAN) to find optimum sets of floristic regions (reporting units) that contain grasslands of high conservation priority. We sought optimum sets that would accommodate 136 important dry-grassland species and that would minimize forest regeneration and costs of management needed to forestall predicted forest regeneration. We did not consider other conservation elements of dry grasslands, such as animal species richness, cultural heritage, and changes due to climate change. Optimal sets that included 95–100% of the dry grassland species encompassed an average of 56–59 floristic regions (standard deviation, SD 5). This is about 15% of approximately 400 floristic regions that contain dry-grassland sites and translates to 4800–5300 ha of dry grassland out of a total of approximately 23,000 ha for the entire study area. Projected costs to manage the grasslands in these optimum sets ranged from CHF (Swiss francs) 5.2 to 6.0 million/year. This is only 15–20% of the current total estimated cost of approximately CHF30–45 million/year required if all dry grasslands were to be protected. The grasslands of the optimal sets may be viewed as core sites in a national conservation strategy.

  9. Structural relationships between highly conserved elements and genes in vertebrate genomes.

    Directory of Open Access Journals (Sweden)

    Hong Sun

    Full Text Available Large numbers of sequence elements have been identified to be highly conserved among vertebrate genomes. These highly conserved elements (HCEs are often located in or around genes that are involved in transcription regulation and early development. They have been shown to be involved in cis-regulatory activities through both in vivo and additional computational studies. We have investigated the structural relationships between such elements and genes in six vertebrate genomes human, mouse, rat, chicken, zebrafish and tetraodon and detected several thousand cases of conserved HCE-gene associations, and also cases of HCEs with no common target genes. A few examples underscore the potential significance of our findings about several individual genes. We found that the conserved association between HCE/HCEs and gene/genes are not restricted to elements by their absolute distance on the genome. Notably, long-range associations were identified and the molecular functions of the associated genes do not show any particular overrepresentation of the functional categories previously reported. HCEs in close proximity are found to be linked with different set of gene/genes. The results reflect the highly complex correlation between HCEs and their putative target genes.

  10. Identification and classification of structural soil conservation measures based on very high resolution stereo satellite data. (United States)

    Eckert, Sandra; Tesfay Ghebremicael, Selamawit; Hurni, Hans; Kohler, Thomas


    Land degradation affects large areas of land around the globe, with grave consequences for those living off the land. Major efforts are being made to implement soil and water conservation measures that counteract soil erosion and help secure vital ecosystem services. However, where and to what extent such measures have been implemented is often not well documented. Knowledge about this could help to identify areas where soil and water conservation measures are successfully supporting sustainable land management, as well as areas requiring urgent rehabilitation of conservation structures such as terraces and bunds. This study explores the potential of the latest satellite-based remote sensing technology for use in assessing and monitoring the extent of existing soil and water conservation structures. We used a set of very high resolution stereo Geoeye-1 satellite data, from which we derived a detailed digital surface model as well as a set of other spectral, terrain, texture, and filtered information layers. We developed and applied an object-based classification approach, working on two segmentation levels. On the coarser level, the aim was to delimit certain landscape zones. Information about these landscape zones is useful in distinguishing different types of soil and water conservation structures, as each zone contains certain specific types of structures. On the finer level, the goal was to extract and identify different types of linear soil and water conservation structures. The classification rules were based mainly on spectral, textural, shape, and topographic properties, and included object relationships. This approach enabled us to identify and separate from other classes the majority (78.5%) of terraces and bunds, as well as most hillside terraces (81.25%). Omission and commission errors are similar to those obtained by the few existing studies focusing on the same research objective but using different types of remotely sensed data. Based on our results

  11. Conservative Management for Stable High Ankle Injuries in Professional Football Players. (United States)

    Knapik, Derrick M; Trem, Anthony; Sheehan, Joseph; Salata, Michael J; Voos, James E

    High ankle "syndesmosis" injuries are common in American football players relative to the general population. At the professional level, syndesmotic sprains represent a challenging and unique injury lacking a standardized rehabilitation protocol during conservative management. PubMed, Biosis Preview, SPORTDiscus, PEDro, and EMBASE databases were searched using the terms syndesmotic injuries, American football, conservative management, and rehabilitation. Clinical review. Level 3. When compared with lateral ankle sprains, syndesmosis injuries result in significantly prolonged recovery times and games lost. For stable syndesmotic injuries, conservative management features a brief period of immobilization and protected weightbearing followed by progressive strengthening exercises and running, and athletes can expect to return to competition in 2 to 6 weeks. Further research investigating the efficacy of dry needling and blood flow restriction therapy is necessary to evaluate the benefit of these techniques in the rehabilitation process. Successful conservative management of stable syndesmotic injuries in professional American football athletes requires a thorough understanding of the anatomy, injury mechanisms, diagnosis, and rehabilitation strategies utilized in elite athletes.

  12. Taxonomic distinctness and conservation of a new high biodiversity subterranean area in Brazil. (United States)

    Gallão, Jonas E; Bichuette, Maria Elina


    Subterranean environments, even though they do not possess a primary production (photosynthesis), may present high biodiversity, faunistic originality, endemism, phylogenetic isolations and unique ecological and/or evolution events, in addition to rare taxa. Studies investigating the biological diversity in Neotropical caves are relatively rare and recent, and most of them have been conducted in Brazil. We sampled caves from the state of Bahia, northeastern Brazil, and through sampling sufficiency tests and richness estimators, we demonstrate that the normatization for the Brazilian cave laws is not adequate for its conservation and that only α diversity index is not enough to verify faunistic patterns. We suggest that a phylogenetic diversity index be more robust and accurate for conservation purposes, particularly the Taxonomic Distinctness index. Moreover, we propose that the sandstone complex caves from Chapada Diamantina National Park need to be classified as being of high subterranean biodiversity in a global scope.

  13. Assessing the importance of High Nature Value farmlands for the conservation of Lesser Kestrels Falco naumanni


    Galanaki Antonia; Kominos Theodoros; Jones Martin J.


    Agricultural areas, such as cereal cultivations, that support species of European and/or national conservation concern are considered as ‘High Nature Value’ farmlands (HNVf) and are very important for the preservation of biodiversity in Europe. The lesser kestrel Falco naumanni is a migratory falcon breeding largely in the HNVf of the Mediterranean basin. The main cause of its decline in Europe has been habitat loss and degradation as a result of agricultural intensification driven largely by...

  14. Entropy Viscosity Method for High-Order Approximations of Conservation Laws

    KAUST Repository

    Guermond, J. L.


    A stabilization technique for conservation laws is presented. It introduces in the governing equations a nonlinear dissipation function of the residual of the associated entropy equation and bounded from above by a first order viscous term. Different two-dimensional test cases are simulated - a 2D Burgers problem, the "KPP rotating wave" and the Euler system - using high order methods: spectral elements or Fourier expansions. Details on the tuning of the parameters controlling the entropy viscosity are given. © 2011 Springer.

  15. Highly conserved non-coding sequences are associated with vertebrate development.

    Directory of Open Access Journals (Sweden)

    Adam Woolfe


    Full Text Available In addition to protein coding sequence, the human genome contains a significant amount of regulatory DNA, the identification of which is proving somewhat recalcitrant to both in silico and functional methods. An approach that has been used with some success is comparative sequence analysis, whereby equivalent genomic regions from different organisms are compared in order to identify both similarities and differences. In general, similarities in sequence between highly divergent organisms imply functional constraint. We have used a whole-genome comparison between humans and the pufferfish, Fugu rubripes, to identify nearly 1,400 highly conserved non-coding sequences. Given the evolutionary divergence between these species, it is likely that these sequences are found in, and furthermore are essential to, all vertebrates. Most, and possibly all, of these sequences are located in and around genes that act as developmental regulators. Some of these sequences are over 90% identical across more than 500 bases, being more highly conserved than coding sequence between these two species. Despite this, we cannot find any similar sequences in invertebrate genomes. In order to begin to functionally test this set of sequences, we have used a rapid in vivo assay system using zebrafish embryos that allows tissue-specific enhancer activity to be identified. Functional data is presented for highly conserved non-coding sequences associated with four unrelated developmental regulators (SOX21, PAX6, HLXB9, and SHH, in order to demonstrate the suitability of this screen to a wide range of genes and expression patterns. Of 25 sequence elements tested around these four genes, 23 show significant enhancer activity in one or more tissues. We have identified a set of non-coding sequences that are highly conserved throughout vertebrates. They are found in clusters across the human genome, principally around genes that are implicated in the regulation of development


    Rampal, Raajit; Arboleda-Velasquez, Joseph F.; Nita-Lazar, Alexandra; Kosik, Kenneth S.; Haltiwanger, Robert S.


    The extracellular domain of mouse Notch1 contains 36 tandem epidermal growth factor like (EGF) repeats, many of which are modified with O-fucose. Previous work from several laboratories has indicated that O-fucosylation plays an important role in ligand mediated Notch activation. Nonetheless, it is not clear whether all, or a subset, of the EGF repeats need to be O-fucosylated. Three O-fucose sites are invariantly conserved in all Notch homologues with 36 EGF repeats (within EGF repeats 12, 26 and 27). In order to investigate which O-fucose sites on Notch1 are important for ligand-mediated signaling, we mutated the three invariant O-fucose sites in mouse Notch1, along with several less highly conserved sites, and evaluated their ability to transduce Jagged1 and Delta1 mediated signaling in a cell-based assay. Our analysis revealed that mutation of any of the three invariant O-fucose sites resulted in significant changes in both Delta1 and Jagged1 mediated signaling, but mutations in less highly conserved sites had no detectable effect. Interestingly, mutation of each invariant site gave a distinct effect on Notch function. Mutation of the O-fucose site in EGF repeat 12 resulted in loss of Delta1 and Jagged1 signaling, while mutation of the O-fucose site in EGF repeat 26 resulted in hyperactivation of both Delta1 and Jagged1 signaling. Mutation of the O-fucose site in EGF repeat 27 resulted in faulty trafficking of the Notch receptor to the cell surface and a decreased S1 processing of the receptor. These results indicate that the most highly conserved O-fucose sites in Notch1 are important for both processing and ligand mediated signaling in the context of a cell-based signaling assay. PMID:15994302

  17. Identification of LAG3 high affinity aptamers by HT-SELEX and Conserved Motif Accumulation (CMA.

    Directory of Open Access Journals (Sweden)

    Mario Martínez Soldevilla

    Full Text Available LAG3 receptor belongs to a family of immune-checkpoints expressed in T lymphocytes and other cells of the immune system. It plays an important role as a rheostat of the immune response. Focus on this receptor as a potential therapeutic target in cancer immunotherapy has been underscored after the success of other immune-checkpoint blockade strategies in clinical trials. LAG3 showcases the interest in the field of autoimmunity as several studies show that LAG3-targeting antibodies can also be used for the treatment of autoimmune diseases. In this work we describe the identification of a high-affinity LAG3 aptamer by High Throughput Sequencing SELEX in combination with a study of potential conserved binding modes according to sequence conservation by using 2D-structure prediction and 3D-RNA modeling using Rosetta. The aptamer with the highest accumulation of these conserved sequence motifs displays the highest affinity to LAG3 recombinant soluble proteins and binds to LAG3-expressing lymphocytes. The aptamer described herein has the potential to be used as a therapeutic agent, as it enhances the threshold of T-cell activation. Nonetheless, in future applications, it could also be engineered for treatment of autoimmune diseases by target depletion of LAG3-effector T lymphocytes.

  18. Water Wisdom: 23 Stand-Alone Activities on Water Supply and Water Conservation for High School Students. 2nd Edition. (United States)

    Massachusetts State Water Resources Authority, Boston.

    This water conservation education program for high schools consists of both stand-alone activities and teacher support materials. Lessons are divided into six broad categories: (1) The Water Cycle; (2) Water and Society; (3) Keeping Water Pure; (4) Visualizing Volumes; (5) The Economics of Water Use; and (6) Domestic Water Conservation. The…

  19. [Comparative chromosome painting shows the red panda (Ailurus fulgens) has a highly conserved karyotype]. (United States)

    Tian, Ying; Nie, Wen-Hui; Wang, Jin-Huan; Yang, Yun-Fei; Yang, Feng-Tang


    We have established a comparative chromosome map between red panda (Ailurus fulgens, 2n = 36) and dog by chromosome painting with biotin-labelled chromosome-specific probes of the dog. Dog probes specific for the 38 automates delineated 71 homologous segments in the metaphase chromosomes of red panda. Of the 38 autosomal paints, 18 probes each delineated one homologous segment in red panda genome, while the other 20 ones each detected two to five homologous segments. The dog X chromosome-specific paint delineated the whole X chromosome of the red panda. The results indicate that at least 28 fissions (breaks), 49 fusions and 4 inversions were needed to "convert" the dog karyotype to that of the red panda, suggesting that extensive chromosome rearrangements differentiate the karyotypes of red panda and dog. Based on the established comparative chromosome homologies of dog and domestic cat, we could infer that there were 26 segments of conserved synteny between red panda and domestic cat. Comparative analysis of the distribution patterns of conserved segments defined by dog paints in red panda and domestic cat genomes revealed at least 2 cryptic inversions in two large chromosomal regions of conserved synteny between red panda and domestic cat. The karyotype of red panda shows high degree of homology with that of domestic cat.

  20. Insight into highly conserved H1 subtype-specific epitopes in influenza virus hemagglutinin.

    Directory of Open Access Journals (Sweden)

    Ki Joon Cho

    Full Text Available Influenza viruses continuously undergo antigenic changes with gradual accumulation of mutations in hemagglutinin (HA that is a major determinant in subtype specificity. The identification of conserved epitopes within specific HA subtypes gives an important clue for developing new vaccines and diagnostics. We produced and characterized nine monoclonal antibodies that showed significant neutralizing activities against H1 subtype influenza viruses, and determined the complex structure of HA derived from a 2009 pandemic virus A/Korea/01/2009 (KR01 and the Fab fragment from H1-specific monoclonal antibody GC0587. The overall structure of the complex was essentially identical to the previously determined KR01 HA-Fab0757 complex structure. Both Fab0587 and Fab0757 recognize readily accessible head regions of HA, revealing broadly shared and conserved antigenic determinants among H1 subtypes. The β-strands constituted by Ser110-Glu115 and Lys169-Lys170 form H1 epitopes with distinct conformations from those of H1 and H3 HA sites. In particular, Glu112, Glu115, Lys169, and Lys171 that are highly conserved among H1 subtype HAs have close contacts with HCDR3 and LCDR3. The differences between Fab0587 and Fab0757 complexes reside mainly in HCDR3 and LCDR3, providing distinct antigenic determinants specific for 1918 pdm influenza strain. Our results demonstrate a potential key neutralizing epitope important for H1 subtype specificity in influenza virus.

  1. Species Richness and Community Structure on a High Latitude Reef: Implications for Conservation and Management

    Directory of Open Access Journals (Sweden)

    Wayne Houston


    Full Text Available In spite of the wealth of research on the Great Barrier Reef, few detailed biodiversity assessments of its inshore coral communities have been conducted. Effective conservation and management of marine ecosystems begins with fine-scale biophysical assessments focused on diversity and the architectural species that build the structural framework of the reef. In this study, we investigate key coral diversity and environmental attributes of an inshore reef system surrounding the Keppel Bay Islands near Rockhampton in Central Queensland, Australia, and assess their implications for conservation and management. The Keppels has much higher coral diversity than previously found. The average species richness for the 19 study sites was ~40 with representatives from 68% of the ~244 species previously described for the southern Great Barrier Reef. Using scleractinian coral species richness, taxonomic distinctiveness and coral cover as the main criteria, we found that five out of 19 sites had particularly high conservation value. A further site was also considered to be of relatively high value. Corals at this site were taxonomically distinct from the others (representatives of two families were found here but not at other sites and a wide range of functionally diverse taxa were present. This site was associated with more stressful conditions such as high temperatures and turbidity. Highly diverse coral communities or biodiversity ‘hotspots’ and taxonomically distinct reefs may act as insurance policies for climatic disturbance, much like Noah’s Arks for reefs. While improving water quality and limiting anthropogenic impacts are clearly important management initiatives to improve the long-term outlook for inshore reefs, identifying, mapping and protecting these coastal ‘refugia’ may be the key for ensuring their regeneration against catastrophic climatic disturbance in the meantime.

  2. National-scale analysis for the identification of High Conservation Value Forests (HCVFs

    Directory of Open Access Journals (Sweden)

    Maesano M


    Full Text Available In Italy, forests cover about one third of the national territory. In recent years, sustainability has been applied to forest management through the introduction of the Sustainable Forest Management (SFM concept. Since the Rio Conference, several initiatives at international and governmental level aimed to realize the SFM concept by the establishment of a set of principles with general validity. One of the most successful initiatives is the Forest Stewardship Council (FSC, which has developed a system of voluntary certification specific for the forestry sector, as well as 10 principles and 56 criteria for good forest management. The concept of High Conservation Value Forest concept (HCVFs was defined in 1999 by FSC under Principle 9, and its application requires the identification of six categories of High Conservation Values (HCV. The aim of this study was to define the parameters for the HCVFs Italian forests, A first national mapping for the first level of High Conservation Value was developed focusing on protected areas, threatened and endangered species and the ecosystemic temporal use. Protected areas may constitute the basis of the SFM. This work is the result of data processing and distribution analysis through the intersection of vectorial data of national forests areas in ArcMap, on the basis of available information. Protected forest areas represent 34% of the national forest area. The different categories of protected areas contribute differently to protection, in particular the larger amount of preserved forests (22.96% falls within Sites of Community Importance (SCI. The analysis of highly protected forest types revealed major differences likely linked to site ecological conditions, which are extremely variable over the country. The HCVF concept is applied in the forest certification field and can be used in sustainable forest management, planning and land use, and policy commitments.

  3. High order numerical methods for networks of hyperbolic conservation laws coupled with ODEs and lumped parameter models (United States)

    Borsche, Raul; Kall, Jochen


    In this paper we construct high order finite volume schemes on networks of hyperbolic conservation laws with coupling conditions involving ODEs. We consider two generalized Riemann solvers at the junction, one of Toro-Castro type and a solver of Harten, Enquist, Osher, Chakravarthy type. The ODE is treated with a Taylor method or an explicit Runge-Kutta scheme, respectively. Both resulting high order methods conserve quantities exactly if the conservation is part of the coupling conditions. Furthermore we present a technique to incorporate lumped parameter models, which arise from simplifying parts of a network. The high order convergence and the robust capturing of shocks are investigated numerically in several test cases.

  4. Fisheries conservation on the high seas: linking conservation physiology and fisheries ecology for the management of large pelagic fishes. (United States)

    Horodysky, Andrij Z; Cooke, Steven J; Graves, John E; Brill, Richard W


    Populations of tunas, billfishes and pelagic sharks are fished at or over capacity in many regions of the world. They are captured by directed commercial and recreational fisheries (the latter of which often promote catch and release) or as incidental catch or bycatch in commercial fisheries. Population assessments of pelagic fishes typically incorporate catch-per-unit-effort time-series data from commercial and recreational fisheries; however, there have been notable changes in target species, areas fished and depth-specific gear deployments over the years that may have affected catchability. Some regional fisheries management organizations take into account the effects of time- and area-specific changes in the behaviours of fish and fishers, as well as fishing gear, to standardize catch-per-unit-effort indices and refine population estimates. However, estimates of changes in stock size over time may be very sensitive to underlying assumptions of the effects of oceanographic conditions and prey distribution on the horizontal and vertical movement patterns and distribution of pelagic fishes. Effective management and successful conservation of pelagic fishes requires a mechanistic understanding of their physiological and behavioural responses to environmental variability, potential for interaction with commercial and recreational fishing gear, and the capture process. The interdisciplinary field of conservation physiology can provide insights into pelagic fish demography and ecology (including environmental relationships and interspecific interactions) by uniting the complementary expertise and skills of fish physiologists and fisheries scientists. The iterative testing by one discipline of hypotheses generated by the other can span the fundamental-applied science continuum, leading to the development of robust insights supporting informed management. The resulting species-specific understanding of physiological abilities and tolerances can help to improve stock

  5. Fisheries conservation on the high seas: linking conservation physiology and fisheries ecology for the management of large pelagic fishes (United States)

    Horodysky, Andrij Z.; Cooke, Steven J.; Graves, John E.; Brill, Richard W.


    Populations of tunas, billfishes and pelagic sharks are fished at or over capacity in many regions of the world. They are captured by directed commercial and recreational fisheries (the latter of which often promote catch and release) or as incidental catch or bycatch in commercial fisheries. Population assessments of pelagic fishes typically incorporate catch-per-unit-effort time-series data from commercial and recreational fisheries; however, there have been notable changes in target species, areas fished and depth-specific gear deployments over the years that may have affected catchability. Some regional fisheries management organizations take into account the effects of time- and area-specific changes in the behaviours of fish and fishers, as well as fishing gear, to standardize catch-per-unit-effort indices and refine population estimates. However, estimates of changes in stock size over time may be very sensitive to underlying assumptions of the effects of oceanographic conditions and prey distribution on the horizontal and vertical movement patterns and distribution of pelagic fishes. Effective management and successful conservation of pelagic fishes requires a mechanistic understanding of their physiological and behavioural responses to environmental variability, potential for interaction with commercial and recreational fishing gear, and the capture process. The interdisciplinary field of conservation physiology can provide insights into pelagic fish demography and ecology (including environmental relationships and interspecific interactions) by uniting the complementary expertise and skills of fish physiologists and fisheries scientists. The iterative testing by one discipline of hypotheses generated by the other can span the fundamental–applied science continuum, leading to the development of robust insights supporting informed management. The resulting species-specific understanding of physiological abilities and tolerances can help to improve stock

  6. Identification of proteins that form specific complexes with the highly conserved protein Translin in Schizosaccharomyces pombe. (United States)

    Eliahoo, Elad; Litovco, Phyana; Ben Yosef, Ron; Bendalak, Keren; Ziv, Tamar; Manor, Haim


    Translin is a single-stranded DNA and RNA binding protein that has a high affinity for G-rich sequences. TRAX is a Translin paralog that associates with Translin. Both Translin and TRAX were highly conserved in eukaryotes. The nucleic acid binding form of Translin is a barrel-shaped homo-octamer. A Translin-TRAX hetero-octamer having a similar structure also binds nucleic acids. Previous reports suggested that Translin may be involved in chromosomal translocations, telomere metabolism and the control of mRNA transport and translation. More recent studies have indicated that Translin-TRAX hetero-octamers are involved in RNA silencing. To gain a further insight into the functions of Translin, we have undertaken to systematically search for proteins with which it forms specific complexes in living cells. Here we report the results of such a search conducted in the fission yeast Schizosaccharomyces pombe, a suitable model system. This search was carried out by affinity purification and immuno-precipitation techniques, combined with differential labeling of the intracellular proteins with the stable isotopes ¹⁵N and ¹⁴N. We identified for the first time two proteins containing an RNA Recognition Motif (RRM), which are specifically associated with the yeast Translin: (1) the pre-mRNA-splicing factor srp1 that belongs to the highly conserved SR family of proteins and (2) vip1, a protein conserved in fungi. Our data also support the presence of RNA in these intracellular complexes. Our experimental approach should be generally applicable to studies of weak intracellular protein-protein interactions and provides a clear distinction between false positive vs. truly interacting proteins. Copyright © 2013 The Authors. Published by Elsevier B.V. All rights reserved.

  7. Use of ancient sedimentary DNA as a novel conservation tool for high-altitude tropical biodiversity. (United States)

    Boessenkool, Sanne; McGlynn, Gayle; Epp, Laura S; Taylor, David; Pimentel, Manuel; Gizaw, Abel; Nemomissa, Sileshi; Brochmann, Christian; Popp, Magnus


    Conservation of biodiversity may in the future increasingly depend upon the availability of scientific information to set suitable restoration targets. In traditional paleoecology, sediment-based pollen provides a means to define preanthropogenic impact conditions, but problems in establishing the exact provenance and ecologically meaningful levels of taxonomic resolution of the evidence are limiting. We explored the extent to which the use of sedimentary ancient DNA (sedaDNA) may complement pollen data in reconstructing past alpine environments in the tropics. We constructed a record of afro-alpine plants retrieved from DNA preserved in sediment cores from 2 volcanic crater sites in the Albertine Rift, eastern Africa. The record extended well beyond the onset of substantial anthropogenic effects on tropical mountains. To ensure high-quality taxonomic inference from the sedaDNA sequences, we built an extensive DNA reference library covering the majority of the afro-alpine flora, by sequencing DNA from taxonomically verified specimens. Comparisons with pollen records from the same sediment cores showed that plant diversity recovered with sedaDNA improved vegetation reconstructions based on pollen records by revealing both additional taxa and providing increased taxonomic resolution. Furthermore, combining the 2 measures assisted in distinguishing vegetation change at different geographic scales; sedaDNA almost exclusively reflects local vegetation, whereas pollen can potentially originate from a wide area that in highlands in particular can span several ecozones. Our results suggest that sedaDNA may provide information on restoration targets and the nature and magnitude of human-induced environmental changes, including in high conservation priority, biodiversity hotspots, where understanding of preanthropogenic impact (or reference) conditions is highly limited. © 2013 Society for Conservation Biology.

  8. Restriction fragment length polymorphism analysis shows that the hippuricase gene of Campylobacter jejuni is highly conserved. (United States)

    Slater, E R; Owen, R J


    A 1151-bp amplicon containing the hippuricase (hipO) gene was obtained from 118 strains of Campylobacter jejuni and double-digested with AluI and DdeI to give five different PCR-RFLP patterns. Most strains had the six-banded profile predicted from sequence data. Lack of polymorphisms within the hipO gene indicated it was highly conserved amongst strains of Camp.jejuni, and the RFLP analysis provided only low discrimination as an epidemiological typing method. Detection of hipO by PCR provided a useful test for confirmatory identification of Camp. jejuni.

  9. Low-intensity agricultural landscapes in Transylvania support high butterfly diversity: implications for conservation. (United States)

    Loos, Jacqueline; Dorresteijn, Ine; Hanspach, Jan; Fust, Pascal; Rakosy, László; Fischer, Joern


    European farmland biodiversity is declining due to land use changes towards agricultural intensification or abandonment. Some Eastern European farming systems have sustained traditional forms of use, resulting in high levels of biodiversity. However, global markets and international policies now imply rapid and major changes to these systems. To effectively protect farmland biodiversity, understanding landscape features which underpin species diversity is crucial. Focusing on butterflies, we addressed this question for a cultural-historic landscape in Southern Transylvania, Romania. Following a natural experiment, we randomly selected 120 survey sites in farmland, 60 each in grassland and arable land. We surveyed butterfly species richness and abundance by walking transects with four repeats in summer 2012. We analysed species composition using Detrended Correspondence Analysis. We modelled species richness, richness of functional groups, and abundance of selected species in response to topography, woody vegetation cover and heterogeneity at three spatial scales, using generalised linear mixed effects models. Species composition widely overlapped in grassland and arable land. Composition changed along gradients of heterogeneity at local and context scales, and of woody vegetation cover at context and landscape scales. The effect of local heterogeneity on species richness was positive in arable land, but negative in grassland. Plant species richness, and structural and topographic conditions at multiple scales explained species richness, richness of functional groups and species abundances. Our study revealed high conservation value of both grassland and arable land in low-intensity Eastern European farmland. Besides grassland, also heterogeneous arable land provides important habitat for butterflies. While butterfly diversity in arable land benefits from heterogeneity by small-scale structures, grasslands should be protected from fragmentation to provide

  10. Low-intensity agricultural landscapes in Transylvania support high butterfly diversity: implications for conservation.

    Directory of Open Access Journals (Sweden)

    Jacqueline Loos

    Full Text Available European farmland biodiversity is declining due to land use changes towards agricultural intensification or abandonment. Some Eastern European farming systems have sustained traditional forms of use, resulting in high levels of biodiversity. However, global markets and international policies now imply rapid and major changes to these systems. To effectively protect farmland biodiversity, understanding landscape features which underpin species diversity is crucial. Focusing on butterflies, we addressed this question for a cultural-historic landscape in Southern Transylvania, Romania. Following a natural experiment, we randomly selected 120 survey sites in farmland, 60 each in grassland and arable land. We surveyed butterfly species richness and abundance by walking transects with four repeats in summer 2012. We analysed species composition using Detrended Correspondence Analysis. We modelled species richness, richness of functional groups, and abundance of selected species in response to topography, woody vegetation cover and heterogeneity at three spatial scales, using generalised linear mixed effects models. Species composition widely overlapped in grassland and arable land. Composition changed along gradients of heterogeneity at local and context scales, and of woody vegetation cover at context and landscape scales. The effect of local heterogeneity on species richness was positive in arable land, but negative in grassland. Plant species richness, and structural and topographic conditions at multiple scales explained species richness, richness of functional groups and species abundances. Our study revealed high conservation value of both grassland and arable land in low-intensity Eastern European farmland. Besides grassland, also heterogeneous arable land provides important habitat for butterflies. While butterfly diversity in arable land benefits from heterogeneity by small-scale structures, grasslands should be protected from fragmentation

  11. Skinks (Reptilia: Scincidae) have highly conserved karyotypes as revealed by chromosome painting. (United States)

    Giovannotti, M; Caputo, V; O'Brien, P C M; Lovell, F L; Trifonov, V; Cerioni, P Nisi; Olmo, E; Ferguson-Smith, M A; Rens, W


    Skinks represent the most diversified squamate reptiles with a great variation in body size and form, and are found worldwide in a variety of habitats. Their remarkable diversification has been accompanied by only a few chromosome rearrangements, resulting in highly-conservative chromosomal complements of these lizards. In this study cross-species chromosome painting using Scincus scincus (2n = 32) as the source genome, was used to detect the chromosomal rearrangements and homologies between the following skinks: Chalcides chalcides (2n = 28), C. ocellatus (2n = 28), Eumeces schneideri (2n = 32), Lepidothyris fernandi (2n = 30), Mabuya quinquetaeniata (2n = 32). The results of this study confirmed a high degree of chromosome conservation between these species. The main rearrangements in the studied skinks involve chromosomes 3, 5, 6 and 7 of S. scincus. These subtelocentric chromosomes are homologous to the p and q arms of metacentric pair 3 and 4 in C. chalcides, C. ocellatus, L. fernandi, and M. quinquetaeniata, while they are entirely conserved in E. schneideri. Other rearrangements involve S. scincus 11 in L. fernandi and M. quinquetaeniata, supporting the monophyly of Lygosominae, and one of the chromosomes S. scincus 12-16, in M. quinquetaeniata. In conclusion, our data support the monophyly of Scincidae and confirm that Scincus-Eumeces plus Chalcides do not form a monophyletic clade, suggesting that the Scincus-Eumeces clade is basal to other members of this family. This study represents the first time the whole genome of any reptile species has been used for cross-species chromosome painting to assess chromosomal evolution in this group of vertebrates. Copyright 2010 S. Karger AG, Basel.

  12. Entropy stable high order discontinuous Galerkin methods with suitable quadrature rules for hyperbolic conservation laws (United States)

    Chen, Tianheng; Shu, Chi-Wang


    It is well known that semi-discrete high order discontinuous Galerkin (DG) methods satisfy cell entropy inequalities for the square entropy for both scalar conservation laws (Jiang and Shu (1994) [39]) and symmetric hyperbolic systems (Hou and Liu (2007) [36]), in any space dimension and for any triangulations. However, this property holds only for the square entropy and the integrations in the DG methods must be exact. It is significantly more difficult to design DG methods to satisfy entropy inequalities for a non-square convex entropy, and/or when the integration is approximated by a numerical quadrature. In this paper, we develop a unified framework for designing high order DG methods which will satisfy entropy inequalities for any given single convex entropy, through suitable numerical quadrature which is specific to this given entropy. Our framework applies from one-dimensional scalar cases all the way to multi-dimensional systems of conservation laws. For the one-dimensional case, our numerical quadrature is based on the methodology established in Carpenter et al. (2014) [5] and Gassner (2013) [19]. The main ingredients are summation-by-parts (SBP) operators derived from Legendre Gauss-Lobatto quadrature, the entropy conservative flux within elements, and the entropy stable flux at element interfaces. We then generalize the scheme to two-dimensional triangular meshes by constructing SBP operators on triangles based on a special quadrature rule. A local discontinuous Galerkin (LDG) type treatment is also incorporated to achieve the generalization to convection-diffusion equations. Extensive numerical experiments are performed to validate the accuracy and shock capturing efficacy of these entropy stable DG methods.

  13. High-order conservative discretizations for some cases of the rigid body motion

    Energy Technology Data Exchange (ETDEWEB)

    Kozlov, Roman [Department of Mathematics, University of Bergen, Johannes Brunsgate 12, 5008 Bergen (Norway)], E-mail:


    Modified vector fields can be used to construct high-order structure-preserving numerical integrators for ordinary differential equations. In the present Letter we consider high-order integrators based on the implicit midpoint rule, which conserve quadratic first integrals. It is shown that these integrators are particularly suitable for the rigid body motion with an additional quadratic first integral. In this case high-order integrators preserve all four first integrals of motion. The approach is illustrated on the Lagrange top (a rotationally symmetric rigid body with a fixed point on the symmetry axis). The equations of motion are considered in the space fixed frame because in this frame Lagrange top admits a neat description. The Lagrange top motion includes the spherical pendulum and the planar pendulum, which swings in a vertical plane, as particular cases.

  14. 7 CFR 12.23 - Conservation plans and conservation systems. (United States)


    ... 7 Agriculture 1 2010-01-01 2010-01-01 false Conservation plans and conservation systems. 12.23... CONSERVATION Highly Erodible Land Conservation § 12.23 Conservation plans and conservation systems. (a) Use of field office technical guide. A conservation plan or conservation system developed for the purposes of...

  15. Nosema ceranae alters a highly conserved hormonal stress pathway in honeybees. (United States)

    Mayack, C; Natsopoulou, M E; McMahon, D P


    Nosema ceranae, an emerging pathogen of the western honeybee (Apis mellifera), is implicated in recent pollinator losses and causes severe energetic stress. However, whether precocious foraging and accelerated behavioural maturation in infected bees are caused by the infection itself or via indirect energetic stress remains unknown. Using a combination of nutritional and infection treatments, we investigated how starvation and infection alters the regulation of adipokinetic hormone (AKH) and octopamine, two highly conserved physiological pathways that respond to energetic stress by mobilizing fat stores and increasing search activity for food. Although there was no response from AKH when bees were experimentally infected with N. ceranae or starved, supporting the notion that honeybees have lost this pathway, there were significant regulatory changes in the octopamine pathway. Significantly, we found no evidence of acute energetic stress being the only cause of symptoms associated with N. ceranae infection. Therefore, the parasite itself appears to alter regulatory components along a highly conserved physiological pathway in an infection-specific manner. This indicates that pathogen-induced behavioural alteration of chronically infected bees should not just be viewed as a coincidental short-term by-product of pathogenesis (acute energetic stress) and may be a result of a generalist manipulation strategy to obtain energy for reproduction. © 2015 The Royal Entomological Society.

  16. Effects of the Conservation Reserve Program on Hydrologic Processes in the Southern High Plains (United States)

    Haacker, E. M.; Smidt, S. J.; Kendall, A. D.; Basso, B.; Hyndman, D. W.


    The Southern High Plains Aquifer is a rapidly depleting resource that supports agriculture in parts of New Mexico and the Texas Panhandle. The development of the aquifer has changed the landscape and the water cycle of the region. This study illustrates the evolving patterns of land use and the effects of cultivation, from irrigated to dryland farming to the countermanding influence of the Conservation Reserve Program (CRP). Previous research indicates that greater recharge rates occur under cultivated land in the Southern High Plains than under unbroken soil: the transition to cultivation causes increased recharge, under both dryland and irrigated management, though most recharge still occurs through playa lakes. The Conservation Reserve Program takes land out of crop production, replacing the land cover with something more like the natural ecosystem. This may decrease recharge below fields, and reduce runoff that feeds playa lakes; or, CRP may help stabilize playa lakes, increasing recharge. Changes to the water cycle are investigated at the field scale using the System Approach to Land Use Sustainability (SALUS) crop model, and at the regional scale with the Landscape Hydrology Model (LHM), and compared with historical data and water table elevations.

  17. High-performance teams in wildlife conservation: A species reintroduction and recovery example (United States)

    Clark, Tim W.; Westrum, Ron


    Reintroduction of animals to the wild to establish free-ranging viable populations is a valuable conservation tool, but ecological skills alone are not enough to ensure a successful reintroduction; also needed to do the work are effectively designed and managed programs. This article suggests general guidelines for organizing and managing reintroduction programs, reviews some basic organizational issues, and considers ways to develop high-performance teams The need to integrate reintroduction programs into their larger interorganizational context is discussed. The reintroduction program's structure must be appropriate for its function and should be properly staffed, led, and buffered from its political environment It should process information well, learn rapidly from its own mistakes, and be creative A high-performance team devotes most of its energies to solving external rather than internal problems

  18. High Re-Operation Rates Using Conserve Metal-On-Metal Total Hip Articulations

    DEFF Research Database (Denmark)

    Mogensen, S L; Jakobsen, Thomas; Christoffersen, Hardy


    INTRODUCTION: Metal-on-metal hip articulations have been intensely debated after reports of adverse reactions and high failure rates. The aim of this study was to retrospectively evaluate the implant of a metal-on.metal total hip articulation (MOM THA) from a single manufacture in a two...... of 53 months. 4 pseudotumors were diagnosed at time of follow up but no substantiated link was made between adverse reactions and re-operations. CONCLUSION: The high re-operation rates found in this study raised concern about the usage of the MOM THA and subsequently lead to the termination......-center study. MATERIALS AND METHODS: 108 CONSERVE(®) MOM THA were implanted in 92 patients between November 2005 and December 2010. Patients had at time of retrospective evaluation their journals reviewed for re-operations and adverse reactions. RESULTS: 20 hips were re-operated (18.4%) at a mean follow up...

  19. An assessment of high carbon stock and high conservation value approaches to sustainable oil palm cultivation in Gabon (United States)

    Austin, Kemen G.; Lee, Michelle E.; Clark, Connie; Forester, Brenna R.; Urban, Dean L.; White, Lee; Kasibhatla, Prasad S.; Poulsen, John R.


    Industrial-scale oil palm cultivation is rapidly expanding in Gabon, where it has the potential to drive economic growth, but also threatens forest, biodiversity and carbon resources. The Gabonese government is promoting an ambitious agricultural expansion strategy, while simultaneously committing to minimize negative environmental impacts of oil palm agriculture. This study estimates the extent and location of suitable land for oil palm cultivation in Gabon, based on an analysis of recent trends in plantation permitting. We use the resulting suitability map to evaluate two proposed approaches to minimizing negative environmental impacts: a High Carbon Stock (HCS) approach, which emphasizes forest protection and climate change mitigation, and a High Conservation Value (HCV) approach, which focuses on safeguarding biodiversity and ecosystems. We quantify the forest area, carbon stock, and biodiversity resources protected under each approach, using newly developed maps of priority species distributions and forest biomass for Gabon. We find 2.7-3.9 Mha of suitable or moderately suitable land that avoid HCS areas, 4.4 million hectares (Mha) that avoid HCV areas, and 1.2-1.7 Mha that avoid both. This suggests that Gabon’s oil palm production target could likely be met without compromising important ecosystem services, if appropriate safeguards are put in place. Our analysis improves understanding of suitability for oil palm in Gabon, determines how conservation strategies align with national targets for oil palm production, and informs national land use planning.

  20. Human Activities in Natura 2000 Sites: A Highly Diversified Conservation Network (United States)

    Tsiafouli, Maria A.; Apostolopoulou, Evangelia; Mazaris, Antonios D.; Kallimanis, Athanasios S.; Drakou, Evangelia G.; Pantis, John D.


    The Natura 2000 network was established across the European Union's (EU) Member States with the aim to conserve biodiversity, while ensuring the sustainability of human activities. However, to what kind and to what extent Natura 2000 sites are subject to human activities and how this varies across Member States remains unspecified. Here, we analyzed 111,269 human activity records from 14,727 protected sites in 20 Member States. The frequency of occurrence of activities differs among countries, with more than 86 % of all sites being subjected to agriculture or forestry. Activities like hunting, fishing, urbanization, transportation, and tourism are more frequently recorded in south European sites than in northern or eastern ones. The observed variations indicate that Natura 2000 networks are highly heterogeneous among EU Member States. Our analysis highlights the importance of agriculture in European landscapes and indicates possible targets for policy interventions at national, European, or "sub-European" level. The strong human presence in the Natura 2000 network throughout Member States, shows that conservation initiatives could succeed only by combining social and ecological sustainability and by ensuring the integration of policies affecting biodiversity.

  1. Determining the drivers of population structure in a highly urbanized landscape to inform conservation planning. (United States)

    Thomassen, Henri A; Harrigan, Ryan J; Semple Delaney, Kathleen; Riley, Seth P D; Serieys, Laurel E K; Pease, Katherine; Wayne, Robert K; Smith, Thomas B


    Understanding the environmental contributors to population structure is of paramount importance for conservation in urbanized environments. We used spatially explicit models to determine genetic population structure under current and future environmental conditions across a highly fragmented, human-dominated environment in Southern California to assess the effects of natural ecological variation and urbanization. We focused on 7 common species with diverse habitat requirements, home-range sizes, and dispersal abilities. We quantified the relative roles of potential barriers, including natural environmental characteristics and an anthropogenic barrier created by a major highway, in shaping genetic variation. The ability to predict genetic variation in our models differed among species: 11-81% of intraspecific genetic variation was explained by environmental variables. Although an anthropogenically induced barrier (a major highway) severely restricted gene flow and movement at broad scales for some species, genetic variation seemed to be primarily driven by natural environmental heterogeneity at a local level. Our results show how assessing environmentally associated variation for multiple species under current and future climate conditions can help identify priority regions for maximizing population persistence under environmental change in urbanized regions. © 2017 Society for Conservation Biology.

  2. Highly conserved molecular pathways, including Wnt signaling, promote functional recovery from spinal cord injury in lampreys. (United States)

    Herman, Paige E; Papatheodorou, Angelos; Bryant, Stephanie A; Waterbury, Courtney K M; Herdy, Joseph R; Arcese, Anthony A; Buxbaum, Joseph D; Smith, Jeramiah J; Morgan, Jennifer R; Bloom, Ona


    In mammals, spinal cord injury (SCI) leads to dramatic losses in neurons and synaptic connections, and consequently function. Unlike mammals, lampreys are vertebrates that undergo spontaneous regeneration and achieve functional recovery after SCI. Therefore our goal was to determine the complete transcriptional responses that occur after SCI in lampreys and to identify deeply conserved pathways that promote regeneration. We performed RNA-Seq on lamprey spinal cord and brain throughout the course of functional recovery. We describe complex transcriptional responses in the injured spinal cord, and somewhat surprisingly, also in the brain. Transcriptional responses to SCI in lampreys included transcription factor networks that promote peripheral nerve regeneration in mammals such as Atf3 and Jun. Furthermore, a number of highly conserved axon guidance, extracellular matrix, and proliferation genes were also differentially expressed after SCI in lampreys. Strikingly, ~3% of differentially expressed transcripts belonged to the Wnt pathways. These included members of the Wnt and Frizzled gene families, and genes involved in downstream signaling. Pharmacological inhibition of Wnt signaling inhibited functional recovery, confirming a critical role for this pathway. These data indicate that molecular signals present in mammals are also involved in regeneration in lampreys, supporting translational relevance of the model.

  3. Zero-tolerance biosecurity protects high-conservation-value island nature reserve. (United States)

    Scott, John K; McKirdy, Simon J; van der Merwe, Johann; Green, Roy; Burbidge, Andrew A; Pickles, Greg; Hardie, Darryl C; Morris, Keith; Kendrick, Peter G; Thomas, Melissa L; Horton, Kristin L; O'Connor, Simon M; Downs, Justin; Stoklosa, Richard; Lagdon, Russell; Marks, Barbara; Nairn, Malcolm; Mengersen, Kerrie


    Barrow Island, north-west coast of Australia, is one of the world's significant conservation areas, harboring marsupials that have become extinct or threatened on mainland Australia as well as a rich diversity of plants and animals, some endemic. Access to construct a Liquefied Natural Gas (LNG) plant, Australia's largest infrastructure development, on the island was conditional on no non-indigenous species (NIS) becoming established. We developed a comprehensive biosecurity system to protect the island's biodiversity. From 2009 to 2015 more than 0.5 million passengers and 12.2 million tonnes of freight were transported to the island under the biosecurity system, requiring 1.5 million hrs of inspections. No establishments of NIS were detected. We made four observations that will assist development of biosecurity systems. Firstly, the frequency of detections of organisms corresponded best to a mixture log-normal distribution including the high number of zero inspections and extreme values involving rare incursions. Secondly, comprehensive knowledge of the island's biota allowed estimation of false positive detections (62% native species). Thirdly, detections at the border did not predict incursions on the island. Fourthly, the workforce detected more than half post-border incursions (59%). Similar approaches can and should be implemented for all areas of significant conservation value.

  4. High-order conservative reconstruction schemes for finite volume methods in cylindrical and spherical coordinates

    CERN Document Server

    Mignone, A


    High-order reconstruction schemes for the solution of hyperbolic conservation laws in orthogonal curvilinear coordinates are revised in the finite volume approach. The formulation employs a piecewise polynomial approximation to the zone-average values to reconstruct left and right interface states from within a computational zone to arbitrary order of accuracy by inverting a Vandermonde-like linear system of equations with spatially varying coefficients. The approach is general and can be used on uniform and non-uniform meshes although explicit expressions are derived for polynomials from second to fifth degree in cylindrical and spherical geometries with uniform grid spacing. It is shown that, in regions of large curvature, the resulting expressions differ considerably from their Cartesian counterparts and that the lack of such corrections can severely degrade the accuracy of the solution close to the coordinate origin. Limiting techniques and monotonicity constraints are revised for conventional reconstruct...

  5. A highly conserved segmental duplication in the subtelomeres of Plasmodium falciparum chromosomes varies in copy number

    Directory of Open Access Journals (Sweden)

    Ribacke Ulf


    Full Text Available Abstract Background Segmental duplications (SD have been found in genomes of various organisms, often accumulated at the ends of chromosomes. It has been assumed that the sequence homology in-between the SDs allow for ectopic interactions that may contribute to the emergence of new genes or gene variants through recombinatorial events. Methods In silico analysis of the 3D7 Plasmodium falciparum genome, conducted to investigate the subtelomeric compartments, led to the identification of subtelomeric SDs. Sequence variation and copy number polymorphisms of the SDs were studied by DNA sequencing, real-time quantitative PCR (qPCR and fluorescent in situ hybridization (FISH. The levels of transcription and the developmental expression of copy number variant genes were investigated by qPCR. Results A block of six genes of >10 kilobases in size, including var, rif, pfmc-2tm and three hypothetical genes (n-, o- and q-gene, was found duplicated in the subtelomeric regions of chromosomes 1, 2, 3, 6, 7, 10 and 11 (SD1. The number of SD1 per genome was found to vary from 4 to 8 copies in between different parasites. The intragenic regions of SD1 were found to be highly conserved across ten distinct fresh and long-term cultivated P. falciparum. Sequence variation was detected in a ≈ 23 amino-acid long hypervariable region of a surface-exposed loop of PFMC-2TM. A hypothetical gene within SD1, the n-gene, encoding a PEXEL/VTS-containing two-transmembrane protein was found expressed in ring stage parasites. The n-gene transcription levels were found to correlate to the number of n-gene copies. Fragments of SD1 harbouring two or three of the SD1-genes (o-gene, pfmc-2tm, q-gene were also found in the 3D7 genome. In addition a related second SD, SD2, of ≈ 55% sequence identity to SD1 was found duplicated in a fresh clinical isolate but was only present in a single copy in 3D7 and in other P. falciparum lines or clones. Conclusion Plasmodium falciparum carries

  6. Cortical cytasters: a highly conserved developmental trait of Bilateria with similarities to Ctenophora

    Directory of Open Access Journals (Sweden)

    Salinas-Saavedra Miguel


    Full Text Available Abstract Background Cytasters (cytoplasmic asters are centriole-based nucleation centers of microtubule polymerization that are observable in large numbers in the cortical cytoplasm of the egg and zygote of bilaterian organisms. In both protostome and deuterostome taxa, cytasters have been described to develop during oogenesis from vesicles of nuclear membrane that move to the cortical cytoplasm. They become associated with several cytoplasmic components, and participate in the reorganization of cortical cytoplasm after fertilization, patterning the antero-posterior and dorso-ventral body axes. Presentation of the hypothesis The specific resemblances in the development of cytasters in both protostome and deuterostome taxa suggest that an independent evolutionary origin is unlikely. An assessment of published data confirms that cytasters are present in several protostome and deuterostome phyla, but are absent in the non-bilaterian phyla Cnidaria and Ctenophora. We hypothesize that cytasters evolved in the lineage leading to Bilateria and were already present in the most recent common ancestor shared by protostomes and deuterostomes. Thus, cytasters would be an ancient and highly conserved trait that is homologous across the different bilaterian phyla. The alternative possibility is homoplasy, that is cytasters have evolved independently in different lineages of Bilateria. Testing the hypothesis So far, available published information shows that appropriate observations have been made in eight different bilaterian phyla. All of them present cytasters. This is consistent with the hypothesis of homology and conservation. However, there are several important groups for which there are no currently available data. The hypothesis of homology predicts that cytasters should be present in these groups. Increasing the taxonomic sample using modern techniques uniformly will test for evolutionary patterns supporting homology, homoplasy, or secondary loss of

  7. Cortical cytasters: a highly conserved developmental trait of Bilateria with similarities to Ctenophora. (United States)

    Salinas-Saavedra, Miguel; Vargas, Alexander O


    Cytasters (cytoplasmic asters) are centriole-based nucleation centers of microtubule polymerization that are observable in large numbers in the cortical cytoplasm of the egg and zygote of bilaterian organisms. In both protostome and deuterostome taxa, cytasters have been described to develop during oogenesis from vesicles of nuclear membrane that move to the cortical cytoplasm. They become associated with several cytoplasmic components, and participate in the reorganization of cortical cytoplasm after fertilization, patterning the antero-posterior and dorso-ventral body axes. The specific resemblances in the development of cytasters in both protostome and deuterostome taxa suggest that an independent evolutionary origin is unlikely. An assessment of published data confirms that cytasters are present in several protostome and deuterostome phyla, but are absent in the non-bilaterian phyla Cnidaria and Ctenophora. We hypothesize that cytasters evolved in the lineage leading to Bilateria and were already present in the most recent common ancestor shared by protostomes and deuterostomes. Thus, cytasters would be an ancient and highly conserved trait that is homologous across the different bilaterian phyla. The alternative possibility is homoplasy, that is cytasters have evolved independently in different lineages of Bilateria. So far, available published information shows that appropriate observations have been made in eight different bilaterian phyla. All of them present cytasters. This is consistent with the hypothesis of homology and conservation. However, there are several important groups for which there are no currently available data. The hypothesis of homology predicts that cytasters should be present in these groups. Increasing the taxonomic sample using modern techniques uniformly will test for evolutionary patterns supporting homology, homoplasy, or secondary loss of cytasters. If cytasters are homologous and highly conserved across bilateria, their potential

  8. Streamlining and Core Genome Conservation among Highly Divergent Members of the SAR11 Clade (United States)

    Grote, Jana; Thrash, J. Cameron; Huggett, Megan J.; Landry, Zachary C.; Carini, Paul; Giovannoni, Stephen J.; Rappé, Michael S.


    ABSTRACT SAR11 is an ancient and diverse clade of heterotrophic bacteria that are abundant throughout the world’s oceans, where they play a major role in the ocean carbon cycle. Correlations between the phylogenetic branching order and spatiotemporal patterns in cell distributions from planktonic ocean environments indicate that SAR11 has evolved into perhaps a dozen or more specialized ecotypes that span evolutionary distances equivalent to a bacterial order. We isolated and sequenced genomes from diverse SAR11 cultures that represent three major lineages and encompass the full breadth of the clade. The new data expand observations about genome evolution and gene content that previously had been restricted to the SAR11 Ia subclade, providing a much broader perspective on the clade’s origins, evolution, and ecology. We found small genomes throughout the clade and a very high proportion of core genome genes (48 to 56%), indicating that small genome size is probably an ancestral characteristic. In their level of core genome conservation, the members of SAR11 are outliers, the most conserved free-living bacteria known. Shared features of the clade include low GC content, high gene synteny, a large hypervariable region bounded by rRNA genes, and low numbers of paralogs. Variation among the genomes included genes for phosphorus metabolism, glycolysis, and C1 metabolism, suggesting that adaptive specialization in nutrient resource utilization is important to niche partitioning and ecotype divergence within the clade. These data provide support for the conclusion that streamlining selection for efficient cell replication in the planktonic habitat has occurred throughout the evolution and diversification of this clade. PMID:22991429

  9. Evolutionary conservation of essential and highly expressed genes in Pseudomonas aeruginosa

    Directory of Open Access Journals (Sweden)

    Scharfe Maren


    Full Text Available Abstract Background The constant increase in development and spread of bacterial resistance to antibiotics poses a serious threat to human health. New sequencing technologies are now on the horizon that will yield massive increases in our capacity for DNA sequencing and will revolutionize the drug discovery process. Since essential genes are promising novel antibiotic targets, the prediction of gene essentiality based on genomic information has become a major focus. Results In this study we demonstrate that pooled sequencing is applicable for the analysis of sequence variations of strain collections with more than 10 individual isolates. Pooled sequencing of 36 clinical Pseudomonas aeruginosa isolates revealed that essential and highly expressed proteins evolve at lower rates, whereas extracellular proteins evolve at higher rates. We furthermore refined the list of experimentally essential P. aeruginosa genes, and identified 980 genes that show no sequence variation at all. Among the conserved nonessential genes we found several that are involved in regulation, motility and virulence, indicating that they represent factors of evolutionary importance for the lifestyle of a successful environmental bacterium and opportunistic pathogen. Conclusion The detailed analysis of a comprehensive set of P. aeruginosa genomes in this study clearly disclosed detailed information of the genomic makeup and revealed a large set of highly conserved genes that play an important role for the lifestyle of this microorganism. Sequencing strain collections enables for a detailed and extensive identification of sequence variations as potential bacterial adaptation processes, e.g., during the development of antibiotic resistance in the clinical setting and thus may be the basis to uncover putative targets for novel treatment strategies.

  10. A guide to calculating habitat-quality metrics to inform conservation of highly mobile species (United States)

    Bieri, Joanna A.; Sample, Christine; Thogmartin, Wayne E.; Diffendorfer, James E.; Earl, Julia E.; Erickson, Richard A.; Federico, Paula; Flockhart, D. T. Tyler; Nicol, Sam; Semmens, Darius J.; Skraber, T.; Wiederholt, Ruscena; Mattsson, Brady J.


    Many metrics exist for quantifying the relative value of habitats and pathways used by highly mobile species. Properly selecting and applying such metrics requires substantial background in mathematics and understanding the relevant management arena. To address this multidimensional challenge, we demonstrate and compare three measurements of habitat quality: graph-, occupancy-, and demographic-based metrics. Each metric provides insights into system dynamics, at the expense of increasing amounts and complexity of data and models. Our descriptions and comparisons of diverse habitat-quality metrics provide means for practitioners to overcome the modeling challenges associated with management or conservation of such highly mobile species. Whereas previous guidance for applying habitat-quality metrics has been scattered in diversified tracks of literature, we have brought this information together into an approachable format including accessible descriptions and a modeling case study for a typical example that conservation professionals can adapt for their own decision contexts and focal populations.Considerations for Resource ManagersManagement objectives, proposed actions, data availability and quality, and model assumptions are all relevant considerations when applying and interpreting habitat-quality metrics.Graph-based metrics answer questions related to habitat centrality and connectivity, are suitable for populations with any movement pattern, quantify basic spatial and temporal patterns of occupancy and movement, and require the least data.Occupancy-based metrics answer questions about likelihood of persistence or colonization, are suitable for populations that undergo localized extinctions, quantify spatial and temporal patterns of occupancy and movement, and require a moderate amount of data.Demographic-based metrics answer questions about relative or absolute population size, are suitable for populations with any movement pattern, quantify demographic

  11. A highly conserved amino acid in VP1 regulates maturation of enterovirus 71.

    Directory of Open Access Journals (Sweden)

    Yong-Xin Zhang


    Full Text Available Enterovirus 71 (EV71 is the major causative agent of hand, foot and mouth disease (HFMD in children, causing severe clinical outcomes and even death. Here, we report an important role of the highly conserved alanine residue at position 107 in the capsid protein VP1 (VP1A107 in the efficient replication of EV71. Substitutional mutations of VP1A107 significantly diminish viral growth kinetics without significant effect on viral entry, expression of viral genes and viral production. The results of mechanistic studies reveal that VP1A107 regulates the efficient cleavage of the VP0 precursor during EV71 assembly, which is required, in the next round of infection, for the transformation of the mature virion (160S into an intermediate or A-particle (135S, a key step of virus uncoating. Furthermore, the results of molecular dynamic simulations and hydrogen-bond networks analysis of VP1A107 suggest that flexibility of the VP1 BC loop or the region surrounding the VP1107 residue directly correlates with viral infectivity. It is possible that sufficient flexibility of the region surrounding the VP1107 residue favors VP0 conformational change that is required for the efficient cleavage of VP0 as well as subsequent viral uncoating and viral replication. Taken together, our data reveal the structural role of the highly conserved VP1A107 in regulating EV71 maturation. Characterization of this novel determinant of EV71 virulence would promote the study on pathogenesis of Enteroviruses.

  12. Highly conserved type 1 pili promote enterotoxigenic E. coli pathogen-host interactions.

    Directory of Open Access Journals (Sweden)

    Alaullah Sheikh


    Full Text Available Enterotoxigenic Escherichia coli (ETEC, defined by their elaboration of heat-labile (LT and/or heat-stable (ST enterotoxins, are a common cause of diarrheal illness in developing countries. Efficient delivery of these toxins requires ETEC to engage target host enterocytes. This engagement is accomplished using a variety of pathovar-specific and conserved E. coli adhesin molecules as well as plasmid encoded colonization factors. Some of these adhesins undergo significant transcriptional modulation as ETEC encounter intestinal epithelia, perhaps suggesting that they cooperatively facilitate interaction with the host. Among genes significantly upregulated on cell contact are those encoding type 1 pili. We therefore investigated the role played by these pili in facilitating ETEC adhesion, and toxin delivery to model intestinal epithelia. We demonstrate that type 1 pili, encoded in the E. coli core genome, play an essential role in ETEC virulence, acting in concert with plasmid-encoded pathovar specific colonization factor (CF fimbriae to promote optimal bacterial adhesion to cultured intestinal epithelium (CIE and to epithelial monolayers differentiated from human small intestinal stem cells. Type 1 pili are tipped with the FimH adhesin which recognizes mannose with stereochemical specificity. Thus, enhanced production of highly mannosylated proteins on intestinal epithelia promoted FimH-mediated ETEC adhesion, while conversely, interruption of FimH lectin-epithelial interactions with soluble mannose, anti-FimH antibodies or mutagenesis of fimH effectively blocked ETEC adhesion. Moreover, fimH mutants were significantly impaired in delivery of both heat-stable and heat-labile toxins to the target epithelial cells in vitro, and these mutants were substantially less virulent in rabbit ileal loop assays, a classical model of ETEC pathogenesis. Collectively, our data suggest that these highly conserved pili play an essential role in virulence of these

  13. Butterflies of the high-altitude Atacama Desert: habitat use and conservation. (United States)

    Despland, Emma


    The butterfly fauna of the high-altitude desert of Northern Chile, though depauperate, shows high endemism, is poorly known and is of considerable conservation concern. This study surveys butterflies along the Andean slope between 2400 and 5000 m asl (prepuna, puna and Andean steppe habitats) as well as in high and low-altitude wetlands and in the neoriparian vegetation of agricultural sites. We also include historical sightings from museum records. We compare abundances between altitudes, between natural and impacted sites, as well as between two sampling years with different precipitation regimes. The results confirm high altitudinal turnover and show greatest similarity between wetland and slope faunas at similar altitudes. Results also underscore vulnerability to weather fluctuations, particularly in the more arid low-altitude sites, where abundances were much lower in the low precipitation sampling season and several species were not observed at all. Finally, we show that some species have shifted to the neoriparian vegetation of the agricultural landscape, whereas others were only observed in less impacted habitats dominated by native plants. These results suggest that acclimation to novel habitats depends on larval host plant use. The traditional agricultural environment can provide habitat for many, but not all, native butterfly species, but an estimation of the value of these habitats requires better understanding of butterfly life history strategies and relationships with host plants.

  14. Transcribed-ultra conserved region expression is associated with outcome in high-risk neuroblastoma

    Directory of Open Access Journals (Sweden)

    Garaventa Alberto


    Full Text Available Abstract Background Neuroblastoma is the most common, pediatric, extra-cranial, malignant solid tumor. Despite multimodal therapeutic protocols, outcome for children with a high-risk clinical phenotype remains poor, with long-term survival still less than 40%. Hereby, we evaluated the potential of non-coding RNA expression to predict outcome in high-risk, stage 4 neuroblastoma. Methods We analyzed expression of 481 Ultra Conserved Regions (UCRs by reverse transcription-quantitative real-time PCR and of 723 microRNAs by microarrays in 34 high-risk, stage 4 neuroblastoma patients. Results First, the comparison of 8 short- versus 12 long-term survivors showed that 54 UCRs were significantly (P P P P Conclusions Our pilot study suggests that a deregulation of the microRNA/T-UCR network may play an important role in the pathogenesis of neuroblastoma. After further validation on a larger independent set of samples, such findings may be applied as the first T-UCR prognostic signature for high-risk neuroblastoma patients.

  15. Butterflies of the high altitude Atacama Desert: habitat use and conservation

    Directory of Open Access Journals (Sweden)

    Emma eDespland


    Full Text Available The butterfly fauna of the high-altitude desert of Northern Chile, though depauperate, shows high endemism, is poorly known and is of considerable conservation concern. This study surveys butterflies along the Andean slope between 2400 and 500 m asl (prepuna, puna and Andean steppe habitats as well as in high and low altitude wetlands and in the neoriparian vegetation of agricultural sites. We also include historical sightings from museum records. We compare abundances between altitudes, between natural and impacted sites, as well as between two sampling years with different precipitation regimes. The results confirm high altitudinal turnover and show greatest similarity between wetland and slope faunas at similar altitudes. Results also underscore vulnerability to weather fluctuations, particularly in the more arid low-altitude sites, where abundances were much lower in the low precipitation sampling season and several species were not observed at all. Finally, we show that some species have shifted to the neoriparian vegetation of the agricultural landscape, whereas others were only observed in less impacted habitats dominated by native plants. These results suggest that acclimation to novel habitats depends on larval host plant use. The traditional agricultural environment can provide habitat for many, but not all, native butterfly species, but an estimation of the value of these habitats requires better understanding of butterfly life-history strategies and relationships with host plants.

  16. Habitat Re-Creation (Ecological Restoration) as a Strategy for Conserving Insect Communities in Highly Fragmented Landscapes (United States)

    Shuey, John A.


    Because of their vast diversity, measured by both numbers of species as well as life history traits, insects defy comprehensive conservation planning. Thus, almost all insect conservation efforts target individual species. However, serious insect conservation requires goals that are set at the faunal level and conservation success requires strategies that conserve intact communities. This task is complicated in agricultural landscapes by high levels of habitat fragmentation and isolation. In many regions, once widespread insect communities are now functionally trapped on islands of ecosystem remnants and subject to a variety of stressors associated with isolation, small population sizes and artificial population fragmentation. In fragmented landscapes ecological restoration can be an effective strategy for reducing localized insect extinction rates, but insects are seldom included in restoration design criteria. It is possible to incorporate a few simple conservation criteria into restoration designs that enhance impacts to entire insect communities. Restoration can be used as a strategy to address fragmentation threats to isolated insect communities if insect communities are incorporated at the onset of restoration planning. Fully incorporating insect communities into restoration designs may increase the cost of restoration two- to three-fold, but the benefits to biodiversity conservation and the ecological services provided by intact insect communities justify the cost. PMID:26462535

  17. The importance of incorporating functional habitats into conservation planning for highly mobile species in dynamic systems. (United States)

    Webb, Matthew H; Terauds, Aleks; Tulloch, Ayesha; Bell, Phil; Stojanovic, Dejan; Heinsohn, Robert


    The distribution of mobile species in dynamic systems can vary greatly over time and space. Estimating their population size and geographic range can be problematic and affect the accuracy of conservation assessments. Scarce data on mobile species and the resources they need can also limit the type of analytical approaches available to derive such estimates. We quantified change in availability and use of key ecological resources required for breeding for a critically endangered nomadic habitat specialist, the Swift Parrot (Lathamus discolor). We compared estimates of occupied habitat derived from dynamic presence-background (i.e., presence-only data) climatic models with estimates derived from dynamic occupancy models that included a direct measure of food availability. We then compared estimates that incorporate fine-resolution spatial data on the availability of key ecological resources (i.e., functional habitats) with more common approaches that focus on broader climatic suitability or vegetation cover (due to the absence of fine-resolution data). The occupancy models produced significantly (P < 0.001) smaller (up to an order of magnitude) and more spatially discrete estimates of the total occupied area than climate-based models. The spatial location and extent of the total area occupied with the occupancy models was highly variable between years (131 and 1498 km2 ). Estimates accounting for the area of functional habitats were significantly smaller (2-58% [SD 16]) than estimates based only on the total area occupied. An increase or decrease in the area of one functional habitat (foraging or nesting) did not necessarily correspond to an increase or decrease in the other. Thus, an increase in the extent of occupied area may not equate to improved habitat quality or function. We argue these patterns are typical for mobile resource specialists but often go unnoticed because of limited data over relevant spatial and temporal scales and lack of spatial data on the

  18. Highly conserved Z and molecularly diverged W chromosomes in the fish genus Triportheus (Characiformes, Triportheidae). (United States)

    Yano, C F; Bertollo, L A C; Ezaz, T; Trifonov, V; Sember, A; Liehr, T; Cioffi, M B


    The main objectives of this study were to test: (1) whether the W-chromosome differentiation matches to species' evolutionary divergence (phylogenetic concordance) and (2) whether sex chromosomes share a common ancestor within a congeneric group. The monophyletic genus Triportheus (Characiformes, Triportheidae) was the model group for this study. All species in this genus so far analyzed have ZW sex chromosome system, where the Z is always the largest chromosome of the karyotype, whereas the W chromosome is highly variable ranging from almost homomorphic to highly heteromorphic. We applied conventional and molecular cytogenetic approaches including C-banding, ribosomal DNA mapping, comparative genomic hybridization (CGH) and cross-species whole chromosome painting (WCP) to test our questions. We developed Z- and W-chromosome paints from T. auritus for cross-species WCP and performed CGH in a representative species (T. signatus) to decipher level of homologies and rates of differentiation of W chromosomes. Our study revealed that the ZW sex chromosome system had a common origin, showing highly conserved Z chromosomes and remarkably divergent W chromosomes. Notably, the W chromosomes have evolved to different shapes and sequence contents within ~15-25 Myr of divergence time. Such differentiation highlights a dynamic process of W-chromosome evolution within congeneric species of Triportheus.

  19. Silencing Effect of Hominoid Highly Conserved Noncoding Sequences on Embryonic Brain Development (United States)

    Mahmoudi Saber, Morteza


    Abstract Superfamily Hominoidea, which consists of Hominidae (humans and great apes) and Hylobatidae (gibbons), is well-known for sharing human-like characteristics, however, the genomic origins of these shared unique phenotypes have mainly remained elusive. To decipher the underlying genomic basis of Hominoidea-restricted phenotypes, we identified and characterized Hominoidea-restricted highly conserved noncoding sequences (HCNSs) that are a class of potential regulatory elements which may be involved in evolution of lineage-specific phenotypes. We discovered 679 such HCNSs from human, chimpanzee, gorilla, orangutan and gibbon genomes. These HCNSs were demonstrated to be under purifying selection but with lineage-restricted characteristics different from old CNSs. A significant proportion of their ancestral sequences had accelerated rates of nucleotide substitutions, insertions and deletions during the evolution of common ancestor of Hominoidea, suggesting the intervention of positive Darwinian selection for creating those HCNSs. In contrary to enhancer elements and similar to silencer sequences, these Hominoidea-restricted HCNSs are located in close proximity of transcription start sites. Their target genes are enriched in the nervous system, development and transcription, and they tend to be remotely located from the nearest coding gene. Chip-seq signals and gene expression patterns suggest that Hominoidea-restricted HCNSs are likely to be functional regulatory elements by imposing silencing effects on their target genes in a tissue-restricted manner during fetal brain development. These HCNSs, emerged through adaptive evolution and conserved through purifying selection, represent a set of promising targets for future functional studies of the evolution of Hominoidea-restricted phenotypes. PMID:28633494

  20. Protection of the Queuosine Biosynthesis Enzyme QueF from Irreversible Oxidation by a Conserved Intramolecular Disulfide

    Directory of Open Access Journals (Sweden)

    Adeba Mohammad


    Full Text Available QueF enzymes catalyze the nicotinamide adenine dinucleotide phosphate (NADPH-dependent reduction of the nitrile group of 7-cyano-7-deazaguanine (preQ0 to 7-aminomethyl-7-deazaguanine (preQ1 in the biosynthetic pathway to the tRNA modified nucleoside queuosine. The QueF-catalyzed reaction includes formation of a covalent thioimide intermediate with a conserved active site cysteine that is prone to oxidation in vivo. Here, we report the crystal structure of a mutant of Bacillus subtilis QueF, which reveals an unanticipated intramolecular disulfide formed between the catalytic Cys55 and a conserved Cys99 located near the active site. This structure is more symmetric than the substrate-bound structure and exhibits major rearrangement of the loops responsible for substrate binding. Mutation of Cys99 to Ala/Ser does not compromise enzyme activity, indicating that the disulfide does not play a catalytic role. Peroxide-induced inactivation of the wild-type enzyme is reversible with thioredoxin, while such inactivation of the Cys99Ala/Ser mutants is irreversible, consistent with protection of Cys55 from irreversible oxidation by disulfide formation with Cys99. Conservation of the cysteine pair, and the reported in vivo interaction of QueF with the thioredoxin-like hydroperoxide reductase AhpC in Escherichia coli suggest that regulation by the thioredoxin disulfide-thiol exchange system may constitute a general mechanism for protection of QueF from oxidative stress in vivo.

  1. High School Biology Teachers' Use of Wildlife Conservation Magazines in the Classroom. (United States)

    Chipman, Elizabeth; Brody, Michael


    Reports a survey of practicing biology teachers in the State of Maine and their use of conservation magazines, in particular, "Maine Fish and Wildlife Magazine," in their classrooms. Results indicate that 30% of the responding teachers use conservation magazines. Common uses include reporting research, discussing ethical issues, and…

  2. Swertia chirayta, a Threatened High-Value Medicinal Herb: Microhabitats and Conservation Challenges in Sikkim Himalaya, India

    Directory of Open Access Journals (Sweden)

    Bharat Kumar Pradhan


    Full Text Available Assessing the impact of threats, identifying favorable growing conditions, and predicting future population scenarios are vital for the conservation and management of threatened species. This study investigated the availability, microhabitat characteristics, threat status, and community associations of Swertia chirayta, a highly threatened Himalayan medicinal herb, in 22 populations in Sikkim, India, using the vertical belt transect method. Of the 14 microhabitats identified, open grassy slope emerged as the most favorable and wet grassy slope as the least favorable for S. chirayta. The species was dominant in 8 of the 10 major plant communities identified. Among 9 major types of disturbance identified, human movement and collection of non-timber forest products appeared as the biggest threats to S. chirayta. Disturbances significantly affected the availability of the species. S. chirayta, though under high anthropogenic threat, maintains high microhabitat pliability, which is vital for its conservation and management, provided immediate conservation measures are taken.

  3. High severity fire in forests of the southwest: Conservation implications. Progress Report August 2005 (United States)

    Haire, Sandra L.


    The occurrence of large, severe fires in southwestern ponderosa pine (Pinus ponderosa) forests has resulted in concern that these forests may not persist under such an extreme disturbance regime. In our research, we are examining the outcomes of high-severity fire in ponderosa pine forests and their neighboring communities across an elevational gradient. One goal of our work is to contribute to understanding the resiliency of these systems, but we also want to investigate the conservation values intrinsic to the diverse communities that represent alternative successional trajectories after severe fire. One assumption of our research is that the spatial pattern of a disturbance becomes increasingly important when the disturbance is large and biological legacies are few and sparse. We ask, therefore, what spectrum of plant communities results from high severity fire, and what is their relationship to spatial patterns of severity mapped in early post fire timeframes? Also, do spatial patterns of older burns (1950–80) differ from recent burns (1998–present) in ways that make us expect successional changes years from now to differ from those we observed at our older burn field sites?

  4. Comparative genomics of Burkholderia multivorans, a ubiquitous pathogen with a highly conserved genomic structure.

    Directory of Open Access Journals (Sweden)

    Charlotte Peeters

    Full Text Available The natural environment serves as a reservoir of opportunistic pathogens. A well-established method for studying the epidemiology of such opportunists is multilocus sequence typing, which in many cases has defined strains predisposed to causing infection. Burkholderia multivorans is an important pathogen in people with cystic fibrosis (CF and its epidemiology suggests that strains are acquired from non-human sources such as the natural environment. This raises the central question of whether the isolation source (CF or environment or the multilocus sequence type (ST of B. multivorans better predicts their genomic content and functionality. We identified four pairs of B. multivorans isolates, representing distinct STs and consisting of one CF and one environmental isolate each. All genomes were sequenced using the PacBio SMRT sequencing technology, which resulted in eight high-quality B. multivorans genome assemblies. The present study demonstrated that the genomic structure of the examined B. multivorans STs is highly conserved and that the B. multivorans genomic lineages are defined by their ST. Orthologous protein families were not uniformly distributed among chromosomes, with core orthologs being enriched on the primary chromosome and ST-specific orthologs being enriched on the second and third chromosome. The ST-specific orthologs were enriched in genes involved in defense mechanisms and secondary metabolism, corroborating the strain-specificity of these virulence characteristics. Finally, the same B. multivorans genomic lineages occur in both CF and environmental samples and on different continents, demonstrating their ubiquity and evolutionary persistence.

  5. The highly conserved MraZ protein is a transcriptional regulator in Escherichia coli

    Energy Technology Data Exchange (ETDEWEB)

    Eraso, Jesus M.; Markillie, Lye Meng; Mitchell, Hugh D.; Taylor, Ronald C.; Orr, Galya; Margolin, William


    The mraZ and mraW genes are highly conserved in bacteria, both in sequence and location at the head of the division and cell wall (dcw) gene cluster. Although MraZ has structural similarity to the AbrB transition state regulator and the MazE antitoxin, and MraW is known to methylate ribosomal RNA, mraZ and mraW null mutants have no detectable growth phenotype in any species tested to date, hampering progress in understanding their physiological role. Here we show that overproduction of Escherichia coli MraZ perturbs cell division and the cell envelope, is more lethal at high levels or in minimal growth medium, and that MraW antagonizes these effects. MraZGFP localizes to the nucleoid, suggesting that it binds DNA. Indeed, purified MraZ directly binds a region upstream from its own promoter containing three direct repeats to regulate its own expression and that of downstream cell division and cell wall genes. MraZ-LacZ fusions are repressed by excess MraZ but not when DNA binding by MraZ is inhibited. RNAseq analysis indicates that MraZ is a global transcriptional regulator with numerous targets in addition to dcw genes. One of these targets, mioC, is directly bound by MraZ in a region with three direct repeats.

  6. Comparative genomics of Burkholderia multivorans, a ubiquitous pathogen with a highly conserved genomic structure. (United States)

    Peeters, Charlotte; Cooper, Vaughn S; Hatcher, Philip J; Verheyde, Bart; Carlier, Aurélien; Vandamme, Peter


    The natural environment serves as a reservoir of opportunistic pathogens. A well-established method for studying the epidemiology of such opportunists is multilocus sequence typing, which in many cases has defined strains predisposed to causing infection. Burkholderia multivorans is an important pathogen in people with cystic fibrosis (CF) and its epidemiology suggests that strains are acquired from non-human sources such as the natural environment. This raises the central question of whether the isolation source (CF or environment) or the multilocus sequence type (ST) of B. multivorans better predicts their genomic content and functionality. We identified four pairs of B. multivorans isolates, representing distinct STs and consisting of one CF and one environmental isolate each. All genomes were sequenced using the PacBio SMRT sequencing technology, which resulted in eight high-quality B. multivorans genome assemblies. The present study demonstrated that the genomic structure of the examined B. multivorans STs is highly conserved and that the B. multivorans genomic lineages are defined by their ST. Orthologous protein families were not uniformly distributed among chromosomes, with core orthologs being enriched on the primary chromosome and ST-specific orthologs being enriched on the second and third chromosome. The ST-specific orthologs were enriched in genes involved in defense mechanisms and secondary metabolism, corroborating the strain-specificity of these virulence characteristics. Finally, the same B. multivorans genomic lineages occur in both CF and environmental samples and on different continents, demonstrating their ubiquity and evolutionary persistence.

  7. Acacia shrubs respond positively to high severity wildfire: Implications for conservation and fuel hazard management. (United States)

    Gordon, Christopher E; Price, Owen F; Tasker, Elizabeth M; Denham, Andrew J


    High severity wildfires pose threats to human assets, but are also perceived to impact vegetation communities because a small number of species may become dominant immediately after fire. However there are considerable gaps in our knowledge about species-specific responses of plants to different fire severities, and how this influences fuel hazard in the short and long-term. Here we conduct a floristic survey at sites before and two years after a wildfire of unprecedented size and severity in the Warrumbungle National Park (Australia) to explore relationships between post-fire growth of a fire responsive shrub genera (Acacia), total mid-story vegetation cover, fire severity and fuel hazard. We then survey 129 plots surrounding the park to assess relationships between mid-story vegetation cover and time-since-fire. Acacia species richness and cover were 2.3 and 4.3 times greater at plots after than before the fire. However the same common dominant species were present throughout the study. Mid-story vegetation cover was 1.5 times greater after than before the wildfire, and Acacia species contribution to mid-story cover increased from 10 to 40%. Acacia species richness was not affected by fire severity, however strong positive associations were observed between Acacia and total mid-story vegetation cover and severity. Our analysis of mid-story vegetation recovery showed that cover was similarly high between 2 and 30years post-fire, then decreased until 52years. Collectively, our results suggest that Acacia species are extremely resilient to high severity wildfire and drive short to mid-term increases in fuel hazard. Our results are discussed in relation to fire regime management from the twin perspectives of conserving biodiversity and mitigating human losses due to wildfire. Copyright © 2016 Elsevier B.V. All rights reserved.

  8. Novel efficient genome-wide SNP panels for the conservation of the highly endangered Iberian lynx. (United States)

    Kleinman-Ruiz, Daniel; Martínez-Cruz, Begoña; Soriano, Laura; Lucena-Perez, Maria; Cruz, Fernando; Villanueva, Beatriz; Fernández, Jesús; Godoy, José A


    The Iberian lynx (Lynx pardinus) has been acknowledged as the most endangered felid species in the world. An intense contraction and fragmentation during the twentieth century left less than 100 individuals split in two isolated and genetically eroded populations by 2002. Genetic monitoring and management so far have been based on 36 STRs, but their limited variability and the more complex situation of current populations demand more efficient molecular markers. The recent characterization of the Iberian lynx genome identified more than 1.6 million SNPs, of which 1536 were selected and genotyped in an extended Iberian lynx sample. We validated 1492 SNPs and analysed their heterozygosity, Hardy-Weinberg equilibrium, and linkage disequilibrium. We then selected a panel of 343 minimally linked autosomal SNPs from which we extracted subsets optimized for four different typical tasks in conservation applications: individual identification, parentage assignment, relatedness estimation, and admixture classification, and compared their power to currently used STR panels. We ascribed 21 SNPs to chromosome X based on their segregation patterns, and identified one additional marker that showed significant differentiation between sexes. For all applications considered, panels of autosomal SNPs showed higher power than the currently used STR set with only a very modest increase in the number of markers. These novel panels of highly informative genome-wide SNPs provide more powerful, efficient, and flexible tools for the genetic management and non-invasive monitoring of Iberian lynx populations. This example highlights an important outcome of whole-genome studies in genetically threatened species.

  9. High Connectivity of the Crocodile Shark between the Atlantic and Southwest Indian Oceans: Highlights for Conservation (United States)

    da Silva Ferrette, Bruno Lopes; Mendonça, Fernando Fernandes; Coelho, Rui; de Oliveira, Paulo Guilherme Vasconcelos; Hazin, Fábio Hissa Vieira; Romanov, Evgeny V.; Oliveira, Claudio; Santos, Miguel Neves; Foresti, Fausto


    Among the various shark species that are captured as bycatch in commercial fishing operations, the group of pelagic sharks is still one of the least studied and known. Within those, the crocodile shark, Pseudocarcharias kamoharai, a small-sized lamnid shark, is occasionally caught by longline vessels in certain regions of the tropical oceans worldwide. However, the population dynamics of this species, as well as the impact of fishing mortality on its stocks, are still unknown, with the crocodile shark currently one of the least studied of all pelagic sharks. Given this, the present study aimed to assess the population structure of P. kamoharai in several regions of the Atlantic and Indian Oceans using genetic molecular markers. The nucleotide composition of the mitochondrial DNA control region of 255 individuals was analyzed, and 31 haplotypes were found, with an estimated diversity Hd = 0.627, and a nucleotide diversity π = 0.00167. An analysis of molecular variance (AMOVA) revealed a fixation index ΦST = -0.01118, representing an absence of population structure among the sampled regions of the Atlantic Ocean, and between the Atlantic and Indian Oceans. These results show a high degree of gene flow between the studied areas, with a single genetic stock and reduced population variability. In panmictic populations, conservation efforts can be concentrated in more restricted areas, being these representative of the total biodiversity of the species. When necessary, this strategy could be applied to the genetic maintenance of P. kamoharai. PMID:25689742

  10. Highly conserved D-loop-like nuclear mitochondrial sequences (Numts) in tiger (Panthera tigris). (United States)

    Zhang, Wenping; Zhang, Zhihe; Shen, Fujun; Hou, Rong; Lv, Xiaoping; Yue, Bisong


    Using oligonucleotide primers designed to match hypervariable segments I (HVS-1) of Panthera tigris mitochondrial DNA (mtDNA), we amplified two different PCR products (500 bp and 287 bp) in the tiger (Panthera tigris), but got only one PCR product (287 bp) in the leopard (Panthera pardus). Sequence analyses indicated that the sequence of 287 bp was a D-loop-like nuclear mitochondrial sequence (Numts), indicating a nuclear transfer that occurred approximately 4.8-17 million years ago in the tiger and 4.6-16 million years ago in the leopard. Although the mtDNA D-loop sequence has a rapid rate of evolution, the 287-bp Numts are highly conserved; they are nearly identical in tiger subspecies and only 1.742% different between tiger and leopard. Thus, such sequences represent molecular 'fossils' that can shed light on evolution of the mitochondrial genome and may be the most appropriate outgroup for phylogenetic analysis. This is also proved by comparing the phylogenetic trees reconstructed using the D-loop sequence of snow leopard and the 287-bp Numts as outgroup.

  11. A highly conserved metalloprotease effector enhances virulence in the maize anthracnose fungus Colletotrichum graminicola. (United States)

    Sanz-Martín, José M; Pacheco-Arjona, José Ramón; Bello-Rico, Víctor; Vargas, Walter A; Monod, Michel; Díaz-Mínguez, José M; Thon, Michael R; Sukno, Serenella A


    Colletotrichum graminicola causes maize anthracnose, an agronomically important disease with a worldwide distribution. We have identified a fungalysin metalloprotease (Cgfl) with a role in virulence. Transcriptional profiling experiments and live cell imaging show that Cgfl is specifically expressed during the biotrophic stage of infection. To determine whether Cgfl has a role in virulence, we obtained null mutants lacking Cgfl and performed pathogenicity and live microscopy assays. The appressorium morphology of the null mutants is normal, but they exhibit delayed development during the infection process on maize leaves and roots, showing that Cgfl has a role in virulence. In vitro chitinase activity assays of leaves infected with wild-type and null mutant strains show that, in the absence of Cgfl, maize leaves exhibit increased chitinase activity. Phylogenetic analyses show that Cgfl is highly conserved in fungi. Similarity searches, phylogenetic analysis and transcriptional profiling show that C. graminicola encodes two LysM domain-containing homologues of Ecp6, suggesting that this fungus employs both Cgfl-mediated and LysM protein-mediated strategies to control chitin signalling. © 2015 BSPP and John Wiley & Sons Ltd.

  12. A dominant EV71-specific CD4+ T cell epitope is highly conserved among human enteroviruses.

    Directory of Open Access Journals (Sweden)

    Ruicheng Wei

    Full Text Available CD4+ T cell-mediated immunity plays a central role in determining the immunopathogenesis of viral infections. However, the role of CD4+ T cells in EV71 infection, which causes hand, foot and mouth disease (HFMD, has yet to be elucidated. We applied a sophisticated method to identify promiscuous CD4+ T cell epitopes contained within the sequence of the EV71 polyprotein. Fifteen epitopes were identified, and three of them are dominant ones. The most dominant epitope is highly conserved among enterovirus species, including HFMD-related coxsackieviruses, HFMD-unrelated echoviruses and polioviruses. Furthermore, the CD4+ T cells specific to the epitope indeed cross-reacted with the homolog of poliovirus 3 Sabin. Our findings imply that CD4+ T cell responses to poliovirus following vaccination, or to other enteroviruses to which individuals may be exposed in early childhood, may have a modulating effect on subsequent CD4+ T cell response to EV71 infection or vaccine.

  13. High connectivity of the crocodile shark between the Atlantic and Southwest Indian Oceans: highlights for conservation.

    Directory of Open Access Journals (Sweden)

    Bruno Lopes da Silva Ferrette

    Full Text Available Among the various shark species that are captured as bycatch in commercial fishing operations, the group of pelagic sharks is still one of the least studied and known. Within those, the crocodile shark, Pseudocarcharias kamoharai, a small-sized lamnid shark, is occasionally caught by longline vessels in certain regions of the tropical oceans worldwide. However, the population dynamics of this species, as well as the impact of fishing mortality on its stocks, are still unknown, with the crocodile shark currently one of the least studied of all pelagic sharks. Given this, the present study aimed to assess the population structure of P. kamoharai in several regions of the Atlantic and Indian Oceans using genetic molecular markers. The nucleotide composition of the mitochondrial DNA control region of 255 individuals was analyzed, and 31 haplotypes were found, with an estimated diversity Hd = 0.627, and a nucleotide diversity π = 0.00167. An analysis of molecular variance (AMOVA revealed a fixation index ΦST = -0.01118, representing an absence of population structure among the sampled regions of the Atlantic Ocean, and between the Atlantic and Indian Oceans. These results show a high degree of gene flow between the studied areas, with a single genetic stock and reduced population variability. In panmictic populations, conservation efforts can be concentrated in more restricted areas, being these representative of the total biodiversity of the species. When necessary, this strategy could be applied to the genetic maintenance of P. kamoharai.

  14. Specific binding of eukaryotic ORC to DNA replication origins depends on highly conserved basic residues. (United States)

    Kawakami, Hironori; Ohashi, Eiji; Kanamoto, Shota; Tsurimoto, Toshiki; Katayama, Tsutomu


    In eukaryotes, the origin recognition complex (ORC) heterohexamer preferentially binds replication origins to trigger initiation of DNA replication. Crystallographic studies using eubacterial and archaeal ORC orthologs suggested that eukaryotic ORC may bind to origin DNA via putative winged-helix DNA-binding domains and AAA+ ATPase domains. However, the mechanisms how eukaryotic ORC recognizes origin DNA remain elusive. Here, we show in budding yeast that Lys-362 and Arg-367 residues of the largest subunit (Orc1), both outside the aforementioned domains, are crucial for specific binding of ORC to origin DNA. These basic residues, which reside in a putative disordered domain, were dispensable for interaction with ATP and non-specific DNA sequences, suggesting a specific role in recognition. Consistent with this, both residues were required for origin binding of Orc1 in vivo. A truncated Orc1 polypeptide containing these residues solely recognizes ARS sequence with low affinity and Arg-367 residue stimulates sequence specific binding mode of the polypeptide. Lys-362 and Arg-367 residues of Orc1 are highly conserved among eukaryotic ORCs, but not in eubacterial and archaeal orthologs, suggesting a eukaryote-specific mechanism underlying recognition of replication origins by ORC.

  15. Homoeologous chromosomes of Xenopus laevis are highly conserved after whole-genome duplication. (United States)

    Uno, Y; Nishida, C; Takagi, C; Ueno, N; Matsuda, Y


    It has been suggested that whole-genome duplication (WGD) occurred twice during the evolutionary process of vertebrates around 450 and 500 million years ago, which contributed to an increase in the genomic and phenotypic complexities of vertebrates. However, little is still known about the evolutionary process of homoeologous chromosomes after WGD because many duplicate genes have been lost. Therefore, Xenopus laevis (2n=36) and Xenopus (Silurana) tropicalis (2n=20) are good animal models for studying the process of genomic and chromosomal reorganization after WGD because X. laevis is an allotetraploid species that resulted from WGD after the interspecific hybridization of diploid species closely related to X. tropicalis. We constructed a comparative cytogenetic map of X. laevis using 60 complimentary DNA clones that covered the entire chromosomal regions of 10 pairs of X. tropicalis chromosomes. We consequently identified all nine homoeologous chromosome groups of X. laevis. Hybridization signals on two pairs of X. laevis homoeologous chromosomes were detected for 50 of 60 (83%) genes, and the genetic linkage is highly conserved between X. tropicalis and X. laevis chromosomes except for one fusion and one inversion and also between X. laevis homoeologous chromosomes except for two inversions. These results indicate that the loss of duplicated genes and inter- and/or intrachromosomal rearrangements occurred much less frequently in this lineage, suggesting that these events were not essential for diploidization of the allotetraploid genome in X. laevis after WGD.

  16. A Highly Conserved Bacterial D-Serine Uptake System Links Host Metabolism and Virulence.

    Directory of Open Access Journals (Sweden)

    James P R Connolly


    Full Text Available The ability of any organism to sense and respond to challenges presented in the environment is critically important for promoting or restricting colonization of specific sites. Recent work has demonstrated that the host metabolite D-serine has the ability to markedly influence the outcome of infection by repressing the type III secretion system of enterohaemorrhagic Escherichia coli (EHEC in a concentration-dependent manner. However, exactly how EHEC monitors environmental D-serine is not understood. In this work, we have identified two highly conserved members of the E. coli core genome, encoding an inner membrane transporter and a transcriptional regulator, which collectively help to "sense" levels of D-serine by regulating its uptake from the environment and in turn influencing global gene expression. Both proteins are required for full expression of the type III secretion system and diversely regulated prophage-encoded effector proteins demonstrating an important infection-relevant adaptation of the core genome. We propose that this system acts as a key safety net, sampling the environment for this metabolite, thereby promoting colonization of EHEC to favorable sites within the host.

  17. High qualitative and quantitative conservation of alternative splicing in Caenorhabditis elegans and Caenorhabditis briggsae

    DEFF Research Database (Denmark)

    Rukov, Jakob Lewin; Irimia, Manuel; Mørk, Søren


    Alternative splicing (AS) is an important contributor to proteome diversity and is regarded as an explanatory factor for the relatively low number of human genes compared with less complex animals. To assess the evolutionary conservation of AS and its developmental regulation, we have investigated...... the qualitative and quantitative expression of 21 orthologous alternative splice events through the development of 2 nematode species separated by 85-110 Myr of evolutionary time. We demonstrate that most of these alternative splice events present in Caenorhabditis elegans are conserved in Caenorhabditis briggsae...... mechanisms controlling AS are to a large extent conserved during the evolution of Caenorhabditis. This strong conservation indicates that both major and minor splice forms have important functional roles and that the relative quantities in which they are expressed are crucial. Our results therefore suggest...

  18. Design of ecoregional monitoring in conservation areas of high-latitude ecosystems under contemporary climate change (United States)

    Beever, Erik A.; Woodward, Andrea


    Land ownership in Alaska includes a mosaic of federally managed units. Within its agency’s context, each unit has its own management strategy, authority, and resources of conservation concern, many of which are migratory animals. Though some units are geographically isolated, many are nevertheless linked by paths of abiotic and biotic flows, such as rivers, air masses, flyways, and terrestrial and aquatic migration routes. Furthermore, individual land units exist within the context of a larger landscape pattern of shifting conditions, requiring managers to understand at larger spatial scales the status and trends in the synchrony and spatial concurrence of species and associated suitable habitats. Results of these changes will determine the ability of Alaska lands to continue to: provide habitat for local and migratory species; absorb species whose ranges are shifting northward; and experience mitigation or exacerbation of climate change through positive and negative atmospheric feedbacks. We discuss the geographic and statutory contexts that influence development of ecological monitoring; argue for the inclusion of significant amounts of broad-scale monitoring; discuss the importance of defining clear programmatic and monitoring objectives; and draw from lessons learned from existing long-term, broad-scale monitoring programs to apply to the specific contexts relevant to high-latitude protected areas such as those in Alaska. Such areas are distinguished by their: marked seasonality; relatively large magnitudes of contemporary change in climatic parameters; and relative inaccessibility due to broad spatial extent, very low (or zero) road density, and steep and glaciated areas. For ecological monitoring to effectively support management decisions in high-latitude areas such as Alaska, a monitoring program ideally would be structured to address the actual spatial and temporal scales of relevant processes, rather than the artificial boundaries of individual land

  19. High risks of losing genetic diversity in an endemic Mauritian gecko: implications for conservation. (United States)

    Buckland, Steeves; Cole, Nik C; Groombridge, Jim J; Küpper, Clemens; Burke, Terry; Dawson, Deborah A; Gallagher, Laura E; Harris, Stephen


    Genetic structure can be a consequence of recent population fragmentation and isolation, or a remnant of historical localised adaptation. This poses a challenge for conservationists since misinterpreting patterns of genetic structure may lead to inappropriate management. Of 17 species of reptile originally found in Mauritius, only five survive on the main island. One of these, Phelsuma guimbeaui (lowland forest day gecko), is now restricted to 30 small isolated subpopulations following severe forest fragmentation and isolation due to human colonisation. We used 20 microsatellites in ten subpopulations and two mitochondrial DNA (mtDNA) markers in 13 subpopulations to: (i) assess genetic diversity, population structure and genetic differentiation of subpopulations; (ii) estimate effective population sizes and migration rates of subpopulations; and (iii) examine the phylogenetic relationships of haplotypes found in different subpopulations. Microsatellite data revealed significant population structure with high levels of genetic diversity and isolation by distance, substantial genetic differentiation and no migration between most subpopulations. MtDNA, however, showed no evidence of population structure, indicating that there was once a genetically panmictic population. Effective population sizes of ten subpopulations, based on microsatellite markers, were small, ranging from 44 to 167. Simulations suggested that the chance of survival and allelic diversity of some subpopulations will decrease dramatically over the next 50 years if no migration occurs. Our DNA-based evidence reveals an urgent need for a management plan for the conservation of P. guimbeaui. We identified 18 threatened and 12 viable subpopulations and discuss a range of management options that include translocation of threatened subpopulations to retain maximum allelic diversity, and habitat restoration and assisted migration to decrease genetic erosion and inbreeding for the viable subpopulations.

  20. Alternative splicing modulated by genetic variants demonstrates accelerated evolution regulated by highly conserved proteins. (United States)

    Hsiao, Yun-Hua Esther; Bahn, Jae Hoon; Lin, Xianzhi; Chan, Tak-Ming; Wang, Rena; Xiao, Xinshu


    Identification of functional genetic variants and elucidation of their regulatory mechanisms represent significant challenges of the post-genomic era. A poorly understood topic is the involvement of genetic variants in mediating post-transcriptional RNA processing, including alternative splicing. Thus far, little is known about the genomic, evolutionary, and regulatory features of genetically modulated alternative splicing (GMAS). Here, we systematically identified intronic tag variants for genetic modulation of alternative splicing using RNA-seq data specific to cellular compartments. Combined with our previous method that identifies exonic tags for GMAS, this study yielded 622 GMAS exons. We observed that GMAS events are highly cell type independent, indicating that splicing-altering genetic variants could have widespread function across cell types. Interestingly, GMAS genes, exons, and single-nucleotide variants (SNVs) all demonstrated positive selection or accelerated evolution in primates. We predicted that GMAS SNVs often alter binding of splicing factors, with SRSF1 affecting the most GMAS events and demonstrating global allelic binding bias. However, in contrast to their GMAS targets, the predicted splicing factors are more conserved than expected, suggesting that cis-regulatory variation is the major driving force of splicing evolution. Moreover, GMAS-related splicing factors had stronger consensus motifs than expected, consistent with their susceptibility to SNV disruption. Intriguingly, GMAS SNVs in general do not alter the strongest consensus position of the splicing factor motif, except the more than 100 GMAS SNVs in linkage disequilibrium with polymorphisms reported by genome-wide association studies. Our study reports many GMAS events and enables a better understanding of the evolutionary and regulatory features of this phenomenon. © 2016 Hsiao et al.; Published by Cold Spring Harbor Laboratory Press.

  1. High risks of losing genetic diversity in an endemic Mauritian gecko: implications for conservation.

    Directory of Open Access Journals (Sweden)

    Steeves Buckland

    Full Text Available Genetic structure can be a consequence of recent population fragmentation and isolation, or a remnant of historical localised adaptation. This poses a challenge for conservationists since misinterpreting patterns of genetic structure may lead to inappropriate management. Of 17 species of reptile originally found in Mauritius, only five survive on the main island. One of these, Phelsuma guimbeaui (lowland forest day gecko, is now restricted to 30 small isolated subpopulations following severe forest fragmentation and isolation due to human colonisation. We used 20 microsatellites in ten subpopulations and two mitochondrial DNA (mtDNA markers in 13 subpopulations to: (i assess genetic diversity, population structure and genetic differentiation of subpopulations; (ii estimate effective population sizes and migration rates of subpopulations; and (iii examine the phylogenetic relationships of haplotypes found in different subpopulations. Microsatellite data revealed significant population structure with high levels of genetic diversity and isolation by distance, substantial genetic differentiation and no migration between most subpopulations. MtDNA, however, showed no evidence of population structure, indicating that there was once a genetically panmictic population. Effective population sizes of ten subpopulations, based on microsatellite markers, were small, ranging from 44 to 167. Simulations suggested that the chance of survival and allelic diversity of some subpopulations will decrease dramatically over the next 50 years if no migration occurs. Our DNA-based evidence reveals an urgent need for a management plan for the conservation of P. guimbeaui. We identified 18 threatened and 12 viable subpopulations and discuss a range of management options that include translocation of threatened subpopulations to retain maximum allelic diversity, and habitat restoration and assisted migration to decrease genetic erosion and inbreeding for the viable

  2. RNA expression in a cartilaginous fish cell line reveals ancient 3' noncoding regions highly conserved in vertebrates. (United States)

    Forest, David; Nishikawa, Ryuhei; Kobayashi, Hiroshi; Parton, Angela; Bayne, Christopher J; Barnes, David W


    We have established a cartilaginous fish cell line [Squalus acanthias embryo cell line (SAE)], a mesenchymal stem cell line derived from the embryo of an elasmobranch, the spiny dogfish shark S. acanthias. Elasmobranchs (sharks and rays) first appeared >400 million years ago, and existing species provide useful models for comparative vertebrate cell biology, physiology, and genomics. Comparative vertebrate genomics among evolutionarily distant organisms can provide sequence conservation information that facilitates identification of critical coding and noncoding regions. Although these genomic analyses are informative, experimental verification of functions of genomic sequences depends heavily on cell culture approaches. Using ESTs defining mRNAs derived from the SAE cell line, we identified lengthy and highly conserved gene-specific nucleotide sequences in the noncoding 3' UTRs of eight genes involved in the regulation of cell growth and proliferation. Conserved noncoding 3' mRNA regions detected by using the shark nucleotide sequences as a starting point were found in a range of other vertebrate orders, including bony fish, birds, amphibians, and mammals. Nucleotide identity of shark and human in these regions was remarkably well conserved. Our results indicate that highly conserved gene sequences dating from the appearance of jawed vertebrates and representing potential cis-regulatory elements can be identified through the use of cartilaginous fish as a baseline. Because the expression of genes in the SAE cell line was prerequisite for their identification, this cartilaginous fish culture system also provides a physiologically valid tool to test functional hypotheses on the role of these ancient conserved sequences in comparative cell biology.

  3. A Highly Conserved Residue in HIV-1 Nef Alpha Helix 2 Modulates Protein Expression. (United States)

    Johnson, Aaron L; Dirk, Brennan S; Coutu, Mathieu; Haeryfar, S M Mansour; Arts, Eric J; Finzi, Andrés; Dikeakos, Jimmy D


    Extensive genetic diversity is a defining characteristic of human immunodeficiency virus type 1 (HIV-1) and poses a significant barrier to the development of an effective vaccine. To better understand the impact of this genetic diversity on the HIV-1 pathogenic factor Nef, we compiled a panel of reference strains from the NIH Los Alamos HIV Database. Initial sequence analysis identified point mutations at Nef residues 13, 84, and 92 in subtype C reference strain C.BR92025 from Brazil. Functional analysis revealed impaired major histocompatibility complex class I and CD4 downregulation of strain C.BR92025 Nef, which corresponded to decreased protein expression. Metabolic labeling demonstrated that strain C.BR92025 Nef has a greater rate of protein turnover than subtype B reference strain B.JRFL that, on the basis of mutational analysis, is related to Nef residue A84. An alanine-to-valine substitution at position 84, located in alpha helix 2 of Nef, was sufficient to alter the rate of turnover of an otherwise highly expressed Nef protein. In conclusion, these findings highlight HIV-1 Nef residue A84 as a major determinant of protein expression that may offer an additional avenue to disrupt or mediate the effects of this key HIV-1 pathogenic factor. IMPORTANCE The HIV-1 Nef protein has been established as a key pathogenic determinant of HIV/AIDS, but there is little knowledge of how the extensive genetic diversity of HIV-1 affects Nef function. Upon compiling a set of subtype-specific reference strains, we identified a subtype C reference strain, C.BR92025, that contained natural polymorphisms at otherwise highly conserved residues 13, 84, and 92. Interestingly, strain C.BR92025 Nef displayed impaired Nef function and had decreased protein expression. We have demonstrated that strain C.BR92025 Nef has a higher rate of protein turnover than highly expressed Nef proteins and that this higher rate of protein turnover is due to an alanine-to-valine substitution at Nef

  4. High salt intake reprioritizes osmolyte and energy metabolism for body fluid conservation. (United States)

    Kitada, Kento; Daub, Steffen; Zhang, Yahua; Klein, Janet D; Nakano, Daisuke; Pedchenko, Tetyana; Lantier, Louise; LaRocque, Lauren M; Marton, Adriana; Neubert, Patrick; Schröder, Agnes; Rakova, Natalia; Jantsch, Jonathan; Dikalova, Anna E; Dikalov, Sergey I; Harrison, David G; Müller, Dominik N; Nishiyama, Akira; Rauh, Manfred; Harris, Raymond C; Luft, Friedrich C; Wassermann, David H; Sands, Jeff M; Titze, Jens


    Natriuretic regulation of extracellular fluid volume homeostasis includes suppression of the renin-angiotensin-aldosterone system, pressure natriuresis, and reduced renal nerve activity, actions that concomitantly increase urinary Na+ excretion and lead to increased urine volume. The resulting natriuresis-driven diuretic water loss is assumed to control the extracellular volume. Here, we have demonstrated that urine concentration, and therefore regulation of water conservation, is an important control system for urine formation and extracellular volume homeostasis in mice and humans across various levels of salt intake. We observed that the renal concentration mechanism couples natriuresis with correspondent renal water reabsorption, limits natriuretic osmotic diuresis, and results in concurrent extracellular volume conservation and concentration of salt excreted into urine. This water-conserving mechanism of dietary salt excretion relies on urea transporter-driven urea recycling by the kidneys and on urea production by liver and skeletal muscle. The energy-intense nature of hepatic and extrahepatic urea osmolyte production for renal water conservation requires reprioritization of energy and substrate metabolism in liver and skeletal muscle, resulting in hepatic ketogenesis and glucocorticoid-driven muscle catabolism, which are prevented by increasing food intake. This natriuretic-ureotelic, water-conserving principle relies on metabolism-driven extracellular volume control and is regulated by concerted liver, muscle, and renal actions.

  5. High-frequency ultrasound for intraoperative margin assessments in breast conservation surgery: a feasibility study

    Directory of Open Access Journals (Sweden)

    Hart Vern P


    Full Text Available Abstract Background In addition to breast imaging, ultrasound offers the potential for characterizing and distinguishing between benign and malignant breast tissues due to their different microstructures and material properties. The aim of this study was to determine if high-frequency ultrasound (20-80 MHz can provide pathology sensitive measurements for the ex vivo detection of cancer in margins during breast conservation surgery. Methods Ultrasonic tests were performed on resected margins and other tissues obtained from 17 patients, resulting in 34 specimens that were classified into 15 pathology categories. Pulse-echo and through-transmission measurements were acquired from a total of 57 sites on the specimens using two single-element 50-MHz transducers. Ultrasonic attenuation and sound speed were obtained from time-domain waveforms. The waveforms were further processed with fast Fourier transforms to provide ultrasonic spectra and cepstra. The ultrasonic measurements and pathology types were analyzed for correlations. The specimens were additionally re-classified into five pathology types to determine specificity and sensitivity values. Results The density of peaks in the ultrasonic spectra, a measure of spectral structure, showed significantly higher values for carcinomas and precancerous pathologies such as atypical ductal hyperplasia than for normal tissue. The slopes of the cepstra for non-malignant pathologies displayed significantly greater values that differentiated them from the normal and malignant tissues. The attenuation coefficients were sensitive to fat necrosis, fibroadenoma, and invasive lobular carcinoma. Specificities and sensitivities for differentiating pathologies from normal tissue were 100% and 86% for lobular carcinomas, 100% and 74% for ductal carcinomas, 80% and 82% for benign pathologies, and 80% and 100% for fat necrosis and adenomas. Specificities and sensitivities were also determined for differentiating each

  6. Gene co-regulation is highly conserved in the evolution of eukaryotes and prokaryotes.

    NARCIS (Netherlands)

    Snel, B.; Noort, V. van; Huynen, M.A.


    Differences between species have been suggested to largely reside in the network of connections among the genes. Nevertheless, the rate at which these connections evolve has not been properly quantified. Here, we measure the extent to which co-regulation between pairs of genes is conserved over

  7. Conservation hotspots for the turtles on the high seas of the Atlantic Ocean. (United States)

    Huang, Hsiang-Wen


    Understanding the distribution of bycaught sea turtles could inform conservation strategies and priorities. This research analyses the distribution of turtles caught as longline fisheries bycatch on the high seas of the Atlantic Ocean. This research collected 18,142 bycatch observations and 47.1 million hooks from large-scale Taiwanese longline vessels in the Atlantic Ocean from June 2002 to December 2013. The coverage rates were ranged from 0.48% to 17.54% by year. Seven hundred and sixty-seven turtles were caught, and the major species were leatherback (59.8%), olive ridley (27.1%) and loggerhead turtles (8.7%). Most olive ridley (81.7%) and loggerhead (82.1%) turtles were hooked, while the leatherbacks were both hooked (44.0%) and entangled (31.8%). Depending on the species, 21.4% to 57.7% were dead when brought onboard. Most of the turtles were caught in tropical areas, especially in the Gulf of Guinea (15°N-10°S, 30°W-10°E), but loggerheads were caught in the south Atlantic Ocean (25°S-35°S, 40°W-10°E and 30°S-40°S, 55°W-45°W). The bycatch rate was the highest at 0.030 per 1000 hooks for leatherbacks in the tropical area. The bycatch rates of olive ridley ranged from 0 to 0.010 per thousand hooks. The loggerhead bycatch rates were higher in the northern and southern Atlantic Ocean and ranged from 0.0128 to 0.0239 per thousand hooks. Due to the characteristics of the Taiwanese deep-set longline fleet, bycatch rates were lower than those of coastal longline fisheries, but mortality rates were higher because of the long hours of operation. Gear and bait modification should be considered to reduce sea turtle bycatch and increase survival rates while reducing the use of shallow hooks would also be helpful.

  8. Conservation hotspots for the turtles on the high seas of the Atlantic Ocean.

    Directory of Open Access Journals (Sweden)

    Hsiang-Wen Huang

    Full Text Available Understanding the distribution of bycaught sea turtles could inform conservation strategies and priorities. This research analyses the distribution of turtles caught as longline fisheries bycatch on the high seas of the Atlantic Ocean. This research collected 18,142 bycatch observations and 47.1 million hooks from large-scale Taiwanese longline vessels in the Atlantic Ocean from June 2002 to December 2013. The coverage rates were ranged from 0.48% to 17.54% by year. Seven hundred and sixty-seven turtles were caught, and the major species were leatherback (59.8%, olive ridley (27.1% and loggerhead turtles (8.7%. Most olive ridley (81.7% and loggerhead (82.1% turtles were hooked, while the leatherbacks were both hooked (44.0% and entangled (31.8%. Depending on the species, 21.4% to 57.7% were dead when brought onboard. Most of the turtles were caught in tropical areas, especially in the Gulf of Guinea (15°N-10°S, 30°W-10°E, but loggerheads were caught in the south Atlantic Ocean (25°S-35°S, 40°W-10°E and 30°S-40°S, 55°W-45°W. The bycatch rate was the highest at 0.030 per 1000 hooks for leatherbacks in the tropical area. The bycatch rates of olive ridley ranged from 0 to 0.010 per thousand hooks. The loggerhead bycatch rates were higher in the northern and southern Atlantic Ocean and ranged from 0.0128 to 0.0239 per thousand hooks. Due to the characteristics of the Taiwanese deep-set longline fleet, bycatch rates were lower than those of coastal longline fisheries, but mortality rates were higher because of the long hours of operation. Gear and bait modification should be considered to reduce sea turtle bycatch and increase survival rates while reducing the use of shallow hooks would also be helpful.

  9. Applications of very high-resolution imagery in the study and conservation of large predators in the Southern Ocean. (United States)

    Larue, Michelle A; Knight, Joseph


    The Southern Ocean is one of the most rapidly changing ecosystems on the planet due to the effects of climate change and commercial fishing for ecologically important krill and fish. Because sea ice loss is expected to be accompanied by declines in krill and fish predators, decoupling the effects of climate and anthropogenic changes on these predator populations is crucial for ecosystem-based management of the Southern Ocean. We reviewed research published from 2007 to 2014 that incorporated very high-resolution satellite imagery to assess distribution, abundance, and effects of climate and other anthropogenic changes on populations of predators in polar regions. Very high-resolution imagery has been used to study 7 species of polar animals in 13 papers, many of which provide methods through which further research can be conducted. Use of very high-resolution imagery in the Southern Ocean can provide a broader understanding of climate and anthropogenic forces on populations and inform management and conservation recommendations. We recommend that conservation biologists continue to integrate high-resolution remote sensing into broad-scale biodiversity and population studies in remote areas, where it can provide much needed detail. © 2014 Society for Conservation Biology.

  10. High-Quality 3d Models and Their Use in a Cultural Heritage Conservation Project (United States)

    Tucci, G.; Bonora, V.; Conti, A.; Fiorini, L.


    Cultural heritage digitization and 3D modelling processes are mainly based on laser scanning and digital photogrammetry techniques to produce complete, detailed and photorealistic three-dimensional surveys: geometric as well as chromatic aspects, in turn testimony of materials, work techniques, state of preservation, etc., are documented using digitization processes. The paper explores the topic of 3D documentation for conservation purposes; it analyses how geomatics contributes in different steps of a restoration process and it presents an overview of different uses of 3D models for the conservation and enhancement of the cultural heritage. The paper reports on the project to digitize the earthenware frieze of the Ospedale del Ceppo in Pistoia (Italy) for 3D documentation, restoration work support, and digital and physical reconstruction and integration purposes. The intent to design an exhibition area suggests new ways to take advantage of 3D data originally acquired for documentation and scientific purposes.

  11. Further progress on defining highly conserved immunogenic epitopes for a global HIV vaccine

    DEFF Research Database (Denmark)

    De Groot, Anne S; Levitz, Lauren; Ardito, Matthew T


    of global HIV evolution. Twenty-seven HLA-A3 epitopes were chosen from an analysis performed in 2003 on 10,803 HIV-1 sequences, and additional sequences were selected in 2009 based on an expanded set of 43,822 sequences. These epitopes were tested in vitro for HLA binding and for immunogenicity with PBMCs......Two major obstacles confronting HIV vaccine design have been the extensive viral diversity of HIV-1 globally and viral evolution driven by escape from CD8(+) cytotoxic T-cell lymphocyte (CTL)-mediated immune pressure. Regions of the viral genome that are not able to escape immune response...... and that are conserved in sequence and across time may represent the "Achilles' heel" of HIV and would be excellent candidates for vaccine development. In this study, T-cell epitopes were selected using immunoinformatics tools, combining HLA-A3 binding predictions with relative sequence conservation in the context...

  12. High Resolution Mapping of Soils and Landforms for the Desert Renewable Energy Conservation Plan (DRECP) (United States)

    Potter, Christopher S.; Li, Shuang


    The Desert Renewable Energy Conservation Plan (DRECP), a major component of California's renewable energy planning efforts, is intended to provide effective protection and conservation of desert ecosystems, while allowing for the sensible development of renewable energy projects. This NASA mapping report was developed to support the DRECP and the Bureau of Land Management (BLM). We outline in this document remote sensing image processing methods to deliver new maps of biological soils crusts, sand dune movements, desert pavements, and sub-surface water sources across the DRECP area. We focused data processing first on the largely unmapped areas most likely to be used for energy developments, such as those within Renewable Energy Study Areas (RESA) and Solar Energy Zones (SEZs). We used imagery (multispectral and radar) mainly from the years 2009-2011.

  13. Comparative Public Support for Conserving Reptile Species is High: Australian Evidence and its Implications


    Tisdell, Clement A.; Wilson, Clevo; Swarna Nantha, Hemanath


    This paper investigates factors influencing the public’s support for conservation of tropical reptile species in a focal group drawing on Australian data and an experiment involving a sample of the Australian public. The influences of the likeability of the species, their degree of endangerment, ethical considerations as well as knowledge are examined and found to be important. Likeability is found to be much less important than the existing literature suggests. This is highlighted by compari...

  14. Calcified plaque resorptive status as determined by high-resolution ultrasound is predictive of successful conservative management of calcific tendinosis. (United States)

    Lin, Chien-Hung; Chao, Hai-Lun; Chiou, Hong-Jen


    In patients with calcific tendinosis, the morphology of calcified plaques is associated with response to conservative management. We aimed to determine changes in pain and morphology of plaques in patients with calcific tendinosis and non-arc-shaped plaques identified by high-resolution ultrasonography who received only conservative treatment. A total of 33 patients with a mean age of 63.3±10.3 years were included. Pain scores at the time of first and follow-up ultrasound were recorded, and the degree of plaque resolution was calculated. At follow-up, 90.9% (30 of 33) of patients reported improvement in pain, and 84.8% (28 of 33) patient had more than 50% elimination of plaques. Most of increased vascularity observed in color Doppler ultrasonography during 1st visit disappeared at follow-up. In patients with calcific tendinosis, non-arc-shaped plaques determined by high-resolution ultrasonography are likely to resolve and conservative management is warranted. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

  15. Calcified plaque resorptive status as determined by high-resolution ultrasound is predictive of successful conservative management of calcific tendinosis

    Energy Technology Data Exchange (ETDEWEB)

    Lin, Chien-Hung [Department of Diagnostic Radiology, Chi-Mei Medical Center, Yung Kang City, Tainan, Taiwan (China); Department of Health Care Administration, Chung-Hwa University of Medical Technology, Tainan, Taiwan (China); Chao, Hai-Lun [Department of Health Care Administration, Chung-Hwa University of Medical Technology, Tainan, Taiwan (China); Chiou, Hong-Jen, E-mail: [Department of Radiology, Taipei Veterans General Hospital, National Yang Ming University, School of Medicine, and National Defense Medical Center, No. 201, Sec. 2, Shih-Pai Rd., Taipei 11217, Taiwan (China)


    Objective: In patients with calcific tendinosis, the morphology of calcified plaques is associated with response to conservative management. We aimed to determine changes in pain and morphology of plaques in patients with calcific tendinosis and non-arc-shaped plaques identified by high-resolution ultrasonography who received only conservative treatment. Methods: A total of 33 patients with a mean age of 63.3 {+-} 10.3 years were included. Pain scores at the time of first and follow-up ultrasound were recorded, and the degree of plaque resolution was calculated. Results: At follow-up, 90.9% (30 of 33) of patients reported improvement in pain, and 84.8% (28 of 33) patient had more than 50% elimination of plaques. Most of increased vascularity observed in color Doppler ultrasonography during 1st visit disappeared at follow-up. Conclusions: In patients with calcific tendinosis, non-arc-shaped plaques determined by high-resolution ultrasonography are likely to resolve and conservative management is warranted.

  16. Structure Analysis Uncovers a Highly Diverse but Structurally Conserved Effector Family in Phytopathogenic Fungi. (United States)

    de Guillen, Karine; Ortiz-Vallejo, Diana; Gracy, Jérome; Fournier, Elisabeth; Kroj, Thomas; Padilla, André


    Phytopathogenic ascomycete fungi possess huge effector repertoires that are dominated by hundreds of sequence-unrelated small secreted proteins. The molecular function of these effectors and the evolutionary mechanisms that generate this tremendous number of singleton genes are largely unknown. To get a deeper understanding of fungal effectors, we determined by NMR spectroscopy the 3-dimensional structures of the Magnaporthe oryzae effectors AVR1-CO39 and AVR-Pia. Despite a lack of sequence similarity, both proteins have very similar 6 β-sandwich structures that are stabilized in both cases by a disulfide bridge between 2 conserved cysteins located in similar positions of the proteins. Structural similarity searches revealed that AvrPiz-t, another effector from M. oryzae, and ToxB, an effector of the wheat tan spot pathogen Pyrenophora tritici-repentis have the same structures suggesting the existence of a family of sequence-unrelated but structurally conserved fungal effectors that we named MAX-effectors (Magnaporthe Avrs and ToxB like). Structure-informed pattern searches strengthened this hypothesis by identifying MAX-effector candidates in a broad range of ascomycete phytopathogens. Strong expansion of the MAX-effector family was detected in M. oryzae and M. grisea where they seem to be particularly important since they account for 5-10% of the effector repertoire and 50% of the cloned avirulence effectors. Expression analysis indicated that the majority of M. oryzae MAX-effectors are expressed specifically during early infection suggesting important functions during biotrophic host colonization. We hypothesize that the scenario observed for MAX-effectors can serve as a paradigm for ascomycete effector diversity and that the enormous number of sequence-unrelated ascomycete effectors may in fact belong to a restricted set of structurally conserved effector families.

  17. NFAT5 regulates HIV-1 in primary monocytes via a highly conserved long terminal repeat site.

    Directory of Open Access Journals (Sweden)

    Shahin Ranjbar


    Full Text Available To replicate, HIV-1 capitalizes on endogenous cellular activation pathways resulting in recruitment of key host transcription factors to its viral enhancer. RNA interference has been a powerful tool for blocking key checkpoints in HIV-1 entry into cells. Here we apply RNA interference to HIV-1 transcription in primary macrophages, a major reservoir of the virus, and specifically target the transcription factor NFAT5 (nuclear factor of activated T cells 5, which is the most evolutionarily divergent NFAT protein. By molecularly cloning and sequencing isolates from multiple viral subtypes, and performing DNase I footprinting, electrophoretic mobility shift, and promoter mutagenesis transfection assays, we demonstrate that NFAT5 functionally interacts with a specific enhancer binding site conserved in HIV-1, HIV-2, and multiple simian immunodeficiency viruses. Using small interfering RNA to ablate expression of endogenous NFAT5 protein, we show that the replication of three major HIV-1 viral subtypes (B, C, and E is dependent upon NFAT5 in human primary differentiated macrophages. Our results define a novel host factor-viral enhancer interaction that reveals a new regulatory role for NFAT5 and defines a functional DNA motif conserved across HIV-1 subtypes and representative simian immunodeficiency viruses. Inhibition of the NFAT5-LTR interaction may thus present a novel therapeutic target to suppress HIV-1 replication and progression of AIDS.

  18. Universal antibodies against the highly conserved influenza fusion peptide cross-neutralize several subtypes of influenza A virus

    Energy Technology Data Exchange (ETDEWEB)

    Hashem, Anwar M. [Centre for Vaccine Evaluation, Biologics and Genetic Therapies Directorate, HPFB, Health Canada, Ottawa, ON (Canada); Department of Microbiology, Faculty of Medicine, King Abdulaziz University, Jeddah (Saudi Arabia); Department of Biochemistry, Microbiology and Immunology, University of Ottawa, Ottawa, ON (Canada); Van Domselaar, Gary [National Microbiology Laboratory, Public Health Agency of Canada, Winnipeg, MB (Canada); Li, Changgui; Wang, Junzhi [National Institute for the Control of Pharmaceutical and Biological Products, Beijing (China); She, Yi-Min; Cyr, Terry D. [Centre for Vaccine Evaluation, Biologics and Genetic Therapies Directorate, HPFB, Health Canada, Ottawa, ON (Canada); Sui, Jianhua [Department of Cancer Immunology and AIDS, Dana-Farber Cancer Institute, Department of Medicine, Harvard Medical School, 44 Binney Street, Boston, MA 02115 (United States); He, Runtao [National Microbiology Laboratory, Public Health Agency of Canada, Winnipeg, MB (Canada); Marasco, Wayne A. [Department of Cancer Immunology and AIDS, Dana-Farber Cancer Institute, Department of Medicine, Harvard Medical School, 44 Binney Street, Boston, MA 02115 (United States); Li, Xuguang, E-mail: [Centre for Vaccine Evaluation, Biologics and Genetic Therapies Directorate, HPFB, Health Canada, Ottawa, ON (Canada); Department of Biochemistry, Microbiology and Immunology, University of Ottawa, Ottawa, ON (Canada)


    Research highlights: {yields} The fusion peptide is the only universally conserved epitope in all influenza viral hemagglutinins. {yields} Anti-fusion peptide antibodies are universal antibodies that cross-react with all influenza HA subtypes. {yields} The universal antibodies cross-neutralize different influenza A subtypes. {yields} The universal antibodies inhibit the fusion process between the viruses and the target cells. -- Abstract: The fusion peptide of influenza viral hemagglutinin plays a critical role in virus entry by facilitating membrane fusion between the virus and target cells. As the fusion peptide is the only universally conserved epitope in all influenza A and B viruses, it could be an attractive target for vaccine-induced immune responses. We previously reported that antibodies targeting the first 14 amino acids of the N-terminus of the fusion peptide could bind to virtually all influenza virus strains and quantify hemagglutinins in vaccines produced in embryonated eggs. Here we demonstrate that these universal antibodies bind to the viral hemagglutinins in native conformation presented in infected mammalian cell cultures and neutralize multiple subtypes of virus by inhibiting the pH-dependant fusion of viral and cellular membranes. These results suggest that this unique, highly-conserved linear sequence in viral hemagglutinin is exposed sufficiently to be attacked by the antibodies during the course of infection and merits further investigation because of potential importance in the protection against diverse strains of influenza viruses.

  19. Nmf9 Encodes a Highly Conserved Protein Important to Neurological Function in Mice and Flies.

    Directory of Open Access Journals (Sweden)

    Shuxiao Zhang


    Full Text Available Many protein-coding genes identified by genome sequencing remain without functional annotation or biological context. Here we define a novel protein-coding gene, Nmf9, based on a forward genetic screen for neurological function. ENU-induced and genome-edited null mutations in mice produce deficits in vestibular function, fear learning and circadian behavior, which correlated with Nmf9 expression in inner ear, amygdala, and suprachiasmatic nuclei. Homologous genes from unicellular organisms and invertebrate animals predict interactions with small GTPases, but the corresponding domains are absent in mammalian Nmf9. Intriguingly, homozygotes for null mutations in the Drosophila homolog, CG45058, show profound locomotor defects and premature death, while heterozygotes show striking effects on sleep and activity phenotypes. These results link a novel gene orthology group to discrete neurological functions, and show conserved requirement across wide phylogenetic distance and domain level structural changes.

  20. Highly conserved gene order and numerous novel repetitive elements in genomic regions linked to wing pattern variation in Heliconius butterflies

    Directory of Open Access Journals (Sweden)

    Halder Georg


    Full Text Available Abstract Background With over 20 parapatric races differing in their warningly colored wing patterns, the butterfly Heliconius erato provides a fascinating example of an adaptive radiation. Together with matching races of its co-mimic Heliconius melpomene, H. erato also represents a textbook case of Müllerian mimicry, a phenomenon where common warning signals are shared amongst noxious organisms. It is of great interest to identify the specific genes that control the mimetic wing patterns of H. erato and H. melpomene. To this end we have undertaken comparative mapping and targeted genomic sequencing in both species. This paper reports on a comparative analysis of genomic sequences linked to color pattern mimicry genes in Heliconius. Results Scoring AFLP polymorphisms in H. erato broods allowed us to survey loci at approximately 362 kb intervals across the genome. With this strategy we were able to identify markers tightly linked to two color pattern genes: D and Cr, which were then used to screen H. erato BAC libraries in order to identify clones for sequencing. Gene density across 600 kb of BAC sequences appeared relatively low, although the number of predicted open reading frames was typical for an insect. We focused analyses on the D- and Cr-linked H. erato BAC sequences and on the Yb-linked H. melpomene BAC sequence. A comparative analysis between homologous regions of H. erato (Cr-linked BAC and H. melpomene (Yb-linked BAC revealed high levels of sequence conservation and microsynteny between the two species. We found that repeated elements constitute 26% and 20% of BAC sequences from H. erato and H. melpomene respectively. The majority of these repetitive sequences appear to be novel, as they showed no significant similarity to any other available insect sequences. We also observed signs of fine scale conservation of gene order between Heliconius and the moth Bombyx mori, suggesting that lepidopteran genome architecture may be conserved

  1. On optimal control problem for conservation law modelling one class of highly re-entrant production systems (United States)

    D'Apice, Ciro; Kogut, Peter I.


    We discuss the optimal control problem stated as the minimization in the L2-sense of the mismatch between the actual out-flux and a demand forecast for a hyperbolic conservation law that models a highly re-entrant production system. The output of the factory is described as a function of the work in progress and the position of the so-called push-pull point (PPP) where we separate the beginning of the factory employing a push policy from the end of the factory, which uses a pull policy.

  2. Hearing sensitivity in context: Conservation implications for a highly vocal endangered species

    Directory of Open Access Journals (Sweden)

    Megan A. Owen


    Full Text Available Hearing sensitivity is a fundamental determinant of a species’ vulnerability to anthropogenic noise, however little is known about the hearing capacities of most conservation dependent species. When audiometric data are integrated with other aspects of species’ acoustic ecology, life history, and characteristic habitat topography and soundscape, predictions can be made regarding probable vulnerability to the negative impacts of different types of anthropogenic noise. Here we used an adaptive psychoacoustic technique to measure hearing thresholds in the endangered giant panda; a species that uses acoustic communication to coordinate reproduction. Our results suggest that giant pandas have functional hearing into the ultrasonic range, with good sensitivity between 10.0 and 16.0 kHz, and best sensitivity measured at 12.5–14.0 kHz. We estimated the lower and upper limits of functional hearing as 0.10 and 70.0 kHz respectively. While these results suggest that panda hearing is similar to that of some other terrestrial carnivores, panda hearing thresholds above 14.0 kHz were significantly lower (i.e., more sensitive than those of the polar bear, the only other bear species for which data are available. We discuss the implications of this divergence, as well as the relationship between hearing sensitivity and the spectral parameters of panda vocalizations. We suggest that these data, placed in context, can be used towards the development of a sensory-based model of noise disturbance for the species.

  3. The highly conserved KEOPS/EKC complex is essential for a universal tRNA modification, t6A. (United States)

    Srinivasan, Madhusudhan; Mehta, Preeti; Yu, Yao; Prugar, Evelyn; Koonin, Eugene V; Karzai, A Wali; Sternglanz, Rolf


    The highly conserved Kinase, Endopeptidase and Other Proteins of small Size (KEOPS)/Endopeptidase-like and Kinase associated to transcribed Chromatin (EKC) protein complex has been implicated in transcription, telomere maintenance and chromosome segregation, but its exact function remains unknown. The complex consists of five proteins, Kinase-Associated Endopeptidase (Kae1), a highly conserved protein present in bacteria, archaea and eukaryotes, a kinase (Bud32) and three additional small polypeptides. We showed that the complex is required for a universal tRNA modification, threonyl carbamoyl adenosine (t6A), found in all tRNAs that pair with ANN codons in mRNA. We also showed that the bacterial ortholog of Kae1, YgjD, is required for t6A modification of Escherichia coli tRNAs. The ATPase activity of Kae1 and the kinase activity of Bud32 are required for the modification. The yeast protein Sua5 has been reported previously to be required for t6A synthesis. Using yeast extracts, we established an in vitro system for the synthesis of t6A that requires Sua5, Kae1, threonine, bicarbonate and ATP. It remains to be determined whether all reported defects of KEOPS/EKC mutants can be attributed to the lack of t6A, or whether the complex has multiple functions.

  4. Mechanisms regulating GLUT4 transcription in skeletal muscle cells are highly conserved across vertebrates.

    Directory of Open Access Journals (Sweden)

    Rubén Marín-Juez

    Full Text Available The glucose transporter 4 (GLUT4 plays a key role in glucose uptake in insulin target tissues. This transporter has been extensively studied in many species in terms of its function, expression and cellular traffic and complex mechanisms are involved in its regulation at many different levels. However, studies investigating the transcription of the GLUT4 gene and its regulation are scarce. In this study, we have identified the GLUT4 gene in a teleost fish, the Fugu (Takifugu rubripes, and have cloned and characterized a functional promoter of this gene for the first time in a non-mammalian vertebrate. In silico analysis of the Fugu GLUT4 promoter identified potential binding sites for transcription factors such as SP1, C/EBP, MEF2, KLF, SREBP-1c and GC-boxes, as well as a CpG island, but failed to identify a TATA box. In vitro analysis revealed three transcription start sites, with the main residing 307 bp upstream of the ATG codon. Deletion analysis determined that the core promoter was located between nucleotides -132/+94. By transfecting a variety of 5´deletion constructs into L6 muscle cells we have determined that Fugu GLUT4 promoter transcription is regulated by insulin, PG-J2, a PPARγ agonist, and electrical pulse stimulation. Furthermore, our results suggest the implication of motifs such as PPARγ/RXR and HIF-1α in the regulation of Fugu GLUT4 promoter activity by PPARγ and contractile activity, respectively. These data suggest that the characteristics and regulation of the GLUT4 promoter have been remarkably conserved during the evolution from fish to mammals, further evidencing the important role of GLUT4 in metabolic regulation in vertebrates.

  5. Mechanisms Regulating GLUT4 Transcription in Skeletal Muscle Cells Are Highly Conserved across Vertebrates (United States)

    Marín-Juez, Rubén; Diaz, Mónica; Morata, Jordi; Planas, Josep V.


    The glucose transporter 4 (GLUT4) plays a key role in glucose uptake in insulin target tissues. This transporter has been extensively studied in many species in terms of its function, expression and cellular traffic and complex mechanisms are involved in its regulation at many different levels. However, studies investigating the transcription of the GLUT4 gene and its regulation are scarce. In this study, we have identified the GLUT4 gene in a teleost fish, the Fugu (Takifugu rubripes), and have cloned and characterized a functional promoter of this gene for the first time in a non-mammalian vertebrate. In silico analysis of the Fugu GLUT4 promoter identified potential binding sites for transcription factors such as SP1, C/EBP, MEF2, KLF, SREBP-1c and GC-boxes, as well as a CpG island, but failed to identify a TATA box. In vitro analysis revealed three transcription start sites, with the main residing 307 bp upstream of the ATG codon. Deletion analysis determined that the core promoter was located between nucleotides -132/+94. By transfecting a variety of 5´deletion constructs into L6 muscle cells we have determined that Fugu GLUT4 promoter transcription is regulated by insulin, PG-J2, a PPARγ agonist, and electrical pulse stimulation. Furthermore, our results suggest the implication of motifs such as PPARγ/RXR and HIF-1α in the regulation of Fugu GLUT4 promoter activity by PPARγ and contractile activity, respectively. These data suggest that the characteristics and regulation of the GLUT4 promoter have been remarkably conserved during the evolution from fish to mammals, further evidencing the important role of GLUT4 in metabolic regulation in vertebrates. PMID:24260440

  6. Identification and characterization of novel and conserved microRNAs in radish (Raphanus sativus L.) using high-throughput sequencing. (United States)

    Xu, Liang; Wang, Yan; Xu, Yuanyuan; Wang, Liangju; Zhai, Lulu; Zhu, Xianwen; Gong, Yiqin; Ye, Shan; Liu, Liwang


    MicroRNAs (miRNAs) are endogenous, non-coding, small RNAs that play significant regulatory roles in plant growth, development, and biotic and abiotic stress responses. To date, a great number of conserved and species-specific miRNAs have been identified in many important plant species such as Arabidopsis, rice and poplar. However, little is known about identification of miRNAs and their target genes in radish (Raphanus sativus L.). In the present study, a small RNA library from radish root was constructed and sequenced using the high-throughput Solexa sequencing. Through sequence alignment and secondary structure prediction, a total of 545 conserved miRNA families as well as 15 novel (with their miRNA* strand) and 64 potentially novel miRNAs were identified. Quantitative real-time PCR (qRT-PCR) analysis confirmed that both conserved and novel miRNAs were expressed in radish, and some of them were preferentially expressed in certain tissues. A total of 196 potential target genes were predicted for 42 novel radish miRNAs. Gene ontology (GO) analysis showed that most of the targets were involved in plant growth, development, metabolism and stress responses. This study represents a first large-scale identification and characterization of radish miRNAs and their potential target genes. These results could lead to the further identification of radish miRNAs and enhance our understanding of radish miRNA regulatory mechanisms in diverse biological and metabolic processes. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  7. Conservative Management of Cesarean Scar Ectopic Pregnancy with Fetal Heart Activity and a Very High β-hCG. (United States)

    McLaren, Rodney; McCalla, Sandra; Irani, Mohamad


    Cesarean scar ectopic pregnancy (CSP) is a rare type of ectopic pregnancy that is growing in incidence. The diagnosis of most CSP occurs when patients present in unstable conditions requiring surgical management and leading sometimes to hysterectomy. It has been shown that medical management is a safe option for early diagnosed hemodynamically stable CSP. However, no cases of CSP with β-hCG higher than 62,000 IU/L, conservatively treated, have been reported. We report the case of a 29-year-old patient who presented for her first prenatal visit at 13-week gestation and was diagnosed with CSP with present fetal heart tones and a quantitative β-hCG of 144,337 IU/L. She was treated with bilateral uterine artery embolization and systemic methotrexate. Her β-hCG significantly decreased and became undetectable within 10 weeks. We propose that patients with CSP with very high β-hCG and fetal heart activity can be offered conservative or fertility preserving management.

  8. Conservative Management of Cesarean Scar Ectopic Pregnancy with Fetal Heart Activity and a Very High β-hCG

    Directory of Open Access Journals (Sweden)

    Rodney McLaren


    Full Text Available Cesarean scar ectopic pregnancy (CSP is a rare type of ectopic pregnancy that is growing in incidence. The diagnosis of most CSP occurs when patients present in unstable conditions requiring surgical management and leading sometimes to hysterectomy. It has been shown that medical management is a safe option for early diagnosed hemodynamically stable CSP. However, no cases of CSP with β-hCG higher than 62,000 IU/L, conservatively treated, have been reported. We report the case of a 29-year-old patient who presented for her first prenatal visit at 13-week gestation and was diagnosed with CSP with present fetal heart tones and a quantitative β-hCG of 144,337 IU/L. She was treated with bilateral uterine artery embolization and systemic methotrexate. Her β-hCG significantly decreased and became undetectable within 10 weeks. We propose that patients with CSP with very high β-hCG and fetal heart activity can be offered conservative or fertility preserving management.

  9. Identification of a highly conserved valine-glycine-phenylalanine amino acid triplet required for HIV-1 Nef function

    Directory of Open Access Journals (Sweden)

    Meuwissen Pieter J


    Full Text Available Abstract Background The Nef protein of HIV facilitates virus replication and disease progression in infected patients. This role as pathogenesis factor depends on several genetically separable Nef functions that are mediated by interactions of highly conserved protein-protein interaction motifs with different host cell proteins. By studying the functionality of a series of nef alleles from clinical isolates, we identified a dysfunctional HIV group O Nef in which a highly conserved valine-glycine-phenylalanine (VGF region, which links a preceding acidic cluster with the following proline-rich motif into an amphipathic surface was deleted. In this study, we aimed to study the functional importance of this VGF region. Results The dysfunctional HIV group O8 nef allele was restored to the consensus sequence, and mutants of canonical (NL4.3, NA-7, SF2 and non-canonical (B2 and C1422 HIV-1 group M nef alleles were generated in which the amino acids of the VGF region were changed into alanines (VGF→AAA and tested for their capacity to interfere with surface receptor trafficking, signal transduction and enhancement of viral replication and infectivity. We found the VGF motif, and each individual amino acid of this motif, to be critical for downregulation of MHC-I and CXCR4. Moreover, Nef’s association with the cellular p21-activated kinase 2 (PAK2, the resulting deregulation of cofilin and inhibition of host cell actin remodeling, and targeting of Lck kinase to the trans-golgi-network (TGN were affected as well. Of particular interest, VGF integrity was essential for Nef-mediated enhancement of HIV virion infectivity and HIV replication in peripheral blood lymphocytes. For targeting of Lck kinase to the TGN and viral infectivity, especially the phenylalanine of the triplet was essential. At the molecular level, the VGF motif was required for the physical interaction of the adjacent proline-rich motif with Hck. Conclusion Based on these findings, we

  10. Ancient exaptation of a CORE-SINE retroposon into a highly conserved mammalian neuronal enhancer of the proopiomelanocortin gene.

    Directory of Open Access Journals (Sweden)

    Andrea M Santangelo


    Full Text Available The proopiomelanocortin gene (POMC is expressed in the pituitary gland and the ventral hypothalamus of all jawed vertebrates, producing several bioactive peptides that function as peripheral hormones or central neuropeptides, respectively. We have recently determined that mouse and human POMC expression in the hypothalamus is conferred by the action of two 5' distal and unrelated enhancers, nPE1 and nPE2. To investigate the evolutionary origin of the neuronal enhancer nPE2, we searched available vertebrate genome databases and determined that nPE2 is a highly conserved element in placentals, marsupials, and monotremes, whereas it is absent in nonmammalian vertebrates. Following an in silico paleogenomic strategy based on genome-wide searches for paralog sequences, we discovered that opossum and wallaby nPE2 sequences are highly similar to members of the superfamily of CORE-short interspersed nucleotide element (SINE retroposons, in particular to MAR1 retroposons that are widely present in marsupial genomes. Thus, the neuronal enhancer nPE2 originated from the exaptation of a CORE-SINE retroposon in the lineage leading to mammals and remained under purifying selection in all mammalian orders for the last 170 million years. Expression studies performed in transgenic mice showed that two nonadjacent nPE2 subregions are essential to drive reporter gene expression into POMC hypothalamic neurons, providing the first functional example of an exapted enhancer derived from an ancient CORE-SINE retroposon. In addition, we found that this CORE-SINE family of retroposons is likely to still be active in American and Australian marsupial genomes and that several highly conserved exonic, intronic and intergenic sequences in the human genome originated from the exaptation of CORE-SINE retroposons. Together, our results provide clear evidence of the functional novelties that transposed elements contributed to their host genomes throughout evolution.

  11. Ancient exaptation of a CORE-SINE retroposon into a highly conserved mammalian neuronal enhancer of the proopiomelanocortin gene. (United States)

    Santangelo, Andrea M; de Souza, Flávio S J; Franchini, Lucía F; Bumaschny, Viviana F; Low, Malcolm J; Rubinstein, Marcelo


    The proopiomelanocortin gene (POMC) is expressed in the pituitary gland and the ventral hypothalamus of all jawed vertebrates, producing several bioactive peptides that function as peripheral hormones or central neuropeptides, respectively. We have recently determined that mouse and human POMC expression in the hypothalamus is conferred by the action of two 5' distal and unrelated enhancers, nPE1 and nPE2. To investigate the evolutionary origin of the neuronal enhancer nPE2, we searched available vertebrate genome databases and determined that nPE2 is a highly conserved element in placentals, marsupials, and monotremes, whereas it is absent in nonmammalian vertebrates. Following an in silico paleogenomic strategy based on genome-wide searches for paralog sequences, we discovered that opossum and wallaby nPE2 sequences are highly similar to members of the superfamily of CORE-short interspersed nucleotide element (SINE) retroposons, in particular to MAR1 retroposons that are widely present in marsupial genomes. Thus, the neuronal enhancer nPE2 originated from the exaptation of a CORE-SINE retroposon in the lineage leading to mammals and remained under purifying selection in all mammalian orders for the last 170 million years. Expression studies performed in transgenic mice showed that two nonadjacent nPE2 subregions are essential to drive reporter gene expression into POMC hypothalamic neurons, providing the first functional example of an exapted enhancer derived from an ancient CORE-SINE retroposon. In addition, we found that this CORE-SINE family of retroposons is likely to still be active in American and Australian marsupial genomes and that several highly conserved exonic, intronic and intergenic sequences in the human genome originated from the exaptation of CORE-SINE retroposons. Together, our results provide clear evidence of the functional novelties that transposed elements contributed to their host genomes throughout evolution.

  12. 78 FR 20503 - Energy Conservation Program: Availability of the Interim Technical Support Document for High... (United States)


    ... Renewable Energy, Building Technologies, EE-2J, 1000 Independence Avenue SW, Washington, DC 20585- 0121... Document for High-Intensity Discharge Lamps AGENCY: Office of Energy Efficiency and Renewable Energy.... Mail: Ms. Brenda Edwards, U.S. Department of Energy, Building Technologies Program, Mailstop EE-2J...

  13. 77 FR 11785 - Energy Conservation Program: Public Meeting and Availability of the Framework Document for High... (United States)


    ... of Energy Efficiency and Renewable Energy, Building Technologies Program, EE-2J, 1000 Independence... Document for High-Intensity Discharge Lamps AGENCY: Office of Energy Efficiency and Renewable Energy..., 2012. ADDRESSES: The public meeting will be held at the U.S. Department of Energy, Forrestal Building...

  14. Comparison of three-dimensional optical coherence tomography and high resolution photography for art conservation studies. (United States)

    Adler, Desmond C; Stenger, Jens; Gorczynska, Iwona; Lie, Henry; Hensick, Teri; Spronk, Ron; Wolohojian, Stephan; Khandekar, Narayan; Jiang, James Y; Barry, Scott; Cable, Alex E; Huber, Robert; Fujimoto, James G


    Gold punchwork and underdrawing in Renaissance panel paintings are analyzed using both three-dimensional swept source / Fourier domain optical coherence tomography (3D-OCT) and high resolution digital photography. 3D-OCT can generate en face images with micrometer-scale resolutions at arbitrary sectioning depths, rejecting out-of-plane light by coherence gating. Therefore 3D-OCT is well suited for analyzing artwork where a surface layer obscures details of interest. 3D-OCT also enables cross-sectional imaging and quantitative measurement of 3D features such as punch depth, which is beneficial for analyzing the tools and techniques used to create works of art. High volumetric imaging speeds are enabled by the use of a Fourier domain mode locked (FDML) laser as the 3D-OCT light source. High resolution infrared (IR) digital photography is shown to be particularly useful for the analysis of underdrawing, where the materials used for the underdrawing and paint layers have significantly different IR absrption properties. In general, 3D-OCT provides a more flexible and comprehensive analysis of artwork than high resolution photography, but also requires more complex instrumentation and data analysis.

  15. Identification of immunogenic HLA-B7 "Achilles' heel" epitopes within highly conserved regions of HIV

    DEFF Research Database (Denmark)

    De Groot, Anne S; Rivera, Daniel S; McMurry, Julie A


    Genetic polymorphisms in class I human leukocyte antigen molecules (HLA) have been shown to determine susceptibility to HIV infection as well as the rate of progression to AIDS. In particular, the HLA-B7 supertype has been shown to be associated with high viral loads and rapid progression to dise...

  16. Energy conservation and high-frequency damping in numerical time integration

    DEFF Research Database (Denmark)

    Krenk, Steen


    additional variables to represent damping. In the present paper it is demonstrated, how damping equivalent to the α-damping of the Newmark algorithm can be introduced directly via displacement and velocity dependent terms. It is furthermore shown, how this damping can be improved by introduction of a new set...... this often leads to a fairly large number of high-frequency modes, that are not represented well – and occasionally directly erroneously – by the model. It is desirable to cure this problem by devising algorithms that include the possibility of introducing algorithmic energy dissipation of the high......-frequency modes. The problem is well known from classic collocation based algorithms – notably various forms of the Newmark algorithm – where the equation of motion is supplemented by approximate relations between displacement, velocity and acceleration. Here adjustment of the algorithmic parameters can be used...

  17. Energy conservation and high-frequency damping in numerical time-integration

    DEFF Research Database (Denmark)

    Krenk, Steen


    by introduction of a new set of variables related to the displacement and velocity vectors by a suitable first order filter with scalar coefficients. By this device an algorithmic damping can be obtained that is of third order in the low-frequency regime. It is an important feature of both algorithms...... this often leads to a fairly large number of high-frequency modes, that are not represented well - and occasionally directly erroneously - by the model. It is desirable to cure this problem by devising algorithms that include the possibility of introducing algorithmic energy dissipation of the high......-frequency modes. The problem is well known from classic collocation based algorithms - notably various forms of the Newmark algorithm where the equation of motion is supplemented by approximate relations between displacement, velocity and acceleration. Here adjustment of the algorithmic parameters can be used...

  18. A highly conserved Poc1 protein characterized in embryos of the hydrozoan Clytia hemisphaerica: localization and functional studies.

    Directory of Open Access Journals (Sweden)

    Cécile Fourrage

    Full Text Available Poc1 (Protein of Centriole 1 proteins are highly conserved WD40 domain-containing centriole components, well characterized in the alga Chlamydomonas, the ciliated protazoan Tetrahymena, the insect Drosophila and in vertebrate cells including Xenopus and zebrafish embryos. Functions and localizations related to the centriole and ciliary axoneme have been demonstrated for Poc1 in a range of species. The vertebrate Poc1 protein has also been reported to show an additional association with mitochondria, including enrichment in the specialized "germ plasm" region of Xenopus oocytes. We have identified and characterized a highly conserved Poc1 protein in the cnidarian Clytia hemisphaerica. Clytia Poc1 mRNA was found to be strongly expressed in eggs and early embryos, showing a punctate perinuclear localization in young oocytes. Fluorescence-tagged Poc1 proteins expressed in developing embryos showed strong localization to centrioles, including basal bodies. Anti-human Poc1 antibodies decorated mitochondria in Clytia, as reported in human cells, but failed to recognise endogenous or fluorescent-tagged Clytia Poc1. Injection of specific morpholino oligonucleotides into Clytia eggs prior to fertilization to repress Poc1 mRNA translation interfered with cell division from the blastula stage, likely corresponding to when neosynthesis normally takes over from maternally supplied protein. Cell cycle lengthening and arrest were observed, phenotypes consistent with an impaired centriolar biogenesis or function. The specificity of the defects could be demonstrated by injection of synthetic Poc1 mRNA, which restored normal development. We conclude that in Clytia embryos, Poc1 has an essentially centriolar localization and function.

  19. The highly conserved HA2 protein of the influenza A virus induces a cross protective immune response. (United States)

    Lee, Jong-Soo; Chowdhury, Mohammed Y E; Moon, Ho-Jin; Choi, Young-Ki; Talactac, Melbourne R; Kim, Jae-Hoon; Park, Min-Eun; Son, Hwa-Young; Shin, Kwang-Soon; Kim, Chul-Joong


    Existing influenza vaccines protect mostly homologous subtypes and acted most effectively only when well matched to the circulating strain. Immunization with an updated vaccine is therefore necessary to maintain long-term protection and the development of a broadly protective influenza vaccine against the threat of pandemic outbreak. The highly conserved HA2 glyco-polypeptide (HA2 gp) is a promising new candidate for such an influenza vaccine. Helical domain and the fusion peptide (residues 15-137) of surface antigen from influenza A subtype A/EM/Korea/W149/06 (H5N1) was used to assess the potentiality of HA2 vaccination against multiple subtypes of the influenza viruses. The construct, named H5HA2 was expressed in Escherichia coli and allowed to refold from inclusion bodies. Purified proteins were used to investigate the immunogenicity of H5HA2 and its potential for cross protection. The immunization of mice with H5HA2 induced HA2 antibodies, HA2 specific T-cell responses, and protection against homologous A/EM/Korea/W149/06 (H5N1) influenza. Immunized mice were also protected from two distinct heterosubtypes of influenza: A/Puerto Rico/1/34(H1N1) and bird/Korea/w81/2005(H5N2). Results suggest that recombinant proteins based on the highly conserved residues within HA2 are candidates for the development of vaccines against pandemic outbreaks of emergent influenza variants. Copyright © 2013 Elsevier B.V. All rights reserved.

  20. Computation and Analysis of High Rocky Slope Safety in a Water Conservancy Project

    Directory of Open Access Journals (Sweden)

    Meng Yang


    Full Text Available An integrated method, covering the actual monitoring analysis, practical geological model, and theoretical mathematical simulation model, is systematically proposed and successfully applied. Deformation characteristic of a unique high rocky slope was firstly analyzed from multiple angles and multiple layers by changeable elevations and distances. Arrangements of monitoring points were listed and monitoring equipment was designed to comprise a complete monitoring system. Present larger displacement was concluded for bottom larger displacement caused by water erosion and middle larger displacement formed by seepage. Temporal and spatial displacements rule study of multiple-points linkage effects with water factor proved this conclusion. To better excavate useful message and analyze the deep rule from the practical monitoring data, the slope geological model was conducted and rock mechanic parameters were researched. Finally, a unique three-dimensional finite element model was applied to approach the structure character using numerical simulations. The corresponding strength criterion was used to determine the safety coefficient by selecting a typical section. Subsequently, an integrated three-dimensional finite element model of the slope and dam was developed and more detailed deformation evolution mechanism was revealed. This study is expected to provide a powerful and systematic method to analyze very high, important, and dangerous slopes.

  1. Cross-Breeding Is Inevitable to Conserve the Highly Inbred Population of Puffin Hunter: The Norwegian Lundehund. (United States)

    Kettunen, Anne; Daverdin, Marc; Helfjord, Turid; Berg, Peer


    The Norwegian Lundehund is a highly endangered native dog breed. Low fertility and high frequency predisposition to intestinal disorder imply inbreeding depression. We assessed the genetic diversity of the Lundehund population from pedigree data and evaluated the potential of optimal contribution selection and cross-breeding in the long-term management of the Lundehund population. The current Norwegian Lundehund population is highly inbred and has lost 38.8% of the genetic diversity in the base population. Effective population size estimates varied between 13 and 82 depending on the method used. Optimal contribution selection alone facilitates no improvement in the current situation in the Lundehund due to the extremely high relatedness of the whole population. Addition of (replacement with) 10 breeding candidates of foreign breed to 30 Lundehund breeders reduced the parental additive genetic relationship by 40-42% (48-53%). Immediate actions are needed to increase the genetic diversity in the current Lundehund population. The only option to secure the conservation of this rare breed is to introduce individuals from foreign breeds as breeding candidates.

  2. Cross-Breeding Is Inevitable to Conserve the Highly Inbred Population of Puffin Hunter: The Norwegian Lundehund.

    Directory of Open Access Journals (Sweden)

    Anne Kettunen

    Full Text Available The Norwegian Lundehund is a highly endangered native dog breed. Low fertility and high frequency predisposition to intestinal disorder imply inbreeding depression. We assessed the genetic diversity of the Lundehund population from pedigree data and evaluated the potential of optimal contribution selection and cross-breeding in the long-term management of the Lundehund population. The current Norwegian Lundehund population is highly inbred and has lost 38.8% of the genetic diversity in the base population. Effective population size estimates varied between 13 and 82 depending on the method used. Optimal contribution selection alone facilitates no improvement in the current situation in the Lundehund due to the extremely high relatedness of the whole population. Addition of (replacement with 10 breeding candidates of foreign breed to 30 Lundehund breeders reduced the parental additive genetic relationship by 40-42% (48-53%. Immediate actions are needed to increase the genetic diversity in the current Lundehund population. The only option to secure the conservation of this rare breed is to introduce individuals from foreign breeds as breeding candidates.

  3. High-order conservative finite difference GLM-MHD schemes for cell-centered MHD (United States)

    Mignone, Andrea; Tzeferacos, Petros; Bodo, Gianluigi


    We present and compare third- as well as fifth-order accurate finite difference schemes for the numerical solution of the compressible ideal MHD equations in multiple spatial dimensions. The selected methods lean on four different reconstruction techniques based on recently improved versions of the weighted essentially non-oscillatory (WENO) schemes, monotonicity preserving (MP) schemes as well as slope-limited polynomial reconstruction. The proposed numerical methods are highly accurate in smooth regions of the flow, avoid loss of accuracy in proximity of smooth extrema and provide sharp non-oscillatory transitions at discontinuities. We suggest a numerical formulation based on a cell-centered approach where all of the primary flow variables are discretized at the zone center. The divergence-free condition is enforced by augmenting the MHD equations with a generalized Lagrange multiplier yielding a mixed hyperbolic/parabolic correction, as in Dedner et al. [J. Comput. Phys. 175 (2002) 645-673]. The resulting family of schemes is robust, cost-effective and straightforward to implement. Compared to previous existing approaches, it completely avoids the CPU intensive workload associated with an elliptic divergence cleaning step and the additional complexities required by staggered mesh algorithms. Extensive numerical testing demonstrate the robustness and reliability of the proposed framework for computations involving both smooth and discontinuous features.

  4. Two strains of Crocosphaera watsonii with highly conserved genomes are distinguished by strain-specific features

    Directory of Open Access Journals (Sweden)

    Shellie Roxanne Bench


    Full Text Available Unicellular nitrogen-fixing cyanobacteria are important components of marine phytoplankton. Although non-nitrogen-fixing marine phytoplankton generally exhibit high gene sequence and genomic diversity, gene sequences of natural populations and isolated strains of Crocosphaera watsonii, one of two most abundant open ocean unicellular cyanobacteria groups, have been shown to be 98-100% identical.. The low sequence diversity in Crocosphaera is a dramatic contrast to sympatric species of Prochlorococcus and Synechococcus, and raises the question of how genome differences can explain observed phenotypic diversity among Crocosphaera strains. Here we show, through whole genome comparisons of two phenotypically different strains, that there are strain-specific sequences in each genome, and numerous genome rearrangements, despite exceptionally low sequence diversity in shared genomic regions. Some of the strain-specific sequences encode functions that explain observed phenotypic differences, such as exopolysaccharide biosynthesis. The pattern of strain-specific sequences distributed throughout the genomes, along with rearrangements in shared sequences is evidence of significant genetic mobility that may be attributed to the hundreds of transposase genes found in both strains. Furthermore, such genetic mobility appears to be the main mechanism of strain divergence in Crocosphaera which do not accumulate DNA microheterogeneity over the vast majority of their genomes. The strain-specific sequences found in this study provide tools for future physiological studies, as well as genetic markers to help determine the relative abundance of phenotypes in natural populations.

  5. Adenoid cystic breast carcinoma: high rates of margin positivity after breast conserving surgery. (United States)

    Hodgson, Nicole C; Lytwyn, Alice; Bacopulos, Sarah; Elavathil, Leela


    Adenoid cystic carcinoma of the breast (ACCB) is a rare malignancy with favorable prognosis: axillary lymph node involvement, distant metastases, and death due to disease are uncommon. ACCB may recur locally many years after primary surgical excision and may be substantially higher if primary procedure is lumpectomy rather than mastectomy. Pathology database searched to identify patients diagnosed with ACCB between 1988 and 2007 at Hamilton Health Sciences Centre, Hamilton, Ontario, Canada.Two pathologists independently reviewed histology to confirm diagnosis of ACCB, and documented surgical procedure, tumor size, tumor grade, surgical margin, and lymph node status. Immunohistochemistry was performed on representative blocks and independently reviewed by 2 pathologists. Clinical and radiologic data were retrospectively reviewed. Fifteen cases of ACCB were identified and pathology slides were available for 12. The median age was 62 years. Seven patients presented with a palpable mass and breast pain was described in 3. Positive surgical margins were identified in 5 patients (42%). Only 3 patients had postoperative radiation therapy. Our series shows frequent resection margin involvement in ACCB. Neither clinical nor mammographic examination consistently delineated full tumor extent preoperatively. Future use of magnetic resonance imaging in preoperative assessment may prevent high positive margin rate when lumpectomy is planned. Histologic assessment of tumor extent may be difficult, but immunohistochemistry may be helpful in this regard.

  6. Genomic analysis of six new Geobacillus strains reveals highly conserved carbohydrate degradation architectures and strategies

    Directory of Open Access Journals (Sweden)

    Phillip eBrumm


    Full Text Available In this work we report the whole genome sequences of six new Geobacillus xylanolytic strains along with the genomic analysis of their capability to degrade carbohydrates.. The six sequenced Geobacillus strains described here have a range of GC contents from 43.9% to 52.5% and clade with named Geobacillus species throughout the entire genus. We have identified a ~200 kb unique super-cluster in all six strains, containing five to eight distinct carbohydrate degradation clusters in a single genomic region, a feature not seen in other genera. The Geobacillus strains rely on a small number of secreted enzymes located within distinct clusters for carbohydrate utilization, in contrast to most biomass-degrading organisms which contain numerous secreted enzymes located randomly throughout the genomes. All six strains are able to utilize fructose, arabinose, xylose, mannitol, gluconate, xylan, and α-1,6-glucosides. The gene clusters for utilization of these seven substrates have identical organization and the individual proteins have a high percent identity to their homologs. The strains show significant differences in their ability to utilize inositol, sucrose, lactose, α-mannosides, α-1,4-glucosides and arabinan.

  7. Expression and genomic analysis of midasin, a novel and highly conserved AAA protein distantly related to dynein

    Directory of Open Access Journals (Sweden)

    Gibbons I R


    Full Text Available Abstract Background The largest open reading frame in the Saccharomyces genome encodes midasin (MDN1p, YLR106p, an AAA ATPase of 560 kDa that is essential for cell viability. Orthologs of midasin have been identified in the genome projects for Drosophila, Arabidopsis, and Schizosaccharomyces pombe. Results Midasin is present as a single-copy gene encoding a well-conserved protein of ~600 kDa in all eukaryotes for which data are available. In humans, the gene maps to 6q15 and encodes a predicted protein of 5596 residues (632 kDa. Sequence alignments of midasin from humans, yeast, Giardia and Encephalitozoon indicate that its domain structure comprises an N-terminal domain (35 kDa, followed by an AAA domain containing six tandem AAA protomers (~30 kDa each, a linker domain (260 kDa, an acidic domain (~70 kDa containing 35–40% aspartate and glutamate, and a carboxy-terminal M-domain (30 kDa that possesses MIDAS sequence motifs and is homologous to the I-domain of integrins. Expression of hemagglutamin-tagged midasin in yeast demonstrates a polypeptide of the anticipated size that is localized principally in the nucleus. Conclusions The highly conserved structure of midasin in eukaryotes, taken in conjunction with its nuclear localization in yeast, suggests that midasin may function as a nuclear chaperone and be involved in the assembly/disassembly of macromolecular complexes in the nucleus. The AAA domain of midasin is evolutionarily related to that of dynein, but it appears to lack a microtubule-binding site.

  8. based conservation

    African Journals Online (AJOL) Increasing women's par- ticipation in community- based conservation: key to success? Ensuring that both men and women benefit equitably from conservation and development programs is likely to increase the long-term success of both conservation and development goals. However ...

  9. Energy audit of three energy-conserving devices in a steel industry demonstration program. Task III. GTE high temperature recuperation

    Energy Technology Data Exchange (ETDEWEB)

    Holden, F.C.; Hoffman, A.O.; Lownie, H.W.


    The Office of Industrial Programs of the Department of Energy has undertaken a program to demonstrate to industry the benefits of installing various energy-conserving devices and equipment. This report presents results on one of those systems, a high-temperature ceramic recuperator designed and manufactured by Sylvania Chemical and Metallurgical Division, GTE Products Corporation of Towanda, Pennsylvania. The ceramic cross-flow recuperator unit recovers waste heat from the hot combustion gases and delivers preheated air to high-temperature burners of various manufacture. Of the 38 host site installations included in the program, sufficient operating data were obtained from 28 sites to evaluate the benefits in terms of energy and economic savings that can be achieved. Performance and cost data are analyzed and presented for those 28 installations, which covered a variety of applications, sizes, and industry types. Except for 5 sites where unusual operating or data-collection problems were encountered, the improvements in performance of the recuperated furnaces equalled or exceeded estimates; the average of the total fuel savings for these 23 sites was 44.0 percent, some portion of which resulted from furnace improvements other than recuperation. Payback times were calculated for both total costs and for recuperator-related costs, using a cumulative annual after-tax cash flow method which includes tax investment credits, estimates of general and fuel-price inflation, and maintenance costs.

  10. A highly conserved epitope-vaccine candidate against varicella-zoster virus induces neutralizing antibodies in mice. (United States)

    Zhu, Rui; Liu, Jian; Chen, Chunye; Ye, Xiangzhong; Xu, Longfa; Wang, Wei; Zhao, Qinjian; Zhu, Hua; Cheng, Tong; Xia, Ningshao


    Varicella-zoster virus (VZV) is a highly infectious agent of varicella and herpes zoster (HZ). Vaccination is by far the most effective way to prevent these diseases. More safe, stable and efficient vaccines, such as epitope-based vaccines, now have been increasingly investigated by many researchers. However, only a few VZV neutralizing epitopes have been identified to date. We have previously identified a linear epitope between amino acid residues 121 and 135 of gE. In this study, we validated that this epitope is highly conserved amongst different VZV strains that covered five existing phylogenetic clades with an identity of 100%. We evaluated the immunogenicity of the recombinant hepatitis B virus core (HBc) virus-like particles (VLPs) which included amino acids (121-135). VZV-gE-specific antibodies were detected in immunized mouse serum using ELISA. The anti-peptide antiserum positively detected VZV via Western blot and immunofluorescent staining assays. More importantly, these peptides could neutralize VZV, indicating that these peptides represented neutralizing epitopes. These findings have important implications for the development of epitope-based protective VZV vaccines. Copyright © 2016 Elsevier Ltd. All rights reserved.

  11. A Web-Based GIS for Reporting Water Usage in the High Plains Underground Water Conservation District (United States)

    Jia, M.; Deeds, N.; Winckler, M.


    The High Plains Underground Water Conservation District (HPWD) is the largest and oldest of the Texas water conservation districts, and oversees approximately 1.7 million irrigated acres. Recent rule changes have motivated HPWD to develop a more automated system to allow owners and operators to report well locations, meter locations, meter readings, the association between meters and wells, and contiguous acres. INTERA, Inc. has developed a web-based interactive system for HPWD water users to report water usage and for the district to better manage its water resources. The HPWD web management system utilizes state-of-the-art GIS techniques, including cloud-based Amazon EC2 virtual machine, ArcGIS Server, ArcSDE and ArcGIS Viewer for Flex, to support web-based water use management. The system enables users to navigate to their area of interest using a well-established base-map and perform a variety of operations and inquiries against their spatial features. The application currently has six components: user privilege management, property management, water meter registration, area registration, meter-well association and water use report. The system is composed of two main databases: spatial database and non-spatial database. With the help of Adobe Flex application at the front end and ArcGIS Server as the middle-ware, the spatial feature geometry and attributes update will be reflected immediately in the back end. As a result, property owners, along with the HPWD staff, collaborate together to weave the fabric of the spatial database. Interactions between the spatial and non-spatial databases are established by Windows Communication Foundation (WCF) services to record water-use report, user-property associations, owner-area associations, as well as meter-well associations. Mobile capabilities will be enabled in the near future for field workers to collect data and synchronize them to the spatial database. The entire solution is built on a highly scalable cloud

  12. Genetic diversity and genetic structure of an endemic Mexican Dusky Rattlesnake (Crotalus triseriatus) in a highly modified agricultural landscape: implications for conservation. (United States)

    Sunny, Armando; Monroy-Vilchis, Octavio; Zarco-González, Martha M; Mendoza-Martínez, Germán David; Martínez-Gómez, Daniel


    It is necessary to determine genetic diversity of fragmented populations in highly modified landscapes to understand how populations respond to land-use change. This information will help guide future conservation and management strategies. We conducted a population genetic study on an endemic Mexican Dusky Rattlesnake (Crotalus triseriatus) in a highly modified landscape near the Toluca metropolitan area, in order to provide crucial information for the conservation of this species. There was medium levels of genetic diversity, with a few alleles and genotypes. We identified three genetically differentiated clusters, likely as a result of different habitat cover type. We also found evidence of an ancestral genetic bottleneck and medium values of effective population size. Inbreeding coefficients were low and there was a moderate gene flow. Our results can be used as a basis for future research and C. triseriatus conservation efforts, particularly considering that the Trans-Mexican Volcanic Belt is heavily impacted by destructive land-use practices.

  13. Sialic acid mediated transcriptional modulation of a highly conserved sialometabolism gene cluster in Haemophilus influenzae and its effect on virulence

    Directory of Open Access Journals (Sweden)

    Moxon Richard


    Full Text Available Abstract Background Sialic acid has been shown to be a major virulence determinant in the pathogenesis of otitis media caused by the bacterium Haemophilus influenzae. This study aimed to characterise the expression of genes required for the metabolism of sialic acid and to investigate the role of these genes in virulence. Results Using qRT-PCR, we observed decreased transcriptional activity of genes within a cluster that are required for uptake and catabolism of 5-acetyl neuraminic acid (Neu5Ac, when bacteria were cultured in the presence of the sugar. We show that these uptake and catabolic genes, including a sialic acid regulatory gene (siaR, are highly conserved in the H. influenzae natural population. Mutant strains were constructed for seven of the nine genes and their influence upon LPS sialylation and resistance of the bacteria to the killing effect of normal human serum were assessed. Mutations in the Neu5Ac uptake (TRAP transporter genes decreased virulence in the chinchilla model of otitis media, but the attenuation was strain dependent. In contrast, mutations in catabolism genes and genes regulating sialic acid metabolism (siaR and crp did not attenuate virulence. Conclusion The commensal and pathogenic behaviour of H. influenzae involves LPS sialylation that can be influenced by a complex regulatory interplay of sialometabolism genes.

  14. A missense mutation in a highly conserved alternate exon of dynamin-1 causes epilepsy in fitful mice.

    Directory of Open Access Journals (Sweden)

    Rebecca M Boumil


    Full Text Available Dynamin-1 (Dnm1 encodes a large multimeric GTPase necessary for activity-dependent membrane recycling in neurons, including synaptic vesicle endocytosis. Mice heterozygous for a novel spontaneous Dnm1 mutation--fitful--experience recurrent seizures, and homozygotes have more debilitating, often lethal seizures in addition to severe ataxia and neurosensory deficits. Fitful is a missense mutation in an exon that defines the DNM1a isoform, leaving intact the alternatively spliced exon that encodes DNM1b. The expression of the corresponding alternate transcripts is developmentally regulated, with DNM1b expression highest during early neuronal development and DNM1a expression increasing postnatally with synaptic maturation. Mutant DNM1a does not efficiently self-assemble into higher order complexes known to be necessary for proper dynamin function, and it also interferes with endocytic recycling in cell culture. In mice, the mutation results in defective synaptic transmission characterized by a slower recovery from depression after trains of stimulation. The DNM1a and DNM1b isoform pair is highly conserved in vertebrate evolution, whereas invertebrates have only one isoform. We speculate that the emergence of more specialized forms of DNM1 may be important in organisms with complex neuronal function.

  15. The master switchers in the aging of cardiovascular system, reverse senescence by microRNA signatures; as highly conserved molecules. (United States)

    Pourrajab, Fatemeh; Vakili Zarch, Abbas; Hekmatimoghaddam, Seyedhossein; Zare-Khormizi, Mohamad Reza


    The incidence of CVD increases with aging, because of long-term exposure to risk factors/stressors. Aging is a complex biological process resulting in progressive loss of physiological integrity, leading to impaired function and increased vulnerability to death. The main hallmarks of aging are cellular senescence, stem cell exhaustion, and altered intracellular communication. The major hallmarks of senescence are mitochondrial dysfunction, genomic instability, telomere attrition and epigenetic alterations, all of which contributing to cellular aging. Such events are controls by a family of small, non-coding RNAs (miRNAs) that interact with component of cellular senescence pathway; mitochondrial biogenesis/removal, DNA damage response machinery and IGF-1 signaling pathway. Here, we review recent in vivo/in vitro reports that miRNAs are key modulators of heart senescence, and act as master switchers to influence reprogramming pathway. We discuss evidence that abrupt deregulation of some mit-miRNAs governing senescence programs underlies age-associated CVD. In particular, due to the highly conserved nature and well-recognized target sites, miRNAs have been defined as master switchers in controlling heart progenitor cell biology. Modulation of mit-miRNA expression holds the great promise in switching off/on cellular senescence/reprogramming to rejuvenate stem cells to aid regenerative process. Copyright © 2015 Elsevier Ltd. All rights reserved.

  16. Comparative Mitogenomics of the Genus Odontobutis (Perciformes: Gobioidei: Odontobutidae) Revealed Conserved Gene Rearrangement and High Sequence Variations. (United States)

    Ma, Zhihong; Yang, Xuefen; Bercsenyi, Miklos; Wu, Junjie; Yu, Yongyao; Wei, Kaijian; Fan, Qixue; Yang, Ruibin


    To understand the molecular evolution of mitochondrial genomes (mitogenomes) in the genus Odontobutis, the mitogenome of Odontobutis yaluensis was sequenced and compared with those of another four Odontobutis species. Our results displayed similar mitogenome features among species in genome organization, base composition, codon usage, and gene rearrangement. The identical gene rearrangement of trnS-trnL-trnH tRNA cluster observed in mitogenomes of these five closely related freshwater sleepers suggests that this unique gene order is conserved within Odontobutis. Additionally, the present gene order and the positions of associated intergenic spacers of these Odontobutis mitogenomes indicate that this unusual gene rearrangement results from tandem duplication and random loss of large-scale gene regions. Moreover, these mitogenomes exhibit a high level of sequence variation, mainly due to the differences of corresponding intergenic sequences in gene rearrangement regions and the heterogeneity of tandem repeats in the control regions. Phylogenetic analyses support Odontobutis species with shared gene rearrangement forming a monophyletic group, and the interspecific phylogenetic relationships are associated with structural differences among their mitogenomes. The present study contributes to understanding the evolutionary patterns of Odontobutidae species.

  17. Highly conserved serine residue 40 in HIV-1 p6 regulates capsid processing and virus core assembly

    Directory of Open Access Journals (Sweden)

    Solbak Sara MØ


    Full Text Available Abstract Background The HIV-1 p6 Gag protein regulates the final abscission step of nascent virions from the cell membrane by the action of two late assembly (L- domains. Although p6 is located within one of the most polymorphic regions of the HIV-1 gag gene, the 52 amino acid peptide binds at least to two cellular budding factors (Tsg101 and ALIX, is a substrate for phosphorylation, ubiquitination, and sumoylation, and mediates the incorporation of the HIV-1 accessory protein Vpr into viral particles. As expected, known functional domains mostly overlap with several conserved residues in p6. In this study, we investigated the importance of the highly conserved serine residue at position 40, which until now has not been assigned to any known function of p6. Results Consistently with previous data, we found that mutation of Ser-40 has no effect on ALIX mediated rescue of HIV-1 L-domain mutants. However, the only feasible S40F mutation that preserves the overlapping pol open reading frame (ORF reduces virus replication in T-cell lines and in human lymphocyte tissue cultivated ex vivo. Most intriguingly, L-domain mediated virus release is not dependent on the integrity of Ser-40. However, the S40F mutation significantly reduces the specific infectivity of released virions. Further, it was observed that mutation of Ser-40 selectively interferes with the cleavage between capsid (CA and the spacer peptide SP1 in Gag, without affecting cleavage of other Gag products. This deficiency in processing of CA, in consequence, led to an irregular morphology of the virus core and the formation of an electron dense extra core structure. Moreover, the defects induced by the S40F mutation in p6 can be rescued by the A1V mutation in SP1 that generally enhances processing of the CA-SP1 cleavage site. Conclusions Overall, these data support a so far unrecognized function of p6 mediated by Ser-40 that occurs independently of the L-domain function, but selectively

  18. Hepatic Long Intergenic Noncoding RNAs: High Promoter Conservation and Dynamic, Sex-Dependent Transcriptional Regulation by Growth Hormone. (United States)

    Melia, Tisha; Hao, Pengying; Yilmaz, Feyza; Waxman, David J


    Long intergenic noncoding RNAs (lincRNAs) are increasingly recognized as key chromatin regulators, yet few studies have characterized lincRNAs in a single tissue under diverse conditions. Here, we analyzed 45 mouse liver RNA sequencing (RNA-Seq) data sets collected under diverse conditions to systematically characterize 4,961 liver lincRNAs, 59% of them novel, with regard to gene structures, species conservation, chromatin accessibility, transcription factor binding, and epigenetic states. To investigate the potential for functionality, we focused on the responses of the liver lincRNAs to growth hormone stimulation, which imparts clinically relevant sex differences to hepatic metabolism and liver disease susceptibility. Sex-biased expression characterized 247 liver lincRNAs, with many being nuclear RNA enriched and regulated by growth hormone. The sex-biased lincRNA genes are enriched for nearby and correspondingly sex-biased accessible chromatin regions, as well as sex-biased binding sites for growth hormone-regulated transcriptional activators (STAT5, hepatocyte nuclear factor 6 [HNF6], FOXA1, and FOXA2) and transcriptional repressors (CUX2 and BCL6). Repression of female-specific lincRNAs in male liver, but not that of male-specific lincRNAs in female liver, was associated with enrichment of H3K27me3-associated inactive states and poised (bivalent) enhancer states. Strikingly, we found that liver-specific lincRNA gene promoters are more highly species conserved and have a significantly higher frequency of proximal binding by liver transcription factors than liver-specific protein-coding gene promoters. Orthologs for many liver lincRNAs were identified in one or more supraprimates, including two rat lincRNAs showing the same growth hormone-regulated, sex-biased expression as their mouse counterparts. This integrative analysis of liver lincRNA chromatin states, transcription factor occupancy, and growth hormone regulation provides novel insights into the

  19. Biodiversity Conservation in Asia


    Dale Squires


    Asian's remarkable economic growth brought many benefits but also fuelled threats to its ecosystems and biodiversity. Economic growth brings biodiversity threats but also conservation opportunities. Continued biodiversity loss is inevitable, but the types, areas and rates of biodiversity loss are not. Prioritising biodiversity conservation, tempered by what is tractable, remains a high priority. Policy and market distortions and failures significantly underprice biodiversity, undermine ecosys...

  20. Surgical versus conservative treatment for high-risk stress fractures of the lower leg (anterior tibial cortex, navicular and fifth metatarsal base): a systematic review

    NARCIS (Netherlands)

    Mallee, W.H.; Weel, H.; van Dijk, C.N.; van Tulder, M.W.; Kerkhoffs, G.M.; Lin, C.W.C.


    Aim To compare surgical and conservative treatment for high-risk stress fractures of the anterior tibial cortex, navicular and proximal fifth metatarsal. Methods Systematic searches of CENTRAL, MEDLINE, EMBASE, CINAHL, SPORTDiscus and PEDro were performed to identify relevant prospective and

  1. Comparing the cost-effectiveness of water conservation policies in a depleting aquifer:A dynamic analysis of the Kansas High Plains (United States)

    This research analyzes two groundwater conservation policies in the Kansas High Plains located within the Ogallala aquifer: 1) cost-share assistance to increase irrigation efficiency; and 2) incentive payments to convert irrigated crop production to dryland crop production. To compare the cost-effec...

  2. Phosphocholine-containing, zwitterionic glycosphingolipids of adult Onchocerca volvulus as highly conserved antigenic structures of parasitic nematodes. (United States)

    Wuhrer, M; Rickhoff, S; Dennis, R D; Lochnit, G; Soboslay, P T; Baumeister, S; Geyer, R


    Human Onchocerca volvulus infection sera were found to recognize zwitterionic glycolipids of O. volvulus and to cross-react with those of other parasitic nematodes (Ascaris suum, Setaria digitata and Litomosoides sigmodontis). By the use of an epitope-specific monoclonal antibody, zwitterionic glycolipids of all these nematode species were observed to contain the antigenic determinant phosphocholine. A hyperimmune serum specific for arthro-series glycolipid structures reacted with the various neutral glycolipids of all these nematodes, which demonstrated that their oligosaccharide moieties belonged to the arthro-series of protostomial glycolipids. These results indicated that arthro-series glycosphingolipids carrying, in part, phosphocholine substituents, represent highly conserved, antigenic glycolipid markers of parasitic nematodes. Three glycolipid components of the O. volvulus zwitterionic fraction were structurally characterized by matrix-assisted laser-desorption/ionization time-of-flight MS, methylation analysis and exoglycosidase treatment. Their chemical structures were elucidated to be phosphocholine-6GlcNAc(beta1-3)Man(beta1-4)Glc(1-1)ceramide, GalNAc(beta1-4)[phosphocholine-6]GlcNAc(beta1-3)Man(beta1-4)Glc(1-1) ceramide and Gal(alpha1-3)GalNAc(beta1-4)[phosphocholine-6]GlcNAc(beta1-3)Man(beta 1-4)Glc(1-1)ceramide for the zwitterionic ceramide tri-, tetra- and penta-hexosides respectively. The ceramide composition was found to be dominated by 2-hydroxylated docosanoic (C(22h:0)), tricosanoic (C(23h:0)) and tetracosanoic (C(24h:0)) acids, and C(17) sphingosine (C(d17:1)) (where (h) is hydroxylated and (d) is dihydroxylated). PMID:10816437

  3. An insulator element located at the cyclin B1 interacting protein 1 gene locus is highly conserved among mammalian species. (United States)

    Yoshida, Wataru; Tomikawa, Junko; Inaki, Makoto; Kimura, Hiroshi; Onodera, Masafumi; Hata, Kenichiro; Nakabayashi, Kazuhiko


    Insulators are cis-elements that control the direction of enhancer and silencer activities (enhancer-blocking) and protect genes from silencing by heterochromatinization (barrier activity). Understanding insulators is critical to elucidate gene regulatory mechanisms at chromosomal domain levels. Here, we focused on a genomic region upstream of the mouse Ccnb1ip1 (cyclin B1 interacting protein 1) gene that was methylated in E9.5 embryos of the C57BL/6 strain, but unmethylated in those of the 129X1/SvJ and JF1/Ms strains. We hypothesized the existence of an insulator-type element that prevents the spread of DNA methylation within the 1.8 kbp segment, and actually identified a 242-bp and a 185-bp fragments that were located adjacent to each other and showed insulator and enhancer activities, respectively, in reporter assays. We designated these genomic regions as the Ccnb1ip1 insulator and the Ccnb1ip1 enhancer. The Ccnb1ip1 insulator showed enhancer-blocking activity in the luciferase assays and barrier activity in the colony formation assays. Further examination of the Ccnb1ip1 locus in other mammalian species revealed that the insulator and enhancer are highly conserved among a wide variety of species, and are located immediately upstream of the transcriptional start site of Ccnb1ip1. These newly identified cis-elements may be involved in transcriptional regulation of Ccnb1ip1, which is important in meiotic crossing-over and G2/M transition of the mitotic cell cycle.

  4. An Insulator Element Located at the Cyclin B1 Interacting Protein 1 Gene Locus Is Highly Conserved among Mammalian Species (United States)

    Yoshida, Wataru; Tomikawa, Junko; Inaki, Makoto; Kimura, Hiroshi; Onodera, Masafumi; Hata, Kenichiro; Nakabayashi, Kazuhiko


    Insulators are cis-elements that control the direction of enhancer and silencer activities (enhancer-blocking) and protect genes from silencing by heterochromatinization (barrier activity). Understanding insulators is critical to elucidate gene regulatory mechanisms at chromosomal domain levels. Here, we focused on a genomic region upstream of the mouse Ccnb1ip1 (cyclin B1 interacting protein 1) gene that was methylated in E9.5 embryos of the C57BL/6 strain, but unmethylated in those of the 129X1/SvJ and JF1/Ms strains. We hypothesized the existence of an insulator-type element that prevents the spread of DNA methylation within the 1.8 kbp segment, and actually identified a 242-bp and a 185-bp fragments that were located adjacent to each other and showed insulator and enhancer activities, respectively, in reporter assays. We designated these genomic regions as the Ccnb1ip1 insulator and the Ccnb1ip1 enhancer. The Ccnb1ip1 insulator showed enhancer-blocking activity in the luciferase assays and barrier activity in the colony formation assays. Further examination of the Ccnb1ip1 locus in other mammalian species revealed that the insulator and enhancer are highly conserved among a wide variety of species, and are located immediately upstream of the transcriptional start site of Ccnb1ip1. These newly identified cis-elements may be involved in transcriptional regulation of Ccnb1ip1, which is important in meiotic crossing-over and G2/M transition of the mitotic cell cycle. PMID:26110280

  5. Conservation of the S10-spc-alpha locus within otherwise highly plastic genomes provides phylogenetic insight into the genus Leptospira.

    Directory of Open Access Journals (Sweden)

    Berta Victoria

    Full Text Available S10-spc-alpha is a 17.5 kb cluster of 32 genes encoding ribosomal proteins. This locus has an unusual composition and organization in Leptospira interrogans. We demonstrate the highly conserved nature of this region among diverse Leptospira and show its utility as a phylogenetically informative region. Comparative analyses were performed by PCR using primer sets covering the whole locus. Correctly sized fragments were obtained by PCR from all L. interrogans strains tested for each primer set indicating that this locus is well conserved in this species. Few differences were detected in amplification profiles between different pathogenic species, indicating that the S10-spc-alpha locus is conserved among pathogenic Leptospira. In contrast, PCR analysis of this locus using DNA from saprophytic Leptospira species and species with an intermediate pathogenic capacity generated varied results. Sequence alignment of the S10-spc-alpha locus from two pathogenic species, L. interrogans and L. borgpetersenii, with the corresponding locus from the saprophyte L. biflexa serovar Patoc showed that genetic organization of this locus is well conserved within Leptospira. Multilocus sequence typing (MLST of four conserved regions resulted in the construction of well-defined phylogenetic trees that help resolve questions about the interrelationships of pathogenic Leptospira. Based on the results of secY sequence analysis, we found that reliable species identification of pathogenic Leptospira is possible by comparative analysis of a 245 bp region commonly used as a target for diagnostic PCR for leptospirosis. Comparative analysis of Leptospira strains revealed that strain H6 previously classified as L. inadai actually belongs to the pathogenic species L. interrogans and that L. meyeri strain ICF phylogenetically co-localized with the pathogenic clusters. These findings demonstrate that the S10-spc-alpha locus is highly conserved throughout the genus and may be more

  6. A review of the allozyme data set for the Canarian endemic flora: causes of the high genetic diversity levels and implications for conservation. (United States)

    Pérez de Paz, Julia; Caujapé-Castells, Juli


    Background and Aims Allozyme and reproductive data sets for the Canarian flora are updated in order to assess how the present levels and structuring of genetic variation have been influenced by the abiotic island traits and by phylogenetically determined biotic traits of the corresponding taxa; and in order to suggest conservation guidelines. Methods Kruskal-Wallis tests are conducted to assess the relationships of 27 variables with genetic diversity (estimated by A, P, Ho and He) and structuring (GST) of 123 taxa representing 309 populations and 16 families. Multiple linear regression analyses (MLRAs) are carried out to determine the relative influence of the less correlated significant abiotic and biotic factors on the genetic diversity levels. Key Results and Conclusions The interactions between biotic features of the colonizing taxa and the abiotic island features drive plant diversification in the Canarian flora. However, the lower weight of closeness to the mainland than of (respectively) high basic chromosome number, partial or total self-incompatibility and polyploidy in the MLRAs indicates substantial phylogenetic constraint; the importance of a high chromosome number is feasibly due to the generation of a larger number of linkage groups, which increase gametic and genotypic diversity. Genetic structure is also more influenced by biotic factors (long-range seed dispersal, basic chromosome number and partial or total self-incompatibility) than by distance to the mainland. Conservation-wise, genetic structure estimates (FST/GST) only reflect endangerment under intensive population sampling designs, and neutral genetic variation levels do not directly relate to threat status or to small population sizes. Habitat protection is emphasized, but the results suggest the need for urgent implementation of elementary reproductive studies in all cases, and for ex situ conservation measures for the most endangered taxa, even without prior studies. In non

  7. The maize INDETERMINATE1 flowering time regulator defines a highly conserved zinc finger protein family in higher plants

    Directory of Open Access Journals (Sweden)

    Colasanti Joseph


    Full Text Available Abstract Background The maize INDETERMINATE1 gene, ID1, is a key regulator of the transition to flowering and the founding member of a transcription factor gene family that encodes a protein with a distinct arrangement of zinc finger motifs. The zinc fingers and surrounding sequence make up the signature ID domain (IDD, which appears to be found in all higher plant genomes. The presence of zinc finger domains and previous biochemical studies showing that ID1 binds to DNA suggests that members of this gene family are involved in transcriptional regulation. Results Comparison of IDD genes identified in Arabidopsis and rice genomes, and all IDD genes discovered in maize EST and genomic databases, suggest that ID1 is a unique member of this gene family. High levels of sequence similarity amongst all IDD genes from maize, rice and Arabidopsis suggest that they are derived from a common ancestor. Several unique features of ID1 suggest that it is a divergent member of the maize IDD family. Although no clear ID1 ortholog was identified in the Arabidopsis genome, highly similar genes that encode proteins with identity extending beyond the ID domain were isolated from rice and sorghum. Phylogenetic comparisons show that these putative orthologs, along with maize ID1, form a group separate from other IDD genes. In contrast to ID1 mRNA, which is detected exclusively in immature leaves, several maize IDD genes showed a broad range of expression in various tissues. Further, Western analysis with an antibody that cross-reacts with ID1 protein and potential orthologs from rice and sorghum shows that all three proteins are detected in immature leaves only. Conclusion Comparative genomic analysis shows that the IDD zinc finger family is highly conserved among both monocots and dicots. The leaf-specific ID1 expression pattern distinguishes it from other maize IDD genes examined. A similar leaf-specific localization pattern was observed for the putative ID1 protein

  8. Reshaping conservation

    DEFF Research Database (Denmark)

    Funder, Mikkel; Danielsen, Finn; Ngaga, Yonika


    members strengthen the monitoring practices to their advantage, and to some extent move them beyond the reach of government agencies and conservation and development practitioners. This has led to outcomes that are of greater social and strategic value to communities than the original 'planned' benefits......, although the monitoring scheme has also to some extent become dominated by local 'conservation elites' who negotiate the terrain between the state and other community members. Our findings suggest that we need to move beyond simplistic assumptions of community strategies and incentives in participatory...... conservation and allow for more adaptive and politically explicit governance spaces in protected area management....

  9. A pathway for low zinc homeostasis that is conserved in animals and acts in parallel to the pathway for high zinc homeostasis. (United States)

    Dietrich, Nicholas; Schneider, Daniel L; Kornfeld, Kerry


    The essential element zinc plays critical roles in biology. High zinc homeostasis mechanisms are beginning to be defined in animals, but low zinc homeostasis is poorly characterized. We investigated low zinc homeostasis in Caenorhabditis elegans because the genome encodes 14 evolutionarily conserved Zrt, Irt-like protein (ZIP) zinc transporter family members. Three C. elegans zipt genes were regulated in zinc-deficient conditions; these promoters contained an evolutionarily conserved motif that we named the low zinc activation (LZA) element that was both necessary and sufficient for activation of transcription in response to zinc deficiency. These results demonstrated that the LZA element is a critical part of the low zinc homeostasis pathway. Transcriptional regulation of the LZA element required the transcription factor ELT-2 and mediator complex member MDT-15. We investigated conservation in mammals by analyzing LZA element function in human cultured cells; the LZA element-mediated transcriptional activation in response to zinc deficiency in cells, suggesting a conserved pathway of low zinc homeostasis. We propose that the pathway for low zinc homeostasis, which includes the LZA element and ZIP transporters, acts in parallel to the pathway for high zinc homeostasis, which includes the HZA element, HIZR-1 transcription factor and cation diffusion facilitator transporters. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  10. "Toward High School Biology": Helping Middle School Students Understand Chemical Reactions and Conservation of Mass in Nonliving and Living Systems (United States)

    Herrmann-Abell, Cari F.; Koppal, Mary; Roseman, Jo Ellen


    Modern biology has become increasingly molecular in nature, requiring students to understand basic chemical concepts. Studies show, however, that many students fail to grasp ideas about atom rearrangement and conservation during chemical reactions or the application of these ideas to biological systems. To help provide students with a better…

  11. Implementing Community-Based Comprehensive Sexuality Education with High-Risk Youth in a Conservative Environment: Lessons Learned (United States)

    Secor-Turner, Molly; Randall, Brandy A.; Christensen, Katie; Jacobson, Amy; Loyola Meléndez, Migdalia


    Although comprehensive sexuality education programmes have the potential to improve the sexual health and well-being of young people, many socially conservative rural states in the USA have laws and policies restricting school-based comprehensive sexuality education and supporting abstinence-only education. This paper describes the process of…

  12. Structural organization of essential iron-sulfur clusters in the evolutionarily highly conserved ATP-binding cassette protein ABCE1

    NARCIS (Netherlands)

    Barthelme, Dominik; Scheele, Urte; Dinkelaker, Stephanie; Janoschka, Adam; MacMillan, Fraser; Albers, Sonja-Verena; Driessen, Arnold J. M.; Stagni, Marco Salamone; Bill, Eckhard; Meyer-Klaucke, Wolfram; Schuenemann, Volker; Tampe, Robert; Schünemann, Volker


    The ABC protein ABCE1, formerly named RNase L inhibitor RLI1, is one of the most conserved proteins in evolution and is expressed in all organisms except eubacteria. Because of its fundamental role in translation initiation and/or ribosome biosynthesis, ABCE1 is essential for life. Its molecular

  13. Hearing Conservation (United States)


    the federal standard. Footnote** See Title 29 Code of Federal Regulations (CFR) 1910.95 "Occupational Noise Exposure." (Back to text) | USDOL | CONTACT INFORMATION | DISCLAIMER | 15 of 15 OSHA 3074 - Hearing Conservation

  14. Wildlife Conservation


    Spash, Clive L.; Aldred, Jonathan


    In this paper we consider how conservation has arisen as a key aspect of the reaction to human-initiated degradation and disappearance of ecosystems, wild lands. and wildlife. Concern over species extinction is given an historical perspective which shows the way in which pressure on wild and natural aspects of global ecology have changed in recent centuries. The role of conservation in the struggle to protect the environment is then analysed using underlying ethical arguments behind the econo...

  15. Austere conservation

    DEFF Research Database (Denmark)

    Bluwstein, Jevgeniy; Moyo, Francis; Kicheleri, Rose Peter


    . Our findings suggest that WMAs foster very limited ownership, participation and collective action at the community level, because WMA governance follows an austere logic of centralized control over key resources. Thus, we suggest that it is difficult to argue that WMAs are community-owned conservation...... initiatives until a genuinely devolved and more flexible conservation model is implemented to give space for popular participation in rule-making....

  16. A zebrafish screen for craniofacial mutants identifies wdr68 as a highly conserved gene required for endothelin-1 expression

    Directory of Open Access Journals (Sweden)

    Amsterdam Adam


    identification of approximately 25% of the essential genes required for craniofacial development. The identification of zebrafish models for two human disease syndromes indicates that homologs to the other genes are likely to also be relevant for human craniofacial development. The initial characterization of wdr68 suggests an important role in craniofacial development for the highly conserved Wdr68-Dyrk1 protein complexes.

  17. Targeting of highly conserved Dengue virus sequences with anti-Dengue virus trans-splicing group I introns

    Directory of Open Access Journals (Sweden)

    Fraser Tresa S


    Full Text Available Abstract Background Dengue viruses (DENV are one of the most important viral diseases in the world with approximately 100 million infections and 200,000 deaths each year. The current lack of an approved tetravalent vaccine and ineffective insecticide control measures warrant a search for alternatives to effectively combat DENV. The trans-splicing variant of the Tetrahymena thermophila group I intron catalytic RNA, or ribozyme, is a powerful tool for post-transcriptional RNA modification. The nature of the ribozyme and the predictability with which it can be directed makes it a powerful tool for modifying RNA in nearly any cell type without the need for genome-altering gene therapy techniques or dependence on native cofactors. Results Several anti-DENV Group I trans-splicing introns (αDENV-GrpIs were designed and tested for their ability to target DENV-2 NGC genomes in situ. We have successfully targeted two different uracil bases on the positive sense genomic strand within the highly conserved 5'-3' cyclization sequence (CS region common to all serotypes of DENV with our αDENV-GrpIs. Our ribozymes have demonstrated ability to specifically trans-splice a new RNA sequence downstream of the targeted site in vitro and in transfected insect cells as analyzed by firefly luciferase and RT-PCR assays. The effectiveness of these αDENV-GrpIs to target infecting DENV genomes is also validated in transfected or transformed Aedes mosquito cell lines upon infection with unattenuated DENV-2 NGC. Conclusions Analysis shows that our αDENV-GrpIs have the ability to effectively trans-splice the DENV genome in situ. Notably, these results show that the αDENV-GrpI 9v1, designed to be active against all forms of Dengue virus, effectively targeted the DENV-2 NGC genome in a sequence specific manner. These novel αDENV-GrpI introns provide a striking alternative to other RNA based approaches for the transgenic suppression of DENV in transformed mosquito cells and

  18. Inhibitory control and visuo-spatial reversibility in Piaget’s seminal number conservation task: A high-density ERP study.

    Directory of Open Access Journals (Sweden)

    Gregoire eBorst


    Full Text Available The present high-density ERP study on 13 adults aimed to determine whether number conservation relies on the ability to inhibit the overlearned length-equals-number strategy and then imagine the shortening of the row that was lengthened. Participants performed the number-conservation task and, after the EEG session, the mental imagery task. In the number-conservation task, first two rows with the same number of tokens and the same length were presented on a computer screen (COV condition and then, the tokens in one of the two rows were spread apart (INT condition. Participants were instructed to determine whether the two rows had an identical number of tokens. In the mental imagery task, two rows with different lengths but the same number of tokens were presented and participants were instructed to imagine the tokens in the longer row aligning with the tokens in the shorter row. In the number-conservation task, we found that the amplitudes of the centro-parietal N2 and fronto-central P3 were higher in the INT than in the COV conditions. In addition, the differences in response times between the two conditions were correlated with the differences in the amplitudes of the fronto-central P3. In light of previous results reported on the number-conservation task in adults, the present results suggest that inhibition might be necessary to succeed the number-conservation task in adults even when the transformation of the length of one of the row is displayed. Finally, we also reported correlations between the speed at which participants could imagine the shortening of one of the row in the mental imagery task, the speed at which participants could determine that the two rows had the same number of tokens after the tokens in one of the row were spread apart and the latency of the late positive parietal component in the number-conservation task. Therefore, performing the number-conservation task might involve mental transformation processes in adults.

  19. Highly conserved elements discovered in vertebrates are present in non-syntenic loci of tunicates, act as enhancers and can be transcribed during development (United States)

    Sanges, Remo; Hadzhiev, Yavor; Gueroult-Bellone, Marion; Roure, Agnes; Ferg, Marco; Meola, Nicola; Amore, Gabriele; Basu, Swaraj; Brown, Euan R.; De Simone, Marco; Petrera, Francesca; Licastro, Danilo; Strähle, Uwe; Banfi, Sandro; Lemaire, Patrick; Birney, Ewan; Müller, Ferenc; Stupka, Elia


    Co-option of cis-regulatory modules has been suggested as a mechanism for the evolution of expression sites during development. However, the extent and mechanisms involved in mobilization of cis-regulatory modules remains elusive. To trace the history of non-coding elements, which may represent candidate ancestral cis-regulatory modules affirmed during chordate evolution, we have searched for conserved elements in tunicate and vertebrate (Olfactores) genomes. We identified, for the first time, 183 non-coding sequences that are highly conserved between the two groups. Our results show that all but one element are conserved in non-syntenic regions between vertebrate and tunicate genomes, while being syntenic among vertebrates. Nevertheless, in all the groups, they are significantly associated with transcription factors showing specific functions fundamental to animal development, such as multicellular organism development and sequence-specific DNA binding. The majority of these regions map onto ultraconserved elements and we demonstrate that they can act as functional enhancers within the organism of origin, as well as in cross-transgenesis experiments, and that they are transcribed in extant species of Olfactores. We refer to the elements as ‘Olfactores conserved non-coding elements’. PMID:23393190

  20. Conservation Research and Development/ New Ultra-Low Carbon High Strength Steels with Improved Bake Hardenability for Enhanced Stretch Formability and Dent Resistance

    Energy Technology Data Exchange (ETDEWEB)

    Anthony J. DeArdo; C. Isaac Garcia


    Conservation Research and Development/New Ultra-Low Carbon High Strength Steels with Improved Bake Hardenability for Enhanced Stretch Formability and Dent Resistance. The experimental work can be divided into four phases. In each phase, the materials were received or designed, processed and tested, to evaluate the BH increment or response, as a function of compositions and processing conditions. Microstructural characterization by various techniques was performed in order to gain insights into the mechanisms of flow stress increment by bake hardening.

  1. Reconciling nature conservation and traditional farming practices: a spatially explicit framework to assess the extent of High Nature Value farmlands in the European countryside. (United States)

    Lomba, Angela; Alves, Paulo; Jongman, Rob H G; McCracken, David I


    Agriculture constitutes a dominant land cover worldwide, and rural landscapes under extensive farming practices acknowledged due to high biodiversity levels. The High Nature Value farmland (HNVf) concept has been highlighted in the EU environmental and rural policies due to their inherent potential to help characterize and direct financial support to European landscapes where high nature and/or conservation value is dependent on the continuation of specific low-intensity farming systems. Assessing the extent of HNV farmland by necessity relies on the availability of both ecological and farming systems' data, and difficulties associated with making such assessments have been widely described across Europe. A spatially explicit framework of data collection, building out from local administrative units, has recently been suggested as a means of addressing such difficulties. This manuscript tests the relevance of the proposed approach, describes the spatially explicit framework in a case study area in northern Portugal, and discusses the potential of the approach to help better inform the implementation of conservation and rural development policies. Synthesis and applications: The potential of a novel approach (combining land use/cover, farming and environmental data) to provide more accurate and efficient mapping and monitoring of HNV farmlands is tested at the local level in northern Portugal. The approach is considered to constitute a step forward toward a more precise targeting of landscapes for agri-environment schemes, as it allowed a more accurate discrimination of areas within the case study landscape that have a higher value for nature conservation.

  2. The selective conservative management of small traumatic pneumothoraces following stab injuries is safe: experience from a high-volume trauma service in South Africa. (United States)

    Kong, V Y; Oosthuizen, G V; Clarke, D L


    The selective conservative management of small pneumothoraces (PTXs) following stab injuries is controversial. We reviewed a cohort of patients managed conservatively in a high volume trauma service in South Africa. A retrospective review over a 2-year period identified 125 asymptomatic patients with small PTXs measuring chest radiograph who were managed conservatively. Of the 125 patients included in the study, 92% were male (115/125), and the median age for all patients was 21 years (19-24). Ninety-seven per cent (121/125) of the weapons involved were knives, and 3% (4/125) were screwdrivers. Sixty-one per cent of all injuries were on the left side. Eighty-two per cent (102/125) sustained a single stab, and 18% (23/125) had multiple stabs. Thirty-nine per cent (49/125) had a PTX <0.5 cm (Group A), 26% (32/125) were ≥ 0.5 to <1 cm (Group B), 19% (24/125) were ≥ 1 to <1.5 cm (Group C) and 15% (20/125) were ≥ 1.5 to <2 cm (Group D). Three per cent of all patients (4/125) eventually required ICDs (one in Group C, three in Group D). All four patients had ICDs in situ for 24 h. The remaining 97% (121/125) were all managed successfully by active clinical observation alone. There were no subsequent readmissions, morbidity or mortality as a direct result of our conservative approach. The selective conservative management of asymptomatic small PTXs from stab injuries is safe if undertaken in the appropriate setting.

  3. Conservation endocrinology (United States)

    McCormick, Stephen; Romero, L. Michael


    Endocrinologists can make significant contributions to conservation biology by helping to understand the mechanisms by which organisms cope with changing environments. Field endocrine techniques have advanced rapidly in recent years and can provide substantial information on the growth, stress, and reproductive status of individual animals, thereby providing insight into current and future responses of populations to changes in the environment. Environmental stressors and reproductive status can be detected nonlethally by measuring a number of endocrine-related endpoints, including steroids in plasma, living and nonliving tissue, urine, and feces. Information on the environmental or endocrine requirements of individual species for normal growth, development, and reproduction will provide critical information for species and ecosystem conservation. For many taxa, basic information on endocrinology is lacking, and advances in conservation endocrinology will require approaches that are both “basic” and “applied” and include integration of laboratory and field approaches.

  4. Bioproduction and optimization of rosmarinic acid production in Solenostemon scutellarioides through media manipulation and conservation of high yielding clone via encapsulation. (United States)

    Sahu, Ranabir; Dewanjee, Saikat; Gangopadhyay, Moumita


    The present study describes the role of different exogenous phytohormones, polyamines and sucrose on growth and rosmarinic acid (RA) production in whole plant culture of Solenostemon scutellarioides. It was further aimed to conserve elite clones via synthetic seed technology. S. scutellarioides was treated either singly or in combination with different phytohormones. Cultures incubated with NAA (0.5 mg L(-1)) yielded the highest RA accumulation (g(-1FW)), but negatively affected the growth. So, overall RA content was insignificant. Cultures incubated with IBA, BAP and GA3 at low concentration significantly improved growth and RA bioaccumulation. In the combinatorial study, IBA+BAP+GA3 (0.5 mg L(-1) each) was found optimum for plant biomass and RA production (65.2% improvement of total RA). Amongst polyamines, putrescine (1 mg L(-1)) exhibited 20.4% improvement of total RA content. The intracellular RA accumulation (g(-1FW)) was significantly higher between 5 and 7% of sucrose concentrations. However, the total increase in RA content was inhibited due to deterioration of the culture with increasing sucrose concentration. Based on the effect of different treatments on growth and RA accumulation, a high yielding and stable plant line was selected for conservation via alginate encapsulation. Uniform shaped alginate coated synthetic seeds conserved up to 6 months exhibited high regeneration potential and RA content.

  5. Using evolutionary conserved modules in gene networks as a strategy to leverage high throughput gene expression queries.

    Directory of Open Access Journals (Sweden)

    Jeanne M Serb

    Full Text Available BACKGROUND: Large-scale gene expression studies have not yielded the expected insight into genetic networks that control complex processes. These anticipated discoveries have been limited not by technology, but by a lack of effective strategies to investigate the data in a manageable and meaningful way. Previous work suggests that using a pre-determined seed-network of gene relationships to query large-scale expression datasets is an effective way to generate candidate genes for further study and network expansion or enrichment. Based on the evolutionary conservation of gene relationships, we test the hypothesis that a seed network derived from studies of retinal cell determination in the fly, Drosophila melanogaster, will be an effective way to identify novel candidate genes for their role in mouse retinal development. METHODOLOGY/PRINCIPAL FINDINGS: Our results demonstrate that a number of gene relationships regulating retinal cell differentiation in the fly are identifiable as pairwise correlations between genes from developing mouse retina. In addition, we demonstrate that our extracted seed-network of correlated mouse genes is an effective tool for querying datasets and provides a context to generate hypotheses. Our query identified 46 genes correlated with our extracted seed-network members. Approximately 54% of these candidates had been previously linked to the developing brain and 33% had been previously linked to the developing retina. Five of six candidate genes investigated further were validated by experiments examining spatial and temporal protein expression in the developing retina. CONCLUSIONS/SIGNIFICANCE: We present an effective strategy for pursuing a systems biology approach that utilizes an evolutionary comparative framework between two model organisms, fly and mouse. Future implementation of this strategy will be useful to determine the extent of network conservation, not just gene conservation, between species and will

  6. Colorful Conservation (United States)

    Skophammer, Karen


    Some people only think about conservation on Earth Day. Being in the "art business" however, this author is always conscious of the many products she thinks get wasted when they could be reused, recycled, and restored--especially in a school building and art room. In this article, she describes an art lesson that allows students to paint…

  7. Creative conservation

    NARCIS (Netherlands)

    Bentham, Roelof J.


    The increasing exploitation of our natural resources, the unlimited occupation of ever more new areas, and the intensification of land-use, make it necessary for us to expand the concept of conservation. But we also need to reconsider that concept itself. For the changing conditions in the

  8. [Conservation Units. (United States)

    Texas Education Agency, Austin.

    Each of the six instructional units deals with one aspect of conservation: forests, water, rangeland, minerals (petroleum), and soil. The area of the elementary school curriculum with which each correlates is indicated. Lists of general and specific objectives are followed by suggested teaching procedures, including ideas for introducing the…

  9. Integrating conservation costs into sea level rise adaptive conservation prioritization

    Directory of Open Access Journals (Sweden)

    Mingjian Zhu


    Full Text Available Biodiversity conservation requires strategic investment as resources for conservation are often limited. As sea level rises, it is important and necessary to consider both sea level rise and costs in conservation decision making. In this study, we consider costs of conservation in an integrated modeling process that incorporates a geomorphological model (SLAMM, species habitat models, and conservation prioritization (Zonation to identify conservation priorities in the face of landscape dynamics due to sea level rise in the Matanzas River basin of northeast Florida. Compared to conservation priorities that do not consider land costs in the analysis process, conservation priorities that consider costs in the planning process change significantly. The comparison demonstrates that some areas with high conservation values might be identified as lower priorities when integrating economic costs in the planning process and some areas with low conservation values might be identified as high priorities when considering costs in the planning process. This research could help coastal resources managers make informed decisions about where and how to allocate conservation resources more wisely to facilitate biodiversity adaptation to sea level rise.

  10. The high-resolution structure of activated opsin reveals a conserved solvent network in the transmembrane region essential for activation (United States)

    Blankenship, Elise; Vahedi-Faridi, Ardeschir; Lodowski, David T.


    Rhodopsin, a light-activated G protein coupled receptor (GPCR), has been the subject of numerous biochemical and structural investigations, serving as a model receptor for GPCRs and their activation. Herein we present the 2.3 Å resolution structure of native-source rhodopsin stabilized in a conformation competent for G protein binding. An extensive water-mediated hydrogen bond network linking the chromophore binding site to the site of G protein binding is observed, providing connections to conserved motifs essential for GPCR activation. Comparison of this extensive solvent mediated hydrogen-bonding network to the positions of ordered solvent in earlier crystallographic structures of rhodopsin photointermediates reveals both static structural and dynamic functional water-protein interactions present during the activation process. When taken with observations that solvent occupies similar positions in the structures of other GPCRs, these analyses strongly support an integral role for this dynamic ordered water network in both rhodopsin and GPCR activation. PMID:26526852

  11. Exporting conservation




    Metadata only record Soil degradation represents a major threat to food security, particularly in mountainous regions of Southeast Asia, where rainfall can wash away inches of topsoil. This article presents conservation agriculture as a potential solution, focusing on the work that North Carolina Agricultural and Technical State University conducts in Southeast Asia in conjunction with regional partners as part of the Sustainable Agriculture and Natural Resource Management (SANREM) collabo...

  12. Identification and solution structure of a highly conserved C-terminal domain within ORF1p required for retrotransposition of long interspersed nuclear element-1. (United States)

    Januszyk, Kurt; Li, Patrick Wai-Lun; Villareal, Valerie; Branciforte, Dan; Wu, Haihong; Xie, Yongming; Feigon, Juli; Loo, Joseph A; Martin, Sandra L; Clubb, Robert T


    Long interspersed nuclear element-1 (LINE-1 or L1) retrotransposons comprise a large fraction of the human and mouse genomes. The mobility of these successful elements requires the protein encoded by open reading frame-1 (ORF1p), which binds single-stranded RNA with high affinity and functions as a nucleic acid chaperone. In this report, we have used limited proteolysis, filter binding, and NMR spectroscopy to characterize the global structure of ORF1p and the three-dimensional structure of a highly conserved RNA binding domain. ORF1p contains three structured regions, a coiled-coil domain, a middle domain of unknown function, and a C-terminal domain (CTD). We show that high affinity RNA binding by ORF1p requires the CTD and residues within an amino acid protease-sensitive segment that joins the CTD to the middle domain. Insights in the mechanism of RNA binding were obtained by determining the solution structure of the CTD, which is shown to adopt a novel fold consisting of a three-stranded beta sheet that is packed against three alpha-helices. An RNA binding surface on the CTD has been localized using chemical shift perturbation experiments and is proximal to residues previously shown to be essential for retrotransposition, RNA binding, and chaperone activity. A similar structure and mechanism of RNA binding is expected for all vertebrate long interspersed nuclear element-1 elements, since residues encoding the middle, protease-sensitive segment, and CTD are highly conserved.

  13. Computational analysis and determination of a highly conserved surface exposed segment in H5N1 avian flu and H1N1 swine flu neuraminidase

    Directory of Open Access Journals (Sweden)

    Nandy Ashesh


    Full Text Available Abstract Background Catalytic activity of influenza neuraminidase (NA facilitates elution of progeny virions from infected cells and prevents their self-aggregation mediated by the catalytic site located in the body region. Research on the active site of the molecule has led to development of effective inhibitors like oseltamivir, zanamivir etc, but the high rate of mutation and interspecies reassortment in viral sequences and the recent reports of oseltamivir resistant strains underlines the importance of determining additional target sites for developing future antiviral compounds. In a recent computational study of 173 H5N1 NA gene sequences we had identified a 50-base highly conserved region in 3'-terminal end of the NA gene. Results We extend the graphical and numerical analyses to a larger number of H5N1 NA sequences (514 and H1N1 swine flu sequences (425 accessed from GenBank. We use a 2D graphical representation model for the gene sequences and a Graphical Sliding Window Method (GSWM for protein sequences scanning the sequences as a block of 16 amino acids at a time. Using a protein sequence descriptor defined in our model, the protein sliding scan method allowed us to compare the different strains for block level variability, which showed significant statistical correlation to average solvent accessibility of the residue blocks; single amino acid position variability results in no correlation, indicating the impact of stretch variability in chemical environment. Close to the C-terminal end the GSWM showed less descriptor-variability with increased average solvent accessibility (ASA that is also supported by conserved predicted secondary structure of 3' terminal RNA and visual evidence from 3D crystallographic structure. Conclusion The identified terminal segment, strongly conserved in both RNA and protein sequences, is especially significant as it is surface exposed and structural chemistry reveals the probable role of this stretch in

  14. Orchid conservation: further links. (United States)

    Fay, Michael F


    Due in great part to their often complex interactions with mycorrhizal fungi, pollinators and host trees, Orchidaceae present particular challenges for conservation. Furthermore, orchids, as potentially the largest family of angiosperms with >26000 species, species complexes and frequent hybrid formation, are complex to catalogue. Following a highlight in 2015, a further seven papers focusing on orchids, their interactions with beneficial organisms, pollinators and mycorrhiza, and other factors relating to their conservation, including threats from human utilization and changing land use, are presented here. The production of an online flora of all known plants and an assessment of the conservation status of all known plant species as far as possible, to guide conservation action are the first two targets of the Global Strategy for Plant Conservation Without knowing how many species there are and how they should be circumscribed, neither of these targets is achievable. Orchids are a fascinating subject for fundamental research with rapid species evolution, specific organ structure and development, but they also suffer from high levels of threat. Effective orchid conservation must take account of the beneficial interactions with fungi and pollinators and the potentially detrimental effects of over-collection and changes in land use. © The Author 2016. Published by Oxford University Press on behalf of the Annals of Botany Company. All rights reserved. For Permissions, please email:

  15. Determination of 5 '-leader sequences from radically disparate strains of porcine reproductive and respiratory syndrome virus reveals the presence of highly conserved sequence motifs

    DEFF Research Database (Denmark)

    Oleksiewicz, M.B.; Bøtner, Anette; Nielsen, Jens


    We determined the untranslated 5'-leader sequence for three different isolates of porcine reproductive and respiratory syndrome virus (PRRSV): pathogenic European- and American-types, as well as an American-type vaccine strain. 5'-leader from European- and American-type PRRSV differed in length...... (220 and 190 nt, respectively), and exhibited only approximately 50% nucleotide homology. Nevertheless, highly conserved areas were identified in the leader of all 3 PRRSV isolates, which constitute candidate motifs for binding of protein(s) involved in viral replication. These comparative data provide...

  16. A highly conserved NF-κB-responsive enhancer is critical for thymic expression of Aire in mice. (United States)

    Haljasorg, Uku; Bichele, Rudolf; Saare, Mario; Guha, Mithu; Maslovskaja, Julia; Kõnd, Karin; Remm, Anu; Pihlap, Maire; Tomson, Laura; Kisand, Kai; Laan, Martti; Peterson, Pärt


    Autoimmune regulator (Aire) has a unique expression pattern in thymic medullary epithelial cells (mTECs), in which it plays a critical role in the activation of tissue-specific antigens. The expression of Aire in mTECs is activated by receptor activator of nuclear factor κB (RANK) signaling; however, the molecular mechanism behind this activation is unknown. Here, we characterize a conserved noncoding sequence 1 (CNS1) containing two NF-κB binding sites upstream of the Aire coding region. We show that CNS1-deficient mice lack thymic expression of Aire and share several features of Aire-knockout mice, including downregulation of Aire-dependent genes, impaired terminal differentiation of the mTEC population, and reduced production of thymic Treg cells. In addition, we show that CNS1 is indispensable for RANK-induced Aire expression and that CNS1 is activated by NF-κB pathway complexes containing RelA. Together, our results indicate that CNS1 is a critical link between RANK signaling, NF-κB activation, and thymic expression of Aire. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Highly conserved functions of the Brachyury gene on morphogenetic movements: insight from the early-diverging phylum Ctenophora. (United States)

    Yamada, Atsuko; Martindale, Mark Q; Fukui, Akimasa; Tochinai, Shin


    Brachyury, a member of the T-box transcription family identified in a diverse array of metazoans, was initially recognized for its function in mesoderm formation and notochord differentiation in vertebrates; however, its ancestral role has been suggested to be in control of morphogenetic movements. Here, we show that morpholino oligonucleotide knockdown of Brachyury (MlBra) in embryos of a ctenophore, one of the most ancient groups of animals, prevents the invagination of MlBra expressing stomodeal cells and is rescued with corresponding RNA injections. Injection of RNA encoding a dominant-interfering construct of MlBra causes identical phenotypes to that of RNA encoding a dominant-interfering form of Xenopus Brachyury (Xbra) in Xenopus embryos. Both injected embryos down-regulate Xbra downstream genes, Xbra itself and Xwnt11 but not axial mesodermal markers, resulting in failure to complete gastrulation due to loss of convergent extension movements. Moreover, animal cap assay reveals that MlBra induces Xwnt11 like Xbra. Overall results using Xenopus embryos show that these two genes are functionally interchangeable. These functional experiments demonstrate for the first time in a basal metazoan that the primitive role of Brachyury is to regulate morphogenetic movements, rather than to specify endomesodermal fates, and the role is conserved between non-bilaterian metazoans and vertebrates. Copyright 2009 Elsevier Inc. All rights reserved.

  18. A high-order finite-volume method for hyperbolic conservation laws on locally-refined grids

    Energy Technology Data Exchange (ETDEWEB)

    McCorquodale, Peter; Colella, Phillip


    We present a fourth-order accurate finite-volume method for solving time-dependent hyperbolic systems of conservation laws on Cartesian grids with multiple levels of refinement. The underlying method is a generalization of that in [5] to nonlinear systems, and is based on using fourth-order accurate quadratures for computing fluxes on faces, combined with fourth-order accurate Runge?Kutta discretization in time. To interpolate boundary conditions at refinement boundaries, we interpolate in time in a manner consistent with the individual stages of the Runge-Kutta method, and interpolate in space by solving a least-squares problem over a neighborhood of each target cell for the coefficients of a cubic polynomial. The method also uses a variation on the extremum-preserving limiter in [8], as well as slope flattening and a fourth-order accurate artificial viscosity for strong shocks. We show that the resulting method is fourth-order accurate for smooth solutions, and is robust in the presence of complex combinations of shocks and smooth flows.

  19. High spatial resolution mapping of the Cerrado's land cover and land use types in the priority area for conservation Chapada da Contagem, Brazil. (United States)

    Ribeiro, F.; Roberts, D. A.; Davis, F. W.; Antunes Daldegan, G.; Nackoney, J.; Hess, L. L.


    The Brazilian savanna, Cerrado, is the second largest biome over South America and the most floristically diverse savanna in the world. This biome is considered a conservation hotspot in respect to its biodiversity importance and rapid transformation of its landscape. The Cerrado's natural vegetation has been severely transformed by agriculture and pasture activities. Currently it is the main agricultural frontier in Brazil and one of the most threatened Brazilian biomes. This scenario results in environmental impacts such as ecosystems fragmentation as well as losses in connectivity, biodiversity and gene flow, changes in the microclimate and energy, carbon and nutrients cycles, among others. The Priority Areas for Conservation is a governmental program from Brazil that identifies areas with high conservation priority. One of this program's recommendation is a natural vegetation map including their major ecosystem classes. This study aims to generate more precise information for the Cerrado's vegetation. The main objective of this study is to identify which ecosystems are being prioritized and/or threatened by land use, refining information for further protection. In order to test methods, the priority area for conservation Chapada da Contagem was selected as the study site. This area is ranked as "extremely high priority" by the government and is located in the Federal District and Goias State, Brazil. Satellites with finer spatial resolution may improve the classification of the Cerrado's vegetation. Remote sensing methods and two criteria were tested using RapidEye 3A imagery (5m spatial resolution) collected in 2014 in order to classify the Cerrado's major land cover types of this area, as well as its land use. One criterion considers the Cerrado's major terrestrial ecosystems, which are divided into forest, savanna and grassland. The other involves scaling it down to the major physiognomic groups of each ecosystem. Other sources of environmental dataset such

  20. Importance of Highly Conserved Peptide Sites of Human Cytomegalovirus gO for Formation of the gH/gL/gO Complex. (United States)

    Stegmann, Cora; Abdellatif, Mohamed E A; Laib Sampaio, Kerstin; Walther, Paul; Sinzger, Christian


    The glycoprotein O (gO) is betaherpesvirus specific. Together with the viral glycoproteins H and L, gO forms a covalent trimeric complex that is part of the viral envelope. This trimer is crucial for cell-free infectivity of human cytomegalovirus (HCMV) but dispensable for cell-associated spread. We hypothesized that the amino acids that are conserved among gOs of different cytomegaloviruses are important for the formation of the trimeric complex and hence for efficient virus spread. In a mutational approach, nine peptide sites, containing all 13 highly conserved amino acids, were analyzed in the context of HCMV strain TB40-BAC4 with regard to infection efficiency and formation of the gH/gL/gO complex. Mutation of amino acids (aa) 181 to 186 or aa 193 to 198 resulted in the loss of the trimer and a complete small-plaque phenotype, whereas mutation of aa 108 or aa 249 to 254 caused an intermediate phenotype. While individual mutations of the five conserved cysteines had little impact, their relevance was revealed in a combined mutation, which abrogated both complex formation and cell-free infectivity. C343 was unique, as it was sufficient and necessary for covalent binding of gO to gH/gL. Remarkably, however, C218 together with C167 rescued infectivity in the absence of detectable covalent complex formation. We conclude that all highly conserved amino acids contribute to the function of gO to some extent but that aa 181 to 198 and cysteines 343, 218, and 167 are particularly relevant. Surprisingly, covalent binding of gO to gH/gL is required neither for its incorporation into virions nor for proper function in cell-free infection. Like all herpesviruses, the widespread human pathogen HCMV depends on glycoproteins gB, gH, and gL for entry into target cells. Additionally, gH and gL have to bind gO in a trimeric complex for efficient cell-free infection. Homologs of gO are shared by all cytomegaloviruses, with 13 amino acids being highly conserved. In a mutational

  1. Positive selection drives rapid evolution of certain amino acid residues in an evolutionarily highly conserved interferon-inducible antiviral protein of fishes. (United States)

    Padhi, Abinash


    Viperin, an evolutionarily highly conserved interferon-inducible multifunctional protein, has previously been reported to exhibit antiviral activity against a wide range of DNA and RNA viruses. Utilizing the complete nucleotide coding sequence data of fish viperin antiviral genes, and employing the maximum likelihood-based codon substitution models, the present study reports the pervasive role of positive selection in the evolution of viperin antiviral protein in fishes. The overall rate of nonsynonymous (dN) to synonymous (dS) substitutions (dN/dS) for the three functional domains of viperin (N-terminal, central domain and C-terminal) were 1.1, 0.12, and 0.24, respectively. Codon-by-codon substitution analyses have revealed that while most of the positively selected sites were located at the N-terminal amphipathic α-helix domain, few amino acid residues at the C-terminal domain were under positive selection. However, none of the sites in the central domain were under positive selection. These results indicate that, although viperin is evolutionarily highly conserved, the three functional domains experienced differential selection pressures. Taken together with the results of previous studies, the present study suggests that the persistent antagonistic nature of surrounding infectious viral pathogens might be the likely cause for such adaptive evolutionary changes of certain amino acids in fish viperin antiviral protein.

  2. Toward High School Biology: Helping Middle School Students Understand Chemical Reactions and Conservation of Mass in Nonliving and Living Systems. (United States)

    Herrmann-Abell, Cari F; Koppal, Mary; Roseman, Jo Ellen


    Modern biology has become increasingly molecular in nature, requiring students to understand basic chemical concepts. Studies show, however, that many students fail to grasp ideas about atom rearrangement and conservation during chemical reactions or the application of these ideas to biological systems. To help provide students with a better foundation, we used research-based design principles and collaborated in the development of a curricular intervention that applies chemistry ideas to living and nonliving contexts. Six eighth grade teachers and their students participated in a test of the unit during the Spring of 2013. Two of the teachers had used an earlier version of the unit the previous spring. The other four teachers were randomly assigned either to implement the unit or to continue teaching the same content using existing materials. Pre- and posttests were administered, and the data were analyzed using Rasch modeling and hierarchical linear modeling. The results showed that, when controlling for pretest score, gender, language, and ethnicity, students who used the curricular intervention performed better on the posttest than the students using existing materials. Additionally, students who participated in the intervention held fewer misconceptions. These results demonstrate the unit's promise in improving students' understanding of the targeted ideas. © 2016 C. F. Herrmann-Abell et al. CBE—Life Sciences Education © 2016 The American Society for Cell Biology. This article is distributed by The American Society for Cell Biology under license from the author(s). It is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (

  3. High-Level Systemic Expression of Conserved Influenza Epitope in Plants on the Surface of Rod-Shaped Chimeric Particles

    Directory of Open Access Journals (Sweden)

    Natalia V. Petukhova


    Full Text Available Recombinant viruses based on the cDNA copy of the tobacco mosaic virus (TMV genome carrying different versions of the conserved M2e epitope from influenza virus A cloned into the coat protein (CP gene were obtained and partially characterized by our group previously; cysteines in the human consensus M2e sequence were changed to serine residues. This work intends to show some biological properties of these viruses following plant infections. Agroinfiltration experiments on Nicotiana benthamiana confirmed the efficient systemic expression of M2e peptides, and two point amino acid substitutions in recombinant CPs significantly influenced the symptoms and development of viral infections. Joint expression of RNA interference suppressor protein p19 from tomato bushy stunt virus (TBSV did not affect the accumulation of CP-M2e-ser recombinant protein in non-inoculated leaves. RT-PCR analysis of RNA isolated from either infected leaves or purified TMV-M2e particles proved the genetic stability of TMV‑based viral vectors. Immunoelectron microscopy of crude plant extracts demonstrated that foreign epitopes are located on the surface of chimeric virions. The rod‑shaped geometry of plant-produced M2e epitopes is different from the icosahedral or helical filamentous arrangement of M2e antigens on the carrier virus-like particles (VLP described earlier. Thereby, we created a simple and efficient system that employs agrobacteria and plant viral vectors in order to produce a candidate broad-spectrum flu vaccine.

  4. Physiology in conservation translocations (United States)

    Tarszisz, Esther; Dickman, Christopher R.; Munn, Adam J.


    Conservation translocations aim to restore species to their indigenous ranges, protect populations from threats and/or reinstate ecosystem functions. They are particularly important for the conservation and management of rare and threatened species. Despite tremendous efforts and advancement in recent years, animal conservation translocations generally have variable success, and the reasons for this are often uncertain. We suggest that when little is known about the physiology and wellbeing of individuals either before or after release, it will be difficult to determine their likelihood of survival, and this could limit advancements in the science of translocations for conservation. In this regard, we argue that physiology offers novel approaches that could substantially improve translocations and associated practices. As a discipline, it is apparent that physiology may be undervalued, perhaps because of the invasive nature of some physiological measurement techniques (e.g. sampling body fluids, surgical implantation). We examined 232 publications that dealt with translocations of terrestrial vertebrates and aquatic mammals and, defining ‘success’ as high or low, determined how many of these studies explicitly incorporated physiological aspects into their protocols and monitoring. From this review, it is apparent that physiological evaluation before and after animal releases could progress and improve translocation/reintroduction successes. We propose a suite of physiological measures, in addition to animal health indices, for assisting conservation translocations over the short term and also for longer term post-release monitoring. Perhaps most importantly, we argue that the incorporation of physiological assessments of animals at all stages of translocation can have important welfare implications by helping to reduce the total number of animals used. Physiological indicators can also help to refine conservation translocation methods. These approaches fall

  5. Comparative Study of Regulatory Circuits in Two Sea Urchin Species Reveals Tight Control of Timing and High Conservation of Expression Dynamics.

    Directory of Open Access Journals (Sweden)

    Tsvia Gildor


    Full Text Available Accurate temporal control of gene expression is essential for normal development and must be robust to natural genetic and environmental variation. Studying gene expression variation within and between related species can delineate the level of expression variability that development can tolerate. Here we exploit the comprehensive model of sea urchin gene regulatory networks and generate high-density expression profiles of key regulatory genes of the Mediterranean sea urchin, Paracentrotus lividus (Pl. The high resolution of our studies reveals highly reproducible gene initiation times that have lower variation than those of maximal mRNA levels between different individuals of the same species. This observation supports a threshold behavior of gene activation that is less sensitive to input concentrations. We then compare Mediterranean sea urchin gene expression profiles to those of its Pacific Ocean relative, Strongylocentrotus purpuratus (Sp. These species shared a common ancestor about 40 million years ago and show highly similar embryonic morphologies. Our comparative analyses of five regulatory circuits operating in different embryonic territories reveal a high conservation of the temporal order of gene activation but also some cases of divergence. A linear ratio of 1.3-fold between gene initiation times in Pl and Sp is partially explained by scaling of the developmental rates with temperature. Scaling the developmental rates according to the estimated Sp-Pl ratio and normalizing the expression levels reveals a striking conservation of relative dynamics of gene expression between the species. Overall, our findings demonstrate the ability of biological developmental systems to tightly control the timing of gene activation and relative dynamics and overcome expression noise induced by genetic variation and growth conditions.

  6. Comparative Study of Regulatory Circuits in Two Sea Urchin Species Reveals Tight Control of Timing and High Conservation of Expression Dynamics. (United States)

    Gildor, Tsvia; Ben-Tabou de-Leon, Smadar


    Accurate temporal control of gene expression is essential for normal development and must be robust to natural genetic and environmental variation. Studying gene expression variation within and between related species can delineate the level of expression variability that development can tolerate. Here we exploit the comprehensive model of sea urchin gene regulatory networks and generate high-density expression profiles of key regulatory genes of the Mediterranean sea urchin, Paracentrotus lividus (Pl). The high resolution of our studies reveals highly reproducible gene initiation times that have lower variation than those of maximal mRNA levels between different individuals of the same species. This observation supports a threshold behavior of gene activation that is less sensitive to input concentrations. We then compare Mediterranean sea urchin gene expression profiles to those of its Pacific Ocean relative, Strongylocentrotus purpuratus (Sp). These species shared a common ancestor about 40 million years ago and show highly similar embryonic morphologies. Our comparative analyses of five regulatory circuits operating in different embryonic territories reveal a high conservation of the temporal order of gene activation but also some cases of divergence. A linear ratio of 1.3-fold between gene initiation times in Pl and Sp is partially explained by scaling of the developmental rates with temperature. Scaling the developmental rates according to the estimated Sp-Pl ratio and normalizing the expression levels reveals a striking conservation of relative dynamics of gene expression between the species. Overall, our findings demonstrate the ability of biological developmental systems to tightly control the timing of gene activation and relative dynamics and overcome expression noise induced by genetic variation and growth conditions.

  7. Mammals of the high altitudes of western Arunachal Pradesh, eastern Himalaya: an assessment of threats and conservation needs

    NARCIS (Netherlands)

    Mishra, C.; Madhusudan, M.D.; Datta, A.


    he high altitudes of Arunachal Pradesh, India, located in the Eastern Himalaya biodiversity hotspot, remain zoologically unexplored and unprotected. We report results of recent mammal surveys in the high altitude habitats of western Arunachal Pradesh. A total of 35 mammal species (including 12

  8. Comprehensive Non-Destructive Conservation Documentation of Lunar Samples Using High-Resolution Image-Based 3D Reconstructions and X-Ray CT Data (United States)

    Blumenfeld, E. H.; Evans, C. A.; Oshel, E. R.; Liddle, D. A.; Beaulieu, K.; Zeigler, R. A.; Hanna, R. D.; Ketcham, R. A.


    Established contemporary conservation methods within the fields of Natural and Cultural Heritage encourage an interdisciplinary approach to preservation of heritage material (both tangible and intangible) that holds "Outstanding Universal Value" for our global community. NASA's lunar samples were acquired from the moon for the primary purpose of intensive scientific investigation. These samples, however, also invoke cultural significance, as evidenced by the millions of people per year that visit lunar displays in museums and heritage centers around the world. Being both scientifically and culturally significant, the lunar samples require a unique conservation approach. Government mandate dictates that NASA's Astromaterials Acquisition and Curation Office develop and maintain protocols for "documentation, preservation, preparation and distribution of samples for research, education and public outreach" for both current and future collections of astromaterials. Documentation, considered the first stage within the conservation methodology, has evolved many new techniques since curation protocols for the lunar samples were first implemented, and the development of new documentation strategies for current and future astromaterials is beneficial to keeping curation protocols up to date. We have developed and tested a comprehensive non-destructive documentation technique using high-resolution image-based 3D reconstruction and X-ray CT (XCT) data in order to create interactive 3D models of lunar samples that would ultimately be served to both researchers and the public. These data enhance preliminary scientific investigations including targeted sample requests, and also provide a new visual platform for the public to experience and interact with the lunar samples. We intend to serve these data as they are acquired on NASA's Astromaterials Acquisistion and Curation website at Providing 3D interior and exterior documentation of astromaterial

  9. A model of tripeptidyl-peptidase I (CLN2, a ubiquitous and highly conserved member of the sedolisin family of serine-carboxyl peptidases

    Directory of Open Access Journals (Sweden)

    Oyama Hiroshi


    Full Text Available Abstract Background Tripeptidyl-peptidase I, also known as CLN2, is a member of the family of sedolisins (serine-carboxyl peptidases. In humans, defects in expression of this enzyme lead to a fatal neurodegenerative disease, classical late-infantile neuronal ceroid lipofuscinosis. Similar enzymes have been found in the genomic sequences of several species, but neither systematic analyses of their distribution nor modeling of their structures have been previously attempted. Results We have analyzed the presence of orthologs of human CLN2 in the genomic sequences of a number of eukaryotic species. Enzymes with sequences sharing over 80% identity have been found in the genomes of macaque, mouse, rat, dog, and cow. Closely related, although clearly distinct, enzymes are present in fish (fugu and zebra, as well as in frogs (Xenopus tropicalis. A three-dimensional model of human CLN2 was built based mainly on the homology with Pseudomonas sp. 101 sedolisin. Conclusion CLN2 is very highly conserved and widely distributed among higher organisms and may play an important role in their life cycles. The model presented here indicates a very open and accessible active site that is almost completely conserved among all known CLN2 enzymes. This result is somehow surprising for a tripeptidase where the presence of a more constrained binding pocket was anticipated. This structural model should be useful in the search for the physiological substrates of these enzymes and in the design of more specific inhibitors of CLN2.

  10. Characterization of chicken octamer-binding proteins demonstrates that POU domain-containing homeobox transcription factors have been highly conserved during vertebrate evolution

    Energy Technology Data Exchange (ETDEWEB)

    Petryniak, B.; Postema, C.E.; McCormack, W.T.; Thompson, C.B. (Univ. of Michigan Medical Center, Ann Arbor (USA)); Staudt, L.M. (National Cancer Institute, Bethesda, MD (USA))


    The DNA sequence motif ATTTGCAT (octamer) or its inverse complement has been identified as an evolutionarily conserved element in the promoter region of immunoglobulin genes. Two major DNA-binding proteins that bind in a sequence-specific manner to the octamer DNA sequence have been identified in mammalian species--a ubiquitously expressed protein (Oct-1) and a lymphoid-specific protein (Oct-2). During characterization of the promoter region of the chicken immunoglobulin light chain gene, the authors identified two homologous octamer-binding proteins in chicken B cells. when the cloning of the human gene for Oct-2 revealed it to be a member of a distinct family of homeobox genes, they sought to determine if the human Oct-2 cDNA could be used to identify homologous chicken homeobox genes. Using a human Oct-2 homeobox-specific DNA probe, they were able to identify 6-10 homeobox-containing genes in the chicken genome, demonstrating that the Oct-2-related subfamily of homeobox genes exists in avian species. DNA sequence analysis revealed it to be the chicken homologue of the human Oct-1 gene. Together, the data show that the POU-containing subfamily of homeobox genes have been highly conserved during vertebrate evolution, apparently as a result of selection for their DNA-binding and transcriptional regulatory properties.

  11. High order sub-cell finite volume schemes for solving hyperbolic conservation laws I: basic formulation and one-dimensional analysis (United States)

    Pan, JianHua; Ren, YuXin


    In this paper, a family of sub-cell finite volume schemes for solving the hyperbolic conservation laws is proposed and analyzed in one-dimensional cases. The basic idea of this method is to subdivide a control volume (main cell) into several sub-cells and the finite volume discretization is applied to each of the sub-cells. The averaged values on the sub-cells of current and face neighboring main cells are used to reconstruct the polynomial distributions of the dependent variables. This method can achieve arbitrarily high order of accuracy using a compact stencil. It is similar to the spectral volume method incorporating with PNPM technique but with fundamental differences. An elaborate utilization of these differences overcomes some shortcomings of the spectral volume method and results in a family of accurate and robust schemes for solving the hyperbolic conservation laws. In this paper, the basic formulation of the proposed method is presented. The Fourier analysis is performed to study the properties of the one-dimensional schemes. A WENO limiter based on the secondary reconstruction is constructed.

  12. Sensitivity analysis of conservation targets in systematic conservation planning. (United States)

    Levin, Noam; Mazor, Tessa; Brokovich, Eran; Jablon, Pierre-Elie; Kark, Salit


    Systematic conservation planning has rapidly advanced in the past decade and has been increasingly incorporated in multiple studies and conservation projects. One of its requirements is a quantitative definition of conservation targets. While the Convention on Biological Diversity aims to expand the world's protected area network to 17% of the land surface, in many cases such uniform policy-driven targets may not be appropriate for achieving persistence of various species. Targets are often set arbitrarily, often because information required for the persistence of each species is unavailable or unknown in the focal region. Conservation planners therefore need to establish complementary novel approaches to address the gaps in setting targets. Here, we develop and present a novel method that aims to help guide the selection of conservation targets, providing support for decision makers, planners, and managers. This is achieved by examining the overall flexibility of the conservation network resulting from conservation prioritization, and aiming for greater flexibility. To test this approach we applied the decision support tool Marxan to determine marine conservation priority areas in the eastern Mediterranean Sea as a case study. We assessed the flexibility of the conservation network by comparing 80 different scenarios in which conservation targets were gradually increased and assessed by a range of calculated metrics (e.g., the percentage of the total area selected, the overall connectivity). We discovered that when conservation targets were set too low (i.e., below 10% of the distribution range of each species), very few areas were identified as irreplaceable and the conservation network was not well defined. Interestingly, when conservation targets were set too high (over 50% of the species' range), too many conservation priority areas were selected as irreplaceable, an outcome which is realistically infeasible to implement. As a general guideline, we found that

  13. Inhibition of Hepatitis C Virus in Mice by a Small Interfering RNA Targeting a Highly Conserved Sequence in Viral IRES Pseudoknot.

    Directory of Open Access Journals (Sweden)

    Jae-Su Moon

    Full Text Available The hepatitis C virus (HCV internal ribosome entry site (IRES that directs cap-independent viral translation is a primary target for small interfering RNA (siRNA-based HCV antiviral therapy. However, identification of potent siRNAs against HCV IRES by bioinformatics-based siRNA design is a challenging task given the complexity of HCV IRES secondary and tertiary structures and association with multiple proteins, which can also dynamically change the structure of this cis-acting RNA element. In this work, we utilized siRNA tiling approach whereby siRNAs were tiled with overlapping sequences that were shifted by one or two nucleotides over the HCV IRES stem-loop structures III and IV spanning nucleotides (nts 277-343. Based on their antiviral activity, we mapped a druggable region (nts 313-343 where the targets of potent siRNAs were enriched. siIE22, which showed the greatest anti-HCV potency, targeted a highly conserved sequence across diverse HCV genotypes, locating within the IRES subdomain IIIf involved in pseudoknot formation. Stepwise target shifting toward the 5' or 3' direction by 1 or 2 nucleotides reduced the antiviral potency of siIE22, demonstrating the importance of siRNA accessibility to this highly structured and sequence-conserved region of HCV IRES for RNA interference. Nanoparticle-mediated systemic delivery of the stability-improved siIE22 derivative gs_PS1 siIE22, which contains a single phosphorothioate linkage on the guide strand, reduced the serum HCV genome titer by more than 4 log10 in a xenograft mouse model for HCV replication without generation of resistant variants. Our results provide a strategy for identifying potent siRNA species against a highly structured RNA target and offer a potential pan-HCV genotypic siRNA therapy that might be beneficial for patients resistant to current treatment regimens.

  14. The highly conserved 5' untranslated region as an effective target towards the inhibition of Enterovirus 71 replication by unmodified and appropriate 2'-modified siRNAs

    Directory of Open Access Journals (Sweden)

    Deng Jun-Xia


    Full Text Available Abstract Background Enterovirus 71 (EV71 is a highly infectious agent that plays an etiological role in hand, foot, and mouth disease. It is associated with severe neurological complications and has caused significant mortalities in recent large-scale outbreaks. Currently, no effective vaccine or specific clinical therapy is available against EV71. Methods Unmodified 21 nucleotide small interfering RNAs (siRNAs and classic 2′-modified (2′-O-methylation or 2′-fluoro modification siRNAs were designed to target highly conserved 5′ untranslated region (UTR of the EV71 genome and employed as anti-EV71 agents. Real-time TaqMan RT-PCR, western blot analysis and plaque assays were carried out to evaluate specific viral inhibition by the siRNAs. Results Transfection of rhabdomyosarcoma (RD cells with siRNAs targeting the EV71 genomic 5′ UTR significantly delayed and alleviated the cytopathic effects of EV71 infection, increased cell viability in EV71-infected RD cells. The inhibitory effect on EV71 replication was sequence-specific and dosage-dependent, with significant corresponding decreases in viral RNA, VP1 protein and viral titer. Appropriate 2′-modified siRNAs exhibited similar RNA interference (RNAi activity with dramatically increased serum stability in comparison with unmodified counterparts. Conclusion Sequences were identified within the highly conserved 5′ UTR that can be targeted to effectively inhibit EV71 replication through RNAi strategies. Appropriate 2′-modified siRNAs provide a promising approach to optimizing siRNAs to overcome barriers on RNAi-based antiviral therapies for broader administration.

  15. The highly conserved 5' untranslated region as an effective target towards the inhibition of Enterovirus 71 replication by unmodified and appropriate 2'-modified siRNAs. (United States)

    Deng, Jun-Xia; Nie, Xiao-Jing; Lei, Ying-Feng; Ma, Chao-Feng; Xu, Dong-Liang; Li, Biao; Xu, Zhi-Kai; Zhang, Guo-Cheng


    Enterovirus 71 (EV71) is a highly infectious agent that plays an etiological role in hand, foot, and mouth disease. It is associated with severe neurological complications and has caused significant mortalities in recent large-scale outbreaks. Currently, no effective vaccine or specific clinical therapy is available against EV71. Unmodified 21 nucleotide small interfering RNAs (siRNAs) and classic 2'-modified (2'-O-methylation or 2'-fluoro modification) siRNAs were designed to target highly conserved 5' untranslated region (UTR) of the EV71 genome and employed as anti-EV71 agents. Real-time TaqMan RT-PCR, western blot analysis and plaque assays were carried out to evaluate specific viral inhibition by the siRNAs. Transfection of rhabdomyosarcoma (RD) cells with siRNAs targeting the EV71 genomic 5' UTR significantly delayed and alleviated the cytopathic effects of EV71 infection, increased cell viability in EV71-infected RD cells. The inhibitory effect on EV71 replication was sequence-specific and dosage-dependent, with significant corresponding decreases in viral RNA, VP1 protein and viral titer. Appropriate 2'-modified siRNAs exhibited similar RNA interference (RNAi) activity with dramatically increased serum stability in comparison with unmodified counterparts. Sequences were identified within the highly conserved 5' UTR that can be targeted to effectively inhibit EV71 replication through RNAi strategies. Appropriate 2'-modified siRNAs provide a promising approach to optimizing siRNAs to overcome barriers on RNAi-based antiviral therapies for broader administration.

  16. Hepatitis B virus depicts a high degree of conservation during the immune-tolerant phase in familiarly transmitted chronic hepatitis B infection: deep-sequencing and phylogenetic analysis. (United States)

    Sede, M; Lopez-Ledesma, M; Frider, B; Pozzati, M; Campos, R H; Flichman, D; Quarleri, J


    When intrafamilial transmission of hepatitis B virus (HBV) occurs, a virus with the same characteristics interacts with diverse hosts' immune systems and may thus result in different mutations to escape immune pressure. In this study, the HBV genomic characterization was assessed longitudinally after intrafamilial transmission using nucleotide sequence data of phylogenetic and mutational analyses, including those obtained by deep-sequencing for the first time. Furthermore, HBeAg-anti-HBe profile and variability of HBV core-derived epitopes were also evaluated. Strong evidence was obtained from intrafamilial transmission of HBV genotype D1 by phylogenetic inferences. HBV isolates exhibited high degree (~99%) of genomic conservation for almost 20 years, when patients were persistently HBeAg positive with normal amino transferase levels. This identity remained high among immune-tolerant siblings. In contrast, it diminished significantly (P = 0.02) when the mother cleared HBeAg (immune clearance phase). By deep-sequencing, the quantitative analysis of the dynamics of basal core promoter (BCP) (A1762T, G1764A; A1766C; T1773C; 8-bp deletion; and other) and precore (G1896A) variants among HBV isolates from family members exhibited differences during the follow-up. However, only those from the mother showed amino acid variations at core protein that would impair their MHC-II binding. Hence, when intrafamilial transmission occurs, HBV was highly conserved under the immune-tolerant phase, but it exhibited mutations more frequently during the immune clearance phase. The analysis of the HBV BCP and precore mutants after intrafamilial HBV transmission contributes to a better understanding of how they evolve over time. © 2013 John Wiley & Sons Ltd.

  17. Use of genotyping by sequencing data to develop a high-throughput and multifunctional SNP panel for conservation applications in Pacific lamprey. (United States)

    Hess, Jon E; Campbell, Nathan R; Docker, Margaret F; Baker, Cyndi; Jackson, Aaron; Lampman, Ralph; McIlraith, Brian; Moser, Mary L; Statler, David P; Young, William P; Wildbill, Andrew J; Narum, Shawn R


    Next-generation sequencing data can be mined for highly informative single nucleotide polymorphisms (SNPs) to develop high-throughput genomic assays for nonmodel organisms. However, choosing a set of SNPs to address a variety of objectives can be difficult because SNPs are often not equally informative. We developed an optimal combination of 96 high-throughput SNP assays from a total of 4439 SNPs identified in a previous study of Pacific lamprey (Entosphenus tridentatus) and used them to address four disparate objectives: parentage analysis, species identification and characterization of neutral and adaptive variation. Nine of these SNPs are FST outliers, and five of these outliers are localized within genes and significantly associated with geography, run-timing and dwarf life history. Two of the 96 SNPs were diagnostic for two other lamprey species that were morphologically indistinguishable at early larval stages and were sympatric in the Pacific Northwest. The majority (85) of SNPs in the panel were highly informative for parentage analysis, that is, putatively neutral with high minor allele frequency across the species' range. Results from three case studies are presented to demonstrate the broad utility of this panel of SNP markers in this species. As Pacific lamprey populations are undergoing rapid decline, these SNPs provide an important resource to address critical uncertainties associated with the conservation and recovery of this imperiled species. © 2014 John Wiley & Sons Ltd.

  18. High degree of conservancy among secreted salivary gland proteins from two geographically distant Phlebotomus duboscqi sandflies populations (Mali and Kenya

    Directory of Open Access Journals (Sweden)

    Sissoko Ibrahim


    Full Text Available Abstract Background Salivary proteins from sandflies are potential targets for exploitation as vaccines to control Leishmania infection; in this work we tested the hypothesis that salivary proteins from geographically distant Phlebotomus duboscqi sandfly populations are highly divergent due to the pressure exerted by the host immune response. Salivary gland cDNA libraries were prepared from wild-caught P. duboscqi from Mali and recently colonised flies of the same species from Kenya. Results Transcriptome and proteome analysis resulted in the identification of the most abundant salivary gland-secreted proteins. Orthologues of these salivary proteins were identified by phylogenetic tree analysis. Moreover, comparative analysis between the orthologues of these two different populations resulted in a high level of protein identity, including the predicted MHC class II T-cell epitopes from all these salivary proteins. Conclusion These data refute the hypothesis that salivary proteins from geographically distinct populations of the same Phlebotomus sandfly species are highly divergent. They also suggest the potential for using the same species-specific components in a potential vector saliva-based vaccine.

  19. Priorities for global felid conservation. (United States)

    Dickman, Amy J; Hinks, Amy E; Macdonald, Ewan A; Burnham, Dawn; Macdonald, David W


    Conservation resources are limited, necessitating prioritization of species and locations for action. Most prioritization approaches are based solely on biologically relevant characteristics of taxa or areas and ignore geopolitical realities. Doing so risks a poor return on conservation investment due to nonbiological factors, such as economic or political instability. We considered felids, a taxon which attracts intense conservation attention, to demonstrate a new approach that incorporates both intrinsic species traits and geopolitical characteristics of countries. We developed conservation priority scores for wild felids based on their International Union for Conservation of Nature status, body mass, habitat, range within protected area, evolutionary distinctiveness, and conservation umbrella potential. We used published data on governance, economics and welfare, human population pressures, and conservation policy to assign conservation-likelihood scores to 142 felid-hosting countries. We identified 71 countries as high priorities (above median) for felid conservation. These countries collectively encompassed all 36 felid species and supported an average of 96% of each species' range. Of these countries, 60.6% had below-average conservation-likelihood scores, which indicated these countries are relatively risky conservation investments. Governance was the most common factor limiting conservation likelihood. It was the major contributor to below-median likelihood scores for 62.5% of the 32 felid species occurring in lower-likelihood countries. Governance was followed by economics for which scores were below median for 25% of these species. An average of 58% of species' ranges occurred in 43 higher-priority lower-likelihood countries. Human population pressure was second to governance as a limiting factor when accounting for percentage of species' ranges in each country. As conservation likelihood decreases, it will be increasingly important to identify relevant

  20. The ORF59 DNA polymerase processivity factor homologs of Old World primate RV2 rhadinoviruses are highly conserved nuclear antigens expressed in differentiated epithelium in infected macaques

    Directory of Open Access Journals (Sweden)

    Burnside Kellie L


    Full Text Available Abstract Background ORF59 DNA polymerase processivity factor of the human rhadinovirus, Kaposi's sarcoma-associated herpesvirus (KSHV, is required for efficient copying of the genome during virus replication. KSHV ORF59 is antigenic in the infected host and is used as a marker for virus activation and replication. Results We cloned, sequenced and expressed the genes encoding related ORF59 proteins from the RV1 rhadinovirus homologs of KSHV from chimpanzee (PtrRV1 and three species of macaques (RFHVMm, RFHVMn and RFHVMf, and have compared them with ORF59 proteins obtained from members of the more distantly-related RV2 rhadinovirus lineage infecting the same non-human primate species (PtrRV2, RRV, MneRV2, and MfaRV2, respectively. We found that ORF59 homologs of the RV1 and RV2 Old World primate rhadinoviruses are highly conserved with distinct phylogenetic clustering of the two rhadinovirus lineages. RV1 and RV2 ORF59 C-terminal domains exhibit a strong lineage-specific conservation. Rabbit antiserum was developed against a C-terminal polypeptide that is highly conserved between the macaque RV2 ORF59 sequences. This anti-serum showed strong reactivity towards ORF59 encoded by the macaque RV2 rhadinoviruses, RRV (rhesus and MneRV2 (pig-tail, with no cross reaction to human or macaque RV1 ORF59 proteins. Using this antiserum and RT-qPCR, we determined that RRV ORF59 is expressed early after permissive infection of both rhesus primary fetal fibroblasts and African green monkey kidney epithelial cells (Vero in vitro. RRV- and MneRV2-infected foci showed strong nuclear expression of ORF59 that correlated with production of infectious progeny virus. Immunohistochemical studies of an MneRV2-infected macaque revealed strong nuclear expression of ORF59 in infected cells within the differentiating layer of epidermis corroborating previous observations that differentiated epithelial cells are permissive for replication of KSHV-like rhadinoviruses

  1. Molecular Characterization and Expression Profiling of Brachypodium distachyon L. Cystatin Genes Reveal High Evolutionary Conservation and Functional Divergence in Response to Abiotic Stress

    Directory of Open Access Journals (Sweden)

    Saminathan Subburaj


    Full Text Available Cystatin is a class of proteins mainly involved in cysteine protease inhibition and plant growth and development, as well as tolerance under various abiotic stresses. In this study, we performed the first comprehensive analysis of the molecular characterization and expression profiling in response to various abiotic stresses of the cystatin gene family in Brachypodium distachyon, a novel model plant for Triticum species with huge genomes. Comprehensive searches of the Brachypodium genome database identified 25 B. distachyon cystatin (BdC genes that are distributed unevenly on chromosomes; of these, nine and two were involved in tandem and segmental duplication events, respectively. All BdC genes had similar exon/intron structural organization, with three conserved motifs similar to those from other plant species, indicating their high evolutionary conservation. Expression profiling of 10 typical BdC genes revealed ubiquitous expression in different organs at varying expression levels. BdC gene expression in seedling leaves was particularly highly induced by various abiotic stresses, including the plant hormone abscisic acid and various environmental cues (cold, H2O2, CdCl2, salt, and drought. Interestingly, most BdC genes were significantly upregulated under multiple abiotic stresses, including BdC15 under all stresses, BdC7-2 and BdC10 under five stresses, and BdC7-1, BdC2-1, BdC14, and BdC12 under four stresses. The putative metabolic pathways of cytastin genes in response to various abiotic stresses mainly involve the aberrant protein degradation pathway and reactive oxygen species (ROS-triggered programmed cell death signaling pathways. These observations provide a better understanding of the structural and functional characteristics of the plant cystatin gene family.

  2. Repeated conservation threats across the Americas: High levels of blood and bone lead in the Andean Condor widen the problem to a continental scale. (United States)

    Wiemeyer, Guillermo M; Pérez, Miguel A; Torres Bianchini, Laura; Sampietro, Luciano; Bravo, Guillermo F; Jácome, N Luis; Astore, Vanesa; Lambertucci, Sergio A


    Wildlife lead exposure is an increasing conservation threat that is being widely investigated. However, for some areas of the world (e.g., South America) and certain species, research on this subject is still scarce or only local information is available. We analyzed the extent and intensity of lead exposure for a widely distributed threatened species, the Andean Condor (Vultur gryphus). We conducted the study at two different scales: 1) sampling of birds received for rehabilitation or necropsy in Argentina, and 2) bibliographic review and extensive survey considering exposure event for the species' distribution in South America. Wild condors from Argentina (n = 76) presented high lead levels consistent with both recent and previous exposure (up to 104 μg/dL blood level, mean 15.47 ± 21.21 μg/dL and up to 148.20 ppm bone level, mean 23.08 ± 31.39 ppm). In contrast, captive bred individuals -not exposed to lead contamination- had much lower lead levels (mean blood level 5.63 ± 3.08 μg/dL, and mean bone level 2.76 ± 3.06 ppm). Condors were exposed to lead throughout their entire range in continental Argentina, which represents almost sixty percent (>4000 km) of their geographical distribution. We also present evidence of lead exposure events in Chile, Ecuador, and Peru. Lead poisoning is a widespread major conservation threat for the Andean Condor, and probably other sympatric carnivores from South America. The high number and wide range of Andean Condors with lead values complement the results for the California Condor and other scavengers in North America suggesting lead poisoning is a continental threat. Urgent actions are needed to reduce this poison in the wild. Copyright © 2016 Elsevier Ltd. All rights reserved.

  3. Integrating Landsat Data and High-Resolution Imagery for Applied Conservation Assessment of Forest Cover in Latin American Heterogenous Landscapes (United States)

    Thomas, N.; Rueda, X.; Lambin, E.; Mendenhall, C. D.


    Large intact forested regions of the world are known to be critical to maintaining Earth's climate, ecosystem health, and human livelihoods. Remote sensing has been successfully implemented as a tool to monitor forest cover and landscape dynamics over broad regions. Much of this work has been done using coarse resolution sensors such as AVHRR and MODIS in combination with moderate resolution sensors, particularly Landsat. Finer scale analysis of heterogeneous and fragmented landscapes is commonly performed with medium resolution data and has had varying success depending on many factors including the level of fragmentation, variability of land cover types, patch size, and image availability. Fine scale tree cover in mixed agricultural areas can have a major impact on biodiversity and ecosystem sustainability but may often be inadequately captured with the global to regional (coarse resolution and moderate resolution) satellite sensors and processing techniques widely used to detect land use and land cover changes. This study investigates whether advanced remote sensing methods are able to assess and monitor percent tree canopy cover in spatially complex human-dominated agricultural landscapes that prove challenging for traditional mapping techniques. Our study areas are in high altitude, mixed agricultural coffee-growing regions in Costa Rica and the Colombian Andes. We applied Random Forests regression tree analysis to Landsat data along with additional spectral, environmental, and spatial variables to predict percent tree canopy cover at 30m resolution. Image object-based texture, shape, and neighborhood metrics were generated at the Landsat scale using eCognition and included in the variable suite. Training and validation data was generated using high resolution imagery from digital aerial photography at 1m to 2.5 m resolution. Our results are promising with Pearson's correlation coefficients between observed and predicted percent tree canopy cover of .86 (Costa

  4. Conservation Kickstart- Catalyzing Conservation Initiatives Worldwide (United States)

    Treinish, G.


    Adventurers and Scientists for Conservation (ASC) is a nonprofit organization that collects environmental data to catalyze conservation initiatives worldwide. Adventure athletes have the skills and motivation to reach the most remote corners of the world. ASC utilizes those skills to provide the scientific community with data while providing the outdoor community with purpose beyond the personal high of reaching a summit or rowing across an ocean. We carefully select projects, choosing partnerships that will maximize the impact of ASC volunteers. Each project must have a clear path to a tangible conservation outcome and demonstrate a clear need for our brand of volunteers. We partner with government agencies, universities, and independant reseachers to kickstart data collection efforts around the world. Last year, through a partnership with the Olympic National Forest, 20 volunteers from the Seattle area set up and monitored camera traps in an effort to survey for costal Pacific marten. Our work led to the species' listing as "critically imperiled" with NatureServe. A partnership with the inaugural Great Pacific Race, engaging trans-Pacific rowing teams, searched for microplastics in the Pacific Ocean as part of our ongoing microplastics campaign. In a multi-year partnership with the American Prairie Reserve (APR), ASC volunteer crews live and work on the Reserve collecting wildlife data year round. The data we obtain directly informs the Reserve's wildlife management decisions. On this project, our crews have safely and effectively navigated temperature extremes from -30 degrees to 100+ degrees while traveling in a remote location. We are currently scouting projects in the Okavango Delta of Botswana and the rainforest of Suriname where we will be able to cover large amounts of area in a short periord of time. ASC is at the crossroads of the adventure and coservation science communities. Our approach of answering specific questions by using highly skilled and

  5. Development and implementation of a site-specific water quality limit for uranium in a high conservation value ecosystem. (United States)

    van Dam, Rick A; Hogan, Alicia C; Harford, Andrew J


    Water quality guideline values (GVs) are a key tool for water quality assessments. Site-specific GVs, which incorporate data relevant to local conditions and organisms, provide a higher level of confidence that the GV will protect the aquatic ecosystem at a site compared to generic GVs. Site-specific GVs are, therefore, considered particularly suitable for sites of high sociopolitical or ecological importance. The present paper provides an example of the refinement of a site-specific GV for high ecological value aquatic ecosystems in Kakadu National Park, Northern Territory, Australia, to improve its site specificity and statistical robustness, thereby increasing confidence in its application. Uranium is a contaminant of concern for Ranger U mine, which releases water into Magela Creek and Gulungul Creek in Kakadu National Park. A site-specific GV for U has been applied, as a statutory limit, to Magela Creek since 2004 and to Gulungul Creek since 2015. The GV of 6 μg/L U was derived from toxicity data for 5 local species tested under local conditions. The acquisition of additional U data, including new information on the effect of DOC on U toxicity, enabled a revision of the site-specific U GV to 2.8 μg/L U and an ability to adjust the value on the basis of environmental concentrations of DOC. The revised GV has been adopted as the statutory limit, with the regulatory framework structured so the GV requires adjustment based on DOC concentration only when an exceedance occurs. Monitoring data for Magela Creek (2001-2013) and Gulungul Creek (2003-2013) downstream of the mine show that dissolved U has not exceeded 1 μg/L. Integr Environ Assess Manag 2017;13:765-777. © 2016 SETAC. © 2016 SETAC.

  6. The Genetic Linkage Map of the Medicinal Mushroom Agaricus subrufescens Reveals Highly Conserved Macrosynteny with the Congeneric Species Agaricus bisporus

    Directory of Open Access Journals (Sweden)

    Marie Foulongne-Oriol


    Full Text Available Comparative linkage mapping can rapidly facilitate the transfer of genetic information from model species to orphan species. This macrosynteny analysis approach has been extensively used in plant species, but few example are available in fungi, and even fewer in mushroom crop species. Among the latter, the Agaricus genus comprises the most cultivable or potentially cultivable species. Agaricus bisporus, the button mushroom, is the model for edible and cultivable mushrooms. We have developed the first genetic linkage map for the basidiomycete A. subrufescens, an emerging mushroom crop known for its therapeutic properties and potential medicinal applications. The map includes 202 markers distributed over 16 linkage groups (LG, and covers a total length of 1701 cM, with an average marker spacing of 8.2 cM. Using 96 homologous loci, we also demonstrated the high level of macrosynteny with the genome of A. bisporus. The 13 main LG of A. subrufescens were syntenic to the 13 A. bisporus chromosomes. A disrupted synteny was observed for the three remaining A. subrufescens LG. Electronic mapping of a collection of A. subrufescens expressed sequence tags on A. bisporus genome showed that the homologous loci were evenly spread, with the exception of a few local hot or cold spots of homology. Our results were discussed in the light of Agaricus species evolution process. The map provides a framework for future genetic or genomic studies of the medicinal mushroom A. subrufescens.

  7. Effectiveness of convective drying to conserve indigenous yeasts with high volatile profile isolated from algerian fermented raw bovine milk (Rayeb

    Directory of Open Access Journals (Sweden)



    Full Text Available Abstract Yeasts Candida tropicalis, Yarrowia lipolytica, Wickerhamomyces anomalus, Issatchenkia orientalis, Kluyveromyces marxianus, Saprochaete suaveolens and Trichosporon coremiiforme were isolated and identified by physiological, biochemical tests with API 20C AUX system and molecular methods by restriction fragment analysis of PCR-amplified 28S-rRNA from Algerian fermented raw bovine milk (Rayeb. Selected yeasts S. suaveolens, I. orientalis, K. marxianus and W. anomalus produced esters and higher esters which can exert a pertinent influence on the sensory characteristics of Rayeb. Viability of S. suaveolens and W. anomalus using three methods of drying (freeze-drying, convective drying, and spray-drying and during 4 months of storage at 4 °C and 25 °C in the darkness was studied. Immediately after each drying method, high survival was obtained using freeze-drying followed by convective drying in rice cakes and spray-drying respectively. During storage at 4 °C, convective drying provided better survival of yeast cultures of S. suaveolens and W. anomalus than freeze-drying. At 25 °C of storage, convective and freeze-dried yeast cultures showed no significant loss of viable cells up to 2 months of storage. Spray-dried yeast cultures had the greatest loss of viable count during the 3 months of storage at 25 °C.

  8. Identification of a Highly Conserved Epitope on Avian Influenza Virus Non-Structural Protein 1 Using a Peptide Microarray.

    Directory of Open Access Journals (Sweden)

    Jiashan Sun

    Full Text Available Avian influenza virus (AIV non-structural protein 1 (NS1 is a multifunctional protein. It is present at high levels in infected cells and can be used for AIV detection and diagnosis. In this study, we generated monoclonal antibody (MAb D7 against AIV NS1 protein by immunization of BALB/c mice with purified recombinant NS1 protein expressed in Escherichia coli. Isotype determination revealed that the MAb was IgG1/κ-type subclass. To identify the epitope of the MAb D7, the NS1 protein was truncated into a total of 225 15-mer peptides with 14 amino acid overlaps, which were spotted for a peptide microarray. The results revealed that the MAb D7 recognized the consensus DAPF motif. Furthermore, the AIV NS1 protein with the DAPF motif deletion was transiently expressed in 293T cells and failed to react with MAb D7. Subsequently, the DAPF motif was synthesized with an elongated GSGS linker at both the C- and N-termini. The MAb D7 reacted with the synthesized peptide both in enzyme-linked immunosorbent assay (ELISA and dot-blot assays. From these results, we concluded that DAPF motif is the epitope of MAb D7. To our knowledge, this is the first report of a 4-mer epitope on the NS1 protein of AIV that can be recognized by MAb using a peptide microarray, which is able to simplify epitope identification, and that could serve as the basis for immune responses against avian influenza.

  9. High levels of genetic diversity and population structure in an endemic and rare species: implications for conservation. (United States)

    Turchetto, Caroline; Segatto, Ana Lúcia A; Mäder, Geraldo; Rodrigues, Daniele M; Bonatto, Sandro L; Freitas, Loreta B


    The analysis of genetic structure and variability of isolated species is of critical importance in evaluating whether stochastic or human-caused factors are affecting rare species. Low genetic diversity compromises the ability of populations to evolve and reduces their chances of survival under environmental changes. Petunia secreta, a rare and endemic species, is an annual and heliophilous herb that is bee-pollinated and easily recognizable by its purple and salverform corolla. It was described as a new species of the Petunia genus in 2005. Few individuals of P. secreta have been observed in nature and little is known about this species. All the natural populations of P. secreta that were found were studied using 15 microsatellite loci, two intergenic plastid sequences and morphological traits. Statistical analysis was performed to describe the genetic diversity of this rare species and the results compared with those of more widespread and frequent Petunia species from the same geographic area to understand whether factors associated with population size could affect rare species of this genus. The results showed that despite its rarity, P. secreta presented high genetic diversity that was equivalent to or even higher than that of widespread Petunia species. It was shown that this species is divided into two evolutionary lineages, and the genetic differentiation indices between them and other congeneric species presented different patterns. The major risk to P. secreta maintenance is its rarity, suggesting the necessity of a preservation programme and more biological and evolutionary studies that handle the two evolutionary lineages independently. Published by Oxford University Press on behalf of the Annals of Botany Company.

  10. Cuvier's Beaked Whale, Ziphius cavirostris, Distribution and Occurrence in the Mediterranean Sea: High-Use Areas and Conservation Threats. (United States)

    Podestà, M; Azzellino, A; Cañadas, A; Frantzis, A; Moulins, A; Rosso, M; Tepsich, P; Lanfredi, C

    Cuvier's beaked whale (Ziphius cavirostris G. Cuvier, 1823) is the only beaked whale species commonly found in the Mediterranean Sea. Until recently, species presence in this area was only inferred from stranding events. Dedicated cetacean surveys have increased our knowledge of the distribution of Cuvier's beaked whales, even though many areas still remain unexplored. Here, we present an updated analysis of available sighting and stranding data, focusing on the atypical mass strandings that have occurred in the Mediterranean Sea since 1963. We describe in detail the five more recent events (2006-14), highlighting their relationship with naval exercises that used mid-frequency active sonar. The distribution of the species is apparently characterized by areas of high density where animals seem to be relatively abundant, including the Alborán Sea, Ligurian Sea, Central Tyrrhenian Sea, southern Adriatic Sea and the Hellenic Trench, but other such areas may exist where little or no survey work has been conducted. Population size has been estimated for the Alborán and Ligurian seas. Habitat modelling studies for those areas, confirmed the species preference for the continental slope and its particular association with submarine canyons, as has also been found to be the case in other areas of the world. The application of results from habitat modelling to areas different from their calibration sites is proposed as a management tool for minimizing the potential impacts of human activities at sea. Military sonar is known worldwide as a threat for this species and is suggested to be a major threat for Cuvier's beaked whale in the Mediterranean Sea. © 2016 Elsevier Ltd. All rights reserved.

  11. A highly conserved candidate chemoreceptor expressed in both olfactory and gustatory tissues in the malaria vector Anopheles gambiae. (United States)

    Pitts, R Jason; Fox, A Nicole; Zwiebel, Laurence J


    Anopheles gambiae is a highly anthropophilic mosquito responsible for the majority of malaria transmission in Africa. The biting and host preference behavior of this disease vector is largely influenced by its sense of smell, which is presumably facilitated by G protein-coupled receptor signaling [Takken, W. & Knols, B. (1999) Annu. Rev. Entomol. 44, 131-157]. Because of the importance of host preference to the mosquitoes' ability to transmit disease, we have initiated studies intended to elucidate the molecular mechanisms underlying olfaction in An. gambiae. In the course of these studies, we have identified a number of genes potentially involved in signal transduction, including a family of candidate odorant receptors. One of these receptors, encoded by GPRor7 (hereafter referred to as AgOr7), is remarkably similar to an odorant receptor that is expressed broadly in olfactory tissues and has been identified in Drosophila melanogaster and other insects [Krieger, J., Klink, O., Mohl, C., Raming, K. & Breer, H. (2003) J. Comp. Physiol. A 189, 519-526; Vosshall, L. B., Amrein, H., Morozov, P. S., Rzhetsky, A. & Axel, R. (1999) Cell 96, 725-736]. We have observed AgOr7 expression in olfactory and gustatory tissues in adult An. gambiae and during several stages of the mosquitoes' development. Within the female adult peripheral chemosensory system, antiserum against the AgOR7 polypeptide labels most sensilla of the antenna and maxillary palp as well as a subset of proboscis sensilla. Furthermore, AgOR7 antiserum labeling is observed within the larval antenna and maxillary palpus. These results are consistent with a role for AgOr7 in both olfaction and gustation in An. gambiae and raise the possibility that AgOr7 orthologs may also be of general importance to both modalities of chemosensation in other insects.

  12. Multi-species comparative analysis of the equine ACE gene identifies a highly conserved potential transcription factor binding site in intron 16.

    Directory of Open Access Journals (Sweden)

    Natasha A Hamilton

    Full Text Available Angiotensin converting enzyme (ACE is essential for control of blood pressure. The human ACE gene contains an intronic Alu indel (I/D polymorphism that has been associated with variation in serum enzyme levels, although the functional mechanism has not been identified. The polymorphism has also been associated with cardiovascular disease, type II diabetes, renal disease and elite athleticism. We have characterized the ACE gene in horses of breeds selected for differing physical abilities. The equine gene has a similar structure to that of all known mammalian ACE genes. Nine common single nucleotide polymorphisms (SNPs discovered in pooled DNA were found to be inherited in nine haplotypes. Three of these SNPs were located in intron 16, homologous to that containing the Alu polymorphism in the human. A highly conserved 18 bp sequence, also within that intron, was identified as being a potential binding site for the transcription factors Oct-1, HFH-1 and HNF-3β, and lies within a larger area of higher than normal homology. This putative regulatory element may contribute to regulation of the documented inter-individual variation in human circulating enzyme levels, for which a functional mechanism is yet to be defined. Two equine SNPs occurred within the conserved area in intron 16, although neither of them disrupted the putative binding site. We propose a possible regulatory mechanism of the ACE gene in mammalian species which was previously unknown. This advance will allow further analysis leading to a better understanding of the mechanisms underpinning the associations seen between the human Alu polymorphism and enzyme levels, cardiovascular disease states and elite athleticism.

  13. The human CD8+ T cell responses induced by a live attenuated tetravalent dengue vaccine are directed against highly conserved epitopes. (United States)

    Weiskopf, Daniela; Angelo, Michael A; Bangs, Derek J; Sidney, John; Paul, Sinu; Peters, Bjoern; de Silva, Aruna D; Lindow, Janet C; Diehl, Sean A; Whitehead, Stephen; Durbin, Anna; Kirkpatrick, Beth; Sette, Alessandro


    The incidence of infection with any of the four dengue virus serotypes (DENV1 to -4) has increased dramatically in the last few decades, and the lack of a treatment or vaccine has contributed to significant morbidity and mortality worldwide. A recent comprehensive analysis of the human T cell response against wild-type DENV suggested an human lymphocyte antigen (HLA)-linked protective role for CD8(+) T cells. We have collected one-unit blood donations from study participants receiving the monovalent or tetravalent live attenuated DENV vaccine (DLAV), developed by the U.S. National Institutes of Health. Peripheral blood mononuclear cells from these donors were screened in gamma interferon enzyme-linked immunosorbent spot assays with pools of predicted, HLA-matched, class I binding peptides covering the entire DENV proteome. Here, we characterize for the first time CD8(+) T cell responses after live attenuated dengue vaccination and show that CD8(+) T cell responses in vaccinees were readily detectable and comparable to natural dengue infection. Interestingly, whereas broad responses to structural and nonstructural (NS) proteins were observed after monovalent vaccination, T cell responses following tetravalent vaccination were, dramatically, focused toward the highly conserved NS proteins. Epitopes were highly conserved in a vast variety of field isolates and able to elicit multifunctional T cell responses. Detailed knowledge of the T cell response will contribute to the identification of robust correlates of protection in natural immunity and following vaccination against DENV. The development of effective vaccination strategies against dengue virus (DENV) infection and clinically significant disease is a task of high global public health value and significance, while also being a challenge of significant complexity. A recent efficacy trial of the most advanced dengue vaccine candidate, demonstrated only partial protection against all four DENV serotypes, despite

  14. The Human CD8+ T Cell Responses Induced by a Live Attenuated Tetravalent Dengue Vaccine Are Directed against Highly Conserved Epitopes (United States)

    Angelo, Michael A.; Bangs, Derek J.; Sidney, John; Paul, Sinu; Peters, Bjoern; de Silva, Aruna D.; Lindow, Janet C.; Diehl, Sean A.; Whitehead, Stephen; Durbin, Anna; Kirkpatrick, Beth; Sette, Alessandro


    ABSTRACT The incidence of infection with any of the four dengue virus serotypes (DENV1 to -4) has increased dramatically in the last few decades, and the lack of a treatment or vaccine has contributed to significant morbidity and mortality worldwide. A recent comprehensive analysis of the human T cell response against wild-type DENV suggested an human lymphocyte antigen (HLA)-linked protective role for CD8+ T cells. We have collected one-unit blood donations from study participants receiving the monovalent or tetravalent live attenuated DENV vaccine (DLAV), developed by the U.S. National Institutes of Health. Peripheral blood mononuclear cells from these donors were screened in gamma interferon enzyme-linked immunosorbent spot assays with pools of predicted, HLA-matched, class I binding peptides covering the entire DENV proteome. Here, we characterize for the first time CD8+ T cell responses after live attenuated dengue vaccination and show that CD8+ T cell responses in vaccinees were readily detectable and comparable to natural dengue infection. Interestingly, whereas broad responses to structural and nonstructural (NS) proteins were observed after monovalent vaccination, T cell responses following tetravalent vaccination were, dramatically, focused toward the highly conserved NS proteins. Epitopes were highly conserved in a vast variety of field isolates and able to elicit multifunctional T cell responses. Detailed knowledge of the T cell response will contribute to the identification of robust correlates of protection in natural immunity and following vaccination against DENV. IMPORTANCE The development of effective vaccination strategies against dengue virus (DENV) infection and clinically significant disease is a task of high global public health value and significance, while also being a challenge of significant complexity. A recent efficacy trial of the most advanced dengue vaccine candidate, demonstrated only partial protection against all four DENV

  15. Non-native and native organisms moving into high elevation and high latitude ecosystems in an era of climate change: new challenges for ecology and conservation (United States)

    Pauchard, Aníbal; Albihn, Ann; Alexander, Jake; Burgess, Treena; Daehler, Curt; Essl, Franz; Evengard, Birgitta; Greenwood, Greg; Haider, Sylvia; Lenoir, Jonathan; McDougall, K.; Milbau, Ann; Muths, Erin L.; Nunez, Martin; Pellissier, Lois; Rabitsch, Wolfgang; Rew, Lisa; Robertson, Mark; Sanders, Nathan; Kueffer, Christoph


    Cold environments at high elevation and high latitude are often viewed as resistant to biological invasions. However, climate warming, land use change and associated increased connectivity all increase the risk of biological invasions in these environments. Here we present a summary of the key discussions of the workshop ‘Biosecurity in Mountains and Northern Ecosystems: Current Status and Future Challenges’ (Flen, Sweden, 1–3 June 2015). The aims of the workshop were to (1) increase awareness about the growing importance of species expansion—both non-native and native—at high elevation and high latitude with climate change, (2) review existing knowledge about invasion risks in these areas, and (3) encourage more research on how species will move and interact in cold environments, the consequences for biodiversity, and animal and human health and wellbeing. The diversity of potential and actual invaders reported at the workshop and the likely interactions between them create major challenges for managers of cold environments. However, since these cold environments have experienced fewer invasions when compared with many warmer, more populated environments, prevention has a real chance of success, especially if it is coupled with prioritisation schemes for targeting invaders likely to have greatest impact. Communication and co-operation between cold environment regions will facilitate rapid response, and maximise the use of limited research and management resources.

  16. Integrated maps in quail (Coturnix japonica confirm the high degree of synteny conservation with chicken (Gallus gallus despite 35 million years of divergence

    Directory of Open Access Journals (Sweden)

    Vignoles Matthieu


    Full Text Available Abstract Background By comparing the quail genome with that of chicken, chromosome rearrangements that have occurred in these two galliform species over 35 million years of evolution can be detected. From a more practical point of view, the definition of conserved syntenies helps to predict the position of genes in quail, based on information taken from the chicken sequence, thus enhancing the utility of this species in biological studies through a better knowledge of its genome structure. A microsatellite and an Amplified Fragment Length Polymorphism (AFLP genetic map were previously published for quail, as well as comparative cytogenetic data with chicken for macrochromosomes. Quail genomics will benefit from the extension and the integration of these maps. Results The integrated linkage map presented here is based on segregation analysis of both anonymous markers and functional gene loci in 1,050 quail from three independent F2 populations. Ninety-two loci are resolved into 14 autosomal linkage groups and a Z chromosome-specific linkage group, aligned with the quail AFLP map. The size of linkage groups ranges from 7.8 cM to 274.8 cM. The total map distance covers 904.3 cM with an average spacing of 9.7 cM between loci. The coverage is not complete, as macrochromosome CJA08, the gonosome CJAW and 23 microchromosomes have no marker assigned yet. Significant sequence identities of quail markers with chicken enabled the alignment of the quail linkage groups on the chicken genome sequence assembly. This, together with interspecific Fluorescence In Situ Hybridization (FISH, revealed very high similarities in marker order between the two species for the eight macrochromosomes and the 14 microchromosomes studied. Conclusion Integrating the two microsatellite and the AFLP quail genetic maps greatly enhances the quality of the resulting information and will thus facilitate the identification of Quantitative Trait Loci (QTL. The alignment with the

  17. The Oklahoma Field Test: Air-conditioning electricity savings from standard energy conservation measures, radiant barriers, and high-efficiency window air conditioners

    Energy Technology Data Exchange (ETDEWEB)

    Ternes, M.P.; Levins, W.P.


    A field test Involving 104 houses was performed in Tulsa, Oklahoma, to measure the air-conditioning electricity consumption of low-income houses equipped with window air conditioners, the reduction in this electricity consumption attributed to the installation of energy conservation measures (ECMS) as typically installed under the Oklahoma Weatherization Assistance Program (WAP), and the reduction achieved by the replacement of low-efficiency window air conditioners with high-efficiency units and the installation of attic radiant barriers. Air-conditioning electricity consumption and indoor temperature were monitored weekly during the pre-weatherization period (June to September 1988) and post-weatherization period (May to September 1989). House energy consumption models and regression analyses were used to normalize the air-conditioning electricity savings to average outdoor temperature conditions and the pre-weatherization indoor temperature of each house. The following conclusions were drawn from the study: (1) programs directed at reducing air-conditioning electricity consumption should be targeted at clients with high consumption to improve cost effectiveness; (2) replacing low-efficiency air conditioners with high-efficiency units should be considered an option in a weatherization program directed at reducing air-conditioning electricity consumption; (3) ECMs currently being installed under the Oklahoma WAP (chosen based on effectiveness at reducing space-heating energy consumption) should continue to be justified based on their space-heating energy savings potential only; and (4) attic radiant barriers should not be included in the Oklahoma WAP if alternatives with verified savings are available or until further testing demonstrates energy savings or other benefits in this typo of housing.

  18. Whole-genome sequences of Odocoileus hemionus deer adenovirus isolates from deer, moose and elk are highly conserved and support a new species in the genus Atadenovirus. (United States)

    Miller, Myrna M; Cornish, Todd E; Creekmore, Terry E; Fox, Karen; Laegreid, Will; McKenna, Jennifer; Vasquez, Marce; Woods, Leslie W


    We present the first complete genome sequence of Odocoileus hemionus deer adenovirus 1 (OdAdV-1). This virus can cause sporadic haemorrhagic disease in cervids, although epizootics with high mortality have occurred in California. OdAdV-1 has been placed in the genus Atadenovirus, based on partial hexon, pVIII and fibre genes. Ten field isolates recovered from naturally infected mule deer (Odocoileus hemionus), white-tailed deer (Odocoileus virginiana) and moose (Alces alces) from Wyoming, black-tailed deer (Odocoileus hemionus columbianus) from California, and Rocky Mountain elk (Cervus elaphus nelsoni) from Colorado and Washington state were sequenced. The genome lengths ranged from 30 620 to 30 699 bp, contained the predicted proteins and gene organization typical of members of genus Atadenovirus, and had a high percentage of A/T nucleotides (66.7 %). Phylogenic analysis found that the closest ancestry was with ruminant atadenoviruses, while a divergence of the hexon, polymerase and penton base proteins of more than 15 % supports classification as a new species. Genetic global comparison between the 10 isolates found an overall 99 % identity, but greater divergence was found between those recovered from moose and elk as compared to deer, and a single variable region contained most of these differences. Our findings demonstrate that OdAdV-1 is highly conserved between 10 isolates recovered from multiple related cervid species, but genotypic differences, largely localized to a variable region, define two strains. We propose that the virus type name be changed to cervid adenovirus 1, with the species name Cervid atadenovirus A. Sequence data were used to develop molecular assays for improved detection and genotyping.

  19. IAA-Ala Resistant3, an evolutionarily conserved target of miR167, mediates Arabidopsis root architecture changes during high osmotic stress

    KAUST Repository

    Kinoshita, Natsuko


    The functions of microRNAs and their target mRNAs in Arabidopsis thaliana development have been widely documented; however, roles of stress-responsive microRNAs and their targets are not as well understood. Using small RNA deep sequencing and ATH1 microarrays to profile mRNAs, we identified IAA-Ala Resistant3 (IAR3) as a new target of miR167a. As expected, IAR3 mRNA was cleaved at the miR167a complementary site and under high osmotic stress miR167a levels decreased, whereas IAR3 mRNA levels increased. IAR3 hydrolyzes an inactive form of auxin (indole-3-acetic acid [IAA]-alanine) and releases bioactive auxin (IAA), a central phytohormone for root development. In contrast with the wild type, iar3 mutants accumulated reduced IAA levels and did not display high osmotic stress-induced root architecture changes. Transgenic plants expressing a cleavage-resistant form of IAR3 mRNA accumulated high levels of IAR3 mRNAs and showed increased lateral root development compared with transgenic plants expressing wild-type IAR3. Expression of an inducible noncoding RNA to sequester miR167a by target mimicry led to an increase in IAR3 mRNA levels, further confirming the inverse relationship between the two partners. Sequence comparison revealed the miR167 target site on IAR3 mRNA is conserved in evolutionarily distant plant species. Finally, we showed that IAR3 is required for drought tolerance. © 2012 American Society of Plant Biologists. All rights reserved.

  20. Mutational analysis of the resolution sequence of vaccinia virus DNA: essential sequence consists of two separate AT-rich regions highly conserved among poxviruses. (United States)

    Merchlinsky, M


    In replicative forms of vaccinia virus DNA, the unit genomes are connected by palindromic junction fragments that are resolved into mature viral genomes with hairpin termini. Bacterial plasmids containing the junction fragment for vaccinia virus or Shope fibroma virus were converted into linear minichromosomes of vector sequence flanked by poxvirus hairpin loops after transfection into infected cells. Analysis of a series of symmetrical deletion mutations demonstrated that in vaccinia virus the presence of the DNA sequence ATTTAGTGTCTAGAAAAAAA on both sides of the apical segment of the concatemer junction is crucial for resolution. To determine the precise architecture of the resolution site, a series of site-directed mutations within this tract of nucleotides were made and the relative contribution of each nucleotide to the efficaciousness of resolution was determined. The nucleotide sequence necessary for the resolution of the vaccinia virus concatemer junction, (A/T)TTT(A/G)N7-9AAAAAAA, is highly conserved among poxviruses and found proximal to the hairpin loop in the genomes of members of the Leporipoxvirus, Avipoxvirus, and Capripoxvirus genera. Images PMID:2398534

  1. A highly conserved gene island of three genes on chromosome 3B of hexaploid wheat: diverse gene function and genomic structure maintained in a tightly linked block

    Directory of Open Access Journals (Sweden)

    Ma Wujun


    Full Text Available Abstract Background The complexity of the wheat genome has resulted from waves of retrotransposable element insertions. Gene deletions and disruptions generated by the fast replacement of repetitive elements in wheat have resulted in disruption of colinearity at a micro (sub-megabase level among the cereals. In view of genomic changes that are possible within a given time span, conservation of genes between species tends to imply an important functional or regional constraint that does not permit a change in genomic structure. The ctg1034 contig completed in this paper was initially studied because it was assigned to the Sr2 resistance locus region, but detailed mapping studies subsequently assigned it to the long arm of 3B and revealed its unusual features. Results BAC shotgun sequencing of the hexaploid wheat (Triticum aestivum cv. Chinese Spring genome has been used to assemble a group of 15 wheat BACs from the chromosome 3B physical map FPC contig ctg1034 into a 783,553 bp genomic sequence. This ctg1034 sequence was annotated for biological features such as genes and transposable elements. A three-gene island was identified among >80% repetitive DNA sequence. Using bioinformatics analysis there were no observable similarity in their gene functions. The ctg1034 gene island also displayed complete conservation of gene order and orientation with syntenic gene islands found in publicly available genome sequences of Brachypodium distachyon, Oryza sativa, Sorghum bicolor and Zea mays, even though the intergenic space and introns were divergent. Conclusion We propose that ctg1034 is located within the heterochromatic C-band region of deletion bin 3BL7 based on the identification of heterochromatic tandem repeats and presence of significant matches to chromodomain-containing gypsy LTR retrotransposable elements. We also speculate that this location, among other highly repetitive sequences, may account for the relative stability in gene order and

  2. Subsets of Women With Close or Positive Margins After Breast-Conserving Surgery With High Local Recurrence Risk Despite Breast Plus Boost Radiotherapy

    Energy Technology Data Exchange (ETDEWEB)

    Lupe, Krystine [British Columbia Cancer Agency, Department of Radiation Oncology, Victoria and Vancouver, British Columbia (Canada); Truong, Pauline T., E-mail: [British Columbia Cancer Agency, Department of Radiation Oncology, Victoria and Vancouver, British Columbia (Canada); Breast Cancer Outcomes Unit, British Columbia Cancer Agency, Vancouver, British Columbia (Canada); University of British Columbia, Vancouver, British Columbia (Canada); Alexander, Cheryl [Breast Cancer Outcomes Unit, British Columbia Cancer Agency, Vancouver, British Columbia (Canada); Lesperance, Mary [Department of Mathematics and Statistics, University of Victoria, Victoria, Vancouver, British Columbia (Canada); Speers, Caroline [Breast Cancer Outcomes Unit, British Columbia Cancer Agency, Vancouver, British Columbia (Canada); Tyldesley, Scott [British Columbia Cancer Agency, Department of Radiation Oncology, Victoria and Vancouver, British Columbia (Canada); Breast Cancer Outcomes Unit, British Columbia Cancer Agency, Vancouver, British Columbia (Canada); University of British Columbia, Vancouver, British Columbia (Canada)


    Purpose: (1) To examine the effect of surgical margin status on local recurrence (LR) and survival following breast-conserving therapy; (2) To identify subsets with close or positive margins with high LR risk despite whole breast radiotherapy (RT) plus boost. Methods and Materials: Subjects were 2,264 women with pT1-3, any N, M0 invasive breast cancer, treated with breast-conserving surgery and whole breast {+-} boost RT. Five-year Kaplan-Meier (KM) LR, breast cancer-specific and overall survival (BCSS and OS) were compared between cohorts with negative (n = 1,980), close (n = 222), and positive (n = 62) margins. LR rates were analyzed according to clinicopathologic characteristics. Multivariable Cox regression modeling and matched analysis of close/positive margin cases and negative margin controls were performed. Results: Median follow-up was 5.2 years. Boost RT was used in 92% of patients with close or positive margins. Five-year KM LR rates in the negative, close and positive margin cohorts were 1.3%, 4.0%, and 5.2%, respectively (p = 0.001). BCSS and OS were similar in the three margin subgroups. In the close/positive margin cohort, LR rates were 10.2% with age <45 years, 11.8% with Grade III, 11.3% with lymphovascular invasion (LVI), and 26.3% with {>=}4 positive nodes. Corresponding rates in the negative margin cohort were 2.3%, 2.4%, 1.0%, and 2.4%, respectively. On Cox regression analysis of the entire cohort, close or positive margin, Grade III histology, {>=}4 positive nodes, and lack of systemic therapy were significantly associated with higher LR risk. When close/positive margin cases were matched to negative margin controls, the difference in 5-year LR remained significant (4.25% vs. 0.7%, p < 0.001). Conclusions: On univariable analysis, subsets with close or positive margins, in combination with age <45 years, Grade III, LVI, and {>=}4 positive nodes, have 5-year LR >10% despite whole breast plus boost RT. These patients should be considered for

  3. Induction of Heme Oxygenase-1 Deficiency and Associated Glutamate-Mediated Neurotoxicity Is a Highly Conserved HIV Phenotype of Chronic Macrophage Infection That Is Resistant to Antiretroviral Therapy. (United States)

    Gill, Alexander J; Kovacsics, Colleen E; Vance, Patricia J; Collman, Ronald G; Kolson, Dennis L


    neuropathological processes that persist in antiretroviral therapy (ART)-treated HIV-infected individuals. To this end, we previously identified one such possible process, a deficiency of the antioxidative and anti-inflammatory enzyme heme oxygenase-1 (HO-1) in the brains of individuals with HAND. In the present study, our findings suggest that the HO-1 deficiency associated with excess glutamate production and neurotoxicity in HIV-infected macrophages is a highly conserved phenotype of macrophage-tropic HIV strains and that this phenotype can persist in the macrophage compartment in the presence of ART. This suggests a plausible mechanism by which HIV infection of brain macrophages in ART-treated individuals could exacerbate oxidative stress and glutamate-induced neuronal injury, each of which is associated with neurocognitive dysfunction in infected individuals. Thus, therapies that rescue the HO-1 deficiency in HIV-infected individuals could provide additional neuroprotection to ART. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  4. Making conservation work for everyone

    Energy Technology Data Exchange (ETDEWEB)

    Wiersma, J. [Veridian Corp., Ajax, ON (Canada)


    This presentation discussed the economic value of conservation, the optimal deployment of energy conservation. A sample load profile was presented to demonstrate how much electricity the average residential customer uses on a summer day. The average customer does not have the tools to understand the financial consequences of conservation for different types of equipment at different times of the day. Smart metering technology could help in this regard. Accurate unsubsidized prices are also considered to be the best incentive to conserve because customers will reduce electricity use when the prices are high. It was also suggested that standards for new appliances should be increased effectively to their economic value. The enablers to energy conservation include solid consumer education programs, real time metering in places where it is cost effective, real time pricing in places where it is practical, and power rates that reflect real costs. Barriers to energy conservation include the residual economic advantage that may be insufficient to justify investment; support from local distribution companies and transmission companies if the lost revenue adjustment mechanism (LRAM) is not sufficient to recover lost revenue and if LDCs are not sufficiently involved in the design of the electricity conservation program. 7 figs.

  5. Immunogenicity of Leishmania-derived hepatitis B small surface antigen particles exposing highly conserved E2 epitope of hepatitis C virus. (United States)

    Czarnota, Anna; Tyborowska, Jolanta; Peszyńska-Sularz, Grażyna; Gromadzka, Beata; Bieńkowska-Szewczyk, Krystyna; Grzyb, Katarzyna


    Hepatitis C virus (HCV) infection is a major health problem worldwide, affecting an estimated 2-3 % of human population. An HCV vaccine, however, remains unavailable. High viral diversity poses a challenge in developing a vaccine capable of eliciting a broad neutralizing antibody response against all HCV genotypes. The small surface antigen (sHBsAg) of hepatitis B virus (HBV) has the ability to form highly immunogenic subviral particles which are currently used as an efficient anti-HBV vaccine. It also represents an attractive antigen carrier for the delivery of foreign sequences. In the present study, we propose a bivalent vaccine candidate based on novel chimeric particles in which highly conserved epitope of HCV E2 glycoprotein (residues 412-425) was inserted into the hydrophilic loop of sHBsAg. The expression of chimeric protein was performed in an unconventional, Leishmania tarentolae expression system resulting in an assembly of particles which retained immunogenicity of both HCV epitope and sHBsAg protein. Direct transmission electron microscopy observation and immunogold staining confirmed the formation of spherical particles approximately 22 nm in diameter, and proper foreign epitope exposition. Furthermore, the sera of mice immunized with chimeric particles proved reactive not only to purified yeast-derived sHBsAg proteins but also HCV E2 412-425 synthetic peptide. Most importantly, they were also able to cross-react with E1E2 complexes from different HCV genotypes. For the first time, we confirmed successful assembly of chimeric sHBsAg virus-like particles (VLPs) in the L. tarentolae expression system which has the potential to produce high-yields of properly N-glycosylated mammalian proteins. We also proved that chimeric Leishmania-derived VLPs are highly immunogenic and able to elicit cross-reactive antibody response against HCV. This approach may prove useful in the development of a bivalent prophylactic vaccine against HBV and HCV and opens up a new

  6. Conservation and genetic characterisation of common bean landraces from Cilento region (southern Italy): high differentiation in spite of low genetic diversity. (United States)

    De Luca, Daniele; Cennamo, Paola; Del Guacchio, Emanuele; Di Novella, Riccardo; Caputo, Paolo


    Since its introduction from Central-South America to Italy almost 500 years ago, the common bean (Phaseolus vulgaris L.) was largely cultivated across the peninsula in hundreds of different landraces. However, globalisation and technological modernisation of agricultural practices in the last decades promoted the cultivation of few varieties at the expense of traditional and local agro-ecotypes, which have been confined to local markets or have completely disappeared. The aim of this study was to evaluate the genetic diversity and differentiation in 12 common bean landraces once largely cultivated in the Cilento region (Campania region, southern Italy), and now the object of a recovery program to save them from extinction. The analysis conducted using 13 nuclear microsatellite loci in 140 individuals revealed a high degree of homozygosity within each landrace and a strong genetic differentiation that was reflected in the success in assigning individuals to the source landrace. On the contrary, internal transcribed spacers 1 and 2, analysed in one individual per landrace, were highly similar among common bean landraces but allowed the identification of a cowpea variety (Vigna unguiculata Walp.), a crop largely cultivated in the Old World before the arrival of common bean from Americas. In conclusion, our study highlighted that conservation of landraces is important not only for the cultural and socio-economic value that they have for local communities, but also because the time and conditions in which they have been selected have led to that genetic distinctiveness that is at the basis of many potential agronomical applications and dietary benefits.

  7. The albinism of the feral Asinara white donkeys (Equus asinus) is determined by a missense mutation in a highly conserved position of the tyrosinase (TYR) gene deduced protein. (United States)

    Utzeri, V J; Bertolini, F; Ribani, A; Schiavo, G; Dall'Olio, S; Fontanesi, L


    A feral donkey population (Equus asinus), living in the Asinara National Park (an island north-west of Sardinia, Italy), includes a unique white albino donkey subpopulation or colour morph that is a major attraction of this park. Disrupting mutations in the tyrosinase (TYR) gene are known to cause recessive albinisms in humans (oculocutaneous albinism Type 1; OCA1) and other species. In this study, we analysed the donkey TYR gene as a strong candidate to identify the causative mutation of the albinism of these donkeys. The TYR gene was sequenced from 13 donkeys (seven Asinara white albino and six coloured animals). Seven single nucleotide polymorphisms were identified. A missense mutation (c.604C>G; p.His202Asp) in a highly conserved amino acid position (even across kingdoms), which disrupts the first copper-binding site (CuA) of functional protein, was identified in the homozygous condition (G/G or D/D) in all Asinara white albino donkeys and in the albino son of a trio (the grey parents had genotype C/G or H/D), supporting the recessive mode of inheritance of this mutation. Genotyping 82 donkeys confirmed that Asinara albino donkeys had genotype G/G whereas all other coloured donkeys had genotype C/C or C/G. Across-population association between the c.604C>G genotypes and the albino coat colour was highly significant (P = 6.17E-18). The identification of the causative mutation of the albinism in the Asinara white donkeys might open new perspectives to study the dynamics of this putative deleterious allele in a feral population and to manage this interesting animal genetic resource. © 2015 Stichting International Foundation for Animal Genetics.

  8. Mistaken identity: activating conservative political identities induces "conservative" financial decisions. (United States)

    Morris, Michael W; Carranza, Erica; Fox, Craig R


    Four studies investigated whether activating a social identity can lead group members to choose options that are labeled in words associated with that identity. When political identities were made salient, Republicans (but not Democrats) became more likely to choose the gamble or investment option labeled "conservative." This shift did not occur in a condition in which the same options were unlabeled. Thus, the mechanism underlying the effect appears to be not activated identity-related values prioritizing low risk, but rather activated identity-related language (the group label "conservative"). Indeed, when political identities were salient, Republicans favored options labeled "conservative" regardless of whether the options were low or high risk. Finally, requiring participants to explain the label "conservative" before making their choice did not diminish the effect, which suggests that it does not merely reflect inattention to content or construct accessibility. We discuss the implications of these results for the literatures on identity, priming, choice, politics, and marketing.

  9. Electron and high-dose-rate brachytherapy boost in the conservative treatment of stage I-II breast cancer. First results of the randomized Budapest boost trial

    Energy Technology Data Exchange (ETDEWEB)

    Polgar, C.; Fodor, J. [National Institute of Oncology, Department of Radiotherapy, Budapest (Hungary); Orosz, Z. [National Institute of Oncology, Center of Experimental and Human Tumor Pathology Budapest (HU)] [and others


    Background and Aims: To evaluate the effect of electron and high-dose-rate brachytherapy (HDR BT) boost on local tumor control (LTC), side effects and cosmesis after breast-conserving surgery (BCS) in a prospective randomized study. Patients and Methods: 207 women with stage I-II breast cancer who underwent BCS were treated by 50 Gy irradiation to the whole breast and then randomly assigned to receive either a boost to the tumor bed (n=104) or no further radiotherapy (n=103). Boost treatments consisted of either 16 Gy electron irradiation (n=52) or 12-14.25 Gy HDR BT (n=52). Breast cancer-related events, side effects, and cosmetic results were assessed. Results: At a median follow-up of 5.3 years, the crude rate of local recurrence was 6.7% (7/104) with and 15.5% (16/103) without boost. The 5-year probability of LTC, relapse-free survival (RFS), and cancer-specific survival (CSS) was 92.7% vs 84.9% (p=0.049), 76.6% vs 66.2% (p=0.044), and 90.4% vs. 82.1% (p=0.053), respectively. There was no significant difference in LTC between patients treated with electron or HDR BT boost (94.2% vs 91.4%; p=0.74). On multivariate analysis, patient age <40 years (RR: 4.53), positive margin status (RR: 4.17), and high mitotic activity index (RR: 3.60) were found to be significant risk factors for local recurrence. The incidence of grade 2-3 side effects was higher in the boost arm (17.3% vs 7.8%; p=0.03). However, the rate of excellent/good cosmetic results was similar for the two arms (85.6% vs 91.3%; p=0.14). Cosmesis was rated as excellent/good in 88.5% of patients treated with HDR BT and 82.7% of patients with electron boost (p=0.29). Conclusions: Boost dose significantly improves LTC and RFS in patients treated with BCS and radiotherapy. In spite of the higher incidence of late side effects in the boost arm, boost dose is strongly recommended for patients at high risk for local recurrence. Positive or close margin status, high mitotic activity index, and young patient age

  10. Conservation genetics of amphibians. (United States)

    Beebee, T J C


    Amphibians are good models for investigating the genetics of wild animal populations because they are: (1) widely distributed in most ecosystems; (2) easy to sample in breeding assemblages; (3) often philopatric to breeding sites, generating high levels of population genetic structure; (4) amenable to controlled crossings in the laboratory; and (5) of major conservation concern. Neutral genetic markers, mostly microsatellites, have been used successfully in studies of amphibian effective population sizes and structures, and in assessing the consequences of hybridisation. Phylogeography has provided important insights into population histories and the fates of introductions. Quantitative genetic methods have demonstrated adaptive variation in life history traits of importance to fitness and therefore to population viability.

  11. The highly conserved skb1 gene encodes a protein that interacts with Shk1, a fission yeast Ste20/PAK homolog. (United States)

    Gilbreth, M; Yang, P; Wang, D; Frost, J; Polverino, A; Cobb, M H; Marcus, S


    The Shk1 protein kinase, a homolog of Saccharomyces cerevisiae Ste20 and mammalian p21Cdc42/Rac-activated kinases, is an essential component of a Ras- and Cdc42-dependent signaling cascade required for cell viability, normal morphology, and mitogen-activated protein kinase-mediated sexual responses in the fission yeast, Schizosaccharomyces pombe. To identify S. pombe proteins that modulate or mediate Shk1 functions, we conducted a two-hybrid screen for Shk1-interacting proteins. One of the genes identified as a result of this screen was skb1. We show that Skb1 interacts with a region of the N-terminal regulatory domain of Shk1 distinct from that to which Cdc42 binds, and that Shk1, Cdc42, and Skb1 are able to form a ternary complex in vivo. S.pombe cells carrying an skb1 null mutation are less elongate in morphology than wild-type cells and exhibit a moderate growth defect. The morphology defect of the skb1 deletion mutant is suppressed by overexpression of Shk1. Overexpression of Skb1 causes wild-type S. pombe cells to become hyperelongated. Additional genetic analyses described herein suggest that Skb1 is a component of the morphology control branch of the Ras signaling cascade in S. pombe and that it positively modulates Shk1 function. Homologs of Skb1 are encoded by open reading frames in the genomes of S. cerevisiae and Caenorhabditis elegans and by an uncharacterized human cDNA sequence. Thus, skb1 may be the first well-characterized member of a highly conserved family of genes encoding potential p21Cdc42/Rac-activated kinase regulators.

  12. The highly conserved skb1 gene encodes a protein that interacts with Shk1, a fission yeast Ste20/PAK homolog (United States)

    Gilbreth, Mary; Yang, Peirong; Wang, Dan; Frost, Jeff; Polverino, Anthony; Cobb, Melanie H.; Marcus, Stevan


    The Shk1 protein kinase, a homolog of Saccharomyces cerevisiae Ste20 and mammalian p21Cdc42/Rac-activated kinases, is an essential component of a Ras- and Cdc42-dependent signaling cascade required for cell viability, normal morphology, and mitogen-activated protein kinase-mediated sexual responses in the fission yeast, Schizosaccharomyces pombe. To identify S. pombe proteins that modulate or mediate Shk1 functions, we conducted a two-hybrid screen for Shk1-interacting proteins. One of the genes identified as a result of this screen was skb1. We show that Skb1 interacts with a region of the N-terminal regulatory domain of Shk1 distinct from that to which Cdc42 binds, and that Shk1, Cdc42, and Skb1 are able to form a ternary complex in vivo. S. pombe cells carrying an skb1 null mutation are less elongate in morphology than wild-type cells and exhibit a moderate growth defect. The morphology defect of the skb1 deletion mutant is suppressed by overexpression of Shk1. Overexpression of Skb1 causes wild-type S. pombe cells to become hyperelongated. Additional genetic analyses described herein suggest that Skb1 is a component of the morphology control branch of the Ras signaling cascade in S. pombe and that it positively modulates Shk1 function. Homologs of Skb1 are encoded by open reading frames in the genomes of S. cerevisiae and Caenorhabditis elegans and by an uncharacterized human cDNA sequence. Thus, skb1 may be the first well-characterized member of a highly conserved family of genes encoding potential p21Cdc42/Rac-activated kinase regulators. PMID:8943016

  13. Identification of novel and conserved miRNAs involved in pollen development in Brassica campestris ssp. chinensis by high-throughput sequencing and degradome analysis (United States)


    Background microRNAs (miRNAs) are endogenous, noncoding, small RNAs that have essential regulatory functions in plant growth, development, and stress response processes. However, limited information is available about their functions in sexual reproduction of flowering plants. Pollen development is an important process in the life cycle of a flowering plant and is a major factor that affects the yield and quality of crop seeds. Results This study aims to identify miRNAs involved in pollen development. Two independent small RNA libraries were constructed from the flower buds of the male sterile line (Bcajh97-01A) and male fertile line (Bcajh97-01B) of Brassica campestris ssp. chinensis. The libraries were subjected to high-throughput sequencing by using the Illumina Solexa system. Eight novel miRNAs on the other arm of known pre-miRNAs, 54 new conserved miRNAs, and 8 novel miRNA members were identified. Twenty-five pairs of novel miRNA/miRNA* were found. Among all the identified miRNAs, 18 differentially expressed miRNAs with over two-fold change between flower buds of male sterile line (Bcajh97-01A) and male fertile line (Bcajh97-01B) were identified. qRT-PCR analysis revealed that most of the differentially expressed miRNAs were preferentially expressed in flower buds of the male fertile line (Bcajh97-01B). Degradome analysis showed that a total of 15 genes were predicted to be the targets of seven miRNAs. Conclusions Our findings provide an overview of potential miRNAs involved in pollen development and interactions between miRNAs and their corresponding targets, which may provide important clues on the function of miRNAs in pollen development. PMID:24559317

  14. Molecular Evolution of Vertebrate Neurotrophins: Co-Option of the Highly Conserved Nerve Growth Factor Gene into the Advanced Snake Venom Arsenalf (United States)

    Sunagar, Kartik; Fry, Bryan Grieg; Jackson, Timothy N. W.; Casewell, Nicholas R.; Undheim, Eivind A. B.; Vidal, Nicolas; Ali, Syed A.; King, Glenn F.; Vasudevan, Karthikeyan; Vasconcelos, Vitor; Antunes, Agostinho


    Neurotrophins are a diverse class of structurally related proteins, essential for neuronal development, survival, plasticity and regeneration. They are characterized by major family members, such as the nerve growth factors (NGF), brain-derived neurotrophic factors (BDNF) and neurotrophin-3 (NT-3), which have been demonstrated here to lack coding sequence variations and follow the regime of negative selection, highlighting their extremely important conserved role in vertebrate homeostasis. However, in stark contrast, venom NGF secreted as part of the chemical arsenal of the venomous advanced snake family Elapidae (and to a lesser extent Viperidae) have characteristics consistent with the typical accelerated molecular evolution of venom components. This includes a rapid rate of diversification under the significant influence of positive-selection, with the majority of positively-selected sites found in the secreted β-polypeptide chain (74%) and on the molecular surface of the protein (92%), while the core structural and functional residues remain highly constrained. Such focal mutagenesis generates active residues on the toxin molecular surface, which are capable of interacting with novel biological targets in prey to induce a myriad of pharmacological effects. We propose that caenophidian NGFs could participate in prey-envenoming by causing a massive release of chemical mediators from mast cells to mount inflammatory reactions and increase vascular permeability, thereby aiding the spread of other toxins and/or by acting as proapoptotic factors. Despite their presence in reptilian venom having been known for over 60 years, this is the first evidence that venom-secreted NGF follows the molecular evolutionary pattern of other venom components, and thus likely participates in prey-envenomation. PMID:24312363

  15. Molecular evolution of vertebrate neurotrophins: co-option of the highly conserved nerve growth factor gene into the advanced snake venom arsenalf.

    Directory of Open Access Journals (Sweden)

    Kartik Sunagar

    Full Text Available Neurotrophins are a diverse class of structurally related proteins, essential for neuronal development, survival, plasticity and regeneration. They are characterized by major family members, such as the nerve growth factors (NGF, brain-derived neurotrophic factors (BDNF and neurotrophin-3 (NT-3, which have been demonstrated here to lack coding sequence variations and follow the regime of negative selection, highlighting their extremely important conserved role in vertebrate homeostasis. However, in stark contrast, venom NGF secreted as part of the chemical arsenal of the venomous advanced snake family Elapidae (and to a lesser extent Viperidae have characteristics consistent with the typical accelerated molecular evolution of venom components. This includes a rapid rate of diversification under the significant influence of positive-selection, with the majority of positively-selected sites found in the secreted β-polypeptide chain (74% and on the molecular surface of the protein (92%, while the core structural and functional residues remain highly constrained. Such focal mutagenesis generates active residues on the toxin molecular surface, which are capable of interacting with novel biological targets in prey to induce a myriad of pharmacological effects. We propose that caenophidian NGFs could participate in prey-envenoming by causing a massive release of chemical mediators from mast cells to mount inflammatory reactions and increase vascular permeability, thereby aiding the spread of other toxins and/or by acting as proapoptotic factors. Despite their presence in reptilian venom having been known for over 60 years, this is the first evidence that venom-secreted NGF follows the molecular evolutionary pattern of other venom components, and thus likely participates in prey-envenomation.

  16. Some AFLP amplicons are highly conserved DNA sequences mapping to the same linkage groups in two F2 populations of carrot

    Directory of Open Access Journals (Sweden)

    Santos Carlos A.F.


    Full Text Available Amplified fragment length polymorphism (AFLP is a fast and reliable tool to generate a large number of DNA markers. In two unrelated F2 populations of carrot (Daucus carota L., Brasilia x HCM and B493 x QAL (wild carrot, it was hypothesized that DNA 1 digested with the same restriction endonuclease enzymes and amplified with the same primer combination and 2 sharing the same position in polyacrylamide gels should be conserved sequences. To test this hypothesis AFLP fragments from polyacrylamide gels were eluted, reamplified, separated in agarose gels, purified, cloned and sequenced. Among thirty-one paired fragments from each F2 population, twenty-six had identity greater than 91% and five presented identity of 24% to 44%. Among the twenty-six conserved AFLPs only one mapped to different linkage groups in the two populations while four of the five less-conserved bands mapped to different linkage groups. Of eight SCAR (sequence characterized amplified regions primers tested, one conserved AFLP resulted in co-dominant markers in both populations. Screening among 14 carrot inbreds or cultivars with three AFLP-SCAR primers revealed clear and polymorphic PCR products, with similar molecular sizes on agarose gels. The development of co-dominant markers based on conserved AFLP fragments will be useful to detect seed mixtures among hybrids, to improve and to merge linkage maps and to study diversity and phylogenetic relationships.

  17. Building robust conservation plans. (United States)

    Visconti, Piero; Joppa, Lucas


    Systematic conservation planning optimizes trade-offs between biodiversity conservation and human activities by accounting for socioeconomic costs while aiming to achieve prescribed conservation objectives. However, the most cost-efficient conservation plan can be very dissimilar to any other plan achieving the set of conservation objectives. This is problematic under conditions of implementation uncertainty (e.g., if all or part of the plan becomes unattainable). We determined through simulations of parallel implementation of conservation plans and habitat loss the conditions under which optimal plans have limited chances of implementation and where implementation attempts would fail to meet objectives. We then devised a new, flexible method for identifying conservation priorities and scheduling conservation actions. This method entails generating a number of alternative plans, calculating the similarity in site composition among all plans, and selecting the plan with the highest density of neighboring plans in similarity space. We compared our method with the classic method that maximizes cost efficiency with synthetic and real data sets. When implementation was uncertain--a common reality--our method provided higher likelihood of achieving conservation targets. We found that χ, a measure of the shortfall in objectives achieved by a conservation plan if the plan could not be implemented entirely, was the main factor determining the relative performance of a flexibility enhanced approach to conservation prioritization. Our findings should help planning authorities prioritize conservation efforts in the face of uncertainty about future condition and availability of sites. © 2014 Society for Conservation Biology.

  18. The Oklahoma Field Test: Air-Conditioning Electricity Savings from Standard Energy Conservation Measures, Radiant Barriers, and High-Efficiency Window Air Conditioners

    Energy Technology Data Exchange (ETDEWEB)

    Ternes, M.P.


    A field test involving 104 houses was performed in Tulsa, Oklahoma, to measure the air-conditioning electricity consumption of low-income houses equipped with window air conditioners, the reduction in this electricity consumption attributed to the installation of energy conservation measures (ECMs) as typically installed under the Oklahoma Weatherization Assistance Program (WAP), and the reduction achieved by the replacement of low-efficiency window air conditioners with high-efficiency units and the installation of attic radiant barriers. Air-conditioning electricity consumption and indoor temperature were monitored weekly during the pre-weatherization period (June to September 1988) and post-weatherization period (May to September 1989). House energy consumption models and regression analyses were used to normalize the air-conditioning electricity savings to average outdoor temperature conditions and the pre-weatherization indoor temperature of each house. The average measured pre-weatherization air-conditioning electricity consumption was 1664 kWh/year ($119/year). Ten percent of the houses used less than 250 kWh/year, while another 10% used more than 3000 kWh/year. An average reduction in air-conditioning electricity consumption of 535 kWh/year ($38/year and 28% of pre-weatherization consumption) was obtained from replacement of one low-efficiency window air conditioner (EER less than 7.0) per house with a high-efficiency unit (EER greater than 9.0). For approximately the same cost, savings tripled to 1503 kWh/year ($107/year and 41% of pre-weatherization consumption) in those houses with initial air-conditioning electricity consumption greater than 2750 kWh/year. For these houses, replacement of a low-efficiency air conditioner with a high-efficiency unit was cost effective using the incremental cost of installing a new unit now rather than later; the average installation cost for these houses under a weatherization program was estimated to be $786. The

  19. Local recurrence after breast-conserving therapy for invasive breast cancer: high incidence in young patients and association with poor survival

    NARCIS (Netherlands)

    Elkhuizen, P. H.; van de Vijver, M. J.; Hermans, J.; Zonderland, H. M.; van de Velde, C. J.; Leer, J. W.


    PURPOSE: To study risk factors for local recurrence (LR) after breast-conserving therapy (BCT) for invasive breast cancer and, for patients with an LR, the mode of detection, location, treatment, influence of radiation therapy, and impact on survival. METHODS AND MATERIALS: 1360 patients (median age

  20. Conservation of the S10-spc-alpha Locus within Otherwise Highly Pastic Genomes Provides Phylogenetic Insight into the Genus Leptospira (United States)

    A comparative analysis of the Leptospira interrogans S10-spc-alpha operon was performed by PCR using primer sets covering the whole operon. Correctly sized fragments were obtained by PCR from all of L. interrogans strains for each primer set indicating that the S10-spc-alpha locus is well conserved ...

  1. Conservation genetics in transition to conservation genomics

    DEFF Research Database (Denmark)

    Ouborg, N. Joop; Pertoldi, Cino; Loeschcke, Volker


    in conservation biology. This has allowed assessment of the impact of genetic drift on genetic variation, of the level of inbreeding within populations, and of the amount of gene flow between or within populations. Recent developments in genomic techniques, including next generation sequencing, whole genome scans...... and gene-expression pattern analysis, have made it possible to step up from a limited number of neutral markers to genome-wide estimates of functional genetic variation. Here, we focus on how the transition of conservation genetics to conservation genomics leads to insights into the dynamics of selectively...

  2. Identification of Plasmodium falciparum reticulocyte binding protein homologue 5-interacting protein, PfRipr, as a highly conserved blood-stage malaria vaccine candidate. (United States)

    Ntege, Edward H; Arisue, Nobuko; Ito, Daisuke; Hasegawa, Tomoyuki; Palacpac, Nirianne M Q; Egwang, Thomas G; Horii, Toshihiro; Takashima, Eizo; Tsuboi, Takafumi


    Genetic variability in Plasmodium falciparum malaria parasites hampers current malaria vaccine development efforts. Here, we hypothesize that to address the impact of genetic variability on vaccine efficacy in clinical trials, conserved antigen targets should be selected to achieve robust host immunity across multiple falciparum strains. Therefore, suitable vaccine antigens should be assessed for levels of polymorphism and genetic diversity. Using a total of one hundred and two clinical isolates from a region of high malaria transmission in Uganda, we analyzed extent of polymorphism and genetic diversity in four recently reported novel blood-stage malaria vaccine candidate proteins: Rh5 interacting protein (PfRipr), GPI anchored micronemal antigen (PfGAMA), rhoptry-associated leucine zipper-like protein 1 (PfRALP1) and Duffy binding-like merozoite surface protein 1 (PfMSPDBL1). In addition, utilizing the wheat germ cell-free system, we expressed recombinant proteins for the four candidates based on P. falciparum laboratory strain 3D7 sequences, immunized rabbits to obtain specific antibodies (Abs) and performed functional growth inhibition assay (GIA). The GIA activity of the raised Abs was demonstrated using both homologous 3D7 and heterologous FVO strains in vitro. Both pfripr and pfralp1 are less polymorphic but the latter is comparatively more diverse, with varied number of regions having insertions and deletions, asparagine and 6-mer repeats in the coding sequences. Pfgama and pfmspdbl1 are polymorphic and genetically diverse among the isolates with antibodies against the 3D7-based recombinant PfGAMA and PfMSPDBL1 inhibiting merozoite invasion only in the 3D7 but not FVO strain. Moreover, although Abs against the 3D7-based recombinant PfRipr and PfRALP1 proteins potently inhibited merozoite invasion of both 3D7 and FVO, the GIA activity of anti-PfRipr was much higher than that of anti-PfRALP1. Thus, PfRipr is regarded as a promising blood-stage vaccine

  3. Water quality of the Ogallala Formation, central High Plains aquifer within the North Plains Groundwater Conservation District, Texas Panhandle, 2012-13 (United States)

    Baldys, Stanley; Haynie, Monti M.; Beussink, Amy M.


    In cooperation with the North Plains Groundwater Conservation District (NPGCD), the U.S. Geological Survey collected and analyzed water-quality samples at 30 groundwater monitor wells in the NPGCD in the Texas Panhandle. All of the wells were completed in the Ogallala Formation of the central High Plains aquifer. Samples from each well were collected during February–March 2012 and in March 2013. Depth to groundwater in feet below land surface was measured at each well before sampling to determine the water-quality sampling depths. Water-quality samples were analyzed for physical properties, major ions, nutrients, and trace metals, and 6 of the 30 samples were analyzed for pesticides. There was a strong relation between specific conductance and dissolved solids as evidenced by a coefficient of determination (R2) value of 0.98. The dissolved-solids concentration in water from five wells exceeded the secondary drinking-water standard of 500 milligrams per liter set by the U.S. Environmental Protection Agency. Water from 3 of these 5 wells was near the north central part of the NPGCD. Nitrate values exceeded the U.S. Environmental Protection Agency maximum contaminant level of 10 milligrams per liter in 2 of the 30 wells. A sodium-adsorption ratio of 23.4 was measured in the sample collected from well Da-3589 in Dallam County, with the next largest sodium-adsorption ratio measured in the sample collected from well Da-3588 (12.5), also in Dallum County. The sodium-adsorption ratios measured in all other samples were less than 10. The groundwater was generally a mixed cation-bicarbonate plus carbonate type. Twenty-three trace elements were analyzed, and no concentrations exceeded the secondary drinking-water standard or maximum contaminant level set by the U.S. Environmental Protection Agency for water supplies. In 2012, 6 of the 30 wells were sampled for commonly used pesticides. Atrazine and its degradate 2-Chloro-4-isopropylamino-6-amino-s-triazine were detected in

  4. Beyond Conservation Agriculture

    Directory of Open Access Journals (Sweden)

    Ken E Giller


    Full Text Available Global support for Conservation Agriculture (CA as a pathway to Sustainable Intensification is strong. CA revolves around three principles: no-till (or minimal soil disturbance, soil cover, and crop rotation. The benefits arising from the ease of crop management, energy/cost/time savings and soil and water conservation led to widespread adoption of CA, particularly on large farms in the Americas and Australia, where farmers harness the tools of modern science: highly-sophisticated machines, potent agrochemicals and biotechnology. Over the past ten years CA has been promoted among smallholder farmers in the (sub- tropics, often with disappointing results. Growing evidence challenges the claims that CA increases crop yields and builds-up soil carbon although increased stability of crop yields in dry climates is evident. Our analyses suggest pragmatic adoption on larger mechanized farms, and limited uptake of CA by smallholder farmers in developing countries. We propose a rigorous, context-sensitive approach based on Systems Agronomy to analyze and explore sustainable intensification options, including the potential of CA. There is an urgent need to move beyond dogma and prescriptive approaches to provide soil and crop management options for farmers to enable the Sustainable Intensification of agriculture.

  5. Beyond conservation agriculture (United States)

    Giller, Ken E.; Andersson, Jens A.; Corbeels, Marc; Kirkegaard, John; Mortensen, David; Erenstein, Olaf; Vanlauwe, Bernard


    Global support for Conservation Agriculture (CA) as a pathway to Sustainable Intensification is strong. CA revolves around three principles: no-till (or minimal soil disturbance), soil cover, and crop rotation. The benefits arising from the ease of crop management, energy/cost/time savings, and soil and water conservation led to widespread adoption of CA, particularly on large farms in the Americas and Australia, where farmers harness the tools of modern science: highly-sophisticated machines, potent agrochemicals, and biotechnology. Over the past 10 years CA has been promoted among smallholder farmers in the (sub-) tropics, often with disappointing results. Growing evidence challenges the claims that CA increases crop yields and builds-up soil carbon although increased stability of crop yields in dry climates is evident. Our analyses suggest pragmatic adoption on larger mechanized farms, and limited uptake of CA by smallholder farmers in developing countries. We propose a rigorous, context-sensitive approach based on Systems Agronomy to analyze and explore sustainable intensification options, including the potential of CA. There is an urgent need to move beyond dogma and prescriptive approaches to provide soil and crop management options for farmers to enable the Sustainable Intensification of agriculture. PMID:26579139

  6. Mutational analysis of two highly conserved motifs in the silencing suppressor encoded by tomato spotted wilt virus (genus Tospovirus, family Bunyaviridae). (United States)

    Zhai, Ying; Bag, Sudeep; Mitter, Neena; Turina, Massimo; Pappu, Hanu R


    Tospoviruses cause serious economic losses to a wide range of field and horticultural crops on a global scale. The NSs gene encoded by tospoviruses acts as a suppressor of host plant defense. We identified amino acid motifs that are conserved in all of the NSs proteins of tospoviruses for which the sequence is known. Using tomato spotted wilt virus (TSWV) as a model, the role of these motifs in suppressor activity of NSs was investigated. Using site-directed point mutations in two conserved motifs, glycine, lysine and valine/threonine (GKV/T) at positions 181-183 and tyrosine and leucine (YL) at positions 412-413, and an assay to measure the reversal of gene silencing in Nicotiana benthamiana line 16c, we show that substitutions (K182 to A, and L413 to A) in these motifs abolished suppressor activity of the NSs protein, indicating that these two motifs are essential for the RNAi suppressor function of tospoviruses.

  7. Further progress on defining highly conserved immunogenic epitopes for a global HIV vaccine: HLA-A3-restricted GAIA vaccine epitopes. (United States)

    De Groot, Anne S; Levitz, Lauren; Ardito, Matthew T; Skowron, Gail; Mayer, Kenneth H; Buus, Soren; Boyle, Christine M; Martin, William D


    Two major obstacles confronting HIV vaccine design have been the extensive viral diversity of HIV-1 globally and viral evolution driven by escape from CD8(+) cytotoxic T-cell lymphocyte (CTL)-mediated immune pressure. Regions of the viral genome that are not able to escape immune response and that are conserved in sequence and across time may represent the "Achilles' heel" of HIV and would be excellent candidates for vaccine development. In this study, T-cell epitopes were selected using immunoinformatics tools, combining HLA-A3 binding predictions with relative sequence conservation in the context of global HIV evolution. Twenty-seven HLA-A3 epitopes were chosen from an analysis performed in 2003 on 10,803 HIV-1 sequences, and additional sequences were selected in 2009 based on an expanded set of 43,822 sequences. These epitopes were tested in vitro for HLA binding and for immunogenicity with PBMCs of HIV-infected donors from Providence, Rhode Island. Validation of these HLA-A3 epitopes conserved across time, clades, and geography supports the hypothesis that epitopes such as these would be candidates for inclusion in our globally relevant GAIA HIV vaccine constructs.

  8. Water conservation behavior in Australia (United States)

    Dolnicar, Sara; Hurlimann, Anna; Grün, Bettina


    Ensuring a nation's long term water supply requires the use of both supply-sided approaches such as water augmentation through water recycling, and demand-sided approaches such as water conservation. Conservation behavior can only be increased if the key drivers of such behavior are understood. The aim of this study is to reveal the main drivers from a comprehensive pool of hypothesized factors. An empirical study was conducted with 3094 Australians. Data was analyzed using multivariate linear regression analysis and decision trees to determine which factors best predict self-reported water conservation behavior. Two key factors emerge: high level of pro-environmental behavior; and pro-actively seeking out information about water. A number of less influential factors are also revealed. Public communication strategy implications are derived. PMID:22522412

  9. Conservation: Toward firmer ground (United States)


    The following aspects of energy conservation were discussed: conservation history and goals, conservation modes, conservation accounting-criteria, and a method to overcome obstacles. The conservation modes tested fall into one of the following categories: reduced energy consumption, increased efficiency of energy utilization, or substitution of one or more forms of energy for another which is in shorter supply or in some sense thought to be of more value. The conservation accounting criteria include net energy reduction, economic, and technical criteria. A method to overcome obstacles includes (approaches such as: direct personal impact (life style, income, security, aspiration), an element of crisis, large scale involvement of environmental, safety, and health issues, connections to big government, big business, big politics, involvement of known and speculative science and technology, appeal to moral and ethical standards, the transient nature of opportunities to correct the system.

  10. Comparative Developmental Transcriptomics Reveals Rewiring of a Highly Conserved Gene Regulatory Network during a Major Life History Switch in the Sea Urchin Genus Heliocidaris.

    Directory of Open Access Journals (Sweden)

    Jennifer W Israel


    Full Text Available The ecologically significant shift in developmental strategy from planktotrophic (feeding to lecithotrophic (nonfeeding development in the sea urchin genus Heliocidaris is one of the most comprehensively studied life history transitions in any animal. Although the evolution of lecithotrophy involved substantial changes to larval development and morphology, it is not known to what extent changes in gene expression underlie the developmental differences between species, nor do we understand how these changes evolved within the context of the well-defined gene regulatory network (GRN underlying sea urchin development. To address these questions, we used RNA-seq to measure expression dynamics across development in three species: the lecithotroph Heliocidaris erythrogramma, the closely related planktotroph H. tuberculata, and an outgroup planktotroph Lytechinus variegatus. Using well-established statistical methods, we developed a novel framework for identifying, quantifying, and polarizing evolutionary changes in gene expression profiles across the transcriptome and within the GRN. We found that major changes in gene expression profiles were more numerous during the evolution of lecithotrophy than during the persistence of planktotrophy, and that genes with derived expression profiles in the lecithotroph displayed specific characteristics as a group that are consistent with the dramatically altered developmental program in this species. Compared to the transcriptome, changes in gene expression profiles within the GRN were even more pronounced in the lecithotroph. We found evidence for conservation and likely divergence of particular GRN regulatory interactions in the lecithotroph, as well as significant changes in the expression of genes with known roles in larval skeletogenesis. We further use coexpression analysis to identify genes of unknown function that may contribute to both conserved and derived developmental traits between species

  11. Comparative Developmental Transcriptomics Reveals Rewiring of a Highly Conserved Gene Regulatory Network during a Major Life History Switch in the Sea Urchin Genus Heliocidaris. (United States)

    Israel, Jennifer W; Martik, Megan L; Byrne, Maria; Raff, Elizabeth C; Raff, Rudolf A; McClay, David R; Wray, Gregory A


    The ecologically significant shift in developmental strategy from planktotrophic (feeding) to lecithotrophic (nonfeeding) development in the sea urchin genus Heliocidaris is one of the most comprehensively studied life history transitions in any animal. Although the evolution of lecithotrophy involved substantial changes to larval development and morphology, it is not known to what extent changes in gene expression underlie the developmental differences between species, nor do we understand how these changes evolved within the context of the well-defined gene regulatory network (GRN) underlying sea urchin development. To address these questions, we used RNA-seq to measure expression dynamics across development in three species: the lecithotroph Heliocidaris erythrogramma, the closely related planktotroph H. tuberculata, and an outgroup planktotroph Lytechinus variegatus. Using well-established statistical methods, we developed a novel framework for identifying, quantifying, and polarizing evolutionary changes in gene expression profiles across the transcriptome and within the GRN. We found that major changes in gene expression profiles were more numerous during the evolution of lecithotrophy than during the persistence of planktotrophy, and that genes with derived expression profiles in the lecithotroph displayed specific characteristics as a group that are consistent with the dramatically altered developmental program in this species. Compared to the transcriptome, changes in gene expression profiles within the GRN were even more pronounced in the lecithotroph. We found evidence for conservation and likely divergence of particular GRN regulatory interactions in the lecithotroph, as well as significant changes in the expression of genes with known roles in larval skeletogenesis. We further use coexpression analysis to identify genes of unknown function that may contribute to both conserved and derived developmental traits between species. Collectively, our results

  12. Spatially conserved regulatory elements identified within human and mouse Cd247 gene using high-throughput sequencing data from the ENCODE project

    DEFF Research Database (Denmark)

    Pundhir, Sachin; Hannibal, Tine Dahlbæk; Bang-Berthelsen, Claus Heiner


    , supported by histone marks and ChIP-seq data, that specifically have features of an enhancer and a promoter, respectively. We also identified a putative long non-coding RNA from the characteristically long first intron of the Cd247 gene. The long non-coding RNA annotation is supported by manual annotations...... from the GENCODE project in human and our expression quantification analysis performed in NOD and B6 mice using qRT-PCR. Furthermore, 17 of the 23 SNPs already known to be implicated with T1D were observed within the long non-coding RNA region in mouse. The spatially conserved regulatory elements...

  13. Exploiting deterministic maintenance opportunity windows created by conservative engineering design rules that result in free time locked into large high-speed coupled production lines with finite buffers

    Directory of Open Access Journals (Sweden)

    Durandt, Casper


    Full Text Available Conservative engineering design rules for large serial coupled production processes result in machines having locked-in free time (also called ‘critical downtime’ or ‘maintenance opportunity windows’, which cause idle time if not used. Operators are not able to assess a large production process holistically, and so may not be aware that they form the current bottleneck – or that they have free time available due to interruptions elsewhere. A real-time method is developed to accurately calculate and display free time in location and magnitude, and efficiency improvements are demonstrated in large-scale production runs.

  14. Wildlife conservation on farmland

    National Research Council Canada - National Science Library

    Macdonald, David W; Feber, R. (Ruth)


    ...: Integrates more than 30 years of research by the Wildlife Conservation Research Unit at Oxford to reveal how agricultural systems and wildlife interact, presenting examples from scales varying...

  15. Paradigms for parasite conservation. (United States)

    Dougherty, Eric R; Carlson, Colin J; Bueno, Veronica M; Burgio, Kevin R; Cizauskas, Carrie A; Clements, Christopher F; Seidel, Dana P; Harris, Nyeema C


    Parasitic species, which depend directly on host species for their survival, represent a major regulatory force in ecosystems and a significant component of Earth's biodiversity. Yet the negative impacts of parasites observed at the host level have motivated a conservation paradigm of eradication, moving us farther from attainment of taxonomically unbiased conservation goals. Despite a growing body of literature highlighting the importance of parasite-inclusive conservation, most parasite species remain understudied, underfunded, and underappreciated. We argue the protection of parasitic biodiversity requires a paradigm shift in the perception and valuation of their role as consumer species, similar to that of apex predators in the mid-20th century. Beyond recognizing parasites as vital trophic regulators, existing tools available to conservation practitioners should explicitly account for the unique threats facing dependent species. We built upon concepts from epidemiology and economics (e.g., host-density threshold and cost-benefit analysis) to devise novel metrics of margin of error and minimum investment for parasite conservation. We define margin of error as the risk of accidental host extinction from misestimating equilibrium population sizes and predicted oscillations, while minimum investment represents the cost associated with conserving the additional hosts required to maintain viable parasite populations. This framework will aid in the identification of readily conserved parasites that present minimal health risks. To establish parasite conservation, we propose an extension of population viability analysis for host-parasite assemblages to assess extinction risk. In the direst cases, ex situ breeding programs for parasites should be evaluated to maximize success without undermining host protection. Though parasitic species pose a considerable conservation challenge, adaptations to conservation tools will help protect parasite biodiversity in the face of

  16. Introducing Conservation of Momentum (United States)

    Brunt, Marjorie; Brunt, Geoff


    The teaching of the principle of conservation of linear momentum is considered (ages 15 + ). From the principle, the momenta of two masses in an isolated system are considered. Sketch graphs of the momenta make Newton's laws appear obvious. Examples using different collision conditions are considered. Conservation of momentum is considered…

  17. Resource Conservation Glossary. (United States)

    Soil Conservation Society of America, Ankeny, IA.

    This glossary is a composite of terms selected from 13 technologies, and is the expanded revision of the original 1952 edition of "The Soil and Water Conservation Glossary." The terms were selected from these areas: agronomy, biology, conservation, ecology, economics, engineering, forestry, geology, hydrology, range, recreation, soils, and…

  18. Creative Soil Conservation (United States)

    Smith, Martha


    Take plant lessons outdoors with this engaging and inquiry-based activity in which third-grade students learn how to apply soil conservation methods to growing plants. They also collect data and draw conclusions about the effectiveness of their method of soil conservation. An added benefit to this activity is that the third-grade students played…

  19. Fixism and conservation science. (United States)

    Robert, Alexandre; Fontaine, Colin; Veron, Simon; Monnet, Anne-Christine; Legrand, Marine; Clavel, Joanne; Chantepie, Stéphane; Couvet, Denis; Ducarme, Frédéric; Fontaine, Benoît; Jiguet, Frédéric; le Viol, Isabelle; Rolland, Jonathan; Sarrazin, François; Teplitsky, Céline; Mouchet, Maud


    The field of biodiversity conservation has recently been criticized as relying on a fixist view of the living world in which existing species constitute at the same time targets of conservation efforts and static states of reference, which is in apparent disagreement with evolutionary dynamics. We reviewed the prominent role of species as conservation units and the common benchmark approach to conservation that aims to use past biodiversity as a reference to conserve current biodiversity. We found that the species approach is justified by the discrepancy between the time scales of macroevolution and human influence and that biodiversity benchmarks are based on reference processes rather than fixed reference states. Overall, we argue that the ethical and theoretical frameworks underlying conservation research are based on macroevolutionary processes, such as extinction dynamics. Current species, phylogenetic, community, and functional conservation approaches constitute short-term responses to short-term human effects on these reference processes, and these approaches are consistent with evolutionary principles. © 2016 Society for Conservation Biology.

  20. Context and Number Conservation. (United States)

    Silverman, Irwin W.


    A replication study was conducted to determine whether conservation-of-number performance would be improved by questioning the subject only after the transformation is performed, rather than before and after the transformation, as is done in the standard conservation test. Subjects were preschoolers, aged 0-4 to 5-7. (Author/MP)

  1. Conservation in transportation

    Energy Technology Data Exchange (ETDEWEB)



    A nationwide examination was made of grassroots energy conservation programs related to transportation. Information compiled from civic groups, trade associations, and corporations is included on driver awareness/mass transit; travel; and ride sharing. It is concluded that a willingness by the public to cooperate in transportation energy conservation exists and should be exploited. (LCL)

  2. Madagascar Conservation & Development

    African Journals Online (AJOL)

    Madagascar Conservation & Development welcomes the results of original research, field surveys, advances in field and laboratory techniques, book reviews, and informal status reports from research, conservation, development and management programs and in-field projects in Madagascar. In addition, notes on changes ...

  3. Water Conservation Resource List. (United States)

    NJEA Review, 1981


    Alarmed by the growing water shortage, the New Jersey State Office of Dissemination has prepared this annotated list of free or inexpensive instructional materials for teaching about water conservation, K-l2. A tipsheet for home water conservation is appended. (Editor/SJL)

  4. Risk propensity differences between managers and entrepreneurs and between low- and high-growth entrepreneurs: a reply in a more conservative vein. (United States)

    Miner, John B; Raju, Nambury S


    A recent article (W. H. Stewart & P. L. Roth, 2001) in the Journal of Applied Psychology presented the conclusion from meta-analysis that entrepreneurs have a higher risk propensity than managers and that this propensity is particularly pronounced among the growth-oriented. A previously unresolved question was said to be laid to rest and a "vital component" of a theory of entrepreneurship established. The present article disagrees and cites data from 14 studies not included in the Stewart and Roth (2001) analysis, adding up to a conclusion (supported by new meta-analyses) that entrepreneurs (and those with a growth orientation) are more risk avoidant. Thus, a conservative view, retaining the position that the role of risk propensity in entrepreneurship remains unresolved, is upheld. Potential explanations for the conflicting results are explored. ((c) 2004 APA, all rights reserved)

  5. A highly conserved N-terminal sequence for teleost vitellogenin with potential value to the biochemistry, molecular biology and pathology of vitellogenesis (United States)

    Folmar, L.D.; Denslow, N.D.; Wallace, R.A.; LaFleur, G.; Gross, T.S.; Bonomelli, S.; Sullivan, C.V.


    N-terminal amino acid sequences for vitellogenin (Vtg) from six species of teleost fish (striped bass, mummichog, pinfish, brown bullhead, medaka, yellow perch and the sturgeon) are compared with published N-terminal Vtg sequences for the lamprey, clawed frog and domestic chicken. Striped bass and mummichog had 100% identical amino acids between positions 7 and 21, while pinfish, brown bullhead, sturgeon, lamprey, Xenopus and chicken had 87%, 93%, 60%, 47%, 47-60%) for four transcripts and had 40% identical, respectively, with striped bass for the same positions. Partial sequences obtained for medaka and yellow perch were 100% identical between positions 5 to 10. The potential utility of this conserved sequence for studies on the biochemistry, molecular biology and pathology of vitellogenesis is discussed.

  6. Highly conserved regions in Ebola virus RNA dependent RNA polymerase may be act as a universal novel peptide vaccine target: a computational approach. (United States)

    Oany, Arafat Rahman; Sharmin, Tahmina; Chowdhury, Afrin Sultana; Jyoti, Tahmina Pervin; Hasan, Md Anayet


    Ebola virus (EBOV) is such kind of virus which is responsible for 23,825 cases and 9675 deaths worldwide only in 2014 and with an average diseases fatality rate between 25 % and 90 %. Although, medical technology has tried to handle the problems, there is no Food and Drug Administration (FDA)-approved therapeutics or vaccines available for the prevention, post exposure, or treatment of Ebola virus disease (EVD). In the present study, we used the immunoinformatics approach to design a potential epitope-based vaccine against the RNA-dependent RNA polymerase-L of EBOV. BioEdit v7.2.3 sequence alignment editor, Jalview v2 and CLC Sequence Viewer v7.0.2 were used for the initial sequence analysis for securing the conservancy from the sequences. Later the Immune Epitope Database and Analysis Resource (IEDB-AR) was used for the identification of T-cell and B-cellepitopes associated with type I and II major histocompatibility complex molecules analysis. Finally, the population coverage analysis was employed. The core epitope "FRYEFTAPF" was found to be the most potential one, with 100 % conservancy among all the strains of EBOV. It also interacted with both type I and II major histocompatibility complex molecules and is considered as nonallergenic in nature. Finally, with impressive cumulative population coverage of 99.87 % for the both MHC-I and MHC-II class throughout the world population was found for the proposed epitope. To end, the projected peptide gave us a solid stand to propose for vaccine consideration and that might be experimented for its potency in eliciting immunity through humoral and cell mediated immune responses in vitro and in vivo.

  7. The highly conserved serine threonine kinase StkP of Streptococcus pneumoniae contributes to penicillin susceptibility independently from genes encoding penicillin-binding proteins

    Directory of Open Access Journals (Sweden)

    Dias Ricardo


    Full Text Available Abstract Background The serine/threonine kinase StkP of Streptococcus pneumoniae is a major virulence factor in the mouse model of infection. StkP is a modular protein with a N-terminal kinase domain a C-terminal PASTA domain carrying the signature of penicillin-binding protein (PBP and prokaryotic serine threonine kinase. In laboratory cultures, one target of StkP is the phosphoglucosamine mutase GlmM involved in the first steps of peptidoglycan biosynthesis. In order to further elucidate the importance of StkP in S. pneumoniae, its role in resistance to β-lactams has been assessed by mutational analysis in laboratory cultures and its genetic conservation has been investigated in isolates from infected sites (virulent, asymptomatic carriers, susceptible and non-susceptible to β-lactams. Results Deletion replacement mutation in stkP conferred hypersensitivity to penicillin G and was epistatic on mutations in PBP2X, PBP2B and PBP1A from the resistant 9V clinical isolate URA1258. Genetic analysis of 55 clinical isolates identified 11 StkP alleles differing from the reference R6 allele. None relevant mutation in the kinase or the PASTA domains were found to account for susceptibility of the isolates. Rather the minimal inhibitory concentration (MIC values of the strains appeared to be determined by their PBP alleles. Conclusion The results of genetic dissection analysis in lab strain Cp1015 reveal that StkP is involved in the bacterial response to penicillin and is epistatic on mutations PBP 2B, 2X and 1A. However analysis of the clinical isolates did not allow us to find the StkP alleles putatively involved in determining the virulence or the resistance level of a given strain, suggesting a strong conservation of StkP in clinical isolates.

  8. Wildlife cancer: a conservation perspective. (United States)

    McAloose, Denise; Newton, Alisa L


    Until recently, cancer in wildlife was not considered to be a conservation concern. However, with the identification of Tasmanian devil facial tumour disease, sea turtle fibropapillomatosis and sea lion genital carcinoma, it has become apparent that neoplasia can be highly prevalent and have considerable effects on some species. It is also clear that anthropogenic activities contribute to the development of neoplasia in wildlife species, such as beluga whales and bottom-dwelling fish, making them sensitive sentinels of disturbed environments.

  9. Integrating agricultural expansion into conservation biogeography: conflicts and priorities

    Directory of Open Access Journals (Sweden)

    Ricardo Dobrovolski


    Full Text Available Increasing food production without compromising biodiversity is one of the great challenges for humanity. The aims of my thesis were to define spatial priorities for biodiversity conservation and to evaluate conservation conflicts considering agricultural expansion in the 21st century. I also tested the effect of globalizing conservation efforts on both food production and biodiversity conservation. I found spatial conflicts between biodiversity conservation and agricultural expansion. However, incorporating agricultural expansion data into the spatial prioritization process can significantly alleviate conservation conflicts, by reducing spatial correlation between the areas under high impact of agriculture and the priority areas for conservation. Moreover, developing conservation blueprints at the global scale, instead of the usual approach based on national boundaries, can benefit both food production and biodiversity. Based on these findings I conclude that the incorporation of agricultural expansion as a key component for defining global conservation strategies should be added to the list of solutions for our cultivated planet.

  10. Making conservation research more relevant for conservation practitioners

    NARCIS (Netherlands)

    Laurance, W.F.; Koster, H.; Grooten, M.; Anderson, A.B.; Zuidema, P.A.; Zwick, S.; Zagt, R.J.; Lynam, A.J.; Linkie, M.; Anten, N.P.R.


    Conservation scientists and practitioners share many of the same goals. Yet in a majority of cases, we argue, research conducted by academic conservation scientists actually makes surprisingly few direct contributions to environmental conservation. We illustrate how researchers can increase the

  11. Association of Locoregional Control With High Body Mass Index in Women Undergoing Breast Conservation Therapy for Early-Stage Breast Cancer

    Energy Technology Data Exchange (ETDEWEB)

    Bergom, Carmen; Kelly, Tracy; Bedi, Meena; Saeed, Hina; Prior, Phillip [Department of Radiation Oncology, Medical College of Wisconsin, Milwaukee, Wisconsin (United States); Rein, Lisa E.; Szabo, Aniko [Division of Biostatistics, Medical College of Wisconsin, Milwaukee, Wisconsin (United States); Wilson, J. Frank; Currey, Adam D. [Department of Radiation Oncology, Medical College of Wisconsin, Milwaukee, Wisconsin (United States); White, Julia, E-mail: [Department of Radiation Oncology, James Cancer Hospital, Ohio State University Comprehensive Cancer Center, Columbus, Ohio (United States)


    Purpose: Obesity, as measured by the body mass index (BMI), is a risk factor for distant recurrence and decreased survival in breast cancer. We sought to determine whether the BMI correlated with local recurrence and reduced survival in a cohort of predominantly obese women treated with breast conservation therapy. Methods and Materials: From 1998 to 2010, 154 women with early-stage invasive breast cancer and 39 patients with ductal carcinoma in situ underwent prone whole breast irradiation. Cox proportional hazards regression, Kaplan-Meier methods with the log-rank test, and multivariate analysis were used to explore the association of the outcomes with the BMI. Results: The median patient age was 60 years, and the median follow-up duration was 73 months. The median BMI was 33.2 kg/m{sup 2}; 91% of the patients were overweight (BMI ≥25 kg/m{sup 2}) and 69% of the patients were clinically obese (BMI ≥30 kg/m{sup 2}). The BMI was significantly associated with the locoregional recurrence-free interval for patients with invasive cancer and ductal carcinoma in situ (hazard ratio [HR], 1.09; P=.047). Also, a trend was seen for increased locoregional recurrence with a higher BMI (P=.09) for patients with invasive disease, which was significant when examining the outcomes with a BMI stratified by the median value of 33.2 kg/m{sup 2} (P=.008). A greater BMI was also significantly associated with decreased distant recurrence-free interval (HR, 1.09; P=.011) and overall survival (HR, 1.09; P=.004); this association remained on multivariate analysis (distant recurrence-free interval, P=.034; overall survival, P=.0007). Conclusions: These data suggest that the BMI might affect the rate of locoregional recurrence in breast cancer patients. A higher BMI predicted a worse distant recurrence-free interval and overall survival. The present investigation adds to the increasing evidence that BMI is an important prognostic factor in early-stage breast cancer treated with

  12. Lasers in the Conservation of Artworks

    CERN Document Server

    Nimmrichter, Johann; Schreiner, Manfred; LACONA VI Proceedings


    Within the last decades, the use of lasers in artworks conservation became an important tool for many conservators, scientists, architects and other experts, who are involved in the care of monuments and artefacts or laser technology. For the first time in 1995 Professor Costas Fotakis brought together restorers and scientists to discuss the potential of lasers in art conservation. Since then the field of "Lasers in the Conservation of Artworks" has gained enormously in importance. Nowadays restorers and laser scientists work close together in order to develop new fields of applications during the last years. Furthermore a large number of national and international research projects have been carried out by conservator-restorers, architects and scientists. In the last 10 years a number of historical and artistic high quality monuments (e.g. St. Stephens Cathedral in Vienna) have been cleaned or measured by laser and brought the laser in the spectra of tools which are useful in the sensible field of artworks. ...

  13. Novel urban ecosystems, biodiversity, and conservation. (United States)

    Kowarik, Ingo


    With increasing urbanization the importance of cities for biodiversity conservation grows. This paper reviews the ways in which biodiversity is affected by urbanization and discusses the consequences of different conservation approaches. Cities can be richer in plant species, including in native species, than rural areas. Alien species can lead to both homogenization and differentiation among urban regions. Urban habitats can harbor self-sustaining populations of rare and endangered native species, but cannot replace the complete functionality of (semi-)natural remnants. While many conservation approaches tend to focus on such relict habitats and native species in urban settings, this paper argues for a paradigm shift towards considering the whole range of urban ecosystems. Although conservation attitudes may be challenged by the novelty of some urban ecosystems, which are often linked to high numbers of nonnative species, it is promising to consider their associated ecosystem services, social benefits, and possible contribution to biodiversity conservation. Copyright © 2011 Elsevier Ltd. All rights reserved.

  14. Climate change threatens European conservation areas (United States)

    Araújo, Miguel B; Alagador, Diogo; Cabeza, Mar; Nogués-Bravo, David; Thuiller, Wilfried


    Europe has the world's most extensive network of conservation areas. Conservation areas are selected without taking into account the effects of climate change. How effectively would such areas conserve biodiversity under climate change? We assess the effectiveness of protected areas and the Natura 2000 network in conserving a large proportion of European plant and terrestrial vertebrate species under climate change. We found that by 2080, 58 ± 2.6% of the species would lose suitable climate in protected areas, whereas losses affected 63 ± 2.1% of the species of European concern occurring in Natura 2000 areas. Protected areas are expected to retain climatic suitability for species better than unprotected areas (Pareas retain climate suitability for species no better and sometimes less effectively than unprotected areas. The risk is high that ongoing efforts to conserve Europe's biodiversity are jeopardized by climate change. New policies are required to avert this risk. PMID:21447141

  15. Identification of highly conserved regions in L-segment of Crimean-Congo hemorrhagic fever virus and immunoinformatic prediction about potential novel vaccine. (United States)

    Oany, Arafat Rahman; Ahmad, Shah Adil Ishtiyaq; Hossain, Mohammad Uzzal; Jyoti, Tahmina Pervin


    Crimean-Congo hemorrhagic fever (CCHF) is a tick-borne zoonotic viral disease with a disease fatality rate between 15% and 70%. Despite the wide range of distribution, the virus (CCHFV) is basically endemic in Africa, Asia, eastern Europe, and the Middle East. Acute febrile illness associated with petechiae, disseminated intravascular coagulation, and multiple-organ failure are the main symptoms of the disease. With all these fatal effects, CCHFV is considered a huge threat as no successful therapeutic approach is currently available for the treatment of this disease. In the present study, we have used the immunoinformatics approach to design a potential epitope-based vaccine against the RNA-dependent RNA polymerase-L of CCHFV. Both the T-cell and B-cell epitopes were assessed, and the epitope "DCSSTPPDR" was found to be the most potential one, with 100% conservancy among all the strains of CCHFV. The epitope was also found to interact with both type I and II major histocompatibility complex molecules and is considered nonallergenic as well. In vivo study of our proposed peptide is advised for novel universal vaccine production, which might be an effective path to prevent CCHF disease.

  16. Tourism and Conservation

    DEFF Research Database (Denmark)

    Budeanu, Adriana


    Tourism is promoted by policy makers and international organizations as a tool for advancing conservation agendas, while contributing to poverty alleviation and human development, under the banner of ecotourism or sustainable tourism. However, the indiscriminating use of complex and ambiguous...

  17. Hearing Conservation Team (United States)

    Federal Laboratory Consortium — The Hearing Conservation Team focuses on ways to identify the early stages of noise-induced damage to the human ear.Our current research involves the evaluation of...

  18. Energy Conservation Behaviour Toolkit

    NARCIS (Netherlands)

    Kalz, Marco; Börner, Dirk; Ternier, Stefaan; Specht, Marcus


    Kalz, M., Börner, D., Ternier, S., & Specht, M. (2013, 31 January). Energy Conservation Behaviour Toolkit. Presentation given at the symposium "Groene ICT en Duurzame ontwikkeling: Meters maken in het Hoger Onderwijs", Driebergen, The Netherlands.

  19. Metro Conservation Corridors (United States)

    Minnesota Department of Natural Resources — The Metro Conservation Corridors (MeCC) grow out of the natural resource analysis work done by the DNR in the late '90's, documented in the Metro Greenprint...

  20. Mesocycles in conserving plastics

    DEFF Research Database (Denmark)

    Shashoua, Yvonne


    Analysis suggests that progress in conservation of plastics objects and artworks can be described by a series of overlapping mesocycles. Focus has been placed for periods of 5-10 years each on determining the degradation pathways in the 1990s, developing strategies to inhibit those pathways from...... plastics has been the origin of the data describing lifetimes. By contrast, mesocycles in developing suitable storage and display microclimates for plastics have mirrored preventive conservation practices for natural polymeric materials. The rate of the third mesocycle, interventive conservation, has been...... driven by the need to balance the requirements for reversibility in conservation practices with the artist’s intent and significance. Developments within each of the three mesocycles from the 1990s to date are discussed in this article. Environmental science and toxicology of waste plastics offer a novel...

  1. Novel urban ecosystems, biodiversity, and conservation

    Energy Technology Data Exchange (ETDEWEB)

    Kowarik, Ingo, E-mail: [Department of Ecology, Technische Universitaet Berlin, Rothenburgstr. 12, D 12165 Berlin (Germany)


    With increasing urbanization the importance of cities for biodiversity conservation grows. This paper reviews the ways in which biodiversity is affected by urbanization and discusses the consequences of different conservation approaches. Cities can be richer in plant species, including in native species, than rural areas. Alien species can lead to both homogenization and differentiation among urban regions. Urban habitats can harbor self-sustaining populations of rare and endangered native species, but cannot replace the complete functionality of (semi-)natural remnants. While many conservation approaches tend to focus on such relict habitats and native species in urban settings, this paper argues for a paradigm shift towards considering the whole range of urban ecosystems. Although conservation attitudes may be challenged by the novelty of some urban ecosystems, which are often linked to high numbers of nonnative species, it is promising to consider their associated ecosystem services, social benefits, and possible contribution to biodiversity conservation. - Highlights: > This paper reviews biotic responses to urbanization and urban conservation approaches. > Cities may be rich in both native and nonnative species. > Urban habitats cannot replace the functionality of natural remnants. > However, even novel urban habitats may harbour rare and endangered species. > Conservation approaches should consider the perspective of novel urban ecosystems. - This paper reviews the ways in which biodiversity is affected by urbanization and argues for expanding urban conservation approaches.

  2. 76 FR 22785 - Wetland Conservation (United States)


    ... 7 CFR Part 12 RIN 0578-AA58 Wetland Conservation AGENCY: Office of the Secretary, United States... concerning the Natural Resources Conservation Service's (NRCS) coordination responsibilities. DATES..., Director, Ecological Sciences Division, U.S. Department of Agriculture, Natural Resources Conservation...

  3. RapA2 Is a Calcium-binding Lectin Composed of Two Highly Conserved Cadherin-like Domains That Specifically Recognize Rhizobium leguminosarum Acidic Exopolysaccharides* (United States)

    Abdian, Patricia L.; Caramelo, Julio J.; Ausmees, Nora; Zorreguieta, Angeles


    In silico analyses have revealed a conserved protein domain (CHDL) widely present in bacteria that has significant structural similarity to eukaryotic cadherins. A CHDL domain was shown to be present in RapA, a protein that is involved in autoaggregation of Rhizobium cells, biofilm formation, and adhesion to plant roots as shown by us and others. Structural similarity to cadherins suggested calcium-dependent oligomerization of CHDL domains as a mechanistic basis for RapA action. Here we show by circular dichroism spectroscopy, light scattering, isothermal titration calorimetry, and other methods that RapA2 from Rhizobium leguminosarum indeed exhibits a cadherin-like β-sheet conformation and that its proper folding and stability are dependent on the binding of one calcium ion per protein molecule. By further in silico analysis we also reveal that RapA2 consists of two CHDL domains and expand the range of CHDL-containing proteins in bacteria and archaea. However, light scattering assays at various concentrations of added calcium revealed that RapA2 formed neither homo-oligomers nor hetero-oligomers with RapB (a distinct CHDL protein), indicating that RapA2 does not mediate cellular interactions through a cadherin-like mechanism. Instead, we demonstrate that RapA2 interacts specifically with the acidic exopolysaccharides (EPSs) produced by R. leguminosarum in a calcium-dependent manner, sustaining a role of these proteins in the development of the biofilm matrix made of EPS. Because EPS binding by RapA2 can only be attributed to its two CHDL domains, we propose that RapA2 is a calcium-dependent lectin and that CHDL domains in various bacterial and archaeal proteins confer carbohydrate binding activity to these proteins. PMID:23235153

  4. HvHMA2, a P(1B)-ATPase from barley, is highly conserved among cereals and functions in Zn and Cd transport. (United States)

    Mills, Rebecca F; Peaston, Kerry A; Runions, John; Williams, Lorraine E


    Manipulation of crops to improve their nutritional value (biofortification) and optimisation of plants for removal of toxic metals from contaminated soils (phytoremediation) are major goals. Identification of membrane transporters with roles in zinc and cadmium transport would be useful for both aspects. The P(1B)-ATPases play important roles in heavy metal allocation and detoxification in Arabidopsis and it is now important to elucidate their roles in monocots. We identified nine P(1B)-ATPases in barley and this study focuses on the functional characterization of HvHMA2, providing evidence for its role in heavy metal transport. HvHMA2 was cloned using information from EST analysis and 5' RACE. It possesses the conserved aspartate that is phosphorylated during the reaction cycle of P-type pumps and has motifs and key residues characteristic of P(1B)-ATPases, falling into the P(1B-2) subclass. Homologous sequences occur in three major sub-families of the Poaceae (Gramineae). Heterologous expression in Saccharomyces cerevisiae demonstrates that HvHMA2 functions as a Zn and Cd pump. Mutagenesis studies show that proposed cation coordination sites of the P(1B-2) pumps are crucial for the metal responses conferred by HvHMA2 in yeast. HvHMA2 expression suppresses the Zn-deficient phenotype of the Arabidopsis hma2hma4 mutant indicating that HvHMA2 functions as a Zn pump in planta and could play a role in root to shoot Zn transport. When expressed in Arabidopsis, HvHMA2 localises predominantly to the plasma membrane.

  5. HvHMA2, a P(1B-ATPase from barley, is highly conserved among cereals and functions in Zn and Cd transport.

    Directory of Open Access Journals (Sweden)

    Rebecca F Mills

    Full Text Available Manipulation of crops to improve their nutritional value (biofortification and optimisation of plants for removal of toxic metals from contaminated soils (phytoremediation are major goals. Identification of membrane transporters with roles in zinc and cadmium transport would be useful for both aspects. The P(1B-ATPases play important roles in heavy metal allocation and detoxification in Arabidopsis and it is now important to elucidate their roles in monocots. We identified nine P(1B-ATPases in barley and this study focuses on the functional characterization of HvHMA2, providing evidence for its role in heavy metal transport. HvHMA2 was cloned using information from EST analysis and 5' RACE. It possesses the conserved aspartate that is phosphorylated during the reaction cycle of P-type pumps and has motifs and key residues characteristic of P(1B-ATPases, falling into the P(1B-2 subclass. Homologous sequences occur in three major sub-families of the Poaceae (Gramineae. Heterologous expression in Saccharomyces cerevisiae demonstrates that HvHMA2 functions as a Zn and Cd pump. Mutagenesis studies show that proposed cation coordination sites of the P(1B-2 pumps are crucial for the metal responses conferred by HvHMA2 in yeast. HvHMA2 expression suppresses the Zn-deficient phenotype of the Arabidopsis hma2hma4 mutant indicating that HvHMA2 functions as a Zn pump in planta and could play a role in root to shoot Zn transport. When expressed in Arabidopsis, HvHMA2 localises predominantly to the plasma membrane.

  6. Characterization of a highly conserved human homolog to the chicken neural cell surface protein Bravo/Nr-CAM that maps to chromosome band 7q31

    Energy Technology Data Exchange (ETDEWEB)

    Lane, R.P.; Vielmetter, J.; Dreyer, W.J. [California Institute of Technology, Pasadena, CA (United States)] [and others


    The neuronal cell adhesion molecule Bravo/Nr-CAM is a cell surface protein of the immunoglobulin (Ig) superfamily and is closely related to the L1/NgCAM and neurofascin molecules, all of which contain six immunoglobulin domains, five fibronectin repeats, a transmembrane region, and an intracellular domain. Chicken Bravo/Nr-CAM has been shown to interact with other cell surface molecules of the Ig superfamily and has been implicated in specific pathfinding roles of axonal growth cones in the developing nervous system. We now report the characterization of cDNA clones encoding the human Bravo/Nr-CAM protein, which, like its chicken homolog, is composed of six V-like Ig domains and five fibronectin type III repeats. The human Bravo/Nr-CAM homolog also contains a transmembrane and intracellular domain, both of which are 100% conserved at the amino acid level compared to its chicken homolog. Overall, the human Bravo/Nr-CAM homolog is 82% identical to the chicken Bravo/Nr-CAM amino acid sequence. Independent cDNAs encoding four different isoforms were also identified, all of which contain alternatively spliced variants around the fifth fibronectin type III repeat, including one isoform that had been previously identified for chicken Bravo/Nr-CAM. Northern blot analysis reveals one mRNA species of approximately 7.0 kb in adult human brain tissue. Fluorescence in situ hybridization maps the gene for human Bravo/Nr-CAM to human chromosome 7q31.1-q31.2. This chromosomal locus has been previously identified as containing a tumore suppressor candidate gene commonly deleted in certain human cancer tissues. 38 refs., 5 figs.

  7. A NEW WORLD MONKEY MICROSATELLITE (AP74 HIGHLY CONSERVED IN PRIMATES AP74, un microsatélite de Monos del Nuevo Mundo altamente conservado en Primates

    Directory of Open Access Journals (Sweden)



    Full Text Available Given their great variability, microsatellites or STRs became the most commonly used genetic markers over the last 15 years. The analysis of these markers requires minimum quantities of DNA, allowing the use of non invasive samples, such as feces or hair. We amplified the microsatellite Ap74 in blood and hair samples in order to analyze the levels of genomic conservation among a wide range of primates including: Lemur catta, Alouatta caraya, Ateles belzebuth, Ateles chamek, Pan troglodytes, Papio sp., and Homo sapiens. In all cases we obtained amplification products that exhibited similar size both in monkeys and human (oscillating between 126 and 176 bp, except in the lemur where the detected fragment presented a size of approximately 1000 bp. The analysis of the nucleotide sequences permitted the evaluation of the molecular modifications experienced during the evolutionary process in primates.Dado su alta variabilidad, los microsatélites o STR se convirtieron en los marcadores genéticos más ampliamente utilizados en los últimos 15 años. El análisis de estos marcadores requiere una mínima cantidad de ADN, permitiendo el uso de muestras no invasivas, tales como pelos o heces. Con el objetivo de analizar niveles de conservación genómica, amplificamos el microsatélite Ap74 en muestras de pelo y sangre de un amplio rango de primates incluyendo: Lemur catta, Alouatta caraya, Ateles belzebuth, Ateles chamek, Pan troglodytes, Papio sp., y Homo sapiens. En todos los casos obtuvimos productos de amplificación que exhibieron un tamaño similar (oscilando entre 126 y 176 pb, con excepción del lémur, donde el fragmento detectado presentó un tamaño de aproximadamente 1000 pb. El análisis de las secuencias nucleotídicas nos permitió evaluar las modificaciones moleculares ocurridas durante el proceso evolutivo en primates.

  8. Conservative Management of Urinary Incontinence in Women (United States)

    Faiena, Izak; Patel, Neal; Parihar, Jaspreet S; Calabrese, Marc; Tunuguntla, Hari


    Urinary incontinence in women has a high prevalence and causes significant morbidity. Given that urinary incontinence is not generally a progressive disease, conservative therapies play an integral part in the management of these patients. We conducted a nonsystematic review of the literature to identify high-quality studies that evaluated the different components of conservative management of stress urinary incontinence, including behavioral therapy, bladder training, pelvic floor muscle training, lifestyle changes, mechanical devices, vaginal cones, and electrical stimulation. Urinary incontinence can have a severe impact on our healthcare system and patients’ quality of life. There are currently a wide variety of treatment options for these patients, ranging from conservative treatment to surgical treatment. Although further research is required in the area of conservative therapies, nonsurgical treatments are effective and are preferred by some patients. PMID:26543427

  9. Creative Conservation Communication (United States)

    Houston, Jason


    I am a fellow with the International League of Conservation photographers (iLCP) and have been focused on photographing conservation dynamics at the intersection of social and environmental issues for a decade. Subjects have included traditional concerns such as deforestation, water conservation, endangered species, and fisheries. However, I rarely make photographs of the traditional nature, wildlife, landscapes, or environmental atrocities that most people think of when they think about environmentalism. Instead, I photograph people and how they live on the planet, as I believe passionately that without also considering social and cultural concerns, we will not be able to effectively and sustainably do conservation work or achieve positive environmental change. My presentation will share recent photography projects on forest conservation in Indonesian Borneo and fisheries management in Central America where I used a 'stakeholder profile-based' process to broadly survey the complexity of the issues while also making personal connections for these projects' diverse audiences. Through these case studies I will explore the opportunities and challenges of combining the authenticity, accuracy, and scientific validity of journalistic and documentary work with the emotional impact of the conventions of art and storytelling.

  10. Comparative Study of Regulatory Circuits in Two Sea Urchin Species Reveals Tight Control of Timing and High Conservation of Expression Dynamics

    National Research Council Canada - National Science Library

    Gildor, Tsvia; Ben-Tabou de-Leon, Smadar


    .... Here we exploit the comprehensive model of sea urchin gene regulatory networks and generate high-density expression profiles of key regulatory genes of the Mediterranean sea urchin, Paracentrotus lividus (Pl...

  11. Smart Water Conservation System for Irrigated Landscape (United States)


    a semi - arid climate , where indoor air is mostly re-circulated, and HVAC unit temperature set points are intentionally high to conserve energy...Traditional Irrigation System • May be applicable in any climate (i.e., arid and/or semi - arid ). • Are economical in many regions of the country where...consumption for irrigation at our DoD installations located in semi - arid regions where alternative water conservation measures are being pursued. The

  12. Biochemical and Structural Characterizations of Two Dictyostelium Cellobiohydrolases from the Amoebozoa Kingdom Reveal a High Level of Conservation between Distant Phylogenetic Trees of Life (United States)

    Hobdey, Sarah E.; Knott, Brandon C.; Haddad Momeni, Majid; Taylor, Larry E.; Borisova, Anna S.; Podkaminer, Kara K.; VanderWall, Todd A.; Himmel, Michael E.; Decker, Stephen R.


    ABSTRACT Glycoside hydrolase family 7 (GH7) cellobiohydrolases (CBHs) are enzymes commonly employed in plant cell wall degradation across eukaryotic kingdoms of life, as they provide significant hydrolytic potential in cellulose turnover. To date, many fungal GH7 CBHs have been examined, yet many questions regarding structure-activity relationships in these important natural and commercial enzymes remain. Here, we present the crystal structures and a biochemical analysis of two GH7 CBHs from social amoeba: Dictyostelium discoideum Cel7A (DdiCel7A) and Dictyostelium purpureum Cel7A (DpuCel7A). DdiCel7A and DpuCel7A natively consist of a catalytic domain and do not exhibit a carbohydrate-binding module (CBM). The structures of DdiCel7A and DpuCel7A, resolved to 2.1 Å and 2.7 Å, respectively, are homologous to those of other GH7 CBHs with an enclosed active-site tunnel. Two primary differences between the Dictyostelium CBHs and the archetypal model GH7 CBH, Trichoderma reesei Cel7A (TreCel7A), occur near the hydrolytic active site and the product-binding sites. To compare the activities of these enzymes with the activity of TreCel7A, the family 1 TreCel7A CBM and linker were added to the C terminus of each of the Dictyostelium enzymes, creating DdiCel7ACBM and DpuCel7ACBM, which were recombinantly expressed in T. reesei. DdiCel7ACBM and DpuCel7ACBM hydrolyzed Avicel, pretreated corn stover, and phosphoric acid-swollen cellulose as efficiently as TreCel7A when hydrolysis was compared at their temperature optima. The Ki of cellobiose was significantly higher for DdiCel7ACBM and DpuCel7ACBM than for TreCel7A: 205, 130, and 29 μM, respectively. Taken together, the present study highlights the remarkable degree of conservation of the activity of these key natural and industrial enzymes across quite distant phylogenetic trees of life. IMPORTANCE GH7 CBHs are among the most important cellulolytic enzymes both in nature and for emerging industrial applications for

  13. Energy conservation in high-rise buildings: changes in air conditioning load induced by vertical temperature and humidity profile in Delhi

    Energy Technology Data Exchange (ETDEWEB)

    Sinha, S. [Institute of Social Forestry and Eco-rehabilitation, ICFRE, Allahabad (India); Kumar, Sanjay [Indian Inst. of Technology, Centre for Atmospheric Sciences, New Delhi (India); Kumar, N. [MIT, Civil Engineering Dept., Bihar (India)


    Temperature and humidity profiles in the upper atmosphere are different from those observed by ground level meteorological stations and used to design HVAC systems for high-rise buildings. There exist correlations among solar energy, atmospheric turbidity and pollutants in urban areas, affecting the temperature and humidity profiles with variation in height. In the present study, a theoretical model is developed considering these parameters, and the HVAC load is calculated. The results are compared with the HVAC load calculated from data obtained from the meteorological station, and the comparison showed that the results differ significantly (20%) for a hypothetical 200 m high office building. (Author)

  14. Two Centuries of Soil Conservation. (United States)

    Helms, Douglas


    Narrates U.S. soil conservation history since the late eighteenth century. Discusses early practices such as contour plowing. Profiles individuals who promoted soil conservation and were largely responsible for the creation of the Soil Conservation Service. Explains the causes of erosion and how soil conservation districts help farmers prevent…

  15. Information, conservation and retrieval

    Energy Technology Data Exchange (ETDEWEB)

    Eng, T. [Swedish Nuclear Fuel and Waste Management Co., Stockholm (Sweden); Norberg, E. [National Swedish Archives, Stockholm (Sweden); Torbacke, J. [Stockholm Univ. (Sweden). Dept. of History; Jensen, M. [Swedish Radiation Protection Inst., Stockholm (Sweden)


    The seminar took place on the Swedish ship for transportation of radioactive wastes, M/S Sigyn, which at summer time is used for exhibitions. The seminar treated items related to general information needs in society and questions related to radioactive waste, i.e. how knowledge about a waste repository should be passed on to future generations. Three contributions are contained in the report from the seminar and are indexed separately: `Active preservation - otherwise no achieves`; `The conservation and dissemination of information - A democratic issue`; and, `Conservation and retrieval of information - Elements of a strategy to inform future societies about nuclear waste repositories`.

  16. Energy conservation in infants. (United States)

    Blass, Elliott


    Energy acquisition through suckling has been widely studied in rat and human infants. Processes mediating energy conservation, however, have not received the attention that they deserve. This essay, in honor of Professor Jerry Hogan, discusses parallel behaviors used by rat and human mothers to minimize energy loss in their offspring. Parallel mechanisms underlying energy preservation have been identified in rats and humans, suggesting phylogenetic conservation and possibly continuity. This article is part of a Special Issue entitled: In Honor of Jerry Hogan. Copyright © 2015. Published by Elsevier B.V.

  17. From Civic Conservation to the Age of Ecology: The Rise and Synthesis of Ecological Ideas in the American High School Science Curriculum, 1900-1980 (United States)

    Laubach, Stephen A.


    Ecological ideas have been manifested in diverse ways in American high schools since the early twentieth century. Core scientific concepts in ecology--the study of the relationship between organisms and their environment--include adaptations, plant succession, ecosystem ecology, and population ecology. This dissertation argues, however, that there…

  18. Quantifying solute transport processes: are chemically "conservative" tracers electrically conservative? (United States)

    Singha, Kamini; Li, Li; Day-Lewis, Frederick D.; Regberg, Aaron B.


    The concept of a nonreactive or conservative tracer, commonly invoked in investigations of solute transport, requires additional study in the context of electrical geophysical monitoring. Tracers that are commonly considered conservative may undergo reactive processes, such as ion exchange, thus changing the aqueous composition of the system. As a result, the measured electrical conductivity may reflect not only solute transport but also reactive processes. We have evaluated the impacts of ion exchange reactions, rate-limited mass transfer, and surface conduction on quantifying tracer mass, mean arrival time, and temporal variance in laboratory-scale column experiments. Numerical examples showed that (1) ion exchange can lead to resistivity-estimated tracer mass, velocity, and dispersivity that may be inaccurate; (2) mass transfer leads to an overestimate in the mobile tracer mass and an underestimate in velocity when using electrical methods; and (3) surface conductance does not notably affect estimated moments when high-concentration tracers are used, although this phenomenon may be important at low concentrations or in sediments with high and/or spatially variable cation-exchange capacity. In all cases, colocated groundwater concentration measurements are of high importance for interpreting geophysical data with respect to the controlling transport processes of interest.

  19. Comparative Study of Regulatory Circuits in Two Sea Urchin Species Reveals Tight Control of Timing and High Conservation of Expression Dynamics.


    Tsvia Gildor; Smadar Ben-Tabou de-Leon


    Accurate temporal control of gene expression is essential for normal development and must be robust to natural genetic and environmental variation. Studying gene expression variation within and between related species can delineate the level of expression variability that development can tolerate. Here we exploit the comprehensive model of sea urchin gene regulatory networks and generate high-density expression profiles of key regulatory genes of the Mediterranean sea urchin, Paracentrotus li...

  20. High-resolution mapping of H4K16 and H3K23 acetylation reveals conserved and unique distribution patterns in Arabidopsis and rice


    Lu, Li; Chen, Xiangsong; Sanders, Dean; Qian, Shuiming; Zhong, Xuehua


    Histone acetylation and deacetylation are key epigenetic gene regulatory mechanisms that play critical roles in eukaryotes. Acetylation of histone 4 lysine 16 (H4K16ac) is implicated in many cellular processes. However, its biological function and relationship with transcription are largely unexplored in plants. We generated first genome-wide high-resolution maps of H4K16ac in Arabidopsis thaliana and Oryza sativa. We showed that H4K16ac is preferentially enriched around the transcription sta...

  1. Future directions for conservation

    NARCIS (Netherlands)

    Keulartz, Jozef


    The use of target baselines or reference states for conservation and restoration has become increasingly problematic and impractical, due to rapid environmental change, the paradigm shift in ecology from a static to a dynamic view of nature, and growing awareness of the role of cultural

  2. Conservation of Beclardia macrostachya

    African Journals Online (AJOL)


    little research was done on the biology of these orchids in Mauritius (Roberts, 2001). Therefore, the biology of Beclardia macrostachya was studied and consequently, appropriate strategies would be devised for its conservation. There is only one known species under the genus Beclardia which is Beclardia macrostachya ...

  3. Biological science in conservation (United States)

    David M. Johns


    Large-scale wildlands reserve systems offer one of the best hopes for slowing, if not reversing, the loss of biodiversity and wilderness. Establishing such reserves requires both sound biology and effective advocacy. Attempts by The Wildlands Project and its cooperators to meld science and advocacy in the service of conservation is working, but is not without some...

  4. Conservation and gene banking (United States)

    Plant conservation has several objectives the main ones include safeguarding our food supply, preserving crop wild relatives for breeding and selection of new cultivars, providing material for industrial and pharmaceutical uses and preserving the beauty and diversity of our flora for generations to ...

  5. Urban bird conservation

    NARCIS (Netherlands)

    Snep, Robbert P.H.; Kooijmans, Jip Louwe; Kwak, Robert G.M.; Foppen, Ruud P.B.; Parsons, Holly; Awasthy, Monica; Sierdsema, Henk L.K.; Marzluff, John M.; Fernandez-Juricic, Esteban; Laet, de Jenny


    Following the call from the United Nations Convention on Biological Diversity “Cities & Biodiversity Outlook” project to better preserve urban biodiversity, this paper presents stakeholder-specific statements for bird conservation in city environments. Based upon the current urban bird

  6. Foundry energy conservation workbook

    Energy Technology Data Exchange (ETDEWEB)



    This report discusses methods for promoting energy conservation in foundries. Use of electric power, natural gas, and coke are evaluated. Waste heat recovery systems are considered. Energy consumption in the specific processes of electric melting, natural gas melting, heat treatments, ladle melting, and coke fuel melting is described. An example energy analysis is included. (GHH)

  7. Foundry energy conservation workbook

    Energy Technology Data Exchange (ETDEWEB)


    This report discusses methods for promoting energy conservation in foundries. Use of electric power, natural gas, and coke are evaluated. Waste heat recovery systems are considered. Energy consumption in the specific processes of electric melting, natural gas melting, heat treatments, ladle melting, and coke fuel melting is described. An example energy analysis is included. (GHH)

  8. Energy Conservation Simplified (United States)

    Hecht, Eugene


    The standard formulation of energy conservation involves the subsidiary ideas of kinetic energy ("KE"), work ("W"), thermal energy, internal energy, and a half-dozen different kinds of potential energy ("PE"): elastic, chemical, nuclear, gravitational, and so forth. These quantities came to be recognized during the centuries over which the…

  9. "Conservative" views of abortion. (United States)

    Devine, P E


    The introduction to this essay, which presents and defends the "conservative" position on abortion, explains that this position holds that 1) abortion is wrong because it destroys the fetus; 2) the fetus has full personhood from conception (or very near conception); 3) abortion is only justified under special circumstances, such as when the pregnancy poses a threat to the woman's life; and 4) these conclusions should be reflected in law and public policy. Part 2 sets forth the moral foundations for this position. The third part considers the status of the fetus and reviews the various arguments that have been forwarded to resolve the question, such as the species principle, the potentiality principle, the sentience principle, and the conventionalist principle. Part 4 applies the conservative position to problems posed by hard cases, determines that abortion is a form of homicide from two weeks after fertilization (at the latest), reviews circumstances in which various legal definitions of homicide are applicable, argues for the denial of abortion funding by the state, and notes that violent militancy is not the appropriate response to a belief that abortion should be illegal. Section 5 refutes objections to the conservative position based on the fact that some opponents of abortion also oppose contraception, based on feminist ideals, and based on calls for religious freedom in a pluralistic society. In conclusion, the labels applied to the abortion debate are examined, and it is suggested that "communitarian" is the best term for the conservative position.

  10. Madagascar Conservation & Development

    African Journals Online (AJOL)

    MADAGASCAR CONSERVATION & DEVELOPMENT. VOLUME 7 | ISSUE 1 — JUNE 2012. PAGE 5 .... and measurements of deforestation in Africa and Madagascar, but the deforestation itself continues: in some places – espe ... the islands around Africa, in the 1982 FAO compila- tion. For the purpose of the present article, ...

  11. Beyond conservation agriculture

    NARCIS (Netherlands)

    Giller, K.E.; Andersson, J.A.; Corbeels, Marc; Kirkegaard, John; Mortensen, David; Erenstein, Olaf; Vanlauwe, Bernard


    Global support for Conservation Agriculture (CA) as a pathway to Sustainable Intensification is strong. CA revolves around three principles: no-till (or minimal soil disturbance), soil cover, and crop rotation. The benefits arising from the ease of crop management, energy/cost/time savings, and

  12. Large-scale nucleotide sequence alignment and sequence variability assessment to identify the evolutionarily highly conserved regions for universal screening PCR assay design: an example of influenza A virus. (United States)

    Nagy, Alexander; Jiřinec, Tomáš; Černíková, Lenka; Jiřincová, Helena; Havlíčková, Martina


    The development of a diagnostic polymerase chain reaction (PCR) or quantitative PCR (qPCR) assay for universal detection of highly variable viral genomes is always a difficult task. The purpose of this chapter is to provide a guideline on how to align, process, and evaluate a huge set of homologous nucleotide sequences in order to reveal the evolutionarily most conserved positions suitable for universal qPCR primer and hybridization probe design. Attention is paid to the quantification and clear graphical visualization of the sequence variability at each position of the alignment. In addition, specific problems related to the processing of the extremely large sequence pool are highlighted. All of these steps are performed using an ordinary desktop computer without the need for extensive mathematical or computational skills.

  13. Understanding conservationists' perspectives on the new-conservation debate. (United States)

    Holmes, George; Sandbrook, Chris; Fisher, Janet A


    A vibrant debate about the future direction of biodiversity conservation centers on the merits of the so-called new conservation. Proponents of the new conservation advocate a series of positions on key conservation ideas, such as the importance of human-dominated landscapes and conservation's engagement with capitalism. These have been fiercely contested in a debate dominated by a few high-profile individuals, and so far there has been no empirical exploration of existing perspectives on these issues among a wider community of conservationists. We used Q methodology to examine empirically perspectives on the new conservation held by attendees at the 2015 International Congress for Conservation Biology (ICCB). Although we identified a consensus on several key issues, 3 distinct positions emerged: in favor of conservation to benefit people but opposed to links with capitalism and corporations, in favor of biocentric approaches but with less emphasis on wilderness protection than prominent opponents of new conservation, and in favor of the published new conservation perspective but with less emphasis on increasing human well-being as a goal of conservation. Our results revealed differences between the debate on the new conservation in the literature and views held within a wider, but still limited, conservation community and demonstrated the existence of at least one viewpoint (in favor of conservation to benefit people but opposed to links with capitalism and corporations) that is almost absent from the published debate. We hope the fuller understanding we present of the variety of views that exist but have not yet been heard, will improve the quality and tone of debates on the subject. © 2016 The Authors. Conservation Biology published by Wiley Periodicals, Inc. on behalf of Society for Conservation Biology.

  14. Discovery of sympatric dwarf lemur species in the high-altitude rain forest of Tsinjoarivo, Eastern Madagascar: implications for biogeography and conservation. (United States)

    Blanco, Marina B; Godfrey, Laurie R; Rakotondratsima, Mamihasimbola; Rahalinarivo, Vololonirina; Samonds, Karen E; Raharison, Jean-Luc; Irwin, Mitchell T


    The number of species within the Malagasy lemur genus Cheirogaleus is currently under debate. Museum collections are spotty, and field work, supplemented by morphometric and genetic analysis, is essential for documenting geographic distributions, ecological characteristics and species boundaries. We report here field evidence for 2 dwarf lemur species at Tsinjoarivo, an eastern-central high-altitude rain forest: one, from a forest fragment, displaying coat and dental characteristics similar to C. sibreei (previously described only from museum specimens) and the other, from the continuous forest, resembling individuals of Cheirogaleus found today at Ranomafana National Park, further to the south. This study represents the first confirmation of a living population of grey-fawn, C.-sibreei-like, dwarf lemurs in Madagascar. 2008 S. Karger AG, Basel.

  15. Cosmetic Analysis Following Breast-Conserving Surgery and Adjuvant High-Dose-Rate Interstitial Brachytherapy for Early-Stage Breast Cancer: A Prospective Clinical Study

    Energy Technology Data Exchange (ETDEWEB)

    Garsa, Adam A.; Ferraro, Daniel J.; DeWees, Todd [Department of Radiation Oncology, Siteman Cancer Center, Barnes-Jewish Hospital and Washington University School of Medicine, St. Louis, Missouri (United States); Margenthaler, Julie A. [Department of Surgery, Siteman Cancer Center, Barnes-Jewish Hospital and Washington University School of Medicine, St. Louis, Missouri (United States); Naughton, Michael [Department of Medicine, Siteman Cancer Center, Barnes-Jewish Hospital and Washington University School of Medicine, St. Louis, Missouri (United States); Aft, Rebecca [Department of Surgery, Siteman Cancer Center, Barnes-Jewish Hospital and Washington University School of Medicine, St. Louis, Missouri (United States); Department of Surgery, John Cochran Veterans Hospital, St. Louis, Missouri (United States); Gillanders, William E.; Eberlein, Timothy [Department of Surgery, Siteman Cancer Center, Barnes-Jewish Hospital and Washington University School of Medicine, St. Louis, Missouri (United States); Matesa, Melissa A. [Department of Radiation Oncology, Siteman Cancer Center, Barnes-Jewish Hospital and Washington University School of Medicine, St. Louis, Missouri (United States); Zoberi, Imran, E-mail: [Department of Radiation Oncology, Siteman Cancer Center, Barnes-Jewish Hospital and Washington University School of Medicine, St. Louis, Missouri (United States)


    Purpose: To prospectively evaluate cosmetic outcomes in women treated with accelerated partial breast irradiation using high-dose-rate interstitial brachytherapy for early-stage breast cancer. Methods and Materials: Between 2004 and 2008, 151 patients with early-stage breast cancer were enrolled in a phase 2 prospective clinical trial. Eligible patients had stage Tis-T2 tumors of ≤3 cm that were excised with negative margins and with no nodal involvement. Patients received 3.4 Gy twice daily to a total dose of 34 Gy. Both the patients and the treating radiation oncologist qualitatively rated cosmesis as excellent, good, fair, or poor over time and ascribed a cause for changes in cosmesis. Cosmetic outcome was evaluated quantitatively by percentage of breast retraction assessment (pBRA). Patients also reported their satisfaction with treatment over time. Results: Median follow-up was 55 months. The rates of excellent-to-good cosmesis reported by patients and the treating radiation oncologist were 92% and 97% pretreatment, 91% and 97% at 3 to 4 months' follow-up, 87% and 94% at 2 years, and 92% and 94% at 3 years, respectively. Breast infection and adjuvant chemotherapy were independent predictors of a fair-to-poor cosmetic outcome at 3 years. Compared to pretreatment pBRA (7.35), there was no significant change in pBRA over time. The volume receiving more than 150 Gy (V150) was the only significant predictor of pBRA. The majority of patients (86.6%) were completely satisfied with their treatment. Conclusions: Patients and the treating physician reported a high rate of excellent-to-good cosmetic outcomes at all follow-up time points. Acute breast infection and chemotherapy were associated with worse cosmetic outcomes. Multicatheter interstitial brachytherapy does not significantly change breast size as measured by pBRA.

  16. Genetic evaluation of seeds of highly endangered Pinus uliginosa Neumann from Węgliniec reserve for ex-situ conservation program

    Directory of Open Access Journals (Sweden)

    Andrzej Lewandowski


    Full Text Available Peat-bog pine Pinus uliginosa Neumann has become extinct or rare in many parts of Europe. We have investigated the levels of genetic variation and inbreeding in seeds collected from a highly endangered reserve of this species in Poland, using allozymes as genetic markers. Generally, a high level of genetic variation was observed. The mean expected heterozygosity was 0.376, while average (Na and effective (Ne numbers of alleles per locus were 2.45 and 1.67, respectively. Nevertheless, we have detected relatively low levels of outcrossing, and potential biparental inbreeding. The population-wide multilocus outcrossing rate was estimated to be 0.706 (±0.091, while the minimum variance mean of single-locus estimates was distinctly lower (ts=0.611. The estimates of outcrossing calculated for individual trees ranged widely from 0.051 to 1.017, indicating the complexity of outcrossing patterns. The investigated population of P. uliginasa from Węgliniec is small and surrounded by extensive forest stands of P. sylvestris. Our three-year records of phenological observations demonstrated that flowering periods for P. uliginosa and P. sylvestris overlap, allowing for cross-pollination. The possibility of P. uliginosa pollination by P. sylvestris creates a potential danger of genetic erosion of the P. uliginosa gene pool. Nonetheless, based on a species specific cpDNA marker we have found that among 533 seedlings of P. uliginosa there were only six seedlings carrying cpDNA marker specific for P. sylvestris, indicating that such hybridization seems to be rare.

  17. Conserving tigers in working landscapes. (United States)

    Chanchani, Pranav; Noon, Barry R; Bailey, Larissa L; Warrier, Rekha A


    Tiger (Panthera tigris) conservation efforts in Asia are focused on protected areas embedded in human-dominated landscapes. A system of protected areas is an effective conservation strategy for many endangered species if the network is large enough to support stable metapopulations. The long-term conservation of tigers requires that the species be able to meet some of its life-history needs beyond the boundaries of small protected areas and within the working landscape, including multiple-use forests with logging and high human use. However, understanding of factors that promote or limit the occurrence of tigers in working landscapes is incomplete. We assessed the relative influence of protection status, prey occurrence, extent of grasslands, intensity of human use, and patch connectivity on tiger occurrence in the 5400 km(2) Central Terai Landscape of India, adjacent to Nepal. Two observer teams independently surveyed 1009 km of forest trails and water courses distributed across 60 166-km(2) cells. In each cell, the teams recorded detection of tiger signs along evenly spaced trail segments. We used occupancy models that permitted multiscale analysis of spatially correlated data to estimate cell-scale occupancy and segment-scale habitat use by tigers as a function of management and environmental covariates. Prey availability and habitat quality, rather than protected-area designation, influenced tiger occupancy. Tiger occupancy was low in some protected areas in India that were connected to extensive areas of tiger habitat in Nepal, which brings into question the efficacy of current protection and management strategies in both India and Nepal. At a finer spatial scale, tiger habitat use was high in trail segments associated with abundant prey and large grasslands, but it declined as human and livestock use increased. We speculate that riparian grasslands may provide tigers with critical refugia from human activity in the daytime and thereby promote tiger occurrence

  18. Conservation businesses and conservation planning in a biological diversity hotspot. (United States)

    Di Minin, Enrico; Macmillan, Douglas Craig; Goodman, Peter Styan; Escott, Boyd; Slotow, Rob; Moilanen, Atte


    The allocation of land to biological diversity conservation competes with other land uses and the needs of society for development, food, and extraction of natural resources. Trade-offs between biological diversity conservation and alternative land uses are unavoidable, given the realities of limited conservation resources and the competing demands of society. We developed a conservation-planning assessment for the South African province of KwaZulu-Natal, which forms the central component of the Maputaland-Pondoland-Albany biological diversity hotspot. Our objective was to enhance biological diversity protection while promoting sustainable development and providing spatial guidance in the resolution of potential policy conflicts over priority areas for conservation at risk of transformation. The conservation-planning assessment combined spatial-distribution models for 646 conservation features, spatial economic-return models for 28 alternative land uses, and spatial maps for 4 threats. Nature-based tourism businesses were competitive with other land uses and could provide revenues of >US$60 million/year to local stakeholders and simultaneously help meeting conservation goals for almost half the conservation features in the planning region. Accounting for opportunity costs substantially decreased conflicts between biological diversity, agricultural use, commercial forestry, and mining. Accounting for economic benefits arising from conservation and reducing potential policy conflicts with alternative plans for development can provide opportunities for successful strategies that combine conservation and sustainable development and facilitate conservation action. © 2013 Society for Conservation Biology.

  19. Six Highly Conserved Targets of RNAi Revealed in HIV-1-Infected Patients from Russia Are Also Present in Many HIV-1 Strains Worldwide

    Directory of Open Access Journals (Sweden)

    Olga V. Kretova


    Full Text Available RNAi has been suggested for use in gene therapy of HIV/AIDS, but the main problem is that HIV-1 is highly variable and could escape attack from the small interfering RNAs (siRNAs due to even single nucleotide substitutions in the potential targets. To exhaustively check the variability in selected RNA targets of HIV-1, we used ultra-deep sequencing of six regions of HIV-1 from the plasma of two independent cohorts of patients from Russia. Six RNAi targets were found that are invariable in 82%–97% of viruses in both cohorts and are located inside the domains specifying reverse transcriptase (RT, integrase, vpu, gp120, and p17. The analysis of mutation frequencies and their characteristics inside the targets suggests a likely role for APOBEC3G (apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3G, A3G in G-to-A mutations and a predominant effect of RT biases in the detected variability of the virus. The lowest frequency of mutations was detected in the central part of all six targets. We also discovered that the identical RNAi targets are present in many HIV-1 strains from many countries and from all continents. The data are important for both the understanding of the patterns of HIV-1 mutability and properties of RT and for the development of gene therapy approaches using RNAi for the treatment of HIV/AIDS.

  20. Bison Conservation Initiative : Bison Conservation Genetics Workshop : Reports and Recommendations (United States)

    US Fish and Wildlife Service, Department of the Interior — One of the first outcomes of the Department of the Interior (DOI) Bison Conservation Initiative was the Bison Conservation Genetics Workshop held in Nebraska in...

  1. Geomorphological characterization of conservation agriculture (United States)

    Tarolli, Paolo; Cecchin, Marco; Prosdocimi, Massimo; Masin, Roberta


    Soil water erosion is one of the major threats to soil resources throughout the world. Conventional agriculture has worsened the situation. Therefore, agriculture is facing multiple challenges: it has to produce more food to feed a growing population, and, on the other hand, safeguard natural resources adopting more sustainable production practices. In this perspective, more conservation-minded soil management practices should be taken to achieve an environmental sustainability of crop production. Indeed, conservation agriculture is considered to produce relevant environmental positive outcomes (e.g. reducing runoff and soil erosion, improving soil organic matter content and soil structure, and promoting biological activity). However, as mechanical weed control is limited or absent, in conservation agriculture, dependence on herbicides increases especially in the first years of transition from the conventional system. Consequently, also the risk of herbicide losses via runoff or adsorbed to eroded soil particles could be increased. To better analyse the complexity of soil water erosion and runoff processes in landscapes characterised by conservation agriculture, first, it is necessary to demonstrate if such different practices can significantly affect the surface morphology. Indeed, surface processes such erosion and runoff strongly depend on the shape of the surface. The questions are: are the lands treated with conservation and conventional agriculture different from each other regarding surface morphology? If so, can these differences provide a better understanding of hydrogeomorphic processes as the basis for a better and sustainable land management? To give an answer to these questions, we considered six study areas (three cultivated with no-tillage techniques, three with tillage techniques) in an experimental farm. High-resolution topography, derived from low-cost and fast photogrammetric techniques Structure-from-Motion (SfM), served as the basis to

  2. Hepatic methionine homeostasis is conserved in C57BL/6N mice on high-fat diet despite major changes in hepatic one-carbon metabolism.

    Directory of Open Access Journals (Sweden)

    Christoph Dahlhoff

    Full Text Available Obesity is an underlying risk factor in the development of cardiovascular disease, dyslipidemia and non-alcoholic fatty liver disease (NAFLD. Increased hepatic lipid accumulation is a hallmark in the progression of NAFLD and impairments in liver phosphatidylcholine (PC metabolism may be central to the pathogenesis. Hepatic PC biosynthesis, which is linked to the one-carbon (C1 metabolism by phosphatidylethanolamine N-methyltransferase, is known to be important for hepatic lipid export by VLDL particles. Here, we assessed the influence of a high-fat (HF diet and NAFLD status in mice on hepatic methyl-group expenditure and C1-metabolism by analyzing changes in gene expression, protein levels, metabolite concentrations, and nuclear epigenetic processes. In livers from HF diet induced obese mice a significant downregulation of cystathionine β-synthase (CBS and an increased betaine-homocysteine methyltransferase (BHMT expression were observed. Experiments in vitro, using hepatoma cells stimulated with peroxisome proliferator activated receptor alpha (PPARα agonist WY14,643, revealed a significantly reduced Cbs mRNA expression. Moreover, metabolite measurements identified decreased hepatic cystathionine and L-α-amino-n-butyrate concentrations as part of the transsulfuration pathway and reduced hepatic betaine concentrations, but no metabolite changes in the methionine cycle in HF diet fed mice compared to controls. Furthermore, we detected diminished hepatic gene expression of de novo DNA methyltransferase 3b but no effects on hepatic global genomic DNA methylation or hepatic DNA methylation in the Cbs promoter region upon HF diet. Our data suggest that HF diet induces a PPARα-mediated downregulation of key enzymes in the hepatic transsulfuration pathway and upregulates BHMT expression in mice to accommodate to enhanced dietary fat processing while preserving the essential amino acid methionine.

  3. A unique, highly conserved secretory invertase is differentially expressed by promastigote developmental forms of all species of the human pathogen, Leishmania. (United States)

    Lyda, Todd A; Joshi, Manju B; Andersen, John F; Kelada, Andrew Y; Owings, Joshua P; Bates, Paul A; Dwyer, Dennis M


    Leishmania are protozoan pathogens of humans that exist as extracellular promastigotes in the gut of their sand fly vectors and as obligate intracellular amastigotes within phagolysosomes of infected macrophages. Between infectious blood meal feeds, sand flies take plant juice meals that contain sucrose and store these sugars in their crop. Such sugars are regurgitated into the sand fly anterior midgut where they impact the developing promastigote parasite population. In this report we showed that promastigotes of all Leishmania species secreted an invertase/sucrase enzyme during their growth in vitro. In contrast, neither L. donovani nor L. mexicana amastigotes possessed any detectable invertase activity. Importantly, no released/secreted invertase activity was detected in culture supernatants from either Trypanosoma brucei or Trypanosoma cruzi. Using HPLC, the L. donovani secretory invertase was isolated and subjected to amino acid sequencing. Subsequently, we used a molecular approach to identify the LdINV and LmexINV genes encoding the ~72 kDa invertases produced by these organisms. Interestingly, we identified high fidelity LdINV-like homologs in the genomes of all Leishmania sp. but none were present in either T. brucei or T. cruzi. Northern blot and RT-PCR analyses showed that these genes were developmentally/differentially expressed in promastigotes but not amastigotes of these parasites. Homologous transfection studies demonstrated that these genes in fact encoded the functional secretory invertases produced by these parasites. Cumulatively, our results suggest that these secretory enzymes play critical roles in the survival/growth/development and transmission of all Leishmania parasites within their sand fly vector hosts.

  4. A Prospective Longitudinal Clinical Trial Evaluating Quality of Life After Breast-Conserving Surgery and High-Dose-Rate Interstitial Brachytherapy for Early-Stage Breast Cancer

    Energy Technology Data Exchange (ETDEWEB)

    Garsa, Adam A.; Ferraro, Daniel J.; DeWees, Todd A. [Department of Radiation Oncology, Siteman Cancer Center, Barnes-Jewish Hospital and Washington University School of Medicine, St. Louis, Missouri (United States); Deshields, Teresa L. [Department of Medicine, Siteman Cancer Center, Barnes-Jewish Hospital and Washington University School of Medicine, St. Louis, Missouri (United States); Margenthaler, Julie A.; Cyr, Amy E. [Department of Surgery, Siteman Cancer Center, Barnes-Jewish Hospital and Washington University School of Medicine, St. Louis, Missouri (United States); Naughton, Michael [Department of Medicine, Siteman Cancer Center, Barnes-Jewish Hospital and Washington University School of Medicine, St. Louis, Missouri (United States); Aft, Rebecca [Department of Surgery, Siteman Cancer Center, Barnes-Jewish Hospital and Washington University School of Medicine, St. Louis, Missouri (United States); Department of Surgery, John Cochran Veterans Hospital, St. Louis, Missouri (United States); Gillanders, William E.; Eberlein, Timothy [Department of Surgery, Siteman Cancer Center, Barnes-Jewish Hospital and Washington University School of Medicine, St. Louis, Missouri (United States); Matesa, Melissa A.; Ochoa, Laura L. [Department of Radiation Oncology, Siteman Cancer Center, Barnes-Jewish Hospital and Washington University School of Medicine, St. Louis, Missouri (United States); Zoberi, Imran, E-mail: [Department of Radiation Oncology, Siteman Cancer Center, Barnes-Jewish Hospital and Washington University School of Medicine, St. Louis, Missouri (United States)


    Purpose: To prospectively examine quality of life (QOL) of patients with early stage breast cancer treated with accelerated partial breast irradiation (APBI) using high-dose-rate (HDR) interstitial brachytherapy. Methods and Materials: Between March 2004 and December 2008, 151 patients with early stage breast cancer were enrolled in a phase 2 prospective clinical trial. Eligible patients included those with Tis-T2 tumors measuring ≤3 cm excised with negative surgical margins and with no nodal involvement. Patients received 3.4 Gy twice daily to a total dose of 34 Gy. QOL was measured using European Organization for Research and Treatment of Cancer (EORTC) QLQ-C30, version 3.0, and QLQ-BR23 questionnaires. The QLQ-C30 and QLQ-BR23 questionnaires were evaluated during pretreatment and then at 6 to 8 weeks, 3 to 4 months, 6 to 8 months, and 1 and 2 years after treatment. Results: The median follow-up was 55 months. Breast symptom scores remained stable in the months after treatment, and they significantly improved 6 to 8 months after treatment. Scores for emotional functioning, social functioning, and future perspective showed significant improvement 2 years after treatment. Symptomatic fat necrosis was associated with several changes in QOL, including increased pain, breast symptoms, systemic treatment side effects, dyspnea, and fatigue, as well as decreased role functioning, emotional functioning, and social functioning. Conclusions: HDR multicatheter interstitial brachytherapy was well tolerated, with no significant detrimental effect on measured QOL scales/items through 2 years of follow-up. Compared to pretreatment scores, there was improvement in breast symptoms, emotional functioning, social functioning, and future perspective 2 years after treatment.

  5. Conservation of Mangifera sylvatica

    DEFF Research Database (Denmark)

    Akhter, Sayma

    and mostly focused on wood quality and phylogenetic relationships. Therefore, this study investigated the conservation potential of wild mango considering its contribution for food, nutrition and livelihoods. To do so, an assessment was made of the current and future distribution of the species, which......Many wild and underutilised plants contribute to food and nutrition. However, overexploitation due to ever increasing demand for wood products has frequently led to declines in populations of these species. Enhanced knowledge of the status of such species is necessary for livelihood security...... and conservation of these valuable species. The present study considers an underutilised and threatened species of Bangladesh, namely wild mango (Mangifera sylvatica Roxb.). Although this wild mango is one of the genetically closest species to the common mango (Mangifera indica L.) research is very limited...



    Seema Sharma


    The importance of natural resources in sustaining productivity and environmental protection is now relatively more realized than the past. Over the past few decades or so, more and more attention is being paid all over the world to conserve the Natural Resources. Natural resources are important material basis for a stable economy and social development too With Industrialization and Urbanization, mankind’s great demand for natural resources and their large scale exploitation and consumption h...

  7. Conservation of earthen constructions


    Mattone, Manuela; Bignamini, Elena


    Earthen constructions, built in many European, American, Asian and African countries, represent an interesting and important architectural heritage, whose conservation is necessary in order to make possible the transmission of a technological culture which keeps values of the uniqueness of the landscape as well as of their history. A study of the conditions of preservation of many unplastered earthen buildings revealed the need to set-up and test out treatments for the protection of the walls...

  8. Madagascar Conservation & Development

    African Journals Online (AJOL)

    MADAGASCAR CONSERVATION & DEVELOPMENT. VOLUME 7 | ISSUE 1 — JUNE 2012. PAGE 9. SPOTLIGHTS RÉSUMÉ. Depuis le .... Selon la Loi de finance 2011, les salaires et avantages de ces 'parlementaires' s'élevaient à 4 400 000 Ariary mensuels (1 $US équivaut à 2 000 ...

  9. Non-random escape pathways from a broadly neutralizing human monoclonal antibody map to a highly conserved region on the hepatitis C virus E2 glycoprotein encompassing amino acids 412-423. (United States)

    Keck, Zhen-yong; Angus, Allan G N; Wang, Wenyan; Lau, Patrick; Wang, Yong; Gatherer, Derek; Patel, Arvind H; Foung, Steven K H


    A challenge for hepatitis C virus (HCV) vaccine development is to define epitopes that are able to elicit protective antibodies against this highly diverse virus. The E2 glycoprotein region located at residues 412-423 is conserved and antibodies to 412-423 have broadly neutralizing activities. However, an adaptive mutation, N417S, is associated with a glycan shift in a variant that cannot be neutralized by a murine but by human monoclonal antibodies (HMAbs) against 412-423. To determine whether HCV escapes from these antibodies, we analyzed variants that emerged when cell culture infectious HCV virions (HCVcc) were passaged under increasing concentrations of a specific HMAb, HC33.1. Multiple nonrandom escape pathways were identified. Two pathways occurred in the context of an N-glycan shift mutation at N417T. At low antibody concentrations, substitutions of two residues outside of the epitope, N434D and K610R, led to variants having improved in vitro viral fitness and reduced sensitivity to HC33.1 binding and neutralization. At moderate concentrations, a S419N mutation occurred within 412-423 in escape variants that have greatly reduced sensitivity to HC33.1 but compromised viral fitness. Importantly, the variants generated from these pathways differed in their stability. N434D and K610R-associated variants were stable and became dominant as the virions were passaged. The S419N mutation reverted back to N419S when immune pressure was reduced by removing HC33.1. At high antibody concentrations, a mutation at L413I was observed in variants that were resistant to HC33.1 neutralization. Collectively, the combination of multiple escape pathways enabled the virus to persist under a wide range of antibody concentrations. Moreover, these findings pose a different challenge to vaccine development beyond the identification of highly conserved epitopes. It will be necessary for a vaccine to induce high potency antibodies that prevent the formation of escape variants, which

  10. External beam boost versus interstitial high-dose-rate brachytherapy boost in the adjuvant radiotherapy following breast-conserving therapy in early-stage breast cancer: a dosimetric comparison (United States)

    Melchert, Corinna; Kovács, György


    Purpose This study aims to compare the dosimetric data of local tumor's bed dose escalation (boost) with photon beams (external beam radiation therapy – EBRT) versus high-dose-rate interstitial brachytherapy (HDR-BT) after breast-conserving treatment in women with early-stage breast cancer. Material and methods We analyzed the treatment planning data of 136 irradiated patients, treated between 2006 and 2013, who underwent breast-conserving surgery and adjuvant whole breast irradiation (WBI; 50.4 Gy) and boost (HDR-BT: 10 Gy in one fraction [n = 36]; EBRT: 10 Gy in five fractions [n = 100]). Organs at risk (OAR; heart, ipsilateral lung, skin, most exposed rib segment) were delineated. Dosimetric parameters were calculated with the aid of dose-volume histograms (DVH). A non-parametric test was performed to compare the two different boost forms. Results There was no difference for left-sided cancers regarding the maximum dose to the heart (HDR-BT 29.8% vs. EBRT 29.95%, p = 0.34). The maximum doses to the other OAR were significantly lower for HDR-BT (Dmax lung 47.12% vs. 87.7%, p skin 57.1% vs. 94.75%, p < 0.01; in the case of right-sided breast irradiation, dose of the heart 6.00% vs. 16.75%, p < 0.01). Conclusions Compared to EBRT, local dose escalation with HDR-BT presented a significant dose reduction to the investigated OAR. Only left-sided irradiation showed no difference regarding the maximum dose to the heart. Reducing irradiation exposure to OAR could result in a reduction of long-term side effects. Therefore, from a dosimetric point of view, an interstitial boost complementary to WBI via EBRT seems to be more advantageous in the adjuvant radiotherapy of breast cancer. PMID:27648082

  11. External beam boost versus interstitial high-dose-rate brachytherapy boost in the adjuvant radiotherapy following breast-conserving therapy in early-stage breast cancer: a dosimetric comparison

    Directory of Open Access Journals (Sweden)

    Martje Marie Terheyden


    Full Text Available Purpose : This study aims to compare the dosimetric data of local tumor’s bed dose escalation (boost with photon beams (external beam radiation therapy – EBRT versus high-dose-rate interstitial brachytherapy (HDR-BT after breast-conserving treatment in women with early-stage breast cancer. Material and methods : We analyzed the treatment planning data of 136 irradiated patients, treated between 2006 and 2013, who underwent breast-conserving surgery and adjuvant whole breast irradiation (WBI; 50.4 Gy and boost (HDR-BT: 10 Gy in one fraction [n = 36]; EBRT: 10 Gy in five fractions [n = 100]. Organs at risk (OAR; heart, ipsilateral lung, skin, most exposed rib segment were delineated. Dosimetric parameters were calculated with the aid of dose-volume histograms (DVH. A non-parametric test was performed to compare the two different boost forms. Results : There was no difference for left-sided cancers regarding the maximum dose to the heart (HDR-BT 29.8% vs. EBRT 29.95%, p = 0.34. The maximum doses to the other OAR were significantly lower for HDR-BT (Dmax lung 47.12% vs. 87.7%, p < 0.01; rib 61.17% vs. 98.5%, p < 0.01; skin 57.1% vs. 94.75%, p < 0.01; in the case of right-sided breast irradiation, dose of the heart 6.00% vs. 16.75%, p < 0.01. Conclusions : Compared to EBRT, local dose escalation with HDR-BT presented a significant dose reduction to the investigated OAR. Only left-sided irradiation showed no difference regarding the maximum dose to the heart. Reducing irradiation exposure to OAR could result in a reduction of long-term side effects. Therefore, from a dosimetric point of view, an interstitial boost complementary to WBI via EBRT seems to be more advantageous in the adjuvant radiotherapy of breast cancer.

  12. Geographic bias in citation rates of conservation research. (United States)

    Meijaard, Erik; Cardillo, Marcel; Meijaard, Emily M; Possingham, Hugh P


    We investigated whether the impact of conservation science is greater for research conducted in countries with more pressing conservation problems. We quantified research impact for 231 countries based on 2 citation metrics (mean cites per paper and h index) and fitted models predicting research impact based on number of threatened bird and mammal species (as a measure of conservation importance of a country) and a range of demographic variables. Citation rates of conservation research increased as a country's conservation need increased and as human population, quality of governance, and wealth increased. Even after accounting for these factors, citation rates among regions and countries within regions varied significantly. The conservation research community needs to consider ways to begin addressing the entrenched disadvantages some countries have when it comes to initiating projects and producing high-quality research. © 2015 Society for Conservation Biology.

  13. Impending conservation crisis for Southeast Asian amphibians (United States)

    Rowley, Jodi; Brown, Rafe; Bain, Raoul; Kusrini, Mirza; Inger, Robert; Stuart, Bryan; Wogan, Guin; Thy, Neang; Chan-ard, Tanya; Trung, Cao Tien; Diesmos, Arvin; Iskandar, Djoko T.; Lau, Michael; Ming, Leong Tzi; Makchai, Sunchai; Truong, Nguyen Quang; Phimmachak, Somphouthone


    With an understudied amphibian fauna, the highest deforestation rate on the planet and high harvesting pressures, Southeast Asian amphibians are facing a conservation crisis. Owing to the overriding threat of habitat loss, the most critical conservation action required is the identification and strict protection of habitat assessed as having high amphibian species diversity and/or representing distinctive regional amphibian faunas. Long-term population monitoring, enhanced survey efforts, collection of basic biological and ecological information, continued taxonomic research and evaluation of the impact of commercial trade for food, medicine and pets are also needed. Strong involvement of regional stakeholders, students and professionals is essential to accomplish these actions. PMID:20007165

  14. Impending conservation crisis for Southeast Asian amphibians. (United States)

    Rowley, Jodi; Brown, Rafe; Bain, Raoul; Kusrini, Mirza; Inger, Robert; Stuart, Bryan; Wogan, Guin; Thy, Neang; Chan-Ard, Tanya; Trung, Cao Tien; Diesmos, Arvin; Iskandar, Djoko T; Lau, Michael; Ming, Leong Tzi; Makchai, Sunchai; Truong, Nguyen Quang; Phimmachak, Somphouthone


    With an understudied amphibian fauna, the highest deforestation rate on the planet and high harvesting pressures, Southeast Asian amphibians are facing a conservation crisis. Owing to the overriding threat of habitat loss, the most critical conservation action required is the identification and strict protection of habitat assessed as having high amphibian species diversity and/or representing distinctive regional amphibian faunas. Long-term population monitoring, enhanced survey efforts, collection of basic biological and ecological information, continued taxonomic research and evaluation of the impact of commercial trade for food, medicine and pets are also needed. Strong involvement of regional stakeholders, students and professionals is essential to accomplish these actions.

  15. Immunization of rabbits with synthetic peptides derived from a highly conserved β-sheet epitope region underneath the receptor binding site of influenza A virus

    Directory of Open Access Journals (Sweden)

    Ideno S


    Full Text Available Shoji Ideno,1,3 Kaoru Sakai,1 Mikihiro Yunoki,2–4 Ritsuko Kubota-Koketsu,3,5 Yuji Inoue,3 Shota Nakamura,6 Teruo Yasunaga,6 Yoshinobu Okuno,5 Kazuyoshi Ikuta3 1Infectious Pathogen Research Section, Central Research Laboratory, Research and Development Division, Japan Blood Products Organization, Kobe, Japan; 2Research and Development Promotion Section, Research and Development Division, Japan Blood Products Organization, Tokyo, Japan; 3Department of Virology, Research Institute for Microbial Diseases, Osaka University, Suita, Osaka, Japan; 4Department of Veterinary Microbiology, School of Veterinary Medicine, Rakuno Gakuen University, Ebetsu, Hokkaido, Japan; 5Kanonji Institute, The Research Foundation for Microbial Diseases of Osaka University, Kanonji, Kagawa, Japan; 6Department of Genome Informatics, Genome Information Research Center, Research Institute for Microbial Diseases, Osaka University, Suita, Osaka, Japan Background: There is increasing concern about the speed with which health care providers can administer prophylaxis and treatment in an influenza pandemic. Generally, it takes several months to manufacture an influenza vaccine by propagation of the virus in chicken eggs or cultured cells. Newer, faster protocols for the production of vaccines that induce broad-spectrum immunity are therefore highly desirable. We previously developed human monoclonal antibody B-1 that shows broadly neutralizing activity against influenza A virus H3N2. B-1 recognizes an epitope region that includes an antiparallel β-sheet structure underneath the receptor binding site of influenza hemagglutinin (HA. In this study, the efficacy of a synthetic peptide vaccine derived from this epitope region against influenza A was evaluated. Materials and methods: Two peptides were synthesized, the upper and lower peptides. These peptides comprise amino acid residues 167–187 and 225–241, respectively, of the B-1 epitope region of HA, which is involved in

  16. Animal behaviour and wildlife conservation

    National Research Council Canada - National Science Library

    Festa-Bianchet, M; Appollonio, M


    .... The contributions discuss the conservation of free-living but exploited animals. Efforts to conserve wildlife populations and preserve biological diversity are often hampered by an inadequate understanding of animal behaviour...

  17. Cultivating creativity in conservation science. (United States)

    Aslan, Clare E; Pinsky, Malin L; Ryan, Maureen E; Souther, Sara; Terrell, Kimberly A


    Conservation practitioners and scientists are often faced with seemingly intractable problems in which traditional approaches fail. While other sectors (e.g., business) frequently emphasize creative thinking to overcome complex challenges, creativity is rarely identified as an essential skill for conservationists. Yet more creative approaches are urgently needed in the effort to sustain Earth's biodiversity. We identified 4 strategies to develop skills in creative thinking and discuss underlying research and examples supporting each strategy. First, by breaking down barriers between disciplines and surrounding oneself with unfamiliar people, concepts, and perspectives, one can expand base knowledge and experiences and increase the potential for new combinations of ideas. Second, by meeting people where they are (both literally and figuratively), one exposes oneself to new environments and perspectives, which again broadens experiences and increases ability to communicate effectively with stakeholders. Third, by embracing risk responsibly, one is more likely to develop new, nontraditional solutions and be open to high-impact outcomes. Finally, by following a cycle of learning, struggle, and reflection, one can trigger neurophysiological changes that allow the brain to become more creative. Creativity is a learned trait, rather than an innate skill. It can be actively developed at both the individual and institutional levels, and learning to navigate the relevant social and practical barriers is key to the process. To maximize the success of conservation in the face of escalating challenges, one must take advantage of what has been learned from other disciplines and foster creativity as both a professional skill and an essential component of career training and individual development. © 2013 Society for Conservation Biology.

  18. Conserved secondary structures in Aspergillus.

    Directory of Open Access Journals (Sweden)

    Abigail Manson McGuire


    Full Text Available Recent evidence suggests that the number and variety of functional RNAs (ncRNAs as well as cis-acting RNA elements within mRNAs is much higher than previously thought; thus, the ability to computationally predict and analyze RNAs has taken on new importance. We have computationally studied the secondary structures in an alignment of six Aspergillus genomes. Little is known about the RNAs present in this set of fungi, and this diverse set of genomes has an optimal level of sequence conservation for observing the correlated evolution of base-pairs seen in RNAs.We report the results of a whole-genome search for evolutionarily conserved secondary structures, as well as the results of clustering these predicted secondary structures by structural similarity. We find a total of 7450 predicted secondary structures, including a new predicted approximately 60 bp long hairpin motif found primarily inside introns. We find no evidence for microRNAs. Different types of genomic regions are over-represented in different classes of predicted secondary structures. Exons contain the longest motifs (primarily long, branched hairpins, 5' UTRs primarily contain groupings of short hairpins located near the start codon, and 3' UTRs contain very little secondary structure compared to other regions. There is a large concentration of short hairpins just inside the boundaries of exons. The density of predicted intronic RNAs increases with the length of introns, and the density of predicted secondary structures within mRNA coding regions increases with the number of introns in a gene.There are many conserved, high-confidence RNAs of unknown function in these Aspergillus genomes, as well as interesting spatial distributions of predicted secondary structures. This study increases our knowledge of secondary structure in these aspergillus organisms.

  19. Outcomes after planned invasive or conservative treatment strategy in patients with non-ST-elevation acute coronary syndrome and a normal value of high sensitivity troponin at randomisation: A Platelet Inhibition and Patient Outcomes (PLATO) trial biomarker substudy. (United States)

    Giannitsis, Evangelos; Wallentin, Lars; James, Stefan K; Bertilsson, Maria; Siegbahn, Agneta; Storey, Robert F; Husted, Steen; Cannon, Christopher P; Armstrong, Paul W; Steg, Philippe G; Katus, Hugo A


    Current guidelines for patients with non-ST-elevation acute coronary syndrome (NSTE-ACS) recommend early invasive treatment in intermediate-to-high risk patients based on medical history, electrocardiogram (ECG) and elevated troponin. Patients with normal levels of cardiac troponin measured with a high-sensitivity method (cTnT-hs) might not benefit from early invasive procedures. In this Prospective Randomized Platelet Inhibition and Patient Outcomes (PLATO) blood-core substudy, 1232 patients presented with NSTE-ACS had a high sensitivity cardiac troponin T (cTnT-hs) level <99th percentile (<14 ng/l) at randomisation. The outcomes in relation to a planned invasive ( n=473) vs planned conservative treatment ( n=759), were evaluated by adjusted Cox proportional hazard analyses. In patients with a normal cTnT-hs at randomisation, regardless of randomised treatment, a planned invasive vs conservative treatment was associated with a 2.3-fold higher risk (7.3% vs 3.4%, p=0.0028) for cardiovascular (CV) death or myocardial infarction (MI), driven by higher rates of procedure-related MI (3.4% vs 0.1%), while there were no differences in rates of CV death (1.3% vs 1.3%, p=0.72) or spontaneous MI (3.0% vs 2.1%, p=0.28). There were significantly more major bleeds (hazard ratio (HR) 2.98, p<0.0001), mainly due to coronary artery bypass graft (CABG)-related (HR 4.05, p<0.0001) and non-CABG procedural-related major bleeding events (HR 5.31, p=0.0175), however there were no differences in non-procedure-related major bleeding (1.5% vs 1.9%, p=0.45). Findings were consistent for patients with a normal cTnI-hs at randomisation. In patients with NSTE-ACS and normal cTnT-hs, a planned early invasive treatment strategy was associated with increased rates of procedure-related MI and bleeding but no differences in long-term spontaneous MI, non-procedure-related bleeding or mortality.

  20. Conservation genetics of Iberian raptors


    Martínez-Cruz, Begoña


    [EN] In this paper I provide an overview of conservation genetics and describe the management actions in the wild that can benefit from conservation genetic studies. I describe the genetic factors of risk for the survival of wild species, the consequences of loss of genetic diversity, inbreeding and outbreeding depression, and the use of genetic tools to delimitate units of conservation. Then I introduce the most common applications of conservation genetics in the management of wild populatio...

  1. Conservation Education: A Position Statement. (United States)

    Soil Conservation Society of America, Ankeny, IA.

    The Soil Conservation Society of America's (SCSA) aim is to advance the science and art of good land and water use. Conservation education has a significant role in achieving the wise use of these resources. In this report, perspectives are offered on: (1) the requirements for effective conservation education programs; (2) rationale for…

  2. Evolutionarily conserved sequences on human chromosome 21

    Energy Technology Data Exchange (ETDEWEB)

    Frazer, Kelly A.; Sheehan, John B.; Stokowski, Renee P.; Chen, Xiyin; Hosseini, Roya; Cheng, Jan-Fang; Fodor, Stephen P.A.; Cox, David R.; Patil, Nila


    Comparison of human sequences with the DNA of other mammals is an excellent means of identifying functional elements in the human genome. Here we describe the utility of high-density oligonucleotide arrays as a rapid approach for comparing human sequences with the DNA of multiple species whose sequences are not presently available. High-density arrays representing approximately 22.5 Mb of nonrepetitive human chromosome 21 sequence were synthesized and then hybridized with mouse and dog DNA to identify sequences conserved between humans and mice (human-mouse elements) and between humans and dogs (human-dog elements). Our data show that sequence comparison of multiple species provides a powerful empiric method for identifying actively conserved elements in the human genome. A large fraction of these evolutionarily conserved elements are present in regions on chromosome 21 that do not encode known genes.

  3. Algal MIPs, high diversity and conserved motifs

    Directory of Open Access Journals (Sweden)

    Johanson Urban


    Full Text Available Abstract Background Major intrinsic proteins (MIPs also named aquaporins form channels facilitating the passive transport of water and other small polar molecules across membranes. MIPs are particularly abundant and diverse in terrestrial plants but little is known about their evolutionary history. In an attempt to investigate the origin of the plant MIP subfamilies, genomes of chlorophyte algae, the sister group of charophyte algae and land plants, were searched for MIP encoding genes. Results A total of 22 MIPs were identified in the nine analysed genomes and phylogenetic analyses classified them into seven subfamilies. Two of these, Plasma membrane Intrinsic Proteins (PIPs and GlpF-like Intrinsic Proteins (GIPs, are also present in land plants and divergence dating support a common origin of these algal and land plant MIPs, predating the evolution of terrestrial plants. The subfamilies unique to algae were named MIPA to MIPE to facilitate the use of a common nomenclature for plant MIPs reflecting phylogenetically stable groups. All of the investigated genomes contained at least one MIP gene but only a few species encoded MIPs belonging to more than one subfamily. Conclusions Our results suggest that at least two of the seven subfamilies found in land plants were present already in an algal ancestor. The total variation of MIPs and the number of different subfamilies in chlorophyte algae is likely to be even higher than that found in land plants. Our analyses indicate that genetic exchanges between several of the algal subfamilies have occurred. The PIP1 and PIP2 groups and the Ca2+ gating appear to be specific to land plants whereas the pH gating is a more ancient characteristic shared by all PIPs. Further studies are needed to discern the function of the algal specific subfamilies MIPA-E and to fully understand the evolutionary relationship of algal and terrestrial plant MIPs.

  4. Energy conservation technologies

    Energy Technology Data Exchange (ETDEWEB)

    Courtright, H.A. [Electric Power Research Inst., Palo Alto, CA (United States)


    The conservation of energy through the efficiency improvement of existing end-uses and the development of new technologies to replace less efficient systems is an important component of the overall effort to reduce greenhouse gases which may contribute to global climate change. Even though uncertainties exist on the degree and causes of global warming, efficiency improvements in end-use applications remain in the best interest of utilities, their customers and society because efficiency improvements not only reduce environmental exposures but also contribute to industrial productivity, business cost reductions and consumer savings in energy costs.

  5. Hearing Conservation Live #2430

    Energy Technology Data Exchange (ETDEWEB)

    Chochoms, Michael [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)


    Occupational hearing loss is one of the most common work-related illnesses in the United States (US). From 22 to 30 million US workers are exposed to hazardous noise levels at work, and 25% of these workers will develop permanent hearing loss. Hearing loss from noise is slow and painless, and you can have a disability before you notice it. This course presents the hazards associated with workplace noise, the purpose and elements of the Los Alamos National Laboratory (LANL) Hearing Conservation Program (HCP), and controls that are available to reduce your exposure to hazardous levels of noise.

  6. Bison conservation initiative: Bison conservation genetics workshop: report and recommendations (United States)

    Gogan, Peter J.; Dratch, Peter


    One of the first outcomes of the Department of the Interior (DOI) Bison Conservation Initiative was the Bison Conservation Genetics Workshop held in Nebraska in September 2008. The workshop brought together scientists from government agencies and non-governmental organizations with professional population geneticists to develop guidance for the genetic management of the federal bison herds. The scientists agreed on the basic tenets of genetic management for the DOI herds and discussed different approaches to meeting those goals. First, the 12 DOI herds are an irreplaceable resource for the long-term conservation of North American plains bison. Most of the herds show low levels of cattle introgression dating from the time when they were saved from extirpation; those herds should not be mixed without careful consideration as to their origin. Herds that show no evidence of cattle ancestry by the current molecular methods are the highest priority for protection from genetic mixing with any other bison herds. Second, despite the fact that most of the herds now managed by the U.S. government were founded with very few bison and have been maintained for many generations at relatively low population sizes, they do not show obvious effects of inbreeding. They have retained significant amounts of genetic variation by the standard measures, heterozygosity and allelic diversity. This may be explained in part by the fact that most of these herds are not remnants of a single population. Third, to preserve genetic variation in federal bison herds over decades and centuries, herds should be managed at a population or metapopulation level of 1,000 animals or more, with a sex ratio that enables competition between breeding bulls. The parks and refuges that currently have bison herds, with the exception of Yellowstone National Park, do not have enough land to support a population of this size. In the short term, it will be important to develop satellite herds to attain population

  7. Lyme disease and conservation (United States)

    Ginsberg, H.


    Lyme disease is a tick-borne illness that is wide-spread in North America, especially in the northeastern and northcentral United States. This disease could negatively influence efforts to conserve natural populations in two ways: (1) the disease could directly affect wild animal health; and (2) tick control efforts could adversely affect natural populations and communities. Lyme disease affects several domestic animals, but symptoms have been reported in only a few wild species. Direct effects of Lyme disease on wild animal populations have not been reported, but the disease should be considered as a possible cause in cases of unexplained population declines in endemic areas. Methods available to manage ticks and Lyme disease include human self-protection techniques, manipulation of habitats and hosts species populations, biological control, and pesticide applications. The diversity of available techniques allows selection of approaches to minimize environmental effects by (1) emphasizing personal protection techniques, (2) carefully targeting management efforts to maximize efficiency, and (3) integrating environmentally benign techniques to improve management while avoiding broad-scale environmentally destructive approaches. The environmental effects of Lyme disease depend, to a large extent, on the methods chosen to minimize human exposure to infected ticks. Conservation biologists can help design tick management programs that effectively lower the incidence of human Lyme disease while simultaneously minimizing negative effects on natural populations.

  8. Spatial prioritisation for conserving ecosystem services

    NARCIS (Netherlands)

    Schröter, Matthias; Remme, Roy P.


    Context: The variation in spatial distribution between ecosystem services can be high. Hence, there is a need to spatially identify important sites for conservation planning. The term ‘ecosystem service hotspot’ has often been used for this purpose, but definitions of this term are ambiguous.

  9. Conservative management of intra- abdominal injuries

    African Journals Online (AJOL)

    Conservative management of intra- abdominal injuries. South Africa has a particularly high volume of blunt trauma in paediatric injury. J A LOVELAND, MB BCh, FCS (SA), Certificate in Paediatric Surgery. Jerome Loveland received his undergraduate degree from the University of the Witwatersrand in 1996, and completed ...

  10. Collaborative learning of water conservation practices: cultivation ...

    African Journals Online (AJOL)

    Collaborative learning of water conservation practices: cultivation and expansion of a learning network around rainwater harvesting demonstration sites in the Eastern Cape, ... South Africa has water, nutrition and food security challenges, especially the Eastern Cape Province where there is a relatively high level of poverty.

  11. Biodiversity Conservation, Tourism and Development in Okomu ...

    African Journals Online (AJOL)

    The survival of many species in Okomu National Park as is the case with other conservation areas depends on effective management and collaboration amongst all stakeholders. Highly critical in this regard is awareness and acceptance by the local community. This paper examines various sustainable development issues ...

  12. Optimized spatial priorities for biodiversity conservation in China: a systematic conservation planning perspective. (United States)

    Wu, Ruidong; Long, Yongcheng; Malanson, George P; Garber, Paul A; Zhang, Shuang; Li, Diqiang; Zhao, Peng; Wang, Longzhu; Duo, Hairui


    By addressing several key features overlooked in previous studies, i.e. human disturbance, integration of ecosystem- and species-level conservation features, and principles of complementarity and representativeness, we present the first national-scale systematic conservation planning for China to determine the optimized spatial priorities for biodiversity conservation. We compiled a spatial database on the distributions of ecosystem- and species-level conservation features, and modeled a human disturbance index (HDI) by aggregating information using several socioeconomic proxies. We ran Marxan with two scenarios (HDI-ignored and HDI-considered) to investigate the effects of human disturbance, and explored the geographic patterns of the optimized spatial conservation priorities. Compared to when HDI was ignored, the HDI-considered scenario resulted in (1) a marked reduction (∼9%) in the total HDI score and a slight increase (∼7%) in the total area of the portfolio of priority units, (2) a significant increase (∼43%) in the total irreplaceable area and (3) more irreplaceable units being identified in almost all environmental zones and highly-disturbed provinces. Thus the inclusion of human disturbance is essential for cost-effective priority-setting. Attention should be targeted to the areas that are characterized as moderately-disturbed, biodiversity, but those isolated priority units in disturbed regions are in more urgent need of conservation actions so as to prevent immediate and severe biodiversity loss. This study presents a spatially optimized national-scale portfolio of conservation priorities--effectively representing the overall biodiversity of China while minimizing conflicts with economic development. Our results offer critical insights for current conservation and strategic land-use planning in China. The approach is transferable and easy to implement by end-users, and applicable for national- and local-scale systematic conservation prioritization

  13. Assessment of the conservation measures partnership's effort to improve conservation outcomes through adaptive management. (United States)

    Redford, Kent H; Hulvey, Kristin B; Williamson, Matthew; Schwartz, Mark W


    Conservation practice has demonstrated an increasing desire for accountability of actions, particularly with respect to effectiveness, efficiency, and impact to specified objectives. This has been accompanied by increased attention to achieving adaptive management. In 2003 practitioners representing several prominent conservation non-governmental organizations (NGO's) launched a community of practice called the Conservation Measures Partnership (CMP). This organization has worked to establish standards of conservation practice to improve accountability of conservation actions through adaptive management. The focal organizing entity for the CMP has been the Open Standards for the Practice of Conservation (OS). We present results of an evaluation, using an online survey and personal interviews, of the first decade of CMP and the OS. We find that the CMP, has garnered a positive reputation among the leading scientists across conservation NGO's and succeeded at developing a large user base of the OS. However, the CMP has not fully achieved its goal of making the OS standard operating procedure for the large NGO's. This lack of institutionalization is attributable to multiple causes, including an increase in the number of competing decision support frameworks and challenges achieving full cycle adaptive management. We find that users strongly feel that the OS fosters better conservation practice and highly value the OS for improving their practice. A primary objective of the OS is to assist practitioners to achieve full cycle adaptive management in order to better integrate learning into improving the effectiveness and efficiency of actions. However, we find that most practitioners have not yet achieved cycle completion for their projects. We summarize recommendations for improving effectiveness of the CMP, OS, and generally for conservation practice. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  14. Optimized production and energy conservation

    Energy Technology Data Exchange (ETDEWEB)

    Nilsson, T.R.; Sinner, B.; Volden, O.V.


    The possibilities of energy conservation in a cement factory are great. At least two important energy waste sources can be identified: flue gas heat and electrical energy of fan drives. A study of the Cementa AB factory at Slite, Sweden (production 2.1 million ton/y) shows that even though considerable efforts already have been made in energy saving, the potential is still great. Thus it is estimated that about 40 MW of gas heat can be turned into 3.5 MW of electrical energy. By applying high-efficiency motor drives about 2 MW can be recovered from fan drives. These two sources correspond to a total annual saving of /2.5 million. An investment to recover this energy will be paid back in less than a year.

  15. High antiviral effect of TiO2·PL–DNA nanocomposites targeted to conservative regions of (−RNA and (+RNA of influenza A virus in cell culture

    Directory of Open Access Journals (Sweden)

    Asya S. Levina


    Full Text Available Background: The development of new antiviral drugs based on nucleic acids is under scrutiny. An important problem in this aspect is to find the most vulnerable conservative regions in the viral genome as targets for the action of these agents. Another challenge is the development of an efficient system for their delivery into cells. To solve this problem, we proposed a TiO2·PL–DNA nanocomposite consisting of titanium dioxide nanoparticles and polylysine (PL-containing oligonucleotides.Results: The TiO2·PL–DNA nanocomposites bearing the DNA fragments targeted to different conservative regions of (−RNA and (+RNA of segment 5 of influenza A virus (IAV were studied for their antiviral activity in MDCK cells infected with the H1N1, H5N1, and H3N2 virus subtypes. Within the negative strand of each of the studied strains, the efficiency of DNA fragments increased in the direction of its 3’-end. Thus, the DNA fragment aimed at the 3’-noncoding region of (−RNA was the most efficient and inhibited the reproduction of different IAV subtypes by 3–4 orders of magnitude. Although to a lesser extent, the DNA fragments targeted at the AUG region of (+RNA and the corresponding region of (−RNA were also active. For all studied viral subtypes, the nanocomposites bearing the DNA fragments targeted to (−RNA appeared to be more efficient than those containing fragments aimed at the corresponding (+RNA regions.Conclusion: The proposed TiO2·PL–DNA nanocomposites can be successfully used for highly efficient and site-specific inhibition of influenza A virus of different subtypes. Some patterns of localization of the most vulnerable regions in IAV segment 5 for the action of DNA-based drugs were found. The (−RNA strand of IAV segment 5 appeared to be more sensitive as compared to (+RNA.

  16. International energy conservation: comparative law and policy

    Energy Technology Data Exchange (ETDEWEB)


    Ernest C. Baynard III, in the Foreword to the conference, told of the purpose of the conference - to compare and discuss the policies and laws that highly industrialized nations have used and considered to meet the challenge of energy conservation. The following countries participated in the conference: U.K.; Australia; Federal Republic of Germany; Japan; France; Canada; Sweden; Italy; the Netherlands; and the U.S. The IEA and the Commission of the European Communities also participated. The conference format consisted of ministerial addresses to the conference, interspersed with panel discussions focusing on energy conservation in transportation, industry, agriculture, and utilities; residential, commercial, and industrial buildings; and emergency situations. There was also a panel discussion on the role of government in energy conservation and energy information collection. The panels were composed of participating countries' representatives. (MCW)

  17. Social benefits of financial investment support in energy conservation policy

    Energy Technology Data Exchange (ETDEWEB)

    Haugland, T. [ECON Centre for Economic Analysis, Oslo (Norway)


    Energy conservation became an important component of energy policy after the oil price increases in the 1970s. The authors refer to energy conservation as policy measures other than price and tax changes intended to improve the efficiency in end use of energy. From 1973 to 1985, more stringent technical standards, information and financial incentives contributed to a 20 percent drop in energy intensities in Organization Economic and Cooperative Developing (OECD) countries. However, high end use prices rather than conservation policies had the greatist effect. The author examines the costs and benefits of a Norwegian energy conservation program that provided financial support for investments in energy efficiency. 28 refs., 6 figs.

  18. Conserving Phylogenetic Diversity Can Be a Poor Strategy for Conserving Functional Diversity. (United States)

    Mazel, Florent; Mooers, Arne O; Riva, Giulio Valentino Dalla; Pennell, Matthew W


    For decades, academic biologists have advocated for making conservation decisions in light of evolutionary history. Specifically, they suggest that policy makers should prioritize conserving phylogenetically diverse assemblages. The most prominent argument is that conserving phylogenetic diversity (PD) will also conserve diversity in traits and features (functional diversity [FD]), which may be valuable for a number of reasons. The claim that PD-maximized ("maxPD") sets of taxa will also have high FD is often taken at face value and in cases where researchers have actually tested it, they have done so by measuring the phylogenetic signal in ecologically important functional traits. The rationale is that if traits closely mirror phylogeny, then saving the maxPD set of taxa will tend to maximize FD and if traits do not have phylogenetic structure, then saving the maxPD set of taxa will be no better at capturing FD than criteria that ignore PD. Here, we suggest that measuring the phylogenetic signal in traits is uninformative for evaluating the effectiveness of using PD in conservation. We evolve traits under several different models and, for the first time, directly compare the FD of a set of taxa that maximize PD to the FD of a random set of the same size. Under many common models of trait evolution and tree shapes, conserving the maxPD set of taxa will conserve more FD than conserving a random set of the same size. However, this result cannot be generalized to other classes of models. We find that under biologically plausible scenarios, using PD to select species can actually lead to less FD compared with a random set. Critically, this can occur even when there is phylogenetic signal in the traits. Predicting exactly when we expect using PD to be a good strategy for conserving FD is challenging, as it depends on complex interactions between tree shape and the assumptions of the evolutionary model. Nonetheless, if our goal is to maintain trait diversity, the fact

  19. Objective and Longitudinal Assessment of Dermatitis After Postoperative Accelerated Partial Breast Irradiation Using High-Dose-Rate Interstitial Brachytherapy in Patients With Breast Cancer Treated With Breast Conserving Therapy: Reduction of Moisture Deterioration by APBI

    Energy Technology Data Exchange (ETDEWEB)

    Tanaka, Eiichi [Department of Radiation Oncology, National Hospital Organization, Osaka National Hospital, Osaka (Japan); Yamazaki, Hideya, E-mail: [Department of Radiology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Yoshida, Ken; Takenaka, Tadashi [Department of Radiation Oncology, National Hospital Organization, Osaka National Hospital, Osaka (Japan); Masuda, Norikazu [Department of Surgery and Breast Oncology, National Hospital Organization, Osaka National Hospital, Osaka (Japan); Kotsuma, Tadayuki; Yoshioka, Yasuo; Inoue, Takehiro [Department of Radiation Oncology, Osaka University Graduate School of Medicine, Suita (Japan)


    Purpose: To objectively evaluate the radiation dermatitis caused by accelerated partial breast irradiation (APBI) using high-dose-rate interstitial brachytherapy. Patients and Methods: The skin color and moisture changes were examined using a newly installed spectrophotometer and corneometer in 22 patients who had undergone APBI using open cavity implant high-dose-rate interstitial brachytherapy (36 Gy in six fractions) and compared with the corresponding values for 44 patients in an external beam radiotherapy (EBRT) control group (50-60 Gy in 25-30 fractions within 5-6 weeks) after breast conserving surgery. Results: All values changed significantly as a result of APBI. The extent of elevation in a Asterisk-Operator (reddish) and reduction in L Asterisk-Operator (black) values caused by APBI were similar to those for EBRT, with slightly delayed recovery for 6-12 months after treatment owing to the surgical procedure. In contrast, only APBI caused a change in the b Asterisk-Operator values, and EBRT did not, demonstrating that the reduction in b Asterisk-Operator values (yellowish) depends largely on the surgical procedure. The changes in moisture were less severe after APBI than after EBRT, and the recovery was more rapid. The toxicity assessment using the Common Toxicity Criteria, version 3, showed that all dermatitis caused by APBI was Grade 2 or less. Conclusion: An objective analysis can quantify the effects of APBI procedures on color and moisture cosmesis. The radiation dermatitis caused by APBI using the present schedule showed an equivalent effect on skin color and a less severe effect on moisture than the effects caused by standard EBRT.

  20. A Conserved HIV-1-Derived Peptide Presented by HLA-E Renders Infected T-cells Highly Susceptible to Attack by NKG2A/CD94-Bearing Natural Killer Cells.

    Directory of Open Access Journals (Sweden)

    Zachary B Davis


    Full Text Available Major histocompatibility class I (MHC-I-specific inhibitory receptors on natural killer (NK cells (iNKRs tolerize mature NK cell responses toward normal cells. NK cells generate cytolytic responses to virus-infected or malignant target cells with altered or decreased MHC-I surface expression due to the loss of tolerizing ligands. The NKG2A/CD94 iNKR suppresses NK cell responses through recognition of the non-classical MHC-I, HLA-E. We used HIV-infected primary T-cells as targets in an in vitro cytolytic assay with autologous NK cells from healthy donors. In these experiments, primary NKG2A/CD94(+ NK cells surprisingly generated the most efficient responses toward HIV-infected T-cells, despite high HLA-E expression on the infected targets. Since certain MHC-I-presented peptides can alter recognition by iNKRs, we hypothesized that HIV-1-derived peptides presented by HLA-E on infected cells may block engagement with NKG2A/CD94, thereby engendering susceptibility to NKG2A/CD94(+ NK cells. We demonstrate that HLA-E is capable of presenting a highly conserved peptide from HIV-1 capsid (AISPRTLNA that is not recognized by NKG2A/CD94. We further confirmed that HLA-C expressed on HIV-infected cells restricts attack by KIR2DL(+ CD56(dim NK cells, in contrast to the efficient responses by CD56(bright NK cells, which express predominantly NKG2A/CD94 and lack KIR2DLs. These findings are important since the use of NK cells was recently proposed to treat latently HIV-1-infected patients in combination with latency reversing agents. Our results provide a mechanistic basis to guide these future clinical studies, suggesting that ex vivo-expanded NKG2A/CD94(+ KIR2DL(- NK cells may be uniquely beneficial.

  1. 75 FR 20111 - Energy Conservation Program: Energy Conservation Standards for Residential Water Heaters, Direct... (United States)


    ... Energy 10 CFR Part 430 Energy Conservation Program: Energy Conservation Standards for Residential Water... Energy Conservation Program: Energy Conservation Standards for Residential Water Heaters, Direct Heating... conservation standards for residential water heaters (other than tabletop and electric instantaneous models...

  2. Setting priorities for regional conservation planning in the Mediterranean Sea. (United States)

    Micheli, Fiorenza; Levin, Noam; Giakoumi, Sylvaine; Katsanevakis, Stelios; Abdulla, Ameer; Coll, Marta; Fraschetti, Simonetta; Kark, Salit; Koutsoubas, Drosos; Mackelworth, Peter; Maiorano, Luigi; Possingham, Hugh P


    Spatial prioritization in conservation is required to direct limited resources to where actions are most urgently needed and most likely to produce effective conservation outcomes. In an effort to advance the protection of a highly threatened hotspot of marine biodiversity, the Mediterranean Sea, multiple spatial conservation plans have been developed in recent years. Here, we review and integrate these different plans with the goal of identifying priority conservation areas that represent the current consensus among the different initiatives. A review of six existing and twelve proposed conservation initiatives highlights gaps in conservation and management planning, particularly within the southern and eastern regions of the Mediterranean and for offshore and deep sea habitats. The eighteen initiatives vary substantially in their extent (covering 0.1-58.5% of the Mediterranean Sea) and in the location of additional proposed conservation and management areas. Differences in the criteria, approaches and data used explain such variation. Despite the diversity among proposals, our analyses identified ten areas, encompassing 10% of the Mediterranean Sea, that are consistently identified among the existing proposals, with an additional 10% selected by at least five proposals. These areas represent top priorities for immediate conservation action. Despite the plethora of initiatives, major challenges face Mediterranean biodiversity and conservation. These include the need for spatial prioritization within a comprehensive framework for regional conservation planning, the acquisition of additional information from data-poor areas, species or habitats, and addressing the challenges of establishing transboundary governance and collaboration in socially, culturally and politically complex conditions. Collective prioritised action, not new conservation plans, is needed for the north, western, and high seas of the Mediterranean, while developing initial information-based plans

  3. Setting Priorities for Regional Conservation Planning in the Mediterranean Sea (United States)

    Micheli, Fiorenza; Levin, Noam; Giakoumi, Sylvaine; Katsanevakis, Stelios; Abdulla, Ameer; Coll, Marta; Fraschetti, Simonetta; Kark, Salit; Koutsoubas, Drosos; Mackelworth, Peter; Maiorano, Luigi; Possingham, Hugh P.


    Spatial prioritization in conservation is required to direct limited resources to where actions are most urgently needed and most likely to produce effective conservation outcomes. In an effort to advance the protection of a highly threatened hotspot of marine biodiversity, the Mediterranean Sea, multiple spatial conservation plans have been developed in recent years. Here, we review and integrate these different plans with the goal of identifying priority conservation areas that represent the current consensus among the different initiatives. A review of six existing and twelve proposed conservation initiatives highlights gaps in conservation and management planning, particularly within the southern and eastern regions of the Mediterranean and for offshore and deep sea habitats. The eighteen initiatives vary substantially in their extent (covering 0.1–58.5% of the Mediterranean Sea) and in the location of additional proposed conservation and management areas. Differences in the criteria, approaches and data used explain such variation. Despite the diversity among proposals, our analyses identified ten areas, encompassing 10% of the Mediterranean Sea, that are consistently identified among the existing proposals, with an additional 10% selected by at least five proposals. These areas represent top priorities for immediate conservation action. Despite the plethora of initiatives, major challenges face Mediterranean biodiversity and conservation. These include the need for spatial prioritization within a comprehensive framework for regional conservation planning, the acquisition of additional information from data-poor areas, species or habitats, and addressing the challenges of establishing transboundary governance and collaboration in socially, culturally and politically complex conditions. Collective prioritised action, not new conservation plans, is needed for the north, western, and high seas of the Mediterranean, while developing initial information

  4. Democracy in Conservation – Wall Painting Conservation and Church Communities

    DEFF Research Database (Denmark)

    Brajer, Isabelle Eve


    Wall painting conservation in Denmark has been functioning within a democratically organised church infrastructure for more than 100 years, which permits an overview of community involvement in conservation over a longer period. The case stories presented here show widely varying attitudes held...

  5. Global priorities for conservation across multiple dimensions of mammalian diversity. (United States)

    Brum, Fernanda T; Graham, Catherine H; Costa, Gabriel C; Hedges, S Blair; Penone, Caterina; Radeloff, Volker C; Rondinini, Carlo; Loyola, Rafael; Davidson, Ana D


    Conservation priorities that are based on species distribution, endemism, and vulnerability may underrepresent biologically unique species as well as their functional roles and evolutionary histories. To ensure that priorities are biologically comprehensive, multiple dimensions of diversity must be considered. Further, understanding how the different dimensions relate to one another spatially is important for conservation prioritization, but the relationship remains poorly understood. Here, we use spatial conservation planning to (i) identify and compare priority regions for global mammal conservation across three key dimensions of biodiversity-taxonomic, phylogenetic, and traits-and (ii) determine the overlap of these regions with the locations of threatened species and existing protected areas. We show that priority areas for mammal conservation exhibit low overlap across the three dimensions, highlighting the need for an integrative approach for biodiversity conservation. Additionally, currently protected areas poorly represent the three dimensions of mammalian biodiversity. We identify areas of high conservation priority among and across the dimensions that should receive special attention for expanding the global protected area network. These high-priority areas, combined with areas of high priority for other taxonomic groups and with social, economic, and political considerations, provide a biological foundation for future conservation planning efforts.

  6. Cultivation and Conservation of Guggulu (Commiphora mukul) (United States)

    Thosar, Sheetal L; Yende, Mohan R


    Guggulu (Commiphora mukul) is about 2-3.5 mt heighted plant of Burceraceae family. The plant grows wild in the arid, rocky tracts, also in low rainy and hot areas. The part used in medicinal preparation is resin, collected by tapping the barks. Guggulu deserves high values in Ayurvedic medicines. Guggulu is Rasayana, Vatakaphaghna, and used in various diseases. Due to high values and excessive demands, improper methods of collection, uncontrolled forest destruction and poor knowledge of cultivation; number of plants highly decreased. Now it categorized as threatened plant. Hence cultivation and conservation of this plant is necessary. Guggulu can be propagated by seed and vegetative method. Germination through seed is very poor. Vegetative propagation through stem cutting is most common and successful method. Farming care is also necessary f or proper growth. Conservation can be effected by knowledge of collection methods and awareness. PMID:22557340

  7. Cultivation and Conservation of Guggulu (Commiphora mukul). (United States)

    Thosar, Sheetal L; Yende, Mohan R


    Guggulu (Commiphora mukul) is about 2-3.5 mt heighted plant of Burceraceae family. The plant grows wild in the arid, rocky tracts, also in low rainy and hot areas. The part used in medicinal preparation is resin, collected by tapping the barks. Guggulu deserves high values in Ayurvedic medicines. Guggulu is Rasayana, Vatakaphaghna, and used in various diseases. Due to high values and excessive demands, improper methods of collection, uncontrolled forest destruction and poor knowledge of cultivation; number of plants highly decreased. Now it categorized as threatened plant. Hence cultivation and conservation of this plant is necessary. Guggulu can be propagated by seed and vegetative method. Germination through seed is very poor. Vegetative propagation through stem cutting is most common and successful method. Farming care is also necessary f or proper growth. Conservation can be effected by knowledge of collection methods and awareness.

  8. Biochemical characterization of the water-soluble squalene synthase from Methylococcus capsulatus and the functional analyses of its two DXXD(E)D motifs and the highly conserved aromatic amino acid residues. (United States)

    Ohtake, Kana; Saito, Naoki; Shibuya, Satoshi; Kobayashi, Wakako; Amano, Ryosuke; Hirai, Takumi; Sasaki, Shinji; Nakano, Chiaki; Hoshino, Tsutomu


    Information regarding squalene synthases (SQSs) from prokaryotes is scarce. We aimed to characterize the SQS from Methylococcus capsulatus. We studied its reaction mechanism by kinetic analysis and evaluated the structure of the substrate/inhibitor-binding sites via homology modeling. The cloned M. capsulatus SQS was expressed in Escherichia coli and purified by nickel-nitrilotriacetic acid column chromatography. Interestingly, M. capsulatus SQS was water-soluble and did not require any detergent for its higher activity, unlike other SQSs studied previously; supplementation of any type of detergent inhibited enzyme activity. The specific activity and the kinetic values (Km and kcat ) for the substrate farnesyl diphosphate and NADPH are reported. The substrate analog farnesyl methylenediphosphonate showed potent inhibition toward the enzyme. We prepared the site-specific mutants directed at potential active-site residues (58) DXX(61) E(62) D (S1 site) and (213) DXX(216) D(217) D (S2 site), which were assumed to be involved in the binding of the substrate farnesyl diphosphate through the Mg(2+) ion. We first demonstrated that the S1 site and the two basic residues (R55 and K212) were responsible for the binding of farnesyl diphosphate. Furthermore, we examined the catalytic roles of the highly conserved aromatic residues and demonstrated that the Y164 residue abstracts the proton of cation 5, which is produced during the first half-reaction (Scheme 1), to afford presqualene diphosphate, and that the W224 residue stabilizes the intermediary cation 5 via the cation-π interaction. Furthermore, we confirm for the first time that the F32 and the Y51 residues also stabilize the carbocation intermediate(s) generated during the second half-reaction. © 2014 FEBS.

  9. A common highly conserved cadmium detoxification mechanism from bacteria to humans: heavy metal tolerance conferred by the ATP-binding cassette (ABC) transporter SpHMT1 requires glutathione but not metal-chelating phytochelatin peptides. (United States)

    Prévéral, Sandra; Gayet, Landry; Moldes, Cristina; Hoffmann, Jonathan; Mounicou, Sandra; Gruet, Antoine; Reynaud, Florie; Lobinski, Ryszard; Verbavatz, Jean-Marc; Vavasseur, Alain; Forestier, Cyrille


    Cadmium poses a significant threat to human health due to its toxicity. In mammals and in bakers' yeast, cadmium is detoxified by ATP-binding cassette transporters after conjugation to glutathione. In fission yeast, phytochelatins constitute the co-substrate with cadmium for the transporter SpHMT1. In plants, a detoxification mechanism similar to the one in fission yeast is supposed, but the molecular nature of the transporter is still lacking. To investigate further the relationship between SpHMT1 and its co-substrate, we overexpressed the transporter in a Schizosaccharomyces pombe strain deleted for the phytochelatin synthase gene and heterologously in Saccharomyces cerevisiae and in Escherichia coli. In all organisms, overexpression of SpHMT1 conferred a markedly enhanced tolerance to cadmium but not to Sb(III), AgNO(3), As(III), As(V), CuSO(4), or HgCl(2). Abolishment of the catalytic activity by expression of SpHMT1(K623M) mutant suppressed the cadmium tolerance phenotype independently of the presence of phytochelatins. Depletion of the glutathione pool inhibited the SpHMT1 activity but not that of AtHMA4, a P-type ATPase, indicating that GSH is necessary for the SpHMT1-mediated cadmium resistance. In E. coli, SpHMT1 was targeted to the periplasmic membrane and led to an increased amount of cadmium in the periplasm. These results demonstrate that SpHMT1 confers cadmium tolerance in the absence of phytochelatins but depending on the presence of GSH and ATP. Our results challenge the dogma of the two separate cadmium detoxification pathways and demonstrate that a common highly conserved mechanism has been selected during the evolution from bacteria to humans.

  10. Educating Astronauts About Conservation Biology (United States)

    Robinson, Julie A.


    This article reviews the training of astronauts in the interdisciplinary work of conservation biology. The primary responsibility of the conservation biologist at NASA is directing and supporting the photography of the Earth and maintaining the complete database of the photographs. In order to perform this work, the astronauts who take the pictures must be educated in ecological issues.

  11. Motivations for conserving urban biodiversity. (United States)

    Dearborn, Donald C; Kark, Salit


    In a time of increasing urbanization, the fundamental value of conserving urban biodiversity remains controversial. How much of a fixed budget should be spent on conservation in urban versus nonurban landscapes? The answer should depend on the goals that drive our conservation actions, yet proponents of urban conservation often fail to specify the motivation for protecting urban biodiversity. This is an important shortcoming on several fronts, including a missed opportunity to make a stronger appeal to those who believe conservation biology should focus exclusively on more natural, wilder landscapes. We argue that urban areas do offer an important venue for conservation biology, but that we must become better at choosing and articulating our goals. We explored seven possible motivations for urban biodiversity conservation: preserving local biodiversity, creating stepping stones to nonurban habitat, understanding and facilitating responses to environmental change, conducting environmental education, providing ecosystem services, fulfilling ethical responsibilities, and improving human well-being. To attain all these goals, challenges must be faced that are common to the urban environment, such as localized pollution, disruption of ecosystem structure, and limited availability of land. There are, however, also challenges specific only to particular goals, meaning that different goals will require different approaches and actions. This highlights the importance of specifying the motivations behind urban biodiversity conservation. If the goals are unknown, progress cannot be assessed.

  12. Operationalizing biodiversity for conservation planning

    Indian Academy of Sciences (India)

    The relative concept of biodiversity built into the definition of complementarity has the level of precision needed to undertake conservation planning. ... Biodiversity and Biocultural Conservation Laboratory, Program in the History and Philosophy of Science and the Department of Philosophy, University of Texas at Austin, ...

  13. Tax aspects of conservation easements (United States)

    William C. Siegel


    A woodland owner may wish to guarantee that his or her forest land always remains as forest. Persons in this situation sometimes consider placing a conservation easement on the property to achieve that goal. A qualified conservation easement is defined as a transfer of a qualified real property interest means a restriction, granted in perpetuity, on the use that may be...

  14. Conservation business: sustaining Africa's future

    Directory of Open Access Journals (Sweden)

    I.P. Sonnekus


    Full Text Available Protected areas in Africa are threatened by a lack of funds to conduct their work effectively and by extremely poor communities that surround their resource-rich areas. We believe that conservation staff suffer from mental blocks. They assume that business and profitability reflect unethical processes that destroy natural resources. We developed a workshop process that allows conservationists to integrate entrepreneurial thinking with conservation principles and ethics. We measured perceptions both before and after such a workshop to assess the impact of the process. The process assisted conservationists at the Southern African Wildlife College to develop the integrated mental frameworks that are required to develop conservation into a sustainable business. The group internalised the new mental framework, whereby conservation and business, when integrated in an ethical manner, are viewed as virtually synonymous. The group also identified many innovative ways in which they could derive sustainable income from their natural resources while simultaneously achieving their conservation objectives.

  15. Optimal conservation of migratory species.

    Directory of Open Access Journals (Sweden)

    Tara G Martin

    Full Text Available BACKGROUND: Migratory animals comprise a significant portion of biodiversity worldwide with annual investment for their conservation exceeding several billion dollars. Designing effective conservation plans presents enormous challenges. Migratory species are influenced by multiple events across land and sea-regions that are often separated by thousands of kilometres and span international borders. To date, conservation strategies for migratory species fail to take into account how migratory animals are spatially connected between different periods of the annual cycle (i.e. migratory connectivity bringing into question the utility and efficiency of current conservation efforts. METHODOLOGY/PRINCIPAL FINDINGS: Here, we report the first framework for determining an optimal conservation strategy for a migratory species. Employing a decision theoretic approach using dynamic optimization, we address the problem of how to allocate resources for habitat conservation for a Neotropical-Nearctic migratory bird, the American redstart Setophaga ruticilla, whose winter habitat is under threat. Our first conservation strategy used the acquisition of winter habitat based on land cost, relative bird density, and the rate of habitat loss to maximize the abundance of birds on the wintering grounds. Our second strategy maximized bird abundance across the entire range of the species by adding the constraint of maintaining a minimum percentage of birds within each breeding region in North America using information on migratory connectivity as estimated from stable-hydrogen isotopes in feathers. We show that failure to take into account migratory connectivity may doom some regional populations to extinction, whereas including information on migratory connectivity results in the protection of the species across its entire range. CONCLUSIONS/SIGNIFICANCE: We demonstrate that conservation strategies for migratory animals depend critically upon two factors: knowledge of

  16. Red Rock Canyon National Conservation Area Transportation Feasibility Study (United States)


    Red Rock Canyon National Conservation Area is a popular Bureau of Land Management natural area located near Las Vegas, Nevada. Red Rock Canyon experiences heavy congestion on its Scenic Drive and associated parking areas, due to high volumes of visit...

  17. The Conservation Principles and Kepler's Laws of Planetary Motion (United States)

    Motz, Lloyd


    Derives Kepler's three laws of planetary motion algebraically from conservation principles without introducing Newton's law of force explicitly. This procedure can be presented to students who have had no more than high school algebra. (Author)

  18. Conserving biodiversity that matters: practitioners' perspectives on brownfield development and urban nature conservation in London. (United States)

    Harrison, Carolyn; Davies, Gail


    Policies designed to conserve sites of nature conservation importance are an important aspect of city planning in the UK. London has led the way in putting in place a spatial hierarchy of sites of nature conservation importance designed to protect wildlife habitats from development. Some wasteland habitats associated with derelict and vacant land receive protection in this way but development pressure on these so-called 'brownfield sites' is high and is likely to continue. This paper examines how conservation professionals in the private, public and voluntary sectors are responding to the threats of biodiversity loss and opportunities for habitat creation posed by re-development of brownfield sites. The study draws on in-depth interviews conducted with conservation professionals and the practices employed by ecological advisers employed by developers seeking to re-develop wasteland sites. It finds that practitioners are negotiating their role in the re-development process in different ways. Key issues relate to the role of ecological science in codifying wasteland habitats, uncertainties about how best to evaluate the conservation importance of such sites and the strategies and tactics employed by different practitioners as they seek to mobilise a range of knowledges and practices to secure ecologically sensitive proposals. Scientific knowledge about wasteland habitats has not stabilised in ways that can consistently inform conservation policy and practice. As a result biodiversity issues of wasteland sites are often discounted in the re-development process. Investment in studies of the basic ecology of urban wastelands could provide a firmer scientific foundation on which conservation policies could build. At the same time, many conservation professionals involved in urban re-development are struggling to promote a pro-active approach to secure environmentally sensitive development. The knowledge and co-operation networks being mobilised to support this approach

  19. Conservation through the economics lens. (United States)

    Farley, Joshua


    Although conservation is an inherently transdisciplinary issue, there is much to be gained from examining the problem through an economics lens. Three benefits of such an approach are laid out in this paper. First, many of the drivers of environmental degradation are economic in origin, and the better we understand them, the better we can conserve ecosystems by reducing degradation. Second, economics offers us a when-to-stop rule, which is equivalent to a when-to-conserve rule. All economic production is based on the transformation of raw materials provided by nature. As the economic system grows in physical size, it necessarily displaces and degrades ecosystems. The marginal benefits of economic growth are diminishing, and the marginal costs of ecological degradation are increasing. Conceptually, we should stop economic growth and focus on conservation when the two are equal. Third, economics can help us understand how to efficiently and justly allocate resources toward conservation, and this paper lays out some basic principles for doing so. Unfortunately, the field of economics is dominated by neoclassical economics, which builds an analytical framework based on questionable assumptions and takes an excessively disciplinary and formalistic approach. Conservation is a complex problem, and analysis from individual disciplinary lenses can make important contributions to conservation only when the resulting insights are synthesized into a coherent vision of the whole. Fortunately, there are a number of emerging transdisciplines, such as ecological economics and environmental management, that are dedicated to this task.

  20. Targeted gene flow for conservation. (United States)

    Kelly, Ella; Phillips, Ben L


    Anthropogenic threats often impose strong selection on affected populations, causing rapid evolutionary responses. Unfortunately, these adaptive responses are rarely harnessed for conservation. We suggest that conservation managers pay close attention to adaptive processes and geographic variation, with an eye to using them for conservation goals. Translocating pre-adapted individuals into recipient populations is currently considered a potentially important management tool in the face of climate change. Targeted gene flow, which involves moving individuals with favorable traits to areas where these traits would have a conservation benefit, could have a much broader application in conservation. Across a species' range there may be long-standing geographic variation in traits or variation may have rapidly developed in response to a threatening process. Targeted gene flow could be used to promote natural resistance to threats to increase species resilience. We suggest that targeted gene flow is a currently underappreciated strategy in conservation that has applications ranging from the management of invasive species and their impacts to controlling the impact and virulence of pathogens. © 2015 Society for Conservation Biology.

  1. Conservation Lands and Preserves, Private - Volusia County Conservation Corridor (United States)

    NSGIC Local Govt | GIS Inventory — The Volusia Conservation Corridor (VCC) is a mosaic of contiguous parcels of land, approximately 55,000 acres in size, which sits essentially in the middle of the...

  2. 76 FR 22453 - Energy Conservation Program: Energy Conservation Standards for Residential Clothes Dryers and... (United States)


    ...) prescribes energy conservation standards for various consumer products and commercial and industrial.... Screening Analysis 1. Clothes Dryers 2. Room Air Conditioners C. Engineering Analysis 1. Technologies Not... price trends. The high end of this range corresponds to a constant real equipment price trend. Using the...

  3. Evaluation of Conservation Costs and Benefits of Developing Conservation Strategies


    Olanipekun N. O.


    Due to environmental degradation, depletion and overexploitation of natural resources caused by human activities resulted in development of strategies for conservation of species, habitats and resource. Hence, this paper thus examines the advantages of financial investment and critical elements associated with creating strategies for the conservation of various species. Interdependent to one another are fish, wildlife species, natural habitats as well as natural resources. It rightly observed...

  4. The conservation of orbital symmetry

    CERN Document Server

    Woodward, R B


    The Conservation of Orbital Symmetry examines the principle of conservation of orbital symmetry and its use. The central content of the principle was that reactions occur readily when there is congruence between orbital symmetry characteristics of reactants and products, and only with difficulty when that congruence does not obtain-or to put it more succinctly, orbital symmetry is conserved in concerted reaction. This principle is expected to endure, whatever the language in which it may be couched, or whatever greater precision may be developed in its application and extension. The book ope

  5. Challenges of conservation: working objects

    Directory of Open Access Journals (Sweden)

    Professor Elizabeth Pye


    Full Text Available This paper discusses the concepts and practice of museum conservation, and the role of conservation in preserving both material and significance of objects. It explores the conservation of science and industry collections and the fact that the significance of many of these objects lies in their operation. It considers alternatives to operating original objects but emphasises the value of experiencing the real thing, and argues that visitors should be given greater physical access to museum objects, including being enabled to handle and work functioning objects. It finishes by calling for research into the effects of operation on the objects themselves, and into what constitutes a satisfying experience of working objects.

  6. Climate, Carbon, Conservation and Communities

    Energy Technology Data Exchange (ETDEWEB)

    Vaugn, Kit; Brickell, Emily [WWF-UK (United Kingdom); Roe, Dilys; Reid, Hannah; Elliot, Jo


    The growing market for carbon offers great opportunities for linking greenhouse gas mitigation with conservation of forests and biodiversity, and the generation of local livelihoods. For these combined objectives to be achieved, strong governance is needed along with institutions that ensure poor people win, rather than lose out, from the new challenges posed by climate change. This briefing paper explores the opportunities from and limitations to carbon-based funds for conservation and development. It highlights mechanisms that may help secure benefits for climate, conservation and communities.

  7. Local Responses to Participatory Conservation in Annapurna Conservation Area, Nepal (United States)

    Khadka, Damodar; Nepal, Sanjay K.


    Biodiversity conservation has undergone a profound change in philosophy, policies and management approaches over the last forty years. The traditional top-down approach to nature protection has been widely criticized for failing to include critical social elements in management practices, and is being gradually replaced by a slew of participatory strategies under the rubric of bottom-up conservation. The new approach recognizes local communities as key partners in wildlife management and seeks their participation in social development and biodiversity conservation. However, every social context is different in its structure and functions, and in the way social groups respond to calls for participation. In order to gain a better understanding of the approach and the barriers encountered in its implementation, a questionnaire survey of 188 households was employed in the communities of the Upper Mustang extension of Annapurna Conservation Area (ACA) in Nepal. The study provides a comparative analysis of community participation and its barriers between Non-Tourist (NT) and Tourist (TV) villages. The results revealed important differences between the two groups in terms of their participation in community programs, barriers to participation, and perception of benefits from participation. Owing to their distinct spatial, demographic and attitudinal differences, the two village groups have their own sets of needs, values and motivation factors which cannot be generalized and treated as such. The research clearly identifies the need for the conservation agency to be creative in devising strategies and initiatives appropriate to specific social groups so as to optimize their input in participatory conservation.

  8. Local responses to participatory conservation in Annapurna conservation area, Nepal. (United States)

    Khadka, Damodar; Nepal, Sanjay K


    Biodiversity conservation has undergone a profound change in philosophy, policies and management approaches over the last forty years. The traditional top-down approach to nature protection has been widely criticized for failing to include critical social elements in management practices, and is being gradually replaced by a slew of participatory strategies under the rubric of bottom-up conservation. The new approach recognizes local communities as key partners in wildlife management and seeks their participation in social development and biodiversity conservation. However, every social context is different in its structure and functions, and in the way social groups respond to calls for participation. In order to gain a better understanding of the approach and the barriers encountered in its implementation, a questionnaire survey of 188 households was employed in the communities of the Upper Mustang extension of Annapurna Conservation Area (ACA) in Nepal. The study provides a comparative analysis of community participation and its barriers between Non-Tourist (NT) and Tourist (TV) villages. The results revealed important differences between the two groups in terms of their participation in community programs, barriers to participation, and perception of benefits from participation. Owing to their distinct spatial, demographic and attitudinal differences, the two village groups have their own sets of needs, values and motivation factors which cannot be generalized and treated as such. The research clearly identifies the need for the conservation agency to be creative in devising strategies and initiatives appropriate to specific social groups so as to optimize their input in participatory conservation.

  9. Epitope of titin A-band-specific monoclonal antibody Tit1 5 H1.1 is highly conserved in several Fn3 domains of the titin molecule. Centriole staining in human, mouse and zebrafish cells

    Directory of Open Access Journals (Sweden)

    Mikelsaar Aavo-Valdur


    Full Text Available Abstract Background Previously we have reported on the development of a new mouse anti-titin monoclonal antibody, named MAb Titl 5 H1.1, using the synthetic peptide N-AVNKYGIGEPLESDSVVAK-C which corresponds to an amino acid sequence in the A-region of the titin molecule as immunogen. In the human skeletal muscles, MAb Titl 5 H1.1 reacts specifically with titin in the A-band of the sarcomere and in different non-muscle cell types with nucleus and cytoplasm, including centrioles. In this report we have studied the evolutionary aspects of the binding of MAb Tit1 5 H1.1 with its target antigen (titin. Results We have specified the epitope area of MAb Tit1 5 H1.1 by subpeptide mapping to the hexapeptide N-AVNKYG-C. According to protein databases this amino acid sequence is located in the COOH-terminus of several different Fn3 domains of the A-region of titin molecule in many organisms, such as human being, mouse, rabbit, zebrafish (Danio rerio, and even in sea squirt (Ciona intestinalis. Our immunohisto- and cytochemical studies with MAb Tit1 5 H1.1 in human, mouse and zebrafish tissues and cell cultures showed a striated staining pattern in muscle cells and also staining of centrioles, cytoplasm and nuclei in non-muscle cells. Conclusions The data confirm that titin can play, in addition to the known roles in striated muscle cells also an important role in non-muscle cells as a centriole associated protein. This phenomenon is highly conserved in the evolution and is related to Fn3 domains of the titin molecule. Using titin A-band-specific monoclonal antibody MAb Tit1 5 H1.1 it was possible to locate titin in the sarcomeres of skeletal muscle cells and in the centrioles, cytoplasm and nuclei of non-muscle cells in phylogenetically so distant organisms as Homo sapiens, Mus musculus and zebrafish (Danio rerio.

  10. Linkage disequilibrium of evolutionarily conserved regions in the human genome

    Directory of Open Access Journals (Sweden)

    Johnson Todd A


    Full Text Available Abstract Background The strong linkage disequilibrium (LD recently found in genic or exonic regions of the human genome demonstrated that LD can be increased by evolutionary mechanisms that select for functionally important loci. This suggests that LD might be stronger in regions conserved among species than in non-conserved regions, since regions exposed to natural selection tend to be conserved. To assess this hypothesis, we used genome-wide polymorphism data from the HapMap project and investigated LD within DNA sequences conserved between the human and mouse genomes. Results Unexpectedly, we observed that LD was significantly weaker in conserved regions than in non-conserved regions. To investigate why, we examined sequence features that may distort the relationship between LD and conserved regions. We found that interspersed repeats, and not other sequence features, were associated with the weak LD tendency in conserved regions. To appropriately understand the relationship between LD and conserved regions, we removed the effect of repetitive elements and found that the high degree of sequence conservation was strongly associated with strong LD in coding regions but not with that in non-coding regions. Conclusion Our work demonstrates that the degree of sequence conservation does not simply increase LD as predicted by the hypothesis. Rather, it implies that purifying selection changes the polymorphic patterns of coding sequences but has little influence on the patterns of functional units such as regulatory elements present in non-coding regions, since the former are generally restricted by the constraint of maintaining a functional protein product across multiple exons while the latter may exist more as individually isolated units.

  11. Effects of preference heterogeneity among landowners on spatial conservation prioritization

    DEFF Research Database (Denmark)

    Nielsen, Anne Sofie Elberg; Strange, Niels; Bruun, Hans Henrik


    The participation of private landowners in conservation is crucial to efficient biodiversity conservation. This is especially the case in settings where the share of private ownership is large and the economic costs associated with land acquisition are high. We used probit regression analysis...... and historical participation data to examine the likelihood of participation of Danish forest owners in a voluntary conservation program. We used the results to spatially predict the likelihood of participation of all forest owners in Denmark. We merged spatial data on the presence of forest, cadastral...... into a spatial prioritization for conservation of unmanaged forests. The choice models are based on sociodemographic data on the entire population of Danish forest owners and historical data on their participation in conservation schemes. Inclusion in the model of information on private landowners' willingness...


    Directory of Open Access Journals (Sweden)

    Arkady Tishkov


    Full Text Available High biodiversity and degree of endemism of mountain biota strengthen the mountain regions’ status for the territorial nature conservation. Analysis of the protected areas’ representativeness in various mountain regions of Russia shows some discrepancy between their quantity, square and regional biodiversity originality. The biggest divergences are marked for the Northern Caucasus. The main problems: small area of the protected territories and also cluster character of their spatial distribution, mostly in the high mountains are not supposed to conform with the highest values of the regional flora’s and fauna’s uniqueness, to compensate representativeness of the protected biota and, in anyway, to correspond with the purpose of nature protection frame—the protected territories ecologic network’s forming. The situation in the Urals, Siberia and the Far East seems to be better. The large areas of the protected territories are in general agreement with the high originality of the nature ecosystems. Nevertheless each concrete case needs analysis of the regional biota’s and ecosystems’ biodiversity distribution within the protected areas, including character and (or unique elements of the regional biodiversity to be held. The development of the effectual territorial conservation of mountain regions needs differential approach. The creation of the large representative parcels of nature landscapes in the key-areas has the considerable meaning in the low-developed regions, difficult to access. And well-developed regions have the necessity of nature protected territories’ network development and the planning of the ecological frame’s forming. The territorial biodiversity conservation, including the system of federal, regional and local levels with protective conservation of the rare species has to be combined with ecosystem’s restoration, especially in the zones disturbed by erosion, recreation and military actions. Also it is

  13. The Conservation of Panel paintings

    DEFF Research Database (Denmark)

    Until the early 17th century almost all portable paintings were created on wood supports, including masterpieces by famous painters, ranging from Giotto to Dürer to Rembrandt. The structural conservation of these paintings requires specific knowledge and skills as the supports are susceptible...... to damage caused by unstable environmental conditions. Unfortunately, past structural interventions often caused significant damage due to insufficient knowledge of the behaviour of the wood panels, glue and paint layers. Over the last fifty years, the field has developed treatment strategies based...... on interdisciplinary collaboration and on the knowledge of specialist conservators. Most current conservation protocols rely on empirical knowledge of conservators and are not necessarily based on a scientific understanding of the nature and behaviour of wood and paint layers. In order to move the field forward...

  14. Operationalizing biodiversity for conservation planning

    Indian Academy of Sciences (India)


    diversity conservation has emerged as a central focus of environmental concern. ..... and temperature (and, sometimes, soil types). For many areas of the world, ..... fauna of Australia (eds) W R Baker and P J M Greensdale. (Adelaide: Peacock ...

  15. Planning, implementing, and monitoring multiple-species habitat conservation plans. (United States)

    Franklin, Janet; Regan, Helen M; Hierl, Lauren A; Deutschman, Douglas H; Johnson, Brenda S; Winchell, Clark S


    Despite numerous recommendations for various aspects of the design and monitoring of habitat conservation plans, there remains a need to synthesize existing guidelines into a comprehensive scheme and apply it to real-world conservation programs. We review tools for systematic conservation planning and elements for designing and implementing ecological monitoring in an adaptive management context. We apply principles of monitoring design to the San Diego Multiple Species Conservation Program (MSCP) in California, USA--one of the first multispecies habitat conservation plans, located in a landscape where high biodiversity and urban development converge. Tools for spatial conservation planning are aimed to conserve biodiversity, often in the context of a limited budget. In practice, these methods may not accommodate legislative mandates, budgetary uncertainties, and the range of implementation mechanisms available across consortia of stakeholders. Once a reserve is implemented, the question becomes whether it is effective at conserving biodiversity, and if not, what actions are required to make it effective. In monitoring plan development, status and threats should be used to prioritize species and communities that require management action to ensure their persistence. Conceptual models documenting the state of knowledge of the system should highlight the main drivers affecting status and trends of species or communities. Monitoring strategies require scientifically justified decisions based on sampling, response, and data design. Because the framework illustrated here tackles multiple species, communities, and threats at the urban-wildland interface, it will have utility for ecosystem managers struggling to design monitoring programs.

  16. Effects of preference heterogeneity among landowners on spatial conservation prioritization. (United States)

    Nielsen, Anne Sofie Elberg; Strange, Niels; Bruun, Hans Henrik; Jacobsen, Jette Bredahl


    The participation of private landowners in conservation is crucial to efficient biodiversity conservation. This is especially the case in settings where the share of private ownership is large and the economic costs associated with land acquisition are high. We used probit regression analysis and historical participation data to examine the likelihood of participation of Danish forest owners in a voluntary conservation program. We used the results to spatially predict the likelihood of participation of all forest owners in Denmark. We merged spatial data on the presence of forest, cadastral information on participation contracts, and individual-level socioeconomic information about the forest owners and their households. We included predicted participation in a probability model for species survival. Uninformed and informed (included land owner characteristics) models were then incorporated into a spatial prioritization for conservation of unmanaged forests. The choice models are based on sociodemographic data on the entire population of Danish forest owners and historical data on their participation in conservation schemes. Inclusion in the model of information on private landowners' willingness to supply land for conservation yielded at intermediate budget levels up to 30% more expected species coverage than the uninformed prioritization scheme. Our landowner-choice model provides an example of moving toward more implementable conservation planning. © 2016 Society for Conservation Biology.

  17. Conservation tillage in organic farming


    PEIGNE, J.; Vedie, H.; DEMEUSY, J.; Gerber, M.; VIAN, J-F.; GAUTRONNEAU, Y.; CANNAVACCUIOLO, M.; Aveline, A.; GITEAU, L.L.; Berry, D.


    Organic farmers are interested in adopting conservation tillage to preserve soil quality and fertility and to prevent soil erosion. Within the framework of a French national study, we compared conventional (ploughing) and conservation tillage systems in organic farming for arable and vegetable cropping systems. Field experiments and on-farm surveys were conducted in several regions of France in order to assess the effects of different tillage systems on soil fertility (physical, chemical, bio...

  18. Linearization of conservative nonlinear oscillators

    Energy Technology Data Exchange (ETDEWEB)

    Belendez, A; Alvarez, M L [Departamento de Fisica, IngenierIa de Sistemas y TeorIa de la Senal, Universidad de Alicante, Apartado 99, E-03080 Alicante (Spain); Fernandez, E; Pascual, I [Departamento de Optica, FarmacologIa y AnatomIa, Universidad de Alicante, Apartado 99, E-03080 Alicante (Spain)], E-mail:


    A linearization method of the nonlinear differential equation for conservative nonlinear oscillators is analysed and discussed. This scheme is based on the Chebyshev series expansion of the restoring force which allows us to obtain a frequency-amplitude relation which is valid not only for small but also for large amplitudes and, sometimes, for the complete range of oscillation amplitudes. Some conservative nonlinear oscillators are analysed to illustrate the usefulness and effectiveness of the technique.

  19. Orchid conservation: making the links. (United States)

    Fay, Michael F; Pailler, Thierry; Dixon, Kingsley W


    Orchidaceae, one of the largest families of flowering plants, present particular challenges for conservation, due in great part to their often complex interactions with mycorrhizal fungi, pollinators and host trees. In this Highlight, we present seven papers focusing on orchids and their interactions and other factors relating to their conservation. © The Author 2015. Published by Oxford University Press on behalf of the Annals of Botany Company. All rights reserved. For Permissions, please email:

  20. 75 FR 34924 - Conservation Stewardship Program (United States)


    ... Commodity Credit Corporation 7 CFR Part 1470 RIN 0578-AA43 Conservation Stewardship Program AGENCY: Commodity Credit Corporation, Natural Resources Conservation Service, United States Department of..., Rulemaking Manager, Natural Resources Conservation Service. BILLING CODE 3410-16-P ...

  1. Successful conservative treatment of chylothorax following ...

    African Journals Online (AJOL)

    Successful conservative treatment of chylothorax following oesophagectomy – a clinical algorithm. ... Design. During a 2-year period, 3 patients developed chylothorax after oesophagectomy. This was treated conservatively, following our departmental protocol. Results. Conservative management (total parenteral nutrition, ...

  2. Conservation genetics of Iberian raptors

    Directory of Open Access Journals (Sweden)

    Martinez–Cruz, B.


    Full Text Available In this paper I provide an overview of conservation genetics and describe the management actions in the wild that can benefit from conservation genetic studies. I describe the genetic factors of risk for the survival of wild species, the consequences of loss of genetic diversity, inbreeding and outbreeding depression, and the use of genetic tools to delimitate units of conservation. Then I introduce the most common applications of conservation genetics in the management of wild populations. In a second part of the paper I review the conservation genetic studies carried on the Iberian raptors. I introduce several studies on the Spanish imperial eagle, the bearded vulture, the black vulture and the red kite that were carried out using autosomal microsatellite markers and mitochondrial DNA (mtDNA sequencing. I describe studies on the lesser kestrel and Egyptian vulture that additionally applied major histocompatibility complex (MHC markers, with the purpose of incorporating the study of non–neutral variation. For every species I explain how these studies can be and/or are applied in the strategy of conservation in the wild.

  3. Energy conservations from an environmental viewpoint

    Energy Technology Data Exchange (ETDEWEB)

    Hijikata, Kunio [Tokyo Inst. of Technology, Ohokayama, Meguroku (Japan)


    It is not incorrect to state that all major environmental problems, such as the greenhouse effect, destruction of the ozone layer from CFC`s, acid rain due to air pollution by NOx and SOx, etc., are caused by excessive industrial and residential energy consumption. Considering the finite world energy resources and limited global space, the day might be already upon us in which the total amount of energy consumption in the world should be reduced. To maintain a high living standard without increasing energy consumption, waste energy recovery and energy conservation are vitally important. In order to effective use of energy resources, we should really know the meaning of the energy consumption and the characteristics of energy resources. In this paper, the technological aspects of energy conservation are stated from the standpoint of available energy.


    Directory of Open Access Journals (Sweden)

    Milota KUSTROVÁ


    Full Text Available Military areas are very valuable sites from the perspective of nature conservation. The article explains the key factors in maintaining high biodiversity in these areas. It discusses the impact of destructive military activities on building and maintaining valuable habitats of European importance and the necessity to preserve these areas for the conservation of natural values for future generations. Extensive reorganization of the armed forces after the Cold War in Europe has resulted in the decommissioning of a large number of military sites from active military use. Ultimately their changed use has a negative impact on biodiversity. This article informs about the existence and importance of a database of military areas in Central and Eastern Europe and the attempt to declare these as protected areas. At the end of the article mentions LIFE+ projects aimed at the protection of nature in military areas, carried out in the countries of Central and Eastern Europe.

  5. Mediterranean seabird conservation: what can we do?

    Directory of Open Access Journals (Sweden)

    Eduardo Mínguez


    Full Text Available Human activities in the Mediterranean determine, to a large extent, the availability of food and breeding sites for seabirds, the two most important ecological requirements for breeding seabirds. Food availability is highly dependent on fisheries activities and the availability of breeding sites is largely related with tourism pressure. Conservation plans necessarily need to incorporate the fact that Mediterranean seabirds and human activities are forced partners. However, solutions are complex because fishing policies are not commonly designed by environmental agencies and also because seabirds are organized in metapopulations which do not coincide with administrative borders. In this monographic volume, several authors describe the main characteristics of the Mediterranean seabird community, identify its conservation problems and suggest a number of technical solutions.

  6. Constructing Conservation Impact: Understanding Monitoring and Evaluation in Conservation NGOs

    Directory of Open Access Journals (Sweden)

    Catherine Benson Wahlén


    Full Text Available A growing number of scholars critically examine large conservation organisations to explore organisational intentions, practices, and outcomes. In parallel, other scholars have problematised audit cultures, suggesting that these seemingly good practices of evaluation and measurement are not neutral and instead have consequences for governance and power. This article combines literature on conservation NGOs, organisational theory, and audit culture to study the inner workings of conservation and to understand the construction of effectiveness and impact. I draw on semi-structured interviews to examine how a large, international conservation organisation, which I term the World Conservation Organisation (WCO; a pseudonym, coordinates monitoring and evaluation (M&E processes among its international, national, and local offices. I find individual staff within WCO make varying assumptions about the M&E policies and place different values on M&E, which results in different institutional logics towards M&E and a broader organisational failure to measure progress and reflect upon outcomes. The findings also show difficulties in translating broad organisational goals into specific project activities, underscoring tensions in implementation and limitations in M&E practice. I also find that organisational and managerial pressure to report success is greater than donor pressure, a finding that expands understandings of NGO-donor dynamics.

  7. In Vivo Characterization of a Vertebrate Ultra-conserved Enhancer

    Energy Technology Data Exchange (ETDEWEB)

    Poulin, Francis; Nobrega, Marcelo A.; Plajzer-Frick, Ingrid; Holt, Amy; Afzal, Veena; Rubin, Edward M.; Pennacchio, Len


    Genomic sequence comparisons between human, mouse and pufferfish (Takifugu rubripes (Fugu))have revealed a set of extremely conserved noncoding sequences. While this high degree of sequence conservation suggests severe evolutionary constraint and predicts a lack of tolerance to change in order to retain in vivo functionality, such elements have been minimally explored experimentally. In this study, we describe the in-depth characterization of an ancient conserved enhancer, Dc2 located near the dachshund gene, which displays a human-Fugu identity of 84 percent over 424 basepairs (bp). In addition to this large overall conservation, we find that Dc2 is characterized by the presence of a large block of sequence (144 bp) that is completely identical between human, mouse, chicken, zebrafish and Fugu. Through the testing of reporter vector constructs in transgenic mice, we observed that the 424 bp Dc2 conserved element is necessary and sufficient for brain tissue enhancer activity. In vivo analyses also revealed that the 144 bp 100 percent conserved sequence is necessary, but not sufficient, to replicate Dc2 enhancer function. However, the introduction of two separate 16 bp insertions into the highly conserved enhancer core did not cause any detectable modification of its in vivo activity. Our observations indicate that the 144 bp 100 percent conserved element is tolerant of change at least at the resolution of this transgenic mouse assay and suggest that purifying selection on Dc2 sequence might not be as strong as we predicted or that some unknown property also constrains this highly conserved enhancer sequence.

  8. Conservation and Role of Electrostatics in Thymidylate Synthase (United States)

    Garg, Divita; Skouloubris, Stephane; Briffotaux, Julien; Myllykallio, Hannu; Wade, Rebecca C.


    Conservation of function across families of orthologous enzymes is generally accompanied by conservation of their active site electrostatic potentials. To study the electrostatic conservation in the highly conserved essential enzyme, thymidylate synthase (TS), we conducted a systematic species-based comparison of the electrostatic potential in the vicinity of its active site. Whereas the electrostatics of the active site of TS are generally well conserved, the TSs from minimal organisms do not conform to the overall trend. Since the genomes of minimal organisms have a high thymidine content compared to other organisms, the observation of non-conserved electrostatics was surprising. Analysis of the symbiotic relationship between minimal organisms and their hosts, and the genetic completeness of the thymidine synthesis pathway suggested that TS from the minimal organism Wigglesworthia glossinidia (W.g.b.) must be active. Four residues in the vicinity of the active site of Escherichia coli TS were mutated individually and simultaneously to mimic the electrostatics of W.g.b TS. The measured activities of the E. coli TS mutants imply that conservation of electrostatics in the region of the active site is important for the activity of TS, and suggest that the W.g.b. TS has the minimal activity necessary to support replication of its reduced genome.

  9. Spontaneous coronary artery dissection: revascularization versus conservative therapy. (United States)

    Tweet, Marysia S; Eleid, Mackram F; Best, Patricia J M; Lennon, Ryan J; Lerman, Amir; Rihal, Charanjit S; Holmes, David R; Hayes, Sharonne N; Gulati, Rajiv


    Spontaneous coronary artery dissection (SCAD) is a nonatherosclerotic acute coronary syndrome for which optimal management remains undefined. We performed a retrospective study of 189 patients presenting with a first SCAD episode. We evaluated outcomes according to initial management: (1) revascularization versus conservative therapy and (2) percutaneous coronary intervention (PCI) versus conservative therapy stratified by vessel flow at presentation. Demographics were similar in revascularization versus conservative (mean age, 44±9 years; women 92% both groups), but vessel occlusion was more frequent in revascularization (44/95 versus 18/94). There was 1 in-hospital death (revascularization) and 1 late death (conservative). Procedural failure rate was 53% in those managed with PCI. In the subgroup of patients presenting with preserved vessel flow, rates of PCI failure were similarly high (50%), and 6 (13%) required emergency coronary artery bypass grafting. In the conservative group, 85 of 94 (90%) had an uneventful in-hospital course, but 9 (10%) experienced early SCAD progression requiring revascularization. Kaplan-Meier estimated 5-year rates of target vessel revascularization and recurrent SCAD were no different in revascularization versus conservative therapy (30% versus 19%; P=0.06 and 23% versus 31%; P=0.7). PCI for SCAD is associated with high rates of technical failure even in those presenting with preserved vessel flow and does not protect against target vessel revascularization or recurrent SCAD. A strategy of conservative management with prolonged observation may be preferable. © 2014 American Heart Association, Inc.

  10. Conservation and Role of Electrostatics in Thymidylate Synthase. (United States)

    Garg, Divita; Skouloubris, Stephane; Briffotaux, Julien; Myllykallio, Hannu; Wade, Rebecca C


    Conservation of function across families of orthologous enzymes is generally accompanied by conservation of their active site electrostatic potentials. To study the electrostatic conservation in the highly conserved essential enzyme, thymidylate synthase (TS), we conducted a systematic species-based comparison of the electrostatic potential in the vicinity of its active site. Whereas the electrostatics of the active site of TS are generally well conserved, the TSs from minimal organisms do not conform to the overall trend. Since the genomes of minimal organisms have a high thymidine content compared to other organisms, the observation of non-conserved electrostatics was surprising. Analysis of the symbiotic relationship between minimal organisms and their hosts, and the genetic completeness of the thymidine synthesis pathway suggested that TS from the minimal organism Wigglesworthia glossinidia (W.g.b.) must be active. Four residues in the vicinity of the active site of Escherichia coli TS were mutated individually and simultaneously to mimic the electrostatics of W.g.b TS. The measured activities of the E. coli TS mutants imply that conservation of electrostatics in the region of the active site is important for the activity of TS, and suggest that the W.g.b. TS has the minimal activity necessary to support replication of its reduced genome.

  11. Domain architecture conservation in orthologs. (United States)

    Forslund, Kristoffer; Pekkari, Isabella; Sonnhammer, Erik L L


    As orthologous proteins are expected to retain function more often than other homologs, they are often used for functional annotation transfer between species. However, ortholog identification methods do not take into account changes in domain architecture, which are likely to modify a protein's function. By domain architecture we refer to the sequential arrangement of domains along a protein sequence.To assess the level of domain architecture conservation among orthologs, we carried out a large-scale study of such events between human and 40 other species spanning the entire evolutionary range. We designed a score to measure domain architecture similarity and used it to analyze differences in domain architecture conservation between orthologs and paralogs relative to the conservation of primary sequence. We also statistically characterized the extents of different types of domain swapping events across pairs of orthologs and paralogs. The analysis shows that orthologs exhibit greater domain architecture conservation than paralogous homologs, even when differences in average sequence divergence are compensated for, for homologs that have diverged beyond a certain threshold. We interpret this as an indication of a stronger selective pressure on orthologs than paralogs to retain the domain architecture required for the proteins to perform a specific function. In general, orthologs as well as the closest paralogous homologs have very similar domain architectures, even at large evolutionary separation.The most common domain architecture changes observed in both ortholog and paralog pairs involved insertion/deletion of new domains, while domain shuffling and segment duplication/deletion were very infrequent. On the whole, our results support the hypothesis that function conservation between orthologs demands higher domain architecture conservation than other types of homologs, relative to primary sequence conservation. This supports the notion that orthologs are

  12. Water Conservation and Water Storage (United States)

    Narayanan, M.


    Water storage can be a viable part of the solution to water conservation. This means that we should include reservoirs. Regardless, one should evaluate all aspects of water conservation principles. Recent drought in California indicates that there is an urgent need to re-visit the techniques used to maintain the water supply-chain mechanism in the entire state. We all recognize the fact that fish and wildlife depend on the streams, rivers and wetlands for survival. It is a well-known fact that there is an immediate need to provide solid protection to all these resources. Laws and regulations should help meet the needs of natural systems. Farmers may be forced to drilling wells deeper than ever. But, they will be eventually depleting groundwater reserves. Needless to say that birds, fish and wildlife cannot access these groundwater table. California is talking a lot about conservation. Unfortunately, the conservation efforts have not established a strong visible hold. The Environmental Protection Agency has a plan called E2PLAN (Narayanan, 2012). It is EPA's plan for achieving energy and environmental performance, leadership, accountability, and carbon neutrality. In June 2011, the EPA published a comprehensive, multi-year planning document called Strategic Sustainability Performance Plan. The author has previously reported these in detail at the 2012 AGU fall meeting. References: Ziegler, Jay (15 JUNE 2014). The Conversation: Water conservation efforts aren't taking hold, but there are encouraging signs. THE SACRAMENTO BEE. California. Narayanan, Mysore. (2012). The Importance of Water Conservation in the 21st Century. 72nd AGU International Conference. Eos Transactions: American Geophysical Union, Vol. 92, No. 56, Fall Meeting Supplement, 2012. H31I - 1255.

  13. Domain architecture conservation in orthologs (United States)


    Background As orthologous proteins are expected to retain function more often than other homologs, they are often used for functional annotation transfer between species. However, ortholog identification methods do not take into account changes in domain architecture, which are likely to modify a protein's function. By domain architecture we refer to the sequential arrangement of domains along a protein sequence. To assess the level of domain architecture conservation among orthologs, we carried out a large-scale study of such events between human and 40 other species spanning the entire evolutionary range. We designed a score to measure domain architecture similarity and used it to analyze differences in domain architecture conservation between orthologs and paralogs relative to the conservation of primary sequence. We also statistically characterized the extents of different types of domain swapping events across pairs of orthologs and paralogs. Results The analysis shows that orthologs exhibit greater domain architecture conservation than paralogous homologs, even when differences in average sequence divergence are compensated for, for homologs that have diverged beyond a certain threshold. We interpret this as an indication of a stronger selective pressure on orthologs than paralogs to retain the domain architecture required for the proteins to perform a specific function. In general, orthologs as well as the closest paralogous homologs have very similar domain architectures, even at large evolutionary separation. The most common domain architecture changes observed in both ortholog and paralog pairs involved insertion/deletion of new domains, while domain shuffling and segment duplication/deletion were very infrequent. Conclusions On the whole, our results support the hypothesis that function conservation between orthologs demands higher domain architecture conservation than other types of homologs, relative to primary sequence conservation. This supports the

  14. The Value of Forest Conservation for Water Quality Protection

    Directory of Open Access Journals (Sweden)

    Melissa M. Kreye


    Full Text Available Forests protect water quality by reducing soil erosion, sedimentation, and pollution; yet there is little information about the economic value of conserving forests for water quality protection in much of the United States. To assess this value, we conducted a meta-analysis of willingness-to-pay (WTP for protecting unimpaired waters, and econometrically determined several significant drivers of WTP: type of conservation instrument (tool, aquatic resource type, geographic context, spatial scale, time, and household income. Using a benefit transfer to two highly forested sites, we illustrate the importance of these factors on WTP for water quality protection programs, forest conservation and policy design.

  15. Conservation issues: California chaparral (United States)

    Halsey, Richard W.; Keeley, Jon E.


    California chaparral, a sclerophyllous shrub-dominated plant community shaped by a Mediterranean-type climate and infrequent, high-intensity fire, is one of the most biodiverse and threatened habitats on Earth. Distinct forms of chaparral, distinguished by differing species composition, geography, and edaphic characteristics, can cover thousands of hectares with dense vegetation or be restricted to smaller communities identified by the presence of endemic species. To maintain the biodiversity of chaparral, protective land management actions will be required to mitigate the loss due to the impacts of human population growth, development, climate change, and increased fire frequencies.

  16. Conservation and functional element discovery in 20 angiosperm plant genomes. (United States)

    Hupalo, Daniel; Kern, Andrew D


    Here, we describe the construction of a phylogenetically deep, whole-genome alignment of 20 flowering plants, along with an analysis of plant genome conservation. Each included angiosperm genome was aligned to a reference genome, Arabidopsis thaliana, using the LASTZ/MULTIZ paradigm and tools from the University of California-Santa Cruz Genome Browser source code. In addition to the multiple alignment, we created a local genome browser displaying multiple tracks of newly generated genome annotation, as well as annotation sourced from published data of other research groups. An investigation into A. thaliana gene features present in the aligned A. lyrata genome revealed better conservation of start codons, stop codons, and splice sites within our alignments (51% of features from A. thaliana conserved without interruption in A. lyrata) when compared with previous publicly available plant pairwise alignments (34% of features conserved). The detailed view of conservation across angiosperms revealed not only high coding-sequence conservation but also a large set of previously uncharacterized intergenic conservation. From this, we annotated the collection of conserved features, revealing dozens of putative noncoding RNAs, including some with recorded small RNA expression. Comparing conservation between kingdoms revealed a faster decay of vertebrate genome features when compared with angiosperm genomes. Finally, conserved sequences were searched for folding RNA features, including but not limited to noncoding RNA (ncRNA) genes. Among these, we highlight a double hairpin in the 5'-untranslated region (5'-UTR) of the PRIN2 gene and a putative ncRNA with homology targeting the LAF3 protein.

  17. Conservation and diversification of Msx protein in metazoan evolution. (United States)

    Takahashi, Hirokazu; Kamiya, Akiko; Ishiguro, Akira; Suzuki, Atsushi C; Saitou, Naruya; Toyoda, Atsushi; Aruga, Jun


    Msx (/msh) family genes encode homeodomain (HD) proteins that control ontogeny in many animal species. We compared the structures of Msx genes from a wide range of Metazoa (Porifera, Cnidaria, Nematoda, Arthropoda, Tardigrada, Platyhelminthes, Mollusca, Brachiopoda, Annelida, Echiura, Echinodermata, Hemichordata, and Chordata) to gain an understanding of the role of these genes in phylogeny. Exon-intron boundary analysis suggested that the position of the intron located N-terminally to the HDs was widely conserved in all the genes examined, including those of cnidarians. Amino acid (aa) sequence comparison revealed 3 new evolutionarily conserved domains, as well as very strong conservation of the HDs. Two of the three domains were associated with Groucho-like protein binding in both a vertebrate and a cnidarian Msx homolog, suggesting that the interaction between Groucho-like proteins and Msx proteins was established in eumetazoan ancestors. Pairwise comparison among the collected HDs and their C-flanking aa sequences revealed that the degree of sequence conservation varied depending on the animal taxa from which the sequences were derived. Highly conserved Msx genes were identified in the Vertebrata, Cephalochordata, Hemichordata, Echinodermata, Mollusca, Brachiopoda, and Anthozoa. The wide distribution of the conserved sequences in the animal phylogenetic tree suggested that metazoan ancestors had already acquired a set of conserved domains of the current Msx family genes. Interestingly, although strongly conserved sequences were recovered from the Vertebrata, Cephalochordata, and Anthozoa, the sequences from the Urochordata and Hydrozoa showed weak conservation. Because the Vertebrata-Cephalochordata-Urochordata and Anthozoa-Hydrozoa represent sister groups in the Chordata and Cnidaria, respectively, Msx sequence diversification may have occurred differentially in the course of evolution. We speculate that selective loss of the conserved domains in Msx family

  18. Decentralizing conservation and diversifying livelihoods within Kanchenjunga Conservation Area, Nepal. (United States)

    Parker, Pete; Thapa, Brijesh; Jacob, Aerin


    To alleviate poverty and enhance conservation in resource dependent communities, managers must identify existing livelihood strategies and the associated factors that impede household access to livelihood assets. Researchers increasingly advocate reallocating management power from exclusionary central institutions to a decentralized system of management based on local and inclusive participation. However, it is yet to be shown if decentralizing conservation leads to diversified livelihoods within a protected area. The purpose of this study was to identify and assess factors affecting household livelihood diversification within Nepal's Kanchenjunga Conservation Area Project, the first protected area in Asia to decentralize conservation. We randomly surveyed 25% of Kanchenjunga households to assess household socioeconomic and demographic characteristics and access to livelihood assets. We used a cluster analysis with the ten most common income generating activities (both on- and off-farm) to group the strategies households use to diversify livelihoods, and a multinomial logistic regression to identify predictors of livelihood diversification. We found four distinct groups of household livelihood strategies with a range of diversification that directly corresponded to household income. The predictors of livelihood diversification were more related to pre-existing socioeconomic and demographic factors (e.g., more landholdings and livestock, fewer dependents, receiving remittances) than activities sponsored by decentralizing conservation (e.g., microcredit, training, education, interaction with project staff). Taken together, our findings indicate that without direct policies to target marginalized groups, decentralized conservation in Kanchenjunga will continue to exclude marginalized groups, limiting a household's ability to diversify their livelihood and perpetuating their dependence on natural resources. Copyright © 2015 Elsevier Ltd. All rights reserved.

  19. Violations of conservation laws in viscous liquid dynamics

    DEFF Research Database (Denmark)

    Dyre, Jeppe


    The laws expressing conservation of momentum and energy apply to any isolated system, but these laws are violated for highly viscous liquids under laboratory conditions because of the unavoidable interactions with the measuring equipment over the long times needed to study the dynamics. Moreover,......, although particle number conservation applies strictly for any liquid, the solidity of viscous liquids implies that even this conservation law is apparently violated in coarse-grained descriptions of density fluctuations.......The laws expressing conservation of momentum and energy apply to any isolated system, but these laws are violated for highly viscous liquids under laboratory conditions because of the unavoidable interactions with the measuring equipment over the long times needed to study the dynamics. Moreover...

  20. Conservation needs of amphibians in China: a review. (United States)

    Xie, Feng; Lau, Michael Wai Neng; Stuart, Simon N; Chanson, Janice S; Cox, Neil A; Fischman, Debra L


    The conservation status of all the amphibians in China is analyzed, and the country is shown to be a global priority for conservation in comparison to many other countries of the world. Three Chinese regions are particularly rich in amphibian diversity: Hengduan, Nanling, and Wuyi mountains. Salamanders are more threatened than frogs and toads. Several smaller families show a high propensity to become seriously threatened: Bombinatoridae, Cryptobranchidae, Hynobiidae and Salamandridae. Like other parts of the world, stream-breeding, high-elevation forest amphibians have a much higher likelihood of being seriously threatened. Habitat loss, pollution, and over-harvesting are the most serious threats to Chinese amphibians. Over-harvesting is a less pervasive threat than habitat loss, but it is more likely to drive a species into rapid decline. Five conservation challenges are mentioned with recommendations for the highest priority research and conservation actions.

  1. Animal conservation, carbon and sustainability. (United States)

    Leader-Williams, N


    International conventions to reduce carbon dioxide levels focus on ecosystems and do not specifically recognize the need to conserve species. However, species are the building blocks of ecosystems, they are more widely understood among the public, and they provide means of capturing market values from ecosystems. Achieving successful conservation globally will require ensuring that the systems under which species and ecosystems are conserved are more inclusive than statutory protected areas. Equal emphasis needs to be placed on including effective regimes that also encompass private and communal ownership through incentive-based approaches. Nevertheless, if globalized industries such as nature-based tourism or consumptive use are to provide meaningful incentives locally, a key requirement is to reduce leakage of revenue that is earned as a result of conserving species, such that local development concerns are addressed. However, current biodiversity conventions that address these needs are largely aspirational, while globalized industries such as tourism mainly promote their green credentials only through voluntary codes of conduct. Greatly improved linkages are needed between international conservation concerns and ensuring effective solutions to sustainability, which inevitably rest at national and sub-national levels, through systems of rights, tenure, benefits and incentives.

  2. Restricted-range fishes and the conservation of Brazilian freshwaters.

    Directory of Open Access Journals (Sweden)

    Cristiano Nogueira

    Full Text Available BACKGROUND: Freshwaters are the most threatened ecosystems on earth. Although recent assessments provide data on global priority regions for freshwater conservation, local scale priorities remain unknown. Refining the scale of global biodiversity assessments (both at terrestrial and freshwater realms and translating these into conservation priorities on the ground remains a major challenge to biodiversity science, and depends directly on species occurrence data of high taxonomic and geographic resolution. Brazil harbors the richest freshwater ichthyofauna in the world, but knowledge on endemic areas and conservation in Brazilian rivers is still scarce. METHODOLOGY/PRINCIPAL FINDINGS: Using data on environmental threats and revised species distribution data we detect and delineate 540 small watershed areas harboring 819 restricted-range fishes in Brazil. Many of these areas are already highly threatened, as 159 (29% watersheds have lost more than 70% of their original vegetation cover, and only 141 (26% show significant overlap with formally protected areas or indigenous lands. We detected 220 (40% critical watersheds overlapping hydroelectric dams or showing both poor formal protection and widespread habitat loss; these sites harbor 344 endemic fish species that may face extinction if no conservation action is in place in the near future. CONCLUSIONS/SIGNIFICANCE: We provide the first analysis of site-scale conservation priorities in the richest freshwater ecosystems of the globe. Our results corroborate the hypothesis that freshwater biodiversity has been neglected in former conservation assessments. The study provides a simple and straightforward method for detecting freshwater priority areas based on endemism and threat, and represents a starting point for integrating freshwater and terrestrial conservation in representative and biogeographically consistent site-scale conservation strategies, that may be scaled-up following naturally linked



    Babita Sengwar


    Conservation is the proper management of natural resources to prevent its exploitation, destruction or degradation. India is blessed with natural resources but these resources from our research study on the usage of natural resources are depleting every day. As we know nature provides all the basic needs which are necessary to us but we are over exploiting or over using these resources. Conservation of natural resources has acquired great attention at present. It is high time that man must re...

  4. Effectiveness of Two Water Conservation Policies: An Integrated Modeling Approach


    Das, Biswa R.; Willis, David B.; Johnson, Jeffrey W.


    Agriculture in the Texas High Plains depends entirely on the Ogallala Aquifer. Texas enacted water conservation legislation to address declining reserves in the aquifer. We developed an integrated regional water policy model that links a hydrology model with an economic optimization model to estimate policy impacts with respect to economic cost and water conservation. Testing the effectiveness of two policies, a groundwater extraction tax and extraction quotas, we observe that neither signifi...

  5. Parity and time-reversal non-conservation in atoms

    Energy Technology Data Exchange (ETDEWEB)

    Lynn, B.W.


    We examine the implications of parity and time-reversal non-conservation for atomic physics. We conclude that a determination of Q/sub W//N to 10% would give an indirect determination of M/sub Z/ competitive with that available from high-energy physics, limits on the electric dipole moments of neutrons and electrons give non-trivial constraints on model building of CP non-conservation.

  6. Can conservation funding be left to carbon finance?


    Ravikumar, Ashwin; Larjavaara, Markku; Larson, Anne; Kanninen, Markku


    Revenues derived from carbon have been seen as an important tool for supporting forest conservation over the past decade. At the same time, there is high uncertainty about how much revenue can reasonably be expected from land use emissions reductions initiatives. Despite this uncertainty, REDD+ projects and conservation initiatives that aim to take advantage of available or, more commonly, future funding from carbon markets have proliferated. This study used participatory multi-stakeholder wo...

  7. Dynamic conservation for migratory species (United States)

    Reynolds, Mark D.; Sullivan, Brian L.; Hallstein, Eric; Matsumoto, Sandra; Kelling, Steve; Merrifield, Matthew; Fink, Daniel; Johnston, Alison; Hochachka, Wesley M.; Bruns, Nicholas E.; Reiter, Matthew E.; Veloz, Sam; Hickey, Catherine; Elliott, Nathan; Martin, Leslie; Fitzpatrick, John W.; Spraycar, Paul; Golet, Gregory H.; McColl, Christopher; Morrison, Scott A.


    In an era of unprecedented and rapid global change, dynamic conservation strategies that tailor the delivery of habitat to when and where it is most needed can be critical for the persistence of species, especially those with diverse and dispersed habitat requirements. We demonstrate the effectiveness of such a strategy for migratory waterbirds. We analyzed citizen science and satellite data to develop predictive models of bird populations and the availability of wetlands, which we used to determine temporal and spatial gaps in habitat during a vital stage of the annual migration. We then filled those gaps using a reverse auction marketplace to incent qualifying landowners to create temporary wetlands on their properties. This approach is a cost-effective way of adaptively meeting habitat needs for migratory species, optimizes conservation outcomes relative to investment, and can be applied broadly to other conservation challenges. PMID:28845449

  8. Improving Water Quality With Conservation Buffers (United States)

    Lowrance, R.; Dabney, S.; Schultz, R.


    Conservation buffer technologies are new approaches that need wider application. In-field buffer practices work best when used in combination with other buffer types and other conservation practices. Vegetative barriers may be used in combination with edge-of-field buffers to protect and improve their function and longevity by dispersing runoff and encouraging sediment deposition upslope of the buffer. It's important to understand how buffers can be managed to help reduce nutrient transport potential for high loading of nutrients from manure land application sites, A restored riparian wetland buffer retained or removed at least 59 percent of the nitrogen and 66 percent of the phosphorus that entered from an adjacent manure land application site. The Bear Creek National Restoration Demonstration Watershed project in Iowa has been the site of riparian forest buffers and filter strips creation; constructed wetlands to capture tile flow; stream-bank bioengineering; in-stream structures; and controlling livestock grazing. We need field studies that test various widths of buffers of different plant community compositions for their efficacy in trapping surface runoff, reducing nonpoint source pollutants in subsurface waters, and enhancing the aquatic ecosystem. Research is needed to evaluate the impact of different riparian grazing strategies on channel morphology, water quality, and the fate of livestock-associated pathogens and antibiotics. Integrating riparian buffers and other conservation buffers into these models is a key objective in future model development.

  9. Evolutionarily conserved herpesviral protein interaction networks.

    Directory of Open Access Journals (Sweden)

    Even Fossum


    Full Text Available Herpesviruses constitute a family of large DNA viruses widely spread in vertebrates and causing a variety of different diseases. They possess dsDNA genomes ranging from 120 to 240 kbp encoding between 70 to 170 open reading frames. We previously reported the protein interaction networks of two herpesviruses, varicella-zoster virus (VZV and Kaposi's sarcoma-associated herpesvirus (KSHV. In this study, we systematically tested three additional herpesvirus species, herpes simplex virus 1 (HSV-1, murine cytomegalovirus and Epstein-Barr virus, for protein interactions in order to be able to perform a comparative analysis of all three herpesvirus subfamilies. We identified 735 interactions by genome-wide yeast-two-hybrid screens (Y2H, and, together with the interactomes of VZV and KSHV, included a total of 1,007 intraviral protein interactions in the analysis. Whereas a large number of interactions have not been reported previously, we were able to identify a core set of highly conserved protein interactions, like the interaction between HSV-1 UL33 with the nuclear egress proteins UL31/UL34. Interactions were conserved between orthologous proteins despite generally low sequence similarity, suggesting that function may be more conserved than sequence. By combining interactomes of different species we were able to systematically address the low coverage of the Y2H system and to extract biologically relevant interactions which were not evident from single species.

  10. Phylogenetically-Informed Priorities for Amphibian Conservation (United States)

    Isaac, Nick J. B.; Redding, David W.; Meredith, Helen M.; Safi, Kamran


    The amphibian decline and extinction crisis demands urgent action to prevent further large numbers of species extinctions. Lists of priority species for conservation, based on a combination of species’ threat status and unique contribution to phylogenetic diversity, are one tool for the direction and catalyzation of conservation action. We describe the construction of a near-complete species-level phylogeny of 5713 amphibian species, which we use to create a list of evolutionarily distinct and globally endangered species (EDGE list) for the entire class Amphibia. We present sensitivity analyses to test the robustness of our priority list to uncertainty in species’ phylogenetic position and threat status. We find that both sources of uncertainty have only minor impacts on our ‘top 100‘ list of priority species, indicating the robustness of the approach. By contrast, our analyses suggest that a large number of Data Deficient species are likely to be high priorities for conservation action from the perspective of their contribution to the evolutionary history. PMID:22952807

  11. Global conservation priorities for crop wild relatives. (United States)

    Castañeda-Álvarez, Nora P; Khoury, Colin K; Achicanoy, Harold A; Bernau, Vivian; Dempewolf, Hannes; Eastwood, Ruth J; Guarino, Luigi; Harker, Ruth H; Jarvis, Andy; Maxted, Nigel; Müller, Jonas V; Ramirez-Villegas, Julian; Sosa, Chrystian C; Struik, Paul C; Vincent, Holly; Toll, Jane


    The wild relatives of domesticated crops possess genetic diversity useful for developing more productive, nutritious and resilient crop varieties. However, their conservation status and availability for utilization are a concern, and have not been quantified globally. Here, we model the global distribution of 1,076 taxa related to 81 crops, using occurrence information collected from biodiversity, herbarium and gene bank databases. We compare the potential geographic and ecological diversity encompassed in these distributions with that currently accessible in gene banks, as a means to estimate the comprehensiveness of the conservation of genetic diversity. Our results indicate that the diversity of crop wild relatives is poorly represented in gene banks. For 313 (29.1% of total) taxa associated with 63 crops, no germplasm accessions exist, and a further 257 (23.9%) are represented by fewer than ten accessions. Over 70% of taxa are identified as high priority for further collecting in order to improve their representation in gene banks, and over 95% are insufficiently represented in regard to the full range of geographic and ecological variation in their native distributions. The most critical collecting gaps occur in the Mediterranean and the Near East, western and southern Europe, Southeast and East Asia, and South America. We conclude that a systematic effort is needed to improve the conservation and availability of crop wild relatives for use in plant breeding.

  12. Equity trade-offs in conservation decision making. (United States)

    Law, Elizabeth A; Bennett, Nathan J; Ives, Christopher D; Friedman, Rachel; Davis, Katrina J; Archibald, Carla; Wilson, Kerrie A


    Conservation decisions increasingly involve multiple environmental and social objectives, which result in complex decision contexts with high potential for trade-offs. Improving social equity is one such objective that is often considered an enabler of successful outcomes and a virtuous ideal in itself. Despite its idealized importance in conservation policy, social equity is often highly simplified or ill-defined and is applied uncritically. What constitutes equitable outcomes and processes is highly normative and subject to ethical deliberation. Different ethical frameworks may lead to different conceptions of equity through alternative perspectives of what is good or right. This can lead to different and potentially conflicting equity objectives in practice. We promote a more transparent, nuanced, and pluralistic conceptualization of equity in conservation decision making that particularly recognizes where multidimensional equity objectives may conflict. To help identify and mitigate ethical conflicts and avoid cases of good intentions producing bad outcomes, we encourage a more analytical incorporation of equity into conservation decision making particularly during mechanistic integration of equity objectives. We recommend that in conservation planning motivations and objectives for equity be made explicit within the problem context, methods used to incorporate equity objectives be applied with respect to stated objectives, and, should objectives dictate, evaluation of equity outcomes and adaptation of strategies be employed during policy implementation. © 2017 Society for Conservation Biology.

  13. 7 CFR 631.9 - Conservation plan. (United States)


    ... 7 Agriculture 6 2010-01-01 2010-01-01 false Conservation plan. 631.9 Section 631.9 Agriculture Regulations of the Department of Agriculture (Continued) NATURAL RESOURCES CONSERVATION SERVICE, DEPARTMENT OF AGRICULTURE LONG TERM CONTRACTING GREAT PLAINS CONSERVATION PROGRAM General Provisions § 631.9 Conservation...

  14. 77 FR 15933 - Conservation Loan Program (United States)


    ... Agency (FSA) implemented the new Conservation Loan (CL) Program authorized by the Food, Conservation, and... the conservation plan demonstrate NRCS Field Office Technical Guide quality criteria for at least... Farm Service Agency 7 CFR Parts 761, 762, 764, 765, and 766 RIN 0560-AI04 Conservation Loan Program...

  15. Developing conservation agriculture in the Philippines


    Mercado, Agustin R., Jr.; Reyes, Manuel R.; Ella, Victor B.


    This presentation describes the implementation of Conservation Agriculture production practices in Claveria, Misamis, Philippines, as well as its impacts on soil conservation and marketable produce yields. This research was conducted by the SANREM CRSP Long Term Research Activity 12, Conservation agriculture for food security in Cambodia and the Philippines. LTRA-12 (Conservation agriculture for food security in Cambodia and the Philippines)

  16. 43 CFR 427.1 - Water conservation. (United States)


    ... 43 Public Lands: Interior 1 2010-10-01 2010-10-01 false Water conservation. 427.1 Section 427.1... INTERIOR WATER CONSERVATION RULES AND REGULATIONS § 427.1 Water conservation. (a) In general. The Secretary shall encourage the full consideration and incorporation of prudent and responsible water conservation...

  17. Incorporating seascape connectivity in conservation prioritisation (United States)


    In conservation prioritisation, it is often implicit that representation targets for individual habitat types act as surrogates for the species that inhabit them. Yet for many commercially and ecologically important coral reef fish species, connectivity among different habitats in a seascape may be more important than any single habitat alone. Approaches to conservation prioritisation that consider seascape connectivity are thus warranted. I demonstrate an approach that can be implemented within a relatively data-poor context, using widely available conservation planning software. Based on clearly stated assumptions regarding species’ habitat usage and movement ability, this approach can be adapted to different focal species and contexts, or refined as further data become available. I first derive a seascape connectivity metric based on area-weighted proximity between juvenile and adult habitat patches, and then apply this during spatial prioritisation using the decision-support software Marxan. Using a case study from Micronesia, I present two applications: first, to inform prioritisation for a network of marine protected areas to achieve regional objectives for habitat representation; and second, to identify nursery habitat patches that are most likely to supply juveniles to adult populations on reefs within existing protected areas. Incorporating seascape connectivity in conservation prioritisation highlights areas where small marine protected areas placed on coral reefs might benefit from proximity to other habitats in the seascape, and thus be more effective. Within the context of community tenure over resources, identification of critical nursery habitats to improve the effectiveness of existing marine protected areas indicates where collaboration across community boundaries might be required. Outputs from these analyses are likely to be most useful in regions where management is highly decentralised, imposing spatial constraints on the size of individual

  18. Conservative Management of Hip Dysplasia. (United States)

    Harper, Tisha A M


    Hip dysplasia (HD) is a common orthopedic condition seen in small animal patients that leads to osteoarthritis of the coxofemoral joint. The disease can be managed conservatively or surgically. The goals of surgical treatment in the immature patient are to either prevent the clinical signs of HD or to prevent or slow the progression of osteoarthritis. In mature patients surgery is used as a salvage procedure to treat debilitating osteoarthritis. Conservative management can be used in dogs with mild or intermittent clinical signs and includes nutritional management and weight control, exercise modification, physical rehabilitation, pain management and disease-modifying agents. Copyright © 2017 Elsevier Inc. All rights reserved.

  19. Animal models and conserved processes

    Directory of Open Access Journals (Sweden)

    Greek Ray


    Full Text Available Abstract Background The concept of conserved processes presents unique opportunities for using nonhuman animal models in biomedical research. However, the concept must be examined in the context that humans and nonhuman animals are evolved, complex, adaptive systems. Given that nonhuman animals are examples of living systems that are differently complex from humans, what does the existence of a conserved gene or process imply for inter-species extrapolation? Methods We surveyed the literature including philosophy of science, biological complexity, conserved processes, evolutionary biology, comparative medicine, anti-neoplastic agents, inhalational anesthetics, and drug development journals in order to determine the value of nonhuman animal models when studying conserved processes. Results Evolution through natural selection has employed components and processes both to produce the same outcomes among species but also to generate different functions and traits. Many genes and processes are conserved, but new combinations of these processes or different regulation of the genes involved in these processes have resulted in unique organisms. Further, there is a hierarchy of organization in complex living systems. At some levels, the components are simple systems that can be analyzed by mathematics or the physical sciences, while at other levels the system cannot be fully analyzed by reducing it to a physical system. The study of complex living systems must alternate between focusing on the parts and examining the intact whole organism while taking into account the connections between the two. Systems biology aims for this holism. We examined the actions of inhalational anesthetic agents and anti-neoplastic agents in order to address what the characteristics of complex living systems imply for inter-species extrapolation of traits and responses related to conserved processes. Conclusion We conclude that even the presence of conserved processes is

  20. Conservation laws and LETKF with 2D Shallow Water Model (United States)

    Zeng, Yuefei; Janjic, Tijana


    Numerous approaches have been proposed to maintain physical conservation laws in the numerical weather prediction models. However, to achieve a reliable prediction, adequate initial conditions are also necessary, which are produced by a data assimilation algorithm. If an ensemble Kalman filters (EnKF) is used for this purpose, it has been shown that it could yield unphysical analysis ensemble that for example violates principles of mass conservation and positivity preservation (e.g. Janjic et al 2014) . In this presentation, we discuss the selection of conservation criteria for the analysis step, and start with testing the conservation of mass, energy and enstrophy. The simple experiments deal with nonlinear shallow water equations and simulated observations that are assimilated with LETKF (Localized Ensemble Transform Kalman Filter, Hunt et al. 2007). The model is discretized in a specific way to conserve mass, angular momentum, energy and enstrophy. The effects of the data assimilation on the conserved quantities (of mass, energy and enstrophy) depend on observation covarage, localization radius, observed variable and observation operator. Having in mind that Arakawa (1966) and Arakawa and Lamb (1977) showed that the conservation of both kinetic energy and enstrophy by momentum advection schemes in the case of nondivergent flow prevents systematic and unrealistic energy cascade towards high wave numbers, a cause of excessive numerical noise and possible eventual nonlinear instability, we test the effects on prediction depending on the type of errors in the initial condition. The performance with respect to nonlinear energy cascade is assessed as well.

  1. Effectiveness of amphibians as biodiversity surrogates in pond conservation. (United States)

    Ilg, Christiane; Oertli, Beat


    Amphibian decline has led to worldwide conservation efforts, including the identification and designation of sites for their protection. These sites could also play an important role in the conservation of other freshwater taxa. In 89 ponds in Switzerland, we assessed the effectiveness of amphibians as a surrogate for 4 taxonomic groups that occur in the same freshwater ecosystems as amphibians: dragonflies, aquatic beetles, aquatic gastropods, and aquatic plants. The ponds were all of high value for amphibian conservation. Cross-taxon correlations were tested for species richness and conservation value, and Mantel tests were used to investigate community congruence. Species richness, conservation value, and community composition of amphibians were weakly congruent with these measures for the other taxonomic groups. Paired comparisons for the 5 groups considered showed that for each metric, amphibians had the lowest degree of congruence. Our results imply that site designation for amphibian conservation will not necessarily provide protection for freshwater biodiversity as a whole. To provide adequate protection for freshwater species, we recommend other taxonomic groups be considered in addition to amphibians in the prioritization and site designation process. © 2016 Society for Conservation Biology.

  2. Local ensemble assimilation scheme with global constraints and conservation (United States)

    Barth, Alexander; Yan, Yajing; Alvera-Azcárate, Aida; Beckers, Jean-Marie


    Ensemble assimilation schemes applied in their original, global formulation respect linear conservation properties if the ensemble perturbations are set up accordingly. For realistic ocean systems, only a relatively small number of ensemble members can be calculated. A localization of the ensemble increment is therefore necessary to filter out spurious long-range correlations. The conservation of the global properties will be lost if the assimilation is performed locally, since the conservation requires a coupling between all model grid points which is removed by the localization. The distribution of ocean observations is often highly inhomogeneous. Systematic errors of the observed parts of the ocean state can lead to spurious adjustment of the non-observed parts via data assimilation and thus to a spurious increase or decrease in long-term simulations of global properties which should be conserved. In this paper, we propose a local assimilation scheme (with different variants and assumptions) which can satisfy global conservation properties. The proposed scheme can also be used for non-local observation operators. Different variants of the proposed scheme are tested in an idealized model and compared to the traditional covariance localization with an ad-hoc step enforcing conservation. It is shown that the inclusion of the conservation property reduces the total RMS error and that the presented stochastic and deterministic schemes avoiding error space rotation provide better results than the traditional covariance localization.

  3. Conservation implications of species–genetic diversity correlations

    Directory of Open Access Journals (Sweden)

    Aapo Kahilainen


    Full Text Available Despite its importance for the long-term viability of populations and functioning of ecosystems, the genetic diversity of populations is seldom given explicit consideration in conservation prioritization. Research on the species–genetic diversity correlation (SGDC suggests that species diversity within a community and intrapopulation genetic diversity are positively correlated, due to the parallel influences of environmental characteristics (area, connectivity, and environmental heterogeneity on both levels of diversity. A positive locality scale SGDC (i.e. α-SGDC thus provides potential for simultaneous conservation of both species diversity within a locality and intrapopulation genetic diversity. However, caution is needed, since in some situations environmental characteristics can influence species diversity and genetic diversity differently, resulting in a negative α-SGDC. In such cases there can be a conflict between conservation of species diversity within localities and genetic diversity within populations. SGDCs provide useful information also for conservation planning, which considers compositional differences between localities, since the mechanisms behind α-SGDCs can also drive correlations between differentiation of community and genetic compositions (i.e. β-SGDCs. We suggest that emphasizing locality area and connectivity between similar localities in conservation planning best conserves both species and intrapopulation genetic diversity, and that focusing on highly complementary species richness may compromise conservation of genetic diversity.

  4. Comparison of conservation metrics in a case study of lemurs. (United States)

    Gudde, Renske; Venditti, Chris


    Conservation planning is important to protect species from going extinct now that natural habitats are decreasing owing to human activity and climate change. However, there is considerable controversy in choosing appropriate metrics to weigh the value of species and geographic regions. For example, the added value of phylogenetic conservation-selection criteria remains disputed because high correlations between them and the nonphylogenetic criteria of species richness have been reported. We evaluated the commonly used conservation metrics species richness, endemism, phylogenetic diversity (PD), and phylogenetic endemism (PE) in a case study on lemurs of Madagascar. This enabled us to identify the conservation target of each metric and consider how they may be used in future conservation planning. We also devised a novel metric that uses a phylogeny scaled according to the rate of phenotypic evolution as a proxy for a species' ability to adapt to change. High rates of evolution may indicate generalization or specialization. Both specialization and low rates of evolution may result in an inability to adapt to changing environments. We examined conservation priorities by using the inverse of the rate of body mass evolution to account for species with low rates of evolution. In line with previous work, we found high correlations among species richness and PD (r = 0.96), and endemism and PE (r = 0.82) in Malagasy lemurs. Phylogenetic endemism in combination with rates of evolution and their inverse prioritized grid cells containing highly endemic and specialized lemurs at risk of extinction, such as Avahi occidentalis and Lepilemur edwardsi, 2 endangered lemurs with high rates of phenotypic evolution and low-quality diets, and Hapalemur aureus, a critically endangered species with a low rate of body mass evolution and a diet consisting of very high doses of cyanide. © 2016 Society for Conservation Biology.

  5. Community Markets for Conservation (COMACO) links biodiversity conservation with sustainable improvements in livelihoods and food production. (United States)

    Lewis, Dale; Bell, Samuel D; Fay, John; Bothi, Kim L; Gatere, Lydiah; Kabila, Makando; Mukamba, Mwangala; Matokwani, Edwin; Mushimbalume, Matthews; Moraru, Carmen I; Lehmann, Johannes; Lassoie, James; Wolfe, David; Lee, David R; Buck, Louise; Travis, Alexander J


    In the Luangwa Valley, Zambia, persistent poverty and hunger present linked challenges to rural development and biodiversity conservation. Both household coping strategies and larger-scale economic development efforts have caused severe natural resource degradation that limits future economic opportunities and endangers ecosystem services. A model based on a business infrastructure has been developed to promote and maintain sustainable agricultural and natural resource management practices, leading to direct and indirect conservation outcomes. The Community Markets for Conservation (COMACO) model operates primarily with communities surrounding national parks, strengthening conservation benefits produced by these protected areas. COMACO first identifies the least food-secure households and trains them in sustainable agricultural practices that minimize threats to natural resources while meeting household needs. In addition, COMACO identifies people responsible for severe natural resource depletion and trains them to generate alternative income sources. In an effort to maintain compliance with these practices, COMACO provides extension support and access to high-value markets that would otherwise be inaccessible to participants. Because the model is continually evolving via adaptive management, success or failure of the model as a whole is difficult to quantify at this early stage. We therefore test specific hypotheses and present data documenting the stabilization of previously declining wildlife populations; the meeting of thresholds of productivity that give COMACO access to stable, high-value markets and progress toward economic self-sufficiency; and the adoption of sustainable agricultural practices by participants and other community members. Together, these findings describe a unique, business-oriented model for poverty alleviation, food production, and biodiversity conservation.

  6. Conserving Biodiversity Through Certification of Tropical Agroforestry Crops at Local and Landscape Scales

    National Research Council Canada - National Science Library

    Tscharntke, Teja; Milder, Jeffrey C; Schroth, Götz; Clough, Yann; DeClerck, Fabrice; Waldron, Anthony; Rice, Robert; Ghazoul, Jaboury


    .... From a conservation standpoint, certification of tropical agroforestry crops, especially coffee and cocoa, is of particular interest given the potentially high biodiversity value of agroforestry...

  7. Impact of conservation tillage on nematode populations. (United States)

    Minton, N A


    Literature reporting the development of conservation tillage and the research that has been conducted on nematode control in crops grown in conservation tillage systems is reviewed. Effects of different types of conservation tillage on population densities of various nematode species in monocropping and multicropping systems, effects of tillage on nematode distribution in the soil profile, effects of conservation tillage on nematode control, and the role of nematology in conservation tillage research are discussed.

  8. Mainstreaming the social sciences in conservation. (United States)

    Bennett, Nathan J; Roth, Robin; Klain, Sarah C; Chan, Kai M A; Clark, Douglas A; Cullman, Georgina; Epstein, Graham; Nelson, Michael Paul; Stedman, Richard; Teel, Tara L; Thomas, Rebecca E W; Wyborn, Carina; Curran, Deborah; Greenberg, Alison; Sandlos, John; Veríssimo, Diogo


    Despite broad recognition of the value of social sciences and increasingly vocal calls for better engagement with the human element of conservation, the conservation social sciences remain misunderstood and underutilized in practice. The conservation social sciences can provide unique and important contributions to society's understanding of the relationships between humans and nature and to improving conservation practice and outcomes. There are 4 barriers-ideological, institutional, knowledge, and capacity-to meaningful integration of the social sciences into conservation. We provide practical guidance on overcoming these barriers to mainstream the social sciences in conservation science, practice, and policy. Broadly, we recommend fostering knowledge on the scope and contributions of the social sciences to conservation, including social scientists from the inception of interdisciplinary research projects, incorporating social science research and insights during all stages of conservation planning and implementation, building social science capacity at all scales in conservation organizations and agencies, and promoting engagement with the social sciences in and through global conservation policy-influencing organizations. Conservation social scientists, too, need to be willing to engage with natural science knowledge and to communicate insights and recommendations clearly. We urge the conservation community to move beyond superficial engagement with the conservation social sciences. A more inclusive and integrative conservation science-one that includes the natural and social sciences-will enable more ecologically effective and socially just conservation. Better collaboration among social scientists, natural scientists, practitioners, and policy makers will facilitate a renewed and more robust conservation. Mainstreaming the conservation social sciences will facilitate the uptake of the full range of insights and contributions from these fields into

  9. Conservative approach to rectosigmoid endometriosis

    DEFF Research Database (Denmark)

    Egekvist, Anne G; Marinovskij, Edvard; Forman, Axel


    INTRODUCTION: The aim of the study was to assess the risk of surgery after initial conservative treatment of rectosigmoid endometriosis in relation to demographic data. MATERIAL AND METHODS: The study was conducted on the tertiary endometriosis referral unit, Aarhus University Hospital. Medical r...

  10. Conservation physiology of marine fishes

    DEFF Research Database (Denmark)

    Jørgensen, Christian; Peck, Myron A.; Antognarelli, Fabio


    At the end of May, 17 scientists involved in an EU COST Action on Conservation Physiology of Marine Fishes met in Oristano, Sardinia, to discuss how physiology can be better used in modelling tools to aid in management of marine ecosystems. Current modelling approaches incorporate physiology...

  11. Prime time for turtle conservation (United States)

    A. Ross Kiester; Deanna H. Olson


    Our turtle heritage is diminishing at a rate outpacing that of other main animal groups. The 2011-Year of the Turtle partnership and campaign is an opportunity to raise awareness for turtles, celebrate our turtle heritage, herald conservation and research successes, and identify gaps in our understanding that can be the focus of future work. We outline seven...

  12. The conservator-restorer perspective


    Licari, James


    Cultural Heritage may be tangible or intangible. Industrial Heritage also includes many intangible dimensions embodied in the skills, memories and social life of workers and their communities. Conservator restorers must strive to the best of their ability to study and document cultural assets while clearly identifying their values to better preserve them.

  13. Training in Conservation of Weight (United States)

    Overbeck, Carla; Schwartz, Marian


    Reinforcement training was shown to facilitate acquisition of conservation of weight, while active participation was no more effective than passive observation. This report is based on a thesis submitted in partial fulfillment of requirements for the M.S. degree by the first author under the supervision of the second author. (MH)

  14. Conservation of threatened natural habitats

    CSIR Research Space (South Africa)

    Hall, AV


    Full Text Available The aim of this book is to give a holistic setting to the conservation of plants and animals. Instead of concentrating on species alone, the aim is to spread the concern to the physical and biological features; including humanity that make up...

  15. Regularity of conservative inductive limits

    Directory of Open Access Journals (Sweden)

    Jan Kucera


    Full Text Available A sequentially complete inductive limit of Fréchet spaces is regular, see [3]. With a minor modification, this property can be extended to inductive limits of arbitrary locally convex spaces under an additional assumption of conservativeness.

  16. Cubication of Conservative Nonlinear Oscillators (United States)

    Belendez, Augusto; Alvarez, Mariela L.; Fernandez, Elena; Pascual, Immaculada


    A cubication procedure of the nonlinear differential equation for conservative nonlinear oscillators is analysed and discussed. This scheme is based on the Chebyshev series expansion of the restoring force, and this allows us to approximate the original nonlinear differential equation by a Duffing equation in which the coefficients for the linear…

  17. Linearization of Conservative Nonlinear Oscillators (United States)

    Belendez, A.; Alvarez, M. L.; Fernandez, E.; Pascual, I.


    A linearization method of the nonlinear differential equation for conservative nonlinear oscillators is analysed and discussed. This scheme is based on the Chebyshev series expansion of the restoring force which allows us to obtain a frequency-amplitude relation which is valid not only for small but also for large amplitudes and, sometimes, for…

  18. Theological paradigms and conservative Afrikaners

    African Journals Online (AJOL)

    logical paradigm for conservative Afrikaner believers must be critical, legitimising and free of .... thoughts with a belief in the divine source of knowledge. Both aimed at arriving at knowledge which is .... the right-wing Afrikaners with the vision that they are the chosen Israel. These peo ple emphasise the concept of election in ...

  19. Food production and nature conservation

    NARCIS (Netherlands)

    Gordon, Iain J.; Squire, Geoff R.; Prins, Herbert H.T.


    Feeding the world's growing human population is increasingly challenging, especially as more people adopt a western diet and lifestyle. Doing so without causing damage to nature poses an even greater challenge. This book argues that in order to create a sustainable food supply whilst conserving

  20. Understanding Conservation: A Playful Process (United States)

    Kefaloukos, Mary-Anne; Bobis, Janette


    This article describes some aspects of Piaget's Theory of Cognitive Development. It highlights the importance of giving young children specific access to explore conservation in measurement, which will give students invaluable experiences in measurement that in years to come will be regarded as their prior knowledge of the concept. This is…

  1. Madagascar Conservation & Development: Editorial Policies

    African Journals Online (AJOL)

    Readers are also encouraged to alert Madagascar Conservation & Developmentto pertinent letter-writing campaigns and other activities, which may need the support of the Madagascar ... They send in a detailed review on the contribution together with the reviewer recommendation form (the latter is for the editors only).

  2. Renewable energy and wildlife conservation (United States)

    Khalil, Mona


    The renewable energy sector is rapidly expanding and diversifying the power supply of the country. Yet, as our Nation works to advance renewable energy and to conserve wildlife, some conflicts arise. To address these challenges, the U.S. Geological Survey (USGS) is conducting innovative research and developing workable solutions to reduce impacts of renewable energy production on wildlife.

  3. Nonlinearity, Conservation Law and Shocks

    Indian Academy of Sciences (India)

    Nonlinearity, Conservation Law and Shocks. Part I : Genuine Nonlinearity and Discontinuous Solutions. Phoolan Prasad is with the. Department of. Mathematics, Indian. Institute of Science and has been working in the area of nonlinear waves and hyperbolic partial differential equations. He is deeply interested in.

  4. Nonlinearity, Conservation Law and Shocks

    Indian Academy of Sciences (India)

    Nonlinearity, Conservation Law and Shocks. 2. Stability Consideration and Examples. Phoolan Prasad is with the. Department of. Mathematics, Indian. Institute of Science and has been working in the area of nonlinear waves and hyperbolic partial differential equations. He is deeply interested in mathematics education at.

  5. Conservation and Renewable Energy Program

    Energy Technology Data Exchange (ETDEWEB)

    Vaughan, K.H.


    This bibliography lists reports and selected papers published under the Oak Ridge National Laboratory Conservation and Renewable Energy Program from 1986 through February 1991. Information on documents published prior to 1986 can be obtained from ORNL. Most of the documents in the bibliography are available from Oak Ridge National Laboratory.

  6. Conservative Ideology and Ambivalent Sexism (United States)

    Christopher, Andrew N.; Mull, Melinda S.


    To assess the relationship between different facets of conservative ideology and ambivalent sexism, 246 residents of two towns in southern Michigan completed a social dominance orientation scale (SDO), a right-wing authoritarianism scale (RWA), a Protestant work ethic scale (PWE), and the Glick and Fiske (1996) Ambivalent Sexism Inventory via a…

  7. Arizona Conserve Water Educators Guide (United States)

    Project WET Foundation, 2007


    This award-winning, 350-page, full-color book provides a thorough study of Arizona water resources from a water conservation perspective. Its background section contains maps, graphs, diagrams and photos that facilitate the teaching of 15 interactive, multi-disciplinary lessons to K-12 students. In addition, 10 Arizona case studies are highlighted…

  8. Energy conservation in rented buildings

    Energy Technology Data Exchange (ETDEWEB)

    Klingberg, T.; Broechner, J.; Forsman, J.; Gaunt, L.; Holgersson, M.


    The bulletin is an anthology of nine essays by different authors addressing the issue of energy conservation in buildings, where there exists a landlord/tenant relationship. After an overview of the rental market and the stock of rental buildings different types of rental contracts and energy charges are described.

  9. Entropy viscosity method for nonlinear conservation laws

    KAUST Repository

    Guermond, Jean-Luc


    A new class of high-order numerical methods for approximating nonlinear conservation laws is described (entropy viscosity method). The novelty is that a nonlinear viscosity based on the local size of an entropy production is added to the numerical discretization at hand. This new approach does not use any flux or slope limiters, applies to equations or systems supplemented with one or more entropy inequalities and does not depend on the mesh type and polynomial approximation. Various benchmark problems are solved with finite elements, spectral elements and Fourier series to illustrate the capability of the proposed method. © 2010 Elsevier Inc.

  10. Widespread evolutionary conservation of alternatively spliced exons in caenorhabditis

    DEFF Research Database (Denmark)

    Irimia, Manuel; Rukov, Jakob L; Penny, David


    Alternative splicing (AS) contributes to increased transcriptome and proteome diversity in various eukaryotic lineages. Previous studies showed low levels of conservation of alternatively spliced (cassette) exons within mammals and within dipterans. We report a strikingly different pattern...... in Caenorhabditis nematodes-more than 92% of cassette exons from Caenorhabditis elegans are conserved in Caenorhabditis briggsae and/or Caenorhabditis remanei. High levels of conservation extend to minor-form exons (present in a minority of transcripts) and are particularly pronounced for exons showing complex...... patterns of splicing. The functionality of the vast majority of cassette exons is underscored by various other features. We suggest that differences in conservation between lineages reflect differences in levels of functionality and further suggest that these differences are due to differences in intron...

  11. Key research questions of global importance for cetacean conservation (United States)

    Parsons, E. C. M.


    Limited resources and increasing environmental concerns have prompted calls to identify the critical questions that most need to be answered to advance conservation, thereby providing an agenda for scientific research priorities. Cetaceans are often keystone indicator species but also high profile, charismatic flagship taxa that capture public and media attention as well as political interest. A dedicated workshop was held at the conference of the Society for Marine Mammalogy (December 2013, New Zealand) to identify where lack of data was hindering cetacean conservation and which questions need to be addressed most urgently. This paper summarizes 15 themes and component questions prioritized during the workshop. We hope this list will encourage cetacean conservation-orientated research and help agencies and policy makers to prioritize funding and future activities. This will ultimately remove some of the current obstacles to science-based cetacean conservation.

  12. Conservation tillage impacts on national soil and atmospheric carbon levels

    Energy Technology Data Exchange (ETDEWEB)

    Kern, J.S.; Johnson, M.G.


    Soil organic matter is the largest global terrestrial C pool and is a source of CO2, CH4 and other greenhouse gases. Changes in soil organic C (SOC) content and fossil fuel C emissions in response to conversion of conventional tillage to conservation tillage in the contiguous USA for field crop production by the year 2020 were projected by developing a model based on published data, and geographic databases of current conservation tillage usage and agricultural SOC. Three scenarios of conservation tillage use, 27% (current usage), and 57% (low), and 76% (high) of field crops planted were considered. Conversion of land to conservation tillage alone is not likely to sequester sufficient C to offset the impact of C released by fossil fuel consumption.

  13. Conserving endangered marine organisms: causes, trends and challenges (United States)



    Increasing demand for marine resources in recent decades for human needs has led to intensified exploitation. This increase accelerates the process of extinction of various marine resources. In order to avoid extinction, it requires conservation measures of marine resources appropriately. This paper provides an overview of causes of extinction, trends and challenges in the conservation of endangered marine organisms. The success of conservation measures is highly dependent on various stakeholders such as governments, communities, the private sector and academics. Differences of the interest of these parties often lead to the failure of conservation programs. In general there is an increasing public awareness of the importance of protecting the diversity of marine resources and avoiding extinction of marine organisms, especially endangered organisms. The existence of comprehensive actions, legislation and improved coordination among government, community, private sector, and academics will significantly improve the success in overcoming all the challenges.

  14. Evolutionary conservation of regulatory elements in vertebrate HOX gene clusters

    Energy Technology Data Exchange (ETDEWEB)

    Santini, Simona; Boore, Jeffrey L.; Meyer, Axel


    Due to their high degree of conservation, comparisons of DNA sequences among evolutionarily distantly-related genomes permit to identify functional regions in noncoding DNA. Hox genes are optimal candidate sequences for comparative genome analyses, because they are extremely conserved in vertebrates and occur in clusters. We aligned (Pipmaker) the nucleotide sequences of HoxA clusters of tilapia, pufferfish, striped bass, zebrafish, horn shark, human and mouse (over 500 million years of evolutionary distance). We identified several highly conserved intergenic sequences, likely to be important in gene regulation. Only a few of these putative regulatory elements have been previously described as being involved in the regulation of Hox genes, while several others are new elements that might have regulatory functions. The majority of these newly identified putative regulatory elements contain short fragments that are almost completely conserved and are identical to known binding sites for regulatory proteins (Transfac). The conserved intergenic regions located between the most rostrally expressed genes in the developing embryo are longer and better retained through evolution. We document that presumed regulatory sequences are retained differentially in either A or A clusters resulting from a genome duplication in the fish lineage. This observation supports both the hypothesis that the conserved elements are involved in gene regulation and the Duplication-Deletion-Complementation model.

  15. Perception as a Possible Source of Conservation: Evidence for Length Conservation (United States)

    Silverman, Irwin W.; And Others


    Perceptual counterparts of a series of conservation of length tests were presented to subjects who were categorized as conservers or nonconservers conservation of length pre-tests, and to conservers and nonconservers given conservation length training. Perceptual performance of the untrained nonconservers was significantly worse than that of the…

  16. Googling trends in conservation biology. (United States)

    Proulx, Raphaël; Massicotte, Philippe; Pépino, Marc


    Web-crawling approaches, that is, automated programs data mining the internet to obtain information about a particular process, have recently been proposed for monitoring early signs of ecosystem degradation or for establishing crop calendars. However, lack of a clear conceptual and methodological framework has prevented the development of such approaches within the field of conservation biology. Our objective was to illustrate how Google Trends, a freely accessible web-crawling engine, can be used to track changes in timing of biological processes, spatial distribution of invasive species, and level of public awareness about key conservation issues. Google Trends returns the number of internet searches that were made for a keyword in a given region of the world over a defined period. Using data retrieved online for 13 countries, we exemplify how Google Trends can be used to study the timing of biological processes, such as the seasonal recurrence of pollen release or mosquito outbreaks across a latitudinal gradient. We mapped the spatial extent of results from Google Trends for 5 invasive species in the United States and found geographic patterns in invasions that are consistent with their coarse-grained distribution at state levels. From 2004 through 2012, Google Trends showed that the level of public interest and awareness about conservation issues related to ecosystem services, biodiversity, and climate change increased, decreased, and followed both trends, respectively. Finally, to further the development of research approaches at the interface of conservation biology, collective knowledge, and environmental management, we developed an algorithm that allows the rapid retrieval of Google Trends data. © 2013 Society for Conservation Biology.

  17. Achieving the triple bottom line in the face of inherent trade-offs among social equity, economic return, and conservation

    National Research Council Canada - National Science Library

    Benjamin S. Halpern; Carissa J. Klein; Christopher J. Brown; Maria Beger; Hedley S. Grantham; Sangeeta Mangubhai; Mary Ruckelshaus; Vivitskaia J. Tulloch; Matt Watts; Crow White; Hugh P. Possingham


    Triple-bottom-line outcomes from resource management and conservation, where conservation goals and equity in social outcomes are maximized while overall costs are minimized, remain a highly sought-after ideal...

  18. Conservation Treatment and the Custodian/Conservator Relationship

    Directory of Open Access Journals (Sweden)

    Barbara Appelbaum


    Full Text Available La collaboration entre les conservateurs-restaurateurs et les conservateurs et de musées joue un rôle important dans la planification de la conservation-restauration, en ce qu’elle permet de déterminer ensemble le but final du traitement. Les conservateurs de musées devraient ainsi comprendre le processus de prise de décisions en matière d’intervention de restauration,  pour y participer d'une façon significative et s’assurer que les décisions de traitement sont compatibles avec l'utilisation actuelle, la signification et les valeurs d'une oeuvre d'art. Cette collaboration est cependant rare, et rendue de surcroît difficile par l’usage fréquent que les conservateurs-restaurateurs font du vocabulaire technique.Collaboration between conservators and custodians is an important part of conservation treatment planning, particularly while deciding on the treatment goal. Custodians need to understand more about the treatment decision-making process in order to participate in a meaningful way and to assure that treatment decisions are consistent with the current use, meaning, and values of a work of art.  Meaningful collaboration is, however, rare, made difficult by a lack of understanding among the parties, and exacerbated by conservators’ habitual use of technical language.  It is possible – and desirable - for conservators to discuss the treatment decision-making process using non-technical terminology so that real collaboration can take place.  

  19. Conservation Genetics, Precision Conservation, and De-extinction. (United States)

    Desalle, Rob; Amato, George


    It has been estimated that three species on the planet now go extinct every hour and that this rate is orders of magnitude higher than the planet has seen in previous catastrophic extinction events. We clearly are in the midst of a sixth extinction, and this one is different from the previous five. Why? This sixth extinction is caused by the activity of a single species-us. If there is any hope of ameliorating this extinction, it will entirely be up to us, as the current stewards of this planet, to change the course. There are many challenges, though, to marshaling this effort. Two primary ones immediately come to mind. The first is that we simply haven't found the right biological tools to address this crisis. The second is that many humans on this planet don't even admit we have a problem. These are two very different problems. The first is primarily technological. Only recently has some of the more advanced biologically focused technology been available to conservation biology and extinction science. Humans are enthralled by cutting-edge technology for the most part, and for the public, one of the more exciting possibilities in the realm of conservation biology is that some of the more charismatic species that have g